JP2009039118A - Composition and method for diagnosing and treating lesion associated with angiogenesis - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a composition and a method for stimulating or inhibiting angiogenesis and/or cardiovascularization in mammals including humans. <P>SOLUTION: A new polypeptide and a nucleic acid molecule encoding the polypeptide are provided. A vector and host cell containing the base sequence of the nucleic acid molecule, a chimera polypeptide molecule containing the polypeptide fused with a foreign polypeptide, an antibody binding with the polypeptide, and the method for producing the polypeptide are provided. A pharmaceutical composition is based on the polypeptide or the antagonist thereto and is useful for diseases such as trauma such as wound, various kinds of cancers and disorders of vessels including atherosclerosis and cardiac hypertrophy. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

Detailed Description of the Invention

1. The present invention relates to compositions and methods useful for modulating (eg, promoting or inhibiting) angiogenesis and / or cardiovascularization in a mammal in need of such biological effect. Furthermore, the present invention relates to the diagnosis and treatment of diseases involving angiogenesis (eg cardiovascular and oncological diseases).

2. 2. Background of the Invention 2.1. Angiogenesis Induction of angiogenesis, defined as the growth or sprouting of new blood vessels from existing blood vessels, is a complex process that occurs primarily during embryonic development. Under normal physiological conditions in adults, angiogenesis occurs only under very limited circumstances such as hair growth and wound healing (Auerbach, W. and Auerbach, R., 1994, Pharmacol Ther 63 (3 ): 265-3 11; Ribatti et al., 1991, Haematologica 76 (4): 3 11-20; Risau, 1997, Nature 386 (6626): 67 1-4). Uncontrolled angiogenesis has been gradually recognized to be responsible for a wide range of diseases including but not limited to cardiovascular disease, cancer, rheumatoid arthritis, psoriasis and diabetic retinopathy (Folkman, 1995, Nat Med 1 (1): 27-31; Isner, 1999, Circulation 99 (13): 1653-5; Koch, 1998, Arthritis Rheum 41 (6): 951-62; Walsh, 1999, Rheumatology (Oxford) 38 (2) : 103-12; Ware and Simons, 1997, Nat Med 3 (2): 158-64).
2.2. Heart Diseases and Factors About 5 million Americans have heart failure, and about 400,000 new cases of heart failure each year. It is the single most common cause of hospitalization for people over the age of 65 in the United States. Recent advances in responding to acute heart failure, including acute myocardial infarction, have resulted in an increasing number of patients with chronic heart failure. From 1979 to 1995, the number of patients with congestive heart failure (CHF) rose from 377,000 to 872,000 (up 130 percent) and death from CHF increased 116 percent.
CHF is a syndrome characterized by left ventricular dysfunction, reduced exercise tolerance, worsening of life standards, and markedly reduced life expectancy. A prerequisite for heart failure is that the heart is unable to push blood at a rate sufficient to meet the metabolic requirements of body tissues (in other words, lack of cardiac output).
At least four major compensation mechanisms are activated in the case of heart failure, including peripheral vasoconstriction, increased heart rate, increased cardiac contractility, and increased plasma volume. These effects are mainly mediated by the sympathetic nervous system and the renin-angiotensin system. See Eichhorn, American Journal of Medicine, 104: 163-169 (1998). Increasing output from the sympathetic nervous system increases pulse, heart rate, and contractility. Angiotensi II 1) stimulates vascular smooth muscle contraction directly, 2) stimulates aldosterone and antidiuretic hormone secretion, promotes plasma volume expansion, 3) stimulates sympathetic-mediated vascular tone, 4) Increases blood pressure by catalyzing the modification of bradykinin with vasodilation and natriuretic activity. See the review by Brown and Vaughan, Circulation, 97: 1411-1420 (1998). As described below, angiotensin II also has a direct detrimental effect by promoting myocyte necrosis (deterioration of systolic function) and cardiac fibrosis (diastole and sometimes worsening contractile function). Have. See Weber, Circulation, 96: 4065-4082 (1998).

A common feature of congestive heart failure (CHF) is cardiac hypertrophy, where heart enlargement is activated by both mechanical and hormonal stimulation, allowing the heart to meet the demand for increased cardiac output. Morgan and Baker, Circulation, 83: 13-25 (1991). This hypertrophic response is often associated with various characteristic conditions such as hypertension, aortic stenosis, myocardial infarction, cardiomyopathy, valvular regurgitation, and intracardiac shunting, all of which are chronically hemodynamically overactive. It becomes a load.
Hypertrophy is usually defined as an increase in the size of an organ or structure that does not involve tumor formation and is not involved in natural growth. Cardiac hypertrophy is caused by either or both an increase in the mass of individual cells (myocytes) or an increase in the number of cells that form tissue (hyperplasia). The expansion of the fetal heart depends mainly on an increase in the number of myocytes (which continues until immediately after birth), but postnatal cardiac myocytes lose their ability to proliferate. Further development occurs through the enlargement of individual cells.
The expansion of adult myocytes is initially beneficial as a short-term response to impaired cardiac function by first allowing the individual muscle fiber burden to be reduced. However, when subjected to severe and prolonged overload, the hypertrophic cells begin to deteriorate and die. Katz, "Heart Failure", in: Katz AM ed., Physiology of the Heart (New York: Raven Press, 1992) pp. 638-668. Cardiac hypertrophy is a significant risk factor for mortality and morbidity in the clinical course of heart failure. Katz, Trends Cardiovasc. Med., 5: 37-44 (1995). For further details of causes and symptoms of cardiac hypertrophy, see, for example, Heart Disease, A Textbook of Cardiovascular Medicine, Braunwald, E. ed. (WB Saunders Co., 1988), Chapter 14, “Pathophysiology of Heart Failure”.
At the cellular level, the heart is made up of surrounding supporting cells called myocytes and collectively non-myocytes. Non-myocytes are initially fibroblasts / mesenchymal cells and they include endothelial and smooth muscle cells. Indeed, myocytes form the majority of adult myocardial mass, but represent only about 30% of the total number of cells present in the heart. In response to hormonal, physiological, hemodynamic, and pathological stimuli, adult ventricular myocytes can adapt to an increased burden through activation of the hypertrophic process. This reaction occurs without concomitant cell division and activation of fetal genes, including the gene for atrial natriuretic peptide (ANP), and increases the content of contractile proteins in individual cardiomyocytes and the cell size of myocytes Is characterized by Chien et al., FASEB J., 5: 3037-3046 (1991); Chien et al., Annu. Rev. Physiol., 55: 77-95 (1993). Increased myocardial mass as a result of increased myocyte size associated with the accumulation of interstitial collagen in the extracellular matrix and around the intramyocardial coronary artery is associated with left ventricular hypertrophy following pressure overload in humans is described. Caspari et al., Cardiovasc. Res. 11: 554-558 (1977); Schwarz et al., Am. J. Cardiol., 42: 895-903 (1978); Hess et al., Circulation, 63: 360-371 (1981); Pearlman et al., Lab. Invest. 46 158-164 (1982).

It is also suggested that paracrine factors produced by non-myocyte-supporting cells may further contribute to the development of cardiac hypertrophy, and various non-myocyte-derived hypertrophic factors such as leukocyte inhibitory factor (LIF) and endothelin have been identified. ing. Metcalf, Growth Factors, 7: 169-173 (1992); Kurzrock et al., Endocrinne Reviews, 12: 208-217 (1991); Inoue et al., Proc. Natl. Acad. Sci. USA, 86: 2863-2867 (1989) Yanagisawa and Masaki, Treds Pharm. Sci., 10: 374-378 (1989); US Pat. No. 5,573,762 (published 12 November 1996). Additional exemplary factors considered as potential mediators of cardiac hypertrophy are cardiotrophin-1 (CT-1) (Pennica et al., Proc. Nat. Acad. Sci. USA, 92: 1142-1146 ( 1995)), catecholamines, corticosteroids, angiotensin, and prostaglandins.
At present, the treatment of cardiac hypertrophy varies depending on the potential heart disease. Catecholamines, corticosteroids, angiotensin, prostaglandins, LIF, endothelin (including endothelin-1, -2, and -3 and big endothelin) and CT-1 are potential hypertrophy It is a factor that is considered an intervening substance. For example, β-adrenergic receptor blockers (β-blockers such as propranolol, timolol, tertalolol, carteolol, nadolol, betaxolol, penbutolol, acetobutrol, atenolol, metoprolol, carvedilol, etc.) and verapamil Is widely used in the treatment of hypertrophic cardiomyopathy. The beneficial effects of β-blockers on symptoms (eg chest pain) and exercise load depend primarily on reducing heart rate, thus prolonging the relaxation phase and passively increasing ventricular filling. Thompson et al., Br. Heart J., 44: 488-98 (1980); Harrison et al., Circulation, 29: 84-98 (1964). Verapamil has been described to improve ventricular filling and possibly reduce myocardial ischemia. Bonow et al., Circulation, 72: 853-64 (1985).
Nifedipine and diltiazem are sometimes used to treat hypertrophic cardiomyopathy. Lorell et al., Circulation, 65: 499-507 (1982); Betocchi et al., Am. J. Cardiol., 78: 451-457 (1996). However, due to its strong vasodilator properties, nifedipine can be harmful, especially for patients with outflow disorders. Disopyramide is used to relieve symptoms due to its negative muscle contraction properties. Pollick, N. Engl. J. Med., 307: 997-999 (1982). However, in many patients, the initial effect is gradually reduced. Wigle et al., Circulation, 92: 1680-1692 (1995). Antihypertensive treatment has been reported to have a beneficial effect on cardiac hypertrophy associated with increased blood pressure. Examples of drugs used alone or in combination for antihypertensive treatment include calcium antagonists such as nitrendipine; adrenergic receptor inhibitors such as those listed above; such as quinapril, captopril, enalapril, ramipril, Angiotensin converting enzyme (ACE) inhibitors such as benazepril, fosinopril, lisinopril; diuretics such as chlorothiazide, hydrochlorothiazide, hydroflumethiazide, methylchlothiazide, benzthiazide, dichlorophenamide, acetazolamide, and indapamide; and There are calcium channel inhibitors such as diltiazene, nifedipine, verapamil, and nicardipine.
For example, treatment of hypertension with diltiazene and captolyl showed a decrease in left ventricular muscle mass, but the Doppler index of diastolic function did not become normal. Szlachcic et al., Am. J. Cardiol., 63: 198-201 (1989); Shahi et al., Lancet, 336: 458-461 (1990). These findings are interpreted to represent that excessive amounts of interstitial collagen can remain after degeneration of left ventricular hypertrophy. Rossi et al., Am. Heart J., 124: 700-709 (1992). Rossi et al., Supra, studied the effects of captopril on the suppression and degeneration of interstitial fibrosis and cardiomyocyte hypertrophy in pressure-induced cardiac hypertrophy in experimental rats.

Agents that directly increase myocardial contractility (inotropic agents) were initially thought to be useful for patients with heart failure to improve cardiac output in a short period of time. However, all positive inotropic agents, except digoxigenin, increase mortality in the long term, even if they improve heart performance in the short term. Massie, Curr. Op. In Cardiology, 12: 209-217 (1997); Reddy et al., Curr. Opin. Cardiol., 12: 233-241 (1997). Recently, β-adrenergic receptor inhibitors have been proposed for use in heart failure. Evidence from clinical trials suggests that improved cardiac function can be achieved without increasing mortality, but it has not yet been demonstrated that patient survival is improved. Also, US Pat. Nos. 5,592,924, 5,624,806; 5,661,122; and WO 95/28173 relating to cardiotropin-1 or antagonists thereof for CHF treatment, or growth hormone and / or insulin-like growth factor-I. reference. Another treatment modality is heart transplantation, but this is limited by the availability of donor hearts.
Endothelin is a vasoconstrictor peptide comprising 21 amino acids, isolated from porcine arterial endothelial culture supernatant and structurally determined. Yanagisawa et al., Nature, 332: 411-415 (1998). Endothelin has been later discovered to have various effects, and endothelin antibodies such as endothelin antagonists have proven effective in the treatment of myocardial infarction, renal failure, and other diseases. Since endothelin is present in the body and exhibits vasoconstrictive activity, it is expected to be an endogenous factor related to the regulation of the circulatory system. Can be involved. Endothelin antagonists are described, for example, in US Pat. No. 5,734,414; Japanese Patent Publication No. 3130299/1991, European Patent 457195, European Patent 460679; and European Patent 552489. A novel endothelin B receptor for identifying endothelin receptor antagonists is described in US Pat. No. 5,773,223.
Current treatments for heart disease are primarily directed to the use of angiotensin converting enzyme (ACE) inhibitors such as captopril and diuretics. These drugs improve hemodynamic aspects and exercise load and reduce mortality and morbidity in patients with CHF. Kramer et al., Circulation, 67 (4): 807-816 (1983); Captopril Multicenter Research Group, JACC, 2 (4): 755-763 (1983); The CONSENSUS Trial Study Group, N. Engl. J. Med. 316 (23): 1429-1435 (1987); The SOLVD Investigators, N. Engl. J. Med., 325 (5): 293-302 (1991). In addition, they are used for hypertension, left ventricular dysfunction, atherosclerotic vascular disease, and diabetic nephropathy. Brown and Vaughan listed above. However, despite the proven effectiveness, the response of ACE inhibitors is limited. For example, ACE inhibitors appear to delay progression to end-stage heart failure when prolonging life in a heart failure situation, but the majority of patients with ACE inhibitors have functional class III heart failure.
Furthermore, functional tolerance improvements and exercise time are negligible and mortality is reduced but still high. The CONSESUS Trial Study Group, N. Engl. J. Med., 316 (23): 1429-1453 (1987); The SOLVD Investigators, N. Engl. J. Med., 325 (5): 293-302 (1991) Cohn et al., N. Engl. J. Med., 325 (5): 303-310 (1991); The Captopril-Digoxin Multicenter Research Group, JAMA, 259 (4): 539-544 (1988). Thus, it appears that ACE inhibitors cannot relieve symptoms in more than 60% of heart failure patients and only reduce heart failure mortality to about 15-20%. For further side effects, see Broun and Vaughan above.

Alternatives to ACE inhibitors are represented by specific AT1 receptor antagonists. Clinical studies are planned to compare the effects of these two aspects in the treatment of cardiovascular and renal diseases. However, animal model data suggest that the ACE / AngII pathway is clearly associated with cardiac hypertrophy, but is not the only or active primary pathway in this role. The mouse gene “knockout” model has been created to test individual components of the pathway. In one such model, the major heart disease receptor for AngII, ATsub1A, was genetically deleted; these mice did not develop hypertrophy when AngII was given experimentally (AngII Confirmed the basic success of the model in the removal of secondary hypertrophy. However, when the aorta is contracted in these animals (hypertensive heart stress model), the heart still becomes hypertrophic. This suggests that another signaling pathway unrelated to this receptor (ATsub1A) is activated in hypertension. ACE inhibitors probably cannot inhibit these pathways. See Harada et al., Circulation, 97: 1952-1959 (1998). See also Homcy, Circulation, 97: 1890-1892 (1998) for mysteries related to the process and mechanism of cardiac hypertrophy.
About 750,000 patients each year suffer from acute myocardial infarction (AMI), and approximately one quarter of all deaths in the United States are due to AMI. In recent years, thrombolytic agents such as streptokinase, urokinase, and especially tissue plasminogen activator (t-PA) have greatly improved the survival rate of patients suffering from myocardial infarction. When administered as a continuous intravenous injection of 1.5 to 4 hours, t-PA causes coronary vascular release in 90 minutes in 69% to 90% of treated patients. Topol et al., Am. J. Cardiol., 61: 723-728 (1988); Neuhaus et al., J. Am. Coll. Cardiol., 12: 581-587 (1988); Neuhaus et al., J. Am. Coll. Cardiol ., 14: 1566-1569 (1989). The highest open rates have been reported at high doses or rapid dosing regimens. Topol, J. Am. Coll. Cardiol., 15: 922-924 (1990). T-PA can also be administered as a single bolus and, depending on its short half-life, is suitable for infusion therapy. Tebbe et al., Am. J. Cardiol., 64: 448-453 (1989). t-PA mutants are made to have a particularly long half-life and high fibrin specificity, but TNKt-PA (aT103N, N117Q, KHRR (296-299) AAAAt-PA mutant, Keyt et al., PROc Natl. Acad. Sci. USA, 91: 3670-3674 (1994)) is particularly suitable for bolus administration. However, despite all these developments, the long-term prognosis of patient survival is highly dependent on patient post-infusion monitoring and treatment, including monitoring and treatment of cardiac hypertrophy.

2.3. Growth factors According to reports, various naturally occurring polypeptides induce endothelial cell proliferation. These polypeptides include basic and acidic fibroblast growth factor (FGF) (Burgess and Maciag, Annual Rev. Biochem., 58: 575 (1989)), platelet derived endothelial cell growth factor (PD-ECGF) (Ishikawa et al., Nature, 338: 557 (1989)), and vascular endothelial growth factor (VEGF). Leung et al., Science, 246: 1306 (1989); Ferrara and Henzel, Biochem. Biophys. Res. Commun., 161: 851 (1989); Tischer et al., Biochem. Biophys. Res. Commun., 165: 1198 (1989) ; European Patent No. 471754B granted on July 31, 1996.
Conditioned medium with cells transfected with human VEGF (hVEGF) cDNA promotes proliferation of capillary endothelial cells, but not in the control. Leung et al., Science 246: 1306 (1989). Several additional cDNAs have been identified in human cDNA libraries encoding 121-, 189-, and 206-amino acid isoforms of hVEGF (also collectively referred to as hVEGF-related proteins). The 121-amino acid protein differs from hVEGF by the feature that the 44 amino acids between residues 116 and 159 of hVEGF are deleted. The 189-amino acid protein differs from hVEGF due to the insertion of 24 amino acids at residue 116 of hVEGF and is clearly identical to human vascular permeability factor (hVPF). The 206-amino acid protein differs from hVEGF due to the insertion of 41 amino acids at residue 116 of hVEGF. Houck et al., Mol. Endocrin., 5: 1806 (1991); Ferrara et al., J. Cell. Biochem., 47: 211 (1991); Endocrine Reviews, 13:18 (1992); Keck et al., Science, 246: 1309 (1989); Connolly et al., J. Biol. Chem., 264: 20017 (1989); European Patent No. 370989 published May 30, 1990.
Currently, angiogenesis, including the formation of new blood vessels from pre-existing endothelium, has been well documented to be associated with the pathogenesis of various diseases. These include solid tumors and metastases, atherosclerosis, retro-lens fibroproliferation, hemangiomas, chronic inflammation, intraocular neovascular syndromes such as proliferative retinopathy (eg diabetic retinopathy), age-related macular Degeneration (AMD), neovascular glaucoma, transplanted corneal and other cell immune responses, rheumatoid arthritis, and psoriasis. Folkman et al., J. Biol. Chem., 267: 10931-10934 (1992); Klagsbrun et al., Annu. Rev. Physiol., 53: 217-239 (1991); and Garner A., "Vascular diseases", In: Pathobiology of Ocular Disease. A Dynamic Approach, Garner A., Klintworth GK, eds., 2nd Edition (Marcel Dekker, NY, 1994), pp 1625-1710.
In the case of tumor growth, angiogenesis appears to be very important in the transition from hyperplasia to tumor formation, providing nourishment for solid tumor growth. Folkman et al., Nature, 339: 58 (1989). Neovascularization favors the growth of tumor cells compared to normal cells and provides proliferative independence. Tumors usually develop as abnormal single cells that can only grow to a size of a few cubic millimeters, depending on the distance from the available capillary bed, with further growth and dissemination over time. Can stay in no "sleeping state". Specific tumors then switch to an angiogenic phenotype that activates endothelial cells, grow into new capillaries, and mature. These newly formed blood vessels not only allow the primary tumor to continue to grow, but also allow the generalization and recolonization of metastatic tumor cells. Therefore, there is a correlation between tumor vessel microvessel density and patient survival in breast cancer as well as several other tumors. Weidner et al., N. Engl. J. Med, 324: 1-6 (1991); Horak et al., Lancet, 340: 1120-1124 (1992); Macchiarini et al., Lancet, 340: 145-146 (1992). The exact mechanism that controls the angiogenic switch is not well understood, but the neovascularization of the tumor mass results in a net balance of many angiogenic stimulators and inhibitors (Folkman , 1995, Nat Med 1 (1): 27-31).
In search of positive regulators of angiogenesis, a number of candidates including aFGF, bFGF, TGF-α, TGF-β, HGF, TNF-α, angiotensin, IL-8, etc. were given. The above-mentioned Folkman et al., JBC, and the above-mentioned Klagsbrun et al. Negative regulators so far defined are thrombospondin (Good et al., Proc. Natl. Acad. Sci. USA., 87: 6624-6628 (1990)), 16-kilodalton N-terminal fragment of prolactin ( Clapp et al., Endocrinology, 133: 1292-1299 (1993)), Angiostatin (O'Reilly et al., Cell, 79: 315-328 (1994)), and endostatin. O'Reilly et al., Cell, 88: 277-285 (1996).

Research in the last few years has revealed an important role for VEGF in not only stimulating the proliferation of vascular endothelial cells but also inducing vascular penetration and angiogenesis. Ferrara et al., Endocr. Rev., 18: 4-25 (1997). The finding that the loss of even one VEGF allele leads to fetal death suggests an irreplaceable role for this factor in vascular development and differentiation. Furthermore, VEGF has been shown to be an important mediator of neovascularization associated with tumors and intraocular diseases. Ferrara et al., Endocr. Rev., supra. VEGF mRNA is overexpressed in many human tumors examined. Berkman et al., J. Clin. Invest., 91: 153-159 (1993); Brown et al., Human Pathol., 26: 89-91 (1995); Brown et al., Cancer Res., 53: 4727-4735 (1993) Mattan et al., Brit. J. Cancer, 73: 931-934 (1996); Dvorak et al., Am. J. Pathol., 146: 1029-1039 (1995).
Also, the concentration level of VEGF in the ocular fluid is highly correlated with the presence of active vascular proliferation in patients with diabetes and other ischemia-related retinopathy. Aiello et al., N. Engl. J. Med., 331: 1480-1487 (1994). Furthermore, recent studies have shown that VEGF is localized in the choroidal neovascular membrane of patients affected by AMD. Lopez et al., Invest. Ophthalmol. Vis. Sci., 37: 855-868 (1996).
Anti-VEGF neutralizing antibodies inhibit the growth of various human tumor cell lines in nude mice (Kim et al., Nature, 362: 841-844 (1993); Warren et al., J. Clin. Invest., 95 : 1789-1797 (1995); Borgstrom et al., Cancer Res., 56: 4032-4039 (1996); Melnyk et al., Cancer Res., 56: 921-924 (1996)), and intraocular blood vessels in ischemic retinal diseases Inhibits formation. Adamis et al., Arch. Ophthalmol., 114: 66-71 (1996). Thus, anti-VEGF monoclonal antibodies or other inhibitors for VEGF action are candidates for the treatment of solid tumors and various intraocular neovascular diseases. Such antibodies are described, for example, in EP817,648 published 14 January 1998 and WO 98/45331 and WO 98/45332 published together 15 October 1998. ing.

There are a number of other growth and mitogenic factors, including transforming oncogenes, that can quickly induce a complex of genes expressed by certain cells. Lau and Nathans, Molecular Aspects of Cellular Regulation, 6: 165-202 (1991). These genes, termed immediate early genes or early response genes, are transcriptionally activated within a few minutes after contact with growth factors or mitogenic factors, regardless of new protein synthesis. These immediate early gene groups encode secreted extracellular proteins that are required to regulate complex biological processes such as differentiation and proliferation, regeneration, and wound healing. Ryseck et al., Cell Growth Differ., 2: 235-233 (1991).
Highly related proteins belonging to this group are rapidly activated by cef10 (Simmons et al., Proc. Natl. Acad. Sci. USA, 86: 1178-1182 (1989)), serum- or platelet-derived growth factor (PDGF) Cyr61 (O'Brien et al., Mol. Cell. Biol., 10: 3569-3577 (1990)), secreted by human vascular endothelial cells at high levels after activation by transforming growth factor β (TGF-β) Human connective tissue growth factor (CTGF), which exhibits PDGF-like biological and immunological activity and competes with PDGF for specific cell surface receptors (Bradham et al., J. Cell. Biol., 114: 1285 -1294 (1991)), fisp-12 (Ryseck et al., Cell Growth Differ., 2: 235-233 (1991)), human vascular IBP-like growth factor (VIGF) (WO96 / 17931), and usually adult kidney Nov which has been found to be quiescent in cells and overexpressed in myeloblast-related-virus type I induced nephroblastoma is included. Joloit et al., Mol. Cell. Biol., 12: 10-21 (1992).
The expression of these immediate early genes acts as a “third messenger” in a cascade of events triggered by growth factors. They are also considered necessary to integrate and coordinate complex biological processes such as wound healing, where differentiation and cell proliferation are normal events.
As an additional mitogen, insulin-like growth factor binding proteins (IGFBPs) increase IGF binding to fibroblast and smooth muscle cell surface receptors in complex with insulin-like growth factor (IGF) Has been shown to irritate. Clemmons et al., J. Clin. Invest., 77: 1548 (1986). Inhibitory effects of IGFBP on various in vitro IGF actions include stimulation of glucose transport by adipocytes, uptake of sulfate by chondrocytes, and uptake of thymidine into fibroblasts. Zapf et al., J. Clin. Invest., 63: 1077 (1979). Furthermore, the inhibitory effect of IGFBP on growth factor-mediated mitogen activity in normal cells has been shown.

2.4. The need for further treatment In view of the role of vascular endothelial cell growth and angiogenesis in many diseases and disorders, it has means to reduce or suppress one or more biological effects resulting from these processes It is preferable. It would also be desirable to have a means to test for the presence of pathogenic polypeptides in normal and disease states, particularly cancer. In addition, in certain aspects, there is no treatment generally applicable to the treatment of cardiac hypertrophy, so identifying factors that can prevent or reduce cardiac myocyte hypertrophy inhibit pathophysiological heart growth Is very important in the development of new treatment strategies. Although there are several treatment modalities for various cardiovascular and oncogenic diseases, further therapeutic approaches are still needed.

3. SUMMARY OF THE INVENTION The present invention relates to compositions and methods for modulating (eg, promoting or inhibiting) angiogenesis and / or cardiovascularization in a mammal. The present invention is based on the identification of compounds (ie proteins) that test positive in various cardiovascular assays that test the modulation (eg, promotion or inhibition) of certain biological activities. Thus, promoting or inhibiting angiogenesis, inhibiting or stimulating vascular endothelial cell growth, stimulating vascular endothelial cell growth or proliferation, inhibiting tumor growth, inhibiting angiogenesis-dependent tissue growth, stimulating angiogenesis-dependent tissue growth Where an effect is desired, such as inhibition of cardiac hypertrophy and stimulation of cardiac hypertrophy, eg treatment of congestive heart failure, the compound has certain effects, such as promoting or inhibiting angiogenesis, inhibiting vascular endothelial cell proliferation Or diagnosis of disease, stimulation of vascular endothelial cell growth or proliferation, inhibition of tumor growth, angiogenesis-dependent tissue growth, eg inhibition of cardiac hypertrophy in the treatment of congestive heart failure and stimulation of cardiac hypertrophy, etc. It is considered to be a drug and / or drug component useful for treatment (including prevention and remission). Furthermore, the compositions and methods of the present invention provide clinical evaluation for the treatment of angiogenesis-related diseases, for monitoring effects in clinical trials, and for identifying patients prone to such angiogenesis-related diseases. Provide diagnostic monitoring of the patient receiving.
In one embodiment, the invention provides a composition comprising a PRO polypeptide, an agonist or antagonist thereof, or an anti-PRO antibody mixed with a pharmaceutically acceptable carrier. In one aspect, the composition contains a therapeutically effective amount of the polypeptide. In other embodiments, the composition contains a further active ingredient, ie, a cardiovascular, endothelial or angiogenic or angiostatic agent, preferably an angiogenic or angiostatic agent. Preferably the composition is sterile. The PRO polypeptide, agonist, antagonist or antibody can be administered in the form of a liquid pharmaceutical preparation, which can be stored to increase storage stability. A stored liquid pharmaceutical preparation may contain a multi-dose PRO polypeptide, agonist, antagonist or antibody and is therefore suitable for repeated use. In a preferred embodiment, the composition comprises an antibody, and the antibody is a monoclonal antibody, antibody fragment, humanized antibody or single chain antibody.

In a further embodiment, the present invention is useful for the treatment of cardiovascular, endothelial or angiogenic diseases comprising a mixture of a pharmaceutically acceptable carrier and a therapeutically effective amount of a PRO polypeptide, agonist, antagonist or antibody. A method for preparing such a composition is provided.
In yet a further aspect, the present invention provides:
(a) a composition of matter containing a PRO polypeptide or an agonist or antagonist thereof;
(b) a container containing the composition; and
(c) providing an article of manufacture comprising a label attached to the container or a packaging insert contained in the container, describing the use of the PRO polypeptide in the treatment of cardiovascular, endothelial or angiogenic diseases; The agonist or antagonist may be an antibody that binds to a PRO polypeptide. The composition may comprise a therapeutically effective amount of a PRO polypeptide or an agonist or antagonist thereof.
In another embodiment, the present invention provides a method for identifying an agonist of a PRO polypeptide, comprising:
(A) contacting the cell with a test compound to be screened under conditions suitable for inducing a cellular response normally elicited by a PRO polypeptide; and (b) measuring the induction of said cellular response; Determining whether the test compound is an effective agonist, wherein the induction of the cellular response indicates that the test compound is an effective agonist.
In another embodiment, the present invention provides a method for identifying an agonist of a PRO polypeptide, comprising:
(A) contacting the cell with a test compound to be screened under conditions suitable for stimulation of cell proliferation by the PRO polypeptide; and (b) measuring the proliferation of the cell so that the test compound is an effective agonist. Determining whether or not the stimulation of cell proliferation indicates that the test compound is an effective agonist.

In another embodiment, the invention provides a method of identifying a compound that inhibits the activity of a PRO polypeptide, which comprises a test compound under conditions sufficient for the PRO polypeptide to interact with the test compound and the polypeptide. And contacting with time to determine whether the activity of the PRO polypeptide is inhibited. In particularly preferred embodiments, either the test compound or the PRO polypeptide is immobilized on a solid support. In other preferred embodiments, the non-immobilized component carries a detectable label. In a preferred embodiment, the method is:
(A) contacting the cell with a test compound to be screened in the presence of the PRO polypeptide under conditions suitable for inducing a cellular response normally elicited by the PRO polypeptide; and (b) the cellularity Measuring the induction of a response to determine whether the test compound is an effective agonist.
In other preferred embodiments, the method comprises:
(A) contacting the cell with the test compound to be screened in the presence of the PRO polypeptide under conditions suitable for stimulation of cell proliferation by the PRO polypeptide; and (b) measuring the proliferation of the cell. Determining whether the test compound is an effective agonist.
In another embodiment, the invention provides a method of identifying a compound that inhibits expression of a cell that normally expresses the PRO polypeptide, the method comprising contacting the cell with a test compound, Measuring whether the expression of the peptide is inhibited. In a preferred embodiment, the method is:
(a) contacting the cell with a test compound to be screened under conditions suitable for expressing the PRO polypeptide; and
(b) measuring the inhibition of expression of the polypeptide.
In yet a further embodiment, the invention provides compounds that inhibit the expression of a PRO polypeptide, such as the compounds identified by the above methods.

Other aspects of the invention are directed to agonists or antagonists of the PRO polypeptide that may be identified by the methods described above.
One type of antagonist of a PRO polypeptide that inhibits one or more functions or activities of the PRO polypeptide is an antibody. Thus, in another aspect, the invention provides an isolated antibody that binds to a PRO polypeptide. In a preferred embodiment, the antibody is a monoclonal antibody, preferably having non-human complementarity determining region (CDR) residues and human framework region (FR) residues. The antibody may be labeled or immobilized on a solid support. In a further aspect, the antibody is an antibody fragment, a single chain antibody, or a humanized antibody. Preferably, the antibody specifically binds to the polypeptide.
In yet a further aspect, the invention provides a method of diagnosing a disease or susceptibility to a disease associated with a mutation in a nucleic acid sequence encoding a PRO polypeptide, wherein the presence or absence of said mutation in the PRO polypeptide-encoding nucleic acid sequence. Providing a method comprising determining the presence, wherein the presence or absence of the mutation indicates the presence of the disease or susceptibility to the disease.
In yet a further aspect, the invention provides a method of diagnosing a cardiovascular, endothelial or angiogenic disease in a mammal, which comprises (a) a test sample of tissue cells obtained from said mammal, and (b) the same Analyzing the expression level of the gene encoding the PRO polypeptide in a control sample of known normal tissue cells of the cell type, wherein the level of expression in the test sample when compared to the control sample Indicates the presence of cardiovascular, endothelial or angiogenic disease in the animal. Expression of the gene encoding the PRO polypeptide may optionally be made by measuring the level of mRNA or polypeptide in the test sample as compared to the control sample.
In yet a further aspect, the present invention provides a method of diagnosing cardiovascular, endothelial or angiogenic disease in a mammal, which detects the presence or absence of a polypeptide in a test sample of tissue cells obtained from said mammal And the presence or absence of the polypeptide in the test sample indicates the presence of a cardiovascular, endothelial or angiogenic disease in the mammal.

In yet a further aspect, the present invention provides a method of diagnosing a cardiovascular, endothelial or angiogenic disease in a mammal comprising: (a) treating a test sample of tissue cells obtained from said mammal with an anti-PRO antibody. And b) detecting complex formation between said antibody and PRO polypeptide in a test sample, wherein said complex formation is a cardiovascular, endothelial or angiogenic disease in said mammal Indicates the presence of Detection may be qualitative or quantitative and may be performed relative to monitoring complex formation in a control sample of known normal tissue cells of the same cell type. The amount of complex formation in the test sample indicates the presence of cardiovascular, endothelial or angiogenic failure in the mammal from which the test tissue cells were obtained. The antibody preferably carries a detectable label. Complex formation can be monitored, for example, by light microscopy, flow cytometry, fluorimetry, or other techniques known in the art. Test samples are usually obtained from individuals suspected of having cardiovascular, endothelial or angiogenic diseases.
In another embodiment, the present invention provides a method for determining the presence of a PRO polypeptide in a sample, which comprises contacting a sample suspected of containing a PRO polypeptide with an anti-PRO antibody, Measuring binding to components of the sample. In a particular embodiment, the sample comprises cells presumed to contain a PRO polypeptide and the antibody binds to the cells. The antibody is preferably detectably labeled and / or immobilized on a solid support.
In a further aspect, the present invention provides a cardiovascular, endothelial or angiogenic disease diagnostic kit comprising an anti-PRO antibody and a carrier in a suitable package. Preferably, such a kit further comprises instructions for using said antibody for detecting the presence of PRO polypeptide. Preferably, the carrier is a buffer, for example. Preferably, the cardiovascular, endothelial or angiogenic disease is cancer.
In yet another embodiment, the invention provides a method of treating a cardiovascular, endothelial or angiogenic disease in a mammal, comprising administering to the mammal an effective amount of a PRO polypeptide. . Preferably, the disease is a cardiac hypertrophy, trauma such as a wound or burn, or a type of cancer. In a further aspect, if the cardiovascular, endothelial or angiogenic disease is a type of cancer, the mammal may be an angioplasty or an agent for treating the cardiovascular, endothelial or angiogenic disease, such as an ACE inhibitor, Or further exposure to chemotherapeutic agents. Preferably the mammal is a human, preferably a human at risk of developing cardiac hypertrophy, more preferably a human suffering from myocardial infarction.
In another preferred embodiment, cardiac hypertrophy is characterized by the presence of elevated PEG _2α levels. Alternatively, cardiac hypertrophy is induced by myocardial infarction, where preferably administration of the PRO polypeptide is initiated within 48 hours, preferably within 24 hours following myocardial infarction.

In another preferred embodiment, the cardiovascular, endothelial or angiogenic disease is cardiac hypertrophy and the PRO polypeptide is administered with a cardiovascular, endothelial or angiogenic agent. Preferred cardiovascular, endothelial or angiogenic agents for this purpose are selected from the group consisting of antihypertensive agents, ACE inhibitors, endothelin receptor antagonists and thrombolytic agents. Where a thrombolytic agent is administered, preferably the PRO polypeptide is administered after administration of such an agent. More preferably, the thrombolytic agent is a recombinant human tissue plasminogen activator.
In other preferred embodiments, the cardiovascular, endothelial or angiogenic disease is cardiac hypertrophy and the PRO polypeptide is administered following primary angioplasty for the treatment of acute myocardial infarction, preferably wherein the mammal Is further exposed to angioplasty or cardiovascular, endothelial or angiogenic drugs.
In another preferred embodiment, the cardiovascular, endothelial or angiogenic disease is cancer and the PRO polypeptide is administered in combination with a chemotherapeutic agent, growth inhibitory agent or cytotoxic agent.
In a further embodiment, the invention provides a method for treating a cardiovascular, endothelial or angiogenic disease in a mammal, which comprises administering to the mammal an effective amount of an agonist, antagonist or antibody of a PRO polypeptide. Comprising. Preferably, the cardiovascular, endothelial or angiogenic disease is cardiac hypertrophy, trauma, cancer, or age-related macular degeneration. Also preferably, the mammal is a human and an effective amount of an angiogenic or angiostatic agent is administered with an agonist, antagonist or antibody.

In yet a further embodiment, the present invention provides a method for treating a cardiovascular, endothelial or angiogenic disease in a mammal suffering from a cardiovascular, endothelial or angiogenic disease comprising: (a) a PRO polypeptide, ( b) administering to the mammal a nucleic acid molecule encoding either an agonist of the PRO polypeptide or (c) an antagonist of the PRO polypeptide, wherein the agonist or antagonist is an anti-PRO antibody. It's okay. In a preferred embodiment, the mammal is a human. In another preferred embodiment, the gene is administered via ex vivo gene therapy. In a further preferred embodiment, the gene is included in a vector, more preferably an adenovirus, adeno-associated virus, lentivirus, or retroviral vector.
In another aspect, the invention also provides a promoter, (a) a PRO polypeptide, (b) an agonist polypeptide of the PRO polypeptide, or (c) a nucleic acid molecule encoding an antagonist polypeptide of the PRO polypeptide, and A recombinant retroviral particle is provided that contains a retroviral vector consisting essentially of a signal sequence for cellular secretion of the peptide, wherein the retroviral vector is associated with a retroviral structural protein. Preferably, the signal sequence is from a mammal, such as a native PRO polypeptide.
In yet a further embodiment, the present invention comprises a nucleic acid construct that expresses a retroviral structural protein and comprises a promoter, (a) a PRO polypeptide, (b) an agonist polypeptide of a PRO polypeptide, or (c) PRO. An ex vivo producer cell, further comprising a retroviral vector consisting essentially of a nucleic acid molecule encoding a polypeptide antagonist polypeptide and a signal sequence for cellular secretion of the polypeptide, wherein said production The cells include retroviral vectors associated with structural proteins that produce recombinant retroviral particles.
In yet another embodiment, the invention provides a method of inhibiting the growth of mammalian endothelial cells, comprising (a) a PRO polypeptide, (b) an agonist of the PRO polypeptide, or (c) a PRO polypeptide. Administering to the mammal, wherein the mammal's endothelial cell growth is inhibited, and said agonist or antagonist may be an anti-PRO antibody. Preferably, the mammal is a human and the endothelial cell growth is associated with a tumor or retinal disease.
In yet another embodiment, the present invention provides a method of stimulating mammalian endothelial cell growth, which comprises (a) a PRO polypeptide, (b) an PRO polypeptide agonist, or (c) a PRO polypeptide. Administering to the mammal, wherein the growth of the endothelial cells of said mammal is stimulated, and said agonist or antagonist may be an anti-PRO antibody. Preferably the mammal is a human.
In yet another embodiment, the invention provides a method of inhibiting cardiac hypertrophy in a mammal, which comprises (a) a PRO polypeptide, (b) an PRO polypeptide agonist, or (c) an PRO polypeptide antagonist. Administering to a mammal, wherein the mammal's cardiac hypertrophy is inhibited and the agonist or antagonist may be an anti-PRO antibody. Preferably, the mammal is a human and the cardiac hypertrophy is induced by myocardial infarction.

In yet another embodiment, the present invention provides a method of stimulating mammalian cardiac hypertrophy, which comprises (a) a PRO polypeptide, (b) an PRO polypeptide agonist, or (c) an PRO polypeptide antagonist. Administering to a mammal, wherein said mammal's cardiac hypertrophy is stimulated and said agonist or antagonist may be an anti-PRO antibody. Preferably, the mammal is a human suffering from congestive heart failure.
In yet another embodiment, the invention provides a method of inhibiting angiogenesis induced by a PRO polypeptide in a mammal, comprising administering to the mammal a therapeutically effective amount of an anti-PRO antibody. Comprising. Preferably, the mammal is a human suffering from congestive heart failure.
In yet another embodiment, the invention provides a method of stimulating angiogenesis induced by a PRO polypeptide in a mammal, comprising administering to the mammal a therapeutically effective amount of the PRO polypeptide. Comprising. Preferably, the mammal is a human, more preferably angiogenesis promotes tissue regeneration or trauma healing.
In yet another embodiment, the present invention relates to PRO21, PRO181, PRO205, PRO214, PRO221, PRO229, PRO231, PRO238, PRO241, PRO247, PRO256, PRO258, PRO263, PRO265, PRO295, PRO321, PRO322, PRO337 to mammals. , PRO363, PRO365, PRO444, PRO533, PRO697, PRO720, PRO725, PRO771, PRO788, PRO791, PRO819, PRO827, PRO828, PRO836, PRO846, PRO865, PRO1005, PRO1006, PRO1007, PRO1025, PRO1029, PRO1054, PRO1071, PRO1075, PRO1079 , PRO1080, PRO1114, PRO1131, PRO1155, PRO1160, PRO1184, PRO1186, PRO1190, PRO1192, PRO1195, PRO1244, PRO1272, PRO1273, PRO1274, PRO1279, PRO1283, PRO1286, PRO1306, PRO1309, PRO1325, PRO1329, PRO1347, PRO1356, PRO1376, PRO1382 , PRO1411, PRO1412, PRO1419, PRO1474, PRO1477, PRO1488, PRO1508, PRO1550, PRO1556, PRO1760, PRO1782, PRO1787, PRO1801, PRO1868, PRO1887, PRO1890, PRO3438, PRO3444, PRO4302, PRO4324, PRO4333, PRO4341, PRO4342, PRO4353, PRO4354 , PRO4356, PRO4371, PRO4405, PRO4408, PRO4422, PRO4425, PRO4499, PRO5723, PRO5725, PRO5737, PRO5776, PRO6006, PRO6029, PRO6071, PRO743 6, PRO9771, PRO9821, PRO9873, PRO10008, PRO10096, PRO19670, PRO20040, PRO20044, PRO21055, PRO21384 or PRO28631 modulate endothelial cell proliferation in a mammal comprising administration of an agonist or antagonist thereof (eg, inhibition) Or a method of modulating endothelial cell proliferation in said mammal.

In yet another embodiment, the present invention provides PRO162, PRO181, PRO182, PRO195, PRO204, PRO221, PRO230, PRO256, PRO258, PRO533, PRO697, PRO725, PRO738, PRO826, PRO836, PRO840, PRO846, PRO865 to mammals. , PRO982, PRO1025, PRO1029, PRO1071, PRO1080, PRO1083, PRO1134, PRO1160, PRO1182, PRO1184, PRO1186, PRO1192, PRO1265, PRO1274, PRO1279, PRO1283, PRO1306, PRO1308, PRO1309, PRO1325, PRO1337, PRO1338, PRO1343, PRO1376, PRO1387 , PRO1411, PRO1412, PRO1415, PRO1434, PRO1474, PRO1488, PRO1550, PRO1556, PRO1567, PRO1600, PRO1754, PRO1758, PRO1760, PRO1787, PRO1865, PRO1868, PRO1917, PRO1928, PRO3438, PRO3562, PRO4302, PRO4333, PRO4345, PRO4353, PRO4354 , PRO4405, PRO4408, PRO4430, PRO4503, PRO5725, PRO6714, PRO9771, PRO9820, PRO9940, PRO10096, PRO21055, PRO21184 or PRO21366 regulates smooth muscle cell proliferation in mammals comprising administration of an agonist or antagonist thereof ( For example, inhibiting or stimulating), Proliferation of smooth muscle cells in serial mammal provides a method to be adjusted.
In yet another embodiment, the invention provides a method of modulating (eg, inducing or reducing) cardiac hypertrophy in a mammal comprising administration of a PRO21 polypeptide, agonist or antagonist thereof to the mammal, comprising: Provided are methods by which cardiac hypertrophy is stimulated in a mammal.
In yet another embodiment, the invention provides a method of modulating (eg, inducing or reducing) apoptosis of endothelial cells in a mammal comprising administering to the mammal a PRO4302 polypeptide, an agonist or antagonist thereof. A method is provided wherein cardiac hypertrophy is modulated in said mammal.
In yet another embodiment, the invention modulates angiogenesis in a mammal comprising administering to the mammal a therapeutically effective amount of a PRO1376 or PRO1449 polypeptide, agonist or antagonist thereof (eg, inhibiting or A method of stimulating) in which the angiogenesis is modulated.
In yet another embodiment, the present invention provides PRO178, PRO195, PRO228, PRO301, PRO302, PRO532, PRO724, PRO730, PRO734, PRO793, PRO871, PRO938, PRO1012, PRO1120, PRO1139, PRO1198, PRO1287, PRO1361, PRO1864, PRO1873 , PRO2010, PRO3579, PRO4313, PRO4527, PRO4538, PRO4553, PRO4995, PRO5730, PRO6008, PRO7223, PRO7248 or PRO7261 polypeptide, comprising administering to the mammal an endothelial cell tube formation comprising Provided is a method of modulating (eg, inducing or reducing) angiogenesis by modulating (eg, inducing or reducing), wherein the endothelial cell tube formation in said mammal is regulated.
In another embodiment of the invention, the invention provides an isolated nucleic acid sequence comprising a nucleotide sequence that encodes a PRO polypeptide.

In one aspect, an isolated nucleic acid molecule comprises: (a) a full-length amino acid sequence disclosed herein, an amino acid sequence lacking a signal peptide disclosed herein, an extracellular of a transmembrane protein with or without a signal peptide disclosed herein. A DNA molecule encoding a PRO polypeptide having a domain or other specifically identified fragment of the full-length amino acid sequence disclosed herein, or (b) at least about 80% relative to the complementary strand of the DNA molecule of (a), 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% Or a nucleotide sequence having 98% nucleic acid sequence identity, or at least about 99% nucleic acid sequence identity.
In other embodiments, the isolated nucleic acid molecule comprises (a) a full-length PRO polypeptide cDNA coding sequence disclosed herein, a coding sequence of a PRO polypeptide that lacks a signal peptide disclosed herein, a signal disclosed herein. A DNA molecule having the coding sequence of the extracellular domain of a transmembrane PRO polypeptide with or without a peptide, or the coding sequence of another particularly identified fragment of the full-length amino acid sequence disclosed herein, or (b) (a ) At least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92% , 93%, 94%, 95%, 96%, 97% or 98% nucleic acid sequence identity, or at least about 99% nucleic acid sequence identity.
In a further aspect, the present invention provides (a) a DNA molecule that encodes the same mature polypeptide encoded by any of the human protein cDNAs deposited with the ATCC disclosed herein, or (b) of (a) At least about 80% sequence identity to the complementary strand of the DNA molecule, preferably at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% , 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 98% nucleic acid sequence identity, or at least about 99% nucleotide sequence identity It relates to an isolated nucleic acid molecule.
Another aspect of the invention provides a nucleotide sequence encoding a PRO polypeptide, wherein the transmembrane domain is deleted or the transmembrane domain is inactivated, or a nucleotide complementary to such an encoded nucleotide sequence An isolated nucleic acid molecule comprising the sequence is provided, and the transmembrane domain of such a polypeptide is disclosed herein. Accordingly, the soluble extracellular domain of the PRO polypeptides described herein is contemplated.

  Another embodiment is directed to a fragment of the PRO polypeptide coding sequence, or its complementary strand, which encodes a polypeptide that encodes, for example, a polypeptide that optionally includes a binding site for an anti-PRO antibody. Applications are found as fragment hybridization probes or as antisense oligonucleotide probes. Such nucleic acid fragments are usually at least about 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250 , 300, 350, 400, 450, 500, 600, 700 or 800 nucleotides in length, or at least about 1000 nucleotides in length, where the content of the word “about” is plus or minus the length of reference It is meant to refer to a nucleotide sequence length of 10%. A novel fragment of a PRO polypeptide-encoding nucleotide sequence can be used to align any PRO polypeptide-encoding nucleotide sequence with other known nucleotide sequences using any of a number of well-known sequence alignment programs. It should be noted that the peptide-encoded nucleotide sequence fragment may be identified by conventional methods by determining whether it is novel. All such PRO polypeptide-encoding nucleotide sequences are contemplated herein. Also contemplated are PRO polypeptide fragments encoded by these nucleotide molecule fragments, preferably PRO polypeptide fragments comprising a binding site for an anti-PRO antibody.

In other embodiments, the present invention provides an isolated PRO polypeptide encoded by any of the isolated nucleic acid sequences identified above.
In certain embodiments, the invention discloses a full-length amino acid sequence disclosed herein, an amino acid sequence lacking a signal peptide disclosed herein, an extracellular domain of a transmembrane protein with or without a signal peptide disclosed herein, or disclosed herein. At least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% relative to PRO polypeptides with other specifically identified fragments of the full-length amino acid sequence , 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 98% amino acid sequence identity, or at least about 99% amino acid sequence identity An isolated PRO polypeptide is provided.
In a further aspect, the invention provides at least about 80%, 81%, 82%, 83%, 84%, relative to the amino acid sequence encoded by any of the human protein cDNAs deposited with the ATCC disclosed herein. 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 98% amino acid sequence identity, or at least An isolated PRO polypeptide comprising an amino acid sequence having about 99% amino acid sequence identity is provided.
In a particular embodiment, the present invention provides an isolated PRO polypeptide encoded by a nucleotide sequence that does not have an N-terminal signal sequence and / or an initiation methionine and encodes an amino acid sequence as described above. Methods for producing them are also described herein, which involve culturing host cells containing a vector containing a suitable encoding nucleic acid molecule under conditions suitable for the expression of the PRO polypeptide, and using the PRO polypeptide from the culture medium. Recovering.
Another aspect of the invention provides an isolated PRO polypeptide lacking a transmembrane domain or having an inactivated transmembrane domain. Methods for producing them are also described herein, which involve culturing host cells containing a vector containing a suitable encoding nucleic acid molecule under conditions suitable for the expression of the PRO polypeptide, from the cell medium. Recovering.
In yet other embodiments, the present invention provides agonists and antagonists of the native PRO polypeptides identified herein. In a particular embodiment, the agonist or antagonist is an anti-PRO antibody or a small molecule.
In a further embodiment, the present invention relates to a method for identifying an agonist or antagonist of a PRO polypeptide, which comprises contacting the PRO polypeptide with a candidate molecule and monitoring biological activity mediated by said PRO polypeptide. including. Preferably, the PRO polypeptide is a native PRO polypeptide.

In yet a further embodiment, the invention relates to a composition of matter comprising a PRO polypeptide, or an agonist or antagonist of a PRO polypeptide described herein, or an anti-PRO antibody in combination with a carrier. In some cases, the carrier is a pharmaceutically acceptable carrier.
Another embodiment of the present invention is the treatment of a condition caused by a PRO polypeptide, an agonist or antagonist thereof or an anti-PRO antibody of a PRO polypeptide, or an agonist or antagonist thereof, or an anti-PRO antibody as described above. Directed to use for the preparation of useful medicaments.
In a further embodiment of the invention, the invention provides a vector comprising DNA encoding any of the polypeptides described herein. Host cells containing any of such vectors are also provided. By way of example, the host cell may be a CHO cell, E. coli, or baculovirus infected insect cell. Further provided is a method for producing any of the polypeptides described herein, comprising culturing host cells under conditions suitable for expression of the desired polypeptide and recovering the desired polypeptide from the cell culture medium.
In other embodiments, the invention provides chimeric molecules comprising any of the polypeptides described herein fused to a heterologous polypeptide or amino acid sequence. Examples of such chimeric molecules include any polypeptide described herein fused to an epitope tag sequence or an Fc region of an immunoglobulin.
In another embodiment, the invention provides an antibody that specifically binds to any of the above or below described polypeptides. In some cases, the antibody is a monoclonal antibody, a humanized antibody, an antibody fragment or a single chain antibody.
In yet another embodiment, the present invention provides oligonucleotide probes useful for the isolation of genomic and cDNA nucleotide sequences or antisense probes, which probes are derived from any of the nucleotide sequences described above or below. sell.

5). Detailed Description of the Invention 5.1. Definitions The terms “cardiovascular, endothelial and angiogenic disease”, “cardiovascular, endothelial and angiogenic dysfunction”, “cardiovascular, endothelial or angiogenic dysfunction” and “cardiovascular, endothelial or angiogenic dysfunction” Used interchangeably and refers to the part of a systemic disease that affects blood vessels, such as diabetes, of diseases of blood vessels such as arteries, capillaries, veins, and / or lymphatic vessels themselves. This includes signs that stimulate angiogenesis and / or cardiovascularization, and signs that inhibit angiogenesis and / or cardiovascularization. Such diseases include, for example, arterial diseases such as atherosclerosis, hypertension, inflammatory vasculitis, Lehno's disease and Lehno phenomenon, aneurysms, and arterial restenosis; venous and lymphatic diseases such as thrombotic veins Inflammation, lymphangitis, and lymphedema; and other vascular diseases such as peripheral vascular disease, cancer such as vascular tumors such as hemangiomas (capillary and spongy), glomus tumors, telangiectasia, bacterial hemangiomatosis, Hemangioendothelioma, hemangiosarcoma, angiodermocytoma, Kaposi's sarcoma, lymphangioma, and lymphangiosarcoma, tumor angiogenesis, trauma, such as wounds, burns, and other damaged tissue, graft fixation, scarring, Examples include ischemia reperfusion injury, rheumatoid arthritis, cerebrovascular disease, kidney disease such as acute renal failure, and osteoporosis. Also included are angina, myocardial infarction, such as acute myocardial infarction, cardiac hypertrophy, and heart failure, such as CHF.
“Hypertrophy” as used herein is defined as an increase in the size of a tissue or structure regardless of normal growth not involved in tumor formation. Organ or tissue hypertrophy is due to either an increase in the size of individual cells (true hypertrophy), or an increase in the number of cells forming the tissue (hyperplasia), or both. Certain organs, such as the heart, lose their ability to divide shortly after birth. Thus, “cardiac hypertrophy” is defined as an increase in heart size and is characterized by an increase in contractile protein content and myocyte cell size without accompanying cell division in adults . Characteristics of stress that causes hypertrophy (e.g., increased preload, increased afterload, loss of myocytes as in myocardial infarction, primary decrease in contractility) are important in determining the nature of the response. Clearly it has a role. The early stages of cardiac hypertrophy are usually morphologically characterized by increased myofibril and mitochondrial size, as well as mitochondrial and nuclear enlargement. At this stage, myocytes become larger than normal and the cellular tissue is considerably preserved. As the stage of cardiac hypertrophy further progresses, the number and size of certain organelles, such as mitochondria, preferentially increase, and new contractile elements are added in an irregular manner to the localized region of the cell. Cells that have undergone hypertrophy for many years in cellular tissues, including highly enlarged nuclei, with highly lobulated membranes that replace adjacent myofibrils and cause disruption of normal Z membrane registration. It shows a clearer division. The term “cardiac hypertrophy” is used to include all stages in the progression of a disease state characterized by varying degrees of structural damage to the myocardium, regardless of the underlying heart disease. Thus, the term also includes physiological conditions in the progression of cardiac hypertrophy, such as elevated blood pressure, aortic stenosis, or myocardial infarction.

“Heart failure” refers to an abnormality in cardiac function in which the heart does not pump blood as fast as the demands of the tissue being metabolized. Heart failure can be caused by a variety of factors, including ischemia, congenital, rheumatic or idiopathic forms.
“Congestive heart failure” (CHF) is a progression of the heart that cannot supply enough cardiac output (the volume of blood that is pushed out by the heart over time) to deliver oxygenated blood to peripheral tissues. It is a sexual condition. As CHF progresses, structural and hemodynamic damage occurs. These damages appear in various ways, and one characteristic symptom is ventricular hypertrophy. CHF is a common end result of many heart diseases.
“Myocardial infarction” is commonly regarded as the result of atherosclerosis of the coronary arteries, often accompanied by multiple coronary thrombosis. It is an intramural infarction with myocardial necrosis across the entire thickness of the ventricular wall, and necrosis is in the subendothelium, myocardial wall, or both, without extending all the way through the ventricular wall to the epicardium It can be divided into two types of accessory endocardial (non-mural) infarctions. Myocardial infarction is known to be caused by both changes in hemodynamic effects and changes in damaged structures and healthy zones of the heart. Thus, for example, due to myocardial infarction, the maximum outflow amount of the heart and the heart beating volume are reduced. Also, in connection with myocardial infarction, DNA synthesis occurring in the gap is stimulated, increasing collagen formation in unaffected heart regions.
In long-term hypertension, increased cardiac stress and pressure results in increased total peripheral tolerance, for example, and cardiac hypertrophy becomes associated with long-term “hypertension”. As a result of chronic pressure, a characteristic of an enlarged ventricle is that the performance of diastole is impaired. Fouad et al., J. Am. Coll. Cardiol., 4: 1500-1506 (1984); Smith et al., J. Am. Coll. Cardiol., 5: 869-874 (1985). Long-term left ventricular relaxation was seen early in essential hypertension, regardless of normal or normal systolic function. Hartford et al., Hypertension, 6: 329-338 (1984). However, there is no close parallel between blood pressure levels and cardiac hypertrophy. In humans, improved left ventricular function has been reported in response to antihypertensive treatment, but patients treated with diuretics (hydrochlorothiazide), beta-blockers (prepanolol), or calcium channel blockers (diltiazem) There is a reversion to left ventricular hypertrophy without any improvement in diastolic function. Inouye et al., Am. J. Cardiol., 53: 1583-7 (1984).

Another complex heart disease associated with cardiac hypertrophy is “hypertrophic cardiomyopathy”. The pathology is very diverse in morphological, functional and clinical characteristics (Maron et al., N. Engl. J. Med., 316: 780-789 (1987); Spirito et al., N. Engl. J Med., 320: 749-755 (1989); Louie and Edwards, PROg. Cardiovasc. Dis., 36: 275-308 (1994); Wigle et al., Circulation, 92: 1680-1692 (1995)). That heterogeneity is stressed in that it afflicts patients of all ages. Spirito et al., N. Engl. J. Med., 336: 775-785 (1997). In addition, the factors that cause hypertrophic cardiomyopathy are diverse and are hardly understood. In general, mutations in genes encoding sarcomeric proteins are involved in hypertrophic cardiomyopathy. Recent data suggest that β-myosin heavy chain mutations are measured to account for about 30 to 40 percent of the causes of familial hypertrophic cardiomyopathy. Watkins et al., N. Engl. J. Med., 326: 1108-1114 (1992); Schwartz et al., Circulation, 91: 532-540 (1995); Marian and Roberts, Circulation, 92: 1336-1347 (1995); Thierfelder et al., Cell, 77: 701-712 (1994); Watkins et al., Nat. Gen., 11: 434-437 (1995). In addition to β-myosin heavy chain, genetic mutations at other positions include cardiac troponin T, alpha topomyosin, cardiac myosin binding protein C, essential myosin light chain, and regulatory myosin light chain. See Malik and Watkins, Curr. Opin. Cardiol., 12: 295-302 (1997).
The superior valve “aortic stenosis” is an inherited vascular disease characterized by a narrowing of the ascending aorta, but other arteries including the pulmonary arteries may be further affected. In untreated aortic stenosis, intracardiac pressure increases, resulting in cardiac hypertrophy and eventually heart failure and death. The etiology of the disease is not fully understood, but intermediate smooth muscle hyperplasia and hypertrophy are possibly a hallmark of the disease. It has been reported in US Pat. No. 5,650,282 published July 22, 1997 that molecular variants of the elastin gene are involved in the pathogenesis of aortic stenosis progression.
“Heart valve regurgitation” occurs as a result of heart disease as a result of heart valve disease. Various illnesses such as rheumatic fever cause contraction or pulling of the valve orifice, while other illnesses include endocarditis, inflammation of the membrane inside the endocardium or atrial orifice, and heart movement About. Defects such as valve stenosis or close proximity of the valve result in accumulation of blood in the heart cavity or backflow of blood through the valve. Failure to heal valve stenosis or failure for a long period of time results in cardiac hypertrophy and damage associated with the myocardium, eventually requiring valve replacement.
All of these, and treatment of other cardiovascular, endothelial and angiogenic diseases, whether or not accompanied by cardiac hypertrophy, are included in the present invention.

The terms “cancer”, “cancerous” and “malignant” refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include, but are not limited to, carcinomas including adenocarcinomas, lymphomas, blastomas, melanomas, sarcomas, and leukemias. More specific examples of such cancers include squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, gastric cancer, Hodgkin and non-Hodgkin lymphoma, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, Liver cancer such as hepatic carcinoma and hepatoma, bladder cancer, breast cancer, colorectal cancer, colorectal cancer, endometrial cancer, salivary gland cancer, renal cell carcinoma and Wilms tumor, basal cell carcinoma Melanoma, prostate cancer, spawning cancer, thyroid cancer, testicular cancer, esophageal cancer, and various types of head and neck cancer. Suitable cancers for treatment here include breast cancer, colon cancer, lung cancer, melanoma, ovarian cancer and vascular tumors described above.
The term “cytotoxic agent” as used herein refers to a substance that inhibits or prevents the function of cells and / or causes destruction of cells. The term includes radioisotopes (eg, ¹³¹ I, ¹²⁵ I, ⁹⁰ Y and ¹⁸⁶ Re), chemotherapeutic drugs, and toxins such as enzyme-active toxins of bacterial, fungal, plant or animal origin, or fragments thereof. I intend to.
A “chemotherapeutic agent” is a chemical compound useful in the treatment of cancer. Examples of chemotherapeutic agents include alkylating agents, folic acid antagonists, antimetabolites of nucleic acid metabolism, antibiotics, pyrimidine analogs, 5-fluorouracil, cisplatin, purine nucleosides, amines, amino acids, triazole nucleosides, or corticosteroids Includes. Specific examples include adriamycin, doxorubicin, 5-fluorouracil, cytosine arabinoside (“Ara-C”), cyclophosphamide, thiotepa, busulfan, cytoxin, taxol, toxotea, methotrexate, cisplatin, melphalan, vinblastine , Bleomycin, etoposide, ifosfamide, mitomycin C, mitoxantrone, vincristine, vinorelbine, carboplatin, teniposide, daunomycin, carminomycin, aminopterin, dactinomycin, mitomycin, esperamicin (see US Pat. No. 4,675,187), melphalan And related nitrogen mustard. Also included in this definition are hormonal drugs that function to modulate or inhibit hormonal action on tumors such as tamoxifen and onapristone.

“Growth inhibitory agent” as used herein refers to a compound or composition that inhibits the growth of cells, eg, Wnt-overexpressing cancer cells, in vitro or in vivo. That is, growth inhibitors significantly reduce the percentage of malignant cells in S phase. Examples of growth inhibitory agents include agents that block cell cycle progression (at a place other than S phase), such as agents that induce G1 arrest and M-phase arrest. Classic M-phase blockers include vincas (vincristine and vinblastine), taxol, and topo II inhibitors such as doxorubicin, daunorubicin, etoposide, and bleomycin. These agents that arrest G1 also affect S-phase arrest, for example, DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5-fluorouracil and Ara-C. Further information can be found in the title “Cell cycle regulation, oncogenes, and antineoplastic drugs” (WB Saunders: Philadelphia, 1995), especially page 13, by The Molecular Basis of Cancer, Mendelsohn and Israel, edited by Chapter 1, Murakami et al. Further examples include antibodies that can inhibit or neutralize the angiogenic activity of tumor necrosis factor (TNF), acidic or basic FGF or hepatocyte growth factor (HGF), can inhibit or neutralize the clotting activity of tissue factor Antibody, protein C or protein S (see WO91 / 01753 published February 21, 1991), or an antibody capable of binding to the HER2 receptor (WO89 / 06692), eg 4D5 antibodies (and their functions) (E.g., WO92 / 22653).
“Treatment” is intended to prevent or modify the progression of pathological conditions of cardiovascular, endothelial and angiogenic diseases. The concept of treatment is used in its broadest sense and specifically includes prevention (prevention), alleviation, reduction, and cure of any stage of cardiovascular, endothelial and angiogenic diseases. Thus, “treatment” refers to both curative treatment and prophylactic or preventative measures, the purpose being to prevent or delay (reduce) or ameliorate cardiovascular, endothelial and angiogenic diseases such as hypertrophy. It is in. Those in need of treatment include those already suffering from the disease, as well as those susceptible to the disease or those in which the disease has been prevented. The disease is the result of any cause, including onset, cardiotrophic, or myotrophic causes, or ischemia or ischemic stroke, eg, myocardial infarction.
“Chronic” administration refers to administering the drug in a continuous manner, unlike the acute mode, and maintaining the initial therapeutic effect, eg, an antihypertrophic effect, over time.
A “mammal” for therapeutic purposes is any mammal classified as a mammal, including humans, household and agricultural animals, zoos, sports, or pet animals such as dogs, horses, cats, cows, sheep, pigs, etc. Refers to animals. Preferably the mammal is a human.
Administration “in combination with” one or more further therapeutic agents includes simultaneous (concurrent) and consecutive administration in any order.

The term “cardiovascular, endothelial and angiogenic agent” generally refers to any agent that acts in the treatment of cardiovascular, endothelial and angiogenic diseases. Examples of cardiovascular agents are those that promote blood pressure, heart rate, cardiac contraction, and vascular homeostasis that regulate endothelium and smooth muscle biology, all of which have a role in cardiovascular disease. These specific examples include angiotensin-II receptor antagonists; endothelin receptor antagonists such as BOSENTAN ^™ and MOXONODIN ^™ ; interferon-gamma (IFN-γ); des-aspartate-angiotensin I; thrombolytic agents such as streptokinase, Urokinase, t-PA, and a t-PA variant with a longer half-life and a very high fibrin specificity, TNK-t-PA (T103N, N117Q, KHRR (296-299) AAAAt- PA mutant, Keyt et al., Proc. Natl. Acad. Sci. USA, 91: 3670-3674 (1994)): cardiotonic or vasopressors such as digoxigenin, and β-adrenergic receptor blocking agents such as propranolol, timolol, Tartarolol, carteolol, nadolol, betaxolol, penbutolol, acetobutolol, atenolol, metopro And carvedilol; angiotensin converting enzyme (ACE) inhibitors such as quinapyryl, captopril, enalapril, ramipril, benazepril, fosinopril and lisinopril; diuretics such as chlorothiazide, hydrochlorothiazide, hydroflumetazide, methylcrothiazide, Benzthiazides, dichlorophenamide, acetazolamide, and indapamide; and calcium channel blockers such as diltiazem, nifedipine, verapamil and nicardipine. One preferred category of this type is a therapeutic agent used to treat cardiac hypertrophy, or physiological conditions in the progression of cardiac hypertrophy, such as elevated blood pressure, aortic stenosis or myocardial infarction.
“Angiogenic agents” and “endothelial agents” are active agents that promote angiogenesis and / or endothelial cell growth, or, if appropriate, angiogenesis. This includes factors that promote wound healing, such as growth hormone, insulin-like growth factor-I (IGF-I), VEGF, VIGF, PDGF, epidermal growth factor (EGF), CTGF and its family members, EGF, And TGF-α and TGF-β.
“Angiostatic agents” are active agents that inhibit angiogenesis or tube formation, or inhibit or prevent the growth of cancer cells. Examples include antibodies to the above-mentioned angiogenic agents or other antagonists such as antibodies to VEGF. In addition, cell therapies such as cytotoxic drugs, chemotherapeutic drugs, growth inhibitors, apoptotic drugs, and other drugs that treat cancer such as anti-HER-2, anti-CD20, and biologically active and organic chemicals included.
In the pharmacological sense of the present invention, a “therapeutically effective amount” of an active agent, such as a PRO polypeptide, or an agonist or antagonist thereof, or an anti-PRO antibody refers to a cardiovascular, endothelial and angiogenic disease in mammals. Is an effective amount for the treatment of and can be determined empirically.
As used herein, an `` effective amount '' of an active agent, such as a PRO polypeptide, or agonist or antagonist thereof, or an anti-PRO antibody, refers to an amount effective to carry out the stated purpose, Such an amount can be determined empirically depending on the desired effect.
As used herein, the terms “PRO polypeptide” and “PRO” refer to various polypeptides immediately followed by a numerical code, and the full code (eg, PRO / number) refers to the specific polypeptide described herein. Means peptide sequence. The terms “PRO / number polypeptide” and “PRO / number”, where the term “number” is given as the actual numerical sign used herein, are native sequence polypeptides and variants (as defined in more detail herein). )including. The PRO polypeptides described herein may be isolated from a variety of sources, such as human tissue types or other sources, and may be prepared by recombinant or synthetic methods.

A “native sequence PRO polypeptide” includes a polypeptide having the same amino acid sequence as the corresponding PRO polypeptide derived from nature. Such native sequence PRO polypeptides can be isolated from nature or can be produced by recombinant or synthetic means. The term `` native sequence PRO polypeptide '' specifically includes naturally occurring truncated or secreted forms (e.g., extracellular domain sequences), naturally occurring mutated forms (e.g., alternatively spliced) of a particular PRO polypeptide. Form) and naturally occurring allelic variants of the polypeptide. In various embodiments of the invention, the native sequence PRO polypeptide disclosed herein is a mature or full length native sequence polypeptide comprising the full length amino acid sequence shown in the accompanying drawings. Start and stop codons are shown in bold and underlined in the figure. However, although the PRO polypeptide disclosed in the accompanying drawings is shown to begin at the methionine residue designated herein as amino acid position 1 in the drawings, other PRO polypeptides are located upstream or downstream of amino acid position 1 in the drawings. It is conceivable or possible to use the methionine residue as the starting amino acid residue of the PRO polypeptide.
PRO polypeptide “extracellular domain” or “ECD” means a form of a PRO polypeptide that is substantially free of transmembrane and cytoplasmic domains. Usually PRO polypeptide ECDs have less than 1% of their transmembrane and / or cytoplasmic domains, preferably less than 0.5% of such domains. It will be understood that any transmembrane domain identified for a PRO polypeptide of the invention is identified according to criteria routinely used in the art to identify that type of hydrophobic domain. . Although the exact boundaries of the transmembrane domain can vary, it is likely not to exceed about 5 amino acids from either end of the originally identified domain. Accordingly, the PRO polypeptide extracellular domain optionally comprises no more than about 5 amino acids from either side of the transmembrane domain and / or extracellular domain boundary, as identified in the Examples or specification. Alternatively, those polypeptides and the nucleic acids that encode them, with or without signal peptides, are contemplated by the present invention.
Appropriate positions for the “signal peptides” of the various PRO polypeptides disclosed herein are indicated herein and / or in the accompanying drawings. However, as noted, the C-terminal boundary of the signal peptide can vary, but is most likely less than about 5 amino acids on either side of the signal peptide C-terminal boundary originally identified here. The C-terminal boundary of a signal peptide can be identified according to criteria routinely used to identify such types of amino acid sequence components (eg, Nielsen et al., PROt. Eng. 10: 1-6 ( 1997) and von Heinje et al., Nucl. Acids. Res. 14: 4683-4690 (1986)). Furthermore, in some cases, it is also observed that cleavage of the signal peptide from the secreted polypeptide is not completely uniform, resulting in one or more secreted species. These mature polypeptides, and the polynucleotides that encode them, which are cleaved within less than about 5 amino acids on either side of the C-terminal boundary of the signal peptides identified herein, are contemplated in the present invention. The

  A “PRO polypeptide variant”, as defined above or below, is a full-length native sequence PRO polypeptide sequence disclosed herein, a PRO polypeptide sequence that lacks a signal peptide disclosed herein, disclosed herein An activity having at least about 80% amino acid sequence identity with the extracellular domain of the PRO polypeptide with or without a signal peptide, or any other fragment of the full-length PRO polypeptide sequence disclosed herein, such as Means PRO polypeptide. Such PRO polypeptide variants include, for example, PRO polypeptides with one or more amino acid residues added or deleted at the N- or C-terminus of the full-length natural amino acid sequence. Typically, a PRO polypeptide variant has or does not have a full-length native sequence PRO polypeptide sequence disclosed herein, a PRO polypeptide sequence that lacks the signal peptide disclosed herein, or a signal peptide as disclosed herein. At least about 80%, 81%, 82%, 83%, 84%, 85% with the extracellular domain of the PRO polypeptide or any other specifically defined fragment of the full-length PRO polypeptide sequence disclosed herein , 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 98% amino acid sequence identity, and or at least about It has 99% amino acid sequence identity. Typically, the PRO variant polypeptide is at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150 or 200 amino acids in length, or at least about 300 amino acids in length, or Longer than that.

“Percent (%) amino acid sequence identity” relative to a PRO polypeptide sequence as defined herein introduces gaps as necessary to align the sequences and obtain maximum percent sequence identity, and any conservative substitutions. Defined as the percentage of amino acid residues in the candidate sequence that are identical to the amino acid residues of the PRO sequence, not considered part of the sequence identity. Alignments for determining percent amino acid sequence identity are publicly available in various ways within the skill of the art, such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software This can be achieved by using possible computer software. One skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms necessary to achieve maximal alignment over the full length of the sequences being compared. However, for purposes herein,% amino acid sequence identity values are derived from the sequence comparison program ALIGN-2, whose complete source code for the ALIGN-2 program is provided in Table 1, as described below. Is obtained. The ALIGN-2 sequence comparison computer program was created by Genentech, and the source code shown in Table 1 was submitted to the US Copyright Office, Washington DC, 20559 with user documentation and under US Copyright Registration Number TXU510087 It is registered. ALIGN-2 is publicly available through Genentech, South San Francisco, California, and may be compiled from the source code given in Table 1. The ALIGN-2 program is compiled for use on a UNIX® operating system, preferably digital UNIX® V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.
For purposes herein, the% amino acid sequence identity of a given amino acid sequence A to, or against, a given amino acid sequence B (or a given amino acid sequence) A given amino acid sequence A (which can also be referred to as having or containing a certain percentage of amino acid sequence identity) with or in contrast to B) is calculated as follows:
100 times the fraction X / Y, where X is the number of amino acid residues with a score matched by A and B alignment of the sequence alignment program ALIGN-2, and Y is the total amino acid residue of B Is a number. It will be understood that if the length of amino acid sequence A is different from the length of amino acid sequence B, then the% amino acid sequence identity of A to B is different from the% amino acid sequence identity of B to A. As an example of calculating% amino acid sequence identity using this method, Table 2-3 shows the% amino acid sequence identity of the amino acid sequence designated “Comparative Protein” relative to the amino acid sequence designated “PRO”. The calculation method is shown.

Unless otherwise noted, all% amino acid sequence identity values herein are obtained using the ALIGN-2 sequence comparison computer program as described above. However,% amino acid sequence identity may be determined using the sequence comparison program NCBI-BLAST2 (Altschul et al., Nucleic Acids Res. 25: 3389-3402 (1997)). The NCBI-BLAST2 sequence comparison program can be downloaded from http://www.ncbi.nlm.nih.gov., Or otherwise obtained from the National Institute of Health, Bethesda, MD. NCBI-BLAST2 uses several search parameters, all of which are set to initial values, for example, unmask = allowable, chain = all, predicted occurrence = 10, minimum low composite length = 15/5 Multipass e-value = 0.01, multipass constant = 25, final gap alignment dropoff = 25, and scoring matrix = BLOSUM62.
In situations where NCBI-BLAST2 is used for amino acid sequence comparisons, the% amino acid sequence identity of a given amino acid sequence A to, or against, a given amino acid sequence B (or given The given amino acid sequence A (which can also be referred to as having or containing a certain percentage of amino acid sequence identity to, or in contrast to) the given amino acid sequence B) is calculated as follows: R:
100 times the fraction X / Y, where X is the number of amino acid residues with a score matched by A and B alignment of the sequence alignment program NCBI-BLAST2, and Y is the total amino acid residue of B Is a number. It will be understood that if the length of amino acid sequence A is different from the length of amino acid sequence B, then the% amino acid sequence identity of A to B is different from the% amino acid sequence identity of B to A.
Furthermore,% amino acid sequence identity values may be determined using the WU-BLAST-2 computer program (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Most WU-BLAST-2 search parameters are set to initial values. Parameters that are not set to initial values, ie adjustable parameters, are set to the following values: overlap span = 1, overlap fraction = 0.125, word threshold (T) = 11, and scoring matrix = BLOSUM62. For purposes herein,% amino acid sequence identity values are: (a) the amino acid sequence of a subject PRO polypeptide having a sequence derived from a native PRO polypeptide and the subject comparative amino acid sequence (ie, The number of identical identical amino acid residues determined by WU-BLAST-2 between the subject PRO polypeptide and the sequence that may be a PRO polypeptide variant to be compared) (b) subject and Determined by the quotient divided by the total number of residues in the PRO polypeptide. For example, in the expression “polypeptide comprising amino acid sequence A having or having at least 80% amino acid sequence identity to amino acid sequence B”, amino acid sequence A is a comparative amino acid sequence of interest, Amino acid sequence B is the amino acid sequence of the target PRO polypeptide.

“PRO variant polynucleotide” or “PRO variant nucleic acid sequence” means a nucleic acid molecule that encodes an active PRO polypeptide as defined below, and is a full-length native sequence PRO polypeptide sequence disclosed herein, Which encodes a full-length native sequence PRO polypeptide sequence lacking the signal peptide disclosed in, a PRO polypeptide extracellular domain with or without a signal peptide disclosed herein, or any other fragment of the full-length PRO polypeptide sequence disclosed herein Has at least about 80% nucleic acid sequence identity to the nucleic acid sequence to be Typically, a PRO variant polynucleotide is a full-length native sequence PRO polypeptide sequence disclosed herein, a full-length native sequence PRO polypeptide sequence lacking a signal peptide disclosed herein, a PRO polypeptide with or without a signal peptide disclosed herein. At least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87% with a nucleic acid sequence encoding a peptide extracellular domain, or other fragment of the full-length PRO polypeptide sequence disclosed herein , 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98% nucleic acid sequence identity, and / or at least about 99% nucleic acid sequence Have identity. Variants do not contain the native nucleotide sequence.
Typically, the PRO variant polynucleotide is at least about 30, 60, 90, 120, 150, 180, 210, 240, 270, 300, 450 or 600 nucleotides in length, or at least about 900 nucleotides in length, or longer. long.

“Percent (%) nucleic acid sequence identity” relative to the PRO polypeptide-encoding nucleic acid sequence identified herein is any conserved, introducing gaps if necessary to align the sequences and obtain maximum percent sequence identity. Substitution is also defined as the percentage of nucleotides in the candidate sequence that are identical to the nucleotides of the PRO polypeptide coding sequence, not considered part of the sequence identity. Alignments for determining percent nucleic acid sequence identity are publicly available in various ways within the skill of the artisan, such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software This can be achieved by using possible computer software. One skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms necessary to achieve maximal alignment over the full length of the sequences being compared. However, for purposes herein,% nucleic acid sequence identity values are derived from the sequence comparison program ALIGN-2, whose complete source code for the ALIGN-2 program is provided in Table 1, as described below. Is obtained. The ALIGN-2 sequence comparison computer program was created by Genentech, and the source code shown in Table 1 was submitted to the US Copyright Office, Washington DC, 20559 with user documentation and under US Copyright Registration Number TXU510087 It is registered. ALIGN-2 is publicly available through Genentech, South San Francisco, California, and may be compiled from the source code given in Fig. 2A-P. The ALIGN-2 program is compiled for use on a UNIX® operating system, preferably digital UNIX® V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.
For purposes herein, the% nucleic acid sequence identity of a given nucleic acid sequence C to, or against, a given nucleic acid sequence D (or a given nucleic acid sequence D Can be referred to as a given amino acid sequence C having or containing a certain percentage of nucleic acid sequence identity to, or in contrast to) is calculated as follows:
100 times the fraction W / Z, where W is the number of nucleotides with a score matched by C and D alignment of the sequence alignment program ALIGN-2, and Z is the total number of nucleotides in D. It will be appreciated that if the length of the nucleic acid sequence C is different from the length of the nucleic acid sequence D, then the% nucleic acid sequence identity of C to D is different from the% nucleic acid sequence identity of D to C. As an example of calculating% nucleic acid sequence identity using this method, Table 4-5 shows the% nucleic acid sequence identity of a nucleic acid sequence called “Comparative DNA” to a nucleic acid sequence called “PRO-DNA” The calculation method of is shown.
Unless otherwise indicated, all% nucleic acid sequence identity values herein are obtained using the ALIGN-2 sequence comparison computer program as described above. However,% nucleic acid sequence identity may be determined using the sequence comparison program NCBI-BLAST2 (Altschul et al., Nucleic Acids Res. 25: 3389-3402 (1997)). The NCBI-BLAST2 sequence comparison program can be downloaded from http://ww.ncbi.nlm.nih.gov or otherwise obtained from the National Institute of Medical Science, Bethesda, MD. NCBI-BLAST2 uses several search parameters, all of which are set to initial values, for example, unmask = allowable, chain = all, predicted occurrence = 10, minimum low composite length = 15/5 Multipass e-value = 0.01, multipass constant = 25, final gap alignment dropoff = 25, and scoring matrix = BLOSUM62.

In situations where NCBI-BLAST2 is used for sequence comparison, the% nucleic acid sequence identity of a given nucleic acid sequence C to, or against, a given nucleic acid sequence D (or given A given nucleic acid sequence C having or containing a certain percentage of nucleic acid sequence identity to, or in contrast to, the nucleic acid sequence D) is calculated as follows: :
100 times the fraction W / Z, where W is the number of nucleotides with a score matched by C and D alignment of the sequence alignment program NCBI-BLAST2, and Z is the total number of nucleotides in D. It will be appreciated that if the length of the nucleic acid sequence C is different from the length of the nucleic acid sequence D, then the% nucleic acid sequence identity of C to D is different from the% nucleic acid sequence identity of D to C.
Furthermore,% nucleic acid sequence identity values may be determined using the WU-BLAST-2 computer program (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Most WU-BLAST-2 search parameters are set to initial values. Parameters that are not set to initial values, ie adjustable parameters, are set to the following values: overlap span = 1, overlap fraction = 0.125, word threshold (T) = 11, and scoring matrix = BLOSUM62. For purposes herein, the% nucleic acid sequence identity value is: (a) the nucleic acid sequence of a subject PRO polypeptide-encoding sequence having a sequence derived from a native sequence PRO polypeptide-encoding nucleic acid; Identical identity as determined by WU-BLAST-2 with a comparison nucleic acid molecule (ie, a sequence that may be a variant polynucleotide to which the sequence of the PRO polypeptide-encoding nucleic acid molecule of interest is compared) Determined by the quotient of the number of nucleotides divided by (b) the total number of nucleotides of the subject PRO polypeptide-encoding nucleic acid. For example, in the expression “an isolated nucleic acid molecule comprising a nucleic acid sequence A having or having at least 80% amino acid sequence identity to the nucleic acid sequence B”, the reference nucleic acid to which the nucleic acid sequence A is directed The nucleic acid sequence B is the nucleic acid sequence of the PRO polypeptide-encoding nucleic acid molecule of interest.
In other embodiments, the PRO variant polynucleotide is a nucleic acid molecule that encodes an active PRO polypeptide, preferably as shown herein and in the accompanying figures, under stringent hybridization and wash conditions. Can be hybridized to a nucleotide sequence encoding a full-length PRO polypeptide. The PRO variant polypeptide may be one encoded by a PRO variant polynucleotide.

“Isolated”, when used to describe the various polypeptides disclosed herein, means a polypeptide that has been identified and separated and / or recovered from a component of its natural environment. Preferably, an isolated polypeptide does not bind to all components that naturally bind. Contaminant components of the natural environment are substances that typically interfere with the diagnostic or therapeutic use of the polypeptide, including enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. In a preferred embodiment, the polypeptide is (1) sufficient to obtain an N-terminal or internal amino acid sequence of at least 15 residues by using a spinning cup sequenator, or (2) Coomassie blue or It is preferably purified to homogeneity by SDS-PAGE under non-reducing or reducing conditions using silver staining. Isolated polypeptide includes polypeptide in situ within recombinant cells, since at least one component of the PRO polypeptide natural environment will not be present. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step.
An “isolated” nucleic acid molecule that encodes a PRO polypeptide, or an “isolated” nucleic acid molecule that encodes an anti-PRO antibody, has been identified and is a natural source of PRO-encoding nucleic acid, or anti-PRO- A nucleic acid molecule separated from at least one contaminating nucleic acid molecule normally associated with a natural source of the encoded nucleic acid. Preferably, the isolated nucleic acid molecule is not bound to any contaminants that naturally bind. An isolated PRO-encoding nucleic acid molecule or isolated anti-PRO-encoding nucleic acid molecule is other than in the form or setting in which it is found in nature. Thus, an isolated nucleic acid molecule is distinguished from a PRO-encoding nucleic acid molecule or an anti-PRO-encoding nucleic acid molecule that is present in natural cells. However, an isolated nucleic acid molecule that encodes a PRO polypeptide or an isolated nucleic acid molecule that encodes an anti-PRO antibody is, for example, a PRO polypeptide in which the nucleic acid molecule is at a chromosomal location different from that of natural cells. It includes PRO-nucleic acid molecules or anti-PRO-nucleic acid molecules that are normally contained in cells that express peptides or anti-PRO antibodies.

The term “control sequence” refers to a DNA sequence necessary to express an operably linked coding sequence in a particular host organism. For example, suitable control sequences for prokaryotes include a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals and enhancers.
A nucleic acid is “operably linked” when it is in a functional relationship with another nucleic acid sequence. For example, if the presequence or secretory leader DNA is expressed as a preprotein that participates in polypeptide secretion, it is operably linked to the PRO polypeptide DNA; the promoter or enhancer is a transcription of the sequence. Is operably linked to the coding sequence; or the ribosome binding site is operably linked to the coding sequence if it is positioned so as to facilitate translation. In general, “operably linked” means that the bound DNA sequences are in close proximity and, in the case of a secretory leader, in close proximity and in the reading phase. However, enhancers do not necessarily have to be close together. Binding is achieved by ligation at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers are used according to conventional techniques.
The “stringency” of a hybridization reaction is readily determined by those skilled in the art and is generally an empirical calculation that depends on probe length, wash temperature, and salt concentration. In general, the longer the probe, the higher the temperature for proper annealing, and the shorter the probe, the lower the temperature. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below its melting point. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature that can be used. As a result, higher relative temperatures make the reaction conditions more stringent, while lower temperatures reduce stringency. For further details and explanation of the stringency of hybridization reactions, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).
As defined herein, “stringent conditions” or “highly stringent conditions” are: (1) 0.015 M sodium chloride / 0.0015 M citric acid at low ionic strength and high temperature, eg, 50 ° C., for washing. Using sodium / 0.1% sodium dodecyl sulfate; (2) denaturing agents such as formamide during hybridization, eg 50% (v / v) formamide and 0.1% bovine serum albumin / 0.1% ficoll / 0.1 at 42 ° C. % Polyvinylpyrrolidone / 50 mM sodium phosphate buffer pH 6.5 and 750 mM sodium chloride, 75 mM sodium citrate; (3) 50% formamide at 42 ° C., 5 × SSC (0.75 M NaCl, 0.075 M Sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5x Denhardt's solution, sonicated salmon sperm DNA (50 μg / ml), 0.1% SDS, and 1 Using a high stringency wash consisting of 0% dextran sulfate and a wash in 0.2xSSC (sodium chloride / sodium citrate) at 42 ° C and 50% formamide at 55 ° C followed by 0.1xSSC containing EDTA at 55 ° C Identified by
“Moderate stringency conditions” are identified as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Press, 1989), and include washing solutions and hybrids below the stringency described above. Including the use of formation conditions (eg, temperature, ionic strength and% SDS). Moderate stringency conditions include 20% formamide, 5xSSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 mg / ml. Conditions such as overnight incubation at 37 ° C. in a solution containing denatured sheared salmon sperm DNA, followed by washing the filter at 37-50 ° C. in 1 × SSC. One skilled in the art will recognize how to adjust temperature, ionic strength, etc. as needed to accommodate factors such as probe length.

The modifier “epitope tag” as used herein refers to a chimeric polypeptide comprising a PRO polypeptide fused to a “tag polypeptide”. A tag polypeptide has a sufficient number of residues to provide an epitope from which the antibody can be produced, but its length is short enough not to inhibit the activity of the fused polypeptide. Also, the tag polypeptide is preferably fairly unique so that the antibody does not substantially cross-react with other epitopes. Suitable tag polypeptides generally have at least 6 amino acid residues, usually about 8 to 50 amino acid residues (preferably about 10 to about 20 amino acid residues).
“Active” and “activity” in a PRO variant refers to the form of the PRO protein that retains the biological and / or immunological activity of the native or naturally occurring PRO polypeptide.
`` Biological activity '' in a molecule that antagonizes a PRO polypeptide that can be identified by the screening assays disclosed herein (e.g., organic or inorganic small molecules, peptides, etc.) refers to the PRO polypeptide identified here. Used to refer to the ability of a molecule to bind or complex, or interfere with the interaction of other cellular proteins with a PRO polypeptide, or inhibit transcription or translation of a PRO polypeptide. Particularly preferred biological activities include systemic diseases affecting the blood vessels, such as diabetes mellitus, and diseases of arteries, capillaries, veins and / or lymphatic vessels, and cardiac hypertrophy activity acting on cancer.
The term “antagonist” is used in the broadest sense and prevents or inhibits one or more biological activities of a native PRO polypeptide disclosed herein, such as its mitogenic or angiogenic activity, if appropriate. Or any molecule that neutralizes. PRO polypeptide antagonists interfere with the binding of PRO polypeptide to cellular receptors, neutralize or kill cells activated by PRO polypeptide, or vascular endothelial cells after PRO polypeptide binds to cell receptor Acts by interfering with activation. All such points of mediation by PRO polypeptide antagonists are considered equivalent to the purposes of this invention. Antagonists inhibit mitogenesis, angiogenesis, or other biological activities of the PRO polypeptide, and thus tumors, particularly solid malignancies, rheumatoid arthritis, psoriasis, atherosclerosis, diabetes, other retinopathy Undesirably excessive new, including post-lens fibroplasia, age-related macular degeneration, neovascular glaucoma, hemangioma, thyroid hyperplasia (including Graves' disease), corneal and other tissue transplantation, and chronic inflammation Useful for the treatment of diseases or disorders characterized by angiogenesis. Antagonists may also be diseases or disorders characterized by unwanted excessive vascular permeability, such as edema associated with brain tumors, ascites associated with malignant tumors, Megs syndrome, pneumonia, nephrotic syndrome, epicardial fluid (e.g. cardiac Useful in the treatment of pleural effusion. Similarly, the term “agonist” is used in the broadest sense and includes any molecule that mimics the biological activity of a native PRO polypeptide disclosed herein. Suitable agonist or antagonist molecules include in particular agonist or antagonist antibodies or antibody fragments, fragments or amino acid sequence variants of natural PRO polypeptides, peptides, small organic molecules and the like.
“Small molecule” is defined herein as having a molecular weight of about 500 Daltons or less.
The term "PRO polypeptide receptor" as used herein retains the ability of PRO protein to bind to cellular receptors, usually cell surface receptors found on vascular endothelial cells, as well as to PRO polypeptides. These variants are referred to.

“Antibodies” (ABs) and “immunoglobulins” (Igs) are glycoproteins having the same structural characteristics. While antibodies exhibit binding specificity for a particular antigen, immunoglobulins include both antibodies and other antibody-like molecules that lack antigen specificity. The latter type of polypeptide is produced, for example, at low levels by the lymphatic system and at increased levels by myeloma. The term “antibody” is used in the broadest sense and includes, but is not limited to, intact monoclonal antibodies, polyclonal antibodies, multispecific antibodies formed from at least two intact antibodies (eg, bispecific antibodies). And antibody fragments so long as they exhibit the desired biological activity.
“Natural antibodies” and “natural immunoglobulins” are heterotetrameric glycoproteins of approximately 150,000 daltons, usually composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is linked to the heavy chain by one covalent disulfide bond, and the number of disulfide bonds varies among the heavy chains of different immunoglobulin isotypes. Each heavy and light chain has regularly spaced interchain disulfide bonds. Each heavy chain has at one end a variable domain (V _H ) followed by a number of constant domains. Each light chain has a variable domain (V _L ) at one end and a constant domain at the other end; the light chain constant domain is aligned with the first constant domain of the heavy chain, and the light chain variable domain is the heavy chain Is aligned with the variable domain of. Certain amino acid residues are thought to form an interface between the light and heavy chain variable domains.
The term “variable” refers to the fact that a site in a variable domain varies widely in sequence within an antibody and is used for the binding and specificity of each particular antibody for its particular antigen. . However, variability is not uniformly distributed across the variable domains of antibodies. It is concentrated in three segments called hypervariable regions or complementarity determining regions (CDRs) of both the light and heavy chain variable domains. The more highly conserved portions of variable domains are called the framework region (FR). The natural heavy and light chain variable domains primarily take a β-sheet arrangement linked by three CDRs that bind the β-sheet structure and in some cases form a loop bond that forms part of it. Each contains one FR region. The CDRs of each chain are bound closer to the FR and contribute to the formation of the antigen binding site of the antibody together with the CDRs of the other chains. See Kabat et al., NIH Publ. No. 91-3242, Vol. I, pp. 647-669 [1991]. The constant domain is not directly related to the binding of the antibody to the antigen, but indicates the involvement of the antibody in various effector functions, such as antibody-dependent cytotoxic activity.

“Antibody fragments” include a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab ′, F (ab ′) ₂ and Fv fragments; diabodies; linear antibodies (Zapata et al., Protein Eng. 8 (10): 1057-1062 [1995] ); Single chain antibody molecules; and multispecific antibodies formed from antibody fragments.
Upon papain digestion of the antibody, two identical antigen-binding fragments, each called a “Fab” fragment, each with a single antigen-binding site, and the remaining “Fc” fragment, whose name represents the ability to easily crystallize, Produced. Pepsin treatment yields an F (ab ′) ₂ fragment that has two antigen binding sites and can further crosslink antigen.
“Fv” is the minimum antibody fragment which contains a complete antigen recognition and antigen binding site. This region consists of a dimer of one heavy chain and one light chain variable domain in a tight non-covalent bond. In this arrangement, the three CDRs of each variable domain interact to form an antigen binding site on the V _H -V _L dimer surface. Collectively, the six CDRs confer antigen binding specificity to the antibody. However, even a single variable domain (or half of an Fv containing only three CDRs specific for the antigen) has a lower affinity than the entire binding site, but has the ability to recognize and bind to the antigen. Have.
The Fab fragment also has a light chain constant domain and a heavy chain first constant region (CH1). Fab ′ fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 region including one or more cysteines from the antibody hinge region. Fab'-SH is the nomenclature here for Fab 'in which the cysteine residue of the constant domain carries a free thiol group. F (ab ′) ₂ antibody fragments were produced as pairs of Fab ′ fragments which have hinge cysteines between them. Other chemical bonds of antibody fragments are also known.
The “light chain” of an antibody (immunoglobulin) from any vertebrate species has two distinct types, called kappa (κ) and lambda (λ), based on the amino acid sequence of its constant domain. One is assigned.
Depending on the amino acid sequence of the heavy chain constant domain, immunoglobulins can be assigned to different classes. There are five main classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM, some of which are further divided into subclasses (isotypes) such as IgG1, IgG2, IgG3 and IgG4, IgA and IgA2. The heavy chain constant domains that correspond to the different classes of immunoglobulins are called α, σ, ε, γ, and μ, respectively. The subunit structures and three-dimensional structures of different classes of immunoglobulins are well known.

The term “monoclonal antibody” as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, ie, the naturally occurring possible mutations in which the individual antibodies comprising the population may be present in small amounts. Identical except for mutations. Monoclonal antibodies are highly specific and are directed against a single antigenic site. Furthermore, each monoclonal antibody is directed against a single determinant on the antigen as compared to a normal (polyclonal) antibody that typically includes different antibodies directed against different determinants (epitopes). In addition to its specificity, monoclonal antibodies are advantageous in that they are synthesized from hybridoma cultures that are not contaminated by other immunoglobulins. The modifier “monoclonal” indicates the character of the antibody as being derived from a substantially homogeneous antibody population, and does not imply that the antibody must be produced in any particular way. For example, monoclonal antibodies used in the present invention can be made by the hybridoma method first disclosed by Kohler et al., Nature 256, 495 (1975), or can be made by recombinant DNA methods (e.g., US (See Patent No. 4,816,567). The “monoclonal antibody” is a phage antibody library using the technique described in, for example, Clackson et al., Nature 352: 624-628 (1991), and Marks et al., J. Mol. Biol. 222: 581-597 (1991). It can also be isolated from
Here, a monoclonal antibody is a portion of the heavy chain and / or light chain that is identical or homologous to the corresponding sequence of an antibody from a particular species or an antibody belonging to a particular antibody class or subclass, and the remainder of the chain. A “chimeric” antibody (immunoglobulin) that is identical or homologous to the corresponding sequence of an antibody from another species or of an antibody belonging to another antibody class or subclass, as well as having the desired biological activity As long as they specifically include fragments of these antibodies (US Pat. No. 4,816,567; Morrison et al., Proc. Natl. Acad. Sci. USA, 81: 6851-6855 [1984]).
“Humanized” forms of non-human (eg, murine) antibodies are chimeric immunoglobulins, immunoglobulin chains, or fragments thereof (eg, Fv, Fab, Fab ′, F (ab ′) ₂ or other antigen-binding sub-antibodies of antibodies). Sequence), which includes a minimal sequence derived from non-human immunoglobulin. In most humanized antibodies, recipient CDR residues are replaced by the CDR residues of a non-human species (donor antibody) with the desired specificity, affinity and ability, such as mouse, rat or rabbit. Human immunoglobulin (recipient antibody). In some cases, FvFR region residues of human immunoglobulins are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are made to further refine and optimize antibody properties. Generally, a humanized antibody has at least one, typically all or almost all CDR regions corresponding to those of non-human immunoglobulin and all or almost all FR regions of human immunoglobulin sequences. Contains substantially all of the two variable domains. A humanized antibody optimally comprises at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details see Jones et al., Nature 321, 522-525 (1986); Reichmann et al., Nature 332, 323-329 (1988); and Presta, Curr. Op. Struct. Biol. 2, 593-596 (1992). checking ... Humanized antibodies include pre-primed PRIMATIZED ^™ antibodies in which the antigen-binding region of the antibody is derived from an antibody produced by immunizing a macaque monkey with an antigen of interest.

“Single-chain Fv” or “sFv” antibody fragments comprise the V _H and V _L domains of antibody, wherein these domains are present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises a polypeptide linker between the _VH and _VL domains that allows the sFv to form the desired structure for antigen binding. For a review of sFv, see, for example, Pluckthun, The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and edited by Moore (Springer-Verlag, New York, 1994) pp. 269-315.
The term “diabody” refers to a small antibody fragment having two antigen binding sites, the fragment comprising a heavy chain variable domain (V _H ) linked to a light chain variable domain (V _L ) and the same polypeptide chain. Contained in (V _H -V _L ). By using a linker that is too short to allow pairing between two domains on the same chain, the domain is forced to pair with the complementary domain of the other chain, creating two antigen binding sites. Diabodies are described in more detail, for example, in EP 404,097; WO 93/11161; and Hollinger et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448 (1993).
An “isolated” antibody is one that has been identified and separated and / or recovered from a component of its natural environment. Contaminating components of the natural environment are substances that interfere with the use of the antibody in diagnosis or therapy, including enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. In a preferred embodiment, the antibody is (1) more than 95% antibody, most preferably more than 99% by weight as measured by the Lowry method, (2) by using a spinning cup sequenator, Enough to obtain an N-terminal or internal amino acid sequence of at least 15 residues, or (3) to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or preferably silver staining Purified. Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.
An antibody that "specifically binds" or is "specific" to a specific polypeptide or epitope on a specific polypeptide is a specific polypeptide without substantially binding to any other polypeptide or polypeptide epitope It binds to an epitope on a polypeptide or a specific polypeptide.
The term “label” as used herein refers to a detectable compound or composition that is conjugated directly or indirectly to the antibody to produce a “labeled” antibody. The label may itself be detectable (eg, a radioactive label or a fluorescent label) or, in the case of an enzyme label, may catalyze chemical conversion of the detectable substrate compound or composition. Radionuclides that can be provided as detectable labels include, for example, I-131, I-123, I-125, Y-90, Re-188, At-211, Cu-67, Bi-212, and Pd-109. Including. The label may be a non-detectable substance such as a toxin.

“Solid phase” means a non-aqueous matrix to which an antibody of the invention can be attached. Examples of solid phases included herein include those formed, in part or in whole, from glass (eg, pore control glass), polysaccharides (eg, agarose), polyacrylamide, polystyrene, polyvinyl alcohol and silicone. In certain embodiments, depending on the content, the solid phase can constitute the well of an assay plate; in others it can be a purification column (eg, an affinity chromatography column). The term also encompasses a discontinuous solid phase of discrete particles, such as those described in US Pat. No. 4,275,149.
“Liposomes” are small vesicles composed of various types of lipids, phospholipids and / or surfactants, which are used to deliver drugs to mammals (such as PRO polypeptides or their antibodies disclosed herein). Useful for transportation. The components of the liposome are usually arranged in a bilayer format similar to the lipid arrangement of biological membranes.
The term “immunoadhesin” as used herein refers to an antibody-like molecule that combines the binding specificity of a heterologous protein (“adhesin”) with the effector function of an immunoglobulin constant domain. Structurally, an immunoadhesin comprises a fusion of an immunoglobulin constant domain sequence with the desired binding specificity and other than the antigen recognition and binding site of an antibody (ie, “heterologous”) and an immunoglobulin constant domain sequence. . The adhesin portion of an immunoadhesin molecule is typically a contiguous amino acid sequence that includes at least a receptor or ligand binding site. The immunoglobulin constant domain sequence of the immunoadhesin can be any IgG-1, IgG-2, IgG-3 or IgG-4 subtype, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM. It can be obtained from the immunoglobulins.
As shown below, Table 1 provides the secure source code for the ALIGN-2 sequence comparison computer program. This source code is routinely compiled for use with the UNIX® operating system and provides the ALIGN-2 sequence comparison computer program.
In addition, Table 2-5 shows the following method for determining% amino acid sequence identity (Table 2-3) and% nucleic acid sequence identity (Table 4-5) using the ALIGN-2 sequence comparison computer program. It is a figure which shows the hypothetical example used, "PRO" shows the amino acid sequence of the hypothetical PRO polypeptide of interest, and "comparison protein" is the amino acid of the polypeptide with which the "PRO" polypeptide of interest is compared "PRO-DNA" indicates the target PRO-encoding nucleic acid sequence, "Comparative DNA" indicates the nucleotide sequence of the nucleic acid molecule to be compared with the target "PRO-DNA" nucleic acid molecule, “X”, “Y” and “Z” each represent a different hypothetical amino acid residue, and “N”, “L” and “V” each represent a different hypothetical nucleotide.

5.2. Compositions and Methods of the Invention 5.2.1. PRO variants In addition to the full-length native sequence PRO described herein, it is contemplated that PRO variants can also be prepared. PRO variants can be prepared by introducing appropriate nucleotide changes into the PRO polypeptide DNA and / or by synthesizing the desired PRO polypeptide. One skilled in the art will appreciate that amino acid changes such as changes in the number or position of glycosylation sites or changes in membrane anchoring properties can alter the post-translational process of the PRO polypeptide.
Mutations in the various domains of the native full-length sequence PRO or the PRO polypeptide described herein can be made using any techniques and guidelines for conservative and non-conservative mutations described, for example, in U.S. Pat.No. 5,364,934. be able to. A mutation may be a substitution, deletion or insertion of one or more codons that encode a PRO polypeptide that results in a change in the amino acid sequence of the PRO polypeptide when compared to the native sequence PRO polypeptide. In some cases, the mutation is a substitution of at least one amino acid by any other amino acid in one or more domains of the PRO polypeptide. Guidance on which amino acid residues are inserted, substituted or deleted without adversely affecting the desired activity is compared by comparing the sequence of the PRO polypeptide with that of a known protein molecule of homology. Is found by minimizing amino acid sequence changes made within the high region of. Amino acid substitutions can be the result of substitution of one amino acid with another amino acid having similar structural and / or chemical properties, eg, substitution of leucine with serine, ie, a conservative amino acid substitution. Insertions and deletions can optionally be in the range of 1 to 5 amino acids. Permissible mutations are determined by systematically making amino acid insertions, deletions or substitutions in the sequence and testing the resulting mutants for activity exhibited by the full-length or mature native sequence.

In a particular embodiment, the conservative substitutions of interest are shown in Table 6 starting with the preferred substitution. If such a substitution results in a change in biological activity, more substitutional changes are introduced and products are screened as shown in Table 6 or further described in the amino acid classification below.

Substitutional modifications of the PRO polypeptide function and immunological identity can include (a) the structure of the polypeptide backbone of the substitution region, eg, a sheet or helical arrangement, (b) the charge or hydrophobicity of the molecule at the target site, or ( c) achieved by selecting substituents that differ substantially in their effect while maintaining the bulk of the side chains. Naturally occurring residues can be grouped based on common side chain properties:
(1) Hydrophobicity: norleucine, met, ala, val, leu, ile;
(2) Neutral hydrophilicity: cys, ser, thr;
(3) Acidity: asp, glu;
(4) Basicity: asn, gln, his, lys, arg;
(5) Residues affecting chain orientation: gly, PRO; and (6) Aromatics: trp, tyr, phe
Non-conservative substitutions will require exchanging one member of these classes for another. Residues so substituted can also be introduced at conservative substitution sites, preferably at remaining (non-conserved) sites.

Mutations can be made using techniques known in the art such as oligonucleotide-mediated (site-specific) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis [Carter et al., Nucl. Acids Res., 13: 4331 (1986); Zoller et al., Nucl. Acids Res., 10: 6487 (1987)], cassette mutagenesis [Wells et al., Gene, 34: 315 (1985)], restriction-selective mutagenesis [Wells et al., Philos. Trans. R. Soc. London SerA, 317: 415 (1986)] or other well-known techniques produce PRO mutant DNA. Can be performed on the cloned DNA.
Scanning amino acid analysis can also be used to identify one or more amino acids along adjacent sequences. Preferred scanning amino acids are relatively small and neutral amino acids. Such amino acids include alanine, glycine, serine, and cysteine. Alanine is a typically preferred scanning amino acid in this group because it eliminates side chains beyond the beta carbon and is unlikely to change the backbone structure of the mutant [Cunningham and Wells, Science, 244: 1081-1085 (1989)]. Alanine is also typically preferred because it is the most common amino acid. Furthermore, it is often found in both buried and exposed positions [Creighton, The Proteins, (WH Freeman & Co., NY); Chothia, J. Mol. Biol., 150: 1 (1976)]. If alanine substitution does not result in a sufficient amount of mutants, isoteric amino acids can be used.

5.2.2. Modification of PRO polypeptides
Covalent modifications of the PRO polypeptide are included within the scope of the present invention. One type of covalent modification is to react an amino acid residue targeted by a PRO polypeptide with an organic derivatization reagent capable of reacting with a selected side chain or N- or C-terminal residue of the PRO polypeptide. . Derivatization with a bifunctional reagent is useful, for example, to cross-link PRO polypeptides to a surface for use in water-insoluble support matrices or anti-PRO antibody purification methods and vice versa. Commonly used crosslinking agents include, for example, 1,1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide ester, such as 4-azidosalicylic acid, 3,3′-dithiobis (succinimidyl) Homobifunctional imidoesters including disuccinimidyl esters such as propionate), bifunctional maleimides such as bis-N-maleimide-1,8-octane, and methyl-3-[(p-azidophenyl)- Reagents such as dithio] propioimidate.
Other modifications include deamination of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, hydroxylation of proline and lysine, phosphorylation of the hydroxyl group of seryl or threonyl residues, lysine, arginine, and histidine, respectively. Methylation of α-amino group of side chain [TE Creighton, Proteins: Structure and Molecular Properties, WH Freeman & Co., San Francisco, pp. 79-86 (1983)], acetylation of N-terminal amine, and optional Includes amidation of the C-terminal carboxyl group.

Another type of covalent modification of a PRO polypeptide that is included within the scope of the invention involves altering the native glycosylation pattern of the polypeptide. By “altering the native glycosylation pattern” is intended herein the deletion of one or more carbohydrate moieties found in the native sequence PRO polypeptide (removal of existing glycosylation sites or chemical and / or Means the addition of one or more glycosylation sites that are not present in the native sequence PRO polypeptide and / or by deletion of glycosylation by enzymatic means) and / or. Furthermore, this phrase includes qualitative changes in glycosylation of natural proteins, including changes in the nature and proportion of the various carbohydrate moieties present.
Addition of glycosylation sites to the PRO polypeptide may involve amino acid sequence alterations. This alteration may be made, for example, by addition or substitution of one or more serine or threonine residues to the native sequence PRO polypeptide (O-linked glycosylation site). The PRO amino acid sequence is sometimes altered through changes at the DNA level, particularly by mutating the DNA encoding the PRO polypeptide at a preselected base to generate a codon that is translated into the desired amino acid. Also good.

Another way to increase the number of sugar chains on a PRO polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, for example, in WO 87/05330 issued September 11, 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem., Pp. 259-306 (1981). Are listed.
Removal of the sugar chain moiety present on the PRO polypeptide can be accomplished chemically or enzymatically, or by mutational substitution of codons encoding amino acid residues presented as targets for glucosylation. Chemical deglycosylation techniques are known in the art, for example, by Hakimuddin et al., Arch. Biochem. Biophys., 259: 52 (1987), and Edge et al., Anal. Biochem., 118: 131 (1981 ). Enzymatic cleavage of the carbohydrate moiety on the polypeptide is accomplished by using various endo and exoglycosidases as described in Thotakura et al., Meth. Enzymol. 138: 350 (1987).
Another type of covalent modification of a PRO polypeptide is described in US Pat. No. 4,640,835 to one of various non-proteinaceous polymers of PRO polypeptide, such as polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylene. No. 4,496,689; No. 4,301,144; No. 4,670,417; No. 4,791,192 or No. 4,179,337.

The PRO of the present invention may also be modified by a method that forms a chimeric molecule comprising a PRO polypeptide fused to another heterologous polypeptide or amino acid sequence.
In one embodiment, such chimeric molecules pass through the brain-blood barrier using, for example, the delivery of various tissues and, more particularly, the protein transduction domain of the TAT protein of human immunodeficiency virus, For fusion, including fusion of a PRO polypeptide with a protein transduction domain that targets the PRO polypeptide (Schwarze et al., 1999, Science 285: 1659-72).
In other embodiments, such chimeric molecules comprise a fusion of a tag polypeptide and a PRO polypeptide that provides an epitope to which an anti-tag antibody can selectively bind. The epitope tag is generally located at the amino or carboxyl terminus of the PRO polypeptide. The presence of such an epitope tag form of a PRO polypeptide can be detected using an antibody against the tag polypeptide. Providing the epitope tag also allows the PRO polypeptide to be easily purified by affinity purification using an anti-tag antibody or other type of affinity matrix that binds to the epitope tag. Various tag polypeptides and their respective antibodies are well known in the art. Examples include poly-histidine (poly-His) or poly-histidine-glycine (poly-His-gly) tag; flu HA tag polypeptide and its antibody 12CA5 [Field et al., Mol. Cell. Biol., 8: 2159 -2165 (1988)]; c-myc tag and 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al., Molecular and Cellular Biology, 5: 3610-3616 (1985)]; and herpes simplex virus sugars A protein D (gD) tag and its antibody [Paborsky et al., Protein Engineering, 3 (6): 547-553 (1990)]. Other tag polypeptides include flag peptides [Hopp et al., BioTechnology, 6: 1204-1210 (1988)]; KT3 epitope peptides [Martin et al., Science, 255: 192-194 (1992)]; α-tubulin epitope peptides [Skinner et al., J. Biol. Chem., 266: 15163-15166 (1991)]; and T7 gene 10 protein peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA, 87: 6393-6397 ( 1990)].
In an alternative embodiment, the chimeric molecule may comprise a fusion of a PRO polypeptide and an immunoglobulin or a specific region of an immunoglobulin. For a bivalent form of a chimeric molecule (also called “immunoadhesin”), such a fusion may be the Fc region of an IgG molecule. The Ig fusion preferably comprises a solubilized (transmembrane domain deleted or inactivated) form of the PRO polypeptide in place of at least one variable region within the Ig molecule. In particularly preferred embodiments, the immunoglobulin fusion comprises the hinge, CH2 and CH3, or hinge, CH1, CH2 and CH3 regions of the IgG1 molecule. For the production of immunoglobulin fusions, see US Pat. No. 5,428,130 issued June 27, 1995.

5.2.3. Preparation of PRO Polypeptides The present invention provides newly identified and isolated nucleotide sequence encoding polypeptides, referred to in this application as PRO polypeptides. In particular, a cDNA encoding a PRO polypeptide is identified and isolated as further details are disclosed in the Examples below. Proteins produced in isolated expression circles are assigned different PRO numbers, but the UNQ number is unique for any given DNA and encoded protein and will not change. However, for the purposes of simplicity, in this application, the protein encoded by PRO DNA, the additional natural homologues, and the variants included in the previous definition of PRO polypeptide are each independently of origin or method of preparation. It is called “PRO”.
The following description relates primarily to a method of producing a PRO polypeptide by culturing cells transformed or transfected with a vector comprising a nucleic acid encoding the PRO polypeptide. Of course, it is contemplated that the PRO polypeptide can be prepared using other methods well known in the art. For example, PRO polypeptide sequences, or portions thereof, may be produced by direct peptide synthesis using solid phase techniques. See Stewart et al., Solid-Phase Peptide Synthesis, (WH Freeman Co., San Francisco, CA 1969); Merrifield, J. Am. Chem. Soc., 85: 2149-2154 (1963). In vitro protein synthesis may be performed by manual techniques or by automation. Automated synthesis may be performed, for example, using an Applied Biosystems Peptide Synthesizer (Foster City, CA) according to the manufacturer's instructions. Various portions of the PRO polypeptide may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the full-length PRO polypeptide.

5.2.3.1. Isolation of DNA encoding PRO polypeptide
DNA encoding a PRO polypeptide can be obtained from a cDNA library prepared from a tissue that possesses mRNA encoding the PRO polypeptide and is believed to express it at a detectable level. Therefore, DNA encoding human PRO polypeptide can be conveniently obtained from a cDNA library prepared from human tissue, as described in the Examples. A gene encoding a PRO polypeptide can also be obtained from a genomic library or by oligonucleotide synthesis.
Libraries can be screened with probes (such as antibodies to PRO polypeptides or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded thereby. Screening of cDNA or genomic libraries with selected probes can be performed using standard procedures described, for example, in Sambrook et al., Supra. Another method for isolating the gene encoding the desired PRO polypeptide is to use the PCR method. Sambrook et al., Supra; Dieffenbach et al., PCR Primer: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1995).
The following examples describe cDNA library screening techniques. The oligonucleotide sequence selected as the probe must be long enough and clear enough to minimize false positives. The oligonucleotide is preferably labeled such that it can be detected upon hybridization to DNA in the library being screened. Methods of labeling are well known in the art and include the use of radiolabels such as ³² P-labeled ATP, biotinylation or enzyme labeling. Hybridization conditions including moderate stringency and high stringency are given by Sambrook et al., Supra.
The sequences identified in such library screening methods can be compared and aligned with known sequences deposited in public databases such as Genbank or personal sequence databases and made available to the public. Sequence identity (either at the amino acid or nucleic acid level) within a determined region of the molecule or over the full length sequence can be determined using a computer software program such as ALIGN, which uses various algorithms to measure homology. It can be determined by DNAstar and INHERIT.
Nucleic acids having protein coding sequences use the deduced amino acid sequences disclosed herein for the first time and, if necessary, Sambrook et al., Supra, which detects mRNA production intermediates and precursors that were not reverse transcribed into cDNA. Obtained by screening selected cDNA or genomic libraries using conventional primer extension methods as described in.

5.2.3.2. Host Cell Selection and Transformation Host cells are transfected or transformed with the expression or cloning vectors described herein for PRO polypeptide production, promoters derived, transformants selected, or desired sequences In order to amplify the gene coding for, it is cultured in a suitably modified conventional nutrient medium. Culture conditions such as medium, temperature, pH, etc. can be selected by those skilled in the art without undue experimentation. In general, principles, protocols, and practical techniques for maximizing cell culture productivity can be found in Mammalian Cell Biotechnology: A Practical Approach, edited by M. Butler (IRL Press, 1991) and Sambrook et al., Supra. it can.
Methods of transfection, such as CaPO ₄ treatment and electroporation are known to those skilled in the art. Depending on the host cell used, transformation is done using standard methods appropriate to that cell. Calcium treatment or electroporation with calcium chloride described in Sambrook et al., Supra, is commonly used for prokaryotes or other cells that contain substantial cell wall barriers. Infection by Agrobacterium tumefaciens is as described in Shaw et al., Gene, 23: 315 (1983) and International Patent Application Publication No. WO89 / 05859, published June 29, 1989. In addition, it is used for transformation of certain plant cells. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham and van der Eb, Virology, 52: 456-457 (1978) is used. General aspects of mammalian cell host system transformations are described in US Pat. No. 4,399,216. Transformation into yeast is typically performed by Van solingen et al., J. Bact., 130: 946 (1977) and Hsiao et al., Proc. Natl. Acad. Sci. (USA), 76: 3829 (1979). It is carried out according to the method. However, other methods of introducing DNA into cells, such as nuclear microinjection, electroporation, intact cells, or bacterial protoplast fusion using polycations such as polybrene, polyornithine, etc. can also be used. For various techniques for transforming mammalian cells, see Keown et al., Methods in Enzymology, 185: 527-537 (1990) and Mansour et al., Nature, 336: 348-352 (1988).

Suitable host cells for cloning or expressing the DNA in the vectors described herein include prokaryotes, yeast, or higher eukaryote cells. Suitable prokaryotes include, but are not limited to, eubacteria such as Gram negative or Gram positive organisms such as Enterobacteriaceae such as E. coli. Various E. coli strains are available to the public, such as E. coli K12 strain MM294 (ATCC 31,446); E. coli X1776 (ATCC 31,537); E. coli strains W3110 (ATCC 27,325) and K5772 (ATCC 53,635). Other preferred prokaryotic host cells are E. coli, such as E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, such as Salmonella typhimurium, Serratia, eg Serratia marcesans ( Serratia marcescans), and Shigella, and Neisseria gonorrhoeae, such as B. subtilis and B. licheniformis (for example, Bacillicenifol described in DD 266,710 issued April 12, 1989) Miss 41P), Pseudomonas, including Enterobacteriaceae such as Pseudomonas aeruginosa and Streptomyces. These examples are illustrative rather than limiting. Strain W3110 is one particularly preferred host or parent host because it is a common host strain for the issuance of recombinant DNA production. Preferably, the host cell secretes a minimal amount of proteolytic enzyme. For example, strain W3110 may be modified to have a genetic mutation in a gene encoding a foreign protein in the host, examples of such hosts include E. coli W3110 strain 1A2 with the complete genotype tonA; Escherichia coli W3110 strain 9E4 with the complete genotype tonA ptr3; E. coli W3110 strain 27C7 (ATCC 55,244) with the complete genotype tonA ptr3 phoA E15 (argF-lac) 169 degPomp Tkan ^r ; argF-lac) E. coli W3110 strain 37D6 with 169 degP ompT rbs7ilvGkan ^r ; E. coli W3110 strain 40B4, a 37D6 strain with a non-kanamycin resistant degP deletion mutation; and US Pat. No. 4,946,783 issued August 7, 1990 E. coli strains having a mutated periplasmic protease. Alternatively, in vitro methods of cloning such as PCR or other nucleic acid polymerase reactions are preferred.

In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for PRO polypeptide-encoding vectors. Saccharomyces cerevisia is a commonly used lower eukaryotic host microorganism. Others are Schizosaccharomyces Pombe (Beach and Nurse, Nature, 290: 140 [1981]; EP 139,383 issued May 2, 1985); Kluveromyces hosts (US patent) No. 4,943,529; Fleer et al., Bio / Technology, 9: 968-975 (1991)), for example, K. lactis (MW98-8C, CBS683, CBS4574; Louvencourt et al., J. Bacteriol. 737 [1983]), K. fragilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K. wickeramii (ATCC 24,178), K. waltii (ATCC 56,500), Cedro Sophyllum ( K. drosophilarum (ATCC 36,906; Van den Berg et al., Bio / Technology, 8: 135 (1990)), K. themotolerans and K. marxianus; Yarrowia (EP 402,226); Pichia pastoris (EP 183,070; Sreekrishna et al., J. Basic Microbiol, 28: 265-278 [1988]); Candida; Trichodel Malaysia (EP 244,234); Red-skinned mold (Case et al., Proc. Natl. Acad. Sci. USA, 76: 5259-5263 [1979]); Schwanniomyces, eg, Schwanniomyces Occidentalis (EP 394,538 published October 31, 1990); and filamentous fungi such as Neurospora, Penicillium, Tolypocladium (WO91 / 00357 published January 10, 1991); And Koji fungi, such as pseudonogenic Koji fungi (Ballance et al., Biochem. Biophys. Res. Commun., 112: 284-289 [1983]; Tilburn et al., Gene, 26: 205-221 [1983]; Yelton et al., Proc Natl. Acad. Sci. USA, 81: 1470-1474 [1984]) and black mold (Kelly and Hynes, EMBO J., 4: 475-479 [1985]). Preferred methylotropic yeasts here include, but are not limited to, Hansenula, Candida, Kloeckera, Pichia, Saccharomyces, Torulopsis, and Rhodotorula. Includes yeast that can grow on methanol selected from the genus. A list of specific species, illustrative of this yeast classification, is described in C. Anthony, The Biochemistry of Methylotrophs, 269 (1982).
Suitable host cells for the expression of nucleic acid encoding glycosylated PRO polypeptide are derived from multicellular organisms. Examples of invertebrate cells include insect cells such as Drosophila S2 and Spodospera Sf9, and plant cells. Examples of useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells. More detailed examples include monkey kidney CV1 strain transformed with SV40 (COS-7, ATCC CRL 1651); human embryonic kidney strain (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol., 36:59 (1977)); Chinese hamster ovary cells / -DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77: 4216 (1980)); mouse Sertoli cells (TM4, Mather, Biol. Reprod., 23: 243-251 (1980)); human lung cells (W138, ATCC CCL 75); human hepatocytes (Hep G2, HB 8065); and mouse breast tumor cells (MMT 060562, ATCC CCL51). The selection of an appropriate host cell is within the common general knowledge of this field.

5.2.2.3. Selection and use of replicable vectors
Nucleic acid (eg, cDNA or genomic DNA) encoding a PRO polypeptide is inserted into a replicable vector for cloning (amplification of DNA) or expression. Various vectors are publicly available. The vector can be, for example, in the form of a plasmid, cosmid, virus particle, or phage. The appropriate nucleic acid sequence is inserted into the vector by a variety of techniques. In general, DNA is inserted into an appropriate restriction endonuclease site using techniques well known in the art. Vector components are generally not limited to these, but if the sequence is secreted, one or more signal sequences, origin of replication, one or more marker genes, enhancer elements, promoters, and transcription Contains termination sequence. Standard ligation techniques known to those skilled in the art are used to make suitable vectors containing one or more of these components.
PRO polypeptides are not only produced directly by recombinant techniques, but also fused to heterologous polypeptides, which are signal sequences or mature proteins or other polypeptides having a specific cleavage site at the N-terminus of the polypeptide. It is also produced as a peptide. In general, the signal sequence is a component of the vector or a part of the DNA encoding PRO that is inserted into the vector. The signal sequence may be, for example, a prokaryotic signal sequence selected from the group of alkaline phosphatase, penicillinase, lpp or a thermostable enterotoxin II leader. For yeast secretion, signal sequences include yeast invertase leader, alpha factor leader (including the Saccharomyces and Kluyveromyces alpha factor leaders, the latter described in US Pat. No. 5,010,182). Or an acid phosphatase leader, a C. albicans glucoamylase leader (EP362179 issued April 4, 1990), or a signal described in WO90 / 13646 published November 15, 1990 It can be. In mammalian cell expression, mammalian signal sequences may be used for direct secretion of proteins such as signal sequences from the same or related species of secreted polypeptides as well as viral secretory leaders.

Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are well known for many bacteria, yeasts and viruses. The origin of replication derived from plasmid pBR322 is suitable for most gram negative bacteria, the 2μ plasmid origin is suitable for yeast, and the various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are suckling. Useful for cloning vectors in animal cells.
Expression and cloning vectors typically contain a selection gene, also termed a selectable marker. Typical selection genes are (a) conferring resistance to antibiotics or other toxins such as ampicillin, neomycin, methotrexate or tetracycline, (b) compensate for auxotrophic defects, or (c) the genetic code for eg Basili It encodes a protein that supplies important nutrients not available from complex media, such as D-alanine racemase.
Examples of selectable markers suitable for mammalian cells are those that can identify cellular components capable of taking up nucleic acids encoding PRO polypeptides, such as DHFR or thymidine kinase. Suitable host cells when using wild-type DHFR are DHFR activity prepared and propagated as described by Urlaub et al., Proc. Natl. Acad. Sci. USA, 77: 4216 (1980). It is a defective CHO cell line. A suitable selection gene for use in yeast is the trp1 gene present in the yeast plasmid YRp7. Stinchcomb et al., Nature, 282: 39 (1979); Kingsman et al., Gene, 7: 141 (1979); Tschemper et al., Gene, 10: 157 (1980). The trp1 gene provides a selectable marker for a mutant strain of yeast lacking the ability to grow in tryptophan, such as, for example, ATCC No. 44076 or PEP4-1. Jones, Genetics, 85:12 (1977).
Expression and cloning vectors usually contain a promoter operably linked to the nucleic acid sequence encoding the PRO polypeptide and controlling mRNA synthesis. Suitable promoters that are recognized by a variety of possible host cells are known. Suitable promoters for use in prokaryotic hosts are the β-lactamase and lactose promoter systems [Chang et al., Nature, 275: 615 (1978); Goeddel et al., Nature, 281: 544 (1979)], alkaline phosphatase, tryptophan (trp ) Promoter system [Goeddel, Nucleic Acids Res., 8: 4057 (1980); EP 36,776], and hybrid promoters such as the tac promoter [deBoer et al., Proc. Natl. Acad. Sci. USA, 80: 21-25 (1983). )]including. Promoters used in bacterial systems also have a Shine-Dalgarno (SD) sequence operably linked to the DNA encoding PRO.
Examples of suitable promoter sequences for use with yeast hosts include 3-phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem., 255: 2073 (1980)) or other glycolytic enzymes (Hess et al., J. Adv. Enzyme Reg., 7: 149 (1968); Holland, Biochemistry, 17: 4900 (1987)), eg enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, Glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, trioselate isomerase, phosphoglucose isomerase, and glucokinase are included.
Other yeast promoters are inducible promoters that have the additional effect that transcription is controlled by growth conditions, such as alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degrading enzymes related to nitrogen metabolism, metallothionein, glycerin There are promoter regions of aldehyde-3-phosphate dehydrogenase and the enzymes that govern the utilization of maltose and galactose. Vectors and promoters suitably used for expression in yeast are further described in EP 73,657.

Transcription of PRO nucleic acids from vectors in mammalian host cells is, for example, polyoma virus, infectious epithelioma virus (UK 2,211,504 published July 5, 1989), adenovirus (eg adenovirus 2), bovine papilloma virus, Promoters derived from the genomes of viruses such as avian sarcoma virus, cytomegalovirus, retrovirus, hepatitis B virus and simian virus 40 (SV40), heterologous mammalian promoters such as actin promoter or immunoglobulin promoter, and heat shock The promoter obtained from the promoter is controlled as long as such promoter is compatible with the host cell system.
Transcription of the DNA encoding the desired PRO polypeptide by higher eukaryotes can be enhanced by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs, that act on a promoter to enhance its transcription. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, α-fetoprotein and insulin). Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the late SV40 enhancer (100-270 base pairs), the cytomegalovirus early promoter enhancer, the late polyoma enhancer and the adenovirus enhancer of the origin of replication. Enhancers can be spliced into the vector at positions 5 'or 3' of the sequence encoding the PRO polypeptide, but are preferably located 5 'from the promoter.
Expression vectors used for eukaryotic host cells (nucleated cells derived from yeast, fungi, insects, plants, animals, humans, or other multicellular organisms) are sequences required for termination of transcription and stabilization of mRNA. Including. Such sequences can be obtained from the normally 5 'and sometimes 3' untranslated regions of eukaryotic or viral DNA or cDNA. These regions contain nucleotide segments that are transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding PRO.
Other methods, vectors and host cells suitable for adapting to the synthesis of PRO polypeptides in recombinant vertebrate cell culture are described in Gething et al., Nature, 293: 620-625 (1981); Mantei et al., Nature, 281: 40-46 (1979); EP 117,060; and EP 117,058.

5.2.3.4. Gene amplification / expression detection Gene amplification and / or expression is based on the sequences provided herein, using appropriately labeled probes, eg, conventional Southern blotting, Northern to quantify mRNA transcription Can be measured directly in the sample by blotting (Thomas, Proc. Natl. Acad. Sci. USA, 77: 5201-5205 (1980)), dot blotting (DNA analysis), or in situ hybridization. it can. Alternatively, antibodies capable of recognizing specific duplexes, including DNA duplexes, RNA duplexes and DNA-RNA hybrid duplexes or DNA-protein duplexes, can also be used. The antibody can then be labeled and an assay can be performed, where the duplex is bound to the surface, so that the antibody bound to the duplex at the time of formation on the surface of the duplex is bound. The presence can be detected.
Alternatively, gene expression can be measured by immunological methods that directly quantify gene product expression, such as immunohistochemical staining of cells or tissue sections and cell culture or body fluid assays. Antibodies useful for immunohistochemical staining and / or assay of sample fluids can be monoclonal or polyclonal and can be prepared in any mammal. Conveniently, the antibody is fused to a native sequence PRO polypeptide, or to a synthetic peptide based on the DNA sequence provided herein, or to a DNA encoding the PRO polypeptide and presents a specific antibody epitope. It can be prepared against the encoding exogenous sequence.
5.2.3.5. Purification of PRO polypeptides
The PRO polypeptide form can be recovered from the culture medium or the lysate of the host cell. If membrane-bound, it can be detached from the membrane using an appropriate wash solution (eg, Triton-X ^™ 100) or enzymatic cleavage. Cells used for PRO polypeptide expression can be disrupted by various chemical or physical means such as freeze-thaw cycles, sonication, mechanical disruption, or cytolytic agents. It may be desirable to purify the PRO polypeptide from recombinant cell proteins or polypeptides. Purified by the following procedure, which is an example of a suitable purification procedure: fractionation on an ion exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica or cation exchange resin such as DEAE; chromatofocusing; PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G-75; protein A sepharose column to remove contaminants such as IgG; and metal chelation column to bind the epitope tag form of the PRO polypeptide. It is possible to use many protein purification methods known in the art and described, for example, in Deutscher, Methods in Enzymology, 182 (1990); Scopes, Protein Purification: Principles and Practice, (Springer-Verlag, New York 1982). it can. The purification process chosen depends, for example, on the production method used and in particular on the nature of the particular PRO produced.

5.2.4. Uses of PRO polypeptides 5.2.4.1. Cardiovascular, Endothelial and Angiogenic Activity Assays A variety of assays can be used to test the cardiovascular, endothelial and angiogenic activity of the polypeptides described herein. These assays also include those provided in the examples below.
The assay for testing endothelin antagonist activity disclosed in US Pat. No. 5,773,414 includes a rat ventricular binding assay to test the ability of a polypeptide to inhibit iodinated endothelin-I binding in a receptor assay, rabbit renal artery smooth muscle cells An endothelin receptor binding assay to test the intact cell binding properties of radiolabeled endothelin-I, by measuring the intracellular level of a second messenger functional activity in Rat-I cells In the inositol phosphate accumulation assay to be measured, in vitro studies using male New Zealand rabbit endothelium, and in vivo studies using SD rats, the added compounds were cultured in cultured vascular smooth muscle. Ability to reduce released endothelin-stimulated arachidonic acid Include arachidonic acid release assay that measures.
Tissue-generating activity assays are described in, but not limited to, WO95 / 16035 (bone, cartilage, tendon); WO95 / 05846 (nerve, neuron), and WO91 / 07491 (skin, endothelium). Things are included.
Assays for wound healing activity include, for example, Winter, Epidermal Wound Healing, Maibach, HI and Rovee, DT, modified in the paper of Eaglelstein and Mertz, J. Invest. Dermatol., 71: 382-384 (1978). , Ed. (Year Book Medical Publishers. Inc., Chicago), pp 71-112.
Endothelin B ₁ (ETB ₁₎ binds to the receptor polypeptide, a screening assay of a test molecule relating to a PRO polypeptide that modulates signal transduction activity, as described in U.S. Patent No. 5,773,223, endothelin B ₁ A host cell transformed with DNA encoding a receptor polypeptide is provided, the cell is exposed to a test candidate drug, and endothelin B ₁ receptor signal transduction activity is measured.
There are several cardiac hypertrophy assays. In vitro assays include induction of diffusion of adult rat heart myocytes. In this assay, ventricular myocytes were derived from Piper et al., “Adult ventricular rat heart muscle cells”, Cell Culture Techniques in Heart and Vessel Research. HM Piper. Ed (Berlin: Springer-Verlag, 1990), pp. 36-60. Isolated from a single (male SD) rat essentially according to a modification of the procedure described in detail. This procedure allows for the isolation of growing ventricular myocytes and long-term culture of rod phenotype cells. Phenylephrine and prostaglandin F ₂ α (PGF ₂ α) have been shown to induce the metastatic response of these growing cells. By potential inhibitors of various cardiac hypertrophy, PGF ₂ alpha or PGF ₂ alpha analogs (e.g. fluprostenol) myocyte migration inhibitory induced by and phenylephrine are then tested.

An example of an in vivo assay is to test the inhibition of cardiac hypertrophy induced by fluprostenol in vivo. This pharmacological model, rats (e.g., male Wistar or SD) by subcutaneous injection of fluprostenol (an agonist analog of PGF ₂ alpha) testing the ability of PRO polypeptides to inhibit cardiac hypertrophy induced in Is. In rats with pathologic cardiac hypertrophy induced myocardial infarction, PGF ₂ alpha in the myocardium it has been known to be chronically elevated to detectable levels. Lai et al., Am. J. Physiol. (Heart Circ. Physiol.), 271: H2197-H2208 (1996). Thus, factors that can inhibit the effect of fluprostenol on myocardial growth in vivo may be useful in the treatment of cardiac hypertrophy. The efficacy of a PRO polypeptide in cardiac hypertrophy is determined by measuring the weight of the heart, ventricle and left ventricle (normalized by body weight) on fluprostenol-treated rats that do not receive the PRO polypeptide.
Another example of an in vivo assay is the pressure overload cardiac hypertrophy assay. In vivo testing, it is common to induce pressure overload hypertrophy due to contraction of the abdominal aorta of the test animal. In a typical protocol, rats (eg, male Wistar or SD) are anesthetized and each rat's abdominal aorta is narrowed to just below the diaphragm. Beznak M., Can. J. Biochem. Physiol., 33: 985-94 (1955). The aorta is exposed through a surgical incision and a short thick needle is placed next to the tube. The aorta is ligated around the needle with silk thread and allowed to contract and removed immediately, reducing the lumen of the aorta to the needle diameter. This approach is described, for example, in Rossi et al., Am. Heart J., 124: 700-709 (1992) and O'Rourke and Reibel, PSEMB, 200: 95-100 (1992).
In yet another in vivo assay, the effect on cardiac hypertrophy followed by experimentally induced myocardial infarction (MI) is measured. In rats, acute MI is induced by ligation of the left coronary artery, which is further confirmed by an electrocardiogram test. An animal sham operation group is prepared as a control animal. Early data showed that cardiac hypertrophy was present in the group with MI and that the heart weight increased by 18% relative to body weight. Lai et al. Treat these animals with candidate blockers for cardiac hypertrophy, such as PRO polypeptides, to provide valuable information about the therapeutic potential of the tested candidate drugs. A further assay test in the induction of cardiac hypertrophy using SD rats is disclosed in US Pat. No. 5,773,415.

To further understand the role of the genes identified here in tumor pathogenesis and progression in cancer and to test the efficacy of therapeutic candidates including antibodies and other antagonists of natural PRO polypeptides such as small molecule antagonists Various well-known animal models can be used. The in vivo nature of such models is particularly provocative for human patients. Animal models of tumors and cancers (breast cancer, colon cancer, prostate cancer, lung cancer, etc.) include non-recombinant and recombinant (transgenic) animals. Non-recombinant animal models include, for example, rodents such as murine models. Such models use standard techniques such as subcutaneous injections, tail vein injections, spleen transplants, peritoneal transplants, subrenal transplants, or orthopin transplants, such as colon cancer cells transplanted into colon tissue, It can be generated by transferring tumor cells into syngeneic mice. See, for example, PCT Publication No. WO97 / 33551 published September 18, 1997. Perhaps the animal species most frequently used for oncogene research are immune deficient mice, especially nude mice. The finding that nude mice with thymic stimulation / dysplasia successfully act as a host for human tumor xenografts has led to widespread use for this purpose. Autosomal recessive nu genes include, for example, ASW, A / He, AKR, BALB / c, B10.LP, C17, C3H, C57BL, C57, CBA, DBA, DDD, I / st, NC, NFR, NFS, NFS / Introduced into a large number of clearly cognate nude mice, including N, NZB, NZC, NZW, P, RIII and SJL. In addition to nude mice, a wide range of other animals that have inherited immunological deficits are raised and used as recipients of tumor xenografts. For further details, see The Nude Mouse in Oncology Research, E. Boven and B. Winograd. Eds. (CRC Press, Inc., 1991).
Cells introduced into such animals may be known tumor / cancer cells such as any of the tumor cell lines listed above, such as the B104-1 cell line (stable NIH-3T3 cells transfected with the neu proto-oncogene. Can be derived from Caco-2 (ATCC HTB-37); or moderately differentiated grade II human colon adenocarcinoma cell line, HT-29 (ATCC HTB-38), or tumors and cancers . Tumor or cancer cell samples are used in standard conditions, including freezing and storage in liquid nitrogen, and can be obtained from the patient by surgery. Karmali et al., Br. J. Cancer. 48: 689-696 (1983).

Tumor cells can be introduced into animals such as nude mice by various procedures. The mouse subcutaneous (sc) space is very suitable for tumor transplantation. The tumor can also be implanted as a solid block, eg, a needle biopsy using trocar, or a cell suspension. Tumor tissue fragments of a size suitable for solid block or trocar implantation are introduced into the subcutaneous space. Cell suspensions are freshly prepared from primary tumors or stable tumor cell lines and injected subcutaneously. Tumor cells can also be injected as subcutaneous implants. In this position, the graft is applied between the lower part of the dermal connective tissue and the subcutaneous tissue.
Animal models of breast cancer are described in, for example, rat neuroblasts (from the originally isolated neu oncogene, as described in Drebin et al., Proc. Nat. Acad. Sci. USA, 83: 9129-9133 (1986). Or neu-transformed NIH-3T3 cells can be produced by transplanting into nude mice.
Similarly, animal models of colon cancer can be created by passing colon cancer cells through animals such as nude mice and causing tumors to appear in these animals. Orthotopic models of human colon cancer in nude mice are described, for example, by Wang et al., Cancer Research, 54: 4726-4728 (1994) and Too et al., Cancer Research, 55: 681-684 (1995). This model is based on the so-called “METAMOUSE ^™ ” sold by AntiCancer, Inc., (San Diego, California).
Tumors that arise in the animal are removed and can be cultured in vitro. The cells from the in vitro culture are then passaged into animals. Such tumors can be useful for further testing or drug screening purposes. Alternatively, tumors obtained by passage can be isolated, and RNA of pre-passage cells and cells isolated after one or more passage steps can be analyzed for differential expression of the gene of interest. Is done. Such passaging techniques can be performed on any well-known tumor or cancer cell line.
For example, Meth A, CMS4, CMS5, CMS21 and WEHI-164 chemically induce fibrosarcoma in BALB / c female mice (DeLeo et al., J. Exp. Med., 146: 720 (1977)) Provide a highly controlled model system to study the antitumor activity of drugs. Palladino et al., J. Immunol., 138: 4023-4032 (1987). Briefly, tumor cells are grown in vitro in cell culture. Prior to injection into animals, cell lines are washed and suspended in buffer at a cell density of 10 × 10 ⁶ to 10 × 10 ⁷ cells / ml. Subsequently, when animals are injected subcutaneously with 10 to 100 μl of cell suspension, tumors appear in 1 to 3 weeks.
Furthermore, the mouse Lewis lung (3LL) carcinoma, one of the most studied tumors studied, can be used as a research tumor model. The efficacy of this tumor model correlates with favorable effects in human patients diagnosed with small cell carcinoma of the lung (SCCL). The tumor can be introduced into normal mice by injecting diseased mice or tumor fragments from cultured cells. Zupi et al., Br. J. Cancer, 41: suppl. 4. 30 (1980). There was evidence that the tumor started from a single cell injection and that the infected cells were alive at a fairly high rate. For further information about this tumor model, see Zacharski, Haemostasis, 16: 300-320 (1986).

One method of assessing the efficacy of a test compound in an animal model with a transplanted tumor is to measure the size of the tumor before or after treatment. Traditionally, the size of the transplanted tumor is measured with a two or three dimensional slide caliper. Measurements limited to two dimensions do not accurately reflect the size of the tumor; therefore, they are usually converted to corresponding quantities using mathematical formulas. However, tumor size measurements are very inaccurate. The therapeutic effect of a candidate drug can be described as better when treatment-induced growth is delayed and specific growth is delayed. Another important variable in the description of tumor growth is the time at which tumor burden doubles. Also reported by computer programs for calculation and description of tumor growth such as Rygaard and Spang-Thomsen, Proc. 6th Int. Workshop on Immune-Deficient Animals. Wu and Sheng. Eds. (Basel. 1989), p. 301. Can be obtained program. However, it should be noted that post-treatment necrosis and inflammatory responses may actually result at least initially in increasing tumor size. Therefore, these changes need to be carefully monitored using a combination of morphometry and flow cytometry analysis.
In addition, the recombinant (transgenic) animal model introduces the PRO gene coding site identified here into the genome of the animal of interest and uses standard techniques to create transgenic animals. Can be processed. Animals that can be provided as targets for transgenic manipulation include, but are not limited to, mice, rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human primates such as baboons, chimpanzees and monkeys. Well known techniques in the art for introducing transgenes into such animals include pronuclear microinjection (US Pat. No. 4,873,191); retrovirus-mediated gene transfer into the embryo (eg, Van der Putten). , Proc. Natl. Acad. Sci. USA, 82: 6148-615 (1985)); targeting genes in embryonic stem cells (Thompson et al., Cell, 56: 313-321 (1989)); embryo electroporation (Lo, Mol. Cell. Biol., 3: 1803-1814 (1983)); and sperm-mediated gene transfer. Lavitrano et al., Cell, 57: 717-73 (1989). For review, see, for example, US Pat. No. 4,736,866.
For the purposes of the present invention, transgenic animals include those that carry the transgene only in a portion of their cells ("mosaic animals"). The transgene can be integrated as a single transgene or in a chain, eg, head-to-head or head-to-tail tandem. Alternatively, selective introduction of a transgene into a particular cell line is possible following the technique of, for example, Lasko et al., Proc. Natl. Acad. Sci. USA, 89: 6232-636 (1992). Expression of the transgene in the transgenic animal can be monitored by conventional techniques. For example, Southern blot analysis or PCR amplification can be used to verify transgene integration. The mRNA expression level can then be analyzed using techniques such as in situ hybridization, Northern blot analysis, PCR or immunocytochemistry. The animals are further tested for signs of tumor or cancer progression.

Alternatively, the PRO polypeptide identified here can be obtained by homologous recombination between a modified genomic DNA encoding a PRO polypeptide introduced into an animal embryonic cell and an endogenous gene encoding the PRO polypeptide. “Knockout” animals can be constructed that have a defective or altered gene encoding. For example, a cDNA encoding a particular PRO polypeptide can be used for cloning genomic DNA encoding the polypeptide according to established techniques. A portion of the genomic DNA encoding a particular PRO polypeptide can be deleted or replaced with another gene, such as a gene encoding a selectable marker used to monitor integration. Typically, vectors contain several kilobases of unchanged flanking DNA (both 5 'and 3' ends). For example, see Thomas and Capecchi, Cell, 51: 503 (1987) for homologous recombination vectors. The vector is introduced into embryonic stem cells (for example, by electroporation), and cells in which the introduced DNA is recombined homologously with endogenous DNA are selected. See, for example, Li et al., Cell, 69: 915 (1992). The selected cells are then injected into the blastocyst of the animal (eg mouse or rat) to form an aggregate chimera. See, for example, Bradley, Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, EJ Robertson, ed. (IRL, Oxford, 1987), pp. 113-152. The chimeric embryo is then transplanted into an appropriate pseudopregnant female nanny to create a “knock-out” animal over time. Offspring with DNA homologously recombined into embryonic cells are identified by standard techniques and can be used to breed animals that contain DNA in which all cells of the animal are homologously recombined . Knockout animals are characterized by their ability to defend against certain pathological conditions and the progression of those pathological conditions due to the absence of PRO polypeptide.
The effects of antibodies that specifically bind to the PRO polypeptides identified herein, and other candidate drugs, can be further tested in the treatment of spontaneous animal tumors. A suitable target for this study is cat mouth squamous cell carcinoma (SCC). Cat mouth SCC is highly invasive and this malignancy is considered the most common mouth malignancy in cats, and more than 60% of mouth tumors have been measured to repeat in this species. Although it rarely metastasizes to distant sites, the low incidence of metastasis is reflected in the short survival of cats with this tumor. These tumors cannot usually be treated by surgery, mainly due to the anatomy of the cat's mouth. There is currently no effective treatment for this tumor. Prior to entering this study, each cat will be a complete clinical biopsy and scanned by computed tomography (CT). Cats diagnosed as sublingual squamous cell tumors are excluded from this study. The tongue is paralyzed as a result of such a tumor, and if the tumor dies as a result of treatment, the animal cannot feed itself. Each cat is treated repeatedly over time. During the treatment period, a picture of the tumor is taken daily and subsequently rechecked. After treatment, each cat is subjected to another CT scan. CT scans and chest radiographs are evaluated every 8 weeks thereafter. The data were evaluated as different in survival rate, reactivity and toxicity relative to the control group. A positive response preferably requires evidence of tumor regression with improved survival quality and / or increased life span.
In addition, canine, cat and baboon and other spontaneous animal tumors such as fibrosarcoma, adenocarcinoma, lymphoma, chondroma, or leiomyosarcoma can also be tested. Of course, canine and feline breast adenocarcinoma are the preferred models, and their appearance and properties are very similar to those of humans. However, the use of this model is limited by the incidence of this type of tumor in animals.
Also suitable here are other in vitro and in vivo cardiovascular, endothelial and angiogenic tests well known in the art.

5.2.4.2. Tissue distribution Further studies, such as measuring mRNA expression in various human tissues, can now demonstrate the results of cardiovascular, endothelial and angiogenesis assays.
As described above, gene amplification and / or expression in various tissues is based on the sequences provided here, using appropriately labeled probes, for example, conventional Southern blotting, quantifying mRNA transcription. Northern blotting (Thomas, Proc. Natl. Acad. Sci. USA, 77: 5201-5205 (1980)), dot blotting (DNA analysis), or in situ hybridization. Alternatively, antibodies capable of recognizing specific duplexes, including DNA duplexes, RNA duplexes and DNA-RNA hybrid duplexes or DNA-protein duplexes, can also be used.
Alternatively, gene expression in various tissues can be measured by immunological methods that directly quantitate gene product expression, such as immunohistochemical staining of tissue sections and cell culture or body fluid assays. Antibodies useful for immunohistochemical staining and / or assay of sample fluids can be monoclonal or polyclonal and can be prepared in any mammal. Conveniently, the antibody is directed against a native sequence PRO polypeptide or against a synthetic peptide based on the DNA sequence provided herein, or on a foreign sequence fused to PRODNA and encoding a specific antibody epitope. Can be prepared for. General techniques for antibody production and specific protocols for in situ hybridization are provided below.

5.2.2.3. Antibody binding studies Cardiovascular, endothelial and angiogenesis studies to test the ability of anti-PRO antibodies to inhibit the effects of PRO polypeptides on endothelial cells or other cells used in cardiovascular, endothelial and angiogenesis assays This result can be proved by studying antibody binding. Examples of antibodies include polyclonal, monoclonal, humanized, bispecific and heteroconjugate antibodies, the preparation of which is described below.
Antibody binding studies can be performed by any well-known assay method, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays. Zola, Monoclonal Antibodies: A Manual of Techniques, (CRC Press, Inc. 1987) pp. 147-158.
Competitive binding assays rely on the ability of a labeled standard to compete for a test sample in binding to a finite amount of antibody. The amount of target protein in the test sample is inversely proportional to the amount of standard to which the antibody binds. To facilitate measurement of the amount of standard that binds, the antibody is preferably insolubilized before and after competition, and analytes and standards that bind to the antibody are separated from standards and analytes that remain unbound for convenience. To do.
In a sandwich assay, two antibodies that are capable of binding to different immunogenic portions or epitopes or proteins to be detected are used. In a sandwich assay, a test sample to be analyzed binds to a first antibody immobilized on a solid support, after which a second antibody binds to the analyte, thus forming an insoluble three-site complex. Is done. See, for example, US Pat. No. 4,376,110. The second antibody is a detectable moiety and may itself be labeled (direct sandwich assay) or measured using an anti-immunoglobulin antibody labeled with a detectable moiety (indirect sandwich). Assay). For example, one type of sandwich assay is an ELISA assay, in which case the detectable moiety is an enzyme.
In immunohistochemistry, tissue samples may be fresh or frozen, embedded in paraffin, or fixed with a preservative, such as formalin.

5.2.4.4. Cell-based tumor assays Cell-based assays and animal models for cardiovascular, endothelial and angiogenic diseases, such as tumors, now demonstrate the discovery of cardiovascular, endothelial and angiogenic assays and are further identified here. And can be used to understand the relationship between the progression and pathogenesis of unwanted cardiovascular, endothelial and angiogenic cell growth. The role of the gene products identified here in undesired cardiovascular, endothelial and angiogenic cell growth, e.g. tumor progression and pathogenesis, uses cells or cell lines identified as being stimulated or inhibited by PRO polypeptides. Can be tested. Such cells include, for example, those shown in the examples below.
In a different approach, the ability to transfect cells of known cell types associated with specific cardiovascular, endothelial and angiogenic diseases with cDNA, which can induce excessive growth or inhibit growth Analyze. Where the cardiovascular, endothelial and angiogenic disease is cancer, suitable tumor cells include, for example, stable tumor cell lines, such as the B104-1-1 cell line (stable NIH-3T3 cells transfected with the neu proto-oncogene Line) and ras-transfected NIH-3T3 cells, which can be transfected with the desired gene and can monitor tumorigenic growth. Then, using such transfected cell lines, the poly- or monoclonal antibody or antibody composition exerts cytostatic or cytotoxic activity on the growth of the transfected cells, or antibody-dependent cellular cells Test the ability to inhibit tumorigenic cell growth by mediating toxicity (ADCC). In addition, cells transfected with the coding sequences of the genes identified herein can be used to identify candidate drugs for the treatment of cardiovascular, endothelial and angiogenic diseases such as cancer.
In addition, primary cultures (described above) obtained from tumors of transgenic animals can be used for cell-based assays, although stable cell lines are preferred. Techniques for deriving certain cell lines from transgenic animals are well known in the art. See, for example, Small et al., Mol. Cell. Biol., 5: 642-648 (1985).

5.2.4.5. Gene Therapy The following description relates to methods and compositions by which disease symptoms can be ameliorated. Certain diseases are caused, at least in part, by the presence of excessive levels of gene products or gene products that exhibit abnormal or excessive activity. Thus, a reduction in the level and / or activity of such gene products causes a amelioration of the symptoms of such diseases.
Alternatively, certain other diseases are caused, at least in part, by a lack or decrease in the level of gene expression or a decrease in the level of gene product activity. Thus, the level of gene expression and / or activity of such gene products results in remission of symptoms of such diseases.
In some cases, gene upregulation in disease states reflects a protective role for gene products that respond to disease states. Promotion of such target gene expression or target gene product activity would reinforce the protective effect it exerts. Certain disease states result from abnormally low levels of activity of such protective genes. Also, in such cases, increased gene expression levels and / or activity of such gene products will result in remission of such disease symptoms.
The PRO polypeptides and polypeptide peptidyl agonists and antagonists described herein may be used in accordance with the present invention by in vivo expression, often referred to as gene therapy.
There are two main ways to get the nucleic acid (optionally contained in a vector) into the patient's cells: in vivo and ex vivo. For in vivo delivery, the nucleic acid usually has a site where the PRO polypeptide is required, i.e., the site where the PRO polypeptide is synthesized, or where known, the biological activity of the PRO polypeptide is required ( For example, wounds are injected directly into the patient. In ex vivo treatment, a patient's cells are removed, nucleic acids are introduced into these isolated cells, and the modified cells are administered to the patient either directly or encapsulated in, for example, a porous membrane that is implanted in the patient (US Patents 4,892,538 and 5,283,187). There are a variety of techniques available for introducing nucleic acids into living cells. These techniques depend on whether the nucleic acid is transferred in vitro into cultured cells or in vivo into the host of interest. Suitable techniques for transferring nucleic acids into mammalian cells in vitro include liposomes, electroporation, microinjection, transduction, cell fusion, DEAE-dextran, calcium phosphate precipitation, and the like. Transduction includes replication defects, binding of recombinant viral (preferably retroviral) particles to cellular receptors, followed by introduction of nucleic acids contained in the particles into the cells. A commonly used vector for ex vivo delivery of genes is a retrovirus.

Currently preferred in vivo nucleic acid transfer techniques are viral or non-viral vectors (adenovirus, lentivirus, herpes simplex I virus, or adeno-associated virus (AAV)), and lipid-based systems (useful for lipid-mediated transfer of genes. Lipids include, for example, transfection with DOTMA, DOPE, and DC-Chol; see, for example, Tonkinson et al., Cancer Investigation, 14 (1): 54-65 (1996)). The most preferred vector for use in gene therapy is a virus, most preferably an adenovirus, AAV, lentivirus, or retrovirus. Viral vectors, such as retroviral vectors, are at least one transcriptional promoter / enhancer or positioning factor, or other factors that control gene expression by other means such as alternative splicing, nuclear RNA export, or post-translational modification of messenger including. In addition, a viral vector such as a retroviral vector includes a nucleic acid molecule that, when transcribed in the presence of a gene encoding a PRO polypeptide, operably binds to it and functions as a translation initiation sequence. Such vector constructs also include a packaging signal suitable for the virus used, a terminal repeat (LTR) or part thereof, and positive and negative strand primer binding sites (if they are not already present in the viral vector). . In addition, these vectors typically contain a signal sequence that causes the PRO polypeptide to be secreted from the host cell in which it is located. Preferably, the signal sequence for this purpose is a mammalian signal sequence, most preferably the natural signal sequence for the PRO polypeptide. In some cases, the vector construct also includes polyadenylation and signals directed to one or more restriction sites and a translation termination sequence. By way of example, such vectors typically include a 5 ′ LTR, a tRNA binding site, a packaging signal, a starting point for second strand DNA synthesis, and a 3 ′ LTR or a portion thereof. Other non-viral vectors such as cationic lipids, polylysine, and dendrimers can also be used.
In some situations, it may be desirable to provide a nucleic acid source with a reagent that targets a target cell, such as an antibody specific for a cell surface membrane protein or a target cell, a ligand for a receptor on the target cell, and the like. When liposomes are used, proteins that bind to cell surface membrane proteins with endocytosis are used to facilitate targeting and / or uptake, such as capsid proteins or fragments thereof of a particular cell type. Antibodies of proteins that undergo internalization in cycling and proteins that target intracellular localization and improve intracellular half-life. Techniques for receptor-mediated endocytosis are described, for example, by Wu et al., J. Biol. Chem., 262: 4429-4432 (1987) and Wagner et al., Proc. Natl. Acad. Sci. USA, 87: 3410-3414 (1990). )It is described in. For a review of currently known gene labeling and gene therapy protocols, see Anderson et al., Science, 256: 808-813 (1992). See also WO93 / 25673 and references cited therein.
Suitable gene therapy and methods for making retroviral particles and structural proteins are found in US Pat. No. 5,681,746.

5.2.4.6. Use of the gene as a diagnostic method The present invention also relates to the use of a gene encoding a PRO polypeptide as a diagnostic method. Since variants in PRO polypeptides are responsible for tumors, detection of mutated forms of PRO polypeptides is sensitive to cardiovascular, endothelial and angiogenic diseases, or cardiovascular, endothelial and angiogenic diseases such as tumors. Enables diagnosis.
Individuals carrying variants in the gene encoding human PRO polypeptide can detect DNA levels by a variety of techniques. Nucleic acids for diagnosis can be obtained from patient cells, such as blood, urine, saliva, tissue biopsy, and test substances. Genomic DNA can be amplified enzymatically using PCR prior to analysis (Saiki et al., Nature, 324: 163-166 (1986)) or used directly for detection. RNA or cDNA can be used for the same purpose. As an example, PCR primers complementary to a nucleic acid encoding a PRO polypeptide can be used for identification and analysis of PRO polypeptide variants. For example, deletions and insertions can be detected by a change in the size of the amplified product compared to the normal genotype. Point mutations are identified by hybridizing amplified DNA to radiolabeled RNA encoding a PRO polypeptide or to a radiolabeled antisense DNA sequence encoding a PRO polypeptide. be able to. Perfectly matched sequences can be distinguished from incompatible duplexes by differences in RNase A digestion or dissolution temperatures.
Genetic testing based on DNA sequence differences is accomplished by detecting changes in electrophoretic mobility of DNA fragments in the gel, with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. Different sequence DNA fragments are distinguished in a denaturing formamidine gradient gel, and the migration of the different DNA fragments is inhibited at different locations on the gel by specific lysis or partial lysis temperatures. For example, Myers et al., Science, 230: 1242 (1985).
Also, sequence changes at specific positions are revealed by nuclease protection assays such as RNase and SI protection, or chemical cleavage methods such as Cotton et al., Proc. Natl. Acad. Sci. USA, 85: 4397-4401 (1985). become.
Thus, deletion of specific DNA sequences may include hybridization, RNase protection, chemical cleavage, direct DNA sequencing, or use of restriction enzymes such as restriction fragment length polymorphism (RFLP), and Southern blots of genomic DNA, etc. It can be achieved by the method.

5.2.4.7. Applications for PRO polypeptide level detection In addition to more convenient gel electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.
Expression of a nucleic acid encoding a PRO polypeptide is linked to a vascular disease associated with tumorigenesis or neovascularization. If the PRO polypeptide has a signal sequence, mRNA is less expressed in smooth muscle cells but highly expressed in endothelial cells, indicating that the PRO polypeptide is present in the serum. Is shown. Therefore, anti-PRO polypeptide antibodies are used in the diagnosis of such diseases, as this change in the level of PRO polypeptide is indicative of vascular disease or neovascularization associated with tumorigenesis. can do.
It is also possible to use a competitive assay in which an antibody specific for a PRO polypeptide is mounted on a solid support and the labeled PRO polypeptide and a sample derived from the host are passed through the solid support. The amount of level detected is correlated with the amount of PRO polypeptide in the sample.

5.2.4.8. Chromosome mapping The sequences of the present invention are also important in chromosome identification. The sequence is specifically targeted and can be hybridized to a specific location on an individual's human chromosome. In addition, there is a current need for identifying specific sites on the chromosome. Several chromosomal marking reagents based on actual sequence data (repetitive polymorphisms) are currently available for marking chromosomal locations. Chromosomal DNA mapping of the present invention is an important first step to correlate sequences with genes associated with disease.
Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 base pairs) from cDNA. Using computer analysis of the 3′-untranslated region, primers that are not spanned more than one exon of genomic DNA are quickly selected, thus making the amplification process more complex. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will produce an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure for assigning specific DNA to specific chromosomes. When similar oligonucleotide primers are used in the present invention, sub-localization can be achieved in a similar manner on a large pool of genomic clones or a panel of fragments from a particular chromosome. Similarly, other mapping methods that can be used to map the chromosome include in situ hybridization, pre-screening with labeled flow-sorted chromosomes, and pre-selection by hybridization to assemble a chromosome-specific cDNA library. Is included.
Fluorescence in situ hybridization (FISH) of cDNA clones to metaphase chromosome expansion can be used to provide the exact chromosomal location in one step. Although this technique can be used with cDNA as short as 500 or 600 bases; clones longer than 2000 base pairs are likely to bind to unique chromosomal locations with sufficient signal strength for simple detection Is expensive. FISH requires the use of a clone that induces the gene encoding the PRO polypeptide, the longer the better. For example, 2000 base pairs are good, 4000 base pairs are more preferred, and exceeding 4000 is probably not necessary to get good results in a reasonable percentage of time. For a review of this technology, see Verma et al., Human Chromosomes; a Manual of Basic Techniques (Pergamon Press, New York. 1988).
Once a sequence is mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data is found, for example, in V. McKusick, Mendelian Inheritance in Man (Johns Hopkins University Welch Medical Library). Next, the relationship between genes mapped to the same chromosomal region and the disease is identified by linkage assay (joint inheritance of physically adjacent genes).
Next, it is necessary to measure the differences in the cDNA or genomic sequence between individuals with or without the disease. If the mutation is afflicted and found in several or all individuals, and not found in normal individuals, the mutation is likely responsible for the disease.
According to the current resolution of physical mapping and gene mapping techniques, a cDNA located exactly in a disease-related chromosomal region is one of 50 and 500 potential causative genes (this is 1 megabase Is assumed to be 1 gene per 20 kb).

5.2.4.9. Candidate Drug Screening Assays The invention also encompasses methods of screening compounds to identify those that are similar to PRO polypeptides (agonists) or that inhibit the effects of PRO polypeptides (antagonists). A screening assay for an antagonist candidate drug is a compound that binds or forms a complex with the PRO polypeptide encoded by the gene identified herein, or a compound that inhibits the interaction between the encoded polypeptide and other cellular proteins. Designed to identify Such screening assays include those applicable to high-throughput screening of chemical libraries that make it particularly suitable for the identification of small molecule drug candidates.
This assay is performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays, and cell-based assays, known in the art.
All assays for antagonists require that they contact the candidate drug with the PRO polypeptide encoded by the nucleic acid identified here under conditions and for a time sufficient for these two components to interact. Is common.
In binding assays, the interaction is binding and the complex formed is isolated or detected in the reaction mixture. In a particular embodiment, the PRO polypeptide or candidate drug encoded by the gene identified herein is immobilized to a solid phase, such as a microtiter plate, by covalent or non-covalent bonding. Non-covalent binding is generally achieved by coating a solid surface with a solution of PRO polypeptide and drying. Alternatively, an immobilized antibody specific for the immobilized PRO polypeptide, such as a monoclonal antibody, can be used to anchor it to a solid surface. The assay is performed by adding a non-immobilized component, which may be labeled with a detectable label, to a coated surface containing an immobilized component, such as an anchoring component. When the reaction is completed, unreacted components are removed, for example, by washing, and the complex adhered to the solid surface is detected. If the first non-immobilized component has a detectable label, detection of the label immobilized on the surface indicates that complex formation has occurred. If the initial non-immobilized component does not have a label, complex formation can be detected, for example, by a labeled antibody that specifically binds to the immobilized complex.

If a candidate compound interacts but does not bind to a specific PRO polypeptide encoded by the gene identified herein, the interaction with that polypeptide is a well-known method for detecting protein-protein interactions. Can be assayed. Such assays include traditional techniques such as cross-linking, co-immunoprecipitation, and co-purification through a gradient or chromatographic column. In addition, protein-protein interactions can be performed as described in Chevray and Nathans, Proc. Natl. Acad. Sci. USA 89, 5789-5793 (1991) (Fields and co-workers [Fields and Song et al. , Nature (London) 340, 245-246 (1989); Chien et al., Proc. Natl. Acad. Sci. USA 88, 9578-9582 (1991)). can do. Many transcriptional activators, such as yeast GAL4, consist of two physically distinct modular domains, one that acts as a DNA binding domain and the other that functions as a transcriptional activation domain. The yeast expression system described in the previous literature (commonly referred to as the “2-hybrid system”) takes advantage of this property and uses two hybrid proteins, while the target protein is the DNA binding domain of GAL4. On the other hand, the candidate activation protein is fused to the activation domain. Expression of the GAL1-lacZ reporter gene under the control of a GAL4-activated promoter depends on reconstitution of GAL4 activity through protein-protein interactions. Colonies containing interacting polypeptides are detected with a chromogenic substance for β-galactosidase. A complete kit (MATCHMAKER ™) for identifying protein-protein interactions between two specific proteins using the two-hybrid technology is commercially available from Clontech. This system can also be extended to the mapping of protein domains involved in a particular protein interaction as well as the identification of amino acid residues important for this interaction.
Compounds that inhibit the interaction of the gene encoding the PRO polypeptide identified here with intracellular or extracellular components can be tested as follows: Usually the reaction mixture is the gene product and extracellular or intracellular. The ingredients are prepared to include the conditions and time that the two products interact and bind. In order to test the ability of a candidate compound to inhibit binding, the reaction is performed in the absence and presence of the test compound. In addition, a placebo may be added to the third reaction mixture to provide a positive control. Binding (complex formation) between the test compound present in the mixture and the intracellular or extracellular component is monitored as described above. Formation of the complex in the control reaction but not the reaction mixture containing the test compound indicates that the test compound inhibits the interaction between the test compound and its binding partner.

If the PRO polypeptide has the ability to stimulate endothelial cell proliferation in the presence of the concomitant mitogen ConA, an example of a screening method takes advantage of this ability. In particular, in proliferation assays, human umbilical vein endothelial cells are obtained and cultured in 96-well flat bottom culture dishes (Costar, Cambridge, MA), supplemented with a suitable reaction mixture to facilitate cell growth, Con-A (Calbiochem, La Jolla, CA). After adding Con-A and the compound to be screened and incubating at 37 ° C., the culture is labeled with ^3- H thymidine and collected on glass fiber filters (phD; Cambridge Technology, Watertown, Mass.). Average ^3- H thymidine incorporation (cpm) of triplicate cultures is measured using a liquid scintillation instrument (Beckman Instruments. Irvine. CA). Significant ^3- (H) thymidine contamination was shown in endothelial cell stimulation.
To assay for antagonists, the above-described assay is performed, in which the PRO polypeptide may be added with the compound to be screened and the compound inhibits ^3- (H) thymidine incorporation in the presence of the PRO polypeptide. This ability indicates that the compound is an antagonist of the PRO polypeptide. Alternatively, antagonists may be detected by binding potential antagonists with PRO polypeptides and membrane-bound PRO polypeptide receptors or recombinant receptors under conditions suitable for competitive inhibition assays. PRO polypeptides can be labeled, such as with radioactivity, and the number of PRO polypeptide molecules bound to the receptor can be used to determine the effectiveness of a potential antagonist. The gene encoding the receptor can be identified by a number of methods known to those skilled in the art, such as ligand panning and FACS sorting. Coligan et al., Current Protocols in Immun., 1 (2): Chapter 5 (1991). Preferably, expression cloning is used, polyadenylated RNA is prepared from cells reactive to the PRO polypeptide, and a cDNA library generated from this RNA is partitioned into pools and COS cells or other non-PRO polypeptide reactive Used for transfection of cells. Transfected cells grown on glass slides are exposed to labeled PRO polypeptide. PRO polypeptides can be labeled by a variety of means including iodination or inclusion of a recognition site for a site-specific protein kinase. After fixation and incubation, the slides are subjected to autoradiographic analysis. Positive pools are identified, and subpools are prepared and retransfected using an interactive subpooling and rescreening process, resulting in the generation of a single clone encoding the putative receptor.

As an alternative receptor identification approach, the labeled PRO polypeptide can be photoaffinity bound to a cell membrane or extract preparation that expresses the receptor molecule. The cross-linked material is dissolved in PAGE and exposed to X-ray film. The labeled complex containing the receptor can be excited, separated into peptide fragments, and subjected to protein microsequencing. The amino acid sequence obtained from the microsequence is used to design a set of degradable oligonucleotide probes that screen a cDNA library that identifies the gene encoding the putative receptor.
In other assays for antagonists, mammalian cells or membrane preparations expressing the receptor are incubated with labeled PRO polypeptide in the presence of the candidate compound. The ability of the compound to promote or block this interaction is then measured.
Compositions useful for the treatment of cardiovascular, endothelial and angiogenic diseases include, but are not limited to, antibodies, small organic and inorganic molecules, peptides, phosphopeptides that inhibit the activity and / or expression of target gene products, Antisense and ribozyme molecules, triple helix molecules are included.
More specific examples of potential antagonists include oligonucleotides that bind to fusions of immunoglobulins and PRO polypeptides, particularly but not limited to poly- and monoclonal antibodies and antibody fragments, single chain antibodies, anti-idio Type antibodies, and chimeric or humanized forms of these antibodies or fragments, as well as antibodies, including human antibodies and antibody fragments. Alternatively, a potential antagonist may be a closely related protein, eg, a mutant form of a PRO polypeptide that recognizes but does not affect the receptor, thereby competitively inhibiting the action of the PRO polypeptide.
Other potential PRO polypeptide antagonists are antisense RNA or DNA constructs prepared using antisense technology, e.g., antisense RNA or DNA molecules are hybridized to target mRNA for protein translation. It acts to directly block the translation of mRNA by interfering. Antisense technology can be used to control gene expression through triple helix formation or antisense DNA or RNA, both of which are based on the binding of polynucleotides to DNA or RNA. For example, the 5 ′ coding portion of the polynucleotide sequence encoding the mature PRO polypeptide herein is used in the design of antisense RNA oligonucleotides of about 10 to 40 base pairs in length. DNA oligonucleotides are designed to be complementary to regions of the gene involved in transcription (Triple Helix-Lee et al., Nucl, Acids Res., 6: 3073 (1979); Cooney et al., Science, 241: 456 (1988); Dervan et al., Science, 251: 1360 (1991)), thereby preventing transcription and production of PRO polypeptides. As described herein, a sequence that is “complementary” to a portion of RNA means that it has a complementarity capable of hybridizing to RNA and forms a stable duplex; In the case of sense nucleic acids, a single strand of double stranded DNA is tested and triplex helix formation is assayed. The ability to hybridize will depend on the degree of complementarity and the length of the antisense nucleic acid. In general, the longer the nucleic acid that hybridizes, the more base mismatches with RNA will be included, further forming a stable duplex (or triplex in some cases). One skilled in the art can assess the possible temperatures by using standard techniques to determine the melting temperature of the hybridized complex. Antisense RNA oligonucleotides hybridize to mRNA in vivo to block translation of mRNA molecules into PRO polypeptides (Antisense-Okano, Neurochem., 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression ( CRC Press: Boca Raton, FL, 1988)).

Antisense oligonucleotides may be DNA or RNA or chimeric mixtures or derivatives or modified types, single stranded or double stranded thereof. Oligonucleotides may be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of molecules, hybridization, and the like. Oligonucleotides can be peptides (eg, to target host cell receptors in vivo) or cell membranes (eg, Letsinger et al., 1989, Proc. Natl. Acad. Sci. USA 86: 6553-6556; Lemaitre et al. , 1987, Proc. Natl. Acad. Sci. USA 84: 648-652; see PCT publication, WO 88/09810, issued December 15, 1988) or blood vessel-brain barrier (eg, PCT publication, WO 89 / 10134, published 25 April 1988) agents that facilitate transport, hybridization-triggered cleavage agents (see eg Krol et al., 1988, BioTechniques 6: 958-976) or intercalating agents (Zon, 1988, Pharm. Res. 5: 539-549) and other additional populations may be included. For this purpose, the oligonucleotide may be coupled to other molecules, such as peptides, hybridization-triggered crosslinkers, transport agents, hybridization-triggered cleaving agents, and the like.
Antisense oligonucleotides include, but are not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5 -Carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosilk eosin, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2 -Dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D Mannosilk eosin, 5′-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (V), wivetoxosin, pseudouracil, queosin, 2-thiocytosine, 5- Methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (V), 5-methyl-2-thiouracil, 3- (3 It may comprise at least one modified base moiety selected from the group comprising -amino-3-N-2-carboxypropyl) uracil, (acp3) w, and 2,6-diaminopurine.
Antisense oligonucleotides may also include at least one modified sugar moiety selected from the group comprising, but not limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose.
In still other embodiments, the antisense oligonucleotide consists of phosphorothioate, phosphorodithioate, phosphoramidothioate, phosphoramidate, phosphordiamidate, methylphosphonate, alkylphosphotriester and formacetal or analogs thereof. Comprising at least one modified phosphate backbone selected from the population.
In yet another embodiment, the antisense oligonucleotide is a _-anomeric oligonucleotide. _-Anomeric oligonucleotides form specific double-stranded hybrids with complementary RNA, but the strands are parallel to each other as opposed to normal _-units (Gautier et al., 1987, Nucl. Acids Res. 15: 6625-6641). Oligonucleotides are 2'-O-methyl ribonucleotides (Inoue et al., 1987, Nucl. Acids Res. 15: 6131-6148) or chimeric RNA-DNA analogs (Inoue et al., 1987, Febs Lett. 215: 327 -330).
Oligonucleotides of the invention may be synthesized by standard methods known in the art, for example, using an automated DNA synthesizer (such as that available from Biosearch, Applied Biosystems, etc.). For example, phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (1988, Nucl. Acids Res. 16: 3209), and methylphosphonate oligonucleotides are prepared using tuned pore glass polymer supports and the like. (Sarin et al., 1988, Proc. Natl. Acad. Sci. USA 85: 7448-7451).
The above oligonucleotides can also be transported into the cell to express antisense RNA or DNA in vivo to inhibit the production of PRO polypeptides. When antisense DNA is used, oligodeoxyribonucleotides derived from the translation initiation site, eg, between about -10 and +10 positions of the target gene nucleotide sequence, are preferred.

Antisense RNA or DNA molecules generally have a length of at least about 5 bases, about 10 bases, about 15 bases, about 20 bases, about 25 bases, about 30 bases, about 35 bases, about 40 bases. Long, about 45 bases, about 50 bases, about 55 bases, about 60 bases, about 65 bases, about 70 bases, about 75 bases, about 80 bases, about 85 bases, about 90 bases Long, about 95 bases long, about 100 bases long or longer.
Potential antagonists include small molecules that bind to the active site, receptor binding site, or growth factor or other relevant binding site of a PRO polypeptide, thereby blocking the normal biological activity of the PRO polypeptide. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules, preferably soluble peptides, and synthetic non-peptide organic or inorganic compounds.
A further potential antagonist is a ribozyme, which is an enzymatic RNA molecule that can catalyze the specific cleavage of RNA. Ribozymes act by sequence-specific hybridization to complementary target RNA, followed by nucleotide strand breaks. Specific ribozyme cleavage sites within a potential RNA target can be identified by known techniques. For further details, see, for example, Rossi, Current Biology 4: 469-471 (1994) and PCT Publication No. WO 97/33551 (issued September 18, 1997).
Ribozymes that cleave mRNA at specific recognition sites can be used to destroy target gene mRNAs, but the use of hammerhead ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at positions determined by flanking regions that form complementary base pairs with the target mRNA. The only condition is that the target mRNA has the following two base sequence: 5′-UG-3 ′. The construction and production of hammerhead ribozymes is well known in the art and is incorporated herein by reference in its entirety, Myers, 1995, Molecular Biology and Biotechnology: A Comprehensive Desk Reference, VCH Publishers, New York, ( (See, in particular, FIG. 4 on page 833) in more detail in Haseloff and Gerlach, 1988, Nature, 334: 585-591.
Preferably, the ribozyme is engineered so that the cleavage recognition site is located near the 5 ′ end of the target gene mRNA, ie, to increase efficiency and minimize intracellular accumulation of non-functional mRNA transcription.
Also, the ribozymes of the present invention are naturally produced in Tetrahymena thermophila (known as IVS or L-19 IVSRNA), and Thomas Cech and collaborators (Zaug et al., 1984, Science, 224: 574-578; Zaug and Cech, 1986, Science, 231: 470-475; Zaug et al., 1986, Nature, 324: 429-433; published international patent application number WO 88/04300 by University Patents Inc .; Been and Cech, 1986, Cell, 47: 207-216), and RNA endoribonucleases (described below as “Cech-type ribozymes”) which have been extensively described. Cech-type ribozymes have an active site of 8 base pairs that causes cleavage of the target RNA after hybridization with the target RNA sequence. The present invention encompasses these Cech-type ribozymes that target an active sequence of 8 base pairs present in the target gene.
In an antisense approach, ribozymes are composed of modified oligonucleotides (eg, for improved stability, targeting, etc.) and delivered to cells that express the target gene in vivo. A preferred method of delivery is a potent and constitutive pol III or pol II so that the transfected cells produce sufficient amounts of ribozyme to destroy endogenous target gene messages and inhibit translation. Using a DNA construct encoding a ribozyme under the control of a promoter. Unlike antisense molecules, ribozymes are enzymatic, so low intracellular concentrations are required for efficiency.
Nucleic acid molecules in triple helix formation used for transcription inhibition are single-stranded and composed of deoxynucleotides. The basic composition of these oligonucleotides is designed to promote triple helix formation via Hoogstin base pairing rules, which generally requires a resizable extension of purines or pyrimidines on one strand of the duplex . For further details see, for example, the above-mentioned PCT publication, number WO 97/33551.
These small molecules can be identified by any one or more of the screening assays discussed above and / or by any other screening technique well known to those skilled in the art.

5.2.4.10. Types of Cardiovascular, Endothelial and Angiogenic Diseases to be Treated are found active in the cardiovascular, endothelial and angiogenic assays described herein and / or their gene products are located in the cardiovascular system PRO polypeptides or agonists or antagonists thereof that are believed to have therapeutic use in a variety of cardiovascular, endothelial and angiogenic diseases, including systemic diseases that affect blood vessels such as diabetes mellitus. Their therapeutic effectiveness may include arterial, capillary, venous, and / or lymphatic disease. The following treatment examples include muscle wasting disease treatment, osteoporosis treatment, transplant fixation assistance to stimulate peri-transplant cell growth, thus facilitating its binding to the intended site, IGF stability in tissue or serum Increased, if appropriate, increased binding to the IGF receptor (since it has been shown in vitro that IGF enhances the growth of human bone marrow erythrocytes and granulocyte progenitor cells).
Also, PRO polypeptides or agonists or antagonists thereof stimulate erythropoiesis or granulocyte formation, stimulate wound healing and tissue regeneration, such as tissue, eg connective tissue, skin, bone, cartilage, muscle, lung or kidney Can be used to stimulate or inhibit endothelial cell migration and increase vascular smooth muscle proliferation and endothelial cell production. Increased angiogenesis mediated by PRO polypeptides or antagonists is beneficial for ischemic tissue, side branch coronary arteries of the heart, followed by coronary stenosis. Antagonists inhibit the action of such polypeptides, for example to limit the production of excessive connective tissue during wound healing or embryonic fibrosis if the PRO polypeptide promotes such production. Used for. This includes acute myocardial infarction and heart failure.
Furthermore, the present invention relates to the treatment of cardiac hypertrophy by administering a therapeutically effective amount of a PRO polypeptide, or agonist or antagonist thereof, regardless of the cause. Where the goal is to treat a human patient, the PRO polypeptide is preferably a recombinant human PRO polypeptide (rhPRO polypeptide). Treatment of cardiac hypertrophy can be performed at any of its various stages in the outcome of a wide variety of medical conditions, including myocardial infarction, hypertension, hypertrophic cardiomyopathy, and heart valve regurgitation. Treatment can be extended to all stages of the progression of cardiac hypertrophy, with or without structural damage to the myocardium, regardless of the underlying heart disease.
When opposed to an antagonist of a molecule, the decision whether to use the molecule itself or an agonist thereof for a particular indication is primarily that the molecule promotes neovascularization, endothelial cell development, or angiogenesis, Or it depends on whether to inhibit these pathologies. For example, if the molecule promotes angiogenesis, the antagonist is useful in the treatment of diseases where it is desired to limit or prevent angiogenesis. Examples of such diseases include vascular tumors such as hemangiomas, tumor angiogenesis, retinal neovascularization, diabetic retinopathy or premature infantile retinopathy or macular degeneration and proliferative vitreoretinopathy Choroid, rheumatoid arthritis, Crohn's disease, atherosclerosis, ovarian hyperstimulation, psoriasis, endometriosis associated with neovascularization, balloon angiogenesis followed by restenosis, scar tissue overproduction, eg after surgery Such as keloids formed, fibrosis after myocardial infarction, or fibrotic disorders associated with embryonic fibrosis.
However, if the molecule inhibits angiogenesis, it is expected to be used directly in the treatment of the above mentioned pathologies.

On the other hand, if the molecule stimulates angiogenesis, the angiogenesis desired per se, eg peripheral vascular disease, hypertension, vasculitis, Lehno's disease and Lehno phenomenon, aneurysm and arterial restenosis, thrombophlebitis , Lymphangitis, lymphedema, wound healing and tissue repair, ischemia reperfusion injury, angina, myocardial infarction, eg acute myocardial infarction, chronic heart disease, heart failure, eg congestive heart failure, osteoporosis and the like.
However, if the molecule inhibits angiogenesis, the agonist or antagonist is used to treat a condition where angiogenesis is desired.
Certain types of diseases are described below, where a PRO polypeptide or antagonist thereof is provided as a therapeutic target for the prevention or treatment of a disease or useful as a targeted vascular release agent. Atherosclerosis is a disease characterized by the accumulation of plaque in the intima of the thickened artery, due to fluid accumulation, smooth muscle cell proliferation, and the formation of fibrous tissue in the arterial wall. is there. The disease attacks the large, medium and small arteries in any organ. Changes in endothelial and vascular smooth muscle cell function are known to play an important role in regulating the accumulation and relaxation of these plaques.
Hypertension is characterized by an increase in blood pressure in the systemic artery, pulmonary artery, or portal system. Elevated blood pressure results in or due to defective endothelial function and / or vascular disease.
Vasculitis includes giant cell arteritis, Takayas arteritis, multiple arterial nodosa (including microangiopathy forms), Kawasaki disease, micropolyangiitis, Wegener's granulomatosis, various infection-related vascular diseases ( Henoch-Schonlein prupura). Altered endothelial cell function has been shown to be important in these diseases.
Lehno disease and the Lehno phenomenon are characterized by intermittent abnormalities of circulation through limbs exposed to cold. Altered endothelial cell function has been shown to be important in these diseases.
Aneurysms are arterial or venous dendritic sac-like or fusiform dilatations associated with altered endothelial cells and / or vascular smooth muscle cells.
Arterial restenosis (arterial wall restenosis) is the result of changes in endothelial and vascular smooth muscle cell proliferation and function, followed by angiogenesis.
Thrombophlebitis and lymphangitis are inflammatory diseases of the vein and lymphatic vessels that result in and / or result from altered endothelial cell function, respectively. Similarly, lymphedema is a pathology associated with lymphatic vessel defects from endothelial cell function.
The family of benign and malignant vascular tumors is characterized by abnormal proliferation and growth of cellular elements of the vasculature. For example, lymphangioma is a congenital, often benign tumor of the lymphatic system of the bladder, usually a malformation of the lymph that occurs in newborns. Bladder tumors tend to grow in adjacent tissues. Bladder tumors usually occur in the cervix and in the heel region. They also occur in the soft tissues of the limbs. The main symptom is swelling, and occasionally reticularly structured lymphocytes and lymphocysts are surrounded by connective tissue. It has been postulated that lymphangioma results from improper binding to fetal lymphatic vessels or their deletion. The result is locally damaging lymph drainage. Griener et al., Lymphology, 4: 140-144 (1971).

Another use of PRO polypeptides or agonists or antagonists thereof here is in tumor angiogenesis that is involved in angiogenesis of tumors that can grow and / or metastasize. This process depends on the growth of new blood vessels. Examples of neoplasia and related pathologies related to tumor angiogenesis include breast cancer, lung carcinoma, gastric carcinoma, esophageal carcinoma, colorectal carcinoma, liver carcinoma, ovarian carcinoma, tecoma, male embryo, cervical carcinoma, uterus Endometrial carcinoma, endometrial hyperplasia, endometriosis, fibrosarcoma, choriocarcinoma, head and neck cancer, nasopharyngeal carcinoma, laryngeal carcinoma, hepatoblastoma, Kaposi's sarcoma, melanoma, skin carcinoma, blood vessel Tumor, marine hemangioma, hemangioblastoma, pancreatic carcinoma, retinal carcinoma, astrocytoma, glioblastoma, Schwann cell tumor, oligodendroglioma, medulloblastoma, neuroblastoma, rhabdomyosarcoma, bone Primitive sarcoma, leiomyosarcoma, urosarcoma, thyroid carcinoma, Wilms tumor, renal cell carcinoma, prostate carcinoma, abnormal vascular growth associated with phakomatoses, edema (eg, associated with brain tumor), and Meigs syndrome .
Age-related macular degeneration (AMD) is the cause of severe visual loss in the elderly population. The exudative form of AMD is characterized by choroidal neovascularization and retinal pigment endothelial cell detachment. Since choroidal neovascularization is associated with dynamic prognosis, PRO polypeptides or their agonists or antagonists are expected to be useful in reducing severe AMD.
Also, wound healing, such as wound healing and tissue repair, is the intended use of the PRO polypeptides or their agonists or antagonists herein. The formation and relaxation of new blood vessels is essentially tissue healing and repair. This category includes bone, cartilage, tendon, ligament, and / or nerve tissue growth or regeneration, as well as wound healing and tissue regeneration and replacement, and burn, amputation, and ulcer treatment. PRO polypeptides or agonists or antagonists thereof that induce cartilage and / or bone growth in an environment where bone does not form normally are applied in the treatment of fractures and cartilage damage, or defects in humans and other animals. Such preparations using PRO polypeptides or agonists or antagonists thereof are used prophylactically in reducing fractures and improving prosthetic joint fixation. New bone formation induced by osteogenic agents contributes to the repair of congenital, traumatic, or oncological, resection-induced cranial defects and is also useful in cosmetic plastic surgery.
Furthermore, PRO polypeptides or agonists or antagonists thereof are better and faster to treat unhealed wounds including, but not limited to, pressure ulcers, ulcers associated with vascular failure, surgical or traumatic wounds, etc. Useful for promoting occlusion.
Still further, the PRO polypeptide or agonist or antagonist thereof may be present in other tissues such as organs (including pancreas, liver, intestine, kidney, skin or endothelium), muscles (smooth muscle, skeletal muscle or myocardium), and blood vessels. It may show the activity of generating or regenerating tissues (including vascular endothelium) or promoting cell growth containing such tissues. Part of the desired effect is to inhibit or regulate fibrotic scarring and regenerate normal tissue.

The PRO polypeptides or agonists or antagonists thereof herein are also useful for pathologies from systemic cytokine damage, and wound reperfusion in various tissues, treatment of lung or liver fibrosis, and regeneration or protection. PRO polypeptides or agonists or antagonists thereof are also useful for promoting or inhibiting the differentiation of the aforementioned tissue from pioneer tissue or cells, or inhibiting the growth of the aforementioned tissue.
Furthermore, PRO polypeptides or agonists or antagonists thereof can be used in the treatment of periodontal disease and other dental restoration processes. Such agents are provided in an environment that attracts osteogenic cells, stimulates osteogenic cell growth, or induces differentiation of osteogenic cell progenitors. The PRO polypeptide or agonist or antagonist thereof here stimulates osteoporosis or osteoarthritis, for example bone and / or cartilage repair, since blood vessels play an important role in the regulation of bone rotation and growth, Alternatively, it is useful for treatment by blocking the process or inflammation of tissue destruction (collagenase activity, osteoclasts, etc.) mediated by the inflammatory process.
Another category of tissue regeneration activity that is referred to herein as PRO polypeptides or agonists or antagonists thereof is tendon / ligament formation. Proteins that induce tendon / ligament-like tissue or other tissue formation in environments where tissue is not normally formed are applied to healing tendons or ligament tears, malformations, and tendon or ligament defects in humans and other animals The Such preparations are used prophylactically in preventing damage to tendon or ligament tissue and improving fixation of tendon or ligament to bone or other tissue, and repairing tendon or ligament tissue defect. New tendon / ligament-like tissue formation induced by a PRO polypeptide or agonist or antagonist composition thereof here contributes to the repair of other defects of the tendon or ligament due to congenital, traumaticity, or other origin It is also useful in cosmetic plastic surgery for tendon or ligament attachment or repair. The composition herein attracts tendon- or ligament-forming cells, stimulates tendon-or ligament-forming cell growth, induces differentiation of tendon- or ligament-forming cell progenitors, or recovers in vivo ex vivo Provided in an environment that induces the growth of tendon / ligament cells or progenitors in a tissue repair effect. The compositions herein are also useful for tendinitis, carpal tunnel syndrome, and other tendon or ligament defects. In addition, the composition includes the same suitable matrix and / or sequestering agent as the carriers well known in the art.

PRO polypeptide or agonist or antagonist thereof is a neuronal proliferation and regeneration of nerve and brain tissue, i.e. central and peripheral nervous system diseases and neurological disorders involved in neuronal cell or neural tissue degeneration, death or trauma, and machinery Useful for the treatment of traumatic or traumatic diseases. In particular, PRO polypeptides or agonists or antagonists thereof are those of peripheral nervous system diseases such as peripheral nerve injury, peripheral and local neurological disorders, and central nervous system diseases such as Alzheimer's disease, Parkinson's disease, Huntington's disease, muscle Used in the treatment of amyotrophic lateral sclerosis and Shy-Drager syndrome. Additional medical conditions treated with the present invention include mechanical or traumatic diseases such as spinal cord disease, head trauma and cerebrovascular diseases such as stroke. Peripheral neuropathy resulting from chemotherapy or other medical therapies can also be treated using PRO polypeptides or agonists or antagonists thereto.
Ischemia-reperfusion injury is another sign. Endothelial cell dysfunction is important in both the initiation and regulation of the sequelae of events that are followed by ischemia-reperfusion injury.
Rheumatoid arthritis is a further sign. Targets of inflammatory cells that pass through blood vessel growth and vasculature are important factors in the pathogenesis of rheumatoid and serum negative forms of arthritis.
PRO polypeptides or agonists or antagonists thereof are also administered prophylactically to patients with cardiac hypertrophy to prevent the progression of disease states and to avoid sudden death including the death of asymptomatic patients. Such prophylactic treatment is for cases of large left ventricular heart hypertrophy (maximum wall thickness of 35 mm or more in adults or comparable values in children) or when the hemangioma load in the heart is particularly intense This is especially true in the example.
Furthermore, PRO polypeptides or agonists or antagonists thereof are useful for the treatment of atrial fibrillation, which is expressed in a significant portion of patients diagnosed with hypertrophic cardiomyopathy.
Further signs include angina, myocardial infarction, such as acute myocardial infarction, and heart failure, such as congestive heart failure. Additional non-neoplastic conditions include psoriasis, diabetes, and premature retinopathy, posterior lens fibroproliferation, other proliferative retinopathy including neovascular glaucoma, thyroid hyperplasia (including Graves' disease), cornea and others Tissue transplantation, chronic inflammation, pneumonia, nephrotic syndrome, preeclampsia, ascites, pericardial effusion (eg, related to pericarditis), and pleural effusion.
In view of the above, the PRO polypeptides described herein, or agonists or antagonists thereof, which have been shown to alter or impact endothelial cell function, proliferation and / or morphology, may be many or all of the above mentioned It plays an important role in the causes and pathogenesis of these diseases, and may be provided as a vascular-related agent that targets these diseases, or as a therapeutic target to increase or inhibit these processes.

5.2.4.11. Administration Protocol, Schedule, Dosage and Formulation The molecules described herein and their agonists and antagonists are pharmaceutically useful as prophylactic and therapeutic agents for the various diseases and conditions described above.
A therapeutic composition of a PRO polypeptide or agonist or antagonist can produce the desired molecule of appropriate purity with any pharmaceutically acceptable carrier, excipient, or stabilizer (Remington's Pharmaceutical Sciences, 16th edition, Osol , A. Ed. (1980)) and lyophilized preparations or aqueous solutions. Acceptable carriers, excipients, or stabilizers are preferably non-toxic to recipients at the dosages and concentrations used; buffers such as phosphates, citrate flames, and other organic acids; ascorbine Antioxidants including acids and methionine; preservatives (octadecyldimethylbenzylammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol Cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptide; protein such as serum albumin, gelatin, or immunoglobulin; hydrophilic polymer such as polyvinylpyrrolidone; glycine; Amino acids such as rutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose or dextran; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; Salt-forming counterions such as sodium; metal complexes (eg, Zn-protein complexes); and / or nonionic surfactants such as TWEEN ^™ , PLURONICS ^™ or polyethylene glycol (PEG).
Further examples of such carriers are ion exchangers, alumina, aluminum stearate, lecithin, serum proteins such as human serum albumin, buffer substances such as phosphate, glycine, sorbic acid, potassium sorbate, saturated vegetable fatty acids. Partial glyceride mixtures, water, salts, or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose based materials, and Polyethylene glycol. Topical carriers or gel-based forms include polysaccharides such as sodium carboxymethylcellulose or methylcellulose, polyvinylpyrrolidone, polyacrylates, polyoxyethylene-polyoxypropylene block polymers, polyethylene glycols, and mole alcohol. For any administration, conventional depot forms are preferably used. Such forms include, for example, microcapsules, nano-capsules, liposomes, plasters, inhaled forms, nasal sprays, sublingual tablets, and sustained release formulations. The PRO polypeptide or agonist or antagonist is typically formulated in such a medium at a concentration of about 0.1 mg / ml to 100 mg / ml.

Other preparations are included in the formed product by introducing PRO polypeptides or their agonists or antagonists. Such products can be used to regulate endothelial cell growth and angiogenesis. In addition, tumor invasion and metastasis may be modulated with these products.
The PRO polypeptide or agonist or antagonist used for in vivo administration must be sterile. This is easily accomplished by filtration through a sterile filtration membrane before or after lyophilization and reformation. PRO polypeptides are usually stored in lyophilized form or in solution when administered systemically. When in lyophilized form, the PRO polypeptide or agonist or antagonist is typically formulated in combination with other ingredients, including an appropriate diluent at the time of use. An example of a liquid formulation of PRO polypeptide or agonist or antagonist is a sterile, clear, colorless fresh solution, filled into single dose vials for subcutaneous injection. Preservative pharmaceutical compositions suitable for repeated use depend primarily on, for example, the type and instruction of the polypeptide,
a) PRO polypeptides or their agonists or antagonists;
b) a buffer capable of maintaining a pH within a range that maximizes the stability of the polypeptide or other molecule in solution, preferably about 4-8;
c) a detergent / surfactant that stabilizes the polypeptide or molecule primarily against agitation-induced aggregates;
d) isotonic agents;
e) a preservative selected from the group of phenol, benzyl alcohol and benzethonium halides, eg chloride; and f) water;
May be contained.
If the detergent used is nonionic, it can be, for example, a polysorbate (eg POLYSORBATE ^™ (TWEEN ^™ ) 20, 80 etc.), a poloxamer (eg POLOXAMER ^™ 188 etc.). By using nonionic surfactants, the preparation can be subjected to shearing of surface stress without causing denaturation of the polypeptide. In addition, such surfactant-containing preparations can be used in aerosol devices, such as those used for intravenous administration, and needleless jet injection guns (see, eg, EP 257,956).
An isotonic agent is present to ensure that the liquid composition of the PRO polypeptide or agonist or antagonist thereof is isotonic, and is a polyhydric sugar alcohol, preferably a trivalent or higher sugar alcohol such as glycerin, erythritol, arabitol. Xylitol, sorbitol and mannitol. These sugar alcohols can be used alone or in combination. Sodium chloride or other suitable salt may also be used to make the solution isotonic.
The buffer may be an acetate, citrate, succinate or phosphate buffer depending on the desired pH. One pH of the liquid preparation of the present invention is buffered in the range of about 4 to 8, preferably about physiological pH.
Preservatives, phenol, benzyl alcohol and benzethonium halides, such as chloride, are well known antimicrobial agents that can be used.

The therapeutic PRO polypeptide composition is generally placed in a container with a sterile access port, eg, a vial with a stopper pierceable with an intravenous solution bag or hypodermic needle. The formulation is preferably administered as intravenous (iv), subcutaneous (sc), or intramuscular (im) repeated injection, or as an aerosol formulation suitable for intranasal or intrapulmonary delivery (for intrapulmonary delivery, See for example EP 257,956).
The PRO polypeptide can also be administered in the form of a sustained release formulation. Suitable examples of sustained release formulations include a semi-permeable matrix of a solid hydrophobic polymer containing proteins, which matrix is in the form of a molding, for example a film or a microcapsule. Examples of sustained release matrices include polyesters, hydrogels (eg, Langer et al., J. Biomed. Mater. Res., 15: 167-277 (1981) and Langer, Chem. Tech., 12: 98-105 (1982)). Poly (2-hydroxyethyl-methacrylate) or poly (vinyl alcohol)), polyactides (US Pat. No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gammaethyl-L-glutamate (Sidman et al., Biopolymers, 22: 547-556 (1983) ), non-degradable ethylene - consisting glycolic acid copolymer and leuprolide acetate - vinyl acetate (Langer et al., supra), degradable lactic acid - glycolic acid copolymers such as Lupron Depot ^{TM (lactic} Injectable microspheres), and poly-D-(-)-3-hydroxybutyric acid (EP 133,988).
While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid can release molecules for over 100 days, certain hydrogels release proteins for shorter time periods. If the encapsulated protein remains in the body for a long time, it may be denatured or aggregated by exposure to moisture at 37 ° C., resulting in a loss of physiological activity or a change in immunogenicity. Reasonable measures for obtaining stability through such a mechanism are conceivable. For example, if the aggregation mechanism is found to be an intermolecular SS bond by thio-disulfide exchange, the sulfhydryl residue can be changed, lyophilized from an acidic solution, adjusted for water content, used with appropriate additives, and identified The stability can be ensured by developing a polymer matrix compound.
A PRO polypeptide sustained release composition comprises liposome-encapsulated PRO polypeptide. Liposomes containing a PRO polypeptide may be obtained by methods known per se, for example, DE 3,218,121, Epstein et al., Proc. Natl. Acad. Sci. USA, 82: 3688-3692 (1985), Hwang et al., Proc. Natl. Acad. Sci. USA, 77: 4030-4034 (1980), EP 52,322, EP 36,676, EP 88,046, EP 143,949, EP 142,641, Japanese Patent Application No. 58-118008, U.S. Patent Nos. 4,485,045 and 4,544,545, and EP 102,324 It is prepared by the method according to the above. Liposomes typically have a lipid content of about 30 mol% or higher cholesterol and are microlamellar (about 200-800 angstroms) single lamellar with the selected proportion adjusted for the optimal treatment.

A therapeutically effective amount of a PRO polypeptide or agonist or antagonist thereof will, of course, be a pathological condition to be treated (including prophylaxis), a method of administration, a type of compound used in the treatment, any simultaneous included. It depends on factors such as treatment, patient age, weight, general medical condition, medical history, etc., and is well determined within the skill of the physician in charge. Therefore, the therapist needs to titrate the dose and modify the administration route so as to obtain the maximum therapeutic effect. If the PRO polypeptide has a narrow range of hosts, it is preferably a preparation containing human PRO polypeptide, more preferably a native sequence human PRO polypeptide, for the treatment of human patients. The clinician will administer the PRO polypeptide until the dosage has the desired effect in treating the condition. For example, when the objective is treatment of CHF, the amount is an amount that inhibits progressive cardiac hypertrophy associated with this pathology. This treatment and progress is easily monitored by echocardiography. Similarly, patients with hypertrophic cardiomyopathy can be administered PRO polypeptides based on experience.
In the above guidelines, effective dosages are generally in the range of about 0.001 to about 1.0 mg / kg, preferably about 0.01-1.0 mg / kg, most preferably about 0.01-0.1 mg / kg.
For parenteral use in the treatment of adult hypertension, about 0.01 to 50 mg, preferably about 0.05 to 20 mg, most preferably 1 to 20 mg of PRO polypeptide per kg body weight in the form of injections is administered by intravenous injection. It is advantageous to administer 1 to 3 times a day. For oral administration, the PRO polypeptide-based molecule is preferably administered from about 5 mg to 1 g, preferably from about 10 to 100 mg per kg body weight, 1 to 3 times a day. Endotoxin contaminants should be kept at a safe minimum level, eg, less than 0.5 ng / mg protein. Further, for human administration, the preparation is preferably sterile, pyrogenic, generally safe and purified as required by FDA Office and Biologics standards.
The dosage regimen of a pharmaceutical composition containing a PRO polypeptide used for tissue regeneration is subject to various factors that alter the action of the polypeptide, such as the weight of the tissue (e.g., bone) desired to form, the site of injury, the injury. Considering the condition of the affected tissue, the size of the wound, the type of tissue injured (eg, bone), the patient's age, sex, diet, severity of infection, administration time, and other clinical factors , Will be determined by the doctor in charge. The dose may vary depending on the type of matrix used for reconstitution, other protein content of the pharmaceutical composition. For example, the addition of other well known growth factors such as IGF-I to the final composition will further affect the dose. Progress can be monitored by periodically assessing tissue / bone growth and / or repair, eg, by X-ray, histomorphometric determinations and tetracycline labeling.

The route of administration of the PRO polypeptide or antagonist or agonist follows known methods, for example, intravenous, intramuscular, intracerebral, intraperitoneal, intracerebral spinal, subcutaneous, intraocular, intraarticular, intrasynovial, intracapsular, oral By injection or infusion by local or inhalation route, or by the sustained release system described below. PRO polypeptides or their agonists or antagonists are preferably administered intratumorally, around tumors, within lesions, or around lesions, and exert therapeutic effects locally as well as systemically. The intraperitoneal route is expected to be particularly useful, for example, in the treatment of ovarian tumors.
When peptides or small molecules are used as antagonists or agonists, they are preferably administered to mammals orally or parenterally in liquid or solid form.
Examples of pharmacologically acceptable salts of molecules that form salts and are useful in the following include alkali metal salts (eg, sodium salts, potassium salts), alkaline earth metal salts (eg, calcium salts, magnesium salts), ammonium Salts, organic base salts (eg pyridine salt, triethylamine salt), inorganic acid salts (eg hydrochloric acid, sulfate, nitrate) and organic acid salts (eg acetate, oxalate, p-toluenesulfonate).
Methods of treatment in the compositions described herein and useful for bone, cartilage, tendon, or ligament regeneration include administration of the topically, systemically or locally composition as an implant or device. Is included. When administered, useful therapeutic compositions are in a physiologically acceptable form containing no pyrogen. It is further desirable that the composition be injected or encapsulated in a viscous form that is delivered to the site of bone, cartilage or tissue damage. Topical administration is suitable for wound healing and tissue repair. Preferably, for bone and / or cartilage formation, the composition delivers the protein-containing composition to the site of bone and / or cartilage damage, and preferably develops resorbable bone and cartilage into the body. It includes a matrix that can provide a structure. Such matrices are made of materials used for other transplantation medical applications.

The choice of matrix material is based on biocompatibility, biodegradability, mechanical properties, cosmetic appearance, and surface activity. The particular use of the composition is defined by the appropriate formulation. The potential matrix of the composition is biodegradable and may be chemically defined calcium sulfate, tricalcium phosphate, hydroxyapatite, polylactic acid, polyglycolic acid, and polyanhydrides. Other potential matrices are biodegradable and biologically well defined, such as bone or dermal collagen. The further matrix consists of pure protein or extracellular matrix components. Other potential matrices are non-biodegradable and chemically defined, such as sintered hydroxyapatite, bioglass, aluminate, or other ceramics. The matrix may consist of any of the materials described above, such as a combination of polylactic acid and hydroxyapatite or collagen and tricalcium phosphate. The bioceramic may be changed in composition, for example, calcium-aluminate-phosphate, and may be subjected to a process to change pore size, particle size and biodegradation performance.
In one particular embodiment, lactic acid and glycolic acid are 50:50 (molar weight) copolymer and are in the form of porous particles having a diameter in the range of 150 to 800 microns. In some applications, sequestering agents such as carboxymethylcellulose, or autograft clots are utilized to help protect the composition from separation from the matrix.
One suitable family of sequestering agents are cellulosic materials such as methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose and alkylcellulose (including hydroxyalkylcellulose) including carboxymethylcellulose, preferably carboxymethylcellulose. It is a cation salt of (CMC). Other preferred sequestering agents include hyaluronic acid, sodium alginate, poly (ethylene glycol), polyoxyethylene oxide, carboxyvinyl polymer, and poly (vinyl alcohol). The amount of sequestering agent useful here is 0.5-20% by weight, preferably 1-10% by weight, based on the total amount of the preparation, to prevent desorption of the polypeptide (or its antagonist) from the polymer matrix. Providing the composition with appropriate operability, and further preventing the penetration of the progenitor cells into the matrix, thus providing the polypeptide (or its antagonist) an opportunity to promote the osteogenic activity of the progenitor cells. It is a necessary amount.

5.2.4.12. Combination therapy The efficacy of a PRO polypeptide, agonist or antagonist thereof in preventing or treating the disease in question can be combined with other agents effective for these purposes in the same composition or in separate compositions, Or it improves by administering an active agent continuously.
For example, for the treatment of cardiac hypertrophy, PRO polypeptide therapy is a well-known inhibitor of myocardial myocyte hypertrophy factor, such as inhibitors of α-adrenergic agonists such as phenylephrine; endothelin-1 inhibitors such as BOSENTAN ^™ and MOXONODIN ^™ ; Administration of inhibitors for CT-1 (US Pat. No. 5,679,545); inhibitors for LIF; ACE inhibitors; des-aspartate-angiotensin I inhibitors (US Pat. No. 5,773,415) and angiotensin II inhibitors can be combined.
For the treatment of hypertension-related cardiac hypertrophy, a PRO polypeptide is a β-adrenergic receptor blocking agent such as propranolol, timolol, tartarolol, carteolol, nadolol, betaxolol, penbutolol, acetobutrol, atenolol, metoprolol, Or carvedilol; ACE inhibitors such as quinapril, captopril, enalapril, ramipril, benazepril, fosinopril or lisinopril; And / or calcium channel blockers such as diltiazem, nifedipine, verapamil It may be administered in combination with nicardipine. Genetic pharmaceutical compositions containing the therapeutic agents identified here by their generic names are commercially available and are administered according to the manufacturer's instructions for dosage, method of administration, side effects, contraindications, etc. For example, see Physicians'Desk Reference (Medical Economics Data Production Co .: Montvale, NJ, 1997), 51st edition.

Preferred candidates for combination therapy in the treatment of cardiac hypertrophy are β-adrenergic receptor blockers (propranolol, timolol, tartarolol, carteolol, nadolol, betaxolol, penbutolol, acetobutrol, atenolol, metoprolol, or carvedilol), verapamil , Diphedipine, or diltiazem. Treatment of hypertrophy with hypertension includes calcium channel blockers such as diltiazem, nifedipine, verapamil or nicardipine; β-adrenergic receptor blocking agents; And / or dichlorophenamide, acetazolamide, or indapamide; and / or the use of anti-hypertensive drugs using ACE inhibitors such as quinapril, captopril, enalapril, ramipril, benazepril, fosinopril or lisinopril.
For other indications, PRO polypeptides or their agonists or antagonists may be combined with other agents useful for the treatment of bone and / or cartilage defects, wounds or tissues in question. Such agents include various growth factors such as EGF, PDGF, TGF-α or TGF-β, IGF, FGF, and CTGF.
In addition, the PRO polypeptides or their agonists or antagonists used in the treatment of cancer are combined with cytotoxic, chemotherapeutic or growth inhibitory agents as identified above. Also for the treatment of cancer, PRO polypeptides or agonists or antagonists thereof are suitably administered continuously or combined with radiological treatment, with or without irradiation or administration of radioactive substances.
The effective amount of therapeutic agent administered in combination with a PRO polypeptide or agonist thereof is at the discretion of the physician or veterinarian. The dosage and its adjustment are made so that the maximum therapeutic effect is achieved for the condition being treated. For example, in the treatment of hypertension, these amounts ideally take into account the use of diuretics or digital, and hypertension or hypotension, kidney damage, and the like. The dose depends on factors such as the particular patient being treated and the type of therapeutic agent used. Typically, the amount used is the same dose as when the therapeutic agent is not administered with the PRO polypeptide.

5.2.4.13. Articles of Manufacture An article of manufacture such as a kit comprising a PRO polypeptide or agonist or antagonist thereof useful for the diagnosis or treatment of the diseases described above comprises at least one container and a label. Suitable containers include, for example, bottles, vials, syringes and test tubes. The container can be formed from a variety of materials such as glass or plastic. The container contains a composition useful for diagnosis or treatment of a condition and may have a sterile access port (eg, the container may be an intravenous bag or vial with a stopper pierceable with a hypodermic needle) ). The active agent in the composition is a PRO polypeptide or an agonist or antagonist thereof. The label on or on the container indicates that the composition is used for diagnosis or treatment of the selected condition. The article of manufacture may further comprise a second container containing a pharmaceutically acceptable buffer, such as phosphate buffered saline, Ringer's solution, and dextrose solution. In addition, other materials desirable from a commercial and user standpoint may be provided, including other buffers, diluents, filters, needles, syringes, and packaging inserts with instructions for use. The manufactured product may also include a second or third container containing the other active agent described above.

5.2.5. Antibodies Some of the many useful candidate drugs of the present invention are antibodies and antibody fragments that produce the genes identified herein, or inhibit the gene products and / or reduce the activity of the gene products.
5.2.5.1. Polyclonal antibodies Methods for preparing polyclonal antibodies are known to those skilled in the art. Polyclonal antibodies in mammals can be generated by one or more injections of, for example, an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and / or adjuvant is injected into the mammal by multiple subcutaneous or intraperitoneal injections. The immunizing agent can comprise a PRO polypeptide or a fusion protein thereof. It is useful to conjugate the immunizing agent to a protein that is known to be immunogenic in the immunized mammal. Examples of such immunogenic proteins include but are not limited to keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Examples of adjuvants that can be used include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl lipid A, synthetic trehalose dicorynomycolate). The immunization protocol will be selected by one skilled in the art without undue experimentation.

5.2.5.2. Monoclonal antibody Alternatively, the anti-PRO antibody may be a monoclonal antibody. Monoclonal antibodies can be prepared using the hybridoma method as described in Kohler and Milstein, Nature, 256: 495 (1975). In hybridoma methods, mice, hamsters or other suitable host animals are typically immunized with an immunizing agent to generate antibodies that specifically bind to the immunizing agent or to generate lymphocytes that can be generated. Trigger. Lymphocytes can also be immunized in vitro.
The immunizing agent typically comprises a subject PRO polypeptide or a fusion protein thereof. Generally, peripheral blood lymphocytes ("PBL") are used when cells derived from humans are desired, or spleen cells or lymph node cells are used when non-human mammalian sources are desired. The lymphocytes are then fused with immortalized cell lines using a suitable fusing agent such as polyethylene glycol to form hybridoma cells. Goding, Monoclonal Antibodies: Principles and Practice, (New York; Academic Press, 1986) pp. 59-103. Immortalized cell lines are usually transformed mammalian cells, in particular myeloma cells from rodents, cows and humans. Usually, rat or mouse myeloma cell lines are used. The hybridoma cells are preferably cultured in a suitable medium containing one or more substances that inhibit the survival or growth of unfused, immortalized cells. For example, if the parent cell lacks the enzyme hypoxanthine guanine phosphoribosyltransferase (HGPRT or HPRT), the hybridoma medium typically contains hypoxanthine, aminopetitin and thymidine (`` HAT medium ''). This substance prevents the growth of HGPRT-deficient cells.
Preferred immortalized cell lines are those that fuse efficiently, support stable high levels of antibody expression by selected antibody-producing cells, and are sensitive to a medium such as HAT medium. A more preferred immortalized cell line is the mouse myeloma line, which is available, for example, from the Salk Institute Cell Distribution Center in San Diego, California and the American Type Culture Collection in Manassas, Virginia. Human myeloma and mouse-human heteromyeloma cell lines for producing human monoclonal antibodies have also been disclosed. Kozbor, J. Immunol., 133: 3001 (1984), Brodeur et al., Monoclonal Antibody Production Techniques and Applications, (Marcel Dekker, Inc., New York, 1987) pp. 51-63.
The culture medium in which the hybridoma cells are cultured is then assayed for the presence of monoclonal antibodies against the PRO polypeptide. Preferably, the binding specificity of monoclonal antibodies produced by hybridoma cells is measured by immunoprecipitation or in vitro binding assays such as radioimmunoassay (RIA) or enzyme-linked immunoassay (ELISA). Such techniques and assays are known in the art. The binding affinity of the monoclonal antibody can be measured, for example, by the Scatchard assay by Munson and Pollard, Anal. Biochem., 107: 220 (1980).

After the desired hybridoma cells are identified, the clones can be subcloned by a limiting dilution step and grown by standard methods. Goding, supra. Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells can be grown as ascites in vivo in a mammal.
Monoclonal antibodies secreted by the subclone can be isolated from the culture medium or ascites fluid by conventional immunoglobulin purification methods such as protein A-Sepharose method, hydroxylapatite chromatography method, gel electrophoresis method, dialysis method or affinity chromatography. Separated or purified.
Monoclonal antibodies can also be made by recombinant DNA methods, such as those described in US Pat. No. 4,816,567. DNA encoding the monoclonal antibody of the present invention can be easily obtained using conventional methods (for example, using an oligonucleotide probe capable of specifically binding to a gene encoding the heavy and light chains of a mouse antibody). Can be isolated and sequenced. The hybridoma cells of the present invention are a preferred source of such DNA. Once isolated, the DNA can be placed in an expression vector that can be transfected into host cells, such as monkey COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not produce immunoglobulin proteins. The monoclonal antibody can be synthesized in a recombinant host cell. DNA can also be replaced, for example, by replacing the coding sequences of human heavy and light chain constant domains in place of homologous mouse sequences (US Pat. No. 4,816,567; Morrison et al., Supra) or nonimmune to immunoglobulin coding sequences. Modification can be made by covalently linking part or all of the globulin polypeptide coding sequence. Such non-immunoglobulin polypeptides can be substituted for the constant domains of the antibodies of the invention, or can be substituted for the variable domains of one antigen binding site of the antibodies of the invention, producing chimeric bivalent antibodies.
The antibody may be a monovalent antibody. Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chains and modified heavy chains. The heavy chain is generally cleaved at any point in the Fc region so as to prevent heavy chain crosslinking. Alternatively, the relevant cysteine residues are substituted or deleted with other amino acid residues to prevent crosslinking.
In vitro methods are also suitable for preparing monovalent antibodies. Generation of fragments, particularly Fab fragments, by antibody digestion can be accomplished using conventional techniques known in the art.

5.2.5.3. Human and humanized antibodies Anti-PRO antibodies further include humanized antibodies or human antibodies. A humanized form of a non-human (e.g. mouse) antibody is a chimeric immunoglobulin, immunoglobulin chain or fragment thereof (e.g. Fv, Fab, Fab ', F (ab') ₂ or other antigen binding subsequence of the antibody). And contains the minimum sequence derived from non-human immunoglobulin. Humanized antibodies are human immunoglobulins in which the CDR residues are replaced by the CDR residues of a non-human species (donor antibody) with the desired specificity, affinity and ability, such as mouse, rat or rabbit. Ent antibody). In some examples, the Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also contain residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, a humanized antibody has at least one, typically all or almost all CDR regions corresponding to those of a non-human immunoglobulin and all or almost all FR regions of a human immunoglobulin consensus sequence, typically Contains substantially all of the two variable domains. A humanized antibody optimally comprises at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., Nature, 332: 323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2: 593-596 (1992).
Methods for humanizing non-human antibodies are well known in the art. In general, humanized antibodies are introduced with one or more amino acid residues originating from a non-human source. These non-human amino acid residues are often referred to as “import” residues, which are typically taken from an “import” variable domain. Humanization is basically performed by replacing the relevant sequence of a human antibody with a rodent CDR or CDR sequence by Winter and colleagues (Jones et al., Nature, 321: 522-525 (1986); Riechmann Et al., Nature, 332: 323-327 (1988); Verhoeyen et al., Science, 239: 1534-1536 (1988)). Thus, such “humanized” antibodies are chimeric antibodies (US Pat. No. 4,816,567) wherein substantially less than an intact human variable domain has been substituted with the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
Human antibodies can also be generated using various methods known in the art, including phage display libraries. Hoogenboom and Winter, J. Mol. Biol., 227: 381 (1991); Marks et al., J. Mol. Biol., 222: 581 (1991). Also, methods such as Cole et al. And Boerner et al. Can be used for the preparation of human monoclonal antibodies. Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss. P. 77 (1985) and Boerner et al., J. Immunol., 147 (1): 86-95 (1991). Similarly, human antibodies can be produced by introducing human immunoglobulin loci into transgenic animals, eg, mice in which the endogenous immunoglobulin genes are partially or completely inactivated. Upon administration, human antibody production is observed that is very similar to that found in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in US Pat. Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016 and the following scientific literature: Marks et al., Bio / Technology 10, 779-783 (1992); Lonberg et al., Nature 368 856-859 (1994); Morrison, Nature 368, 812-813 (1994); Fishwild et al., Nature Biotechnology 14, 845-851 (1996); Neuberger, Nature Biotechnology 14 , 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93 (1995).

5.2.5.4. Bispecific antibodies Bispecific antibodies are monoclonal antibodies, preferably human or humanized antibodies, that have binding specificities for at least two different antigens. In this case, one of the binding specificities is for a PRO polypeptide and the other is for any other antigen, preferably a cell surface protein or receptor or receptor subunit.
Methods for making bispecific antibodies are well known in the art. Traditionally, recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy / light chain pairs, where the two heavy chains have different specificities. Milstein and Cuello, Nature, 305: 537-539 (1983). Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, only one of which has the correct bispecific structure. Purification of the correct molecule is usually accomplished by an affinity chromatography step. Similar procedures are disclosed in WO 93/08829 published May 13, 1993, and Traunecker et al., EMBO J., 10: 3655-36569 (1991).
Antibody variable domains with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant domain sequences. The fusion preferably is with an immunoglobulin heavy chain constant domain, comprising at least part of the hinge, CH2, and CH3 regions. Desirably, at least one fusion has a first heavy chain constant region (CH1) containing the site necessary for light chain binding. The DNA encoding the immunoglobulin heavy chain fusion and, if desired, the immunoglobulin light chain are inserted into separate expression vectors and cotransfected into a suitable host organism. For further details of generating bispecific antibodies see, for example, Suresh et al., Methods in Enzymology, 121: 210 (1986).

5.2.5.5. Heteroconjugate antibody A heteroconjugate antibody consists of two covalently bound antibodies. Such antibodies are used, for example, to target immune system cells to unwanted cells (US Pat. No. 4,676,980) and for the treatment of HIV infection (WO 91/00360; WO 92/200373; EP 03089). Proposed. This antibody could be prepared in vitro using known methods in synthetic protein chemistry, including those related to crosslinkers. For example, immunotoxins can be made using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate and those disclosed, for example, in US Pat. No. 4,676,980.
5.2.5.6. Processing of Effector Function It is desirable to modify the antibody of the present invention for effector function, for example to improve the effectiveness of the antibody in treating cancer. For example, a cysteine residue may be introduced into the Fc region, thereby forming an interchain disulfide bond in this region. Allogeneic dimeric antibodies so produced can have improved internalization ability and / or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). See Caron et al., J. Exp. Med. 176: 1191-1195 (1992) and Shopes, J. Immunol. 148: 2918-2922 (1992). Allogeneic dimeric antibodies with improved anti-tumor activity can also be prepared using heterobifunctional cross-linking as described in Wolff et al., Cancer Research 53: 2560-2565 (1993). Alternatively, the antibody can be engineered to have two Fc regions, thereby improving complement lysis and ADCC capabilities. See Stevenson et al., Anti-Cancer Drug Design 3: 219-230 (1989).

5.2.5.7. Immunoconjugates The invention also provides for chemotherapeutic agents, cytotoxic agents such as toxins (eg, enzymatically active toxins from bacteria, fungi, plants or animals, or fragments thereof), or radioisotopes (ie, radioconjugates). It also relates to an immunoconjugate comprising a conjugated antibody.
Chemotherapeutic agents useful for the generation of such immune complexes have been described above. Enzyme-active toxins and fragments thereof that can be used include diphtheria A chain, non-binding active fragment of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain , Alpha-sarcin, Aleurites fordii protein, dianthin protein, Phytolaca americana protein (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, crusin (curcin), crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin and trichothecene )including. A variety of radioactive nucleotides are available for the production of radioconjugated antibodies. Examples include ²¹² Bi, ¹³¹ I, ¹³¹ In, ⁹⁰ Y and ¹⁸⁶ Re.
Conjugates of antibodies and cytotoxic agents may be selected from a variety of bifunctional protein coupling agents such as N-succinimidyl-3- (2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), imidoester bifunctionality. Derivatives (such as dimethyl adipimidate HCl), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azide compounds (such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium Using derivatives (such as bis- (p-diazoniumbenzoyl) -ethylenediamine), diisocyanates (such as triene 2,6-diisocyanate), and bis-active fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene) Can be created. For example, a ricin immunotoxin can be prepared as described in Vitetta et al., Science 238: 1098 (1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriaminepentaacetic acid (MX-DTPA) is an example of a chelating agent for conjugation of radionucleotide to an antibody. See WO 94/11026.
In other embodiments, the antibody may be conjugated to a “receptor” (such as streptavidin) for use in tumor pre-targeting, and the antibody-receptor complex is administered to the patient, followed by a clarifier. Used to remove unbound complexes from the circulation, followed by administration of a “ligand” (eg, avidin) conjugated to a cytotoxic agent (eg, a radionucleotide, etc.).
5.2.5.8. Immunoliposomes The antibodies disclosed herein may also be prepared as immunoliposomes. Liposomes containing antibodies are described in Epstein et al., Proc. Natl. Acad. Sci. USA, 82: 3688 (1985); Hwang et al., Proc. Natl. Acad. Sci. USA, 77: 4030 (1980); Prepared by methods known in the art, such as described in 4,485,045 and 4,544,545. Liposomes with improved circulation time are disclosed in US Pat. No. 5,013,556.
Particularly useful liposomes are generated by the reverse phase evaporation method with a lipid composition comprising phosphatidylcholine, cholesterol and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through a filter with a predetermined pore size to produce liposomes having a desired diameter. Fab ′ fragments of the antibodies of the invention can be conjugated to liposomes via a disulfide exchange reaction as described in Martin et al., J. Biol. Chem. 257: 286-288 (1982). A chemotherapeutic agent (such as doxorubicin) is optionally contained within the liposome. See Gabizon et al., J. National Cancer Inst. 81 (19) 1484 (1989).

5.2.5.9. Antibody Pharmaceutical Compositions Antibodies that specifically bind to the PRO polypeptides identified herein, as well as other molecules identified in the screening assays disclosed above, are useful for the treatment of various diseases described above and below. Therefore, it can be administered in the form of a pharmaceutical composition.
When the PRO polypeptide is intracellular and the whole antibody is used as an inhibitor, an internalizing antibody is preferred. However, lipofection or liposomes can also be used to introduce antibodies, or antibody fragments, into cells. Where antibody fragments are used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, peptide molecules that retain the ability to bind to a target protein sequence can be designed based on the variable region sequence of the antibody. Such peptides can be synthesized chemically and / or produced by recombinant DNA techniques. See, for example, Marasco et al., Proc. Natl. Acad. Sci. USA 90, 7889-7893 (1993).
The formulations herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. Alternatively or in addition, the composition may comprise a cytotoxic agent, cytokine, chemotherapeutic agent or growth inhibitory agent. These molecules are suitably present in combination in amounts that are effective for the purpose intended.
The active ingredient can also be used in colloidal drug delivery systems (eg , Liposomes, albumin globules, microemulsions, nanoparticles and nanocapsules) or microemulsions. These techniques are disclosed in Remington's Pharmaceutical Sciences, supra.
Formulations used for in vivo administration must be sterile. This is easily accomplished by filtration through sterile filtration membranes.
Sustained release formulations may be prepared. Suitable examples of sustained release formulations include a semi-permeable matrix of solid hydrophobic polymer containing antibodies, which matrix is in the form of a molded article, such as a film or a microcapsule. Examples of sustained-release matrices are polyester hydrogels (eg poly (2-hydroxyethyl-methacrylate) or poly (vinyl alcohol)), polylactide (US Pat. No. 3,773,919), L-glutamic acid and γ-ethyl-L-glutamate Degradable lactic acid-glycolic acid copolymer, such as non-degradable ethylene-vinyl acetate, LUPRON DEPOT (trade name) (injectable globules of lactic acid-glycolic acid copolymer and leuprolide acetate), poly-D-(-) Contains -3-hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid can release molecules for over 100 days, certain hydrogels release proteins in a shorter time. When encapsulated antibodies remain in the body for a long time, they denature or aggregate upon exposure to moisture at 37 ° C, resulting in reduced biological activity and possible changes in immunogenicity. . Reasonable methods can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is found to be intermolecular S—S bond formation through thio-disulfide exchange, stabilization may include modification of sulfhydryl residues, lyophilization from acidic solutions, control of water content, Addition of various additives and the development of specific polymer matrix compositions.

5.2.5.10. Treatment methods using antibodies
It is anticipated that antibodies against PRO polypeptides can be used to treat the various cardiovascular, endothelial and angiogenic diseases described above.
The antibody is administered to mammals, preferably humans, in a well-known manner, such as intravenous administration as a bolus or by continuous infusion over time, intramuscular, intraperitoneal, intracerebral spinal, subcutaneous, interarticular, intrasynovial, It is administered by intrathecal, oral, topical, or inhalation route. Intravenous administration of the antibody is preferred.
Other therapeutic regimens may be combined with, for example, administration of the antibodies of the invention described above. For example, when treating cancer with antibodies, patients treated with such antibodies may receive radiation therapy. Alternatively, or in addition, a chemotherapeutic agent may be administered to the patient. The preparation method and dosage schedule for such chemotherapeutic agents are either used according to the manufacturer's instructions or determined empirically by skilled practitioners. Preparation methods and dose schedules for such chemotherapy are also described in Chemotherapy Service MC Perry, Ed. (Williams & Wilkins, Baltimore, MD, 1992). The chemotherapeutic agent may be administered prior to or subsequent to the administration of the antibody, or may be administered at the same time. The antibodies may be combined with doses known for those molecules of anti-estrogenic compounds such as tamoxifen or EVISTA ^™ or anti-progesterones such as onapristone (see EP 616812).
When antibodies are used for the treatment of cancer, it is also preferable to administer antibodies against other tumor-associated antigens, such as antibodies that bind to one or more ErbB2, EGFR, ErbB3, ErbB4, or VEGF receptors. Moreover, the medicine mentioned above is also included. The antibody is suitably administered sequentially or combined with radiological treatment, with or without irradiation or administration of radioactive material. Alternatively, or in addition, two or more antibodies as disclosed herein that bind to the same or two or more different antigens may be co-administered to the patient. Sometimes it is also advantageous to administer one or more cytokines to the patient. In a preferred embodiment, the antibody herein is co-administered with a growth inhibitory agent. For example, the growth inhibitor is first administered, followed by the antibody of the invention. However, simultaneous administration or administration of the anticancer agent of the present invention first is also conceivable. A suitable dose for a growth inhibitor is the amount currently used, but can be reduced by the combined (synergistic) effect of the growth inhibitor and this antibody.

In one embodiment, tumor angiogenesis is attacked in combination therapy. The anti-PRO polypeptide antibody and other antibodies (eg, anti-VEGF) are administered to a patient having a tumor in a therapeutically effective amount determined, for example, to show necrosis of the tumor or metastatic lesion. This treatment is continued until a favorable effect is observed or there is no trace of the tumor or any metastatic lesion. TNF is then added to an adjuvant such as alpha-, beta- or gamma-interferon, anti-HER2 antibody, heregulin, anti- heregulin antibody, D-factor, interleukin-1 (IL-1), interleukin- 2 (IL-2), granulocyte-macrophage colony stimulating factor (GM-CSF), or microvascular coagulation promoters in tumors such as anti-protein C antibody, anti-protein S antibody, or C4b binding protein (1991 It is administered in combination with WO91 / 01753) published February 21, or with heat or radiation.
Adjuvants vary depending on their effectiveness and should be compared to their impact on tumors by a matrix that is screened in a convenient manner. Administration of the anti-PRO polypeptide antibody and TNF is repeated until the desired clinical effect is achieved. The anti-PRO polypeptide antibody is also administered with TNF, optionally with an adjuvant. In examples where solid tumors are found in limbs or other locations where isolation from the general circulatory organ is possible, the therapeutic agents described herein are administered to the isolated tumor or organ. In other embodiments, an FGF or PDGF antagonist, such as an anti-FGF or anti-PDGF neutralizing agent, is administered to a patient along with an anti-PRO polypeptide antibody. Treatment with anti-PRO polypeptide antibody is preferably discontinued during wound healing or the desired period of neovascularization.
For the prevention or treatment of cardiovascular, endothelial and angiogenic diseases, the appropriate dose of antibody herein is the type of disease to be treated, the severity and course of the disease, prevention or treatment as defined above. Whether the drug is administered for the purpose, previous treatment, patient clinical history and response to antibodies, and at the discretion of the attending physician. The antibody is suitably administered to the patient at one time or over a series of treatments.
For example, depending on the type and severity of the disease, about 1 μg / kg to 50 mg / kg (eg, 0.1-20 mg / kg) of antibody can be administered, for example, in one or more separate doses or continuous infusions. Even the first candidate dose for administration to a patient. A typical daily or weekly dose will be about 1 μg / kg to 100 mg / kg or more, depending on the above factors. For repeated administrations over several days or longer, depending on the condition, the treatment is continued until a desired suppression of disease symptoms appears. However, other dose schedules may be useful. The progress of this therapy is easily monitored by conventional techniques and assays, such as X-ray tumor imaging.

5.2.5.11. Antibody Manufactured Product Also provided is a manufactured product comprising a container containing the antibody and a label. Such articles of manufacture are described above, where the active agent is an anti-PRO antibody.
5.2.5.12. Diagnosis and prognosis of tumors using antibodies When the indication that antibodies are used is cancer, cell surface proteins such as growth receptors that are overexpressed in certain tumors are candidates for drug or tumor (eg, cancer) treatment. Although an excellent target, the same protein as the PRO polypeptide has found further use in tumor diagnosis and prognosis. For example, antibodies directed against PRO polypeptides can be used for tumor diagnosis and prognosis.
For example, an antibody comprising an antibody fragment can be used for qualitative or quantitative detection of expression of a gene including a gene encoding a PRO polypeptide. The antibody is preferably detectable, eg, equipped with a fluorescent label, and binding can be monitored by light microscopy, flow cytometry, fluorometry, or other techniques known in the art. Such binding assays are performed substantially as described above.
In situ detection of antibodies that bind to the marker gene product can be performed, for example, by immunofluorescence or immunoelectron microscopy. For this purpose, a histological sample is removed from the patient and the labeled antibody is applied to it, preferably by covering the biological sample with the antibody. This approach also allows the distribution of the marker gene product in the tissue being tested to be determined. It will be apparent to those skilled in the art that a wide variety of histological methods are readily available for in situ detection.

The following examples are provided for purposes of illustration only and are not intended to limit the scope of the invention in any way.
The entire disclosures of all patents and references cited herein are hereby incorporated by reference.
6). EXAMPLES Commercially available reagents referred to in the examples were used according to manufacturer's instructions unless otherwise indicated. The source of cells identified by the ATCC registration number throughout the following examples and specification is American Type Culture Collection, Manassas, VA. Unless otherwise noted, the present invention used standard techniques of recombinant DNA technology such as those described above and in the following textbooks: Sambrook et al. Supra; Ausubel et al., Current Protocols in Molecular Biology (Green Publishing) Associates and Wiley Interscience, NY, 1989); Innis et al., PCR Protocols: A Guide to Methods and Applications (Academic Press, Inc .; NY, 1990); Harlow et al., Antibodies: A Laboratory Manual (Cold Spring Harbor Press: Cold Spring Harbor 1988); Gait, Oligonucleotide Synthesis (IRL Press, Oxford, 1984); Freshney, Animal Cell Culture, 1987; Coligan et al., Current Protocols in Immunology, 1991.

6.1. Example 1: Extracellular domain homology screening to identify novel polypeptides and cDNAs encoding them
Extracellular domain (ECD) sequences (including secreted signal sequences, if any) from about 950 known secreted proteins from the Swiss-Prot public database were used to search the EST database. EST databases include public databases (eg, GenBank) and corporate databases (eg, LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST-2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)) as a comparison with the 6-frame translation of the EST sequence of the ECD protein sequence. Comparisons that do not encode known proteins and have a BLAST score of 70 (possibly 90) or higher can be grouped with the program “phrap” (Phil Green, University of Washington, Seattle, WA) and consensus DNA sequences Built.
Using this extracellular domain homology screen, consensus DNA sequences were constructed against other identified EST sequences using phrap. In addition, the resulting consensus DNA sequence is often extended using repeated (but not always) BLAST or BLAST-2 and phrap cycles, and the consensus sequence is as long as possible using the sources of EST sequences discussed above. Elongated.
Based on the consensus sequence obtained as described above, oligonucleotides are then synthesized, and a cDNA library containing the sequence of interest is identified by PCR and a clone of the full-length coding sequence of the PRO polypeptide is isolated. Used for use as a probe. Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give PCR products that are about 100-1000 bp long. The probe sequence is typically 40-55 bp long. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5 kbp. To screen several libraries for full-length clones, DNA from the libraries was screened by PCR amplification with PCR primer pairs as in Ausubel et al., Current Protocols in Molecular Biology. The positive library was then used to isolate clones encoding the gene of interest using one of the probe oligonucleotides and primer pairs.
The cDNA library used to isolate the cDNA clones was made by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA is primed with oligo dT containing a NotI site, ligated to a SalI hemikinase adapter with blunt ends, cut with NotI, appropriately sized by gel electrophoresis, and an appropriate cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain an SfiI site; see Holmes et al., Science, 253: 1278-1280 (1991)) and was cloned in a defined orientation at unique XhoI and NotI sites.

6.2. Example 2: Isolation of cDNA clones by amylase screening 6.2.1. Preparation of Oligo dT Primed cDNA Library mRNA was isolated from human tissues of interest using reagents and protocols from Invitrogen, San Diego, CA (Fast Track 2). This RNA was used to generate oligo dT primed cDNA library in vector pRK5D using reagents and protocols from Life Technologies, Gaithersburg, MD (Super Script Plasmid System). In this method, double stranded cDNA was sized over 1000 bp and SalI / NotI binding cDNA was cloned into an XhoI / NotI cut vector. pRK5D was cloned into a vector having an sp6 transcription start site followed by an SfiI restriction enzyme site, followed by an XhoI / NotI cDNA cloning site.
6.2.2. Preparation of random primed cDNA library A secondary cDNA library was created to favorably express the 5 'end of the primary cDNA clone. Sp6RNA is generated from a primary library (above) and this RNA is generated from a random-primed cDNA library using reagents and protocols from Life Technologies (Super Script Plasmid System referenced above) in the vector pSST-AMY.0 Used for. In this method, double stranded cDNA was sized to 500-1000 bp, ligated to a NotI adapter with blunt ends, cut at the SfiI site, and cloned into a SfiI / NotI cut vector. pSST-AMY.0 is a cloning vector having a yeast alcohol dehydrogenase promoter before the cDNA cloning site, and a mouse amylase sequence (a mature sequence without a secretion signal) after the cloning site followed by a yeast alcohol dehydrogenase transcription termination region. That is, cDNA cloned into this vector fused in frame with the amylase sequence will lead to secretion of amylase from appropriately transfected yeast colonies.

6.2.3. Transformation and detection DNA from the library described in the above two paragraphs was chilled on ice, to which electrocompetent DH10B bacteria (Life Technologies, 20 ml) were added. The bacteria and vector mixture was then electroporated as recommended by the manufacturer. SOC medium (Life Technologies, 1 ml) was then added and the mixture was incubated at 37 ° C. for 30 minutes. Transformants were then plated on 20 standard 150 mm LB plates containing ampicillin and incubated for 16 hours (37 ° C.). Positive colonies were picked from the plates and DNA was isolated from bacterial pellets using standard methods such as CsCl-gradient. The purified DNA was then used in the following yeast protocol.
Yeast methods are divided into three categories: (1) transformation with yeast plasmid / cDNA binding vectors; (2) detection and isolation of yeast clones secreting amylase; and (3) direct from yeast colonies. PCR amplification and sequencing of the insert and purification of DNA for further analysis.
The yeast strain used was HD56-5A (ATCC-90785). This strain has the following genotypes: MAT alpha, ura3-52, leu2-3, leu2-112, his3-11, his3-15, MAL ⁺ , SUC ⁺ , GAL ⁺ . Preferably, yeast mutants with incomplete post-translational pathways can be used. Such mutants have transpositional deficient alleles at sec71, sec72, and sec62, with truncated sec71 being most preferred. Alternatively, antagonists (including antisense nucleotides and / or ligands) that inhibit the normal manipulation of these genes, other proteins involved in this post-translational pathway (eg SEC61p, SEC72p, SEC62p, SEC63p, TDJ1p or SSA1p− 4p) or complex formation of these proteins is also preferably used in combination with amylase-expressing yeast.
Transformation was performed based on the protocol outlined in Gietz et al., Nucl. Acid. Res., 20: 1425 (1992). The transformed cells were then seeded from agar into YEPD complex medium broth (100 ml) and grown overnight at 30 ° C. YEPD broth was prepared as described in Kaiser et al., Methods in Yeast Genetics, Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 207 (1994). The overnight medium was then diluted to approximately 2 × 10 ⁶ cells / ml (approximately OD ₆₀₀ = 0.1) in fresh YEPD broth (500 ml) and regrown to 1 × 10 ⁷ cells / ml (approximately OD ₆₀₀ = 0.4-0.5). .

Cells are then harvested, transferred to a GS3 rotor bottle in a Sorval GS3 rotor for 5 minutes at 5,000 rpm, prepared for transformation by discarding the supernatant and then resuspending in sterile water, and in a 50 ml Falcon tube And centrifuged again at 3,500 rpm in a Beckman GS-6KR centrifuge. Discard the supernatant and wash the cells successively with LiAc / TE (10 ml, 10 mM Tris-HCl, 1 mM EDTA pH 7.5, 100 mM Li ₂ OOCCH ₃ ) and resuspend in LiAc / TE (2.5 ml). Made cloudy.
Transformation is accomplished by mixing the prepared cells (100 μl) with fresh denatured single-stranded salmon sperm DNA (Lofstrand Labs, Gaitherburg, MD) and transforming DNA (1 μg. Vol. <10 μl) in a microtube. I woke up. The mixture was mixed briefly by vortexing, then 40% PEG / TE (600 μl, 40% polyethylene glycol-4000, 10 mM Tris-HCl, 1 mM EDTA, 100 mM Li ₂ OOCCH ₃ , pH 7.5) was added. The mixture was gently stirred and incubated for 30 minutes with stirring at 30 ° C. The cells were then heat shocked at 42 ° C. for 15 minutes, and the reaction vessel was centrifuged in a microtube at 12,000 rpm for 5-10 seconds and decanted and TE (500 μl, 10 mM Tris-HCl, 1 mM EDTA pH 7.5). Followed by centrifugation. Cells were then diluted in TE (1 ml) and aliquots (200 μl) were spread on selective media previously prepared in 150 mm growth plates (VWR).
Alternatively, transformation was performed in one large scale reaction rather than multiple small reactions, but the amount of reagent was scaled up accordingly.
The selective media used was synthetic complete dextrose agar lacking uracil prepared as described in Kaiser et al., Methods in Yeast Genetics, Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 208-210 (1994). SCD-Ura). Transformants were grown at 30 ° C. for 2-3 days.
Detection of colonies secreting amylase was performed by inclusion of red starch in the selective growth medium. Starch was coupled to a red dye (reactive Red-120, Sigma) according to the method described in Biely et al., Anal. Biochem., 172: 176-179 (1988). Bound starch was introduced into SCD-Ura agar plates at a final concentration of 0.15% (w / v) and buffered to pH 7.0 with potassium phosphate (final concentration 50-100 mM).
Positive colonies were picked and streaked on fresh selective medium (150 mm plate) to obtain a well-isolated and identifiable single colony. Well isolated colonies positive for amylase secretion were detected by direct introduction of red starch into buffered SCD-Ura agar. Positive colonies were determined by their ability to degrade starch and form visible wrinkles directly around positive colonies.

6.2.4. Isolation of DNA by PCR amplification When a positive colony was isolated, a portion was picked with a toothpick and diluted in sterile water (30 μl) in a 96-well plate. At this point, positive colonies are either frozen and stored for subsequent analysis or are immediately amplified. Aliquots of cells (5 μl), 0.5 μl Klentaq (Clontech, Palo Alto, Calif.); 4.0 μl 10 mM dNTP (Perkin Elmer-Cetus); 2.5 μl Kentaq buffer (Clontech); 0.25 μl forward oligo 1; Used as template for PCR reaction in 25 μl volume containing 0.25 μl reverse oligo 2; 12.5 μl distilled water. The sequence of forward oligonucleotide 1 is:
5'-TGTAAAACGACGGCCAGTTAAATAGACCTGCAATTATTAATCT-3 '
(SEQ ID NO: 382).
The sequence of reverse oligonucleotide 2 is:
5'-CAGGAAACAGCTATGACCACCTGCACACCTGCAAATCCATT-3 '
(SEQ ID NO: 383).
PCR was then performed as follows:
a. Denaturation 92 ° C, 5 minutes b. Next 3 cycles: Denaturation 92 ℃, 30 seconds
Annealing 59 ℃, 30 seconds
Elongation 72 ° C, 60 seconds c. Next 3 cycles: Denaturation 92 ℃, 30 seconds
Annealing 57 ℃, 30 seconds
Elongation 72 ° C, 60 seconds d. Next 25 cycles: Denaturation 92 ° C, 30 seconds
Annealing 55 ℃, 30 seconds
Elongation 72 ° C, 60 seconds e. Holding 4 ℃
The underlined regions are annealed to the ADH promoter region and amylase region, respectively, and amplify the 307 bp region from the vector pSST-AMY.0 when no insert is present. Typically, the first 18 nucleotides at the 5 'end of these oligonucleotides contained an annealing site for the sequence primer. That is, the total product of the PCR reaction from the empty vector was 343 bp. However, the signal sequence fusion cDNA resulted in a fairly long nucleotide sequence.
Following PCR, an aliquot (5 μl) of the reaction was examined by agarose gel electrophoresis using a Tris-borate-EDTA (TBE) buffer system in a 1% agarose gel as described in Sambrook et al., Supra. . Clones that yielded a single strong PCR product larger than 400 bp were further analyzed by DNA sequence after purification on a 96 Qiaquick PCR purification column (Qiagen Inc., Chatsworth, Calif.).

6.3. Example 3 Isolation of cDNA Clones Using Signal Algorithm Analysis Various polypeptide-encoding nucleic acid sequences were developed using a proprietary sequence discovery algorithm developed by Genentech, Inc. (South San Francisco, Calif.). For example, identified by applying to ESTs and populations and constructed EST fragments from GenBank) and / or private (LIFESEQ®, Incyte Pharmaceuticals, Inc., Palo Alto, Calif.) Databases. The signal sequence algorithm calculates a secretion signal score based on the nature of the DNA nucleotide surrounding the first, possibly second, methionine codon (ATG) at the 5'-end of the sequence or sequence fragment under consideration. The nucleotide following the first ATG must encode at least 35 obscure amino acids without a stop codon. If the first ATG has the required amino acid, the second is not tested. If none of the requirements were met, the candidate sequence was not scored. In order to determine whether an EST sequence contains a genuine signal sequence, a set of seven sensors (evaluation parameters) known to be associated with the secretion signal, the DNA surrounding the ATG codon and the corresponding amino acid sequence Used to score. Through the use of this algorithm, a number of polypeptide-encoding nucleic acid sequences have been identified.

6.4. Example 4 Isolation of cDNA Clones Encoding Human PRO Polypeptides Using the techniques described in Examples 1 to 3 above, a number of full-length cDNA clones encode the PRO polypeptides disclosed herein. Was identified as These cDNAs were deposited with the American Type Culture Collection, 10801 University Boulevard, Manassas, Virginia 20110-2209 USA (ATCC) according to the terms of the Budapest Treaty as shown in Table 7 below.

This deposit was made in accordance with the provisions of the Budapest Treaty and its regulations (Budapest Convention) on the international recognition of the deposit of microorganisms in the patent procedure. This ensures that the viable culture of the deposit is maintained for 30 years from the date of deposit. Deposits may be obtained from the ATCC in accordance with the terms of the Budapest Treaty and in accordance with the agreement between Genentech and the ATCC, regardless of which is the first issue of the relevant U.S. patent or any Ensures that the progeny of the deposited culture are made available permanently and unrestricted at the time of publication of a U.S. or foreign patent application. Guarantees that the offspring will be available to those who have been determined to have the rights in accordance with (including Section 1.14).
The assignee of this application agrees that if the deposited culture dies or is lost or destroyed when cultured under appropriate conditions, the material will be immediately replaced with the same other upon notification. To do. The availability of deposited materials is not considered a license to practice the present invention in violation of rights granted under any governmental authority in accordance with patent law.

6.5. Example 5: PRO1873, PRO7223, PRO7248, PRO730, PRO532, PRO7261, PRO734, PRO771, PRO2010, PRO5723, PRO3444, PRO9940, PRO3562, PRO10008, PRO5730, PRO6008, PRO4527, PRO4538 and PRO4553
DNA encoding the PRO1873, PRO7223, PRO7248, PRO730, PRO532, PRO7261, PRO734, PRO771, PRO2010, PRO5723, PRO3444, PRO9940, PRO3562, PRO10008, PRO5730, PRO6008, PRO4527, PRO4538 and PRO4553 polypeptides shown in the attached figure The molecules were obtained through GenBank.

6.6. Example 6: Use of PRO as a hybridization probe The following method describes the use of a nucleotide sequence encoding PRO as a hybridization probe. DNA containing the coding sequence of full-length or mature PRO (shown in the accompanying figures) or a fragment thereof is DNA homologous to human tissue cDNA library or human tissue genomic library (such as those encoding naturally occurring variants of PRO, etc. ) Can be used as a probe for screening.
Hybridization and washing of the filter containing any library DNA is performed under the following high stringency conditions. Hybridization of the radiolabeled probe derived from the gene encoding the PRO polypeptide to the filter consists of 50% formamide, 5x SSC, 0.1% SDS, 0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH 6.8, The test was carried out at 42 ° C. for 20 hours in a solution of 2 × Denhardt's solution and 10% dextran sulfate. The filter was washed at 42 ° C. in 0.1 × SSC and 0.1% SDS aqueous solution.
DNA having the desired identity with the DNA encoding the full-length native sequence can then be identified using standard techniques known in the art.

6.7. Example 7: Expression of PRO in E. coli This example illustrates the preparation of a non-glycosylated form of PRO by recombinant expression in E. coli.
The DNA sequence encoding is first amplified using selected PCR primers. This primer must contain a restriction enzyme site corresponding to the restriction enzyme site on the selected expression vector. A variety of expression vectors can be used. An example of a suitable vector is pBR322 (derived from E. coli; see Bolivar et al., Gene, 2:95 (1977)) containing genes for ampicillin and tetracycline resistance. The vector is digested with restriction enzymes and dephosphorylated. The PCR amplified sequence is then ligated to the vector. The vector preferably encodes an antibiotic resistance gene, trp promoter, poly-His leader (including the first 6 STII codons, poly-His sequence, and enterokinase cleavage site), PRO coding region, lambda transcription concentrator and argU gene Contains an array.
This ligation mixture was then utilized to transform selected E. coli strains using the method described in Sambrook et al., Supra. Transformants are identified by their ability to grow on LB plates and then antibiotic resistant colonies are selected. Plasmid DNA can be isolated and confirmed by restriction analysis and DNA sequencing.
Selected clones can be grown overnight in liquid medium such as LB broth supplemented with antibiotics. This overnight culture may then be used to seed a larger scale culture. The cells are then grown to the desired optical density, during which the expression promoter begins to act.
After further culturing the cells for several hours, the cells can be collected by centrifugation. The cell pellet obtained by centrifugation can be solubilized using various agents known in the art, and then this lysed PRO protein is metal chelated under conditions that allow tight binding of the protein. It is possible to purify using a column.

PRO may be expressed in E. coli in poly-His tag form using the following procedure. DNA encoding PRO was first amplified using selected PCR primers. This primer provides a restriction enzyme site that corresponds to the restriction enzyme site of the chosen expression vector, and efficient and reliable translation initiation, rapid purification on metal chelate columns, and proteolytic removal with enterokinase. Contains other useful sequences to give. The PCR-amplified poly-His tag sequence was then ligated into an expression vector, which was used for transformation of an E. coli host based on strain 52 (W3110 fuhA (tonA) longalE rpoHts (htpRts) clpP (lacIq)). Transformants were first grown in LB containing 50 mg / ml carbenicillin with shaking at 30 ° C. until reaching an OD600 of 3-5. The culture was then added to CRAP medium (3.57 g (NH ₄ ) ₂ SO ₄ , 0.71 g sodium citrate 2H ₂ O, 1.07 g KCl, 5.36 g Difco yeast extract, 5.36 g Sheffield hycase in 500 mL water. SF and 110 mM MPOS, pH 7.3, prepared in a mixture of 0.55% (w / v) glucose and 7 mM MgSO ₄ ), diluted 50-100 times and shaken at 30 ° C. for about 20-30 hours Grown up. Samples were removed to confirm expression by SDS-PAGE, and the bulk medium was centrifuged so that the cells were pelleted. The cell pellet was frozen until purification and refolding (refolding).
E. coli paste from 0.5 to 1 L fermentation (6-10 g pellet) was resuspended in 10 volumes (w / v) in 7 M guanidine, 20 mM Tris, pH 8 buffer. Solid sodium sulfate and sodium tetrathionate were added to final concentrations of 0.1 M and 0.02 M, respectively, and the solution was stirred at 4 ° C. overnight. This step results in a denatured protein in which all cysteine residues are blocked with sulfite. The solution was concentrated in a Beckman Ultracentifuge at 40,000 rpm for 30 minutes. The supernatant is diluted with 3-5 volumes of metal chelate column buffer (6M guanidine, 20 mM Tris, pH 7.4) and filtered through a 0.22 micron filter for clarity. The clear extract was loaded onto a 5 ml Qiagen Ni ²⁺ -NTA metal chelate column equilibrated with metal chelate column buffer. The column was washed with an additional buffer containing 50 mM imidazole (Calbiochem, Utrol grade), pH 7.4. The protein was eluted with a buffer containing 250 mM imidazole. Fractions containing the desired protein were pooled and stored at 4 ° C. The protein concentration was estimated by its absorption at 280 nm using the extinction coefficient calculated based on its amino acid sequence.

Proteins are diluted by gradual dilution of the sample in freshly prepared regeneration buffer consisting of 20 mM Tris, pH 8.6, 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 mM glycine and 1 mM EDTA. Regenerated. The refolding volume was selected so that the final protein concentration was 50-100 microgram / ml. The refolding solution was slowly stirred at 4 ° C. for 12-36 hours. The refolding reaction was stopped by adding TFA at a collection concentration of 0.4% (pH of about 3). Prior to further purification of the protein, the solution was filtered through a 0.22 micron filter and acetonitrile was added at a final concentration of 2-10%. The renatured protein was chromatographed on a Poros R1 / H reverse phase column, eluting with a 0.1% TFA transfer buffer and a 10-80% acetonitrile gradient. Aliquots of fractions with A ₂₈₀ absorption were analyzed on SDS polyacrylamide gels and fractions containing homologous regenerative proteins were pooled. In general, most correctly regenerated protein species are eluted at the lowest concentration of acetonitrile because these species are the most compact and their hydrophobic inner surface is shielded from interaction with the reverse phase resin. Aggregated species are usually eluted at higher acetonitrile concentrations. In addition to removing the incorrectly regenerated protein from the desired form, the reverse phase process also removes endotoxin from the sample.
Fractions containing the desired regenerated PRO polypeptide were pooled and acetonitrile was removed using a gentle stream of nitrogen directed at the solution. The protein was prepared to 20 mM Hepes, pH 6.8 containing 0.14 M sodium chloride and 4% mannitol by gel filtration and sterile filtration on G25 Superfine (Pharmacia) resin equilibrated with dialysis or preparation buffer.
Many of the PRO polypeptides disclosed herein were successfully expressed by the methods described above.

6.8. Example 8: Expression of PRO in mammalian cells This example illustrates the preparation of a potentially glycosylated form of PRO by recombinant expression in mammalian cells.
The vector pRK5 (see EP 307,247 issued on March 15, 1989) was used as the expression vector. In some cases, PRODNA is bound to pRK5 with a selected restriction enzyme, and PRO DNA is inserted using a binding method such as that described in Sambrook et al. The resulting vector is called pRK5-PRO.
In one embodiment, the selected host cell can be a 293 cell. Human 293 cells (ATCC CCL 1573) were grown and confluent in tissue culture plates in media such as DMEM supplemented with fetal calf serum and optionally nourishing ingredients or antibiotics. About 10 μg of pRK5-PRO is mixed with about 1 μg of DNA encoding VA RNA gene [Thimmappaya et al., Cell, 31: 543 (1982))], 500 μl of 1 mM Tris-HCl, 0.1 mM EDTA, 0.227 M It was dissolved in CaCl _2. To this mixture, 500 μl of 50 mM HEPES (pH 7.35), 280 mM NaCl, 1.5 mM NaPO ₄ was added dropwise and a precipitate formed at 25 ° C. for 10 minutes. The precipitate was suspended and added to 293 cells and allowed to settle for about 4 hours at 37 ° C. The culture medium was aspirated and 2 ml of 20% glycerol in PBS was added for 30 seconds. The 293 cells were then washed with serum free medium, fresh medium was added and the cells were incubated for about 5 days.
Approximately 24 hours after transfection, the culture medium was removed and replaced with culture medium (only) or culture medium containing 200 μCi / ml ³⁵ S-cysteine and 200 μCi / ml ³⁵ S-methionine. After 12 hours of incubation, the conditioned medium was collected, concentrated with a spin filter and added to a 15% SDS gel. The treated gel was dried and exposed to the film for a selected time manifesting the presence of PRO polypeptide. The medium containing the transformed cells was further incubated (in serum-free medium) and the medium was tested in the selected bioassay.

In an alternative technique, PRO may be transiently introduced into 293 cells using the dextran sulfate method described in Somparyrac et al., Proc. Natl. Acad. Sci., 12: 7575 (1981). 293 cells are grown to maximal density in a spinner flask and 700 μg pRK5-PRO DNA is added. The cells were first concentrated from the spinner flask by centrifugation and washed with PBS. The DNA-dextran precipitate was incubated on the cell pellet for 4 hours. Cells were treated with 20% glycerol for 90 seconds, washed with tissue culture medium, and re-introduced into a spinner flask containing tissue culture medium, 5 μg / ml bovine insulin and 0.1 μg / ml bovine transferrin. After about 4 days, the conditioned medium was centrifuged and filtered to remove cells and cell debris. The sample containing the expressed gene encoding the expressed PRO was then concentrated, concentrated and purified by a selected method such as dialysis or column chromatography.
In other embodiments, PRO can be expressed in CHO cells. pRK5-PRO can be transfected into CHO cells using known reagents such as CaPO ₄ or DEAE-dextran. As described above, the cell culture medium can be incubated and the culture medium can be replaced with a culture medium (alone) or a medium containing a radioactive label such as ³⁵ S-methionine. After identifying the presence of the PRO polypeptide, the culture medium may be replaced with serum-free medium. Preferably, the medium is incubated for about 6 days and then the conditioned medium is collected. The medium containing the expressed PRO polypeptide can then be concentrated and purified by the selected method.
In addition, epitope-tagged PRO may be expressed in host CHO cells. PRO may be subcloned from the pRK5 vector. Subclone inserts can be PCRed and fused in frame with selected epitope tags such as poly-His tags in baculovirus expression vectors. The poly-His tagged PRO insert can then be subcloned into an SV40 derived vector containing a selectable marker such as DHFR for selection of stable clones. Finally, CHO cells were transfected with the SV40 derived vector (as described above). In order to confirm expression, labeling may be performed as described above. The medium containing the expressed poly-His-tagged PRO can then be concentrated and purified by selected methods such as Ni ²⁺ -chelate affinity chromatography.
PRO may be expressed transiently in CHO cells and / or COS cells, or in other stable expression methods in CHO cells.
Stable expression in CHO cells was performed using the following method. Proteins are IgG constructs (immuno-immune) in which the coding sequence of a solubilized form of the protein (eg, the extracellular domain) is fused to a constant region sequence comprising the hinge, CH2 and CH2 domains and / or poly-His tag form of IgG1. Adhesin).
Following PCR amplification, the corresponding DNA was subcloned into a CHO expression vector using standard techniques as described in Ausubel et al., Current Protocols of Molecular Biology, Unit 3.16, John Wiley and Sons (1997). The CHO expression vector has restriction sites compatible with 5 ′ and 3 ′ of the DNA of interest and is constructed so that the cDNA can be conveniently shuttled. The vector was expressed in CHO cells as described in Lucas et al., Nucl. Acids Res. 24: 9, 1774-1779 (1996), and used to express the target cDNA and dihydrofolate reductase (DHFR). Use SV40 early promoter / enhancer for control. DHFR expression allows selection for stable maintenance of the plasmid following transfection.
Twelve micrograms of the desired plasmid DNA is transferred to approximately 10 million CHO cells using the commercially available transfection reagents Superfect® (Qiagen), Dosper® and Fugene® (Boehringer Mannheim). Introduced. Cells were grown as described in Lucas et al. Approximately 3 × 10 ⁷ cells were frozen in ampoules for further growth and production as described below.

An ampoule containing the plasmid DNA was placed in a water bath, thawed, and mixed by vortexing. The contents were pipetted into a centrifuge tube containing 10 mL of medium and centrifuged at 1000 rpm for 5 minutes. The supernatant was aspirated and the cells were suspended in 10 mL selective medium (0.2 μm filtered PS20, supplemented with 5% 0.2 μm diafiltered fetal bovine serum). The cells were then divided into 100 ml spinners containing 90 mL selective medium. After 1-2 days, the cells were transferred to a 250 mL spinner filled with 150 mL selective medium and incubated at 37 ° C. After a further 2-3 days, 250 mL, 500 mL and 2000 mL spinners were seeded at 3 × 10 ⁵ cells / mL. The cell medium was replaced with fresh medium by centrifugation and resuspended in production medium. Any suitable CHO medium may be used, but in practice the production medium described in US Pat. No. 5,122,469 issued June 16, 1992 was used. A 3 L production spinner was seeded at 1.2 × 10 ⁶ cells / mL. On day 0, cell number and pH were measured. On the first day, the spinner was sampled and sprayed with filtered air. On the second day, sample the spinner, change the temperature to 33 ° C, and add 500 g / L glucose and 30 mL of 0.6 mL of 10% antifoam (eg 35% polydimethylsiloxane emulsion, Dow Corning 365 Medical Grade Emulsion) did. Throughout production, the pH was adjusted and maintained near 7.2. After 10 days, or until the viability fell below 70%, the cell culture medium was collected by centrifugation and filtered through a 0.22 μm filter. The filtrate was stored at 4 ° C. or immediately loaded onto a purification column.
For the poly-His tag construct, the protein was purified using a Ni ²⁺ -NTA column (Qiagen). Prior to purification, imidazole was added to the conditioned medium to a concentration of 5 mM. Conditioned medium was pumped at 4 ° C. at a flow rate of 4-5 ml / min onto a 6 ml Ni ²⁺ -NTA column equilibrated with 20 mM Hepes, pH 7.4 buffer containing 0.3 M NaCl and 5 mM imidazole. After loading, the column was further washed with equilibration buffer and the protein was eluted with equilibration buffer containing 0.25 M imidazole. The highly purified protein was subsequently desalted with 25 ml G25 Superfine (Pharmacia) in storage buffer containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol and stored at −80 ° C.
The immunoadhesin (containing Fc) construct was purified from conditioned medium as follows. The conditioned medium was loaded onto a 5 ml protein A column (Pharmacia) equilibrated with 20 mM sodium phosphate buffer, pH 6.8. After loading, the column was washed extensively with equilibration buffer and then eluted with 100 mM citric acid, pH 3.5. The eluted protein was immediately neutralized by collecting 1 ml fractions into a tube containing 275 μl of 1M Tris buffer, pH 9. The highly purified protein was subsequently desalted in the storage buffer described above for the poly-His tag protein. Uniformity was tested on SDS polyacrylamide gels and N-terminal amino acid sequencing was determined by Edman degradation.
Many of the PRO polypeptides disclosed herein were successfully expressed as described above.

6.9. Example 9: Expression of PRO in yeast The following method describes recombinant expression of PRO in yeast.
First, a yeast expression vector is produced for intracellular production or secretion of PRO from the ADH2 / GAPDH promoter. A DNA encoding PRO and a promoter are inserted into appropriate restriction enzyme sites of the selected plasmid to direct intracellular expression of PRO. A plasmid selected for DNA encoding PRO for secretion, DNA encoding an ADH2 / GAPDH promoter, native PRO signal peptide or other mammalian signal peptide, or, for example, a yeast alpha factor secretion signal / leader sequence, and Can be cloned with a linker sequence for expression of PRO (if necessary).
Yeasts such as yeast strain AB110 can then be transformed with the above expression plasmid and cultured in the selected fermentation medium. Transformed yeast supernatants can be analyzed by precipitation with 10% trichloroacetic acid and separation by SDS-PAGE, followed by staining of the gel with Coomassie blue staining.
The recombinant PRO can then be isolated and purified by removing the yeast cells from the fermentation medium by centrifugation and then concentrating the medium using a selected cartridge filter. The concentrate containing PRO may be further purified using a selected column chromatography resin.
Many of the PRO polypeptides disclosed herein were successfully expressed as described above.

6.10. Example 10: Expression of PRO in baculovirus infected insect cells The following method describes recombinant expression in baculovirus infected insect cells.
The sequence encoding PRO was fused upstream of an epitope tag contained in a baculovirus expression vector. Such epitope tags include poly-His tags and immunoglobulin tags (such as the Fc region of IgG). Various plasmids can be used, including plasmids derived from commercially available plasmids such as pVL1393 (Novagen). Briefly, PRO or a predetermined portion of the coding sequence of PRO (such as a sequence encoding the extracellular domain of a transmembrane protein, or a sequence encoding a mature protein if the protein is extracellular) is 5 ′ and Amplified by PCR with primers complementary to the 3 'region. The 5 ′ primer may include flanking (selected) restriction enzyme sites. The product is then digested with selected restriction enzymes and subcloned into an expression vector.
Recombinant baculoviruses can be obtained by co-transfecting the above plasmid and BaculoGold ™ viral DNA (Pharmingen) into Spodoptera frugiperda (“Sf9”) cells (ATCC CRL 1711) using lipofectin (commercially available from GIBCO-BRL). Created. After incubation at 28 ° C. for 4-5 days, the released virus was collected and used for further amplification. Viral infection and protein expression were performed as described in O'Reilley et al., Baculovirus expression vectors: A Laboratory Manual, Oxford: Oxford University Press (1994).
The expressed poly-His-tagged PRO is then purified by, for example, Ni ²⁺ -chelate affinity chromatography as follows. Extracts were prepared from virus-infected recombinant Sf9 cells as described in Rupert et al., Nature, 362: 175-179 (1993). Briefly, Sf9 cells were washed and sonicated buffer (25 ml Hepes, pH 7.9; 12.5 mM MgCl ₂ ; 0.1 mM EDTA; 10% glycerol; 0.1% NP-40; 0.4 M Resuspended in KCl) and sonicated twice on ice for 20 seconds. The sonicated product was clarified by centrifugation, and the supernatant was diluted 50-fold with a loading buffer (50 mM phosphate, 300 mM NaCl, 10% glycerol, pH 7.8) and filtered through a 0.45 μm filter. A Ni ²⁺ -NTA agarose column (commercially available from Qiagen) was prepared in a total volume of 5 ml, washed with 25 ml water and equilibrated with 25 ml loading buffer. The filtered cell extract was loaded onto the column at 0.5 ml per minute. The column was washed with loading buffer to A ₂₈₀ baseline where fraction collection started. The column was then washed with a secondary wash buffer (50 mM phosphate; 300 mM NaCl, 10% glycerol, pH 6.0), which elutes nonspecifically bound protein. After reaching baseline again A _280, the column is developed with a 0 to the secondary wash buffer imidazole gradient of 500 mM. 1 ml fractions were collected and analyzed by SDS-PAGE and silver blot or Western blot with Ni ²⁺ -NTA conjugated to alkaline phosphatase (Qiagen). Fractions containing the eluted His ₁₀ -tag PRO were pooled and dialyzed against loading buffer.

Alternatively, purification of IgG tag (or Fc tag) PRO can be performed using known chromatographic techniques including, for example, protein A or protein G column chromatography.
Following PCR amplification, the corresponding coding sequence was subcloned into a baculovirus expression vector (pb.PH.IgG for IgG fusion and pb.PH.His.c for poly-His tag), and the vector and Baculogold (registered). Trademark Baculovirus DNA (Pharmingen) was co-transfected into 105 Spodoptera frugiperda (“Sf9”) cells (ATCC CRL 1711) using Lipofectin (Gibco BRL). pb.PH.IgG and pb.PH.His are modified products of the commercially available baculovirus expression vector pVL1393 (Pharmingen), and have a polylinker region modified to include a His or Fc tag sequence. Cells were grown in Hink's TNM-FH medium supplemented with 10% FBS (Hyclone). The cells were incubated for 5 days at 28 ° C. Supernatants were collected and used for initial virus amplification at approximately 10 infection efficiency (MOI) by Sf9 cell infection in Hink's TNM-FH medium supplemented with 10% FBS. Cells were incubated for 3 days at 28 ° C. The supernatant is collected and the expression of the construct in the baculovirus expression vector is expressed in 1 ml of supernatant with 25 mL of Ni ²⁺ -NTA beads (QIAGEN) for histidine tag protein or protein A sepharose CL-4B for IgG tag protein. Measured by SDS-PAGE analysis by batch binding to beads (Pharmacia) followed by Coomassie blue staining and comparison to known concentrations of protein standards.
The first amplified virus supernatant was used to infect Sf9 cell spinner medium (500 ml) grown in ESF-921 medium (Expression Systems LLC) at an MOI of about 0.1. The cells were incubated at 28 ° C. for 3 days. The supernatant was collected and filtered. Batch binding and SDS-PAGE were repeated as necessary until expression of the spinner medium was confirmed.
Conditioned medium (0.5-3 L) from transfected cells was collected by removing the cells by centrifugation and filtering through a 0.22 micron filter. For the poly-His tag construct, the protein containing the sequence was purified using a Ni ²⁺ -NTA column (Qiagen). Prior to purification, imidazole was added to the conditioned medium to a concentration of 5 mM. Conditioned medium was pumped at 4 ° C. at a flow rate of 4-5 ml / min onto a 6 ml Ni ²⁺ -NTA column equilibrated with 20 mM Hepes, pH 7.4 buffer containing 0.3 M NaCl and 5 mM imidazole. After loading, the column was further washed with equilibration buffer and the protein was eluted with equilibration buffer containing 0.25 M imidazole. The highly purified protein was subsequently desalted using a 25 ml G25 Superfine (Pharmacia) column in a storage buffer, pH 6.8 containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol, and -80 Stored at 0C.

Protein immunoadhesin (Fc-containing) constructs were purified from conditioned media as follows. The conditioned medium was loaded onto a 5 ml protein A column (Pharmacia) equilibrated with 20 mM sodium phosphate buffer, pH 6.8. After loading, the column was washed extensively with equilibration buffer and then eluted with 100 mM citric acid, pH 3.5. The eluted protein was immediately neutralized by collecting 1 ml fractions into a tube containing 275 mL of 1 M Tris buffer, pH 9. The highly purified protein was subsequently desalted in the storage buffer described above for the poly-His tag protein. Protein homogeneity can be assessed by SDS polyacrylamide gel (PEG) electrophoresis and N-terminal amino acid sequencing by Edman degradation.
Alternatively, the modified baculovirus method may be used for high5 cell uptake. In this method, DNA encoding the desired sequence may be amplified in a suitable system such as Pfu (Stratagene) or fused upstream (5′-) to the epitope tag contained in the baculovirus expression vector. Good. Such epitope tags include poly-His tags and immunoglobulin tags (such as the Fc region of IgG). Various plasmids can be used, including plasmids derived from commercially available plasmids such as pIE1-1 (Novagen). The pIE1-1 and pIE1-2 vectors are designed for constitutive expression of the recombinant protein from the baculovirus ie1 promoter in stably transformed insect cells (1). This plasmid differs only in the direction of multiple cloning sites and contains all promoter sequences known to be important for ie1 mediated gene expression in uninfected insect cells as well as the hr5 enhancer component. pIE1-1 and pIE1-2 contain a translation initiation site and can be used to produce fusion proteins. Briefly, a desired sequence or a desired portion of the sequence (such as a sequence encoding the extracellular domain of a transmembrane protein) is amplified by PCR with primers complementary to the 5 ′ and 3 ′ regions. The 5 ′ primer may introduce flanking (selected) restriction enzyme sites. The product is then digested with selected restriction enzymes and subcloned into an expression vector. For example, a derivative of pIEl-1 can comprise the Fc region of human IgG (pb.PH.IgG) or the 8 histidine (pb.PH.His) tag downstream (3′-). Preferably, the vector construct is sequenced for confirmation.

High-5 cells were grown to 50% confluence under conditions of 27 ° C., no CO _{2 and} no pen / strep. For each 150 mm plate, add 30 μg of pIE base vector containing the sequence to 1 ml of Ex-cell medium (medium: Ex-cell 401 + 1/100 L-Glu JRH Biosciences # 14401-78P (Note: this medium is light sensitive)) In a separate tube, 100 μl of cellfectin (CellFECTIN (Gibco BRL # 10362-010) (mixed by vortex)) was mixed with 1 ml of Ex-cell medium in a separate tube. The two solutions were mixed and incubated for 15 minutes at room temperature. 8 ml Ex-cell medium was added to 2 ml DNA / cellfectin mixture and layered on high-5 cells washed once with Ex-cell medium. The plate was then incubated for 1 hour at room temperature in the dark. The DNA / cellfectin mixture was then aspirated and the cells were washed once with Ex-cells to remove excess cellfectin. 30 ml of fresh Ex-cell medium was added and the cells were incubated at 28 ° C. for 3 days. The supernatant is collected and expression of the sequence in a baculovirus expression vector is performed using 1 ml of supernatant, 25 mL of Ni ²⁺ -NTA beads for histidine tag protein (QIAGEN) or Protein A Sepharose CL- for IgG tag protein. Measured by SDS-PAGE analysis by batch binding to 4B beads (Pharmacia) followed by Coomassie blue staining to a known concentration of protein standard.
Conditioned medium (0.5-3 L) from transfected cells was collected by removing the cells by centrifugation and filtering through a 0.22 micron filter. For the poly-His tag construct, the protein construct was purified using a Ni ²⁺ -NTA column (Qiagen). Prior to purification, imidazole was added to the conditioned medium to a concentration of 5 mM. Conditioned medium was pumped at 48 ° C. at a flow rate of 4-5 ml / min onto a 6 ml Ni ²⁺ -NTA column equilibrated with 20 mM Hepes, pH 7.4 buffer containing 0.3 M NaCl and 5 mM imidazole. After loading, the column was further washed with equilibration buffer and the protein was eluted with equilibration buffer containing 0.25 M imidazole. The highly purified protein is subsequently desalted using a 25 ml G25 Superfine (Pharmacia) column in storage buffer, pH 6.8, containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol. Stored at 0C.
Protein immunoadhesin (Fc-containing) constructs were purified from conditioned media as follows. The conditioned medium was loaded onto a 5 ml protein A column (Pharmacia) equilibrated with 20 mM sodium phosphate buffer, pH 6.8. After loading, the column was washed extensively with equilibration buffer and then eluted with 100 mM citric acid, pH 3.5. The eluted protein was immediately neutralized by collecting 1 ml fraction into a tube containing 275 ml 1M Tris buffer, pH 9. The highly purified protein was subsequently desalted in the storage buffer described above for the poly-His tag protein. Sequence homogeneity can be assessed by SDS polyacrylamide gels and N-terminal amino acid sequencing by Edman degradation and other analytical techniques as desired or required.
Many of the PRO polypeptides disclosed herein have been successfully expressed by the methods described above.

6.11. Example 11: Preparation of an antibody that binds to PRO This example is specific to a PRO polypeptide or an epitope on a PRO polypeptide without substantially binding to any other polypeptide or polypeptide epitope. Illustrates the preparation of monoclonal antibodies capable of binding.
Techniques for the production of monoclonal antibodies are known in the art and are described, for example, in Goding, supra. Immunogens that can be used include purified PRO, a fusion protein comprising PRO, and a cell expressing a gene encoding recombinant PRO on the cell surface. The selection of the immunogen can be made without undue experimentation by one skilled in the art.
Mice such as Balb / c are immunized with PRO immunogen emulsified in complete Freund's adjuvant and injected subcutaneously or intraperitoneally at 1-100 micrograms. Alternatively, the immunogen may be emulsified in MPL-TDM adjuvant (Ribi Immunochemical Research, Hamilton, MT) and injected into the animal's hind footpad. Immunized mice are then boosted 10 to 12 days later with additional immunogen emulsified in the selected adjuvant. Thereafter, for several weeks, the mice are boosted with additional immunization injections. Serum samples from retroorbital hemorrhage may be taken periodically from mice for testing in an ELISA assay for detection of anti-PRO antibodies.

After a suitable antibody titer has been detected, the animals “positive” for antibodies can be given a final infusion of an intravenous injection of PRO. Three to four days later, the mice were sacrificed and spleen cells were removed. The spleen cells were then fused (using 35% polyethylene glycol) to a selected mouse myeloma cell line, such as P3X63AgU.1, available from ATCC under the number CRL1597. Hybridoma cells were generated by fusion and then plated on 96-well tissue culture plates containing HAT (hypoxanthine, aminopterin, and thymidine) medium to inhibit the growth of non-fused cells, myeloma hybrids, and spleen cell hybrids.
Hybridoma cells are screened by ELISA for reactivity to PRO. The determination of “positive” hybridoma cells that secrete monoclonal antibodies to the desired PRO is within the common general knowledge.
Positive hybridoma cells are injected intraperitoneally into syngeneic Balb / c mice to produce ascites containing anti-PRO monoclonal antibodies. Alternatively, hybridoma cells can be grown in tissue culture flasks or roller bottles. Purification of monoclonal antibodies produced in ascites can be performed using ammonium sulfate precipitation followed by gel exclusion chromatography. Alternatively, affinity chromatography based on the affinity of antibody for protein A or protein G can also be used.

6.12. Example 12: Purification of PRO polypeptides using specific antibodies Native or recombinant PRO polypeptides can be purified by various standard protein purification methods in the art. For example, pro-PRO polypeptide, mature PRO polypeptide, or pre-PRO polypeptide is purified by immunoaffinity chromatography using an antibody specific for the subject PRO polypeptide. In general, an immunoaffinity column is made by covalently binding an anti-PRO polypeptide antibody to an activated chromatography resin.
Polyclonal immunoglobulins are prepared from immune sera either by precipitation with ammonium sulfate or purification with immobilized protein A (Pharmacia LKB Biotechnology, Piscataway, NJ). Similarly, monoclonal antibodies are prepared from mouse ascites fluid by ammonium sulfate precipitation or chromatography with immobilized protein A. The partially purified immunoglobulin is covalently bound to a chromatographic resin such as CnBr-activated Sepharose (trade name) (Pharmacia LKB Biotechnology). The antibody is bound to the resin, the resin is blocked, and the derivative resin is washed according to the manufacturer's instructions.
Such immunoaffinity columns are utilized in the purification of PRO polypeptides by preparing fractions from cells containing a solubilized form of PRO polypeptide. This preparation is derived by solubilization of whole cells or cell component fractions obtained via addition of detergents or differential centrifugation by methods known in the art. Alternatively, solubilized PRO polypeptide comprising a signal sequence is secreted in useful amounts into the medium in which the cells are grown.
The solubilized PRO polypeptide-containing preparation is passed through an immunoaffinity column and the column is washed under conditions that allow preferred adsorption of the PRO polypeptide (eg, a high ionic strength buffer in the presence of a detergent). The column is then eluted under conditions that degrade antibody / PRO polypeptide binding (eg, a low pH of about 2-3, high concentrations of urea or chaotropes such as thiocyanate ions), and the PRO polypeptide is recovered. .

6.13. Example 13: Drug Screening The present invention is particularly useful for screening compounds by using PRO polypeptides or binding fragments thereof in various drug screening techniques. The PRO polypeptide or fragment used in such a test may be free in solution, immobilized on a solid support, supported on the cell surface, or located within the cell. One method of drug screening utilizes eukaryotic or prokaryotic host cells that are stably transfected with recombinant nucleic acids that express the PRO polypeptide or fragment. Agents are screened against such transfected cells by competitive binding assays. Depending on either the viable or immobilized form, such cells can be used in standard binding assays. For example, the formation of a complex between the PRO polypeptide or fragment and the reagent being tested may be measured. Alternatively, the reduction in complex formation between the PRO polypeptide and its target cell or target receptor caused by the reagent being tested can be tested.
Thus, the present invention provides methods for screening for drugs or any other reagent that can affect a PRO polypeptide related disease or disorder. These methods involve contacting the reagent with the PRO polypeptide or fragment by methods well known in the art for (I) the presence of a complex between the reagent and the PRO polypeptide or fragment, or (ii) Assaying for the presence of a complex between the PRO polypeptide or fragment and the cell. In these competitive binding assays, the PRO polypeptide or fragment is typically labeled. After appropriate incubation, free PRO polypeptide or fragments are separated from those in bound form and the amount of free or uncomplexed label binds to the PRO polypeptide or PRO polypeptide / cell complex. It is a measure of the ability to inhibit

Other techniques for drug screening provide high-throughput screening for compounds with appropriate binding affinity for polypeptides and are described in detail in WO84 / 03564 published September 13, 1984. ing. Briefly, a number of different small peptide test compounds are synthesized on a solid support such as plastic pins or some other surface. When applied to a PRO polypeptide, the peptide test compound reacts with the PRO polypeptide and is washed. Bound PRO polypeptide is detected by methods well known in the art. Purified PRO polypeptide can also be coated directly onto plates for use in the drug screening techniques described above. Furthermore, non-neutralizing antibodies can be used to capture the peptide and immobilize it on a solid support.
The present invention also contemplates competitive drug screening assays in which neutralizing antibodies capable of binding to the PRO polypeptide specifically compete with the test compound for the PRO polypeptide or fragment thereof. In this way, the antibody can be used to detect the presence of any peptide with one or more antigenic determinants with a PRO polypeptide.

6.14. Example 14: Rational drug design The purpose of rational drug design is the structure of the biologically active polypeptide of interest (ie, PRO polypeptide) or the small molecule with which they interact, such as an agonist, antagonist, or inhibitor Is to produce a similar analog. Any of these examples can be used to create a more active and stable form of a PRO polypeptide or a drug that promotes or inhibits the function of a PRO polypeptide in vivo (see Hodgson, Bio / Technology, 9: 19 -21 (1991)).

  In one method, the three-dimensional structure of a PRO polypeptide, or PRO polypeptide-inhibitor complex, is determined by X-ray crystallography, by computer modeling, most typically by a combination of the two methods. In order to elucidate the structure of the molecule and determine the active site, both the shape and charge of the PRO polypeptide must be confirmed. Less often, useful information regarding the structure of the PRO polypeptide may be obtained by modeling based on the structure of homologous proteins. In both cases, relevant structural information is used to design similar PRO polypeptide-like molecules or to identify effective inhibitors. Useful examples of rational drug design are molecules with improved activity or stability as shown in Braxton and Wells, Biochemistry, 31: 7796-7801 (1992), or Athauda et al., J. Biochem. , 113: 742-746 (1993), including molecules that act as inhibitors, agonists or antagonists of natural peptides.

It is also possible to isolate a target-specific antibody selected by the functional assay as described above and elucidate its crystal structure. This method in principle produces a pharmacore on which subsequent drug design can be based. By generating anti-idiotype antibodies (anti-ids) against functional pharmacologically active antibodies, protein crystallography can be bypassed. As a mirror image of the mirror image, the anti-ids binding site can be predicted to be an analog of the original receptor. Anti-ids can then be used to identify and isolate peptides from a bank of chemically or biologically produced peptides. The isolated peptide will function as a pharmacore.
In accordance with the present invention, sufficient quantities of PRO polypeptides are available to perform analytical experiments such as X-ray crystallography. Furthermore, the PRO polypeptide amino acid sequence knowledge provided herein provides guidance for use in computer modeling techniques to replace or add to X-ray crystallography.

6.15. Example 15: Stimulation of endothelial cell proliferation (Assay 8)
This assay is designed to determine whether a PRO polypeptide of the invention exhibits the ability to stimulate adrenocortical capillary endothelial cell (ACE) growth. Polypeptides tested positive in this assay include, for example, wound healing, and the like, and are expected to be useful in the therapeutic treatment of conditions and diseases where angiogenesis is beneficial (these PRO polypeptides). Like peptide agonists). PRO polypeptide antagonists tested positive in this assay are expected to be useful for therapeutic treatment of cancerous tumors.
Bovine adrenal cortex capillary endothelial (ACE) cells (from primary culture, up to 12-14 passages) were plated at 500 cells / well per 100 microliters in 96 well plates. The assay medium includes low glucose DMEM, 10% calf serum, 2 mM glutamine, and 1 × penicillin / streptomycin / fungizone. Control wells include: (1) no ACE cells added; (2) ACE cells only; (3) ACE cells + VEGF (5 ng / ml); and (4) ACE cells + FGF (5 ng / ml). Control and test samples (100 microliter volume) were then added to the wells (1%, 0.1% and 0.01% dilutions, respectively). Cell culture medium was incubated at 37 ° C./5% CO ₂ for 6-7 days. After incubation, the medium in the wells was aspirated and the cells were washed 1x with PBS. The acid phosphatase reaction mixture (100 microliters, 0.1 M sodium acetate, pH 5.5, 0.1% Triton X-100, 10 mM p-nitrophenyl phosphate) was then added to each well. After 2 hours incubation at 37 ° C., the reaction was stopped by the addition of 10 microliters 1N NaOH. Optical density (OD) was measured with a microplate reader at 405 nm.
PRO polypeptide activity was calculated as the fold increase in proliferation (acid phosphatase activity, measured at OD 405 nm) (1) against cell-only background and (2) maximal stimulation with VEGF. VEGF (3-10 ng / ml) and FGF (1-5 ng / ml) were used as activity references for maximal stimulation. The results of the assay were considered “positive” if the observed stimulus was ≧ 50% over background. The VEGF (5 ng / ml) control gave 1.24 times stimulation at 1% dilution; the FGF (5 ng / ml) control gave 1.46 times stimulation at 1% dilution.
PRO21 tested was positive in this assay.

6.16. Example 16: Inhibition of endothelial cell growth by stimulation of vascular endothelial growth factor (VEGF) (Assay 9)
The ability of various PRO polypeptides to inhibit the proliferation of endothelial cells stimulated by VEGF was tested. A positive polypeptide test in this assay is useful for inhibiting mammalian endothelial cell growth, and such an effect is advantageous, for example, for inhibiting tumor growth.
In particular, bovine adrenal cortical capillary endothelial (ACE) cells (from primary medium up to 12-14 passages) were seeded at 500 cells / well per 100 microliters of 96-well plate. The assay medium contains low glucose DMEM, 10% bovine serum, 2 mM glutamine, 1 × penicillin / streptomycin / fungizone. Control wells include: (1) ACE cells not added; (2) ACE cells alone; (3) ACE cells plus 5 ng / ml FGF; (4) ACE cells plus 3 ng / ml VEGF; (5) ACE cells plus 3 ng / ml VEGF plus 1 ng / ml TGF-beta; and (6) ACE cells plus 3 ng / ml VEGF plus 5 ng / ml LIF. The test sample, poly-his tagged PRO polypeptide (in 100 microliter volume) was then added to the wells (diluted to 1%, 0.1% and 0.01%, respectively). Cells were incubated for 6-7 days at 37 ° C./5% CO ₂ . After incubation, the medium in the wells was aspirated and the cells were washed with 1x PBS. Acid phosphatase reaction mixture (100 microliters, 0.1 M sodium acetate, pH 5.5, 0.1% Triton X-100, 10 mM p-nitrophenyl phosphate) was added to each well. After 2 hours of incubation at 37 ° C., the reaction was stopped by adding 10 microliters of 1N NaOH. Optical density (OD) was measured at 405 nm with a microplate reader.
The activity of the PRO polypeptide was calculated as the percent inhibition of VEGF (3 ng / ml) stimulated proliferation (as determined by measuring acid phosphatase activity at OD405 nm) on unstimulated cells. TGF-β blocked VEGF-stimulated ACE cell proliferation by 70-90% and was used as an activity reference at 1 ng / ml. The results indicate the usefulness of PRO polypeptides in cancer therapy, particularly in inhibiting tumor angiogenesis. The value (relative inhibition) calculates the percent inhibition of VEGF-stimulated proliferation by PRO polypeptide relative to unstimulated cells, and then TGF-β at a concentration of 1 ng / ml can block VEGF-stimulated cell proliferation by 70-90%. It is determined by dividing the percent inhibition obtained with known percentages. Results are considered positive when the PRO polypeptide inhibits VEGF stimulation of endothelial cell growth by 30% or more (relative inhibition of 30% or more).
Tested PRO247, PRO720 and PRO4302 were positive in this assay.

6.17. Example 17: Stimulation of cardiac neonatal hypertrophy induced by LIF + ET-1 (Assay 75)
This assay is designed to determine whether a PRO polypeptide of the invention exhibits the ability to stimulate neonatal cardiac hypertrophy induced by LIF and endothelin-1 (ET-1). Test compounds that give a positive response in this assay are useful for therapeutic treatment of heart failure diseases or disorders characterized or associated with undesirable levels of myocardial hypertrophy.
Postnatal day 1 SD rat cardiomyocytes (7.5 x 10 ⁴ / ml, 180 μl, serum <0.1, freshly isolated) 96-well pre-coated with DMEM / F12 + 4% FCS on day 1 Transferred to plate. Thereafter, the test PRO polypeptide sample or growth medium alone (negative control) is added directly into the wells at a 20 μl dose on day 2. Thereafter, LIF + ET-1 is added to the wells on the third day. Cells are further stained after 2 days in culture and then visually scored the next day. A positive in the assay if the PRO polypeptide treated myocytes get a score greater than zero. A score of zero indicates unresponsive cells and a score of 1 or 2 indicates enhancement (ie they are generally larger and more numerous than visually untreated myocytes).
PRO21 polypeptide was positive in this assay.
6.18. Example 18: Detection of Endothelial Cell Apoptosis (FACS) (Assay 96)
The ability of the PRO polypeptides of the present invention to induce apoptosis in endothelial cells has been demonstrated in humanized umbilical vein endothelial cells (HUVEC, Cell) using less than 10 passages of HUVEC cells in gelatinized T-175 flasks. Systems). Positive test PRO polypeptides in this assay are expected to be useful for therapeutically treating conditions where endothelial cell apoptosis is beneficial, including, for example, therapeutic treatment of tumors.
On day 1, cells were passaged [420,000 cells per gelatinized 6 cm dish- (11 x 10 ³ cells / cm ² Falcon, Primaria)], one in serum-containing medium (CS-C, Cell System) Grow overnight or 16 to 24 hours.
On day 2, cells were washed once with 5 ml PBS; 3 ml of 0% serum medium was added with VEGF (100 ng / ml); and 30 μl of PRO test compound (1% final dilution) or 0% serum Medium (negative control) was added. The mixture was incubated for 48 hours until collected.
Cells were then collected for FACS analysis. The medium was aspirated and the cells were washed once with PBS. 1 ml trypsin, 5 ml was added to the cells in the T-175 flask and the cells were allowed to stand until they detached from the plate (about 5-10 minutes). Trypsinization was stopped by adding 5 ml growth medium. The cells were centrifuged at 1000 rpm for 5 minutes at 4 ° C. The medium was aspirated, the cells were suspended in 10 ml of medium supplemented with 10% serum (Cell System), 5 μl of annexin-FITC (Bio Vison) was added, and the cooled tube was subjected to FACS. A positive result was determined as enhanced apoptosis in the PRO polypeptide treated sample compared to the negative control.
PRO4302 polypeptide was positive in this assay.

6.19. Example 19: Induction of c-fos in HUVEC cells (Assay 123)
This assay is designed to determine whether a PRO polypeptide exhibits the ability to induce c-fos in HUVEC cells. PRO polypeptides that are tested as positive are useful for the therapeutic treatment of conditions or diseases in which angiogenesis is beneficial, including wound healing and the like (as are agonists of PRO polypeptides). PRO polypeptide antagonists that are tested positive in this assay are expected to be useful for therapeutic treatment of cancerous tumors.
Human venous umbilical vein endothelial cells in growth medium (50% Ham's F12w / o GHT: low glucose and no 50% DMEM glycine: NaHCO3, 1% glutamine, 10 mM HEPES, 10% FBS, 10 ng / ml bFGF) HUVEC, Cell Systems) were plated on 96-well microtiter plates at a cell density of 5 × 10 ³ cells / well. The day after the plate (Day 2), the cells were starved for 24 hours by removing the growth medium and replacing the serum-free medium. On day 3, cells were treated with 100 μl / well test sample and control (positive control = growth medium; negative control = Protein 32 buffer = 10 mM HEPES, 140 mM NaCl, 4% (w / v) mannitol, pH 6. 8). One plate of cells was incubated for 30 minutes at 37 ° C., 5% CO ₂ . Other cell plates were incubated for 60 minutes at 37 ° C., 5% CO ₂ . Samples were removed and RNA was collected using RNeasy 96 kit (Qiagen). The RNA was then assayed using Taqman for induction of c-fos, egr-1 and GAPDH.
The measured activity of the fold increase relative to the negative control (Protein 32 / HEPES buffer described above) value was obtained by calculating the fold increase of c-fos relative to GAPDH in the test sample compared to the negative control. A result was positive if the PRO polypeptide showed a value at least twice that of the negative buffer control.
PRO1376 polypeptide was positive in this assay.
6.20. Example 20: Proliferation of normal human iliac artery endothelial cells (Assay 138)
This assay is designed to determine whether the PRO polypeptides of the present invention demonstrate the ability to induce proliferation of human iliac artery endothelial cells in culture and consequently function as a useful growth or inhibitor. Is done.
On day 0, human iliac artery endothelial cells (from cell lines up to 12-14 passages) were plated in 96-well plates at 1000 cells / well per 100 microliters and incubated overnight in complete media [ Epithelial cell growth medium (EGM, Clonetics), + supplements: human epidermal growth factor (hEGF), bovine brain extract (BBE), hydrocortisone, GA-1000, and fetal bovine serum (FBS, Clonetics)]. On day 1, the complete medium was replaced with basal medium [EGM + 1% FBS] and 1%, 0.1%, 0.01% by addition of PRO polypeptide. On day 7, cell proliferation assessment was performed by the Alamar Blue assay by Crystal Violet. Results are expressed as% of cell growth observed in control buffer.
The following PRO polypeptides promoted proliferation in this assay: PRO214, PRO256, PRO363, PRO365, PRO791, PRO836, PRO1025, PRO1186, PRO1192, PRO1272, PRO1306, PRO1325, PRO1329, PRO1376, PRO1411, PRO1508, PRO1787, PRO1868, PRO4324, PRO4333, PRO4408, PRO4499, PRO9821, PRO9873, PRO10008, PRO10096, PRO19670, PRO20040, PRO20044 and PRO21384.
The following PRO polypeptides inhibited proliferation in this assay: PRO238, PRO1029, PRO1274, PRO1279, PRO1419, PRO1890, PRO6006 and PRO28631.

6.21. Example 21: Proliferation of pooled human umbilical vein endothelial cells (Assay 139)
This assay demonstrates the ability of the PRO polypeptides of the invention to induce proliferation of pooled human umbilical vein endothelial cells in culture, and as a result, functions as a useful growth or inhibitor. Designed.
On day 0, pooled human umbilical vein endothelial cells (from cell lines up to 12-14 passages) are plated in 96-well plates at 1000 cells / well per 100 microliters and incubated overnight in complete media [Epithelial cell growth medium (EGM, Clonetics), + supplement: human epidermal growth factor (hEGF), bovine brain extract (BBE), hydrocortisone, GA-1000, and fetal bovine serum (FBS, Clonetics)]. On day 1, the complete medium was replaced with basal medium [EGM + 1% FBS] and 1%, 0.1%, 0.01% by addition of PRO polypeptide. On day 7, cell proliferation assessment was performed by the Alamar Blue assay by Crystal Violet. Results are expressed as% of cell growth observed in control buffer.
The following PRO polypeptides promoted proliferation in this assay: PRO181, PRO205, PRO221, PRO231, PRO238, PRO241, PRO247, PRO256, PRO258, PRO263, PRO265, PRO295, PRO321, PRO322, PRO337, PRO363, PRO533, PRO697, PRO725, PRO771, PRO788, PRO819, PRO828, PRO846, PRO865, PRO1005, PRO1006, PRO1025, PRO1054, PRO1071, PRO1079, PRO1080, PRO1114, PRO1131, PRO1155, PRO1160, PRO1192, PRO1244, PRO1272, PRO1273, PRO1279, PRO1283, PRO1286, PRO1306, PRO1309, PRO1325, PRO1329, PRO1347, PRO1356, PRO1376, PRO1382, PRO1412, PRO1550, PRO1556, PRO1760, PRO1787, PRO1801, PRO1868, PRO1887, PRO3438, PRO3444, PRO4324, PRO4341, PRO4342, PRO4354, PRO4356, PRO4371, PRO4422, PRO4425, PRO5723, PRO5737, PRO6029, PRO6071, PRO10096 and PRO21055.
The following PRO polypeptides inhibited proliferation in this assay: PRO229, PRO444, PRO827, PRO1007, PRO1075, PRO1184, PRO1190, PRO1195, PRO1419, PRO1474, PRO1477, PRO1488, PRO1782, PRO4302, PRO4405, PRO5725, PRO5776, PRO7436, PRO9771, PRO10008 and PRO21384.

6.22. Example 22: Human coronary artery smooth muscle cell proliferation (assay 140)
This assay is designed to determine whether a PRO polypeptide of the invention exhibits the ability to induce proliferation of human coronary artery smooth muscle cells in culture and consequently functions as a useful growth or inhibitor. The
On day 0, human coronary artery smooth muscle cells (from cell lines up to 12-14 passages) were plated in 96-well plates at 1000 cells / well per 100 microliters and incubated overnight in complete media [smooth Muscle growth medium (SmGM, Clonetics), + supplements: insulin, human epidermal growth factor (hEGF), human fibroblast growth factor (hFGF), and fetal bovine serum (FBS, Clonetics)]. On day 1, the complete medium was replaced with basal medium [SmGM + 1% FBS] at 1%, 0.1%, 0.01% by addition of PRO polypeptide. On day 7, cell proliferation assessment was performed by the Alamar Blue assay by Crystal Violet. Results are expressed as% of cell growth observed in control buffer.
The following PRO polypeptides promoted proliferation in this assay: PRO162, PRO182, PRO204, PRO221, PRO230, PRO256, PRO258, PRO533, PRO697, PRO725, PRO738, PRO826, PRO836, PRO840, PRO846, PRO865, PRO982, PRO1025, PRO1029, PRO1071, PRO1083, PRO1134, PRO1160, PRO1182, PRO1184, PRO1186, PRO1192, PRO1274, PRO1279, PRO1283, PRO1306, PRO1308, PRO1325, PRO1337, PRO1338, PRO1343, PRO1376, PRO1387, PRO1411, PRO14115, PRO1434, PRO1474, PRO1550, PRO1556, PRO1567, PRO1600, PRO1754, PRO1758, PRO1760, PRO1787, PRO1865, PRO1868, PRO1917, PRO1928, PRO3438, PRO3562, PRO4333, PRO4345, PRO4353, PRO4354, PRO4408, PRO4430, PRO4503, PRO6714, PRO9771, PRO9820, PRO99 PRO10096, PRO21055, PRO21184 and PRO21366.
The following PRO polypeptides inhibited proliferation in this assay: PRO181, PRO195, PRO1080, PRO1265, PRO1309, PRO1488, PRO4302, PRO4405 and PRO5725.

6.23. Example 23: Microarray analysis to detect overexpression of PRO polypeptide in growth factor treated HUVEC cells This assay demonstrates that the PRO polypeptide of the invention stimulates endothelial cell tube formation in HUVEC cells Designed to determine whether it exhibits the ability to induce angiogenesis.
Often, nucleic acid microarrays containing thousands of gene sequences are differentially expressed in tissues exposed to various stimuli (eg, growth factors) when compared to their normal tissues, ie, tissues that are not exposed to stimuli This is useful for identifying the genes that are present. When using nucleic acid microarrays, test and control mRNA samples from test and control tissue samples are reverse transcribed and labeled to generate cDNA probes. This cDNA probe is then hybridized with a number of nucleic acids immobilized on a solid support. This array is constructed so that the sequence and position of each member of the array is known. Hybridization of a labeled probe with a member of a particular array indicates that the sample from which the probe is derived expresses that gene. If the hybridization signal of the probe from the test (tissue exposed to the stimulus) is greater than the hybridization signal of the probe from the control (normal tissue, unexposed tissue) sample, there is an excess in the tissue exposed to the stimulus. The gene or genes that are expressed are identified. The implication of this result is that proteins that are overexpressed in tissues exposed to stimuli are involved in functional changes (eg, tube formation) in tissues exposed to stimuli.
Nucleic acid hybridization and microarray technology methodologies are well known to those skilled in the art. In this example, hybridization and probes, special preparation of nucleic acids for slides, and hybridization conditions are all described in detail in US Provisional Application Serial No. 60 / 193,767, filed March 31, 2000. Which is incorporated herein by reference.

In this example, HUVEC cells growing in either collagen gel or fibrin gel were induced to form tubes by the addition of various growth factors. In particular, collagen gels have already been prepared as described in Yang et al., American J. Pathology, 1999, 155 (3): 887-895 and Xin et al., American J. Pathology, 2001, 158 (3): 1111-1120. It was. After gelation of the HUVEC cells, 1 X basal medium 1% FBS was added include M199, 1 X ITS, 2 mM L- glutamine, 50 [mu] g / ml ascorbic _{acid, 26.5 mM NaHCO 3, 100U /} ml penicillin and 100U / ml streptomycin was added. Tube formation may be phorbol myristate acetate (50 nM), vascular endothelial growth factor (40 ng / ml) and basic fibroblast growth factor (40 ng / ml) ("PMA growth factor mixture"), or liver It was induced by including either cell growth factor (40 ng / ml) and vascular endothelial growth factor (40 ng / ml) (HGF / VEGF mixture) for the indicated period. Fibrin gels were prepared by suspending Huvec (4 × 10 ⁵ cells / ml) in M199 containing 1% fetal calf serum (Hyclone) and human fibrinogen (2.5 mg / ml). Thrombin (50 U / ml) was then added to the fibrinogen suspension at a ratio of 1 part thrombin solution: 30 part fibrinogen suspension. The solution was then overlaid on a 10 cm tissue culture plate (total volume: 15 ml / plate) and then allowed to clot at 37 ° C. for 20 minutes. Thereafter, tissue culture medium (10 ml BM containing PMA (50 nM), bFGF (40 ng / ml) and VEGF (40 ng / ml)) was added, and the cells were air at 37 ° C., 5% CO ₂ . Incubated for the indicated period.
Total RNA was extracted from HUVEC cells incubated at 0, 4, 8, 24, 40 and 50 hours in a different matrix and medium combination, followed by a second extraction using RNAeasy Mini Kit (Qiagen) after TRIzol extraction Extracted using. Total RNA was later used to prepare cRNA hybridized to the microarray.
In this experiment, nucleic acid probes derived from the PRO polypeptide-encoding nucleic acid sequences described herein were used for the production of microarrays, and RNA from the above HUVEC cells was used for hybridization therewith. The comparison between the two sets was done using a time 0 chip as the baseline. Three replicate samples were analyzed for each experimental condition and time. Therefore, there were 3 time 0 samples for each treatment and 3 replicates at each passage. Therefore, a 3 to 3 comparison for each time 0 was made at each time point. This resulted in 9 comparisons at each time point. Only genes with increased expression in all non-time 0 replicates in each different matrix and media combination were positive when compared to any of the three time 0s. This stringent data analysis method can tolerate false negatives, but minimizes false positives.
PRO178, PRO195, PRO228, PRO301, PRO302, PRO532, PRO724, PRO730, PRO734, PRO793, PRO871, PRO938, PRO1012, PRO1120, PRO1139, PRO1198, PRO1287, PRO1361, PRO1864, PRO1873, PRO2010, PRO3579, PRO4313, PRO4527, PRO4538, PRO4553, PRO4995, PRO5730, PRO6008, PRO7223, PRO7248 and PRO7261 polypeptides were positive in this assay.

6.24. Example 24: In situ hybridization In situ hybridization is a powerful and versatile technique for the detection and localization of nucleic acid sequences within cell or tissue preparations. It is useful, for example, in identifying gene expression sites, analyzing the tissue distribution of transcripts, identifying and localizing viral infections, tracking changes in specific mRNA synthesis and assisting in chromosomal mapping.
In situ hybridization is performed with PCR-generated ³³ P-labeled riboprobe according to an optimized version of the protocol of Lu and Gillett, Cell Vision 1: 169-176 (1994). Briefly, formalin-fixed, paraffin-embedded human tissue was sectioned, deparaffinized, deproteinized with proteinase K (20 g / ml) for 15 minutes at 37 ° C., and as described in Lu and Gillett, supra. In situ hybrid formation. ( ³³ -P) UTP-labeled antisense riboprobe is generated from the PCR product and hybridized at 55 ° C. overnight. The slides are immersed in Kodak NTB2 ^™ nuclear track emulsion and exposed for 4 weeks.
6.24.1. ³³ P-riboprobe synthesis
6.0 μl (125 mCi) of ³³ P-UTP (Amersham BF 1002, SA <2000 Ci / mmol) was speed-vacuum dried. The following ingredients were added to each tube containing dry ³³ P-UTP:
2.0 μl of 5x transcription buffer
1.0 μl DTT (100 mM)
2.0 μl NTP mixture (2.5 mM: 10 μl each 10 mM GTP, CTP and ATP + 10 μl H ₂ O)
1.0 μl UTP (50 μM)
1.0 μl RNAsin
1.0 μl DNA template (1 μg)
1.0 μl H ₂ O
1.0 μl of RNA polymerase (T3 = AS, T7 = S, normal for PCR products)
Tubes were incubated for 1 hour at 37 ° C. 1.0 μl RQ1 DNase was added and then incubated at 37 ° C. for 15 minutes. 90 μl TE (10 mM Tris pH 7.6 / 1 mM EDTA pH 8.0) was added and the mixture was pipetted onto DE81 paper. The remaining solution was loaded into a MICROCON-50 ^™ ultrafiltration unit and spun using program 10 (6 minutes). The filtration unit was converted to a second tube and spun using program 2 (3 minutes). After the final recovery spin, 100 μl TE was added. 1 μl of final product was pipetted onto DE81 paper and counted with 6 ml of BIOFLUOR II ^™ .
The probe was run on a TBE / urea gel. 1-3 μl probe or 5 μl RNA MrkIII was added to 3 μl loading buffer. After heating on a heating block to 95 ° C. for 3 minutes, the gel was immediately placed on ice. Gel wells were flushed, sample loaded, and run at 180-250 volts for 45 minutes. The gel was wrapped with plastic wrap (SARAN ^™ ) and exposed to XAR film with a reinforced screen in a -70 ° C freezer for 1 hour to overnight.

6.24.2. ³³ P-hybridization 6.22.4.2.1. Pretreatment of frozen sections Slides were removed from the refrigerator, placed in an aluminum tray and thawed at room temperature for 10 minutes. The tray was placed in a 55 ° C. incubator for 5 minutes to reduce condensation. Slides were fixed in 4% paraformaldehyde on ice for 5 minutes in a steam hood and washed with 0.5 × SSC for 5 minutes at room temperature (25 ml 20 × SSC + 975 ml SQ H ₂ O). After deproteinization for 10 minutes at 37 ° C. in 0.5 μg / ml proteinase K (12.5 μl of 10 mg / ml stock in RNase buffer without 250 ml preheated RNase), the sections were washed with 0.5 × SSC for 10 minutes at room temperature. Sections were dehydrated in 70%, 95%, and 100% ethanol for 2 minutes each.
6.24.2.2. Pretreatment of paraffin-embedded sections Slides were deparaffinized, placed in SQ H ₂ O and rinsed twice with 2 × SSC for 5 minutes each at room temperature. Sections were 20 μg / ml proteinase K (500 μl 10 mg / ml in 250 ml RNase-free RNase buffer; 37 ° C., 15 minutes) —human embryo tissue or 8 × proteinase K (100 μl in 250 ml RNase buffer, 37 ° C., 30 minutes) -Deproteinized with formalin tissue. Subsequent rinsing and dehydration with 0.5 × SSC was performed as described above.
6.24.3. Prehybridization Slides were arranged in plastic boxes lined with Box buffer (4 × SSC, 50% formamide) -saturated filter paper. The tissue was coated with 50 μl of hybridization buffer (3.75 g dextran sulfate + 6 ml SQ H ₂ O), vortexed, uncapped and heated in the microwave for 2 minutes. After cooling on ice, 18.75 ml formamide, 3.75 ml 20 × SSC and 9 ml SQ H ₂ O were added and the tissue was vortexed well and incubated at 42 ° C. for 1-4 hours.
6.22.4.2. Hybridization 1.0 × 10 ⁶ cpm probe and 1.0 μl tRNA (50 mg / ml stock) per slide were heated at 95 ° C. for 3 minutes. Slides were chilled on ice and 48 μl of hybridization buffer was added per slide. After vortexing, 50 μl of ³³ P mix was added to 50 μl of prehybrid on the slide. Slides were incubated overnight at 55 ° C.
6.24.2.5. Washing Washing was performed 2 x 10 min at 2 x SSC, EDTA at room temperature (400 ml 20 x SSC + 16 ml 0.25 M EDTA, V _f = 4 L) followed by RNAseA treatment for 30 min at 37 ° C (500 μl of 10 mg / ml in 250 ml RNase buffer) = 20 μg / ml). Slides were washed 2 × 10 minutes with 2 × SSC, EDTA at room temperature. Stringent wash conditions are as follows: 2 hours at 55 ° C., 0.1 × SSC, EDTA (20 ml 20 × SSC + 16 ml EDTA, V _f = 4 L).

6.22.6. Oligonucleotides In situ analysis was performed on three of the DNA sequences disclosed herein. The primers used to make the probes and / or the probes used for these analyzes are as follows:
DNA33100-p1: 5'GGA TTC TAA TAC GAC TCA CTA TAG GGC CGG GTG GAG GTG GAA CAG AAA 3 '(SEQ ID NO: 375)
DNA33100-p2: 5 'CTA TGA AAT TAA CCC TCA CTA AAG GGA CAC AGA CAG AGC CCC ATA CGC 3' (SEQ ID NO: 376)
DNA34431-p1: 5 'GGA TTC TAA TAC GAC TCA CTA TAG GGC CAG GGA AAT CCG GAT GTC TC 3' (SEQ ID NO: 377)
DNA34431-p2: 5 'CTA TGA AAT TAA CCC TCA CTA AAG GGA GTA AGG GGA TGC CAC CGA GTA 3' (SEQ ID NO: 378)
DNA38268-p1: 5'GGA TTC TAA TAC GAC TCA CTA TAG GGC CAG CTA CCC GCA GGA GGA GG 3 '(SEQ ID NO: 379)
DNA38268-p2: 5 'CTA TGA AAT TAA CCC TCA CTA AAG GGA TCC CAG GTG ATG AGG TCC AGA 3' (SEQ ID NO: 380)
DNA64908 probe:
5'CCATCTCGGAGACCTTTGTGCAGCGTGTATACCAGCCTTACCTCACCACTTGCGACGGACACAGAGCCTGCAGCACCTACCGAACCATCTACCGGACTGCCTATCGCCGTAGCCCTGGGGTGACTCCCGCAAGCCTCGCTATGCTTGCTGCCCTGGTTGGAAGAGGACCAGTGGGCTCCCTGGGGCTTGTGGAGCAGCAATATGCCAGCCTCCATGTGGGAATGGAGGGAGTTGCATCCGCCCAGGACACTGCCGCTGCCCTGTGGGATGGCAGGGAGATACTTGCCAGACAGATGTTGATGAATGCAGTACAGGAGAGGCCAGTTGTCCCCAGCGCTGTGTCAATACTGTGGGAAGTTACTGGTGCCAGGGATGGGAGGGACAAAGCCCATCTGCAGATGGGACGCGCTGCCTGTCTAAGGAGGGGCCCTCCCGGTGGCCCCAACCCCACAGCAGGAGTGGACAGCA3 '(SEQ ID NO: 381)

6.22.7.7. Results In situ analysis was performed and the results of these analyzes are shown below:
6.24.2.7.1. DNA33100-1159 (PRO229) (scavenger-R / CD6 homolog TNF motif)
Specific positive signals were observed in human fetal and adult mononuclear phagocytes (macrophages), spleen, liver, lymph nodes and thymus. All other cells were negative.
6.24.2.7.2. DNA34431-1177 (PRO263) (CD44)
Specific positive signals were observed in epithelial cells of the adrenal cortex with strong expression in human fetal tissue and placental mononuclear cells. All adult tissues were negative.
6.24.2.7.3. DNA38268-1188 (PRO295) (integrin)
Specific positive signals were observed in human fetal ganglion cells, fetal neurons, adult adrenal medulla, and adult neurons. All other tissues were negative.
6.24.2.7.4. DNA64908-1163-1 (PRO1449)
Specific positive signals were observed in whole-mount mouse fetal in situ hybridization in the developing vasculature (E7 to E11), endothelial cells and endothelial cell precursors (FIG. 375). Specific expression was also observed in a subset of blood vessels and epidermis after E12. A mouse ortholog of PRO1449 having approximately 78% amino acid identity with PRO1449 was used as a probe.
In normal adult tissues, expression ranged from low to no confirmed at all. When present, expression was restricted to blood vessels (Figure 376). In addition, FIG. 376 shows that the highest expression in adult tissues was observed locally in blood vessels within the white matter of the brain. Also, but not limited to, increased expression was observed in many inflammatory and diseased tissue vasculature, including tumor vasculature. Subsequent electroporation of the mouse PRO1449 ortholog to the choroid layer in the eyes of the chick fetus revealed new angiogenesis in the electroporated eye (upper right), but the control side (upper left) from the same fetus. Or, it was not observed in the fetus (lower right) electroporated with control cDNA (FIG. 377).

6.25. Example 25: Inhibition of basic fibroblast growth factor (bFGF) -stimulated proliferation of endothelial cell growth The ability of various PRO polypeptides to inhibit bFGF-stimulated proliferation of endothelial cells was tested. Polypeptides tested positive in this assay are useful for inhibiting endothelial cell growth in mammals where such effects are beneficial, for example, for inhibiting tumor growth.
Specifically, human umbilical vein endothelial cells (HUVEC, Cell Systems) in endothelial cell growth medium (EGM, Clonetics) were seeded in a 96-well microtiter plate at a cell density of 5 × 10 ³ cells / well and a volume of 100 μl / well. On the day after seeding (Day 2), the growth medium is removed and replaced with starvation medium (M199 supplemented with 1% FBS, 2 mM L-glutamine, 100 U / ml penicillin and 100 U / ml streptomycin). Cells were starved for hours. On day 5, cells were: (1) M199 containing 10% FBS; (2) M199 containing 1% FBS; (3) M199 containing 1% FBS and 20 ng / ml bFGF; 4) M199 containing 1% FBS and 20 ng / ml bFGF and PRO polypeptide (500 nM); (5) M199 containing 1% FBS and 20 ng / ml bFGF and PRO polypeptide (50 nM); or (6) Treated with either M199 containing 1% FBS and 20 ng / ml bFGF and PRO polypeptide (5 nM). On day 8, cell proliferation was assessed by Alamar Blue assay. Absorbance (OD) was measured at excitation 530 and emission 590 nm using a microplate reader.
PRO polypeptide activity was measured as the percent inhibition of bFGF stimulated proliferation relative to unstimulated cells. The results demonstrate the usefulness of PRO polypeptides in cancer therapy, particularly in inhibiting tumor angiogenesis. The numerical value (relative inhibition) was determined by calculating the percent inhibition of bFGF stimulated proliferation by the PRO polypeptide relative to unstimulated cells. A result is considered positive if the PRO polypeptide shows inhibition of bFEGF stimulation of endothelial cell growth by 30% or higher.
PRO5725 was tested positive in this assay.

  The above written description is considered to be sufficient to enable one skilled in the art to practice the invention. The deposited embodiments are intended as an illustration of certain aspects of the invention, and since any functionally equivalent product is within the scope of the invention, the deposited product will limit the scope of the invention. It is not limited. The deposit of material herein is not an admission that the written description contained herein is insufficient to allow implementation of any aspect of the invention, including its best mode. It is not to be construed as limiting the scope of the claims to the specific illustrations presented. Indeed, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims.

FIG. 1 shows the nucleotide sequence of the native sequence PRO181 cDNA (SEQ ID NO: 1), which is a clone designated herein as “DNA23330-1390”. FIG. 2 shows an amino acid sequence (SEQ ID NO: 2) derived from the coding sequence of SEQ ID NO: 1 shown in FIG. FIG. 3 shows the nucleotide sequence of the native sequence PRO178 cDNA (SEQ ID NO: 3), which is a clone designated herein as “DNA23339-1130”. FIG. 4 shows the amino acid sequence (SEQ ID NO: 4) derived from the coding sequence of SEQ ID NO: 3 shown in FIG. FIG. 5 shows the nucleotide sequence of the native sequence PRO444 cDNA (SEQ ID NO: 5), which is a clone designated herein as “DNA26846-1397”. FIG. 6 shows an amino acid sequence (SEQ ID NO: 6) derived from the coding sequence of SEQ ID NO: 5 shown in FIG. FIG. 7 shows the nucleotide sequence of the native sequence PRO195 cDNA (SEQ ID NO: 7), which is a clone designated herein as “DNA26847-1395”. FIG. 8 shows an amino acid sequence (SEQ ID NO: 8) derived from the coding sequence of SEQ ID NO: 7 shown in FIG. FIG. 9 shows the nucleotide sequence of the native sequence PRO182 cDNA (SEQ ID NO: 9), which is a clone designated herein as “DNA27865-1091”. FIG. 10 shows an amino acid sequence (SEQ ID NO: 10) derived from the coding sequence of SEQ ID NO: 9 shown in FIG. FIG. 11 shows the nucleotide sequence of the native sequence PRO205 cDNA (SEQ ID NO: 11), which is a clone designated herein as “DNA30868-1156”. FIG. 12 shows an amino acid sequence (SEQ ID NO: 12) derived from the coding sequence of SEQ ID NO: 11 shown in FIG. FIG. 13 shows the nucleotide sequence of the native sequence PRO204 cDNA (SEQ ID NO: 13), which is a clone designated herein as “DNA30871-1157”. FIG. 14 shows an amino acid sequence (SEQ ID NO: 14) derived from the coding sequence of SEQ ID NO: 13 shown in FIG. FIG. 15 shows the nucleotide sequence of the native sequence PRO1873 cDNA (SEQ ID NO: 15), which is a clone herein designated “DNA30880”. FIG. 16 shows the amino acid sequence (SEQ ID NO: 16) derived from the coding sequence of SEQ ID NO: 15 shown in FIG. FIG. 17 shows the nucleotide sequence of the native sequence PRO214 cDNA (SEQ ID NO: 17), which is a clone designated herein as “DNA32286-1191”. FIG. 18 shows an amino acid sequence (SEQ ID NO: 18) derived from the coding sequence of SEQ ID NO: 17 shown in FIG. FIG. 19 shows the nucleotide sequence of the native sequence PRO221 cDNA (SEQ ID NO: 19), which is a clone designated herein as “DNA33089-1132”. FIG. 20 shows an amino acid sequence (SEQ ID NO: 20) derived from the coding sequence of SEQ ID NO: 19 shown in FIG. FIG. 21 shows the nucleotide sequence of the native sequence PRO228 cDNA (SEQ ID NO: 21), which is a clone designated herein as “DNA33092-1202”. FIG. 22 shows the amino acid sequence (SEQ ID NO: 22) derived from the coding sequence of SEQ ID NO: 21 shown in FIG. FIG. 23 shows the nucleotide sequence of the native sequence PRO229 cDNA (SEQ ID NO: 23), which is a clone designated herein as “DNA33100-1159”. FIG. 24 shows the amino acid sequence (SEQ ID NO: 24) derived from the coding sequence of SEQ ID NO: 23 shown in FIG. FIG. 25 shows the nucleotide sequence of the native sequence PRO230 cDNA (SEQ ID NO: 25), which is a clone designated herein as “DNA33223-1136”. FIG. 26 shows the amino acid sequence (SEQ ID NO: 26) derived from the coding sequence of SEQ ID NO: 25 shown in FIG. FIG. 27 shows the nucleotide sequence of the native sequence PRO7223 cDNA (SEQ ID NO: 27), which is a clone herein designated “DNA34385”. FIG. 28 shows the amino acid sequence (SEQ ID NO: 28) derived from the coding sequence of SEQ ID NO: 27 shown in FIG. FIG. 29 shows the nucleotide sequence of the native sequence PRO241 cDNA (SEQ ID NO: 29), which is a clone designated herein as “DNA34392-1170”. FIG. 30 shows the amino acid sequence (SEQ ID NO: 30) derived from the coding sequence of SEQ ID NO: 29 shown in FIG. FIG. 31 shows the nucleotide sequence of the native sequence PRO263 cDNA (SEQ ID NO: 31), which is a clone designated herein as “DNA34431-1177”. FIG. 32 shows the amino acid sequence (SEQ ID NO: 32) derived from the coding sequence of SEQ ID NO: 31 shown in FIG. FIG. 33 shows the nucleotide sequence of the native sequence PRO321 cDNA (SEQ ID NO: 33), which is a clone designated herein as “DNA34433-1308”. FIG. 34 shows the amino acid sequence (SEQ ID NO: 34) derived from the coding sequence of SEQ ID NO: 33 shown in FIG. FIG. 35 shows the nucleotide sequence of the native sequence PRO231 cDNA (SEQ ID NO: 35), which is a clone designated herein as “DNA34434-1139”. FIG. 36 shows an amino acid sequence (SEQ ID NO: 36) derived from the coding sequence of SEQ ID NO: 35 shown in FIG. FIG. 37 shows the nucleotide sequence of the native sequence PRO238 cDNA (SEQ ID NO: 37), which is a clone designated herein as “DNA35600-1162”. FIG. 38 shows the amino acid sequence (SEQ ID NO: 38) derived from the coding sequence of SEQ ID NO: 37 shown in FIG. FIG. 39 shows the nucleotide sequence of the native sequence PRO247 cDNA (SEQ ID NO: 39), which is a clone herein designated “DNA35673-1201”. FIG. 40 shows the amino acid sequence (SEQ ID NO: 40) derived from the coding sequence of SEQ ID NO: 39 shown in FIG. FIG. 41 shows the nucleotide sequence of the native sequence PRO256 cDNA (SEQ ID NO: 41), which is a clone designated herein as “DNA35880-1160”. FIG. 42 shows the amino acid sequence (SEQ ID NO: 42) derived from the coding sequence of SEQ ID NO: 41 shown in FIG. FIG. 43 shows the nucleotide sequence of the native sequence PRO258 cDNA (SEQ ID NO: 43), which is a clone designated herein as “DNA35918-1174”. FIG. 44 shows the amino acid sequence (SEQ ID NO: 44) derived from the coding sequence of SEQ ID NO: 43 shown in FIG. FIG. 45 shows the nucleotide sequence of the native sequence PRO265 cDNA (SEQ ID NO: 45), which is a clone designated herein as “DNA36350-1158”. FIG. 46 shows an amino acid sequence (SEQ ID NO: 46) derived from the coding sequence of SEQ ID NO: 45 shown in FIG. FIG. 47 shows the nucleotide sequence of the native sequence PRO21 cDNA (SEQ ID NO: 47), which is a clone herein designated “DNA36638-1056”. FIG. 48 shows the amino acid sequence (SEQ ID NO: 48) derived from the coding sequence of SEQ ID NO: 47 shown in FIG. FIG. 49 shows the nucleotide sequence of the native sequence PRO295 cDNA (SEQ ID NO: 49), which is a clone designated herein as “DNA38268-1188”. FIG. 50 shows the amino acid sequence (SEQ ID NO: 50) derived from the coding sequence of SEQ ID NO: 49 shown in FIG. FIG. 51 shows the nucleotide sequence of the native sequence PRO302 cDNA (SEQ ID NO: 51), which is a clone designated herein as “DNA40370-1217”. FIG. 52 shows the amino acid sequence (SEQ ID NO: 52) derived from the coding sequence of SEQ ID NO: 51 shown in FIG. FIG. 53 shows the nucleotide sequence of the native sequence PRO301 cDNA (SEQ ID NO: 53), which is a clone designated herein as “DNA40628-1216”. FIG. 54 shows the amino acid sequence (SEQ ID NO: 54) derived from the coding sequence of SEQ ID NO: 53 shown in FIG. FIG. 55 shows the nucleotide sequence of the native sequence PRO337 cDNA (SEQ ID NO: 55), which is a clone designated herein as “DNA43316-1237”. FIG. 56 shows the amino acid sequence (SEQ ID NO: 56) derived from the coding sequence of SEQ ID NO: 55 shown in FIG. FIG. 57 shows the nucleotide sequence of the native sequence PRO7248 cDNA (SEQ ID NO: 57), which is a clone designated herein as “DNA44195”. FIG. 58 shows the amino acid sequence (SEQ ID NO: 58) derived from the coding sequence of SEQ ID NO: 57 shown in FIG. FIG. 59 shows the nucleotide sequence of the native sequence PRO846 cDNA (SEQ ID NO: 59), which is a clone herein designated “DNA44196-1353”. FIG. 60 shows the amino acid sequence (SEQ ID NO: 60) derived from the coding sequence of SEQ ID NO: 59 shown in FIG. FIG. 61 shows the nucleotide sequence of the native sequence PRO1864 cDNA (SEQ ID NO: 61), which is a clone designated herein as “DNA45409-2511”. FIG. 62 shows an amino acid sequence (SEQ ID NO: 62) derived from the coding sequence of SEQ ID NO: 61 shown in FIG. FIG. 63 shows the nucleotide sequence of the native sequence PRO363 cDNA (SEQ ID NO: 63), which is a clone herein designated “DNA45419-1252”. FIG. 64 shows the amino acid sequence (SEQ ID NO: 64) derived from the coding sequence of SEQ ID NO: 63 shown in FIG. FIG. 65 shows the nucleotide sequence of the native sequence PRO730 cDNA (SEQ ID NO: 65), which is a clone designated herein as “DNA45624-1400”. FIG. 66 shows the amino acid sequence (SEQ ID NO: 66) derived from the coding sequence of SEQ ID NO: 65 shown in FIG. FIG. 67 shows the nucleotide sequence of the native sequence PRO365 cDNA (SEQ ID NO: 67), which is a clone herein designated “DNA46777-1253”. FIG. 68 shows the amino acid sequence (SEQ ID NO: 68) derived from the coding sequence of SEQ ID NO: 67 shown in FIG. FIG. 69 shows the nucleotide sequence of the native sequence PRO532 cDNA (SEQ ID NO: 69), which is a clone designated herein as “DNA48335”. FIG. 70 shows the amino acid sequence (SEQ ID NO: 70) derived from the coding sequence of SEQ ID NO: 69 shown in FIG. FIG. 71 shows the nucleotide sequence of the native sequence PRO322 cDNA (SEQ ID NO: 71), which is a clone designated herein as “DNA48336-1309”. FIG. 72 shows an amino acid sequence (SEQ ID NO: 72) derived from the coding sequence of SEQ ID NO: 71 shown in FIG. FIG. 73 shows the nucleotide sequence of the native sequence PRO1120 cDNA (SEQ ID NO: 73), which is a clone designated herein as “DNA48606-1479”. FIG. 74 shows an amino acid sequence (SEQ ID NO: 74) derived from the coding sequence of SEQ ID NO: 73 shown in FIG. FIG. 75 shows the nucleotide sequence of the native sequence PRO7261 cDNA (SEQ ID NO: 75), which is a clone herein designated “DNA49149”. FIG. 76 shows the amino acid sequence (SEQ ID NO: 76) derived from the coding sequence of SEQ ID NO: 75 shown in FIG. FIG. 77 shows the nucleotide sequence of the native sequence PRO533 cDNA (SEQ ID NO: 77), which is a clone herein designated “DNA49435-1219”. FIG. 78 shows the amino acid sequence (SEQ ID NO: 78) derived from the coding sequence of SEQ ID NO: 77 shown in FIG. FIG. 79 shows the nucleotide sequence of the native sequence PRO724 cDNA (SEQ ID NO: 79), which is a clone herein designated “DNA49631-1328”. FIG. 80 shows the amino acid sequence (SEQ ID NO: 80) derived from the coding sequence of SEQ ID NO: 79 shown in FIG. FIG. 81 shows the nucleotide sequence of the native sequence PRO734 cDNA (SEQ ID NO: 81), which is a clone designated herein as “DNA49817”. FIG. 82 shows the amino acid sequence (SEQ ID NO: 82) derived from the coding sequence of SEQ ID NO: 81 shown in FIG. FIG. 83 shows the nucleotide sequence of the native sequence PRO771 cDNA (SEQ ID NO: 83), which is a clone herein designated “DNA49829-1346”. FIG. 84 shows an amino acid sequence (SEQ ID NO: 84) derived from the coding sequence of SEQ ID NO: 83 shown in FIG. FIG. 85 shows the nucleotide sequence of the native sequence PRO2010 cDNA (SEQ ID NO: 85), which is a clone designated herein as “DNA50792”. FIG. 86 shows the amino acid sequence (SEQ ID NO: 86) derived from the coding sequence of SEQ ID NO: 85 shown in FIG. FIG. 87 shows the nucleotide sequence of the native sequence PRO871 cDNA (SEQ ID NO: 87), which is a clone designated herein as “DNA50919-1361”. FIG. 88 shows the amino acid sequence (SEQ ID NO: 88) derived from the coding sequence of SEQ ID NO: 87 shown in FIG. FIG. 89 shows the nucleotide sequence of the native sequence PRO697 cDNA (SEQ ID NO: 89), which is a clone designated herein as “DNA50920-1325”. FIG. 90 shows an amino acid sequence (SEQ ID NO: 90) derived from the coding sequence of SEQ ID NO: 89 shown in FIG. FIG. 91 shows the nucleotide sequence of the native sequence PRO1083 cDNA (SEQ ID NO: 91), which is a clone designated herein as “DNA50921-1458”. FIG. 92 shows the amino acid sequence (SEQ ID NO: 22) derived from the coding sequence of SEQ ID NO: 91 shown in FIG. FIG. 93 shows the nucleotide sequence of the native sequence PRO725 cDNA (SEQ ID NO: 93), which is a clone herein designated “DNA52758-1399”. FIG. 94 shows the amino acid sequence (SEQ ID NO: 94) derived from the coding sequence of SEQ ID NO: 93 shown in FIG. FIG. 95 shows the nucleotide sequence of the native sequence PRO720 cDNA (SEQ ID NO: 95), which is a clone herein designated “DNA53517-1366-1”. FIG. 96 shows the amino acid sequence (SEQ ID NO: 96) derived from the coding sequence of SEQ ID NO: 95 shown in FIG. FIG. 97 shows the nucleotide sequence of the native sequence PRO738 cDNA (SEQ ID NO: 97), which is a clone designated herein as “DNA53915-1258”. FIG. 98 shows the amino acid sequence (SEQ ID NO: 98) derived from the coding sequence of SEQ ID NO: 97 shown in FIG. FIG. 99 shows the nucleotide sequence of the native sequence PRO865 cDNA (SEQ ID NO: 99), which is a clone designated herein as “DNA53974-1401”. FIG. 100 shows the amino acid sequence (SEQ ID NO: 100) derived from the coding sequence of SEQ ID NO: 99 shown in FIG. FIG. 101 shows the nucleotide sequence of the native sequence PRO840 cDNA (SEQ ID NO: 101), which is a clone designated herein as “DNA53987-1438”. FIG. 102 shows the amino acid sequence (SEQ ID NO: 102) derived from the coding sequence of SEQ ID NO: 101 shown in FIG. FIG. 103 shows the nucleotide sequence of the native sequence PRO1080 cDNA (SEQ ID NO: 103), which is a clone designated herein as “DNA56047-1456”. FIG. 104 shows the amino acid sequence (SEQ ID NO: 104) derived from the coding sequence of SEQ ID NO: 103 shown in FIG. FIG. 105 shows the nucleotide sequence of the native sequence PRO1079 cDNA (SEQ ID NO: 105), which is a clone designated herein as “DNA56050-1455”. FIG. 106 shows the amino acid sequence (SEQ ID NO: 106) derived from the coding sequence of SEQ ID NO: 105 shown in FIG. FIG. 107 shows the nucleotide sequence of the native sequence PRO793 cDNA (SEQ ID NO: 107), which is a clone designated herein as “DNA56110-1437”. FIG. 108 shows the amino acid sequence (SEQ ID NO: 108) derived from the coding sequence of SEQ ID NO: 107 shown in FIG. FIG. 109 shows the nucleotide sequence of the native sequence PRO788 cDNA (SEQ ID NO: 109), which is a clone designated herein as “DNA56405-1357”. FIG. 110 shows the amino acid sequence (SEQ ID NO: 110) derived from the coding sequence of SEQ ID NO: 109 shown in FIG. FIG. 111 shows the nucleotide sequence of the native sequence PRO938 cDNA (SEQ ID NO: 111), which is a clone designated herein as “DNA56433-1406”. FIG. 112 shows the amino acid sequence (SEQ ID NO: 112) derived from the coding sequence of SEQ ID NO: 111 shown in FIG. FIG. 113 shows the nucleotide sequence of the native sequence PRO1012 cDNA (SEQ ID NO: 113), which is a clone designated herein as “DNA56439-1376”. FIG. 114 shows the amino acid sequence (SEQ ID NO: 114) derived from the coding sequence of SEQ ID NO: 113 shown in FIG. FIG. 115 shows the nucleotide sequence of the native sequence PRO1477 cDNA (SEQ ID NO: 115), which is a clone designated herein as “DNA56529-1647”. FIG. 116 shows an amino acid sequence (SEQ ID NO: 116) derived from the coding sequence of SEQ ID NO: 115 shown in FIG. FIG. 117 shows the nucleotide sequence of the native sequence PRO1134 cDNA (SEQ ID NO: 117), which is a clone designated herein as “DNA56865-1491”. 118 shows the amino acid sequence (SEQ ID NO: 118) derived from the coding sequence of SEQ ID NO: 117 shown in FIG. FIG. 119 shows the nucleotide sequence of the native sequence PRO162 cDNA (SEQ ID NO: 119), which is a clone herein designated “DNA56965-1356”. FIG. 120 shows the amino acid sequence (SEQ ID NO: 120) derived from the coding sequence of SEQ ID NO: 119 shown in FIG. FIG. 121 shows the nucleotide sequence of the native sequence PRO1114 cDNA (SEQ ID NO: 121), which is a clone designated herein as “DNA57033-1430-1”. 122 shows an amino acid sequence (SEQ ID NO: 122) derived from the coding sequence of SEQ ID NO: 121 shown in FIG. 121. FIG. 123 shows the nucleotide sequence of the native sequence PRO828 cDNA (SEQ ID NO: 123), which is a clone herein designated “DNA57037-1444”. FIG. 124 shows an amino acid sequence (SEQ ID NO: 124) derived from the coding sequence of SEQ ID NO: 123 shown in FIG. FIG. 125 shows the nucleotide sequence of native sequence PRO827 cDNA (SEQ ID NO: 125), which is a clone designated herein as “DNA57039-1402”. FIG. 126 shows the amino acid sequence (SEQ ID NO: 126) derived from the coding sequence of SEQ ID NO: 125 shown in FIG. FIG. 127 shows the nucleotide sequence of the native sequence PRO1075 cDNA (SEQ ID NO: 127), which is a clone designated herein as “DNA57689-1385”. 128 shows the amino acid sequence (SEQ ID NO: 128) derived from the coding sequence of SEQ ID NO: 127 shown in FIG. FIG. 129 shows the nucleotide sequence of the native sequence PRO1007 cDNA (SEQ ID NO: 129), which is a clone designated herein as “DNA57690-1374”. FIG. 130 shows the amino acid sequence (SEQ ID NO: 130) derived from the coding sequence of SEQ ID NO: 129 shown in FIG. FIG. 131 shows the nucleotide sequence of the native sequence PRO826 cDNA (SEQ ID NO: 131), which is a clone designated herein as “DNA57694-1341”. FIG. 132 shows the amino acid sequence (SEQ ID NO: 132) derived from the coding sequence of SEQ ID NO: 131 shown in FIG. 131. FIG. 133 shows the nucleotide sequence of the native sequence PRO819 cDNA (SEQ ID NO: 133), where SEQ ID NO: 132 is a clone designated herein as “DNA57695-1340”. FIG. 134 shows the amino acid sequence (SEQ ID NO: 134) derived from the coding sequence of SEQ ID NO: 133 shown in FIG. FIG. 135 shows the nucleotide sequence of the native sequence PRO1006 cDNA (SEQ ID NO: 135), which is a clone herein designated “DNA57699-1412”. FIG. 136 shows an amino acid sequence (SEQ ID NO: 136) derived from the coding sequence of SEQ ID NO: 135 shown in FIG. FIG. 137 shows the nucleotide sequence of the native sequence PRO982 cDNA (SEQ ID NO: 137), which is a clone designated herein as “DNA57700-1408”. FIG. 138 shows the amino acid sequence (SEQ ID NO: 138) derived from the coding sequence of SEQ ID NO: 137 shown in FIG. FIG. 139 shows the nucleotide sequence of the native sequence PRO1005 cDNA (SEQ ID NO: 139), which is a clone designated herein as “DNA57708-1411”. FIG. 140 shows an amino acid sequence (SEQ ID NO: 140) derived from the coding sequence of SEQ ID NO: 139 shown in FIG. 139. FIG. 141 shows the nucleotide sequence of the native sequence PRO791 cDNA (SEQ ID NO: 141), which is a clone designated herein as “DNA57838-1337”. FIG. 142 shows the amino acid sequence (SEQ ID NO: 142) derived from the coding sequence of SEQ ID NO: 141 shown in FIG. FIG. 143 shows the nucleotide sequence of the native sequence PRO1071 cDNA (SEQ ID NO: 143), which is a clone designated herein as “DNA58847-1383”. FIG. 144 shows an amino acid sequence (SEQ ID NO: 144) derived from the coding sequence of SEQ ID NO: 143 shown in FIG. FIG. 145 shows the nucleotide sequence of the native sequence PRO1415 cDNA (SEQ ID NO: 145), which is a clone herein designated “DNA58852-1637”. FIG. 146 shows the amino acid sequence (SEQ ID NO: 146) derived from the coding sequence of SEQ ID NO: 145 shown in FIG. FIG. 147 shows the nucleotide sequence of the native sequence PRO1054 cDNA (SEQ ID NO: 147), which is a clone designated herein as “DNA58853-1423”. FIG. 148 shows the amino acid sequence (SEQ ID NO: 148) derived from the coding sequence of SEQ ID NO: 147 shown in FIG. FIG. 149 shows the nucleotide sequence of the native sequence PRO1411 cDNA (SEQ ID NO: 149), which is a clone herein designated “DNA59212-1627”. FIG. 150 shows the amino acid sequence (SEQ ID NO: 150) derived from the coding sequence of SEQ ID NO: 149 shown in FIG. FIG. 151 shows the nucleotide sequence of the native sequence PRO1184 cDNA (SEQ ID NO: 151), which is a clone herein designated “DNA59220-1514”. FIG. 152 shows the amino acid sequence (SEQ ID NO: 152) derived from the coding sequence of SEQ ID NO: 151 shown in FIG. FIG. 153 shows the nucleotide sequence of the native sequence PRO1029 cDNA (SEQ ID NO: 153), which is a clone herein designated “DNA59493-1420”. FIG. 154 shows the amino acid sequence (SEQ ID NO: 154) derived from the coding sequence of SEQ ID NO: 153 shown in FIG. FIG. 155 shows the nucleotide sequence of the native sequence PRO1139 cDNA (SEQ ID NO: 155), which is a clone designated herein as “DNA59497-1496”. FIG. 156 shows the amino acid sequence (SEQ ID NO: 156) derived from the coding sequence of SEQ ID NO: 155 shown in FIG. FIG. 157 shows the nucleotide sequence of the native sequence PRO1190 cDNA (SEQ ID NO: 157), which is a clone herein designated “DNA59586-1520”. FIG. 158 shows the amino acid sequence (SEQ ID NO: 158) derived from the coding sequence of SEQ ID NO: 157 shown in FIG. FIG. 159 shows the nucleotide sequence of the native sequence PRO1309 cDNA (SEQ ID NO: 159), which is a clone designated herein as “DNA59588-1571”. FIG. 160 shows the amino acid sequence (SEQ ID NO: 160) derived from the coding sequence of SEQ ID NO: 159 shown in FIG. FIG. 161 shows the nucleotide sequence of the native sequence PRO836 cDNA (SEQ ID NO: 161), which is a clone designated herein as “DNA59620-1463”. FIG. 162 shows an amino acid sequence (SEQ ID NO: 162) derived from the coding sequence of SEQ ID NO: 161 shown in FIG. 161. FIG. 163 shows the nucleotide sequence of the native sequence PRO1025 cDNA (SEQ ID NO: 163), which is a clone designated herein as “DNA59622-1334”. FIG. 164 shows the amino acid sequence (SEQ ID NO: 164) derived from the coding sequence of SEQ ID NO: 163 shown in FIG. FIG. 165 shows the nucleotide sequence of the native sequence PRO1131 cDNA (SEQ ID NO: 165), which is a clone herein designated “DNA59777-1480”. FIG. 166 shows the amino acid sequence (SEQ ID NO: 166) derived from the coding sequence of SEQ ID NO: 165 shown in FIG. 165. FIG. 167 shows the nucleotide sequence of the native sequence PRO1182 cDNA (SEQ ID NO: 167), which is a clone designated herein as “DNA59848-1512”. FIG. 168 shows the amino acid sequence (SEQ ID NO: 168) derived from the coding sequence of SEQ ID NO: 167 shown in FIG. FIG. 169 shows the nucleotide sequence of the native sequence PRO1155 cDNA (SEQ ID NO: 169), which is a clone herein designated “DNA59849-1504”. FIG. 170 shows the amino acid sequence (SEQ ID NO: 170) derived from the coding sequence of SEQ ID NO: 169 shown in FIG. FIG. 171 shows the nucleotide sequence of the native sequence PRO1186 cDNA (SEQ ID NO: 171), which is a clone herein designated “DNA60621-1516”. FIG. 172 shows the amino acid sequence (SEQ ID NO: 172) derived from the coding sequence of SEQ ID NO: 171 shown in FIG. FIG. 173 shows the nucleotide sequence of the native sequence PRO1198 cDNA (SEQ ID NO: 173), which is a clone herein designated “DNA60622-1525”. FIG. 174 shows the amino acid sequence (SEQ ID NO: 174) derived from the coding sequence of SEQ ID NO: 173 shown in FIG. 173. FIG. 175 shows the nucleotide sequence of the native sequence PRO1265 cDNA (SEQ ID NO: 175), which is a clone herein designated “DNA60764-1533”. FIG. 176 shows the amino acid sequence (SEQ ID NO: 176) derived from the coding sequence of SEQ ID NO: 175 shown in FIG. 175. FIG. 177 shows the nucleotide sequence of the native sequence PRO1361 cDNA (SEQ ID NO: 177), which is a clone designated herein as “DNA60783-1611”. FIG. 178 shows the amino acid sequence (SEQ ID NO: 178) derived from the coding sequence of SEQ ID NO: 177 shown in FIG. 177. FIG. 179 shows the nucleotide sequence of the native sequence PRO1287 cDNA (SEQ ID NO: 179), which is a clone designated herein as “DNA61755-1554”. FIG. 180 shows an amino acid sequence (SEQ ID NO: 180) derived from the coding sequence of SEQ ID NO: 179 shown in FIG. 179. FIG. 181 shows the nucleotide sequence of the native sequence PRO1308 cDNA (SEQ ID NO: 181), which is a clone designated herein as “DNA62306-1570”. FIG. 182 shows the amino acid sequence (SEQ ID NO: 182) derived from the coding sequence of SEQ ID NO: 181 shown in FIG. FIG. 183 shows the nucleotide sequence of the native sequence PRO4313 cDNA (SEQ ID NO: 183), which is a clone herein designated “DNA62312-2558”. FIG. 184 shows the amino acid sequence (SEQ ID NO: 184) derived from the coding sequence of SEQ ID NO: 183 shown in FIG. FIG. 185 shows the nucleotide sequence of the native sequence PRO1192 cDNA (SEQ ID NO: 185), which is a clone herein designated “DNA62814-1521”. FIG. 186 shows the amino acid sequence (SEQ ID NO: 186) derived from the coding sequence of SEQ ID NO: 185 shown in FIG. 185. FIG. 187 shows the nucleotide sequence of the native sequence PRO1160 cDNA (SEQ ID NO: 187), which is a clone designated herein as “DNA62872-1509”. FIG. 188 shows the amino acid sequence (SEQ ID NO: 188) derived from the coding sequence of SEQ ID NO: 187 shown in FIG. 187. FIG. 189 shows the nucleotide sequence of the native sequence PRO1244 cDNA (SEQ ID NO: 189), which is a clone designated herein as “DNA64883-1526”. FIG. 190 shows an amino acid sequence (SEQ ID NO: 190) derived from the coding sequence of SEQ ID NO: 189 shown in FIG. FIG. 191 shows the nucleotide sequence of the native sequence PRO1356 cDNA (SEQ ID NO: 191), which is a clone designated herein as “DNA64886-1601”. FIG. 192 shows the amino acid sequence (SEQ ID NO: 192) derived from the coding sequence of SEQ ID NO: 191 shown in FIG. FIG. 193 shows the nucleotide sequence of the native sequence PRO1274 cDNA (SEQ ID NO: 193), which is a clone herein designated “DNA64889-1541”. FIG. 194 shows the amino acid sequence (SEQ ID NO: 194) derived from the coding sequence of SEQ ID NO: 193 shown in FIG. 193. FIG. 195 shows the nucleotide sequence of the native sequence PRO1272 cDNA (SEQ ID NO: 195), which is a clone designated herein as “DNA64896-1539”. FIG. 196 shows the amino acid sequence (SEQ ID NO: 196) derived from the coding sequence of SEQ ID NO: 195 shown in FIG. 195. FIG. 197 shows the nucleotide sequence of the native sequence PRO1412 cDNA (SEQ ID NO: 197), which is a clone designated herein as “DNA64897-1628”. FIG. 198 shows the amino acid sequence (SEQ ID NO: 198) derived from the coding sequence of SEQ ID NO: 197 shown in FIG. FIG. 199 shows the nucleotide sequence of the native sequence PRO1286 cDNA (SEQ ID NO: 199), which is a clone designated herein as “DNA64903-1553”. FIG. 200 shows the amino acid sequence (SEQ ID NO: 200) derived from the coding sequence of SEQ ID NO: 199 shown in FIG. FIG. 201 shows the nucleotide sequence of the native sequence PRO1347 cDNA (SEQ ID NO: 201), which is a clone designated herein as “DNA64950-1590”. 202 shows the amino acid sequence (SEQ ID NO: 202) derived from the coding sequence of SEQ ID NO: 201 shown in FIG. FIG. 203 shows the nucleotide sequence of the native sequence PRO1273 cDNA (SEQ ID NO: 203), which is a clone designated herein as “DNA65402-1540”. FIG. 204 shows the amino acid sequence (SEQ ID NO: 204) derived from the coding sequence of SEQ ID NO: 203 shown in FIG. FIG. 205 shows the nucleotide sequence of the native sequence PRO1283 cDNA (SEQ ID NO: 205), which is a clone designated herein as “DNA65404-1551”. FIG. 206 shows the amino acid sequence (SEQ ID NO: 206) derived from the coding sequence of SEQ ID NO: 205 shown in FIG. FIG. 207 shows the nucleotide sequence of the native sequence PRO1279 cDNA (SEQ ID NO: 207), which is a clone designated herein as “DNA65405-1547”. FIG. 208 shows the amino acid sequence (SEQ ID NO: 208) derived from the coding sequence of SEQ ID NO: 207 shown in FIG. FIG. 209 shows the nucleotide sequence of the native sequence PRO1306 cDNA (SEQ ID NO: 209), which is a clone designated herein as “DNA65410-1569”. FIG. 210 shows the amino acid sequence (SEQ ID NO: 210) derived from the coding sequence of SEQ ID NO: 209 shown in FIG. FIG. 211 shows the nucleotide sequence of the native sequence PRO1195 cDNA (SEQ ID NO: 211), which is a clone designated herein as “DNA65412-1523”. FIG. 212 shows an amino acid sequence (SEQ ID NO: 212) derived from the coding sequence of SEQ ID NO: 211 shown in FIG. 211. FIG. 213 shows the nucleotide sequence of the native sequence PRO4995 cDNA (SEQ ID NO: 213), which is a clone designated herein as “DNA66307-2661”. FIG. 214 shows the amino acid sequence (SEQ ID NO: 214) derived from the coding sequence of SEQ ID NO: 213 shown in FIG. FIG. 215 shows the nucleotide sequence of the native sequence PRO1382 cDNA (SEQ ID NO: 215), which is a clone herein designated “DNA66526-1616”. FIG. 216 shows the amino acid sequence (SEQ ID NO: 216) derived from the coding sequence of SEQ ID NO: 215 shown in FIG. FIG. 217 shows the nucleotide sequence of the native sequence PRO1325 cDNA (SEQ ID NO: 217), which is a clone designated herein as “DNA66659-1593”. FIG. 218 shows the amino acid sequence (SEQ ID NO: 218) derived from the coding sequence of SEQ ID NO: 217 shown in FIG. 217. FIG. 219 shows the nucleotide sequence of the native sequence PRO1329 cDNA (SEQ ID NO: 219), which is a clone designated herein as “DNA66660-1585”. FIG. 220 shows an amino acid sequence (SEQ ID NO: 220) derived from the coding sequence of SEQ ID NO: 219 shown in FIG. 219. FIG. 221 shows the nucleotide sequence of the native sequence PRO1338 cDNA (SEQ ID NO: 221), which is a clone herein designated “DNA66667-1596”. FIG. 222 shows the amino acid sequence (SEQ ID NO: 222) derived from the coding sequence of SEQ ID NO: 221 shown in FIG. FIG. 223 shows the nucleotide sequence of the native sequence PR1337 cDNA (SEQ ID NO: 223), which is a clone herein designated “DNA66672-1586”. FIG. 224 shows the amino acid sequence (SEQ ID NO: 224) derived from the coding sequence of SEQ ID NO: 223 shown in FIG. FIG. 225 shows the nucleotide sequence of the native sequence PRO1343 cDNA (SEQ ID NO: 225), which is a clone herein designated “DNA66675-1587”. FIG. 226 shows the amino acid sequence (SEQ ID NO: 226) derived from the coding sequence of SEQ ID NO: 225 shown in FIG. 225. FIG. 227 shows the nucleotide sequence of the native sequence PRO1376 cDNA (SEQ ID NO: 27), which is a clone herein designated “DNA67300-1605”. FIG. 228 shows the amino acid sequence (SEQ ID NO: 228) derived from the coding sequence of SEQ ID NO: 227 shown in FIG. FIG. 229 shows the nucleotide sequence of the native sequence PRO1434 cDNA (SEQ ID NO: 229), which is a clone designated herein as “DNA68818-2536”. FIG. 230 shows the amino acid sequence (SEQ ID NO: 230) derived from the coding sequence of SEQ ID NO: 229 shown in FIG. FIG. 231 shows the nucleotide sequence of the native sequence PRO3579 cDNA (SEQ ID NO: 231), which is a clone designated herein as “DNA68862-2546”. FIG. 232 shows the amino acid sequence (SEQ ID NO: 232) derived from the coding sequence of SEQ ID NO: 231 shown in FIG. FIG. 233 shows the nucleotide sequence of the native sequence PRO1387 cDNA (SEQ ID NO: 233), which is a clone designated herein as “DNA68872-1620”. FIG. 234 shows the amino acid sequence (SEQ ID NO: 234) derived from the coding sequence of SEQ ID NO: 233 shown in FIG. FIG. 235 shows the nucleotide sequence of the native sequence PRO1419 cDNA (SEQ ID NO: 235), which is a clone designated herein as “DNA71290-1630”. FIG. 236 shows the amino acid sequence (SEQ ID NO: 236) derived from the coding sequence of SEQ ID NO: 235 shown in FIG. FIG. 237 shows the nucleotide sequence of the native sequence PRO1488 cDNA (SEQ ID NO: 237), which is a clone herein designated “DNA73736-1657”. FIG. 238 shows the amino acid sequence (SEQ ID NO: 238) derived from the coding sequence of SEQ ID NO: 237 shown in FIG. FIG. 239 shows the nucleotide sequence of the native sequence PRO1474 cDNA (SEQ ID NO: 239), which is a clone designated herein as “DNA73739-1645”. 240 shows the amino acid sequence (SEQ ID NO: 240) derived from the coding sequence of SEQ ID NO: 239 shown in FIG. 239. FIG. 241 shows the nucleotide sequence of the native sequence PRO1508 cDNA (SEQ ID NO: 241), which is a clone designated herein as “DNA73742-1662”. FIG. 242 shows the amino acid sequence (SEQ ID NO: 242) derived from the coding sequence of SEQ ID NO: 241 shown in FIG. FIG. 243 shows the nucleotide sequence of the native sequence PRO1754 cDNA (SEQ ID NO: 243), which is a clone designated herein as “DNA76385-1692”. FIG. 244 shows the amino acid sequence (SEQ ID NO: 244) derived from the coding sequence of SEQ ID NO: 243 shown in FIG. FIG. 245 shows the nucleotide sequence of the native sequence PRO1550 cDNA (SEQ ID NO: 245), which is a clone designated herein as “DNA76393-1664”. FIG. 246 shows the amino acid sequence (SEQ ID NO: 246) derived from the coding sequence of SEQ ID NO: 245 shown in FIG. FIG. 247 shows the nucleotide sequence of the native sequence PRO1758 cDNA (SEQ ID NO: 247), which is a clone herein designated “DNA76399-1700”. FIG. 248 shows the amino acid sequence (SEQ ID NO: 248) derived from the coding sequence of SEQ ID NO: 247 shown in FIG. 247. FIG. 249 shows the nucleotide sequence of the native sequence PRO1917 cDNA (SEQ ID NO: 249), which is a clone herein designated “DNA76400-2528”. FIG. 250 shows the amino acid sequence (SEQ ID NO: 250) derived from the coding sequence of SEQ ID NO: 249 shown in FIG. FIG. 251 shows the nucleotide sequence of the native sequence PRO1787 cDNA (SEQ ID NO: 251), which is a clone designated herein as “DNA76510-2504”. FIG. 252 shows the amino acid sequence (SEQ ID NO: 252) derived from the coding sequence of SEQ ID NO: 251 shown in FIG. FIG. 253 shows the nucleotide sequence of the native sequence PRO1556 cDNA (SEQ ID NO: 253), which is a clone herein designated “DNA76529-1666”. FIG. 254 shows the amino acid sequence (SEQ ID NO: 254) derived from the coding sequence of SEQ ID NO: 253 shown in FIG. FIG. 255 shows the nucleotide sequence of the native sequence PRO1760 cDNA (SEQ ID NO: 255), which is a clone designated herein as “DNA76532-1702”. FIG. 256 shows an amino acid sequence (SEQ ID NO: 256) derived from the coding sequence of SEQ ID NO: 255 shown in FIG. FIG. 257 shows the nucleotide sequence of the native sequence PRO1567 cDNA (SEQ ID NO: 257), which is a clone designated herein as “DNA76541-1675”. FIG. 258 shows the amino acid sequence (SEQ ID NO: 258) derived from the coding sequence of SEQ ID NO: 257 shown in FIG. FIG. 259 shows the nucleotide sequence of the native sequence PRO1600 cDNA (SEQ ID NO: 259), which is a clone designated herein as “DNA77503-1686”. FIG. 260 shows an amino acid sequence (SEQ ID NO: 260) derived from the coding sequence of SEQ ID NO: 259 shown in FIG. FIG. 261 shows the nucleotide sequence (SEQ ID NO: 261) of native sequence PRO1868 cDNA, which is a clone designated herein as “DNA77624-2515”. FIG. 262 shows the amino acid sequence (SEQ ID NO: 262) derived from the coding sequence of SEQ ID NO: 261 shown in FIG. FIG. 263 shows the nucleotide sequence of the native sequence PRO1890 cDNA (SEQ ID NO: 263), which is a clone designated herein as “DNA79230-2525”. FIG. 264 shows the amino acid sequence (SEQ ID NO: 264) derived from the coding sequence of SEQ ID NO: 263 shown in FIG. FIG. 265 shows the nucleotide sequence of the native sequence PRO1887 cDNA (SEQ ID NO: 265), which is a clone designated herein as “DNA79862-2522”. FIG. 266 shows the amino acid sequence (SEQ ID NO: 266) derived from the coding sequence of SEQ ID NO: 265 shown in FIG. 265. FIG. 267 shows the nucleotide sequence of the native sequence PRO4353 cDNA (SEQ ID NO: 267), which is a clone designated herein as “DNA80145-2594”. FIG. 268 shows the amino acid sequence (SEQ ID NO: 268) derived from the coding sequence of SEQ ID NO: 267 shown in FIG. 267. FIG. 269 shows the nucleotide sequence of native sequence PRO1782 cDNA (SEQ ID NO: 269), which is a clone designated herein as “DNA80899-2501”. FIG. 270 shows the amino acid sequence (SEQ ID NO: 270) derived from the coding sequence of SEQ ID NO: 269 shown in FIG. FIG. 271 shows the nucleotide sequence of the native sequence PRO1928 cDNA (SEQ ID NO: 271), which is a clone herein designated “DNA81754-2532”. FIG. 272 shows the amino acid sequence (SEQ ID NO: 272) derived from the coding sequence of SEQ ID NO: 271 shown in FIG. FIG. 273 shows the nucleotide sequence of the native sequence PRO1865 cDNA (SEQ ID NO: 273), which is a clone designated herein as “DNA81757-2512”. FIG. 274 shows the amino acid sequence (SEQ ID NO: 274) derived from the coding sequence of SEQ ID NO: 273 shown in FIG. 273. FIG. 275 shows the nucleotide sequence of the native sequence PRO4341 cDNA (SEQ ID NO: 275), which is a clone herein designated “DNA81761-2583”. FIG. 276 shows the amino acid sequence (SEQ ID NO: 276) derived from the coding sequence of SEQ ID NO: 275 shown in FIG. 275. FIG. 277 shows the nucleotide sequence of the native sequence PRO6714 cDNA (SEQ ID NO: 277), which is a clone designated herein as “DNA82358-2738”. FIG. 278 shows the amino acid sequence (SEQ ID NO: 278) derived from the coding sequence of SEQ ID NO: 277 shown in FIG. 277. FIG. 279 shows the nucleotide sequence of the native sequence PRO5723 cDNA (SEQ ID NO: 279), which is a clone designated herein as “DNA82361”. FIG. 280 shows the amino acid sequence (SEQ ID NO: 280) derived from the coding sequence of SEQ ID NO: 279 shown in FIG. FIG. 281 shows the nucleotide sequence of the native sequence PRO3438 cDNA (SEQ ID NO: 281), which is a clone herein designated “DNA82364-2538”. FIG. 282 shows the amino acid sequence (SEQ ID NO: 282) derived from the coding sequence of SEQ ID NO: 281 shown in FIG. FIG. 283 shows the nucleotide sequence of the native sequence PRO6071 cDNA (SEQ ID NO: 283), which is a clone designated herein as “DNA82403-2959”. FIG. 284 shows the amino acid sequence (SEQ ID NO: 284) derived from the coding sequence of SEQ ID NO: 283 shown in FIG. FIG. 285 shows the nucleotide sequence of the native sequence PRO1801 cDNA (SEQ ID NO: 285), which is a clone designated herein as “DNA83500-2506”. FIG. 286 shows the amino acid sequence (SEQ ID NO: 286) derived from the coding sequence of SEQ ID NO: 285 shown in FIG. FIG. 287 shows the nucleotide sequence of the native sequence PRO4324 cDNA (SEQ ID NO: 287), which is a clone herein designated “DNA83560-2569”. FIG. 288 shows the amino acid sequence (SEQ ID NO: 288) derived from the coding sequence of SEQ ID NO: 287 shown in FIG. 287. FIG. 289 shows the nucleotide sequence of the native sequence PRO4333 cDNA (SEQ ID NO: 289), which is a clone designated herein as “DNA84210-2576”. FIG. 290 shows the amino acid sequence (SEQ ID NO: 290) derived from the coding sequence of SEQ ID NO: 289 shown in FIG. FIG. 291 shows the nucleotide sequence of the native sequence PRO4405 cDNA (SEQ ID NO: 291), which is a clone herein designated “DNA84920-2614”. FIG. 292 shows the amino acid sequence (SEQ ID NO: 292) derived from the coding sequence of SEQ ID NO: 291 shown in FIG. FIG. 293 shows the nucleotide sequence of the native sequence PRO4356 cDNA (SEQ ID NO: 293), which is a clone designated herein as “DNA86576-2595”. FIG. 294 shows the amino acid sequence (SEQ ID NO: 294) derived from the coding sequence of SEQ ID NO: 293 shown in FIG. 293. FIG. 295 shows the nucleotide sequence of the native sequence PRO3444 cDNA (SEQ ID NO: 295), which is a clone herein designated “DNA87997”. FIG. 296 shows the amino acid sequence (SEQ ID NO: 296) derived from the coding sequence of SEQ ID NO: 295 shown in FIG. 295. FIG. 297 shows the nucleotide sequence of the native sequence PRO4302 cDNA (SEQ ID NO: 297), which is a clone herein designated “DNA92218-2554”. FIG. 298 shows the amino acid sequence (SEQ ID NO: 298) derived from the coding sequence of SEQ ID NO: 297 shown in FIG. 297. FIG. 299 shows the nucleotide sequence of the native sequence PRO4371 cDNA (SEQ ID NO: 299), which is a clone herein designated “DNA92233-2599”. FIG. 300 shows an amino acid sequence (SEQ ID NO: 300) derived from the coding sequence of SEQ ID NO: 299 shown in FIG. FIG. 301 shows the nucleotide sequence of the native sequence PRO4354 cDNA (SEQ ID NO: 301), which is a clone designated herein as “DNA92256-2596”. 302 shows the amino acid sequence (SEQ ID NO: 302) derived from the coding sequence of SEQ ID NO: 301 shown in FIG. 301. FIG. 303 shows the nucleotide sequence of the native sequence PRO5725 cDNA (SEQ ID NO: 303), which is a clone herein designated “DNA92265-2669”. 304 shows the amino acid sequence (SEQ ID NO: 304) derived from the coding sequence of SEQ ID NO: 303 shown in FIG. 303. FIG. 305 shows the nucleotide sequence of the native sequence PRO4408 cDNA (SEQ ID NO: 305), which is a clone herein designated “DNA92274-2617”. FIG. 306 shows the amino acid sequence (SEQ ID NO: 306) derived from the coding sequence of SEQ ID NO: 305 shown in FIG. 305. FIG. 307 shows the nucleotide sequence of the native sequence PRO9940 cDNA (SEQ ID NO: 307), which is a clone herein designated “DNA92282”. FIG. 308 shows the amino acid sequence (SEQ ID NO: 308) derived from the coding sequence of SEQ ID NO: 307 shown in FIG. FIG. 309 shows the nucleotide sequence of the native sequence PRO5737 cDNA (SEQ ID NO: 309), which is a clone designated herein as “DNA92929-2534-1”. FIG. 310 shows the amino acid sequence (SEQ ID NO: 310) derived from the coding sequence of SEQ ID NO: 309 shown in FIG. FIG. 311 shows the nucleotide sequence of the native sequence PRO4425 cDNA (SEQ ID NO: 311), which is a clone designated herein as “DNA93011-2637”. FIG. 312 shows an amino acid sequence (SEQ ID NO: 312) derived from the coding sequence of SEQ ID NO: 311 shown in FIG. 311. FIG. 313 shows the nucleotide sequence of the native sequence PRO4345 cDNA (SEQ ID NO: 313), which is a clone herein designated “DNA94854-2586”. FIG. 314 shows the amino acid sequence (SEQ ID NO: 314) derived from the coding sequence of SEQ ID NO: 313 shown in FIG. FIG. 315 shows the nucleotide sequence of the native sequence PRO4342 cDNA (SEQ ID NO: 315), which is a clone designated herein as “DNA96787-2534-1”. FIG. 316 shows the amino acid sequence (SEQ ID NO: 316) derived from the coding sequence of SEQ ID NO: 315 shown in FIG. FIG. 317 shows the nucleotide sequence of the native sequence PRO3562 cDNA (SEQ ID NO: 317), which is a clone designated herein as “DNA96791”. FIG. 318 shows the amino acid sequence (SEQ ID NO: 318) derived from the coding sequence of SEQ ID NO: 317 shown in FIG. FIG. 319 shows the nucleotide sequence of the native sequence PRO4422 cDNA (SEQ ID NO: 319), which is a clone designated herein as “DNA96867-2620”. FIG. 320 shows the amino acid sequence (SEQ ID NO: 320) derived from the coding sequence of SEQ ID NO: 319 shown in FIG. FIG. 321 shows the nucleotide sequence of the native sequence PRO5776 cDNA (SEQ ID NO: 321), which is a clone designated herein as “DNA96872-2674”. FIG. 322 shows the amino acid sequence (SEQ ID NO: 322) derived from the coding sequence of SEQ ID NO: 321 shown in FIG. FIG. 323 shows the nucleotide sequence of the native sequence PRO4430 cDNA (SEQ ID NO: 323), which is a clone herein designated “DNA96878-2626”. FIG. 324 shows the amino acid sequence (SEQ ID NO: 324) derived from the coding sequence of SEQ ID NO: 323 shown in FIG. 323. FIG. 325 shows the nucleotide sequence of native sequence PRO4499 cDNA (SEQ ID NO: 325), which is a clone designated herein as “DNA96889-2641”. FIG. 326 shows the amino acid sequence (SEQ ID NO: 326) derived from the coding sequence of SEQ ID NO: 325 shown in FIG. 325. FIG. 327 shows the nucleotide sequence of the native sequence PRO4503 cDNA (SEQ ID NO: 327), which is a clone designated herein as “DNA100312-2645”. FIG. 328 shows the amino acid sequence (SEQ ID NO: 328) derived from the coding sequence of SEQ ID NO: 327 shown in FIG. FIG. 329 shows the nucleotide sequence of the native sequence PRO10008 cDNA (SEQ ID NO: 329), which is a clone herein designated “DNA101921”. FIG. 330 shows the amino acid sequence (SEQ ID NO: 330) derived from the coding sequence of SEQ ID NO: 329 shown in FIG. 329. FIG. 331 shows the nucleotide sequence of the native sequence PRO5730 cDNA (SEQ ID NO: 331), which is a clone herein designated “DNA101926”. FIG. 332 shows the amino acid sequence (SEQ ID NO: 332) derived from the coding sequence of SEQ ID NO: 331 shown in FIG. FIG. 333 shows the nucleotide sequence of the native sequence PRO6008 cDNA (SEQ ID NO: 333), which is a clone herein designated “DNA102844”. FIG. 334 shows the amino acid sequence (SEQ ID NO: 334) derived from the coding sequence of SEQ ID NO: 333 shown in FIG. 333. FIG. 335 shows the nucleotide sequence of the native sequence PRO4527 cDNA (SEQ ID NO: 335), which is a clone herein designated “DNA103197”. FIG. 336 shows the amino acid sequence (SEQ ID NO: 336) derived from the coding sequence of SEQ ID NO: 335 shown in FIG. FIG. 337 shows the nucleotide sequence of the native sequence PRO4538 cDNA (SEQ ID NO: 337), which is a clone designated herein as “DNA103208”. FIG. 338 shows the amino acid sequence (SEQ ID NO: 338) derived from the coding sequence of SEQ ID NO: 337 shown in FIG. FIG. 339 shows the nucleotide sequence of the native sequence PRO4553 cDNA (SEQ ID NO: 339), which is a clone herein designated “DNA103223”. FIG. 340 shows the amino acid sequence (SEQ ID NO: 340) derived from the coding sequence of SEQ ID NO: 339 shown in FIG. FIG. 341 shows the nucleotide sequence of the native sequence PRO6006 cDNA (SEQ ID NO: 341), which is a clone herein designated “DNA105782-2693”. FIG. 342 shows the amino acid sequence (SEQ ID NO: 342) derived from the coding sequence of SEQ ID NO: 341 shown in FIG. FIG. 343 shows the nucleotide sequence of the native sequence PRO6029 cDNA (SEQ ID NO: 343), which is a clone designated herein as “DNA105849-2704”. FIG. 344 shows the amino acid sequence (SEQ ID NO: 344) derived from the coding sequence of SEQ ID NO: 343 shown in FIG. 343. FIG. 345 shows the nucleotide sequence of the native sequence PRO9821 cDNA (SEQ ID NO: 345), which is a clone designated herein as “DNA108725-2766”. FIG. 346 shows the amino acid sequence (SEQ ID NO: 346) derived from the coding sequence of SEQ ID NO: 345 shown in FIG. 345. FIG. 347 shows the nucleotide sequence of the native sequence PRO9820 cDNA (SEQ ID NO: 347), which is a clone designated herein as “DNA108769-2765”. FIG. 348 shows the amino acid sequence (SEQ ID NO: 348) derived from the coding sequence of SEQ ID NO: 347 shown in FIG. 347. FIG. 349 shows the nucleotide sequence of the native sequence PRO9771 cDNA (SEQ ID NO: 349), which is a clone designated herein as “DNA119498-2965”. FIG. 350 shows the amino acid sequence (SEQ ID NO: 350) derived from the coding sequence of SEQ ID NO: 349 shown in FIG. FIG. 351 shows the nucleotide sequence of the native sequence PRO7436 cDNA (SEQ ID NO: 351), which is a clone herein designated “DNA119535-2756”. FIG. 352 shows the amino acid sequence (SEQ ID NO: 352) derived from the coding sequence of SEQ ID NO: 351 shown in FIG. FIG. 353 shows the nucleotide sequence of the native sequence PRO10096 cDNA (SEQ ID NO: 353), which is a clone herein designated “DNA125185-2806”. FIG. 354 shows the amino acid sequence (SEQ ID NO: 354) derived from the coding sequence of SEQ ID NO: 353 shown in FIG. FIG. 355 shows the nucleotide sequence of the native sequence PRO19670 cDNA (SEQ ID NO: 355), which is a clone designated herein as “DNA131639-2874”. FIG. 356 shows the amino acid sequence (SEQ ID NO: 356) derived from the coding sequence of SEQ ID NO: 355 shown in FIG.355. FIG. 357 shows the nucleotide sequence of the native sequence PRO20044 cDNA (SEQ ID NO: 357), which is a clone herein designated “DNA139623-2893”. FIG. 358 shows the amino acid sequence (SEQ ID NO: 358) derived from the coding sequence of SEQ ID NO: 357 shown in FIG. FIG. 359 shows the nucleotide sequence of the native sequence PRO9873 cDNA (SEQ ID NO: 359), which is a clone designated herein as “DNA143076-2787”. FIG. 360 shows an amino acid sequence (SEQ ID NO: 360) derived from the coding sequence of SEQ ID NO: 359 shown in FIG. FIG. 361 shows the nucleotide sequence of the native sequence PRO21366 cDNA (SEQ ID NO: 361), which is a clone designated herein as “DNA143276-2975”. FIG. 362 shows the amino acid sequence (SEQ ID NO: 362) derived from the coding sequence of SEQ ID NO: 361 shown in FIG. FIG. 363 shows the nucleotide sequence of the native sequence PRO20040 cDNA (SEQ ID NO: 363), which is a clone herein designated “DNA164625-2890”. FIG. 364 shows the amino acid sequence (SEQ ID NO: 364) derived from the coding sequence of SEQ ID NO: 363 shown in FIG. 363. FIG. 365 shows the nucleotide sequence of the native sequence PRO21184 cDNA (SEQ ID NO: 365), which is a clone designated herein as “DNA167678-2963”. FIG. 366 shows the amino acid sequence (SEQ ID NO: 366) derived from the coding sequence of SEQ ID NO: 365 shown in FIG. 365. FIG. 367 shows the nucleotide sequence of the native sequence PRO21055 cDNA (SEQ ID NO: 367), which is a clone designated herein as “DNA170021-2923”. FIG. 368 shows the amino acid sequence (SEQ ID NO: 368) derived from the coding sequence of SEQ ID NO: 367 shown in FIG. FIG. 369 shows the nucleotide sequence of the native sequence PRO28631 cDNA (SEQ ID NO: 369), which is a clone herein designated “DNA170212-3000”. FIG. 370 shows the amino acid sequence (SEQ ID NO: 370) derived from the coding sequence of SEQ ID NO: 369 shown in FIG. FIG. 371 shows the nucleotide sequence of the native sequence PRO21384 cDNA (SEQ ID NO: 371), which is a clone designated herein as “DNA177313-2982”. FIG. 372 shows the amino acid sequence (SEQ ID NO: 372) derived from the coding sequence of SEQ ID NO: 371 shown in FIG. FIG. 373 shows the nucleotide sequence of the native sequence PRO1449 cDNA (SEQ ID NO: 373), which is a clone herein designated “DNA64908-1163-1”. FIG. 374 shows the amino acid sequence (SEQ ID NO: 374) derived from the coding sequence of SEQ ID NO: 373 shown in FIG. FIG. 375 shows the results of whole-mount hybridization of in situ hybridization in a mouse embryo using a mouse ortholog of PRO1449 having about 78% amino acid identity with PRO1449. The results indicate that PRO1449 ortholog is expressed in the developing vasculature. Furthermore, the sections show expression in endothelial cells and endothelial progenitor cells. FIG. 376 shows that an ortholog of PRO1449 with about 78% amino acid identity to PRO1449 is expressed in the vasculature of many inflamed and diseased tissues, and very low in normal adult blood vessels Or indicate that it is deficient. FIG. 377 shows that an ortholog of PRO1449 with about 78% amino acid identity to PRO1449 induces ectopic blood vessels in the chick fetal eye.

Claims (43)

Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 4), Figure 6 (SEQ ID NO: 6), Figure 8 (SEQ ID NO: 8), Figure 10 (SEQ ID NO: 10), Figure 12 (SEQ ID NO: : 12), Figure 14 (SEQ ID NO: 14), Figure 16 (SEQ ID NO: 16), Figure 18 (SEQ ID NO: 18), Figure 20 (SEQ ID NO: 20), Figure 22 (SEQ ID NO: 22), Figure 24 (SEQ ID NO: 24), Figure 26 (SEQ ID NO: 26), Figure 28 (SEQ ID NO: 28), Figure 30 (SEQ ID NO: 30), Figure 32 (SEQ ID NO: 32), Figure 34 (SEQ ID NO: 34), Figure 36 (SEQ ID NO: 36), Figure 38 (SEQ ID NO: 38), Figure 40 (SEQ ID NO: 40), Figure 42 (SEQ ID NO: 42), Figure 44 (SEQ ID NO: 44), Figure 46 (SEQ ID NO: 46), Figure 48 (SEQ ID NO: 48), Figure 50 (SEQ ID NO: 50), Figure 52 (SEQ ID NO: 52), Figure 54 (SEQ ID NO: 54), Figure 56 (SEQ ID NO: 56) ), Figure 58 (SEQ ID NO: 58), Figure 60 (SEQ ID NO: 60), Figure 62 (SEQ ID NO: 62), Figure 64 (SEQ ID NO: 64), Figure 66 (SEQ ID NO: 66), Figure 68 ( SEQ ID NO: 68), FIG. 70 (SEQ ID NO: 70), FIG. 72 (SEQ ID NO: 72), Figure 74 (SEQ ID NO: 74), Figure 76 (SEQ ID NO: 76), Figure 78 (SEQ ID NO: 78), Figure 80 (SEQ ID NO: 80), Figure 82 (SEQ ID NO: 82), Figure 84 (SEQ ID NO: : 84), Figure 86 (SEQ ID NO: 86), Figure 88 (SEQ ID NO: 88), Figure 90 (SEQ ID NO: 90), Figure 92 (SEQ ID NO: 92), Figure 94 (SEQ ID NO: 94), Figure 96 (SEQ ID NO: 96), Figure 98 (SEQ ID NO: 98), Figure 100 (SEQ ID NO: 100), Figure 102 (SEQ ID NO: 102), Figure 104 (SEQ ID NO: 104), Figure 106 (SEQ ID NO: 106), Figure 108 (SEQ ID NO: 108), Figure 110 (SEQ ID NO: 110), Figure 112 (SEQ ID NO: 112), Figure 114 (SEQ ID NO: 114), Figure 116 (SEQ ID NO: 116), Figure 118 (SEQ ID NO: 118), Figure 120 (SEQ ID NO: 120), Figure 122 (SEQ ID NO: 122), Figure 124 (SEQ ID NO: 124), Figure 126 (SEQ ID NO: 126), Figure 128 (SEQ ID NO: 128) ), Figure 130 (SEQ ID NO: 130), Figure 132 (SEQ ID NO: 132), Figure 134 (SEQ ID NO: 134), Figure 136 (SEQ ID NO: 136), Figure 138 (SEQ ID NO: 138), Figure 140 ( SEQ ID NO: 140), Figure 1 42 (SEQ ID NO: 142), Figure 144 (SEQ ID NO: 144), Figure 146 (SEQ ID NO: 146), Figure 148 (SEQ ID NO: 148), Figure 150 (SEQ ID NO: 150), Figure 152 (SEQ ID NO: 152), Figure 154 (SEQ ID NO: 154), Figure 156 (SEQ ID NO: 156), Figure 158 (SEQ ID NO: 158), Figure 160 (SEQ ID NO: 160), Figure 162 (SEQ ID NO: 162), Figure 164 (SEQ ID NO: 164), Figure 166 (SEQ ID NO: 166), Figure 168 (SEQ ID NO: 168), Figure 170 (SEQ ID NO: 170), Figure 172 (SEQ ID NO: 172), Figure 174 (SEQ ID NO: 174) ), Figure 176 (SEQ ID NO: 176), Figure 178 (SEQ ID NO: 178), Figure 180 (SEQ ID NO: 180), Figure 182 (SEQ ID NO: 182), Figure 184 (SEQ ID NO: 184), Figure 186 ( SEQ ID NO: 186), Figure 188 (SEQ ID NO: 188), Figure 190 (SEQ ID NO: 190), Figure 192 (SEQ ID NO: 192), Figure 194 (SEQ ID NO: 194), Figure 196 (SEQ ID NO: 196) , Figure 198 (SEQ ID NO: 198), Figure 200 (SEQ ID NO: 200), Figure 202 (SEQ ID NO: 202), Figure 204 (SEQ ID NO: 204), Figure 206 (SEQ ID NO: 206), Figure 208 (Array Figure 208 (SEQ ID NO: 210), Figure 212 (SEQ ID NO: 212), Figure 214 (SEQ ID NO: 214), Figure 216 (SEQ ID NO: 216), Figure 218 (SEQ ID NO: 218), Figure 220 (SEQ ID NO: 220), Figure 222 (SEQ ID NO: 222), Figure 224 (SEQ ID NO: 224), Figure 226 (SEQ ID NO: 226), Figure 228 (SEQ ID NO: 228), Figure 230 (SEQ ID NO: : 230), Figure 232 (SEQ ID NO: 232), Figure 234 (SEQ ID NO: 234), Figure 236 (SEQ ID NO: 236), Figure 238 (SEQ ID NO: 238), Figure 240 (SEQ ID NO: 240), Figure 242 (SEQ ID NO: 242), Figure 244 (SEQ ID NO: 244), Figure 246 (SEQ ID NO: 246), Figure 248 (SEQ ID NO: 248), Figure 250 (SEQ ID NO: 250), Figure 252 (SEQ ID NO: 252), Figure 254 (SEQ ID NO: 254), Figure 256 (SEQ ID NO: 256), Figure 258 (SEQ ID NO: 258), Figure 260 (SEQ ID NO: 260), Figure 262 (SEQ ID NO: 262), Figure 264 (SEQ ID NO: 264), Figure 266 (SEQ ID NO: 266), Figure 268 (SEQ ID NO: 268), Figure 270 (SEQ ID NO: 270), Figure 272 (SEQ ID NO: 272), Figure 274 (SEQ ID NO: 274), Figure 276 (SEQ ID NO: 276), Figure 278 (SEQ ID NO: 278), Figure 280 (SEQ ID NO: 280), Figure 282 (SEQ ID NO: 282), Figure 284 (SEQ ID NO: 284), Figure 286 (SEQ ID NO: 286), Figure 288 (SEQ ID NO: 288), Figure 290 (SEQ ID NO: 290), Figure 292 (SEQ ID NO: 292), Figure 294 (SEQ ID NO: 294), Figure 296 (SEQ ID NO: 296) ), Figure 298 (SEQ ID NO: 298), Figure 300 (SEQ ID NO: 300), Figure 302 (SEQ ID NO: 302), Figure 304 (SEQ ID NO: 304), Figure 306 (SEQ ID NO: 306), Figure 308 ( SEQ ID NO: 308), Figure 310 (SEQ ID NO: 310), Figure 312 (SEQ ID NO: 312), Figure 314 (SEQ ID NO: 314), Figure 316 (SEQ ID NO: 316), Figure 318 (SEQ ID NO: 318) , Figure 320 (SEQ ID NO: 320), Figure 322 (SEQ ID NO: 322), Figure 324 (SEQ ID NO: 324), Figure 326 (SEQ ID NO: 326), Figure 328 (SEQ ID NO: 328), Figure 330 (Sequence) Figure 332 (SEQ ID NO: 332), Figure 334 (SEQ ID NO: 334), Figure 336 (SEQ ID NO: 336), Figure 338 (SEQ ID NO: 338), Figure 340 (SEQ ID NO: 340), Figure 342 (SEQ ID NO: 342), Figure 344 (SEQ ID NO: 344), Figure 346 (SEQ ID NO: 346), Figure 348 (SEQ ID NO: 348), Figure 350 (SEQ ID NO: 350), Figure 352 (SEQ ID NO: 352), Figure 354 (SEQ ID NO: 354), Figure 356 (SEQ ID NO: 356), Figure 358 (SEQ ID NO: 358), Figure 360 (SEQ ID NO: 360), Figure 362 (SEQ ID NO: 362), Figure 364 (SEQ ID NO: 364), Figure 366 (SEQ ID NO: 366), Figure 368 (SEQ ID NO: 368), Figure 370 (SEQ ID NO: 370), Figure 372 (SEQ ID NO: 372) and Figure 374 (SEQ ID NO: 374) ) An isolated nucleic acid molecule having at least 80% nucleic acid sequence identity with a nucleotide sequence encoding an amino acid selected from the group consisting of the amino acid sequences shown in Figure 1 (SEQ ID NO: 1), Figure 3 (SEQ ID NO: 3), Figure 5 (SEQ ID NO: 5), Figure 7 (SEQ ID NO: 7), Figure 9 (SEQ ID NO: 9), Figure 11 (SEQ ID NO: : 11), Figure 13 (SEQ ID NO: 13), Figure 15 (SEQ ID NO: 15), Figure 17 (SEQ ID NO: 17), Figure 19 (SEQ ID NO: 19), Figure 21 (SEQ ID NO: 21), Figure 23 (SEQ ID NO: 23), Figure 25 (SEQ ID NO: 25), Figure 27 (SEQ ID NO: 27), Figure 29 (SEQ ID NO: 29), Figure 31 (SEQ ID NO: 31), Figure 33 (SEQ ID NO: 33), Figure 35 (SEQ ID NO: 35), Figure 37 (SEQ ID NO: 37), Figure 39 (SEQ ID NO: 39), Figure 41 (SEQ ID NO: 41), Figure 43 (SEQ ID NO: 43), Figure 45 (SEQ ID NO: 45), Figure 47 (SEQ ID NO: 47), Figure 49 (SEQ ID NO: 49), Figure 51 (SEQ ID NO: 51), Figure 53 (SEQ ID NO: 53), Figure 55 (SEQ ID NO: 55) ), Figure 57 (SEQ ID NO: 57), Figure 59 (SEQ ID NO: 59), Figure 61 (SEQ ID NO: 61), Figure 63 (SEQ ID NO: 63), Figure 65 (SEQ ID NO: 65), Figure 67 ( SEQ ID NO: 67), FIG. 69 (SEQ ID NO: 69), FIG. 71 (SEQ ID NO: 71), 73 (SEQ ID NO: 73), Figure s 75A-75B (SEQ ID NO: 75), Figure 77 (SEQ ID NO: 77), Figure 79 (SEQ ID NO: 79), Figure 81 (SEQ ID NO: 81), Figure 83 ( SEQ ID NO: 83), FIG. 85 (SEQ ID NO: 85), FIG. 87 (SEQ ID NO: 87), FIG. 89 (SEQ ID NO: 89), FIG. 91 (SEQ ID NO: 91), FIG. 93 (SEQ ID NO: 93) , Figure 95 (SEQ ID NO: 95), Figure 97 (SEQ ID NO: 97), Figure 99 (SEQ ID NO: 99), Figure 101 (SEQ ID NO: 101), Figure 103 (SEQ ID NO: 103), Figure 105 (SEQ ID NO: 103) No. 105), FIG. 107 (SEQ ID NO: 107), FIG. 109 (SEQ ID NO: 109), FIG. 111 (SEQ ID NO: 111), FIG. 113 (SEQ ID NO: 113), FIG. 115 (SEQ ID NO: 115), Figure 117 (SEQ ID NO: 117), Figure 119 (SEQ ID NO: 119), Figure 121 (SEQ ID NO: 121), Figure 123 (SEQ ID NO: 123), Figure 125 (SEQ ID NO: 125), Figure 127 (SEQ ID NO: : 127), Figure 129 (SEQ ID NO: 129), Figure 131 (SEQ ID NO: 131), Figure 133 (SEQ ID NO: 133), Figure 135 (SEQ ID NO: 135), Figure 137 (SEQ ID NO: 137), Figure 139 (SEQ ID NO: 139), figure 141 (SEQ ID NO: 141), Figure 143 (SEQ ID NO: 143), Figure 145 (SEQ ID NO: 145), Figure 147 (SEQ ID NO: 147), Figure 149 (SEQ ID NO: 149), Figure 151 (SEQ ID NO: 151), Figure 153 (SEQ ID NO: 153), Figure 155 (SEQ ID NO: 155), Figure 157 (SEQ ID NO: 157), Figure 159 (SEQ ID NO: 159), Figure 161 (SEQ ID NO: 161), Figure 163 (SEQ ID NO: 163), Figure 165 (SEQ ID NO: 165), Figure 167 (SEQ ID NO: 167), Figure 169 (SEQ ID NO: 169), Figure 171 (SEQ ID NO: 171), Figure 173 (SEQ ID NO: 173) ), Figure 175 (SEQ ID NO: 175), Figure 177 (SEQ ID NO: 177), Figure 179 (SEQ ID NO: 179), Figure 181 (SEQ ID NO: 181), Figure 183 (SEQ ID NO: 183), Figure 185 ( SEQ ID NO: 185), Figure 187 (SEQ ID NO: 187), Figure 189 (SEQ ID NO: 189), Figure 191 (SEQ ID NO: 191), Figure 193 (SEQ ID NO: 193), Figure 195 (SEQ ID NO: 195) , Figure 197 (SEQ ID NO: 197), Figure 199 (SEQ ID NO: 199), Figure 201 (SEQ ID NO: 201), Figure 203 (SEQ ID NO: 203), Figure 205 (SEQ ID NO: 205), Figure 207 (Arrangement Column number: 207), Figure 209 (SEQ ID NO: 209), Figure 211 (SEQ ID NO: 211), Figure 213 (SEQ ID NO: 213), Figure 215 (SEQ ID NO: 215), Figure 217 (SEQ ID NO: 217) , Figure 219 (SEQ ID NO: 219), Figure 221 (SEQ ID NO: 221), Figure 223 (SEQ ID NO: 223), Figure 225 (SEQ ID NO: 225), Figure 227 (SEQ ID NO: 227), Figure 229 (Sequence) Figure 231), Figure 231 (SEQ ID NO: 231), Figure 233 (SEQ ID NO: 233), Figure 235 (SEQ ID NO: 235), Figure 237 (SEQ ID NO: 237), Figure 239 (SEQ ID NO: 239), Figure 241 (SEQ ID NO: 241), Figure 243 (SEQ ID NO: 243), Figure 245 (SEQ ID NO: 245), Figure 247 (SEQ ID NO: 247), Figure 249 (SEQ ID NO: 249), Figure 251 (SEQ ID NO: : 251), Figure 253 (SEQ ID NO: 253), Figure 255 (SEQ ID NO: 255), Figure 257 (SEQ ID NO: 257), Figure 259 (SEQ ID NO: 259), Figure 261 (SEQ ID NO: 261), Figure 263 (SEQ ID NO: 263), Figure 265 (SEQ ID NO: 265), Figure 267 (SEQ ID NO: 267), Figure 269 (SEQ ID NO: 269), Figure 271 (SEQ ID NO: 271), Figure 273 (SEQ ID NO: 273), Figure 275 (SEQ ID NO: 275), Figure 277 (SEQ ID NO: 277), Figure 279 (SEQ ID NO: 279), Figure 281 (SEQ ID NO: 281), Figure 283 (SEQ ID NO: 283), Figure 285 (SEQ ID NO: 285), Figure 287 (SEQ ID NO: 287), Figure s 289A-289B (SEQ ID NO: 289), Figure 291 (SEQ ID NO: 291), Figure 293 (SEQ ID NO: 293), Figure 295 (Sequence) Figure 297), Figure 297 (SEQ ID NO: 297), Figure 299 (SEQ ID NO: 299), Figure 301 (SEQ ID NO: 301), Figure 303 (SEQ ID NO: 303), Figure 305 (SEQ ID NO: 305), Figure 307 (SEQ ID NO: 307), Figure 309 (SEQ ID NO: 309), Figure s 311A-311B (SEQ ID NO: 311), Figure 313 (SEQ ID NO: 313), Figure 315 (SEQ ID NO: 315), Figure 317 (SEQ ID NO: 317), Figure 319 (SEQ ID NO: 319), Figure 321 (SEQ ID NO: 321), Figure 323 (SEQ ID NO: 323), Figure 325 (SEQ ID NO: 325), Figure 327 (SEQ ID NO: 327) ), Figure 329 (SEQ ID NO: 329), Figure 331 (SEQ ID NO: 331), Figure 333 (SEQ ID NO: 333), Figure 335 (SEQ ID NO: 335), Figure 337 (SEQ ID NO: 337), Figure 339 ( Array 339), Fig. 341 (SEQ ID NO: 341), Fig. 343 (SEQ ID NO: 343), Fig. 345 (SEQ ID NO: 345), Fig. 347 (SEQ ID NO: 347), Fig. 349 (SEQ ID NO: 349), Figures 351A-351B (SEQ ID NO: 351), Figure 353 (SEQ ID NO: 353), Figure 355 (SEQ ID NO: 355), Figure 357 (SEQ ID NO: 357), Figure 359 (SEQ ID NO: 359), Figure 361 (SEQ ID NO: 361), Figure 363 (SEQ ID NO: 363), Figure 365 (SEQ ID NO: 365), Figure 367 (SEQ ID NO: 367), Figure 369 (SEQ ID NO: 369), Figure 371 (SEQ ID NO: 371) ) And FIG. 373 (SEQ ID NO: 373) an isolated nucleic acid molecule having at least 80% nucleic acid sequence identity with a nucleotide sequence selected from the group consisting of the nucleotide sequences shown in FIG. Figure 1 (SEQ ID NO: 1), Figure 3 (SEQ ID NO: 3), Figure 5 (SEQ ID NO: 5), Figure 7 (SEQ ID NO: 7), Figure 9 (SEQ ID NO: 9), Figure 11 (SEQ ID NO: : 11), Figure 13 (SEQ ID NO: 13), Figure 15 (SEQ ID NO: 15), Figure 17 (SEQ ID NO: 17), Figure 19 (SEQ ID NO: 19), Figure 21 (SEQ ID NO: 21), Figure 23 (SEQ ID NO: 23), Figure 25 (SEQ ID NO: 25), Figure 27 (SEQ ID NO: 27), Figure 29 (SEQ ID NO: 29), Figure 31 (SEQ ID NO: 31), Figure 33 (SEQ ID NO: 33), Figure 35 (SEQ ID NO: 35), Figure 37 (SEQ ID NO: 37), Figure 39 (SEQ ID NO: 39), Figure 41 (SEQ ID NO: 41), Figure 43 (SEQ ID NO: 43), Figure 45 (SEQ ID NO: 45), Figure 47 (SEQ ID NO: 47), Figure 49 (SEQ ID NO: 49), Figure 51 (SEQ ID NO: 51), Figure 53 (SEQ ID NO: 53), Figure 55 (SEQ ID NO: 55) ), Figure 57 (SEQ ID NO: 57), Figure 59 (SEQ ID NO: 59), Figure 61 (SEQ ID NO: 61), Figure 63 (SEQ ID NO: 63), Figure 65 (SEQ ID NO: 65), Figure 67 ( SEQ ID NO: 67), FIG. 69 (SEQ ID NO: 69), FIG. 71 (SEQ ID NO: 71), 73 (SEQ ID NO: 73), Figure s 75A-75B (SEQ ID NO: 75), Figure 77 (SEQ ID NO: 77), Figure 79 (SEQ ID NO: 79), Figure 81 (SEQ ID NO: 81), Figure 83 ( SEQ ID NO: 83), FIG. 85 (SEQ ID NO: 85), FIG. 87 (SEQ ID NO: 87), FIG. 89 (SEQ ID NO: 89), FIG. 91 (SEQ ID NO: 91), FIG. 93 (SEQ ID NO: 93) , Figure 95 (SEQ ID NO: 95), Figure 97 (SEQ ID NO: 97), Figure 99 (SEQ ID NO: 99), Figure 101 (SEQ ID NO: 101), Figure 103 (SEQ ID NO: 103), Figure 105 (SEQ ID NO: 103) No. 105), FIG. 107 (SEQ ID NO: 107), FIG. 109 (SEQ ID NO: 109), FIG. 111 (SEQ ID NO: 111), FIG. 113 (SEQ ID NO: 113), FIG. 115 (SEQ ID NO: 115), Figure 117 (SEQ ID NO: 117), Figure 119 (SEQ ID NO: 119), Figure 121 (SEQ ID NO: 121), Figure 123 (SEQ ID NO: 123), Figure 125 (SEQ ID NO: 125), Figure 127 (SEQ ID NO: : 127), Figure 129 (SEQ ID NO: 129), Figure 131 (SEQ ID NO: 131), Figure 133 (SEQ ID NO: 133), Figure 135 (SEQ ID NO: 135), Figure 137 (SEQ ID NO: 137), Figure 139 (SEQ ID NO: 139), figure 141 (SEQ ID NO: 141), Figure 143 (SEQ ID NO: 143), Figure 145 (SEQ ID NO: 145), Figure 147 (SEQ ID NO: 147), Figure 149 (SEQ ID NO: 149), Figure 151 (SEQ ID NO: 151), Figure 153 (SEQ ID NO: 153), Figure 155 (SEQ ID NO: 155), Figure 157 (SEQ ID NO: 157), Figure 159 (SEQ ID NO: 159), Figure 161 (SEQ ID NO: 161), Figure 163 (SEQ ID NO: 163), Figure 165 (SEQ ID NO: 165), Figure 167 (SEQ ID NO: 167), Figure 169 (SEQ ID NO: 169), Figure 171 (SEQ ID NO: 171), Figure 173 (SEQ ID NO: 173) ), Figure 175 (SEQ ID NO: 175), Figure 177 (SEQ ID NO: 177), Figure 179 (SEQ ID NO: 179), Figure 181 (SEQ ID NO: 181), Figure 183 (SEQ ID NO: 183), Figure 185 ( SEQ ID NO: 185), Figure 187 (SEQ ID NO: 187), Figure 189 (SEQ ID NO: 189), Figure 191 (SEQ ID NO: 191), Figure 193 (SEQ ID NO: 193), Figure 195 (SEQ ID NO: 195) , Figure 197 (SEQ ID NO: 197), Figure 199 (SEQ ID NO: 199), Figure 201 (SEQ ID NO: 201), Figure 203 (SEQ ID NO: 203), Figure 205 (SEQ ID NO: 205), Figure 207 (Arrangement Column number: 207), Figure 209 (SEQ ID NO: 209), Figure 211 (SEQ ID NO: 211), Figure 213 (SEQ ID NO: 213), Figure 215 (SEQ ID NO: 215), Figure 217 (SEQ ID NO: 217) , Figure 219 (SEQ ID NO: 219), Figure 221 (SEQ ID NO: 221), Figure 223 (SEQ ID NO: 223), Figure 225 (SEQ ID NO: 225), Figure 227 (SEQ ID NO: 227), Figure 229 (Sequence) Figure 231), Figure 231 (SEQ ID NO: 231), Figure 233 (SEQ ID NO: 233), Figure 235 (SEQ ID NO: 235), Figure 237 (SEQ ID NO: 237), Figure 239 (SEQ ID NO: 239), Figure 241 (SEQ ID NO: 241), Figure 243 (SEQ ID NO: 243), Figure 245 (SEQ ID NO: 245), Figure 247 (SEQ ID NO: 247), Figure 249 (SEQ ID NO: 249), Figure 251 (SEQ ID NO: : 251), Figure 253 (SEQ ID NO: 253), Figure 255 (SEQ ID NO: 255), Figure 257 (SEQ ID NO: 257), Figure 259 (SEQ ID NO: 259), Figure 261 (SEQ ID NO: 261), Figure 263 (SEQ ID NO: 263), Figure 265 (SEQ ID NO: 265), Figure 267 (SEQ ID NO: 267), Figure 269 (SEQ ID NO: 269), Figure 271 (SEQ ID NO: 271), Figure 273 (SEQ ID NO: 273), Figure 275 (SEQ ID NO: 275), Figure 277 (SEQ ID NO: 277), Figure 279 (SEQ ID NO: 279), Figure 281 (SEQ ID NO: 281), Figure 283 (SEQ ID NO: 283), Figure 285 (SEQ ID NO: 285), Figure 287 (SEQ ID NO: 287), Figure s 289A-289B (SEQ ID NO: 289), Figure 291 (SEQ ID NO: 291), Figure 293 (SEQ ID NO: 293), Figure 295 (Sequence) Figure 297), Figure 297 (SEQ ID NO: 297), Figure 299 (SEQ ID NO: 299), Figure 301 (SEQ ID NO: 301), Figure 303 (SEQ ID NO: 303), Figure 305 (SEQ ID NO: 305), Figure 307 (SEQ ID NO: 307), Figure 309 (SEQ ID NO: 309), Figure s 311A-311B (SEQ ID NO: 311), Figure 313 (SEQ ID NO: 313), Figure 315 (SEQ ID NO: 315), Figure 317 (SEQ ID NO: 317), Figure 319 (SEQ ID NO: 319), Figure 321 (SEQ ID NO: 321), Figure 323 (SEQ ID NO: 323), Figure 325 (SEQ ID NO: 325), Figure 327 (SEQ ID NO: 327) ), Figure 329 (SEQ ID NO: 329), Figure 331 (SEQ ID NO: 331), Figure 333 (SEQ ID NO: 333), Figure 335 (SEQ ID NO: 335), Figure 337 (SEQ ID NO: 337), Figure 339 ( Array 339), Fig. 341 (SEQ ID NO: 341), Fig. 343 (SEQ ID NO: 343), Fig. 345 (SEQ ID NO: 345), Fig. 347 (SEQ ID NO: 347), Fig. 349 (SEQ ID NO: 349), Figures 351A-351B (SEQ ID NO: 351), Figure 353 (SEQ ID NO: 353), Figure 355 (SEQ ID NO: 355), Figure 357 (SEQ ID NO: 357), Figure 359 (SEQ ID NO: 359), Figure 361 (SEQ ID NO: 361), Figure 363 (SEQ ID NO: 363), Figure 365 (SEQ ID NO: 365), Figure 367 (SEQ ID NO: 367), Figure 369 (SEQ ID NO: 369), Figure 371 (SEQ ID NO: 371) ) And FIG. 373 (SEQ ID NO: 373) an isolated nucleic acid molecule having at least 80% nucleic acid sequence identity with a nucleotide sequence selected from the group consisting of the full-length coding sequence of the nucleotide sequence shown in FIG. An isolated nucleic acid molecule having at least 80% nucleic acid sequence identity with the full-length coding sequence of the deposited DNA under any ATCC accession number shown in Table 7. A vector comprising the nucleic acid according to claim 1. A host cell comprising the vector of claim 5. The host cell according to claim 6, wherein the cell is a CHO cell. The host cell according to claim 6, wherein the cell is Escherichia coli. The host cell according to claim 6, wherein the cell is a yeast cell. A method for producing a PRO polypeptide comprising culturing a host cell according to claim 6 under conditions suitable for expression of the PRO polypeptide, and recovering the PRO polypeptide from a cell culture. Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 4), Figure 6 (SEQ ID NO: 6), Figure 8 (SEQ ID NO: 8), Figure 10 (SEQ ID NO: 10), Figure 12 (SEQ ID NO: : 12), Figure 14 (SEQ ID NO: 14), Figure 16 (SEQ ID NO: 16), Figure 18 (SEQ ID NO: 18), Figure 20 (SEQ ID NO: 20), Figure 22 (SEQ ID NO: 22), Figure 24 (SEQ ID NO: 24), Figure 26 (SEQ ID NO: 26), Figure 28 (SEQ ID NO: 28), Figure 30 (SEQ ID NO: 30), Figure 32 (SEQ ID NO: 32), Figure 34 (SEQ ID NO: 34), Figure 36 (SEQ ID NO: 36), Figure 38 (SEQ ID NO: 38), Figure 40 (SEQ ID NO: 40), Figure 42 (SEQ ID NO: 42), Figure 44 (SEQ ID NO: 44), Figure 46 (SEQ ID NO: 46), Figure 48 (SEQ ID NO: 48), Figure 50 (SEQ ID NO: 50), Figure 52 (SEQ ID NO: 52), Figure 54 (SEQ ID NO: 54), Figure 56 (SEQ ID NO: 56) ), Figure 58 (SEQ ID NO: 58), Figure 60 (SEQ ID NO: 60), Figure 62 (SEQ ID NO: 62), Figure 64 (SEQ ID NO: 64), Figure 66 (SEQ ID NO: 66), Figure 68 ( SEQ ID NO: 68), FIG. 70 (SEQ ID NO: 70), FIG. 72 (SEQ ID NO: 72), Figure 74 (SEQ ID NO: 74), Figure 76 (SEQ ID NO: 76), Figure 78 (SEQ ID NO: 78), Figure 80 (SEQ ID NO: 80), Figure 82 (SEQ ID NO: 82), Figure 84 (SEQ ID NO: : 84), Figure 86 (SEQ ID NO: 86), Figure 88 (SEQ ID NO: 88), Figure 90 (SEQ ID NO: 90), Figure 92 (SEQ ID NO: 92), Figure 94 (SEQ ID NO: 94), Figure 96 (SEQ ID NO: 96), Figure 98 (SEQ ID NO: 98), Figure 100 (SEQ ID NO: 100), Figure 102 (SEQ ID NO: 102), Figure 104 (SEQ ID NO: 104), Figure 106 (SEQ ID NO: 106), Figure 108 (SEQ ID NO: 108), Figure 110 (SEQ ID NO: 110), Figure 112 (SEQ ID NO: 112), Figure 114 (SEQ ID NO: 114), Figure 116 (SEQ ID NO: 116), Figure 118 (SEQ ID NO: 118), Figure 120 (SEQ ID NO: 120), Figure 122 (SEQ ID NO: 122), Figure 124 (SEQ ID NO: 124), Figure 126 (SEQ ID NO: 126), Figure 128 (SEQ ID NO: 128) ), Figure 130 (SEQ ID NO: 130), Figure 132 (SEQ ID NO: 132), Figure 134 (SEQ ID NO: 134), Figure 136 (SEQ ID NO: 136), Figure 138 (SEQ ID NO: 138), Figure 140 ( SEQ ID NO: 140), Figure 1 42 (SEQ ID NO: 142), Figure 144 (SEQ ID NO: 144), Figure 146 (SEQ ID NO: 146), Figure 148 (SEQ ID NO: 148), Figure 150 (SEQ ID NO: 150), Figure 152 (SEQ ID NO: 152), Figure 154 (SEQ ID NO: 154), Figure 156 (SEQ ID NO: 156), Figure 158 (SEQ ID NO: 158), Figure 160 (SEQ ID NO: 160), Figure 162 (SEQ ID NO: 162), Figure 164 (SEQ ID NO: 164), Figure 166 (SEQ ID NO: 166), Figure 168 (SEQ ID NO: 168), Figure 170 (SEQ ID NO: 170), Figure 172 (SEQ ID NO: 172), Figure 174 (SEQ ID NO: 174) ), Figure 176 (SEQ ID NO: 176), Figure 178 (SEQ ID NO: 178), Figure 180 (SEQ ID NO: 180), Figure 182 (SEQ ID NO: 182), Figure 184 (SEQ ID NO: 184), Figure 186 ( SEQ ID NO: 186), Figure 188 (SEQ ID NO: 188), Figure 190 (SEQ ID NO: 190), Figure 192 (SEQ ID NO: 192), Figure 194 (SEQ ID NO: 194), Figure 196 (SEQ ID NO: 196) , Figure 198 (SEQ ID NO: 198), Figure 200 (SEQ ID NO: 200), Figure 202 (SEQ ID NO: 202), Figure 204 (SEQ ID NO: 204), Figure 206 (SEQ ID NO: 206), Figure 208 (Array Figure 208 (SEQ ID NO: 210), Figure 212 (SEQ ID NO: 212), Figure 214 (SEQ ID NO: 214), Figure 216 (SEQ ID NO: 216), Figure 218 (SEQ ID NO: 218), Figure 220 (SEQ ID NO: 220), Figure 222 (SEQ ID NO: 222), Figure 224 (SEQ ID NO: 224), Figure 226 (SEQ ID NO: 226), Figure 228 (SEQ ID NO: 228), Figure 230 (SEQ ID NO: : 230), Figure 232 (SEQ ID NO: 232), Figure 234 (SEQ ID NO: 234), Figure 236 (SEQ ID NO: 236), Figure 238 (SEQ ID NO: 238), Figure 240 (SEQ ID NO: 240), Figure 242 (SEQ ID NO: 242), Figure 244 (SEQ ID NO: 244), Figure 246 (SEQ ID NO: 246), Figure 248 (SEQ ID NO: 248), Figure 250 (SEQ ID NO: 250), Figure 252 (SEQ ID NO: 252), Figure 254 (SEQ ID NO: 254), Figure 256 (SEQ ID NO: 256), Figure 258 (SEQ ID NO: 258), Figure 260 (SEQ ID NO: 260), Figure 262 (SEQ ID NO: 262), Figure 264 (SEQ ID NO: 264), Figure 266 (SEQ ID NO: 266), Figure 268 (SEQ ID NO: 268), Figure 270 (SEQ ID NO: 270), Figure 272 (SEQ ID NO: 272), Figure 274 (SEQ ID NO: 274), Figure 276 (SEQ ID NO: 276), Figure 278 (SEQ ID NO: 278), Figure 280 (SEQ ID NO: 280), Figure 282 (SEQ ID NO: 282), Figure 284 (SEQ ID NO: 284), Figure 286 (SEQ ID NO: 286), Figure 288 (SEQ ID NO: 288), Figure 290 (SEQ ID NO: 290), Figure 292 (SEQ ID NO: 292), Figure 294 (SEQ ID NO: 294), Figure 296 (SEQ ID NO: 296) ), Figure 298 (SEQ ID NO: 298), Figure 300 (SEQ ID NO: 300), Figure 302 (SEQ ID NO: 302), Figure 304 (SEQ ID NO: 304), Figure 306 (SEQ ID NO: 306), Figure 308 ( SEQ ID NO: 308), Figure 310 (SEQ ID NO: 310), Figure 312 (SEQ ID NO: 312), Figure 314 (SEQ ID NO: 314), Figure 316 (SEQ ID NO: 316), Figure 318 (SEQ ID NO: 318) , Figure 320 (SEQ ID NO: 320), Figure 322 (SEQ ID NO: 322), Figure 324 (SEQ ID NO: 324), Figure 326 (SEQ ID NO: 326), Figure 328 (SEQ ID NO: 328), Figure 330 (Sequence) Figure 332 (SEQ ID NO: 332), Figure 334 (SEQ ID NO: 334), Figure 336 (SEQ ID NO: 336), Figure 338 (SEQ ID NO: 338), Figure 340 (SEQ ID NO: 340), Figure 342 (SEQ ID NO: 342), Figure 344 (SEQ ID NO: 344), Figure 346 (SEQ ID NO: 346), Figure 348 (SEQ ID NO: 348), Figure 350 (SEQ ID NO: 350), Figure 352 (SEQ ID NO: 352), Figure 354 (SEQ ID NO: 354), Figure 356 (SEQ ID NO: 356), Figure 358 (SEQ ID NO: 358), Figure 360 (SEQ ID NO: 360), Figure 362 (SEQ ID NO: 362), Figure 364 (SEQ ID NO: 364), Figure 366 (SEQ ID NO: 366), Figure 368 (SEQ ID NO: 368), Figure 370 (SEQ ID NO: 370), Figure 372 (SEQ ID NO: 372) and Figure 374 (SEQ ID NO: 374) ) An isolated polypeptide having at least 80% amino acid sequence identity with an amino acid selected from the group consisting of the amino acid sequences shown in An isolated polypeptide having at least 80% amino acid sequence identity with the amino acid sequence encoded by the full-length coding sequence of the deposited DNA under any ATCC accession number shown in Table 7. A chimeric molecule comprising the polypeptide of claim 11 fused to a heterologous amino acid sequence. The chimeric molecule according to claim 13, wherein the heterologous amino acid sequence is an epitope tag sequence. The chimeric molecule according to claim 13, wherein the heterologous amino acid sequence is an Fc region of an immunoglobulin. An antibody that specifically binds to the polypeptide of claim 11. The antibody according to claim 16, wherein the antibody is a monoclonal antibody, a humanized antibody or a single chain antibody. (A) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 4), Figure 6 (SEQ ID NO: 6), Figure 8 (SEQ ID NO: 8), Figure 10 (SEQ ID NO: 10), Figure 12 (SEQ ID NO: 12), Figure 14 (SEQ ID NO: 14), Figure 16 (SEQ ID NO: 16), Figure 18 (SEQ ID NO: 18), Figure 20 (SEQ ID NO: 20), Figure 22 (SEQ ID NO: 22) ), Figure 24 (SEQ ID NO: 24), Figure 26 (SEQ ID NO: 26), Figure 28 (SEQ ID NO: 28), Figure 30 (SEQ ID NO: 30), Figure 32 (SEQ ID NO: 32), Figure 34 ( SEQ ID NO: 34), FIG. 36 (SEQ ID NO: 36), FIG. 38 (SEQ ID NO: 38), FIG. 40 (SEQ ID NO: 40), FIG. 42 (SEQ ID NO: 42), FIG. 44 (SEQ ID NO: 44) Figure 46 (SEQ ID NO: 46), Figure 48 (SEQ ID NO: 48), Figure 50 (SEQ ID NO: 50), Figure 52 (SEQ ID NO: 52), Figure 54 (SEQ ID NO: 54), Figure 56 (Sequence) Number: 56), Figure 58 (SEQ ID NO: 58), Figure 60 (SEQ ID NO: 60), Figure 62 (SEQ ID NO: 62), Figure 64 (SEQ ID NO: 64), Figure 66 (SEQ ID NO: 66), Figure 68 (SEQ ID NO: 68), Figure 70 (SEQ ID NO: 70), Figure 72 (SEQ ID NO: 72), Figure 74 (SEQ ID NO: 74), Figure 76 (SEQ ID NO: 76), Figure 78 (SEQ ID NO: 78), Figure 80 (SEQ ID NO: 80), Figure 82 (SEQ ID NO: 82), Figure 84 (SEQ ID NO: 84), Figure 86 (SEQ ID NO: 86), Figure 88 (SEQ ID NO: 88), Figure 90 (SEQ ID NO: 90), Figure 92 (SEQ ID NO: 92), Figure 94 (SEQ ID NO: 94) ), FIG. 96 (SEQ ID NO: 96), FIG. 98 (SEQ ID NO: 98), FIG. 100 (SEQ ID NO: 100), FIG. 102 (SEQ ID NO: 102), FIG. 104 (SEQ ID NO: 104), FIG. 106 ( SEQ ID NO: 106), FIG. 108 (SEQ ID NO: 108), FIG. 110 (SEQ ID NO: 110), FIG. 112 (SEQ ID NO: 112), FIG. 114 (SEQ ID NO: 114), FIG. 116 (SEQ ID NO: 116) , Fig. 118 (SEQ ID NO: 118), Fig. 120 (SEQ ID NO: 120), Fig. 122 (SEQ ID NO: 122), Fig. 124 (SEQ ID NO: 124), Fig. 126 (SEQ ID NO: 126), Fig. 128 (Sequence) Number: 128), Figure 130 (SEQ ID NO: 130), Figure 132 (SEQ ID NO: 132), Figure 134 (SEQ ID NO: 134), Figure 136 (SEQ ID NO: 136), Figure 138 (SEQ ID NO: 138), Figure 140 (SEQ ID NO: 140), Figure 142 (SEQ ID NO: 142), Figure 144 (SEQ ID NO: 144), Figure 146 (SEQ ID NO: 146), Figure 148 (SEQ ID NO: 148), Figure 150 (SEQ ID NO: 150), Figure 152 (SEQ ID NO: : 152), Figure 154 (SEQ ID NO: 154), Figure 156 (SEQ ID NO: 156), Figure 158 (SEQ ID NO: 158), Figure 160 (SEQ ID NO: 160), Figure 162 (SEQ ID NO: 162), Figure 164 (SEQ ID NO: 164), Figure 166 (SEQ ID NO: 166), Figure 168 (SEQ ID NO: 168), Figure 170 (SEQ ID NO: 170), Figure 172 (SEQ ID NO: 172), Figure 174 (SEQ ID NO: 174), Figure 176 (SEQ ID NO: 176), Figure 178 (SEQ ID NO: 178), Figure 180 (SEQ ID NO: 180), Figure 182 (SEQ ID NO: 182), Figure 184 (SEQ ID NO: 184), Figure 186 (SEQ ID NO: 186), Figure 188 (SEQ ID NO: 188), Figure 190 (SEQ ID NO: 190), Figure 192 (SEQ ID NO: 192), Figure 194 (SEQ ID NO: 194), Figure 196 (SEQ ID NO: 196) ), Figure 198 (SEQ ID NO: 198), Figure 200 (SEQ ID NO: 200), Figure 202 (SEQ ID NO: 202), Figure 204 (SEQ ID NO: 204), Figure 206 (SEQ ID NO: 206), Figure 208 ( SEQ ID NO: 208), Figure 210 (SEQ ID NO: 210), Figure 212 (SEQ ID NO: 212), Figure 214 (SEQ ID NO: 214), Figure 216 (SEQ ID NO: 216), Figure 218 (SEQ ID NO: 218) , Figure 220 (SEQ ID NO: 220), Figure 222 (SEQ ID NO: 222), Figure 224 (SEQ ID NO: 224), Figure 226 (SEQ ID NO: 226), Figure 228 (SEQ ID NO: 228), Figure 230 (Sequence) Figure 232 (SEQ ID NO: 232), Figure 234 (SEQ ID NO: 234), Figure 236 (SEQ ID NO: 236), Figure 238 (SEQ ID NO: 238), Figure 240 (SEQ ID NO: 240), Figure 242 (SEQ ID NO: 242), Figure 244 (SEQ ID NO: 244), Figure 246 (SEQ ID NO: 246), Figure 248 (SEQ ID NO: 248), Figure 250 (SEQ ID NO: 250), Figure 252 (SEQ ID NO: : 252), Figure 254 (SEQ ID NO: 254), Figure 256 (SEQ ID NO: 256), Figure 258 (SEQ ID NO: 258), Figure 260 (SEQ ID NO: 260), Figure 262 (SEQ ID NO: 262), Figure 264 (SEQ ID NO: 264), Figure 266 (SEQ ID NO: 266), Figure 268 (SEQ ID NO: 268), Figure 270 (SEQ ID NO: 270), Figure 272 (SEQ ID NO: 272), Figure 274 (SEQ ID NO: : 274), Figure 276 (SEQ ID NO: 276), Figure 278 (SEQ ID NO: 278), Figure 280 (SEQ ID NO: 280), Figure 282 (SEQ ID NO: 282), Figure 284 (SEQ ID NO: 284), Figure 286 (SEQ ID NO: 286), Figure 288 (SEQ ID NO: 288), Figure 290 (SEQ ID NO: 290), Figure 292 (SEQ ID NO: 292), Figure 294 (SEQ ID NO: 294), Figure 296 (SEQ ID NO: 296), Figure 298 (SEQ ID NO: 298), Figure 300 (SEQ ID NO: 300), Figure 302 (SEQ ID NO: 302), Figure 304 (SEQ ID NO: 304), Figure 306 (SEQ ID NO: 306), Figure 308 (SEQ ID NO: 308), Figure 310 (SEQ ID NO: 310), Figure 312 (SEQ ID NO: 312), Figure 314 (SEQ ID NO: 314), Figure 316 (SEQ ID NO: 316), Figure 318 (SEQ ID NO: 318) ), Figure 320 (SEQ ID NO: 320), Figure 322 (SEQ ID NO: 322), Figure 324 (SEQ ID NO: 324), Figure 326 (SEQ ID NO: 326), Figure 328 (SEQ ID NO: 328), Figure 330 ( SEQ ID NO: 330), Figure 332 (SEQ ID NO: 332), Figure 334 (SEQ ID NO: 334), Figure 336 (SEQ ID NO: 336), Figure 338 (SEQ ID NO: 338), Figure 340 (SEQ ID NO: 340) , Figure 342 (SEQ ID NO: 342), Figure 344 (SEQ ID NO: 344), Figure 346 (SEQ ID NO: 346), Figure 348 (SEQ ID NO: 348), Figure 350 (SEQ ID NO: 350), Figure 352 (SEQ ID NO: : 352), Figure 354 (SEQ ID NO: 354), Figure 356 (SEQ ID NO: 356), Figure 358 (SEQ ID NO: 358), Figure 360 (SEQ ID NO: 360), Figure 362 (SEQ ID NO: 362), Figure 364 (SEQ ID NO: 364), Figure 366 (SEQ ID NO: 366), Figure 368 (SEQ ID NO: 368), Figure 370 (SEQ ID NO: 370), Figure 372 (SEQ ID NO: 372) or Figure 374 (SEQ ID NO: 374) a nucleotide sequence encoding a polypeptide as set forth in which lacks its associated signal peptide;
(B) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 4), Figure 6 (SEQ ID NO: 6), Figure 8 (SEQ ID NO: 8), Figure 10 (SEQ ID NO: 10), Figure 12 (SEQ ID NO: 12), Figure 14 (SEQ ID NO: 14), Figure 16 (SEQ ID NO: 16), Figure 18 (SEQ ID NO: 18), Figure 20 (SEQ ID NO: 20), Figure 22 (SEQ ID NO: 22) ), Figure 24 (SEQ ID NO: 24), Figure 26 (SEQ ID NO: 26), Figure 28 (SEQ ID NO: 28), Figure 30 (SEQ ID NO: 30), Figure 32 (SEQ ID NO: 32), Figure 34 ( SEQ ID NO: 34), FIG. 36 (SEQ ID NO: 36), FIG. 38 (SEQ ID NO: 38), FIG. 40 (SEQ ID NO: 40), FIG. 42 (SEQ ID NO: 42), FIG. 44 (SEQ ID NO: 44) Figure 46 (SEQ ID NO: 46), Figure 48 (SEQ ID NO: 48), Figure 50 (SEQ ID NO: 50), Figure 52 (SEQ ID NO: 52), Figure 54 (SEQ ID NO: 54), Figure 56 (Sequence) Number: 56), Figure 58 (SEQ ID NO: 58), Figure 60 (SEQ ID NO: 60), Figure 62 (SEQ ID NO: 62), Figure 64 (SEQ ID NO: 64), Figure 66 (SEQ ID NO: 66), Figure 68 (SEQ ID NO: 68), Figure 70 (SEQ ID NO: 70), Figure 72 (SEQ ID NO: 72), Figure 74 (SEQ ID NO: 74), Figure 76 (SEQ ID NO: 76), Figure 78 (SEQ ID NO: 78), Figure 80 (SEQ ID NO: 80), Figure 82 (SEQ ID NO: 82), Figure 84 (SEQ ID NO: 84), Figure 86 (SEQ ID NO: 86), Figure 88 (SEQ ID NO: 88), Figure 90 (SEQ ID NO: 90), Figure 92 (SEQ ID NO: 92), Figure 94 (SEQ ID NO: 94) ), FIG. 96 (SEQ ID NO: 96), FIG. 98 (SEQ ID NO: 98), FIG. 100 (SEQ ID NO: 100), FIG. 102 (SEQ ID NO: 102), FIG. 104 (SEQ ID NO: 104), FIG. 106 ( SEQ ID NO: 106), FIG. 108 (SEQ ID NO: 108), FIG. 110 (SEQ ID NO: 110), FIG. 112 (SEQ ID NO: 112), FIG. 114 (SEQ ID NO: 114), FIG. 116 (SEQ ID NO: 116) , Fig. 118 (SEQ ID NO: 118), Fig. 120 (SEQ ID NO: 120), Fig. 122 (SEQ ID NO: 122), Fig. 124 (SEQ ID NO: 124), Fig. 126 (SEQ ID NO: 126), Fig. 128 (Sequence) Number: 128), Figure 130 (SEQ ID NO: 130), Figure 132 (SEQ ID NO: 132), Figure 134 (SEQ ID NO: 134), Figure 136 (SEQ ID NO: 136), Figure 138 (SEQ ID NO: 138), Figure 140 (SEQ ID NO: 140), Figure 142 (SEQ ID NO: 142), Figure 144 (SEQ ID NO: 144), Figure 146 (SEQ ID NO: 146), Figure 148 (SEQ ID NO: 148), Figure 150 (SEQ ID NO: 150), Figure 152 (SEQ ID NO: : 152), Figure 154 (SEQ ID NO: 154), Figure 156 (SEQ ID NO: 156), Figure 158 (SEQ ID NO: 158), Figure 160 (SEQ ID NO: 160), Figure 162 (SEQ ID NO: 162), Figure 164 (SEQ ID NO: 164), Figure 166 (SEQ ID NO: 166), Figure 168 (SEQ ID NO: 168), Figure 170 (SEQ ID NO: 170), Figure 172 (SEQ ID NO: 172), Figure 174 (SEQ ID NO: 174), Figure 176 (SEQ ID NO: 176), Figure 178 (SEQ ID NO: 178), Figure 180 (SEQ ID NO: 180), Figure 182 (SEQ ID NO: 182), Figure 184 (SEQ ID NO: 184), Figure 186 (SEQ ID NO: 186), Figure 188 (SEQ ID NO: 188), Figure 190 (SEQ ID NO: 190), Figure 192 (SEQ ID NO: 192), Figure 194 (SEQ ID NO: 194), Figure 196 (SEQ ID NO: 196) ), Figure 198 (SEQ ID NO: 198), Figure 200 (SEQ ID NO: 200), Figure 202 (SEQ ID NO: 202), Figure 204 (SEQ ID NO: 204), Figure 206 (SEQ ID NO: 206), Figure 208 ( SEQ ID NO: 208), Figure 210 (SEQ ID NO: 210), Figure 212 (SEQ ID NO: 212), Figure 214 (SEQ ID NO: 214), Figure 216 (SEQ ID NO: 216), Figure 218 (SEQ ID NO: 218) , Figure 220 (SEQ ID NO: 220), Figure 222 (SEQ ID NO: 222), Figure 224 (SEQ ID NO: 224), Figure 226 (SEQ ID NO: 226), Figure 228 (SEQ ID NO: 228), Figure 230 (Sequence) Figure 232 (SEQ ID NO: 232), Figure 234 (SEQ ID NO: 234), Figure 236 (SEQ ID NO: 236), Figure 238 (SEQ ID NO: 238), Figure 240 (SEQ ID NO: 240), Figure 242 (SEQ ID NO: 242), Figure 244 (SEQ ID NO: 244), Figure 246 (SEQ ID NO: 246), Figure 248 (SEQ ID NO: 248), Figure 250 (SEQ ID NO: 250), Figure 252 (SEQ ID NO: : 252), Figure 254 (SEQ ID NO: 254), Figure 256 (SEQ ID NO: 256), Figure 258 (SEQ ID NO: 258), Figure 260 (SEQ ID NO: 260), Figure 262 (SEQ ID NO: 262), Figure 264 (SEQ ID NO: 264), Figure 266 (SEQ ID NO: 266), Figure 268 (SEQ ID NO: 268), Figure 270 (SEQ ID NO: 270), Figure 272 (SEQ ID NO: 272), Figure 274 (SEQ ID NO: : 274), Figure 276 (SEQ ID NO: 276), Figure 278 (SEQ ID NO: 278), Figure 280 (SEQ ID NO: 280), Figure 282 (SEQ ID NO: 282), Figure 284 (SEQ ID NO: 284), Figure 286 (SEQ ID NO: 286), Figure 288 (SEQ ID NO: 288), Figure 290 (SEQ ID NO: 290), Figure 292 (SEQ ID NO: 292), Figure 294 (SEQ ID NO: 294), Figure 296 (SEQ ID NO: 296), Figure 298 (SEQ ID NO: 298), Figure 300 (SEQ ID NO: 300), Figure 302 (SEQ ID NO: 302), Figure 304 (SEQ ID NO: 304), Figure 306 (SEQ ID NO: 306), Figure 308 (SEQ ID NO: 308), Figure 310 (SEQ ID NO: 310), Figure 312 (SEQ ID NO: 312), Figure 314 (SEQ ID NO: 314), Figure 316 (SEQ ID NO: 316), Figure 318 (SEQ ID NO: 318) ), Figure 320 (SEQ ID NO: 320), Figure 322 (SEQ ID NO: 322), Figure 324 (SEQ ID NO: 324), Figure 326 (SEQ ID NO: 326), Figure 328 (SEQ ID NO: 328), Figure 330 ( SEQ ID NO: 330), Figure 332 (SEQ ID NO: 332), Figure 334 (SEQ ID NO: 334), Figure 336 (SEQ ID NO: 336), Figure 338 (SEQ ID NO: 338), Figure 340 (SEQ ID NO: 340) , Figure 342 (SEQ ID NO: 342), Figure 344 (SEQ ID NO: 344), Figure 346 (SEQ ID NO: 346), Figure 348 (SEQ ID NO: 348), Figure 350 (SEQ ID NO: 350), Figure 352 (SEQ ID NO: : 352), Figure 354 (SEQ ID NO: 354), Figure 356 (SEQ ID NO: 356), Figure 358 (SEQ ID NO: 358), Figure 360 (SEQ ID NO: 360), Figure 362 (SEQ ID NO: 362), Figure 364 (SEQ ID NO: 364), Figure 366 (SEQ ID NO: 366), Figure 368 (SEQ ID NO: 368), Figure 370 (SEQ ID NO: 370), Figure 372 (SEQ ID NO: 372) or Figure 374 (SEQ ID NO: 374) Nucleotide sequence encoding the extracellular domain of the polypeptide shown in FIG. 2 having its associated signal peptide; or (c) FIG. 2 (SEQ ID NO: 2), FIG. 4 (SEQ ID NO: 4 ), Figure 6 (SEQ ID NO: 6), Figure 8 (SEQ ID NO: 8), Figure 10 (SEQ ID NO: 10), Figure 12 (SEQ ID NO: 12), Figure 14 (SEQ ID NO: 14), Figure 16 ( SEQ ID NO: 16), FIG. 18 (SEQ ID NO: 18), FIG. 20 (SEQ ID NO: 20), FIG. 22 (SEQ ID NO: 22), Figure 24 (SEQ ID NO: 24), Figure 26 (SEQ ID NO: 26), Figure 28 (SEQ ID NO: 28), Figure 30 (SEQ ID NO: 30), Figure 32 (SEQ ID NO: 32), Figure 34 (SEQ ID NO: : 34), Figure 36 (SEQ ID NO: 36), Figure 38 (SEQ ID NO: 38), Figure 40 (SEQ ID NO: 40), Figure 42 (SEQ ID NO: 42), Figure 44 (SEQ ID NO: 44), Figure 46 (SEQ ID NO: 46), Figure 48 (SEQ ID NO: 48), Figure 50 (SEQ ID NO: 50), Figure 52 (SEQ ID NO: 52), Figure 54 (SEQ ID NO: 54), Figure 56 (SEQ ID NO: 56), Figure 58 (SEQ ID NO: 58), Figure 60 (SEQ ID NO: 60), Figure 62 (SEQ ID NO: 62), Figure 64 (SEQ ID NO: 64), Figure 66 (SEQ ID NO: 66), Figure 68 (SEQ ID NO: 68), Figure 70 (SEQ ID NO: 70), Figure 72 (SEQ ID NO: 72), Figure 74 (SEQ ID NO: 74), Figure 76 (SEQ ID NO: 76), Figure 78 (SEQ ID NO: 78) ), Figure 80 (SEQ ID NO: 80), Figure 82 (SEQ ID NO: 82), Figure 84 (SEQ ID NO: 84), Figure 86 (SEQ ID NO: 86), Figure 88 (SEQ ID NO: 88), Figure 90 ( SEQ ID NO: 90), Figure 92 (SEQ ID NO: 92), Figure 94 (SEQ ID NO: : 94), Figure 96 (SEQ ID NO: 96), Figure 98 (SEQ ID NO: 98), Figure 100 (SEQ ID NO: 100), Figure 102 (SEQ ID NO: 102), Figure 104 (SEQ ID NO: 104), Figure 106 (SEQ ID NO: 106), Figure 108 (SEQ ID NO: 108), Figure 110 (SEQ ID NO: 110), Figure 112 (SEQ ID NO: 112), Figure 114 (SEQ ID NO: 114), Figure 116 (SEQ ID NO: 116), Figure 118 (SEQ ID NO: 118), Figure 120 (SEQ ID NO: 120), Figure 122 (SEQ ID NO: 122), Figure 124 (SEQ ID NO: 124), Figure 126 (SEQ ID NO: 126), Figure 128 (SEQ ID NO: 128), Figure 130 (SEQ ID NO: 130), Figure 132 (SEQ ID NO: 132), Figure 134 (SEQ ID NO: 134), Figure 136 (SEQ ID NO: 136), Figure 138 (SEQ ID NO: 138) ), FIG. 140 (SEQ ID NO: 140), FIG. 142 (SEQ ID NO: 142), FIG. 144 (SEQ ID NO: 144), FIG. 146 (SEQ ID NO: 146), FIG. 148 (SEQ ID NO: 148), FIG. 150 ( SEQ ID NO: 150), Figure 152 (SEQ ID NO: 152), Figure 154 (SEQ ID NO: 154), Figure 156 (SEQ ID NO: 156), Figure 158 (SEQ ID NO: 158), Figure 160 (SEQ ID NO: 160) , Figure 1 62 (SEQ ID NO: 162), Figure 164 (SEQ ID NO: 164), Figure 166 (SEQ ID NO: 166), Figure 168 (SEQ ID NO: 168), Figure 170 (SEQ ID NO: 170), Figure 172 (SEQ ID NO: 172), Figure 174 (SEQ ID NO: 174), Figure 176 (SEQ ID NO: 176), Figure 178 (SEQ ID NO: 178), Figure 180 (SEQ ID NO: 180), Figure 182 (SEQ ID NO: 182), Figure 184 (SEQ ID NO: 184), Figure 186 (SEQ ID NO: 186), Figure 188 (SEQ ID NO: 188), Figure 190 (SEQ ID NO: 190), Figure 192 (SEQ ID NO: 192), Figure 194 (SEQ ID NO: 194) ), Figure 196 (SEQ ID NO: 196), Figure 198 (SEQ ID NO: 198), Figure 200 (SEQ ID NO: 200), Figure 202 (SEQ ID NO: 202), Figure 204 (SEQ ID NO: 204), Figure 206 ( SEQ ID NO: 206), FIG. 208 (SEQ ID NO: 208), FIG. 210 (SEQ ID NO: 210), FIG. 212 (SEQ ID NO: 212), FIG. 214 (SEQ ID NO: 214), FIG. 216 (SEQ ID NO: 216) , Figure 218 (SEQ ID NO: 218), Figure 220 (SEQ ID NO: 220), Figure 222 (SEQ ID NO: 222), Figure 224 (SEQ ID NO: 224), Figure 226 (SEQ ID NO: 226), Figure 228 (Sequence) Number: 228), Figure 230 (SEQ ID NO: 230), Figure 232 (SEQ ID NO: 232), Figure 234 (SEQ ID NO: 234), Figure 236 (SEQ ID NO: 236), Figure 238 (SEQ ID NO: 238), Figure 240 (SEQ ID NO: 240), Figure 242 (SEQ ID NO: 242), Figure 244 (SEQ ID NO: 244), Figure 246 (SEQ ID NO: 246), Figure 248 (SEQ ID NO: 248), Figure 250 (SEQ ID NO: : 250), Figure 252 (SEQ ID NO: 252), Figure 254 (SEQ ID NO: 254), Figure 256 (SEQ ID NO: 256), Figure 258 (SEQ ID NO: 258), Figure 260 (SEQ ID NO: 260), Figure 262 (SEQ ID NO: 262), Figure 264 (SEQ ID NO: 264), Figure 266 (SEQ ID NO: 266), Figure 268 (SEQ ID NO: 268), Figure 270 (SEQ ID NO: 270), Figure 272 (SEQ ID NO: 272), Figure 274 (SEQ ID NO: 274), Figure 276 (SEQ ID NO: 276), Figure 278 (SEQ ID NO: 278), Figure 280 (SEQ ID NO: 280), Figure 282 (SEQ ID NO: 282), Figure 284 (SEQ ID NO: 284), Figure 286 (SEQ ID NO: 286), Figure 288 (SEQ ID NO: 288), Figure 290 (SEQ ID NO: 290), Figure 292 (SEQ ID NO: 292), Figure 294 (SEQ ID NO: 2) 94), Figure 296 (SEQ ID NO: 296), Figure 298 (SEQ ID NO: 298), Figure 300 (SEQ ID NO: 300), Figure 302 (SEQ ID NO: 302), Figure 304 (SEQ ID NO: 304), Figure 306 (SEQ ID NO: 306), Figure 308 (SEQ ID NO: 308), Figure 310 (SEQ ID NO: 310), Figure 312 (SEQ ID NO: 312), Figure 314 (SEQ ID NO: 314), Figure 316 (SEQ ID NO: 316) ), Figure 318 (SEQ ID NO: 318), Figure 320 (SEQ ID NO: 320), Figure 322 (SEQ ID NO: 322), Figure 324 (SEQ ID NO: 324), Figure 326 (SEQ ID NO: 326), Figure 328 ( SEQ ID NO: 328), Figure 330 (SEQ ID NO: 330), Figure 332 (SEQ ID NO: 332), Figure 334 (SEQ ID NO: 334), Figure 336 (SEQ ID NO: 336), Figure 338 (SEQ ID NO: 338) , Figure 340 (SEQ ID NO: 340), Figure 342 (SEQ ID NO: 342), Figure 344 (SEQ ID NO: 344), Figure 346 (SEQ ID NO: 346), Figure 348 (SEQ ID NO: 348), Figure 350 (Sequence) Figure 352 (SEQ ID NO: 354), Figure 356 (SEQ ID NO: 356), Figure 358 (SEQ ID NO: 358), Figure 360 (SEQ ID NO: 360), Fig 3 62 (SEQ ID NO: 362), Figure 364 (SEQ ID NO: 364), Figure 366 (SEQ ID NO: 366), Figure 368 (SEQ ID NO: 368), Figure 370 (SEQ ID NO: 370), Figure 372 (SEQ ID NO: 372) or the nucleotide sequence encoding the extracellular domain of the polypeptide shown in Figure 374 (SEQ ID NO: 374) lacking its associated signal peptide:
An isolated nucleic acid molecule having at least 80% nucleic acid sequence identity with (A) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 4), Figure 6 (SEQ ID NO: 6), Figure 8 (SEQ ID NO: 8), Figure 10 (SEQ ID NO: 10), Figure 12 (SEQ ID NO: 12), Figure 14 (SEQ ID NO: 14), Figure 16 (SEQ ID NO: 16), Figure 18 (SEQ ID NO: 18), Figure 20 (SEQ ID NO: 20), Figure 22 (SEQ ID NO: 22) ), Figure 24 (SEQ ID NO: 24), Figure 26 (SEQ ID NO: 26), Figure 28 (SEQ ID NO: 28), Figure 30 (SEQ ID NO: 30), Figure 32 (SEQ ID NO: 32), Figure 34 ( SEQ ID NO: 34), FIG. 36 (SEQ ID NO: 36), FIG. 38 (SEQ ID NO: 38), FIG. 40 (SEQ ID NO: 40), FIG. 42 (SEQ ID NO: 42), FIG. 44 (SEQ ID NO: 44) Figure 46 (SEQ ID NO: 46), Figure 48 (SEQ ID NO: 48), Figure 50 (SEQ ID NO: 50), Figure 52 (SEQ ID NO: 52), Figure 54 (SEQ ID NO: 54), Figure 56 (Sequence) Number: 56), Figure 58 (SEQ ID NO: 58), Figure 60 (SEQ ID NO: 60), Figure 62 (SEQ ID NO: 62), Figure 64 (SEQ ID NO: 64), Figure 66 (SEQ ID NO: 66), Figure 68 (SEQ ID NO: 68), Figure 70 (SEQ ID NO: 70), Figure 72 (SEQ ID NO: 72), Figure 74 (SEQ ID NO: 74), Figure 76 (SEQ ID NO: 76), Figure 78 (SEQ ID NO: 78), Figure 80 (SEQ ID NO: 80), Figure 82 (SEQ ID NO: 82), Figure 84 (SEQ ID NO: 84), Figure 86 (SEQ ID NO: 86), Figure 88 (SEQ ID NO: 88), Figure 90 (SEQ ID NO: 90), Figure 92 (SEQ ID NO: 92), Figure 94 (SEQ ID NO: 94) ), FIG. 96 (SEQ ID NO: 96), FIG. 98 (SEQ ID NO: 98), FIG. 100 (SEQ ID NO: 100), FIG. 102 (SEQ ID NO: 102), FIG. 104 (SEQ ID NO: 104), FIG. 106 ( SEQ ID NO: 106), FIG. 108 (SEQ ID NO: 108), FIG. 110 (SEQ ID NO: 110), FIG. 112 (SEQ ID NO: 112), FIG. 114 (SEQ ID NO: 114), FIG. 116 (SEQ ID NO: 116) , Fig. 118 (SEQ ID NO: 118), Fig. 120 (SEQ ID NO: 120), Fig. 122 (SEQ ID NO: 122), Fig. 124 (SEQ ID NO: 124), Fig. 126 (SEQ ID NO: 126), Fig. 128 (Sequence) Number: 128), Figure 130 (SEQ ID NO: 130), Figure 132 (SEQ ID NO: 132), Figure 134 (SEQ ID NO: 134), Figure 136 (SEQ ID NO: 136), Figure 138 (SEQ ID NO: 138), Figure 140 (SEQ ID NO: 140), Figure 142 (SEQ ID NO: 142), Figure 144 (SEQ ID NO: 144), Figure 146 (SEQ ID NO: 146), Figure 148 (SEQ ID NO: 148), Figure 150 (SEQ ID NO: 150), Figure 152 (SEQ ID NO: : 152), Figure 154 (SEQ ID NO: 154), Figure 156 (SEQ ID NO: 156), Figure 158 (SEQ ID NO: 158), Figure 160 (SEQ ID NO: 160), Figure 162 (SEQ ID NO: 162), Figure 164 (SEQ ID NO: 164), Figure 166 (SEQ ID NO: 166), Figure 168 (SEQ ID NO: 168), Figure 170 (SEQ ID NO: 170), Figure 172 (SEQ ID NO: 172), Figure 174 (SEQ ID NO: 174), Figure 176 (SEQ ID NO: 176), Figure 178 (SEQ ID NO: 178), Figure 180 (SEQ ID NO: 180), Figure 182 (SEQ ID NO: 182), Figure 184 (SEQ ID NO: 184), Figure 186 (SEQ ID NO: 186), Figure 188 (SEQ ID NO: 188), Figure 190 (SEQ ID NO: 190), Figure 192 (SEQ ID NO: 192), Figure 194 (SEQ ID NO: 194), Figure 196 (SEQ ID NO: 196) ), Figure 198 (SEQ ID NO: 198), Figure 200 (SEQ ID NO: 200), Figure 202 (SEQ ID NO: 202), Figure 204 (SEQ ID NO: 204), Figure 206 (SEQ ID NO: 206), Figure 208 ( SEQ ID NO: 208), Figure 210 (SEQ ID NO: 210), Figure 212 (SEQ ID NO: 212), Figure 214 (SEQ ID NO: 214), Figure 216 (SEQ ID NO: 216), Figure 218 (SEQ ID NO: 218) , Figure 220 (SEQ ID NO: 220), Figure 222 (SEQ ID NO: 222), Figure 224 (SEQ ID NO: 224), Figure 226 (SEQ ID NO: 226), Figure 228 (SEQ ID NO: 228), Figure 230 (Sequence) Figure 232 (SEQ ID NO: 232), Figure 234 (SEQ ID NO: 234), Figure 236 (SEQ ID NO: 236), Figure 238 (SEQ ID NO: 238), Figure 240 (SEQ ID NO: 240), Figure 242 (SEQ ID NO: 242), Figure 244 (SEQ ID NO: 244), Figure 246 (SEQ ID NO: 246), Figure 248 (SEQ ID NO: 248), Figure 250 (SEQ ID NO: 250), Figure 252 (SEQ ID NO: : 252), Figure 254 (SEQ ID NO: 254), Figure 256 (SEQ ID NO: 256), Figure 258 (SEQ ID NO: 258), Figure 260 (SEQ ID NO: 260), Figure 262 (SEQ ID NO: 262), Figure 264 (SEQ ID NO: 264), Figure 266 (SEQ ID NO: 266), Figure 268 (SEQ ID NO: 268), Figure 270 (SEQ ID NO: 270), Figure 272 (SEQ ID NO: 272), Figure 274 (SEQ ID NO: : 274), Figure 276 (SEQ ID NO: 276), Figure 278 (SEQ ID NO: 278), Figure 280 (SEQ ID NO: 280), Figure 282 (SEQ ID NO: 282), Figure 284 (SEQ ID NO: 284), Figure 286 (SEQ ID NO: 286), Figure 288 (SEQ ID NO: 288), Figure 290 (SEQ ID NO: 290), Figure 292 (SEQ ID NO: 292), Figure 294 (SEQ ID NO: 294), Figure 296 (SEQ ID NO: 296), Figure 298 (SEQ ID NO: 298), Figure 300 (SEQ ID NO: 300), Figure 302 (SEQ ID NO: 302), Figure 304 (SEQ ID NO: 304), Figure 306 (SEQ ID NO: 306), Figure 308 (SEQ ID NO: 308), Figure 310 (SEQ ID NO: 310), Figure 312 (SEQ ID NO: 312), Figure 314 (SEQ ID NO: 314), Figure 316 (SEQ ID NO: 316), Figure 318 (SEQ ID NO: 318) ), Figure 320 (SEQ ID NO: 320), Figure 322 (SEQ ID NO: 322), Figure 324 (SEQ ID NO: 324), Figure 326 (SEQ ID NO: 326), Figure 328 (SEQ ID NO: 328), Figure 330 ( SEQ ID NO: 330), Figure 332 (SEQ ID NO: 332), Figure 334 (SEQ ID NO: 334), Figure 336 (SEQ ID NO: 336), Figure 338 (SEQ ID NO: 338), Figure 340 (SEQ ID NO: 340) , Figure 342 (SEQ ID NO: 342), Figure 344 (SEQ ID NO: 344), Figure 346 (SEQ ID NO: 346), Figure 348 (SEQ ID NO: 348), Figure 350 (SEQ ID NO: 350), Figure 352 (SEQ ID NO: : 352), Figure 354 (SEQ ID NO: 354), Figure 356 (SEQ ID NO: 356), Figure 358 (SEQ ID NO: 358), Figure 360 (SEQ ID NO: 360), Figure 362 (SEQ ID NO: 362), Figure 364 (SEQ ID NO: 364), Figure 366 (SEQ ID NO: 366), Figure 368 (SEQ ID NO: 368), Figure 370 (SEQ ID NO: 370), Figure 372 (SEQ ID NO: 372) or Figure 374 (SEQ ID NO: 374) the amino acid sequence of a polypeptide as shown in claim 3 lacking its associated signal peptide;
(B) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 4), Figure 6 (SEQ ID NO: 6), Figure 8 (SEQ ID NO: 8), Figure 10 (SEQ ID NO: 10), Figure 12 (SEQ ID NO: 12), Figure 14 (SEQ ID NO: 14), Figure 16 (SEQ ID NO: 16), Figure 18 (SEQ ID NO: 18), Figure 20 (SEQ ID NO: 20), Figure 22 (SEQ ID NO: 22) ), Figure 24 (SEQ ID NO: 24), Figure 26 (SEQ ID NO: 26), Figure 28 (SEQ ID NO: 28), Figure 30 (SEQ ID NO: 30), Figure 32 (SEQ ID NO: 32), Figure 34 ( SEQ ID NO: 34), FIG. 36 (SEQ ID NO: 36), FIG. 38 (SEQ ID NO: 38), FIG. 40 (SEQ ID NO: 40), FIG. 42 (SEQ ID NO: 42), FIG. 44 (SEQ ID NO: 44) Figure 46 (SEQ ID NO: 46), Figure 48 (SEQ ID NO: 48), Figure 50 (SEQ ID NO: 50), Figure 52 (SEQ ID NO: 52), Figure 54 (SEQ ID NO: 54), Figure 56 (Sequence) Number: 56), Figure 58 (SEQ ID NO: 58), Figure 60 (SEQ ID NO: 60), Figure 62 (SEQ ID NO: 62), Figure 64 (SEQ ID NO: 64), Figure 66 (SEQ ID NO: 66), Figure 68 (SEQ ID NO: 68), Figure 70 (SEQ ID NO: 70), Figure 72 (SEQ ID NO: 72), Figure 74 (SEQ ID NO: 74), Figure 76 (SEQ ID NO: 76), Figure 78 (SEQ ID NO: 78), Figure 80 (SEQ ID NO: 80), Figure 82 (SEQ ID NO: 82), Figure 84 (SEQ ID NO: 84), Figure 86 (SEQ ID NO: 86), Figure 88 (SEQ ID NO: 88), Figure 90 (SEQ ID NO: 90), Figure 92 (SEQ ID NO: 92), Figure 94 (SEQ ID NO: 94) ), FIG. 96 (SEQ ID NO: 96), FIG. 98 (SEQ ID NO: 98), FIG. 100 (SEQ ID NO: 100), FIG. 102 (SEQ ID NO: 102), FIG. 104 (SEQ ID NO: 104), FIG. 106 ( SEQ ID NO: 106), FIG. 108 (SEQ ID NO: 108), FIG. 110 (SEQ ID NO: 110), FIG. 112 (SEQ ID NO: 112), FIG. 114 (SEQ ID NO: 114), FIG. 116 (SEQ ID NO: 116) , Fig. 118 (SEQ ID NO: 118), Fig. 120 (SEQ ID NO: 120), Fig. 122 (SEQ ID NO: 122), Fig. 124 (SEQ ID NO: 124), Fig. 126 (SEQ ID NO: 126), Fig. 128 (Sequence) Number: 128), Figure 130 (SEQ ID NO: 130), Figure 132 (SEQ ID NO: 132), Figure 134 (SEQ ID NO: 134), Figure 136 (SEQ ID NO: 136), Figure 138 (SEQ ID NO: 138), Figure 140 (SEQ ID NO: 140), Figure 142 (SEQ ID NO: 142), Figure 144 (SEQ ID NO: 144), Figure 146 (SEQ ID NO: 146), Figure 148 (SEQ ID NO: 148), Figure 150 (SEQ ID NO: 150), Figure 152 (SEQ ID NO: : 152), Figure 154 (SEQ ID NO: 154), Figure 156 (SEQ ID NO: 156), Figure 158 (SEQ ID NO: 158), Figure 160 (SEQ ID NO: 160), Figure 162 (SEQ ID NO: 162), Figure 164 (SEQ ID NO: 164), Figure 166 (SEQ ID NO: 166), Figure 168 (SEQ ID NO: 168), Figure 170 (SEQ ID NO: 170), Figure 172 (SEQ ID NO: 172), Figure 174 (SEQ ID NO: 174), Figure 176 (SEQ ID NO: 176), Figure 178 (SEQ ID NO: 178), Figure 180 (SEQ ID NO: 180), Figure 182 (SEQ ID NO: 182), Figure 184 (SEQ ID NO: 184), Figure 186 (SEQ ID NO: 186), Figure 188 (SEQ ID NO: 188), Figure 190 (SEQ ID NO: 190), Figure 192 (SEQ ID NO: 192), Figure 194 (SEQ ID NO: 194), Figure 196 (SEQ ID NO: 196) ), Figure 198 (SEQ ID NO: 198), Figure 200 (SEQ ID NO: 200), Figure 202 (SEQ ID NO: 202), Figure 204 (SEQ ID NO: 204), Figure 206 (SEQ ID NO: 206), Figure 208 ( SEQ ID NO: 208), Figure 210 (SEQ ID NO: 210), Figure 212 (SEQ ID NO: 212), Figure 214 (SEQ ID NO: 214), Figure 216 (SEQ ID NO: 216), Figure 218 (SEQ ID NO: 218) , Figure 220 (SEQ ID NO: 220), Figure 222 (SEQ ID NO: 222), Figure 224 (SEQ ID NO: 224), Figure 226 (SEQ ID NO: 226), Figure 228 (SEQ ID NO: 228), Figure 230 (Sequence) Figure 232 (SEQ ID NO: 232), Figure 234 (SEQ ID NO: 234), Figure 236 (SEQ ID NO: 236), Figure 238 (SEQ ID NO: 238), Figure 240 (SEQ ID NO: 240), Figure 242 (SEQ ID NO: 242), Figure 244 (SEQ ID NO: 244), Figure 246 (SEQ ID NO: 246), Figure 248 (SEQ ID NO: 248), Figure 250 (SEQ ID NO: 250), Figure 252 (SEQ ID NO: : 252), Figure 254 (SEQ ID NO: 254), Figure 256 (SEQ ID NO: 256), Figure 258 (SEQ ID NO: 258), Figure 260 (SEQ ID NO: 260), Figure 262 (SEQ ID NO: 262), Figure 264 (SEQ ID NO: 264), Figure 266 (SEQ ID NO: 266), Figure 268 (SEQ ID NO: 268), Figure 270 (SEQ ID NO: 270), Figure 272 (SEQ ID NO: 272), Figure 274 (SEQ ID NO: : 274), Figure 276 (SEQ ID NO: 276), Figure 278 (SEQ ID NO: 278), Figure 280 (SEQ ID NO: 280), Figure 282 (SEQ ID NO: 282), Figure 284 (SEQ ID NO: 284), Figure 286 (SEQ ID NO: 286), Figure 288 (SEQ ID NO: 288), Figure 290 (SEQ ID NO: 290), Figure 292 (SEQ ID NO: 292), Figure 294 (SEQ ID NO: 294), Figure 296 (SEQ ID NO: 296), Figure 298 (SEQ ID NO: 298), Figure 300 (SEQ ID NO: 300), Figure 302 (SEQ ID NO: 302), Figure 304 (SEQ ID NO: 304), Figure 306 (SEQ ID NO: 306), Figure 308 (SEQ ID NO: 308), Figure 310 (SEQ ID NO: 310), Figure 312 (SEQ ID NO: 312), Figure 314 (SEQ ID NO: 314), Figure 316 (SEQ ID NO: 316), Figure 318 (SEQ ID NO: 318) ), Figure 320 (SEQ ID NO: 320), Figure 322 (SEQ ID NO: 322), Figure 324 (SEQ ID NO: 324), Figure 326 (SEQ ID NO: 326), Figure 328 (SEQ ID NO: 328), Figure 330 ( SEQ ID NO: 330), Figure 332 (SEQ ID NO: 332), Figure 334 (SEQ ID NO: 334), Figure 336 (SEQ ID NO: 336), Figure 338 (SEQ ID NO: 338), Figure 340 (SEQ ID NO: 340) , Figure 342 (SEQ ID NO: 342), Figure 344 (SEQ ID NO: 344), Figure 346 (SEQ ID NO: 346), Figure 348 (SEQ ID NO: 348), Figure 350 (SEQ ID NO: 350), Figure 352 (SEQ ID NO: : 352), Figure 354 (SEQ ID NO: 354), Figure 356 (SEQ ID NO: 356), Figure 358 (SEQ ID NO: 358), Figure 360 (SEQ ID NO: 360), Figure 362 (SEQ ID NO: 362), Figure 364 (SEQ ID NO: 364), Figure 366 (SEQ ID NO: 366), Figure 368 (SEQ ID NO: 368), Figure 370 (SEQ ID NO: 370), Figure 372 (SEQ ID NO: 372) or Figure 374 (SEQ ID NO: 374) Amino acid sequence of the extracellular domain of the polypeptide shown in FIG. 2 having its associated signal peptide; or (c) FIG. 2 (SEQ ID NO: 2), FIG. 4 (SEQ ID NO: 4), FIG. 6 (SEQ ID NO: 6), Figure 8 (SEQ ID NO: 8), Figure 10 (SEQ ID NO: 10), Figure 12 (SEQ ID NO: 12), Figure 14 (SEQ ID NO: 14), Figure 16 (SEQ ID NO: 16), Figure 18 (SEQ ID NO: 18), Figure 20 (SEQ ID NO: 20), Figure 22 (SEQ ID NO: 22), Figure 24 (SEQ ID NO: No. 24), Figure 26 (SEQ ID NO: 26), Figure 28 (SEQ ID NO: 28), Figure 30 (SEQ ID NO: 30), Figure 32 (SEQ ID NO: 32), Figure 34 (SEQ ID NO: 34), Figure 36 (SEQ ID NO: 36), Figure 38 (SEQ ID NO: 38), Figure 40 (SEQ ID NO: 40), Figure 42 (SEQ ID NO: 42), Figure 44 (SEQ ID NO: 44), Figure 46 (SEQ ID NO: : 46), Figure 48 (SEQ ID NO: 48), Figure 50 (SEQ ID NO: 50), Figure 52 (SEQ ID NO: 52), Figure 54 (SEQ ID NO: 54), Figure 56 (SEQ ID NO: 56), Figure 58 (SEQ ID NO: 58), Figure 60 (SEQ ID NO: 60), Figure 62 (SEQ ID NO: 62), Figure 64 (SEQ ID NO: 64), Figure 66 (SEQ ID NO: 66), Figure 68 (SEQ ID NO: 68), Figure 70 (SEQ ID NO: 70), Figure 72 (SEQ ID NO: 72), Figure 74 (SEQ ID NO: 74), Figure 76 (SEQ ID NO: 76), Figure 78 (SEQ ID NO: 78), Figure 80 (SEQ ID NO: 80), Figure 82 (SEQ ID NO: 82), Figure 84 (SEQ ID NO: 84), Figure 86 (SEQ ID NO: 86), Figure 88 (SEQ ID NO: 88), Figure 90 (SEQ ID NO: 90) ), Fig. 92 (SEQ ID NO: 92), Fig. 94 (SEQ ID NO: 94), Fig. 96 ( (Column number: 96), figure 98 (sequence number: 98), figure 100 (sequence number: 100), figure 102 (sequence number: 102), figure 104 (sequence number: 104), figure 106 (sequence number: 106) Figure 108 (SEQ ID NO: 108), Figure 110 (SEQ ID NO: 110), Figure 112 (SEQ ID NO: 112), Figure 114 (SEQ ID NO: 114), Figure 116 (SEQ ID NO: 116), Figure 118 (Sequence) Number: 118), Figure 120 (SEQ ID NO: 120), Figure 122 (SEQ ID NO: 122), Figure 124 (SEQ ID NO: 124), Figure 126 (SEQ ID NO: 126), Figure 128 (SEQ ID NO: 128), Figure 130 (SEQ ID NO: 130), Figure 132 (SEQ ID NO: 132), Figure 134 (SEQ ID NO: 134), Figure 136 (SEQ ID NO: 136), Figure 138 (SEQ ID NO: 138), Figure 140 (SEQ ID NO: : 140), Figure 142 (SEQ ID NO: 142), Figure 144 (SEQ ID NO: 144), Figure 146 (SEQ ID NO: 146), Figure 148 (SEQ ID NO: 148), Figure 150 (SEQ ID NO: 150), Figure 152 (SEQ ID NO: 152), Figure 154 (SEQ ID NO: 154), Figure 156 (SEQ ID NO: 156), Figure 158 (SEQ ID NO: 158), Figure 160 (SEQ ID NO: 160), Figure 162 (SEQ ID NO: 162), Figure 164 (SEQ ID NO: 164), Figure 166 (SEQ ID NO: 166), Figure 168 (SEQ ID NO: 168), Figure 170 (SEQ ID NO: 170), Figure 172 (SEQ ID NO: 172), Figure 174 (SEQ ID NO: 174), Figure 176 (SEQ ID NO: 176), Figure 178 (SEQ ID NO: 178), Figure 180 (SEQ ID NO: 180), Figure 182 (SEQ ID NO: 182), Figure 184 (SEQ ID NO: 184) ), Figure 186 (SEQ ID NO: 186), Figure 188 (SEQ ID NO: 188), Figure 190 (SEQ ID NO: 190), Figure 192 (SEQ ID NO: 192), Figure 194 (SEQ ID NO: 194), Figure 196 ( SEQ ID NO: 196), Figure 198 (SEQ ID NO: 198), Figure 200 (SEQ ID NO: 200), Figure 202 (SEQ ID NO: 202), Figure 204 (SEQ ID NO: 204), Figure 206 (SEQ ID NO: 206) , Figure 208 (SEQ ID NO: 208), Figure 210 (SEQ ID NO: 210), Figure 212 (SEQ ID NO: 212), Figure 214 (SEQ ID NO: 214), Figure 216 (SEQ ID NO: 216), Figure 218 (Sequence) Number: 218), Figure 220 (SEQ ID NO: 220), Figure 222 (SEQ ID NO: 222), Figure 224 (SEQ ID NO: 224), Figure 226 (SEQ ID NO: 226), Figure 228 (SEQ ID NO: 228), Figure 230 (SEQ ID NO: 230), Figure 232 (SEQ ID NO: 232), Figure 234 (SEQ ID NO: 234), Figure 236 (SEQ ID NO: 236), Figure 238 (SEQ ID NO: 238), Figure 240 (SEQ ID NO: 240), Figure 242 (SEQ ID NO: 242), Figure 244 (SEQ ID NO: 244), Figure 246 (SEQ ID NO: 246), Figure 248 (SEQ ID NO: 248), Figure 250 (SEQ ID NO: 250), Figure 252 (SEQ ID NO: 252), Figure 254 (SEQ ID NO: 254), Figure 256 (SEQ ID NO: 256), Figure 258 (SEQ ID NO: 258), Figure 260 (SEQ ID NO: 260), Figure 262 (SEQ ID NO: 262) ), Figure 264 (SEQ ID NO: 264), Figure 266 (SEQ ID NO: 266), Figure 268 (SEQ ID NO: 268), Figure 270 (SEQ ID NO: 270), Figure 272 (SEQ ID NO: 272), Figure 274 ( SEQ ID NO: 274), Figure 276 (SEQ ID NO: 276), Figure 278 (SEQ ID NO: 278), Figure 280 (SEQ ID NO: 280), Figure 282 (SEQ ID NO: 282), Figure 284 (SEQ ID NO: 284) , Figure 286 (SEQ ID NO: 286), Figure 288 (SEQ ID NO: 288), Figure 290 (SEQ ID NO: 290), Figure 292 (SEQ ID NO: 292), Figure 294 (SEQ ID NO: 294), Figure 296 (Arrangement) Figure 298), Figure 298 (SEQ ID NO: 298), Figure 300 (SEQ ID NO: 300), Figure 302 (SEQ ID NO: 302), Figure 304 (SEQ ID NO: 304), Figure 306 (SEQ ID NO: 306), Figure 308 (SEQ ID NO: 308), Figure 310 (SEQ ID NO: 310), Figure 312 (SEQ ID NO: 312), Figure 314 (SEQ ID NO: 314), Figure 316 (SEQ ID NO: 316), Figure 318 (SEQ ID NO: : 318), Figure 320 (SEQ ID NO: 320), Figure 322 (SEQ ID NO: 322), Figure 324 (SEQ ID NO: 324), Figure 326 (SEQ ID NO: 326), Figure 328 (SEQ ID NO: 328), Figure 330 (SEQ ID NO: 330), Figure 332 (SEQ ID NO: 332), Figure 334 (SEQ ID NO: 334), Figure 336 (SEQ ID NO: 336), Figure 338 (SEQ ID NO: 338), Figure 340 (SEQ ID NO: 340), Figure 342 (SEQ ID NO: 342), Figure 344 (SEQ ID NO: 344), Figure 346 (SEQ ID NO: 346), Figure 348 (SEQ ID NO: 348), Figure 350 (SEQ ID NO: 350), Figure 352 (SEQ ID NO: 352), Figure 354 (SEQ ID NO: 354), Figure 356 (SEQ ID NO: 356), Figure 358 (SEQ ID NO: 358), Figure 360 (SEQ ID NO: 360), Figure 362 (SEQ ID NO: 362), Figure 364 (SEQ ID NO: 364), Figure 366 (SEQ ID NO: 366), Figure 368 (SEQ ID NO: 368), Figure 370 (SEQ ID NO: 370), Figure 372 (SEQ ID NO: 372) or Figure 374 Amino acid sequence of the extracellular domain of the polypeptide shown in (SEQ ID NO: 374) lacking its associated signal peptide:
And an isolated polypeptide having at least 80% amino acid sequence identity. Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 4), Figure 6 (SEQ ID NO: 6), Figure 8 (SEQ ID NO: 8), Figure 10 (SEQ ID NO: 10), Figure 12 (SEQ ID NO: : 12), Figure 14 (SEQ ID NO: 14), Figure 16 (SEQ ID NO: 16), Figure 18 (SEQ ID NO: 18), Figure 20 (SEQ ID NO: 20), Figure 22 (SEQ ID NO: 22), Figure 24 (SEQ ID NO: 24), Figure 26 (SEQ ID NO: 26), Figure 28 (SEQ ID NO: 28), Figure 30 (SEQ ID NO: 30), Figure 32 (SEQ ID NO: 32), Figure 34 (SEQ ID NO: 34), Figure 36 (SEQ ID NO: 36), Figure 38 (SEQ ID NO: 38), Figure 40 (SEQ ID NO: 40), Figure 42 (SEQ ID NO: 42), Figure 44 (SEQ ID NO: 44), Figure 46 (SEQ ID NO: 46), Figure 48 (SEQ ID NO: 48), Figure 50 (SEQ ID NO: 50), Figure 52 (SEQ ID NO: 52), Figure 54 (SEQ ID NO: 54), Figure 56 (SEQ ID NO: 56) ), Figure 58 (SEQ ID NO: 58), Figure 60 (SEQ ID NO: 60), Figure 62 (SEQ ID NO: 62), Figure 64 (SEQ ID NO: 64), Figure 66 (SEQ ID NO: 66), Figure 68 ( SEQ ID NO: 68), FIG. 70 (SEQ ID NO: 70), FIG. 72 (SEQ ID NO: 72), Figure 74 (SEQ ID NO: 74), Figure 76 (SEQ ID NO: 76), Figure 78 (SEQ ID NO: 78), Figure 80 (SEQ ID NO: 80), Figure 82 (SEQ ID NO: 82), Figure 84 (SEQ ID NO: : 84), Figure 86 (SEQ ID NO: 86), Figure 88 (SEQ ID NO: 88), Figure 90 (SEQ ID NO: 90), Figure 92 (SEQ ID NO: 92), Figure 94 (SEQ ID NO: 94), Figure 96 (SEQ ID NO: 96), Figure 98 (SEQ ID NO: 98), Figure 100 (SEQ ID NO: 100), Figure 102 (SEQ ID NO: 102), Figure 104 (SEQ ID NO: 104), Figure 106 (SEQ ID NO: 106), Figure 108 (SEQ ID NO: 108), Figure 110 (SEQ ID NO: 110), Figure 112 (SEQ ID NO: 112), Figure 114 (SEQ ID NO: 114), Figure 116 (SEQ ID NO: 116), Figure 118 (SEQ ID NO: 118), Figure 120 (SEQ ID NO: 120), Figure 122 (SEQ ID NO: 122), Figure 124 (SEQ ID NO: 124), Figure 126 (SEQ ID NO: 126), Figure 128 (SEQ ID NO: 128) ), Figure 130 (SEQ ID NO: 130), Figure 132 (SEQ ID NO: 132), Figure 134 (SEQ ID NO: 134), Figure 136 (SEQ ID NO: 136), Figure 138 (SEQ ID NO: 138), Figure 140 ( SEQ ID NO: 140), Figure 1 42 (SEQ ID NO: 142), Figure 144 (SEQ ID NO: 144), Figure 146 (SEQ ID NO: 146), Figure 148 (SEQ ID NO: 148), Figure 150 (SEQ ID NO: 150), Figure 152 (SEQ ID NO: 152), Figure 154 (SEQ ID NO: 154), Figure 156 (SEQ ID NO: 156), Figure 158 (SEQ ID NO: 158), Figure 160 (SEQ ID NO: 160), Figure 162 (SEQ ID NO: 162), Figure 164 (SEQ ID NO: 164), Figure 166 (SEQ ID NO: 166), Figure 168 (SEQ ID NO: 168), Figure 170 (SEQ ID NO: 170), Figure 172 (SEQ ID NO: 172), Figure 174 (SEQ ID NO: 174) ), Figure 176 (SEQ ID NO: 176), Figure 178 (SEQ ID NO: 178), Figure 180 (SEQ ID NO: 180), Figure 182 (SEQ ID NO: 182), Figure 184 (SEQ ID NO: 184), Figure 186 ( SEQ ID NO: 186), Figure 188 (SEQ ID NO: 188), Figure 190 (SEQ ID NO: 190), Figure 192 (SEQ ID NO: 192), Figure 194 (SEQ ID NO: 194), Figure 196 (SEQ ID NO: 196) , Figure 198 (SEQ ID NO: 198), Figure 200 (SEQ ID NO: 200), Figure 202 (SEQ ID NO: 202), Figure 204 (SEQ ID NO: 204), Figure 206 (SEQ ID NO: 206), Figure 208 (Array Figure 208 (SEQ ID NO: 210), Figure 212 (SEQ ID NO: 212), Figure 214 (SEQ ID NO: 214), Figure 216 (SEQ ID NO: 216), Figure 218 (SEQ ID NO: 218), Figure 220 (SEQ ID NO: 220), Figure 222 (SEQ ID NO: 222), Figure 224 (SEQ ID NO: 224), Figure 226 (SEQ ID NO: 226), Figure 228 (SEQ ID NO: 228), Figure 230 (SEQ ID NO: : 230), Figure 232 (SEQ ID NO: 232), Figure 234 (SEQ ID NO: 234), Figure 236 (SEQ ID NO: 236), Figure 238 (SEQ ID NO: 238), Figure 240 (SEQ ID NO: 240), Figure 242 (SEQ ID NO: 242), Figure 244 (SEQ ID NO: 244), Figure 246 (SEQ ID NO: 246), Figure 248 (SEQ ID NO: 248), Figure 250 (SEQ ID NO: 250), Figure 252 (SEQ ID NO: 252), Figure 254 (SEQ ID NO: 254), Figure 256 (SEQ ID NO: 256), Figure 258 (SEQ ID NO: 258), Figure 260 (SEQ ID NO: 260), Figure 262 (SEQ ID NO: 262), Figure 264 (SEQ ID NO: 264), Figure 266 (SEQ ID NO: 266), Figure 268 (SEQ ID NO: 268), Figure 270 (SEQ ID NO: 270), Figure 272 (SEQ ID NO: 272), Figure 274 (SEQ ID NO: 274), Figure 276 (SEQ ID NO: 276), Figure 278 (SEQ ID NO: 278), Figure 280 (SEQ ID NO: 280), Figure 282 (SEQ ID NO: 282), Figure 284 (SEQ ID NO: 284), Figure 286 (SEQ ID NO: 286), Figure 288 (SEQ ID NO: 288), Figure 290 (SEQ ID NO: 290), Figure 292 (SEQ ID NO: 292), Figure 294 (SEQ ID NO: 294), Figure 296 (SEQ ID NO: 296) ), Figure 298 (SEQ ID NO: 298), Figure 300 (SEQ ID NO: 300), Figure 302 (SEQ ID NO: 302), Figure 304 (SEQ ID NO: 304), Figure 306 (SEQ ID NO: 306), Figure 308 ( SEQ ID NO: 308), Figure 310 (SEQ ID NO: 310), Figure 312 (SEQ ID NO: 312), Figure 314 (SEQ ID NO: 314), Figure 316 (SEQ ID NO: 316), Figure 318 (SEQ ID NO: 318) , Figure 320 (SEQ ID NO: 320), Figure 322 (SEQ ID NO: 322), Figure 324 (SEQ ID NO: 324), Figure 326 (SEQ ID NO: 326), Figure 328 (SEQ ID NO: 328), Figure 330 (Sequence) Figure 332 (SEQ ID NO: 332), Figure 334 (SEQ ID NO: 334), Figure 336 (SEQ ID NO: 336), Figure 338 (SEQ ID NO: 338), Figure 340 (SEQ ID NO: 340), Figure 342 (SEQ ID NO: 342), Figure 344 (SEQ ID NO: 344), Figure 346 (SEQ ID NO: 346), Figure 348 (SEQ ID NO: 348), Figure 350 (SEQ ID NO: 350), Figure 352 (SEQ ID NO: 352), Figure 354 (SEQ ID NO: 354), Figure 356 (SEQ ID NO: 356), Figure 358 (SEQ ID NO: 358), Figure 360 (SEQ ID NO: 360), Figure 362 (SEQ ID NO: 362), Figure 364 (SEQ ID NO: 364), Figure 366 (SEQ ID NO: 366), Figure 368 (SEQ ID NO: 368), Figure 370 (SEQ ID NO: 370), Figure 372 (SEQ ID NO: 372) or Figure 374 (SEQ ID NO: 374) ) A method of treating a cardiovascular, endothelial or angiogenic disease in a mammal comprising administering to the mammal a therapeutically effective amount of the polypeptide shown in). 21. The method of claim 20, wherein the mammal is a human. 24. The method of claim 21, wherein the human suffers from myocardial infarction. The method according to claim 21, wherein the human suffers from cardiac hypertrophy, trauma, cancer or age-related macular degeneration. 24. The method of claim 23, wherein cardiac hypertrophy is characterized by the presence of elevated levels of PGF _2α . 21. The method of claim 20, wherein the polypeptide is administered with a cardiovascular, endothelial or angiogenic agent. 24. The method of claim 23, wherein the polypeptide is administered according to primary angioplasty. 21. The method of claim 20, wherein the cardiovascular, endothelial or angiogenic disease is cancer. 28. The method of claim 27, wherein the polypeptide is administered in combination with a chemotherapeutic agent, growth inhibitory agent or cytotoxic agent. 21. The method of claim 20, wherein the agonist is an antibody against the polypeptide. 21. The method of claim 20, wherein the antagonist is an antibody against the polypeptide. Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 4), Figure 6 (SEQ ID NO: 6), Figure 8 (SEQ ID NO: 8), Figure 10 (SEQ ID NO: 10), Figure 12 (SEQ ID NO: : 12), Figure 14 (SEQ ID NO: 14), Figure 16 (SEQ ID NO: 16), Figure 18 (SEQ ID NO: 18), Figure 20 (SEQ ID NO: 20), Figure 22 (SEQ ID NO: 22), Figure 24 (SEQ ID NO: 24), Figure 26 (SEQ ID NO: 26), Figure 28 (SEQ ID NO: 28), Figure 30 (SEQ ID NO: 30), Figure 32 (SEQ ID NO: 32), Figure 34 (SEQ ID NO: 34), Figure 36 (SEQ ID NO: 36), Figure 38 (SEQ ID NO: 38), Figure 40 (SEQ ID NO: 40), Figure 42 (SEQ ID NO: 42), Figure 44 (SEQ ID NO: 44), Figure 46 (SEQ ID NO: 46), Figure 48 (SEQ ID NO: 48), Figure 50 (SEQ ID NO: 50), Figure 52 (SEQ ID NO: 52), Figure 54 (SEQ ID NO: 54), Figure 56 (SEQ ID NO: 56) ), Figure 58 (SEQ ID NO: 58), Figure 60 (SEQ ID NO: 60), Figure 62 (SEQ ID NO: 62), Figure 64 (SEQ ID NO: 64), Figure 66 (SEQ ID NO: 66), Figure 68 ( SEQ ID NO: 68), FIG. 70 (SEQ ID NO: 70), FIG. 72 (SEQ ID NO: 72), Figure 74 (SEQ ID NO: 74), Figure 76 (SEQ ID NO: 76), Figure 78 (SEQ ID NO: 78), Figure 80 (SEQ ID NO: 80), Figure 82 (SEQ ID NO: 82), Figure 84 (SEQ ID NO: : 84), Figure 86 (SEQ ID NO: 86), Figure 88 (SEQ ID NO: 88), Figure 90 (SEQ ID NO: 90), Figure 92 (SEQ ID NO: 92), Figure 94 (SEQ ID NO: 94), Figure 96 (SEQ ID NO: 96), Figure 98 (SEQ ID NO: 98), Figure 100 (SEQ ID NO: 100), Figure 102 (SEQ ID NO: 102), Figure 104 (SEQ ID NO: 104), Figure 106 (SEQ ID NO: 106), Figure 108 (SEQ ID NO: 108), Figure 110 (SEQ ID NO: 110), Figure 112 (SEQ ID NO: 112), Figure 114 (SEQ ID NO: 114), Figure 116 (SEQ ID NO: 116), Figure 118 (SEQ ID NO: 118), Figure 120 (SEQ ID NO: 120), Figure 122 (SEQ ID NO: 122), Figure 124 (SEQ ID NO: 124), Figure 126 (SEQ ID NO: 126), Figure 128 (SEQ ID NO: 128) ), Figure 130 (SEQ ID NO: 130), Figure 132 (SEQ ID NO: 132), Figure 134 (SEQ ID NO: 134), Figure 136 (SEQ ID NO: 136), Figure 138 (SEQ ID NO: 138), Figure 140 ( SEQ ID NO: 140), Figure 1 42 (SEQ ID NO: 142), Figure 144 (SEQ ID NO: 144), Figure 146 (SEQ ID NO: 146), Figure 148 (SEQ ID NO: 148), Figure 150 (SEQ ID NO: 150), Figure 152 (SEQ ID NO: 152), Figure 154 (SEQ ID NO: 154), Figure 156 (SEQ ID NO: 156), Figure 158 (SEQ ID NO: 158), Figure 160 (SEQ ID NO: 160), Figure 162 (SEQ ID NO: 162), Figure 164 (SEQ ID NO: 164), Figure 166 (SEQ ID NO: 166), Figure 168 (SEQ ID NO: 168), Figure 170 (SEQ ID NO: 170), Figure 172 (SEQ ID NO: 172), Figure 174 (SEQ ID NO: 174) ), Figure 176 (SEQ ID NO: 176), Figure 178 (SEQ ID NO: 178), Figure 180 (SEQ ID NO: 180), Figure 182 (SEQ ID NO: 182), Figure 184 (SEQ ID NO: 184), Figure 186 ( SEQ ID NO: 186), Figure 188 (SEQ ID NO: 188), Figure 190 (SEQ ID NO: 190), Figure 192 (SEQ ID NO: 192), Figure 194 (SEQ ID NO: 194), Figure 196 (SEQ ID NO: 196) , Figure 198 (SEQ ID NO: 198), Figure 200 (SEQ ID NO: 200), Figure 202 (SEQ ID NO: 202), Figure 204 (SEQ ID NO: 204), Figure 206 (SEQ ID NO: 206), Figure 208 (Array Figure 208 (SEQ ID NO: 210), Figure 212 (SEQ ID NO: 212), Figure 214 (SEQ ID NO: 214), Figure 216 (SEQ ID NO: 216), Figure 218 (SEQ ID NO: 218), Figure 220 (SEQ ID NO: 220), Figure 222 (SEQ ID NO: 222), Figure 224 (SEQ ID NO: 224), Figure 226 (SEQ ID NO: 226), Figure 228 (SEQ ID NO: 228), Figure 230 (SEQ ID NO: : 230), Figure 232 (SEQ ID NO: 232), Figure 234 (SEQ ID NO: 234), Figure 236 (SEQ ID NO: 236), Figure 238 (SEQ ID NO: 238), Figure 240 (SEQ ID NO: 240), Figure 242 (SEQ ID NO: 242), Figure 244 (SEQ ID NO: 244), Figure 246 (SEQ ID NO: 246), Figure 248 (SEQ ID NO: 248), Figure 250 (SEQ ID NO: 250), Figure 252 (SEQ ID NO: 252), Figure 254 (SEQ ID NO: 254), Figure 256 (SEQ ID NO: 256), Figure 258 (SEQ ID NO: 258), Figure 260 (SEQ ID NO: 260), Figure 262 (SEQ ID NO: 262), Figure 264 (SEQ ID NO: 264), Figure 266 (SEQ ID NO: 266), Figure 268 (SEQ ID NO: 268), Figure 270 (SEQ ID NO: 270), Figure 272 (SEQ ID NO: 272), Figure 274 (SEQ ID NO: 274), Figure 276 (SEQ ID NO: 276), Figure 278 (SEQ ID NO: 278), Figure 280 (SEQ ID NO: 280), Figure 282 (SEQ ID NO: 282), Figure 284 (SEQ ID NO: 284), Figure 286 (SEQ ID NO: 286), Figure 288 (SEQ ID NO: 288), Figure 290 (SEQ ID NO: 290), Figure 292 (SEQ ID NO: 292), Figure 294 (SEQ ID NO: 294), Figure 296 (SEQ ID NO: 296) ), Figure 298 (SEQ ID NO: 298), Figure 300 (SEQ ID NO: 300), Figure 302 (SEQ ID NO: 302), Figure 304 (SEQ ID NO: 304), Figure 306 (SEQ ID NO: 306), Figure 308 ( SEQ ID NO: 308), Figure 310 (SEQ ID NO: 310), Figure 312 (SEQ ID NO: 312), Figure 314 (SEQ ID NO: 314), Figure 316 (SEQ ID NO: 316), Figure 318 (SEQ ID NO: 318) , Figure 320 (SEQ ID NO: 320), Figure 322 (SEQ ID NO: 322), Figure 324 (SEQ ID NO: 324), Figure 326 (SEQ ID NO: 326), Figure 328 (SEQ ID NO: 328), Figure 330 (Sequence) Figure 332 (SEQ ID NO: 332), Figure 334 (SEQ ID NO: 334), Figure 336 (SEQ ID NO: 336), Figure 338 (SEQ ID NO: 338), Figure 340 (SEQ ID NO: 340), Figure 342 (SEQ ID NO: 342), Figure 344 (SEQ ID NO: 344), Figure 346 (SEQ ID NO: 346), Figure 348 (SEQ ID NO: 348), Figure 350 (SEQ ID NO: 350), Figure 352 (SEQ ID NO: 352), Figure 354 (SEQ ID NO: 354), Figure 356 (SEQ ID NO: 356), Figure 358 (SEQ ID NO: 358), Figure 360 (SEQ ID NO: 360), Figure 362 (SEQ ID NO: 362), Figure 364 (SEQ ID NO: 364), Figure 366 (SEQ ID NO: 366), Figure 368 (SEQ ID NO: 368), Figure 370 (SEQ ID NO: 370), Figure 372 (SEQ ID NO: 372) or Figure 374 (SEQ ID NO: 374) ) A method of treating a cardiovascular, endothelial or angiogenic disease in a mammal, comprising administering to the mammal a nucleic acid molecule encoding the polypeptide shown in the above or an agonist or antagonist thereof. 32. The method of claim 31, wherein the agonist is an antibody of the polypeptide. 32. The method of claim 31, wherein the antagonist is an antibody of the polypeptide. 32. The method of claim 31, wherein the mammal is a human. 32. The method of claim 31, wherein the nucleic acid molecule is administered by ex vivo gene therapy. PRO229, PRO238, PRO247, PRO444, PRO720, PRO827, PRO1007, PRO1029, PRO1075, PRO1184, PRO1190, PRO1195, PRO1274, PRO1279, PRO1419, PRO1474, PRO1477, PRO1488, PRO1782, PRO1890, PPRO4302, PRO4405, PRO5725, PRO5776, PRO6006, A method of inhibiting endothelial cell proliferation in a mammal comprising administering PRO7436, PRO9771, PRO10008, PRO21384 or PRO28631 polypeptide or an agonist thereof to the mammal, wherein the proliferation of the endothelial cell in said mammal is inhibited How to be. PRO21, PRO181, PRO205, PRO214, PRO221, PRO231, PRO238, PRO241, PRO247, PRO256, PRO258, PRO263, PRO265, PRO295, PRO321, PRO322, PRO337, PRO363, PRO365, PRO533, PRO697, PRO725, PRO771, PRO788 , PRO791, PRO819, PRO828, PRO836, PRO846, PRO865, PRO1005, PRO1006, PRO1025, PRO1054, PRO1071, PRO1079, PRO1080, PRO1114, PRO1131, PRO1155, PRO1160, PRO1186, PRO1192, PRO1244, PRO1272, PRO1273, PRO1279, PRO1283, PRO1286 , PRO1306, PRO1309, PRO1325, PRO1329, PRO1347, PRO1356, PRO1376, PRO1382, PRO1411, PRO1412, PRO1508, PRO1550, PRO1556, PRO1760, PRO1787, PRO1801, PRO1868, PRO1887, PRO3438, PRO3444, PRO4324, PRO4333, PRO4341, PRO4342, PRO4353 , PRO4354, PRO4356, PRO4371, PRO4408, PRO4422, PRO4425, PRO4499, PRO5723, PRO5737, PRO6029, PRO6071, PRO9821, PRO9873, PRO10008, PRO10096, PRO19670, PRO20040, PRO20044, PRO21055 or PRO21384 polypeptide, or an agonist thereof A method of stimulating endothelial cell proliferation in mammals containing A method wherein the proliferation of endothelial cells in the mammal is stimulated. A method for inducing cardiac hypertrophy in a mammal comprising administering a PRO21 polypeptide or an agonist thereof to the mammal, wherein the cardiac hypertrophy is induced in said mammal. A method of stimulating angiogenesis induced by PRO1376 or PRO1449 in a mammal comprising administering to the mammal a therapeutically effective amount of said polypeptide, wherein said angiogenesis is stimulated. A method for inducing apoptosis of endothelial cells, comprising administering PRO4302 polypeptide or an agonist thereof to the endothelial cells, wherein apoptosis in the endothelial cells is induced. PRO162, PRO182, PRO204, PRO221, PRO230, PRO256, PRO258, PRO533, PRO697, PRO725, PRO738, PRO826, PRO836, PRO840, PRO846, PRO865, PRO982, PRO1025, PRO1029, PRO1071, PRO1083, PRO1134, PRO1160, PRO1182, PRO1184, PRO1186, PRO1192, PRO1274, PRO1279, PRO1283, PRO1306, PRO1308, PRO1325, PRO1337, PRO1338, PRO1343, PRO1376, PRO1387, PRO1411, PRO1412, PRO1415, PRO1434, PRO1474, PRO1550, PRO1556, PRO1567, PRO1600, PRO1754, PRO1758, PRO1760, PRO1787, PRO1865, PRO1868, PRO1917, PRO1928, PRO3438, PRO3562, PRO4333, PRO4345, PRO4353, PRO4354, PRO4408, PRO4430, PRO4503, PRO6714, PRO9771, PRO9820, PRO9940, PRO10096, PRO21055, PRO21184 or PRO21366 or PRO21366 polypeptide A method of stimulating smooth muscle cell proliferation comprising administering the agonist, wherein the smooth muscle cell proliferation is stimulated in the smooth muscle cells. Smooth muscle cell proliferation is promoted in smooth muscle cells, comprising administering PRO181, PRO195, PRO1080, PRO1265, PRO1309, PRO1488, PRO4302, PRO4405 or PRO5725 polypeptides, or agonists thereof, to smooth muscle cells. A method of inhibiting proliferation. PRO178, PRO195, PRO228, PRO301, PRO302, PRO532, PRO724, PRO730, PRO734, PRO793, PRO871, PRO938, PRO1012, PRO1120, PRO1139, PRO1198, PRO1287, PRO1361, PRO1864, PRO1873, PRO2010, PRO3579, PRO4313, PRO4527, PRO4538, A method of inducing endothelial cell tube formation comprising administering PRO4553, PRO4995, PRO5730, PRO6008, PRO7223, PRO7248 or PRO7261 polypeptide or an agonist thereof to endothelial cells, wherein tube formation in said endothelial cells is induced How to be.

Images