JP2009044996A - Additive for fermented milk - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide an additive for fermented milk which reinforces physiology of fermented milk and improving quality stability and palatability of the fermented milk. <P>SOLUTION: The additive for fermented milk contains xylooligosaccharide having an average chain length of 3.5 or more and a xylobiose content of 25 wt.% or more as an active ingredient. The additive for fermented milk contains acidic xylooligosaccharide as an active ingredient: wherein the acidic xylooligosaccharide has at least one uronic acid residue as a side chain in one molecule; the uronic acid is glucuronic acid or 4-O-methyl-glucuronic acid; the xylooligosaccharide or the acidic xylooligosaccharide is obtained by "producing a complex of the xylooligosaccharide component, the acidic xylooligosaccharide component, and a lignin component through subjecting lignocellulose material to enzymatic and/or physicochemical treatment, and then separating a xyloorigosaccharide mixture obtained by subjecting the complex to acid hydrolysis. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  It relates to a fermented milk additive that, when added to fermented milk, enhances the physiological function of fermented milk and at the same time stabilizes the quality and improves the taste of fermented milk.

In recent years, an increase in lifestyle-related diseases has become a problem in Japan. Many causes of lifestyle-related diseases are due to disorder of lifestyle. For example, excessive intake of calories and nutritional imbalances in the diet, contamination with various environmental pollutants that adversely affect the human body, and mental stress from the surrounding environment are problems that worsen lifestyle habits. In recent years it has become prominent.
In such an environment, the concept of preventive medicine is to delay the time to suffer from lifestyle-related diseases as much as possible, and for that purpose, it is necessary to add a little ingenuity to daily eating habits.

In addition to the three nutrients of proteins, lipids, and carbohydrates that make up the body, food nutrients include two vitamins and minerals that are necessary to smoothly carry out the various metabolisms that form the basis of life activities. The five added nutrients are the basis. In addition, dietary fiber recognized in recent years plays an important role in the regulation of the intestinal tract function that absorbs the above nutrients. In modern nutrition science, it is recommended that the six major nutrients, which are the five major nutrients combined with dietary fiber, be taken without any bias, and it is the basis for dietary guidance such as “30 items a day”. However, the environment surrounding modern people is not necessarily able to live such an ideal diet.
Therefore, the intake of food having tertiary functions (metabolic regulation, biological defense, disease prevention, disease recovery, aging prevention, etc.) is proposed. For example, fermented milk (probiotics) and oligosaccharides (prebiotics), which are widely recognized as ingredients in foods for specified health use, relieve symptoms of hay fever and atopic dermatitis in addition to intestinal regulation. It is expected to be used in a wide range of fields such as the action to be performed (see Non-Patent Document 1).

By the way, for the purpose of enhancing the respective effects of the probiotics and prebiotics, a product defined as synbiotics containing both has been developed (see Non-Patent Document 1).
Symbiotics include, for example, those obtained by mixing dry powders such as lactic acid bacteria and oligosaccharides at an appropriate ratio, and the forms thereof include granules, powders, capsule tablets, tablet tablets, chewable tablets and the like.
However, since fermented milk, which is a typical probiotic food, has a low pH, when prebiotics are blended, stability under low pH conditions is necessary. Moreover, the added prebiotics are consumed by the lactic acid bacteria in the fermented milk.
Therefore, when prebiotics are blended in fermented milk, there are problems such as a decrease in prebiotics and a tendency for quality deterioration due to overfermentation by lactic acid bacteria.

  From the above background, fermented milk additives as prebiotics that are stable in fermented milk, do not affect lactic acid bacteria, and do not impair the functions of flavor and nutrition have been demanded.

Examples of fermented milk additives as described above include galactooligosaccharides and xylo-oligosaccharides, and fermented milk containing these oligosaccharides is on the market.
Galactooligosaccharide is relatively stable to acids and heat, and is an excellent material as a fermented milk additive. However, since galactooligosaccharides are assimilated by lactic acid bacteria, when used as a fermented milk additive, galactooligosaccharides are decomposed during the fermentation process and storage period, and overfermented during the production process and fermented milk during the storage period. On the other hand, xylo-oligosaccharide is stable to acid and heat like galacto-oligosaccharide, and is not assimilated by lactic acid bacteria, so that it hardly affects the quality of fermented milk.

The xylo-oligosaccharides currently on the market are obtained by enzymatic reaction of corn cob (Zea mays) with xylanase (derived from Trichoderma sp.) And containing xylobiose as a main component (28% or more) (Non-patent Document 2). reference). Xylobiose is excellent in assimilation against Bifidobacteria, and is widely used as a component involved in foods for specified health use (individual application type and standard specification type) that adjust the stomach. However, oligosaccharides having a low degree of polymerization such as xylobiose are sweeter than xylo-oligosaccharides having a high degree of polymerization, and there are problems such as adding unnecessary sweetness depending on the food to be added.
As a method for producing xylooligosaccharides using raw materials other than corn cob, methods using acid hydrolysis or saturated steam treatment of hardwood xylan have been reported. However, xylo-oligosaccharides obtained by these methods account for nearly 30% of xylobiose and xylotriose, and have the same problems as corn cob-derived xylo-oligosaccharides (see Non-Patent Document 3).

Curr Opin Biotechnol. 2002 Oct; 13 (5): 490-496. No. 0721001 from food safety July 21, 2006 "About partial revision of ingredient specifications of food for specified health use (standard specification type)" The latest technology of Wood Chemicals; Chapter 4 "Technology for using hemicellulose" Kazuaki Shimizu, CM Publishing (2000) Abstracts of Annual Meeting of Japanese Society of Agricultural Chemistry 2005 Annual Meeting (Sapporo): 264 Abstracts of the 127th Annual Meeting of the Japanese Pharmaceutical Society (2007) 4:60 JP 2001-226409 A JP 2003-183133 A JP 2003-221307 A JP 2007-049953 A JP 2004-182621 A

  An object of the present invention is to provide a fermented milk additive that, when added to fermented milk, enhances the physiological function of the fermented milk and at the same time stabilizes the quality of the fermented milk and improves the taste.

  As a result of intensive studies to solve the above problems, the present inventors have added xylo-oligosaccharides or acidic xylo-oligosaccharides to fermented milk, thereby enhancing the physiological functions of fermented milk and simultaneously stabilizing the quality of fermented milk. As a result, the present invention has been completed.

The method of obtaining xylooligosaccharides and acidic xylooligosaccharides from lignocellulose materials, and the xylooligosaccharides and acidic xylooligosaccharides obtained by the method have a characteristic structure and have many physiological activities. (See Patent Documents 1 to 5).
The present invention relates to a novel fermented milk additive containing these xylo-oligosaccharides and acidic xylo-oligosaccharides as active ingredients.

The present invention employs the following configuration.
That is, the first of the present invention is a fermented milk additive containing xylo-oligosaccharide as an active ingredient, having an average chain length of 3.5 or more and a xylobiose content of 25% or less.

  The second of the present invention is a fermented milk additive containing acidic xylo-oligosaccharide as an active ingredient.

  A third aspect of the present invention is the fermented milk additive according to the second aspect of the present invention, wherein the acidic xylo-oligosaccharide has at least one uronic acid residue as a side chain in one molecule.

  A fourth aspect of the present invention is the fermented milk additive according to the third aspect of the present invention, wherein the uronic acid is glucuronic acid or 4-O-methyl-glucuronic acid.

  According to the fifth aspect of the present invention, xylooligosaccharide or acidic xylooligosaccharide is obtained by “treating lignocellulose material enzymatically and / or physicochemically to obtain a xylooligosaccharide component and a complex of acidic xylooligosaccharide component and lignin component, The fermented milk additive according to either the first or second aspect of the present invention is “obtained by separating the xylooligosaccharide mixture obtained by subjecting the complex to an acid hydrolysis treatment”.

The fermented milk additive of the present invention contains xylo-oligosaccharide or acidic xylo-oligosaccharide having an average chain length of 3.5 or more and an xylobiose content of 25% or less as an active ingredient. is there. Xylooligosaccharide having a high degree of polymerization and low sweetness is suitable as an active ingredient of the fermented milk additive of the present invention.
The xylooligosaccharide is a xylobiose that is a dimer of xylose, a xylotriose that is a trimer, or a polymer of about tetramer to 20-mer.
The degree of polymerization of the xylo-oligosaccharide used in the present invention is preferably 3.5 to 20 and more preferably 5 to 10 in the case of a xylo-oligosaccharide having a single polymerization degree.
In the present invention, a mixed composition of a plurality of xylo-oligosaccharides having different degrees of polymerization is also referred to as xylo-oligosaccharide. Since xylo-oligosaccharides are generally produced from natural products, they are actually often obtained as such mixed compositions. The average degree of polymerization of the mixed composition is indicated by the average value of the xylose chain length of the xylooligosaccharide.
The average degree of polymerization of the xylooligosaccharide used in the present invention is preferably from 3.5 to 20, and more preferably from 3.5 to 6.5.
In addition, the difference between the upper limit and the lower limit of the xylose chain length contained in the xylooligosaccharide composition is preferably 20 or less, and more preferably 15 or less.
Further, the xylobiose content in the xylo-oligosaccharide composition is preferably 25% or less, and more preferably 10% or less.

Moreover, the acidic xylo-oligosaccharide which becomes an active ingredient of the fermented milk additive in the present invention means one having at least one uronic acid side chain in one molecule of the xylo-oligosaccharide. The number of uronic acid side chains in one molecule is preferably 1 to 5 on average and more preferably 1 to 2 on average.
Examples of naturally occurring uronic acids include glucuronic acid, 4-O-methylglucuronic acid, galacturonic acid, mannuronic acid, and iduronic acid.
The uronic acid side chain of the acidic xylooligosaccharide used in the present invention is not particularly limited, but glucuronic acid or 4-O-methylglucuronic acid is preferable.
In the case of an acid xylo-oligosaccharide having a single polymerization degree, the acid xylo-oligosaccharide used in the present invention is preferably 1 to 30, and more preferably 5 to 20.
In addition, the average degree of polymerization of acidic xylo-oligosaccharides, which is a mixed composition of a plurality of acidic xylo-oligosaccharides having different polymerization degrees, is preferably 4 to 20, and more preferably 7 to 13. The polydispersity is preferably 1 to 2, and more preferably 1 to 1.6.
In the present invention, the binding position of uronic acid in the molecule of acidic xylooligosaccharide is not particularly limited. The type of bond is not particularly limited, but an α-1,2 bond in which the 2-position of xylose and the 1-position of uronic acid are bonded is preferable.

As a method for producing xylooligosaccharides, (1) a method for producing a xylo-oligosaccharide solution directly by performing saccharification treatment such as pressure heating, explosion or alkali treatment, and (2) pressure heating, alkali heat treatment or extraction and purification. A method of producing xylo-oligosaccharide liquid by using xylan as a starting material and saccharifying it by causing an enzyme to act on it, (3) saccharifying the raw material of the plant body by fragmenting it, heating it with alkali, and then directly acting on the enzyme (4) Lignocellulose material is enzymatically and / or physicochemically processed to obtain a complex of xylooligosaccharide component and lignin component, and then the complex The body is subjected to an acid hydrolysis treatment to obtain a xylooligosaccharide mixture, and from the resulting xylooligosaccharide mixture, the xylooligosaccharide and at least one or more uronic acid residues in one molecule are side chains. Method for separating an acidic xylooligosaccharide having been the like.
The production method of the xylooligosaccharide and acidic xylooligosaccharide used in the present invention is not particularly limited, but the production method of (4) can produce a relatively high degree of polymerization in a large amount at a low cost. This is particularly preferable. The outline is shown below.

  Xylooligosaccharides and acidic xylo-oligosaccharides can be obtained through a hydrolysis process, a concentration process, a dilute acid treatment process, and a purification process using a lignocellulose material derived from chemical pulp as a raw material. In the hydrolysis process, xylan in lignocellulose is selectively hydrolyzed with dilute acid treatment, high-temperature and high-pressure steam (cooking / explosion) treatment, or hemicellulase, and a high molecular weight complex composed of oligosaccharide and lignin is intermediated. Get as a body. In the concentration step, the oligosaccharide-lignin-like substance complex is concentrated by a reverse osmosis membrane or the like, and oligosaccharides having a low polymerization degree, low-molecular impurities, and the like can be removed. In the concentration step, a reverse osmosis membrane is preferably used, but ultrafiltration membrane, salting out, dialysis and the like are also possible. A lignin-like substance is liberated from the complex by the diluted acid treatment step of the obtained concentrated liquid, and a diluted acid-treated liquid containing xylo-oligosaccharide and acidic xylo-oligosaccharide can be obtained. At this time, the lignin-like substance separated from the complex condenses and precipitates under acidic conditions, and can be removed by filtration using a ceramic filter or filter paper. In the dilute acid treatment step, acid hydrolysis is preferably used, but enzymatic degradation using lignin degrading enzyme or the like is also possible.

  The purification process includes an ultrafiltration process, a decolorization process, and an adsorption process. Some lignin-like substances remain in the solution as soluble polymers, but are removed by an ultrafiltration process, and most of impurities such as coloring substances are removed by a decolorization process using activated carbon. In the ultrafiltration step, an ultrafiltration membrane is preferably used, but reverse osmosis membrane, salting out, dialysis and the like are also possible. Xylooligosaccharide and acidic xylo-oligosaccharide are dissolved in the sugar solution thus obtained. An ion exchange resin can be used to separate and purify xylooligosaccharides and acidic xylooligosaccharides. First, the sugar solution is treated with a strong cation exchange resin to remove metal ions in the sugar solution. Subsequently, sulfate ions and the like in the sugar solution are removed using a strong anion exchange resin. In this step, simultaneously with the removal of sulfate ions, a part of the organic acid, which is a weak acid, and the colored component are simultaneously removed. The sugar solution treated with the strong anion exchange resin is treated again with the strong cation exchange resin to further remove metal ions. Finally, it is treated with a weak anion exchange resin to adsorb acidic xylo-oligosaccharides to the resin. Since xylo-oligosaccharide has no charge, it can be obtained from the non-adsorbed fraction of the last weak anion exchange resin. From the xylo-oligosaccharide solution thus obtained, a white xylo-oligosaccharide composition powder can be obtained by spray drying, freeze-drying treatment or the like.

By eluting the acidic xylo-oligosaccharide adsorbed on the weak anion exchange resin with a low-concentration salt (NaCl, CaCl ₂ , KCl, MgCl _2, etc.), an acidic xylo-oligosaccharide solution free from impurities can be obtained. At this time, the acidic xylo-oligosaccharide solution that has been eluted can be further converted with a strong cation exchange resin to convert the salt into a free acid. Moreover, it is possible to arbitrarily change the ratio of salt to free acid by adjusting the treatment time with the cation exchange resin. From the acidic xylo-oligosaccharide solution thus obtained, white acidic xylo-oligosaccharide composition powder can be obtained by spray drying, freeze-drying treatment or the like.

  As described above, the merit of the production method is that xylo-oligosaccharide and acidic xylo-oligosaccharide having high economic efficiency and high average polymerization degree can be easily obtained. In addition, the average degree of polymerization of the xylo-oligosaccharide and acidic xylo-oligosaccharide obtained by this method can be changed by, for example, adjusting the dilute acid treatment conditions or treating with hemicellulase again.

The present invention is a fermented milk additive comprising the above-described xylo-oligosaccharide or acidic xylo-oligosaccharide as an active ingredient. The fermented milk additive may be composed solely of these xylo-oligosaccharides and acidic xylo-oligosaccharides, or may be a composition in which these are combined with any other component.
The fermented milk additive can be used alone. Or it can be used with the solid or liquid excipient | filler well-known in the said field | area, and can be used as a fermented milk additive.

  Examples of solid excipients include lactose, sucrose, glucose, corn starch, gelatin, and starch. Examples of the liquid excipient include water, glycerin, fatty oil, sorbitol and the like.

The fermented milk to which the fermented milk additive of the present invention is added is “hatsu fermented milk” defined by a ministerial ordinance and “lactic acid bacteria beverage” defined by the ministerial ordinance.

  It has been confirmed by a human intervention test that an intestinal regulating effect is exhibited by ingesting 1 g of xylooligosaccharide used in the present invention per day (see Non-Patent Document 4). In addition, it has been confirmed that the acidic xylo-oligosaccharide used in the present invention is suppressed by a 0.1-per-kg body weight of atopic dermatitis model mice to suppress the deterioration of skin inflammation (see Non-Patent Document 5). . From this result, it is considered that in humans, the effect is exhibited by ingesting 0.1 to 1 g per day. Therefore, it is desirable to add to the fermented milk so that the daily intake of xylo-oligosaccharide or acidic xylo-oligosaccharide is about 0.1 to 1 g. The amount added can be appropriately adjusted depending on the type and form of fermented milk, but it is preferable to add 0.01 to 10% by mass of an active ingredient xylo-oligosaccharide or acidic xylo-oligosaccharide. More preferably, 0.1% by mass to 5% by mass is added.

  EXAMPLES Hereinafter, although an Example demonstrates this invention in detail, this invention is not limited by this.

<Summary of analysis method>
A method for analyzing the physicochemical properties of xylo-oligosaccharide and acidic xylo-oligosaccharide in the present invention is shown below.
(1) Quantification of total sugar amount The total sugar amount was prepared using D-xylose (manufactured by Wako Pure Chemical Industries, Ltd.) as a calibration curve, and the phenol-sulfuric acid method (quantitative method for reducing sugar, 2nd edition, Academic Publishing Center) Issue: ISBN 4-7622-0102-2).
(2) Quantification of the amount of reducing sugar The amount of reducing sugar was prepared using D-xylose (manufactured by Wako Pure Chemical Industries, Ltd.) as a calibration curve. The Sommoji-Nelson method (quantitative method for reducing sugar, 2nd edition, Academic Publishing Center) Issue: ISBN 4-7622-0102-2).
(3) Determination of the amount of uronic acid The uronic acid was prepared using a calibration curve of D-glucuronic acid (manufactured by Wako Pure Chemical Industries, Ltd.), and a modified method of the carbazole sulfate method (Anal. Biochem., 54, 484-489). ). The number of uronic acids per molecule of acidic xylo-oligosaccharide was determined by the following formula.
Number of uronic acids per molecule = uronic acid concentration ÷ reducing sugar concentration (4) Method of determining average polymerization degree The total sugar concentration and reducing sugar concentration of the sugar solution were measured, and the average polymerization degree was determined by the following equation.
Average degree of polymerization = Total sugar concentration ÷ Reducing sugar concentration (5) Molecular weight distribution analysis method of xylooligosaccharides The degree of polymerization of xylooligosaccharides was measured using an ion chromatograph (Dionex DX500 sugar analysis system) and the column was Carbo Pac PA. −10 (4.6 × 250 mm) was used. As an eluent, a 0.1 M NaOH solution was used as the A liquid, and a 0.1 M NaOH solution containing 0.5 M CH ₃ COONa was used as the B liquid. The elution conditions for the linear concentration gradient from solution A to solution B were as follows. For detection, a pulse amperometric electrochemical detector ED50 was used.
0-10min A 100%, B 0%
10-30min A 60%, B 40%
From the obtained chromatogram, the distribution of the xylooligosaccharides of each degree of polymerization and the difference between the upper limit and the lower limit of the degree of polymerization were determined.
(6) Xylobiose Concentration Measurement Method in Xylooligosaccharide Composition Using the apparatus, column, eluent, and detector described in (5) above, and setting elution conditions in the same manner, the sample was treated with gentiobiose (sum) as an internal standard. The content of xylobiose in the sample was determined from the area ratio of gentiobiose and xylobiose.
(7) Molecular weight distribution analysis method of acidic xylo-oligosaccharide The molecular weight distribution of acidic xylo-oligosaccharide was analyzed by gel filtration chromatography. Use Waters Alliance (2695 Separations Module) and connect HOpak SB-803 HQ (8.0 × 300 mm) manufactured by SHODEX and OHpak SB-802.5 HQ (8.0 × 300 mm) in series. It was. The column oven was set to 50 ° C. A 0.2M NaCl solution was used as the eluent, and the flow rate was 0.5 ml / min. For detection, a differential refraction system (2414 RI Detector) was used. A pullulan standard product (STANDARD P-82 manufactured by Shodex) was used to prepare a standard curve of molecular weight distribution. As a standard product of the low-molecular oligosaccharide fraction, glucose M.I. W. 180), maltotriose (M.W. 504) and maltoheptaose (M.W. 1152) were used. From the obtained acidic xylo-oligosaccharide chromatography and molecular weight standard curve, the molecular weight distribution (pullulan conversion) and polydispersity of the acidic xylo-oligosaccharide were determined.

<Preparation of xylooligosaccharide and acidic xylooligosaccharide>
The preparation method of the xylo-oligosaccharide and acidic xylo-oligosaccharide used by this invention is shown below.
(1) As a raw material, pulp obtained by kraft cooking and oxygen delignification of mixed hardwood chips made of 20% domestic hardwood chips and 80% eucalyptus wood was used. Using 60 ° C. hot water, the pulp concentration was diluted to 1.6% and received in a 10 m ³ tank. Subsequently, concentrated sulfuric acid was added to the tank and stirred to adjust the pH to 5.5, and then the pulp was dehydrated and washed with a drum filter (Shinryo Seisakusho: φ2000 × 600SUF). The pulp concentration after dehydration was about 20%. Warm water at 50 ° C. was added to the 20% pulp to dilute the pulp concentration to 10%, and at the same time, the xylanase conc was continuously added so as to be 50 [unit / g] of pulp, and thoroughly mixed with a tram screw. The mixed pulp is pushed into a cylindrical reaction tank (φ800mm × 4000mmH) with a volume of 2m ³ with a medium concentration pump (Shinryo Seisakusho: 200 x RPK), and continuously treated so that the reaction time is 40 minutes, then the reaction The subsequent pulp was dehydrated to about 40% with a screw press (manufactured by Shinryo Seisakusho: 250 × 1000 SPH-EN) to obtain a xylanase reaction filtrate of the pulp. After 60 minutes from the start of the reaction, 50% by mass of the xylanase reaction filtrate, not 50 ° C warm water, is returned to the trump screw, and 20% pulp dehydrated with a drum filter is diluted to 10% and xylanase treatment is performed continuously. It was. From 150 minutes after the start of the reaction, the total sugar concentration in the xylanase reaction filtrate increased to 0.92%, and the average degree of polymerization of the xylo-oligosaccharide at this time was 4.7. By continuously performing such xylanase treatment on the pulp for 24 hours, the reaction filtrate having a sugar concentration of about 0.9% can be stably removed after 150 minutes from the start of the reaction. 15 m ^{3 of} 9% xylanase reaction filtrate could be obtained. The obtained reaction filtrate was filtered through a back filter (manufactured by ISP Filters) with a micron rate of 1 μm, and subsequently with a ceramic filter (manufactured by Nippon Pole) with a micron rate of 0.2 μm to obtain a clear reaction filtrate. Further, by concentrating 15 times with a reverse osmosis membrane (manufactured by Nitto Denko: NTR-7450), 1 m ³ of a concentrated solution having a total sugar concentration of 11% could be obtained.

(2) 1 m ^{3 of} the concentrated sugar solution obtained above was adjusted to pH 3.5 using concentrated sulfuric acid, and then acid-treated at 121 ° C. for 45 minutes. After cooling to 50 ° C., the insoluble residue produced after the acid treatment was removed with a ceramic filter (manufactured by Nippon Pole) with a micron rate of 0.2 μm, decolorized with a UF membrane (manufactured by Kuraray: MU-6025), and further activated carbon ( 10 kg of Mikura Kasei Co., Ltd. (PM-SX) was added and treated at 50 ° C. for 2 hours to obtain a decolorized sugar solution. The obtained sugar solution was subjected to SV1.5 with a strong cation resin (Mitsubishi Chemical: PK-218, 300 L) → weak anion resin (Mitsubishi Chemical: WA30, 300 L) → strong cation resin (Mitsubishi Chemical: PK-218). , 300L) → Purified xylooligosaccharide solution (sugar concentration: 4.3%) by ion-exchange treatment and desalting / decolorization using a 4-bed, 4-tower system consisting of weak anion resin (Mitsubishi Chemical: WA30, 300L) 1100 L). The obtained xylo-oligosaccharide solution was treated with a spray dryer (Okawara Kakoki: ODA-25 type) to obtain 45 kg of xylo-oligosaccharide powder.
The average degree of polymerization of the xylo-oligosaccharide obtained here was 5.1.
Further, the difference between the upper limit and the lower limit of the polymerization degree was 13, and the content of xylobiose was 6.7%.
In addition, the chromatograph which showed the polymerization degree distribution of xylo-oligosaccharide was shown in FIG.

(3) After obtaining the purified xylo-oligosaccharide solution in (2) above, a 75 mM sodium chloride aqueous solution was passed through the weak anion resin of the second and fourth towers at SV1.5 to give an acidic xylo-oligosaccharide solution ( Sugar concentration 2.8%, 600 L) was recovered. The collected acidic xylo-oligosaccharide solution is adjusted to pH 5 with a strong cation resin, concentrated to a sugar concentration of 20%, treated with a spray dryer (Okawara Kakoki: ODA-25 type), and 15 kg of acidic xylo-oligosaccharide powder is obtained. Obtained.
The average degree of polymerization of the acidic xylo-oligosaccharide obtained here was 10.8.
Further, the acid xylo-oligosaccharide obtained had a degree of polymerization of 10.1 and a polydispersity of 1.28. The number of uronic acids in one molecule of oligosaccharide was 1.4.
The molecular weight distribution of acidic xylooligosaccharides is shown in FIG.

  In the following examples, the obtained xylo-oligosaccharide and acidic xylo-oligosaccharide were designated as NX5 and UX10, respectively.

<Test 1: Comparison of growth promoting activity of intestinal Bifidobacterium>
The growth promoting activity of the xylooligosaccharide and acidic xylooligosaccharide of the present invention against the genus Bifidobacterium was tested by the following method.
As test substances, NX5, UX10 obtained by the above-mentioned method, and commercially available xylooligosaccharides (manufactured by Suntory, hereinafter referred to as XOS), galactooligosaccharides (manufactured by Nissin Sugar, hereinafter referred to as GOS), fructo-oligosaccharides (manufactured by Meiji Seika, hereinafter) FOS) was used.

<Outline of test method>
(1) Procedure of stool batch culture method Feces were collected from one healthy adult male, and immediately replaced with nitrogen in an anaerobic glove box (Former Scientific) (phosphate buffered saline) To give a 10% slurry. Next, 100 μl of the 10% slurry was added, 100 μl of the test substance solution diluted in the PBS to a final concentration of 1%, and 800 μl of the PBS were added to make the total volume 1 ml. In addition, PBS which does not contain oligosaccharide was used for the object. Next, it incubated at 37 degreeC for 48 hours in the incubator in an anaerobic glove box. After the incubation, the suspension was centrifuged at 15,000 rpm for 5 minutes to collect the fecal pellet.

(2) Extraction of DNA from stool DNA was extracted from the stool pellet obtained in (1) and stool before incubation. For extraction, QIAamp DNA Tool Mini Kit manufactured by Qiagen was used, and extraction was performed according to the attached protocol.

(3) Measurement of Bifidobacterium genus occupancy ratio in total number of bacteria in stool Measurement of Bifidobacterium genus occupancy ratio in total number of bacteria in stool was performed by a quantitative PCR method using fecal DNA extracted in (2) above. For quantitative PCR, DNA Engine Opticon manufactured by MJ Research and DyNAmo HS SYBER Green qPCR kit manufactured by FINNZYMES optimized for this apparatus were used. For quantification and analysis of the PCR product, an Opticon Monitor manufactured by MJ Research was used.
The following primer combinations were used to measure the total number of bacteria.
Forward primer 5 'CGTATTACCGCGGCTGCT 3'
Reverse Primer 5 'CCAGGGTATCTAATCCTGTTTGC 3'
In addition, the following primer combinations were used for the measurement of the genus Bifidobacterium.
Forward primer 5 'CTCCTGGAAACGGGTC 3'
Reverse Primer 5 'GGTGTTCTTCCCGATATCTA 3'

The composition of the PCR reaction solution was 1 μl of DNA solution extracted from stool, 1 μl of the primer prepared in 5 μM, 7 μl of ultrapure water, and 10 μl of the PCR reaction buffer attached to the kit to make 20 μl. PCR reaction conditions are 95 ° C, 15 minutes for 1 cycle, 94 ° C for 15 seconds, 60 ° C for 15 seconds, 72 ° C for 30 seconds, and 75 ° C for 30 cycles of fluorescence measurement for measuring the total number of bacteria. One cycle of fluorescence measurement was performed in 1 ° C increments at 950 ° C to 95 ° C.
In counting the number of Bifidobacterium, 95 ° C, 15 minutes for 1 cycle, 94 ° C for 15 seconds, 55 ° C for 15 seconds, 72 ° C for 60 seconds, 75 ° C for fluorescence measurement for 30 cycles, 50 ° C to 95 ° C Then, one cycle of fluorescence measurement was performed in increments of 1 ° C.
The amplification region when the primer for measuring the total number of bacteria is used is referred to as region A, and the amplification region when the primer for measuring the number of bacteria in the genus Bifidobacterium is used as region B. The PCR products of region A and region B were prepared and purified in advance, and the copy number calculated from the absorbance at 280 nm was used as the calibration curve DNA. In each PCR reaction of regions A and B, a standard curve was created from the number of copies of the calibration curve DNA prepared earlier and the Ct value, and the number of copies of regions A and B contained in 1 μl of DNA extracted from stool Was calculated.
The occupation ratio of the genus Bifidobacterium in the total number of bacteria can be expressed by the following formula.
Occupancy rate of Bifidobacterium genus = (number of copies of region B / number of copies of region A) × 100 (%)

(4) Comparison of intestinal Bifidobacterium growth-promoting activity In the fecal batch culture test, the occupancy rate of Bifidobacterium in the stool before the addition of oligosaccharides, and the Bifidobacterium genus in the stool after adding various oligosaccharides and incubating for 48 hours The growth promoting activity of the intestinal Bifidobacterium was evaluated.

<Test results>
In the fecal batch culture test, Example 1 was obtained by adding NX5 as a test substance, Example 2 was added by adding UX10, Comparative Example 1 was added by XOS, and Comparative Example 2 was added by GOS. Table 1 shows the growth-promoting activity of intestinal Bifidobacterium in each test section, with Comparative Example 3 containing FOS and Comparative Example 4 using PBS not containing oligosaccharide.
From Table 1, it was found that NX5 and UX10 have a Bifidobacterium genus growth-promoting activity, and the activity is higher than that of GOS and FOS, and is equivalent to commercially available xylooligosaccharide (XOS).
Therefore, NX5 and UX10 have a prebiotic action, and their growth promoting activity is higher than that of GOS conventionally used as a fermented milk additive and is equivalent to commercially available XOS. It became clear that it was suitable as an agent.

<Test 2: Comparison of effects on yogurt quality>
A yogurt containing the xylooligosaccharide and acidic xylooligosaccharide of the present invention as a fermented milk additive was prepared, and the number of bacteria, pH, taste, and oligosaccharide remaining rate were tested.
As test substances used as fermented milk additives, as in Test 1, NX5, UX10, and XOS, GOS, and FOS were used.

<Outline of test method>
(1) Preparation of yogurt 500 ml of water was boiled for 5 minutes and then allowed to stand at room temperature until it reached about 50 ° C. 100 g of commercially available skim milk was added, and the test substance was added to a final concentration of 1%, and then stirred to make it uniform. Next, 50 g of a commercially available yogurt (plain type) was added, and the mixture was stirred to be uniform, and then incubated at 40 ° C. for 7 hours. This was transferred to a refrigerator at 6 ° C., cooled for 3 hours, and then subjected to the following test.

(2) Measurement of the number of lactic acid bacteria in yogurt 1 g of yogurt was weighed, 9 ml of PBS was added and stirred until uniform, and a yogurt diluted solution was further prepared using PBS.
100 μl of this yogurt diluted solution was placed in a sterilized petri dish, 15 ml of lactic acid bacteria detection medium heated to 50 ° C. was added, and cultured at 37 ° C. for 48 hours. After culturing, the yellowed colonies were counted and multiplied by the dilution factor to determine the number of lactic acid bacteria in 1 g of yogurt.
As the lactic acid bacteria detection medium, a BCP-added plate count medium (manufactured by Kyokuto Pharmaceutical) was used.

(3) pH measurement of yogurt 1 g of yogurt was weighed, 9 ml of distilled water was added and stirred until it was uniform, immediately after preparation using a handy pH meter (Twin pH, manufactured by Horiba, Ltd.), and after refrigerated storage for 2 weeks. The pH was measured.

(4) Yogurt intake test About yogurt immediately after preparation and after refrigerated storage for 2 weeks, the panelists (3 men, 3 women; ages 28-48 years) selected arbitrarily were ingested and delicious. The scales of sourness and sweetness were evaluated on a scale of 0 to 10 by the VAS (Visual Analog Scale) method.
The questionnaire table used for evaluation is shown in FIG. The t-test was used for the test.

(5) Quantification of oligosaccharide in yogurt 1 g of yogurt was weighed, 1 ml of 500 ppm gentiobiose and 8 ml of distilled water were added and stirred until uniform, and then centrifuged at 15,000 rpm for 10 minutes to collect the supernatant. The oligosaccharide in the obtained supernatant was measured using an ion chromatograph. A DX500 sugar analysis system manufactured by Dionex was used, and the column was Carbo Pac PA-10 (4.6 × 250 mm). As an eluent, a 0.1 M NaOH solution was used as the A liquid, and a 0.1 M NaOH solution containing 0.5 M CH ₃ COONa was used as the B liquid. The elution conditions for the linear concentration gradient from solution A to solution B were as follows. For detection, a pulse amperometric electrochemical detector ED50 was used.
0-10min A 100%, B 0%
10-30min A 60%, B 40%
The oligosaccharide content in the sample was determined from the area ratio of gentiobiose added as an internal standard and each oligosaccharide.
UX10 was evaluated for its stability in yogurt by measuring neutral xylo-oligosaccharides produced by decomposition.
The oligosaccharide residual rate was expressed as a percentage of the concentration determined from yogurt with respect to the added concentration (1%).

<Test results>
Example 3 with NX5 added as a test substance at the time of yogurt preparation, Example 4 with UX10 added, Comparative Example 5 with XOS added, Comparative Example 5 with GOS added, Comparative Example 6 with FOS added This was used as Comparative Example 7, and the product prepared without adding oligosaccharide was used as Comparative Example 8. Table 2 shows the number of lactic acid bacteria in yogurt, Table 3 shows the pH of yogurt, Table 4 shows the evaluation of the yogurt intake test, and Table 5 shows the oligosaccharide residual rate in yogurt.
From the results in Table 2, no difference was observed between the Examples and Comparative Examples in the number of lactic acid bacteria immediately after production. On the other hand, after refrigerated storage for 2 weeks, there was a tendency for Comparative Examples 6 to 8 to decrease compared to Example 3 and Example 4.
From the results in Table 3, no difference was found between the examples and comparative examples in the pH of yogurt immediately after production. On the other hand, after refrigerated storage for 2 weeks, a tendency to decrease in Comparative Examples 6 to 8 as compared with Example 3 and Example 4 was observed.
From the results of Table 4, in the yogurt immediately after production and after storage for 2 weeks, Examples 3 and 4 had significantly higher deliciousness scores than Comparative Examples 5-8.
Regarding the sourness score, Examples 3 and 4 and Comparative Example 5 were significantly lower than Comparative Examples 6 to 8 in yogurt after storage for 2 weeks.
Regarding the sweetness strength score, in the yogurt immediately after production, Example 3, Example 4, Comparative Example 6, and Comparative Example 8 were significantly lower than Comparative Examples 5 and 7.
From the results of Table 5, in Comparative Examples 6 and 7, oligosaccharides decreased immediately after yogurt preparation and after storage for 2 weeks.
From the above results, the xylo-oligosaccharides and acidic xylo-oligosaccharides of the present invention have high prebiotic activity, are less susceptible to degradation during the production process and storage period of yogurt, and when added to fermented milk, It is effective in stabilizing and improving the taste, and has high performance as a fermented milk additive compared to xylobiose and galactooligosaccharide, which is mainly used as a fermented milk additive. It became clear that.

  By adding the xylo-oligosaccharide or acidic xylo-oligosaccharide of the present invention to the fermented milk as a fermented milk additive, the physiological function of the fermented milk is enhanced, and at the same time, the quality of the fermented milk can be stabilized and the taste can be improved.

It is a figure showing the chromatogram of xylooligosaccharide. It is a figure showing the molecular weight distribution pattern of acidic xylo-oligosaccharide. It is a figure showing the questionnaire of a yogurt intake test.

Claims (5)

A fermented milk additive comprising, as an active ingredient, xylooligosaccharide having an average chain length of 3.5 or more and a xylobiose content of 25% or less. A fermented milk additive comprising acidic xylo-oligosaccharide as an active ingredient. The fermented milk additive according to claim 2, wherein the acidic xylo-oligosaccharide has at least one uronic acid residue as a side chain in one molecule. 4. The fermented milk additive according to claim 3, wherein the uronic acid is glucuronic acid or 4-O-methyl-glucuronic acid. Xylooligosaccharides or acidic xylo-oligosaccharides can be obtained by treating the lignocellulosic material enzymatically and / or physicochemically to obtain a xylooligosaccharide component and a complex of an acidic xylo-oligosaccharide component and a lignin component, and then subjecting the complex to acid hydrolysis The fermented milk additive according to claim 1 or 2, which is obtained by separating a xylooligosaccharide mixture obtained by treatment.

Images