KR20030002292A - Secreted and Transmembrane Polypeptides and Nucleic Acids Encoding the Same - Google Patents

Abstract

The present invention relates to novel polypeptides and nucleic acid molecules encoding the polypeptides. Further, herein, a vector comprising a nucleic acid sequence and a host cell, a chimeric polypeptide molecule comprising a polypeptide of the invention fused with a heterologous polypeptide sequence, an antibody binding to a polypeptide of the invention, and a method of producing a polypeptide of the invention Is provided.

Description

Secretory and transmembrane polypeptides and nucleic acids encoding them {Secreted and Transmembrane Polypeptides and Nucleic Acids Encoding the Same}

Extracellular proteins play an important role, among other things, in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, such as proliferation, migration, differentiation or interaction with other cells, is typically dictated by information received from other cells and / or adjacent environments. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. These secretory polypeptides or signaling molecules generally reach their site of action in the extracellular environment via the secretory pathway of the cell.

Secretory proteins have a variety of industrial uses, including pharmaceuticals, diagnostics, biosensors, and bioreactors. Most protein drugs currently available such as thrombolytics, interferons, interleukins, erythropoietins, colony promoters and various other cytokines are secreted proteins. In addition, membrane proteins that are their receptors also have potential as therapeutic or diagnostic agents. Efforts to find new natural secreted proteins are being made by both industry and academia. Much of this effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637.

Membrane binding proteins and receptors can play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, such as proliferation, migration, differentiation or interaction with other cells, is typically dictated by information received from other cells and / or adjacent environments. Often, this information is delivered by secreted polypeptides (e.g., mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. . Such membrane-binding proteins and cellular receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatase, receptors involved in cell-cell interactions, and cellular adhesin molecules such as selectins and integrins. For example, the transmission of signals that regulate cell growth and differentiation is in part regulated by phosphorylation of several cellular proteins. Protein tyrosine kinases, enzymes that accelerate this process, can also act as growth factor receptors. Examples include fibroblast growth factor receptors and nerve growth factor receptors.

Membrane binding proteins and receptor molecules have a variety of industrial uses, including pharmaceuticals and diagnostics. For example, receptor immunoadhesin can be used as a therapeutic agent to block receptor-ligand interactions. Membrane binding proteins can also be used to screen for potential peptide or small molecule inhibitors for related receptor / ligand interactions. Efforts to find new natural receptors or membrane-bound proteins have been made by both industry and academia. Much effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for new receptor proteins.

We herein describe the identification and characterization of novel secretory and transmembrane polypeptides, and novel nucleic acids encoding such polypeptides.

1.PRO213

Human growth arrest-specific gene 6 (gas6) is expressed in several different tissues and has been reported to be highly expressed during periods of interrupted serum supply and negatively regulated during periods of growth induction. Manfioletti et al., Mol. Cell. Biol. 13 (8): 4976-4985 (1993) and Stitt et al., Cell 80: 661-670 (1995). Manfioletti et al. (1993) supra, gas6 protein is a member of the vitamin K-dependent protein family, and members of the vitamin K-dependent protein family (including, for example, protein S, protein C and factor X) are all involved in the blood coagulation pathway. It is suggested to play a regulatory role. Thus, it has been suggested that gas6 may play a role in regulating protease sequence associated with growth regulation or blood coagulation sequence.

Because gas6 proteins are physiologically important, both industry and academia are working to find new natural proteins homologous to gas6. Much of this effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel secretion and membrane binding receptor proteins, particularly proteins homologous to gas6. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637. Here we describe a novel polypeptide having homology with the gas6 polypeptide.

2.PRO274

7-membrane ("7TM") proteins or receptors, also referred to in the literature as G-protein coupled receptors, are specialized proteins designed to recognize ligands and subsequently signal information contained within these ligands to cellular tissue. The main purpose of cell surface receptors is to regulate the cellular response by distinguishing the appropriate ligand from the various extracellular stimuli that each cell encounters and then activating an operating system that generates intracellular signals [Dohlman, H., Ann. Rev. Biochem., 60: 653 (1991)]. The ability of the 7TM receptor to bind ligands to the recognition domain and allosterically deliver information to the intracellular domain is a special feature of the 7TM protein [Kenakin, T., Pharmacol. Rev., 48: 413 (1996). The gene family encoding the 7TM receptor or G-protein coupled receptor encodes a receptor that recognizes a number of ligands, including but not limited to C5a, interleukin 8 and related chemokines. Research in this area suggests that many other signals are sent to a common cell activation pathway at the cell surface [Gerard, C. and Gerard, N., Curr. Op. Immunol., 6: 140 (1994), Gerard, C. and Gerard, N., Ann. Rev. Immunol., 12: 775 (1994). The large family of receptors coupled to 7TM or G-proteins contains hundreds of members, among others, capable of recognizing a variety of messages such as photons, ions and amino acids [Schwartz, TW, et al., H., Trends in Pharmacol. Sci., 17 (6): 213 (1996)].

Dohlman, H., Ann. Rev. Biochem., 60: 653 (1991)]. Schwartz, T. W., et al., H., Eur. J. Pharm. Sci., 2:85 (1994)]. We herein describe a novel polypeptide (named PRO274 herein) having homology with the 7-membrane fragment receptor protein and the Fn54 protein.

3.PRO300

Diff 33 protein is overexpressed in mouse testicular tumors. The role of the Diff 33 protein is not clear at this time, but it can work in cancer. As understanding cancer physiology is medically important, efforts are currently being made to find new natural proteins involved in cancer. We herein describe a novel polypeptide (named PRO300 herein) having homology with Diff 33.

4.PRO284

Efforts are currently being made to identify and characterize novel transmembrane proteins. We herein describe the identification and characterization of novel transmembrane polypeptides (named PRO284 herein).

5.PRO296

Cancer cells often express many proteins that are not expressed in their normal cell types or that are expressed at different levels than their corresponding normal cell types. Many of these proteins are involved in inducing normal cells to transform into cancer cells or maintaining cancer traits. As such, identifying and characterizing proteins expressed in cancer cells is of considerable interest. Here we describe the identification and characterization of novel polypeptides (named PRO296 herein) having homology with the protein SAS amplified in sarcoma.

6.PRO329

Immunoglobulin molecules work in many important physiological responses in mammals. The structure of immunoglobulin molecules has been studied extensively, and the domains of intact immunoglobulins are different from each other, one of which is well documented in the literature that the constant domain or F _c region of an immunoglobulin molecule. The F _c domains of immunoglobulins are not directly involved in antigen recognition and binding, but the immunoglobulin molecules either circulate in the serum with or without binding to each antigen or bind to F _c receptors on the cell surface. Mediate ability. The ability of the immunoglobulin's F _c domain to bind an F _c receptor molecule is manifested in a variety of important activities, including, for example, an activity that enhances the immune response to unwanted foreign particles. As such, identifying novel F _c receptor proteins and their subunits is of considerable interest. Here we describe the identification and characterization of new polypeptides (named PRO329 herein) which are homologous to the high affinity immunoglobulin F _c receptor protein.

7.PRO362

Colorectal cancer is a high incidence of malignant tumor disease in the western world, especially in the United States. This type of tumor often spreads through lymphatic vessels and blood vessels, causing about 62,000 deaths per year in the United States.

Monoclonal antibody A33 (mAbA33) is a rat immunoglobulin that is widely used for preclinical and local studies of patients suffering from colorectal cancer [Welt et al., J. Clin. Oncol. 8: 1894-1906 (1990) and Welt et al., J. Clin. Oncol. 12: 1561-1571 (1994). mAbA33 is known to bind antigen present in and on normal colon cells and colon cancer cells. In cancers occurring in the colon mucosa, the A33 antigen is uniformly expressed in at least 95% of these cancer patients. However, the A33 antigen is not detected in a wide range of other normal tissues, ie its expression appears to be somewhat organ specific. Thus, the A33 antigen appears to play an important role in the induction of colorectal cancer.

As the A33 antigen is clearly important in the formation and / or proliferation of tumor cells, identifying homologues of the A33 antigen is of considerable interest. In this regard, the inventors herein describe the identification and characterization of novel polypeptides (named PRO362 herein) that are homologous to the A33 antigen protein.

8.PRO363

The cell surface protein, HCAR, is a membrane binding protein that acts as a receptor for subgroup C of adenoviruses and subgroup B of coxsackieviruses. Thus, HCAR can provide a means of mediating viral infection of cells in that the presence of HCAR receptors on the cell surface promotes viral infection by providing a binding site for viral particles.

In view of the physiological importance of membrane-bound proteins, especially those that act as cell surface receptors for viruses, both industry and academia are now working to find new natural membrane-bound receptor proteins. Much of this effort is focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel receptor proteins. We herein describe novel membrane-binding polypeptides homologous to various tumor antigens, including cell surface proteins HCAR, and A33 and carcinoembryonic antigens, herein named PRO363, which polypeptides are novel cell surface viral receptors or May be a tumor antigen).

9.PRO868

Regulation of cell numbers in mammals is thought to be determined, in part, by the balance between cell proliferation and cell death. One form of cell death, sometimes called necrotic cell death, is typically characterized by a pathological form of cell death due to some trauma or cell damage. In contrast, there are other “physiological” forms of cell death that often proceed in a sequential or controlled manner. This sequential or regulated form of cell death is often referred to as “apoptosis” (see, eg, Barr et al., Bio / Technology, 12: 487-493 (1994); Steller et al., Science, 267: 1445-1449 (1995). Apoptotic cell death occurs naturally in many physiological responses, including embryonic development and clonal selection in the immune system (Itoh et al., Cell, 66: 233-243 (1991)). Reduction in apoptotic cell death levels is associated with various pathological symptoms including cancer, lupus and herpes virus infections (Thompson, Science, 267: 1456-1462 (1995)). Increased levels of apoptotic cell death include AIDS, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, multiple sclerosis, retinitis pigmentosa, cerebellar degeneration, aplastic anemia, myocardial infarction, stroke, reperfusion injury, and liver disease caused by toxins. It may be associated with a variety of other pathological symptoms [see, Thompson, supra].

Apoptotic cell death usually involves one or more characteristic morphological and biochemical changes in the cell, such as, for example, enrichment of the cytoplasm, loss of plasma membrane microvilli, nuclear fission, degradation of chromosomal DNA, or loss of mitochondrial function. . Various foreign and intrinsic signals are believed to initiate or induce such morphological and biochemical cellular changes [Raff, Nature, 356: 397-400 (1992); Steller, supra; Sachs et al., Blood, 82:15 (1993). For example, such changes can be initiated by hormonal stimulation such as glucocorticoids in immature thymic cells, as well as by the cessation of several growth factors (Watanabe-Fukunaga et al., Nature, 356: 314-317 (1992)). In addition, several identified oncogenes such as myc , rel and E1A and tumor suppressor genes such as p53 have been reported to play a role in inducing apoptosis. Some chemotherapy drugs and some forms of radiation have also been found to have apoptosis-inducing activity [Thompson, supra].

Tumor necrosis factor-α ("TNF-α"), tumor necrosis factor-β ("TNF-β" or "lymphotoxin-α"), lymphotoxin-β ("LT-β"), CD30 ligand , Various molecules such as CD27 ligand, CD40 ligand, OX-40 ligand, 4-1BB ligand, Apo-1 ligand (also known as Fas ligand or CD95 ligand), and Apo-2 ligand (also known as TRAIL) "TNF") have been identified as members of the cytokine family (see, eg, Gruss and Dower, Blood, 85: 3378-3404 (1995); Pitti et al., J. Biol. Chem., 271: 12687-12690 (1996); Wiley et al., Immunity, 3: 673-682 (1995); Browning et al., Cell, 72: 847-856 (1993); Armitage et al. Nature, 357: 80-82 (1992), WO 97/01633 published January 16, 1997; WO 97/25428 published July 17, 1997]. Among these molecules, TNF-α, TNF-β, CD30 ligand, 4-1BB ligand, Apo-1 ligand and Apo-2 ligand (TRAIL) have been reported to be involved in apoptotic cell death. Both TNF-α and TNF-β have been reported to induce apoptotic killing in susceptible tumor cells [Schmid et al., Proc. Natl. Acad. Sci., 83: 1881 (1986); Dealtry et al., Eur. J. Immunol., 17: 689 (1987)]. Zheng et al. Reported that TNF-α is involved in apoptosis after stimulation of CD8-positive T cells (Zheng et al., Nature, 377: 348-351 (1995)). Other researchers have reported that CD30 ligand may be involved in the removal of self-reactive T cells from the thymus [Amakawa et al., Cold Spring Harbor Laboratory Symposium on Programmed Cell Death, Abstr. No. 10, (1995)].

Mutations in the mouse Fas / Apo-1 receptor or ligand genes (called lpr and gld , respectively) are associated with several autoimmune diseases, which play a role in the Apo-1 ligand in regulating clone defects of autoreactive lymphocytes in the periphery. Imply that it can be done [Krammer et al., Curr. Op. Immunol., 6: 279-289 (1994); Nagata et al., Science, 267: 1449-1456 (1995). Apo-1 ligands have also been reported to induce apoptosis after stimulation in CD4-positive T lymphocytes and B lymphocytes, and may be involved in removing activated lymphocytes when their function is no longer needed [Krammer et al., Supra; Nagata et al., Supra. Agonist mouse monoclonal antibodies that specifically bind to the Apo-1 receptor have been reported to exhibit comparable or similar cell killing activity to that of TNF-α [Yonehara et al., J. Exp. Med., 169: 1747-1756 (1989).

Induction of various cellular responses mediated by these TNF family cytokines is thought to be initiated by binding to specific cellular receptors. Two different TNF receptors of about 55-kDa (TNFR1) and 75-kDa (TNFR2) have been identified [Hohman et al., J. Biol. Chem., 264: 14927-14934 (1989); Brockhaus et al., Proc. Natl. Acad. Sci., 87: 3127-3131 (1990); EP 417,563, published March 20, 1991], both human and mouse cDNAs corresponding to these two receptor types have been isolated and characterized [Loetscher et al., Cell, 61: 351 (1990); Schall et al., Cell, 61: 361 (1990); Smith et al., Science, 248: 1019-1023 (1990); Lewis et al., Proc. Natl. Acad. Sci., 88: 2830-2834 (1991); Goodwin et al., Mol. Cell. Biol., 11: 3020-3026 (1991)]. Extensive polymorphism is associated with these two TNF receptor genes (see, eg, Takao et al., Immunogenetics, 37: 199-203 (1993)). These two TNFRs share the typical structure of cell surface receptors, including extracellular, transmembrane and intracellular regions. The extracellular portion of both receptors is also known as soluble TNF-binding protein inherently [Nophar, Y. et al., EMBO J., 9: 3269 (1990); and Kohno, T. et al., Proc. Natl. Acad. Sci. U.S.A., 87: 8331 (1990)]. More recently, Hale et al., J. et al. Cell. Biochem. Supplement 15F, 1991, p. 113 (P424), for cloning of recombinant soluble TNF receptors.

The extracellular portions of type 1 and type 2 TNFRs (TNFR1 and TNFR2) comprise a repeating amino acid sequence pattern of four cysteine-rich domains (CRDs), named 1-4, starting at the NH ₂ -terminus. Each CRD is about 40 amino acids long and contains 4 to 6 cysteines in well conserved positions [Schall et al., Supra; Loetscher et al., Supra; Smith et al., Supra; Nophar et al., Supra; Kohno et al., Supra. In TNFR1, the approximate boundaries of the four CRDs are as follows: approximately 53 in CRD1-amino acids 14; CRD2-approximate amino acids 54 to 97; CRD3-approximate amino acids 98 to 138; CRD4-approximately amino acids 139 to 167. In TNFR2, CRD1 is approximately 54 at amino acid 17; CRD2 is approximately amino acids 55 to 97; CRD3 is approximately amino acid 98 to 140; CRD4 comprises approximately amino acids 141 to 179 (Banner et al., Cell, 73: 431-435 (1993)). Possible roles of CRD in ligand binding are also described in Banner et al., Supra.

Similar repeating patterns of CRD are described in p75 nerve growth factor receptor (NGFR) [Johnson et al., Cell, 47: 545 (1986); Radeke et al., Nature, 325: 593 (1987)], B cell antigen CD40 [Stamenkovic et al., EMBO J., 8: 1403 (1989)], T cell antigen OX40 [Mallet et al., EMBO J. , 9: 1063 (1990)] and Fas antigen [Yonehara et al., Supra and Itoh et al., Cell, 66: 233-243 (1991)]. CRD is also present in soluble TNFR (sTNFR) -like T2 proteins of Shope and Myxoma poxviruses (Upton et al., Virology, 160: 20-29 (1987); Smith et al., Biochem. Biophys. Res. Commun., 176: 335 (1991); Upton et al., Virology, 184: 370 (1991). Optimal arrangement of these sequences indicates that the positions of the cysteine residues are well conserved. These receptors are sometimes referred to collectively as members of the TNF / NGF receptor cohort. Recent studies on p75NGFR have shown the deletion of CRD1 [Welcher, A.A. et al., Proc. Natl. Acad. Sci. USA, 88: 159-163 (1991)] or insertion of 5-amino acids in such domains [Yan, H. and Chao, M. V., J. Biol. Chem., 266: 12099-12104 (1991), have been found to have little or no effect on NGF binding [Yan, H. and Chao, M.V., supra]. p75 NGFR comprises a proline-rich stretch of about 60 amino acids that is not involved in NFG binding between its CRD4 and the transmembrane region [Peetre, C. et al., Eur. J. Hematol., 41: 414-419 (1988); Seckinger, P. et al., J. Biol. Chem., 264: 11966-11973 (1989); Yan, H. and Chao, M. V., supra]. Similar proline-rich regions are present in TNFR2 and not in TNFR1.

TNF family ligands discovered until recently are type II transmembrane proteins with C-terminus present extracellularly, except for lymphotoxin-α. In contrast, most receptors of the TNF receptor (TNFR) family that have been discovered until recently are type I transmembrane proteins. However, for both the TNF ligand and receptor family, the identified homology between these family members is predominantly in the extracellular domain ("ECD"). Several TNF family cytokines, including TNF-α, Apo-1 ligand, and CD40 ligand, are cleaved by proteolysis at the cell surface, and in each case the resulting protein is a homotrimeric molecule that normally acts as a soluble cytokine To form. In addition, TNF receptor family proteins are generally cleaved by proteolysis to release soluble receptor ECDs that can act as inhibitors of cognate cytokines.

Recently, other members of the TNFR family have been identified. Members of this newly identified family of TNFRs include CAR1, HVEM, and osteoprotegerin (OPG) [Brojatsch et al., Cell, 87: 845-855 (1996); Montgomery et al., Cell, 87: 427-436 (1996); Marsters et al., J. Biol. Chem., 272: 14029-14032 (1997); Simonet et al., Cell, 89: 309-319 (1997). Unlike other known TNFR-like molecules, Simonet et al., Supra, describe that OPG does not include hydrophobic transmembrane sequences.

In addition, new members of the TNF / NGF receptor family have been identified in mice, which are called "GITR" for "glucocorticoid-induced tumor necrosis factor receptor family-related genes" [Nocentini et al., Proc. Natl. Acad. Sci. USA 94: 6216-6221 (1997). The mouse GITR receptor is a type I transmembrane protein consisting of 228 amino acids and is expressed in normal mouse T lymphocytes from the thymus, spleen and lymph nodes. Expression of the mouse GITR receptor is induced in T lymphocytes when activated with anti-CD3 antibody, ConA or phorbol 12-myristate 13-acetate. The authors thought that mouse GITR receptors are involved in the regulation of T-cell receptor-mediated cell death.

Marsters et al., Curr. Biol., 6: 750 (1996), investigators show similarities to the TNFR family in extracellular cysteine-rich repeats and human polypeptides of full-length native sequence similar to TNFR1 and CD95 in that they contain a cytoplasmic death domain sequence. (Called Apo-3). Marsters et al., Curr. Biol., 6: 1669 (1996). Other researchers also call Apo-3 DR3, wsl-1 and TRAMP [Chinnaiyan et al., Science, 274: 990 (1996); Kitson et al., Nature, 384: 372 (1996); Bodmer et al., Immunity, 6:79 (1997).

Pan et al. Described another TNF receptor family member called "DR4" (Pan et al., Science, 276: 111-113 (1997)). DR4 has been reported to contain cytoplasmic killing domains that may be involved in apoptotic devices. Pan et al. Describe that DR4 is thought to be a receptor for a ligand known as Apo-2 ligand or TRAIL.

Sheridan et al., Science, 277: 818-821 (1997) and Pan et al., Science, 277: 815-818 (1997) describe other molecules thought to be receptors for the Apo-2 ligand (TRAIL). Is described. This molecule is called DR5 (or Apo-2). Similar to DR4, DR5 has been reported to contain cytoplasmic death domains and be capable of signaling apoptosis.

Sheridan et al., Supra discloses a receptor called DcR1 (or Apo-2DcR) as a possible decoy receptor for Apo-2 ligand (TRAIL). Sheridan et al. Reported that DcR1 could inhibit the function of Apo-2 ligand in vitro. See also Pan et al., Supra for a description of the attractor receptor called TRID.

For a review of the TNF cytokine family and its receptors, see Gruss and Dower, supra.

As recently understood, the cell death program comprises at least three important factors: activator, inhibitor and agonist. In C. elegans these elements are encoded by three genes, Ced-4 , Ced-9 and Ced-3 , respectively [Steller, Science, 267: 1445 (1995); Chinnaiyan et al., Science, 275: 1122-1126 (1997); Wang et al., Cell, 90: 1-20 (1997). Two members of the TNFR family, TNFR1 and Fas / Apo1 (CD95), can activate apoptotic cell death [Chinnaiyan and Dixit, Current Biology, 6: 555-562 (1996); Fraser and Evan, Cell; 85: 781-784 (1996). TNFR1 is also known to modulate the activity of the transcription factor NF-κB [Tartaglia et al., Cell, 74: 845-853 (1993); Hsu et al., Cell, 84: 299-308 (1996). In addition to the homology of several ECDs, these two receptors share homology in their intracellular domains (ICDs) in oligomerization interfaces known as death domains [Tartaglia et al., Supra; Nagata, Cell, 88: 355 (1997). Death domains are also present in some epidermal proteins that regulate apoptosis, ie, Drosophila proteins, Reapers, and mammalian proteins called FADD / MORT1, TRADD and RIP [Cleaveland and Ihle, Cell, 81: 479-482 (1995).

In ligand binding and receptor compaction, TNFR1 and CD95 are thought to supplement FADD with a death-inducing signaling conjugate. Known, CD95 binds directly with FADD, while TNFR1 binds indirectly with FADD via TRADD [Chinnaiyan et al., Cell, 81: 505-512 (1995); Boldin et al., J. Biol. Chem., 270: 387-391 (1995); Hsu et al., Supra; Chinnaiyan et al., J. Biol. Chem., 271: 4961-4965 (1996). FADD has been reported to act as an adapter protein that supplements the Ced-3 -related protease MACHα / FLICE (Caspase 8) with death signaling conjugates [Boldin et al., Cell, 85: 803-815 (1996); Muzio et al., Cell, 85: 817-827 (1996). MACHα / FLICE appears to be an initiator that initiates a cascade of apoptotic proteases, including interleukin-1β convertase (ICE) and CPP32 / Yama, which can perform several important aspects of the cell death program [Fraser and Evan, supra]. .

Planned cell death is seed. It has recently been found to include the activity of cysteine protease family members associated with elegans cell death gene ced-3 and mammalian IL-1-converting enzyme ICE. The activity of ICE and CPP32 / Yama proteases can be inhibited by the product of crmA, the cowpox virus gene [Ray et al., Cell, 69: 597-604 (1992); Tewari et al., Cell, 81: 801-809 (1995). Recent studies have shown that CrmA can inhibit TNFR1- and CD95-induced cell death [Enari et al., Nature, 375: 78-81 (1995); Tewari et al., J. Biol. Chem., 270: 3255-3260 (1995).

As recently investigated by Tewari et al., TNFR1, TNFR2 and CD40 are responsible for the expression of cell adhesion molecules through activation of proinflammatory and co-stimulatory cytokines, cytokine receptors, and transcription factor NF-κB. Control [Tewari et al., Curr. Op. Genet. Develop., 6: 39-44 (1996). NF-κB is a prototype of a dimeric transcription factor family comprising a Rel region in which subunits are conserved [Verma et al., Genes Develop., 9: 2723-2735 (1996); Baldwin, Ann. Rev. Immunol., 14: 649-681 (1996). In a potential form, NF-κB binds to members of the family of IκB inhibitors, and when IκB is inactivated in response to a stimulus, the released NF-κB migrates to the nucleus, where it binds to a specific DNA sequence and gene Activate transcription.

10.PRO382

Proteases are enzyme proteins involved in many very important biological reactions in mammalian and non-mammalian organisms. Many other protease enzymes from various mammalian and non-mammalian organisms have been identified and characterized, including serine proteases that exhibit specific activity against a variety of serine-containing proteins. Mammalian protease enzymes play an important role in biological reactions such as, for example, proteolysis, activation, inactivation, or regulation of peptide hormone activity, and alteration of the physical properties of proteins and enzymes.

In light of the important physiological role played by protease enzymes, both industry and academia are now working to find new natural protease analogs. Much of this effort is focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel membrane-bound receptor proteins. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637. We herein describe a novel polypeptide (designated herein as PRO382 polypeptide) that is homologous to the serine protease enzyme.

11.PRO545

ADAM (A disintegrin and metalloprotease), a family of proteins that has a meltrin as a member, can play an important role in the regulation of cellular interactions and cellular responses [eg, Gilpin et al. , J. Biol. Chem., 273 (1): 157-166 (1998). ADAM proteins are associated with carcinogenesis. Meltrin-α (ADAM12) is a myoblast gene product known to be required for cell fusion [Harris et al., J. Cell. Biochem., 67 (1): 136-142 (1997), Yagami-Hiromasa et al., Nature, 377: 652-656 (1995). Meltrin contains disintegrin and metalloprotease domains and, through integrin-binding disintegrin domains, participates in growth-related cell adhesion reactions, as well as anti-adhesion function through zinc-dependent metalloprotease domains. Also have Alfandari et al., Devel. Biol., 182 (2): 314-330 (1997). As cell fusion and the regulation of cellular responses are medically important in carcinogenesis and other disease mechanisms, efforts are currently being made to identify novel natural proteins involved in cell fusion and regulation of cellular responses. We herein describe a novel polypeptide (designated herein as PRO545) that is homologous to meltrin.

12.PRO617

CD24 is a protein that binds to the cell surface of several other cells of the mammalian immune system, including, for example, neutrophils, monocytes, and some lymphocytes (eg, B lymphocytes). CD24 is constitutively synthesized in both platelets and endothelial cells, and when activated, P-selectin (granule membrane protein-140 or GMP-) is a platelet-binding surface glycoprotein, a glycoprotein that is exposed to the surface of platelets. Known as 140). In this way, P-selectin regulates calcium-dependent adhesion of activated platelets and endothelial cells with various cells of the immune system that express one or more ligands for P-selectin molecules, especially CD24. This mechanism replenishes these cells at the site of greatest need for immune system cells, such as the site of injury. Therefore, it is of practical interest to identify novel polypeptides that show homology with antigens on the cell surface of immune system cells. We herein describe the identification and characterization of a novel polypeptide (designated herein as PRO617) that is homologous to the CD24 protein.

13.PRO700

Protein-disulfide isomerase (PDI) catalyzes the formation and isomerization of disulfide during protein folding. This catalyst has two catalytic sites contained within two domains homologous to thioredoxin, one site near the N terminus and the other near the C terminus [eg Gilbert HF, J. Biol. Chem., 47: 29399-29402 (1997), Mayfield KJ, Science, 278: 1954-1957 (1997) and Puig et al., J. Biol. Chem., 52: 32988-32994 ( 1997)]. PDI is useful for the formation of naturally occurring disulfide bonds in proteins produced in prokaryotic cells. U.S. Patent Nos. 5,700,659 and 5,700,678).

Thus, PDI and related molecules are of particular interest for their ability to promote the formation of disulfide bonds. In addition, these molecules are generally of interest in the study of redox and related reactions. PDI and related molecules are further described in Darby, et al., Biochemistry 34, 11725-11735 (1995). We herein describe the identification and characterization of novel polypeptides, herein designated PRO700 polypeptides, which are homologous to the protein disulfide isomerase.

14.PRO702

Conglutinin was first described as a vertebrate lectin protein, and has four distinct domains: (1) N-terminal cysteine-rich domain, (2) collagen-like domain, (3) neck It is a bovine serum protein belonging to the C-type lectin family having a domain and (4) a carbohydrate recognition domain (CRD). Recent studies have demonstrated that bovine conglutinin can inhibit hemagglutinination by influenza A virus due to its lectin characteristics (Eda et al., Biochem. J. 316: 43-48 (1996) ). It has also been suggested that lectins, such as conglutinin, can act as immunoglobulin-dependent defense molecules due to complement-mediated mechanisms. As such, conglutinin is known to be useful for purifying immune complexes in vitro and for removing circulating immune complexes from the patient's plasma in vivo (Lim et al., Biochem. Biophys. Res. Commun. 218: 260-266 (1996)). Here we describe the identification and characterization of a novel polypeptide (designated herein as PRO702) that is homologous to the conglutinin protein.

15.PRO703

Very long chain acyl-CoA synthetase ("VLCAS") is a long chain fatty acid transporter protein that is active in the intracellular transport of very long chain fatty acids (see, for example, Uchida et al., J Biochem (Tokyo) 119 ( 3): 565-571 (1996) and Uchiyama et al., J Biol Chem 271 (48): 30360-30365 (1996). Since fatty acid transport mechanisms are biologically important, efforts are currently being made to find new natural proteins involved in fatty acid transport. We herein describe a novel polypeptide (named PRO703 herein) that is homologous to VLCAS.

16.PRO705

Glypicans are glycosylphosphatidylinositol (GPI)-that can regulate cell responses to many heparin-binding growth factors, cell adhesion molecules, and extracellular interstitial components by allowing them to be localized on the cell surface and possess heparin sulfate chains. Anchored proteoglycans. Variation in one glypican protein is responsible for human birth defect syndrome, suggesting that glypican may play an important role in development (Litwack et al., Dev. Dyn. 211: 72). -87 (1998). In addition, glypican may play an important role in wound healing because it can interact with various extracellular epilepsy (McGrath et al., Pathol. 183: 251-252 (1997)). In addition, since glypican is expressed in neurons and glioma cells, it may play an important role in regulating cell division and cell survival in the nervous system (Liang et al., J. Cell. Biol. 139: 851-864 (1997)). Thus, it is clear that glypican is a very important proteoglycan family. Thus, identifying new polypeptides homologous to members of the glypican family is of practical interest. Here we describe the identification and characterization of a novel polypeptide (designated herein as PRO705) that is homologous to K-glypican.

17.PRO708

Aryl sulfatase is present in many other isoforms, including aryl sulfatase A (ASA), aryl sulfatase B (ASB), and aryl sulfatase C (ASC) and has the ability to hydrolyze a variety of other aromatic sulfates. It is an enzyme. Aryl sulfatase has been isolated from a variety of different animal tissues and microbial sources, and its structure and function have been extensively studied [see, for example, Nichol and Roy, J. Biochem. 55: 643-651 (1964). ASA deficiency has been reported to be associated with metachromatic leukodystrophy (MLD) (Giles et al., Prenat. Diagn. 7 (4): 245-252 (1987) and Herska et al., Am. J.). Med. Genet. 26 (3): 629-635 (1987)). In addition, aryl sulfatase has been reported to be present at high levels in the natural killer cells of the immune system, hypothesized that aryl sulfatase may act in NK cell-mediated cell lysis [eg, , Zucker-Franklin et al., Proc. Natl. Acad. Sci. USA 80 (22): 6977-6981 (1983). Since aryl sulfatase enzymes are clearly physiologically important, identifying new aryl sulfatase homolog polypeptides is of practical interest. We herein describe the identification and characterization of novel polypeptides (designated herein as PRO708 polypeptides) that are homologous to aryl sulfatase.

18.PRO320

Fibulin-1 is a cysteine-rich calcium-binding extracellular epilepsy (ECM) component of the basement membrane and connective tissue elastic fibers, and has four isoforms of A to D derived from selective splicing Protein. Fibulin-1 is an amino-terminal anaphylatoxin-like module, nine epidermal growth factor (EGF) -like modules, and a modular glycoprotein comprising four possible carboxyl ends in sequence, upon selective splicing to be. Fibulin-2 is a novel extracellular interstitial protein that is often present in tight binding to microfibers containing fibronectin or fibrin. The various forms of fibulin-1 produced through the selective splicing process of precursor RNAs differ in their C-terminal regions [see, eg, Tran et al., Matrix Biol 15 (7): 479. -493 (1997).

Northern and Western blotting analyzes of 16 cell lines established from tumors formed in thymic mice and malignant cell lines from patients suggest that low expression of fibulin-1D plays a role in tumor formation and invasion [ Qing et al., Oncogene, 18: 2159-2168 (1997). The hallmark of ovarian cancer cells is their ability to penetrate freely in the abdominal cavity. Estradiol has been shown to stimulate the expression of fibulin-1 as well as the proliferation of estrogen-receptor (ER) -positive ovarian cancer cells. Studies of the effects of fibulin-1 on the mobility of MDA-MB231 breast cancer cell lines have revealed inhibition of migration by contact with MDA-MB231 cells, and the authors found that fibulin-1 could inhibit the migration of cancer cells in vitro. It was concluded that it can, therefore, inhibit tumor penetration (Hayashido et al., Int J Cancer, 75 (4): 654-658 (1998)).

Thus, fibulin and its related molecules are of particular interest for use in preventing cancer. In addition, these molecules are generally of interest in the study of connective tissue and adhesion molecules, and related mechanisms. For fibulin and related molecules, see Adams, et al., J. Mol. Biol., 272 (2): 226-36 (1997); Kielty and Shuttleworth, Microsc. Res. Tech., 38 (4): 413-27 (1997); and Child, J. Card. Surg ,. 12 (2Supp.): 131-5 (1997).

The inventors herein describe the identification and characterization of novel polypeptides (designated herein as PRO320 polypeptides) that are homologous to fibulin.

19.PRO324

Oxidoreductases are enzymes that catalyze the reaction of two molecules of one compound to oxidize one compound and reduce the other, in which one molecule of water participates in the reaction. There are many different types of oxidoreductase enzymes that play a very important physiological role in mammalian organisms. Some of the most important oxidoreductases include, for example, lyase, lactase and cholesterol oxidase. These enzymes work in essential reactions such as digestion, signal transduction, and maintenance of ion homeostasis. As such, since oxidoreductase enzymes are essentially used in a variety of mammalian organisms, identifying new oxidoreductase enzyme homologues is of practical interest. Here we describe the identification and characterization of a novel polypeptide (designated herein as PRO324) that is homologous to oxidoreductase.

20.PRO351

Prostasin is a new serine proteinase in humans purified from human semen. Immunohistologic localization has revealed that prostacin is present in epithelial cells and prostate tubes. CDNA for prostacin was cloned and characterized. Southern blot analysis after reverse transcriptase chain reaction showed that prostatin mRNA is expressed in prostate, salivary gland, kidney, lung, pancreas, colon, bronchus, near renal coronary and prostate cancer LNCaP cells. In situ hybridization histochemistry confirmed that the intracellular location of prostacin mRNA is in human prostate epithelial cells. See, eg, Yu et al., J Biol Chem. (1994) 269 (29): 18843-18848, and Yu et al., J Biol Chem. (1994) 270 (22): 13483-13489.

Thus, prostacin and related molecules are of interest, particularly in the study, diagnosis and treatment of medical conditions, including the prostate. Prostacins and related molecules are further described in Yu et al., Genomics (1996) 32 (3): 334-340. We herein describe the identification and characterization of novel polypeptides, designated herein as PRO351 polypeptides, which are homologous to prostacins.

21.PRO352

Butyrophylline is a latex glycoprotein that constitutes at least 40% of the total protein that binds to the membranes of fat globules in the milk of mammals. The expression of butyrophylline mRNA is known to correlate with the onset of milkfat production at the end of pregnancy and is maintained throughout lactation. Butyrophylline has been identified in bovine, murine and human [Taylor et al., Biochim. Biophys. Acta 1306: 1-4 (1996), Ishii et al., Biochim. Biophys. Acta 1245: 285-292 (1995), Mather et al., J. Dairy Sci. 76: 3832-3850 (1993) and Banghart et al., J. Biol. Chem. 273: 4171-4179 (1998)], a type I transmembrane protein incorporated into a fat globulin membrane. Butyrophylline has been suggested to be able to serve as a major backbone for the formation of xanthine dehydrogenase / oxidase and other proteins and conjugates that act to bud and release the milk fat from the outer surface during lactation (Banghart et al., supra).

It is clear that butyrophylline plays an important role in mammalian milk production, so identifying new butyrophylline homologues is of practical interest. Here we describe the identification and characterization of a novel polypeptide (designated herein as PRO352) that is homologous to butyrophylline.

22.PRO381

Immunophylline is a family of proteins that act as receptors for immunosuppressive drugs such as cyclosporin A, FK506 and rapamycin. Immunophylline exists in two different classes: (1) FK506-binding protein (FKBP), which binds FK506 and rapamycin, and (2) cyclophilin, which binds cyclosporin A. For FK506-binding proteins, FK506 / FKBP conjugates have been reported to function to provide immunosuppressive activity by inhibiting the activity of serine / threonine protein phosphatase 2B (calcineurin) (Gold, Mol. Neurobiol. 15: 285). -306 (1997)). In addition, FKBP immunophilin is present in the mammalian nervous system and has been reported to be involved in axon regeneration in the central nervous system through a mechanism independent of the response to which immunosuppression is achieved (Gold, supra). Thus, identifying novel polypeptides homologous to FKBP immunophilin is of practical interest. We herein describe the identification and characterization of a novel polypeptide (designated herein as PRO381) that is homologous to the FKBP immunophilin protein.

23.PRO386

Mammalian cell membranes perform very important functions related to the structural integrity and activity of various cells and tissues. In membrane physiology, the study of transmembrane ion channels that act directly to control various physiological, pharmacological and cellular responses is of particular interest. Many ion channels have been identified, including calcium (Ca), sodium (Na) and potassium (K) channels, each of which has been analyzed in detail to determine their role in the intracellular physiological responses of vertebrates and insects.

Sodium channels, one form of cell membrane-bound ion channels, play a very important role in the ability of cells to maintain ion homeostasis and to transmit intracellular and extracellular signals. Voltage-gated sodium channels in neurons in the brain have been found to be combinations of pore-forming alpha units with smaller beta-1 and beta-2 subunits (Isom et al., Cell 83: 433-442 (1995). )). Since sodium channels are clearly important in cell homeostasis and other important physiological functions, identifying new polypeptides having homology with subunits of sodium channels is of considerable interest. We herein describe the identification and characterization of a novel polypeptide (named PRO386 herein) that is homologous to the beta-2 subunit of the sodium channel of rats.

24.PRO540

Lecithin-cholesterol acyltransferase (“LCAT”), also known as phosphatidylcholine-sterol acyltransferase, is a key enzyme in the vascular metabolism of high-density lipoproteins, particularly cholesterol metabolism [see, eg, Brousseau et al. , J. Lipid Res., 38 (12): 2537-2547 (1997), Hill et al., Biochem. J., 294: 879-884 (1993), and Drayna et al., Nature 327 (6123): 632-634 (1987). Since lipid metabolism is medically important, efforts are now being made to find new natural proteins involved in lipid transport. We herein describe a novel polypeptide (named PRO540 herein) that is homologous to LCAT.

25.PRO615

Synaptogyrin is a synaptic vesicle protein that is unevenly distributed in the nervous system. The cDNA encoding synaptogirin was cloned and sequenced, which is expected to be a protein of molecular weight 25,900 D with four transmembrane domains. Synaptogirin is involved in the migration of membranes into and from the plasma membranes [Stenius et al., J. Cell. Biol. 131 (6-2): 1801-1809 (1995). In addition, a new isoform of synaptogirin called cellugyrin exhibits sequence identity with synaptogirin. In rat tissues, celugirin and synaptogirin are expressed in a mirror image pattern. Selegiline is ubiquitous in all tissues tested and is present at the lowest levels in brain tissue, but synaptogiline proteins can only be detected in the brain. In rat tissues, celugirin and synaptogirin are expressed in a mirror image pattern. Synaptic vesicles, synaptic giraffe proteins, may be a specific form of the localized protein, selugirin, which are structurally similar but differ in their positions. This fact supports the recent idea of synaptic vesicles as a simplified and specialized form of general transporter organelles [Janz et al., J. Biol. Chem. 273 (5): 2851-2857 (1998). The sequence of selugulin derived from the Norwegian rat Rattus norvegicus was deposited on Dec. 23, 1997 in Genbank database under Accession No. AF039085. See also, Janz et al., J. Biol. Chem. 273 (1998), in press.

Because synaptic transmission is medically important, efforts are currently being made to find new natural proteins that may be part of the simplified and specialized general carrier organelles of the synaptic vesicle form. Here we describe a novel polypeptide (designated herein as PRO615) that is homologous to synaptogirin.

26.PRO618

Enteropeptidase is a major enzyme in the digestive sequencing of the small intestine, in particular cleaving the acidic propeptide of trypsinogen to produce active trypsin. This cleavage initiates a sequence of proteolytic reactions that activate many zymogens in the pancreas. For example, Matsushima et al., J. Biol. Chem. 269 (31): 19976-19982 (1994), Kitamoto et al., Proc. Nat. Acad. Sci., 91 (16): 7588-7592 (1994). Enterokinase (entopeptidase) is associated with mammalian serine proteases involved in digestion, coagulation and fibrinolysis [LaVallie et al., J Biol Chem., 268 (31): 23311-23317 (1993) ].

As the digestion process is medically important, efforts are now being made to find new natural proteins that may be involved in digestion, coagulation and fibrinolysis. We herein describe a novel polypeptide (designated herein as PRO618) that is homologous to enteropeptidase.

27.PRO719

Lipoprotein lipase is a major enzyme that regulates the hydrolysis of triglycerides and phospholipids present in circulating plasma lipoproteins (Dugi et al., J. Biol. Chem .. 270: 25396-25401 (1995)). In addition, lipoprotein lipases regulate the uptake of intracellular lipoproteins, wherein uptake of intracellular lipoproteins is known to be initiated by the binding of lipoprotein lipases to proteoglycans and low density lipoprotein (LDL) receptor-related proteins on the cell surface (Krapp et. al., J. Lipid Res. 36: 2362-2373 (1995)). Thus, it is clear that lipoprotein lipase plays a very important role in lipoprotein and cholesterol metabolism. Thus, identifying novel polypeptides that share sequence homology and / or biological activity with lipoprotein lipases is of practical interest. Here we describe the identification and characterization of a novel polypeptide (designated herein as PRO719) having sequence homology with lipoprotein lipase H.

28.PRO724

Low-density lipoprotein (LDL) receptors play a key role in cholesterol homeostasis and are membrane-bound proteins that regulate intracellular uptake of lipoprotein particles by high affinity binding to ligands, apolipoprotein (apo) B-100 and apoE. The ligand-binding domain of the LDL receptor comprises seven cysteine-rich repeats of about 40 amino acids, where each repeat contains six cysteines that form three inner-repeating disulfide bonds. This unique structural feature allows the LDL receptor to specifically interact with apo B-100 and apoE to transport these lipoprotein particles through the cell membrane and metabolize these components. Soluble fragments comprising the extracellular domain of the LDL receptor are known to possess the ability to interact with specific lipoprotein ligands (Simmons et al., J. Biol. Chem. 272: 25531-25536 (1997)). Thus, it is clear that LDL receptors are closely related to important physiological activities associated with cholesterol metabolism. As such, identifying homologous proteins of novel LDL receptors is of practical interest. We herein describe the identification and characterization of novel polypeptides (designated herein as PRO724) having homology with human LDL receptor proteins.

29.PRO772

Human gene A4 is highly expressed in the epithelium of colon and is transcriptionally activated when differentiating colonic epithelial cells in vitro (Oliva et al., Arch. Biochem. Biophys. 302: 183-192 (1993) and Oliva et al., Am. J. Physiol. 272: C957-C965 (1997)). The A4 cDNA contains one open reading frame encoding a polypeptide of about 17 kilodaltons in size. Hydropatchathy analysis of the A4 protein revealed four putative transmembrane alpha-helices. Immunohistochemical studies of cells expressing A4 protein showed that the expression was restricted to the endoplasmic reticulum. The four transmembrane domains of the A4 protein and their biophysical characteristics suggest that this protein is a family of whole membrane proteins called proteolipes, some of which polymerize to form ion channels. In fact, previous evidence suggests that A4 can polymerize on its own and have the characteristics of ion channels (Oliva et al., Am. J. Physiol. 272: C957-C965 (1997)). Ion channels that maintain cell homeostasis are important, and therefore, identifying new polypeptides having homology with known and putative ion channels is of considerable interest. Here we describe the identification and characterization of a novel polypeptide (named PRO772 herein) having homology with the putative ion channel protein A4.

30.PRO852

Proteases are enzyme proteins involved in many biological reactions that are of great importance in mammalian and non-mammalian organisms. Many other protease enzymes from various other mammalian and non-mammalian organisms have been identified and characterized. Mammalian protease enzymes play an important role in many other biological reactions, including, for example, proteolysis, activation, inactivation, or modulation of peptide hormone activity, and alteration of physical properties of proteins and enzymes.

In light of the important physiological role played by protease enzymes, both industry and academia are now working to find new natural protease analogs. Much of this effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel secretory and membrane bound receptor proteins. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637. We herein describe a novel polypeptide (designated herein as PRO852) having homology with various protease enzymes.

31.PRO853

Research has shown that the redox state of cells is an important determinant of cell fate. In addition, reactive oxygen species are cytotoxic and cause inflammatory diseases including tissue necrosis, organ failure, atherosclerosis, infertility, birth defects, early maturation, mutations and malignancies. Thus, the regulation of oxidation and reduction is important for many reasons, including control and prevention of stroke, heart attack, oxidative stress and hypertension, and may be associated with the development of malignant tumors. Levels of antioxidant enzymes such as reductase, which catalyze the conversion of oxidative oxygen species to water, have been found to be very low in cancer cells. In particular, malignant prostate epithelium can reduce the expression of these antioxidant enzymes (Baker et al., Prostate 32 (4): 229-233 (1997)). In this regard, reductase is of interest. In addition, the transcription factors NF-kappa B and AP-1 are regulated by redox status and affect the expression of many different genes that are thought to be involved in the development of AIDS, cancer, atherosclerosis and diabetic complications. Known. Publications which further describe such subject matter are described in Engman et al., Anticancer Res. (Greece), 17: 4599-4605 (1997), Kelsey, et al., Br. J. Cancer, 76 (7): 852-4 (1997); Friedrich and Weiss, J. Theor. Biol., 187 (4): 529-40 (1997) and Pieulle, et al., J. Bacteriol., 179 (18): 5684-92 (1997). Since the in vivo redox reaction is physiologically important, efforts are now being made to find new natural proteins involved in the redox reaction. We herein describe a novel prostate specific polypeptide (designated herein as PRO853) with sequence similarity to reductase.

32.PRO860

Neurofascin is a member of the L1 subgroup of the cell adhesion molecule ("CAM") family of neuronal adhesion molecules and is involved in cell aggregation. Patterning of cell-cell recognition and cell contact plays an important role in regulating the reversible assembly of a wide variety of cell penetrating complexes in the nervous system. Cellular interactions can be regulated through the regulation of ankyrin that binds neuropascin. See, eg, Tuvia et al., Proc. Nat Acad. Sci., 94 (24) 12957-12962 (1997). Neuropascine has been described as a member of the L1 subgroup of immunoglobulin macrophages involved in neurite outgrowth during embryogenesis, where many isoforms are detected at various developmental stages. See also Hasssel et al., J. Biol. Chem., 272 (45) 28742-28749 (1997), Grumet., Cell. Tissue Res. 290 (2) 423-428 (1997), Garver et al., J. Cell. Biol., 137: 703-714 (1997), and Lambert et al., J. Neurosci., 17: 7025-7-36 (1997).

Since the development of cell adhesion molecules and the nervous system in vivo is physiologically important, efforts are now being made to find new natural proteins involved in the regulation of cellular interactions in the nervous system. We herein describe the identification and characterization of novel polypeptides (named PRO860 herein) with sequence similarity to neuropascin.

33.PRO846

CMRF35 monoclonal antibodies were used to identify monocytes, neutrophils, portions of T and B lymphocytes of peripheral blood, and cell membrane antigens (named CMRF35) present on the surface of lymph cell lines. CMRF35 cDNA encodes a novel whole membrane glycoprotein member of the immunoglobulin (Ig) gene cohort. This molecule contains (a) a single extracellular Ig variable domain very similar to the F _c receptors for polymers IgA and IgM, and (b) high proportions of proline, serine and threonine residues that are thought to be highly O-glycosylated. And (c) specific transmembrane anchors comprising glutamic acid and proline residues, and (d) short cytoplasmic ends. As a result of immunocytostaining, transcripts encoding the CMRF35 protein were detected in early monocyte cell lines, T cells in peripheral blood and some B lymphoblast lines [Jackson et al., Eur. J. Immunol. 22 (5): 1157-1163 (1992). CMRF-35 molecules are specifically expressed in hematopoietic cells, and the expression of antigens against them has been shown to be distinctly affected by mitogen and cytokines. See, eg, Clark et al., Exp. Hematol. 25 (8): 759 (1997), Daish et al., Immunol. 79 (1): 55-63 (1993), and Clark et al., Tissue Antigens 48: 461 (1996).

As the antigens that bind the immune system and various immune system cells are physiologically important, efforts are now being made to find new natural proteins expressed in various cells of the immune system. We herein describe a novel polypeptide (designated herein as PRO846) with sequence similarity to CMRF35.

34.PRO862

Lysozyme is a protein that is widely distributed in various tissues and secretions of humans, including milk, tears, and saliva. Lysozyme has been demonstrated to hydrolyze the bond between N-acetylglucosamine. Lysozyme is an inhibitor of chemotactic and toxic oxygen free radical production and has been shown to play several roles in the calcification reaction. As such, the identification of novel polypeptides having homology with lysozyme is of practical interest. Here we describe a novel polypeptide having sequence similarity with lysozyme.

35.PRO864

Wnt-4 is a secreted glycoprotein that is associated with renal tubular production. Mice lacking Wnt-4 activity do not form reserve tube cell aggregates, but other aspects of mesoderm and ureter development are not affected. Thus, Wnt-4 appears to act as an autoinducer in the conversion of mesoderm into epithelium, which underlies nephron development (Stark et al., Nature; 372 (6507): 679-683 (1994)). In addition, members of the Wnt gene family code for cysteine-rich secreted proteins, which are specifically expressed in the developing brain and can act as signaling molecules between cells. The Wnt gene, for example Wnt-1, is known to be essential for determining the fate of midbrain cells [Yoshioka et al., Biochem. Biophys. Res. Commun. 203 (3): 1581-1588 (1994). Several members of the Wnt family of secretory factors are strongly associated as regulators of growth and differentiation of breast cells [Shimizu et al., Cell Growth Differ. 8 (12) 1349-1358. Wnt-4 is normally expressed early in pregnancy. Thus, Wnt-4 may be a local signal inducing epithelial differentiation during pregnancy (Edwards PA, Biochem Soc Symp. 63: 21-34 (1998)). See also Lippschutz JH, Am. J. Kidney Dis. 31 (3): 383-397, (1998). Here we describe the identification and characterization of a novel polypeptide (designated herein as PRO864) with sequence similarity to Wnt-4.

36.PRO792

It has been found that two or more cell-derived signals are required to induce the conversion of immunoglobulin isotypes to B-cells. The first signal is provided by soluble lymphokine, interleukin (IL) -4 or IL-13, which induces the expression of epsilon transcripts of germ cells, but alone secretion of immunoglobulin E (IgE) Insufficient to initiate. The second signal is provided by the physical interaction of B-cells with activated T-cells, basophils and mast cells, and it has been found that pairing of CD40 / CD40 ligands is crucial for regulating IgE synthesis. In addition, among the many pairs of cell adhesion molecules involved in IgE synthesis, the CD23 / CD21 pair appears to play a key role in the production of IgE. CD23 is a protein that is both positively and negatively regulated by factors that increase or decrease IgE production, respectively. Antibodies against CD23 have been shown to inhibit the production of human IgE induced by IL-4 in vitro and to inhibit antigen-specific IgE responses in an isotype selective manner in rat models (Bonnefoy et al., Eur.Respir.J.Suppl. 22: 63S-66S (1996)). CD23 interacts with CD21 on B-cells, leading primarily to the production of IgE. Since the CD23 protein plays a very important role in the induction of mammalian IgE responses, the identification of novel polypeptides homologous to CD23 is of considerable interest. We herein describe the identification and characterization of a novel polypeptide (named PRO792 herein) having homology with CD23.

37.PRO866

Mindine and spondine proteins are structurally related and secreted proteins found in a variety of organisms. See, eg, Higashijima et al., Dev Biol. 192: 211-227 (1997) reported the presence of spondins and mindin in the floor plate cells of zebradani's embryonic axis, suggesting that the mindine and spondin proteins play an important role in embryonic development. do. The literature reports that the mindine and spondine proteins act as extracellular interstitial proteins with high affinity for the basal layer (Id.). F-spondin is a secreted protein that promotes neural attachment and neurite extension (Klar et al., Cell 69: 95-110 (1992), and M-spondin is an extracellular epilepsy protein located at the muscle attachment site in Drosophila) (Umemiya et al., Dev. Biol. 186: 165-176 (1997)) Therefore, identifying new polypeptides having homology with the mindine and spondine proteins is of considerable interest. We herein describe the identification and characterization of novel polypeptides (designated herein as PRO866) having homology with Mindin2 and Mindin1.

38.PRO871

Cyclophylline is a family of proteins that binds cyclosporin A and retains peptidyl-prolyl cis-trans isomerase activity (Sherry et al., Proc. Natl. Acad. Sci. USA 95: 1758-1763 (1998) ). In addition, cyclophylline is secreted by activated cells and will probably act in a manner similar to cytokinin by signaling through cyclophilin receptors on the cell surface. Host cell-derived cyclophilin A is incorporated into HIV-1 virions, the incorporation of which is known to be essential for viral infectivity. Thus, one or more cyclophilins may be directly related to HIV-1 infectivity. Since cyclophylline proteins are clearly important, it is of practical interest to identify novel polypeptides having sequence homology with one or more cyclophilin proteins. We herein describe the identification and characterization of a novel polypeptide (designated herein as PRO871) having homology with the cyclophilin-like protein CyP-60.

39.PRO873

Enzyme proteins play an important role in chemical reactions involved in food digestion, biosynthesis of macromolecules, controlled release and utilization of chemical energy, and other reactions necessary to sustain life. Enzymes are also known to play an important role in combating various diseases and disorders. For example, hepatic carboxyesterases have been reported to help human tumor cells susceptibility to cancer prodrugs. Dans et al. Reported that, upon stable expression of carboxyesterase-encoding cDNA in Rh30 human rhabdomyosarcoma cells, the cell's susceptibility to CPT-11 cancer prodrugs increased 8.1-fold [ Cancer Res. (1998) 58 (1): 20-22. The authors can use this prodrug / enzyme combination for treatment in a manner similar to the current approach of investigating the combination of ganciclovir / herpes simplex virus thymidine kinase and 5-fluorocytosine / cytosine deaminase. Van Pelt et al suggest that carboxyesterase in 55 kD human liver in culture inhibits the infiltration of Plasmodium falciparum malaria sporozoite in early human hepatocytes. J Hepatol (1997) 27 (4): 688-698].

Carboxysterases have also been found to be important in the detoxification of drugs, pesticides and other xenobiotics. Carboxysterases of purified human liver are known to be involved in the metabolism of various drugs, including cocaine and heroin. Prindel et al. Promote the hydrolysis of cocaine and heroin, and are involved in the purification and cloning of carboxyl esterases between humans with a wide range of substrate specificities that may play an important role in the degradation of these drugs in human tissues. [J. Biol. Chem. (1997) 6: 272 (23): 14769-14775. Brzenzinski et al. Describe a competitive inhibition assay by spectrophotometry used to identify esters of drugs or environments that are metabolized by carboxyl esterases [Drug Metab Dispos (1997) 25 (9). : 1089-1096].

In light of the important physiological role played by carboxyl esterases, both industry and academia are working to find new natural carboxyl ester analogs. We herein describe the identification and characterization of novel polypeptides (designated herein as PRO873) having homology with carboxyesterases.

40.PRO940

CD33 is a member of the sialoadhesin family of proteins capable of regulating sialic acid dependent binding, having different specificities for both the form of sialic acid and the linkage to sugars at the lower end of sialic acid. CD33 is specifically expressed in early bone marrow and several monocyte lineages and is known to be strongly associated with various bone marrow tumors, including, for example, acute nonlymphocytic leukemia (ANLL). As such, CD33 has been suggested as a possible target in the treatment of cancer associated with high levels of expression of this protein. Therefore, identifying new polypeptides having homology with CD33 is of considerable interest. Indeed, one CD33 homologue (named CD33L) has already been identified and described (Takei et al., Cytogenet. Cell Genet. 78: 295-300 (1997). We herein describe another novel polypeptide (designated herein as PRO940) having homology with CD33. In addition, the novel polypeptides described herein show significant homology with human OB binding proteins named HSU71382_1 and HSU71383_1 in the Dayhof database (version 35.45 SwissProt 35).

41.PRO941

Cadherin is a large family of transmembrane proteins. Cadherin actually constitutes a calcium-dependent glycoprotein family that functions to regulate cell-cell adhesion in all solid tissues of multicellular organisms. At least Cadherin 1-13 and Types B, E, EP, M, N, P and R have been identified and characterized. Among the functions of Cadherin, with a few exceptions, Cadherin is known to participate in cell aggregation and bind to cell-cell adhesion sites. Recently, all Cadherins share several repeats of Cadherin specific motifs that are thought to correspond to the folding of the extracellular domain, but members of the Cadherin giant family have been reported to have different structures and, in some cases, functions It became. In particular, members of the Caherin giant have been reported to be involved in signal transduction (see Suzuki, J. Cell Biochem., 61 (4): 531-542 (1996)). For cadrine, Tanihara et al., J. Cell Sci., 107 (6): 1697-1704 (1994), Aberle et al., J. Cell Biochem., 61 (4): 514-523 (1996 and Tanihara et al., Cell Adhes. Commun., 2 (1): 15-26 (1994). We herein describe the identification and characterization of novel polypeptides (designated herein as PRO941) that have homology with Cadherin proteins.

42.PRO944

Clostridium perfringens enterotoxin (CPE) is seed. It is thought to be a virulence factor that causes symptoms of Perringens type A food poisoning and may be involved in other diseases in humans and animals (McClane, Toxicon. 34: 1335-1343 (1996)). CPE performs adverse cellular functions by binding to a cell surface receptor protein of about 50 kD called Clostridium perfringens enterotoxin receptor (CPE-R) to form a conjugate of about 90,000 kD at the surface of the cell. CDNA encoding the CPE-R protein has been identified and characterized in both humans and mice (Katahira et al., J. Cell Biol. 136: 1239-1247 (1997) and Katahira et al., J. Biol. Chem. 272: 26652-26658 (1997). CPE toxins have been reported to cause a variety of diseases in mammalian hosts, and since these diseases are initiated by the combination of CPE toxins and CPE-Rs, identifying new CPE-R homologues is of considerable interest. We herein describe the identification and characterization of a novel polypeptide (designated herein as PRO944) having homology with CPE-R.

43.PRO983

Membrane binding proteins include cell-surface membrane binding proteins as well as proteins present on the surface of intracellular vesicles. These vesicles are involved in exocytosis, the fusion of secretory vesicles with the plasma membrane of the cell, and has two main functions. One function is the discharge of the vesicle contents into the extracellular space, and the other function is the incorporation of new proteins and lipids into the plasma membrane itself. Extracellular flux may be constitutive or regulated. All eukaryotic cells exhibit a constitutive extracellular flux characterized by immediate fusion after secretory vesicle formation. In contrast, regulated extracellular leakage accumulates secretory vesicles that fuse with the plasma membrane when the vesicle-binding membrane protein receives an appropriate signal. In general, these signals increase the concentration of free Ca ^{2+ in} the cytosol. However, regulated extracellular leakage independent of Ca ²⁺ has been reported [see, for example, Fujita-Yoshigaki et al. J. Biol. Chem. (1996) 31: 271 (22): 13130-13134). Regulated extracellular flux may include neurons (release of neurotransmitters from synaptic vesicles), chromogenic cells of the adrenal glands (adrenergic secretion), pancreatic cells (digestive enzyme secretion), pancreatic α-cells (insulin secretion), It is crucial for many differentiated cells, including mast cells (histamine secretion), breast cells (secretory protein secretion), semen (enzyme secretion), egg cells (sperm membrane production) and adipocytes (insertion of glucose carriers into the plasma membrane).

Diseases involving extracellular flux are known. For example, the release of inflammatory regulators from mast cells causes various diseases, including asthma. Likewise, Chediak-Higashi syndrome (CHS) is a rare autosomal recessive disease in which neutrophils, monocytes and lymphocytes contain huge cellular granules. Therefore, proteins involved in extracellular flux are of utmost interest, and both industry and academia are currently working to find new vesicle-binding proteins. For example, Skehel et al identified a 33-kilodalton-sized membrane protein (named VAP-33) required for extracellular leakage of neurotransmitters in Aplysia [Science (1995) 15 : 269 (5230): 1580-1583, and Neuropharmacology (1995) 34 (11): 1379-1385. Much effort has been focused on screening mammalian recombinant DNA libraries to find coding sequences of novel vesicle-binding membrane proteins. It is an object of the present invention to provide a protein (named PRO983 herein) having homology with the vesicle-binding protein VAP-33.

44.PRO1057

Proteases are enzyme proteins involved in many very important biological reactions in mammalian and non-mammalian organisms. Many other protease enzymes from various other mammalian and non-mammalian organisms have been identified and characterized. Mammalian protease enzymes play an important role in many other biological reactions, including, for example, proteolysis, activation, inactivation, or regulation of peptide hormone activity, and alteration of physical properties of enzymes and proteins.

In light of the important physiological role played by protease enzymes, both industry and academia are now working to find new natural protease analogs. Much of this effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637. We herein describe a novel polypeptide (designated herein as PRO1057 polypeptide) that has homology with various protease enzymes.

45.PRO1071

Thrombospondin-1 is a high molecular weight glycoprotein of trimers that is released from platelet alpha-granules in response to thrombin stimulation and is also a transient component of extracellular epilepsy in tissue development and repair (Adams, Int. J. Biochem. Cell Biol. 29: 861-865 (1997) and Qian et al., Proc. Soc.Exp. Biol. Med. 212: 199-207 (1996)). Various factors regulate thrombospondin expression, and this protein is degraded by both extracellular and intracellular pathways. Trombospondin-1 acts as a cell adhesion molecule and regulates cell motility, cell proliferation, neurite growth and angiogenesis. As such, the identification of novel polypeptides homologous to thrombospondine is of practical interest. We herein describe the identification and characterization of a novel polypeptide (designated herein as PRO1071) having homology with thrombospondin.

46.PRO1072

Research has shown that the redox state of cells is a major factor in determining cell fate. In addition, reactive oxygen species are cytotoxic and cause inflammatory diseases including tissue necrosis, organ failure, atherosclerosis, infertility, birth defects, early maturation, mutations and malignancies. Thus, regulation of oxidation and reduction is important for many reasons, including control and prevention of stroke, heart attack, oxidative stress and hypertension, and may be associated with the development of malignancies. Levels of antioxidant enzymes such as reductase, which catalyze the conversion of reactive oxygen species to water, have been found to be very low in cancer cells. In particular, malignant prostate epithelium can reduce the expression of these antioxidant enzymes (Baker et al., Prostate 32 (4): 229-233 (1997)). In this regard, reductase is of interest. In addition, the transcription factors NF-kappa B and AP-1 are regulated by redox status and affect the expression of many different genes that are thought to be involved in the development of AIDS, cancer, atherosclerosis and diabetic complications. Known. Publications which further describe such subject matter are described in Engman et al., Anticancer Res. (Greece), 17: 4599-4605 (1997), Kelsey, et al., Br. J. Cancer, 76 (7): 852-4 (1997); Friedrich and Weiss, J. Theor. Biol., 187 (4): 529-40 (1997) and Pieulle, et al., J. Bacteriol., 179 (18): 5684-92 (1997). Since the in vivo redox reaction is physiologically important, efforts are now being made to find new natural proteins involved in the redox reaction. Here we describe a novel polypeptide (designated herein as PRO1072) having sequence similarity with the reductase enzyme.

47.PRO1075

Protein disulfide isomerase is an enzyme protein that is involved in promoting correct refolding of proteins through the formation of correct disulfide bonds. Protein disulfide isomerase was initially identified based on its ability to catalyze the regeneration of degraded denatured RNAse (Goldberger et al., J. Biol. Chem. 239: 1406-1410 (1964) and Epstein et al. ., Cold Sprring Harbor Symp.Quant. Biol. 28: 439-449 (1963). Protein disulfide isomerase is known to be an intravesicular enzyme retained in the endoplasmic reticulum via the -KDEL or -HDEL amino acid sequence at the C-terminus.

Disulfide bond-forming enzymes and in many other fields it is important to increase the potential use of these enzymes, such as the exact rate of refolding of recombinantly produced proteins, so that both industry and academia are currently involved in protein disulfide isoforms. Efforts are being made to find novel natural proteins homologous to the merase. Much of this effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel protein disulfide isomerase homologs. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637. We herein describe a novel polypeptide (designated herein as PRO1075) having homology with the protein disulfide isomerase.

48.PRO181

In Drosophila, the dorsal-dorsal polarity of an egg chamber depends on the nucleus of the oocyte and the position of the dorsal-front gerken RNA of the oocyte. Gerken proteins are likely to act as ligands for the Drosophila EGF receptor (torpedo / DER) expressed in somatic follicular cells around oocytes. Cornichon is a gene required for dorsal-back signaling in germ cells (Roth et al., Cell 81: 967-978 (1995)). Cornicones, Gerkens, and torpedoes also act in early signaling responses that determine the fate of posterior follicular cells and specify the forward-backward polarity of the ovaries. Mutations in any or all of these genes result in the formation of correctly polarized microtubule cytoskeleton necessary for proper placement of anterior and posterior determinants, bicoid and oskar, and asymmetric localization of oocyte nuclei. Disturbs. Thus, it is clear that cornicon gene products play an important role in early development. We herein describe the identification and characterization of a novel polypeptide (designated herein as PRO181) having homology with Cornicon protein.

49.PRO195

Efforts are currently being made to identify and characterize novel transmembrane proteins. We herein describe the identification and characterization of novel transmembrane polypeptides, designated herein as PRO195.

50.PRO865

Efforts are currently being made to identify and characterize novel secreted proteins. We herein describe the identification and characterization of novel secreted polypeptides (designated herein as PRO865).

51.PRO827

VLA-2 is a cell-surface integrin protein identified and characterized in many mammalian organisms, including mice and humans. VLA-2 is known to be a receptor on the cell surface for Ecovirus-1 (EV-1), which mediates infection of VLA-2-expressing cells by EV-1 (Zhang et al., Virology 235 (2). ): 293-301 (1997) and Bergelson et al., Science 255: 1718-1720 (1992)). VLA-2 is also known to modulate collagen and endothelial interactions during in vitro angiogenesis (Jackson et al., Cell Biol. Int. 18 (9): 859-867 (1994)). A variety of different integrin proteins that share amino acid sequence homology to varying degrees with VLA-2 have been identified and characterized in a variety of mammalian organisms. These integrins have been reported to play an important role in a variety of different physiological functions. Thus, identifying novel polypeptides having homology with one or more integrin proteins is of considerable interest. Here we describe the identification and characterization of a novel polypeptide (designated herein as PRO827) having homology with the VLA-2 integrin protein.

52.PRO1114

Many important cytokine proteins have been identified and characterized and are known to transmit signals through receptor conjugates on specific cell surfaces. For example, class II cytokine receptor families (CRF2) include interferon receptors, interleukin-10 receptors and tissue factor CRFB4 (Spencer et al., J. Exp. Med. 187: 571-578 (1998) and Kotenko et al., EMBO J. 16: 5894-5903 (1997)). Thus, many biological activities exhibited by several cytokine proteins are absolutely dependent on the presence of cytokine receptor proteins on the surface of the target cell. Thus, the identification and characterization of novel polypeptides having homology with one or more cytokine receptor families is of considerable interest. Here we describe the identification and characterization of a novel polypeptide (designated herein as PRO1117) having homology with the cytokine receptor family-4 protein.

Interferon (IFN) includes a large family of secretory proteins produced in vertebrates. Although interferons were originally named after their antiviral activity, there is a lot of evidence to support the important role of IFN in cell growth and differentiation (Jaramillo et al., Cancer Investigation 13 (3): 327-338 (1995) ). IFN belongs to a class of negative growth factors that have the ability to inhibit the growth of a wide variety of cells with both normal and altered traits. IFN therapy is beneficial for the treatment of malignant tumors in humans such as Karposi's sarcoma, chronic myeloid leukemia, non-Hodgkin's lymphoma and hairy cell leukemia, as well as the treatment of infectious diseases such as hepatitis B. Gamliel et al., Scanning Microscopy 2 (1): 485-492 (1988), Einhorn et al., Med. Oncol. & Tumor Pharmacother. 10: 25-29 (1993), Ringenberg et al., Missouri Medicine 85 (1): 21-26 (1988), Saracco et al., Journal of Gastroenterology and Hepatology 10: 668-673 (1995), Gonzalez-Mateos et al., Hepato-Gastroenterology 42: 893-899 (1995) and Malaguarnera et al., Pharmacotherapy 17 (5): 998-1005 (1997)).

Interferons can be classified into two main groups based on their primary sequence. Type I interferons, IFN-α and IFN-β, are thought to be derived from the IFN-α gene family and a common ancestral gene. It is encoded by a large family of genes without introns made up of genes. Type I interferon can be produced by most cell types. Type II IFNs or IFN-γ are confined to lymphocytes (T cells and natural killer cells) and are stimulated by nonspecific T cell activators or specific antigens in vivo.

Both type I and type II IFNs exhibit similar antiviral and antiproliferative effects, but they act on receptors on different cell surfaces, where binding is generally species specific (Langer et al., Immunol. Today 9: 393-400 (1988)). IFN-α and IFN-β both competitively bind to the same high affinity Type I receptor, while IFN-γ binds to other Type II receptors. Although the effect of IFN proteins is clearly regulated through binding to interferon receptors at the cell surface, the presence and number of IFN receptors on the cell surface generally do not reflect the sensitivity of the cell to IFN. As such, the identification and characterization of novel interferon receptor proteins is of great interest.

We herein describe the identification and characterization of novel interferon receptor polypeptides (herein termed “PRO1114 interferon receptor” polypeptides). Thus, the PRO1114 polypeptide of the present invention provides a new cell surface interferon receptor.

53.PRO237

Carbonic anhydrase is an enzyme protein that helps transport and release carbon dioxide in the mammalian blood system by catalyzing the synthesis of carbon dioxide from carbon dioxide and water and the dehydration of carbonic acid into carbon dioxide and water. Thus, the action of carbonic anhydrase is essential for many important physiological reactions in mammals. As such, the identification and characterization of novel polypeptides having homology with carbonic anhydrase is of considerable interest. Here we describe the identification and characterization of a novel polypeptide (designated herein as PRO237) having homology with carbonic anhydrase.

54.PRO541

Many trypsin inhibitory proteins have been identified and characterized [see, eg, Yamakawa et al., Biochim. Biophys. Acta 1395: 202-208 (1998) and Mizuki et al., Mammalian Genome 3: 274-280 (1992). Trypsin inhibitor proteins play an important role in many different physiological and biological pathways, particularly in reactions such as regulation of protein degradation and digestion. Because the role played by these enzyme proteins is important, it is of considerable interest to identify and characterize novel polypeptides homologous to known trypsin inhibitory proteins. We herein describe the identification and characterization of novel polypeptides (named PRO541 herein) having homology with trypsin inhibitor proteins.

55.PRO273

Leukocytes include monocytes, macrophages, basophils and eosinophils and play an important role in the immune response. These cells are important in mechanisms initiated by T and / or B lymphocytes and secrete several cytokines that replenish and activate other inflammatory cells to destroy tissue.

Therefore, it is important to study the regulatory response in which white blood cells migrate to their appropriate destinations and interact with other cells. Currently, white blood cells are thought to migrate from blood into damaged or inflamed tissue by passing through endothelial cells in the vessel wall. This shift is made by the transient interaction between the selectin and its ligand. The white blood cells must then migrate through the vessel wall into the tissue. These diapedesis and extravasation steps include cell activation that promotes more stable leukocyte-endothelial interactions mediated by integrins and their ligands.

Chemokines are a large family of structurally related polypeptide chemokines. This molecule stimulates the migration of white blood cells and can explain the migration of white blood cells to other sites of inflammation. Chemokines regulate the expression of specific adhesion molecules in endothelial cells and produce chemoattractants that activate specific cell types. Chemokines also promote proliferation and regulate the activation of certain cell types. In all of these activities, chemokines exhibit high levels of target cell specificity.

The chemokine family is classified into two subgroups based on whether two amino terminal cysteine residues are contiguous (C-C) or one amino acid is interposed between them (C-X-C). Chemokines of the C-X-C family generally activate neutrophils and fibroblasts, but C-C chemokines act on a broader target cell population, including monocytes / macrophages, basophils, eosinophils and T lymphocytes. Known chemokines among these two subgroups are described in Thomson A. (1994) The Cytokine Handbook, 2 d Ed. Academic Press, N.Y.]. Chemokines are also described in Schall TJ (1994) Chemotactic Cytokines: Targets for Therapeutic Development. International Business Communications, Southborough Mass. pp 180-270; and in Paul WE (1993) Fundamental Immunology, 3rd Ed. Raven Press, N.Y. pp 822-826.

Known chemokines among the C-X-C subfamily include the alpha and beta (MIP-1 and MIP-2), interleukin-8 (IL-8), and growth regulator proteins (GRO-alpha and beta) of macrophage inflammatory proteins.

MIP-2 was first identified as a 6 kDa heparin binding protein secreted by RAW 264.7, a macrophage cell line in mice when stimulated with lipopolysaccharide (LPS). MIP-2 is a member of the C-X-C (or CXC) subfamily of chemokines. Mouse MIP-2 exhibits chemotaxis against human neutrophils and when injected into the foot pads of mice, induces local neutrophil infiltration. Rat MIP-2 exhibits 86% amino acid homology with mouse MIP-2 and shows chemotaxis against rat neutrophils but does not stimulate the migration of eosinophils or lymphocytes of rat alveolar macrophages or human peripheral blood. It is also known that rat MIP-2 stimulates the proliferation of rat alveolar epithelial cells but not fibroblasts.

Current techniques for diagnosing abnormalities in inflammatory or diseased effluents rely primarily on the observation of clinical signs or serological analysis of body tissues or body fluids on hormones, polypeptides or various metabolites. There are problems with this diagnostic technique. First, the patient may not show clinical signs in the early stages of the disease. Second, serological tests do not always distinguish between invasive disease and hereditary symptoms. Therefore, the identification of expressed chemokines is important in developing new diagnostic techniques and effective therapies, and helping to understand molecular mechanisms of pathogenesis.

Recently, chemokines have been shown to be involved in one or more of the symptoms of psoriasis, inflammatory bowel disease, kidney disease, arthritis, immune-mediated alopecia, stroke, encephalitis, MS, hepatitis and other symptoms. In addition, ELR-free chemokines are involved in the inhibition of angiogenesis and thus this suggests that chemokines control the vascularization and oncogenesis of tumors.

Accordingly, it is an object of the present invention to identify MIP-1, MIP-2 and other related proteins and polypeptides having the same sequence identity and similarity as the chemoattractants of cytokine-induced neutrophils and nucleic acids encoding them. Efforts have been made herein to achieve this purpose.

56.PRO701

Beta neurexin and neuroligin are plasma membrane proteins present on the surface of neurons. Neuroligin 1 is abundant in the plasma membrane of synapses and is a splice site-specific ligand for beta-neurexin as described in Ichtchenko, et al., Cell, 81 (3): 435-443 (1995). Acts as. The extracellular sequence of Neuroligin 1 consists of a catalytically inactive esterase domain homologous to acetylcholinesterase. The structure and sequence of neuroligins 2 and 3 are similar to neuroligins 1. All neuroligins comprise an N-terminal hydrophobic sequence, a large esterase homologous domain, a highly conserved single transmembrane region, and a short cytoplasmic domain that are characterized by truncated signal peptides. These three neuroligins are selectively spliced at the same site and are expressed at high levels only in the brain. Tight binding of these three neuroligins with beta-neuleucine is observed only for beta-neuleucine lacking an insert at splice site 4. Thus, neuroligin constitutes a multifamily of genes consisting of brain-specific proteins with different isoforms that may have overlapping functions in regulating the cognitive response between neurons [Ichtchenko, et al., J. Biol. Chem., 271 (5): 2676-2682 (1996). In addition, neuroxins and neuroligins have been reported to act as adhesion molecules in Ca ²⁺ dependent reactions that are regulated by selective splicing of beta neurons. [Nguyen and Sudhof, J. Biol. Chem., 272 (41): 26032-26039 (1997). Due to this fact, membrane bound proteins are of interest. More generally, membrane-bound proteins and receptors may play an important role in the formation, differentiation and maintenance of multicellular organisms. Membrane binding proteins and receptors may play an important role, among other things, in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, eg, proliferation, migration, differentiation or interaction with other cells, is typically dependent on information received from other cells and / or adjacent environments. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. Such membrane-binding proteins and cellular receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatase, receptors involved in cell-cell interactions, and adhesin molecules of cells such as selectins and integrins. For example, the introduction of signals that regulate cell growth and differentiation is in part regulated by phosphorylation of several cellular proteins. Protein tyrosine kinases, enzymes that accelerate this process, can also act as growth factor receptors. Examples include fibroblast growth factor receptors and nerve growth factor receptors.

Membrane binding proteins and receptor molecules have a variety of industrial uses, including pharmaceuticals and diagnostics. For example, receptor immunoadhesin can be used as a therapeutic agent to block receptor-ligand interactions. Membrane binding proteins can also be used to screen for potential peptide or small molecule inhibitors for related receptor / ligand interactions.

Efforts have been made by both industry and academia to find novel natural membrane binding receptor proteins, particularly proteins with sequence identity and / or similarity to neuroligins 1, 2 and 3. Much effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel secretion and membrane bound receptor proteins. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637. The results of this effort are presented herein.

57.PRO704

VIP36 is located on the Golgi apparatus and cell surface and belongs to the family of lectin homologues of legumes that may be involved in the transport of glycoproteins, glycolipids, or both in the animal secretory pathway. VIP36 also binds to the sugar residues of glycosphingolipids and / or glycosylphosphatidyl-inositol anchors and can provide a link between the outer surface of the glycolipid portion and the inner surface of the cavity and the separation mechanism of the cytoplasmic protein. I think. Another for VIP36 is believed to be a signal at its C-terminus that matches an internalized consensus sequence that confers circulating capacity between the plasma membrane and the Golgi apparatus. Fiedler, et al, EMBO J., 13 (7): 1729-1740 (1994); Fiedler and Simons, J. Cell Sci., 109 (1): 271-276 (1996); Itin, et al., MBO J., 14 (10): 2250-2256 (1995). VIP36 is thought to be identical or very closely related to human GP36b protein. VIP36 and / or GP36b are of interest.

More generally, vesicles, cytoplasm, extracellular and membrane-bound proteins play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, such as proliferation, migration, differentiation or interaction with other cells, is typically dictated by information received from other cells and / or adjacent environments. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. These secreting polypeptides or signaling molecules generally reach the site of their action in the extracellular environment, usually the membrane-bound receptor protein, via the secretory pathway of the cell.

Secretory proteins have a variety of industrial uses, including pharmaceuticals, diagnostics, biosensors, and bioreactors. Indeed, most protein drugs currently available such as thrombolytics, interferons, interleukins, erythropoietins, colony stimulating factors and various other cytokines are secreted proteins. In addition, membrane receptor proteins, which are their receptors, also have potential as therapeutic or diagnostic agents. For example, receptor immunoadhesin can be used as a therapeutic agent to block receptor-ligand interactions. Membrane binding proteins can also be used to screen for potential peptide or small molecule inhibitors for related receptor / ligand interactions. Such membrane-binding proteins and cellular receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatase, receptors involved in cell-cell interactions, and cellular adhesin molecules such as selectins and integrins. The introduction of signals that regulate cell growth and differentiation is in part regulated by phosphorylation of several cellular proteins. Protein tyrosine kinases, enzymes that accelerate this process, can also act as growth factor receptors. Examples include fibroblast growth factor receptors and nerve growth factor receptors.

Efforts have been made by both industry and academia to find new natural blood vessels, cytoplasm, secretory and membrane-bound receptor proteins, particularly proteins with sequence identity and / or similarity to VIP36. Much of this effort is focused on screening mammalian recombinant DNA libraries to find the coding sequences of novel secretory and membrane bound receptor proteins. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637.

58.PRO706

Acid phosphatase proteins are secreted proteins that dephosphorylate terminal phosphate groups under acidic pH conditions. Acid phosphatase includes the RHGXRXP amino acid sequence which is believed to be important for mechanical action. Acid phosphatase may have important functions in the diagnosis and treatment of human disease. For example, prostate acid phosphatase is a secreted protein that is specifically expressed in prostate tissue and prostate cancer. Levels of prostate acid phosphatase can be found in Lankford et al., Int. J. Radiat. Oncol. Biol. Phys. 38 (2): 327-333 (1997), which is a potential diagnostic element in local and biochemical control of patients with prostate cancer treated with radiotherapy. The findings suggest that cellular immune responses to prostate acid phosphatase can modulate detrimental autoimmune prostate inflammation, and that prostate acid phosphatase forms produced in xenogenes may be useful for immunotherapy of prostate cancer. Fong et al., J. Immunol. 169 (7): 3113-3117 (1997). The level of prostatic acid phosphatase in semen is significantly associated with very low semen levels (semenorrhea) in 35 or more individuals [Singh et al., Singapore Med. J. 37 (6): 598-599 (1996). Thus, prostate phosphatase is associated with many diseases in humans and may play an important role in the diagnosis and treatment of such diseases. A group of aminobenzylphosphate compounds is described by Berers et al., Bioorg. Med. Chem. 4 (10): 1693-1701 (1996), is a very potent inhibitor of prostate acid phosphatase.

More generally, extracellular proteins play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, such as proliferation, migration, differentiation or interaction with other cells, is typically dictated by information received from other cells and / or adjacent environments. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. These secretory polypeptides or signaling molecules generally reach their site of action in the extracellular environment via the secretory pathway of the cell.

Secretory proteins have a variety of industrial uses, including pharmaceuticals, diagnostics, biosensors, and bioreactors. Indeed, most protein drugs currently available such as thrombolytics, interferons, interleukins, erythropoietins, colony stimulating factors and various other cytokines are secreted proteins. In addition, membrane proteins that are their receptors also have potential as therapeutic or diagnostic agents. Efforts have been made by both industry and academia to find new natural secreted proteins, particularly acid phosphatase precursors in the prostate and acid phosphatase precursors in lysosomes, and, in some cases, proteins with identity to DNA present in the fetal heart. . Much of this effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in, for example, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637.

59.PRO707

Cadherin is a large family of transmembrane proteins. At least Cadherin 1-13 and Types B, E, EP, M, N, P and R have been identified and characterized. Among the functions of Cadherin, with a few exceptions, Cadherin is known to participate in cell aggregation and bind to cell-cell adhesion sites. For cadrine, Tanihara et al., J. Cell Sci., 107 (6): 1697-1704 (1994), Aberle et al., J. Cell Biochem., 61 (4): 514-523 (1996 and Tanihara et al., Cell Adhes. Commun., 2 (1): 15-26 (1994). In addition, several members of the Caherin giant have been reported to be involved in general cell-cell interaction responses, including signal transduction (Suzuki, J. Cell Biochem., 61 (4): 531-542 (1996)). See]. Thus, new members of the Kaherin Giant are of interest.

More generally, all new proteins, including membrane bound proteins, are of interest. Membrane binding proteins and receptors play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, eg, proliferation, migration, differentiation or interaction with other cells, is typically dependent on information received from other cells and / or adjacent environments. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. Such membrane-bound proteins and cellular receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatase, receptors involved in cell-cell interactions, and cellular adhesin molecules such as selectin and integrin. For example, the introduction of signals that regulate cell growth and differentiation is in part regulated by phosphorylation of several cellular proteins. Protein tyrosine kinases, enzymes that accelerate this process, can also act as growth factor receptors. Examples include fibroblast growth factor receptors and nerve growth factor receptors.

Membrane binding proteins and receptor molecules have a variety of industrial uses, including pharmaceuticals and diagnostics. For example, receptor immunoadhesin can be used as a therapeutic agent to block receptor-ligand interactions. Membrane binding proteins can also be used to screen for potential peptide or small molecule inhibitors for related receptor / ligand interactions.

Efforts have been made by both industry and academia to find new natural secretion and membrane binding receptor proteins, particularly membrane binding proteins that have identity with cardherin. The results of this effort are presented herein.

60.PRO322

Proteases are enzyme proteins involved in many very important biological processes in mammalian and non-mammalian organisms. Many other protease enzymes from various mammalian and non-mammalian organisms have been identified and characterized, including serine proteases that exhibit specific activity against a variety of serine-containing proteins. Mammalian protease enzymes play an important role in biological responses such as, for example, proteolysis, activation, inactivation, or regulation of peptide hormone activity, and alteration of physical properties of proteins and enzymes.

Neuropsin is a novel serine protease whose mRNA is expressed in the central nervous system. Mouse neuropsin has been cloned, and studies have shown that it is involved in the formation of the hippocampus. Neuropsin has also been shown to be involved in the transformation and cell migration of extracellular epilepsy. In general, Chen, et al., Neurosci., 7 (2): 5088-5097 (1995) and Chen, et al., J. Histochem. Cytochem., 46: 313-320 (1998).

Efforts have been made by both industry and academia to find novel natural membrane-bound or secreted proteins, particularly those that have homology with neuropsin, serine proteases, neurosine and trypsinogen. Much of this effort is focused on screening mammalian recombinant DNA libraries to find the coding sequences of novel secretory and membrane bound receptor proteins. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637.

61.PRO526

Protein-protein interactions include those associated with receptor and antigen binding and signaling mechanisms. As is well known for the structural and functional mechanisms underlying protein-protein interactions, protein-protein interactions can be readily manipulated to modulate the specific consequences of that protein-protein interaction. Thus, the underlying mechanisms of protein-protein interactions are of interest to the scientific and medical community.

All proteins, including leucine rich repeats, are thought to be involved in protein-protein interactions. Leucine-rich repeats are short sequence motifs present in many proteins that differ in function and intracellular location. As determined through the crystal structure of the ribonuclease inhibitor protein, leucine rich repeats correspond to beta-alpha structural units. These units form parallel beta sheets with one side exposed to the solvent so that the protein takes on a unique non-spherical shape. These two features have been found to be responsible for the protein-binding function of proteins including leucine rich repeats. In this regard, Kobe and Deisenhofer, Trends Biochem. Sci. , 19 (10): 415-421 (Oct. 1994).

According to one research report, leucine-rich proteoglycans function as tissue formers that orient and organize collagen fibers during development, and are involved in pathological processes such as wound healing, tissue repair and tumor lipid formation [Io]. Izzozzo, RV, Crit. Rev. Biochem. Mol. Biol ., 32 (2): 141-174 (1997)]. Other studies showing that leucine-rich proteins are involved in wound healing and tissue repair include De La Salle, who reported mutations in leucine-rich motifs in conjugates associated with bleeding disorder Bernard-Soulier syndrome. C.) et al. Vouv. Rev. Fr. Hematol . (Germany), 37 (4): 215-222 (1995) and Chlemetson, KJ, who reported that platelets have leucine rich repeats, Thromb. Haemost . (Germany), 74 (1): 111-116 (July 1995)], and the La Jolla Cancer Research Foundation, which reported that decorin binding to transforming growth factor β is involved in cancer treatment, wound healing and scar formation. Cancer Research Foundation, Ruoslahti, EI, et al. WO9110727A. Insulin-like growth factor (IGF) has been shown to be useful in wound healing and related therapies involved in the regrowth of tissues such as connective tissue, skin and bones, in promoting body growth and in other growth-related processes in humans and animals. In relation to the function of the protein group. In addition, subunits of IGF that are labile to acid (ALS) are interesting in that they increase the half-life of IGF and are part of the IGF conjugate in vivo.

Another protein reported to have leucine-rich repeats is the SLIT protein, which has been reported to be useful for the treatment of neurodegenerative diseases such as Alzheimer's disease and neurological damage, such as in Parkinson's, and for the diagnosis of cancer [Artaba] See WO9210518-A1 of Artavanistsakonas, S. and Rothberg, JM, Yale University. Of particular interest is LIG-1, a membrane glycoprotein that is specifically expressed in glial cells of the mouse brain and has leucine rich repeats and immunoglobulin-like domains [Suzuki et al., J. Biol. Chem. (US), 271 (37): 22522 (1996)]. Other research reports on the biological function of proteins with leucine rich repeats include Taray, N. et al ., Mol. Cell Endocrinol. , (Ireland), 125 (1-2): 65-70 (Dec. 1996) (associated with gonadotropin receptor), Miura, Y. et al., Nippon Rinsho (Japan), 54 (7). ): 1784-1789 (July 1996) (related to apoptosis), and Harris, PC, et al ., J. Am. Soc. Nephrol ., 6 (4): 1125-1133 (Oct. 1995)].

Thus, efforts to find new proteins with leucine rich repeats are being made by both industry and academia to better understand protein-protein interactions. Of particular interest are proteins that are homologous to known proteins having leucine rich repeats and leucine rich repeats such as ALS. Much effort is focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secretion and membrane binding proteins with leucine rich repeats. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93 : 7108-7113 (1996) and US Pat. No. 5,536,637.

62.PRO531

Cadherin is a large family of transmembrane proteins. Cadherin actually includes a calcium-dependent glycoprotein family that functions to regulate cell-cell adhesion in all solid tissues of multicellular organisms. At least Cadherin 1-13 and Types B, E, EP, M, N, P and R have been identified and characterized. Among the functions of Cadherin, with a few exceptions, Cadherin is known to participate in cell aggregation and bind to cell-cell adhesion sites. Recently, all Cadherin share several repeats of Cadherin specific motifs that are thought to respond to folding of the extracellular domain, and members of the Cadherin giant family have been reported to have different structures and functions. In particular, members of the Caherin giant have been reported to be involved in signal transduction (see Suzuki, J. Cell Biochem., 61 (4): 531-542 (1996)). For cadrine, Tanihara et al., J. Cell Sci., 107 (6): 1697-1704 (1994), Aberle et al., J. Cell Biochem., 61 (4): 514-523 (1996 and Tanihara et al., Cell Adhes. Commun., 2 (1): 15-26 (1994).

Protocadherin is a member of the Kadherin giant that is highly expressed in the brain. In some studies, protocadherin exhibited cell adhesion activity. See Sano, et al., EMBO J., 12 (6): 2249-2256 (1993). However, studies have also shown that some protocadherins, such as protocadherin 3 (also known as Pcdh3 or pc3), do not exhibit strong calcium dependent cell aggregation activity. For this study and additional features of Pcdh3, see Sago, et al., Genomics, 29 (3): 631-640 (1995).

Therefore, new members of the Kaherin giant are of interest. More generally, all membrane binding proteins and receptors are of interest. This protein plays an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, eg, proliferation, migration, differentiation or interaction with other cells, is typically dependent on information received from other cells and / or adjacent environments. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. Such membrane-binding proteins and cellular receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatase, receptors involved in cell-cell interactions, and cellular adhesin molecules such as selectins and integrins. For example, the introduction of signals that regulate cell growth and differentiation is in part regulated by phosphorylation of several cellular proteins. Protein tyrosine kinases, enzymes that accelerate this process, can also act as growth factor receptors. Examples include fibroblast growth factor receptors and nerve growth factor receptors.

Membrane binding proteins and receptor molecules have a variety of industrial uses, including pharmaceuticals and diagnostics. For example, receptor immunoadhesin can be used as a therapeutic agent to block receptor-ligand interactions. Membrane binding proteins can also be used to screen for potential peptide or small molecule inhibitors for related receptor / ligand interactions.

Efforts have been made by both industry and academia to find new natural membrane-binding proteins, particularly protocadherins, especially proteins having sequence identity with 3 and 4. Much effort has been focused on screening mammalian recombinant DNA libraries to identify coding sequences for new membrane-binding proteins. The results of this effort are presented herein.

63.PRO534

Protein disulfide isomerase is an enzyme protein that is involved in promoting correct refolding of proteins through the formation of correct disulfide bonds. Protein disulfide isomerase was initially identified based on its ability to catalyze the regeneration of degraded denatured RNAse (Goldberger et al., J. Biol. Chem. 239: 1406-1410 (1964) and Epstein et al. ., Cold Sprring Harbor Symp.Quant. Biol. 28: 439-449 (1963). Protein disulfide isomerase is known to be an intravesicular enzyme retained in the endoplasmic reticulum via the -KDEL or -HDEL amino acid sequence at the C-terminus. Protein disulfide isomerase and related proteins are described in Laboissiere, et al., J. Biol. Chem., 270 (47: 28006-28009 (1995); Jeenes, et al., Gene, 193 (2): 151-156 (1997; Koivunen, et al., Genomics, 42 (3): 397-404 ( And Desilva, et al., DNA Cell Biol., 15 (1): 9-16 (1996), suggesting the importance of identifying protein disulfide-related proteins.

More generally, all new membrane binding proteins and receptors are of interest. This protein plays an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, eg, proliferation, migration, differentiation or interaction with other cells, is typically dependent on information received from other cells and / or adjacent environments. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. Such membrane-binding proteins and cellular receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatase, receptors involved in cell-cell interactions, and cellular adhesin molecules such as selectins and integrins. For example, the introduction of signals that regulate cell growth and differentiation is in part regulated by phosphorylation of several cellular proteins. Protein tyrosine kinases, enzymes that accelerate this process, can also act as growth factor receptors. Examples include fibroblast growth factor receptors and nerve growth factor receptors.

Membrane binding proteins and receptor molecules have a variety of industrial uses, including pharmaceuticals and diagnostics. For example, receptor immunoadhesin can be used as a therapeutic agent to block receptor-ligand interactions. Membrane binding proteins can also be used to screen for potential peptide or small molecule inhibitors for related receptor / ligand interactions.

Because membrane binding proteins are important, efforts are being made to find new membrane binding proteins. In addition, in many other fields it is important to increase the rate of accurate refolding of disulfide bond-forming enzymes and their potential uses, such as recombinantly produced proteins, so that both industry and academia are now known as protein disulfide isomers. Efforts are being made to find novel natural proteins with sequence identity to the agent. Much of this effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel protein disulfide isomerase homologs. Here we describe novel polypeptides having sequence identity with protein disulfide isomerase and nucleic acids encoding them.

64.PRO697

The secreted frizzled family of protein (sFRP) is associated with the curly transmembrane receptor family. sFRP is about 30 kDa in size and includes a putative signal sequence, a curly cysteine-rich domain and a conserved hydrophilic carboxy-terminal domain. sFRP regulates Wnt signaling and has been reported to act as a ligand for several receptors (Rattner, et al., PNAS USA, 94 (7): 2859-2863 (1997)). Thus, proteins having sequence identity and / or similarity to sFRP and sFRP are of interest.

Another secretory protein of interest is any member of the secretory apoptosis-related protein (SARP) family. Expression of SARP alters the level of intracellular beta-catenin, suggesting that SARP interferes with the Wnt-curly protein signaling pathway [Melkonyan, et al., PNAS USA, 94 (25): 13636-13641. (1997). Thus, proteins of sequence identity and / or similarity to SARP and SARP are of interest.

In addition to sFRP and SARP, many extracellular proteins are of interest. Extracellular proteins play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, such as proliferation, migration, differentiation, or interaction with other cells, is typically dictated by information received from other cells and / or adjacent environments. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. These secretory polypeptides or signaling molecules generally reach their site of action in the extracellular environment via the secretory pathway of the cell.

Secretory proteins have a variety of industrial uses, including pharmaceuticals, diagnostics, biosensors, and bioreactors. Indeed, most protein drugs currently available such as thrombolytics, interferons, interleukins, erythropoietins, colony stimulating factors and various other cytokines are secreted proteins. In addition, membrane proteins that are their receptors also have potential as therapeutic or diagnostic agents.

Efforts have been made by both industry and academia to find novel naturally secreted proteins, particularly those with sequence identity or similarity to sFRP-2 and SARP-1. Much effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637.

65.PRO717

Efforts to find new natural transmembrane receptor proteins have been made by both industry and academia. Much effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for new receptor proteins. The results of this effort are presented herein.

66.PRO731

Cadherin is a large family of transmembrane proteins. Cadherin actually includes a calcium-dependent glycoprotein family that functions to regulate cell-cell adhesion in all solid tissues of multicellular organisms. At least Cadherin 1-13 and Types B, E, EP, M, N, P and R have been identified and characterized. Among the functions of Cadherin, with a few exceptions, Cadherin is known to participate in cell aggregation and bind to cell-cell adhesion sites. Recently, all Cadherins share several repeats of Cadherin specific motifs that are thought to correspond to the folding of the extracellular domain, but members of the Cadherin giant family have been reported to have different structures and, in some cases, functions It became. In particular, members of the Caherin giant have been reported to be involved in signal transduction (see Suzuki, J. Cell Biochem., 61 (4): 531-542 (1996)). For cadrine, Tanihara et al., J. Cell Sci., 107 (6): 1697-1704 (1994), Aberle et al., J. Cell Biochem., 61 (4): 514-523 (1996 and Tanihara et al., Cell Adhes. Commun., 2 (1): 15-26 (1994).

Protocadherin is a member of the Kadherin giant that is highly expressed in the brain. In some studies, protocadherin exhibited cell adhesion activity. See Sano, et al., EMBO J., 12 (6): 2249-2256 (1993). However, studies have also shown that some protocadherins, such as protocadherin 3 (also known as Pcdh3 or pc3), do not exhibit strong calcium dependent cell aggregation activity. For this study and additional features of Pcdh3, see Sago, et al., Genomics, 29 (3): 631-640 (1995).

Therefore, new members of the Kaherin giant are of interest. More generally, all membrane binding proteins and receptors are of interest. This protein plays an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, eg, proliferation, migration, differentiation or interaction with other cells, is typically dependent on information received from other cells and / or adjacent environments. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. Such membrane-binding proteins and cellular receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatase, receptors involved in cell-cell interactions, and cellular adhesin molecules such as selectins and integrins. For example, the introduction of signals that regulate cell growth and differentiation is in part regulated by phosphorylation of several cellular proteins. Protein tyrosine kinases, enzymes that accelerate this process, can also act as growth factor receptors. Examples include fibroblast growth factor receptors and nerve growth factor receptors.

Membrane binding proteins and receptor molecules have a variety of industrial uses, including pharmaceuticals and diagnostics. For example, receptor immunoadhesin can be used as a therapeutic agent to block receptor-ligand interactions. Membrane binding proteins can also be used to screen for potential peptide or small molecule inhibitors for related receptor / ligand interactions.

Efforts have been made by both industry and academia to find new natural membrane-binding proteins, particularly protocadherins, particularly proteins having sequence identity with 4, 68, 43, 42, 3 and 5. Much effort has been focused on screening mammalian recombinant DNA libraries to identify coding sequences for new membrane-binding proteins. The results of this effort are presented herein.

67.PRO218

Efforts are being made by both industry and academia to find new natural membrane-binding proteins, particularly those with sequence identity to membrane regulatory proteins. Much effort is focused on screening mammalian recombinant DNA libraries to identify coding sequences for new receptor proteins.

68.PRO768

Integrins include a family of macrogenes of cell-surface glycoprotein receptors that promote cell adhesion. Each cell has a number of receptors that determine its cell adhesion capacity. Integrins are involved in a wide variety of interactions between cells and other cell or matrix components. Integrins are particularly important in regulating the movement and function of immune system cells. Platelet IIb / IIIA integrin conjugates are particularly important in regulating platelet aggregation. Among many integrin families, integrin β-6 is expressed in epithelial cells and modulates epithelial inflammatory responses. Another integrin, leukocyte-binding antigen-1 (LFA-1), is important for lymphocyte adhesion during the immune response.

Of particular interest is H36-, an integrin alpha chain that is regulated in developmental stages during muscle development, as described by Song, et al., J. Cell Biol., 117 (3): 643-657 (1992). Alpha 7. Expression patterns of laminin-binding alpha 7 beta 1 integrins are regulated at developmental stages in skeletal muscle, myocardium and smooth muscle [Ziober, et al., Mol. Biol. Cell, 8 (9): 1723-1734 (1997). Expression of alpha 7-X1 / X2 integrins has been reported to be a novel mechanism that regulates receptor affinity status in cell-specific environments and can regulate integrin-dependent responses during muscle development and repair [Id]. Laminin has also been reported to promote the migration of skeletal myoblasts through the alpha 7 integrin receptor. In particular, the alpha 7 beta 1 receptor can promote the attachment and migration of myoblasts with a limited number of laminin isoforms and has been reported to be important for the recruitment of myogenic precursors during regeneration and differentiation [Yao, et al. , J. Cell Sci., 109 (13): 3139-3150 (1996). Spliced variants of integrin alpha 7 are also described in Leung, et al., Biochem. Biophys. Res. Commun., 243 (1): 317-325 (1998) and Fornaro and Languino, Matrix Biol., 16 (4): 185-193 (1997). In addition, the absence of integrin alpha 7 has been reported to cause one form of muscular dystrophy. Thus, interest in integrins, particularly integrin 7 and related molecules, is of interest.

In addition to integrins of interest, more generally, all membrane-bound proteins and receptors are of interest because such proteins can play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, eg, proliferation, migration, differentiation or interaction with other cells, is typically dependent on information received from other cells and / or adjacent environments. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. Such membrane-binding proteins and cellular receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatase, receptors involved in cell-cell interactions, and cellular adhesin molecules such as selectins and integrins. For example, the introduction of signals that regulate cell growth and differentiation is in part regulated by phosphorylation of several cellular proteins. Protein tyrosine kinases, enzymes that accelerate this process, can also act as growth factor receptors. Examples include fibroblast growth factor receptors and nerve growth factor receptors.

Membrane binding proteins and receptor molecules have a variety of industrial uses, including pharmaceuticals and diagnostics. For example, receptor immunoadhesin can be used as a therapeutic agent to block receptor-ligand interactions. Membrane binding proteins can also be used to screen for potential peptide or small molecule inhibitors for related receptor / ligand interactions.

Thus, efforts to find new natural receptor proteins are being made by both industry and academia. Much effort is focused on screening mammalian recombinant DNA libraries to identify coding sequences for new receptor proteins. The results of this effort are presented herein, particularly in the context of efforts focused on identifying novel polypeptides having sequence identity with integrins.

69.PRO771

Testican is a testicular multidomain proteoglycan expressed in many tissue types, including but not limited to neuromuscular tissue, brain and reproductive tissue. Testicans are analogous to modulators for cell population behavior such as regulation of cell morphology, adhesion, migration and proliferation [Bonnet, F. et al., J. Biol. Chem., 271 (8): 4373 (1996), Perin, J.P. et al., Switzerland, 70: 191 (1994), Alliel, P.M., et al, Eur. J. Biochem., 214 (1): 346 (1993), Charbonnier, F., et al., C. R. Seances Soc. Biol. Fil. (France), 191 (1): 127 (1997)]. Above all, testisan is of interest because it is related to the response of neurons and may be related to the growth of connective tissue, testisan and related molecules.

More generally, all extracellular proteins are of interest. Extracellular proteins play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, eg, proliferation, migration, differentiation, or interaction with other cells, is typically dependent on information received from other cells and / or adjacent environments. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. These secretory polypeptides or signaling molecules generally reach their site of action in the extracellular environment via the secretory pathway of the cell.

Secretory proteins have a variety of industrial uses, including pharmaceuticals, diagnostics, biosensors, and bioreactors. Indeed, most protein drugs currently available such as thrombolytics, interferons, interleukins, erythropoietins, colony promoters and various other cytokines are secreted proteins. In addition, membrane proteins that are their receptors also have potential as therapeutic or diagnostic agents. Efforts to find new natural secreted proteins are being made by both industry and academia. Much effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637. The results of these efforts, in particular the results of efforts focused on identifying molecules with identity and / or similarity to testisan, are of interest.

70.PRO733

T1 / ST2 is a receptor-like molecule that is homologous to the type I interleukin-1 receptor and is thought to be involved in cellular signaling. T1 / ST2 receptors and / or putative ligands are described by Gayle, et al., J. Biol. Chem., 271 (10): 5784-5789 (1996), Kumar, et al., J. Biol. Chem., 270 (46): 27905-27913 (1995), and Mitcham, et al., J. Biol. Chem., 271 (10): 5777-5783 (1996). Such proteins and related proteins are of interest.

More generally, all membrane bound proteins and receptors are of interest because such proteins may play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, eg, proliferation, migration, differentiation, or interaction with other cells, is typically dependent on information received from other cells and / or adjacent environments. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. Such membrane-binding proteins and cellular receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatase, receptors involved in cell-cell interactions, and cellular adhesin molecules such as selectins and integrins. For example, the introduction of signals that regulate cell growth and differentiation is in part regulated by phosphorylation of several cellular proteins. Protein tyrosine kinases, enzymes that accelerate this process, can also act as growth factor receptors. Examples include fibroblast growth factor receptors and nerve growth factor receptors.

Membrane binding proteins and receptor molecules have a variety of industrial uses, including pharmaceuticals and diagnostics. For example, receptor immunoadhesin can be used as a therapeutic agent to block receptor-ligand interactions. Membrane binding proteins can also be used to screen for potential peptide or small molecule inhibitors for related receptor / ligand interactions.

Efforts to find new natural receptor proteins are being made by both industry and academia. Much effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for new receptor proteins. The results of this effort are presented herein.

71.PRO162

Pancreatitis-related protein (PAP) is a secreted protein that is overexpressed in the pancreas during acute pancreatitis. Serum levels of PAP were abnormally high in patients with acute pancreatitis [Pezzilli et al., Am. J. Gastroenterol., 92 (10): 1887-1890 (1997).

PAP is synthesized in the pancreas when it is inflamed and is known to be an excellent serum marker for damage to the pancreas. In addition, the level of serum PAP seems to correlate strongly with creatinine clearance measurements. In patients undergoing pancreas-kidney transplantation, PAP may prove to be a useful biological and histological marker for pancreatic transplant rejection. Van der Pijl et al., Transplantation, 63 (7): 995-1003 (1997) ]. PAPs are also known to be useful for screening cystic fibrosis in newborns. Indeed, PAP can distinguish newborns with cystic fibrosis much more specifically than conventional immunoreactive trypsis assays [Iovanna et al., C. R. Acad. Aci. III, 317 (6): 561-564].

Secretory proteins, such as PAP, have a variety of industrial uses, including pharmaceuticals, diagnostics, biosensors, and bioreactors. Indeed, most protein drugs currently available such as thrombolytics, interferons, interleukins, erythropoietins, colony promoters and various other cytokines are secreted proteins. In addition, membrane proteins that are their receptors also have potential as therapeutic or diagnostic agents.

Efforts to find new natural secreted proteins are being made by both industry and academia. Much effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637. The results of this effort are presented herein.

72.PRO788

Anti-tumor urinary protein (ANUP) is present in human urine fractions and exhibits antiproliferative activity against human tumor cell lines without affecting the growth of some normal diploid cell lines or tumor cells of mouse or hamster origin. It was found to be a major protein [Sloane et al., Biochem. J., 234 (2): 355-362 (1986)].

ANUP is a unique cytokine found in human granulocytes. Its N-terminal amino acid sequence is known to be unique. Synthetic peptides corresponding to the first nine residues with Cys at positions 4 and 7 were found to be anti-tumor substances in vitro [Ridge and Sloane, Cytokine, 8 (1): 1-5 (1996). )].

Secretory proteins, such as ANUP, have a variety of industrial uses, including pharmaceuticals, diagnostics, biosensors, and bioreactors. Indeed, most protein drugs currently available such as thrombolytics, interferons, interleukins, erythropoietins, colony stimulating factors and various other cytokines are secreted proteins. In addition, membrane proteins that are their receptors also have potential as therapeutic or diagnostic agents. Efforts to find new natural secreted proteins are being made by both industry and academia. Much effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel secreted proteins. Examples of screening methods and techniques can be found in, for example, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637.

73.PRO1008

Dickkopf-1 (dkk-1) is a family of secreted proteins and functions as a head inducer. Dkk-1 is an inducer of Spemann formation in amphibian embryos (Glinka, et al., Nature, 391 (6665): 357-362 (1998)). Dkk-1 is a potent antagonist in Wnt signaling, suggesting that the dkk gene encodes a family of secreted Wnt inhibitors. Thus, dkk-1 family members and related molecules are of interest.

More generally, all extracellular proteins are of interest because they can play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, eg, proliferation, migration, differentiation or interaction with other cells, is typically dependent on information received from other cells and / or adjacent environments. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. These secretory polypeptides or signaling molecules generally reach their site of action in the extracellular environment via the secretory pathway of the cell.

Secretory proteins have a variety of industrial uses, including pharmaceuticals, diagnostics, biosensors, and bioreactors. Indeed, most protein drugs currently available such as thrombolytics, interferons, interleukins, erythropoietins, colony promoters and various other cytokines are secreted proteins. In addition, membrane proteins that are their receptors also have potential as therapeutic or diagnostic agents.

Efforts to find new natural secreted proteins, especially those related to dkk-1, have been made by both industry and academia. Much effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637. The results of this effort to find molecules related to dkk-1 are presented herein.

74.PRO1012

Protein disulfide isomerase is an enzyme protein that is involved in promoting correct refolding of proteins through the formation of correct disulfide bonds. Protein disulfide isomerase was initially identified based on its ability to catalyze the regeneration of degraded denatured RNAse (Goldberger et al., J. Biol. Chem. 239: 1406-1410 (1964) and Epstein et al. ., Cold Sprring Harbor Symp.Quant. Biol. 28: 439-449 (1963). Protein disulfide isomerase is known to be an intravesicular enzyme retained in the endoplasmic reticulum via the -KDEL or -HDEL amino acid sequence at the C-terminus. Protein disulfide isomerase and related proteins are described in Laboissiere, et al., J. Biol. Chem., 270 (47: 28006-28009 (1995); Jeenes, et al., Gene, 193 (2): 151-156 (1997; Koivunen, et al., Genomics, 42 (3): 397-404 ( And Desilva, et al., DNA Cell Biol., 15 (1): 9-16 (1996), suggesting the importance of identifying protein disulfide-related proteins.

More generally, the identification of all extracellular and membrane bound proteins is of interest because they play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, eg, proliferation, migration, differentiation or interaction with other cells, is typically dependent on information received from other cells and / or adjacent environments. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. These secreting polypeptides or signaling molecules generally reach the site of their action in the extracellular environment, usually the membrane-bound receptor protein, via the secretory pathway of the cell.

Secretory proteins have a variety of industrial uses, including pharmaceuticals, diagnostics, biosensors, and bioreactors. Indeed, most protein drugs currently available such as thrombolytics, interferons, interleukins, erythropoietins, colony promoters and various other cytokines are secreted proteins. In addition, membrane receptor proteins, which are their receptors, also have potential as therapeutic or diagnostic agents. For example, receptor immunoadhesin can be used as a therapeutic agent to block receptor-ligand interactions. Membrane binding proteins can also be used to screen for potential peptide or small molecule inhibitors for related receptor / ligand interactions. Such membrane-binding proteins and cellular receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatase, receptors involved in cell-cell interactions, and cellular adhesin molecules such as selectins and integrins. The introduction of signals that regulate cell growth and differentiation is partly regulated by phosphorylation of several cellular proteins. Protein tyrosine kinases, enzymes that accelerate this process, can also act as growth factor receptors. Examples include fibroblast growth factor receptors and nerve growth factor receptors.

Cellular proteins with endoplasmic reticulum (ER) retention signals are of particular interest. These proteins are retained intracellularly and work closely with the endoplasmic reticulum during protein production. Such proteins have already been described in the literature (ie, see Horrosh and Dixon, Plant J., 2 (1): 51-58 (1992)).

Efforts to find novel natural secreted and membrane bound receptor proteins, particularly cellular proteins with ER-bearing signals, have been made by both industry and academia. Much effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel secretion and membrane bound receptor proteins. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637. The results of this effort are described herein, in particular for finding new polypeptides having sequence identity and similarity with protein disulfide isomerase and nucleic acid sequences encoding them.

75.PRO1014

Oxygen free radicals and antioxidants appear to play an important role in the central nervous system following cerebral ischemia and reperfusion. It has also been reported that heart damage associated with ischemia and reperfusion is caused by the action of oxygen free radicals. In addition, studies have reported that the redox state of cells is a major determinant of cell fate. In addition, reactive oxygen species are cytotoxic and cause inflammatory diseases including tissue necrosis, organ failure, atherosclerosis, infertility, birth defects, early maturation, mutations and malignant tumors. Thus, the regulation of oxidation and reduction is important for many reasons including the control and prevention of stroke, heart attack, oxidative stress and hypertension. In this regard, reductases, in particular oxidoreductases, are of interest. Publications which further describe such subject matter are described in Kelsey, et al., Br. J. Cancer, 76 (7): 852-4 (1997); Friedrich and Weiss, J. Theor. Biol., 187 (4): 529-40 (1997) and Pieulle, et al., J. Bacteriol., 179 (18): 5684-92 (1997).

In addition to reductases, in particular novel polypeptides are generally of interest. Extracellular proteins play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, eg, proliferation, migration, differentiation, or interaction with other cells, is typically dependent on information received from other cells and / or adjacent environments. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. These secretory polypeptides or signaling molecules generally reach their site of action in the extracellular environment via the secretory pathway of the cell.

Secretory proteins have a variety of industrial uses, including pharmaceuticals, diagnostics, biosensors, and bioreactors. Most protein drugs currently available such as thrombolytics, interferons, interleukins, erythropoietins, colony promoters and various other cytokines are secreted proteins. In addition, membrane proteins that are their receptors also have potential as therapeutic or diagnostic agents. Efforts to find new natural secreted proteins are being made by both industry and academia. Much effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637. The results of this effort are presented herein, in particular, for finding polypeptides having sequence identity with reductase and nucleic acids encoding them.

76.PRO1017

Enzyme proteins play an important role in chemical reactions involving food digestion, biosynthesis of macromolecules, controlled release and utilization of chemical energy, and other reactions needed to sustain life. Sulfurtransferases are enzymes that transfer sulphates from sulphate donors to receptor substrates, particularly those containing terminal glucuronic acid. HNK-1 carbohydrate epitopes are expressed in several neuroadhesive glycoproteins and glycolipids and are involved in cellular interactions. Since some of the epitope structures are often present in sugar binders, glucuronyltransferases and sulfotransferases are believed to be key enzymes in the biosynthesis of such epitopes. HNK-1 sulfotransferases are described in Bakker, H., et al., J. Biol. Chem., 272 (47): 29942-29946 (1997).

In addition to HNK-1 sulfotransferase and new proteins associated therewith, all new proteins are of interest. Extracellular and membrane-bound proteins play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, eg, proliferation, migration, differentiation, or interaction with other cells, is typically dependent on information received from other cells and / or adjacent environments. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. These secreting polypeptides or signaling molecules generally reach the site of their action in the extracellular environment, usually the membrane-bound receptor protein, via the secretory pathway of the cell.

Secretory proteins have a variety of industrial uses, including pharmaceuticals, diagnostics, biosensors, and bioreactors. Indeed, most protein drugs currently available such as thrombolytics, interferons, interleukins, erythropoietins, colony promoters and various other cytokines are secreted proteins. In addition, membrane receptor proteins, which are their receptors, also have potential as therapeutic or diagnostic agents. For example, receptor immunoadhesin can be used as a therapeutic agent to block receptor-ligand interactions. Membrane binding proteins can also be used to screen for potential peptide or small molecule inhibitors for related receptor / ligand interactions. Such membrane-binding proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatase, receptors involved in cell-cell interactions, and cellular adhesin molecules such as selectin and integrin. For example, the introduction of signals that regulate cell growth and differentiation is in part regulated by phosphorylation of several cellular proteins. Protein tyrosine kinases, enzymes that accelerate this process, can also act as growth factor receptors. Examples include fibroblast growth factor receptors and nerve growth factor receptors.

Efforts have been made by both industry and academia to find novel natural secretion and membrane-binding receptor proteins, particularly proteins having sequence identity with HNK-1 sulfotransferase. Much effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel secretion and membrane bound receptor proteins. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637. The results of this effort are presented herein.

77.PRO474

Enzyme proteins play an important role in chemical reactions involving food digestion, biosynthesis of macromolecules, controlled release and utilization of chemical energy, and other reactions needed to sustain life. Glucose dehydrogenase functions to oxidize glucose to gluconate to produce metabolically useful energy. The regulation of PQQ-linked glucose dehydrogenase in various organisms is described in Neijssel, et al., Antonie Van Leeuwenhoek, 56 (1): 51-61 (1989). Glucose dehydrogenase acts as a mechanism for generating auxiliary energy because it is maximally synthesized under conditions of energy stress. In addition to molecules associated with glucose dehydrogenase, all novel proteins are of interest. Extracellular proteins play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, eg, proliferation, migration, differentiation, or interaction with other cells, is typically dependent on information received from other cells and / or adjacent environments. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. These secreting polypeptides or signaling molecules generally reach the site of their action in the extracellular environment, usually the membrane-bound receptor protein, via the secretory pathway of the cell.

Secretory proteins have a variety of industrial uses, including pharmaceuticals, diagnostics, biosensors, and bioreactors. Indeed, most protein drugs currently available such as thrombolytics, interferons, interleukins, erythropoietins, colony promoters and various other cytokines are secreted proteins. In addition, membrane receptor proteins, which are their receptors, also have potential as therapeutic or diagnostic agents. For example, receptor immunoadhesin can be used as a therapeutic agent to block receptor-ligand interactions. Membrane binding proteins can also be used to screen for potential peptide or small molecule inhibitors for related receptor / ligand interactions. Such membrane-binding proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatase, receptors involved in cell-cell interactions, and cellular adhesin molecules such as selectin and integrin. For example, the introduction of signals that regulate cell growth and differentiation is in part regulated by phosphorylation of several cellular proteins. Protein tyrosine kinases, enzymes that accelerate this process, can also act as growth factor receptors. Examples include fibroblast growth factor receptors and nerve growth factor receptors.

Efforts have been made by both industry and academia to find novel natural secretory and membrane bound receptor proteins, particularly cellular proteins and proteins related to dehydrogenase or oxidoreductase. Much effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel secretion and membrane bound receptor proteins. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637. The results of this effort are presented herein.

78.PRO1031

Cytokine interleukin 17 (IL-17) has been reported to stimulate epithelial, endothelial and fibroblasts to secrete prostaglandin E2 as well as cytokines such as IL-6, IL-8, and granulocyte-colony-stimulating factors. In addition, when cultured in the presence of IL-17, fibroblasts maintain the proliferation of CD34 ⁺ to mature into neutrophils. Thus, IL-17 has been suggested to constitute an early initiator of T cell-dependent inflammatory responses, and / or elements of the cytokine network that connect the immune system to a hematopoietic response [Yao, et al., J. Immunol., 155 (12): 5483-5486 (1995); Fossiez, et al., J. Exp. Med., 183 (6): 2593-2603 (1996); Kennedy, et al., J. Interferon Cytokine Res., 16 (8): 611-617 (1996). Thus, proteins associated with IL-17 are of interest.

More generally, all new proteins are of interest. Extracellular proteins play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, eg, proliferation, migration, differentiation, or interaction with other cells, is typically dependent on information received from other cells and / or adjacent environments. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. These secretory polypeptides or signaling molecules generally reach their site of action in the extracellular environment via the secretory pathway of the cell.

Secretory proteins have a variety of industrial uses, including pharmaceuticals, diagnostics, biosensors, and bioreactors. Indeed, most protein drugs currently available such as thrombolytics, interferons, interleukins, erythropoietins, colony promoters and various other cytokines are secreted proteins. In addition, membrane proteins that are their receptors also have potential as therapeutic or diagnostic agents.

Efforts to find new natural secreted proteins, especially those related to IL-17, have been made by both industry and academia. Much effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637. The results of this effort are presented herein.

79.PRO938

Protein disulfide isomerase is an enzyme protein that is involved in promoting correct refolding of proteins through the formation of correct disulfide bonds. Protein disulfide isomerase was initially identified based on its ability to catalyze the regeneration of degraded denatured RNAse (Goldberger et al., J. Biol. Chem. 239: 1406-1410 (1964) and Epstein et al. ., Cold Sprring Harbor Symp.Quant. Biol. 28: 439-449 (1963). Protein disulfide isomerase is known to be an intravesicular enzyme retained in the endoplasmic reticulum via the -KDEL or -HDEL amino acid sequence at the C-terminus. Protein disulfide isomerase and related proteins are described in Laboissiere, et al., J. Biol. Chem., 270 (47: 28006-28009 (1995); Jeenes, et al., Gene, 193 (2): 151-156 (1997; Koivunen, et al., Genomics, 42 (3): 397-404 ( And Desilva, et al., DNA Cell Biol., 15 (1): 9-16 (1996), suggesting the importance of identifying protein disulfide-related proteins.

More generally, all new membrane binding proteins and receptors are of interest. This protein can play an important role in the formation, differentiation, and maintenance of multicellular organisms. The fate of many individual cells, for example, proliferation, migration, differentiation, or interaction with other cells, is typically associated with other cells and ( Or) information received from an adjacent environment. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. Such membrane-binding proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatase, receptors involved in cell-cell interactions, and cellular adhesin molecules such as selectin and integrin. For example, the introduction of signals that regulate cell growth and differentiation is in part regulated by phosphorylation of several cellular proteins. Protein tyrosine kinases, enzymes that accelerate this process, can also act as growth factor receptors. Examples include fibroblast growth factor receptors and nerve growth factor receptors.

Membrane binding proteins and receptor molecules have a variety of industrial uses, including pharmaceuticals and diagnostics. For example, receptor immunoadhesin can be used as a therapeutic agent to block receptor-ligand interactions. Membrane binding proteins can also be used to screen for potential peptide or small molecule inhibitors for related receptor / ligand interactions.

Because membrane binding proteins are important, efforts are being made to find new membrane binding proteins. In addition, in many other fields it is important to increase the exact refolding ratio of disulfide bond-forming enzymes and their potential uses, e.g., recombinantly produced proteins, so both industry and academia are currently involved in protein disulfide isoforms. Efforts are being made to find novel natural proteins having sequence identity with the merase. Much of this effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel protein disulfide isomerase homologs.

We herein describe the identification and characterization of novel polypeptides having homology with protein disulfide isomerase.

80.PRO1082

Low density lipoprotein (LDL) receptors are membrane-bound proteins that play a key role in cholesterol homeostasis and regulate the cellular uptake of lipoprotein particles by high affinity binding to their ligands, apolipoprotein (apo) B-100 and apoE. The ligand-binding domain of the LDL receptor comprises seven cysteine-rich repeats of about 40 amino acids, where each repeat contains six cysteines that form three inner-repeating disulfide bonds. This unique structural feature allows the LDL receptor to specifically interact with apo B-100 and apoE to transport these lipoprotein particles through the cell membrane and metabolize these components. Soluble fragments comprising the extracellular domain of the LDL receptor are known to possess the ability to interact with their specific lipoprotein ligands (Simmons et al., J. Biol. Chem. 272: 25531-25536 (1997)). LDL receptors are described in Javitt, FASEB J., 9 (13): 1378-1381 (1995) and Herz and Willnow, Ann. NY Acad. Sci., 737: 14-19 (1994). Thus, proteins having sequence identity with the LDL receptor are of interest.

More generally, all membrane binding proteins and receptors may play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, such as proliferation, migration, differentiation or interaction with other cells, is typically dictated by information received from other cells and / or adjacent environments. Often, this information is delivered by secretory polypeptides (eg, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. Such membrane-binding proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatase, receptors involved in cell-cell interactions, and cellular adhesin molecules such as selectin and integrin. For example, the introduction of signals that regulate cell growth and differentiation is in part regulated by phosphorylation of several cellular proteins. Protein tyrosine kinases, enzymes that accelerate this process, can also act as growth factor receptors. Examples include fibroblast growth factor receptors and nerve growth factor receptors. Membrane binding proteins with type II transmembrane domains are of particular interest.

Membrane binding proteins and receptor molecules have a variety of industrial uses, including pharmaceuticals and diagnostics. For example, receptor immunoadhesin can be used as a therapeutic agent to block receptor-ligand interactions. Membrane binding proteins can also be used to screen for potential peptide or small molecule inhibitors for related receptor / ligand interactions.

Both industry and academia are working to find new natural proteins, particularly membrane binding proteins, including type II transmembrane binding proteins. Much effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for new receptor proteins. The results of this effort are presented herein.

81.PRO1083

Membrane binding proteins belonging to the 7-membrane (7TM) receptor macrofamily are of particular interest. Examples of such receptors include receptors to which G-proteins are coupled, such as ion receptors. Other examples of 7TM receptor macrophage members are described in Osterhoff, et al., DNA Cell Biol., 16 (4): 379-389 (1997).

Membrane binding proteins and receptor molecules have a variety of industrial uses, including pharmaceuticals and diagnostics. For example, receptor immunoadhesin can be used as a therapeutic agent to block receptor-ligand interactions. Membrane binding proteins can also be used to screen for potential peptide or small molecule inhibitors for related receptor / ligand interactions.

Both industry and academia are working to find new natural receptor proteins. Much effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for new receptor proteins. The results of this effort are presented herein.

82.PRO200

Polypeptides involved in the survival, proliferation and / or differentiation of cells are of interest. Polypeptides known to be involved in cell survival, proliferation and / or differentiation include members of the VEGF and bone morphogenic protein families. Thus, novel polypeptides associated with VEGF or bone morphogenic proteins are of interest.

VEGF, a heparin-binding endothelial cell-growth factor, has been identified and purified several years ago from media conditioned by bovine pituitary vesicles or vesicle-astrocytic cells [Ferrara et al., Biophys. Res. Comm. 161, 851 (1989). VEGF is a naturally occurring compound produced in vesicles or vesicle-astrocytic cells (FC), a morphologically well-characterized population of granulocytes. FC is an astrocyte that carries a cytoplasmic response between secretory cells.

VEGF is expressed in various homodimeric forms (121, 165, 189 and 206 amino acids per monomer) resulting from selective RNA splicing in various tissues. VEGF ₁₂₁ is a soluble mitogen that does not bind to heparin, and the longer the VEGF form, the higher the affinity to heparin. Heparin-bound forms of VEGF can be cleaved at the carboxy terminus by plasmin to release the diffusible form of VEGF. The amino acid sequence of the carboxy terminal peptide identified after plasmin cleavage was analyzed to be Arg ₁₁₀ -Ala ₁₁₁ . VEGF (1-110), an amino-terminal "core" protein isolated as a homodimer, has neutralizing monoclonal antibodies (4.6.1 and 2E3) and soluble forms of FMS with similar affinity compared to the circular VEGF ₁₆₅ homodimer. Binds to similar tyrosine kinase (FLT-1), kinase domain region (KDR) and fetal liver kinase (FLK) receptors.

As mentioned, VEGF comprises two domains that each bind to KDR and FLT-1 receptors. These receptors are present only in endothelial (vascular) cells. Because oxygen is depleted in cells for reasons such as trauma, the production of VEGF in these cells increases, and VEGF binds to each receptor and signals the final biological effect. Later, this signal increases vascular permeability and the cells divide and increase, resulting in new vascular pathways, namely vasculogenesis and angiogenesis.

Thus, VEGF is useful in the treatment of vascular damage caused by trauma such as diabetic ulcers and subcutaneous injury, where it is important for the selective action of vascular endothelial cells under conditions where tissue does not grow excessively. . As a blood vessel (arterial and venous) endothelial growth factor, VEGF repairs damaged cells (this process is called vasculogenesis) and stimulates the formation of new blood vessels (this process is called angiogenesis). ).

VEGF can also be used to repair the vasculature after myocardial infarction, as well as other uses. In this regard, sometimes inhibitors of VEGF are desirable for slowing angiogenesis and angiogenesis, particularly in cancer cells.

For the bone morphogenic protein family, members of this family have been reported to be involved in the differentiation of cartilage and the promotion of angiogenesis and osteoinduction in preformed hydroxyapatite [Zou, et al., Genes Dev. (U.S.), 11 (17): 2191 (1997); Levine, et al., Ann. Plast. Surg., 39 (2): 158 (1997). Many related bone morphogenic proteins have been identified, all of which are members of the bone morphogenic protein (BMP) family. Bone morphogenic natural and variant proteins, nucleic acids encoding them, related compounds including receptors, host cells and their use are described in U.S. Pat. Patent Nos. 5,670,338; 5,454,419; 5,661,007; 5,637,480; 5,631,142; 5,166,058; 5,620,867; 5,543,394; 4,877,864; 5,013,649; 55,106,748; and 5,399,677, and the like. Of particular interest are bone morphogenic proteins 1, proteins that have homology with procollagen C-proteinases that play an important role in regulating substrate deposition.

The invention can be carried out in studies to find novel polypeptides associated with the VEGF and BMP families, in particular those that play a role in the survival, proliferation and / or differentiation of cells. While new polypeptides are not believed to have the same biological activity as known polypeptides homologous to them, the biological activity of known polypeptides can be used to determine the relative biological activity of the new polypeptide. In particular, the novel polypeptides described herein can be used in assays to determine the ability of a polypeptide to induce survival, proliferation or differentiation of a cell. In other words, the results of this analysis can be appropriately used for diagnostic and therapeutic purposes. The subject of the present invention is the result of this study.

83.PRO285 and PRO286

Cloning of the Drosophila Toll gene, a maternal effect gene that plays a central role in the establishment of dorsal-dorning patterns in embryos, is described in Hashimoto et al., Cell 52, 269-279 (1988). have. The Drosophila Toll gene encodes an entire membrane protein with an extracellular domain of 803 amino acids and a cytoplasmic domain of 269 amino acids. The extracellular domain has potential transmembrane fragments and contains several copy numbers of leucine-rich fragments, which are structural motifs present in many transmembrane proteins. Toll protein regulates dorsal-dorning patterning of Drosophila embryos and, in combination with its ligand, Spaetzle, activates the transcription factor Dorsal (Morisato and Anderson, Cell 76, 677-688 (1994)). In Drosophila adults, Toll / Dorsal signaling pathways are involved in anti-fungal immune responses (Lenaitre et al., Cell 86, 973-983 (1996)).

Human homologues of the Drosophila Toll protein are described in Medzhitov et al., Nature 388, 394-397 (1997). This human Toll is a type I transmembrane protein, similar to the Drosophila Toll, whose extracellular domain is a leucine-rich motif (leucine-rich) with 21 leucine repeats interspersed with non-LRR regions in between. Region-LRR), the extracellular domain is homologous to the cytoplasmic domain of the human interleukin-1 (IL-1) receptor. Constitutively active human Toll variants, transfected into human cell lines, result in natural T as well as activation of NF-κB and expression of regulated genes for the inflammatory cytokines IL-1, IL-6 and IL-8. It is known to be able to induce the expression of B7.1, a co-stimulatory molecule required for cell activation. Toll acts as a non-clonal receptor for the immune system in vertebrates, which has been shown to be able to induce signals that activate both intrinsic and adaptive immune responses in vertebrates. The human Toll gene, reported in Medzhitov et al., Supra, was most strongly expressed in leukocytes (PBLs) of the spleen and peripheral blood, and the authors found that the expression of this gene in other tissues was an early-warning system for infection. It is suggested that this may be due to the presence of macrophages and dendritic cells that can act. Public GenBank databases include Toll1 (DNAX # HSU88540-1, which is identical to randomly sequenced full-length cDNA # HUMRSC786-1); Toll2 (DNAX # HSU88878-1); Toll3 (DNAX # HSU88879-1); And Toll4 (DNAX # HSU88880-1) sequence which is identical to the DNA sequence reported in Medzhitov et al., Supra. Some Toll sequences (Toll5) are available from sequences deposited under Genbank Accession No. DNAX # HSU88881-1.

Another human homologue of the Drosophila Toll protein (named Toll-like receptor (huTLRs1-5)) has recently been cloned and has been found to mirror the topological structure of the Drosophila counterpart (Rock et al., Proc. Natl. Acad). Sci. USA 95, 588-593 [1998]. Overexpression of one constitutively active human TLR (Toll-protein homologue-Medzhitov et al., Supra; TLR4-Rock et al., Supra) variant results in activation of NF-κB, and a costimulatory molecule with inflammatory cytokines. Induces induction [Medzhitov et al., Supra].

84.PRO213-1, PRO1330, and PRO1449

Cancer increases the number of abnormal or tumor cells derived from normal tissue, proliferates to form tumor masses, infiltrates these tumor cells into adjacent tissues, and eventually expands to local lymph nodes and distant sites through the blood or lymphatic system. It is characterized by the generation of malignant cells (metastasis). In a cancerous state, cells proliferate under conditions in which normal cells do not grow. Cancer manifests itself in a wide variety of forms, characterized by varying degrees of invasiveness and aggressiveness.

Changes in gene expression are closely related to unregulated cell growth and de-differentiation, a common feature of all cancers. Some well-studied tumor genomes are known to reduce the expression of recessive genes, commonly referred to as tumor suppressor genes, which are generally associated with oncogenes that act to promote malignant cell growth and / or malignant growth. It also functions to prevent overexpression of some of the same dominant genes. Changes in each of these genes appear to play a role in conferring some traits that collectively represent a complete tumorous trait (Hunter, Cell 64, 1129 [1991]; Bishop, Cell 64, 235-248 [1991]).

A well known mechanism for overexpression of genes (eg, oncogenes) in cancer cells is gene amplification. Gene amplification is the process by which a particular gene is made up of multiple copies in the chromosome of an ancestral cell. This process involves the chromosomal region containing the gene being unintentionally replicated, followed by recombination of the cloned fragment into the chromosome (Alitalo et al., Adv. Cancer Res. 47, 235-281 [1986]). Gene overexpression is similar to gene amplification, i.e. gene overexpression is thought to be proportional to the number of copies produced.

Proto-oncogenes encoding growth factors and growth factor receptors have been found to play an important role in the development of various malignancies in humans, including breast cancer. For example, the human ErbB2 gene (erbB2, also known as her2 or c-erbB-2), encoding an 185-kD transmembrane glycoprotein receptor (p185HER2; HER2) associated with epidermal growth factor receptor (EGFR) is human Overexpression in about 25% to 30% of breast cancers (Slamon et al., Science 235: 177-182 [1987]; Slamon et al., Science 244: 707-712 [1989]).

Gene amplification of proto-oncogenes is usually associated with a more malignant form of cancer and has been reported to have a pre-cancer effect (Schwab et al., Genes Chromosomes Cancer 1, 181-193 [1990]). Alitalo et al., Supra). Thus, overexpression of erbB2 is generally thought to indicate a poor prognosis in advance, particularly in patients with primary disease affecting axillary lymph nodes (Slamon et al., [1987] and [1989], supra; Ravdin and Chamness, Gene 159: 19-27 [1995]; and Hynes and Stern, Biochem Biophys Acta 1198: 165-184 [1994]), hormone therapy and chemistry including CMF (cyclophosphamide, methotrexate and fluorouracil) and anthracycline Related to sensitivity and / or resistance to therapy (Baselga et al., Oncology 11 (3 Suppl 1): 43-48 [1997]). However, despite the association between overexpression of erbB2 and poor prognosis, the difference between HER2-positive and HER2-negative patients clinically responding to treatment with taxane was greater than three times (Ibid). . Recombinant humanized anti-ErbB2 (anti-HER2) monoclonal antibody (humanized form of murine anti-ErbB2 antibody 4D5 called rhuMAb HER2 or Herceptin 7σ) was previously applied to ErbB2-overexpressing metastatic breast cancer It was clinically active in affected patients (Baselga et al., J. Clin. Oncol. 14: 737-744 [1996]).

Protein Notch and its homologues are key regulatory receptors that determine cell fate in various developmental processes. The protein Notch-4, also known as the int-3 oncogene, was initially identified as a common target in mouse breast tumor virus (MMVS). Notch-4 is thought to be a transgene that affects the differentiation capacity of stem cells and induces tumor proliferation in epithelial cells [Shirayoshi et al., Genes Cells 2 (3): 213- 224 (1997). During embryogenesis, expression of Notch-4 may be expressed in endothelial cells of the vessels forming tissues such as the aorta of the dorsal vessels, blood vessels between the fragments, yolk sac vessels, head vessels, the heart, blood vessels in the branched arch, and capillaries. Was detected in. Notch-4 expression in these tissues was also associated with flk-1, a major regulatory gene for angiogenesis and angiogenesis. Notch-4 is also upregulated in vitro during differentiation of endothelial rod cells. The endothelial cell specific expression pattern of Notch-4 and the structural similarity of Notch-4 and Notch suggest that Notch-4 is a Notch endothelial cell specific homolog and may function in angiogenesis and angiogenesis.

85.PRO298

Both industry and academia are working to find new natural receptor proteins. Much effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for new receptor proteins. We herein describe the identification and characterization of novel transmembrane polypeptides, designated herein as PRO298 polypeptides.

86.PRO337

In higher vertebrates, the development of nerves is characterized by the process of successfully maneuvering unique cellular environments to their synaptic targets. As a result, functionally accurate neural circuits are formed. This precision is thought to stem from mechanisms that regulate the purification and remodeling of these protrusions by reactions that require neuronal activity after pathogenesis of the growth cone and recognition of targets [Goodman and Shatz, Cell / Neuron [Suppl] ] 72 (10): 77-98 (1993). In addition, it is clear that other neurons extend biochemically different nerve fibers and reach their appropriate synaptic targets depending on specific guidance signals provided by cell-cell, cell-substrate and chemotrophic interactions. Goodman et al., Supra.

One particular way to generate neuronal cell surface diversity is by specific expression of cell surface proteins called cell adhesion molecules (CAMs). CAM, expressed in neurons, is a selective fibrolytic contraction of exons in many developmental processes and radiation pathways, including the migration of neurons along the radial glial cells (providing an acceptable or unacceptable substrate for the extension of neurites). fasciculation) [Jessel, Neuron 1: 3-13 (1988); Edelman and Crossin, Annu. Rev. Biochem. 60: 155-190 (1991). The interaction between the CAM present in the growth cone and the molecules on the opposite cell membrane or in the extracellular epilepsy is thought to provide specific guidance signals that direct the growth of nerve fibers along the appropriate protruding pathway. This interaction can activate several secondary messenger systems in growth cones that regulate the growth of neurites [Doherty and Walsh, Curr. Opin Neurobiol. 2: 595-601 (1992).

In higher vertebrates, most neural CAMs have been found to be members of three major structural protein families: the integrin, cardherin and immunoglobulin gene giants (IgSF) [Jessel, supra .; Takeichi, Annu. Rev. Biochem. 59: 237-252 (1990); Reichardt and Tomaselli, Annu. Rev. Neurosci. 14: 531-570 (1991). Cell-adherent molecules of IgSF (or Ig-CAM) are, in particular, components of protein giants that are frequently involved in neuronal interactions and nerve fiber growth during development [Salzer and Colman, Dev. Neurosci. 11: 377-390 (1989); Bruemmendorf and Rathjen, J. Neurochem. 61: 1207-1219 (1993). However, most of mammalian Ig-CAMs are so widely expressed that they do not specify regulatory pathways or synaptic targets, indicating that other previously identified CAMs play a role in the more selective neuronal interactions above. Suggests.

Many of the known neuronal Ig-CAMs have been found to attach to the plasma membrane via glycosylphosphatidylinositol (GPI) anchors. In addition, much research has been conducted on GPI-anchored proteins that provide specific guidance signals to neurons during growth. In studies on the nervous system of grasshoppers, embryos were treated with phosphatidylinositol-specific phospholipase C (PIPLC), which selectively removes GPI-anchored proteins from the cell surface, indicating misalignment in a subgroup of growth cones. In addition to misdirection and faulty navigation, movement patterns of early neuronal subgroups were suppressed [Chang et al., Devel. 114: 507-519 (1992). The protrusion of the retinal fibers into the eye covering appears to depend in part on the 33 kDa GPI-anchored protein, but the exact nature of this protein is unknown [Stahl et al., Neuron 5: 735-743 (1990). )].

Several GPI-anchored proteins are expressed in several groups consisting of primary rat neurons, sympathetic neurons in the cervical ganglia, sympathetic neurons in the cervical ganglia, and granular neurons in the cerebellum. Rosen et al., J. Cell Biol. 117: 617-627 (1992). In contrast to similar patterns of total membrane protein expression by these different types of neurons, a marked difference was observed in the expression of GPI-anchored proteins between these neurons. Recently, a 65 kDa protein band, known as neurotrimin, has been discovered and found to be differentially expressed by major neurons (Rosen et al., Supra), localized to the nervous system, and most, most, in the central nervous system. It was found to be the first expressed GPI-anchored species (Struyk et al., J. Neuroscience 15 (3): 2141-2156 (1995)). The discovery of neurotrimin also identified a family of IgSF members comprising three Ig-like domains (now called IgLONs) that share significant amino acid identity [Struyk et al., Supra; Pimenta et al., Gene 170 (2): 189-95 (1996)].

Other members of the IgLON subfamily include anesthetic binding cell adhesion molecules (OBCAM) (Schofield et al., EMBO J. 8: 489-495 (1989)); Limbic membrane protein (LAMP) [Pimenta et al., Supra; CEPU-1; GP55, Wilson et al., J. Cell Sci. 109: 3129-3138 (1996); Eur. J. Neurosci. 9 (2): 334-41 (1997); And AvGp50 by Hancox et al., Brain Res. Mol. Brain Res. 44 (2): 273-85 (1997).

Although the expression of neurotrimine appears to be widespread, neurotrimine appears to be involved in the development of several neural circuits. For example, between E18 and P10, expression of neurotrimin mRNA in the forebrain may occur in the developing thalamus, cortical subplate, and cortex, particularly lamina V and VI (II, II and IV). Less strongly expressed, and minimally expressed in lamina I) and maintained at high levels in neurons. Neuronal cells in the cortical lower extremities can provide an initial transient framework for endogenous sagittal afferent nerves as their final synaptic target in the cortex [Allendoerfer and Shatz, Annu. Rev. Neurosci. 17: 185-218 (1994). In contrast, the lower-level neurons were suggested to select VI where the cortical neurons in layer V were thalamus, and that the neurons in layer V were required to select their targets in the colliculus, pons, and spinal cord. (McConnell et al., J. Neurosci. 14: 1892-1907 (1994). The high expression of neurotrimin in many of these overhangs suggests that neurotrimine may be involved in the development of these overhangs.

In the dorsal brain, neurotrimine messages were observed to be expressed at high levels in the nucleus of pons and near the internal granulocytes and Purkinje cells of the cerebellum. The nucleus of the pons accepts the influx of afferent nerves from a variety of sources, including cortical glial fibers in layer V, and is a major source of afferent nerve influx into granule cells through mossy fibers, that is, through parallel fibers. It is a major source of afferent nerve influx into Purkinje cells [Palay and Chan-Palay, The cerebellar cortex: cytology and organization. New York: Springer (1974) The high expression of neurotrimin in these neurons suggests that it is likewise likely to be involved in the establishment of this circuit.

Neurotrimin also exhibits differential expression patterns in early striatum striatum. An increase in neurotrimin expression was observed in the part covering the dorsal lateral striatum of the rat, but less hybridization intensity was observed in the portion covering the ventral striatum (Struyk et al., Supra). Regions with higher neurotrimine hybridization intensity correspond to major sites of afferent nerve entry in layer VI of the opposing sensorimotor cortex, rather than regions that may differ in cell formation (Gerfen, Nature 311: 461-). 464 (1984); Donoghue and Herkenham, Brain Res. 365: 397-403 (1986)). The intraperitoneal striatum, in contrast, receives most of the afferent nerve influx from the non-peripheral connective cortex. It is noteworthy that complementary levels of LAMP expression patterns are observed in striatum, highest in the ventral region and lowest in the dorsal side [Levitt, Science 223: 299-301 (1985); Chesselet et al., Neuroscience 40: 725-733 (1991).

87.PRO403

The N-terminal portion of the Type II transmembrane protein, also known as a single transmembrane and transmembrane protein, is in the cytoplasm, while the C-terminal portion is exposed to the extracellular domain.

Endothelin is a family of vasoconstrictive peptides, and many studies have shown the presence and structure of isopeptides and their genes (endothelin-1, -2 and u3), and gene expression, intracellular processing, specific endothelin converting enzymes (ECE) It has focused on better understanding its basic pharmacological, biochemical and molecular biological features, including receptor subtypes (ET-A and ET-B), and the regulation of intracellular signaling following receptor activation.

Endothelin (ET) peptide families have potent vascular, cardiac and renal action that may be pathophysiologically important in many disease symptoms in humans. ET-1 is expressed as a prepropeptide consisting of an inactive 212 amino acids. This prepropeptide is first truncated at Arg52-Cys53 and Arg92-Ala93, and then the carboxy terminal Lys91 and Arg92 are removed from the protein resulting in large propeptide ET-1.

Endothelin is produced from large endothelin, an inactive intermediate, by a unique processing action catalyzed by the endothelin converting enzyme (ECE), a zinc metalloprotease. ECE has recently been cloned and its structure has been found to be a single transmembrane protein with short intracellular N-terminus and long extracellular C-terminus comprising a catalytic domain and many N-glycosylation sites. ECE cleaves the endothelin propeptide between Trp73 and Val74 to produce the active peptide, ET, which appears to act locally rather than as a circulating hormone (Rubanyi, GM & Polokoff, MA, Pharmachological Reviews 46: 325-415 (1994) Thus, the activity of ECE can be a site for modulating endothelin production and a target for therapeutic intervention in the endothelin system: by shielding the activity of ECE, it is a relatively inert precursor The production of ET-1 can be stopped by inhibiting the conversion of ET-1 into a physiologically active form.

Endothelin includes 1) cardiovascular diseases (vascular spasms, hypertension, myocardial ischemia; reperfusion injury and acute myocardial infarction, stroke (cerebroischemia), congestive heart failure, shock, atherosclerosis, vascular thickening); 2) kidney disease (acute and chronic renal failure, glomerulonephritis, cirrhosis); 3) pulmonary disease (bronchial asthma, pulmonary hypertension); 4) gastrointestinal diseases (gastric ulcers, inflammatory bowel disease); 5) may play a role in the pathophysiology of many disease symptoms, including reproductive disorders (premature birth, menstrual irregularities, preeclampsia) and 6) carcinogenesis.

<Overview of invention>

1.PRO213

We have found cDNA clones encoding novel polypeptides (named "PRO213" herein).

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO213 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding the PRO213 polypeptide having amino acid residues 1 to 295 of Figure 2 (SEQ ID NO: 295), and is at least moderate, optionally It remains stable in combination with it under stringent conditions.

In another embodiment, the present invention provides an isolated PRO213 polypeptide. In particular, the present invention provides an isolated native sequence PRO213 polypeptide comprising, in one embodiment, an amino acid sequence comprising residues 1 to 295 of FIG. 2 (SEQ ID NO: 2).

2.PRO274

We have found cDNA clones encoding novel polypeptides (named "PRO274" herein).

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO274 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO274 polypeptide having amino acid residues 1-492 of Figure 4 (SEQ ID NO: 7) or is complementary to such a coding nucleic acid sequence, and at least moderate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA39987-1184 vector (deposited under ATCC Accession No. 209786 on April 21, 1998) comprising a nucleotide sequence encoding PRO274.

In another embodiment, the present invention provides an isolated PRO274 polypeptide. In particular, the present invention provides, in one embodiment, an isolated native sequence PRO274 polypeptide comprising an amino acid sequence comprising residues 1-492 of FIG. 4 (SEQ ID NO: 7). Another embodiment of the invention relates to an isolated extracellular domain of a PRO274 polypeptide. If desired, PRO274 polypeptide can be obtained by expressing a polypeptide that is purchased or encoded by the cDNA insert of the DNA39987-1184 vector deposited under ATCC Accession No. 209786, April 21, 1998.

In another embodiment, the present invention provides the nucleotides of SEQ ID NO: 8 (named herein DNA17873), SEQ ID NO: 9 (named herein DNA36157) and SEQ ID NO: 10 (named herein DNA28929) (see FIGS. 5-7, respectively). Three expressed sequence tags (EST) are provided comprising the sequence.

3.PRO300

We have found a cDNA clone that encodes a novel polypeptide (designated herein as "PRO300").

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO300 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding a PRO300 polypeptide having amino acid residues 1-457 of Figure 9 (SEQ ID NO: 19), and is at least moderately conditioned, optionally with high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA40625-1189 vector (deposited under ATCC Accession No. 209788 on April 21, 1998), comprising the nucleotide sequence encoding PRO300.

In another embodiment, the present invention provides an isolated PRO300 polypeptide. In particular, the present invention provides an isolated native sequence PRO300 polypeptide comprising an amino acid sequence comprising residues 1 to 457 of FIG. 9 (SEQ ID NO: 19) in one embodiment. Another embodiment of the invention relates to an isolated extracellular domain of a PRO300 polypeptide. If desired, the PRO300 polypeptide may be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA40625-1189 vector deposited under ATCC Accession No. 209788 on April 21, 1998.

4.PRO284

We have found cDNA clones encoding novel transmembrane polypeptides (named "PRO284" herein).

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO284 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO284 polypeptide having amino acid residues 1 to 285 of Figure 11 (SEQ ID NO: 28) or is complementary to this coding nucleic acid sequence, and at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises a DNA encoding a PRO284 polypeptide having amino acid residues about 25 to 285 of FIG. 11 (SEQ ID NO: 28), or amino acid residues 1 or about 25 to X of FIG. 11 (SEQ ID NO: 28), or Complementary with such coding nucleic acid sequences, where X is any amino acid from amino acids 71 to 80 of FIG. 11 (SEQ ID NO: 28), and remains stablely associated therewith under at least moderate conditions, optionally high stringency conditions. . The isolated nucleic acid sequence may comprise a cDNA insert of a DNA23318-1211 vector (deposited under ATCC Accession No. 209787 on April 21, 1998) comprising a nucleotide sequence encoding PRO284.

In another embodiment, the present invention provides an isolated PRO284 polypeptide. In particular, the present invention provides an isolated native sequence PRO284 polypeptide comprising, in one embodiment, an amino acid sequence comprising residues 1 to 285 of FIG. 11 (SEQ ID NO: 28). Another embodiment of the invention provides an isolated PRO284 polypeptide comprising about 25 to 285 amino acids of Figure 11 (SEQ ID NO: 28), or amino acids 1 or about 25 to X of Figure 11 (SEQ ID NO: 28), wherein X is Figure 11 ( Any amino acid from amino acid residues 71 to 80 of SEQ ID NO: 28). If desired, the PRO284 polypeptide may be obtained by expressing a polypeptide that is purchased or encoded by the cDNA insert of the DNA23318-1211 vector deposited under ATCC Accession No. 209787 on April 21, 1998.

In another embodiment, the present invention provides an expressed sequence tag (EST) comprising the nucleotide sequence of SEQ ID NO: 29 (denoted herein as DNA12982).

In another embodiment, the present invention provides an expressed sequence tag (EST) comprising the nucleotide sequence of SEQ ID NO: 30 (designated herein as DNA15886).

5.PRO296

We have found cDNA clones encoding novel polypeptides (designated herein as “PRO296”) that are homologous to the sarcoma-amplified protein SAS.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO296 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding a PRO296 polypeptide having amino acid residues 1 to 204 of FIG. 15 (SEQ ID NO: 36), and is at least moderately conditioned, optionally with high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO296 polypeptide comprising about 35 to 204 amino acid residues of FIG. 15 (SEQ ID NO: 36), or amino acids 1 or about 35 to X of FIG. 15 (SEQ ID NO: 36) ( Wherein X is complementary to FIG. 15 (SEQ ID NO: 36) from amino acids 42-51) or such coding nucleic acid sequence, and remains stablely associated therewith under at least moderate conditions, optionally high stringency conditions. . The isolated nucleic acid sequence may comprise a cDNA insert of a DNA39979-1213 vector (deposited under ATCC Accession No. 209789 on April 21, 1998) comprising a nucleotide sequence encoding PRO296.

In another embodiment, the present invention provides an isolated PRO296 polypeptide. In particular, the present invention provides, in one embodiment, an isolated native sequence PRO296 polypeptide comprising an amino acid sequence comprising residues 1-204 of FIG. 15 (SEQ ID NO: 36). Another embodiment of the invention provides a PRO296 polypeptide comprising about 35 to 204 amino acids of Figure 15 (SEQ ID NO: 36), or amino acids 1 or about 35 to X of Figure 15 (SEQ ID NO: 36), wherein X is Figure 15 (SEQ ID NO: 36 ), Any amino acid from amino acids 42 to 51). If desired, the PRO296 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA39979-1213 vector deposited under ATCC Accession No. 209789 on April 21, 1998.

In another embodiment, the present invention provides an expressed sequence tag (EST) comprising the nucleotide sequence of SEQ ID NO: 37 (named herein DNA23020).

In another embodiment, the present invention provides an expressed sequence tag (EST) comprising the nucleotide sequence of SEQ ID NO: 38 (named herein DNA21971).

In another embodiment, the present invention provides an expressed sequence tag (EST) comprising the nucleotide sequence of SEQ ID NO: 39 (denoted herein as DNA29037).

6.PRO329

We have found a cDNA clone that encodes a novel polypeptide (named "PRO329" herein) having homology with the high affinity immunoglobulin F _c receptor.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO329 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO329 polypeptide having amino acid residues 1 to 359 of Figure 20 (SEQ ID NO: 45) or is complementary to such coding nucleic acid sequence, and at least in moderate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA40594-1233 vector (deposited under ATCC Accession No. 209617 on February 5, 1998) comprising a nucleotide sequence encoding PRO329.

In another embodiment, the present invention provides an isolated PRO329 polypeptide. In particular, the present invention provides an isolated native sequence PRO329 polypeptide comprising an amino acid sequence comprising residues 1 to 359 of FIG. 20 (SEQ ID NO: 45) in one embodiment. If desired, the PRO329 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA40594-1233 vector deposited with ATCC Accession No. 209617, February 5, 1998.

7.PRO362

We have found cDNA clones encoding novel polypeptides (designated herein as “PRO362”) that have homology with the A33 antigen and HCAR membrane binding protein.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO362 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding a PRO362 polypeptide having amino acid residues 1-321 of Figure 22 (SEQ ID NO: 52), and is at least moderately conditioned, optionally with high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO362 polypeptide comprising amino acid residues 1 to X of FIG. 22 (SEQ ID NO: 52), wherein X is any amino acid from amino acids 271 to 280, or such coding Complementary with the nucleic acid sequence, it remains stablely associated with it under at least moderate conditions, optionally under high stringency conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA45416-1251 vector (deposited under ATCC Accession No. 209620 on February 5, 1998) comprising a nucleotide sequence encoding PRO362.

In another embodiment, the present invention provides an isolated PRO362 polypeptide. In particular, the present invention provides an isolated native sequence PRO362 polypeptide comprising, in one embodiment, an amino acid sequence comprising residues 1-321 of FIG. 22 (SEQ ID NO: 52). Another embodiment of the invention relates to an isolated extracellular domain of a PRO362 polypeptide comprising amino acids 1 to X of the amino acid sequence shown in FIG. 22 (SEQ ID NO: 52), wherein X is any amino acid from amino acids 271 to 280. If desired, PRO362 polypeptide may be obtained by expressing a polypeptide that is purchased or encoded by the cDNA insert of the DNA45416-1251 vector deposited with ATCC Accession No. 209620, February 5, 1998.

8.PRO363

We have found cDNA clones encoding novel polypeptides (designated herein as "PRO363") that have homology with the receptor protein HCAR on the cell surface.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO363 polypeptide. In one aspect, the isolated nucleic acid comprises or encodes complementary DNA encoding a PRO363 polypeptide having amino acid residues 1 to 373 of Figure 24 (SEQ ID NO: 59), and is at least in moderate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO363 extracellular domain polypeptide having amino acid residues 1-X of FIG. 24 (SEQ ID NO: 59), wherein X is any amino acid from amino acids 216-225, or Complementary with these coding nucleic acid sequences, they remain stable and bound to them under at least moderate conditions, optionally under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA45419-1252 vector (deposited under ATCC Accession No. 209616 on February 5, 1998), comprising the nucleotide sequence encoding PRO363.

In another embodiment, the present invention provides an isolated PRO363 polypeptide. In particular, the present invention provides an isolated native sequence PRO363 polypeptide comprising, in one embodiment, an amino acid sequence comprising residues 1 to 373 of FIG. 24 (SEQ ID NO: 59). Another embodiment of the invention is directed to an isolated extracellular domain of a PRO363 polypeptide, wherein the extracellular domain may comprise amino acids 1 to X of the sequence shown in FIG. 24 (SEQ ID NO: 59), wherein X is amino acid 216 to Any amino acid from 225. If desired, the PRO363 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA45419-1252 vector deposited with ATCC Accession No. 209616, February 5, 1998.

9.PRO868

We have found a cDNA clone that encodes a novel polypeptide (named "PRO868" herein) that is homologous to tumor necrosis factor receptors.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO868 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding a PRO868 polypeptide having amino acid residues 1 to 655 of Figure 26 (SEQ ID NO: 64), and is at least moderately conditional, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO868 polypeptide having amino acid residues 1-X of FIG. 26 (SEQ ID NO: 64), wherein X is amino acids 343-352 of the sequence shown in FIG. 26 (SEQ ID NO: 64). Complementary to such a coding nucleic acid sequence, and remain stablely bound thereto at least under moderate conditions, optionally under high stringency conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO868 polypeptide having amino acid residues X to 655 of Figure 26 (SEQ ID NO: 64), wherein X is amino acid 371 to SEQ ID NO: 3 of the sequence shown in Figure 26 (SEQ ID NO: 64). Any amino acid from 380) or complementary to such a coding nucleic acid sequence, and stably bound to it under at least moderate conditions, optionally under high stringency conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA52594-1270 vector (deposited under ATCC Accession No. 209676 on March 17, 1998) comprising a nucleotide sequence encoding PRO868.

In another embodiment, the present invention provides an isolated PRO868 polypeptide. In particular, the present invention provides an isolated native sequence PRO868 polypeptide comprising an amino acid sequence comprising residues 1 to 655 of Figure 26 (SEQ ID NO: 64) in one embodiment. In another aspect, the isolated PRO868 polypeptide comprises amino acid residues 1-X of FIG. 26 (SEQ ID NO: 64), wherein X is any amino acid from amino acids 343-352 of the sequence shown in FIG. 26 (SEQ ID NO: 64). In another aspect, the PRO868 polypeptide comprises amino acid residues X-655 of FIG. 26 (SEQ ID NO: 64), wherein X is any amino acid from amino acids 371-380 of the sequence shown in FIG. 26 (SEQ ID NO: 64). If desired, the PRO868 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA52594-1270 vector deposited with ATCC Accession No. 209679, March 17, 1998.

10.PRO382

We have found cDNA clones encoding novel polypeptides (designated herein as "PRO382") that are homologous to serine proteases.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO382 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding a PRO382 polypeptide having amino acid residues 1-453 of Figure 28 (SEQ ID NO: 69), and is at least moderate, optionally It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA45234-1277 vector (deposited under ATCC Accession No. 209654 on March 5, 1998), comprising the nucleotide sequence encoding PRO382.

In another embodiment, the present invention provides an isolated PRO382 polypeptide. In particular, the present invention provides an isolated native sequence PRO382 polypeptide comprising, in one embodiment, an amino acid sequence comprising residues 1-453 of FIG. 28 (SEQ ID NO: 69). Another embodiment of the invention relates to an isolated extracellular domain of a PRO380 polypeptide with or without a signal peptide. If desired, the PRO382 polypeptide can be obtained by expressing the polypeptide purchased by the cDNA insert of the DNA45234-1277 vector purchased or deposited March 5, 1998, ATCC Accession No. 209654.

11.PRO545

We have found cDNA clones encoding novel polypeptides (named "PRO545" herein) that have homology with Meltrin.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO545 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding the PRO545 polypeptide having amino acid residues 1 to 735 of Figure 30 (SEQ ID NO: 74), and is at least moderate, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited under ATCC Accession No. 209655 on March 5, 1998) comprising a nucleotide sequence encoding PRO545.

In another embodiment, the present invention provides an isolated PRO545 polypeptide. In particular, the present invention provides an isolated native sequence PRO545 polypeptide comprising an amino acid sequence comprising residues 1 to 735 of FIG. 30 (SEQ ID NO: 74) in one embodiment. Another embodiment of the invention relates to an isolated extracellular domain of a PRO545 polypeptide. If desired, PRO545 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the vector deposited on March 5, 1998, ATCC Accession No. 209655.

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA13217, comprising the nucleotide sequence of SEQ ID NO: 75 (FIG. 31).

12.PRO617

We have found cDNA clones encoding novel polypeptides (named "PRO617" herein) having homology with CD24.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO617 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding a PRO617 polypeptide having amino acid residues 1 to 67 of FIG. 33 (SEQ ID NO: 85), and is at least moderately conditioned, optionally with high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA48309-1280 vector (deposited under ATCC Accession No. 209656 on March 5, 1998) comprising a nucleotide sequence encoding PRO617.

In another embodiment, the present invention provides an isolated PRO617 polypeptide. In particular, the present invention provides an isolated native sequence PRO617 polypeptide comprising, in one embodiment, an amino acid sequence comprising residues 1 to 67 of FIG. 33 (SEQ ID NO: 85). If desired, the PRO617 polypeptide can be obtained by expressing the polypeptide purchased by the cDNA insert of the DNA48309-1280 vector purchased or deposited March 5, 1998, ATCC Accession No. 209656.

13.PRO700

We have found cDNA clones encoding novel polypeptides (named herein "PRO700") having sequence similarity to protein disulfide isomerase.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO700 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding a PRO700 polypeptide having amino acid residues 1 to 432 of Figure 35 (SEQ ID NO: 90), and is at least moderately conditioned, optionally with high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO700 polypeptide having amino acid residues about 34 to 432 of FIG. 35 (SEQ ID NO: 90) or is complementary to such a coding nucleic acid sequence, at least in moderate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited under ATCC Accession No. 209721 on March 31, 1998) comprising a nucleotide sequence encoding PRO700.

In another embodiment, the present invention provides an isolated PRO700 polypeptide. In particular, the present invention provides an isolated native sequence PRO700 polypeptide comprising, in one embodiment, an amino acid sequence comprising residues 1 to 432 of FIG. 35 (SEQ ID NO: 90). In another embodiment, the invention provides an isolated PRO700 polypeptide comprising an amino acid sequence comprising residues about 34 to 432 of FIG. 35 (SEQ ID NO: 90) and lacking a signal sequence. If desired, the PRO700 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the vector deposited on March 31, 1998, ATCC Accession No. 209721.

14.PRO702

We have found a cDNA clone encoding a novel polypeptide (named herein "PRO702") that has homology with conglutinin.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO702 polypeptide. In one aspect, this isolated nucleic acid comprises DNA encoding the PRO702 polypeptide having amino acid residues 1 to 277 of FIG. 37 (SEQ ID NO: 97) or is complementary to such a coding nucleic acid sequence, and at least moderate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises or is complementary to DNA encoding the PRO702 polypeptide having amino acid residues 26 to 277 of FIG. 37 (SEQ ID NO: 97), at least moderate conditions, optionally high stringency. Under these conditions, it remains stablely bonded thereto. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA50980-1286 vector (deposited under ATCC Accession No. 209717 on March 31, 1998) comprising a nucleotide sequence encoding PRO702.

In another embodiment, the present invention provides an isolated PRO702 polypeptide. In particular, the present invention provides an isolated native sequence PRO702 polypeptide comprising an amino acid sequence comprising residues 1-22 of FIG. 37 (SEQ ID NO: 97) in one embodiment. Another embodiment of the invention relates to an isolated PRO702 polypeptide comprising about 26 to 277 amino acid residues in FIG. 37 (SEQ ID NO: 97). If desired, the PRO702 polypeptide may be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA50980-1286 vector deposited under ATCC Accession No. 209717 on March 31, 1998.

15.PRO703

We have found cDNA clones encoding novel polypeptides (named "PRO703" herein) having sequence similarity with VLCAS.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO703 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding a PRO703 polypeptide having amino acid residues 1 to 730 of FIG. 39 (SEQ ID NO: 102), and is at least moderately conditioned, optionally with high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO703 polypeptide having amino acid residues from about 43 to 730 of FIG. 39 (SEQ ID NO: 102) or is complementary to such a coding nucleic acid sequence, at least in moderate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA50913-1287 vector (deposited under ATCC Accession No. 209716, March 31, 1998), comprising the nucleotide sequence encoding PRO703.

In another embodiment, the present invention provides an isolated PRO703 polypeptide. In particular, the present invention provides an isolated native sequence PRO703 polypeptide comprising an amino acid sequence comprising residues 1 to 730 of FIG. 39 (SEQ ID NO: 102) in one embodiment. In another embodiment, the invention relates to an isolated PRO703 polypeptide comprising an amino acid sequence comprising residues about 43 to 730 of FIG. 39 (SEQ ID NO: 102) and lacking a signal sequence. If desired, the PRO730 polypeptide may be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA50913-1287 vector deposited under ATCC Accession No. 209716 on March 31, 1998.

16.PRO705

We have found cDNA clones encoding novel polypeptides (named "PRO705" herein) that have homology with K-glypican.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO705 polypeptide. In one aspect, this isolated nucleic acid comprises or encodes a DNA encoding a PRO705 polypeptide having amino acid residues 1-555 of Figure 41 (SEQ ID NO: 109) and is complementary to at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO705 polypeptide having amino acid residues about 24 to 555 of FIG. 41 (SEQ ID NO: 109), or is complementary to, and at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA50914-1289 vector (deposited under ATCC Accession No. 209722 on March 31, 1998) comprising a nucleotide sequence encoding PRO705.

In another embodiment, the present invention provides an isolated PRO705 polypeptide. In particular, the present invention provides an isolated native sequence PRO705 polypeptide comprising an amino acid sequence comprising residues 1 to 555 of FIG. 41 (SEQ ID NO: 109) in one embodiment. Another embodiment of the invention relates to an isolated PRO705 polypeptide comprising about 24 to 555 amino acid residues of FIG. 41 (SEQ ID NO: 109). If desired, the PRO705 polypeptide may be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA50914-1289 vector deposited under ATCC Accession No. 209722 on March 31, 1998.

17.PRO708

We have found cDNA clones encoding novel polypeptides (named "PRO708" herein) having homology with aryl sulfatase.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO708 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding the PRO708 polypeptide having amino acid residues 1 to 515 of Figure 43 (SEQ ID NO: 114), and is at least moderate, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA48296-1292 vector (deposited under ATCC Accession No. 209668 on March 11, 1998) comprising a nucleotide sequence encoding PRO708.

In another embodiment, the present invention provides an isolated PRO708 polypeptide. In particular, the present invention provides an isolated native sequence PRO708 polypeptide comprising an amino acid sequence comprising residues 1 to 515 of FIG. 43 (SEQ ID NO: 114) in one embodiment. Another embodiment is directed to a PRO708 polypeptide comprising residues 38-515 of the amino acid sequence shown in FIG. 43 (SEQ ID NO: 114). If desired, the PRO708 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA48296-1292 vector, deposited on March 11, 1998, ATCC Accession No. 209668.

18.PRO320

We have found a cDNA clone encoding a novel polypeptide (named herein "PRO320") that has homology with fibulin.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO320 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO320 polypeptide having amino acid residues 1-338 of Figure 45 (SEQ ID NO: 119) or is complementary to this coding nucleic acid sequence, and at least in moderate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited under ATCC Accession No. 209670 on March 11, 1998) comprising a nucleotide sequence encoding PRO320.

In another embodiment, the present invention provides an isolated PRO320 polypeptide. In particular, the present invention provides an isolated native sequence PRO320 polypeptide comprising an amino acid sequence comprising residues 1 to 338 of FIG. 45 (SEQ ID NO: 119) in one embodiment. If desired, PRO320 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the vector deposited on March 11, 1998, ATCC Accession No. 209670.

19.PRO324

We have found cDNA clones encoding novel polypeptides (named "PRO324" herein) having homology with oxidoreductase.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO324 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding the PRO324 polypeptide having amino acid residues 1 to 289 of FIG. 47 (SEQ ID NO: 124), and at least moderate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding amino acid residue 1 of FIG. 47 (SEQ ID NO: 124) or a PRO324 polypeptide having about 32 to X, wherein X is any amino acid from amino acids 131 to 140, or Complementary with these coding nucleic acid sequences, they remain stable and bound to them under at least moderate conditions, optionally under high stringency conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA36343-1310 vector (deposited under ATCC Accession No. 209718 on March 30, 1998) comprising a nucleotide sequence encoding PRO324.

In another embodiment, the present invention provides an isolated PRO324 polypeptide. In particular, the present invention provides an isolated native sequence PRO324 polypeptide comprising an amino acid sequence comprising residues 1-22 of FIG. 47 (SEQ ID NO: 124) in one embodiment. The invention also provides an isolated PRO324 polypeptide comprising residues 1 or about 32-X of FIG. 47 (SEQ ID NO: 124), wherein X is any amino acid from amino acids about 131-140. If desired, the PRO324 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA36343-1310 vector deposited with ATCC Accession No. 209718 on March 30, 1998.

20.PRO351

We have found cDNA clones encoding novel polypeptides (named "PRO351" herein) having sequence similarities to prostacins.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO351 polypeptide. In one aspect, this isolated nucleic acid comprises or encodes a DNA encoding a PRO351 polypeptide having amino acid residues 1-571 of FIG. 49 (SEQ ID NO: 132) and is complementary to at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO351 polypeptide having amino acid residues about 16 to 571 of FIG. 49 (SEQ ID NO: 132) or is complementary to such a coding nucleic acid sequence, and at least moderate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA40571-1315 vector (deposited under ATCC Accession No. 209784 on April 21, 1998) comprising a nucleotide sequence encoding PRO351.

In another embodiment, the present invention provides an isolated PRO351 polypeptide. In particular, the present invention provides an isolated native sequence PRO351 polypeptide comprising an amino acid sequence comprising residues 1 to 571 of FIG. 49 (SEQ ID NO: 132) in one embodiment. In another embodiment, the present invention provides an isolated PRO351 polypeptide comprising an amino acid sequence comprising residues about 16-571 of FIG. 49 (SEQ ID NO: 132) and lacking a signal sequence. If desired, the PRO351 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA40571-1315 vector deposited under ATCC Accession No. 209784 on April 21, 1998.

21.PRO352

We have found cDNA clones encoding novel polypeptides (named "PRO352" herein) having homology with butyrophylline.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO352 polypeptide. In one aspect, this isolated nucleic acid comprises or encodes a DNA encoding a PRO352 polypeptide having amino acid residues 1-316 of Figure 51 (SEQ ID NO: 137), and is complementary to at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO352 polypeptide having amino acid residues about 29 to 316 of FIG. 51 (SEQ ID NO: 137), or amino acid residues 1 or about 29 to X of FIG. 51, wherein X is Or any amino acid from amino acids 246 to 255) or complementary to such a coding nucleic acid sequence, and stably bound thereto at least under moderate conditions, optionally under high stringency conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA41386-1316 vector (deposited under ATCC Accession No. 209703 on March 26, 1998) comprising a nucleotide sequence encoding PRO352.

In another embodiment, the present invention provides an isolated PRO352 polypeptide. In particular, the present invention provides an isolated native sequence PRO352 polypeptide comprising an amino acid sequence comprising residues 1 to 316 of FIG. 51 (SEQ ID NO: 137) in one embodiment. In another embodiment, the invention provides an isolated PRO352 polypeptide comprising residues about 29 to 316 of FIG. 51 (SEQ ID NO: 137), and residues 1 or about 29 to X of FIG. 51 (SEQ ID NO: 137), wherein X is amino acid 246 To any amino acid from 255). If desired, the PRO352 polypeptide may be obtained by expressing the polypeptide purchased by the cDNA insert of the DNA41386-1316 vector purchased or deposited March 26, 1998, ATCC Accession No. 209703.

22.PRO381

We have found cDNA clones encoding novel polypeptides (named herein "PRO381") that have homology with immunophilin proteins.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO381 polypeptide. In one aspect, this isolated nucleic acid comprises DNA encoding a PRO381 polypeptide having amino acid residues 1 to 211 of FIG. 53 (SEQ ID NO: 145) or is complementary to such a coding nucleic acid sequence, at least in moderate conditions, optionally with high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO381 polypeptide having amino acid residues about 21 to 211 of FIG. 53 (SEQ ID NO: 145), or is complementary to, and at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA44194-1317 vector (deposited under ATCC Accession No. 209808 on April 28, 1998) comprising a nucleotide sequence encoding PRO381.

In another embodiment, the present invention provides an isolated PRO381 polypeptide. In particular, the present invention provides an isolated native sequence PRO381 polypeptide comprising, in one embodiment, an amino acid sequence comprising about 1 to 211 residues of FIG. 53 (SEQ ID NO: 145). Another embodiment is directed to a PRO381 polypeptide comprising amino acids about 21 to 211 of FIG. 53 (SEQ ID NO: 145). If desired, the PRO381 polypeptide may be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA44194-1317 vector deposited under ATCC Accession No. 209808 on April 28, 1998.

23.PRO386

We have found cDNA clones encoding novel polypeptides (named "PRO386" herein) having homology with the beta-2 subunit of sodium channels.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO386 polypeptide. In one aspect, this isolated nucleic acid comprises or encodes a DNA encoding a PRO386 polypeptide having amino acid residues 1-215 of Figure 55 (SEQ ID NO: 150) and is complementary to at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO386 polypeptide having amino acid residues from about 21 to 215, or amino acid residue 1 or from about 21 to X of FIG. 55 (SEQ ID NO: 150), wherein X is selected from FIG. 55 ( Any amino acid from amino acids 156 to 165 of SEQ ID NO: 150) or complementary to such a coding nucleic acid sequence, and stably bound to it under at least moderate conditions, optionally under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA45415-1318 vector (deposited under ATCC Accession No. 209810 on April 28, 1998), comprising the nucleotide sequence encoding PRO386.

In another embodiment, the present invention provides an isolated PRO386 polypeptide. In particular, the present invention provides, in one embodiment, an isolated native sequence PRO386 polypeptide comprising an amino acid sequence comprising residues 1-215 of FIG. 55 (SEQ ID NO: 150). Another embodiment of the invention provides an isolated PRO386 polypeptide comprising amino acids about 21 to 215 of FIG. 55 (SEQ ID NO: 150), and amino acids 1 or about 21 to X of FIG. 55 (SEQ ID NO: 150), wherein X is shown in FIG. Any amino acid from amino acids 156 to 165 of SEQ ID NO: 150). If desired, the PRO386 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA45415-1318 vector deposited under ATCC Accession No. 209810 on April 28, 1998.

In another embodiment, the present invention provides an expressed sequence tag (EST) comprising the nucleotide sequence of SEQ ID NO: 151, corresponding to the EST designated herein as DNA23350.

In another embodiment, the present invention provides an expressed sequence tag (EST) comprising the nucleotide sequence of SEQ ID NO: 152, corresponding to the EST named DNA23536 herein.

24.PRO540

We have found cDNA clones encoding novel polypeptides (designated herein as “PRO540”) having sequence similarity to LCAT.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO540 polypeptide. In one aspect, this isolated nucleic acid comprises or encodes a DNA encoding a PRO540 polypeptide having amino acid residues 1-412 of FIG. 59 (SEQ ID NO: 157) and is complementary to at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO540 polypeptide having amino acid residues between about 29 and 412 of FIG. 59 (SEQ ID NO: 157), or is complementary to, and at least in moderate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA44189-1322 vector (deposited under ATCC Accession No. 209699 on March 26, 1998) comprising a nucleotide sequence encoding PRO540.

In another embodiment, the present invention provides an isolated PRO540 polypeptide. In particular, the present invention provides an isolated native sequence PRO540 polypeptide comprising an amino acid sequence comprising residues 1-412 of FIG. 59 (SEQ ID NO: 157) in one embodiment. The invention also provides an isolated PRO540 polypeptide comprising an amino acid sequence comprising residues about 29 to 412 of FIG. 59 (SEQ ID NO: 157). If desired, the PRO540 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA44189-1322 vector deposited with ATCC Accession No. 209699, March 26, 1998.

25.PRO615

We have found cDNA clones encoding novel polypeptides (named "PRO615" herein) having sequence similarity to synaptogirin.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO615 polypeptide. In one aspect, this isolated nucleic acid comprises or encodes a DNA encoding a PRO615 polypeptide having amino acid residues 1-224 of FIG. 61 (SEQ ID NO: 162) and is complementary to at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO615 polypeptide having amino acid residues X-224 of FIG. 61 (SEQ ID NO: 162), wherein X is any amino acid from amino acids 157-166, or such a coding nucleic acid. Complementary with the sequence, it remains stablely associated with it under at least moderate conditions, optionally under high stringency conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA48304-1323 vector (deposited under ATCC Accession No. 209811 on April 28, 1998) comprising a nucleotide sequence encoding PRO615.

In another embodiment, the present invention provides an isolated PRO615 polypeptide. In particular, the present invention provides an isolated native sequence PRO615 polypeptide comprising an amino acid sequence comprising residues 1 to 224 of FIG. 61 (SEQ ID NO: 162) in one embodiment. Another embodiment of the invention provides an isolated cell of a PRO615 polypeptide comprising amino acid residues X-224 of FIG. 61 (SEQ ID NO: 162), wherein X is any amino acid from amino acids 157-166 of FIG. 61 (SEQ ID NO: 162). It is about a non-domain. If desired, the PRO615 polypeptide may be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA48304-1323 vector deposited under ATCC Accession No. 209811 on April 28, 1998.

26.PRO618

We have found cDNA clones encoding novel polypeptides (designated herein as "PRO618") having sequence similarity to enteropeptidase.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO618 polypeptide. In one aspect, this isolated nucleic acid comprises or encodes a DNA encoding a PRO618 polypeptide having amino acid residues 1 to 802 of FIG. 63 (SEQ ID NO: 169), complementary to at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, an isolated nucleic acid is an isolated cell of a PRO618 polypeptide having amino acid residues X-802 of FIG. 63 (SEQ ID NO: 169), wherein X is any amino acid from amino acids 63-72 of FIG. 63 (SEQ ID NO: 169). Comprises or is complementary to such coding nucleic acid sequences and retains stable binding therewith under at least moderate conditions, optionally high stringency conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA49152-1324 vector (deposited under ATCC Accession No. 209813 on April 28, 1998) comprising a nucleotide sequence encoding PRO618.

In another embodiment, the present invention provides an isolated PRO618 polypeptide. In particular, the present invention provides an isolated native sequence PRO618 polypeptide comprising an amino acid sequence comprising residues 1 to 802 of FIG. 63 (SEQ ID NO: 169) in one embodiment. Another embodiment of the invention relates to an isolated extracellular domain of a PRO618 polypeptide comprising amino acids X-802, wherein X is any amino acid from amino acids 63-72 of FIG. 63 (SEQ ID NO: 169). If desired, the PRO618 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA49152-1324 vector deposited under ATCC Accession No. 209813 on April 28, 1998.

In another embodiment, the present invention provides an expressed sequence tag (EST) (named herein DNA35597) comprising the nucleotide sequence of SEQ ID NO: 170 (see FIG. 64).

27.PRO719

We have found cDNA clones encoding novel polypeptides (named herein "PRO719") that have homology with lipoprotein lipase H.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO719 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO719 polypeptide having amino acid residues 1 to 354 of Figure 66 (SEQ ID NO: 178) or is complementary to such a coding nucleic acid sequence, at least in moderate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO719 polypeptide having amino acid residues between about 17 and 354 of FIG. 66 (SEQ ID NO: 178) or is complementary to such a coding nucleic acid sequence, at least in moderate conditions, optionally with high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA49646-1327 vector (deposited under ATCC Accession No. 209705 on March 26, 1998) comprising a nucleotide sequence encoding PRO719.

In another embodiment, the present invention provides an isolated PRO719 polypeptide. In particular, the present invention provides an isolated native sequence PRO719 polypeptide comprising an amino acid sequence comprising residues 1 to 354 of FIG. 66 (SEQ ID NO: 178) in one embodiment. In another embodiment, the present invention provides an isolated PRO719 polypeptide comprising residues about 17-354 of FIG. 66 (SEQ ID NO: 178). If desired, the PRO719 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA49646-1327 vector deposited under ATCC Accession No. 209705 on March 26, 1998.

28.PRO724

We have found cDNA clones encoding novel polypeptides (named "PRO724" herein) that have homology with the LDL receptor.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO724 polypeptide. In one aspect, this isolated nucleic acid comprises DNA encoding a PRO724 polypeptide having amino acid residues 1 to 713 of FIG. 68 (SEQ ID NO: 183) or is complementary to such a coding nucleic acid sequence, and at least moderate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a soluble PRO724 polypeptide having amino acid residues 1 to X of FIG. 68 (SEQ ID NO: 183), wherein X is any amino acid from amino acids 437 to 446, or such coding Complementary with the nucleic acid sequence, it remains stablely associated with it under at least moderate conditions, optionally under high stringency conditions. The two polypeptides may or may not possess signal peptides. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA49631-1328 vector (deposited under ATCC Accession No. 209806 on April 28, 1998) comprising a nucleotide sequence encoding PRO724.

In another embodiment, the present invention provides an isolated PRO724 polypeptide. In particular, the present invention provides an isolated native sequence PRO724 polypeptide comprising an amino acid sequence comprising residues 1 to 713 of FIG. 68 (SEQ ID NO: 183) in one embodiment. In another embodiment, the present invention provides isolated soluble PRO724 polypeptide. In particular, the present invention provides an isolated soluble PRO724 polypeptide comprising an amino acid sequence comprising residues 1 to X of FIG. 68 (SEQ ID NO: 183), wherein X is amino acid 437 of the sequence shown in FIG. 68 (SEQ ID NO: 183). To any amino acid from 446). If desired, the PRO724 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA49631-1328 vector deposited under ATCC Accession No. 209806 on April 28, 1998.

29.PRO772

We have found cDNA clones encoding novel polypeptides (named "PRO772" herein) that have homology with the A4 protein.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO772 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding the PRO772 polypeptide having amino acid residues 1-152 of FIG. 70 (SEQ ID NO: 190), and is at least moderate, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO772 polypeptide having amino acid residues 1-X of FIG. 70 (SEQ ID NO: 190), wherein X is any from amino acids 21-30 of FIG. 70 (SEQ ID NO: 190). Amino acids) or complementary to these coding nucleic acid sequences, and remain stablely associated therewith under at least moderate conditions, optionally under high stringency conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA49645-1347 vector (deposited under ATCC Accession No. 209809 on April 28, 1998) comprising a nucleotide sequence encoding PRO772.

In another embodiment, the present invention provides an isolated PRO772 polypeptide. In particular, the present invention provides, in one embodiment, an isolated native sequence PRO772 polypeptide comprising an amino acid sequence comprising residues 1-152 of FIG. 70 (SEQ ID NO: 190). Another embodiment of the invention relates to a PRO772 polypeptide comprising amino acids 1 to X of FIG. 70 (SEQ ID NO: 190), wherein X is any amino acid from amino acids 21 to 30 of FIG. 70 (SEQ ID NO: 190). If desired, the PRO772 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA49645-1347 vector deposited under ATCC Accession No. 209809 on April 28, 1998.

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA43509, comprising the nucleotide sequence of SEQ ID NO: 191 (FIG. 71).

30.PRO852

We have found cDNA clones encoding novel polypeptides (designated herein as "PRO852") that are homologous to various protease enzymes.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO852 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding a PRO852 polypeptide having amino acid residues 1-518 of Figure 73 (SEQ ID NO: 196), or is complementary to, and at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO852 polypeptide having amino acid residues about 21 to 518 of FIG. 73 (SEQ ID NO: 196), or amino acid residues 1 or about 21 to X of FIG. 73 (SEQ ID NO: 196); Wherein X is any amino acid from amino acids 461 to 470 of FIG. 73 (SEQ ID NO: 196) or complementary to such a coding nucleic acid sequence, and remains stablely associated therewith under at least moderate conditions, optionally high stringency conditions. . The isolated nucleic acid sequence may comprise the cDNA insert of the DNA45493-1349 vector (deposited under ATCC Accession No. 209805 on April 28, 1998), comprising the nucleotide sequence encoding PRO852.

In another embodiment, the present invention provides an isolated PRO852 polypeptide. In particular, the present invention provides an isolated native sequence PRO852 polypeptide comprising an amino acid sequence comprising residues 1-518 of FIG. 73 (SEQ ID NO: 196) in one embodiment. In another embodiment, PRO852 comprises amino acid about 21 to amino acid 518 of FIG. 73 (SEQ ID NO: 196), or amino acid 1 or about 21 to X of FIG. 73 (SEQ ID NO: 196), where X is FIG. 73 (SEQ ID NO: 196). Is any amino acid from amino acids 461 to 470). In some cases, the PRO852 polypeptide may be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA45493-1349 vector deposited under ATCC Accession No. 209805 on April 28, 1998.

31.PRO853

We have found cDNA clones encoding novel polypeptides (named "PRO853" herein) having sequence similarity with reductase.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO853 polypeptide. In one aspect, the isolated nucleic acid comprises or encodes a DNA encoding a PRO853 polypeptide having amino acid residues 1 to 377 of FIG. 75 (SEQ ID NO: 206), complementary to at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO853 polypeptide having amino acid residues about 17 to 377 of FIG. 75 (SEQ ID NO: 206), or is complementary to, and at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA48227-1350 vector (deposited under ATCC Accession No. 209812 on April 28, 1998) comprising a nucleotide sequence encoding PRO853.

In another embodiment, the present invention provides an isolated PRO853 polypeptide. In particular, the present invention provides an isolated native sequence PRO853 polypeptide comprising, in one embodiment, an amino acid sequence comprising residues 1 to 377 of FIG. 75 (SEQ ID NO: 206). In another embodiment, the invention provides an isolated PRO853 polypeptide comprising an amino acid sequence comprising residues about 17 to 377 of FIG. 75 (SEQ ID NO: 206) and lacking a signal sequence. If desired, the PRO853 polypeptide can be obtained by expressing the polypeptide purchased by the cDNA insert of the DNA48227-1350 vector purchased or deposited on April 28, 1998, ATCC Accession No. 209812.

32.PRO860

We have found cDNA clones encoding novel polypeptides (named “PRO860” herein) having sequence similarity to neuropascin.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO860 polypeptide. In one aspect, this isolated nucleic acid comprises or encodes a DNA encoding a PRO860 polypeptide having amino acid residues 1-985 of FIG. 77 (SEQ ID NO: 211), complementary to at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO860 polypeptide having amino acid residues 1-X of FIG. 77 (SEQ ID NO: 211), wherein X is any from amino acids 443-452 of FIG. 77 (SEQ ID NO: 211). Amino acids) or complementary to these coding nucleic acid sequences, and remain stablely associated therewith under at least moderate conditions, optionally under high stringency conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA41404-1352 vector (deposited under ATCC Accession No. 209844 on May 6, 1998) comprising a nucleotide sequence encoding PRO860.

In another embodiment, the present invention provides an isolated PRO860 polypeptide. In particular, the present invention provides an isolated native sequence PRO860 polypeptide comprising an amino acid sequence comprising residues 1 to 985 of FIG. 77 (SEQ ID NO: 211) in one embodiment. In another embodiment, the invention provides an isolated PRO860 polypeptide comprising an amino acid sequence comprising residues 1-X of Figure 77 (SEQ ID NO: 211), wherein X is from amino acid residues 443-452 of Figure 77 (SEQ ID NO: 211). Is any amino acid residue of). If desired, the PRO860 polypeptide may be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA41404-1352 vector deposited with ATCC Accession No. 209844, May 6, 1998.

33.PRO846

We have found cDNA clones encoding novel polypeptides (named "PRO846" herein) having sequence similarity to CMRF35.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO846 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding a PRO846 polypeptide having amino acid residues 1 to 332 of FIG. 79 (SEQ ID NO: 216) or is complementary to this coding nucleic acid sequence, and at least in moderate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO846 polypeptide having amino acid residues about 18 to 332 of Figure 79 (SEQ ID NO: 216), or amino acid residues 1 or about 18 to X of SEQ ID NO: 216, wherein X is Complementary to this coding nucleic acid sequence of FIG. 79 (SEQ ID NO: 243 to 252) or such a coding nucleic acid sequence, and stably bound thereto at least under moderate conditions, optionally high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA44196-1353 vector (deposited under ATCC Accession No. 209847 on May 6, 1998), comprising the nucleotide sequence encoding PRO846.

In another embodiment, the present invention provides an isolated PRO846 polypeptide. In particular, the present invention provides an isolated native sequence PRO846 polypeptide comprising an amino acid sequence comprising residues 1 to 332 of FIG. 79 (SEQ ID NO: 216) in one embodiment. In another embodiment, the invention provides an isolated PRO846 polypeptide comprising an amino acid sequence comprising residues about 18 to 332 of FIG. 79 (SEQ ID NO: 216) and lacking a signal sequence. Another embodiment of the invention provides an isolated PRO846 polypeptide comprising amino acids 1 or about 18 to X of FIG. 79 (SEQ ID NO: 216), wherein X is any amino acid from amino acids 243 to 252 of FIG. 79 (SEQ ID NO: 216). It is about. If desired, the PRO846 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA44196-1353 vector deposited under ATCC Accession No. 209847 on May 6, 1998.

34.PRO862

We have found cDNA clones encoding novel polypeptides (named "PRO862" herein) having sequence similarities to lysozyme.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO862 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding a PRO862 polypeptide having amino acid residues 1 to 146 of FIG. 81 (SEQ ID NO: 221), and is at least in moderate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO862 polypeptide having amino acid residues from about 19 to 146 of FIG. 81 (SEQ ID NO: 221), or is complementary to, and at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA52187-1354 vector (deposited under ATCC Accession No. 209845 on May 6, 1998) comprising a nucleotide sequence encoding PRO862.

In another embodiment, the present invention provides an isolated PRO862 polypeptide. In particular, the present invention provides an isolated native sequence PRO862 polypeptide comprising an amino acid sequence comprising residues 1 to 146 of FIG. 81 (SEQ ID NO: 221) in one embodiment. In another embodiment, the present invention provides an isolated PRO862 polypeptide comprising an amino acid sequence comprising residues about 19 to 146 of FIG. 81 (SEQ ID NO: 221) and lacking a signal sequence. If desired, the PRO862 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA52187-1354 vector deposited with ATCC Accession No. 209845 on May 6, 1998.

35.PRO864

We have found cDNA clones encoding novel polypeptides (named "PRO864" herein) having sequence similarity to Wnt-4.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO864 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding a PRO864 polypeptide having amino acid residues 1 to 351 of Figure 83 (SEQ ID NO: 226) or is complementary to this coding nucleic acid sequence, and at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises or encodes a DNA encoding a PRO864 polypeptide having amino acid residues about 23 to 351 of FIG. 83 (SEQ ID NO: 226), complementary to at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA48328-1355 vector (deposited as ATCC Accession No. 209843 on May 6, 1998) comprising a nucleotide sequence encoding PRO864.

In another embodiment, the present invention provides an isolated PRO864 polypeptide. In particular, the present invention provides an isolated native sequence PRO864 polypeptide comprising an amino acid sequence comprising residues 1 to 351 of FIG. 83 (SEQ ID NO: 226) in one embodiment. In another embodiment, the present invention provides an isolated PRO864 polypeptide comprising an amino acid sequence comprising residues about 23 to 351 of FIG. 83 (SEQ ID NO: 226) and lacking a signal sequence. If desired, the PRO864 polypeptide may be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA48328-1355 vector deposited with ATCC Accession No. 209843 on May 6, 1998.

36.PRO792

We have found a cDNA clone that encodes a novel polypeptide (named "PRO792" herein) having homology with CD23.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO792 polypeptide. In one aspect, this isolated nucleic acid comprises DNA encoding a PRO792 polypeptide having amino acid residues 1 to 293 of FIG. 85 (SEQ ID NO: 231) or is complementary to such a coding nucleic acid sequence, and at least moderate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO792 polypeptide having amino acid residues X to 293 of FIG. 85 (SEQ ID NO: 231), wherein X is any from amino acids 50 to 59 of FIG. 85 (SEQ ID NO: 231). Amino acids) or complementary to these coding nucleic acid sequences, and remain stablely associated therewith under at least moderate conditions, optionally under high stringency conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA56352-1358 vector (deposited under ATCC Accession No. 209846 on May 6, 1998) comprising a nucleotide sequence encoding PRO792.

In another embodiment, the present invention provides an isolated PRO792 polypeptide. In particular, the present invention provides an isolated native sequence PRO792 polypeptide comprising an amino acid sequence comprising residues 1-22 of FIG. 85 (SEQ ID NO: 231) in one embodiment. Another embodiment of the invention is directed to a PRO792 polypeptide comprising amino acids X-293 of FIG. 85 (SEQ ID NO: 231), wherein X is any amino acid from amino acids 50-59 of FIG. 85 (SEQ ID NO: 231). If desired, the PRO792 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA56352-1358 vector deposited under ATCC Accession No. 209846 on May 6, 1998.

37.PRO866

We have found cDNA clones encoding novel polypeptides (designated herein as “PRO866”) that have homology with the Mindine and Spondin proteins.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO866 polypeptide. In one aspect, this isolated nucleic acid comprises DNA encoding a PRO866 polypeptide having amino acid residues 1 to 331 of FIG. 87 (SEQ ID NO: 236) or is complementary to such a coding nucleic acid sequence, at least in moderate conditions, optionally with high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO866 polypeptide having amino acid residues about 27 to 229 of FIG. 87 (SEQ ID NO: 236) or is complementary to such a coding nucleic acid sequence, and at least in moderate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA53971-1359 vector (deposited under ATCC Accession No. 209750 on April 7, 1998) comprising a nucleotide sequence encoding PRO866.

In another embodiment, the present invention provides an isolated PRO866 polypeptide. In particular, the present invention provides an isolated native sequence PRO866 polypeptide comprising an amino acid sequence comprising residues 1 to 331 of FIG. 87 (SEQ ID NO: 236) in one embodiment. Another embodiment of the invention relates to a PRO866 polypeptide comprising amino acids about 27 to 331 of FIG. 87 (SEQ ID NO: 236). If desired, the PRO866 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA53971-1359 vector deposited under ATCC Accession No. 209750 on April 7, 1998.

38.PRO871

We have found a cDNA clone encoding a novel polypeptide (named herein "PRO871") that is homologous to CyP-60.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO871 polypeptide. In one aspect, the isolated nucleic acid comprises or encodes a DNA encoding a PRO871 polypeptide having amino acid residues 1 to 472 of Figure 89 (SEQ ID NO: 245) and is complementary to at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO871 polypeptide having amino acid residues about 22 to 472 of FIG. 89 (SEQ ID NO: 245), or is complementary to, and at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA50919-1361 vector (deposited under ATCC Accession No. 209848 on May 6, 1998), comprising the nucleotide sequence encoding PRO871.

In another embodiment, the present invention provides an isolated PRO871 polypeptide. In particular, the present invention provides an isolated native sequence PRO871 polypeptide comprising, in one embodiment, an amino acid sequence comprising residues 1 to 472 of FIG. 89 (SEQ ID NO: 245). Another embodiment of the invention relates to a PRO871 polypeptide comprising amino acids about 22-472 of FIG. 89 (SEQ ID NO: 245). If desired, the PRO871 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA50919-1361 vector deposited under ATCC Accession No. 209848 on May 6, 1998.

39.PRO873

We have found cDNA clones encoding novel polypeptides (named herein "PRO873") which have homology with carboxyesterases.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO873 polypeptide. In one aspect, this isolated nucleic acid comprises DNA encoding the PRO873 polypeptide having amino acid residues 1-545 of FIG. 91 (SEQ ID NO: 254) or is complementary to such a coding nucleic acid sequence, and at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO873 polypeptide having amino acid residues from about 30 to about 545 of FIG. 91 (SEQ ID NO: 254), or is complementary to, and at least in intermediate conditions, optionally It remains stable in combination with it under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA44179-1362 vector (deposited as ATCC Accession No. 208591 on May 6, 1998), comprising the nucleotide sequence encoding PRO873.

In another embodiment, the present invention provides an isolated PRO873 polypeptide. In particular, the present invention provides an isolated native sequence PRO873 polypeptide comprising, in one embodiment, an amino acid sequence comprising residues 1-545 of FIG. 91 (SEQ ID NO: 254). Another embodiment of the invention relates to a PRO873 polypeptide comprising amino acids about 30 to 545 of FIG. 91 (SEQ ID NO: 254). If desired, the PRO873 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA44179-1362 vector deposited with ATCC Accession No. 209851 on May 6, 1998.

40.PRO940

We have found cDNA clones encoding novel polypeptides (named "PRO940" herein) that have homology with CD33 and OB binding protein-2.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO940 polypeptide. In one aspect, this isolated nucleic acid comprises or encodes a DNA encoding a PRO940 polypeptide having amino acid residues 1-544 of FIG. 93 (SEQ ID NO: 259), complementary to at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO940 polypeptide having amino acid residues about 16 to 544 of Figure 93 (SEQ ID NO: 259), or amino acid residues 1 or about 16 to X of Figure 93 (SEQ ID NO: 259) ( Wherein X is any amino acid from amino acids 394 to 403 of FIG. 93 (SEQ ID NO: 259) or complementary to such a coding nucleic acid sequence, and remains stablely bound thereto at least under moderate conditions, optionally under high stringency conditions. . The isolated nucleic acid sequence may comprise the cDNA insert of the DNA54002-1367 vector (deposited under ATCC Accession No. 209754 on April 7, 1998), comprising the nucleotide sequence encoding PRO940.

In another embodiment, the present invention provides an isolated PRO940 polypeptide. In particular, the present invention provides an isolated native sequence PRO940 polypeptide comprising an amino acid sequence comprising residues 1 to 544 of FIG. 93 (SEQ ID NO: 259) in one embodiment. Another embodiment of the invention provides a PRO940 polypeptide comprising amino acids about 16-544 of Figure 93 (SEQ ID NO: 259), or amino acids 1 or about 16-X of Figure 93 (SEQ ID NO: 259), wherein X is Figure 93 (SEQ ID NO: 259). ), Any amino acid from amino acids 394 to 403). If desired, the PRO940 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA54002-1367 vector deposited under ATCC Accession No. 209754, April 7, 1998.

41.PRO941

We have found cDNA clones encoding novel polypeptides (named "PRO941" herein) that have homology with Cadherin proteins.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO941 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding a PRO941 polypeptide having amino acid residues 1 to 772 of Figure 95 (SEQ ID NO: 264), and complements at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO941 polypeptide having amino acid residues about 22 to about 772 of FIG. 95 (SEQ ID NO: 264), or amino acid residues 1 or about 22 to X of FIG. 95 (SEQ ID NO: 264), or (Where X is any amino acid from amino acids 592 to 601 of FIG. 95 (SEQ ID NO: 264)) or complementary to such a coding nucleic acid sequence and remain stable associated therewith under at least moderate conditions, optionally high stringency conditions. do. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA53906-1368 vector (deposited under ATCC Accession No. 209747 on April 7, 1998), comprising the nucleotide sequence encoding PRO941.

In another embodiment, the present invention provides an isolated PRO941 polypeptide. In particular, the present invention provides an isolated native sequence PRO941 polypeptide comprising an amino acid sequence comprising residues 1 to 772 of FIG. 95 (SEQ ID NO: 264) in one embodiment. Another embodiment of the invention provides a PRO941 polypeptide comprising amino acids about 21 to 772 of Figure 95 (SEQ ID NO: 264), or amino acids 1 or about 22 to X of Figure 95 (SEQ ID NO: 264), wherein X is Figure 95 (SEQ ID NO: 264). ), Any amino acid from amino acids 592 to 601). If desired, the PRO941 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA53906-1368 vector deposited under ATCC Accession No. 209747, April 7, 1998.

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA6415, comprising the nucleotide sequence of FIG. 96 (SEQ ID NO: 265).

42.PRO944

We have found cDNA clones encoding novel polypeptides (named "PRO944" herein) having homology with Clostridium perfringens enterotoxin receptor (CPE-R).

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO944 polypeptide. In one aspect, this isolated nucleic acid comprises or encodes a DNA encoding a PRO944 polypeptide having amino acid residues 1 to 211 of FIG. 98 (SEQ ID NO: 270), complementary to at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO944 polypeptide having about 22 to about 229 amino acid residues in FIG. 98 (SEQ ID NO: 270), or amino acids 1 or about 22 to X in FIG. 98 (SEQ ID NO: 270) ( Where X is any amino acid from amino acids 77-80 of FIG. 98 (SEQ ID NO: 270) or is complementary to such a coding nucleic acid sequence and remains stablely bound thereto at least under moderate conditions, optionally under high stringency conditions. . The isolated nucleic acid sequence may comprise a cDNA insert of a DNA52185-1370 vector (deposited under ATCC Accession No. 209861 on May 14, 1998) comprising a nucleotide sequence encoding PRO944.

In another embodiment, the present invention provides an isolated PRO944 polypeptide. In particular, the present invention provides an isolated native sequence PRO944 polypeptide comprising an amino acid sequence comprising residues 1 to 211 of FIG. 98 (SEQ ID NO: 270) in one embodiment. Another embodiment of the invention provides a PRO944 polypeptide comprising amino acids about 22 to 211 of FIG. 98 (SEQ ID NO: 270), or amino acids 1 or about 22 to X of FIG. 98 (SEQ ID NO: 270), wherein X is shown in FIG. ), Any amino acid from amino acids 77-86. If desired, the PRO944 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA52185-1370 vector deposited with ATCC Accession No. 209861 on May 14, 1998.

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA14007, comprising the nucleotide sequence of FIG. 99 (SEQ ID NO: 271).

In another embodiment, the present invention provides an expressed sequence tag (EST) (named DNA12733 herein) comprising the nucleotide sequence of FIG. 100 (SEQ ID NO: 272).

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA12746, comprising the nucleotide sequence of FIG. 101 (SEQ ID NO: 273).

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA12834, comprising the nucleotide sequence of FIG. 102 (SEQ ID NO: 274).

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA12846, comprising the nucleotide sequence of FIG. 103 (SEQ ID NO: 275).

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA13104, comprising the nucleotide sequence of FIG. 104 (SEQ ID NO: 276).

In another embodiment, the present invention provides an expressed sequence tag (EST) (named DNA13259 herein) comprising the nucleotide sequence of FIG. 105 (SEQ ID NO: 277).

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA13959, comprising the nucleotide sequence of FIG. 106 (SEQ ID NO: 278).

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA13961, comprising the nucleotide sequence of FIG. 107 (SEQ ID NO: 279).

43.PRO983

We have found a cDNA clone encoding a novel polypeptide (named "PRO983" herein) having homology with the vesicle binding protein VAP-33.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO983 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding the PRO983 polypeptide having amino acid residues 1 to 243 of Figure 109 (SEQ ID NO: 284) and at least moderate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO983 polypeptide having amino acid residues 1-X of FIG. 109 (SEQ ID NO: 284), wherein X is any from amino acids 219-228 of FIG. 109 (SEQ ID NO: 284). Amino acids) or complementary to these coding nucleic acid sequences, and remain stablely associated therewith under at least moderate conditions, optionally under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA53977-1371 vector (deposited as ATCC Accession No. 209862 on May 14, 1998), comprising the nucleotide sequence encoding PRO983.

In another embodiment, the present invention provides an isolated PRO983 polypeptide. In particular, the present invention provides an isolated native sequence PRO983 polypeptide comprising, in one embodiment, an amino acid sequence comprising residues 1 to 243 of FIG. 109 (SEQ ID NO: 284). Another embodiment of the invention relates to a PRO983 polypeptide comprising amino acids 1 to X of FIG. 109 (SEQ ID NO: 284), wherein X is any amino acid from amino acids 219 to 228 of FIG. 109 (SEQ ID NO: 284). If desired, the PRO983 polypeptide can be obtained by expressing the polypeptide purchased by the cDNA insert of the DNA53977-1371 vector purchased or deposited May 14, 1998, ATCC Accession No. 209862.

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA17130, comprising the nucleotide sequence of FIG. 110 (SEQ ID NO: 285).

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA23466, comprising the nucleotide sequence of FIG. 111 (SEQ ID NO: 286).

In another embodiment, the present invention provides an expressed sequence tag (EST) (named DNA26818 herein) comprising the nucleotide sequence of FIG. 112 (SEQ ID NO: 287).

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA37618, comprising the nucleotide sequence of FIG. 113 (SEQ ID NO: 288).

In another embodiment, the present invention provides an expressed sequence tag (EST) (named DNA41732 herein) comprising the nucleotide sequence of FIG. 114 (SEQ ID NO: 289).

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA45980, comprising the nucleotide sequence of FIG. 115 (SEQ ID NO: 290).

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA46372, comprising the nucleotide sequence of FIG. 116 (SEQ ID NO: 291).

44.PRO1057

We have found cDNA clones encoding novel polypeptides (named "PRO1057" herein) that have homology with proteases.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1057 polypeptide. In one aspect, this isolated nucleic acid comprises DNA encoding a PRO1057 polypeptide having amino acid residues 1-413 of Figure 118 (SEQ ID NO: 296) or is complementary to such a coding nucleic acid sequence, and at least moderately moderate, optionally It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO1057 polypeptide having amino acid residues between about 17 and 413 of Figure 118 (SEQ ID NO: 296), or is complementary to, and at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA57253-1382 vector (deposited under ATCC Accession No. 209867 on May 14, 1998), comprising the nucleotide sequence encoding PRO1057.

In another embodiment, the present invention provides an isolated PRO1057 polypeptide. In particular, the present invention provides an isolated native sequence PRO1057 polypeptide comprising an amino acid sequence comprising residues 1-413 of FIG. 118 (SEQ ID NO: 296) in one embodiment. Another embodiment of the invention relates to a PRO1057 polypeptide comprising amino acids about 17-413 of FIG. 118 (SEQ ID NO: 296). If desired, the PRO1057 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA57253-1382 vector deposited with ATCC Accession No. 209867 on May 14, 1998.

45.PRO1071

We have found cDNA clones encoding novel polypeptides (named "PRO1071" herein) having homology with thrombospondins.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1071 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding a PRO1071 polypeptide having amino acid residues 1-525 of FIG. 120 (SEQ ID NO: 301) or is complementary to such a coding nucleic acid sequence, and at least moderate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO1071 polypeptide having amino acid residues about 26 to 525 of FIG. 120 (SEQ ID NO: 301), or is complementary to, and at least in moderately moderate, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA58847-1383 vector (deposited under ATCC Accession No. 209879 on May 20, 1998) comprising a nucleotide sequence encoding PRO1071.

In another embodiment, the present invention provides an isolated PRO1071 polypeptide. In particular, the present invention provides an isolated native sequence PRO1071 polypeptide comprising an amino acid sequence comprising residues 1 to 525 of FIG. 120 (SEQ ID NO: 301) in one embodiment. Another embodiment of the invention relates to a PRO1071 polypeptide comprising amino acids about 26 to 525 of FIG. 120 (SEQ ID NO: 301). If desired, the PRO1071 polypeptide may be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA58847-1383 vector deposited under ATCC Accession No. 209879 on May 20, 1998.

46.PRO1072

We have found cDNA clones encoding novel polypeptides (designated herein as "PRO1072") that have homology with reductase proteins.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1072 polypeptide. In one aspect, the isolated nucleic acid comprises or encodes DNA encoding a PRO1072 polypeptide having amino acid residues 1-336 of Figure 122 (SEQ ID NO: 303), and is complementary to, at least in moderate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO1072 polypeptide having amino acid residues about 22 to 336 of FIG. 122 (SEQ ID NO: 303) or is complementary to, and at least in moderately moderate, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA58747-1384 vector (deposited under ATCC Accession No. 209868 on May 14, 1998), comprising the nucleotide sequence encoding PRO1072.

In another embodiment, the present invention provides an isolated PRO1072 polypeptide. In particular, the present invention provides an isolated native sequence PRO1072 polypeptide comprising an amino acid sequence comprising residues 1 to 336 of FIG. 122 (SEQ ID NO: 303) in one embodiment. Another embodiment of the invention relates to a PRO1072 polypeptide comprising amino acids about 22-336 of FIG. 122 (SEQ ID NO: 303). If desired, the PRO1072 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA58747-1384 vector deposited with ATCC Accession No. 209868, May 14, 1998.

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA40210, comprising the nucleotide sequence of FIG. 123 (SEQ ID NO: 304).

47.PRO1075

We have found cDNA clones encoding novel polypeptides (designated herein as "PRO1075") that are homologous to the protein disulfide isomerase.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1075 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO1075 polypeptide having amino acid residues 1-406 of Figure 125 (SEQ ID NO: 309), or is complementary to, and at least moderately moderate, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO1075 polypeptide having amino acid residues from about 30 to 406 of FIG. 125 (SEQ ID NO: 309), or is complementary to, and at least moderately moderate, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA57689-1385 vector (deposited under ATCC Accession No. 209869 on May 14, 1998) comprising a nucleotide sequence encoding PRO1075.

In another embodiment, the present invention provides an isolated PRO1075 polypeptide. In particular, the present invention provides an isolated native sequence PRO1075 polypeptide comprising an amino acid sequence comprising residues 1 to 406 of FIG. 125 (SEQ ID NO: 309) in one embodiment. Another embodiment of the invention relates to a PRO1075 polypeptide comprising about 30 to 406 amino acids of FIG. 125 (SEQ ID NO: 309). If desired, the PRO1075 polypeptide may be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA57689-1385 vector deposited with ATCC Accession No. 209869 on May 14, 1998.

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA13059, comprising the nucleotide sequence of FIG. 126 (SEQ ID NO: 310).

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA19463, comprising the nucleotide sequence of FIG. 127 (SEQ ID NO: 311).

48.PRO181

We have found a cDNA clone that encodes a novel polypeptide (named "PRO181" herein) having homology with the cornichon protein.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO181 polypeptide. In one aspect, this isolated nucleic acid comprises or encodes a DNA encoding a PRO181 polypeptide having amino acid residues 1-144 of Figure 129 (SEQ ID NO: 322) and is complementary to at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO181 polypeptide having about 21 to 144 amino acid residues of FIG. 129 (SEQ ID NO: 322), or amino acids 1 or about 21 to X of FIG. 129 (SEQ ID NO: 322), wherein , X is any amino acid from amino acids 52 to 61 of FIG. 129 (SEQ ID NO: 322) or complementary to such a coding nucleic acid sequence, and remains stablely bound thereto at least under moderate conditions, optionally under high stringency conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA23330-1390 vector (deposited under ATCC Accession No. 209775 on April 14, 1998) comprising a nucleotide sequence encoding PRO181.

In another embodiment, the present invention provides an isolated PRO181 polypeptide. In particular, the present invention provides an isolated native sequence PRO181 polypeptide comprising an amino acid sequence comprising residues 1 to 144 of FIG. 129 (SEQ ID NO: 322) in one embodiment. Another embodiment of the invention provides a PRO181 polypeptide comprising about 21 to 144 amino acids of Figure 129 (SEQ ID NO: 322), or amino acids 1 or about 21 to X of Figure 129 (SEQ ID NO: 322), wherein X is Figure 129 (SEQ ID NO: 322). ), Any amino acid from amino acids 52-61. If desired, the PRO181 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA23330-1390 vector deposited under ATCC Accession No. 209775 on April 14, 1998.

In another embodiment, the present invention provides an expressed sequence tag (EST) (named DNA13242 herein) comprising the nucleotide sequence of FIG. 130 (SEQ ID NO: 323).

49.PRO195

We have found a cDNA clone encoding a novel transmembrane polypeptide named herein as "PRO195".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO195 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding the PRO195 polypeptide having amino acid residues 1 to 323 of Figure 132 (SEQ ID NO: 330), and at least moderate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO195 polypeptide having about 32 to 323 amino acid residues of FIG. 132 (SEQ ID NO: 330), or amino acids 1 or about 32 to X of FIG. 132 (SEQ ID NO: 330), wherein , X is any amino acid from amino acids 236 to 245 of FIG. 132 (SEQ ID NO: 330) or complementary to such a coding nucleic acid sequence, and remains stablely bound thereto at least under moderate conditions, optionally under high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA26847-1395 vector (deposited under ATCC Accession No. 209772 on April 14, 1998), comprising the nucleotide sequence encoding PRO195.

In another embodiment, the present invention provides an isolated PRO195 polypeptide. In particular, the present invention provides an isolated native sequence PRO195 polypeptide comprising an amino acid sequence comprising residues 1 to 323 of FIG. 132 (SEQ ID NO: 330) in one embodiment. Another embodiment of the invention is a PRO195 polypeptide comprising amino acids about 32 to 323 of Figure 132 (SEQ ID NO: 330), or amino acids 1 or about 32 to X of Figure 132 (SEQ ID NO: 330), wherein X is Figure 132 (SEQ ID NO: 330). ), Any amino acid from amino acids 236 to 245). If desired, the PRO195 polypeptide may be obtained by expressing a polypeptide that is purchased or encoded by the cDNA insert of the DNA26847-1395 vector deposited with ATCC Accession No. 209772, April 14, 1998.

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA15062, comprising the nucleotide sequence of FIG. 133 (SEQ ID NO: 331).

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA13199, comprising the nucleotide sequence of FIG. 134 (SEQ ID NO: 332).

50.PRO865

We have found cDNA clones encoding novel secreted polypeptides designated herein as "PRO865".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO865 polypeptide. In one aspect, the isolated nucleic acid comprises or encodes a DNA encoding a PRO865 polypeptide having amino acid residues 1-468 of Figure 136 (SEQ ID NO: 337) and is complementary to at least a moderate condition, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO865 polypeptide having amino acid residues about 24 to 229 of FIG. 136 (SEQ ID NO: 337), or is complementary to, and at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA53974-1401 vector (deposited under ATCC Accession No. 209774 on April 14, 1998), comprising the nucleotide sequence encoding PRO865.

In another embodiment, the present invention provides an isolated PRO865 polypeptide. In particular, the present invention provides an isolated native sequence PRO865 polypeptide comprising an amino acid sequence comprising residues 1 to 468 of FIG. 136 (SEQ ID NO: 337) in one embodiment. Another embodiment of the invention relates to a PRO865 polypeptide comprising amino acids about 24 to 468 of FIG. 136 (SEQ ID NO: 337). If desired, the PRO865 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA53974-1401 vector deposited under ATCC Accession No. 209774, April 14, 1998.

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA37642, comprising the nucleotide sequence of FIG. 137 (SEQ ID NO: 338).

51.PRO827

We have found cDNA clones encoding novel polypeptides (designated herein as "PRO827") that have homology with integrin proteins.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO827 polypeptide. In one aspect, the isolated nucleic acid comprises or encodes a DNA encoding a PRO827 polypeptide having amino acid residues 1 to 124 of Figure 139 (SEQ ID NO: 346) and is complementary to at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO827 polypeptide having amino acid residues about 23 to 124 of FIG. 139 (SEQ ID NO: 346), or is complementary to, and at least moderately moderate, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA57039-1402 vector (deposited under ATCC Accession No. 209777 on April 14, 1998) comprising a nucleotide sequence encoding PRO827.

In another embodiment, the present invention provides an isolated PRO827 polypeptide. In particular, the present invention provides an isolated native sequence PRO827 polypeptide comprising an amino acid sequence comprising residues 1 to 124 of FIG. 139 (SEQ ID NO: 346) in one embodiment. Another embodiment of the invention relates to a PRO827 polypeptide comprising amino acids about 23 to 124 of FIG. 139 (SEQ ID NO: 346). If desired, the PRO827 polypeptide can be obtained by expressing the polypeptide purchased by the cDNA insert of the DNA57039-1402 vector purchased or deposited on April 14, 1998, ATCC Accession No. 209777.

52.PRO1114

We have found cDNA clones encoding novel polypeptides (designated herein as “PRO1114”) that have homology with cytokine receptor family-4 proteins.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding the PRO1114 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO1114 polypeptide having amino acid residues 1 to 311 of FIG. 142 (SEQ ID NO: 352) or is complementary to this coding nucleic acid sequence, and at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO1114 polypeptide having about 30 to 311 amino acid residues in Figure 142 (SEQ ID NO: 352), or amino acids 1 or about 30 to X in Figure 142 (SEQ ID NO: 352), , X is any amino acid from amino acids 225 to 234 of FIG. 142 (SEQ ID NO: 352) or complementary to such a coding nucleic acid sequence, and remains stablely bound thereto at least under moderate conditions, optionally high stringency conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA57033-1403 vector (deposited under ATCC Accession No. 209905 on May 27, 1998) comprising a nucleotide sequence encoding PRO1114.

In another embodiment, the present invention provides an isolated PRO1114 polypeptide. In particular, the present invention provides an isolated native sequence PRO1114 polypeptide comprising an amino acid sequence comprising residues 1 to 311 of FIG. 142 (SEQ ID NO: 352) in one embodiment. Another embodiment of the invention provides a PRO1114 polypeptide comprising about 30 to 311 amino acids of Figure 142 (SEQ ID NO: 352), or amino acids 1 or about 30 to X of Figure 142 (SEQ ID NO: 352), where X is Figure 142 (SEQ ID NO: 352). ), Any amino acid from amino acids 225 to 234). If desired, the PRO1114 polypeptide can be obtained by expressing a polypeptide that is purchased or encoded by the cDNA insert of the DNA57033-1403 vector deposited under ATCC Accession No. 209905 on May 27, 1998.

In another embodiment, the present invention provides an expressed sequence tag (EST), herein designated DNA48466, comprising the nucleotide sequence of FIG. 143 (SEQ ID NO: 353).

We have found a cDNA clone (DNA57033-1403) encoding a novel interferon receptor polypeptide (named herein "PRO1114 interferon receptor").

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1114 interferon receptor polypeptide.

In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1114 interferon receptor polypeptide having a sequence of about 1 or about 30 to about 311 amino acid residues in FIG. 142 (SEQ ID NO: 352), or (b) the (a) A DNA having at least about 80%, preferably at least about 85%, more preferably at least about 90%, most preferably at least about 95% sequence identity with the complement of the DNA molecule.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1114 interferon receptor polypeptide comprising DNA hybridizing with the complement of a nucleic acid between about 250 or about 337 and about 1182 of the nucleotide of FIG. 141 (SEQ ID NO: 351). will be. Preferably, hybridization occurs under stringent hybridization and washing conditions.

In another aspect, the invention relates to a DNA molecule encoding the same mature polypeptide encoded by (a) the human protein cDNA of ATCC Accession No. 209905 (DNA57033-1403) or (b) a nucleic acid molecule of (a) above. An isolated nucleic acid molecule comprising DNA having a sequence identity of at least about 80%, preferably at least about 85%, more preferably at least about 90%, most preferably at least about 95%. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Accession No. 209905 (DNA57033-1403).

In another aspect, the invention provides an antibody comprising (a) at least about 80%, preferably at least about 85% and more preferably at least about 90% of the amino acid residue 1 of Figure 142 (SEQ ID NO: 352) or the sequence of about 30 to about 311; Above, most preferably, it relates to an isolated nucleic acid molecule comprising DNA encoding a polypeptide having sequence identity of at least about 95% or (b) the complement of the DNA of (a).

In another aspect, the invention encodes a PROD114 interferon receptor polypeptide having at least 10 nucleotides and, under stringent conditions, a test DNA molecule (a) having amino acid residue 1 of FIG. 142 (SEQ ID NO: 352) or a sequence from about 30 to about 311 (B) hybridize with the complement of the DNA molecule of (a), and the test DNA molecule is at least about 80%, preferably at least about 85%, more preferably Relates to an isolated nucleic acid molecule produced by isolating a test DNA molecule when it has at least about 90%, most preferably at least about 95% sequence identity.

In certain aspects, the invention includes or encodes a DNA encoding a PRO1114 interferon receptor polypeptide and its soluble variant (ie, the transmembrane domain is deleted or inactivated) with or without an N-terminal signal sequence and / or initiating methionine. Or an isolated nucleic acid molecule complementary to such a coding nucleic acid molecule. By experiment, it was found that the signal peptide spans from about 1 to about 29 amino acid positions in the sequence of FIG. 142 (SEQ ID NO: 352). By experiment, the transmembrane domain was found to span the amino acid position about 230 to about 255 in the PRO1114 interferon receptor amino acid sequence (FIG. 142, SEQ ID NO: 352).

In another aspect, the invention provides (a) at least about 80%, preferably at least about 85%, more preferably about 90 when compared to residue 1 of Figure 142 (SEQ ID NO: 352) or the amino acid sequence of about 30 to about 311 At least%, most preferably at least about 95%, of DNA encoding a polypeptide that is recorded as positive or (b) an isolated nucleic acid molecule comprising the complement of the DNA of (a).

Another embodiment relates to fragments of the PRO1114 interferon receptor polypeptide coding sequence that can be used as hybridization probes. The nucleic acid fragment is about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides, more preferably about 20 to about 50 nucleotides, and most preferably about 20 to about 40 nucleotides in length, Nucleotide sequence shown in FIG. 141 (SEQ ID NO: 351).

In another embodiment, the present invention provides a vector comprising DNA encoding the PRO1114 interferon receptor or variant thereof. This vector may comprise any of the isolated nucleic acid molecules identified above.

The present invention also provides a host cell comprising such a vector. For example, host cells are CHO cells, E. coli. It may be coli or yeast. The invention also provides a method of making a PRO1114 interferon receptor polypeptide, the method comprising culturing a host cell under conditions suitable for expression of the PRO1114 interferon receptor and recovering the PRO1114 interferon receptor from the cell culture.

In another embodiment, the present invention provides an isolated PRO1114 interferon receptor polypeptide encoded by any of the isolated nucleic acid sequences identified above.

In certain aspects, the invention provides an isolated native sequence PRO1114 interferon receptor polypeptide, which in some embodiments comprises an amino acid sequence comprising residue 1 or about 30 to about 311 of FIG. 142 (SEQ ID NO: 352). .

In another aspect, the invention provides an amino acid residue 1 of FIG. 142 (SEQ ID NO: 352) or at least about 80%, preferably at least about 85%, more preferably at least about 90%, most preferred Preferably an isolated PRO1114 interferon receptor polypeptide comprising an amino acid sequence having at least about 95% sequence identity.

In another aspect, the invention provides at least about 80%, preferably at least about 85%, more preferably at least about 90%, when compared to residue 1 of Figure 142 (SEQ ID NO: 352) or the amino acid sequence of about 30 to about 311, Most preferably, it is directed to an isolated PRO1114 interferon receptor polypeptide comprising an amino acid sequence wherein at least about 95% is recorded as positive.

In another aspect, the present invention provides a binding site for an isolated PRO1114 interferon receptor polypeptide, or anti-PRO1114 interferon receptor antibody, comprising the amino acid residue 1 of FIG. 142 (SEQ ID NO: 352) or a sequence from about 30 to about 311. Enough about his short story. Preferably, the PRO1114 interferon receptor fragment retains the qualitative biological activity of the native PRO1114 interferon receptor polypeptide.

In another aspect, the invention provides an antibody comprising (i) a DNA encoding a test DNA molecule under strict conditions (a) a PRO1114 interferon receptor polypeptide having a sequence of about 1 or about 30 to about 311 amino acid residues in FIG. 142 (SEQ ID NO: 352). Hybridizing with the molecule or (b) the complement of the DNA molecule of (a), and wherein the test DNA molecule is at least about 80%, preferably at least about 85%, more preferably with (a) or (b) (Ii) culturing the host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, if at least about 90%, most preferably at least about 95% of sequence identity, and (iii) the cell culture Provided is a polypeptide produced by recovering a polypeptide from the same.

In another embodiment, the present invention provides chimeric molecules comprising a PRO1114 interferon receptor polypeptide fused with a heterologous polypeptide or amino acid sequence. Examples of such chimeric molecules include PRO1114 interferon receptor polypeptides fused with an epitope tag sequence or an F _c region of an immunoglobulin.

In another embodiment, the present invention provides antibodies that specifically bind to PRO1114 interferon receptor polypeptide. Optionally, the antibody is a monoclonal antibody.

In another embodiment, the present invention relates to agonists and antagonists of native PRO1114 interferon receptor polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1114 interferon receptor antibody.

In another embodiment, the present invention relates to a method for identifying an agonist or antagonist of a native PRO1114 interferon receptor polypeptide by contacting the native PRO1114 interferon receptor polypeptide with a candidate molecule and monitoring the biological activity regulated by said polypeptide.

In another embodiment, the present invention relates to a composition comprising a PRO1114 interferon receptor polypeptide or an agonist or antagonist as defined above together with a pharmaceutically acceptable carrier.

53.PRO237

We have found cDNA clones encoding novel polypeptides (named "PRO237" herein) that have homology with carbonic anhydrase.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO237 polypeptide. In one aspect, the isolated nucleic acid comprises or encodes a DNA encoding a PRO237 polypeptide having amino acid residues 1-328 of Figure 145 (SEQ ID NO: 358), complementary to at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, an isolated nucleic acid comprises DNA encoding a PRO237 polypeptide having about 24 to 328 amino acid residues of FIG. 145 (SEQ ID NO: 358), or amino acids 1 or about 24 to X of FIG. 145 (SEQ ID NO: 358), , X is any amino acid from amino acids 172 to 181 of FIG. 145 (SEQ ID NO: 358) or complementary to such a coding nucleic acid sequence, and remains stablely bound thereto at least under moderate conditions, optionally under high stringency conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA34353-1428 vector (deposited under ATCC Accession No. 209855 on May 12, 1998) comprising a nucleotide sequence encoding PRO237.

In another embodiment, the present invention provides an isolated PRO237 polypeptide. In particular, the present invention provides an isolated native sequence PRO237 polypeptide comprising an amino acid sequence comprising residues 1 to 328 of FIG. 145 (SEQ ID NO: 358) in one embodiment. Another embodiment of the invention provides a PRO237 polypeptide comprising about 24 to 328 amino acids of Figure 145 (SEQ ID NO: 358), or amino acids 1 or about 24 to X of Figure 145 (SEQ ID NO: 358), wherein X is Figure 145 (SEQ ID NO: 358). ), Any amino acid from amino acids 172 to 181). If desired, the PRO237 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA34353-1428 vector deposited with ATCC Accession No. 209855 on May 12, 1998.

54.PRO541

We have found cDNA clones encoding novel polypeptides (designated herein as "PRO541") that have homology with trypsin inhibitor proteins.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO541 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO541 polypeptide having amino acid residues 1-500 of FIG. 147 (SEQ ID NO: 363) or is complementary to such a coding nucleic acid sequence, at least in moderate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO541 polypeptide having amino acid residues about 21-500 of FIG. 147 (SEQ ID NO: 363), or is complementary to, and at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a DNA45417-1432 vector (deposited under ATCC Accession No. 209910 on May 27, 1998) comprising a nucleotide sequence encoding PRO541.

In another embodiment, the present invention provides an isolated PRO541 polypeptide. In particular, the present invention provides an isolated native sequence PRO541 polypeptide comprising an amino acid sequence comprising residues 1 to 500 of FIG. 147 (SEQ ID NO: 363) in one embodiment. Another embodiment of the present invention relates to a PRO541 polypeptide comprising amino acids about 21-500 of FIG. 147 (SEQ ID NO: 363). If desired, the PRO541 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA45417-1432 vector deposited under ATCC Accession No. 209910 on May 27, 1998.

55.PRO273

We have found cDNA clones encoding novel polypeptides designated herein as "PRO273".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO273 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO273 polypeptide having amino acid residues 1-111 of Figure 149 (SEQ ID NO: 370) or is complementary to this coding nucleic acid sequence, and at least in moderate conditions, optionally high It remains stable in combination with it under stringent conditions.

In another embodiment, the present invention provides an isolated PRO273 polypeptide. In particular, the present invention provides an isolated native sequence PRO273 polypeptide comprising an amino acid sequence comprising residues 1 to 111 of FIG. 149 (SEQ ID NO: 370) in one embodiment.

56.PRO701

We have found cDNA clones encoding novel polypeptides (named "PRO701" herein) having homology with neuroligin 1, 2 and 3.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO701 polypeptide. In one aspect, this isolated nucleic acid comprises DNA encoding the PRO701 polypeptide having amino acid residues 1-816 of Figure 151 (SEQ ID NO: 375) or is complementary to this coding nucleic acid sequence, and at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited with the ATCC on March 31, 1998) comprising the nucleotide sequence encoding PRO701.

In another embodiment, the present invention provides an isolated PRO701 polypeptide. In particular, the present invention provides an isolated native sequence PRO701 polypeptide comprising an amino acid sequence comprising residues 1 to 816 of FIG. 151 (SEQ ID NO: 375) in one embodiment. Another embodiment of the invention relates to an isolated extracellular domain of a PRO701 polypeptide. If desired, the PRO701 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the vector deposited with the ATCC on March 31, 1998.

57.PRO704

We have found a cDNA clone encoding a novel polypeptide (designated herein as "PRO704") having sequence identity with VIP36.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO704 polypeptide. In one aspect, the isolated nucleic acid comprises or encodes DNA encoding a PRO704 polypeptide having amino acid residues 1 to 348 of Figure 153 (SEQ ID NO: 380) and is complementary to at least a moderate condition, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited with the ATCC as DNA50911-1288 on March 31, 1998) comprising the nucleotide sequence encoding PRO704.

In another embodiment, the present invention provides an isolated PRO704 polypeptide. In particular, the present invention provides an isolated native sequence PRO704 polypeptide comprising an amino acid sequence comprising residues 1 to 348 of Figure 153 (SEQ ID NO: 380) in one embodiment. Another embodiment of the invention relates to an isolated extracellular domain of a PRO704 polypeptide. If desired, the PRO704 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the vector deposited with the ATCC on March 31, 1998, DNA50911-1288.

58.PRO706

We have found cDNA clones encoding novel polypeptides (named herein "PRO706") that have homology with the prostate acid phosphatase precursor and the lysosomal acid phosphatase precursor.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO706 polypeptide. In one aspect, this isolated nucleic acid comprises or encodes a DNA encoding a PRO706 polypeptide having amino acid residues 1 to 480 of Figure 155 (SEQ ID NO: 385) and is complementary to at least a moderate condition, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited with the ATCC as DNA48329-1290 on April 21, 1998) comprising the nucleotide sequence encoding PRO706.

In another embodiment, the present invention provides an isolated PRO706 polypeptide. In particular, the present invention provides an isolated native sequence PRO706 polypeptide comprising, in one embodiment, an amino acid sequence comprising residues 1 to 480 of FIG. 155 (SEQ ID NO: 385) or comprising residues 19 to 480 of FIG. 155 (SEQ ID NO: 385). to provide. If desired, the PRO706 polypeptide may be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the vector deposited with the ATCC as DNA48329-1290 on April 21, 1998.

59.PRO707

We have found a cDNA clone encoding a novel polypeptide (named "PRO707" herein) having homology with Cadherin, in particular Cadherin FIB3.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO707 polypeptide. In one aspect, the isolated nucleic acid comprises or encodes a DNA encoding a PRO707 polypeptide having amino acid residues 1-916 of Figure 157 (SEQ ID NO: 390) and is complementary to at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited with the ATCC as DNA48306-1291 on May 27, 1998) comprising the nucleotide sequence encoding PRO707.

In another embodiment, the present invention provides an isolated PRO707 polypeptide. In particular, the present invention provides an isolated native sequence PRO707 polypeptide comprising an amino acid sequence comprising residues 1 to 916 of Figure 157 (SEQ ID NO: 390) in one embodiment. Another embodiment of the invention relates to an isolated extracellular domain of a PRO707 polypeptide. If desired, PRO707 polypeptide may be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the vector deposited with the ATCC on May 27, 1998, DNA48306-1291.

60.PRO322

We have found a cDNA clone encoding a novel polypeptide (named "PRO322" herein) that has homology with neuropsin.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO322 polypeptide. In one aspect, this isolated nucleic acid comprises DNA encoding the amino acid residues 1 of FIG. 159 (SEQ ID NO: 395) or PRO322 polypeptide having 24 to 260, or is complementary to, and at least intermediate conditions, optionally It remains stable in combination with it under high stringency conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited under ATCC Accession No. 209669 on March 11, 1998) comprising a nucleotide sequence encoding PRO322.

In another embodiment, the present invention provides an isolated PRO322 polypeptide. In particular, the present invention provides an isolated native sequence PRO322 polypeptide comprising an amino acid sequence comprising residues 1 or 24 to 260 of FIG. 159 (SEQ ID NO: 395) in one embodiment. Another embodiment of the invention relates to an isolated extracellular domain of a PRO322 polypeptide. If desired, PRO322 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the vector deposited on March 11, 1998, ATCC Accession No. 209669.

61.PRO526

We have found cDNA clones encoding novel polypeptides (named "PRO526" herein) having sequence identity with ALS.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO526 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO526 polypeptide having amino acid residues 1-473 of Figure 161 (SEQ ID NO: 400), or is complementary to, and at least moderately intermediate, such a coding nucleic acid sequence. It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited with the ATCC as DNA44184-1319 on March 26, 1998) comprising the nucleotide sequence encoding PRO526.

In another embodiment, the present invention provides an isolated PRO526 polypeptide. In particular, the present invention provides an isolated native sequence PRO526 polypeptide comprising an amino acid sequence comprising residues 1 to 473 of Figure 161 (SEQ ID NO: 400) in one embodiment. Optionally, the PRO526 polypeptide is obtained by expressing a polypeptide encoded by the cDNA insert of a vector (deposited by ATCC as DNA44184-1319, March 26, 1998), containing the nucleotide sequence encoding or purchased PRO526. Can be.

62.PRO531

We have found cDNA clones encoding novel polypeptides (named "PRO531" herein) having sequence identity with protocadherin.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO531 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding a PRO531 polypeptide having amino acid residues 1-789 of FIG. 163 (SEQ ID NO: 405), or is complementary to, and at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited as DNA48314-1320 on March 26, 1998) comprising a nucleotide sequence encoding PRO531.

In another embodiment, the present invention provides an isolated PRO531 polypeptide. In particular, the present invention provides an isolated native sequence PRO531 polypeptide comprising an amino acid sequence comprising residues 1 to 789 of FIG. 163 (SEQ ID NO: 405) in one embodiment. Another embodiment of the invention relates to an isolated extracellular domain of a PRO531 polypeptide. If desired, PRO531 polypeptide may be obtained by purchasing or expressing a polypeptide encoded by the cDNA insert of a vector (deposited March 26, 1998 as DNA48314-1320).

63.PRO534

We have found cDNA clones encoding novel polypeptides (named "PRO534" herein) having sequence identity with disulfide isomerase (sometimes referred to herein as protein disulfide isomerase).

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO534 polypeptide. In one aspect, the isolated nucleic acid comprises or encodes a DNA encoding a PRO534 polypeptide having amino acid residues 1-360 of FIG. 165 (SEQ ID NO: 410) and is complementary to at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited as DNA48333-1321 on March 26, 1998) comprising a nucleotide sequence encoding PRO534.

In another embodiment, the present invention provides an isolated PRO534 polypeptide. In particular, the present invention provides an isolated native sequence PRO534 polypeptide comprising an amino acid sequence comprising residues 1 to 360 of FIG. 165 (SEQ ID NO: 410) in one embodiment. Another embodiment of the invention relates to an isolated extracellular domain of a PRO534 polypeptide. If desired, the PRO534 polypeptide can be obtained by expressing it or purchased or expressing the polypeptide encoded by the cDNA insert of the vector (deposited March 26, 1998, DNA48333-1321).

64.PRO697

We have found a cDNA clone encoding a novel polypeptide (designated herein as "PRO697") having sequence identity with sFPR.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO697 polypeptide. In one aspect, this isolated nucleic acid comprises DNA encoding a PRO697 polypeptide having amino acid residues 1 to 295 of FIG. 167 (SEQ ID NO: 415) or is complementary to this coding nucleic acid sequence, and at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited as DNA50920-1325 in the ATCC on March 26, 1998) comprising the nucleotide sequence encoding PRO697.

In another embodiment, the present invention provides an isolated PRO697 polypeptide. In particular, the present invention provides an isolated native sequence PRO697 polypeptide comprising an amino acid sequence comprising residues 1-22 of FIG. 167 (SEQ ID NO: 415) in one embodiment. If desired, the PRO697 polypeptide may be obtained by purchasing or expressing a polypeptide encoded by the cDNA insert of a vector (deposited as AT509509-1325 in the ATCC on March 26, 1998).

65.PRO717

We have found a cDNA clone that encodes a novel 12-membrane polypeptide named herein as "PRO717".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO717 polypeptide. In one aspect, the isolated nucleic acid comprises or encodes a DNA encoding a PRO717 polypeptide having amino acid residues 1-560 of FIG. 169 (SEQ ID NO: 420) and is complementary to at least a moderate condition, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited with the ATCC as DNA50988-1326, April 28, 1998), comprising the nucleotide sequence encoding PRO717.

In another embodiment, the present invention provides an isolated PRO717 polypeptide. In particular, the present invention provides an isolated native sequence PRO717 polypeptide comprising an amino acid sequence comprising residues 1 to 560 of FIG. 169 (SEQ ID NO: 420) in one embodiment. Another embodiment of the invention relates to an isolated extracellular domain of a PRO717 polypeptide. If desired, the PRO717 polypeptide can be obtained by expressing it or purchased or expressing the polypeptide encoded by the cDNA insert of the vector (deposited by ATCC as DNA50988-1326 on April 28, 1998).

66.PRO731

We have found a cDNA clone encoding a novel polypeptide (designated herein as "PRO731") having sequence identity with Protocadherin 4.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO731 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO731 polypeptide having amino acid residues 1 to 1184 of Figure 171 (SEQ ID NO: 425) or is complementary to such a coding nucleic acid sequence, and at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited with the ATCC as DNA48331-1329, March 31, 1998), comprising the nucleotide sequence encoding PRO731.

In another embodiment, the present invention provides an isolated PRO731 polypeptide. In particular, the present invention provides an isolated native sequence PRO731 polypeptide comprising an amino acid sequence comprising residues 1 to 1184 of FIG. 171 (SEQ ID NO: 425) in one embodiment. Another embodiment of the invention relates to an isolated extracellular domain of a PRO731 polypeptide. If desired, the PRO731 polypeptide can be obtained by expressing it or purchased or expressing the polypeptide encoded by the cDNA insert of the vector (deposited by ATCC as DNA48331-1329 on March 31, 1998).

67.PRO218

We have found a cDNA clone encoding a novel multi-membrane protein (named "PRO218" herein) having sequence identity with the membrane regulatory protein.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO218 polypeptide. In one aspect, the isolated nucleic acid comprises or encodes a DNA encoding a PRO218 polypeptide having amino acid residues 1 to 455 of Figure 173 (SEQ ID NO: 430) and is complementary to at least a moderate condition, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited with the ATCC as DNA30867-1335, April 28, 1998), comprising the nucleotide sequence encoding PRO218.

In another embodiment, the present invention provides an isolated PRO218 polypeptide. In particular, the present invention provides an isolated native sequence PRO218 polypeptide comprising an amino acid sequence comprising residues 1 to 455 of FIG. 173 (SEQ ID NO: 430) in one embodiment. If desired, PRO218 polypeptide may be obtained by purchasing or expressing the polypeptide encoded by the cDNA insert of the vector (deposited by ATCC as DNA30867-1335, April 28, 1998).

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA14472, comprising the nucleotide sequence of FIG. 174 (SEQ ID NO: 431).

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA15846, comprising the nucleotide sequence of FIG. 175 (SEQ ID NO: 432).

68.PRO768

We have found cDNA clones encoding novel polypeptides (named "PRO768" herein) having sequence identity with integrins.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO768 polypeptide. In one aspect, the isolated nucleic acid comprises or encodes a DNA encoding a PRO768 polypeptide having amino acid residues 1 to 1141 of FIG. 177 (SEQ ID NO: 437) and is complementary to at least a moderate condition, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited as DNA55737-1345, April 6, 1998), comprising the nucleotide sequence encoding PRO768.

In another embodiment, the present invention provides an isolated PRO768 polypeptide. In particular, the present invention provides an isolated native sequence PRO768 polypeptide comprising an amino acid sequence comprising residues 1 to 1141 of FIG. 177 (SEQ ID NO: 437) in one embodiment. Another embodiment of the invention relates to an isolated extracellular domain of a PRO768 polypeptide. If desired, the PRO768 polypeptide may be obtained by expressing it or purchased or expressing the polypeptide encoded by the cDNA insert of the vector (deposited as DNA55737-1345, April 6, 1998).

69.PRO771

We have found cDNA clones encoding novel polypeptides (named “PRO771” herein) having sequence identity with testican.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO771 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO771 polypeptide having amino acid residues 1-436 of Figure 179 (SEQ ID NO: 442), or is complementary to, and at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited by ATCC as DNA49829-1346 to ATCC on April 7, 1998), comprising the nucleotide sequence encoding PRO771.

In another embodiment, the present invention provides an isolated PRO771 polypeptide. In particular, the present invention provides an isolated native sequence PRO771 polypeptide comprising, in one embodiment, an amino acid sequence comprising residues 1-436 of FIG. 179 (SEQ ID NO: 442). If desired, the PRO771 polypeptide can be obtained by purchasing or expressing the polypeptide encoded by the cDNA insert of the vector (deposited as DNA49829-1346, April 7, 1998).

70.PRO733

We have found cDNA clones encoding novel polypeptides (named herein "PRO733") having sequence identity with the T1 / ST2 receptor binding protein.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO733 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding the PRO733 polypeptide having amino acid residues 1 to 229 of Figure 181 (SEQ ID NO: 447), and is at least moderate, optionally It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited with the ATCC as DNA52196-1348, April 7, 1998), comprising the nucleotide sequence encoding PRO733.

In another embodiment, the present invention provides an isolated PRO733 polypeptide. In particular, the present invention provides an isolated native sequence PRO733 polypeptide comprising, in one embodiment, an amino acid sequence comprising residues 1 to 229 of FIG. 181 (SEQ ID NO: 447). Another embodiment of the invention relates to an isolated extracellular domain of a PRO733 polypeptide. If desired, the PRO733 polypeptide may be obtained by purchasing or expressing the polypeptide encoded by the cDNA insert of the vector (deposited as DNA52196-1348 on April 7, 1998).

71.PRO162

We have found cDNA clones encoding novel polypeptides (named "PRO162" herein) having sequence identity with pancreatitis-related proteins.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO162 polypeptide. In one aspect, the isolated nucleic acid comprises or encodes a DNA encoding a PRO162 polypeptide having amino acid residues 1-175 of Figure 183 (SEQ ID NO: 452) and is complementary to at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited with the ATCC on May 6, 1998, DNA56965-1356) comprising the nucleotide sequence encoding PRO162.

In another embodiment, the present invention provides an isolated PRO162 polypeptide. In particular, the present invention provides an isolated native sequence PRO162 polypeptide comprising an amino acid sequence comprising residues 1 to 175 of FIG. 183 (SEQ ID NO: 452) in one embodiment. If desired, the PRO162 polypeptide can be obtained or obtained by expressing the polypeptide encoded by the cDNA insert of the vector (deposited with the ATCC on May 6, 1998, DNA56965-1356).

72.PRO788

We have found cDNA clones encoding novel polypeptides (named "PRO788" herein) having sequence identity with anti-neoplastic urine proteins.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO788 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding a PRO788 polypeptide having amino acid residues 1-125 of Figure 185 (SEQ ID NO: 454) or is complementary to such a coding nucleic acid sequence, and at least in moderate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited with the ATCC on May 6, 1998, DNA56405-1357) comprising the nucleotide sequence encoding PRO788.

In another embodiment, the present invention provides an isolated PRO788 polypeptide. In particular, the present invention provides an isolated native sequence PRO788 polypeptide comprising an amino acid sequence comprising residues 1 to 125 of FIG. 185 (SEQ ID NO: 454) in one embodiment. Another embodiment of the invention relates to an isolated extracellular domain of a PRO788 polypeptide. If desired, the PRO788 polypeptide can be obtained by expressing it or purchased or expressing the polypeptide encoded by the cDNA insert of the vector (deposited by ATCC as DNA56405-1357 on May 6, 1998).

73.PRO1008

We have found cDNA clones encoding novel polypeptides (named herein "PRO1008") having sequence identity with dickkopf-1 (dkk-1).

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1008 polypeptide. In one aspect, this isolated nucleic acid comprises DNA encoding a PRO1008 polypeptide having amino acid residues 1 to 266 of Figure 187 (SEQ ID NO: 456) or is complementary to such a coding nucleic acid sequence, and at least intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited with the ATCC on May 20, 1998, DNA57530-1375) comprising the nucleotide sequence encoding PRO1008.

In another embodiment, the present invention provides an isolated PRO1008 polypeptide. In particular, the present invention provides an isolated native sequence PRO1008 polypeptide comprising an amino acid sequence comprising residues 1 to 266 of FIG. 187 (SEQ ID NO: 456) in one embodiment. If desired, the PRO1008 polypeptide may be obtained by purchasing or expressing the polypeptide encoded by the cDNA insert of the vector (deposited in ATCC as DNA57530-1375 on May 20, 1998).

In another embodiment, the present invention provides an expressed sequence tag (EST), designated herein as DNA16508, comprising the nucleotide sequence of FIG. 188 (SEQ ID NO: 457).

74.PRO1012

We have found cDNA clones encoding novel polypeptides (designated herein as "PRO1012") having sequence identity with disulfide isomerase and phospholipase C.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1012 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO1012 polypeptide having amino acid residues 1 to 747 of FIG. 190 (SEQ ID NO: 459) or is complementary to such a coding nucleic acid sequence, and at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited with the ATCC as DNA56439-1376, May 14, 1998), comprising the nucleotide sequence encoding PRO1012.

In another embodiment, the present invention provides an isolated PRO1012 polypeptide. In particular, the present invention provides an isolated native sequence PRO1012 polypeptide comprising an amino acid sequence comprising residues 1 to 747 of FIG. 190 (SEQ ID NO: 459) in one embodiment. If desired, the PRO1012 polypeptide can be obtained by expressing it or purchased or expressing the polypeptide encoded by the cDNA insert of the vector (deposited by ATCC as DNA56439-1376 on May 14, 1998).

75.PRO1014

We have found cDNA clones encoding novel polypeptides (named "PRO1014" herein) having sequence identity with reductase.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1014 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding the PRO1014 polypeptide having amino acid residues 1-300 of Figure 192 (SEQ ID NO: 464), and is at least moderately conditioned, optionally with high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited with the ATCC as DNA56409-1377 on May 20, 1998) comprising the nucleotide sequence encoding PRO1014.

In another embodiment, the present invention provides an isolated PRO1014 polypeptide. In particular, the present invention provides an isolated native sequence PRO1014 polypeptide comprising, in one embodiment, an amino acid sequence comprising residues 1 to 300 of FIG. 192 (SEQ ID NO: 464). If desired, the PRO1014 polypeptide can be obtained by purchasing or expressing the polypeptide encoded by the cDNA insert of the vector (deposited by ATCC as DNA56409-1377 on May 20, 1998).

76.PRO1017

We have found a cDNA clone encoding a novel polypeptide (designated herein as "PRO1017") having sequence identity with HNK-1 sulfotransferase.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1017 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO1017 polypeptide having amino acid residues 1 to 414 of Figure 194 (SEQ ID NO: 466) or is complementary to such a coding nucleic acid sequence and, at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited with the ATCC as DNA56112-1379, May 20, 1998) comprising the nucleotide sequence encoding PRO1017.

In another embodiment, the present invention provides an isolated PRO1017 polypeptide. In particular, the present invention provides an isolated native sequence PRO1017 polypeptide comprising an amino acid sequence comprising residues 1-414 of FIG. 194 (SEQ ID NO: 466) in one embodiment. If desired, the PRO1017 polypeptide can be obtained by purchasing or expressing the polypeptide encoded by the cDNA insert of the vector (deposited by ATCC as DNA56112-1379, May 20, 1998).

77.PRO474

We have found cDNA clones encoding novel polypeptides (designated herein as "PRO474") having sequence identity with dehydrogenase.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO474 polypeptide. In one aspect, the isolated nucleic acid comprises or encodes a DNA encoding a PRO474 polypeptide having amino acid residues 1 to 270 of FIG. 196 (SEQ ID NO: 468) and is complementary to at least a moderate condition, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited with the ATCC as DNA56045-1380, May 14, 1998), comprising the nucleotide sequence encoding PRO474.

In another embodiment, the present invention provides an isolated PRO474 polypeptide. In particular, the present invention provides an isolated native sequence PRO474 polypeptide comprising an amino acid sequence comprising residues 1 to 270 of FIG. 196 (SEQ ID NO: 468) in one embodiment. If desired, the PRO474 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the vector deposited with the ATCC with DNA56045-1380 on May 14, 1998.

78.PRO1031

We have found cDNA clones encoding novel polypeptides (named "PRO1031" herein) having sequence identity with IL-17.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1031 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO1031 polypeptide having amino acid residues 1-180 of FIG. 198 (SEQ ID NO: 470) or is complementary to such a coding nucleic acid sequence, and at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited with the ATCC as DNA59294-1381, May 14, 1998) comprising the nucleotide sequence encoding PRO1031.

In another embodiment, the present invention provides an isolated PRO1031 polypeptide. In particular, the present invention provides an isolated native sequence PRO1031 polypeptide comprising an amino acid sequence comprising residues 1 to 180 of FIG. 198 (SEQ ID NO: 470) in one embodiment. If desired, the PRO1031 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the vector deposited with the ATCC as DNA59294-1381 on May 14, 1998.

79.PRO938

We have found cDNA clones encoding novel polypeptides (named "PRO938" herein) having sequence identity with the protein disulfide isomerase.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO938 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding a PRO938 polypeptide having amino acid residues 1 to 349 of FIG. 200 (SEQ ID NO: 472) or is complementary to such a coding nucleic acid sequence, and at least in intermediate conditions, optionally high It remains stable in combination with it under stringent conditions. In another aspect, the isolated nucleic acid comprises DNA encoding a PRO938 polypeptide having about 23 to 349 amino acid residues of FIG. 200 (SEQ ID NO: 472), or amino acids 1 or about 23 to X of FIG. 200 (SEQ ID NO: 472), wherein , X is any amino acid from amino acids 186 to 195 of FIG. 200 (SEQ ID NO: 472) or is complementary to such a coding nucleic acid sequence and remains stablely bound thereto at least under moderate conditions, optionally high stringency conditions. The isolated nucleic acid sequence may comprise the cDNA insert of the DNA56433-1406 vector (deposited under ATCC Accession No. 209857 on May 12, 1998), comprising the nucleotide sequence encoding PRO938.

In another embodiment, the present invention provides an isolated PRO938 polypeptide. In particular, the present invention provides an isolated native sequence PRO938 polypeptide comprising an amino acid sequence comprising residues 1 to 349 of FIG. 200 (SEQ ID NO: 472) in one embodiment. Another embodiment of the present invention provides a PRO938 polypeptide comprising amino acids about 23 to 349 of Figure 200 (SEQ ID NO: 472), or amino acids 1 or about 23 to X of Figure 200 (SEQ ID NO: 472), wherein X is Figure 200 (SEQ ID NO: 472). ), Any amino acid from amino acids 186 to 195. If desired, the PRO938 polypeptide may be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the DNA56433-1406 vector deposited with ATCC Accession No. 209857 on May 12, 1998.

80.PRO1082

We have found cDNA clones encoding novel polypeptides (designated herein as "PRO1082") having sequence identity to oxidized LDL receptors similar to lectins.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1082 polypeptide. In one aspect, this isolated nucleic acid comprises or is complementary to DNA encoding a PRO1082 polypeptide having amino acid residues 1 to 201 of FIG. 202 (SEQ ID NO: 477), at least moderate conditions, optionally high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited with the ATCC as DNA53912-1457, May 14, 1998), comprising the nucleotide sequence encoding PRO1082.

In another embodiment, the present invention provides an isolated PRO1082 polypeptide. In particular, the present invention provides an isolated native sequence PRO1082 polypeptide comprising an amino acid sequence comprising residues 1-20 of FIG. 202 (SEQ ID NO: 477) in one embodiment. Another embodiment of the invention relates to an isolated domain of PRO1082 polypeptide, which does not comprise a transmembrane domain. If desired, the PRO1082 polypeptide may be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the vector deposited with the ATCC on May 14, 1998, DNA53912-1457.

81.PRO1083

We have found a cDNA clone encoding a novel polypeptide (named herein "PRO1083") having sequence identity with the 7TM receptor, latropylin-based protein 1 and glycoproteins on defined cell surfaces of macrophages.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1083 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO1083 polypeptide having amino acid residues 1-693 of FIG. 204 (SEQ ID NO: 483) or is complementary to such a coding nucleic acid sequence, at least in moderate conditions, optionally with high It remains stable in combination with it under stringent conditions. The isolated nucleic acid sequence may comprise a cDNA insert of a vector (deposited with the ATCC on May 12, 1998, DNA50921-1458) comprising the nucleotide sequence encoding PRO1083.

In another embodiment, the present invention provides an isolated PRO1083 polypeptide. In particular, the present invention provides an isolated native sequence PRO1083 polypeptide comprising an amino acid sequence comprising residues 1 to 693 of FIG. 204 (SEQ ID NO: 483) in one embodiment. Another embodiment of the invention relates to an isolated extracellular domain of a PRO1083 polypeptide. If desired, the PRO1083 polypeptide can be obtained by expressing the polypeptide that is purchased or encoded by the cDNA insert of the vector deposited with the ATCC on May 12, 1998, DNA50921-1458.

In another embodiment, the present invention provides an expressed sequence tag (EST) (named DNA24256 herein) comprising the nucleotide sequence of FIG. 205 (SEQ ID NO: 484).

82.PRO200

As described above, it is an object of the present invention to provide at least in part a novel polypeptide VEGF-E (herein also referred to as PRO200 (SEQ ID NO: 488)) and SEQ ID NO: 487 (residues 259-1293) which are nucleic acids encoding it. .

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a VEGF-E polypeptide. In one aspect, the isolated nucleic acid comprises or encodes a DNA encoding a VEGF-E polypeptide having amino acid residues 1-345 of Figure 207 (SEQ ID NO: 488) and is complementary to such coding nucleic acid sequences, and under low stringency conditions. It remains stable and bonded. In other embodiments, the invention provides variants wherein the VEGF-E nucleic acid has one or several deletions, substitutions, insertions, truncations, or a combination thereof.

In another embodiment, the present invention provides an isolated VEGF-E polypeptide. In particular, the present invention provides an isolated native sequence VEGF-E polypeptide comprising an amino acid sequence comprising residues 1 to 345 of FIG. 207 (SEQ ID NO: 488) in one embodiment. In another embodiment, the present invention provides variants wherein the VEGF-E polypeptide has one or several deletions, substitutions, insertions, truncations, or a combination thereof.

In another embodiment, the present invention is directed to a composition useful for the treatment of a condition requiring proliferation, survival and / or differentiation of a cell, comprising a therapeutically effective amount of a VEGF-E polypeptide and a pharmaceutically acceptable carrier.

The invention also includes related embodiments of VEGF-E, such as modified VEGF-E polypeptides and modified variants thereof having the same biological use as VEGF-E, and pharmaceutical compositions comprising the same. The invention also provides inhibitors of VEGF-E.

83.PRO285 and PRO286

We have found two novel cDNA clones that encode novel human Toll polypeptides named PRO285 (coded by DNA40021-1154) and PRO286 (coded by DNA42663-1154) herein.

In one embodiment, the invention provides an antibody comprising (a) a DNA molecule encoding a PRO285 polypeptide having amino acid residues 27 to 839 of Figure 209 (SEQ ID NO: 496) or (b) having amino acid residues 27 to 825 of Figure 211 (SEQ ID NO: 498). At least about 80%, preferably at least about 85%, more preferably at least about 90%, most closely with the DNA molecule encoding the PRO286 polypeptide, or (c) the complement of the DNA molecule of (a) or (b) Preferably, an isolated nucleic acid molecule comprising DNA encoding a polypeptide having at least about 95% sequence identity is provided. Complementary DNA molecules are preferably stably bound to these coding nucleic acid sequences under at least moderate conditions, optionally under high stringency conditions.

In another embodiment, the isolated nucleic acid molecule is at least about 90%, preferably at least about 95%, or 211 (polynucleotide encoding a polypeptide comprising a sequence of amino acids 1-839 of Figure 209 (SEQ ID NO: 496) Polynucleotides having a sequence identity of at least about 90%, preferably at least about 95%, with a polynucleotide encoding a polypeptide comprising a sequence of amino acids 1-1041 of SEQ ID NO: 498).

In certain embodiments, the invention provides isolated nucleic acid molecules comprising DNA encoding native or variant PRO285 and PRO286 polypeptides with or without an N-terminal signal sequence and with or without the transmembrane region of each full length sequence. In one aspect, the isolated nucleic acid comprises DNA encoding a mature full-length native PRO285 or PRO286 polypeptide having amino acid residues 1-1049 of Figure 209 (SEQ ID NO: 496), and amino acid residues 1-1041 of Figure 211 (SEQ ID NO: 498). Or is complementary to such coding nucleic acid sequences. In another aspect, the invention relates to an isolated nucleic acid molecule comprising or complementary to a DNA encoding a native PRO285 or PRO286 polypeptide without an N-terminal signal sequence. In another embodiment, the present invention relates to a nucleic acid encoding a full-length native PRO285 or PRO286 protein in a form in which the transmembrane domain is deleted or inactivated.

In another embodiment, the invention provides a clone deposited as ATCC Accession No. 209389 (October 17, 1997) (DNA40021-1154) or a clone deposited as ATCC Accession No. 209386 (October 17, 1997) (DNA42663-1154). It provides an isolated nucleic acid molecule comprising a.

In another embodiment, the present invention provides vectors comprising DNA encoding PRO285 and PRO286 polypeptides, or variants thereof. As such, the vector may comprise any of the isolated nucleic acid molecules as defined above.

In other embodiments, the present invention provides isolated PRO285 and PRO286 polypeptides. In particular, the present invention provides isolated native sequence PRO285 and PRO286 polypeptides comprising, in one embodiment, amino acid sequences comprising residues 1-1049 and 1-1041 of FIGS. 209 and 211 (SEQ ID NOS: 496 and 498), respectively. The invention also provides variants of the PRO285 and PRO286 polypeptides encoded by any of the isolated nucleic acid molecules as defined above. Certain variants lack the (terminally truncated) variants of the full-length native sequence PRO285 and PRO286 polypeptides with respective transmembrane and / or cytoplasmic domains that lack and / or are deleted or inactivated at each N-terminal signal sequence. Included, but not limited to.

In addition, the present invention includes antibodies having specifically bispecificity, for example, bispecific antibodies that bind to one or more Toll polypeptides.

In another embodiment, the present invention relates to agonists and antagonists of native PRO285 and PRO286 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO285 or anti-PRO286 antibody.

In a further embodiment, the present invention relates to screening assays to identify agonists or antagonists of native PRO285 and PRO286 polypeptides.

In another embodiment, the invention relates to a composition comprising a PRO285 or PRO286 polypeptide, or an agonist or antagonist as defined above, together with a pharmaceutically acceptable carrier.

The invention further relates to a composition comprising an antibody that specifically binds to a PRO285 or PRO286 polypeptide, together with a pharmaceutically acceptable carrier.

The invention also relates to a method of treating sepsis shock comprising administering to a patient an effective amount of an antagonist of PRO285 or PRO286 polypeptide. In certain embodiments, the antagonist is a blocking antibody that specifically binds to a native PRO285 or PRO286 polypeptide.

84.PRO213-1, PRO1330, and PRO1449

The present invention relates to compositions and methods for the diagnosis and treatment of growth and proliferation of tumorous cells of mammals, including humans. The present invention is based on identifying genes that are amplified in the genome of tumor cells. This gene amplification is associated with overexpression of gene products and is thought to contribute to tumor development. Thus, the protein encoded by the amplified gene is considered to be a useful target in the diagnosis and / or treatment (including prevention) of several cancers, and may serve to inform the prognosis of tumor treatment.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding the PRO213-1, PRO1330, and / or PRO1449 polypeptide. In one aspect, the isolated nucleic acid has amino acid residues 1 to 295 of Figure 213 (SEQ ID NO: 506), amino acid residues 20 to 273 of Figure 215 (SEQ ID NO: 508), and amino acid residues 20 to 273 of Figure 217 (SEQ ID NO: 510), respectively. Comprises or complements DNA encoding the PRO213-1, PRO1330, and / or PRO1449 polypeptides, and remains stablely associated therewith under at least moderate conditions, optionally high stringency conditions. Isolated nucleic acid sequences are DNA30943-1163 (ATCC209791) deposited April 21, 1998, DNA64907-1163-1 (ATCC203242) deposited 9 September 1998 and / or DNA64908- deposited 9 September 1998. CDNA insert of a vector named 1163-1 (ATCC203243).

In another embodiment, the present invention relates to (a) amino acid residues 1 to 295 of Figure 213 (SEQ ID NO: 506), amino acid residues 20 to 273 of Figure 215 (SEQ ID NO: 508), and amino acid residues 20 to 273 of Figure 217 (SEQ ID NO: 510). At least about 80%, preferably at least about 85%, more preferably at least about 90% of the DNA molecules encoding the PRO213-1, PRO1330, and / or PRO1449 polypeptides each having a An isolated nucleic acid molecule having sequence identity of at least%, most preferably at least about 95%.

In another embodiment, the present invention provides isolated PRO213-1, PRO1330, and / or PRO1449 polypeptides. In particular, the present invention provides, in one embodiment, an amino acid comprising residues 1-22 of FIG. 213 (SEQ ID NO: 506), residues 20-273 of FIG. 215 (SEQ ID NO: 508), or residues 20-273 of FIG. 217 (SEQ ID NO: 510), respectively. An isolated native sequence PRO213-1, PRO1330, and / or PRO1449 polypeptide comprising the sequence is provided. Optionally, PRO213-1, PRO1330 and / or PRO1449 polypeptides are purchased or encoded by cDNA inserts of DNA30943-1163 (ATCC209791), DNA64907-1163-1 (ATCC203242) or DNA64908-1163-1 (ATCC203243). It can obtain by expressing the polypeptide to become.

In another aspect, the invention provides amino acid residues 1-22 of FIG. 213 (SEQ ID NO: 506), amino acid residues 20-273 of FIG. 215 (SEQ ID NO: 508), or amino acid residues 20-273 of FIG. 217 (SEQ ID NO: 510) and about 80; Isolated PRO213-1, PRO1330, and / or PRO1449 polypeptide comprising amino acid sequences having at least%, preferably at least about 85%, more preferably at least about 90%, most preferably at least about 95% sequence identity To provide.

In another embodiment, the invention comprises amino acid residues 1-22 of FIG. 213 (SEQ ID NO: 506), amino acid residues 20-273 of FIG. 215 (SEQ ID NO: 508), or amino acid residues 20-273 of FIG. 217 (SEQ ID NO: 510). To provide an isolated PRO213-1, PRO1330 and / or PRO1449 polypeptide, or a fragment thereof sufficient to provide a binding site for an anti-PRO213-1, anti-PRO1330 and / or anti-PRO1449 antibody. Preferably, the PRO213-1, PRO1330 and / or PRO1449 fragments retain the qualitative biological activity of the native PRO213-1, PRO1330 and / or PRO1449 polypeptides.

In a further aspect, the invention compares the amino acid sequences of residues 1 to 295 of Figure 213 (SEQ ID NO: 506), residues 20 to 273 of Figure 215 (SEQ ID NO: 508), and residues 20 to 273 of Figure 217 (SEQ ID NO: 510), respectively. Isolated PRO213-1, PRO1330 and at least about 80%, preferably at least about 85%, more preferably at least about 90%, most preferably at least about 95%, comprising amino acid sequences recorded as positive (Or) relates to a PRO1449 polypeptide.

In another aspect, the present invention provides a method for the preparation of (i) test DNA molecules under stringent conditions, including (a) amino acid residues 1 to 295 of FIG. 213 (SEQ ID NO: 506), amino acid residues 20 to 273 of FIG. Hybridizing with a DNA molecule encoding a PRO213-1, PRO1330 and / or PRO1449 polypeptide having amino acid residues 20 to 273 of SEQ ID NO: 510, respectively, or (b) the complement of the DNA molecule of (a), and test DNA If the molecule has at least about 80% sequence identity with (a) or (b), (ii) culturing the host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) cell culture Provided is a polypeptide produced by recovering a polypeptide from water.

In one embodiment, the invention relates to an isolated antibody that binds to PRO213-1, PRO1330, and / or PRO1449 polypeptides. In one aspect, the antibody induces death of cells overexpressing PRO213-1, PRO1330 and / or PRO1449 polypeptides. In another aspect, the antibody is preferably a monoclonal antibody having residues in a non-human complementarity determining region (CDR) and residues in a human framework region (FR). The antibody can be labeled and immobilized on a solid support. In another aspect, the antibody is an antibody fragment, single chain antibody or anti-genic antibody.

In another embodiment, the present invention is directed to a composition comprising an antibody that binds a PRO213-1, PRO1330, and / or PRO1449 polypeptide together with a pharmaceutically acceptable carrier. In one aspect, the composition comprises a therapeutically effective amount of the antibody. In another aspect, the composition includes additional active ingredients, which may be, for example, other antibodies, or cytotoxic or chemotherapeutic agents. Preferably the composition is sterile.

In a further embodiment, the present invention relates to nucleic acids encoding anti-PRO213-1, anti-PRO1330 and / or anti-PRO1449 antibodies, and vectors and recombinant host cells comprising such nucleic acids.

The invention also relates to antagonists and agonists of the PRO213-1, PRO1330 and / or PRO1449 polypeptides that inhibit one or more functions or activities of the PRO213-1, PRO1330 and / or PRO1449 polypeptides.

In a further embodiment, the invention relates to an isolated nucleic acid molecule that hybridizes with the complement of a nucleic acid molecule encoding a PRO213-1, PRO1330, and / or PRO1449 polypeptide. The nucleic acid is preferably DNA and hybridization preferably takes place under stringent conditions. Such nucleic acid molecules can act as antisense molecules of the amplified genes identified herein, that is to say used to control each amplified gene or as an antisense primer in an amplification reaction. This sequence can also be used as part of a ribozyme and / or triple helical sequence, ie, to control amplified genes.

In another embodiment, the invention provides a method of exposing a cell suspected of containing a PRO213-1, PRO1330, and / or PRO1449 polypeptide to an anti-PRO213-1, PRO1330, and / or PRO1449 antibody, and wherein the antibody is A method for identifying the presence of PRO213-1, PRO1330, and / or PRO1449 polypeptides, comprising confirming binding to a cell.

In another embodiment, the invention encodes a PRO213-1, PRO1330 and / or PRO1449 polypeptide in (a) a test sample of tissue cells obtained from a mammal and (b) a control sample of known normal tissue cells of the same cell type. Detecting a level of expression of the gene, wherein the expression is at a higher level in the test sample, wherein the tumor is present in the mammal from which the test tissue cell is obtained. .

In another embodiment, the present invention provides a method for treating a test sample comprising (a) contacting an anti-PRO213-1, anti-PRO1330 and / or anti-PRO1449 antibody with a test sample of tissue cells obtained from a mammal and (b) in the test sample A method for diagnosing a tumor in a mammal comprising detecting the formation of a conjugate of an anti-PRO213-1, anti-PRO1330 and / or anti-PRO1449 antibody with a PRO213-1, PRO1330 and / or PRO1449 polypeptide. will be. Detection can be qualitative or quantitative and can be performed compared to monitoring the formation of conjugates in a control sample of known normal tissue cells of the same cell type. The large amount of conjugate formed in the test sample indicates the presence of tumors in the mammal from which the test tissue cells were obtained. The antibody preferably comprises a detectable label. Formation of the conjugates can be monitored, for example, by optical microscopy, flow cytometry, fluorometry, or other techniques known in the art. Test samples are generally obtained from an individual suspected of growing or proliferating tumor cells (eg, cancer cells).

In another embodiment, the present invention relates to a cancer diagnostic kit comprising an anti-PRO213-1, anti-PRO1330, and / or anti-PRO1449 antibody and a carrier (eg, a buffer) in a suitable container. This kit preferably includes instructions for using antibodies to detect PRO213-1, PRO1330, and / or PRO1449 polypeptides.

In another embodiment, the invention provides an effective amount of a cell that overexpresses PRO213-1, PRO1330, and / or PRO1449 polypeptides and inhibits the expression and / or activity of PRO213-1, PRO1330, and / or PRO1449 polypeptides. A method of inhibiting growth of tumor cells, comprising exposure to a substance. This material is preferably an anti-PRO213-1, anti-PRO1330 and / or anti-PRO1449 antibody, small organic and inorganic molecules, peptides, phosphopeptides, antisense or ribozyme molecules, or triple helical molecules. In certain aspects, these agents, such as anti-PRO213-1, anti-PRO1330 and / or anti-PRO1449 antibodies, induce cell death. In another aspect, the tumor cells are further exposed to radiation treatment and / or cytotoxic or chemotherapeutic agents.

In another embodiment, the present invention provides a container comprising: a) a container; b) a label on the container; And c) a composition comprising an active substance contained in a container, wherein said composition is effective to inhibit the growth of tumor cells, wherein the label on the container uses PRO213-1, PRO1330 and (Or) Indicates that a condition characterized by overexpression of a PRO1449 polypeptide can be treated, and the active agent in the composition is a substance that inhibits the expression and / or activity of PRO213-1, PRO1330, and / or PRO1449 polypeptide. In a preferred aspect, the active agent is an anti-PRO213-1, anti-PRO1330 and / or anti-PRO1449 antibody.

In another embodiment, the present invention relates to contacting a candidate compound with a PRO213-1, PRO1330 and / or PRO1449 polypeptide for a period of time sufficient to allow the candidate compound to interact with the PRO213-1, PRO1330, and / or PRO1449 polypeptide. The present invention relates to a method for identifying a compound that can inhibit the expression and / or activity of PRO213-1, PRO1330, and / or PRO1449 polypeptide. In certain aspects, the candidate compound or PRO213-1, PRO1330, and / or PRO1449 polypeptides are immobilized on a solid phase support. In another aspect, the non-fixed component comprises a detectable label.

85.PRO298

We have found cDNA clones encoding the novel polypeptides. This DNA, herein named "DNA39975-1210", encodes a novel multi-membrane protein called "PRO298".

In one embodiment, the invention provides an antibody comprising (a) a DNA molecule encoding PRO298 comprising the sequences of amino acids 1 to 364 of Figure 219 (SEQ ID NO: 515) or (b) the complement of the DNA molecule of (a) An isolated nucleic acid molecule is provided comprising DNA having sequence identity of at least%, preferably at least about 85%, more preferably at least about 90%, most preferably at least about 95%. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO298 polypeptide having amino acid residues 1 to 364 of Figure 219 (SEQ ID NO: 515) or is complementary to, and at least in moderate conditions, optionally high stringency. Under these conditions, it remains stablely bonded thereto.

In another embodiment, the invention provides a DNA molecule encoding the same mature polypeptide encoded by (a) the human protein cDNA of ATCC Accession No. 209783 (DNA39975-1210) or (b) a DNA molecule of (a) above. An isolated nucleic acid molecule comprising DNA having at least 80% sequence identity with a complement.

In another embodiment, the present invention relates to a nucleic acid comprising a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Accession No. 209783 (DNA39975-1210).

In another embodiment, the present invention provides an isolated PRO298 polypeptide. In particular, the present invention provides an isolated native sequence PRO298 polypeptide comprising an amino acid sequence comprising residues 1 to 364 of Figure 219 (SEQ ID NO: 515) in one embodiment.

In another embodiment, the present invention provides an expressed sequence tag (EST) (named DNA26832) comprising the nucleotide sequence of FIG. 220 (SEQ ID NO: 516).

86.PRO337

We have found a cDNA clone (DNA43316-1237) that encodes a novel polypeptide named "PRO337" herein.

In one embodiment, the invention provides a pharmaceutical composition comprising (a) a DNA molecule encoding a PRO337 polypeptide comprising the sequences of amino acids 1 to 344 of Figure 222 (SEQ ID NO: 523), or (b) the complement of the DNA molecule of (a). An isolated nucleic acid molecule comprising DNA having at least 80% sequence identity is provided. Sequence identity is preferably about 85%, more preferably about 90%, most preferably about 95%. In one aspect, the isolated nucleic acid is at least about 80%, preferably at least about 85%, more preferably at least about 90%, most preferably at least about 100% with the polypeptide having amino acid residues 1-344 of Figure 222 (SEQ ID NO: 523). At least about 95% (including 96, 97, 98, and 99%) sequence identity. Preferably, sequence identity appears to be highest in the immunoglobulin and major histocompatibility domains (FIG. 222, amino acids 113-130 of SEQ ID NO: 523).

In other embodiments, an isolated nucleic acid molecule comprises DNA encoding or complementary to a neurotrimine polypeptide having amino acid residues 1 to 334 of FIG. 222 (SEQ ID NO: 523), and at least moderately neutral, Optionally it remains stablely bonded thereto under high stringency conditions. In another aspect, the present invention provides the nucleic acid of the full-length protein of clone DNA43316-1237 deposited with ATCC under ATCC Accession No. 209487, or the coding sequence of clone DNA43316-1237 deposited with ATCC Accession No. 209487.

In another embodiment, the present invention provides an isolated PRO337 polypeptide. In particular, the present invention provides an isolated native sequence PRO337 polypeptide comprising an amino acid sequence comprising residues 1 to 344 of Figure 222 (SEQ ID NO: 523) in one embodiment. In particular, natural PRO337 polypeptides with or without native signal sequence (amino acids 1 to about 28 in FIG. 222 (SEQ ID NO: 523)), with or without starting methionine, are included. Alternatively, the present invention provides a PRO337 polypeptide encoded by a nucleic acid deposited under ATCC Accession No. 209487.

In another embodiment, the present invention provides an expressed sequence tag (EST) comprising the nucleotide sequence shown as DNA42301 (SEQ ID NO: 524) in FIG. 223.

87.PRO403

We have found a cDNA clone (DNA55800-1263) that encodes a novel polypeptide designated herein as "PRO403".

In one embodiment, the invention provides an antibody comprising (a) a DNA molecule encoding a PRO403 polypeptide comprising the sequence of amino acids 1 to 736 of Figure 225 (SEQ ID NO: 526) or (b) the complement of a DNA molecule of (a) An isolated nucleic acid molecule having at least 80% sequence identity is provided. Sequence identity is preferably about 85%, more preferably about 90%, most preferably about 95%. In one aspect, the isolated nucleic acid is at least about 80%, preferably at least about 85%, more preferably at least about 90%, most preferably at least about 100% with the polypeptide having amino acid residues 1-736 of Figure 225 (SEQ ID NO: 526). At least about 95% sequence identity. Preferably, sequence identity is determined by (1) putative N-glycosylation sites (amino acid residues 132, 136, 177, 237, 282, 349, 505, 598 and 606), and (2) in the Kell blood group protein family. It appears to be the highest within conserved Cys residues (amino acid residues 65, 70, 88 and 96) and putative zinc binding motifs (amino acid residues 570-579).

In other embodiments, the isolated nucleic acid molecule comprises DNA that encodes or is complementary to, and is at least intermediate conditions, optionally, DNA encoding a PRO403 polypeptide having amino acid residues 1-736 of FIG. 225 (SEQ ID NO: 526). It remains stable in combination with it under high stringency conditions. In another aspect, the present invention provides a nucleic acid of the full length protein of clone DNA55800-1263 deposited with ATCC under ATCC Accession No. 209680, or a coding sequence of clone DNA55800-1263 deposited with ATCC Accession No. 209680.

In another embodiment, the present invention provides an isolated PRO403 polypeptide. In particular, the present invention provides an isolated native sequence PRO403 polypeptide comprising an amino acid sequence comprising residues 1 to 736 of FIG. 225 (SEQ ID NO: 526) in one embodiment. In particular, native PRO403 polypeptides having a native signal sequence or starting methionine are included. Alternatively, the present invention provides a PRO403 polypeptide encoded by a nucleic acid deposited under ATCC Accession No. 209680.

In another embodiment, the invention provides an expressed sequence tag (EST) comprising a nucleotide sequence represented herein as DNA34415 (FIG. 226, SEQ ID NO: 527), DNA49830 (FIG. 227, SEQ ID NO: 528), and DNA49831 (FIG. 228, SEQ ID NO: 529). ) And other sequence fragments.

88. Additional Embodiments

In another embodiment of the invention, the invention provides a vector comprising a DNA encoding any of the polypeptides herein. Also provided are host cells comprising such vectors. By way of example, the host cell may be a CHO cell, E. coli. E. coli or yeast. Also provided is a method of producing any of the polypeptides described herein, which method comprises culturing the host cell under conditions suitable for expression of the desired polypeptide and recovering the desired polypeptide from the cell culture.

In another embodiment, the present invention provides chimeric molecules comprising any polypeptide described herein that is fused with a heterologous polypeptide or amino acid sequence. Examples of such chimeric molecules include any polypeptide described herein that is fused with an epitope tag sequence or an F _c region of an immunoglobulin.

In another embodiment, the present invention provides antibodies that specifically bind to any of the above or below polypeptides. Optionally, the antibody is a monoclonal antibody, humanized antibody, antibody fragment or single chain antibody.

In another embodiment, the present invention provides oligonucleotide probes useful for isolating genomic and cDNA nucleotide sequences or as antisense probes, which probes can be derived from any of the above or below nucleotide sequences.

In another embodiment, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PRO polypeptide.

In one aspect, an isolated nucleic acid molecule comprises (a) a cell of a transmembrane protein with or without a full length amino acid sequence as disclosed herein, an amino acid sequence lacking a signal peptide as disclosed herein, or a signal peptide as disclosed herein. At least about 80% of a DNA molecule encoding a PRO polypeptide having an extradomain or any other fragment specifically defined as full-length amino acid sequence as disclosed herein or (b) the complement of the DNA molecule of (a) Is at least about 81%, more preferably at least about 82%, more preferably at least about 83%, more preferably at least about 84%, more preferably at least about 85%, more preferably at least about 86% , More preferably at least about 87%, more preferably at least about 88%, more preferably at least about 89%, more preferably at least about 90%, even more preferably At least 91%, more preferably at least about 92%, more preferably at least about 93%, more preferably at least about 94%, more preferably at least about 95%, more preferably at least about 96%, more Preferably at least about 97%, more preferably at least about 98%, more preferably at least about 99%.

In another aspect, an isolated nucleic acid molecule may comprise (a) the coding sequence of the full-length PRO polypeptide cDNA as disclosed herein, the coding sequence of the PRO polypeptide lacking a signal peptide as disclosed herein, or the signal peptide as disclosed herein A DNA molecule comprising the coding sequence of the extracellular domain of a transmembrane PRO polypeptide that is absent or the coding sequence of any other fragment specifically defined as the full-length amino acid sequence as disclosed herein or (b) the complement of the DNA molecule of (a) above At least about 80%, preferably at least about 81%, more preferably at least about 82%, more preferably at least about 83%, more preferably at least about 84%, more preferably at least about 85% More preferably at least about 86%, more preferably at least about 87%, more preferably at least about 88%, more preferably at least about 89%, even more preferably Is at least about 90%, more preferably at least about 91%, more preferably at least about 92%, more preferably at least about 93%, more preferably at least about 94%, more preferably at least about 95% , More preferably at least about 96%, more preferably at least about 97%, more preferably at least about 98%, more preferably at least about 99%.

In a further aspect, the invention relates to a DNA molecule encoding the same mature polypeptide encoded by any of (a) any of the human protein cDNA deposited with the ATCC as disclosed herein, or (b) a DNA molecule of (a) above. At least about 80%, preferably at least about 81%, more preferably at least about 82%, more preferably at least about 83%, more preferably at least about 84%, more preferably at least about 85% with the complement At least about 86%, more preferably at least about 87%, more preferably at least about 88%, more preferably at least about 89%, more preferably at least about 90%, even more preferably Is at least about 91%, more preferably at least about 92%, more preferably at least about 93%, more preferably at least about 94%, more preferably at least about 95%, more preferably at least about 96% , More preferably at least about 97%, more Preferably it relates to an isolated nucleic acid molecule comprising a nucleotide sequence having at least about 98%, more preferably at least about 99% sequence identity.

In another aspect, the invention provides an isolated nucleic acid molecule comprising or complementary to a nucleotide sequence encoding a PRO polypeptide in which a transmembrane domain is deleted or inactivated, wherein the transmembrane of the polypeptide is provided herein. The domain is disclosed. Thus, the soluble extracellular domain of the PRO polypeptides described herein is under consideration.

Another embodiment is for example an antisense oligonucleotide probe, or for use as a hybridization probe, optionally for encoding a fragment of a PRO polypeptide that can encode a polypeptide comprising a binding site for an anti-PRO antibody. It relates to a fragment of the PRO polypeptide coding sequence or the complement thereof that can be used as. The length of such nucleic acid fragments is generally at least about 20 nucleotides, preferably at least about 30, more preferably at least about 40, more preferably at least about 50, more preferably at least about 60, more Preferably at least about 70, more preferably at least about 80, more preferably at least about 90, more preferably at least about 100, more preferably at least about 110, more preferably about 120 At least about 130, more preferably at least about 140, more preferably at least about 140, more preferably at least about 150, more preferably at least about 160, more preferably at least about 170, more preferred Preferably at least about 180, more preferably at least about 190, more preferably at least about 200, more preferably at least about 250, more preferably at least about 300, and more preferably about 350 More preferably about 400 , More preferably about 450 or more, more preferably about 500 or more, more preferably about 600 or more, more preferably about 700 or more, more preferably about 800 or more, more preferably At least about 900, more preferably at least about 1000, wherein the term "about" refers to the length of the nucleotide sequence mentioned above plus or minus 10% of this length. New fragments of PRO polypeptide-encoding nucleotide sequences may be aligned with the PRO polypeptide-encoding nucleotide sequence and other known nucleotide sequences using any of a number of well-known sequence alignment programs to determine if the PRO polypeptide-encoding nucleotide sequence fragment is new. Can be determined by conventional methods. All such PRO polypeptide-coding nucleotide sequences are considered herein. Also contemplated are PRO polypeptide fragments encoded by this nucleotide molecule fragment, preferably PRO polypeptide fragments comprising a binding site for an anti-PRO antibody.

In another embodiment, the present invention provides an isolated PRO polypeptide encoded by any of the isolated nucleic acid sequences identified above.

In certain aspects, the invention provides a full length amino acid sequence as disclosed herein, an amino acid sequence lacking a signal peptide as disclosed herein, an extracellular domain of a transmembrane protein with or without a signal peptide as disclosed herein, or as disclosed herein. At least about 80%, preferably at least about 81%, more preferably at least about 82%, more preferably at least about 83%, and more than any PRO polypeptide having any other defined fragment of the full length amino acid sequence, as Preferably at least about 84%, more preferably at least about 85%, more preferably at least about 86%, more preferably at least about 87%, more preferably at least about 88%, more preferably at about 89 At least%, more preferably at least about 90%, more preferably at least about 91%, more preferably at least about 92%, even more preferably at least about 93% , More preferably at least about 94%, more preferably at least about 95%, more preferably at least about 96%, more preferably at least about 97%, even more preferably at least about 98%, even more preferably An isolated PRO polypeptide comprising an amino acid sequence having at least about 99% sequence identity.

In a further aspect, the present invention provides at least about 80%, preferably at least about 81%, more preferably about 82% amino acid sequence encoded by any of the human protein cDNA deposited with the ATCC as disclosed herein Or more, more preferably at least about 83%, more preferably at least about 84%, more preferably at least about 85%, more preferably at least about 86%, more preferably at least about 87%, more preferably Is at least about 88%, more preferably at least about 89%, more preferably at least about 90%, more preferably at least about 91%, more preferably at least about 92%, more preferably at least about 93% , More preferably at least about 94%, more preferably at least about 95%, more preferably at least about 96%, more preferably at least about 97%, even more preferably at least about 98%, even more preferably At least about 99% sequence identical The PRO relates to an isolated polypeptide comprising an amino acid sequence having.

In a further aspect, the invention provides a full length amino acid sequence as disclosed herein, an amino acid sequence lacking a signal peptide as disclosed herein, an extracellular domain of a transmembrane protein with or without a signal peptide as disclosed herein or At least about 80%, preferably at least about 81%, more preferably at least about 82%, more preferably as compared to the amino acid sequence of a PRO polypeptide having any other fragment specifically defined as a full length amino acid sequence as disclosed in Is at least about 83%, more preferably at least about 84%, more preferably at least about 85%, more preferably at least about 86%, more preferably at least about 87%, more preferably at least about 88% , More preferably at least about 89%, more preferably at least about 90%, more preferably at least about 91%, more preferably at least about 92% , More preferably at least about 93%, more preferably at least about 94%, more preferably at least about 95%, more preferably at least about 96%, more preferably at least about 97%, even more preferably At least about 98%, more preferably at least about 99%, is directed to an isolated PRO polypeptide comprising an amino acid sequence that is recorded as positive.

In certain aspects, the invention provides an isolated PRO polypeptide encoded by a nucleotide sequence encoding an amino acid sequence as described above, and having no N-terminal signal sequence and / or initiating methionine. Also described herein is a method of making the isolated PRO polypeptide, wherein the method comprises culturing a host cell comprising a vector comprising a suitable coding nucleic acid molecule under conditions suitable for expression of the PRO polypeptide and removing the PRO from the cell culture. Recovering the polypeptide.

In another aspect, the invention provides an isolated PRO polypeptide from which a transmembrane domain has been deleted or inactivated. Also described herein is a method of making the isolated PRO polypeptide, wherein the method comprises culturing a host cell comprising a vector comprising a suitable coding nucleic acid molecule under conditions suitable for expression of the PRO polypeptide and removing the PRO from the cell culture. Recovering the polypeptide.

In another embodiment, the present invention relates to agonists and antagonists of natural PRO polypeptides as defined above. In certain embodiments, the agonist or antagonist is an anti-PRO antibody or small molecule.

In a further embodiment, the invention relates to a method of identifying an agonist or antagonist for a PRO polypeptide, comprising contacting the PRO polypeptide with a candidate molecule and monitoring the biological activity regulated by the PRO polypeptide. Preferably, the PRO polypeptide is a native PRO polypeptide.

In another embodiment, the present invention relates to a composition comprising, together with a carrier, an agonist or antagonist of a PRO polypeptide or a PRO polypeptide as described herein. Optionally, the carrier is a pharmaceutically acceptable carrier.

Another embodiment of the invention provides for the manufacture of a PRO polypeptide, an agonist or antagonist thereof, or a drug useful for the treatment of symptoms reactive to an anti-PRO antibody, wherein the PRO polypeptide, an agonist or antagonist thereof as described above Or to the use of an anti-PRO antibody.

The present invention relates to the identification and isolation of novel DNA, and to the recombinant production of novel polypeptides encoded by this DNA.

1 shows the nucleotide sequence of the native sequence PRO213 cDNA (SEQ ID NO: 1), wherein SEQ ID NO: 1 is a clone designated herein as "UNQ187" and / or "DNA30943-1163".

2 shows an amino acid sequence (SEQ ID NO: 2) derived from the coding sequence of SEQ ID NO: 1 shown in FIG.

3 shows the nucleotide sequence of the native sequence PRO274 cDNA (SEQ ID NO: 6), wherein SEQ ID NO: 6 is a clone designated herein as "UNQ241" and / or "DNA39987-1184".

4 shows an amino acid sequence (SEQ ID NO: 7) derived from the coding sequence of SEQ ID NO: 6 shown in FIG.

5 shows an EST nucleotide sequence named herein DNA17873 (SEQ ID NO: 8).

6 shows an EST nucleotide sequence named herein DNA36157 (SEQ ID NO: 9).

7 shows an EST nucleotide sequence named herein DNA28929 (SEQ ID NO: 10).

8 shows the nucleotide sequence of the native sequence PRO300 cDNA (SEQ ID NO: 18), wherein SEQ ID NO: 18 is a clone designated herein as “UNQ263” and / or “DNA40625-1189”.

FIG. 9 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 18 shown in FIG. 8 (SEQ ID NO: 19).

10 shows the nucleotide sequence of the native sequence PRO284 cDNA (SEQ ID NO: 27), wherein SEQ ID NO: 27 is a clone designated herein as "UNQ247" and / or "DNA23318-1211".

FIG. 11 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 27 shown in FIG. 10 (SEQ ID NO: 28).

12 shows an EST nucleotide sequence designated herein as DNA12982 (SEQ ID NO: 29).

Figure 13 shows an EST nucleotide sequence designated herein as DNA15886 (SEQ ID NO: 30).

FIG. 14 shows the nucleotide sequence of the native sequence PRO296 cDNA (SEQ ID NO: 35), wherein SEQ ID NO: 35 is a clone designated herein as “UNQ260” and / or “DNA39979-1213”.

FIG. 15 shows an amino acid sequence (SEQ ID NO: 36) derived from the coding sequence of SEQ ID NO: 35 shown in FIG.

16 shows the EST nucleotide sequence, designated DNA23020 (SEQ ID NO: 37) herein.

FIG. 17 shows an EST nucleotide sequence designated herein as DNA21971 (SEQ ID NO: 38).

18 shows an EST nucleotide sequence designated herein as DNA29037 (SEQ ID NO: 39).

FIG. 19 shows the nucleotide sequence (SEQ ID NO: 44) of native sequence PRO329 cDNA, wherein SEQ ID NO: 44 is a clone designated herein as "UNQ291" and / or "DNA40594-1233".

FIG. 20 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 44 shown in FIG. 19 (SEQ ID NO: 45).

21 shows the nucleotide sequence of the native sequence PRO362 cDNA (SEQ ID NO: 51), wherein SEQ ID NO: 51 is a clone designated herein as "UNQ317" and / or "DNA45416-1251".

FIG. 22 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 51 shown in FIG. 21 (SEQ ID NO: 52).

FIG. 23 shows the nucleotide sequence of the native sequence PRO363 cDNA (SEQ ID NO: 58), wherein SEQ ID NO: 58 is a clone designated herein as “UNQ318” and / or “DNA45419-1252”.

FIG. 24 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 58 shown in FIG. 23 (SEQ ID NO: 59).

FIG. 25 shows the nucleotide sequence of the native sequence PRO868 cDNA (SEQ ID NO: 63), wherein SEQ ID NO: 63 is a clone designated herein as “UNQ437” and / or “DNA52594-1270”.

FIG. 26 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 63 shown in FIG. 25 (SEQ ID NO: 64).

FIG. 27 shows the nucleotide sequence of the native sequence PRO382 cDNA (SEQ ID NO: 68), wherein SEQ ID NO: 68 is a clone designated herein as “UNQ323” and / or “DNA45234-1277”.

FIG. 28 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 68 shown in FIG. 27 (SEQ ID NO: 69).

29 shows the nucleotide sequence of the native sequence PRO545 cDNA (SEQ ID NO: 73), wherein SEQ ID NO: 73 is a clone designated herein as "UNQ346" and / or "DNA49624-1279".

FIG. 30 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 73 shown in FIG. 29 (SEQ ID NO: 74).

FIG. 31 shows an EST nucleotide sequence named DNA13217 (SEQ ID NO: 75) herein.

FIG. 32 shows the nucleotide sequence of the native sequence PRO617 cDNA (SEQ ID NO: 84), wherein SEQ ID NO: 84 is a clone designated herein as “UNQ353” and / or “DNA48309-1280”.

FIG. 33 shows the amino acid sequence (SEQ ID NO: 85) derived from the coding sequence of SEQ ID NO: 84 shown in FIG.

FIG. 34 shows the nucleotide sequence of the native sequence PRO700 cDNA (SEQ ID NO: 89), wherein SEQ ID NO: 89 is a clone designated herein as “UNQ364” and / or “DNA46776-1284”.

35 shows the amino acid sequence (SEQ ID NO: 90) derived from the coding sequence of SEQ ID NO: 89 shown in FIG.

FIG. 36 shows the nucleotide sequence of the native sequence PRO702 cDNA (SEQ ID NO: 96), wherein SEQ ID NO: 96 is a clone designated herein as “UNQ366” and / or “DNA50980-1286”.

FIG. 37 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 96 shown in FIG. 36 (SEQ ID NO: 97).

FIG. 38 shows the nucleotide sequence of the native sequence PRO703 cDNA (SEQ ID NO: 101), wherein SEQ ID NO: 101 is a clone designated herein as “UNQ367” and / or “DNA50913-1287”.

FIG. 39 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 101 shown in FIG. 38 (SEQ ID NO: 102).

40 shows the nucleotide sequence of the native sequence PRO705 cDNA (SEQ ID NO: 108), wherein SEQ ID NO: 108 is a clone designated herein as "UNQ369" and / or "DNA50914-1289".

FIG. 41 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 108 shown in FIG. 40 (SEQ ID NO: 109).

42A-B show the nucleotide sequence of the native sequence PRO708 cDNA (SEQ ID NO: 113), wherein SEQ ID NO: 113 is a clone designated herein as "UNQ372" and / or "DNA48296-1292".

FIG. 43 shows amino acid sequence (SEQ ID NO: 114) derived from coding sequence of SEQ ID NO: 113 shown in FIGS. 42A-B.

FIG. 44 shows the nucleotide sequence of the native sequence PRO320 cDNA (SEQ ID NO: 118), wherein SEQ ID NO: 118 is a clone designated herein as "UNQ281" and / or "DNA32284-1307".

FIG. 45 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 118 shown in FIG. 44 (SEQ ID NO: 119).

46 shows the nucleotide sequence (SEQ ID NO: 123) of native sequence PRO324 cDNA, wherein SEQ ID NO: 123 is a clone designated herein as "UNQ285" and / or "DNA36343-1310".

FIG. 47 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 123 shown in FIG. 46 (SEQ ID NO: 124).

FIG. 48 shows the nucleotide sequence of the native sequence PRO351 cDNA (SEQ ID NO: 131), wherein SEQ ID NO: 131 is a clone designated herein as "UNQ308" and / or "DNA40571-1315".

FIG. 49 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 131 shown in FIG. 48 (SEQ ID NO: 132).

50 shows the nucleotide sequence of the native sequence PRO352 cDNA (SEQ ID NO: 136), wherein SEQ ID NO: 136 is a clone designated herein as "UNQ309" and / or "DNA41386-1316".

FIG. 51 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 136 shown in FIG. 50 (SEQ ID NO: 137).

FIG. 52 shows the nucleotide sequence of the native sequence PRO381 cDNA (SEQ ID NO: 144), wherein SEQ ID NO: 144 is a clone designated herein as “UNQ322” and / or “DNA44194-1317”.

FIG. 53 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 144 shown in FIG. 52 (SEQ ID NO: 145).

FIG. 54 shows the nucleotide sequence of the native sequence PRO386 cDNA (SEQ ID NO: 149), wherein SEQ ID NO: 149 is a clone designated herein as “UNQ326” and / or “DNA45415-1318”.

FIG. 55 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 149 shown in FIG. 54 (SEQ ID NO: 150).

FIG. 56 shows an EST nucleotide sequence designated herein as DNA23350 (SEQ ID NO: 151).

FIG. 57 shows an EST nucleotide sequence designated herein as DNA23536 (SEQ ID NO: 152).

58 shows the nucleotide sequence of the native sequence PRO540 cDNA (SEQ ID NO: 156), wherein SEQ ID NO: 156 is a clone designated herein as "UNQ341" and / or "DNA44189-1322".

FIG. 59 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 156 shown in FIG. 58 (SEQ ID NO: 157).

FIG. 60 shows the nucleotide sequence of the native sequence PRO615 cDNA (SEQ ID NO: 161), wherein SEQ ID NO: 161 is a clone designated herein as “UNQ352” and / or “DNA48304-1323”.

FIG. 61 shows an amino acid sequence (SEQ ID NO: 162) derived from the coding sequence of SEQ ID NO: 161 shown in FIG.

FIG. 62 shows the nucleotide sequence of the native sequence PRO618 cDNA (SEQ ID NO: 168), wherein SEQ ID NO: 168 is a clone designated herein as "UNQ354" and / or "DNA49152-1324".

FIG. 63 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 168 shown in FIG. 62 (SEQ ID NO: 169).

64 shows the EST nucleotide sequence named herein DNA35597 (SEQ ID NO: 170).

FIG. 65 shows the nucleotide sequence of the native sequence PRO719 cDNA (SEQ ID NO: 177), wherein SEQ ID NO: 177 is a clone designated herein as "UNQ387" and / or "DNA49646-1327".

FIG. 66 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 177 shown in FIG. 65 (SEQ ID NO: 178).

67 shows the nucleotide sequence of the native sequence PRO724 cDNA (SEQ ID NO: 182), wherein SEQ ID NO: 182 is a clone designated herein as “UNQ389” and / or “DNA49631-1328”.

FIG. 68 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 182 shown in FIG. 67 (SEQ ID NO: 183).

FIG. 69 shows the nucleotide sequence of the native sequence PRO772 cDNA (SEQ ID NO: 189), wherein SEQ ID NO: 189 is a clone designated herein as "UNQ410" and / or "DNA49645-1347".

FIG. 70 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 189 shown in FIG. 69 (SEQ ID NO: 190).

71 shows an EST nucleotide sequence named herein DNA43509 (SEQ ID NO: 191).

FIG. 72 shows the nucleotide sequence of the native sequence PRO852 cDNA (SEQ ID NO: 195), wherein SEQ ID NO: 195 is a clone designated herein as “UNQ418” and / or “DNA45493-1349”.

FIG. 73 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 195 shown in FIG. 72 (SEQ ID NO: 196).

FIG. 74 shows the nucleotide sequence of the native sequence PRO853 cDNA (SEQ ID NO: 205), wherein SEQ ID NO: 205 is a clone designated herein as “UNQ419” and / or “DNA48227-1350”.

FIG. 75 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 205 shown in FIG. 74 (SEQ ID NO: 206).

FIG. 76 shows the nucleotide sequence of the native sequence PRO860 cDNA (SEQ ID NO: 210), wherein SEQ ID NO: 210 is a clone designated herein as “UNQ421” and / or “DNA41404-1352”.

FIG. 77 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 210 shown in FIG. 76 (SEQ ID NO: 211).

78 shows the nucleotide sequence of the native sequence PRO846 cDNA (SEQ ID NO: 215), wherein SEQ ID NO: 215 is a clone designated herein as "UNQ422" and / or "DNA44196-1353".

FIG. 79 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 215 shown in FIG. 78 (SEQ ID NO: 216).

80 shows the nucleotide sequence of the native sequence PRO862 cDNA (SEQ ID NO: 220), wherein SEQ ID NO: 220 is a clone designated herein as “UNQ424” and / or “DNA52187-1354”.

FIG. 81 shows an amino acid sequence (SEQ ID NO: 221) derived from the coding sequence of SEQ ID NO: 220 shown in FIG.

FIG. 82 shows the nucleotide sequence of the native sequence PRO864 cDNA (SEQ ID NO: 225), wherein SEQ ID NO: 225 is a clone designated herein as “UNQ426” and / or “DNA48328-1355”.

FIG. 83 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 225 shown in FIG. 82 (SEQ ID NO: 226).

84 shows the nucleotide sequence of the native sequence PRO792 cDNA (SEQ ID NO: 230), wherein SEQ ID NO: 230 is a clone designated herein as "UNQ431" and / or "DNA56352-1358".

FIG. 85 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 230 shown in FIG. 84 (SEQ ID NO: 231).

86 shows the nucleotide sequence (SEQ ID NO: 235) of native sequence PRO866 cDNA, wherein SEQ ID NO: 235 is a clone designated herein as "UNQ435" and / or "DNA53971-1359".

FIG. 87 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 235 shown in FIG. 86 (SEQ ID NO: 236).

FIG. 88 shows the nucleotide sequence of the native sequence PRO871 cDNA (SEQ ID NO: 244), wherein SEQ ID NO: 244 is a clone designated herein as “UNQ438” and / or “DNA50919-1361”.

FIG. 89 shows an amino acid sequence (SEQ ID NO: 245) derived from the coding sequence of SEQ ID NO: 224 shown in FIG. 88. FIG.

90 shows the nucleotide sequence of the native sequence PRO873 cDNA (SEQ ID NO: 253), wherein SEQ ID NO: 253 is a clone designated herein as “UNQ440” and / or “DNA44179-1362”.

FIG. 91 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 253 shown in FIG. 90 (SEQ ID NO: 254).

92 shows the nucleotide sequence of the native sequence PRO940 cDNA (SEQ ID NO: 258), wherein SEQ ID NO: 258 is a clone designated herein as “UNQ477” and / or “DNA54002-1367”.

FIG. 93 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 258 shown in FIG. 92 (SEQ ID NO: 259).

FIG. 94 shows the nucleotide sequence of the native sequence PRO941 cDNA (SEQ ID NO: 263), wherein SEQ ID NO: 263 is a clone designated herein as “UNQ478” and / or “DNA53906-1368”.

FIG. 95 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 263 shown in FIG. 94 (SEQ ID NO: 264).

96 shows the EST nucleotide sequence, designated herein as DNA6415 (SEQ ID NO: 265).

97 shows the nucleotide sequence of the native sequence PRO944 cDNA (SEQ ID NO: 269), wherein SEQ ID NO: 269 is a clone designated herein as “UNQ481” and / or “DNA52185-1370”.

FIG. 98 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 269 shown in FIG. 97 (SEQ ID NO: 270).

99 shows the EST nucleotide sequence named herein DNA14007 (SEQ ID NO: 271).

100 shows the EST nucleotide sequence named herein DNA12773 (SEQ ID NO: 272).

FIG. 101 shows an EST nucleotide sequence designated herein as DNA12746 (SEQ ID NO: 273).

FIG. 102 shows an EST nucleotide sequence designated herein as DNA12834 (SEQ ID NO: 274).

Figure 103 shows an EST nucleotide sequence designated herein as DNA12846 (SEQ ID NO: 275).

FIG. 104 shows an EST nucleotide sequence designated herein as DNA13104 (SEQ ID NO: 276).

105 shows the EST nucleotide sequence designated herein as DNA13259 (SEQ ID NO: 277).

106 shows the EST nucleotide sequence named herein DNA13959 (SEQ ID NO: 278).

107 shows an EST nucleotide sequence designated herein as DNA13961 (SEQ ID NO: 279).

108 shows the nucleotide sequence of the native sequence PRO983 cDNA (SEQ ID NO: 283), wherein SEQ ID NO: 283 is a clone designated herein as "UNQ484" and / or "DNA53977-1371".

FIG. 109 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 283 shown in FIG. 108 (SEQ ID NO: 284).

110 shows the EST nucleotide sequence designated herein as DNA17130 (SEQ ID NO: 285).

111 shows the EST nucleotide sequence designated herein as DNA23466 (SEQ ID NO: 286).

FIG. 112 shows an EST nucleotide sequence designated herein as DNA26818 (SEQ ID NO: 287).

113 shows the EST nucleotide sequence named herein DNA37618 (SEQ ID NO: 288).

FIG. 114 shows an EST nucleotide sequence designated herein as DNA41732 (SEQ ID NO: 289).

FIG. 115 shows an EST nucleotide sequence designated herein as DNA45980 (SEQ ID NO: 290).

116 shows an EST nucleotide sequence designated herein as DNA46372 (SEQ ID NO: 291).

117 shows the nucleotide sequence of the native sequence PRO1057 cDNA (SEQ ID NO: 295), wherein SEQ ID NO: 295 is a clone designated herein as “UNQ522” and / or “DNA57253-1382”.

118 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 295 shown in FIG. 117 (SEQ ID NO: 296).

119 shows the nucleotide sequence of the native sequence PRO1071 cDNA (SEQ ID NO: 300), wherein SEQ ID NO: 300 is a clone designated herein as "UNQ528" and / or "DNA58847-1383".

FIG. 120 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 300 shown in FIG. 119 (SEQ ID NO: 301).

FIG. 121 shows the nucleotide sequence of the native sequence PRO1072 cDNA (SEQ ID NO: 302), wherein SEQ ID NO: 302 is a clone designated herein as “UNQ529” and / or “DNA58747-1384”.

FIG. 122 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 302 shown in FIG. 121 (SEQ ID NO: 303).

123 shows the EST nucleotide sequence designated herein as DNA40210 (SEQ ID NO: 304).

124 shows the nucleotide sequence of the native sequence PRO1075 cDNA (SEQ ID NO: 308), wherein SEQ ID NO: 308 is a clone designated herein as “UNQ532” and / or “DNA57689-1385”.

FIG. 125 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 308 shown in FIG. 124 (SEQ ID NO: 309).

126 shows the EST nucleotide sequence designated herein as DNA13059 (SEQ ID NO: 310).

127 shows an EST nucleotide sequence designated herein as DNA19463 (SEQ ID NO: 311).

FIG. 128 shows the nucleotide sequence of the native sequence PRO181 cDNA (SEQ ID NO: 321), wherein SEQ ID NO: 321 is a clone designated herein as “UNQ155” and / or “DNA23330-1390”.

129 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 321 shown in FIG. 128 (SEQ ID NO: 322).

130 shows an EST nucleotide sequence designated herein as DNA13242 (SEQ ID NO: 323).

131 shows the nucleotide sequence of the native sequence PRO195 cDNA (SEQ ID NO: 329), wherein SEQ ID NO: 329 is a clone designated herein as "UNQ169" and / or "DNA26847-1395".

132 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 329 shown in FIG. 131 (SEQ ID NO: 330).

133 shows an EST nucleotide sequence designated herein as DNA15062 (SEQ ID NO: 331).

134 shows the EST nucleotide sequence designated herein as DNA13199 (SEQ ID NO: 332).

135 shows the nucleotide sequence of the native sequence PRO865 cDNA (SEQ ID NO: 336), wherein SEQ ID NO: 336 is a clone designated herein as "UNQ434" and / or "DNA53974-1401".

136 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 336 shown in FIG. 135 (SEQ ID NO: 337).

137 shows an EST nucleotide sequence designated herein as DNA37642 (SEQ ID NO: 338).

138 shows the nucleotide sequence of the native sequence PRO827 cDNA (SEQ ID NO: 345), wherein SEQ ID NO: 345 is a clone designated herein as "UNQ468" and / or "DNA57039-1402".

139 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 345 shown in FIG. 138 (SEQ ID NO: 346).

140 shows the EST nucleotide sequence named herein DNA47751 (SEQ ID NO: 347).

141 shows the nucleotide sequence of the native sequence PRO1114 cDNA (SEQ ID NO: 351), wherein SEQ ID NO: 351 is a clone designated herein as "UNQ557" and / or "DNA57033-1403".

FIG. 142 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 351 shown in FIG. 141 (SEQ ID NO: 352).

143 shows the EST nucleotide sequence designated herein as DNA48466 (SEQ ID NO: 353).

144 shows the nucleotide sequence of the native sequence PRO237 cDNA (SEQ ID NO: 357), wherein SEQ ID NO: 357 is a clone designated herein as “UNQ211” and / or “DNA34353-1428”.

145 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 357 shown in FIG. 144 (SEQ ID NO: 358).

146 shows the nucleotide sequence of the native sequence PRO541 cDNA (SEQ ID NO: 362), wherein SEQ ID NO: 362 is a clone designated herein as "UNQ342" and / or "DNA45417-1432".

147 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 362 shown in FIG. 146 (SEQ ID NO: 363).

148 shows the nucleotide sequence of the native sequence PRO273 cDNA (SEQ ID NO: 369), wherein SEQ ID NO: 369 is a clone designated herein as "UNQ240" and / or "DNA39523-1192".

149 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 369 shown in FIG. 148 (SEQ ID NO: 370).

150 shows the nucleotide sequence of the native sequence PRO701 cDNA (SEQ ID NO: 374), wherein SEQ ID NO: 374 is a clone designated herein as "UNQ365" and / or "DNA44205-1285".

151 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 374 shown in FIG. 150 (SEQ ID NO: 375).

152 shows the nucleotide sequence of the native sequence PRO704 cDNA (SEQ ID NO: 379), wherein SEQ ID NO: 379 is a clone designated herein as "UNQ368" and / or "DNA50911-1288".

153 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 379 shown in FIG. 152 (SEQ ID NO: 380).

154 shows the nucleotide sequence of the native sequence PRO706 cDNA (SEQ ID NO: 384), wherein SEQ ID NO: 384 is a clone designated herein as "UNQ370" and / or "DNA48329-1290".

FIG. 155 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 384 shown in FIG. 154 (SEQ ID NO: 385).

156 shows the nucleotide sequence of the native sequence PRO707 cDNA (SEQ ID NO: 389), wherein SEQ ID NO: 389 is a clone designated herein as "UNQ371" and / or "DNA48306-1291".

157 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 389 shown in FIG. 156 (SEQ ID NO: 390).

158 shows the nucleotide sequence of the native sequence PRO322 cDNA (SEQ ID NO: 394), wherein SEQ ID NO: 394 is a clone designated herein as “UNQ283” and / or “DNA48336-1309”.

159 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 394 shown in FIG. 158 (SEQ ID NO: 395).

160 shows the nucleotide sequence of the native sequence PRO526 cDNA (SEQ ID NO: 399), wherein SEQ ID NO: 399 is a clone designated herein as "UNQ330" and / or "DNA44184-1319".

161 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 399 shown in FIG. 160 (SEQ ID NO: 400).

162 shows the nucleotide sequence of the native sequence PRO531 cDNA (SEQ ID NO: 404), wherein SEQ ID NO: 404 is a clone designated herein as “UNQ332” and / or “DNA48314-1320”.

FIG. 163 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 404 shown in FIG. 162 (SEQ ID NO: 405).

164 shows the nucleotide sequence of the native sequence PRO534 cDNA (SEQ ID NO: 409), wherein SEQ ID NO: 409 is a clone designated herein as "UNQ335" and / or "DNA48333-1321".

165 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 409 shown in FIG. 164 (SEQ ID NO: 410).

166 shows the nucleotide sequence of the native sequence PRO697 cDNA (SEQ ID NO: 414), wherein SEQ ID NO: 414 is a clone designated herein as “UNQ361” and / or “DNA50920-1325”.

167 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 414 shown in FIG. 166 (SEQ ID NO: 415).

168 shows the nucleotide sequence of the native sequence PRO717 cDNA (SEQ ID NO: 419), wherein SEQ ID NO: 419 is a clone designated herein as "UNQ385" and / or "DNA50988-1326".

FIG. 169 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 419 shown in FIG. 168 (SEQ ID NO: 420).

FIG. 170 shows the nucleotide sequence of the native sequence PRO731 cDNA (SEQ ID NO: 424), wherein SEQ ID NO: 424 is a clone designated herein as “UNQ395” and / or “DNA48331-1329”.

FIG. 171 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 424 shown in FIG. 170 (SEQ ID NO: 425).

172 shows the nucleotide sequence of the native sequence PRO218 cDNA (SEQ ID NO: 429), wherein SEQ ID NO: 429 is a clone designated herein as "UNQ192" and / or "DNA30867-1335".

FIG. 173 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 429 shown in FIG. 172 (SEQ ID NO: 430).

174 shows an EST nucleotide sequence designated herein as DNA14472 (SEQ ID NO: 431).

175 shows an EST nucleotide sequence designated herein as DNA15846 (SEQ ID NO: 432).

176 shows the nucleotide sequence of the native sequence PRO768 cDNA (SEQ ID NO: 436), wherein SEQ ID NO: 436 is a clone designated herein as "UNQ406" and / or "DNA55737-1345".

177 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 436 shown in FIG. 176 (SEQ ID NO: 437).

178 shows the nucleotide sequence of the native sequence PRO771 cDNA (SEQ ID NO: 441), wherein SEQ ID NO: 441 is a clone designated herein as “UNQ409” and / or “DNA49829-1346”.

179 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 441 shown in FIG. 178 (SEQ ID NO: 442).

FIG. 180 shows the nucleotide sequence of the native sequence PRO733 cDNA (SEQ ID NO: 446), wherein SEQ ID NO: 446 is a clone designated herein as “UNQ411” and / or “DNA52196-1348”.

181 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 446 shown in FIG. 180 (SEQ ID NO: 447).

182 shows the nucleotide sequence of the native sequence PRO162 cDNA (SEQ ID NO: 451), wherein SEQ ID NO: 451 is a clone designated herein as “UNQ429” and / or “DNA56965-1356”.

FIG. 183 shows the amino acid sequence (SEQ ID NO: 452) derived from the coding sequence of SEQ ID NO: 451 shown in FIG.

184 shows the nucleotide sequence (SEQ ID NO: 453) of native sequence PRO788 cDNA, wherein SEQ ID NO: 453 is a clone designated herein as "UNQ430" and / or "DNA56405-1357".

185 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 453 shown in FIG. 184 (SEQ ID NO: 454).

186 shows the nucleotide sequence (SEQ ID NO: 455) of native sequence PRO1008 cDNA, wherein SEQ ID NO: 455 is a clone designated herein as "UNQ492" and / or "DNA57530-1375".

187 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 455 shown in FIG. 186 (SEQ ID NO: 456).

188 shows an EST nucleotide sequence designated herein as DNA16508 (SEQ ID NO: 457).

189 shows the nucleotide sequence (SEQ ID NO: 458) of native sequence PRO1012 cDNA, wherein SEQ ID NO: 458 is a clone designated herein as "UNQ495" and / or "DNA56439-1376".

FIG. 190 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 458 shown in FIG. 189 (SEQ ID NO: 459).

191 shows the nucleotide sequence of the native sequence PRO1014 cDNA (SEQ ID NO: 463), wherein SEQ ID NO: 463 is a clone designated herein as “UNQ497” and / or “DNA56409-1377”.

FIG. 192 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 463 shown in FIG. 191 (SEQ ID NO: 464).

193 shows the nucleotide sequence of the native sequence PRO1017 cDNA (SEQ ID NO: 465), wherein SEQ ID NO: 465 is a clone designated herein as “UNQ500” and / or “DNA56112-1379”.

FIG. 194 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 465 shown in FIG. 193 (SEQ ID NO: 466).

195 shows the nucleotide sequence (SEQ ID NO: 467) of native sequence PRO474 cDNA, wherein SEQ ID NO: 467 is a clone designated herein as "UNQ502" and / or "DNA56045-1380".

FIG. 196 shows the amino acid sequence (SEQ ID NO: 468) derived from the coding sequence of SEQ ID NO: 467 shown in FIG. 195.

197 shows the nucleotide sequence (SEQ ID NO: 469) of native sequence PRO1031 cDNA, wherein SEQ ID NO: 469 is a clone designated herein as "UNQ516" and / or "DNA59294-1381".

FIG. 198 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 469 shown in FIG. 197 (SEQ ID NO: 470).

199 shows the nucleotide sequence of the native sequence PRO938 cDNA (SEQ ID NO: 471), wherein SEQ ID NO: 471 is a clone designated herein as “UNQ475” and / or “DNA56433-1406”.

FIG. 200 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 471 shown in FIG. 199 (SEQ ID NO: 472).

201 shows the nucleotide sequence of the native sequence PRO1082 cDNA (SEQ ID NO: 476), wherein SEQ ID NO: 476 is a clone designated herein as "UNQ539" and / or "DNA53912-1457".

FIG. 202 shows the amino acid sequence (SEQ ID NO: 477) derived from the coding sequence of SEQ ID NO: 476 shown in FIG. 201.

203 shows the nucleotide sequence of the native sequence PRO1083 cDNA (SEQ ID NO: 482), wherein SEQ ID NO: 482 is a clone designated herein as "UNQ540" and / or "DNA50921-1458".

204 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 482 shown in FIG. 203 (SEQ ID NO: 483).

205 shows the EST nucleotide sequence named herein DNA24256 (SEQ ID NO: 484).

206 shows the nucleotide sequence of the native sequence PRO200 cDNA (SEQ ID NO: 487), wherein SEQ ID NO: 487 is a clone designated herein as "UNQ174" and / or "DNA29101-1122".

207 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 487 shown in FIG. 206 (SEQ ID NO: 488).

208 shows the nucleotide sequence of the native sequence PRO285 cDNA (SEQ ID NO: 495), wherein SEQ ID NO: 495 is a clone designated herein as “DNA40021-1154”.

209 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 495 shown in FIG. 208 (SEQ ID NO: 496).

FIG. 210 shows the nucleotide sequence of the native sequence PRO286 cDNA (SEQ ID NO: 497), wherein SEQ ID NO: 497 is a clone designated herein as “DNA42663-1154”.

FIG. 211 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 497 shown in FIG. 210 (SEQ ID NO: 498).

212 shows the nucleotide sequence of the native sequence PRO213-1 cDNA (SEQ ID NO: 505), wherein SEQ ID NO: 505 is a clone designated herein as “DNA30943-1-1163-1”.

FIG. 213 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 505 shown in FIG. 212 (SEQ ID NO: 506).

214 shows the nucleotide sequence of the native sequence PRO1330 cDNA (SEQ ID NO: 507), wherein SEQ ID NO: 507 is a clone designated herein as “DNA64907-1163-1”.

FIG. 215 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 507 shown in FIG. 214 (SEQ ID NO: 508).

216 shows the nucleotide sequence of the native sequence PRO1449 cDNA (SEQ ID NO: 509), wherein SEQ ID NO: 509 is a clone designated herein as “DNA64908-1163-1”.

FIG. 217 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 509 shown in FIG. 216 (SEQ ID NO: 510).

218 shows the nucleotide sequence of the native sequence PRO298 cDNA (SEQ ID NO: 514), wherein SEQ ID NO: 514 is a clone designated herein as “UNQ261” and / or “DNA39975-1210”.

FIG. 219 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 514 shown in FIG. 218 (SEQ ID NO: 515).

FIG. 220 shows an EST nucleotide sequence designated herein as DNA26832 (SEQ ID NO: 516).

221 shows the nucleotide sequence of the native sequence PRO337 cDNA (SEQ ID NO: 522), wherein SEQ ID NO: 522 is a clone designated herein as “DNA43316-1237”.

222 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 522 shown in FIG. 221 (SEQ ID NO: 523).

223 shows the EST nucleotide sequence designated herein as DNA42301 (SEQ ID NO: 524).

224 shows the nucleotide sequence of the native sequence PRO403 cDNA (SEQ ID NO: 525), wherein SEQ ID NO: 525 is a clone designated herein as “DNA55800-1263”.

225 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 525 shown in FIG. 224 (SEQ ID NO: 526).

226 shows the EST nucleotide sequence designated herein as DNA34415 (SEQ ID NO: 527).

227 shows an EST nucleotide sequence designated herein as DNA49830 (SEQ ID NO: 528).

228 shows an EST nucleotide sequence designated herein as DNA49831 (SEQ ID NO: 529).

FIG. 229 shows the nucleotide sequence of native sequence PRO4993 cDNA (SEQ ID NO: 611), wherein SEQ ID NO: 611 is a clone designated herein as “DNA94832-2659”.

FIG. 230 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 611 shown in FIG. 229 (SEQ ID NO: 612).

231 shows the nucleotide sequence of native sequence PRO1559 cDNA (SEQ ID NO: 613), wherein SEQ ID NO: 613 is a clone designated herein as "DNA68886".

FIG. 232 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 613 shown in FIG. 231 (SEQ ID NO: 614).

233 shows the nucleotide sequence of native sequence PRO725 cDNA (SEQ ID NO: 615), wherein SEQ ID NO: 615 is a clone designated herein as “DNA52758-1399”.

234 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 615 shown in FIG. 233 (SEQ ID NO: 616).

235 shows the nucleotide sequence of native sequence PRO739 cDNA (SEQ ID NO: 617), wherein SEQ ID NO: 617 is a clone designated herein as “DNA52756”.

236 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 617 shown in FIG. 235 (SEQ ID NO: 618).

<Detailed Description of the Preferred Embodiments>

I. Justice

The terms "PRO polypeptide" and "PRO" as used herein refer to a variety of polypeptides, followed immediately by numbers, where the full name (ie, PRO / number) refers to the specific polypeptide sequence described herein. As used herein, "PRO / numeric polypeptide" and "PRO / numeric", where the numerical portion is represented by actual numbers, are terms that include native sequence polypeptides and polypeptide variants (as further defined herein). The PRO polypeptides described herein can be isolated from a variety of sources, such as human tissue types or other sources, or can be prepared by recombinant or synthetic methods.

"Native sequence PRO polypeptide" includes polypeptides having the same amino acid sequence as the corresponding PRO polypeptide derived from nature. Such native sequence PRO polypeptides can be isolated from nature or can be prepared by recombinant or synthetic methods. The term “natural sequence PRO polypeptide” specifically refers to a naturally-occurring variant form of such polypeptide, in which the naturally-occurring terminus of the particular PRO polypeptide is truncated or secreted (eg, extracellular domain sequence). (Eg, alternatively spliced forms) and naturally-occurring allelic variants. In various embodiments of the invention, the native sequence PRO polypeptides described herein are mature or full length native sequence polypeptides comprising the full length amino acid sequences shown in the accompanying figures. Start and stop codons are indicated in bold and underlined in the figures. However, the PRO polypeptides disclosed herein in the accompanying figures are shown to begin with methionine residues referred to in the figure as amino acid position 1, while other methionine residues located above or below amino acid position 1 in the figure are starting to the PRO polypeptide. It is conceivable that it can be used as an amino acid residue, and is possible.

An “extracellular domain” or “ECD” of a PRO polypeptide refers to a form of PRO polypeptide that is essentially free of transmembrane and cytoplasmic domains. Typically, the PRO polypeptide ECD comprises less than 1% of the transmembrane and / or cytoplasmic domains, preferably less than 0.5% of these domains. All transmembrane domains identified in the PRO polypeptides of the present invention have been identified according to criteria commonly used to identify hydrophobic domain types in the art. The exact borderline of the transmembrane domain may vary, but most are only present at about 5 amino acids at each end of the domain originally identified herein. Thus, the extracellular domain of a PRO polypeptide may optionally contain up to about 5 amino acids on either side of the transmembrane domain / extracellular domain boundary identified in the Examples and the specification, and such polypeptide with or without a signal peptide , And nucleic acids encoding them are included in the present invention.

The approximate location of the “signal peptides” of the various PRO polypeptides disclosed herein are shown in the accompanying figures. Although the C-terminal boundary of the signal peptide may be different, most are only at about 5 amino acids on either side of the C-terminal boundary of the signal peptide first identified herein, where the C-terminal boundary of the signal peptide is an amino acid in the art. It can be identified according to the criteria commonly used to identify the type of sequence element (for example, Nielsen et al . Prot. Eng. 10: 1-6 (1997) and Heinje et al. Nucl. Acids. Res. 14: 4683-4690 (1986)]. In addition, in some cases it is believed that the cleavage of the signal sequence of the secreting polypeptides is not entirely identical, resulting in one or more secreting polypeptides. Mature polypeptides in which the signal peptide is cleaved only at about 5 amino acids on either side of the C-terminal boundary of the signal peptide identified herein, and polynucleotides encoding them, are included in the present invention.

A "PRO polypeptide variant" refers to a full-length native sequence PRO polypeptide sequence disclosed herein, a PRO polypeptide sequence lacking a signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide with or without signal peptide as disclosed herein, or By active PRO polypeptide as defined above or below, having at least about 80% amino acid sequence identity with any other fragment of the disclosed full length PRO polypeptide sequence. Such PRO polypeptide variants include, for example, PRO polypeptides having one or more amino acid residues added or deleted at the N-terminus or C-terminus of the full-length natural amino acid sequence. Typically, a PRO polypeptide variant is a full length native sequence PRO polypeptide sequence disclosed herein, a PRO polypeptide sequence without a signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide with or without signal peptide as disclosed herein, or At least about 80%, preferably at least about 81%, more preferably at least about 82%, more preferably at least about 83%, more preferably at least about any other specifically defined fragment of the disclosed full length PRO polypeptide sequence At least 84%, more preferably at least about 85%, more preferably at least about 86%, more preferably at least about 87%, more preferably at least about 88%, more preferably at least about 89%, more Preferably at least about 90%, more preferably at least about 91%, more preferably at least 92%, more preferably at least about 93%, more preferably at least about 94% More preferably at least about 95%, more preferably at least about 96%, more preferably at least about 97%, more preferably at least about 98%, most preferably at least about 99% . Typically, PRO variant polypeptides are at least about 10 amino acids in length, often at least about 20 amino acids, more often at least about 30 amino acids, more often at least about 40 amino acids, more often at least about 50 amino acids, More often at least about 60 amino acids, more often at least about 70 amino acids, more often at least about 80 amino acids, more often at least about 90 amino acids, more often at least about 100 amino acids, more often about 150 At least about amino acids, more often at least about 200 amino acids, more often at least about 300 amino acids or more.

The "% amino acid sequence identity" for a PRO polypeptide sequence as disclosed herein aligns a candidate sequence with the same PRO polypeptide sequence and amino acid residues thereof, and if necessary introduces a gap to obtain a maximum of sequence identity ratios. Any conservative substitution is defined as the proportion of amino acid residues in a candidate sequence that are identical to amino acid residues in a particular PRO polypeptide sequence without being considered part of the same sequence. Alignment to determine amino acid sequence identity can be accomplished using various methods in the art, for example, publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. One of ordinary skill in the art can determine suitable parameters for measuring alignment, including any algorithms needed to maximally align over the entire length of the sequences being compared. However, for purposes herein,% amino acid sequence identity values are obtained using the sequence comparison computer program ALIGN-2, where the complete source code for the ALIGN-2 program is provided in Table 1 below. The ALIGN-2 sequence comparison computer program was developed by Genentech, Inc., and the source code shown in Table 1 is kept as a user document of the U.S. Copyright Office (20559 Washington, DC). Registered under US Copyright Registration TXU510087. The ALIGN-2 program is publicly available through Genentech, Inc. (South San Francisco, Calif.) Or can be edited from the source code described in Table 1. The ALIGN-2 program can be edited and used on a UNIX operating system, preferably digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not change.

When ALIGN-2 is used to compare amino acid sequences, the amino acid sequence identity (%) of a given amino acid sequence A relative to a given amino acid sequence B or with a given amino acid sequence B relative to a given amino acid sequence B (in a given amino acid sequence B For a given amino acid sequence B, or having a constant amino acid sequence identity (%) relative to a given amino acid sequence B, or otherwise represented by a given amino acid sequence A), is calculated as follows:

X / Y × 100

Where X is the number of amino acid residues recorded by the sequence alignment program ALIGN-2 as equally matched in the program alignment of A and B, and Y is the total number of amino acid residues of B. Of course, when the length of amino acid sequence A is not equal to the length of amino acid sequence B, the amino acid sequence identity of A to B is not equal to the amino acid sequence identity of B to A to A. As an example of calculating the amino acid sequence identity (%) using this method, Tables 2 and 3 below calculate the amino acid sequence identity (%) of the amino acid sequence referred to as the "comparative protein" to the amino acid sequence referred to as "PRO". Method, wherein "PRO" refers to the amino acid sequence of the putative PRO polypeptide of interest, "comparative protein" refers to the amino acid sequence of the polypeptide to which the "PRO" polypeptide is compared, and "X," "Y" and "Z." Each represents a different putative amino acid residue.

Unless specifically stated otherwise, all percent amino acid sequence identity values used herein are obtained using the ALIGN-2 computer program as described in the immediately preceding paragraph. However, amino acid sequence identity values (%) may also be obtained using the WU-BLAST-2 computer program (Melts in Enzymology 266: 460-480 (1996)) as described below. have. Most of the WU-BLAST-2 search parameters are set to their default values. Those not set to the default values, ie adjustable parameters, are set to the following values: overlap span = 1, overlap fraction = 0.125, word threshold (T) = 11, and scoring matrix = BLOSUM62. When WU-BLAST-2 is used, the amino acid sequence identity value (%) is determined by (a) the amino acid sequence of the PRO polypeptide having a sequence derived from the native PRO polypeptide and the comparative amino acid sequence (ie, the PRO polypeptide is compared). The resulting sequence may be obtained by determining by WU-BLAST-2 the number of identical amino acid residues that match between the PRO variant polypeptides) and (b) divided by the total number of amino acid residues of the PRO polypeptide. For example, the term "polypeptide comprising amino acid sequence A having at least 80% amino acid sequence identity with amino acid sequence B", wherein amino acid sequence A is the comparative amino acid sequence and amino acid sequence B is the amino acid sequence of the PRO polypeptide.

Amino acid sequence identity (%) can also be calculated using the sequence comparison program NCBI-BLAST2 [Altschul et al. Nucleic Acids Res. 25: 3389-3402 (1997)]. The NCBI-BLAST2 sequence comparison program can be downloaded from the website (http://www.ncbi.nlm.nih.gov.). NCBI-BLAST2 uses several search parameters, for example, unmask = yes, strand = all, expected occurrences = 10, minimum low complexity length = 15/5, multi-pass e-value = 0.01, constant for All search parameters, including multi-pass = 25, dropoff for final gapped alignment = 25, and scoring matrix = BLOSUM62, are set to their default values.

When NCBI-BLAST2 is used for amino acid sequence comparison, the amino acid sequence identity (%) of a given amino acid sequence A with a given amino acid sequence B or with respect to a given amino acid sequence B relative to a given amino acid sequence B (or a given amino acid sequence) For B, which may be represented by a given amino acid sequence A having or comprising some% amino acid sequence identity (%) relative to a given amino acid sequence B or relative to a given amino acid sequence B) is calculated as follows:

X / Y × 100

Where X is the number of amino acid residues recorded by the sequence alignment program NCBI-BLAST2 as equally matched in the program alignment of A and B, and Y is the total number of amino acid residues of B. Of course, when the length of amino acid sequence A is not equal to the length of amino acid sequence B, the amino acid sequence identity of A to B is not equal to the amino acid sequence identity of B to A to A.

A “PRO variant polynucleotide” or “PRO variant nucleic acid sequence” is a nucleic acid molecule encoding an active PRO polypeptide as defined below, the full length native sequence PRO polypeptide sequence disclosed herein, the full length lacking a signal peptide as disclosed herein At least about 80% nucleic acid sequence identity with a nucleic acid sequence encoding a native sequence PRO polypeptide sequence, an extracellular domain of a PRO polypeptide with or without a signal sequence as disclosed herein, or any other fragment of the full length PRO polypeptide sequence disclosed herein It is a nucleic acid molecule having a. Typically, PRO variant polynucleotides are cells of a full length native sequence PRO polypeptide sequence disclosed herein, a full length native sequence PRO polypeptide sequence lacking a signal peptide as disclosed herein, a PRO polypeptide with or without a signal sequence as disclosed herein At least about 80%, more preferably at least about 81%, more preferably at least about 82%, more preferably about 83 with the nucleic acid sequence encoding the foreign domain, or any other fragment of the full-length PRO polypeptide sequence disclosed herein At least%, more preferably at least about 84%, more preferably at least about 85%, more preferably at least about 86%, more preferably at least about 87%, more preferably at least about 88%, more preferred Preferably at least about 89%, more preferably at least about 90%, more preferably at least about 91%, more preferably at least about 92%, more preferably at least about 93% At least about 94%, more preferably at least about 95%, more preferably at least about 96%, more preferably at least about 97%, more preferably at least about 98%, most preferred Preferably at least about 99% nucleic acid sequence identity. Variants do not include native nucleotide sequences.

Typically, PRO variant polynucleotides are at least about 30 nucleotides in length, often at least about 60 nucleotides, more often at least about 90 nucleotides, more often at least about 120 nucleotides, and more often at least about 150 nucleotides. , More often at least about 180 nucleotides, more often at least about 210 nucleotides, more often at least about 240 nucleotides, more often at least about 270 nucleotides, more often at least about 300 nucleotides, more often At least about 450, more often at least about 600 nucleotides, more often at least about 900 nucleotides, or more.

The "% nucleic acid sequence identity" for a PRO-encoding nucleic acid sequence identified herein refers to that PRO nucleic acid sequence after aligning the PRO nucleic acid sequence with the candidate sequence and introducing a gap if necessary to obtain a maximum of sequence identity. It is defined as the ratio of nucleotides of the same candidate sequence as nucleotide of. Alignment to determine percent nucleic acid sequence identity can be accomplished using a variety of methods known to those skilled in the art, for example, publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. have. However, for purposes herein,% nucleic acid sequence identity values can be obtained using the sequence comparison computer program ALIGN-2, where the complete source code for the ALIGN-2 program is described in Table 1 below. The ALIGN-2 sequence comparison computer program was developed by Genentech, Inc., and the source code shown in Table 1 is kept as a user document of the U.S. Copyright Office (20559 Washington, DC), which code is U.S. Copyright No. TXU510087 It is registered as a call. The ALIGN-2 program is publicly available through Genentech, Inc. (South San Francisco, Calif.) Or can be compiled from the source code described in Table 1 below. The ALIGN-2 program can be edited and used on a UNIX operating system, preferably digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not change.

When ALIGN-2 is used for nucleic acid sequence comparison, the nucleic acid sequence identity (%) of a given nucleic acid sequence C relative to a given nucleic acid sequence D or with respect to a given nucleic acid sequence D (or a given nucleic acid) For sequence D, which can be represented by a given nucleic acid sequence C having or including some percent nucleic acid sequence identity (%) relative to a given nucleic acid sequence D or relative to a given nucleic acid sequence D) is calculated as follows:

W / Z × 100

Where W is the number of nucleotides recorded as identical matches in the program alignment of C and D by the sequence alignment program ALIGN-2, and Z is the total number of nucleotides of D. Of course, if the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, then the percent nucleic acid sequence identity of C to D is not equal to the percent nucleic acid sequence identity of D to C. As an example of nucleic acid sequence identity (%) calculations, Tables 4 and 5 below show methods for calculating nucleic acid sequence identity (%) of nucleic acid sequences referred to as "comparative DNA" and nucleic acid sequences referred to as "PRO-DNA". Wherein "PRO-DNA" refers to the putative PRO-coding nucleic acid sequence, "comparative DNA" refers to the nucleotide sequence of a nucleic acid molecule comparing the "PRO-DNA" nucleic acid molecule, and "N," "L "And" V "each represent a different putative nucleotide.

Unless specifically stated otherwise, all percent nucleic acid sequence identity values used herein are obtained using the ALIGN-2 computer program as described in the immediately preceding paragraph. However,% nucleic acid sequence identity values can also be obtained using the WU-BLAST-2 computer program as described below (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). . Most of the WU-BLAST-2 search parameters are set to default values. Those not set to the default values, ie adjustable parameters, are set to the following values: overlap span = 1, overlap fraction = 0.125, word threshold (T) = 11, and scoring matrix = BLOSUM62. When WU-BLAST-2 is used, the percent nucleic acid sequence identity value is (a) of the PRO polypeptide-encoding nucleic acid molecule having a sequence derived from the native sequence PRO polypeptide-encoding nucleic acid by WU-BLAST-2. Determine the number of identical identical nucleotides matched between the nucleic acid sequence and the comparative nucleic acid molecule (ie, the sequence to which the PRO polypeptide-encoding nucleic acid molecule is compared may be a variant PRO polynucleotide), and (b) the PRO polypeptide- Determine by dividing by the total number of nucleotides of the coding nucleic acid molecule. For example, in the term “isolated nucleic acid molecule comprising nucleic acid sequence A having at least 80% nucleic acid sequence identity with nucleic acid sequence B”, nucleic acid sequence A is the comparative nucleic acid molecule and nucleic acid sequence B is the PRO polypeptide-coding Nucleic acid sequence of a nucleic acid molecule.

Nucleic acid sequence identity (%) can also be calculated using the sequence comparison program NCBI-BLAST2 [Altschul et al. Nucleic Acids Res. 25: 3389-3402 (1997)]. The NCBI-BLAST2 sequence comparison program can be downloaded from the website (http://www.ncbi.nlm.nih.gov.). NCBI-BLAST2 uses several search parameters, for example unmask = yes, strand = all, expected occurrences = 10, minimum low complexity length = 15/5, multi-pass e-value = 0.01, constant for multi- All search parameters including pass = 25, dropoff for final gapped alignment = 25 and scoring matrix = BLOSUM62 are set to default values.

When NCBI-BLAST2 is used for sequence comparison, the nucleic acid sequence identity (%) of a given nucleic acid sequence C relative to a given nucleic acid sequence D, or relative to a given nucleic acid sequence D (or given nucleic acid sequence D) For a given nucleic acid sequence D, or with or containing some% nucleic acid sequence identity relative to a given nucleic acid sequence D, can be expressed as:

W / Z × 100

Where W is the number of nucleotides recorded by the sequence alignment program NCBI-BLAST2 to match identically in the program alignment of C and D, and Z is the total number of nucleotides of D. Of course, if the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the nucleic acid sequence identity (C) of C for D is not the same as the nucleic acid sequence identity (D) of D for C.

In other embodiments, the PRO variant polynucleotide is a nucleic acid molecule capable of hybridizing (preferably under stringent hybridization conditions and wash conditions) with the nucleotide sequence encoding the active PRO polypeptide and encoding the full-length PRO polypeptide disclosed herein. The PRO variant polypeptide may be one encoded by a PRO variant polynucleotide.

The term "positive" with respect to sequence comparisons performed as described above is meant to include residues of the compared sequences which are not identical but have similar properties (e.g., see Table 6 below for the results of conservative substitutions). ). For purposes herein, the positive value (%) is positive between (a) the PRO polypeptide amino acid sequence having a sequence derived from the native PRO polypeptide sequence and the comparative amino acid sequence (ie, the amino acid sequence with which the PRO polypeptide sequence is compared). The number of amino acid residues recording the value is determined in the BLOSUM 62 matrix of WU-BLAST-2, which is then divided by (b) the total number of amino acid residues of the PRO polypeptide.

Unless stated otherwise, positive values (%) are calculated as described in the immediately preceding paragraph. However, comparisons of amino acid sequence identity performed as described for ALIGN-2 and NCBI-BLAST2 above include amino acid residues of the compared sequences that are identical as well as having similar properties. An amino acid residue that records a positive value for that amino acid residue is a residue that is the same residue as the amino acid residue or a preferred substituent of that amino acid residue (defined in Table 6 below).

For amino acid sequence comparisons using ALIGN-2 or NCBI-BLAST2, the positive value (%) of a given amino acid sequence A against a given amino acid sequence B, or a given amino acid sequence B against a given amino acid sequence B (or given For amino acid sequence B, which can be represented by a given amino acid sequence A having or including some positive value (%) relative to a given amino acid sequence B, or relative to a given amino acid sequence B), is calculated as follows:

X / Y × 100

Where X is the number of amino acid residues that record the positive values defined above in the program alignment of A and B by the sequence alignment program ALIGN-2 or NCBI-BLAST2, and Y is the total number of amino acid residues of B. If the length of amino acid sequence A is not equal to the length of amino acid sequence B, of course, the positive value (%) of A for B is not equal to the positive value (%) of B for A.

“Isolated,” as used to describe the various polypeptides disclosed herein, means polypeptides that have been identified, isolated, and / or recovered from their natural environmental elements. Contaminant elements of the polypeptide's natural environment are typically substances that interfere with the diagnostic or therapeutic use of the polypeptide, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In a preferred embodiment, the polypeptide is purified to a degree sufficient to (1) obtain at least 15 residues of the N-terminal or internal amino acid sequence using a spinning cup sequenator, or (2) Coomassie blue ( Coomassie blue) or preferably silver stain is used to purify such that only one band appears in SDS-PAGE under non-reducing or reducing conditions. Since at least one element of the PRO polypeptide will not be present in the natural environment, an isolated polypeptide includes a polypeptide present in a recombinant cell. However, isolated polypeptide is typically obtained by one or more purification steps.

An “isolated” PRO polypeptide-encoding nucleic acid or other polypeptide-encoding nucleic acid is a nucleic acid molecule that has been identified and separated from one or more contaminating nucleic acid molecules that are typically associated with a naturally occurring PRO polypeptide encoding nucleic acid. Isolated polypeptide-encoding nucleic acid molecules are different from the forms or states found in nature. Thus, an isolated polypeptide-encoding nucleic acid molecule is distinguished from certain polypeptide-encoding nucleic acid molecules present in natural cells. However, isolated polypeptide-encoding nucleic acid molecules include, for example, polypeptide-encoding nucleic acid molecules that are present at chromosomal sites different from the chromosomes of natural cells and are typically contained in cells expressing such polypeptides.

The term "regulatory sequence" is a DNA sequence necessary for the expression of a coding sequence operably linked in a particular host organism. Suitable regulatory sequences for prokaryotes include, for example, promoters, optionally operator sequences, and ribosomal binding sites. Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.

A nucleic acid is "operably linked" when placed in a functional relationship with another nucleic acid sequence. For example, the DNA for a presequence or secretion leader is operably linked to the DNA for the polypeptide when expressed as a preprotein that participates in the secretion of the polypeptide, and the promoter or enhancer If he affects the transcription of the coding sequence, it is operably linked to the coding sequence, and the ribosomal binding site is operably linked to the coding sequence if he is placed to facilitate translation. In general, "operably linked" means that the DNA sequences to be linked are contiguous, and in the case of a secretory leader, are contiguous and within the reading site. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adapters or linkers are used in accordance with conventional practice.

The term “antibody” is used in its broadest sense and specifically includes, for example, one anti-PRO monoclonal antibody (including agonists, antagonists and neutralizing antibodies), anti-PRO antibody compositions with polyepitope specificity, single chain Anti-PRO antibodies, and anti-PRO antibody fragments (see below). As used herein, the term “monoclonal antibody” means in fact an antibody obtained from a population of homologous antibodies, ie, individual antibodies that make up a population, except for possible naturally occurring mutations that may be present in small amounts.

The "stringency" of the hybridization reaction can be readily determined by one skilled in the art and is generally an experimental calculation that depends on probe length, wash temperature, salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes require lower temperatures. In general, hybridization is dependent on the renalling ability of the denatured DNA when the complementary strand is present in an environment below its melting temperature. The higher the degree of desired homology between the probe and the hybridizable sequence, the higher the relative temperature available. As a result, the reaction conditions are more stringent at higher relative temperatures, but the reaction conditions are less stringent at lower relative temperatures. For more detailed information and explanations on the stringency of the hybridization reaction, see Ausubel et al. Current Protocols in Molecular Biology, Wiley Interscience Publishers (1995).

As defined herein, "strict conditions" or "high stringency conditions" means (1) 0.015 M sodium chloride / 0.0015 M sodium citrate / 0.1% sodium dodecyl alcohol at low ionic concentration and high temperature at washing, for example at 50 ° C. Conditions using pate, (2) 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone with 750 mM sodium chloride, 75 mM sodium citrate, for example at 42 ° C. during hybridization Conditions using a denaturant such as 50% (v / v) formamide with / 50 mM sodium phosphate buffer (pH 6.5), or (3) 50% formamide at 42 ° C, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 μg / ml), 0.1% SDS, and 10% dex Using tran sulphate, 0.2 x SSC (sodium chloride / sodium citrate) at 42 ° C. and 50% foam at 55 ° C. Washing the amide and then, EDTA containing 0.1 x SSC at 55 to ℃ - to perform a rigorous cleaning.

"Medium stringent conditions" are those described in Sambrook et al., Molecular Cloning: A Laboratory Manual , New York: Cold Spring Harbor Press 1989, and are less stringent than wash solutions and hybridization conditions (above). For example, use of temperature, ion concentration and% SDS). Examples of medium stringency conditions include 20% formamide, 5 x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt solution, 10% dextran And incubating overnight at 37 ° C. in a solution containing 20 mg / ml of pate and denatured truncated salmon sperm DNA, followed by washing the filter with 1 × SSC at about 37-50 ° C. Those skilled in the art will know how to adjust the temperature, ion concentration, and the like necessary to match factors such as probe length and the like.

As used herein, the term “epitope tagged” refers to a chimeric polypeptide comprising a PRO polypeptide fused with a “tag polypeptide”. The tag polypeptide has enough residues to provide an epitope that allows the antibody to be made, but the tag polypeptide is short enough that it does not interfere with the activity of the polypeptide to which it is fused. It is also desirable that the tag polypeptide is very specific so that the antibody against it does not actually cross react with other epitopes. Suitable tag polypeptides generally have six or more amino acid residues, and typically have about 8-50 amino acid residues (preferably about 10-20 amino acid residues).

The term “immunoadhesin” as used herein refers to an antibody-like molecule that combines the binding specificity of a heterologous protein (adhesin) with the effector function of an immunoglobulin constant domain. Structurally, an immunoadhesin comprises a fusion of an immunoglobulin constant domain sequence with an amino acid sequence having some binding specificity (ie, heterologous) that is not the antigen recognition site and binding site of the antibody. The adhesin portion of an immunoadhesin molecule is typically a contiguous amino acid sequence comprising at least the binding site of a receptor or ligand. Immunoglobulin constant domain sequences of immunoadhesin may be IgG-1, IgG-2, IgG-3 or IgG-4 subtypes, such as IgA (including IgA-1 and IgA-2), IgE, IgD or IgM Can be obtained from any immunoglobulin.

As used herein, the term "active" or "activity" refers to a form of a PRO polypeptide that retains the biological and / or immunological activity of a natural or naturally-occurring PRO, wherein "biological" activity means Or biological function (inhibitory or facilitating function) induced by a natural or naturally-occurring PRO, rather than the ability to induce the production of antibodies against antigenic epitopes possessed by a naturally-occurring PRO, and "immunological "Activity refers to the ability to induce the production of antibodies against antigenic epitopes possessed by natural or naturally-occurring PRO.

The term “antagonist” is used in its broadest sense and includes any molecule that partially or completely blocks, inhibits or neutralizes the biological activity of the native PRO polypeptides disclosed herein. Likewise, the term "agonist" is used in its broadest sense and includes any molecule that mimics the biological activity of the native PRO polypeptides disclosed herein. Suitable agonist or antagonist molecules include, in particular, agonist or antagonist antibodies or antibody fragments, fragments or amino acid sequence variants of native PRO polypeptides, peptides, antisense oligonucleotides, small organic molecules and the like. Methods for identifying an agonist or antagonist of a PRO polypeptide may include contacting the PRO polypeptide with a candidate agonist molecule or a candidate antagonist molecule and measuring a detectable change in one or more biological activities, typically associated with the PRO polypeptide.

"Treatment" means a therapeutic treatment and a preventive or preventive measure carried out for the purpose of preventing or slowing (mitigating) a pathological condition or disease in a subject. Subjects in need of treatment include those already afflicted with the disease, as well as those susceptible to disease or those seeking to prevent the disease.

"Chronic" administration refers to the administration of the substance in a continuous manner as opposed to the acute manner, to maintain the initial therapeutic effect (activity) for a long time. "Intermittent" administration refers to treatment that is actually performed periodically, rather than continuing without interruption.

“Mammals” for treatment are mammals, including humans, livestock and breeding animals, and zoo, competition or pet animals such as dogs, cats, cattle, horses, sheep, pigs, goats, and rabbits. Any animal that is classified. Preferred mammals are humans.

“Co-administering” with one or more other therapeutic agents includes simultaneous (in combination) or continuous administration in any order.

As used herein, “carrier” includes pharmaceutically acceptable carriers, excipients or stabilizers which are nontoxic to the cell or mammal being exposed to the dosages and concentrations employed. Physiologically acceptable carriers are often pH buffered aqueous solutions. Examples of physiologically acceptable carriers include buffers such as phosphate, citrate and other organic acids; Antioxidants including ascorbic acid; Low molecular weight (less than about 10 residues) polypeptide; Proteins such as serum albumin, gelatin or immunoglobulins; Hydrophilic polymers such as polyvinylpyrrolidone; Amino acids such as glycine, glutamine, asparagine, arginine or lysine; Monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; Chelating agents such as EDTA; Sugar alcohols such as mannitol or sorbitol; Salt-forming counterions such as sodium; And / or nonionic surfactants such as TWEEN, polyethylene glycol (PEG) and PLURONICS®.

"Antibody fragments" include portions of intact antibodies, preferably antigen binding regions or variable regions of intact antibodies. Examples of antibody fragments include Fab, Fab ', F (ab') ₂ and Fv fragments, diabodies, linear antibodies [Zapata et al., Protein Eng. 8 (10): 1057-1062 (1995)], single chain antibody molecules, and multispecific antibodies formed from antibody fragments.

Papain digestion of the antibody produces two identical antigen binding fragments, a "Fab" fragment with a single antigen-binding site, and the remaining "F _c " fragments, which reflect the ability to readily crystallize. Treatment with pepsin results in an F (ab ') ₂ fragment having two antigen binding sites and capable of crosslinking with the antigen.

"Fv" is the minimum antibody fragment that includes a complete antigen-recognition and antigen-binding site. This region consists of a dimer of one heavy chain variable domain and one light chain variable domain that is tightly covalently bonded. In this form three CDRs of each variable domain interact to form an antigen-binding site on the surface of the V _H -V _L dimer. In conclusion, six CDRs confer antigen-binding specificity to antibodies. However, even a single variable domain (or half of the Fv comprising only three CDRs specific for the antigen), although less affinity than the entire binding site, has the ability to recognize and bind the antigen.

The Fab fragment also comprises the constant domain of the light chain and the first constant domain (CH1) of the heavy chain. Fab fragments differ from Fab 'fragments by the addition of several residues at the carboxy terminus of the CH1 domain of the heavy chain, including one or more cysteines from the hinge region of the antibody. Fab'-SH herein refers to Fab 'in which the cysteine residues of the constant domains bear free thiol groups. F (ab ') ₂ antibody fragments were originally produced as a pair of Fab' fragments with hinge cysteines between them. In addition, other chemical couplings of antibody fragments are known.

The “light chain” of an antibody (immunoglobulin) from any vertebrate species can belong to one of two distinctly different types called kappa (κ) and lambda (λ) based on the amino acid sequence of its constant domain. .

Immunoglobulins can belong to different groups depending on the amino acid sequence of the constant domain of their heavy chains. There are five main groups of immunoglobulins: IgA, IgD, IgE, IgG and IgM, some of which can be further classified into subgroups (isotypes) such as IgG1, IgG2, IgG3, IgG4, IgA and IgA2. Can be.

"Single-chain Fv" or "sFv" antibody fragments comprise the V _H and V _L domains of an antibody present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises a polypeptide linker between the V _H and V _L domains that allows the sFv to form the structure required for binding of the antigen. For sFv, see Pluckthan's [ The Pharmacology of Monoclonal Antibodies , vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994).

The term "dia body (diabody)" in the same polypeptide chain in the (V _H -V _L) of the light chain variable domain (V _L) of a heavy chain associated with the variable domain (V _H), including a small having two antigen binding sites Refers to an antibody fragment. Linkers that are too short to link two domains on the same chain are used to create two antigen-binding sites by linking the domains with the complementary domains of the other chain. Diabodies are described, for example, in European Patent 404,097, WO 93/11611 and Hollinger et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448 (1993).

An “isolated” antibody is an antibody identified, isolated and / or recovered from elements of its natural environment. Antibody contaminating elements of the natural environment are substances that interfere with the diagnostic or therapeutic use of the antibody and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In a preferred embodiment, the antibody is (1) greater than 95% by weight, most preferably at least 99% by weight, as determined by the Lowry method, and (2) using a spinning cup sequencer. Sufficient to obtain at least 15 residues of the N-terminal or internal amino acid, or (3) one band by SDS-PAGE under reducing or non-reducing conditions using Coomassie blue or preferably silver staining. Will be purified. Isolated antibody includes antibodies in recombinant cells since at least one antibody component will not be present in the natural environment. However, isolated antibodies will typically be prepared by one or more purification steps.

As used herein, the term "label" refers to a detectable compound or composition that binds directly or indirectly with an antibody to produce a "labeled" antibody. The label can be detected by itself (eg, a radioisotope label or fluorescent label) or, if it is an enzyme label, can promote chemical modification of the detectable substrate compound or composition.

"Solid phase" means a non-aqueous matrix to which an antibody of the invention may be attached. Examples of solid phases included herein include those formed partially or entirely of glass (eg, controlled pore glass), polysaccharides (eg, agarose), polyacrylamide, polystyrene, polyvinyl alcohol, and silicone. Included. In some embodiments, depending on the circumstances, the solid phase may comprise the wells of an assay plate, and in other embodiments the solid phase is a purification column (eg, an affinity chromatography column). The term also encompasses discrete particles of a discontinuous solid phase, such as those described in US Pat. No. 4,275,149.

A "liposome" is a small vesicle consisting of various forms of lipids, phospholipids, and / or surfactants useful for delivering a drug (eg, a PRO polypeptide or antibody thereto) to a mammal. Liposomal components are typically arranged in bilayer form, similar to the lipid arrangement of biological membranes.

"Small molecule" is defined herein as having a molecular weight of less than about 500 Daltons.

As used herein, "vascular endothelial growth factor-E" or "VEGF-E" refers to all VEGF cysteine residues homologous to VEGF and bone morphogenetic protein 1 and necessary for the biological activity of VEGF. Mammalian growth factor described herein, including the human amino acid sequence of FIG. 207). VEGF-E expression includes expression in the bone, thymus, and gastrointestinal tract of a human fetus. Can promote selective growth and / or survival of umbilical vein endothelial cells, induce proliferation of pluripotent fibroblasts, induce c-fos, an immediate early gene in human endothelial cell lines, and in cardiac cells Certain analogs or variants thereof which cause myoclonal hypertrophy share an immune epitope that shares the biological activity of native VEGF-E, or that is immunologically cross-reactive with antibodies formed against one or more epitopes of the corresponding native VEGF-E. do. Such human VEGF-E is active against rat and mouse cells, suggesting the conservedness of the practitioner. VEGF-E is also expressed in the growth plate region of rats and mice, and is known to be contained in myocytes of the fetus.

As used herein, "vascular endothelial growth factor" or "VEGF" refers to a mammalian growth factor as defined in US Pat. No. 5,332,671. Certain analogs or variants thereof that selectively promote the growth of vascular endothelial cells, but do not promote the growth of bovine corneal endothelial cells, lens epithelial cells, adrenal cortex cells, BHK-21 fibroblasts or keratinocytes, are known to support the biological activity of native VEGF. Retain an immune epitope that is immunologically cross-reactive with antibodies formed against one or more epitopes of, or corresponding to, native VEGF.

As used herein, the terms "VEGF-E polypeptide" and "VEGF-E" include native sequence VEGF-E polypeptides and VEGF-E polypeptide variants (as defined herein). VEGF-E polypeptides can be isolated from a variety of sources, such as, for example, human tissue types or other sources, or prepared by recombinant or synthetic methods.

Inhibitors of VEGF-E induce or inhibit the activity or expression of VEGF-E and include antisense molecules.

The abbreviation “KDR” refers to the kinase domain region of the VEGF molecule. VEGF-E has no homology with VEGF in this region.

The abbreviation “FLT-1” refers to an FMS-like tyrosine kinase binding domain known to bind its corresponding FLT-1 receptor. VEGF-E has no homology with VEGF in this domain.

"Toll receptor 2," "TLR2" and "huTLR2" are interchangeable and refer to the human Toll receptor named "HuTLR2" [Rock et al., Proc. Natl. Acad. Sci. USA 95, 588-593 (1998).

The term "lipopolysaccharide" or "LPS" is used herein as a synonym for "endotoxin". Lipopolysaccharide (LPS) is a characteristic component of the outer membrane of Gram-negative bacteria, such as Escherichia coli. LPS consists of a polysaccharide moiety and a fat called lipid A. Depending on the bacterial species, different polysaccharides consist of O-specific chains (formed from repeats of three to eight sugars) and a two-part core. Lipid A almost always contains two glucosamine sugars modified by phosphates and variable fatty acids. For further information, see, eg, Rietschel and Brade, Scientific American August 1992, 54-61.

As used herein, the term “septic shock” is described by Bone, Ann. Intern Med. 114, 332-333 (1991), the broadest meaning including all definitions. Specifically, septic shock begins with a systemic response to infection, a syndrome called sepsis. If the syndrome causes hypertension and organ failure, this syndrome is called septic shock. Septic shock can be initiated by gram-positive organisms and fungi as well as endotoxin-containing gram-negative organisms. Thus, this definition is not limited to the meaning of "endotoxin shock".

The phrases “gene amplification” and “gene replication” are interchangeable and refer to the process by which multiple copies of a gene or gene fragment are formed in a particular cell or cell line. Replicated regions (amplified DNA stretch) are often called “amplicons”. Typically, the amount of mRNA produced, ie the amount of gene expression, increases in proportion to the number of copies of the particular gene being expressed.

As used herein, "tumor" refers to the growth and proliferation of all tumorous cells, whether malignant or benign, and all precancerous cancerous cells and tissues. The terms "cancer" and "cancerous" mean or define the physiological state of a mammal having the typical characteristic of unregulated cell growth. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More specific examples of such cancers include breast cancer, prostate cancer, colon cancer, squamous cell cancer, small cell lung cancer, non-small cell lung cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, liver tumor, colorectal cancer, and uterus. Endometrial cancer, salivary gland carcinoma, kidney cancer, vulvar cancer, thyroid cancer, liver carcinoma and various types of head and neck cancers.

As used herein, "cytotoxic" refers to a substance that inhibits or inhibits the function of a cell and / or destroys a cell. The term includes radioisotopes (eg I ¹³¹ , I ¹²⁵ , Y ⁹⁰ and Re ¹⁸⁶ ), chemotherapeutic agents and toxins such as toxins or fragments thereof having enzymatic activity of bacterial, fungal, plant or animal origin. Included.

A "chemotherapeutic agent" is a compound useful for the treatment of cancer. Examples include adriamycin, doxorubicin, epirubicin, 5-fluorouracil, cytosine arabinoside ("Ara-C"), cyclophosphamide, thiotepa, busulfan, cytoxins, taxoids, for example Paclitaxel (trade name Taxol, manufactured by Bristol Myers Squirk Okoloji, Princeton, NJ) and docetaxel (trade name Taxotere, Long Plan Lorea Corporation, Antony, France), toxotere, methotrexate, cisplatin , Melphalan, vinblastine, bleomycin, etoposide, phosphamide, mitomycin C, mitoxantrone, vincristine, vinorelbine, carboplatin, teniposide, daunomycin, carminomycin, ami Nofterin, dactinomycin, mitomycin, esperamicin (see US Pat. No. 4,675,187), melphalan and other related nitrogen mustards. Also included in the definition of chemotherapeutic agents are hormonal agents that modulate or inhibit hormonal action on the tumor, such as tamoxifen and onapristone.

As used herein, “growth inhibitor” refers to a compound or composition that inhibits in vitro or in vivo growth of cells, particularly cancer cells that overexpress any of the genes identified herein. Thus, growth inhibitory agents are substances that greatly reduce the proportion of cells that overexpress such genes in the S phase. Examples of growth inhibitory agents include substances that block the progression of the cell cycle (at periods other than S phase), for example, substances that induce the arrest of the G1 and M phases. Typical M blockers include vincas (vincristine and vinblastine), taxol, and topo II inhibitors such as doxorubicin, epirubicin, daunorubicin, etoposide and bleomycin. In addition, substances that stop G1, such as DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechloretamine, cisplatin, methotrexate, 5-fluorouracil and ara-C also act on the stopping of the S group do. For further information, see Murakami et al., The Molecular Basis of Cancer, Mendelsohn and Israel, eds., "Cell cycle regulation, oncogens, and antineoplastic drugs" (WB Saunders: Philadelphia, 1995), Chapter 1, in particular page 13. It is described in.

"Doxorubicin" is an anthracycline antibiotic.

"Cytokine" is a generic term for a protein that acts on another cell as an intercellular mediator released by one cell population. Examples of such cytokines are lymphokine, monocaine and common polypeptide hormones. Cytokines include growth hormones such as human growth hormone, N-methionyl human growth hormone and bovine growth hormone; Parathyroid hormone; Thyroxine; insulin; Proinsulin; Relaxin; And prolylacin and the like. As used herein, the term cytokine includes biologically active equivalents of native sequence cytokines and proteins from natural sources or recombinant cell culture.

II. Compositions and Methods of the Invention

A. Full Length PRO Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO polypeptides. In particular, cDNA encoding various PRO polypeptides were identified and isolated as described in more detail in the Examples below. The PRO number of proteins produced in separate rounds of expression may vary but the UNQ number is specific to any given DNA and protein encoded therefrom and will not change. However, herein, simply, proteins encoded by the full-length natural nucleic acid molecules disclosed herein, and other natural homologs and variants of PRO included in the above definitions, are referred to as "PRO / number" regardless of their origin and manner of preparation. Will be mentioned.

As described in the Examples below, various cDNA clones were deposited with the ATCC. One skilled in the art can readily determine the actual nucleotide sequence of the clone by analyzing the sequence of the deposited clone using conventional methods in the art. General techniques can be used to determine the expected amino acid sequence from the nucleotide sequence. In the case of the PRO polypeptides described herein and the nucleic acids encoding them, the inventors have identified what is considered to be the best identifying frame using sequence information available at the time.

1.Full Length PRO213 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO213. In particular, we identified and isolated cDNA encoding the PRO213 polypeptide, as described in more detail in the Examples below. The inventors have used BLAST and Fast A sequence alignment computer programs to find that some of the PRO213 polypeptides have significant homology with human growth stop-specific 6 (gas) proteins. Thus, it is presently contemplated that the PRO213 polypeptide disclosed herein may have the same or similar activity as the gas6 protein.

2. Full Length PRO274 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO274. In particular, the inventors have identified and isolated cDNA encoding the PRO274 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that various parts of the PRO274 polypeptide have significant homology with the 7-membrane fragment receptor protein and the Fn54 protein. Thus, it is presently believed that the PRO274 polypeptides disclosed herein are newly identified members of the 7-membrane fragment receptor protein and / or Fn54 protein family.

3. Full Length PRO300 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO300. In particular, we identified and isolated the cDNA encoding the PRO300 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that various parts of the PRO300 polypeptide have significant homology with human Diff33 protein. Thus, it is presently believed that the PRO300 polypeptides disclosed herein are newly identified members of the Diff33 family.

4. Full Length PRO284 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO284. In particular, we identified and isolated cDNA encoding the PRO284 polypeptide, as described in more detail in the Examples below. As we currently know, the UNQ247 (DNA23318-1211) nucleotide sequence encodes a new factor; Use of BLAST and Fast A sequence alignment computer programs revealed no sequence identity with any known protein.

5. Full Length PRO296 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO296. In particular, the inventors have identified and isolated cDNA encoding the PRO296 polypeptide, as described in more detail in the Examples below. The inventors have used the BLAST and Fast A sequence alignment computer programs to find that the PRO296 polypeptide has significant similarity to the SAS protein amplified in sarcoma. Thus, it is presently believed that the PRO296 polypeptides disclosed herein are newly identified SAS protein homologs.

6. Full Length PRO329 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO329. In particular, we identified and isolated the cDNA encoding the PRO329 polypeptide, as described in more detail in the Examples below. The inventors have used the BLAST and Fast A sequence alignment computer programs to find that the PRO329 polypeptide has significant similarity with the high affinity immunoglobulin F _c receptor. Thus, it is presently believed that the PRO329 polypeptide disclosed herein is a newly identified F _c receptor homologue.

7. Full Length PRO362 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO362. In particular, we identified and isolated cDNA encoding the PRO362 polypeptide, as described in more detail in the Examples below. The inventors have used the BLAST and Fast A sequence alignment computer programs to find that the PRO362 polypeptide has significant similarity with the A33 antigen protein as well as the HCAR protein and NrCAM related cell adhesion molecules. Thus, it is presently believed that the PRO362 polypeptides disclosed herein are new A33 antigens and HCAR protein analogs.

8. Full Length PRO363 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO363. In particular, we identified and isolated the cDNA encoding the PRO363 polypeptide, as described in more detail in the Examples below. The inventors have used the BLAST and Fast A sequence alignment computer programs to find that the PRO363 polypeptide has significant similarity with the protein HCAR on the cell surface. Thus, it is presently believed that the PRO363 polypeptides disclosed herein are new HCAR homologs.

9. Full Length PRO868 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO868. In particular, we identified and isolated cDNA encoding the PRO868 polypeptide, as described in more detail in the Examples below. We have found that the PRO868 polypeptide has significant similarity to tumor necrosis factor receptors using the BLAST and Fast A sequence alignment computer programs. Thus, it is presently believed that the PRO868 polypeptide disclosed herein is a newly identified member of the tumor necrosis factor receptor protein family.

10. Full Length PRO382 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO382. In particular, the inventors have identified and isolated cDNA encoding the PRO382 polypeptide, as described in more detail in the Examples below. We used BLAST and Fast A sequence alignment computer programs to find that native PRO382 polypeptides share significant homology with various serine protease proteins. In addition, the inventors have found that DNA encoding a PRO382 polypeptide shares significant homology with nucleic acids encoding various serine protease proteins. Thus, it is presently believed that the PRO382 polypeptides disclosed herein are newly identified serine protease homologs.

11.Full Length PRO545 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO545. In particular, we identified and isolated cDNA encoding the PRO545 polypeptide, as described in more detail in the Examples below. The inventors have used BLAST and Fast A sequence alignment computer programs to determine that various portions of the PRO545 polypeptide can be expressed in human metalloproteinases ("P_W01825"), mouse meltrin alpha ("S60257"), metalloproteases-disintegrin mellins. -Alpha ("GEN13695"), ADAM13-Xenopus laevis ("XLU66003_1"), Mouse Meltrin Beta ("S60258"), Rabbit Metalloprotease-Disintegrin Meltrin-Beta ("GEN13696") , Has significant homology with the identified sequences named human meltrin S ("AF023477_1"), human meltrin precursor ("AF023476_1"), human ADAM21 ("AF029900_1"), and human ADAM20 ("AF029899_1"). Found, suggesting that PRO544 may be a novel meltrin protein. Thus, it is presently believed that the PRO545 polypeptide disclosed herein is a newly identified member of the Meltrin family and retains the typical cellular adhesion of Meltrin proteins, including both domains of metalloproteases and disintegrins.

12. Full Length PRO617 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO617. In particular, we identified and isolated cDNA encoding the PRO617 polypeptide, as described in more detail in the Examples below. We used the BLAST and Fast A sequence alignment computer programs to find that the PRO617 polypeptide shares significant homology with the CD24 protein. In addition, the inventors have found that the DNA encoding the PRO617 polypeptide has significant homology with the DNA encoding the CD24 protein. Thus, it is presently believed that the PRO617 polypeptide disclosed herein is a newly identified CD24 homolog.

13. Full Length PRO700 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO700. In particular, we identified and isolated the cDNA encoding the PRO700 polypeptide, as described in more detail in the Examples below. Amino acid sequence analysis of the full length PRO700 polypeptide using the BLAST and Fast A sequence alignment computer programs suggests that various portions of the PRO700 polypeptide have significant sequence similarity with various protein disulfide isomerases. More specifically, analysis of the Deihof database (version 35.45 SwissProt 35) was performed using the PRO700 amino acid sequence and the Deihof sequence [polypeptides with protein disulfide isomerase activity (named “P_P80664”), human PDI (“P_R51696”). ), Human PDI (named "P_R25297"), possible protein disulfide isomerase er-60 precursor (named "ER60_SCHMA"), protein disulfide isomerase precursor-Drosophila melanogaster (as "PDI_DROME") Protein disulfide-isomerase precursor-Nicotiana tabaccum (named "NTPDIGENE_1"), protein disulfide isomerase-Onchocerca volvulus (named "OVU12440_1") ), Human possible protein disulfide isomerase p5 precursor (named "ERP5_HUMAN"), human protein disulfide isomerase-related protein 5 (named "HSU79278_1"), and protein disulfide isomerase Specific / prolyl 4-hydroxy been demonstrated substantial sequence similarity between ( "PDI_HUMAN" as named)], which suggests that the novel protein PRO700 sulfide can isomerase best. Thus, it is presently believed that the PRO700 polypeptide disclosed herein is a newly identified member of the protein disulfide isomerase family and has the ability to promote the formation of typical disulfide bonds of the protein disulfide isomerase family.

14. Full Length PRO702 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO702. In particular, the inventors have identified and isolated cDNA encoding the PRO702 polypeptide, as described in more detail in the Examples below. We used BLAST and Fast A sequence alignment computer programs to find that the PRO702 polypeptide had significant similarity to the conglutinin protein. Thus, it is presently believed that the PRO702 polypeptides disclosed herein are newly identified conglutinin homologs.

15. Full Length PRO703 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO703. In particular, the inventors have identified and isolated cDNA encoding the PRO703 polypeptide, as described in more detail in the Examples below. Amino acid sequence analysis of the full length PRO703 polypeptide using the BLAST and Fast A sequence alignment computer programs suggests that several portions of the PRO703 polypeptide have significant sequence similarity with the VLCAS protein, suggesting that PRO703 may be a novel VLCAS protein. More specifically, analysis of the Dayhof database (version 35.45 SwissProt 35) was performed on the PRO703 amino acid sequence and the Dayhof sequence [human mRNA for very long chain acyl-CoA ("D88308"), very long chain acyl-CoA synthetase. For rat mRNA ("D85100"), the fatty acid carrier protein of Mus musculus ("MMU15976"), the very long-chain acyl-CoA synthetase of human ("D88308_1"), the very long-chain of Musmusculus Acyl-CoA synthetase ("AF033031_1"), the very long-chain acyl-CoA synthetase-Rattus ("D85100_1"), the long-chain fatty acid-carrying protein of rats ("FATP_RAT"), the transport of long-chain fatty acids in mice Protein ("FATP_MOUSE"), the carrier protein of possible long chain fatty acids ("FAT1_YEAST"), and the fatty acid carrier protein ("CHY15839_2")] demonstrated significant sequence similarity, suggesting that PRO703 may be a novel VLCAS. Thus, it is presently believed that the PRO703 polypeptide disclosed herein is a newly identified member of the VLCAS family and has the ability to promote intracellular transport of typical long chain fatty acids of the VLCAS family.

16. Full Length PRO705 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO705. In particular, the inventors have identified and isolated cDNA encoding the PRO705 polypeptide, as described in more detail in the Examples below. The inventors have used the BLAST and Fast A sequence alignment computer programs to find that the PRO705 polypeptide has significant similarity with the K-glypican protein. Thus, it is presently believed that the PRO705 polypeptide disclosed herein is a newly identified member of the Glypican family of proteoglycan proteins.

17. Full Length PRO708 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO708. In particular, we identified and isolated cDNA encoding the PRO708 polypeptide, as described in more detail in the Examples below. We found that the PRO708 polypeptide had significant homology with the aryl sulfatase protein using the BLAST and Fast A sequence alignment computer programs. In addition, the inventors have found that the DNA encoding the PRO708 polypeptide has significant homology with the DNA encoding the aryl sulfatase protein. Thus, it is presently believed that the PRO708 polypeptides disclosed herein are newly identified aryl sulfatase homologs.

18. Full Length PRO320 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO320. In particular, we identified and isolated the cDNA encoding the PRO320 polypeptide, as described in more detail in the Examples below. Amino acid sequence analysis of the full-length PRO320 polypeptide using the BLAST and Fast A sequence alignment computer programs suggests that various parts of the PRO320 polypeptide have significant homology with the fibulin protein. More specifically, analysis of the Deihof database (version 35.45 SwissProt 35) was performed using the PRO320 amino acid sequence and the Deihof sequence (human fibulin-2 precursor (named "FBL2_HUMAN"), human fibulin-1 isoform precursor ("FBLA_HUMAN"). ZK783.1-Caenorhabditis elegans (named "CELZK783_1"), human-notch2 (named "HSU77493_1"), Nel protein precursor-Ratus norvegicus ) (Named "NEL_RAT"), Moose Musculus cell surface protein (named "D32210_1"), (fragment) Notch B protein in mice (named "A49175"), C50H2.3a-Canohabitis elele Significant homology between Gans (named "CEC50H2_3"), MEC-9L-Canohabtis elegans (named "CEU33933_1"), and Moose Musculus notch 4 (named "10 MMMHC29N7_2")] This suggests that PRO320 may be a novel fibulin or fibulin-like protein. Thus, it is presently believed that the PRO320 polypeptides disclosed herein are newly identified members of the fibulin family and have the typical biological activity of the fibulin family.

19. Full length PRO324 polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO324. In particular, the inventors have identified and isolated cDNA encoding the PRO324 polypeptide, as described in more detail in the Examples below. We have found that the PRO324 polypeptide has significant similarity to oxidoreductase using the BLAST and Fast A sequence alignment computer programs. Thus, it is presently believed that the PRO324 polypeptides disclosed herein are newly identified oxidoreductase analogs.

20. Full Length PRO351 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO351. In particular, the inventors have identified and isolated cDNA encoding the PRO351 polypeptide, as described in more detail in the Examples below. Amino acid sequencing of the full length PRO351 polypeptide using the BLAST and Fast A sequence alignment computer programs suggests that various parts of the PRO351 polypeptide have significant sequence similarity with the prostacin protein, suggesting that PRO351 may be a novel prostacin protein. Hints. More specifically, analysis of the Dayhof database (version 35.45 SwissProt 35) can be performed using the PRO351 amino acid sequence and the Dayhof sequence ["AC003965_1", "CELC07G1_7", "GEN12917", "HEPS_HUMAN", "GEN14584", "MCT6_MOUSE", " HSU75329_1 "," PLMN_ERIEU "," TRYB_HUMAN "and" P_W22987 "] demonstrated significant sequence similarity. Thus, it is presently believed that the PRO351 polypeptides disclosed herein are newly identified members of the prostacin family and have typical properties and activities of the prostacin family.

21. Full Length PRO352 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO352. In particular, we identified and isolated cDNA encoding the PRO352 polypeptide, as described in more detail in the Examples below. We found that the PRO352 polypeptide had significant similarity to butyrophylline protein using the BLAST and Fast A sequence alignment computer programs. Thus, it is presently believed that the PRO352 polypeptide disclosed herein is the newly identified butyrophylline homologue.

22. Full Length PRO381 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO381. In particular, we identified and isolated the cDNA encoding the PRO381 polypeptide, as described in more detail in the Examples below. The inventors have used the BLAST and Fast A sequence alignment computer programs to find that the PRO381 polypeptide has significant similarity to the immunophilin protein. Thus, it is presently believed that the PRO381 polypeptide disclosed herein is a newly identified FKBP immunophilin homologue.

23. Full Length PRO386 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO386. In particular, the inventors have identified and isolated cDNA encoding the PRO386 polypeptide, as described in more detail in the Examples below. We used BLAST and Fast A sequence alignment computer programs to find that the PRO386 polypeptide had significant similarity with the beta-2 subunit of the sodium channel protein. Thus, it is presently believed that the PRO386 polypeptides disclosed herein are homologues of beta-2 subunits of sodium channels expressed in mammalian cells.

24. Full Length PRO540 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO540. In particular, the inventors have identified and isolated cDNA encoding the PRO540 polypeptide, as described in more detail in the Examples below. Amino acid sequence analysis of the full length PRO540 polypeptide using the BLAST and Fast A sequence alignment computer programs suggests that various portions of the PRO540 polypeptide have significant sequence similarity with the LCAT protein, suggesting that PRO540 may be a novel LCAT protein. More specifically, analysis of the Deihof database (version 35.45 SwissProt 35) revealed the PRO540 amino acid sequence and the Deihof sequence [phosphatidylcholine-sterol acyltransferase (named "LCAT_HUMAN"), the putative 75.4 kd protein (named "YN84_YEAST"). ), Bacillus licheniformis esterase (named "BLU35855_1"), macrotetrolide resistant protein-Streptomyces (named "JH0655"), T-cell receptor Delta chain precursor (named "C30583"), Rhesus kringle 2 (named "P_W07551"), RAGE-1 ORF5 (named "HSU46191_3"), human Ig kappa chain VKIII-JK3 ("HSU07466_1 "," And Alstroemeria inodora reverse transcriptase (named "ALI223606_1"). Thus, it is presently believed that the PRO540 polypeptide disclosed herein is a newly identified member of the LCAT protein family and has the typical lipid transport capacity of the LCAT family.

25. Full Length PRO615 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO615. In particular, we identified and isolated cDNA encoding the PRO615 polypeptide, as described in more detail in the Examples below. Amino acid sequencing of the full-length PRO615 polypeptide using the BLAST and Fast A sequence alignment computer programs suggests that various parts of the PRO615 polypeptide have significant sequence similarity with human synaptogirin proteins, which may suggest that PRO615 is a novel synaptogirin protein. Imply that there is. More specifically, analysis of the Dayhof database (version 35.45 SwissProt 35) can be performed using the PRO615 amino acid sequence and the Dayhof sequence ["AF039085_1", "RNU39549_1", "CELT08A9_8", "FSU62028_1", "S73645", "Y348_MYCPN", " AC000103_5 "," "," RT12_LEITA ", and" EBVLMP218_1 "] demonstrated significant sequence similarity. Thus, it is presently believed that the PRO615 polypeptide disclosed herein is a newly identified member of the synaptogirin family and has the typical activities and properties of the synaptogirin family.

26. Full Length PRO618 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO618. In particular, the inventors have identified and isolated cDNA encoding the PRO618 polypeptide, as described in more detail in the Examples below. Amino acid sequence analysis of the full-length PRO618 polypeptide using the BLAST and Fast A sequence alignment computer programs suggests that various portions of the PRO618 polypeptide have significant sequence similarity with the enteropeptidase protein, suggesting that PRO618 may be a novel enteropeptidase. Hints. More specifically, analysis of the Dayhof database (version 35.45 SwissProt 35) can be performed using the PRO618 amino acid sequence and the Dayhof sequence ["P_W22987", "KAL_HUMAN", "AC003965_1", "GEN12917", "ENTK_HUMAN", "FA11_HUMAN", " HSU75329_1 "," P_W22986 ", and" PLMN_HORSE "] demonstrated significant sequence similarity. Thus, it is presently believed that the PRO618 polypeptide disclosed herein is a newly identified member of the enteropeptidase family and has the typical catalytic activity of the enteropeptidase family.

27. Full Length PRO719 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO719. In particular, we identified and isolated the cDNA encoding the PRO719 polypeptide, as described in more detail in the Examples below. We found that the PRO719 polypeptide had significant similarity to lipoprotein lipase H protein using the BLAST and Fast A sequence alignment computer programs. Thus, it is presently believed that the PRO719 polypeptides disclosed herein are the newly identified lipoprotein lipase H homologs.

28. Full Length PRO724 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO724. In particular, we identified and isolated the cDNA encoding the PRO724 polypeptide, as described in more detail in the Examples below. We have found that the PRO724 polypeptide has significant similarity to human low density lipoprotein (LDL) receptor proteins using the BLAST and Fast A sequence alignment computer programs. Thus, it is presently believed that the PRO724 polypeptides disclosed herein are newly identified LDL receptor homologs.

29. Full Length PRO772 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO772. In particular, the inventors have identified and isolated cDNA encoding the PRO772 polypeptide, as described in more detail in the Examples below. We found that the PRO772 polypeptide had significant similarity with human A4 protein using the BLAST and Fast A sequence alignment computer programs. Thus, it is presently believed that the PRO772 polypeptide disclosed herein is a newly identified A4 protein homolog.

30. Full Length PRO852 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO852. In particular, we identified and isolated the cDNA encoding the PRO852 polypeptide, as described in more detail in the Examples below. We have found that the PRO852 polypeptide has significant similarity with several protease proteins using the BLAST and Fast A sequence alignment computer programs. Thus, it is presently believed that the PRO852 polypeptides disclosed herein are newly identified protease enzyme homologs.

31. Full Length PRO853 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO853. In particular, the inventors have identified and isolated cDNA encoding the PRO853 polypeptide, as described in more detail in the Examples below. Amino acid sequence analysis of the full length PRO853 polypeptide using the BLAST and Fast A sequence alignment computer programs suggests that various parts of the PRO853 polypeptide have significant sequence similarity with the reductase protein, suggesting that PRO853 may be a novel reductase. More specifically, analysis of the Deihof database (version 35.45 SwissProt 35) was performed using the PRO853 amino acid sequence and the Deihof sequence ["P_W03198", "CEC15H11_6", "MTV030_12", "P_W15759", "S42651", "ATAC00234314", " MTV022_13 "," SCU43704_1 "," CELE04F6_7 "and" ALFA_1 "] demonstrated significant sequence similarity. Thus, it is presently believed that the PRO853 polypeptides disclosed herein are newly identified members of the reductase family and have the activity of typical antioxidant enzymes of the reductase family.

32. Full Length PRO860 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO860. In particular, we identified and isolated the cDNA encoding the PRO860 polypeptide, as described in more detail in the Examples below. Amino acid sequence analysis of the full-length PRO860 polypeptide using the BLAST and Fast A sequence alignment computer programs suggests that various parts of the PRO860 polypeptide have significant sequence similarity with the neuropascin protein, suggesting that PRO860 may be new neuropasine. . More specifically, analysis of the Dayhof database (version 35.45 SwissProt 35) can be performed using the PRO860 amino acid sequence and the Dayhof sequence ["AF040990_1", "AF041053_1", "CELZK377_2", "RNU81035_1", "D86983_1", "S26180", " MMBIG2A_1 "," S46216 "and" RNU68726_1 "] demonstrated significant sequence similarity. Thus, it is presently believed that the PRO860 polypeptides disclosed herein are newly identified members of the neuropascin family and have typical cell adhesion properties of the neuropascin family.

33. Full Length PRO846 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO846. In particular, we identified and isolated cDNA encoding the PRO846 polypeptide, as described in more detail in the Examples below. Amino acid sequence analysis of the full length PRO846 polypeptide using the BLAST and Fast A sequence alignment computer programs suggests that various portions of the PRO846 polypeptide have significant sequence similarity with the CMRF35 protein, suggesting that PRO846 may be a novel CMRF35 protein. More specifically, analysis of the Dayhof database (version 35.45 SwissProt 35) can be performed using the PRO846 amino acid sequence and the Dayhof sequence ["CM35_HUMAN", "AF035963_1", "PIGR_RABIT", "AF043724_1", "RNU89744_1", "A52091_1", " S48841 "," ELK06A9_3 "and" AF049588_1 "] demonstrated significant sequence similarity. Thus, it is presently believed that the PRO846 polypeptide disclosed herein is a newly identified member of the CMRF35 protein family and has typical properties of the CMRF35 protein family.

34. Full Length PRO862 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO862. In particular, we identified and isolated the cDNA encoding the PRO862 polypeptide, as described in more detail in the Examples below. Amino acid sequence analysis of the full length PRO862 polypeptide using the BLAST and Fast A sequence alignment computer programs suggests that various parts of the PRO862 polypeptide have significant sequence similarity with the lysozyme protein, suggesting that PRO862 may be a novel lysozyme protein. More specifically, analysis of the Dayhof database (version 35.45 SwissProt 35) demonstrated significant sequence similarity between the PRO862 amino acid sequence and the Dayhof sequence ["P_P90343" and "LYC_HUMAN"]. Thus, it is presently believed that the PRO862 polypeptides disclosed herein are newly identified members of the lysozyme family and have typical catalytic activity of the lysozyme family.

35. Full Length PRO864 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO864. In particular, we identified and isolated the cDNA encoding the PRO864 polypeptide, as described in more detail in the Examples below. Amino acid sequence analysis of the full length PRO864 polypeptide using the BLAST and Fast A sequence alignment computer programs suggests that several portions of the PRO864 polypeptide have significant sequence similarity with the Wnt-4 protein, suggesting that PRO864 may be a novel Wnt-4 protein. Hints. More specifically, analysis of the Dayhof database (version 35.45 SwissProt 35) can be performed using the PRO864 amino acid sequence and the Dayhof sequence ["WNT4_MOUSE", "WNT3_MOUSE", "WN5A_HUMAN", "WN7B_MOUSE", "WN3A_MOUSE", "XLU66288_1", " WN13_HUMAN "," WN5B_ORYLA "," WNT2_MOUSE "and" WN7A_MOUSE "] demonstrated significant sequence similarity. Thus, it is presently believed that the PRO864 polypeptide disclosed herein is a newly identified member of the Wnt-4 protein family and has typical properties of the Wnt-4 protein family.

36. Full Length PRO792 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO792. In particular, the inventors have identified and isolated cDNA encoding the PRO792 polypeptide, as described in more detail in the Examples below. We used BLAST and Fast A sequence alignment computer programs to find that the PRO792 polypeptide had significant similarity to the CD23 protein. Thus, it is presently believed that the PRO792 polypeptides disclosed herein are newly identified CD23 homologs.

37. Full Length PRO866 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO866. In particular, the inventors have identified and isolated cDNA encoding the PRO866 polypeptide, as described in more detail in the Examples below. The inventors have used the BLAST and Fast A sequence alignment computer programs to find that the PRO866 polypeptide has significant similarity with several mindine and spondine proteins. Thus, it is presently believed that the PRO866 polypeptides disclosed herein are the newly identified mindine / spondine homologues.

38. Full Length PRO871 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO871. In particular, the inventors have identified and isolated cDNA encoding the PRO871 polypeptide, as described in more detail in the Examples below. We used BLAST and Fast A sequence alignment computer programs to find that the PRO871 polypeptide had significant similarity with the CyP-60 protein. Thus, it is presently believed that the PRO871 polypeptide disclosed herein is a newly identified member of the cyclophylline protein family and has typical activity of the cyclophylline protein family.

39. Full length PRO873 polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO873. In particular, we identified and isolated the cDNA encoding the PRO873 polypeptide, as described in more detail in the Examples below. The inventors have used the BLAST and Fast A sequence alignment computer programs to find that the PRO873 polypeptide has significant similarity to carboxyl esterases between humans. Thus, it is presently believed that the PRO873 polypeptides disclosed herein are newly identified members of the carboxyl esterase family and have typical enzymatic activity of the carboxyesterase family.

40. Full length PRO940 polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO940. In particular, we identified and isolated cDNA encoding the PRO940 polypeptide, as described in more detail in the Examples below. We used BLAST and Fast A sequence alignment computer programs to find that the PRO940 polypeptide had significant similarity with CD33 and OB binding protein-2. Thus, it is presently believed that the PRO940 polypeptides disclosed herein are new CD33 and / or OB binding protein-2 analogs.

41. Full Length PRO941 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO941. In particular, we identified and isolated the cDNA encoding the PRO941 polypeptide, as described in more detail in the Examples below. The inventors have used the BLAST and Fast A sequence alignment computer programs to find that the PRO941 polypeptide has significant similarity with one or more catherin proteins. Thus, it is presently believed that the PRO941 polypeptides disclosed herein are newly identified caherin homologs.

42. Full Length PRO944 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO944. In particular, we identified and isolated cDNA encoding the PRO944 polypeptide, as described in more detail in the Examples below. We used BLAST and Fast A sequence alignment computer programs to find that the PRO944 polypeptide had significant similarity with CPE-R cell surface proteins. Thus, it is presently believed that the PRO944 polypeptides disclosed herein are newly identified CPE-R homologs.

43. Full Length PRO983 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO983. In particular, the inventors have identified and isolated cDNA encoding the PRO983 polypeptide, as described in more detail in the Examples below. We used BLAST and Fast A sequence alignment computer programs to find that the PRO983 polypeptide had significant similarity to the vesicle-binding protein VAP-33. Thus, it is presently believed that the PRO983 polypeptides disclosed herein are newly identified members of the vesicle-binding membrane protein family and have the typical activity of vesicle-binding membrane proteins.

44. Full length PRO1057 polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO1057. In particular, we identified and isolated the cDNA encoding the PRO1057 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that PRO1057 polypeptide has significant similarity with several protease proteins. Thus, it is presently believed that the PRO1057 polypeptides disclosed herein are newly identified protease homologs.

45. Full length PRO1071 polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO1071. In particular, the inventors have identified and isolated cDNA encoding the PRO1071 polypeptide, as described in more detail in the Examples below. The inventors have used the BLAST and Fast A sequence alignment computer programs to find that the PRO1071 polypeptide has significant similarity with the thrombospondine protein. Thus, it is presently believed that the PRO1071 polypeptide disclosed herein is a newly identified thrombospondine homologue.

46. Full Length PRO1072 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO1072. In particular, the inventors have identified and isolated cDNA encoding the PRO1072 polypeptide, as described in more detail in the Examples below. We used BLAST and Fast A sequence alignment computer programs to find that the PRO1072 polypeptide has significant similarity with several reductase proteins. Thus, it is presently believed that the PRO1072 polypeptide disclosed herein is a newly identified member of the reductase protein family.

47. Full Length PRO1075 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO1075. In particular, the inventors have identified and isolated cDNA encoding the PRO1075 polypeptide, as described in more detail in the Examples below. The inventors have used the BLAST and Fast A sequence alignment computer programs to find that the PRO1075 polypeptide has significant similarity with protein disulfide isomerase. Thus, the PRO1075 polypeptides disclosed herein are now a newly identified member of the protein disulfide isomerase family and are believed to have typical activity of this family.

48. Full length PRO181 polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO181. In particular, we identified and isolated the cDNA encoding the PRO181 polypeptide, as described in more detail in the Examples below. We used BLAST and Fast A sequence alignment computer programs to find that the PRO181 polypeptide had significant similarity to the Cornikan protein. Thus, it is presently believed that the PRO181 polypeptide disclosed herein is a newly identified Cornicon homologue.

49. Full Length PRO195 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO195. In particular, the inventors have identified and isolated cDNA encoding the PRO195 polypeptide, as described in more detail in the Examples below. PRO195-coding clones were isolated from placental libraries of human fetuses using a trapping technique to select nucleotide sequences encoding secretory proteins. As we currently know, the UNQ169 (DNA26847-1395) nucleotide sequence encodes a new factor and has been found to be free of sequence identity with any known protein using BLAST and FastA sequence alignment computer programs.

50. Full Length PRO865 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO865. In particular, the inventors have identified and isolated cDNA encoding the PRO865 polypeptide, as described in more detail in the Examples below. PRO865-encoding clones were isolated from kidney libraries of human fetuses using trapping techniques to select nucleotide sequences encoding secretory proteins. Thus, the PRO865-coding clone can encode a secretion factor. As we currently know, the UNQ434 (DNA53974-1401) nucleotide sequence encodes a new factor and has been found to be free of sequence identity with any known protein using BLAST and FastA sequence alignment computer programs.

51. Full Length PRO827 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO827. In particular, the inventors have identified and isolated cDNA encoding the PRO827 polypeptide, as described in more detail in the Examples below. We found that the PRO827 polypeptide had significant similarity with VLA-2 and several other integrin proteins using the BLAST and Fast A sequence alignment computer programs. Thus, it is presently believed that the PRO827 polypeptides disclosed herein are new integrin proteins or splice variants thereof.

52. Full Length PRO1114 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO1114. In particular, the inventors have identified and isolated cDNA encoding the PRO1114 polypeptide, as described in more detail in the Examples below. The inventors have used the BLAST and Fast A sequence alignment computer programs to find that the PRO1114 polypeptide has significant similarity with the cytokine receptor protein family. Thus, the PRO1114 polypeptide disclosed herein is now a newly identified member of the cytokine receptor protein family and is believed to have typical activity of this family.

The present invention provides a newly identified and isolated nucleotide sequence encoding a polypeptide referred to herein as a PRO1114 interferon receptor (UNQ557). In particular, cDNA encoding the PRO1114 interferon receptor polypeptide was identified and isolated, as described in more detail in the Examples below. The PRO number of proteins produced in separate rounds of expression may vary, but UNQ numbers are specific to any given DNA and protein encoded therefrom and will not change. However, here, simply, the proteins encoded by DNA57033-1403, included in the above definition of the PRO1114 interferon receptor, as well as all other natural homologs and variants, are referred to as the "PRO1114 interferon receptor" regardless of their origin and mode of manufacture. Will be mentioned.

Using the WU-BLAST2 sequence alignment computer program, the full length native sequence PRO1114 interferon receptor polypeptide (shown in FIGS. 142 and 352) was found to have sequence identity with other known interferon receptors. Therefore, it is currently believed that the PRO1114 interferon receptor has the typical activity of other interferon receptors.

53. Full Length PRO237 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO237. In particular, the inventors have identified and isolated cDNA encoding the PRO237 polypeptide, as described in more detail in the Examples below. We found that the PRO237 polypeptide had significant similarity to carbonic anhydrase using BLAST and Fast A sequence alignment computer programs. Thus, it is presently believed that the PRO237 polypeptide disclosed herein is a newly identified carbonic anhydrase homologue.

54. Full Length PRO541 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO541. In particular, the inventors have identified and isolated cDNA encoding the PRO541 polypeptide, as described in more detail in the Examples below. We found that the PRO541 polypeptide had significant similarity to the trypsin inhibitor protein using the BLAST and Fast A sequence alignment computer programs. Thus, it is presently believed that the PRO541 polypeptides disclosed herein are newly identified members of the trypsin inhibitor protein family.

55. Full Length PRO273 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO273. In particular, the inventors have identified and isolated cDNA encoding the PRO273 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that different parts of the PRO273 polypeptide have significant sequence identity with several chemokines. Thus, it is presently believed that the PRO273 polypeptide disclosed herein is a newly identified member of the chemokine family and has typical activity of the chemokine family.

56. Full Length PRO701 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO701. In particular, the inventors have identified and isolated cDNA encoding the PRO701 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that various parts of the PRO701 polypeptide have significant homology with neuroligins 1, 2 and 3, including carboxyesterase and acetylcholinesterase. Thus, it is presently believed that the PRO701 polypeptides disclosed herein are newly identified members of the family of neuroligins, which regulate the recognition response between neurons and / or act as typical cytoadhesin molecules of neuroligins.

57. Full Length PRO704 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO704. In particular, we identified and isolated the cDNA encoding the PRO704 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that several parts of the PRO704 polypeptide have significant homology with VIP36 and GP36b. Thus, the presently disclosed PRO704 polypeptide is a newly identified member of the entire membrane protein family of vesicles, has the ability to bind sugars, and is typical of this family, circulating between the plasma membrane and the Golgi.

58. Full Length PRO706 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO706. In particular, the inventors have identified and isolated cDNA encoding the PRO706 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that various portions of the PRO706 polypeptide have sequence identity with human prostate acid phosphatase precursors and human lysosomal acid phosphatase precursors. Thus, it is presently believed that the PRO706 polypeptides disclosed herein are newly identified members of the human prostate acid phosphatase precursor family and have typical phosphatase activity of the human prostate acid phosphatase family.

59. Full Length PRO707 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO707. In particular, the inventors have identified and isolated cDNA encoding the PRO707 polypeptide, as described in more detail in the Examples below. The inventors have used BLAST and Fast A sequence alignment computer programs to find that several parts of the PRO707 polypeptide have significant homology with Cadherin, especially Cadherin FIB3 found in fibroblasts. Thus, it is presently believed that the PRO707 polypeptide disclosed herein is a newly identified member of the Kadherin family and has the typical cellular interaction signaling ability of the Kadherin family.

60. Full length PRO322 polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO322. In particular, the inventors have identified and isolated cDNA encoding the PRO322 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that various parts of the PRO322 polypeptide have significant homology with human neuropsin, serine protease, neurosin and trypsinogen. Thus, it is presently believed that the PRO322 polypeptides disclosed herein are newly identified members of the serine protease family and have typical protease activity of this family. PRO322 is also involved in the formation of the hippocampus and is thought to be involved in the modification of extracellular epilepsy and the migration of cells.

61. Full Length PRO526 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO526. In particular, we identified and isolated the cDNA encoding the PRO526 polypeptide, as described in more detail in the Examples below. The inventors have used BLAST and Fast A sequence alignment computer programs to demonstrate that various portions of the PRO526 polypeptide may be significantly different from carboxypeptidase, SLIT and platelet glycoprotein V as well as acid labile subunits of the insulin-like growth factor conjugate (ALS). I found myself having the same sex. Thus, it is presently believed that the PRO526 polypeptides disclosed herein are newly identified members of the leucine-repeat rich macrophage and have typical protein-protein interaction capabilities of this family.

62. Full Length PRO531 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO531. In particular, the inventors have identified and isolated cDNA encoding the PRO531 polypeptide, as described in more detail in the Examples below. The inventors have used BLAST and Fast A sequence alignment computer programs to find that various parts of the PRO531 polypeptide have significant sequence identity and similarity to members of the Caherin giant, especially Protocadherin 3. Thus, it is presently believed that the PRO531 polypeptides disclosed herein are protocadherin, a newly identified member of the Cadherin giant family. PRO531 is a transmembrane protein with an extracellular caherin motif. PRO531 is thought to be involved in cell-cell activity, in particular cell signaling.

63. Full Length PRO534 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO534. In particular, we identified and isolated the cDNA encoding the PRO534 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that various parts of the PRO534 polypeptide have significant identity or similarity to putative disulfide isomerase erp38 precursor and thioredoxin c-3. Thus, it is presently believed that the PRO534 polypeptide disclosed herein is a newly identified member of the disulfide isomerase family and has the ability to recognize and organize typical, medium or incorrect folding patterns of this family.

64. Full Length PRO697 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO697. In particular, we identified and isolated the cDNA encoding the PRO697 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that various parts of the PRO697 polypeptide have significant identity or similarity to sFRP-2, sFRP-1 and SARP-1, -2 and -3. Thus, it is presently believed that the PRO697 polypeptides disclosed herein are newly identified members of the sFRP family and have activity associated with the Wnt signaling pathway.

65. Full Length PRO717 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO717. In particular, the inventors have identified and isolated cDNA encoding the PRO717 polypeptide, as described in more detail in the Examples below. As we currently know, the UNQ385 (DNA50988-1326) nucleotide sequence encodes a new factor and has been found to be free of significant sequence identity with any known human protein using BLAST and FastA sequence alignment computer programs.

66. Full Length PRO731 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO731. In particular, the inventors have identified and isolated cDNA encoding the PRO731 polypeptide, as described in more detail in the Examples below. We used BLAST and Fast A sequence alignment computer programs to find that various parts of the PRO731 polypeptide have significant homology with Protocadherin 4, 68, 43, 42, 3 and 5. Thus, the presently disclosed PRO731 polypeptide is a newly identified member of the protocadherin family and is believed to be related to the typical cell-cell aggregation or signaling activity, or signaling, of this family.

67. Full Length PRO218 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO218. In particular, we identified and isolated cDNA encoding the PRO218 polypeptide, as described in more detail in the Examples below. PRO218-encoding clones were isolated from the kidney library of human fetuses. As we currently know, the UNQ192 (DNA30867-1335) nucleotide sequence encodes a new factor and has been found to be free of significant sequence identity with any known protein using BLAST and FastA sequence alignment computer programs. PRO218 has been found to have some sequence identity with the regulatory proteins of the membrane, suggesting that PRO218 can act as a regulator of the membrane.

68. Full Length PRO768 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO768. In particular, we identified and isolated the cDNA encoding the PRO768 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that various parts of the PRO768 polypeptide have significant homology with integrins, including integrins 7 and 6. Thus, the PRO768 polypeptides disclosed herein at present are thought to be homologous or splice variants of Integrin 7, a newly identified member of the Integrin family, and are involved in cell adhesion and transport between muscle cells and extracellular epilepsy.

69. Full Length PRO771 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO771. In particular, the inventors have identified and isolated cDNA encoding the PRO771 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that various parts of the PRO771 polypeptide have significant sequence identity and similarity with testisan. Thus, it is presently believed that the PRO771 polypeptide disclosed herein is a newly identified member of the Testican family and has typical cellular signaling, binding or attachment properties of this family.

70. Full Length PRO733 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO773. In particular, the inventors have identified and isolated cDNA encoding the PRO773 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that various parts of the PRO773 polypeptide have significant sequence identity with the T1 / ST receptor binding protein. Thus, it is presently believed that the PRO773 polypeptide disclosed herein is a newly identified member of an interleukin-like family binding protein that is a cytokine and may be involved in cellular signaling. PRO733 is thought to be the ApoAIV homolog.

71. Full Length PRO162 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO162. In particular, the inventors have identified and isolated cDNA encoding the PRO162 polypeptide as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that various parts of the PRO162 polypeptide have significant homology with human pancreatitis-related protein (PAP). The inventors have also found that the DNA encoding the PRO162 polypeptide has significant homology with bovine lithostathine precursors and bovine pancreatic dead protein (PTP). Thus, it is presently believed that the PRO162 polypeptide disclosed herein is a newly identified member of the pancreatitis-related protein family and has typical activity of the pancreatitis-related protein family.

72. Full Length PRO788 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO788. In particular, the inventors have identified and isolated cDNA encoding the PRO788 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that various parts of the PRO788 polypeptide have significant homology with anti-tumor urine proteins. We also found that the DNA encoding the PRO788 polypeptide has significant homology with human E48 antigens, human component B proteins and human prostate rodent cell antigens. Thus, it is presently believed that the PRO788 polypeptide disclosed herein is a newly identified member of the anti-tumor urine protein family and has the typical anti-tumor activity of the anti-tumor urine protein family.

73. Full length PRO1008 polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO1008. In particular, the inventors have identified and isolated cDNA encoding the PRO1008 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that various parts of the PRO1008 polypeptide have significant sequence identity and similarity with dkk-1 (mdkk-1) in mice. Thus, it is presently believed that the PRO1008 polypeptides disclosed herein are newly identified members of the dkk-1 family and have typical head-inducing activity of this family.

74. Full Length PRO1012 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO1012. In particular, the inventors have identified and isolated cDNA encoding the PRO1012 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that several parts of the PRO1012 polypeptide have sequence identity with disulfide isomerase. Thus, the presently disclosed PRO1012 polypeptide is a newly identified member of the protein family retained in the ER, and is typical of the disulfide isomerase family and is believed to have activity associated with processing, production and / or folding of the polypeptide. .

75. Full Length PRO1014 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO1014. In particular, we identified and isolated the cDNA encoding the PRO1014 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that various parts of the PRO1014 polypeptide have sequence identity with reductase and dehydrogenase. Thus, the PRO1014 polypeptides disclosed herein are now considered to be a newly identified member of the reductase giant family, and are believed to have the typical reducing ability of this family.

76. Full Length PRO1017 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO1017. In particular, the inventors have identified and isolated cDNA encoding the PRO1017 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that several parts of the PRO1017 polypeptide have sequence identity with HNK-1 sulfotransferase. Thus, the PRO1017 polypeptides disclosed herein are now a newly identified member of the HNK-1 sulfotransferase family and are believed to be involved in the synthesis of typical HNK-1 carbohydrate epitopes of this family.

77. Full Length PRO474 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO474. In particular, we identified and isolated cDNA encoding the PRO474 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that several parts of the PRO474 polypeptide have sequence identity with dehydrogenase, glucose dehydrogenase and oxidoreductase. Therefore, it is presently believed that the PRO474 polypeptide disclosed herein is a newly identified member of the dehydrogenase family and is involved in the oxidation of glucose.

78. Full Length PRO1031 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO1031. In particular, the inventors have identified and isolated cDNA encoding the PRO1031 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that several parts of the PRO1031 polypeptide have sequence identity with IL-17 and CTLA-8. Thus, it is presently believed that the PRO1031 polypeptides disclosed herein are newly identified members of the cytokine family and may be involved in inflammatory reactions and / or the immune system.

79. Full Length PRO938 Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO938. In particular, the inventors have identified and isolated cDNA encoding the PRO938 polypeptide, as described in more detail in the Examples below. We used BLAST and Fast A sequence alignment computer programs to find that the PRO938 polypeptide has significant similarity with protein disulfide isomerase. Thus, it is presently believed that the PRO938 polypeptides disclosed herein are newly identified members of thioredoxin family proteins and have typical activity of protein disulfide isomerase.

80. Full length PRO1082 polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO1082. In particular, we identified and isolated the cDNA encoding the PRO1082 polypeptide, as described in more detail in the Examples below. We have used BLAST and Fast A sequence alignment computer programs to find that several parts of the PRO1082 polypeptide have sequence identity with lectin-like oxidized LDL receptors (which appear to be "AB10710_1" in the database). Thus, it is presently believed that the PRO1082 polypeptide disclosed herein is a newly identified member of the LDL receptor family.

81. Full length PRO1083 polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO1083. In particular, the inventors have identified and isolated cDNA encoding the PRO1083 polypeptide, as described in more detail in the Examples below. PRO1083-encoding clones were isolated from the kidney library of human fetuses using a trapping technique to select nucleotide sequences encoding secretory proteins. As we currently know, the UNQ540 (DNA50921-1458) nucleotide sequence encodes a new factor and, using the BLAST and FastA sequence alignment computer programs, the defined cell surface of the 7TM receptor, latropyline related protein 1 and macrophages. It was found that there was some sequence identity with the glycoprotein of. The kinase phosphorylation site and the G-coupled receptor domain shown in FIG. 204 suggest that PRO1083 is a new member of the 7TM receptor macrophages.

82. Full length PRO200 polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as VEGF-E. In particular, the inventors have identified and isolated cDNA encoding the VEGF-E polypeptide, as described in more detail in the Examples below. We found that VEGF-E polypeptides have significant homology with VEGF and bone morphogenic protein 1 using the BLAST sequence alignment computer program. In particular, the cDNA sequence of VEGF-E shows 24% amino acid similarity with VEGF and is structurally conserved. VEGF-E also contains an N-terminal half that is not present in VEGF and has 28% homology with bone morphogenic protein 1.

83. Full-length PRO285 and PRO286 Polypeptides

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO285 and PRO286. In particular, we identified and isolated cDNA encoding the PRO285 and PRO286 polypeptides, as described in more detail in the Examples below. The inventors have used the BLAST and FastA sequence alignment computer programs to find that the coding sequences of PRO285 and PRO286 are highly homologous to the DNA sequences HSU88540_1, HSU88878_1, HSU88879_1, HSU88880_1 and HSU88881_1 in the Genbank database.

Thus, the PRO285 and PRO286 proteins disclosed herein are the newly identified human homologs of the Drosophila protein Toll and are thought to play an important role in adaptive immunity. More specifically, PRO285 and PRO286 may be associated with inflammatory reactions, septic shock, and response to pathogens, for example, various aggravated by immune responses such as diabetes, ALS, cancer, rheumatoid arthritis and ulcers. May act on medical symptoms. The role of PRO285 and PRO286 as pathogen pattern recognition receptors for detecting the presence of conserved molecular structures present in microorganisms is also supported by the data described herein, where TLR2, a known human Toll-like receptor, is directly responsible for LPS signaling. Show that it is a mediator.

84. Full length PRO213-1, PRO1330 and PRO1449 polypeptides

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as full length PRO213-1, PRO1330, and / or PRO1449. In particular, cDNA encoding PRO213-1, PRO1330, and / or PRO1449 polypeptides were identified and isolated, as described in more detail in the Examples below. The PRO number of proteins produced in separate rounds of expression may vary, but UNQ numbers are specific to any given DNA and protein encoded therefrom and will not change. However, here, simply, proteins encoded by DNA30943-1163-1, DNA64907-1163-1, and DNA64908-1163-1 included in the above definitions of PRO213-1, PRO1330, and / or PRO1449, as well as all other thereof Natural homologs and variants will be referred to as "PRO213-1, PRO1330, and / or PRO1449" regardless of their origin and manner of preparation.

85. Full Length PRO298 Polypeptide

The present invention provides a newly identified and isolated nucleotide sequence encoding a polypeptide referred to herein as PRO298 (PRO298 is a protein encoded by the nucleic acid shown in FIG. 218, SEQ ID NO: 514 and having an amino acid sequence shown in FIG. 219 and SEQ ID NO: 515). An arbitrary name of: Different proteins having the same amino acid sequence but expressed in different rounds of expression may be given different "PRO" numbers).

In particular, as described in more detail in the Examples below, we identified and isolated cDNA encoding the PRO298 polypeptide. We used the BLASTX 2.0a8MP-WashU computer program (scoring parameters: T = 12, S = 68, S2 = 36, Matrix: BLOSUM62) to sequence the PRO298 protein specifically described herein in the Genbank database. [S59392 (possible membrane protein YLR246w-yeast); S58154 (estimated protein SPAC2F7.10-yeast); CELF33D11_9 (F33D11.9b-Canohabitis elegans); YO41_CAEEL (estimated 68.7 kd protein zk757.1); CEAC3_5 (AC3.4-Canohabitis elegans); S52691 (possible transmembrane protein YDR126w-yeast); ATT12H17_14 (protein-Arabidopsis thaliana); S55963 (possible membrane protein YNL326c-yeast); CELC43H6_2 (C43H6.7-Canohabitis elegans); TMO18A10_14 (A_TMO18A10.8-Arabinos thaliana)] and limited (27-38%) sequence identity.

86. Full length PRO337 polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO337. In particular, the inventors have identified and isolated cDNA encoding the PRO337 polypeptide, as described in more detail in the Examples below. We used the BLAST, BLAST2 and Fast A sequence alignment computer programs to show that the full-length native sequence PRO337 was 97% amino acid sequence identity with rat neurotrimine, 85% sequence identity with chicken CEPU, 73% with G55 in chicken. Was found to have sequence identity of 59% homology with human LAMP and 84% homology with human OPCAM. Thus, it is presently believed that the PRO337 disclosed herein is a newly identified member of the IgLON subgroup of the immunoglobulin macrophages and may have properties that increase neurite outgrowth and differentiation.

87. Full length PRO403 polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO403. In particular, the inventors have identified and isolated cDNA encoding the PRO403 polypeptide, as described in more detail in the Examples below. We used the BLAST, BLAST2 and Fast A sequence alignment computer programs to find that the full length native sequence PRO403 had 94% identity to bovine ECE-2 and 64% to human ECE-1. Thus, it is currently believed that PRO403 is a new member of the ECE protein family and may have the ability to promote the production of active endothelin.

B. PRO Polypeptide Variants

In addition to the full-length native sequence PRO polypeptides described herein, it is contemplated that PRO variants may be prepared. PRO variants can be prepared by introducing suitable nucleotide changes into PRO DNA and / or synthesizing the desired PRO polypeptide. Those skilled in the art will appreciate that amino acid changes, such as altering the number or location of glycosylation sites or changing membrane anchoring properties, can alter the post-translational processing of RPO.

Variations in the various domains of the full-length native sequence PRO or PRO described herein can be prepared using any technique and guidance for conservative and non-conservative mutations, eg, disclosed in US Pat. No. 5,364,934. Modification means that one or more codons encoding PRO can be substituted, deleted or inserted to change the amino acid sequence of PRO relative to native sequence PRO. Optionally, the mutation is produced by replacing one or more amino acids with any other amino acid in one or more domains of PRO. Amino acid residues that can be inserted, substituted or deleted without adversely affecting the desired activity compare the sequence of PRO to the sequence of known homologous protein molecules and minimize the number of amino acid sequence changes generated in regions of high homology. You can decide. Amino acid substitutions may be the result of substitution of one amino acid with another amino acid having similar structural and / or chemical properties, eg, replacement of leucine with serine, ie, conservative substitution of amino acids. Insertion or deletion may optionally occur at about 1-5 amino acids. Acceptable variations can be determined by systematically inserting, deleting or replacing amino acids in the sequence and testing the activity of the resulting variant represented by the full length or mature native sequence.

The application provides PRO polypeptide fragments. For example, when compared to full-length natural proteins, these fragments may be truncated at the N-terminus or C-terminus or missing internal residues. Some fragments lack amino acid residues that are not essential for the desired biological activity of the PRO polypeptides of the invention.

PRO fragments can be prepared by any of a number of conventional techniques. Desired peptide fragments can be synthesized chemically. Another method is to produce a PRO fragment by enzymatic digestion, for example by treating the protein with an enzyme known to cut a protein at a site defined by a particular amino acid residue, or by enzymatically cutting the DNA with a suitable restriction enzyme. And isolating this desired fragment. Yet another suitable technique includes isolating and amplifying a DNA fragment encoding a desired polypeptide fragment by polymerase chain reaction (PCR). Oligonucleotides that form the desired end of the DNA fragment are used as 5 'and 3' primers in PCR. Preferably, the PRO polypeptide fragment shares one or more biological and / or immunological activities with the native PRO polypeptide disclosed herein.

In specific embodiments, conservative substitutions of the target are shown in Table 6 under the heading of preferred substitutions. When the biological activity was changed by such substitutions, more substantial changes were introduced and the products were screened as named as substitutions in Table 6 below or as described in more detail below for amino acid species.

Original residues Substitution example Preferred Substitution Ala (A) val, leu, ile val Arg (R) lys, gln, asn lys Asn (N) gln, his, lys, arg gln Asp (D) glu glu Cys (C) ser ser Gln (Q) asn asn Glu (E) asp asp Gly (G) pro, ala ala His (H) asn, gln, lys, arg arg Ile (I) leu, val, met, ala, phe, norleucine leu Leu (L) norleucine, ile, val, met, ala, phe ile Lys (K) arg, gln, asn arg Met (M) leu, phe, ile leu Phe (F) leu, val, ile, ala, tyr leu Pro (P) ala ala Ser (S) thr thr Thr (T) ser ser Trp (W) tyr, phe tyr Tyr (Y) trp, phe, thr, ser phe Val (V) ile, leu, met, phe, ala, norleucine leu

Substantial modifications of the function or immunological identity of the PRO polypeptides may include (a) maintaining the structure of the polypeptide backbone at the substitution region, for example in sheet or helix form, or (b) maintaining the charge or hydrophobicity of the molecule at the target site. Or (c) selecting a substitution that significantly alters its effect of retaining most of the side chains. Natural residues are divided into the following groups according to common side chain properties:

(1) hydrophobic: norleucine, met, ala, val, leu, ile;

(2) neutral hydrophilic: cys, ser, thr;

(3) acidic: asp, glu;

(4) basic: asn, gln, his, lys, arg;

(5) residues affecting chain orientation: gly, pro; And

(6) aromatic; trp, tyr, phe.

Non-conservative substitutions will replace said one type of component with another type. In addition, the residues so substituted may be introduced at conservative substitution sites or more preferably at the remaining (non-conserved) sites.

Variations can be made using methods known in the art such as oligonucleotide-mediated (position-directed) mutagenesis, alanine scanning and PCR mutagenesis. Site-directed mutagenesis [Carter et al. Nucl. Acids Res. , 13 : 4331 (1986), Zoller et al., Nucl. Acids Res. , 10 : 6487 (1987)], cassette mutagenesis [Wells et al., Gene , 34 : 315 (1985)], restriction selection mutagenesis [Wells et al ., Philos. Trans. R. Soc. London SerA , 317 : 415 (1986)] or other known techniques can be performed on cloned DNA to produce the PRO variant DNA of the present invention.

Scanning amino acid assays can also be used to identify one or more amino acids along adjacent sequences. Preferred scanning amino acids are relatively small neutral amino acids. Such amino acids include alanine, glycine, serine and cysteine. Typically, alanine is a preferred scanning amino acid because it is less likely to remove side chains outside the beta-carbon and alter the backbone arrangement of the variants (Cunningham and Wells, Science , 244 : 1081-1085 (1989). )]]. Alanine is also preferred because it is usually the most common amino acid. In addition, alanine is frequently found both in buried and exposed locations (Creighton, The Proteins , (WH Freeman & Co., NY)); And Chothia, J. Mol. Biol. , 150 : 1 (1976)]. If alanine substitutions do not produce adequate amounts of variants, isotopic amino acids can be used.

C. variant of PRO

Covalent modifications of PRO are included within the scope of the present invention. One form of covalent modification involves reacting a target amino acid residue of a PRO polypeptide with an organic derivatizing agent capable of reacting with a selected side chain of PRO, or an N-terminal or C-terminal residue. Derivatization with a bifunctional agent is useful for crosslinking PRO to a water-insoluble support matrix or surface, or vice versa, for example for use in anti-PRO antibody purification methods. Commonly used crosslinkers include, for example, 1,1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, for example esters with 4-azidosalicylic acid, Homo-functional imidoesters, including disuccinimidyl esters such as 3,3'-dithiobis (succinimidylpropionate), difunctional maleimides such as bis-N-maleimido-1,8-octane and Substances such as methyl-3 [(p-azidophenyl) dithio] propioimidate.

Other modifications include deamidation of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, lysine, Methylation of alpha-amino groups of arginine and histidine side chains [TE Creighton, Proteins: Structure and Molecular Properties , WH Freeman & Co., San Francisco, pp. 79-86 (1983)]], acetylation of N-terminal amines and amidation of C-terminal carboxyl groups.

Other types of covalent modifications of PRO polypeptides within the scope of the present invention include changes in the natural glycosylation pattern of the polypeptide. “A change in natural glycosylation pattern” refers to the deletion of one or more carbohydrate residues found in the native sequence PRO (either by removing potential glycosylation sites or by deleting chemical glycosylation by chemical and / or enzymatic methods) and / or ) Addition of one or more glycosylation sites that are not present in native sequence PRO. The term also encompasses qualitative changes in glycosylation of natural proteins, including changes in the properties and proportions of the various carbohydrate residues present.

The addition of glycosylation sites to the PRO polypeptide can be accomplished by changing the amino acid sequence. The change can be made, for example, by the addition or substitution of one or more serine or threonine residues in the native sequence PRO (for O-linked glycosylation sites). The PRO amino acid sequence can be optionally altered through a change in the DNA level by mutating DNA encoding the PRO polypeptide at a preselected base to produce a codon that is translated into the desired amino acid.

Another means of increasing the number of carbohydrate residues on the PRO polypeptide is to couple the glycoside chemically or enzymatically to the polypeptide. Such methods are described, for example, in WO 87/05330 published September 11, 1987 and in Aplin and Wriston, CRC Crit. Rev. Biochem. , pp. 259-306 (1981).

Removal of carbohydrate residues present in a PRO polypeptide may be accomplished chemically or by substitution by an enzyme or by mutation of a codon encoding an amino acid residue that functions as a glycosylation target. Chemical deglycosylation techniques are known in the art and are described, for example, in Hakimuddin et al ., Arch. Biochem. Biophys. , 259 : 52 (1987) and by Edge et al ., Anal. Biochem. , 118 : 131 (1981). Enzymatic cleavage of carbohydrate residues on polypeptides can be accomplished using a variety of endoglycosidases and exoglycosidases [Thotakura et al . Meth. Enzymol. , 138 : 350 (1987)].

Other types of covalent modifications of PRO include various nonproteinaceous polymers, eg, in the manner described in US Pat. Nos. 4,640,835, 4,496,689, 4,301,144, 4,670,417, 4,791,192 or 4,179,337. For example connecting the PRO polypeptide to one of polyethylene glycol (PEG), polypropylene glycol or polyoxyalkylene.

In addition, the PRO of the present invention may be modified in such a way as to form chimeric molecules comprising PRO fused to other heterologous polypeptide or amino acid sequences.

In one embodiment, such chimeric molecules comprise a fusion of PRO with a tag polypeptide that provides an epitope to which an anti-tag antibody can selectively bind. Epitope tags are generally located at the amino or carboxyl terminus of PRO. The presence of the PRO in the form with the epitope tag can be detected using an antibody against the tag polypeptide. In addition, the introduction of epitope tags facilitates the purification of PRO by affinity purification using anti-tag antibodies or other types of affinity matrices that bind to epitope tags. Various tag polypeptides and their respective antibodies are known in the art. Examples include poly-histidine or poly-histidine-glycine tags, flu HA tag polypeptides and antibodies thereof 12CA5 [Field et al ., Mol. Cell. Biol. , 8 : 2159-2165 (1988)], c-myc tags and 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies [Evan et al., Molecular and Cellular Biology , 5 : 3610-3616] (1985)], and herpes simplex virus glycoprotein D (gD) tag and its antibody [Paborsky et al., Protein Engineering , 3 (6): 547-553 (1990)]. have. Other tag polypeptides include Flag-peptides (Hopp et al., BioTechnology , 6 : 1204-1210 (1988)), KT3 epitope peptides [Martin et al., Science , 255 : 192-194 ( 1992)], alpha-tubulin epitope peptide [Skinner et al ., J. Biol. Chem. , 266 : 15163-15166 (1991)] and the T7 gene 10 protein peptide tag [Lutz-Freyermuth et al ., Proc. Natl. Acad. Sci. USA , 87 : 6393-6397 (1990)].

In other embodiments, the chimeric molecule comprises a fusion of PRO with an immunoglobulin or a specific region of immunoglobulins. For the divalent form of the chimeric molecule (also referred to as "immunoadhesin"), the fusion may be the F _c region of an IgG molecule. This Ig fusion preferably comprises the substitution of a site of one or more variable regions in the Ig molecule with a soluble (membrane or inactivation) form of the PRO polypeptide. In a particularly preferred embodiment, the immunoglobulin fusions comprise the hinge, CH2 and CH3, or the hinge, CH1, CH2 and CH3 regions of the IgG1 molecule. For a method of producing immunoglobulin fusions, see US Pat. No. 5,428,130, issued June 27, 1995.

D. Manufacture of PRO

The content described below relates primarily to methods of making PRO by culturing cells transformed or transfected with the vector containing the PRO nucleic acid. Of course, the PRO may be prepared using other methods known in the art. For example, PRO sequences or fragments thereof can be prepared by direct peptide synthesis using solid phase techniques [Stewart et al., Solid-Phase Peptide Synthesis , WH Freeman Co., San Francisco, CA (1969). ) And Merrifield, J. Am. Chem. Soc. , 85 : 2149-2154 (1963). In vitro protein synthesis can be performed by manual or automated methods. Automated synthesis can be performed using, for example, Applied Biosystems Peptide Synthesizer (Foster City, CA) according to the manufacturer's instructions. The full length PRO can be prepared by chemically synthesizing the various parts of the PRO separately and combining them using chemical or enzymatic methods.

1. Isolation of DNA Encoding PRO

DNA encoding PRO may be obtained from a cDNA library prepared from tissues that possess PRO mRNA and are thought to express it at detectable levels. Thus, human PRO DNA can be conveniently obtained from a cDNA library prepared from human tissue as described in the Examples. PRO coding genes can also be obtained from genomic libraries or by known synthetic methods (eg, automated nucleic acid synthesis methods).

Libraries can be screened using probes designed to identify a gene of interest or a protein encoded by the gene (eg, an antibody to PRO or an oligonucleotide consisting of about 20 to 80 or more bases). Screening of cDNAs or genomic libraries using selected probes uses standard methods as described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Haror Laboratory Press, 1989). Can be done. Other means for isolating the gene encoding PRO is to use PCR method [the literature, such as fountain Brook (Sambrook); Dieffenbach et al., PCR Primer: A Laboratory Manual (Cold Spring Haror Laboratory Press, 1995).

The following examples illustrate techniques for screening cDNA libraries. Oligonucleotide sequences selected as probes should be sufficiently long and sufficiently clear to minimize false positive results. Oligonucleotides are preferably labeled so that they can be detected upon hybridization with DNA in the library being screened. Labeling methods are known in the art and include the use of radiolabels, biotinylation or enzyme labels, such as ³² P-labeled ATP. Hybridization conditions, including moderate stringency and high stringency is provided in the described supra, such as literature Sam Brook, (Sambrook).

The sequences identified in the library screening method can be aligned in comparison to other known sequences available deposited in public databases such as GenBank or other proprietary sequence databases. Sequence identity (at the amino acid or nucleotide level) within a defined region of the molecule or across the full length sequence can be determined using known methods of the prior art and the methods described herein.

Nucleic acid having protein coding sequence is the first use of the estimated amino acid sequence disclosed herein, et al., Sam Brook (Sambrook) to detect the precursor, if necessary, using conventional primer extension method described in [supra selected cDNA or Genomic libraries can be obtained by screening and processing intermediates of mRNA that are not reverse transcribed into cDNA.

2. Selection and Transformation of Host Cells

Host cells are conventional nutrient media transfected or transformed with the expression or cloning vectors described herein for PRO production and modified to be suitable for induction of a promoter, selection of a transformant or amplification of a gene encoding a sequence of interest. In culture. Those skilled in the art can select culture conditions such as medium, temperature and pH without undue experimentation. In general, principles, protocols, and techniques to maximize productivity of cell cultures are described in Mammalian Cell Biotechnology: a Practical Approach , M. Butler, ed. Can be found in (IRL Press, 1991)] and Sam Brook et al., (Sambrook) [supra].

Eukaryotic cell transfection methods and prokaryotic transformation methods such as CaCl ₂ , CaPO ₄ , liposome-mediated methods and electroporation are known to those skilled in the art. Depending on the host cell used, transformation is carried out using standard techniques suitable for the cell. Sam Brook (Sambrook) described supra, or electroporation, calcium treatment using calcium chloride method described in, such as is generally used for prokaryotes. Infection with Agrobacterium tumefaciens has been described in particular plants as described in Shaw et al., Gene , 23 : 315 (1983) and WO 89/05859 published June 29, 1989. Used for cell transformation. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham and van der Eb, Virology , 52 : 456-457 (1978) can be used. General features of transfection of mammalian cell host systems are described in US Pat. No. 4,399,216. Transformation into yeast is generally described by Van Solingen et al., J. Bact. , 130 : 946 (1977) and Hsiao et al ., Proc. Natl. Acad. Sci. (USA) , 76 : 3829 (1979)]. However, other methods of introducing DNA into cells, such as intranuclear microinjection, electroporation, fusion of circular cells with bacterial protoplasts, or polycations such as polybrene, polyornithine can also be used. . For various techniques for transformation of mammalian cells, see Keown et al., Methods in Enzymology , 185: 527-537 (1990) and Mansour et al . Nature , 336: 348-352 (1988).

Suitable host cells for cloning or expressing DNA in a vector herein include prokaryotic, yeast or higher eukaryotic cells. Suitable prokaryotic cells are sedative bacteria, for example Gram negative or Gram positive organisms, for example Enterobacteriaceae, for example E. coli. Coli, including but not limited to. A variety of teeth. E. coli strains, for example E. coli K12 strain MM294 (ATCC 31,446); E. coli X1776 (ATCC 31,537). E. coli strains W3110 (ATCC 27,325) and K5 772 (ATCC 53,635) are readily available. Other suitable prokaryotic host cells are Escherichia, such as E. coli. Coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, for example Salmonella typhimurium, Sererratia, for example For example Serratia marcescans and Shigella, and Bacillus, for example B. Subtilis and b. Licheniformis (e.g. B. licheniformis 41P described in DD 266,710, published April 12, 1989), Pseudomonas, for example p. Aeruginosa and Streptomyces. This example is for illustrative purposes only and is not intended to be limiting. Strain W3110 is a particularly preferred host or parent host because it is a common host strain for recombinant DNA product fermentation. Preferably, the host cell secretes minimal amounts of proteolytic enzymes. For example, strain W3110 can be modified to result in a mutation of the gene encoding the endogenous protein of the host, an example of such a host is E. coli with the complete genotype tonA . E. coli W3110 strain 1A2, E. coli with the complete genotype tonA ptr3 . E. coli W3110 strain 9E4, E. coli with the full genotype tonA ptr3 phoA E15 (argF-lac) 169 degP ompT kan ^r . E. coli W3110 strain 27C7 (ATCC 55,244), E. coli with the complete genotype tonA ptr3 phoA E15 (argF-lac) 169 degP ompT rbs7 ilvG kan ^r . E. coli W3110 strain 37D6, strain 37D6 with a non-kanamycin resistant degP deletion mutation. E. coli W3110 strain 40B4 and E. coli with the Periplasm protease variant disclosed in US Pat. No. 4,946,783, issued Aug. 7, 1990. E. coli strains. Alternatively, in vitro cloning methods such as PCR or other nucleic acid polymerase reactions are suitable.

In addition to prokaryotic cells, eukaryotic microorganisms such as fibrous fungi or yeast are suitable as cloning or expression hosts for PRO-coding vectors. Saccharomyces cerevisiae is a commonly used lower eukaryotic host microorganism. Other microorganisms include Shichizosaccharomyces pombe (Beach and Nurse, Nature , 290: 140 [1981]); European Patent No. 139,383, published May 2, 1985; Kluyveromyces hosts (US Pat. No. 4,943,529; Fler et al., Bio / Technology , 9: 968-975 (1991), for example K. et al. Lactis [MW98-8C, CBS683, CBS4574; Louvencourt et al ., J. Bacteriol. , 154 (2): 737-742 [1983], k. Fragilis (ATCC 12,424), k. Bulgaricus (ATCC 16,045), K. Wickeramii (ATCC 24,178), K. Waltii (ATCC 56,500), K. Drosophilarum [ATCC 36,906; Van den Berg et al., Bio / Technology , 8: 135 (1990), K. Thermotolerans and K. Marxianus; Yarrowia (European Patent No. 402,226); Pichia pastoris (European Patent 183,070); Sreekrishna et al ., J. Basic Microbiol. , 28: 265-278 [1988]; Candida; Trichoderma reesia (European Patent No. 244,234); Neurospora crassa [Case et al . Proc. Natl. Acad. Sci. USA , 76: 5259-5263 [1979]; Schwanniomyces, such as, for example, occidentalis (European Patent No. 394,538, published October 31, 1990); And fibrous fungi such as neurospora, penicillium, tolypocladium (WO 91/00357 published January 10, 1991) and Aspergillus hosts, for example Listen a. Nidulans (Ballance et al., Biochem. Biophys. Res. Commun. , 112: 284-289 [1983]; Tilburn et al., Gene , 26: 205-221 [1983]; Yelton et al ., Proc. Natl. Acad. Sci. USA , 81: 1470-1474 [1984] and A. Niger (Kelly and Hynes, EMBO J. , 4: 475-479 [1985]). Methyltrophic yeast is suitable and consists of Hansenula, Candida, Kloeckera, Pichia, Saccharomyces, Torulopsis and Rhodotorula Yeast capable of growing on methanol, selected from, but not limited to. A list of specific species that are examples of these types of yeast is described in C. Anthony's The Biochemistry of Methylotrophs , 269 (1982).

Suitable host cells for the expression of glycosylated PRO are derived from multicellular organisms. Examples of invertebrate cells include insect cells and plant cells, such as Drosophila S2 and Spodoptera Sf9. Examples of useful mammalian host cell lines include Chinese hamster ovary (CHO) cells and COS cells. More specific examples include monkey kidney CV1 cell lines transformed with SV40 (COS-7, ATCC CRL 1651), kidney cell lines of human embryos (293 cells or 293 cells subcloned for growth in suspension culture, Graham et al. J. Gen Virol. , 36:59 (1997)), Chinese hamster ovary cells / -DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA , 77: 4216 ( 1980)), mouse sertoli cells (TM4, Marter, Biol. Reprod. , 23: 243-251 (1980)), human lung cells (W138, ATCC CCL 75), human hepatocytes (Hep G2, HB 8065) and mice Breast tumors (MMT 060562, ATCC CCL 51). One skilled in the art can readily select suitable host cells.

3. Selection and use of replicable vectors

Nucleic acid encoding a PRO (eg cDNA or genomic DNA) is inserted into a replicable vector for cloning (amplification of DNA) or expression. Various vectors can be easily obtained. For example, the vector may be in the form of plasmids, cosmids, viral particles or phages. Suitable nucleic acid sequences can be inserted into the vector by various methods. In general, DNA is inserted into a suitable restriction endonuclease site using techniques known in the art. Vector components generally include, but are not limited to, one or more signal sequences, origins of replication, one or more marker genes, enhancer components, promoters and transcription termination sequences. The preparation of suitable vectors comprising one or more such components uses standard ligation techniques known to those skilled in the art.

PRO can be produced not only by direct recombination methods but also as a fusion polypeptide with a heterologous polypeptide that can be a mature protein or other polypeptide or signal sequence having a specific cleavage site at the N terminus of the polypeptide. In general, the signal sequence may be a component of the vector or part of a PRO-encoding DNA inserted into the vector. The signal sequence can be for example a prokaryotic signal sequence selected from the group of alkali phosphatase, penicillinase, lpp or thermostable enterotoxin II leader. For yeast secretion, the signal sequence can be, for example, a yeast invertase leader, an α factor leader (Saccharomyces and Kluyveromyces α-factor leader (described in US Pat. No. 5,010,182)) or an acid phosphatase leader, C. . C. albicans glucoamylase leader (EP 362,179 published April 4, 1990) or a signal described in WO 90/13646 published November 15, 1990. In expression of mammalian cells, mammalian signal sequences, such as signal sequences from secretory polypeptides of the same or related species, and viral secretion leaders can be used to direct the secretion of the protein.

Both expression and cloning vectors contain nucleic acid sequences that allow the vector to replicate in one or more selected host cells. Such sequences are known for various bacteria, yeasts and viruses. The origin of replication of plasmid pBR322 is suitable for most Gram-negative bacteria, the 2μ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian cells. Do.

Expression and cloning vectors will typically contain a selection gene, also called a selectable marker. Representative selection genes, eg, genes encoding D-alanine racemases for Bacillus, may comprise (a) proteins that confer resistance to antibiotics or other toxins such as ampicillin, neomycin, methotrexate, or tetracycline, (b) Encode proteins that complement nutritional deficiencies or (c) provide important nutrients that are not available from complex media.

Examples of selectable markers suitable for mammalian cells are markers that allow identification of cells capable of receiving PRO-encoding nucleic acids, for example DHFR or thymidine kinase. When wild type DHFR is used, a suitable host cell is a CHO cell line lacking DHFR activity, and Urlaub et al ., Proc. Natl. Acad. Sci. USA , 77: 4216 (1980)]. Suitable selection genes for use in yeast are the trp1 gene present in yeast plasmid YRp7 (Stinchcomb et al. , Nature , 282: 39 (1979)); Kingsman et al., Gene , 7: 141 (1979); Tschemper et al., Gene , 10: 157 (1980). trp1 gene provides a selection marker for variant strains of yeast that cannot grow using tryptophan (eg, ATCC 44076 or PEP4-1) [Jones, Genetics , 85: 12 (1977)] .

Expression and cloning vectors contain a promoter operably linked to a PRO coding nucleic acid sequence that directs mRNA synthesis. Promoters recognized by various potential host cells are known. Suitable promoters for use in prokaryotic hosts include the β-lactamase and lactose promoter systems (Chang et al. , Nature , 275: 615 (1978)); Goeddel et al. , Nature , 281: 544 (1979), alkaline phosphatase, tryptophan (trp) promoter system [Goeddel, Nucleic Acid Res. , 8: 4057 (1980); EP 36,776], and hybrid promoters such as the tac promoter (deBoer et al ., Proc. Natl. Acad. Sci. USA , 80: 21-25 (1983)]. In addition, promoters used in bacterial systems will contain a Shine-Dalgarno (SD) sequence operably linked to the DNA encoding the PRO.

Examples of promoter sequences suitable for use in yeast hosts include 3-phosphoglycerate kinases [Hitzeman et al . J. Biol. Chem. , 255: 2073 (1980)] or other relevant enzymes (Hess et al ., J. Adv. Enzyme Reg. , 7: 149 (1968); Holland, Biochemistry , 17: 4900 (1978)]], for example enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose- Promoters for 6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosphosphate isomerase, phosphoglucose isomerase and glucokinase.

Other yeast promoters, which are inducible promoters with the additional advantage of transcription controlled by growth conditions, include alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degrading enzymes involved in nitrogen metabolism, metallothionein, glyceraldehyde Promoter region for 3-phosphate dehydrogenase, and enzymes that act on maltose and galactose use. Suitable vectors and promoters for use in yeast expression are further described in EP 73,657.

Transcription of PRO from a vector in a mammalian host cell may include viruses such as polyoma virus, poultry virus (UK No. 2,211,504 published July 5, 1989), adenovirus (eg adenovirus 2), bovine Genomes of viruses such as papilloma virus, avian sarcoma virus, cytomegalovirus, retrovirus, hepatitis B virus and monkey virus 40 (SV40), heterologous mammalian promoters such as actin promoters or immunoglobulin promoters, and heat- It is regulated by a promoter that is compatible with the host cell system, obtained from the impact promoter.

Transcription of the DNA encoding PRO by higher eukaryotes can be increased by inserting an enhancer sequence into the vector. Enhancers are cis-functional components of DNA, generally about 10 to 300 bp, that act on the promoter to increase transcription. Currently, many enhancer sequences are known to be derived from mammalian genes (globin, elastase, albumin, α-fetoprotein and insulin). Typically, however, one will use an enhancer derived from a virus of a eukaryotic cell. Examples include the SV40 enhancer (bp 100-270) later in the origin of replication, the cytomegalovirus early promoter enhancer, the polyoma enhancer later in the origin of replication, and the adenovirus enhancer. The enhancer can be spliced into the vector at the 5 'or 3' position in the PRO coding sequence, but is preferably located at the 5 'site from the promoter.

In addition, expression vectors for use in eukaryotic host cells (multinuclear cells derived from yeast, fungi, insects, plants, animals, humans or other multicellular organisms) may comprise sequences necessary for transcription termination and mRNA stabilization. Such sequences are typically obtained from the 5 ', and optionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions contain nucleotide fragments that are transcribed into polyadenylation fragments in the untranslated portion of the mRNA encoding PRO.

Other methods, vectors and host cells suitable for application to the synthesis of PRO in the culture of recombinant vertebrate cells are described in Getting et al. , Nature , 293: 620-625 (1981); Mantei et al. , Nature , 281: 40-46 (1979); European Patent No. 117,060 and European Patent No. 117,058.

4. Detection of Gene Amplification / Expression

Gene amplification and / or expression may be, for example, conventional Southern blotting, Northern blotting to quantify transcription of mRNA [Thomas, Proc. Natl. Acad. Sci. USA , 77: 5201-5205 (1980)], dot blotting (DNA analysis) or appropriately labeled probes based on the sequences provided herein can be measured directly in the sample by hybridization in situ. . Alternatively, an antibody capable of recognizing a specific double chain can be used, including a DNA double strand, an RNA double strand and a DNA-RNA hybrid double strand or a DNA-protein double strand. In other words, an assay can be performed that can label the antibody, bind the double chain to the surface, and detect the presence of the antibody bound to the double chain when the double chain is formed on the surface.

Alternatively, gene expression can be measured by immunological methods such as immunohistochemical staining of cells or tissue sections and analysis of cell culture or body fluids for direct quantification of expression of gene products. Antibodies useful for immunohistochemical staining and / or analysis of sample fluids can be monoclonal or polyclonal antibodies and can be prepared in any mammal. Conveniently, antibodies to exogenous sequences that are fused to native sequence PRO polypeptides or synthetic peptides based on the DNA sequences provided herein or to PRO DNA and that encode specific antibody epitopes can be prepared.

5. Purification of Polypeptides

The form of PRO may be recovered from culture medium or from host cell lysate. When bound to the membrane, it can be released from the membrane using a suitable detergent solution (eg Triton-X 100) or by cleavage of the enzyme. Cells used for expression of PRO may be pulverized by various physical or chemical means such as freeze-thaw cycles, sonication, mechanical grinding or cell lysates.

It may be desirable to purify PRO from recombinant cell proteins or polypeptides. Examples of suitable purification methods include fractionation on ion exchange columns, ethanol precipitation, reverse phase HPLC, silica or cation exchange resins, eg chromatography on DEAE, chromatographic focusing, SDS-PAGE, ammonium sulfate precipitation, for example Sephadex Gel filtration using G-75, Protein A Sepharose column to remove contaminants such as IgG, and metal chelating column to bind epitope tagged forms of PRO. Various protein purification methods can be used and such methods are known in the art and are described, for example, in Deutscher, Methods in Enzymology , 182 (1990); Scopes, Protein Purification: Principles and Practice , Springer-Verlag, New York (1982). The purification step (s) selected will depend, for example, on the production method used and the properties of the particular PRO produced.

E. Use of PRO

Nucleotide sequences (or complements thereof) that encode PRO have a variety of uses in the field of molecular biology, including their use as hybridization probes, in chromosome and gene mapping, and in the production of antisense RNAs and DNA. PRO nucleic acids will also be useful for the production of PRO polypeptides by the recombinant techniques described herein.

The full length native sequence PRO gene or fragment thereof isolates a full length PRO cDNA or other cDNA (eg, a gene encoding a PRO from a native variant or other species of PRO) having the desired sequence identity with the native PRO sequence disclosed herein. It can be used as a hybridization probe for the cDNA library. Optionally, the probe will be about 20 to about 50 bases in length. Hybridization probes can be derived from at least a portion of a new region of the full-length native nucleotide sequence, where this region can be determined without undue experimentation, or from a genomic sequence comprising a promoter, enhancer component and intron of native sequence PRO. For example, the screening method will include isolating the coding region of the PRO gene using known DNA sequences to synthesize selected probes of about 40 bases. Hybridization probes can be labeled with a variety of labels, including radioactive nucleotides such as ³² P or ³⁵ S, or enzymatic labels such as alkaline phosphatase linked to the probe via an avidin / biotin linkage system. Labeled probes having sequences complementary to those of the PRO genes of the invention can be used to screen libraries of human cDNA, genomic DNA or mRNA to determine the members of the library that the probe hybridizes to. Hybridization techniques are described in more detail in the Examples below.

Any EST sequence disclosed herein can similarly be used as a probe using the methods described herein.

Other useful fragments of PRO nucleic acids include antisense or sense oligonucleotides comprising a single-stranded nucleic acid sequence (RNA or DNA) capable of binding to a target PRO mRNA (sense) or PRO DNA (antisense) sequence. Antisense or sense oligonucleotides according to the present invention comprise fragments of coding regions of PRO DNA. This fragment generally comprises at least about 14 nucleotides, preferably about 14 to 30 nucleotides. The ability to induce antisense or sense oligonucleotides based on cDNA sequences encoding a given protein is described, for example, in Stein and Cohen ( Cancer Res. 48: 2659, 1988) and van der Krol et al. ( BioTechniques 6: 958, 1988).

Combination of the antisense or sense oligonucleotide with the target nucleic acid sequence forms a double strand that blocks the transcription or translation of the target sequence by one of several or other methods, including enhanced digestion of the double strand, early termination of transcription or translation. . Thus, antisense oligonucleotides can be used to block the expression of the PRO protein. In addition, antisense or sense oligonucleotides include oligonucleotides having modified sugar-phosphodiester backbones (or other sugar chains, eg, sugar chains disclosed in WO 91/06629), wherein such sugar chains are internal Resistance to clease. Such oligonucleotides with resistant sugar chains are stable in vivo (ie, resistant to enzymatic degradation) but retain sequence specificity capable of binding to the target nucleotide sequence.

Other examples of sense or antisense oligonucleotides include organic residues such as those disclosed in WO 90/10048, and other residues that increase the affinity of the oligonucleotide for the target nucleic acid sequence, such as poly- (L-lysine). Oligonucleotides that are covalently linked with In addition, intercalating agents such as ellipsine, and alkylating agents or metal conjugates can be linked to sense or antisense oligonucleotides to change the binding specificity of the antisense or sense oligonucleotides to the target nucleotide sequence.

Cells containing the target nucleic acid sequence, for example, by any gene transfer method including CaPO ₄ -mediated DNA transfection, electroporation, or by using a gene transfer vector such as Epstein-Barr virus. Antisense or sense oligonucleotides can be introduced. In a preferred method, antisense or sense oligonucleotides are inserted into a suitable retroviral vector. The cell comprising the target nucleic acid sequence is contacted with the recombinant retroviral vector in vivo or ex vivo. Suitable retroviral vectors include vectors derived from double copy vectors designated murine retroviruses M-MuLV, N2 (retrovirus derived from M-MuLV), or DCT5A, DCT5B and DCT5C (see WO 90/13641). Included but not limited to.

In addition, as disclosed in WO 91/04753, it is possible to introduce a sense or antisense oligonucleotide into a cell comprising a target nucleotide sequence by forming a conjugate with a ligand binding molecule. Suitable ligand binding molecules include, but are not limited to, cell surface receptors, growth factors, other cytokines, or other ligands that bind to cell surface receptors. Preferably, the linkage of the ligand binding molecule does not substantially impede the ability of the ligand binding molecule to bind to the corresponding molecule or receptor, nor does it block the intracellular entry of the sense or antisense oligonucleotides or conjugate forms thereof.

Alternatively, as disclosed in WO 90/10448, oligonucleotide-lipid conjugates can be introduced to introduce a sense or antisense oligonucleotide into a cell comprising a target nucleic acid sequence. Such sense or antisense oligonucleotide-lipid conjugates are preferably separated by internal lipases intracellularly.

Antisense or sense RNA or DNA molecules are generally about 5 bases, about 10 bases, about 15 bases, about 20 bases, about 25 bases, about 30 bases, about 35 bases, about 40 bases in length. Base, about 45 bases, about 50 bases, about 55 bases, about 60 bases, about 65 bases, about 70 bases, about 75 bases, about 80 bases, about 85 bases, about 90 bases Base, about 95 bases, about 100 bases or more.

Probes may also be used in PCR techniques to generate a group of sequences for identification of closely related PRO coding sequences.

In addition, nucleotide sequences encoding PRO can be used to prepare hybridization probes for mapping genes encoding PRO and for genetic analysis of individuals with genetic disorders. Nucleotide sequences provided herein can be mapped to specific regions of chromosomes and chromosomes using known techniques such as hybridization in situ, linkage analysis for known chromosomal markers, and hybridization screening using libraries.

If the coding sequence of a PRO encodes a protein that binds to another protein (eg where PRO is a receptor), the PRO can be used in an assay to identify other proteins or molecules involved in this binding interaction. By this method, inhibitors of receptor / ligand binding interactions can also be identified. In addition, proteins involved in such binding interactions can be used to screen for peptides or small molecule inhibitors or agonists of binding interactions. Receptor PRO can also be used to isolate similar ligands. Screening assays can be designed to find lead compounds that mimic the biological activity of a receptor for native PRO or PRO. Such screening assays include high throughput screening assays for chemical libraries and would be particularly suitable for identifying small molecule drug candidates. Small molecules include synthetic organic or inorganic compounds. Assays can be performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays, and cell based assays characterized in the art.

Nucleic acids encoding PRO or variants thereof can also be used to generate transgenic or “knock out” animals useful for the development and screening of useful therapeutics. Transgenic animals (eg, mice or rats) are animals that have cells that contain the transgene, which transgenic genes are present in the animal or its ancestors during the prenatal period, for example the embryonic stage. Is introduced. The transgene is DNA that is integrated into the genome of a cell from which a transgenic animal develops. In one embodiment, a cDNA encoding a PRO can be used to clone genomic DNA encoding the PRO according to established techniques and to use the genomic sequence to transgene comprising cells expressing the DNA encoding the PRO. Animals can be produced. In particular, methods for producing transgenic animals such as mice or rats are routine methods in the art and are described, for example, in US Pat. Nos. 4,736,866 and 4,870,009. Typically, specific cells are targeted in the introduction of a PRO transgene with a tissue specific enhancer. In the embryonic stage, a transgenic animal comprising a copy of a transgene that encodes a PRO introduced into the germ cells of the animal can be used to investigate the effect of increasing the expression of the DNA encoding the PRO. Such animals can be used, for example, as test animals for reagents that are thought to protect against pathological symptoms associated with overexpression of PRO polypeptides. According to this aspect of the invention, treatment of the animal with the reagent results in a lower incidence of pathological symptoms than untreated animals carrying the transgene, indicating a potential therapeutic intervention in the pathological condition.

Or having a defect or modified gene encoding PRO as a result of homologous recombination between the endogenous gene encoding PRO using the non-human homolog of PRO and the modified genomic DNA encoding PRO introduced into the animal's embryonic cells. You can make PRO "knock out" animals. For example, cDNA encoding PRO can be used to clone genomic DNA encoding PRO according to established techniques. Portions of genomic DNA encoding a PRO may be deleted or substituted with other genes, such as genes encoding selective markers that may be used to monitor integration. In general, thousands of bases of unmodified flanking DNA (at both the 5 'and 3' ends) are included in a vector (e.g., for homologous recombinant vectors, see Thomas and Capecchi, Cell , 51: 503). (1987)). This vector is introduced into a stem cell line (e.g., by electroporation), and cells in which homologous recombination of the introduced DNA and the endogenous DNA are selected (see, eg, Li et al., Cell , 69: 915 (1992). Selected cells are then injected into blastocysts of animals (eg mice or rats) to form aggregated chimeras (see, eg, Bradley, Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, EJ Robertson, ed. (IRL, Oxford, 1987), pp. 113-152). The chimeric embryos were then transplanted into suitable fertility surrogate animals to produce "knock out" animals. Progeny that carry homologous recombinant DNA in germ cells can be identified using standard techniques and used to breed animals in which all cells of the animal contain homologous recombinant DNA. Knockout animals are characterized, for example, by the ability to defend against certain pathological symptoms and the development of pathological symptoms due to the absence of PRO polypeptides.

Nucleic acids encoding PRO polypeptides can also be used in gene therapy. When used in gene therapy, genes are introduced into cells to synthesize therapeutic gene products in vivo, eg to replace defective genes. "Gene therapy" includes both traditional gene therapy where a single effect is achieved and administration of gene therapy, including single or repeated administration of DNA or mRNA effective for treatment. Antisense RNAs and DNAs can be used as therapeutic agents to block the expression of certain genes in vivo. Despite the low intracellular concentration of these oligonucleotides due to the limited uptake of short antisense oligonucleotides through the cell membrane, it has already been found that they can act as inhibitors when introduced into cells (Zamecnik et al., Proc. Natl. Acad). , Sci. USA 83, 4143-4146 (1986)). Such oligonucleotides can enhance the uptake of oligonucleotides by modification, for example by replacing their negatively charged phosphodiester groups with non-charged groups.

There are a variety of techniques that can be used to introduce nucleic acids into living cells. This technique depends on whether the nucleic acid is delivered to cells cultured in vitro or to cells of the desired host in vivo. Suitable techniques for delivering nucleic acids to mammalian cells in vitro include liposomes, electroporation, microinjection, cell fusion, DEAE-dextran and calcium phosphate precipitation and the like. Currently preferred for in vivo gene delivery techniques include transfection using viral (usually retroviral) vectors and viral coat protein-liposomal mediated transfection (Dzau et al., Trends in Biotechnology 11, 205-210 ( 1993). In some cases, it is desirable to provide the nucleic acid source with agents that target the target cell, such as membrane proteins on the cell surface or antibodies specific for the target cell, ligands for receptors on the target cell, and the like. If liposomes are used, proteins that bind to membrane proteins on the cell surface involved in endocytosis can be used for targeting and / or promote uptake, such as, for example, directed to specific cell types. Capsid proteins or fragments thereof, antibodies to proteins that undergo internalization in circulation, and proteins that target intracellular locations and increase intracellular half-life. Receptor mediated endocytosis techniques are described, for example, in Wu et al., J. Biol. Chem. 262, 4429-4432 (1987), and Wagner et al., Proc. Natl. Acad. Sci. USA 87, 3410-3414 (1990). For a review of gene marking and gene therapy protocols, see Anderson et al., Science 256, 808-813 (1992).

The PRO polypeptides disclosed herein can also be used as molecular weight markers for protein electrophoresis, and the isolated nucleic acid sequences can be used to recombinantly express these markers.

Nucleic acid molecules or fragments thereof encoding the PRO polypeptides disclosed herein are useful for the identification of chromosomes. In this regard, there is a continuing need to identify new chromosomal markers because there are currently relatively few chromosomal marking reagents available based on actual sequence data. Each of the PRO nucleic acid molecules of the present invention can be used as a chromosome marker.

The PRO polypeptides and nucleic acid molecules of the invention can also be used for tissue typing, wherein the PRO polypeptides of the invention can be differentially expressed in one tissue compared to other tissues. PRO nucleic acid molecules will be used to generate probes for PCR, Northern analysis, Southern analysis and Western analysis.

The PRO polypeptides disclosed herein may also be used as therapeutic agents. Pharmaceutically useful compositions can be prepared by formulating the PRO polypeptides of the invention according to known methods, wherein the PRO product is combined with a pharmaceutically acceptable carrier vehicle. Therapeutic formulations are prepared for storage in the form of lyophilized formulations or aqueous solutions by mixing the active ingredient with the desired purity with any physiologically acceptable carrier, excipient or stabilizer ( Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)). Acceptable carriers, excipients or stabilizers are nontoxic to the subject of administration at the dosages and concentrations employed, and include antioxidants such as phosphates, citrate and other organic acids, ascorbic acid, low molecular weight (less than about 10 residues) polypeptides, serum Proteins such as albumin, gelatin or immunoglobulins, hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine, arginine or lysine, monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins , Chelating agents such as EDTA, sugar alcohols such as mannitol or sorbitol, salt-forming counterions such as sodium, and / or nonionics such as Tween®, Pluronics® or PEG Surfactants and the like.

The formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes before or after lyophilization and thawing.

Therapeutic compositions of the present disclosure may generally be contained in a container with a sterile access door, for example, in a stoppered vial that can be pierced by an intravenous solution bag or a hypodermic needle.

Routes of administration include known methods, for example by injection or infusion by intravenous, intraperitoneal, intracranial, intramuscular, intraocular, intraarterial or intralesional routes, topical administration, or sustained release.

Dosages and desired drug concentrations of the pharmaceutical compositions of the present invention may vary depending upon the particular intended use. Determination of the appropriate dosage and route of administration is well known to those skilled in the art. The results of animal experiments provide reliable guidance in determining dosages effective for human treatment. Scaling effective doses between species is described in Mordenti, J. and Chappell, W. "The use of interspecies scaling in toxicokinetics" In Toxicokinetics and New Drug Development, Yacobi et al., Eds., Pergamon Press, New York 1989, pp. 42-96).

When a PRO polypeptide or agonist or antagonist thereof is administered in vivo, the general dosage depends on the route of administration and is about 10 ng to 100 mg per kg body weight of the mammal, or preferably about 1 μg / kg per day To 10 mg / kg. Guidance as to specific dosages and methods of delivery is provided in the literature, for example in US Pat. No. 4,657,760, 5,206,344 or 5,225,212. Other agents may be effective for other therapeutic compounds and for other diseases, and administration targeted to one organ or tissue is expected to require delivery in a different manner than, for example, administration to another organ or tissue. do.

If sustained release administration of a PRO polypeptide is required for an agent with release properties suitable for the treatment of a disease or disorder requiring administration of the PRO polypeptide, microencapsulation of the PRO polypeptide is contemplated. Microencapsulation of recombinant proteins for delayed release has been successfully performed using human growth hormone (rhGH), interferon (rhIFN), interleukin-2 and MN rgp120 (Johnson et al., Nat. Med. , 2: 795- 799 (1996); Yasuda, Biomed. Ther. , 27: 1221-1223 (1993); Hora et al., Bio / Technology , 8: 755-758 (1990); Cleland, "Design and Production of Single Immunization Vaccines Using Polyactide Polyglycolide Microsphere Systems, "in Vaccine Design: The Subunit and Adjuvant Approach , Powell and Newman, eds, (Plenum Press: New York, 1995), pp. 439-462: WO 97/03692, WO 96/40072, WO 96 / 07399 and US Pat. No. 5,654,010).

Sustained release preparations of these proteins have been developed using poly-lactic acid-co-glycolic acid (PLGA) polymers due to their biocompatibility and broad biodegradable properties. The degradation products of PLGA, lactic acid and glycolic acid, can be quickly removed from the human body. In addition, the resolution of the polymer can be adjusted from months to years depending on its molecular weight and composition (Lewis, "Controlled release of bioactive agents from lactide / glycolide polymer," in: M. Chasin and R. Langer (Eds.), Biodegradable Polymers as Drug Delivery Systems (Marcel Dekker: New York, 1990), pp. 1-41).

The invention includes methods for screening compounds to identify (antagonist) compounds that mimic PRO polypeptides or block the effects of (agonist) PRO polypeptides. Screening assays for antagonist drug candidates were designed to identify compounds that bind or conjugate with the PRO polypeptide encoded by the genes identified herein or interfere with the interaction of the encoded polypeptide with other intracellular proteins. Such screening assays include assays capable of high throughput screening for chemical libraries, which would be particularly suitable for identifying small molecule drug candidates.

Such assays can be performed in a variety of formats including protein-protein binding assays, biochemical screening assays, immunoassays and cell based assays characterized in the art.

Common to all assays for antagonists is that the PRO polypeptide encoded by the nucleic acids identified herein and the candidate drug must be contacted under conditions and time sufficient to allow them to interact with each other.

In binding assays the interaction is to bind and the formed binder can be isolated or detected in the reaction mixture. In certain embodiments, a PRO polypeptide or drug candidate encoded by a gene identified herein is immobilized to a solid phase, eg, a microtiter plate, by covalent or non-covalent attachment. Non-covalent attachment is generally achieved by coating the solid surface with a solution of PRO polypeptide and drying. Alternatively, immobilized antibodies, such as monoclonal antibodies specific for immobilized PRO polypeptides, can be used to anchor them to a solid surface. This analysis is performed by adding an unfixed component that can be labeled by a detectable label to a coded surface comprising a fixed component, for example an anchored component. When the reaction is finished, unreacted components are removed, for example by washing, and the binder anchored to the solid surface is detected. If the component that was not originally immobilized contained a detectable label, detection of the label immobilized on the surface indicates that a complexing reaction occurred. If a component that is not originally immobilized does not include a label, the complexing reaction can be detected, for example, using a labeled antibody that specifically binds to the immobilized conjugate.

If a candidate compound interacts with, but does not bind to, a particular PRO polypeptide encoded by a gene identified herein, the interaction of the candidate compound with that polypeptide can be analyzed by well known methods of detecting protein-protein interactions. . Such assays include conventional methods such as crosslinking, coimmunoprecipitation, and copurification via gradient or chromatography columns. Protein-protein interactions are also described in Fields and co-workers (Fields and Song, Nature (London) , 340: 245-246 (1989); Chien et al., Proc. Natl. Acad. Sci. USA , 88 : 9578-9582 (1991)) as discussed by Chevray and Nathans, Proc. Natl. Acad. Sci. USA , 89: 5789-5793 (1991), can be used to monitor using the yeast-based gene system described. Many transcriptional activators, such as yeast GAL4, consist of two physically distinct modular domains, one acting as a DNA-binding domain and the other as a transcription-active domain. The yeast expression system described in this publication (generally referred to as "2-hybrid system") takes advantage of this property and uses two hybrid proteins, one of which is that the target protein is associated with the DNA-binding domain of GAL4. The other is a candidate active protein fused with an active domain. The expression of the GAL1-lacZ reporter gene under the control of the GAL4-activation promoter depends on the reconstitution of GAL4 activity through protein-protein interactions. Colonies containing the interacting polypeptide are detected using a pigment producing substrate for β-galactosidase. A complete kit (MATCHMAKER®), which identifies protein-protein interactions between two specific proteins using 2-hybrid technology, can be purchased from Clontech. In addition, the system can be extended to map protein domains involved in specific protein interactions, as well as to pinpoint the location of amino acid residues critical for such interactions.

In the following way, compounds which interfere with the interaction of genes encoding PRO polypeptides identified herein with other intracellular or extracellular components can be tested. A reaction mixture comprising the product of a gene encoding a PRO polypeptide and an intracellular or extracellular component was prepared under conditions and times that allow interaction and binding of the two products. To test the ability of the candidate compound to inhibit binding, the reaction was performed in the presence and absence of the test compound. In addition, placebo may be added to a third reaction mixture that serves as a positive control. The binding (conjugate formation) between the test compound and the intracellular or extracellular components present in the mixture was monitored as described above. The conjugate was formed in the control reactant, but no binder was formed in the reaction mixture comprising the test compound, indicating that the test compound interfered with the interaction of the test compound with its reaction counterpart.

To analyze the antagonist, the PRO polypeptide could be added to the cell along with the compound to screen for specific activity, and the ability of the compound to inhibit the desired activity in the presence of the PRO polypeptide indicated that the compound was an antagonist to the PRO polypeptide. Alternatively, antagonists can be detected by combining the PRO polypeptide and potential antagonist with a membrane-bound PRO polypeptide receptor or recombinant receptor under appropriate conditions for competitive inhibition assays. PRO polypeptides can be labeled with radioactive isotopes, for example, to determine the effect of potential antagonists using the number of PRO polypeptide molecules that bind to the receptor. Genes encoding receptors could be identified by several methods known to those of skill in the art, for example ligand panning and FACS classification (Coligan et al., Current Protocols in Immun. , 1 (2): Chapter 5 (1991)). . Preferably, expression cloning methods are used, wherein the polyadenylation RNA is prepared from cells reactive to the PRO polypeptide, and the cDNA library generated from this RNA is classified as pool and is non-responsive to the PRO polypeptide or It is used to transfect other cells. Transfected cells growing on glass slides are exposed to labeled PRO polypeptide. PRO polypeptides can be labeled by a variety of methods, including iodide or encapsulation of recognition sites for site-specific protein kinases. After immobilization and incubation, the slides were analyzed by autoradiography. Sub- pools were identified by identifying positive pools and transfected again using interactive sub- pooling and rescreening methods, resulting in a single clone encoding the putative receptor.

As an alternative method of identifying receptors, labeled PRO polypeptides could be photoaffinity-linked with extract samples expressing cell membranes or receptor molecules. The crosslinked material was analyzed by PAGE and exposed to X-ray film. Label conjugates containing receptors can be cut and digested into peptide fragments for protein micro-sequencing. By designing a set of degenerate oligonucleotide probes using amino acid sequences obtained from micro-sequencing, one could screen cDNA libraries and identify genes encoding putative receptors.

In another antagonist assay method, mammalian cell or membrane samples expressing receptors in the presence of candidate compounds were incubated with labeled PRO polypeptide. Thereafter, the ability of the compound to enhance or block the interaction could be measured.

More specific examples of potential antagonists include oligonucleotides that bind to fusions of immunoglobulins with PRO polypeptides, and in particular poly- and monoclonal antibodies, and antibody fragments, side chain antibodies, anti-genetic antibodies, and such antibodies or fragments thereof. Chimeric or humanized forms of, and antibodies, including human antibodies and antibody fragments. Alternatively, the potential antagonist may be a modified form of a closely related protein, eg, a PRO polypeptide that recognizes but does not affect the receptor but competitively inhibits the action of the PRO polypeptide.

Another potential PRO polypeptide antagonist is an antisense RNA or DNA construct prepared using antisense technology, where the antisense RNA or DNA molecule acts to directly block the translation of the mRNA by hybridizing with the target mRNA to prevent protein translation. . Antisense techniques can be used to regulate gene expression via triple helix formation or antisense DNA or RNA, all of which are based on the binding of polynucleotides to DNA or RNA. For example, the 5 'coding portion of a polynucleotide sequence encoding a mature PRO polypeptide herein can be used to design antisense RNA oligonucleotides of about 10 to 40 base pairs in length. DNA oligonucleotides are designed to be complementary to regions of genes involved in transcription (Lee et al., Nucl. Acids Res. , 6: 3073 (1979); Cooney et al, Science , 241). : 456 (1988); Dervan et al., Science , 251: 1360 (1991))) transcription and production of PRO polypeptides. Antisense RNA oligonucleotides hybridized with their mRNAs in vivo to block the translation of mRNA molecules to PRO polypeptides (antisense-Okano, Neurochem. , 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression (CRC Press: Boca Raton, FL, 1988). In addition, the oligonucleotides described above could be delivered to cells to express antisense RNA or DNA in vivo to inhibit the production of PRO polypeptides. If antisense DNA is used, oligodeoxyribonucleotides derived from transcription-initiation sites, eg, positions between about -10 and +10 of the target gene nucleotide sequence, are preferred.

Potential antagonists include small molecules that bind to the active site, receptor binding site, or small molecules that bind the growth factor or other related binding site of the PRO polypeptide to block the normal biological activity of the PRO polypeptide. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules, preferably soluble peptides, and synthetic bipeptidyl organic or inorganic compounds.

Ribozymes are enzyme RNA molecules that can catalyze specific cleavage of RNA. The ribozyme acts after sequence-specific hybridization with the target RNA complementary thereto, followed by cleavage by endonuclease. Known techniques have been able to identify specific ribozyme cleavage sites within potential RNA targets. See, for example, Rossi, Current Biology , 4: 469-471 (1994) and PCT publication No. WO 97/33551 (published September 18, 1997).

The triple helix form of nucleic acid molecules used to inhibit transcription must be single-stranded and consist of deoxynucleotides. The base composition of such oligonucleotides is designed to facilitate triple helix formation via the Hoogsteen base pair rule, which typically requires significant size purine or pyrimidine stretch in one of the double chains. For further details see, for example, PCT publication No. WO 97/33551, supra.

The small molecules can be identified by one or more screening assays described above and / or by any other screening technique well known to those skilled in the art.

PRO213 polypeptides and portions thereof that possess the ability to modulate growth induction sequencing and / or blood coagulation sequencing may be used both in vivo therapy and in vitro for this purpose. Those skilled in the art will know how to use PRO213 polypeptide for this purpose.

The PRO274 polypeptide and its portion homologous to the 7TM protein and Fn54 may be used for in vivo therapeutic purposes as well as a variety of other applications. Identification of new 7TM proteins and Fn54-like molecules may be associated with many human diseases including recognition of ligands and subsequent signaling of information contained within these ligands to modulate cellular responses. Thus, identification of new 7TM proteins and Fn54-like molecules is particularly important in that such proteins can serve as potential therapeutics for a variety of different human diseases. Such polypeptides may play an important role in a variety of industries, as well as in biotechnology and medical research. As a result, new molecules such as PRO274 are of particular scientific and medical interest.

PRO300 polypeptides and fragments thereof having homology with Diff33 may be useful for in vivo therapeutic purposes as well as a variety of other applications. Identification of new Diff33-like molecules can be associated with many human diseases such as cancer physiology. Thus, the identification of new Diff33-like molecules is particularly important in that these proteins can serve as potential therapeutics for a variety of different human diseases. This polypeptide may play an important role in a variety of industries, as well as in biotechnology and medical research. As a result, new molecules such as PRO300 are of particular scientific and medical interest.

PRO296 polypeptides of the invention that retain biological activity associated with SAS proteins amplified in sarcoma can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO296 polypeptide of the present invention for this purpose.

PRO329 polypeptides of the invention that possess a biological activity associated with an immunoglobulin F _c receptor protein or a subunit thereof can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO329 polypeptide of the present invention for this purpose.

PRO362 polypeptides of the invention that possess biological activity associated with A33 antigen protein, HCAR protein or NrCAM related cell adhesion molecules can be used both in vivo and in vitro for therapeutic purposes.

PRO363 polypeptides of the invention that retain biological activity associated with cell surface HCAR proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO363 polypeptide of the present invention for this purpose. In particular, extracellular domains derived from PRO363 polypeptides can be used therapeutically to mitigate viral infection in vivo.

PRO868 polypeptides of the invention that retain biological activity associated with tumor necrosis factor proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO868 polypeptide of the present invention for this purpose.

PRO382 polypeptides of the invention that retain biological activity associated with serine protease proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO382 polypeptide of the present invention for this purpose.

PRO545 polypeptides and fragments thereof having homology with meltrin may be useful for in vivo therapeutic purposes as well as many other uses. Identification of new molecules involved in cell adhesion may be associated with many human diseases. Since meltrin proteins can play an important role in the process of many diseases, the identification of new meltrin proteins and meltrin-like molecules is particularly important in that they can serve as potential therapeutics for a variety of different human diseases. . This polypeptide may play an important role in a variety of industries, as well as in biotechnology and medical research. As a result, new molecules such as PRO545 are of particular scientific and medical interest.

PRO617 polypeptides of the invention that retain biological activity associated with the CD24 protein can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO617 polypeptide of the present invention for this purpose.

PRO700 polypeptides and portions thereof that are homologous to the protein disulfide isomerase may be useful in vivo as well as in various other fields for therapeutic purposes. Identification of new protein disulfide isomerases and related molecules can be associated with many human diseases. Since the formation of disulfide bonds and the folding of proteins play an important role in many biological reactions, the identification of novel protein disulfide isomerase and protein disulfide isomerase-like molecules has shown that this protein is a potential in many other human diseases. This is particularly important in that it can act as a therapeutic agent. The polypeptide may play an important role in a variety of industrial applications, as well as in biotechnology and medical research. As a result, new molecules such as PRO700 are of particular scientific and medical interest.

PRO702 polypeptides of the invention that retain biological activity associated with the conglutinin protein can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO702 polypeptide of the present invention for this purpose. PRO702 polypeptides with conglutinin activity are thought to inhibit hemagglutinin activity by influenza viruses and / or act as immunoglobulin-dependent defense molecules due to complement-mediated mechanisms.

PRO703 polypeptides of the invention that retain biological activity associated with VLCAS proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO703 polypeptide of the present invention for this purpose.

PRO703 polypeptides and portions thereof having homology with VLCAS may be useful for in vivo therapeutic purposes as well as for a variety of other uses. Identification of new VLCAS proteins and related molecules may be associated with many human diseases. Thus, identification of new VLCAS proteins and VLCAS protein-like molecules is particularly important in that these proteins can serve as potential therapeutics for many other human diseases. The polypeptide may play an important role in many industries, as well as in biotechnology and medical research. As a result, new molecules such as PRO703 are of particular scientific and medical interest.

PRO705 polypeptides of the invention that possess biological activity associated with K-glycancan protein can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO705 polypeptide of the present invention for this purpose.

PRO708 polypeptides of the invention that retain biological activity associated with aryl sulfatase proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO708 polypeptide of the present invention for this purpose.

PRO320 polypeptides of the invention that retain biological activity associated with fibulin proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO320 polypeptide of the present invention for this purpose.

PRO320 polypeptides and fragments thereof homologous to fibulin may be useful for in vivo therapeutic purposes as well as for a variety of other uses. Identification of new fibulin proteins and related molecules can be associated with many human diseases, including human diseases such as cancer or connective tissue, adhesion molecules and related mechanisms. Thus, the identification of novel fibulin proteins and fibulin protein-like molecules is particularly important in that these proteins can serve as potential therapeutics for many other human diseases. The polypeptide may play an important role in many industries, as well as in biotechnology and medical research. As a result, new molecules such as PRO320 are of particular scientific and medical interest.

PRO324 polypeptides of the invention that retain biological activity associated with oxidoreductases can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO324 polypeptide of the present invention for this purpose.

PRO351 polypeptides of the invention that retain biological activity associated with prostacin proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO351 polypeptide of the present invention for this purpose.

PRO351 polypeptides and portions thereof having homology with prostacins may be useful for in vivo therapeutic purposes as well as many other uses. Identification of new prostacin proteins and related molecules may be associated with many human diseases. Thus, the identification of new prostacin proteins and prostacin-like molecules is particularly important in that these proteins can serve as potential therapeutics for many other human diseases. The polypeptide may play an important role in many industries, as well as in biotechnology and medical research. As a result, new molecules such as PRO351 are of particular scientific and medical interest.

PRO352 polypeptides of the invention that retain biological activity associated with butyrophylline protein can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO352 polypeptide of the invention for this purpose.

PRO381 polypeptides of the invention that possess a biological activity associated with one or more FKPB immunophilin proteins may be used for therapeutic purposes both in vivo and in vitro, eg, for immunosuppressive activity and / or for regeneration of axons. Can be. Those skilled in the art will know how to use the PRO381 polypeptide of the present invention for this purpose.

PRO386 polypeptides of the invention that retain biological activity associated with the beta-2 subunit of sodium channels expressed in mammalian cells can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO386 polypeptide of the invention for this purpose.

PRO540 polypeptides of the invention that retain biological activity associated with LCAT proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO540 polypeptide of the present invention for this purpose.

PRO615 polypeptides of the invention that retain biological activity associated with synaptogirin proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO615 polypeptide of the present invention for this purpose.

PRO615 polypeptides and fragments thereof having homology with synaptogirin may be useful for in vivo therapeutic purposes as well as many other uses. Identification of new synaptogirin proteins and related molecules may be associated with many human diseases. Thus, the identification of new synaptogirin proteins and synaptogirin-like molecules is particularly important in that these proteins can serve as potential therapeutics for many other human diseases. The polypeptide may play an important role in many industries, as well as in biotechnology and medical research. As a result, new molecules such as PRO615 are of particular scientific and medical interest.

PRO618 polypeptides of the invention that retain biological activity associated with enteropeptidase can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO618 polypeptide of the present invention for this purpose.

PRO618 polypeptides and portions thereof that are homologous to enteropeptidase may be useful for in vivo therapeutic purposes as well as many other uses. Identification of new enteropeptidase proteins and related molecules may be associated with many human diseases. Thus, identification of novel enteropeptidase proteins and enteropeptidase-like molecules is particularly important in that these proteins can serve as potential therapeutics for many other human diseases. The polypeptide may play an important role in many industries, as well as in biotechnology and medical research. As a result, new molecules such as PRO618 are of particular scientific and medical interest.

PRO719 polypeptides of the invention that possess a biological activity associated with lipoprotein lipase H protein can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO719 polypeptides of the invention for this purpose.

PRO724 polypeptides of the invention that retain biological activity associated with human LDL receptor proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO724 polypeptide of the present invention for this purpose.

PRO772 polypeptides of the invention that retain biological activity associated with human A4 protein can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO772 polypeptide of the present invention for this purpose.

PRO852 polypeptides of the invention that retain biological activity associated with specific protease proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO852 polypeptide of the invention for this purpose.

PRO853 polypeptides of the invention that retain biological activity associated with reductase proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO853 polypeptide of the present invention for this purpose.

PRO853 polypeptides and portions thereof that are homologous to reductase proteins may be useful for in vivo therapeutic purposes as well as many other uses. Since oxygen free radicals and antioxidants appear to play an important role in many disease processes, the identification of novel reductase proteins and reductase-like molecules is particularly beneficial in that these proteins can serve as potential therapeutics for many other human diseases. It is important. The polypeptide may play an important role in many industries, as well as in biotechnology and medical research. As a result, new molecules such as PRO853 are of particular scientific and medical interest.

PRO860 polypeptides of the invention that retain biological activity associated with neuropascin proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO860 polypeptide of the present invention for this purpose.

PRO860 polypeptides homologous to neuropascine and parts thereof may be useful for in vivo therapeutic purposes as well as many other uses. Identification of new neuropascin proteins and related molecules may be associated with many human diseases, including cell adhesion. Thus, the identification of new neuropascin proteins and neuropascin-like molecules is particularly important in that these proteins can serve as potential therapeutics for many other human diseases. The polypeptide may play an important role in many industries, as well as in biotechnology and medical research. As a result, new molecules such as PRO860 are of particular scientific and medical interest.

The PRO846 polypeptide of the present invention having biological activity associated with CMRF35 protein can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO846 polypeptide of the present invention for this purpose.

PRO846 polypeptides homologous to the CMRF35 protein and portions thereof may be useful for in vivo therapeutic purposes as well as many other uses. Identification of new CMRF35 proteins and related molecules may be associated with many human diseases. Thus, the identification of new CMRF35 protein and CMRF35 protein-like molecules is particularly important in that these proteins can serve as potential therapeutics for many other human diseases. The polypeptide may play an important role in many industries, as well as in biotechnology and medical research. As a result, new molecules such as PRO846 are of particular scientific and medical interest.

PRO862 polypeptides of the invention that retain biological activity associated with lysozyme protein can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO862 polypeptide of the present invention for this purpose.

The PRO862 polypeptide and its portion homologous to the lysozyme protein may be useful for in vivo therapeutic purposes as well as many other uses. Identification of new lysosomal proteins and related molecules may be associated with many human diseases. Thus, the identification of new lysosomal and lysosomal-like molecules is particularly important in that these proteins can serve as potential therapeutics for many other human diseases. The polypeptide may play an important role in many industries, as well as in biotechnology and medical research. As a result, new molecules such as PRO862 are of particular scientific and medical interest.

PRO864 polypeptides of the invention that retain biological activity associated with Wnt-4 protein can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO864 polypeptide of the present invention for this purpose.

PRO864 polypeptides and fragments thereof having homology with the Wnt-4 protein may be useful for in vivo therapeutic purposes as well as many other uses. Identification of new Wnt-4 proteins and related molecules may be associated with many human diseases. Thus, the identification of new Wnt-4 protein and Wnt-4 protein-like molecules is particularly important in that these proteins can serve as potential therapeutics for many other human diseases. The polypeptide may play an important role in many industries, as well as in biotechnology and medical research. As a result, new molecules such as PRO864 are of particular scientific and medical interest.

PRO792 polypeptides of the invention that possess biological activity associated with the CD23 protein can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO792 polypeptide of the present invention for this purpose.

PRO866 polypeptides of the invention that retain biological activity associated with the mindine and / or spondin proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO866 polypeptide of the present invention for this purpose.

PRO871 polypeptides of the invention that possess biological activity associated with cyclophilin protein family can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO871 polypeptide of the present invention for this purpose.

PRO873 polypeptides of the invention that possess biological activity related to carboxyesterases can be used both in vivo and in vitro for therapeutic purposes. For example, this polypeptide can be used with a prodrug to convert the prodrug into its active form (see Danks et al., Supra). This polypeptide can be used to inhibit parasitic infections (see van Pelt et al., Supra). Methods for using the PRO873 polypeptides of the invention for these and other purposes are apparent to those skilled in the art.

PRO940 polypeptides of the invention that retain biological activity associated with CD33 protein and / or OB binding protein-2 can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO940 polypeptide of the present invention for this purpose.

PRO941 polypeptides of the invention that possess a biological activity associated with Cadherin protein can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO941 polypeptide of the present invention for this purpose.

PRO944 polypeptides of the invention that retain biological activity associated with CPE-R proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO944 polypeptide of the present invention for this purpose. The PRO944 polypeptide of the invention that functions to bind Clostridial Perfringens Enterotoxin (CPE) can be used to effectively treat infection by CPE Enterotoxin.

PRO983 polypeptides of the invention that possess biological activity associated with the vesicle-binding membrane protein VAP-33 can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO983 polypeptide of the present invention for this purpose.

PRO1057 polypeptides of the invention that retain biological activity associated with protease proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO1057 polypeptide of the present invention for this purpose.

PRO1071 polypeptides of the invention that retain biological activity associated with thrombospondine proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO1071 polypeptide of the present invention for this purpose.

PRO1072 polypeptides of the invention that retain biological activity associated with reductase proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO1072 polypeptide of the present invention for this purpose.

PRO1075 polypeptides of the invention that possess biological activity associated with protein disulfide isomerase can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO1075 polypeptide of the present invention for this purpose.

PRO181 polypeptides of the invention that retain biological activity associated with cornicon proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO181 polypeptide of the present invention for this purpose.

PRO827 polypeptides of the invention that retain biological activity associated with various integrin proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO827 polypeptide of the present invention for this purpose.

PRO1114 polypeptides of the invention that retain biological activity associated with cytokine receptor protein families can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO1114 polypeptide of the present invention for this purpose.

In addition to the above uses, the PRO1114 interferon receptor polypeptide can be used for applications requiring the ability to bind an interferon ligand both in vivo and in vitro. Those skilled in the art will be familiar with this use.

PRO237 polypeptides of the invention that retain biological activity associated with carbonic anhydrase proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO237 polypeptide of the present invention for this purpose.

PRO541 polypeptides of the invention that retain biological activity associated with trypsin inhibitor proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO541 polypeptide of the present invention for this purpose.

The PRO273 polypeptide can be used for competitive assays performed with other chemokines. The results can be used as appropriate.

PRO701 polypeptides of the invention that possess biological activity associated with the neuroligin family can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO701 polypeptide of the present invention for this purpose.

PRO701 can be used in assays with neurons, the activity of which can be compared with that of neuroligin 1, 2 and 3. The results can be used as appropriate.

PRO704 polypeptides of the invention that retain biological activity associated with the vesicle whole membrane protein can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO704 polypeptide of the present invention for this purpose.

To determine relative activity, PRO704 can be used in assays with polypeptides having identity to it. The results can be used as appropriate. The substance that performs endocytosis can be screened by tagging PRO704 or measuring activity to measure endocytosis activity.

PRO706 polypeptides of the invention that retain biological activity associated with endogenous prostate acid phosphatase precursors can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO706 polypeptide of the present invention for this purpose.

PRO706 can be used in assays with human prostate acid phosphatase or human lysosomal acid phosphatase, in which the activity can be compared with the activity of human prostate acid phosphatase or human lysosomal acid phosphatase. The results can be used as appropriate.

PRO707 polypeptides of the invention that possess a biological activity related to Cadherin can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO707 polypeptide of the present invention for this purpose.

PRO707 can be used in the assay to determine its activity in relation to other Cadherin, in particular Cadherin FIB3. The results can be used as appropriate.

PRO322 polypeptides of the invention that possess a biological activity associated with neuropsin can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO322 polypeptide of the present invention for this purpose.

PRO322 can be used in the assay to determine its activity relative to neuropsin, trypsinogen, serine protease and neurosine, and results are available as appropriate.

PRO526 polypeptides of the invention that retain biological activity associated with protein-protein binding proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO526 polypeptide of the present invention for this purpose.

Assays using growth factors and other proteins known to form binders were performed to determine if PRO526 binds to them and whether the binding increases half-life. The results can be used as appropriate.

PRO531 polypeptides of the present invention having biological activity associated with protocadherin can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO531 polypeptide of the present invention for this purpose.

Their relative activity was measured using PRO531 for Protocadherin 3 and other Protocadherin in the assay. The results can be used as appropriate.

PRO534 polypeptides of the invention that possess biological activity associated with protein disulfide isomerase can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO534 polypeptide of the present invention for this purpose.

PRO534 was used in conjunction with protein disulfide isomerase in the assay to determine its relative activity. The results can be used as appropriate.

PRO697 polypeptides of the invention that possess biological activity associated with the sFRP family can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO697 polypeptide of the present invention for this purpose.

PRO697 can be used with sFRP and SARP in assays to determine their relative activity. The results can be used as appropriate.

PRO731 polypeptides of the invention that possess biological activity associated with specific protocadherin can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO731 polypeptide of the present invention for this purpose.

PRO731 was used with polypeptides having identity in the assay to determine their relative activity. The results can be used as appropriate.

PRO768 polypeptides of the invention that retain biological activity associated with integrins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO768 polypeptide of the present invention for this purpose.

PRO768 was used with polypeptides having identity in the assay to determine their relative activity. The results can be used as appropriate.

PRO771 polypeptides of the invention that retain biological activity associated with testiccan proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO771 polypeptide of the present invention for this purpose.

PRO771 was used with polypeptides having identity in the assay to determine their relative activity. The results can be used as appropriate.

PRO733 polypeptides of the invention that retain biological activity associated with proteins that bind to the T1 / ST2 receptor can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO733 polypeptide of the present invention for this purpose.

PRO733 was used with polypeptides having identity in the assay to determine their relative activity. The results can be used as appropriate.

PRO162 polypeptides of the invention that retain biological activity associated with pancreatitis-related proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO162 polypeptide of the present invention for this purpose.

PRO162 was used with polypeptides having identity in the assay to determine their relative activity. The results can be used as appropriate.

PRO788 polypeptides of the invention that retain biological activity associated with anti-tumor urine proteins can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO788 polypeptide of the present invention for this purpose.

PRO788 was used with polypeptides having identity in the assay to determine their relative activity. The results can be used as appropriate.

PRO1008 polypeptides of the invention that possess a biological activity related to dkk-1 can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO1008 polypeptide of the present invention for this purpose.

PRO1008 was used with polypeptides having identity in the assay to determine their relative activity. The results can be used as appropriate.

PRO1012 polypeptides of the invention that possess biological activity associated with protein disulfide isomerase can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO1012 polypeptide of the present invention for this purpose.

PRO1012 was used with polypeptides having identity in the assay to determine their relative activity. The results can be used as appropriate.

PRO1014 polypeptides of the invention that retain biological activity related to reductase can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO1014 polypeptide of the present invention for this purpose.

PRO1014 was used with polypeptides having identity in the assay to determine their relative activity. The results can be used as appropriate.

PRO1017 polypeptides of the invention that possess a biological activity related to sulfotransferase can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO1017 polypeptide of the present invention for this purpose.

PRO1017 was used with polypeptides having identity in the assay to determine their relative activity. The results can be used as appropriate.

PRO474 polypeptides of the invention that retain biological activity related to dehydrogenase can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO474 polypeptide of the present invention for this purpose.

PRO474 was used with polypeptides having identity in the assay to determine their relative activity. The results can be used as appropriate.

PRO1031 polypeptides of the invention having biological activity associated with IL-17 can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO1031 polypeptide of the present invention for this purpose.

PRO1031 was used with polypeptides having identity in the assay to determine their relative activity. The results can be used as appropriate.

PRO938 polypeptides of the invention that possess biological activity associated with protein disulfide isomerase can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO938 polypeptide of the present invention for this purpose.

PRO1082 polypeptides of the invention that retain biological activity associated with LDL receptors can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO1082 polypeptide of the present invention for this purpose.

PRO1082 was used with polypeptides having identity in the assay to determine their relative activity. The results can be used as appropriate. In the assay, PRO1082 can be used to identify candidate substances that modulate receptors.

PRO1083 polypeptides of the invention that retain biological activity associated with 7TM receptors can be used both in vivo and in vitro for therapeutic purposes. Those skilled in the art will know how to use the PRO1083 polypeptide of the present invention for this purpose.

In particular, PRO1083 can be used in assays to determine candidate substances that modulate or modulate PRO1083, ie affect receptors.

The VEGF-E molecules herein have many therapeutic uses related to the survival, proliferation and / or differentiation of cells. Such use includes the treatment of umbilical vein endothelial cells, given that VEGF-E has demonstrated its ability to enhance the survival of human umbilical vein endothelial cells. If this vein is to be traumatized or to use artificial means to enhance the survival of the umbilical vein, treatment may be necessary, for example, in a weakened condition or diseased in an artificial matrix or artificial environment. It also includes other physiological symptoms that can be improved based on the selective promoting properties of VEGF-E. Uses also include the treatment of fibroblasts and myocytes, given that VEGF-E has demonstrated its ability to induce proliferation of fibroblasts and atrophy of myocytes. In particular, VEGF-E can be used for wound healing, tissue growth, and muscle generation and regeneration.

For the above-mentioned symptoms, the VEGF-E molecule is formulated in a manner consistent with good practice taking into account the particular disease to be treated, the symptoms of each patient, the site of delivery of VEGF-E, the method of administration, and other factors known to the physician. Will be administered. Thus, for the purposes herein, a “therapeutically effective amount” of VEGF-E is an amount effective to prevent, lessen, reduce or treat the symptoms to be treated, in particular the survival, proliferation and / or differentiation of the cells to be treated in vivo. It is an amount sufficient to increase.

VEGF-E amino acid variant sequences and derivatives thereof that are immunologically cross-reactive with antibodies produced against native VEGF are useful as standards in the immunoassay of VEGF-E or as a competitive substance when labeled.

VEGF-E having the desired purity is mixed with a physiologically acceptable carrier, excipient or stabilizer to prepare VEGF-E for storage or administration. These substances are nontoxic to the subject to be administered at the dosages and concentrations employed. If VEGF-E is water soluble, VEGF-E may be formulated in a buffer such as phosphate or other organic acid salts, preferably at pH about 7-8. If only a portion of VEGF-E is dissolved in water, VEGF-E may be added in amounts of 0.04-0.05% (w / v) to Tween, Pluronics, or PEG, for example It can be formulated into a microemulsion by combining with a nonionic surfactant such as Tween 80.

Antioxidants such as ascorbic acid, low molecular weight (less than about 10 residues) polypeptides such as polyarginine or tripeptide, proteins such as serum albumin, gelatin or immunoglobulins, hydrophilic polymers such as polyvinylpyrrolidone, glycine, Other components such as amino acids such as glutamic acid, aspartic acid or arginine, monosaccharides, disaccharides, and other carbohydrates including cellulose or derivatives thereof, glucose, mannose, or dextrin, chelating agents such as EDTA, and sugar alcohols such as mannitol or sorbitol May be optionally added.

VEGF-E used for therapeutic administration must be sterile. Sterilization can be readily accomplished by filtration through sterile filtration membranes (eg, 0.2 micron membranes). VEGF-E will usually be stored in lyophilized form or in aqueous solution if it is very stable against thermal and oxidative denaturation. The pH of the VEGF-E formulation will typically be about 6-8, but in some cases higher or lower pH values may be appropriate. Any of the above excipients, carriers or stabilizers may be used to form salts of VEGF-E.

When VEGF-E is used parenterally, a therapeutic composition containing VEGF-E is generally a container with a sterile access door, for example a vial with a stopper that can be pierced by an intravenous solution bag or a hypodermic needle. You can put it in

In general, where acceptable in a disease, VEGF-E should be formulated and administered for site-specific delivery. This is convenient in case of sores and ulcers.

Sustained release formulations may also be prepared and include the formation of microcapsule particles and implantable products. To prepare a sustained release VEGF-E composition, VEGF-E is preferably placed in a biodegradable matrix or microcapsule. Suitable materials for this purpose include polylactide (US Pat. No. 3,773,919), but poly- (a-hydroxycarboxylic acids such as poly-D-(-)-3-hydroxybutyric acid (EP 133,988A) Other polymers of) may also be used. Other biodegradable polymers include poly (lactone), poly (acetal), poly (orthoesters) or poly (orthocarbonates). The original idea was that the carrier itself or its degradation product would be nontoxic to the subject tissue and would not worsen the symptoms. This can be determined by routine screening in animal models of subject disease or in normal animals if this model is not available. Many scientific publications document these animal models in detail.

Examples of sustained release compositions are described in U.S. Pat. Patent No. 3,773,919, EP 58,481A, U.S. Patent No. 3,887,699, EP 158,277A, Canadian Patent No. 1176565, U. Sidman et al., Biopolymers 22, 547 [1983], and R. Langer et al., Chem. Tech. 12, 98 [1982].

When used topically, it is suitable to combine VEGF-E with other ingredients, such as carriers and / or adjuvants. There is no particular limitation on the nature of these other ingredients, but these ingredients must be pharmaceutically acceptable and efficacious in the desired administration, and cannot degrade the active ingredient of the composition. Examples of suitable vehicles include ointments, gels or suspensions with or without purified collagen. The compositions may also be placed in transdermal patches, plasters and bandages, preferably in liquid or semi-liquid formulations.

To obtain a gel formulation, VEGF-E formulated in a liquid composition can be mixed with an effective amount of a water soluble polysaccharide or a synthetic polymer such as polyethylene glycol to form a gel of suitable viscosity for topical use. Polysaccharides that can be used include, for example, alkyl cellulose, hydroxyalkyl cellulose and alkylhydroxyalkyl cellulose (e.g. methylcellulose, hydroxyethyl cellulose, carboxymethyl cellulose, hydroxypropyl methylcellulose and hydroxypropyl). Cellulose derivatives such as etherified cellulose derivatives, including cellulose); Starch and sorted starch; Baby; Alginic acid and alginate; Arabian gum; Pullulan; Agarose; Carrageenan; Dextran; dextrin; Furuktan; Inulin; Mannans; Xylan; Arabinane; Chitosan; Glycogen; Glucan; And synthetic biopolymers as well as xanthan gum; Guar gum; Cancacia fruit gum; Arabian gum; Tragacanth gum; Karaya gum; And derivatives and mixtures thereof. Preferred gelling agents herein include those that are inert to biological systems, non-toxic, simple to prepare, and not excessive in fluidity and viscosity and do not destabilize the VEGF-E contained in the gelling agent.

Preferably, the polysaccharides are etherified cellulose derivatives, more preferably fully defined, purified and listed in the USP, for example methylcellulose and hydroxyalkyl cellulose derivatives such as hydroxypropyl cellulose, Hydroxyethyl cellulose and hydroxypropyl methylcellulose. Most preferred herein is methylcellulose.

Polyethylene glycols useful for gelling are typically mixtures of low and high molecular weight polyethylene glycols in order to obtain an appropriate viscosity. For example, a mixture of polyethylene glycol having a molecular weight of 400 to 600 and polyethylene glycol having a molecular weight of 1500 is effective when mixing in an appropriate ratio to make a dough.

The term "water soluble" as used in polysaccharides and polyethylene glycols is meant to include colloidal solutions and dispersions. In general, the solubility of cellulose derivatives is determined by the degree of substitution of the ether groups, and stable derivatives useful herein must have a sufficient amount of ether groups per anhydroglucose unit in the cellulose chain to make the derivatives water soluble. An ether substitution degree of at least 0.35 ether groups per anhydroglucose unit is generally sufficient. In addition, the cellulose derivative may be in the form of an alkali metal salt, for example Li, Na, K, or Cs salt.

When methylcellulose is used in the gel, preferably when methylcellulose comprises about 2 to 5%, more preferably about 3% of the gel, VEGF is present in an amount of about 300 to 1000 mg per ml of gel. .

The dosage used will depend on these factors. In general, VEGF-E is formulated and delivered to a target site or tissue at a dose that can establish a VEGF-E level above about 0.1 ng / cc to a maximum dose that is effective and not overly toxic in tissue. do. If possible, the concentration in the tissue should be maintained by continuous infusion, slow release, topical use, or infusion empirically determined number of times.

The present invention provides VEGF-E therapy with other new or conventional therapies (eg, VEGF, aFGF, bFGF) to increase the activity of any growth factor, including VEGF-E, in promoting cell proliferation, survival, differentiation and repair. , Growth factors such as PDGF, IGF, NGF, anabolic steroids, EGF or TGF-a). It is not necessary for the co-therapeutic drug itself to be included in the composition of the present invention, but it will be convenient if the drug is proteinaceous. This mixture is suitably administered for the same purpose in the same manner as VEGF-E used alone. The molar ratio of VEGF-E to the second growth factor is typically from 1: 0.1 to 10, and is preferably about equimolar.

Compounds of the present invention may be formulated according to known methods to prepare pharmaceutically useful compositions wherein the PRO polypeptides herein are combined with a pharmaceutically acceptable carrier vehicle. Formulations thereof comprising a suitable carrier vehicle and other human proteins (eg, human serum albumin) are described, for example, in Remington's Pharmaceutical Sciences, 16th ed., 1980, the contents of which are incorporated herein by reference. , Mack Publishing Co., edited by Oslo et al. Here, VEGF-E can be administered to patients suffering from cardiovascular disease or symptoms parenterally, or in other forms by which VEGF-E is delivered to the bloodstream.

Compositions particularly suitable for the clinical administration of VEGF-E for use in the practice of the present invention include, for example, sterile aqueous solutions, or sterile, hydratable powders such as lyophilized proteins. In general, it is desirable to further include an appropriate amount of a pharmaceutically acceptable salt in the formulation, generally in an amount sufficient to render the formulation isotonic. In addition, to maintain a proper pH, generally 5.5 to 7.5, pH regulators such as arginine base and phosphoric acid are usually included in sufficient amounts. It may also be desirable to include additional substances, such as glycerol, in order to improve the lifetime or stability of the liquid formulation. In this way, several t-PA formulations are made suitable for parenteral administration, in particular intravenous administration.

Dosages and preferred drug concentrations of the pharmaceutical compositions of the invention will vary depending upon the particular use desired. For example, in the treatment of deep vein thrombosis or peripheral vascular disease, administration of "bolus" will typically be desirable, and may be continued to maintain approximately constant blood levels, preferably about 3 μg / ml. Should be administered.

However, in applications involving emergency medical care facilities that generally do not have an injector available, due to the important nature of latent diseases (eg embolism, infarction), usually slightly larger initial administration, such as intravenous pills, It would be desirable to provide a quantity.

For the various therapeutic symptoms mentioned for the compounds, the VEGF-E molecule is in a manner consistent with good practice taking into account the particular disease to be treated, the symptoms of each patient, the site of delivery, the method of administration, and other factors known to the physician. Will be formulated and administered. Thus, for the purposes herein, a "therapeutically effective amount" of a VEGF-E molecule is an amount effective to prevent, attenuate, reduce or treat the condition to be treated, in particular to enhance the survival, proliferation or differentiation of target cells in vivo That's enough. In general, doses are used which can establish VEGF-E levels of greater than about 0.1 ng / cm ³ to less than the maximum dose effective and not overly toxic in tissues targeted for the treatment symptoms to be treated. In the case of such compounds, intracellular administration is considered for certain therapeutic symptoms.

Human Toll proteins of the invention can also be used in assays to identify other proteins or molecules involved in Toll-mediated signal transduction. For example, PRO285 and PRO286 are known natural ligands of human Toll, or other factors that participate (directly or indirectly) in the activation and / or signaling of human Toll receptors, such as potential Toll receptor related kinases. Useful for checking. In addition, inhibitors of receptor / ligand binding interactions can be identified. Proteins involved in such binding interactions can be used to screen for peptide or small molecule inhibitors or agonists of binding interactions. Screening assays can be designed to find leading compounds that mimic the biological activity of a native Toll polypeptide or ligand against a native Toll polypeptide. This screening assay includes analysis according to high throughput screening of chemical libraries, which makes the assay particularly suitable for identifying small molecule drug candidates. Small molecules contemplated include synthetic organic or inorganic compounds. Assays can be performed in a variety of forms, including protein-protein binding assays, biochemical screening assays, immunoassays and cell line assays that are well known in the art.

In vitro assays utilize a mixture of components comprising a Toll receptor polypeptide, which may be part of another peptide or polypeptide, eg, a fusion product with a tag such as for detection or anchoring. The assay mixture may also include a natural intracellular or extracellular Toll binding target (ie, a Toll ligand, or another molecule known to activate and / or transmit signals through the Toll receptor) (for binding assays). . Natural binding targets can be used, however, as long as some of the natural binding targets provide binding affinity and requirements for the Toll protein of the subject that are conveniently measurable in the assay, the binding of the natural binding targets (eg, peptides) It is often desirable to use some. In addition, the assay mixture contains candidate drug substance. Candidates include many chemical classes and are usually organic compounds, preferably small organic compounds, and are obtained from a wide variety of sources, including libraries of synthetic or natural compounds. Various other substances may also be included in the mixture, such as salts, buffers, neutral proteins (eg albumin), detergents, protease inhibitors, nuclease inhibitors, biocide inhibitors and the like.

In in vitro binding assays, if the product mixture is incubated under the absence of a candidate molecule, the Toll protein specifically binds to the binding target, part or analog thereof, of the cell with comparative binding affinity. Mixture components may be added in any order to provide the necessary binding, and incubation may be performed at any temperature that promotes optimal binding. Likewise, the incubation period is chosen for optimal binding, minimizing this period to facilitate high speed, high throughput screening.

After incubation, the substance-biased binding between the Toll protein and one or more binding targets is detected by any convenient technique. For cell-free binding assays, the separation step is often used to separate components that are bound to components that are not bound. Separation may be followed by precipitation (e.g., TCA precipitation, immunoprecipitation, etc.), immobilization (e.g., immobilization on a solid substrate), for example, membrane filtration (e.g. Whatman's). P-18 ion exchange paper, Polyfiltronic's hydrophobic GFC membrane, and the like), gel chromatography (eg, gel filtration chromatography, affinity chromatography, etc.). For Toll-dependent transcription analysis, binding is detected by a change in the expression of Toll-dependent reporter.

Detection can be performed in any convenient way. For cell-free binding assays, one of the components generally includes or is linked to a label. The label can provide direct detection such as radioactivity, luminescence, optical or electron density or the like or indirect detection such as epitope tags, enzymes and the like. Depending on the nature of the label and other assay components, the label may be detected using a variety of methods, for example, via optical or electron density, radiation emission, non-radioactive energy transfer, or indirectly using antibody conjugates or the like. have.

Nucleic acids encoding Toll polypeptides can also be used in gene therapy. When used in gene therapy, genes are introduced into cells to synthesize therapeutic gene products in vivo, for example to replace defective genes. "Gene therapy" includes both traditional gene therapy where a single effect is achieved and administration of gene therapy, including single or repeated administration of DNA or mRNA effective for treatment. Antisense RNAs and DNAs can be used as therapeutic agents to block the expression of certain genes in vivo. Despite the low intracellular concentration of these oligonucleotides due to the limited uptake of short antisense oligonucleotides through the cell membrane, it has already been found that they can act as inhibitors when introduced into cells (Zamecnik et al., Proc. Natl. Acad). , Sci. USA 83, 4143-4146 (1986)). Such oligonucleotides can enhance the uptake of oligonucleotides by modification, for example by replacing their negatively charged phosphodiester groups with non-charged groups.

There are a variety of techniques that can be used to introduce nucleic acids into living cells. This technique depends on whether the nucleic acid is delivered to cells cultured in vitro or to cells of the desired host in vivo. Suitable techniques for delivering nucleic acids to mammalian cells in vitro include liposomes, electroporation, microinjection, cell fusion, DEAE-dextran and calcium phosphate precipitation and the like. Currently preferred for in vivo gene delivery techniques include transfection using viral (usually retroviral) vectors and viral coat protein-liposomal mediated transfection (Dzau et al., Trends in Biotechnology 11, 205-210 ( 1993). In some cases, it is desirable to provide the nucleic acid source with agents that target the target cell, such as membrane proteins on the cell surface or antibodies specific for the target cell, ligands for receptors on the target cell, and the like. If liposomes are used, proteins that bind to membrane proteins on the cell surface involved in endocytosis can be used to target and / or promote uptake. Capsid proteins or fragments thereof, antibodies to proteins that experience internalization in circulation, and proteins that target intracellular locations and enhance intracellular half-life. Receptor mediated endocytosis techniques are described, for example, in Wu et al., J. Biol. Chem. 262, 4429-4432 (1987), and Wagner et al., Proc. Natl. Acad. Sci. USA 87, 3410-3414 (1990). For a review of currently known gene marking and gene therapy protocols, see Anderson et al., Science 256, 808-813 (1992).

The various uses listed above in connection with Toll proteins may also be used for agonists of natural Toll receptors that mimic one or more biological functions of the natural Toll receptors.

Neurotrimin as well as other members of the IgLON subgroup of the immunoglobulin giants have been found to affect nerve patterning, differentiation, maturation and growth. As a result, the human neurotrimine homologue polypeptide, PRO337, is a disease characterized by neuronal dysfunction, e.g., motor neuron cell disorders such as amyotrophic lateral sclerosis (Lou Gehrig's disease), Bell's palsy), and a variety of symptoms including spinal muscular atrophy or paralysis. The NGF variant formulations of the invention can be used to treat human neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, epilepsy, multiple sclerosis, Huntington's chorea, Down's syndrome, neuron and Meniere's disease. PRO337 polypeptides can also be used as cognitive enhancers to enhance learning, particularly in dementia or trauma, eg, diseases associated with the disease.

In addition, PRO337 can be used to treat neuropathy, particularly peripheral neuropathy. "Peripheral neuropathy" means a disease affecting the peripheral nervous system, most often manifested as one or a combination of motor, sensory, sensorimotor or autonomic dysfunction. The wide variety of forms manifested by peripheral neuropathy may be from a variety of causes to the equivalent ones. For example, peripheral neuropathy may be genetically acquired, due to systemic diseases, or induced by toxic substances. Examples include, but are not limited to, diabetic peripheral neuropathy, centrifugal sensorimotor neuropathy, or autonomic neuropathy such as gastrointestinal dyskinesia or bladder relaxation. Examples of neuropathies associated with systemic diseases include post-polio syndrome or AIDS-related neuropathies, and examples of hereditary neuropathies include Charcot-Marie-Tooth disease, Refsum's disease, mubetalipoproteinemia (Abetalipoproteinemia), Tangier disease, Krabbe's disease, Metachromatic leukodystrophy, Fabry's disease, and Dejerine-Sottas syndrome. Examples of neuropathies caused by include those caused by treatment with chemotherapeutic agents such as vincristine, cisplatin, methotrexate, or 3'-azido-3'-deoxythymidine. Likewise, neurotrimine antagonists are thought to be useful in diseases characterized by excessive neuronal activity.

Endothelin is produced from large endothelin, an inactive intermediate, by a unique processing process catalyzed by the endothelin converting enzyme (ECE), a zinc metalloprotease. ECE has recently been cloned and its structure has been found to be one transmembrane protein with short intracellular N-terminus and catalytic domain and long extracellular C-terminus comprising many N-glycosylation sites. ECE cleaves the endothelin propeptide between Trp73 and Val74 to produce ET, an active peptide that appears to act locally rather than as a circulating hormone [Rubanyi, G.M. & Polokoff, M.A., Pharmachological Reviews 46: 325-415 (1994)]. Thus, ECE activity is a potential site for regulating endothelin production and may be a target for therapeutic intervention in the endothelin system. By masking ECE activity, the production of ET-1 can be stopped by inhibiting the conversion of large ET-1, a relatively inert precursor, into a physiologically active form.

ECE-2 is 64% identical to bovine ECE-2 at the amino acid level. ECE-2 is closely related to ECE-1 (63% identical, 80% conserved), neutral endopeptidase 24.11 and Kell blood type protein. Bovine ECE-2 is a type II membrane-bound metalloproteinase that is located in the trans-Golgi network, where it acts as an intracellular enzyme that converts large internal endothelin-1 into active endothelin [Emoto, N. and Yanangisawa, M., J. Biol. Chem. 270: 15262-15268 (1995). Bovine ECE-2 mRNA is highest expressed in the brain, cerebral cortex, cerebellum and adrenal medulla. He is expressed at lower levels in the myometrium, testes, ovaries and endothelial cells. Both ECE-2 and ECE-1 in cattle are more active against ET-1 than ET-2 or ET-3 as substrates [Emoto and Yanangisawa, supra].

Human ECE-2 is 736 amino acids long and has 31 amino-terminal tails of amino acid residues, 23 transmembrane helices of amino acid residues, and carboxy-terminal domains of 682 amino acid residues. Human ECE-2 is 94% identical to bovine ECE-2 and 64% identical to human ECE-1. The predicted transmembrane domain is highly conserved between the putative N-linked glycosylation sites between human and bovine ECE-2 proteins and between human ECE-1 and human ECE-2, with Cys residues neutral neutralopeptidase 24.11 and Kel It is conserved in blood type protein families and putative zinc binding motifs. This sequence, like other members of the NEP-ECE-Kell family, is the fact that human ECE-2 encodes a type II transmembrane zinc-binding metalloproteinase and is known for bovine ECE-2. This suggests that it is an intracellular enzyme located within the secretory pathway with the large ET-1 produced internally but still present in the secretory vesicle [Emoto and Yanangisawa, supra].

The expression pattern of ECE-2 is different from the expression pattern observed for ECE-1. Northern blot analysis of mRNA levels showed that 3.3 kb transcripts were highest in the adult brain (cerebellum, dural, bone marrow and temporal lobe, lower levels in the cerebral cortex, occipital and frontal lobes), spinal cord, lung and pancreas. Levels were expressed and 4.5 kb transcripts were found to be expressed at higher levels in the brain and kidney of the fetus. The size of these two transcripts is based on the use of other polyadenylation sites observed for bovine ECE-2 (Emoto and Yanangisawa, supra) and ECE-1 (Xu et al., Cell 78: 473-485 (1994)). Will indicate. PCR results for the cDNA library showed low expression levels in the fetal brain, fetal kidney, fetal small intestine, and adult testes. The fetal liver, fetal lung and adult pancreas were all negative.

Endothelin (ET) peptide families have potent vascular, heart and kidney functions that may be pathologically important in many human disease symptoms. ET-1 is expressed as a prepropeptide of inactive 212 amino acids. This prepropeptide is first cleaved at Arg52-Cys53 and Arg92-Ala93, and then the carboxy terminus Lys91 and Arg92 are removed from this protein to produce a large ET-1 that is a propeptide. ECE then cleaves between Trp73 and Val74 of this propeptide to produce ET, an active peptide that appears to act locally rather than as a circulating hormone [Rubanyi and Polokoff, Pharma. R. 46: 325-415 (1994).

Endothelin includes 1) cardiovascular diseases (angiospasm, hypertension, myocardial ischemia; reperfusion injury and acute myocardial infarction, stroke (cerebral ischemia), congestive heart failure, shock, atherosclerosis, vascular hypertrophy); 2) kidney disease (acute and chronic renal failure, glomerulonephritis, cirrhosis); 3) pulmonary disease (bronchial asthma, pulmonary hypertension); 4) gastrointestinal disorders (gastric ulcer, inflammatory bowel disease); Play a role in the pathophysiology of many disease symptoms, including 5) genital diseases (premature birth, menstrual irregularities, preeclampsia) and 6) carcinogenesis [Rubanyi & Polokoff, supra].

The effect of ET on disease is 1) increased ET production; 2) increase reactivity to ET and / or 3) effect of ET receptor antagonist, antibody or ECE inhibitor. Response to this criterion suggests that ET acts on subarachnoid hemorrhage, hypertension (acute / complications), acute renal failure and congestive heart failure following cerebral vasospasm. Inhibitors of ET production or activity have not been used in models of coronary angioplasty, acute myocardial infarction and atherosclerosis, but they increase ET levels and increase responsiveness to ET. In addition, shock and pulmonary hypertension have been shown to increase ET levels (Rubanyi and Polokoff, supra). In these symptoms, inhibition of ECE may be therapeutically important.

The expression pattern of ECE-2 is different from the expression pattern observed for ECE-1. Northern blot analysis showed that expression levels of ECE-2 were observed at low levels in the brain, lung and pancreas of adults, and higher levels in the brain and kidneys of the fetus (FIG. 8). PCR analysis revealed low expression levels in other tissues, namely the fetal lung, fetal small intestine, and adult testes. Negative in the liver of the fetus. Similar patterns have been reported for cattle ECE-2 (Emoto and Yanangisawa, supra). Bovine ECE-2 is expressed in brain tissue (cerebral cortex, cerebellum and adrenal medulla), myometrium and testes, at low levels in the ovary and at very low levels in many other tissues. Bovine ECE-1 (Xu et al, supra) is more widely expressed. Bovine ECE-1 is found in vascular endothelial cells and some parenchymal cells of most organs. Except in the brain, bovine ECE-2 mRNA was present at lower levels than ECE-1. We believe that ECE-2 is a particularly good target for therapeutic intervention in diseases such as subarachnoid hemorrhage and stroke following cerebral vasospasm.

In addition, the use of the molecules disclosed herein may be based on the positive function assays described above and below.

F. Anti-PRO Antibodies

The invention further provides anti-PRO antibodies. Examples of antibodies include polyclonal, monoclonal, humanized, bispecific and heteroconjugate antibodies.

1. Polyclonal Antibodies

Anti-PRO antibodies constitute polyclonal antibodies. Methods of making polyclonal antibodies are known to those skilled in the art. Polyclonal antibodies can be produced in a mammal, for example, by injecting the immunizing agent and, if necessary, an adjuvant one or more times. In general, the immunizing agent and / or adjuvant will be injected into the mammal by several injections subcutaneously or intraperitoneally. Immunizing agents can include PRO polypeptides or fusion proteins thereof. It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized. Examples of such immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin, serum albumin, bovine tyroglobulin and soybean trypsin inhibitor. Examples of adjuvants that can be used include Freud's complete adjuvant and MPL-TDM adjuvant (monophosphoryl lipid A, synthetic trehalose dicholinomycolate). Immunotreatment methods can be selected by one skilled in the art without undue experimentation.

2. Monoclonal Antibodies

The anti-PRO antibody may be a monoclonal antibody. Monoclonal antibodies can be prepared using hybridoma methods as described in Kohler and Milstein, Nature , 256 : 495 (1975). In hybridoma methods, mice, hamsters or other suitable host animals are typically immunized with an immunizing agent to induce lymphocytes capable of producing or producing antibodies that specifically bind to the immunizing agent. Alternatively, lymphocytes can be immunized in vitro.

Immunizing agents generally include PRO polypeptides or fusion proteins thereof. Generally, peripheral blood lymphocytes (“PBLs”) are used when cells of human origin are desired, but spleen cells or lymph node cells are used when a mammalian source other than human is desired. Then, a suitable fusion agent such as polyethylene glycol is used to fuse the lymphocytes with the immortalized cell line to form hybridoma cells. Monoclonal Antibodies: Principle and Practice , Academic Press, (1986) pp. 59-103]. Immortalized cell lines are largely transformed mammalian cells, especially myeloma cells of rodent, bovine and human origin. In general, rat or mouse myeloma cell lines are used. Hybridoma cells are preferably cultured in a suitable culture medium containing one or more substances that inhibit the proliferation or survival of unfused immortalized cells. For example, if the parent cell lacks hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT) enzymes, the culture medium for hybridomas ("HAT medium") typically includes hypoxanthine, aminopterin and thymidine. These substances will inhibit the growth of HGPRT-deficient cells.

Preferred immortalized cell lines are those that fuse efficiently, maintain stable levels of antibody production by selected antibody-producing cells, and are susceptible to media such as HAT medium. More preferred immortalized cell lines are, for example, murine myeloma cell lines available from the Salk Institute Cell Distribution Center (San Diego, CA) and the American Type Culture Collection (Manassas, VA). . In addition, human myeloma cell lines and mouse-human heteromyeloma cell lines have been described for the production of human monoclonal antibodies [Kozbor, J. Immunol., 133 : 3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications , Marcel Dekker, Inc., New York, (1987) pp. 51-63.

Culture medium in which hybridoma cells are cultured can be assayed for the presence of monoclonal antibodies directed against PRO. Preferably, the binding specificity of monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitation or in in vitro binding assays such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA). Was measured. Such techniques and assays are known in the art. The binding affinity of monoclonal antibodies can be found in, for example, Scatchard analysis (Munson and Pollard, Anal. Biochem. , 107 : 220 (1980).

After identifying the desired hybridoma cells, clones were subcloned by restriction dilution procedures and cultured by standard methods (Goding, supra ). Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, hybridoma cells can be cultured in vivo as ascites tumors in a mammal.

Monoclonal antibodies secreted by the subclones are for example by conventional immunoglobulin purification methods such as protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis or affinity chromatography. It can be isolated and purified from culture medium or ascites fluid.

Monoclonal antibodies can also be prepared by recombinant DNA methods such as those described in US Pat. No. 4,816,567. The DNA encoding the monoclonal antibodies of the invention can be readily obtained using conventional methods (e.g., by using oligonucleotide probes capable of specifically binding to genes encoding the heavy and light chains of murine antibodies). It can be isolated and sequenced. The hybridoma cells of the present invention serve as a preferred source of such DNA. Once isolated, the DNA is placed in an expression vector and then transfected with an expression vector to host cells such as monkey COS cells, Chinese hamster ovary (CHO) cells or myeloma cells that otherwise do not produce immunoglobulin proteins. Monoclonal antibodies can be synthesized in recombinant host cells. In addition, DNA, for example, homologous replacing the murine sequence in the coding sequence for human heavy and light chain constant domain, or (U.S. Patent No. 4,816,567; Morrison (Morrison), etc., supra), or a non-immunoglobulin polypeptide All or part of the coding sequence for may be modified by covalently binding to an immunoglobulin coding sequence. Such non-immunoglobulin polypeptides can be substituted for the constant domains of the antibodies of the invention, or the variable domains of one antibody-binding site of the antibodies of the invention can be used to generate chimeric bivalent antibodies.

The antibody may be a monovalent antibody. Methods of making monovalent antibodies are known in the art. For example, one method involves recombinant expression of immunoglobulin light and modified heavy chains. To prevent crosslinking of the heavy chain, the heavy chain is generally truncated at some point in the F _c region. Alternatively, related cysteine residues are substituted or deleted with other amino acid residues to prevent crosslinking.

In vitro methods are also suitable for the preparation of monovalent antibodies. Degradation of the antibody to prepare antibody fragments, particularly Fab fragments, can be carried out using techniques commonly known in the art.

3. Human and Humanized Antibodies

In addition, the anti-PRO antibodies of the invention may comprise humanized antibodies or human antibodies. Humanized forms of non-human (eg murine) antibodies include immunoglobulin chains or fragments thereof comprising chimeric immunoglobulins, minimal sequences derived from non-human immunoglobulins or fragments thereof (eg, Fv, Fab, Fab ', F (ab') ₂ or other antigen binding small sequence of the antibody). A humanized antibody is a human immunono that has substituted residues from the complementarity determining regions (CDRs) of the receptor with residues from CDRs of species other than the human (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and ability. Globulin (receptive antibody). In some cases, the Fv framework residues of human immunoglobulins are replaced by corresponding non-human residues. In addition, the humanized antibody may include residues which are not present in the antibody to be received or in the sequence of the CDR or framework to be introduced. In general, humanized antibodies will comprise substantially all of one or more, generally two or more variable domains, wherein all or substantially all CDR regions correspond to regions of non-human immunoglobulins, and all or substantially all FRs. The region corresponds to the region of the human immunoglobulin consensus sequence. In addition, humanized antibodies will optimally comprise at least a portion of an immunoglobulin constant region (F _c ), generally a portion of human immunoglobulin (Jones et al. , Nature , 321 : 522-525). (1986); Riechmann et al. , Nature , 332 : 323-329 (1988); And Presta, Curr. Op. Struct. Biol. 2 : 593-596 (1992)].

Methods of humanizing nonhuman antibodies are well known in the art. In general, humanized antibodies have one or more amino acid residues introduced thereto from a non-human source. These non-human amino acid residues are often referred to as "import" residues and are typically obtained from an "import" variable domain. Humanization consists essentially of methods such as Winter et al. ( Nature , 321 : 522-525 (1986)) by replacing the corresponding sequences of human antibodies with rodent CDRs or CDR sequences. Riechmann et al. , Nature , 332 : 323-327 (1988); It may be carried out according to Verhoeyen et al., Science , 239 : 1534-1536 (1988). Thus, such “humanized” antibodies are chimeric antibodies (US Pat. No. 4,816,567) in which substantially fewer intact human variable domains have been replaced by corresponding sequences from non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues of similar sites in rodent antibodies.

Human antibodies can also be prepared using various techniques known in the art, including phage display libraries (Hoogenboom and Winter, J., Mol. Biol. 227 : 381 (1991); Marks et al ., J. Mol. Bio. , 222 : 581 (1991)]. In addition, techniques such as Kohl et al. And Boerner can also be used for the production of human monoclonal antibodies [Cole et al. Monoclonal Antibodies and Cancer Therapy , Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol. , 147 (1) : 86-95 (1991)]. Likewise, human antibodies can be prepared by introducing human immunoglobulin loci into a transgenic animal, eg, a mouse, wherein the internal immunoglobulin genes are partially or fully inactivated. After challenge, the production of human antibodies was observed, which was very similar to the antibodies observed in humans in all respects, including gene rearrangement, assembly and antibody listing. This is described, for example, in US Pat. Nos. 5,545,807, 5,545,806, 5,569,825, 5,625,126, 5,633,425, 5,661,016, and in scientific publications [Marks et al. Bio / Technology 10 , 779-783 (1992); Lonberg et al. , Nature 368 , 856-859 (1994), Morrison, Nature 368 , 812-13 (1994); Fishwild et al. , Nature Biotechnology 14 , 845-51 (1996); Neuberger, Nature Biotechnology 14 , 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93 (1995).

4. Bispecific Antibodies

Bispecific antibodies are monoclonal, preferably human or humanized antibodies with binding specificities for at least two different antigens. In this case, one of the binding specificities is for PRO and the other is for any other antigen, preferably for cell surface proteins or receptors or receptor subunits.

Methods of making bispecific antibodies are known in the art. Typically, recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy chain-light chain / light chain-heavy chain pairs, where the two heavy chains have different specificities [Millstein and Quello Cuello, Nature , 305 : 537-539 (1983). Due to the random classification of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce possible mixtures of 10 different antibody molecules, only one of which has an accurate bispecific structure. Purification of the correct molecule is generally carried out by affinity chromatography steps. Similar methods are described in WO 93/08829 (published May 13, 1993) and Traunecker et al., EMBO J. , 10: 3655-3659 (1991).

The variable domain (antibody-antigen binding site) of an antibody with the desired binding specificity can be fused to an immunoglobulin constant domain sequence. This fusion is preferably fused with an immunoglobulin heavy chain constant domain comprising at least a portion of the hinge, CH2 and CH3 regions. It is preferred that a first heavy chain constant region (CH1) comprising a site necessary for light chain binding is present in at least one of the fusions. Immunoglobulin heavy chain fusions, and, if desired, DNAs encoding immunoglobulin light chains are inserted into separate expression vectors and co-transfected into suitable host organisms. For further details for producing bispecific antibodies, see, for example, Suresh et al. , Methods in Enzymmology , 121 : 210 (1986).

According to another method disclosed in WO 96/27011, the interface between a pair of antibody molecules can be engineered to maximize the proportion of heterodimer recovered from recombinant cell culture. Preferred interfaces comprise at least a portion of the CH3 region of an antibody constant domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule were replaced with larger side chains (eg tyrosine or tryptophan). Replacement of large amino acid side chains with small amino acid side chains (eg, alanine or threonine) created a supplemental "cavity" of the same or similar size as the large side chain at the interface of the second antibody molecule. This provides a mechanism for increasing the yield of heterodimers above the yield of other unwanted end-products such as homodimers.

Bispecific antibodies can be prepared as full length antibodies or antibody fragments (eg, F (ab ') ₂ bispecific antibodies). Techniques for generating bispecific antibodies from antibody fragments are described in the literature. For example, bispecific antibodies can be prepared using chemical linkage. Brennan et al., Science 229: 81 (1985), describe a method of cleaving intact antibodies by proteolysis to generate F (ab ') ₂ fragments. These fragments are reduced in the presence of the dithiol composite material sodium arsenite to stabilize nearby dithiols and prevent the formation of disulfides in the bonsai. The Fab 'fragments generated were then converted to thionitrobenzoate (TNB) derivatives. Thereafter, one of the Fab'-TNB derivatives was reconverted to Fab'-thiol by reduction with mercaptoethylamine and mixed with equimolar amounts of other Fab'-TNB derivatives to form bispecific antibodies. The resulting bispecific antibodies can be used as substances for the selective immobilization of enzymes.

this. Bispecific antibodies were formed by directly recovering Fab 'fragments from E. coli and chemically linking them. Shalaby et al ., J. Exp. Med. 175: 217-225 (1992) discloses fully humanized bispecific antibody F (ab ') ₂ molecules. Each Fab 'fragment was secreted separately from this coli and linked by the in vitro chemical method indicated to form a bispecific antibody. The bispecific antibody thus formed was able to bind cells overexpressing the ErbB2 receptor and normal human T cells, as well as initiate the lytic activity of human cytotoxic lymphocytes against human breast cancer targets.

In addition, several techniques for making and isolating bispecific antibody fragments directly from recombinant cell culture are disclosed. For example, bispecific antibodies were prepared using leucine zippers [Kostelny et al ., J. Immunol . 148 (5): 1547-1553 (1992)]. By gene fusion, leucine zipper peptides from Fos and Jun proteins were linked to the Fab 'portion of two different antibodies. The hinge region of the antibody homodimer was reduced to form a monomer and then reoxidized to form an antibody heterodimer. This method can also be used as a method for producing antibody homodimers. Hollinger et al ., Proc. Natl. Acad. Sci. USA 90: 6444-6448 (1993) provides a different mechanism for making bispecific antibody fragments. This fragment comprises a heavy chain variable domain (V _H ) linked by a linker to the light chain variable domain (V _L ), which is too short to pair the two domains with the same chain. Thus, the V _H and V _L domains of one fragment are paired with the complementary V _L and V _H domains of the other fragment and form two antigen-binding sites. Another strategy for making bispecific antibody fragments using single-chain Fv (sFv) dimers has been reported (see Gruber et al., J. Immunol. 152: 5368 (1994)). Antibodies having the above valences are also contemplated, for example, trispecific antibodies can be made (Tutt et al., J. Immunol. 147: 60 (1991)).

Typical bispecific antibodies may bind to two different epitopes of the PRO polypeptides provided herein. Alternatively, in order to focus on intracellular defense mechanisms against cells expressing a particular PRO polypeptide, the arms of the anti-PRO polypeptide may be replaced with an initiating molecule on leukocytes, such as a T-cell receptor molecule (eg, CD2, CD3). , CD28 or B7), or an arm that binds to an F _c receptor (F _c γ R) of IgG, such as F _c γ RI (CD64), F _c γ RII (CD32) and F _c γ RIII (CD16). In addition, bispecific antibodies can be used to locate cytotoxic agents in cells that express particular PRO polypeptides. Such antibodies have a PRO-binding arm and an arm that binds to a cytotoxic substance or radionuclide chelating agent such as EOTUBE, DPTA, DOTA or TETA. Another bispecific antibody of interest binds to the PRO polypeptide and further binds to tissue factor (TF).

5. Heteroconjugate Antibodies

Heteroconjugate antibodies are also included within the scope of the present invention. Heteroconjugate antibodies consist of two covalently bound antibodies. Such antibodies can be used, for example, to target immune system cells to unwanted cells (US Pat. No. 4,676,980), and for the treatment of HIV infection (WO 91/00360, US 92/200373, and EP 03089). Ho) suggested. It is contemplated that heterozygous antibodies can be prepared in vitro using methods known in synthetic protein chemistry, including methods involving crosslinking agents. For example, immunotoxins can be prepared by forming disulfide exchange reactions or thioether bonds. Suitable reagents for this purpose include iminothiolates and methyl-4-mercaptobutyrimidate and the reagents disclosed in US Pat. No. 4,676,980.

6. Effector function operation

It may be desirable to modify the antibodies of the invention to effector function to enhance the effect of the antibody, for example in the treatment of cancer. For example, cysteine residues may be introduced into the F _c region to form disulfide bonds between the chains within this region. Homodimeric antibodies thus produced enhance the internalization capacity and / or increase complement-mediated cell death and antibody-dependent intracellular cytotoxicity (ADCC) [Caron et al., J. Exp Med. . , 176: 1191-1195 (1992) and Shopes, J. Immunol. , 148: 2918-2922 (1992). In addition, the heterodifunctional cross-links described in Wolf et al., Cancer Research , 53 : 2560-2565 (1993) can be used to prepare homodimeric antibodies with enhanced anti-tumor activity. Alternatively, antibodies with double F _c regions can be engineered to enhance complement lytic and ADCC capabilities (see Stevenson et al., Anti-Cancer Drug Design , 3: 219-230 (1989)). do].

7. Immune Complex

The invention also relates to cytotoxic substances such as chemotherapeutic agents, toxins (eg, enzymatically active bacteria, fungi, plant or animal toxins, or fragments thereof) or radioactive isotopes (ie radiocomplexes). It relates to an immunocomplex comprising an antibody coupled with.

Chemotherapeutic agents useful in the production of such immunocomplexes are described above. Enzymatically active usable toxins and fragments thereof include diphtheria A chain, unbound active fragment of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), lysine A chain, abrin A chain, modeine A chain, alpha-sarsine, Aleurites fordii protein, diantine protein, Phytolaca americana protein (PAPI, PAPII and PAP-S), inhibitor of bitter melon (momordica charantia), cumu Leucine, crotin, sapaonaria officinalis inhibitors, gelonin, mitogelin, resrictocin, phenomycin, enomycin, and tricotessenes. Several radionuclides can be used for the preparation of radiocomplex antibodies. Examples include ²¹² Bi, ¹³¹ I, ¹³¹ In, ⁹⁰ Y and ¹⁸⁶ Re.

Difunctional derivatives of various difunctional protein-linking materials, such as N-succinimidyl-3- (2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), imidoesters (e.g. Dimethyl adipimidate HCL), active esters (e.g. disuccinimidyl suverate), aldehydes (e.g. glutaraldehyde), bis-azido compounds (e.g. bis (p- Azidobenzoyl) hexanediamine), bis-diazonium derivatives (eg bis- (p-diazoniumbenzoyl) -ethylenediamine), diisocyanates (eg tolyene 2,6-diisocyanate), and Bis-active fluorine compounds (eg, 1,5-difluoro-2,4-dinitrobenzene) can be used to make combinations of antibodies and cytotoxic substances. For example, lysine immunotoxins can be prepared as described in Vitta et al., Science , 238 : 1098 (1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid (MX-DTPA) is a typical chelating agent linking radionucleotides to antibodies (see WO 94/11026). do).

In another embodiment, the antibody may be linked to a "receptor" (eg, streptavidin) used for tumor pretargeting, wherein the antibody-receptor conjugate is administered to the subject and then circulated using a chelating agent. Unbound conjugates are removed from and an "ligand" (eg avidin) that binds to a cytotoxic substance (eg radionucleotide) is administered.

8. Immunoliposomes

The antibodies disclosed herein may also be formulated with immunoliposomes. Liposomes containing this antibody can be prepared by methods known in the art, such as in Epstein et al., Proc. Natl. Acad. Sci. USA, 82: 3688 (1985); Hwang et al., Proc. Natl Acad. Sci. USA, 77: 4030 (1980); And US Pat. Nos. 4,485,045 and 4,544,545. Liposomes with increased circulation time are disclosed in US Pat. No. 5,013,556.

Particularly useful liposomes can be produced by reverse phase evaporation using lipid compositions containing phosphatidylcholine, cholesterol and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes were pushed through filters of defined pore size to yield liposomes with the desired diameter. Martin et al ., J. Biol. Chem. , 257 : 286-288 (1982), can be linked to liposomes via Fab 'fragments of the antibodies of the invention via disulfide-interchange reactions. Chemotherapeutic agents (eg, Doxorubicin) are optionally included in liposomes (Gabizon et al ., J. National Cancer Inst. , 81 (19): 1484 (1989).

9. Antibody Pharmaceutical Compositions

To treat a variety of diseases, antibodies that specifically bind to the PRO polypeptides identified herein and other molecules identified by the screening assays described above can be administered in the form of pharmaceutical compositions.

If the PRO polypeptide is intracellular and all of the antibody is used as an inhibitor, it is preferred to internalize the antibody. However, lipofection or liposomes can also be used to deliver the antibody or antibody fragment intracellularly. If antibody fragments are used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, based on the sequence of the variable-region of an antibody, peptide molecules can be designed that have the ability to bind to the sequence of the target protein. Such peptides can be synthesized chemically and / or prepared by recombinant DNA techniques (eg, Marasco et al ., Proc. Natl. Acad. Sci. USA , 90: 7889-7893 (1993). In addition, the formulations herein may include one or more active compounds, preferably compounds with complementary activities that do not adversely affect each other, as needed for the particular condition to be treated. Alternatively, or in addition, the composition may include substances that enhance their function, such as cytotoxic substances, cytokines, chemotherapeutic agents, or growth-inhibiting agents. Such molecules are suitably formulated in amounts that are effective for the purpose intended.

The active ingredient is for example a coacervation technique or interfacial polymerization, for example in a colloidal drug delivery system (e.g. liposomes, albumin microspheres, microemulsions, nanoparticles and nanocapsules) or macroemulsions respectively, For example, it can be contained in microcapsules prepared by hydroxymethylcellulose or gelatin-microcapsules and poly- (methylmethacrylate) microcapsules, respectively. This technique is disclosed in Remington's Pharmaceutical Sciences , supra.

The formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.

Sustained release formulations may also be prepared. Suitable examples of sustained-release preparations include shaped articles of solid hydrophobic polymers containing the antibody, for example semipermeable matrices in the form of films or microcapsules. Examples of sustained release matrices include polyesters, hydrogels (eg, poly (2-hydroxyethyl-methacrylate) or poly (vinyl alcohol)), polylactide (US Pat. No. 3,773,919), L- Copolymers of glutamic acid with γ ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers, such as LUPRON DEPOT® (lactic acid-glycolic acid copolymer and leuprolide acetate Injectable microspheres), and poly-D-(-)-3-hydroxybutyric acid. Polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid release molecules for more than 100 days, while some hydrogels release proteins for shorter periods of time. If an encapsulated antibody remains in the body for a long time, it may be denatured or aggregated due to exposure to moisture at 37 ° C., resulting in a decrease in biological activity, thereby changing immunogenicity. For stabilization, rational strategies can be designed according to the mechanism involved. For example, if the aggregation mechanism is found to form intramolecular SS bonds through thio-disulfide interchange, modification of sulfhydryl residues, lyophilization from acidic solutions, control of moisture content, use of appropriate additives, and Stabilization can be achieved by the development of specific polymer matrix compositions.

G. Uses of Anti-PRO Antibodies

Anti-PRO antibodies of the invention have a variety of utility. For example, anti-PRO antibodies can be used for diagnostic assays for PRO, eg, for detecting expression of PRO in specific cells, tissues or serum. Various diagnostic assay techniques known in the art, such as competitive binding assays, direct or indirect sandwich assays and immunoprecipitation assays performed on heterologous or homologous phases [Zola's Monoclonal Antibodies: A Manual of Techniques , CRC Press , Inc. (1987) pp. 147-158]. Antibodies used in diagnostic assays can be labeled with detectable residues. Detectable residues must be able to generate a detectable signal either directly or indirectly. For example, the detectable moiety can be a radioactive isotope such as ³ H, ¹⁴ C, ³² P, ³⁵ S or ¹²⁵ I, fluorescent or chemiluminescent compound such as fluorescein isothiocyanate, rhodamine or Luciferin, or an enzyme such as alkaline phosphatase, beta-galactosidase or horseradish peroxidase. Hunter et al. , Nature , 144 : 945 (1962); David et al., Biochemistry , 13 : 1014 (1974); Pine et al., J. Immunol. Meth. , 40 : 219 (1981); And Nygren, J. Histochem. and Cytochem. , 30 : 407 (1982), including any method known in the art for binding antibodies and detectable moieties.

In addition, anti-PRO antibodies are useful for affinity purification of PRO from recombinant cell culture or natural sources. In this process, the antibody to PRO is immobilized to a suitable support such as Sephadex resin or filter paper using methods known in the art. Thereafter, the immobilized antibody is contacted with the purified PRO-containing sample, followed by washing with a suitable solvent that substantially removes all material in the sample except the PRO bound to the immobilized antibody. Finally, the support is washed with other suitable solvent to release the PRO polypeptide from the antibody.

The following examples are provided for illustrative purposes only and are not intended to limit the scope of the invention in any way.

All patents and documents cited in this specification are herein incorporated by reference in their entirety.

Commercial reagents mentioned in the examples were used according to the manufacturer's instructions unless otherwise indicated. The source of cells identified by the ATCC accession number throughout the following examples and specification is the American Type Culture Collection (Rockville, Maryland).

Example 1 Extracellular Domain Homology Screening to Identify Novel Polypeptides and cDNAs Encoding It

The EST database was examined using extracellular domain (ECD) sequences (including secretion signal sequences, if present) from about 950 known secretory proteins from the Swiss-Prot public database. . The EST database includes public databases (e.g. Dayhoff, Jenbank) and private databases (e.g. LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, Calif.). Included. Investigations were performed using the computer programs BLAST or BLAST-2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)) as a comparison of the ECD protein sequences to the six frame translations of the EST sequences. Comparatives with BLAST scores of 70 (or in some cases 90) or greater that do not encode known proteins are clustered and consensus DNA sequences using the program "phrap" (Phil Green, University of Washington, Seattle, WA) Assembled.

Using this extracellular domain homology screening, consensus DNA sequences were assembled for other EST sequences identified using phrap. In addition, consensus DNA sequences obtained are often (but not always) stretched using a repeat cycle of BLAST or BLAST-2 and phrap to stretch the consensus sequence as much as possible using the sources of EST sequences discussed above. .

The oligonucleotides are then synthesized based on the consensus sequence obtained as described above, used to identify cDNA libraries containing sequences of interest by PCR and for isolating clones of full-length coding sequences for PRO polypeptides. Used as a probe. Forward (.f) and reverse (.r) PCR primers generally range from 20 to 30 nucleotides and are often designed to provide PCR products of about 100 to 1000 bp in length. The length of the probe sequence is typically 40 to 55 bp. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1 to 1.5 kbp. To screen several libraries for full-length clones, DNA from these libraries was screened by PCR amplification using PCR primer pairs according to Ausubel et al., Current Protocols in Molecular Biology . Then, clones encoding genes of interest were isolated using one of the probe oligonucleotide and primer pairs by using a positive library.

The cDNA library used to isolate the cDNA clones was constructed by standard methods using commercially available reagents such as reagents from Invitrogen (San Diego, CA, USA). The cDNA is primed with oligo dT with a NotI site, ligated to the hemikinase treated SalI adapter, cleaved with NotI, appropriately sized by gel electrophoresis, and appropriate cloning vector (e.g., pRKB or pRKD; pRK5B is a precursor of pRK5D without the SfiI site; see Holmes et al., Science , 253 : 1278-1280 (1991) and cloned in a defined direction to the only XhoI and NotI sites.

Example 2: Isolation of cDNA Clones by Amylase Screening

1. Preparation of oligo dT primed cDNA libraries

MRNA was isolated from human tissue of interest using reagents and protocol (Fast Track 2) from Invitrogen (San Diego, Calif.). The RNA was used to generate oligo dT primed cDNA libraries on vector pRK5D using reagents and protocols from Life Technologies, Gettersburg, Maryland, (Super Script Plasmid System). In this process, the double stranded cDNA was made larger than 1000 bp and the SalI / NotI linker attached cDNA was cloned into the XhoI / NotI cleavage vector. pRK5D is a cloning vector comprising a sp6 transcription initiation site, a SfiI restriction enzyme site, and a XhoI / NotI cDNA cloning site in that order.

2. Preparation of Random Primed cDNA Libraries

Secondary cDNA libraries were generated to preferentially provide the 5 'end of the primary cDNA clone. Sp6 RNA was generated from the primary library (as described above) and random priming to vector pSST-AMY.0 using the RNA using reagents and protocols from Life Technologies (Super Script Plasmid System, as described above) CDNA libraries were generated. In this process, double-stranded cDNAs were made 500-1000 bp in size, ligated to the NotI adapter to the blunt ends, cleaved with SfiI and cloned into the SfiI / NotI cleavage vector. pSST-AMY.0 is a cloning vector having a yeast alcohol dehydrogenase promoter before the cDNA cloning site and mouse amylase sequence (mature sequence without secretion signal) and a yeast alcohol dehydrogenase terminator after the cloning site. Thus, cDNA cloned into the vector, fused with amylase sequence in frame, will secrete amylase from the appropriately transfected yeast colonies.

3. Transformation and detection

The DNA from the library described in paragraph 2 above was ice-cooled and 20 ml of electrocompetent DH10B bacteria (Life Technologies) was added. Bacteria and vector mixtures were electroporated as directed by the manufacturer. Then 1 ml of SOC medium (Life Technologies) was added and the mixture was incubated at 37 ° C. for 30 minutes. The transformants were then plated into 20 standard 150 mm LB plates containing ampicillin and incubated for 16 hours (37 ° C.). Positive colonies were removed from the plates and DNA was isolated from bacterial pellets using standard protocols such as CsCl-gradient method. Purified DNA was used to perform the following yeast protocol.

Yeast methods were classified into three categories: 1) transforming yeast using a plasmid / cDNA combination vector, 2) detecting and isolating yeast clones secreting amylase, and 3) inserting from yeast colonies PCR amplification of the sieve directly and purification of DNA for sequencing and further analysis.

The yeast strain used was HD56-5A (ATCC-90785). This strain has genotypes of MAT alpha, ura3-52, leu2-3, leu2-112, his3-11, his3-15, MAL ⁺ , SUC ⁺ , GAL ⁺ . Preferably, yeast variants lacking post-translational pathways can be used. Such variants may have deficiency alleles due to translocation at sec71, sec72, sec62 , preferably at truncated sec71 . Or an antagonist (antisense nucleotide and (Or) ligands) in combination with amylase expressing yeast may be desirable.

Transformation was performed based on the protocol outlined in Gitz et al., Nucl.Acid.Res ., 20 : 1425 (1992). The transformed cells were then inoculated from agar into 100 ml of YEPD complex media broth and grown overnight at 30 ° C. YEPD broth was prepared as described in Kaiser et al., Methods in Yeast Genetics , Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 207 (1994). Dilute overnight cultures to about 2 x 10 ⁶ cells / ml (about OD ₆₀₀ = 0.1) with 500 ml of fresh YEPD broth and regrow to about 1 x 10 ⁷ cells / ml (about OD ₆₀₀ = 0.4-0.5) I was.

The cells were recovered, then transferred to the GS3 rotor bottle of the Sorval GS3 rotor, centrifuged at 5,000 rpm for 5 minutes, discarded the supernatant and resuspended in sterile water and re-suspended in 50 ml Falcon tubes at 3,500 rpm in a BeckmanGS-6KR centrifuge. Transformation was prepared by centrifugation. The supernatant was discarded and cells were washed with LiAc / TE (10 ml, 10 mM Tris-HCl, 1 mM EDTA pH 7.5, 100 mM Li ₂ OOCCH ₃ ) and resuspended in LiAc / TE (2.5 ml).

In a microcentrifuge tube, 100 μl of the prepared cells were mixed with fresh denatured single stranded salmon testis DNA (Lofstrand Lab, Gaithersburg, Md.) And 1 μg of transformed DNA (vol <10 μl) to perform transformation. After the mixture was briefly mixed by vortexing, 600 μl of 40% PEG / TE (40% polyethylene glycol-4000, 10 mM Tris-HCl, 1 mM EDTA, 100 mM Li ₂ OOCCH ₃ , pH 7.5) was added. The mixture was gently mixed and incubated at 30 ° C. with stirring for 30 minutes. The cells are then heat shocked at 42 ° C. for 15 minutes, the reaction vessel is centrifuged at 12,000 rpm for 5-10 seconds in a microcentrifuge to drain the supernatant, and 500 μl of TE (10 mM Tris-HCl, 1 mM EDTA, pH 7.5) and recentrifuged. Cells were diluted with 1 ml of TE and 200 μl aliquots were plated onto preselected medium in 150 mm growth plates (VWR).

Alternatively, the transformation was performed in one large scale reaction with increasing reagent volume, instead of a small number of multiple reactions.

The selection medium used was a uracil-free synthetic complete dextrose prepared as described by Kaiser et al., Methods in Yeast Genetics , Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 208-210 (1994). It was a baby (SCD-Ura). Transformants were grown at 30 ° C. for 2-3 days.

Detection of amylase secreting colonies was performed by including red starch in the selective growth medium. Starch was coupled with a red dye (reactive Red-120, Sigma) according to the method as described in Biely et al., Anal. Biochem. , 172 : 176-179 (1988). The coupled starch was added to the SCD-Ura agar plate at a final concentration of 0.15% (w / v) and buffered to pH 7.0 with potassium phosphate (final concentration 50-100 mM).

Positive colonies were selected and streaked on fresh selection medium (on 150 mm plates) to obtain well isolated and identifiable single colonies. Red starch was added directly to the buffered SCD-Ura agar to detect well isolated single colonies that were amylase secretion positive. Positive colonies were determined by starch degradability (which produces a clear halo visible to the naked eye directly around the colonies).

4. Isolation of DNA by PCR Amplification

When the positive colonies were isolated, some of them were removed with a toothpick and diluted in 30 μl of sterile water in a 96 well plate. At this time, positive colonies were frozen and stored for subsequent analysis or immediately amplified. 0.5 μl Klentaq (Clontech, Palo Alto, Calif.), 4.0 μl 10 mM dNTP (Perkin Elmer-Cetus), 2.5 μl Kentaq buffer (Clonetec), 0.25 μl forward oligonucleotide-1, reverse oligo 5 μl of cell separation was used as a template for a 25 μl volume PCR reaction containing 0.25 μl of nucleotide-2 and 12.5 μl of distilled water. The sequence of forward oligonucleotide-1 was as follows:

5'-TGTAAAACGACGGCCAGT TAAATAGACCTGCAATTATTAATCT -3 '(SEQ ID NO: 324)

The sequence of reverse oligonucleotide 2 was as follows:

5 '-CAGGAAACAGCTATGACC ACCTGCACACCTGCAAATCCATT -3' (SEQ ID NO: 325)

Thereafter, PCR was performed as follows.

a. Denaturation at 92 ° C. for 5 minutes,

b. Denature for 30 seconds at 92 ° C, anneal for 30 seconds at 59 ° C, stretch for 60 seconds at 72 ° C, three times

c. Denature for 30 seconds at 92 ° C., annealing for 30 seconds at 57 ° C., stretch for 60 seconds at 72 ° C., three times

d. 25 cycles of denaturation at 92 ° C. for 30 seconds, annealing at 55 ° C. for 30 seconds and extension at 72 ° C. for 60 seconds,

e. Maintained at 4 ° C.

The underlined regions of the oligonucleotides were annealed to the ADH promoter region and amylase region, respectively, and amplified the 307 bp region from the vector pSST-AMY.O in the absence of an insert. Typically, the first 18 nucleotides of the 5 'end of the oligonucleotide contained the annealing site of the sequencing primer. Thus, the total product of the PCR reaction from the empty vector was 343 bp. However, cDNA fused signal sequences produced significantly longer nucleotide sequences.

After PCR, the literature for fractions 5 ㎕ of reaction (Sambrook et al., Supra) irradiated by 1% agarose gel eseoui agarose gel electrophoresis using a system Tris-Borate-EDTA (TBE) buffer, as described in did. Clones that produced one powerful PCR product larger than 400 bp were purified on a 96 Qiaquick PCR clean-up column (Qiagen Inc., Chatsworth, CA) and further analyzed by DNA sequencing.

Example 3: Isolation of cDNA Clone Encoding Human PRO213

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA28735. Based on the DNA28735 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO213.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-TGGAGCAGCAATATGCCAGCC-3 '(SEQ ID NO: 3)

Reverse PCR Primer 5'-TTTTCCACTCCTGTCGGGTTGG-3 '(SEQ ID NO: 4)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA28735.

Hybridization probe

5'-GGTGACACTTGCCAGTCAGATGTGGATGAATGCAGTGCTAGGAGGG-3 '(SEQ ID NO: 5)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO213 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from lung tissue of a human fetus.

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO213 (herein referred to as UNQ187 (DNA30943-1163)) (SEQ ID NO: 1) and the protein sequence of PRO213 derived therefrom.

The full nucleotide sequence of UNQ187 (DNA30943-1163) is shown in FIG. 1 (SEQ ID NO: 1). Clone UNQ187 (DNA30943-1163) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 336-338 and terminates at the stop codon at nucleotide positions 1221-1223 (Figure 1). The expected polypeptide precursor is 295 amino acids long (FIG. 2). Clone UNQ187 (DNA30943-1163) was deposited with the ATCC.

Amino acid sequence analysis of the full-length PRO213 polypeptide suggests that some of these sequences have significant homology with human growth arrest-specific gene 6 proteins. More specifically, analysis of the Dayhof database (version 35.45 Swiss Prot 35) demonstrated significant homology between the PRO213 amino acid sequence and the Dayhof sequences of HSMHC3W5A_6 and B48089.

Example 4: Isolation of cDNA Clone Encoding Human PRO274

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA36469. Based on the DNA36469 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO274. Genentech's own EST was used to assemble the consensus. This EST is shown in Figures 5-7, referred to herein as DNA17873, DNA36157 and DNA28929, respectively.

PCR primer pairs (forward and reverse) were synthesized:

Omnidirectional PCR primer 1 (36469.f1) 5'-CTGATCCGGTTCTTGGTGCCCCTG-3 '(SEQ ID NO: 11)

Omnidirectional PCR primer 2 (36469.f2) 5'-GCTCTGTCACTCACGCTC-3 '(SEQ ID NO: 12)

Omnidirectional PCR primer 3 (36469.f3) 5'-TCATCTCTTCCCTCTCCC-3 '(SEQ ID NO: 13)

Omnidirectional PCR primer 4 (36469.f4) 5'-CCTTCCGCCACGGAGTTC-3 '(SEQ ID NO: 14)

Reverse PCR Primer 1 (36469.r1) 5'-GGCAAAGTCCACTCCGATGATGTC-3 '(SEQ ID NO: 15)

Reverse PCR Primer 2 (36469.r2) 5'-GCCTGCTGTGGTCACAGGTCTCCG-3 '(SEQ ID NO: 16)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA36469.

Hybridization Probe (36469.p1)

5'-TCGGGGAGCAGGCCTTGAACCGGGGCATTGCTGCTGTCAAGGAGG-3 '(SEQ ID NO: 17)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO274 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from liver tissue of human fetus (LIB229).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO274 (herein referred to as UNQ241 (DNA39987-1184)) (SEQ ID NO: 1) and the protein sequence of PRO274 derived therefrom.

The full nucleotide sequence of UNQ241 (DNA39987-1184) is shown in FIG. 3 (SEQ ID NO: 6). Clone UNQ241 (DNA39987-1184) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 83 to 85 and terminates at the stop codon at nucleotide positions 1559 to 1561 (FIG. 4). The expected polypeptide precursor is 429 amino acids long (FIG. 4), with a molecular weight of about 54,241 Daltons and a pi of about 8.21. The clone UNQ241 (DNA39987-1184) was deposited with the ATCC and assigned the ATCC Accession No. 209786.

Amino acid sequence analysis of the full-length PRO274 polypeptide suggests that this sequence has significant homology with the Fn54 protein. More specifically, analysis of the Deihof database (version 35.45 Swiss Prot 35) shows that between the PRO274 amino acid sequence and the equivalent of H47, and M47N between the MMFN54S2_1, MMFN54S1_1, CELF48C1_8, CEF38B7_6, PRP3_RAT, INL3_PIG, MTCY07A7_13, YNAX_KLEAE2, A47MOUSE Same sex proved.

Example 5: Isolation of cDNA Clones Encoding Human PRO300

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA35930. Based on the DNA35930 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO300.

Forward and reverse PCR primer pairs were synthesized:

Omnidirectional PCR primer 1 (35930.f1) 5'-GCCGCCTCATCTTCACGTTCTTCC-3 '(SEQ ID NO: 20)

Omnidirectional PCR primer 2 (35930.f2) 5'-TCATCCAGCTGGTGCTGCTC-3 '(SEQ ID NO: 21)

Omnidirectional PCR primer 3 (35930.f3) 5'-CTTCTTCCACTTCTGCCTGG-3 '(SEQ ID NO: 22)

Omnidirectional PCR Primer 4 (35930.f4) 5'-CCTGGGCAAAAATGCAAC-3 '(SEQ ID NO: 23)

Reverse PCR Primer 1 (35930.r1) 5'-CAGGAATGTAGAAGGCACCCACGG-3 '(SEQ ID NO: 24)

Reverse PCR Primer 2 (35930.r2) 5'-TGGCACAGATCTTCACCCACACGG-3 '(SEQ ID NO: 25)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA35930.

Hybridization Probe (35930.p1)

5'-TGTCCATCATTATGCTGAGCCCGGGCGTGGAGAGTCAGCTCTACAAGCTG-3 '(SEQ ID NO: 26)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO300 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus.

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO300 (herein referred to as UNQ263 (DNA40625-1189)) (SEQ ID NO: 18) and the protein sequence of PRO300 derived therefrom.

The full nucleotide sequence of UNQ263 (DNA40625-1189) is shown in FIG. 8 (SEQ ID NO: 18). Clone UNQ263 (DNA40625-1189) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 45 to 47 and terminates at the stop codon at nucleotide positions 1416 to 1418 (FIG. 8). The expected polypeptide precursor is 457 amino acids long (FIG. 9). The clone UNQ263 (DNA40625-1189) was deposited with the ATCC and assigned the ATCC Accession No. 209788.

Amino acid sequence analysis of the full-length PRO300 polypeptide suggests that this sequence has significant homology with the Diff 33 protein. More specifically, analysis of the Dayhof database (version 35.45 Swiss Prot 35) demonstrated significant homology between the PRO300 amino acid sequence and the Dayhof sequence of HSU49188_1.

Example 6: Isolation of cDNA Clone Encoding Human PRO284

Two cDNA sequences were isolated on the amylase screen described in Example 2 above, which cDNA sequences are referred to herein as DNA12982 (see FIG. 12, derived from human placenta) and DNA15886 (see FIG. 13, derived from human salivary glands). Next, the DNA12982 and DNA15886 sequences were clustered and aligned to obtain a consensus nucleotide sequence referred to herein as DNA18832.

Based on the DNA18832 consensus sequence, oligonucleotide probes were synthesized and used to screen for human placental library (LIB89) prepared as described in the first paragraph of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D without the SfiI site; see Holmes et al., Science , 253 : 1278-1280 (1991)) and the cDNA was cut to a size less than 2800 bp.

PCR primer pairs (forward and reverse) were synthesized:

Omnidirectional PCR primer 1 (18832.est.f) 5'-TCGTACAGTTACGCTCTCCC-3 '(SEQ ID NO: 31)

Omnidirectional PCR primer 2 (18832.f) 5'-CTTGAGGAGCGTCAGAAGCG-3 '(SEQ ID NO: 32)

Reverse PCR primer (18832.r) 5'-ATAACGAATGAAGCCTCGTG-3 '(SEQ ID NO: 33)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from the DNA18832 sequence.

Hybridization Probe (18832.p)

5'-GCTAATATCTGTAAGACGGCAGCTACAGCAGGCATCATTG-3 '(SEQ ID NO: 34)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Thereafter, clones encoding the PRO284 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library.

The full length clone was found to have a single open reading frame, with an apparent translation initiation site at nucleotide positions 167-169 and ending at the stop codon at nucleotide positions 1022-1024 (FIG. 10, SEQ ID NO: 27). The expected polypeptide precursor is 285 amino acids in length, the molecular weight is calculated to be approximately 32,190 Daltons, and the pi is estimated to be approximately 9.03. Analysis of the full-length PRO284 sequence shown in FIG. 11 (SEQ ID NO: 28) revealed a signal peptide of about amino acid 1 to about amino acid 24, a transmembrane domain of about amino acid 76 to about amino acid 96 and about amino acid 171 to about amino acid 195, a weak amino acid. The presence of potential N-glycosylation sites of 153 to about amino acid 156 has been demonstrated. The clone UNQ247 (DNA23318-1211) was deposited with the ATCC on April 21, 1998, assigned the ATCC accession number 209787.

Amino acid sequence analysis of the full-length PRO284 polypeptide suggests that this sequence does not have significant sequence similarity with any known protein. However, analysis of the Dayhof database (version 35.45 Swiss Prot 35) shows some degree of homology between the PRO284 amino acid sequence and the Dayhof sequence of JQ0124, CELE04A4_5, AB006451_1, AF030162_1, IM23_YEAST, S71194, NIA_CUCMA, IM17_YEAST, I50479 and HUMZFHP_1. This has been proven.

Example 7: Isolation of cDNA Clone Encoding Human PRO296

The cDNA sequence isolated on the amylase screen described in Example 2 above was confirmed by BLAST and FastA sequence alignment, which had sequence homology with the nucleotide sequence encoding the sarcoma-associated protein SAS. This cDNA sequence is referred to herein as DNA23020 (see FIG. 16). The DNA23020 sequence can then be obtained from a variety of expressed sequences, including public EST databases (e.g., Genbank) and private EST databases (e.g., LIFESEQ ™, Insight Pharmaceutical, Palo Alto, Calif.). Compared to the tag (EST) database, the homology was confirmed. Homology investigations were performed using the computer programs BLAST or BLAST-2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparatives with BLAST scores of 70 (or in some cases 90) or higher that do not encode known proteins were clustered and the program "phrap" (Phil Green, University of Washington, Seattle, Washington, http: // bozeman. mbt.washington.edu/phrap.docs/phrap.html) to assemble into consensus DNA sequences. The consensus sequence obtained therefrom is referred to herein as DNA35858. Two ESTs owned by Genentech were used for assembly, and these EST sequences were identified herein as DNA21971 (FIG. 17, SEQ ID NO: 38) and DNA19037 (FIG. 18, SEQ ID NO: 39).

Based on the DNA35858 consensus sequence, oligonucleotide probes were synthesized and used to screen for human kidney libraries (LIB228) prepared as described in the first paragraph of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D without the SfiI site; see Holmes et al., Science , 253 : 1278-1280 (1991)) and the cDNA was cut to a size less than 2800 bp.

PCR primer pairs (forward and reverse) were synthesized:

Omnidirectional PCR Primer 1 (35858.f1) 5'-ACCCACGTCTGCGTTGCTGCC-3 '(SEQ ID NO: 40)

Omnidirectional PCR Primer 2 (35858.f2) 5'-GAGAATATGCTGGAGAGG-3 '(SEQ ID NO: 41)

Reverse PCR Primer (35858.r1) 5'-AGGAATGCACTAGGATTCGCGCGG-3 '(SEQ ID NO: 42)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA35858.

Hybridization Probe (35858.p1)

5'-GGCCCCAAAGGCAAGGACAAAGCAGCTGTCAGGGAACCTCCGCCG-3 '(SEQ ID NO: 43)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Thereafter, clones encoding the PRO296 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library.

The full length clone was identified as having a single open reading frame with an apparent translation initiation site at nucleotide positions 174-176 and ending at the stop codon at nucleotide positions 786-788 (FIG. 14, SEQ ID NO: 35). The expected polypeptide precursor is 204 amino acids long, the molecular weight is calculated to be approximately 22,147 Daltons, and the pi is estimated to be approximately 8.37. Analyzing the full length PRO296 sequence shown in FIG. 15 (SEQ ID NO: 36), the signal peptide of about amino acid 1 to about amino acid 34, about amino acid 47 to about amino acid 63, about amino acid 72 to about amino acid 95, and about amino acid 162 to about amino acid The presence of 182 transmembrane domains was demonstrated. The clone UNQ260 (DNA39979-1213) was deposited with the ATCC on April 21, 1998, assigned the ATCC accession number 209789.

Amino acid sequence analysis of the full length PRO296 polypeptide suggests that this sequence has significant sequence similarity with the sarcoma-amplified SAS protein, thus indicating that PRO296 may be a novel SAS homolog. More specifically, analysis of the dayhof database (version 35.45 Swiss plot 35) shows significant differences between the PRO296 amino acid sequence and the dayhof sequences of I58391, GEN11061, SSC2B04_1, HSU81031_2, CD63_RAT, CD63_MOUSE, CD63_HUMAN, AF022813_1, CD63_RABIT and CO02_HUMAN. It was proved to be same-sex.

Example 8: Isolation of cDNA Clones Encoding Human PRO329

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA35612. Based on the DNA35612 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR and 2) as a probe to isolate a clone of the full-length coding sequence of PRO329.

PCR primer pairs (forward and reverse) were synthesized:

Omnidirectional PCR primer 1 (35612.f1) 5'-TGGGCTGTGTCCTCATGG-3 '(SEQ ID NO: 46)

Omnidirectional PCR primer 2 (35612.f2) 5'-TTTCCAGCGCCAATTCTC-3 '(SEQ ID NO: 47)

Reverse PCR Primer 1 (35612.r1) 5'-AGTTCTTGGACTGTGATAGCCAC-3 '(SEQ ID NO: 48)

Reverse PCR Primer 2 (35612.r2) 5'-AAACTTGGTTGTCCTCAGTGGCTG-3 '(SEQ ID NO: 49)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA35612.

Hybridization Probe (35612.p1)

5'-GTGAGGGACCTGTCTGCACTGAGGAGAGCAGCTGCCACACGGAGG-3 '(SEQ ID NO: 50)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO329 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from liver tissue of human fetus (LIB6).

DNA sequence analysis of clones isolated as described above yielded the full-length DNA sequence of PRO329 (herein referred to as UNQ291 (DNA40594-1233)) (SEQ ID NO: 44) and the protein sequence of PRO329 derived therefrom.

The full nucleotide sequence of UNQ291 (DNA40594-1233) is shown in FIG. 19 (SEQ ID NO: 44). Clone UNQ291 (DNA40594-1233) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 9-11 and terminates at the stop codon at nucleotide positions 1086-1088 (FIG. 19). The expected polypeptide precursor is 359 amino acids long (FIG. 20). The full-length PRO329 protein shown in FIG. 20 had a molecular weight of about 38,899 Daltons and a pi of about 5.21. The clone UNQ291 (DNA40594-1233) was deposited with the ATCC on February 5, 1998, assigned the ATCC accession number 209617.

Amino acid sequence analysis of the full-length PRO329 polypeptide suggests that this sequence has significant sequence similarity with the high affinity immunoglobulin F _C receptor protein. More specifically, analysis of the Deihof database (version 35.45 Swiss Prot 35) shows a significant difference between the PRO329 amino acid sequence and the equivalent phase sequence between FCG1_HUMAN, FCG0_HUMAN, P_R91439, P_R22549, P_R91438, P_W00859, P_R20811, P_R22550, HUMCD6406_1 and FCG1_MOUSE. It was proved to be same-sex.

Example 9: Isolation of cDNA Clone Encoding Human PRO362

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA42257. Based on the DNA42257 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO362.

PCR primer pairs (forward and reverse) were synthesized:

Omnidirectional PCR primer 1 (42257.f1) 5'-TATCCCTCCAATTGAGCACCCTGG-3 '(SEQ ID NO: 53)

Omnidirectional PCR primer 2 (42257.f2) 5'-GTCGGAAGACATCCCAACAAG-3 '(SEQ ID NO: 54)

Reverse PCR Primer 1 (42257.r1) 5'-CTTCACAATGTCGCTGTGCTGCTC-3 '(SEQ ID NO: 55)

Reverse PCR Primer 2 (42257.r2) 5'-AGCCAAATCCAGCAGCTGGCTTAC-3 '(SEQ ID NO: 56)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA42257.

Hybridization Probe (42257.p1)

5'-TGGATGACCGGAGCCACTACACGTGTGAAGTCACCTGGCAGACTCCTGAT-3 '(SEQ ID NO: 57)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO362 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from brain tissue of human fetus (LIB153).

DNA sequence analysis of clones isolated as described above yielded the full-length DNA sequence of PRO362 (herein referred to as UNQ317 (DNA45416-1251)) (SEQ ID NO: 51) and the protein sequence of PRO362 derived therefrom.

The full nucleotide sequence of UNQ317 (DNA45416-1251) is shown in FIG. 21 (SEQ ID NO: 51). Clone UNQ317 (DNA45416-1251) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 119-121 and terminates at the stop codon at nucleotide positions 1082-1084 (FIG. 21). The expected polypeptide precursor is 321 amino acids long (FIG. 22). The full-length PRO362 protein shown in FIG. 2 has an estimated molecular weight of about 35,544 Daltons and a pI of about 8.51. Analysis of the full length PRO362 polypeptide shown in FIG. 22 demonstrated the presence of a glycosaminoglycan attachment site of about amino acids 149 to about amino acid 152, and a transmembrane domain of about amino acids 276 to about amino acid 306. The clone UNQ317 (DNA45416-1251) was deposited with the ATCC on February 5, 1998, assigned the ATCC accession number 209620.

Amino acid sequence analysis of the full-length PRO362 polypeptide suggests that this sequence has significant sequence similarity with the A33 antigen protein and the HCAR protein. More specifically, analysis of the Deihof database (version 35.45 Swiss Prot 35) shows a significant equivalent of the Dyhope sequence between the PRO362 amino acid sequence and the AB002341_1, HSU55258_1, HSC7NRCAM_1, RNU81037_1, A33_HUMAN, P_W14158, NMNCAMRI_1, HSTITINN2_1, S71824_1 and HSU63041_1. It was proved to be same-sex.

Example 10 Isolation of cDNA Clone Encoding Human PRO363

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA42828. Based on the DNA42828 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO363.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer (42828.f1) 5'-CCAGTGCACAGCAGGCAACGAAGC-3 '(SEQ ID NO: 60)

Reverse PCR Primer (42828.r1) 5'-ACTAGGCTGTATGCCTGGGTGGGC-3 '(SEQ ID NO: 61)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA42828.

Hybridization Probe (42828.p1)

5'-GTATGTACAAAGCATCGGCATGGTTGCAGGAGCAGTGACAGGC-3 '(SEQ ID NO: 62)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO363 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO363 (herein referred to as UNQ318 (DNA45419-1252)) (SEQ ID NO: 58) and the protein sequence of PRO363 derived therefrom.

The full nucleotide sequence of UNQ318 (DNA45419-1252) is shown in FIG. 23 (SEQ ID NO: 58). Clone UNQ318 (DNA45419-1252) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 190-192 and terminates at the stop codon at nucleotide positions 1309-1311 (FIG. 23). The expected polypeptide precursor is 373 amino acids long (FIG. 24). The full-length PRO363 protein shown in FIG. 24 was estimated to have a molecular weight of about 41,281 Daltons and a pi of about 8.33. The transmembrane domain is present at amino acids 221 to 254 of the amino acid sequence shown in FIG. 24 (SEQ ID NO: 59). In addition, the PRO363 polypeptide has at least two myelin PO protein domains from about amino acid 15 to about amino acid 56 and about amino acid 87 to about amino acid 116. The clone UNQ318 (DNA45419-1252) was deposited with the ATCC on February 5, 1998, assigned the ATCC accession number 209616.

Amino acid sequence analysis of the full-length PRO363 polypeptide suggests that this sequence has significant sequence similarity with the cell surface protein HCAR, thus indicating that PRO363 may be a novel HCAR homologue. More specifically, analysis of the Dayhof database (version 35.45 Swiss Prot 35) shows significant differences between the PRO363 amino acid sequence and the Dayhof sequences of HS46KDA_1, HSU90716_1, MMCARH_1, MMCARHOM_1, MMU90715_1, A33_HUMAN, P_W14146, P_W14158, A42632 and B42632. It was proved to be same-sex.

Example 11: Isolation of cDNA Clone Encoding Human PRO868

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA38133. Based on the DNA38133 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO868.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer (38133.f1) 5'-GTAGCAGTGCACATGGGGTGTTGG-3 '(SEQ ID NO: 65)

Reverse PCR primer (38133.r1) 5'-ACCGCACATCCTCAGTCTCTGTCC-3 '(SEQ ID NO: 66)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA38133.

Hybridization Probe (38133.p1)

5'-ACGATGATCGCGGGCTCCCTTCTCCTGCTTGGATTCCTTAGCACCACCAC-3 '(SEQ ID NO: 67)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO868 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO868 (herein referred to as UNQ437 (DNA52594-1270)) (SEQ ID NO: 63) and the protein sequence of PRO868 derived therefrom.

The full nucleotide sequence of UNQ437 (DNA52594-1270) is shown in FIG. 25 (SEQ ID NO: 63). Clone UNQ437 (DNA52594-1270) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 325-327 and terminates at the stop codon at nucleotide positions 2290-2292 (Figure 25). The expected polypeptide precursor is 655 amino acids long (FIG. 26). The full-length PRO868 protein shown in FIG. 26 was estimated to have a molecular weight of about 71,845 Daltons and a pI of about 8.22. Analyzes of the full-length PRO868 polypeptide sequence showed conserved cysteine-containing domains of about amino acids 66 to about amino acids 78 and about amino acids 123 to about amino acids 134, about amino acids 85 to about amino acids 110, of the sequences shown in FIG. 26 (SEQ ID NO: 3). The presence of a TNFR killing domain, a FASA mouse killing domain block of about amino acid 159 to about amino acid 175, and a transmembrane domain of about amino acid 347 to about amino acid 375 was demonstrated. The clone UNQ437 (DNA52594-1270) was deposited with the ATCC on March 17, 1998, assigned the ATCC accession number 209679.

Amino acid sequence analysis of the full length PRO868 polypeptide suggests that this sequence has significant sequence similarity with the tumor necrosis factor receptor protein, and thus PRO868 may be a new member of the tumor necrosis factor receptor family. More specifically, analysis of the Dayhof database (version 35.45 Swiss Prot 35) shows significant differences between the PRO868 amino acid sequence and the dayhof sequence of RNU94330_1, P_R99933, P_R99945, P_R99950, HSU94332_1, CD40_HUMAN, S63368_1, TNR2_HUMAN, MVU87844_1 and CVU87837_1. It was proved to be same-sex.

Example 12 Isolation of cDNA Clone Encoding Human PRO382

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA30892. Based on the DNA30892 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR and 2) as a probe to isolate a clone of the full-length coding sequence of PRO382.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-TGACATCGCCCTTATGAAGCTGGC-3 '(SEQ ID NO: 70)

Reverse PCR primer 5'-TACACGTCCCTGTGGTTGCAGATC-3 '(SEQ ID NO: 71)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA30892.

Hybridization probe

5'-CGTTCAATGCAGAAATGATCCAGCCTGTGTGCCTGCCCAACTCTGAAGAG-3 '(SEQ ID NO: 72)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Thereafter, clones encoding the PRO382 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence (SEQ ID NO: 68) of PRO382 (herein referred to as UNQ323 (DNA45234-1277)) and the protein sequence of PRO382 derived therefrom.

The full nucleotide sequence of UNQ323 (DNA45234-1277) is shown in FIG. 27 (SEQ ID NO: 68). Clone UNQ323 (DNA45234-1277) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 126-128 and terminates at the stop codon at nucleotide positions 1485-1487 (Figure 27). The expected polypeptide precursor is 453 amino acids in length (FIG. 28). The full-length PRO382 protein shown in FIG. 28 has an estimated molecular weight of about 49,334 Daltons and a pI of about 6.32. Analysis of the full length PRO382 polypeptide sequence shown in FIG. 28 (SEQ ID NO: 69) shows a putative transmembrane domain of about amino acids 240 to about amino acids 284, an estimated signal peptide of about amino acids 1 to about amino acids 20, about amino acids 386 to about amino acids 419. The presence of a histidine-containing protease active site of putative apple domain of, amino acid 394 to putative amino acid 406, putative Kringle domain, about amino acid 253 to amino acid 258. The clone UNQ323 (DNA45234-1277) was deposited with the ATCC on March 5, 1998, assigned the ATCC accession number 209654.

Amino acid sequence analysis of the full length PRO382 polypeptide suggests that this sequence has significant homology with the serine protease protein, thus indicating that PRO382 may be a novel serine protease. Specifically, analysis of the Dayhof database (version 35.45 Swiss Prot 35) shows that between the PRO382 amino acid sequence and HSU75329_1, ENTK_MOUSE, HEPS_HUMAN, AF030065_1, HEPS_RAT, PLMN_PIG, P_R89430, P_R89435, PLMN_HORSE, PLMN_BOVIN and P_N_B83959 equivalents. The homology was proved.

Example 13: Isolation of cDNA Clone Encoding Human PRO545

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA44706. Genentech's proprietary EST was used for consensus assembly, referred to herein as DNA13217 (FIG. 31, SEQ ID NO: 75). Based on the DNA44706 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO545.

Forward and reverse PCR primer pairs were synthesized:

Omnidirectional PCR primer 1 5'-GTCTCAGCACGTGTTCTGGTCTCAGGG-3 '(SEQ ID NO: 76)

Omnidirectional PCR primer 2 5'-CATGAGCATGTGCACGGC-3 '(SEQ ID NO: 77)

Omnidirectional PCR primer 3 5'-TACCTGCACGATGGGCAC-3 '(SEQ ID NO: 78)

Omnidirectional PCR primer 4 5'-CACTGGGCACCTCCCTTC-3 '(SEQ ID NO: 79)

Reverse PCR primer 1 5'-CTCCAGGCTGGTCTCCAAGTCCTTCC-3 '(SEQ ID NO: 80)

Reverse PCR primer 2 5'-TCCCTGTTGGACTCTGCAGCTTCC-3 '(SEQ ID NO: 81)

Reverse PCR primer 3 5'-CTTCGCTGGGAAGAGTTTG-3 '(SEQ ID NO: 82)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA44706.

Hybridization probe

5'-GTGCAACCAACAGATACAAACTCTTCCCAGCGAAGAAGCTGAAAAGCGTC-3 '(SEQ ID NO: 83)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO545 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from human placental tissue (LIB90).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence (SEQ ID NO: 73) of PRO545 (herein referred to as UNQ346 (DNA49624-1279)) and the protein sequence of PRO545 derived therefrom.

The full nucleotide sequence of UNQ346 (DNA49624-1279) is shown in FIG. 29 (SEQ ID NO: 73). Clone UNQ346 (DNA49624-1279) contains a single open reading frame that has a clear translation initiation site at nucleotide positions 311 to 313 and terminates at the stop codon at nucleotide positions 2516 to 2518 (FIG. 29). The expected polypeptide precursor is 735 amino acids long (FIG. 30). The full-length PRO545 protein shown in FIG. 30 has an estimated molecular weight of about 80,177 Daltons and a pI of about 7.08. Important regions of the PRO545 amino acid sequence include signal peptides of amino acids 1 to 28, about amino acids 111 to about amino acids 114, about amino acids 146 to about amino acids 149, about amino acids 348 to about amino acids 351, about amino acids 449 to about amino acids 452 and about Five potential N-glycosylation sites of amino acids 648 to about amino acid 651, and neutral zinc metallopeptidase, zinc-binding region signature sequences of about amino acids 344 to about amino acid 353. The clone UNQ346 (DNA49624-1279) was deposited with the ATCC and assigned the ATCC accession number 209655.

Example 14 Isolation of cDNA Clone Encoding Human PRO617

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA42798. Based on the DNA42798 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR and 2) as a probe to isolate a clone of the full-length coding sequence of PRO617.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-ACGGGCACACTGGATCCCAAATG-3 '(SEQ ID NO: 86)

Reverse PCR primer 5'-GGTAGAGATGTAGAAGGGCAAGCAAGACC-3 '(SEQ ID NO: 87)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA42798.

Hybridization probe

5'-GCTCCCTACCCGTGCAGGTTTCTTCATTTGTTCCTTTAACCAGTATGCCG-3 '(SEQ ID NO: 88)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO617 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above yielded the full-length DNA sequence of PRO617 (herein referred to as UNQ353 (DNA48309-1280)) (SEQ ID NO: 1) and the protein sequence of PRO617 derived therefrom.

The full nucleotide sequence of UNQ353 (DNA48309-1280) is shown in FIG. 32 (SEQ ID NO: 84). Clone UNQ353 (DNA48309-1280) contains a single open reading frame that has a clear translation initiation site at nucleotide positions 723-725 and terminates at the stop codon at nucleotide positions 924-926 (Figure 32). The expected polypeptide precursor is 67 amino acids long (FIG. 33). The full-length PRO617 protein shown in FIG. 33 was estimated to have a molecular weight of about 6,981 Daltons and a pI of about 7.47. Analysis of the PRO617 amino acid sequence demonstrated the presence of putative signal peptides from about amino acids 15 to about amino acid 27, and putative protein kinase C phosphorylation sites from about amino acids 41 to about amino acid 43. Clone UNQ353 (DNA48309-1280) was deposited with the ATCC on March 5, 1998, and was assigned ATCC Accession No. 209656.

Amino acid sequence analysis of the full-length PRO617 polypeptide suggests that this sequence has significant homology with the CD24 protein, thus indicating that PRO617 may be a novel CD24 homolog. More specifically, analysis of the Deihof database (version 35.45 Swiss Prot 35) revealed that the PRO617 amino acid sequence and CD24_HUMAN, CD24_MOUSE, S15785, CD24_RAT, VGE BPG4, MSE5_HUMAN, HSMHC3W36A_2, MLU15184_8, P R85075, SEPL_HUMAN and MTCY63_ It has been demonstrated that there is considerable homology between.

Example 15 Isolation of cDNA Clone Encoding Human PRO700

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA30837. Based on the DNA30837 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO700.

PCR primer pairs (forward and reverse) were synthesized:

Omnidirectional PCR primer 1 5'-ATGTTCTTCGCGCCCTGGTG-3 '(SEQ ID NO: 91)

Omnidirectional PCR primer 2 5'-CCAAGCCAACACACTCTACAG-3 '(SEQ ID NO: 92)

Reverse PCR primer 1 5'-AAGTGGTCGCCTTGTGCAACGTGC-3 '(SEQ ID NO: 93)

Reverse PCR primer 2 5'-GGTCAAAGGGGATATATCGCCAC-3 '(SEQ ID NO: 94)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA30837.

Hybridization probe

5'-GCATGGAAGATGCCAAAGTCTATGTGGCTAAAGTGGACTGCACGGCCCA-3 '(SEQ ID NO: 95)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO700 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO700 (herein referred to as UNQ364 (DNA46776-1284)) (SEQ ID NO: 89) and the protein sequence of PRO700 derived therefrom.

The full nucleotide sequence of UNQ364 (DNA46776-1284) is shown in FIG. 34 (SEQ ID NO: 89). Clone UNQ364 (DNA46776-1284) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 33 to 35 and terminates at the stop codon at nucleotide positions 1329 to 1331 (FIG. 34). The expected polypeptide precursor is 432 amino acids long (Figure 35). The full-length PRO700 protein shown in FIG. 35 has an estimated molecular weight of about 47,629 Daltons and a pi of about 5.90. Important regions of the PRO700 amino acid sequence include a signal peptide of about amino acid 1 to about amino acid 33, and a disulfide isomerase of about amino acid 82 to about amino acid 99, about amino acid 210 to about amino acid 255, and about amino acid 345 to about amino acid 360; A homologous region, a tyrosine kinase phosphorylation site of about amino acid 143 to about amino acid 151, and a vesicle target sequence of about amino acid 429 to about amino acid 432. The clone UNQ364 (DNA46776-1284) was deposited with the ATCC and assigned the ATCC Accession No. 209721.

Example 16: Isolation of cDNA Clone Encoding Human PRO702

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA36623. Based on the DNA36623 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO702.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR Primer (36623.f1) 5'-CGCTGACTATGTTGCCAAGAGTGG-3 '(SEQ ID NO: 98)

Reverse PCR Primer (36623.r1) 5'-GATGATGGAGGCTCCATACCTCAG-3 '(SEQ ID NO: 99)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA36623.

Hybridization Probe (36623.p1)

5'-GTGTTCATTGGCGTGAATGACCTTGAAAGGGAGGGACAGTACATGTTCAC-3 '(SEQ ID NO: 100)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO702 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from liver tissue of human fetus (LIB229).

DNA sequence analysis of clones isolated as described above gave the full length DNA sequence of PRO702 (herein referred to as UNQ366 (DNA50980-1286)) (SEQ ID NO: 96) and the protein sequence of PRO702 derived therefrom.

The full nucleotide sequence of UNQ366 (DNA50980-1286) is shown in FIG. 36 (SEQ ID NO: 96). Clone UNQ366 (DNA50980-1286) contains a single open reading frame that has a clear translation initiation site at nucleotide positions 22-24 and terminates at the stop codon at nucleotide positions 853-855 (FIG. 36). The expected polypeptide precursor is 277 amino acids long (FIG. 37). The full-length PRO702 protein shown in FIG. 37 was estimated to have a molecular weight of about 30,645 Daltons and a pI of about 7.47. Analysis of the full-length native PRO702 amino acid sequence revealed a putative signal peptide of about amino acids 1 to about amino acid 25, potential N-glycosylation sites of about amino acids 230 to about amino acids 233 and about amino acids 258 to about amino acids 261, and about amino acids 248. The presence of the C-type lectin domain feature sequence of from about amino acid 270 has been demonstrated. The clone UNQ366 (DNA50980-1286) was deposited with the ATCC on March 31, 1998, assigned the ATCC accession number 209717.

Amino acid sequence analysis of the full-length PRO702 polypeptide suggests that this sequence has significant homology with the conglutinin protein, thus indicating that PRO702 may be a novel conglutinin homolog. More specifically, analysis of the Dayhof database (version 35.45 Swiss Prot 35) shows a significant difference between the PRO702 amino acid sequence and the Dayhof sequence of S32436, P_R75642, P_W18780, P_W18781, A53330, AC002528_1, HSPPA2IC0_1, CA21_HUMAN, CA14_HUMAN and A61262. The homology was proved.

Example 17 Isolation of cDNA Clones Encoding Human PRO703

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA43047. Based on the DNA43047 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO703.

Forward and reverse PCR primer pairs were synthesized:

Omnidirectional PCR primer 5'-GAGAGCCATGGGGCTCCACCTG-3 '(SEQ ID NO: 103)

Reverse PCR primer 1 5'-GGAGAATGTGGCCACAAC-3 '(SEQ ID NO: 104)

Reverse PCR primer 2 5'-GCCCTGGCACAGTGACTCCATAGACG-3 '(SEQ ID NO: 105)

Reverse PCR primer 3 5'-ATCCACTTCAGCGGACAC-3 '(SEQ ID NO: 106)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA40654.

Hybridization probe

5'-CCAGTGCCAGGATACCTCTCTTCCCCCCAGAGCATAACAGACACG-3 '(SEQ ID NO: 107)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO703 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above yielded the full-length DNA sequence of PRO703 (herein referred to as UNQ367 (DNA50913-1287)) (SEQ ID NO: 101) and the protein sequence of PRO703 derived therefrom.

The full nucleotide sequence of UNQ367 (DNA50913-1287) is shown in FIG. 38 (SEQ ID NO: 101). Clone UNQ367 (DNA50913-1287) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 115-117 and terminates at the stop codon at nucleotide positions 2305-2307 (FIG. 38). The expected polypeptide precursor is 730 amino acids long (FIG. 39). The full-length PRO703 protein shown in FIG. 39 has an estimated molecular weight of about 78,644 Daltons and a pi of about 7.65. Important regions of the PRO703 amino acid sequence included signal peptides, cAMP- and cGMP-dependent protein kinase phosphorylation sites, CUB domain protein motifs, N-glycosylation sites and putative AMP-binding domain features. The clone UNQ367 (DNA50913-1287) was deposited with the ATCC and assigned the ATCC Accession No. 209716.

Example 18 Isolation of cDNA Clone Encoding Human PRO705

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA43437. Based on the DNA43437 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO705.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-AAGCGTGACAGCGGGCACGTC-3 '(SEQ ID NO: 110)

Reverse PCR Primer 5'-TGCACAGTCTCTGCAGTGCCCAGG-3 '(SEQ ID NO: 111)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA43437.

Hybridization Probe (43437.p1)

5'-GAATGCTGGAACGGGCACAGCAAAGCCAGATACTTGCCTG-3 '(SEQ ID NO: 112)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO705 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO705 (herein referred to as UNQ369 (DNA50914-1289)) (SEQ ID NO: 108) and the protein sequence of PRO705 derived therefrom.

The full nucleotide sequence of UNQ369 (DNA50914-1289) is shown in FIG. 40 (SEQ ID NO: 108). Clone UNQ369 (DNA50914-1289) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 566-568 and terminates at the stop codon at nucleotide positions 2231-2233 (FIG. 40). The expected polypeptide precursor is 555 amino acids long (FIG. 41). The full-length PRO705 protein shown in FIG. 41 has an estimated molecular weight of about 62,736 Daltons and a pi of about 5.36. Analyzing the full length PRO705 amino acid sequence shown in FIG. 41, the signal peptide of about amino acids 1 to about amino acid 23, the eukaryotic DNA topoisomerase I active site of about amino acids 418 to about amino acid 436, and about amino acids 237 to about Amino acids 279, about amino acids 421 to about amino acids 458, about amino acids 53 to about amino acids 74, about amino acids 466 to about amino acids 504, about amino acids 308 to about amino acids 355, about amino acids 104 to about amino acids 156, and about amino acids 379 to about amino acids 410 The presence of various regions homologous to the various glyciccan proteins of has been demonstrated. The clone UNQ369 (DNA50914-1289) was deposited with the ATCC on March 31, 1998, assigned the ATCC accession number 209722.

Amino acid sequence analysis of the full-length PRO705 polypeptide suggests that this sequence has significant sequence similarity with the K-glypican protein, thus indicating that PRO705 may be a member of the novel glypican protein family. More specifically, analysis of the Deihof database (version 35.45 Swiss Prot 35) shows that the D. apex sequence between the PRO705 amino acid sequence and the equivalent sequence of GPCK_MOUSE, GLYP_CHICK, GLYP_RAT, GLYP_HUMAN, GPC2_RAT, GPC5_HUMAN, GPC3_HUMAN, GPC3_RAT, P_R30168 and CEC03H12_2. It was proved to be same-sex.

Example 19 Isolation of cDNA Clones Encoding Human PRO708

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA34024. Based on the DNA34024 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO708.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-CCCAACCCAACTGTTTACCTCTGG-3 '(SEQ ID NO: 115)

Reverse PCR primer 5'-CTCTCTGAGTGTACATCTGTGTGG-3 '(SEQ ID NO: 116)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA34024.

Hybridization probe

5'-GCCACCCTACCTCAGAAACTGAAGGAGGTTGGNTATTCAACGCATATGGTCGG-3 '(SEQ ID NO: 117)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO708 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from human bone marrow tissue (LIB255).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence (SEQ ID NO: 113) of PRO708 (herein referred to as UNQ372 (DNA48296-1292)) and the protein sequence of PRO708 derived therefrom.

The full nucleotide sequence of UNQ372 (DNA48296-1292) is shown in FIGS. 42A-B (SEQ ID NO: 113). Clone UNQ372 (DNA48296-1292) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 891 to 893 and terminates at the stop codon at nucleotide positions 2436 to 2438 (FIGS. 42A-B). The expected polypeptide precursor is 515 amino acids long (FIG. 43). The full-length PRO708 protein shown in FIG. 43 has an estimated molecular weight of about 56,885 Daltons and a pi of about 6.49. Analyzing the full length PRO708 amino acid sequence shown in FIG. 43 (SEQ ID NO: 114), the putative signal peptide of about amino acid 1 to about amino acid 37, the estimated sulfatase of about amino acid 120 to about amino acid 132 and about amino acid 168 to about amino acid 177 Feature sequence, putative tyrosine kinase phosphorylation site of about amino acids 163 to about amino acid 169, and potential N-glycosylation sites of about amino acid 157 to about amino acid 160, about amino acid 306 to about amino acid 309, and about amino acid 318 to about amino acid 321 The existence of has been proven. The clone UNQ372 (DNA48296-1292) was deposited with the ATCC on March 11, 1998, assigned the ATCC accession number 209668.

Amino acid sequence analysis of the full length PRO708 polypeptide suggests that this sequence has significant homology with the aryl sulfatase protein, thus indicating that PRO708 can be a novel aryl sulfatase homolog. More specifically, analysis of the Dayhof database (version 35.45 Swiss Prot 35) shows significant differences between the PRO708 amino acid sequence and the Dayhof sequence of ARSB_HUMAN, CELC54D2_2, G02857, STS_HUMAN, I37186, I37187, GEN12648, CELD1014_7, GA6S_HUMAN and SPHM_HUMAN. It was proved to be same-sex.

Example 20 Isolation of cDNA Clone Encoding Human PRO320

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA28739. Based on the DNA28739 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO320.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-CCTCAGTGGCCACATGCTCATG-3 '(SEQ ID NO: 120)

Reverse PCR Primer 5'-GGCTGCACGTATGGCTATCCATAG-3 '(SEQ ID NO: 121)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA28739.

Hybridization probe

5'-GATAAACTGTCAGTACAGCTGTGAAGACACAGAAGAAGGGCCACAGTGCC-3 '(SEQ ID NO: 122)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO320 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from lung tissue of human fetus (LIB25).

DNA sequence analysis of clones isolated as described above gave the full length DNA sequence of PRO320 (herein referred to as UNQ281 (DNA32284-1307)) (SEQ ID NO: 118) and the protein sequence of PRO320 derived therefrom.

The full nucleotide sequence of UNQ281 (DNA32284-1307) is shown in FIG. 44 (SEQ ID NO: 118). Clone UNQ281 (DNA32284-1307) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 135-137 and terminates at the stop codon at nucleotide positions 1149-1151 (Figure 44). The expected polypeptide precursor is 338 amino acids long (FIG. 45). The full-length PRO320 protein shown in FIG. 45 was estimated to have a molecular weight of about 37,143 Daltons and a pI of about 8.92. Important regions of the PRO320 amino acid sequence are signal peptides of amino acids 1 to 21, EGF-like domain cysteine pattern features of amino acids 80 to 91, and amino acids 103 to 124, amino acids 230 to amino 151 and amino acids 185 to amino acids, respectively. Three calcium-binding EGF-like domains of 206 were included. The clone UNQ281 (DNA32284-1307) was deposited with the ATCC and assigned the ATCC accession number 209670.

Example 21 Isolation of cDNA Clone Encoding Human PRO324

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA34347. Based on the DNA34347 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO324.

PCR primer pairs (forward and reverse) were synthesized:

Omnidirectional PCR primer 1 5'-GCAATGAACTGGGAGCTGC-3 '(SEQ ID NO: 125)

Omnidirectional PCR primer 2 5'-CTGTGAATAGCATCCTGGG-3 '(SEQ ID NO: 126)

Omnidirectional PCR primer 3 5'-CTTTTCAAGCCACTGGAGGG-3 '(SEQ ID NO: 127)

Reverse PCR primer 1 5'-CTGTAGACATCCAAGCTGGTATCC-3 '(SEQ ID NO: 128)

Reverse PCR primer 2 5'-AAGAGTCTGCATCCACACCACTC-3 '(SEQ ID NO: 129)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA34347.

Hybridization probe

5'-ACCTGACGCTACTATGGGCCGAGTGGCAGGGACGACGCCCAGAATG-3 '(SEQ ID NO: 130)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Thereafter, clones encoding the PRO324 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from liver tissue of human fetus (LIB6).

DNA sequence analysis of clones isolated as described above yielded the full-length DNA sequence of PRO324 (herein referred to as UNQ285 (DNA36343-1310)) (SEQ ID NO: 123) and the protein sequence of PRO324 derived therefrom.

The full nucleotide sequence of UNQ285 (DNA36343-1310) is shown in FIG. 46 (SEQ ID NO: 123). Clone UNQ285 (DNA36343-1310) contains a single open reading frame that has a clear translation initiation site at nucleotide positions 144-146 and terminates at the stop codon at nucleotide positions 1011-1013 (Figure 46). The expected polypeptide precursor is 289 amino acids in length (FIG. 47). The full-length PRO324 protein shown in FIG. 47 has an estimated molecular weight of about 32,268 Daltons and a pi of about 9.21. Analyzing the PRO324 polypeptide sequence shown in FIG. 47 (SEQ ID NO: 124) revealed a signal peptide of about amino acid 1 to about amino acid 31, a transmembrane domain of about amino acid 136 to about amino acid 157, about amino acid 106, or about amino acid 107 to about amino acid. Homologous to the tyrosine kinase phosphorylation site of 113 and the short chain alcohol dehydrogenase region of about amino acid 80 to about amino acid 90, about amino acid 131 to about amino acid 168, about amino acid 1 to about amino acid 13, and about amino acid 176 to about amino acid 185 The existence of the realm has been proven. The clone UNQ285 (DNA36343-1310) was deposited with the ATCC on March 30, 1998, assigned the ATCC accession number 209718.

Amino acid sequence analysis of the full-length PRO324 polypeptide suggests that this sequence has significant sequence similarity with oxidoreductase, thus indicating that PRO324 may be a novel oxidoreductase homolog. More specifically, analysis of the Deihof database (version 35.45 Swiss Prot 35) revealed significant phase differences between the PRO324 amino acid sequence and the Dayhof sequences of B61209, A69965, YQJQ_BACSU, D69930, S76124, FABG_ECOLI, C70023, S77280, FABG_VIBHA and MTV013_6. It was proved to be same-sex.

Example 22 Isolation of cDNA Clone Encoding Human PRO351

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA35950. Based on the DNA35950 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO351.

Forward and reverse PCR primers were synthesized:

Omnidirectional PCR primer 5'-CCTGTGCTGTGCCTCGAGCCTGAC-3 '(SEQ ID NO: 133)

Reverse PCR primer 5'-GTGGGCAGCAGTTAGCACCGCCTC-3 '(SEQ ID NO: 134)

Additionally, synthetic oligonucleotide hybridization probes with the following nucleotide sequences were prepared from consensus sequence DNA35950.

Hybridization probe

5'-GGCTGGCATCATCAGCTTTGCATCAAGCTGTGCCCAGGAGGACGC-3 '(SEQ ID NO: 135)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO351 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from liver tissue of human fetus (LIB230).

DNA sequence analysis of clones isolated as described above gave the full length DNA sequence of PRO351 (herein referred to as UNQ308 (DNA40571-1315)) (SEQ ID NO: 131) and the protein sequence of PRO351 derived therefrom.

The full nucleotide sequence of UNQ308 (DNA40571-1315) is shown in FIG. 48 (SEQ ID NO: 131). Clone UNQ308 (DNA40571-1315) has two distinct open initiation sites at nucleotide positions 189-191 and has a second open reading frame starting at nucleotide position 470 and terminates at stop codons at nucleotide positions 363-365 and 2009-2011, respectively. It includes an open reading frame (Figure 48). The expected polypeptide precursor is 571 amino acids in length (FIG. 49). An important region of the PRO351 amino acid sequence included a signal peptide, a region having sequence similarity with the serine protease of the trypsin family, two N-glycosylation sites, and three klingle domains. The clone UNQ308 (DNA40571-1315) was deposited with the ATCC and assigned the ATCC Accession No. 209784.

Example 23 Isolation of cDNA Clones Encoding Human PRO352

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA36950. Based on the DNA36950 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO352.

PCR primer pairs (forward and reverse) were synthesized:

Omnidirectional PCR primer 1 5'-CTGGCACAGCTCAACCTCATCTGG-3 '(SEQ ID NO: 138)

Omnidirectional PCR primer 2 5'-GCTGTCTGTCTGTCTCATTG-3 '(SEQ ID NO: 139)

Omnidirectional PCR primer 3 5'-GGACACAGTATACTGACCAC-3 '(SEQ ID NO: 140)

Reverse PCR primer 1 5'-TGCGAACCAGGCAGCTGTAAGTGC-3 '(SEQ ID NO: 141)

Reverse PCR primer 2 5'-TGGAAGAAGAGGGTGGTGATGTGG-3 '(SEQ ID NO: 142)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA36950.

Hybridization probe

5'-CAGCTGACAGACACCAAACAGCTGGTGCACAGTTTCACCGAAGGC-3 '(SEQ ID NO: 143)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO352 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO352 (herein referred to as UNQ309 (DNA41386-1316)) (SEQ ID NO: 136) and the protein sequence of PRO352 derived therefrom.

The full nucleotide sequence of UNQ309 (DNA41386-1316) is shown in FIG. 50 (SEQ ID NO: 136). Clone UNQ309 (DNA41386-1316) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 152 to 154 and terminates at the stop codon at nucleotide positions 1100 to 1102 (FIG. 50). The expected polypeptide precursor is 316 amino acids long (FIG. 51). The full-length PRO352 protein shown in FIG. 2 was estimated to have a pI of about 4.62. Analysis of the full-length PRO352 sequence shows a signal peptide of about amino acid 1 to about amino acid 28, a transmembrane domain of about amino acid 251 to about amino acid 270, about amino acid 91 to about amino acid 94, about amino acid 104 to about amino acid 107, about amino acid 189 Potential N-glycosylation sites of from about amino acid 192 and about amino acid 215 to about amino acid 218, and regions homologous to immunoglobulins and MHCs of about amino acid 217 to about amino acid 234, have been demonstrated. The clone UNQ309 (DNA41386-1316) was deposited with the ATCC on March 26, 1998, and was assigned ATCC Accession No. 209703.

Amino acid sequence analysis of the full length PRO352 polypeptide suggests that this sequence has significant sequence similarity with the butyrophylline protein, thus indicating that PRO352 may be a novel butyrophylline homologue. More specifically, analysis of the Dayhof database (version 35.45 Swiss Prot 35) shows significant differences between the PRO352 amino acid sequence and the Dayhof sequences of BUTY_HUMAN, HSB73_1, GGCD80_1, I46690, A33_HUMAN, P_R67988, CD86_MOUSE, P_R71360, B39371 and D50558_1. It was proved to be same-sex.

Example 24 Isolation of cDNA Clone Encoding Human PRO381

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA39651. Based on the DNA39651 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO381.

One pair synthesized PCR primers (forward and reverse):

Omnidirectional PCR primer 5'-CTTTCCTTGCTTCAGCAACATGAGGC-3 '(SEQ ID NO: 146)

Reverse PCR Primer 5'-GCCCAGAGCAGGAGGAATGATGAGC-3 '(SEQ ID NO: 147)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA39651.

Hybridization probe

5'-GTGGAACGCGGTCTTGACTCTGTTCGTCACTTCTTTGATTGGGGCTTTG-3 '(SEQ ID NO: 148)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO381 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO381 (herein referred to as UNQ322 (DNA44194-1317)) (SEQ ID NO: 144) and the protein sequence of PRO381 derived therefrom.

The full nucleotide sequence of UNQ322 (DNA44194-1317) is shown in FIG. 52 (SEQ ID NO: 144). Clone UNQ322 (DNA44194-1317) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 174-176 and terminates at the stop codon at nucleotide positions 807-809 (Figure 52). The expected polypeptide precursor is 211 amino acids long (Figure 53). The full-length PRO381 protein shown in FIG. 53 has an estimated molecular weight of about 24,172 Daltons and a pi of about 5.99. Analyzing the full length PRO381 sequence shown in FIG. 53 (SEQ ID NO: 145), the signal peptide of about amino acid 1 to about amino acid 20, the potential N-glycosylation site of about amino acid 176 to about amino acid 179, about amino acid 143 to about amino acid 146, about amino acid 156 to about amino acid 159, about amino acid 178 to about amino acid 181, and about amino acid 200 to about amino acid 203, the potential casein kinase II phosphorylation site, about vesicle target sequence of about amino acid 208 to about amino acid 211, about amino acid 78 to FKBP-type peptidyl-prolyl cis-trans isomerase site of about amino acid 114 and about amino acid 118 to about amino acid 131, about amino acid 191 to about amino acid 203, about amino acid 184 to about amino acid 203, and about amino acid 140 to about amino acid 159 EF-hand calcium binding domains, and S-100 / ICa of about amino acids 183 to about amino acid 203 The presence of BP type calcium binding domains was demonstrated. The clone UNQ322 (DNA44194-1317) was deposited with the ATCC on April 28, 1998, and was assigned ATCC Accession No. 209808.

Amino acid sequence analysis of the full-length PRO381 polypeptide suggests that this sequence has significant sequence similarity with the FKBP immunophilin protein, thus indicating that PRO381 may be a novel FKBP immunophilin homolog. More specifically, analysis of the Dayhof database (version 35.45 Swiss Prot 35) shows significant differences between the PRO381 amino acid sequence and the Dayhof sequence of AF040252_1, I49669, P_R93551, S71238, CELC05C8_1, CEU27353_1, MIP_TRYCR, CEZC455_3, FKB4_HUMAN, and I40718. It was proved to be same-sex.

Example 25 Isolation of cDNA Clones Encoding Human PRO386

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA40674. Two EST sequences owned by Genentech were used for consensus sequence assembly, and these EST sequences are referred to herein as DNA23350 (FIG. 56, SEQ ID NO: 151) and DNA23536 (FIG. 57, SEQ ID NO: 152). Based on the DNA40674 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO386.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-ACGGAGCATGGAGGTCCACAGTAC-3 '(SEQ ID NO: 153)

Reverse PCR primer 5'-GCACGTTTCTCAGCATCACCGAC-3 '(SEQ ID NO: 154)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA40674.

Hybridization probe

5'-CGCCTGCCCTGCACCTTCAACTCCTGCTACACAGTGAACCACAAACAGTT-3 '(SEQ ID NO: 155)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO386 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from brain tissue of human fetus (LIB153).

DNA sequence analysis of clones isolated as described above gave the full length DNA sequence of PRO386 (herein referred to as UNQ326 (DNA45415-1318)) (SEQ ID NO: 149) and the protein sequence of PRO386 derived therefrom.

The full nucleotide sequence of UNQ326 (DNA45415-1318) is shown in FIG. 54 (SEQ ID NO: 149). Clone UNQ326 (DNA45415-1318) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 146-148 and terminates at the stop codon at nucleotide positions 791-793 (Figure 54). The expected polypeptide precursor is 215 amino acids long (Figure 55). The full-length PRO386 protein shown in FIG. 55 was estimated to have a molecular weight of about 24,326 and a pi of about 6.32. Analyzing the full length PRO386 sequence shown in FIG. 55 (SEQ ID NO: 150), the signal peptide of about amino acid 1 to about amino acid 20, the transmembrane domain of about amino acid 161 to about amino acid 179, and the immuno of about amino acid 83 to about amino acid 127 The presence of globulin-like folds and potential N-glycosylation sites of about amino acids 42 to about amino acids 45, about amino acids 66 to about amino acids 69, and about amino acids 74 to about amino acids 77 has been demonstrated. The clone UNQ326 (DNA45415-1318) was deposited with the ATCC on April 28, 1998, and was assigned ATCC Accession No. 209810.

Amino acid sequence analysis of the full length PRO386 polypeptide suggests that this sequence has significant sequence similarity with the sodium channel beta-2 subunit, thus suggesting that PRO386 may be a novel homolog thereof. More specifically, analysis of the Dayhof database (version 35.45 Swiss Prot 35) shows significant differences between the PRO386 amino acid sequence and the Dayhof sequences of A57843, MYP0_HUMAN, GEN14531, JC4024, HS46KDA_1, HSU90716_1, D86996_2, MUSIGLVD_1, DMU42768_1 and S19247. It was proved to be same-sex.

Example 26 Isolation of cDNA Clone Encoding Human PRO540

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA39631. Based on the DNA39631 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO540.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-CTGGGGCTACACACGGGGTGAGG-3 '(SEQ ID NO: 158)

Reverse PCR primer 5'-GGTGCCGCTGCAGAAAGTAGAGCG-3 '(SEQ ID NO: 159)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA40654.

Hybridization probe

5'-GCCCCAAATGAAAACGGGCCCTACTTCCTGGCCCTCCGCGAGATG-3 '(SEQ ID NO: 160)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO540 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above yielded the full-length DNA sequence of PRO540 (herein referred to as UNQ341 (DNA44189-1322)) (SEQ ID NO: 156) and the protein sequence of PRO540 derived therefrom.

The full nucleotide sequence of UNQ341 (DNA44189-1322) is shown in FIG. 58 (SEQ ID NO: 156). Clone UNQ341 (DNA44189-1322) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 21-23 and terminates at the stop codon at nucleotide positions 1257-1259 (FIG. 58). The expected polypeptide precursor is 412 amino acids long (FIG. 59). The full-length PRO540 protein shown in FIG. 59 has an estimated molecular weight of about 46,658 Daltons and a pI of about 6.65. Important regions of the amino acid sequence of PRO540 included signal peptides, potential N-glycosylation sites, potential lipid substrate binding sites, typical sequences of lipase and serine proteases, and beta-transducin family Trp-Asp repeats. The clone UNQ341 (DNA44189-1322) was deposited with the ATCC and assigned the ATCC Accession No. 209699.

Example 27 Isolation of cDNA Clones Encoding Human PRO615

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA42240. Based on the DNA42240 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO615.

Forward and reverse PCR primer pairs were synthesized:

Omnidirectional PCR primer 5'-TGGTCTTCGCCTTGATCGTGTTCT-3 '(SEQ ID NO: 163)

Omnidirectional PCR primer 5'-GTGTACTGAGCGGCGGTTAG-3 '(SEQ ID NO: 164)

Reverse PCR primer 5'-CTGAAGGTGATGGCTGCCCTCAC-3 '(SEQ ID NO: 165)

Reverse PCR primer 5'-CCAGGAGGCTCATGGGAAAGTCC-3 '(SEQ ID NO: 166)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA42240.

Hybridization probe

5'-CCACGAGTCTAAGCAGATGTACTGCGTGTTCAACCGCAACGAGGATGCCT-3 '(SEQ ID NO: 167)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Thereafter, clones encoding the PRO615 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from human bone marrow tissue (LIB255).

DNA sequence analysis of clones isolated as described above gave the full length DNA sequence of PRO615 (herein referred to as UNQ352 (DNA48304-1323)) (SEQ ID NO: 161) and the protein sequence of PRO615 derived therefrom.

The full nucleotide sequence of UNQ352 (DNA48304-1323) is shown in FIG. 60 (SEQ ID NO: 161). Clone UNQ352 (DNA48304-1323) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 51-53 and terminates at the stop codon at nucleotide positions 723-725 (FIG. 60). The predicted polypeptide precursor is 224 amino acids long (Figure 61). The full-length PRO615 protein shown in FIG. 61 was estimated to have a molecular weight of about 24,810 Daltons and a pi of about 4.75. An important region of the amino acid sequence of PRO615 is the type II transmembrane domain of about amino acid 24 to about amino acid 43, about amino acid 74 to about amino acid 90, about amino acid 108 to about amino acid 126 and other transmembrane of about amino acid 145 to about amino acid 161, respectively. Domain, and a potential N-glycosylation site of about amino acid 97 to about amino acid 100. The clone UNQ352 (DNA48304-1323) was deposited with the ATCC and assigned the ATCC Accession No. 209811.

Example 28 Isolation of cDNA Clone Encoding Human PRO618

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA30900. Based on the DNA30900 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO618.

Forward and reverse PCR primer pairs were synthesized:

Omnidirectional PCR primer 5'-TAACAGCTGCCCACTGCTTCCAGG-3 '(SEQ ID NO: 171)

Reverse PCR primer 5'-TAATCCAGCAGTGCAGGCCGGG-3 '(SEQ ID NO: 172)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA30900.

Hybridization probe

5'-ATGGCCTCCACGGTGCTGTGGACCGTGTTCCTGGGCAAGGTGTGGCAGAA-3 '(SEQ ID NO: 173)

The library described above was screened to obtain a portion of the cDNA clone referred to herein as DNA35597 (SEQ ID NO: 170). This sequence was stretched using repeated cycles of BLAST and phrap to obtain the nucleotide sequence referred to herein as DNA43335. Next, primers based on the DNA43335 consensus sequence were prepared as follows.

Omnidirectional PCR primer 5'-TGCCTATGCACTGAGGAGGCAGAAG-3 '(SEQ ID NO: 174)

Reverse PCR Primer 5'-AGGCAGGGACACAGAGTCCATTCAC-3 '(SEQ ID NO: 175)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA43335.

Hybridization probe

5'-AGTATGATTTGCCGTGCACCCAGGGCCAGTGGACGATCCAGAACAGGAGG-3 '(SEQ ID NO: 176)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Thereafter, clones encoding the PRO618 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from liver tissue of human fetus (LIB229).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO618 (herein referred to as UNQ354 (DNA49152-1324)) (SEQ ID NO: 168) and the protein sequence of PRO618 derived therefrom.

The full nucleotide sequence of UNQ354 (DNA49152-1324) is shown in FIG. 62 (SEQ ID NO: 168). Clone UNQ354 (DNA49152-1324) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 73-75 and terminates at the stop codon at nucleotide positions 2479-2481 (FIG. 62). The expected polypeptide precursor is 802 amino acids long (FIG. 63). The full-length PRO618 protein shown in FIG. 63 was estimated to have a molecular weight of about 88,846 Daltons and a pi of about 6.41. Important regions of the amino acid sequence of PRO618 include the type II transmembrane domain, the typical sequence of the protease, trypsin family, histidine active site, multiple N-glycosylation sites, two typical sequences of the Kringle domain, the Kallikrein light chain and sequence Two regions with similarity and a region with sequence similarity to the low density lipoprotein receptor. The clone UNQ354 (DNA49152-1324) was deposited with the ATCC and assigned the ATCC Accession No. 209813.

Example 29 Isolation of cDNA Clone Encoding Human PRO719

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA44851. Based on the DNA44851 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO719.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-GTGAGCATGAGCGAGCCGTCCAC-3 '(SEQ ID NO: 179)

Reverse PCR primer 5'-GCTATTACAACGGTTCTTGCGGCAGC-3 '(SEQ ID NO: 180)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA44851.

Hybridization probe

5'-TTGACTCTCTGGTGAATCAGGACAAGCCGAGTTTTGCCTTCCAG-3 '(SEQ ID NO: 181)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Thereafter, clones encoding the PRO719 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from human placental tissue (LIB90).

DNA sequence analysis of clones isolated as described above gave the full length DNA sequence of PRO719 (herein referred to as UNQ387 (DNA49646-1327)) (SEQ ID NO: 177) and the protein sequence of PRO719 derived therefrom.

The full nucleotide sequence of UNQ387 (DNA49646-1327) is shown in FIG. 65 (SEQ ID NO: 177). Clone UNQ387 (DNA49646-1327) contains a single open reading frame that has a clear translation initiation site at nucleotide positions 223 to 225 and terminates at the stop codon at nucleotide positions 1285 to 1287 (FIG. 65). The expected polypeptide precursor is 354 amino acids long (FIG. 66). The full-length PRO719 protein shown in FIG. 66 has an estimated molecular weight of about 39,362 daltons and a pI of about 8.35. Analysis of the full length PRO719 sequence showed a signal peptide of about amino acid 1 to about amino acid 16, a lipase-related serine-containing active site of about amino acid 163 to about amino acid 172, and about amino acid as shown in FIG. 66 (SEQ ID NO: 178). The presence of two potential N-glycosylation sites, 80 to about amino acid 83 and about amino acid 136 to about amino acid 139, has been demonstrated. The clone UNQ387 (DNA49646-1327) was deposited with the ATCC on March 26, 1998, assigned the ATCC accession number 209705.

Amino acid sequence analysis of the full length PRO719 polypeptide suggests that this sequence has significant sequence similarity with the lipoprotein lipase H protein, thus indicating that PRO719 may be a novel lipoprotein lipase homologue. More specifically, analysis of the Deihof database (version 35.45 Swiss Prot 35) revealed significant differences between the PRO719 amino acid sequence and the Dayhof sequences of LIPL_HUMAN, LIPH_HUMAN, D83548_1, A24059_1, P_R30740, D88666_1, A43357, A46696, B43357 and A49488. It was proved to be same-sex.

Example 30 Isolation of cDNA Clone Encoding Human PRO724

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA35603. Based on the DNA35603 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO724.

PCR primer pairs (forward and reverse) were synthesized:

Omnidirectional PCR primer 1 5'-GGCTGTCACTGTGGAGACAC-3 '(SEQ ID NO: 184)

Omnidirectional PCR primer 2 5'-GCAAGGTCATTACAGCTG-3 '(SEQ ID NO: 185)

Reverse PCR primer 1 5'-AGAACATAGGAGCAGTCCCACTC-3 '(SEQ ID NO: 186)

Reverse PCR primer 2 5'-TGCCTGCTGCTGCACAATCTCAG-3 '(SEQ ID NO: 187)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA35603.

Hybridization probe

5'-GGCTATTGCTTGCCTTGGGACAGACCCTGTGGCTTAGGCTCTGGC-3 '(SEQ ID NO: 188)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO724 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from lung tissue of human fetus (LIB26).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO724 (herein referred to as UNQ389 (DNA49631-1328)) (SEQ ID NO: 182) and the protein sequence of PRO724 derived therefrom.

The full nucleotide sequence of UNQ389 (DNA49631-1328) is shown in FIG. 67 (SEQ ID NO: 182). Clone UNQ389 (DNA49631-1328) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 546 to 548 and terminates at the stop codon at nucleotide positions 2685 to 2687 (FIG. 67). The expected polypeptide precursor is 713 amino acids long (FIG. 68). The full-length PRO724 protein shown in FIG. 68 has an estimated molecular weight of about 76,193 Daltons and a pi of about 5.42. Analysis of the full length PRO724 sequence shown in FIG. 68 (SEQ ID NO: 183) shows a signal peptide of about amino acids 1 to about amino acid 16, a transmembrane domain of about amino acids 442 to about amino acids 462, and about amino acids 152 to about amino acids 171, about The presence of the LDL receptor class A domain region of amino acids 331 to about amino acid 350, about amino acid 374 to about amino acid 393 and about amino acid 411 to about amino acid 430 was demonstrated. The clone UNQ389 (DNA49631-1328) was deposited with the ATCC on April 28, 1998, and was assigned ATCC Accession No. 209806.

Amino acid sequence analysis of the full-length PRO724 polypeptide suggests that this sequence has significant sequence similarity with human LDL receptor proteins, thus indicating that PRO724 may be a novel LDL receptor homologue. More specifically, analysis of the Deihof database (version 35.45 Swiss Prot 35) shows significant differences between the PRO724 amino acid sequence and the dayhop sequences of P_R48547, MMAM2R_1, LRP2_RAT, P_R60517, P_R47861, P_R05533, A44513_1, A30363, P_R74692 and LMLIPOPHO_1. It was proved to be same-sex.

Example 31 Isolation of cDNA Clone Encoding Human PRO772

One cDNA sequence was isolated from the amylase screen described in Example 2 above, which cDNA sequence is referred to herein as DNA43509 (see FIG. 71). Based on the DNA43509 sequence, oligonucleotide probes were then prepared and used to screen the lung library of the human fetus (LIB25) prepared as described in the first paragraph of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D without the SfiI site; see Holmes et al., Science , 253 : 1278-1280 (1991)) and the cDNA was cut to a size less than 2800 bp.

A pair of PCR primers (forward and reverse) were synthesized based on the DNA43509 sequence:

Omnidirectional PCR primer 5'-CGTTTTGCAGAACCTACTCAGGCAG-3 '(SEQ ID NO: 192)

Reverse PCR Primer 5'-CCTCCACCAACTGTCAATGTTGTGG-3 '(SEQ ID NO: 193)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA43509.

Hybridization probe

5'-AAAGTGCTGCTGCTGGGTCTGCAGACGCGATGGATAACGT-3 '(SEQ ID NO: 194)

Using the primers and libraries described above, the full length clone comprises a single open reading frame that has an apparent translation initiation site at nucleotide positions 131-133 and terminates at the stop codon at nucleotide positions 587-589 (FIG. 69, SEQ ID NO: 189). The expected polypeptide precursor is 152 amino acids long, the molecular weight is calculated to be about 17,170 Daltons, and the pi is estimated to be about 9.62. Analysis of the full length PRO772 sequence shown in FIG. 70 (SEQ ID NO: 190) shows potential type II transmembrane domains of about amino acids 26 to about amino acids 42, about amino acids 44 to about amino acids 65, about amino acids 81 to about amino acids 101, and about The presence of leucine zipper pattern sequences of other potential transmembrane domains of amino acids 109 to about amino acid 129, about amino acids 78 to about amino acids 99 and about amino acids 85 to about amino acids 106, has been demonstrated. The clone UNQ410 (DNA49645-1347) was deposited with the ATCC on April 28, 1998, and was assigned ATCC Accession No. 209809.

Amino acid sequence analysis of the full-length PRO772 polypeptide suggests that this sequence has significant sequence similarity with human A4 protein, thus indicating that PRO772 can be a novel A4 protein homolog. More specifically, analysis of the Deihof database (version 35.45 Swiss Prot 35) shows a significant difference between the PRO772 amino acid sequence and the DH sequences between HSU93305_1, A4P_HUMAN, CELB0454_2, VPU_JSRV, CELC12D12_2, OCCM_AGRT1, LBPHIG1E_50, YIGK_ECOLI, S76245 and P_R50807. Same sex proved.

Example 32 Isolation of cDNA Clone Encoding Human PRO852

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA34364. Based on the DNA34364 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO852.

PCR primer pairs (forward and reverse) were synthesized:

Omnidirectional PCR primer 1 5'-CGCAGAAGCTACAGATTCTCG-3 '(SEQ ID NO: 197)

Omnidirectional PCR primer 2 5'-GGAAATTGGAGGCCAAAGC-3 '(SEQ ID NO: 198)

Omnidirectional PCR primer 3 5'-GGATGTAGCCAGCAACTGTG-3 '(SEQ ID NO: 199)

Omnidirectional PCR primer 4 5'-GCCTTGGCTCGTTCTCTTC-3 '(SEQ ID NO: 200)

Omnidirectional PCR primer 5 5'-GGTCCTGTGCCTGGATGG-3 '(SEQ ID NO: 201)

Reverse PCR primer 1 5'-GACAAGACTACCTCCGTTGGTC-3 '(SEQ ID NO: 202)

Reverse PCR primer 2 5'-TGATGCACAGTTCAGCACCTGTTG-3 '(SEQ ID NO: 203)

In addition, synthetic oligonucleotide hybridization probes with the following nucleotide sequences were prepared from consensus sequence DNA34364.

Hybridization probe

5'-CGCTCCAAGGGCTTTGACGTCACAGTGAAGTACACACAAGGAAGCTG-3 '(SEQ ID NO: 204)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO852 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB228).

DNA sequence analysis of clones isolated as described above gave the full length DNA sequence of PRO852 (herein referred to as UNQ418 (DNA45493-1349)) (SEQ ID NO: 195) and the protein sequence of PRO852 derived therefrom.

The full nucleotide sequence of UNQ418 (DNA45493-1349) is shown in FIG. 72 (SEQ ID NO: 195). Clone UNQ418 (DNA45493-1349) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 94-96 and terminates at a stop codon at nucleotide positions 16748-1650 (FIG. 72). The expected polypeptide precursor is 518 amino acids long (FIG. 73). The full-length PRO852 protein shown in FIG. 73 had an estimated molecular weight of about 56,180 Daltons and a pi of about 5.08. Analysis of the full length PRO852 sequence shown in FIG. 73 (SEQ ID NO: 196) showed a signal peptide of about amino acids 1 to about amino acid 20, a transmembrane domain of about amino acids 466 to about amino acids 494, about 170 to about amino acids 173, and about amino acids. 366 to about amino acid 369 potential N-glycosylation sites, about amino acids 10 to about amino acids 31 and leucine zipper sequence pattern blocks of about amino acids 197 to about amino acids 218, and about amino acids 109 to about amino acids 118, about amino acids 252 to The presence of amino acid blocks homologous to aspartyl proteases of eukaryotic and viral amino acids 261 and about amino acids 298 to about amino acid 310 has been demonstrated. The clone UNQ418 (DNA45493-1349) was deposited with the ATCC on April 28, 1998, assigned the ATCC accession number 209805.

Amino acid sequence analysis of the full-length PRO852 polypeptide suggests that this sequence has significant sequence similarity with various protease proteins, thus indicating that PRO852 may be a novel protease or homolog thereof. More specifically, analysis of the Dayhof database (version 35.45 Swiss Prot 35) shows significant differences between the PRO852 amino acid sequence and the Dayhof sequence of PEPC_HUMAN, S66516, S66517, PEPE_CHICK, CATD_HUMAN, P_R74207, CARP_YEAST, PEP2_RABIT, CATE_HUMAN and RENI_MOUSE. It was proved to be same-sex.

Example 33 Isolation of cDNA Clone Encoding Human PRO853

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA43050. Based on the DNA43050 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR and 2) as a probe to isolate a clone of the full-length coding sequence of PRO853.

Forward and reverse PCR primer pairs were synthesized:

Omnidirectional PCR primer 5'-CTTCATGGCCTTGGACTTGGCCAG-3 '(SEQ ID NO: 207)

Reverse PCR primer 5'-ACGCCAGTGGCCTCAAGCTGGTTG-3 '(SEQ ID NO: 208)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA43050.

Hybridization probe

5'-CTTTCTGAGCTCTGAGCCACGGTTGGACATCCTCATCCACAATGC-3 '(SEQ ID NO: 209)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO853 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB228).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence (SEQ ID NO: 205) of PRO853 (herein referred to as UNQ419 (DNA48227-1350)) and the protein sequence of PRO853 derived therefrom.

The full nucleotide sequence of UNQ419 (DNA48227-1350) is shown in FIG. 74 (SEQ ID NO: 205). Clone UNQ419 (DNA48227-1350) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 128-130 and terminates at the stop codon at nucleotide positions 1259-1261 (FIG. 74). The expected polypeptide precursor is 377 amino acids long (FIG. 75). The full-length PRO853 protein shown in FIG. 75 had an estimated molecular weight of about 40,849 Daltons and a pi of about 7.98. An important region of the amino acid sequence of PRO853 is a signal peptide of about amino acid 1 to about amino acid 16 in SEQ ID NO: 206, a glycosaminoglycan attachment site of about amino acid 46 to about amino acid 49 in SEQ ID NO: 206, and about amino acid 37 in SEQ ID NO: 206, respectively. Two typical sequences of the short chain alcohol dehydrogenase family of from about amino acid 49 to about amino acid 114 to about amino acid 124. The clone UNQ419 (DNA48227-1350) was deposited with the ATCC and assigned the ATCC Accession No. 209812.

Example 34 Isolation of cDNA Clone Encoding Human PRO860

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA38137. Based on the DNA38137 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO860.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-GAAGGGACCTACATGTGTGTGGCC-3 '(SEQ ID NO: 212)

Reverse PCR Primer 5'-ACTGACCTTCCAGCTGAGCCACAC-3 '(SEQ ID NO: 213)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA40654.

Hybridization probe

5'-AGGACTACACGGAGCCTGTGGAGCTTCTGGCTGTGCGAATTCAGCTGGAA-3 '(SEQ ID NO: 214)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Thereafter, clones encoding the PRO860 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from lung tissue of human fetus (LIB26).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence (SEQ ID NO: 210) of PRO860 (herein referred to as UNQ421 (DNA41404-1352)) and the protein sequence of PRO860 derived therefrom.

The full nucleotide sequence of UNQ421 (DNA41404-1352) is shown in FIG. 76 (SEQ ID NO: 210). Clone UNQ421 (DNA41404-1352) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 58 to 60 and terminates at the stop codon at nucleotide positions 3013 to 3015 (FIG. 76). The expected polypeptide precursor is 985 amino acids in length (FIG. 77). The full-length PRO860 protein shown in FIG. 77 has an estimated molecular weight of about 105,336 Daltons and a pI of about 6.55. Important regions of the amino acid sequence of PRO860 include the transmembrane domain of about amino acids 448 to about amino acid 467, the extracellular domain of about amino acids 1 to about amino acid 447, several N-glycosylation sites, numerous N-myristoylation sites and phospho Typical sequences of tyrosine interacting domain proteins were included. The clone UNQ421 (DNA41404-1352) was deposited with the ATCC and assigned the ATCC Accession No. 209844.

Example 35 Isolation of cDNA Clones Encoding Human PRO846

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA39949. Based on the DNA39949 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO846.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-CCCTGCAGTGCACCTACAGGGAAG-3 '(SEQ ID NO: 217)

Reverse PCR primer 5'-CTGTCTTCCCCTGCTTGGCTGTGG-3 '(SEQ ID NO: 218)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA39949.

Hybridization probe

5'-GGTGCAGGAAGGGTGGGATCCTCTTCTCTCGCTGCTCTGGCCACATC-3 '(SEQ ID NO: 219)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO846 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above gave the full length DNA sequence of PRO846 (herein referred to as UNQ422 (DNA44196-1353)) (SEQ ID NO: 215) and the protein sequence of PRO846 derived therefrom.

The full nucleotide sequence of UNQ422 (DNA44196-1353) is shown in FIG. 78 (SEQ ID NO: 215). Clone UNQ422 (DNA44196-1353) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 25-27 and terminates at the stop codon at nucleotide positions 1021-1023 (Figure 78). The expected polypeptide precursor is 332 amino acids long (FIG. 79). The full-length PRO846 protein shown in FIG. 79 has an estimated molecular weight of about 36,143 Daltons and a pi of about 5.89. An important region of the amino acid sequence of PRO846 is typical of signal peptides, transmembrane domains, N-glycosylation sites, fibrinogen beta and gamma chain C-terminal domains, and Ig-like V-type domains, as shown in FIG. 79. Sequence was included. Clone UNQ422 (DNA44196-1353) was deposited with ATCC and assigned ATCC Accession No. 209847.

Example 36 Isolation of cDNA Clones Encoding Human PRO862

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA47370. Based on the DNA47370 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO862.

Forward and reverse PCR primers were synthesized:

Omnidirectional PCR primer 5'GGGATCATGTTGTTGGCCCTGGTC-3 '(SEQ ID NO: 222)

Reverse PCR Primer 5'-GCAAGGCAGACCCAGTCAGCCAG-3 '(SEQ ID NO: 223)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA47370.

Hybridization probe

5'-CTGCCTGCTACCCTCCAAGTGAGGCCAAGCTCTACGGTCGTTGTG-3 '(SEQ ID NO: 225)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO862 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from human pancreatic tissue (LIB55).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO862 (herein referred to as UNQ424 (DNA52187-1354)) (SEQ ID NO: 220) and the protein sequence of PRO862 derived therefrom.

The full nucleotide sequence of UNQ424 (DNA52187-1354) is shown in FIG. 80 (SEQ ID NO: 220). Clone UNQ424 (DNA52187-1354) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 410-412 and terminates at a stop codon at nucleotide positions 848-850 (Figure 80). The expected polypeptide precursor is 146 amino acids long (FIG. 81). The full-length PRO862 protein shown in FIG. 81 has an estimated molecular weight of about 16,430 Daltons and a pi of about 5.05. Important regions of the amino acid sequence of PRO862 included sequences with similarities to signal peptides, N-myristoylation sites, and alpha-lactalbumin / lysozyme C protein regions, as shown in FIG. The clone UNQ424 (DNA52187-1354) was deposited with the ATCC and assigned the ATCC accession number 209845.

Example 37 Isolation of cDNA Clones Encoding Human PRO864

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA40666. Based on the DNA40666 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO864.

Forward and reverse PCR primers were synthesized:

Omnidirectional PCR primer 5'-GCTGCAGCTGCAAATTCCACTGG-3 '(SEQ ID NO: 227)

Reverse PCR Primer 5'-TGGTGGGAGACTGTTTAAATTATCGGCC-3 '(SEQ ID NO: 228)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA40666.

Hybridization probe

5'-TGCTTCGTCAAGTGCCGGCAGTGCCAGCGGCTCGTGGAGTT-3 '(SEQ ID NO: 229)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO864 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from brain tissue of human fetus (LIB153).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO864 (herein referred to as UNQ426 (DNA48328-1355)) (SEQ ID NO: 225) and the protein sequence of PRO864 derived therefrom.

The full nucleotide sequence of UNQ426 (DNA48328-1355) is shown in FIG. 82 (SEQ ID NO: 225). Clone UNQ426 (DNA48328-1355) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 37 to 39 and terminates at the stop codon at nucleotide positions 1090 to 1092 (FIG. 82). The expected polypeptide precursor is 351 amino acids long (FIG. 83). The full-length PRO864 protein shown in FIG. 83 was estimated to have a molecular weight of about 39,052 Daltons and a pi of about 8.97. An important region of the amino acid sequence of PRO864 included a sequence of sequences homologous to the signal peptide, two N-glycosylation sites, the Wnt-1 feature sequence, and the Wnt-1 protein as shown in FIG. 83. The clone UNQ426 (DNA48328-1355) was deposited with the ATCC and assigned the ATCC Accession No. 209843.

Example 38 Isolation of cDNA Clones Encoding Human PRO792

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA38106. Based on the DNA38106 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO792.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-GCGAGAACTGTGTCATGATGCTGC-3 '(SEQ ID NO: 232)

Reverse PCR primer 5'-GTTTCTGAGACTCAGCAGCGGTGG-3 '(SEQ ID NO: 233)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA38106.

Hybridization probe

5'-CACCGTGTGACAGCGAGAAGGACGGCTGGATCTGTGAGAAAAGGCACAAC-3 '(SEQ ID NO: 234)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO792 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from human bone marrow tissue (LIB255).

DNA sequence analysis of clones isolated as described above gave the full length DNA sequence of PRO792 (herein referred to as UNQ431 (DNA56352-1358)) (SEQ ID NO: 230) and the protein sequence of PRO792 derived therefrom.

The full nucleotide sequence of UNQ431 (DNA56352-1358) is shown in FIG. 84 (SEQ ID NO: 230). Clone UNQ431 (DNA56352-1358) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 67 to 69 and terminates at the stop codon at nucleotide positions 946 to 948 (FIG. 84). The expected polypeptide precursor is 293 amino acids long (FIG. 85). The full-length PRO792 protein shown in FIG. 85 was estimated to have a molecular weight of about 32,562 Daltons and a pI of about 6.53. Analysis of the full length PRO792 sequence shown in FIG. 85 (SEQ ID NO: 231) revealed a potential N of the type II transmembrane domain of about amino acid 31 to about amino acid 54, about amino acid 73 to about amino acid 76, and about amino acid 159 to about amino acid 162. A leucine zipper amino acid sequence pattern of glycosylation site, about amino acid 102 to about amino acid 123, about amino acid 18 to about amino acid 23, about amino acid 133 to about amino acid 138, and potential N-myristo of about amino acid 242 to about amino acid 247 The presence of anecdotal sites and C-type lectin domain feature blocks of about amino acids 264 to about amino acids 287 was demonstrated. The clone UNQ431 (DNA56352-1358) was deposited with the ATCC on May 6, 1998, assigned the ATCC accession number 209846.

Amino acid sequence analysis of the full-length PRO792 polypeptide suggests that this sequence has significant sequence similarity with the CD23 protein, thus indicating that PRO792 may be a novel CD23 homolog. More specifically, analysis of the Deihof database (version 35.45 Swiss Prot 35) revealed significant phase differences between the PRO792 amino acid sequence and the Dayhof sequences of S34198, A07100_1, A05303_1, P_R41689, P_P82839, A10871_1, P_R12796, P_R47199, A46274 and P_R32188. It was proved to be same-sex.

Example 39 Isolation of cDNA Clones Encoding Human PRO866

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA44708. Based on the DNA44708 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR and 2) as a probe to isolate a clone of the full-length coding sequence of PRO866.

PCR primer pairs (forward and reverse) were synthesized:

Omnidirectional PCR primer 1 5'-CAGCACTGCCAGGGGAAGAGGG-3 '(SEQ ID NO: 237)

Omnidirectional PCR primer 2 5'-CAGGACTCGCTACGTCCG-3 '(SEQ ID NO: 238)

Omnidirectional PCR primer 3 5'-CAGCCCCTTCTCCTCCTTTCTCCC-3 '(SEQ ID NO: 239)

Reverse PCR primer 1 5'-GCAGTTATCAGGGACGCACTCAGCC-3 '(SEQ ID NO: 240)

Reverse PCR primer 2 5'-CCAGCGAGAGGCAGATAG-3 '(SEQ ID NO: 241)

Reverse PCR primer 3 5'-CGGTCACCGTGTCCTGCGGGATG-3 '(SEQ ID NO: 242)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA44708.

Hybridization probe

5'-CAGCCCCTTCTCCTCCTTTCTCCCACGTCCTATCTGCCTCTC-3 '(SEQ ID NO: 243)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO866 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB228).

DNA sequence analysis of clones isolated as described above yielded the full-length DNA sequence of PRO866 (herein referred to as UNQ435 (DNA53971-1359)) (SEQ ID NO: 235) and the protein sequence of PRO866 derived therefrom.

The full nucleotide sequence of UNQ435 (DNA53971-1359) is shown in FIG. 86 (SEQ ID NO: 235). Clone UNQ435 (DNA53971-1359) contains a single open reading frame that has a clear translation initiation site at nucleotide positions 257 to 277 and terminates at the stop codon at nucleotide positions 1268 to 1270 (FIG. 86). The expected polypeptide precursor is 331 amino acids long (FIG. 87). The full-length PRO866 protein shown in FIG. 87 had an estimated molecular weight of about 35,844 Daltons and a pi of about 5.45. Analysis of the full length PRO866 sequence shown in FIG. 87 (SEQ ID NO: 236) demonstrated the presence of a signal peptide of about amino acid 1 to about amino acid 26. The clone UNQ435 (DNA53971-1359) was deposited with the ATCC on April 7, 1998, assigned the ATCC accession number 209750.

Amino acid sequence analysis of the full-length PRO866 polypeptide suggests that this sequence has significant sequence similarity with proteins of the Mindin / Spondin family, thus indicating that PRO866 may be a novel mindine homolog. More specifically, analysis of the Deihof database (version 35.45 Swiss Prot 35) shows significant differences between the PRO866 amino acid sequence and the Dayhof sequences of AB006085_1, AB006084_1, AB006086_1, AF017267_1, CWU42213_1, AC004160_1, CPMICRP_1, S49108, A48569 and I46687 It was proved to be same-sex.

Example 40 Isolation of cDNA Clones Encoding Human PRO871

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA40324. Based on the DNA40324 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR and 2) as a probe to isolate a clone of the full-length coding sequence of PRO871.

PCR primer pairs (forward and reverse) were synthesized:

Omnidirectional PCR primer 1 5'-TGCGGAGATCCTACTGGCACAGGG-3 '(SEQ ID NO: 246)

Omnidirectional PCR primer 2 5'-CGAGTTAGTCAGAGCATG-3 '(SEQ ID NO: 247)

Omnidirectional PCR primer 3 5'-CAGATGGTGCTGTTGCCG-3 '(SEQ ID NO: 248)

Reverse PCR primer 1 5'-CAACTGGAACAGGAACTGAGATGTGGATC-3 '(SEQ ID NO: 249)

Reverse PCR primer 2 5'-CTGGTTCAGCAGTGCAAGGGTCTG-3 '(SEQ ID NO: 250)

Reverse PCR primer 3 5'-CCTCTCCGATTAAAACGC-3 '(SEQ ID NO: 251)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA40324.

Hybridization probe

5'-GAGAGGACTGGTTGCCATGGCAAATGCTGGTTCTCATGATAATGG-3 '(SEQ ID NO: 252)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO871 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above yielded the full-length DNA sequence of PRO871 (herein referred to as UNQ438 (DNA50919-1361)) (SEQ ID NO: 244) and the protein sequence of PRO871 derived therefrom.

The full nucleotide sequence of UNQ438 (DNA50919-1361) is shown in FIG. 88 (SEQ ID NO: 244). Clone UNQ438 (DNA50919-1361) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 191-193 and terminates at the stop codon at nucleotide positions 1607-1609 (FIG. 88). The expected polypeptide precursor is 472 amino acids long (FIG. 89). The full-length PRO871 protein shown in FIG. 89 has an estimated molecular weight of about 53,847 Daltons and a pi of about 5.75. Analysis of the full-length PRO871 sequence shown in FIG. 89 (SEQ ID NO: 245) shows potential N-glycosylation of signal peptides from about amino acid 1 to about amino acid 21, from about amino acid 109 to about amino acid 112, and from about amino acid 201 to about amino acid 204. Moiety, cyclophilin-type peptidi-prolyl cis-trans isomerase feature sequence of about amino acids 49 to about amino acid 66, and about amino acid 96 to about amino acid 140, about amino acid 49 to about amino acid 89, and about amino acid 22 to The presence of a region homologous to the cyclophylline-type peptidi-prolyl cis-trans isomerase of about amino acid 51 was demonstrated. The clone UNQ438 (DNA50919-1361) was deposited with the ATCC on May 6, 1998, assigned the ATCC accession number 209848.

Amino acid sequence analysis of the full-length PRO871 polypeptide suggests that this sequence has significant sequence similarity with the proteins of the cyclophilin family, thus indicating that PRO871 may be a member of the novel cyclophilin protein family. More specifically, the analysis of the Dayhof database (version 35.45 Swiss Prot 35) shows that between the PRO871 amino acid sequence and SPBC16H5_5, S64705, YAL5_SCHPO, CYP4_CAEEL, CELC34D4_7, CYPA_CAEEL, HUMORF006_1, CYPI_MYCTU, AF043642_1 and HSSRCYP_1 It was proved to be same-sex.

Example 41 Isolation of cDNA Clone Encoding Human PRO873

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA39621. Based on the DNA39621 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO873.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-AGGTGCCTGCAGGAGTCCTGGGG-3 '(SEQ ID NO: 255)

Reverse PCR primer 5'-CCACCTCAGGAAGCCGAAGATGCC-3 '(SEQ ID NO: 256)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA39621.

Hybridization probe

5'-GAACGGTACAAGTGGCTGCGCTTCAGCGAGGACTGTCTGTACCTG-3 '(SEQ ID NO: 257)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO873 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from liver tissue of human fetus (LIB229).

DNA sequence analysis of clones isolated as described above yielded the full-length DNA sequence (SEQ ID NO: 253) of PRO873 (herein referred to as UNQ440 (DNA44179-1362)) and the protein sequence of PRO873 derived therefrom.

The full nucleotide sequence of UNQ440 (DNA44179-1362) is shown in FIG. 90 (SEQ ID NO: 253). Clone UNQ440 (DNA44179-1362) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 139 to 141 and terminates at the stop codon at nucleotide positions 1774 to 1776 (FIG. 90). The expected polypeptide precursor is 545 amino acids long (FIG. 91). The full-length PRO873 protein shown in FIG. 91 has an estimated molecular weight of about 58,934 Daltons and a pi of about 9.45. Analysis of the full length PRO873 sequence shown in FIG. 91 (SEQ ID NO: 254) shows a signal peptide of about amino acid 1 to about amino acid 29, a carboxyesterase type-B serine active site of about amino acid 312 to about amino acid 327, about amino acid. Carboxyesterase type-B feature 2 motifs of 218 to about amino acid 228, and three potential N- of about amino acid 318 to about amino acid 321, about amino acid 380 to about amino acid 383, and about amino acid 465 to about amino acid 468 The presence of glycosylation sites has been demonstrated. The clone UNQ440 (DNA44179-1362) was deposited with the ATCC on May 6, 1998, assigned the ATCC accession number 209851.

Amino acid sequence analysis of the full-length PRO873 polypeptide suggests that this sequence has significant sequence similarity with carboxyl esterases between humans, thus indicating that PRO873 may be a novel carboxyesterase. More specifically, analysis of the Dayhof database (version 35.45 Swiss Prot 35) shows significant differences between the PRO873 amino acid sequence and the Dayhof sequences of ES10_RAT, GEN12405, AB010633_1, EST4_RAT, A48809, SASB_ANAPL, RNU41662_1, RNU22952_1, BAL_RAT, GEN13522. It was proved to be same-sex.

Example 42 Isolation of cDNA Clone Encoding Human PRO940

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA47442. Based on the DNA47442 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO940.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-CAAAGCCTGCGCCTGGTCTGTG-3 '(SEQ ID NO: 260)

Reverse PCR Primer 5'-TTCTGGAGCCCAGAGGGTGCTGAG-3 '(SEQ ID NO: 262)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA47442.

Hybridization probe

5'-GGAGCTGCCACCCATTCAAATGGAGCACGAAGGAGAGTTCACCTG-3 '(SEQ ID NO: 263)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Thereafter, clones encoding the PRO940 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from liver tissue of human fetus (LIB229).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO940 (herein referred to as UNQ477 (DNA54002-1367)) (SEQ ID NO: 258) and the protein sequence of PRO940 derived therefrom.

The full nucleotide sequence of UNQ477 (DNA54002-1367) is shown in FIG. 92 (SEQ ID NO: 258). Clones UNQ477 (DNA54002-1367) contain a single open reading frame that has an apparent translation initiation site at nucleotide positions 46-48 and terminates at the stop codon at nucleotide positions 1678-1680 (FIG. 92). The expected polypeptide precursor is 544 amino acids in length (FIG. 93). The full-length PRO940 protein shown in FIG. 93 has an estimated molecular weight of about 60,268 Daltons and a pi of about 9.53. Analyzing the full length PRO940 sequence shown in FIG. 93 (SEQ ID NO: 259), the signal peptide of about amino acid 1 to about amino acid 15, about amino acid 100 to about amino acid 103, about amino acid 297 to about amino acid 300, and about amino acid 306 to about amino acid Potential N-glycosylation sites of 309 and immunoglobulin and major histocompatibility feature sequence blocks of about amino acids 365 to about amino acids 371 have been demonstrated. The clone UNQ477 (DNA54002-1367) was deposited with the ATCC on April 7, 1998, assigned the ATCC accession number 209754.

Amino acid sequence analysis of the full-length PRO940 polypeptide suggests that this sequence has significant sequence similarity with CD33 and OB binding protein-2. More specifically, analysis of the Deihof database (version 35.45 Swiss Prot 35) showed significant differences between the PRO940 amino acid sequence and the D. apex sequence of CD33_HUMAN, HSU71382_1, HSU71383_1, D86359_1, PGBM_HUMAN, MAGS_MOUSE, D86983_1, C22B_HUMAN, P_W01002 and HVU24116_1. It was proved to be same-sex.

Example 43 Isolation of cDNA Clone Encoding Human PRO941

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA35941. Based on the DNA35941 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO941.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-CTTGACTGTCTCTGAATCTGCACCC-3 '(SEQ ID NO: 266)

Reverse PCR primer 5'-AAGTGGTGGAAGCCTCCAGTGTGG-3 '(SEQ ID NO: 267)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA35941.

Hybridization probe

5'-CCACTACGGTATTAGAGCAAAAGTTAAAAACCATCATGGTTCCTGGAGCAGC-3 '(SEQ ID NO: 268)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO941 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above yielded the full-length DNA sequence of PRO941 (herein referred to as UNQ478 (DNA53906-1368)) (SEQ ID NO: 263) and the protein sequence of PRO941 derived therefrom.

The full nucleotide sequence of UNQ478 (DNA53906-1368) is shown in FIG. 94 (SEQ ID NO: 263). Clone UNQ478 (DNA53906-1368) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 37 to 39 and terminates at the stop codon at nucleotide positions 2353 to 2355 (FIG. 94). The expected polypeptide precursor is 772 amino acids in length (FIG. 95). The full-length PRO941 protein shown in FIG. 95 was estimated to have a molecular weight of about 87,002 Daltons and a pi of about 4.64. Analysis of the full-length PRO941 sequence shown in FIG. 95 (SEQ ID NO: 264) shows a signal peptide of about amino acid 1 to about amino acid 21, about amino acid 57 to about amino acid 60, about amino acid 74 to about amino acid 77, about amino acid 419 to about amino acid. 422, about amino acid 437 to about amino acid 440, about amino acid 508 to about amino acid 511, about amino acid 515 to about amino acid 518, about amino acid 516 to about amino acid 519, and about about 534 to about amino acid 537 a potential N-glycosylation site, And the presence of a cardherin extracellular repeat domain feature sequence of about amino acids 136 to about amino acid 146 and about amino acids 244 to about amino acid 254. The clone UNQ478 (DNA53906-1368) was deposited with the ATCC on April 7, 1998, assigned the ATCC accession number 209747.

Amino acid sequence analysis of the full-length PRO941 polypeptide suggests that this sequence has significant sequence similarity with the Cadherin protein, thus indicating that PRO941 may be a member of the novel Cadrin protein family. More specifically, analysis of the Deihof database (version 35.45 Swiss Prot 35) revealed significant differences between the PRO941 amino acid sequence and the Dayhof sequences of I50180, CADA_CHICK, I50178, GEN12782, CADC_HUMAN, P_W25637, A38992, P_R49731, D38992 and G02678. It was proved to be same-sex.

Example 44 Isolation of cDNA Clones Encoding Human PRO944

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA47374. Various EST sequences owned by Genentech were used for assembly, which are shown in FIGS. 99-107. Based on the DNA47374 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO944.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-CGAGCGAGTCATGGCCAACGC-3 '(SEQ ID NO: 280)

Reverse PCR primer 5'-GTGTCACACGTAGTCTTTCCCGCTGG-3 '(SEQ ID NO: 281)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA47374.

Hybridization probe

5'-CTGCAGCTGTTGGGCTTCATTCTCGCCTTCCTGGGATGGATCG-3 '(SEQ ID NO: 282)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO944 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above gave the full length DNA sequence of PRO944 (herein referred to as UNQ481 (DNA52185-1370)) (SEQ ID NO: 269) and the protein sequence of PRO944 derived therefrom.

The full nucleotide sequence of UNQ481 (DNA52185-1370) is shown in FIG. 97 (SEQ ID NO: 269). Clone UUNQ481 (DNA52185-1370) contains a single open reading frame that has a clear translation initiation site at nucleotide positions 219-221 and terminates at the stop codon at nucleotide positions 852-854 (FIG. 97). The expected polypeptide precursor is 211 amino acids long (FIG. 98). The full-length PRO944 protein shown in FIG. 98 was estimated to have a molecular weight of about 22,744 Daltons and a pi of about 8.51. Analysis of the full-length PRO944 sequence shown in FIG. 98 (SEQ ID NO: 270) revealed a signal peptide of about amino acid 1 to about amino acid 21, about amino acid 82 to about amino acid 102, about amino acid 118 to about amino acid 142, and about amino acid 161 to about amino acid. A transmembrane domain of 187, a potential N-glycosylation site of about amino acids 72 to about amino acid 75, a sequence block homologous to a protein of the PMP-22 / EMP / MP20 family of about amino acids 70 to about amino acid 111, and about amino acid 119 The presence of sequence blocks homologous to the ABC-2 type transport system integral membrane protein of from about amino acid 133 has been demonstrated. The clone UNQ481 (DNA52185-1370) was deposited with the ATCC on May 14, 1998, assigned the ATCC accession number 209861.

Amino acid sequence analysis of the full-length PRO944 polypeptide suggests that this sequence has significant sequence similarity with the CPE-R protein, thus indicating that PRO944 can be a novel CPE-R homolog. More specifically, analysis of the Dayhof database (version 35.45 Swiss Prot 35) shows significant differences between the PRO944 amino acid sequence and the Dayhof sequence of AB000713_1, AB000714_1, AF035814_1, AF000959_1, HSU89916_1, EMP2_HUMAN, JC5732, CELF53B3_6, PM22_MOUSE and CGU49797_1. It was proved to be same-sex.

Example 45 Isolation of cDNA Clone Encoding Human PRO983

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA47473. Based on the DNA47473 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR and 2) as a probe to isolate a clone of the full-length coding sequence of PRO983.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-GCACCACCGTAGGTACTTGTGTGAGGC-3 '(SEQ ID NO: 292)

Reverse PCR primer 5'-AACCACCAGAGCCAAGAGCCGGG-3 '(SEQ ID NO: 293)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA47473.

Hybridization probe

5'-CAGCGGAATCATCGATGCAGGGGCCTCAATTAATGTATCTGTGATGTTAC-3 '(SEQ ID NO: 294)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO983 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from human bone marrow tissue (LIB256).

DNA sequence analysis of clones isolated as described above gave the full length DNA sequence of PRO983 (herein referred to as UNQ484 (DNA53977-1371)) (SEQ ID NO: 283) and the protein sequence of PRO983 derived therefrom.

The total nucleotide sequence of UNQ484 (DNA53977-1371) is shown in FIG. 108 (SEQ ID NO: 283). Clone UNQ484 (DNA53977-1371) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 234-236 and terminates at the stop codon at nucleotide positions 963-965 (FIG. 108). The expected polypeptide precursor is 243 amino acids in length (FIG. 109). The full-length PRO983 protein shown in FIG. 109 was estimated to have a molecular weight of about 27,228 Daltons and a pi of about 7.43. Analysis of the full-length PRO983 sequence shown in FIG. 109 (SEQ ID NO: 284) shows a putative transmembrane domain of about amino acids 224 to about amino acids 239, potential N-glycosylation sites of about amino acids 68 to about amino acids 71, and about amino acids 59. The presence of three potential N-myristoylation sites of from about amino acid 64, about amino acid 64 to about amino acid 69, and about amino acid 235 to about amino acid 240 has been demonstrated. The clone UNQ484 (DNA53977-1371) was deposited with the ATCC on May 14, 1998, assigned the ATCC accession number 209862.

Amino acid sequence analysis of the full length PRO983 polypeptide suggests that this sequence has significant sequence similarity with the vesicle-associated protein, VAP-33, thus indicating that PRO983 may be a novel vesicle-related membrane protein. More specifically, analysis of the Deihof database (version 35.45 Swiss Prot 35) shows that between the PRO983 amino acid sequence and VP33_APLCA, CELF33D11_12, CELF42G2_2, S50623, YDFC_SCHPO, CELF54H5_2, CELZC196_8, CEF57A10_3, MSP3_GLO_1, CEC15H11. It was proved to be same-sex.

Example 46 Isolation of cDNA Clone Encoding Human PRO1057

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA49808. Based on the DNA49808 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR and 2) as a probe to isolate a clone of the full-length coding sequence of PRO1057.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-GCATCTGCAGGAGAGAGCGAAGGG-3 '(SEQ ID NO: 297)

Reverse PCR primer 5'-CATCGTTCCCGTGAATCCAGAGGC-3 '(SEQ ID NO: 298)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA49808.

Hybridization probe

5'-GAAGGGAGGCCTTCCTTTCAGTGGACCCGGGTCAAGAATACCCAC-3 '(SEQ ID NO: 299)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Thereafter, clones encoding the PRO1057 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above yielded the full-length DNA sequence of PRO1057 (herein referred to as UNQ522 (DNA57253-1382)) (SEQ ID NO: 295) and the protein sequence of PRO1057 derived therefrom.

The full nucleotide sequence of UNQ522 (DNA57253-1382) is shown in FIG. 117 (SEQ ID NO: 295). Clone UNQ522 (DNA57253-1382) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 275-277 and terminates at the stop codon at nucleotide positions 1514-1516 (FIG. 117). The expected polypeptide precursor is 413 amino acids long (FIG. 118). The full-length PRO1057 protein shown in FIG. 118 has an estimated molecular weight of about 47,070 Daltons and a pI of about 9.92. Analysis of the full-length PRO1057 sequence shown in FIG. 118 (SEQ ID NO: 296) showed a signal peptide of about amino acid 1 to about amino acid 16, about amino acid 90 to about amino acid 93, about amino acid 110 to about amino acid 113, and about amino acid 193 to about amino acid. The presence of a potential N-glycosylation site of 196, a glycosaminoglycan attachment site of about amino acids 236 to about amino acid 239, and a serine protease histidine-containing active site of about amino acids 165 to about amino acid 170 has been demonstrated. The clone UNQ522 (DNA57253-1382) was deposited with the ATCC on May 14, 1998, assigned the ATCC accession number 209867.

Amino acid sequence analysis of the full-length PRO1057 polypeptide suggests that this sequence has significant sequence similarity with various protease proteins, thus indicating that PRO1057 may be a novel protease. More specifically, analysis of the Dayhof database (version 35.45 Swiss Prot 35) shows significant differences between the PRO1057 amino acid sequence and the Dayhof sequences of TRYE_DROER, P_R14159, A69660, EBN1_EBV, S65494, GEN12688, A51084_1, P_R99571, A57514 and AF003200_1. It was proved to be same-sex.

Example 47 Isolation of cDNA Clones Encoding Human PRO1071

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA53035. Based on the DNA53035 consensus sequence, it was determined whether this consensus sequence shares significant sequence identity with Insight EST clone number 2872569, which appears to encode the full length protein. To this end, Insight EST clone number 2872569 was purchased and its insert was obtained and sequenced to confirm proper sequence. This sequence is referred to herein as UNQ528 or DNA58847-1383.

DNA sequence analysis of clones isolated as described above yielded the full-length DNA sequence of PRO1071 (herein referred to as UNQ528 (DNA58847-1383)) (SEQ ID NO: 300) and the protein sequence of PRO1071 derived therefrom.

The full nucleotide sequence of UNQ528 (DNA58847-1383) is shown in FIG. 119 (SEQ ID NO: 300). Clone UNQ528 (DNA58847-1383) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 133-135 and terminates at the stop codon at nucleotide positions 1708-1710 (Figure 119). The expected polypeptide precursor is 525 amino acids long (FIG. 120). The full-length PRO1071 protein shown in FIG. 120 has an estimated molecular weight of about 58,416 Daltons and a pi of about 6.62. Analyzing the full length PRO1071 sequence shown in FIG. 120 (SEQ ID NO: 301), the signal peptide of about amino acid 1 to about amino acid 25, the potential N-glycosylation site of about amino acid 251 to about amino acid 254, about amino acid 385 to about amino acid 399 thrombospondin-1 homolog block, and about 385 to about amino acid 399, about amino acid 445 to about amino acid 459, and about amino acid 42 to about amino acid 56 of the Willibrands factor type C homolog block It became. The clone UNQ528 (DNA58847-1383) was deposited with the ATCC on May 20, 1998, assigned the ATCC accession number 209879.

Amino acid sequence analysis of the full length PRO1071 polypeptide suggests that this sequence has significant sequence similarity with the thrombospondine protein, thus indicating that PRO1071 may be a novel thrombospondine homolog. More specifically, analysis of the Deihof database (version 35.45 Swiss Prot 35) shows a significant difference between the PRO1071 amino acid sequence and the corresponding amino acids between the AB002364_1, D67076_1, BTPCINPGN_1, CET13H10_1, CEF25H8_5, CEF53B6_2, CEC26C6_6, HSSEMG_1, CET21B6_4 and BTY08561_1. It was proved to be same-sex.

Example 48 Isolation of cDNA Clone Encoding Human PRO1072

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA53125. Based on the DNA53125 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR and 2) as a probe to isolate a clone of the full-length coding sequence of PRO1072.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-CCAGGAAATGCTCCAGGAAGAGCC-3 '(SEQ ID NO: 305)

Reverse PCR primer 5'-GCCCATGACACCAAATTGAAGAGTGG-3 '(SEQ ID NO: 306)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA53125.

Hybridization probe

5'-AACGCAGGGATCTTCCAGTGCCCTTACATGAAGACTGAAGATGGG-3 '(SEQ ID NO: 307)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO1072 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from lung tissue of human fetus (LIB26).

DNA sequence analysis of clones isolated as described above yielded the full-length DNA sequence of PRO1072 (herein referred to as UNQ529 (DNA58747-1384)) (SEQ ID NO: 302) and the protein sequence of PRO1072 derived therefrom.

The full nucleotide sequence of UNQ529 (DNA58747-1384) is shown in FIG. 121 (SEQ ID NO: 302). Clone UNQ529 (DNA58747-1384) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 65-67 and terminates at the stop codon at nucleotide positions 1073-1075 (FIG. 121). The expected polypeptide precursor is 336 amino acids long (FIG. 122). The full-length PRO1072 protein shown in FIG. 122 was estimated to have a molecular weight of about 36,865 Daltons and a pi of about 9.15. Analysis of the full length PRO1072 sequence shown in FIG. 122 (SEQ ID NO: 303) revealed a signal peptide of about amino acid 1 to about amino acid 21, about amino acid 134 to about amino acid 144, about amino acid 44 to about amino acid 56, and about amino acid 239 to about amino acid. 248 short chain alcohol dehydrogenase protein homolog blocks and the presence of potential N-glycosylation sites of about amino acids 212 to about amino acid 215 and about amino acids 239 to about amino acid 242 have been demonstrated. The clone UNQ529 (DNA58747-1384) was deposited with the ATCC on May 14, 1998, assigned the ATCC accession number 209868.

Amino acid sequence analysis of the full-length PRO1072 polypeptide suggests that this sequence has significant sequence similarity with proteins of the reductase family, thus indicating that PRO1072 may be a novel reductase. More specifically, analysis of the Deihof database (version 35.45 Swiss Prot 35) showed a significant difference between the PRO1072 amino acid sequence and the PHOE sequence between P_W03198, P_W15759, P_R60800, MTV037_3, CEC15H11_6, ATAC00234314, MTV022_13, SCU43704_1, OXIR_STRAT and CELC01G8_3. It was proved to be same-sex.

Example 49 Isolation of cDNA Clones Encoding Human PRO1075

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA34363. Based on the DNA34363 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO1075.

PCR primer pairs (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-TGAGAGGCCTCTCTGGAAGTTG-3 '(SEQ ID NO: 312)

Omnidirectional PCR primer 5'-GTCAGCGATCAGTGAAAGC-3 '(SEQ ID NO: 313)

Omnidirectional PCR primer 5'-CCAGAATGAAGTAGCTCGGC-3 '(SEQ ID NO: 314)

Omnidirectional PCR primer 5'-CCGACTCAAAATGCATTGTC-3 '(SEQ ID NO: 315)

Omnidirectional PCR primer 5'-CATTTGGCAGGAATTGTCC-3 '(SEQ ID NO: 316)

Omnidirectional PCR primer 5'-GGTGCTATAGGCCAAGGG-3 '(SEQ ID NO: 317)

Reverse PCR Primer 5'-CTGTATCTCTGGGCTATGTCAGAG-3 '(SEQ ID NO: 318)

Reverse PCR primer 5'-CTACATATAATGGCACATGTCAGCC-3 '(SEQ ID NO: 319)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA34363.

Hybridization probe

5'-CGTCTTCCTATCCTTACCCGACCTCAGATGCTCCCTTCTGCTCCTG-3 '(SEQ ID NO: 320)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO1075 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from human skin tumor tissue (LIB324).

DNA sequence analysis of clones isolated as described above yielded the full-length DNA sequence of PRO1075 (herein referred to as UNQ532 (DNA57689-1385)) (SEQ ID NO: 308) and the protein sequence of PRO1075 derived therefrom.

The full nucleotide sequence of UNQ532 (DNA57689-1385) is shown in FIG. 124 (SEQ ID NO: 308). Clone UNQ532 (DNA57689-1385) contains a single open reading frame that has a clear translation initiation site at nucleotide positions 137-139 and terminates at the stop codon at nucleotide positions 1355-1357 (Figure 124). The expected polypeptide precursor is 406 amino acids long (FIG. 125). The full-length PRO1075 protein shown in FIG. 125 was estimated to have a molecular weight of about 46,927 Daltons and a pi of about 5.21. Analysis of the full length PRO1075 sequence shown in FIG. 125 (SEQ ID NO: 309) revealed a signal peptide of about amino acid 1 to about amino acid 29, a vesicle target sequence of about amino acid 403 to about amino acid 406, a tyrosine kinase of about amino acid 203 to about amino acid 211. The presence of phosphorylation sites and sequence blocks homologous to proteins of the thioredoxin family of about amino acids 50 to about amino acid 66 was demonstrated. The clone UNQ532 (DNA57689-1385) was deposited with the ATCC on May 14, 1998, assigned the ATCC accession number 209869.

Amino acid sequence analysis of the full-length PRO1075 polypeptide suggests that this sequence has significant sequence similarity with protein disulfide isomerase, thus indicating that PRO1075 may be a novel protein disulfide isomerase. More specifically, analysis of the Dayhof database (version 35.45 Swiss Prot 35) revealed significant homology between the PRO1075 amino acid sequence and the Dayhof sequences of CELC30H7_2, CELC06A6_3, CELF42G8_3, S57942, ER72_CAEEL, CELC07A12_3, CEH06O01_4 and P_R51696. Proven.

Example 50 Isolation of cDNA Clone Encoding Human PRO181

The cDNA sequence isolated on the amylase screen described in Example 2 above was confirmed by BLAST and FastA sequence alignment, which had sequence homology with the nucleotide sequence encoding the Cornicon protein. This cDNA sequence is referred to herein as DNA13242 (FIG. 130, SEQ ID NO: 323). Based on sequence homology, oligonucleotide probes were synthesized from the sequence of DNA13242 molecules and used to screen for human placental library (LIB89) prepared as described in the first paragraph of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D without the SfiI site; see Holmes et al., Science , 253 : 1278-1280 (1991)) and the cDNA was cut to a size less than 2800 bp.

The oligonucleotide probes used included the following sequences:

Omnidirectional PCR primer 5'-GTGCAGCAGAGTGGCTTACA-3 '(SEQ ID NO: 326)

Reverse PCR primer 5'-ACTGGACCAATTCTTCTGTG-3 '(SEQ ID NO: 327)

Hybridization probe

5'-GATATTCTAGCATATTGTCAGAAGGAAGGATGGTGCAAATTAGCT-3 '(SEQ ID NO: 328)

The full length clone comprises a single open reading frame with an apparent translation initiation site at nucleotide positions 14-16 and ending at the stop codon at nucleotide positions 446-448 (FIG. 128, SEQ ID NO: 321). The expected polypeptide precursor is 144 amino acids long, the molecular weight is calculated to be about 16,699 Daltons, and the pi is estimated to be about 5.6. Analysis of the full length PRO181 sequence as shown in FIG. 129 (SEQ ID NO: 322) shows a signal peptide of about amino acids 1 to about amino acid 20, a putative type II transmembrane domain of about amino acids 11 to about amino acids 31, and about amino acids 57 to The presence of other transmembrane domains of about amino acid 77 and about amino acid 123 to about amino acid 143 has been demonstrated. The clone UNQ155 (DNA23330-1390) was deposited with the ATCC on April 14, 1998, assigned the ATCC accession number 209775.

Amino acid sequence analysis of the full-length PRO181 polypeptide suggests that this sequence has significant sequence similarity with the Cornicon protein, thus indicating that PRO181 can be a novel Cornicon homologue. More specifically, analysis of the Dayhof database (version 35.45 Swiss Prot 35) revealed significant homology between the PRO181 amino acid sequence and the Dayhof sequences of AF022811_1, CET09E8_3, S64058, YGF4_YEAST, YB60_YEAST, EBU89455_1, SIU36383_3, and PH1371. Proven.

Example 51 Isolation of cDNA Clone Encoding Human PRO195

The cDNA sequence was isolated on the amylase screen described in Example 2 above, referred to herein as DNA13199 (FIG. 134, SEQ ID NO: 332). The DNA13199 sequence was then compared to various expressed sequence tag (EST) databases, including public EST databases (eg, Genbank), to confirm homology. Homology investigations were performed using the computer programs BLAST or BLAST-2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparatives with BLAST scores of 70 (or in some cases 90) or higher that do not encode known proteins were clustered and the program "phrap" (Phil Green, University of Washington, Seattle, Washington, http: // bozeman. mbt.washington.edu/phrap.docs/phrap.html) to assemble into consensus DNA sequences. The consensus sequence obtained therefrom is referred to herein as DNA22778.

Based on the DNA22778 sequence, oligonucleotide probes were synthesized and used to screen for human placental library (LIB89) prepared as described in the first paragraph of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D without the SfiI site; see Holmes et al., Science , 253 : 1278-1280 (1991)) and the cDNA was cut to a size less than 2800 bp.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-ACAAGCTGAGCTGCTGTGACAG-3 '(SEQ ID NO: 333)

Reverse PCR Primer 5'-TGATTCTGGCAACCAAGATGGC-3 '(SEQ ID NO: 334)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA22778.

Hybridization probe

5'-ATGGCCTTGGCCGGAGGTTCGGGGACCGCTTCGGCTGAAG-3 '(SEQ ID NO: 335)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO195 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library.

The full length clone was identified as having a single open reading frame that had an apparent translation initiation site at nucleotide positions 70-72 and terminated at the stop codon at nucleotide positions 1039-1041 (FIG. 132, SEQ ID NO: 330). The expected polypeptide precursor was 323 amino acids long, molecular weight was calculated to be approximately 36,223 Daltons, and pi was estimated to be approximately 5.06. Analysis of the full length PRO195 sequence shown in FIG. 132 (SEQ ID NO: 330) revealed a signal peptide of about amino acid 1 to about amino acid 31, the transmembrane domain of about amino acid 241 to about amino acid 260, and the potential of about amino acid 90 to about amino acid 93. The presence of phosphorus N-glycosylation sites has been demonstrated. The clone UNQ169 (DNA26847-1395) was deposited with the ATCC on April 14, 1998, assigned ATCC accession number 209772.

Amino acid sequence analysis of the full-length PRO195 polypeptide suggests that this sequence does not have significant sequence similarity with any known protein. However, analysis of the Dayhof database (version 35.45 Swiss Prot 35) demonstrated some homology between the PRO195 amino acid sequence and the Dayhof sequences of P_P91380, AF035118_1, HUMTROPCS_1, NUOD_SALTY and E70002.

Example 52 Isolation of cDNA Clone Encoding Human PRO865

The cDNA sequence isolated on the amylase screen described in Example 2 above is referred to herein as DNA37642 (FIG. 137, SEQ ID NO: 338). Next, the DNA37642 sequence was expressed in various expressed forms, including a public EST database (eg, Genbank) and a private EST DNA database (eg, LIFESEQ ™, Insight Pharmaceutical, Palo Alto, CA). Comparison with sequence tag (EST) database confirmed the homology between them. Homology investigations were performed using the computer programs BLAST or BLAST-2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparatives with BLAST scores of 70 (or in some cases 90) or higher that do not encode known proteins were clustered and the program "phrap" (Phil Green, University of Washington, Seattle, Washington, http: // bozeman. mbt.washington.edu/phrap.docs/phrap.html) to assemble into consensus DNA sequences. The consensus sequence obtained therefrom is referred to herein as DNA48615.

Based on the DNA48615 sequence, probes were synthesized and used to screen the human fetal kidney (LIB227) library prepared as described in the first paragraph of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D without the SfiI site; see Holmes et al., Science , 253 : 1278-1280 (1991)) and the cDNA was cut to a size less than 2800 bp.

PCR primer pairs (forward and reverse) were synthesized:

Omnidirectional PCR primer 1 5'-AAGCTGCCGGAGCTGCAATG-3 '(SEQ ID NO: 339)

Omnidirectional PCR primer 2 5'-TTGCTTCTTAATCCTGAGCGC-3 '(SEQ ID NO: 340)

Omnidirectional PCR primer 3 5'-AAAGGAGGACTTTCGACTGC-3 '(SEQ ID NO: 341)

Reverse PCR primer 1 5'-AGAGATTCATCCACTGCTCCAAGTCG-3 '(SEQ ID NO: 342)

Reverse PCR primer 2 5'-TGTCCAGAAACAGGCACATATCAGC-3 '(SEQ ID NO: 343)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA48615.

Hybridization probe

5'-AGACAGCGGCACAGAGGTGCTTCTGCCAGGTTAGTGGTTACTTGGATGAT-3 '(SEQ ID NO: 344)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO865 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library.

The full length clone was found to have a single open reading frame with an apparent translation initiation site at nucleotide positions 173-175 and terminated at the stop codon at nucleotide positions 1577-1579 (FIG. 135, SEQ ID NO: 336). The expected polypeptide precursor is 468 amino acids long, the molecular weight is calculated to be approximately 54,393 Daltons, and the pi is estimated to be approximately 5.63. Analysis of the full length PRO865 sequence shown in FIG. 136 (SEQ ID NO: 337) revealed a potential N-glycosylation of signal peptides from about amino acids 1 to about amino acid 23, from about amino acids 280 to about amino acids 283, and from about amino acids 384 to about amino acids 387. Site, potential amidation site of about amino acid 94 to about amino acid 97, glycosaminoglycan attachment site of about amino acid 20 to about amino acid 23 and about amino acid 223 to about amino acid 226, aminotransfer of about amino acid 216 to about amino acid 222 The presence of Lase class-V pyridoxyl-phosphate amino acid sequence blocks and amino acid sequence blocks similar to those found in the interleukin-7 protein of about amino acids 338 to about amino acid 343 was demonstrated. The clone UNQ434 (DNA53974-1401) was deposited with the ATCC on April 14, 1998, assigned ATCC Accession No. 209774.

Amino acid sequence analysis of the full-length PRO865 polypeptide suggests that this sequence does not have significant sequence similarity with any known protein. However, analysis of the Dayhof database (version 35.45 Swiss Prot 35) demonstrated some homology between the PRO865 amino acid sequence and the Dayhof sequences of YMN0_YEAST, ATFCA4_43, S44168, P_W14549 and RABTCRG4_1.

Example 53 Isolation of cDNA Clones Encoding Human PRO827

The cDNA sequence isolated on the amylase screen described in Example 2 above was confirmed by BLAST and FastA sequence alignment, which had sequence homology with nucleotide sequences encoding various integrin proteins. This cDNA sequence is referred to herein as DNA47751 (FIG. 140, SEQ ID NO: 347). Based on sequence homology, probes were synthesized from the sequence of the DNA47751 molecule and used to screen the human epithelial pigment epithelial library (LIB113) prepared as described in the first paragraph of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D without the SfiI site; see Holmes et al., Science , 253 : 1278-1280 (1991)) and the cDNA was cut to a size less than 2800 bp.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-AGGGACAGAGGCCAGAGGACTTC-3 '(SEQ ID NO: 348)

Reverse PCR Primer 5'-CAGGTGCATATTCACAGCAGGATG-3 '(SEQ ID NO: 349)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA47751.

Hybridization probe

5'-GGAACTCCCCTTCGTCACTCACCTGTTCTTGCCCCTGGTGTTCCT-3 '(SEQ ID NO: 350)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO827 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library.

The full length clone was found to contain a single open reading frame with an apparent translation initiation site at nucleotide positions 134-136 and ending at the stop codon at nucleotide positions 506-508 (FIG. 138, SEQ ID NO: 345). The expected polypeptide precursor is 124 amino acids long, the molecular weight is calculated to be about 13,352 daltons, and the pi is estimated to be about 5.99. Analysis of the full-length PRO827 sequence as shown in FIG. 139 (SEQ ID NO: 346) shows a signal peptide of about amino acid 1 to about amino acid 22, a cell adhesion sequence of about amino acid 70 to about amino acid 72, and about amino acid 98 to about amino acid 101. The presence of a potential N-glycosylation site of, and an integrin alpha chain protein homolog sequence of about amino acids 67 to about amino acid 81 has been demonstrated. The clone UNQ468 (DNA57039-1402) was deposited with the ATCC on April 14, 1998, assigned the ATCC accession number 209777.

Amino acid sequence analysis of the full length PRO827 polypeptide suggests that this sequence has significant sequence similarity with the VLA-2 integrin protein and various integrin proteins, thus indicating that PRO827 may be a novel integrin or a splicing variant thereof. More specifically, analysis of the Deihof database (version 35.45 Swiss Prot 35) shows that between the PRO240 amino acid sequence and the equivalent phase sequence of S44142, ITA2_HUMAN, ITA1_RAT, ITA1_HUMAN, ITA4_HUMAN, ITA9_HUMAN, AF032108_1, ITAM_MOUSE, ITA8_CHICK and ITA6_CHICK. It was proved to be same-sex.

Example 54 Isolation of cDNA Clone Encoding Human PRO1114

The cDNA sequence isolated on the amylase screen described in Example 2 above was confirmed by the WU-BLAST2 sequence alignment computer program, which had sequence identity with other known interferon receptors. This cDNA sequence is referred to herein as DNA48466 (FIG. 143, SEQ ID NO: 352). Based on sequence identity, probes were synthesized from the sequence of DNA48466 molecules and used to screen for the human breast carcinoma library (LIB135) prepared as described in the first paragraph of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D without the SfiI site; see Holmes et al., Science , 253 : 1278-1280 (1991)) and the cDNA was cut to a size less than 2800 bp.

The oligonucleotide probes used included the following sequences:

Omnidirectional PCR primer 5'-AGGCTTCGCTGCGACTAGACCTC-3 '(SEQ ID NO: 354)

Reverse PCR primer 5'-CCAGGTCGGGTAAGGATGGTTGAG-3 '(SEQ ID NO: 355)

Hybridization probe

5'-TTTCTACGCATTGATTCCATGTTTGCTCACAGATGAAGTGGCCATTCTGC-3 '(SEQ ID NO: 356)

The full-length clone contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 250-252 and terminates at the stop codon at nucleotide positions 1183-1185 (Figure 141, SEQ ID NO: 351). The expected polypeptide precursor is 311 amino acids long, the molecular weight is calculated to be about 35,076 daltons, and the pi is estimated to be about 5.04. Analysis of the full-length PRO1114 interferon receptor sequence as shown in FIG. 142 (SEQ ID NO: 352) shows a signal peptide of about amino acid 1 to about amino acid 29, a transmembrane domain of about amino acid 230 to about amino acid 255, about amino acid 40 to about amino acid. 43 and a potential N-glycosylation site of about amino acids 134 to about amino acid 137, an amino acid sequence block homologous to a tissue factor protein of about amino acids 92 to about amino acid 119, and an integrin alpha chain protein of about amino acids 232 to about amino acid 262; The presence of homologous amino acid sequence blocks has been demonstrated. The clone UNQ557 (DNA57033-1403) was deposited with the ATCC on May 27, 1998, and was assigned ATCC Accession No. 209905.

Analysis of the Dayhof database (version 35.45 Swiss Prot 35) using WU-BLAST2 sequence alignment analysis of the full length sequence shown in FIG. It has been demonstrated that there is considerable homology between the Dayhof sequences of A26595_1, A26593_1, I56215 and TF_HUMAN.

Example 55 Isolation of cDNA Clones Encoding Human PRO237

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA30905. Based on the DNA30905 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO237.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-TCTGCTGAGGTGCAGCTCATTCAC-3 '(SEQ ID NO: 359)

Reverse PCR primer 5'-GAGGCTCTGGAAGATCTGAGATGG-3 '(SEQ ID NO: 360)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA30905.

Hybridization probe

5'-GCCTCTTTGTCAACGTTGCCAGTACCTCTAACCCATTCCTCAGTCGCCTC-3 '(SEQ ID NO: 361)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO237 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from brain tissue of human fetus (LIB153).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO237 (herein referred to as UNQ211 (DNA34353-1428)) (SEQ ID NO: 357) and the protein sequence of PRO237 derived therefrom.

The full nucleotide sequence of UNQ211 (DNA34353-1428) is shown in FIG. 144 (SEQ ID NO: 357). Clone UNQ211 (DNA34353-1428) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 586-588 and terminates at the stop codon at nucleotide positions 1570-1572 (FIG. 144). The expected polypeptide precursor is 328 amino acids long (FIG. 145). The full-length PRO237 protein shown in FIG. 145 has an estimated molecular weight of about 36,238 Daltons and a pi of about 9.90. Analysis of the full length PRO237 sequence shown in FIG. 145 (SEQ ID NO: 358) shows a signal peptide of about amino acid 1 to about amino acid 23, the transmembrane domain of about amino acid 177 to about amino acid 199, about amino acid 118 to about amino acid 121, about amino acid. Potential N-glycosylation sites of 170 to about amino acid 173 and about amino acid 260 to about amino acid 263, and eukaryotic cells of about amino acid 222 to about amino acid 270, about amino acid 128 to about amino acid 164, and about amino acid 45 to about amino acid 92- The presence of tangible carbonic anhydrase sequence homolog blocks has been demonstrated. The clone UNQ211 (DNA34353-1428) was deposited with the ATCC on May 12, 1998, assigned the ATCC accession number 209855.

The amino acid sequence analysis of the full length PRO237 polypeptide suggests that this sequence has significant sequence similarity with the carbonic acid dehydrogenated protein. More specifically, analysis of the Dayhof database (version 35.45 Swiss Prot 35) shows significant differences between the PRO237 amino acid sequence and the Dayhof sequence of AF050106_1, OACALP_1, CELD1022_8, CAH2_HUMAN, 1CAC, CAH5_HUMAN, CAHP_HUMAN, CAH3_HUMAN, CAH1_HUMAN and 2CAB. It was proved to be same-sex.

Example 56 Isolation of cDNA Clones Encoding Human PRO541

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA42259. Based on the DNA42259 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO541.

PCR primer pairs (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-GGACAGAATTTGGGAGCACACTGG-3 '(SEQ ID NO: 364)

Omnidirectional PCR primer 5'-CCAAGAGTATACTGTCCTCG-3 '(SEQ ID NO: 365)

Reverse PCR primer 5'-AGCACAGATTTTCTCTACAGCCCCC-3 '(SEQ ID NO: 366)

Reverse PCR primer 5'-AACCACTCCAGCATGTACTGCTGC-3 '(SEQ ID NO: 367)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA42259.

Hybridization probe

5'-CCATTCAGGTGTTCTGGCCCTGTATGTACACATTATACACAGGTCGTGTG-3 '(SEQ ID NO: 368)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO541 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO541 (herein referred to as UNQ211 (DNA34353-1428)) (SEQ ID NO: 362) and the protein sequence of PRO541 derived therefrom.

The full nucleotide sequence of UNQ211 (DNA34353-1428) is shown in FIG. 146 (SEQ ID NO: 362). Clone UNQ342 (DNA45417-1432) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 469-471 and terminates at the stop codon at nucleotide positions 1969-1971 (FIG. 146). The predicted polypeptide precursor is 500 amino acids long (Figure 147). The full-length PRO541 protein shown in FIG. 147 has an estimated molecular weight of about 56,888 Daltons and a pI of about 8.53. Analysis of the full-length PRO541 sequence shown in FIG. 147 (SEQ ID NO: 363) shows that the signal peptide is about amino acid 1 to about amino acid 20, about amino acid 165 to about amino acid 186, about amino acid 196 to about amino acid 218, about amino acid 134 to about amino acid 146, about amino acid 96 to about amino acid 108 and about amino acid 58 to about amino acid 77, an amino acid sequence block homologous to the extracellular protein SCP / Tpx-1 / Ag5 / PR-1 / Sc7, and about amino acid 28 to about amino acid 31 The presence of potential N-glycosylation sites has been demonstrated. The clone UNQ342 (DNA45417-1432) was deposited with the ATCC on May 27, 1998, assigned the ATCC accession number 209910.

Amino acid sequence analysis of the full length PRO541 polypeptide suggests that this sequence has significant sequence similarity with the trypsin inhibitor protein, thus suggesting that PRO541 may be a novel trypsin inhibitor. More specifically, analysis of the Dayhof database (version 35.45 Swiss Prot 35) shows significant differences between the PRO541 amino acid sequence and the dayhof sequences of D45027_1, AB009609_1, JC5308, CRS3_HORSE, TPX1_HUMAN, HELO_HELHO, GEN14351, A28112_1, CET05A10_4 and P_W11485. It was proved to be same-sex.

Example 57 Isolation of cDNA Clones Encoding Human PRO273

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA36465. Based on the DNA36465 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR and 2) as a probe to isolate a clone of the full-length coding sequence of PRO273.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-CAGCGCCCTCCCCATGTCCCTG-3 '(SEQ ID NO: 371)

Reverse PCR Primer 5'-TCCCAACTGGTTTGGAGTTTTCCC-3 '(SEQ ID NO: 372)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA36465.

Hybridization probe

5'-CTCCGGTCAGCATGAGGCTCCTGGCGGCCGCTGCTCCTGCTGCTG-3 '(SEQ ID NO: 373)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO273 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus.

DNA sequence analysis of clones isolated as described above yielded the full-length DNA sequence of PRO273 (herein referred to as UNQ240 (DNA39523-1192)) (SEQ ID NO: 369) and the protein sequence of PRO273 derived therefrom.

The full nucleotide sequence of UNQ240 (DNA39523-1192) is shown in FIG. 148 (SEQ ID NO: 369). Clone UNQ240 (DNA39523-1192) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 167-169 and terminates at the stop codon at nucleotide positions 500-502 (FIG. 148). The expected polypeptide precursor is 111 amino acids long (Figure 149). Clone UNQ240 (DNA39523-1192) was deposited with the ATCC. It is understood that the deposited clones contain the actual sequences and the sequences provided herein are representative only based on current sequencing techniques. In addition, with respect to the sequences provided herein and the general genetic code, nucleotides corresponding to any given amino acid may generally be identifiable and vice versa.

Amino acid sequence analysis of the full-length PRO273 polypeptide suggests that some of these sequences have significant sequence identity with human macrophage inflammatory protein-2, cytokine-induced neutrophil chemoattract 2, and neutrophil chemotactic factor 2-beta. Thus indicating that PRO273 is a novel chemokine.

As discussed further below, cDNA was subcloned into a baculovirus vector and expressed in insect cells as a C-terminally targeted IgG fusion protein. N-terminal sequencing of the resulting protein identified a signal sequence cleavage site that produced a mature polypeptide of 77 amino acids. The mature sequence, which showed 31-40% identity with other human CXC chemokines, included four fully cysteine residues, but lacked the ELR motif. Northern analysis demonstrated expression at least in the small intestine, colon, spleen, lymph nodes and kidneys. By in situ hybridization, mRNA was concentrated in the lamina propria of the small intestine villi and tubules of the kidney, as described in detail below.

Example 58 Isolation of cDNA Clone Encoding Human PRO701

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA39848. Based on the DNA39848 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO701.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-GGCAAGCTACGGAAACGTCATCGTG-3 '(SEQ ID NO: 376)

Reverse PCR Primer 5'-AACCCCCGAGCCAAAAGATGGTCAC-3 '(SEQ ID NO: 377)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA39848.

Hybridization probe

5'-GTACCGGTGACCAGGCAGCAAAAGGCAACTATGGGCTCCTGGATCAG-3 '(SEQ ID NO: 378)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO701 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above gave the full length DNA sequence of PRO701 (herein referred to as UNQ365 (DNA44205-1285)) (SEQ ID NO: 374) and the protein sequence of PRO701 derived therefrom.

The full nucleotide sequence of UNQ365 (DNA44205-1285) is shown in FIG. 150 (SEQ ID NO: 374). Clone UNQ365 (DNA44205-1285) contains a single open reading frame that has a clear translation initiation site at nucleotide positions 50-52 and terminates at the stop codon at nucleotide positions 2498-3000 (FIG. 150). The expected polypeptide precursor is 816 amino acids long (Figure 151). The full-length PRO701 protein shown in FIG. 151 has a molecular weight of about 91,794 Daltons, a pI of about 5.88, and an NX (S / T) of 4. Clone UNQ365 (DNA44205-1285) was deposited with the ATCC on March 31, 1998. It is understood that the deposited clone contains the exact actual sequence and the sequences provided herein are representative based on sequencing techniques.

In relation to the amino acid sequence shown in FIG. 151, there was a potential signal peptide cleavage site at about amino acid 25. There were potential N-glycosylation sites at about amino acid positions 83, 511, 716 and 803. Carboxysterase type-B feature 2 was at about residues 125-135. Regions homologous to carboxyesterase type-B were also at about residues 54 to 74, 197 to 212, and 221 to 261. The potential transmembrane region corresponds to approximately amino acids 671 to about 700. Corresponding nucleic acids can be generally determined from the sequences provided herein.

Analysis of the amino acid sequence of the full-length PRO701 polypeptide suggests that this sequence has significant homology with the neuroligin of rattus norvegicus, suggesting that PRO701 may be a novel human neuroligin. It is present.

Example 59 Isolation of cDNA Clone Encoding Human PRO704

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA43033. Based on the DNA43033 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO704.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-CCTTGGGTCGTGGCAGCAGTGG-3 '(SEQ ID NO: 381)

Reverse PCR primer 5'-CACTCTCCAGGCTGCATGCTCAGG-3 '(SEQ ID NO: 382)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA43033.

Hybridization probe

5'-GTCAAACGTTCGAGTACTTGAAACGGGAGCACTCGCTGTCGAAGC-3 '(SEQ ID NO: 383)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO704 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above gave the full length DNA sequence of PRO704 (herein referred to as UNQ368 (DNA50911-1288)) (SEQ ID NO: 379) and the protein sequence of PRO704 derived therefrom.

The full nucleotide sequence of UNQ368 (DNA50911-1288) is shown in FIG. 152 (SEQ ID NO: 379). Clone UNQ368 (DNA50911-1288) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 8-10 and terminates at the stop codon at nucleotide positions 1052-1054 (FIG. 152). The expected polypeptide precursor is 348 amino acids long (FIG. 153). The full-length PRO704 protein shown in FIG. 153 has an estimated molecular weight of about 39,711 Daltons and a pi of about 8.7. Clone UNQ368 (DNA50911-1288) was deposited with the ATCC on March 31, 1998. With respect to this sequence, it is understood that the deposited sequence contains the correct sequence and the sequences provided herein are based on known sequencing techniques.

Amino acid sequence analysis of the full-length PRO704 polypeptide suggests that some of these sequences have significant homology with the integral membrane protein 36 of the vesicles, thus indicating that PRO704 may be an integral membrane protein of the novel vesicles.

As a result of analyzing the amino acid sequence of SEQ ID NO: 380, it was estimated to have a signal peptide in about amino acids 1 to 39 of SEQ ID NO: 380. The transmembrane domain was at amino acids 310-335 in SEQ ID NO: 380. The potential N-glycosylation site was at about amino acids 180 to 183 in SEQ ID NO: 380. Corresponding nucleotides can be generally determined through the sequences provided herein.

Example 60 Isolation of cDNA Clone Encoding Human PRO706

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA40669. Based on the DNA40669 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO706.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-CCAAGCAGCTTAGAGCTCCAGACC-3 '(SEQ ID NO: 386)

Reverse PCR primer 5'-TTCCCTATGCTCTGTATTGGCATGG-3 '(SEQ ID NO: 387)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA40669.

Hybridization probe

5'-GCCACTTCTGCCACAATGTCAGCTTTCCCTGTACCAGAAATGGCTGTGTT-3 '(SEQ ID NO: 388)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO706 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from brain tissue of human fetus (LIB153).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO706 (herein referred to as UNQ370 (DNA48329-1290)) (SEQ ID NO: 384) and the protein sequence of PRO706 derived therefrom. It is understood that the deposited sequences contain the actual sequences and the sequences provided herein are representative based on current sequencing techniques.

The full nucleotide sequence of UNQ370 (DNA48329-1290) is shown in FIG. 154 (SEQ ID NO: 384). Clone UNQ370 (DNA48329-1290) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 279 to 281 and terminates at the stop codon at nucleotide positions 1719 to 1721 (FIG. 154). The expected polypeptide precursor is 480 amino acids long (FIG. 155). The full-length PRO706 protein shown in FIG. 155 has an estimated molecular weight of about 55,239 Daltons and a pi of about 9.30. Clone UNQ370 (DNA48329-1290) was deposited with the ATCC on April 21, 1998.

In relation to the amino acid sequence shown in FIG. 155, there was a potential signal peptide cleavage site at about amino acid 19. There were potential N-glycosylation sites at about amino acid positions 305 and 354. There was a potential tyrosine kinase phosphorylation site at about amino acid position 333. The region homologous to the histidine acid phosphate was at about residues 87-102. Corresponding nucleic acid regions can generally be determined through the provided sequences. That is, codons can be determined from specifically named amino acids.

Amino acid sequence analysis of the full length PRO706 polypeptide suggests that some of these sequences have significant homology with human prostate acid phosphatase precursors, thus indicating that PRO706 may be a novel human prostate acid phosphatase.

Example 61 Isolation of cDNA Clone Encoding Human PRO707

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA42775. Based on the DNA42775 oligonucleotide, oligonucleotides were synthesized for use in 1) cDNA libraries containing the sequence of interest by PCR, and 2) as probes to isolate clones of the full-length coding sequence of PRO707.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-TCCGTCTCTGTGAACCGCCCCAC-3 '(SEQ ID NO: 391)

Reverse PCR primer 5'-CTCGGGCGCATTGTCGTTCTGGTC-3 '(SEQ ID NO: 392)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA42775.

Hybridization probe

5'-CCGACTGTGAAAGAGAACGCCCCAGATCCACTTATTCCCC-3 '(SEQ ID NO: 393)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO707 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO707 (herein referred to as UNQ371 (DNA48306-1291)) (SEQ ID NO: 389) and the protein sequence of PRO707 derived therefrom.

The full nucleotide sequence of UNQ371 (DNA48306-1291) is shown in FIG. 156 (SEQ ID NO: 389). Clone UNQ371 (DNA48306-1291) has a single open reading frame that has a clear translation initiation site at nucleotide positions 371 to 373 of SEQ ID NO: 389 and terminates at the stop codon at nucleotide positions 3119 to 3121. The expected polypeptide precursor is 916 amino acids long (FIG. 157). The full-length PRO707 protein shown in FIG. 157 has an estimated molecular weight of about 100,204 Daltons and a pi of about 4.92. Clone UNQ371 (DNA48306-1291) was deposited with the ATCC on May 27, 1998. The deposited clone UNQ371 encodes PRO707, and it is understood that the sequences provided herein are representative only based on known sequencing techniques, which may have minor errors.

With respect to this amino acid sequence, the signal sequence has been identified in about 1-30 of SEQ ID NO: 390. Cadherin extracellular repeat domain feature sequences were at about amino acids 121-131, 230-240, 335-345, 440-450, and 550-560 in SEQ ID NO: 390. Tyrosine kinase phosphorylation sites were at about amino acids 124-132 and 580-586 in SEQ ID NO: 390. The potential transmembrane domain was at about amino acids 682-715 ± 5. Nucleic acid positions can be derived by reference to the codon corresponding to the named amino acid.

Amino acid sequence analysis of the full-length PRO707 polypeptide suggests that some of these sequences have significant homology with the CARDHERIN FIB3 protein expressed in human fibroblasts, thus indicating that PRO707 may be a novel CARDIN.

Example 62 Isolation of cDNA Clone Encoding Human PRO322

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA48336. Based on the DNA48336 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO322.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-CAGCCTACAGAATAAAGATGGCCC-3 '(SEQ ID NO: 396)

Reverse PCR Primer 5'-GGTGCAATGATCTGCCAGGCTGAT-3 '(SEQ ID NO: 397)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA48336.

Hybridization probe

5'-AGAAATACCTGTGGTTCAGTCCATCCCAAACCCCTGCTACAACAGCAG-3 '(SEQ ID NO: 398)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Thereafter, clones encoding the PRO322 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above gave the full length DNA sequence of PRO322 (herein referred to as UNQ283 (DNA48336-1309)) (SEQ ID NO: 394) and the protein sequence of PRO322 derived therefrom. The deposited clone UNQ283 (DNA48336-1309) actually encodes PRO322 and it is understood that the sequences provided herein are representative of sequences based on sequencing techniques known in the prior art.

The full nucleotide sequence of UNQ283 (DNA48336-1309) is shown in FIG. 158 (SEQ ID NO: 394). UNQ283 (DNA48336-1309) includes a single open reading frame that has an apparent translation initiation site at nucleotide positions 166-168 and terminates at the stop codon at nucleotide positions 946-948 (FIG. 158). The expected polypeptide precursor is 260 amino acids long (Figure 159). The full-length PRO322 protein shown in FIG. 159 has an estimated molecular weight of about 28,028 Daltons and a pi of about 7.87. The clone UNQ283 (DNA48336-1309) was deposited with the ATCC and was assigned ATCC Accession No. 209669.

With regard to the amino acid sequence shown in FIG. 159, the potential N-glycosylation site was at about amino acid 110 in SEQ ID NO: 395. Serine proteases, trypsin family and histidine active sites were identified at amino acids 69-74 in SEQ ID NO: 395, and consensus sequences were identified at amino acids 207-217 in SEQ ID NO: 395. Kringle domain protein motifs were identified at amino acids 205 to 217 in SEQ ID NO: 395. Putative signal peptides were encoded at about amino acids 1-23.

Amino acid sequence analysis of the full-length PRO322 polypeptide suggests that some of these sequences have significant homology with neuropsin and other serine proteases, thus suggesting that PRO322 may be a novel serine protease associated with neuropsin.

Example 63 Isolation of cDNA Clones Encoding Human PRO526

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA39626. Based on the DNA39626 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO526.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-TGGCTGCCCTGCAGTACCTCTACC-3 '(SEQ ID NO: 401)

Reverse PCR Primer 5'-CCCTGCAGGTCATTGGCAGCTAGG-3 '(SEQ ID NO: 402)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA39626.

Hybridization probe

5'-AGGCACTGCCTGATGACACCTTCCGCGACCTGGGCAACCTCACAC-3 '(SEQ ID NO: 403)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO526 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from liver tissue of human fetus (LIB228).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO526 (herein referred to as UNQ330 (DNA44184-1319)) (SEQ ID NO: 399) and the protein sequence of PRO526 derived therefrom.

The full nucleotide sequence of UNQ330 (DNA44184-1319) is shown in FIG. 160 (SEQ ID NO: 399). Clone UNQ330 (DNA44184-1319) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 514-516 and terminates at the stop codon at nucleotide positions 1933-1935 (Figure 160). The expected polypeptide precursor is 473 amino acids in length (FIG. 161). The full-length PRO526 protein shown in FIG. 161 has an estimated molecular weight of about 50,708 Daltons and a pi of about 9.28. Clone UNQ330 (DNA44184-1319) was deposited with the ATCC on March 26, 1998. This clone contains the actual sequence and it is understood that the sequences provided herein are representative on the basis of conventional sequencing techniques.

Amino acid sequence analysis of the full-length PRO526 polypeptide suggests that some of these sequences have significant homology with leucine repeat-rich proteins, including ALS, SLIT, carboxypeptidase, and platelet glycoprotein V, and thus PRO526 is a protein- It may be a novel protein involved in protein interactions.

Analysis of SEQ ID NO: 400 found the signal sequence to be at about amino acids 1-26. The leucine zipper pattern was at about amino acids 135-156. Glycosaminoglycan attachments are at about amino acids 436-439. N-glycosylation sites were at about amino acids 82-85, 179-182, 237-240 and 423-426. The present von Willebrand factor (VWF) type C domain (s) was found at about amino acids 411-425. Those skilled in the art will understand that nucleotides correspond to these amino acids based on the sequences provided herein.

Example 64 Isolation of cDNA Clones Encoding Human PRO531

The ECD database was examined to confirm that the expressed sequence tag (EST) from LIFESEQ ^™ (Insight Pharmaceutical, Palo Alto, Calif.) Shows homology with Protocadherin 3. Based on this sequence, using a computer program BLAST or BLAST-2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)) as a comparison of ECD protein sequences to six frame translations of the EST sequence An investigation was performed. Comparatives with BLAST scores of 70 (or in some cases 90) or greater that do not encode known proteins are clustered and consensus DNA sequences using the program "phrap" (Phil Green, University of Washington, Seattle, WA) Assembled.

phrap was used to assemble consensus DNA sequences for other EST sequences. Based on the consensus sequences obtained, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO531.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR Primer 5'-CTGAGAACGCGCCTGAAACTGTG-3 '(SEQ ID NO: 406)

Reverse PCR primer 5'-AGCGTTGTCATTGACATCGGCG-3 '(SEQ ID NO: 407)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus DNA sequences.

Hybridization probe

5'-TTAGTTGCTCCATTCAGGAGGATCTACCCTTCCTCCTGAAATCCGCGGAA-3 '(SEQ ID NO: 408)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO531 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from brain tissue of human fetus (LIB153). The cDNA library used to isolate cDNA clones was constructed in a standard manner using commercial reagents such as reagents from Invitrogen (San Diego, CA, USA). The cDNA is primed with oligo dT with a NotI site, ligated to the hemikinase treated SalI adapter, cleaved with NotI, appropriately sized by gel electrophoresis, and appropriate cloning vector (e.g., pRKB or pRKD; pRK5B is a precursor of pRK5D without the SfiI site; see Holmes et al., Science , 253 : 1278-1280 (1991) and cloned in a defined direction to the only XhoI and NotI sites.

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO531 (herein referred to as UNQ332 (DNA48314-1320)) (SEQ ID NO: 404) and the protein sequence of PRO531 derived therefrom.

The full nucleotide sequence of UNQ332 (DNA48314-1320) is shown in FIG. 162 (SEQ ID NO: 404). It is understood that the actual sequence is in the clone deposited with the ATCC as DNA48314-1320. Clone UNQ332 (DNA48314-1320) contains a single open reading frame that has a clear translation initiation site at nucleotide positions 171-173 and terminates at the stop codon at nucleotide positions 2565-2567 (FIG. 162). The expected polypeptide precursor is 789 amino acids in length (FIG. 163). The full-length PRO531 protein shown in FIG. 163 has an estimated molecular weight of about 87,552 Daltons and a pI of about 4.84. Clone UNQ332 (DNA48314-1320) was deposited with the ATCC on March 26, 1998.

Amino acid sequence analysis of the full-length PRO531 polypeptide suggested that some of these sequences have significant homology with protocadherin 3. Also, PRO531 has been found in the brain like other protocadherins, indicating that PRO531 may be a novel member of the Kadherin family.

Analysis of the amino acids of SEQ ID NO: 405 revealed cadherin extracellular repeat domain features at about amino acids 122-132, 231-241, 336-346, 439-449, and 549-559 of SEQ ID NO: 405. ATP / GTP-binding site motif A (P-loop) was found at about amino acids 285 to 292 in SEQ ID NO: 405. N-glycosylation sites were found at about amino acids 567-570, 786-790, 418-421 and 336-339 in SEQ ID NO: 405. In SEQ ID NO: 405 the signal peptide was at about amino acids 1-26 and the transmembrane domain was at about amino acids 685-712.

Example 65 Isolation of cDNA Clones Encoding Human PRO534

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA43038. Based on the DNA43038 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO534.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-CACAGAGCCAGAAGTGGCGGAATC-3 '(SEQ ID NO: 411)

Reverse PCR Primer 5'-CCACATGTTCCTGCTCTTGTCCTGG-3 '(SEQ ID NO: 412)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA43038.

Hybridization probe

5'-CGGTAGTGACTGTACTCTAGTCCTGTTTTACACCCCGTGGTGCCG-3 '(SEQ ID NO: 413)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO534 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from lung tissue of human fetus (LIB26).

DNA sequence analysis of clones isolated as described above yielded the full-length DNA sequence of PRO534 (herein referred to as UNQ335 (DNA48333-1321)) (SEQ ID NO: 409) and the protein sequence of PRO534 derived therefrom.

The full nucleotide sequence of UNQ335 (DNA48333-1321) is shown in FIG. 164 (SEQ ID NO: 409). Clone UNQ335 (DNA48333-1321) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 87-89 and terminates at the stop codon at nucleotide positions 1167-1169 (Figure 164). The expected polypeptide precursor is 360 amino acids long (FIG. 165). The full-length PRO534 protein shown in FIG. 165 has a molecular weight of about 39,885 Daltons and a pI of about 4.79. Clone UNQ335 (DNA48333-1321) was deposited with the ATCC on March 26, 1998. This clone contains the actual sequence and it is understood that the sequences provided herein are representative on the basis of conventional sequencing techniques.

Amino acid sequence analysis of the full-length PRO534 polypeptide suggests that some of these sequences have significant sequence identity with the protein disulfide isomerase, thus suggesting that PRO534 may be a novel disulfide isomerase.

Analysis of the amino acid sequence of PRO534 showed the signal sequences at about amino acids 1-22 of SEQ ID NO: 410. The transmembrane domain was at about amino acids 321 to 340 in SEQ ID NO: 410. The region corresponding to disulfide isomerase was at amino acids 212 to 302 in SEQ ID NO: 410. The thioredoxin domain was at amino acids 211 to 227 in SEQ ID NO: 410. N-glycosylation sites were at 165 to 168, 181 to 184, 187 to 190, 194 to 197, 206 to 209, 278 to 281 and 293 to 296 in SEQ ID NO: 410. Corresponding nucleotides can be generally determined from the sequences provided herein. PRO534, like other protein disulfide isomerases, has a transmembrane domain that is not an ER bearing peptide. In addition, PRO534 may have an intron at the 5 'end.

Example 66 Isolation of cDNA Clone Encoding Human PRO697

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA43052. Based on the DNA43052 consensus sequence, 1) a cDNA library comprising the sequence of interest was identified by PCR, and 2) oligonucleotides were synthesized for use as a probe to isolate a clone of the full-length coding sequence of PRO697.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-CCTGGCTCGCTGCTGCTGCTC-3 '(SEQ ID NO: 416)

Reverse PCR Primer 5'-CCTCACAGGTGCACTGCAAGCTGTC-3 '(SEQ ID NO: 417)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA43052.

Hybridization probe

5'-CTCTTCCTCTTTGGCCAGCCCGACTTCTCCTACAAGCGCAGAATTGC-3 '(SEQ ID NO: 418)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO697 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO697 (herein referred to as UNQ361 (DNA50920-1325)) (SEQ ID NO: 414) and the protein sequence of PRO697 derived therefrom.

The full nucleotide sequence of UNQ361 (DNA50920-1325) is shown in FIG. 166 (SEQ ID NO: 414). Clone UNQ361 (DNA50920-1325) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 44-46 and terminates at the stop codon at nucleotide positions 929-931 (FIG. 166). The expected polypeptide precursor is 295 amino acids long (FIG. 167). The full-length PRO697 protein shown in FIG. 167 has an estimated molecular weight of about 33,518 Daltons and a pi of about 7.74. The clone UNQ361 (DNA50920-1325) was deposited with the ATCC on March 26, 1998. This clone contains the actual sequence and it is understood that the sequences provided herein are representative on the basis of conventional sequencing techniques.

Amino acid sequence analysis of the full-length PRO697 polypeptide suggests that some of these sequences have significant sequence identity with sFRP, thus indicating that PRO697 may be a member of the novel sFRP family.

Analysis of the amino acid sequence of PRO697 found that the signal sequence was at about amino acids 1-20 of SEQ ID NO: 415. Cysteine rich domains with identity to the curly N-terminus were at about amino acids 6-153 in SEQ ID NO: 415. Corresponding nucleotides can be generally determined from the sequences provided herein.

Example 67 Isolation of cDNA Clones Encoding Human PRO717

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA42829. Based on the DNA42829 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO717.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-AGCTTCTCAGCCCTCCTGGAGCAG-3 '(SEQ ID NO: 421)

Reverse PCR primers 5'-CGGGTCAATAAACCTGGACGCTTGG-3 '(SEQ ID NO: 422)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA42829.

Hybridization probe

5'-TATGTGGACCGGACCAAGCACTTCACTGAGGCCACCAAGATTG-3 '(SEQ ID NO: 423)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Thereafter, clones encoding the PRO717 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from liver tissue of human fetus (LIB229).

DNA sequence analysis of clones isolated as described above gave the full length DNA sequence of PRO717 (herein referred to as UNQ385 (DNA50988-1326)) (SEQ ID NO: 419) and the protein sequence of PRO717 derived therefrom.

The full nucleotide sequence of UNQ385 (DNA50988-1326) is shown in FIG. 168 (SEQ ID NO: 419). Clone UNQ385 (DNA50988-1326) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 17-19 and terminates at the stop codon at nucleotide positions 1697-1699 (FIG. 168). The expected polypeptide precursor is 560 amino acids long (FIG. 169). The full-length PRO717 protein shown in FIG. 169 had a molecular weight of about 58,427 Daltons and a pi of about 6.86. Clone UNQ385 (DNA50988-1326) was deposited with the ATCC on April 28, 1998. With respect to this sequence, it is understood that the clones deposited contain the correct sequence and the sequences provided herein are based on known sequencing techniques.

Amino acid sequence analysis of the full-length PRO717 polypeptide suggests that PRO717 may be a novel 12 transmembrane receptor. The reverse complementary strand of DNA50988 has the same identity as the hard strand of human regulatory myosin.

As a result of analyzing the amino acid sequence of SEQ ID NO: 420, the transmembrane domain has about 30 to 50, 61 to 79, 98 to 112, 126 to 146, 169 to 182, 201 to 215, 248 to 268, 280 to 300 amino acids in SEQ ID NO: 420. , 318 to 337, 341 to 357, 375 to 387 and 420 to 441. N-glycosylation sites were at about amino acids 40-43 and 43-46 in SEQ ID NO: 420. The glycosaminoglycan attachment site was at about amino acids 468-471 in SEQ ID NO: 420. Corresponding nucleotides can be generally determined from the sequences provided herein.

Example 68 Isolation of cDNA Clones Encoding Human PRO731

The database was used to examine the expressed sequence tag (EST) database. The EST database used herein was a private EST DNA database (LIFESEQ ™, Insight Pharmaceutical, Palo Alto, CA). Based on this DNA42801 sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO731.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-GTAAGCACATGCCTCCAGAGGTGC-3 '(SEQ ID NO: 426)

Reverse PCR primer 5'-GTGACGTGGATGCTTGGGATGTTG-3 '(SEQ ID NO: 427)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from the DNA42801 sequence.

Hybridization probe

5'-TGGACACCTTCAGTATTGATGCCAAGACAGGCCAGGTCATTCTGCGTCGA-3 '(SEQ ID NO: 428)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO731 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from human bone marrow tissue (LIB255). The cDNA used to isolate the cDNA clone was constructed by standard methods using commercially available reagents such as reagents from Invitrogen (San Diego, CA, USA). The cDNA is primed with oligo dT with a NotI site, ligated to the hemikinase treated SalI adapter, cleaved with NotI, appropriately sized by gel electrophoresis, and appropriate cloning vector (e.g., pRKB or pRKD; pRK5B is a precursor of pRK5D without the SfiI site; see Holmes et al., Science , 253 : 1278-1280 (1991) and cloned in a defined direction to the only XhoI and NotI sites.

DNA sequence analysis of clones isolated as described above gave the full length DNA sequence of PRO731 (herein referred to as UNQ395 (DNA48331-1329)) (SEQ ID NO: 424) and the protein sequence of PRO731 derived therefrom.

The total nucleotide sequence of UNQ395 (DNA48331-1329) is shown in FIG. 170 (SEQ ID NO: 424). Clone UNQ395 (DNA48331-1329) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 329-331 and terminates at the stop codon at nucleotide positions 3881-3883 (Figure 170). The expected polypeptide precursor is 1184 amino acids long (FIG. 171). The full-length PRO731 protein shown in FIG. 171 has an estimated molecular weight of about 129,022 Daltons and a pI of about 5.2. Clone UNQ395 (DNA48331-1329) was deposited with the ATCC on March 31, 1998. With respect to this sequence, it is understood that the clones deposited contain the correct sequence and the sequences provided herein are based on known sequencing techniques.

Amino acid sequence analysis of the full length PRO731 polypeptide suggests that some of these sequences have significant identity and similarity with members of the protocadherin family, thus indicating that PRO731 may be a novel protocadherin.

As a result of analyzing the amino acid sequence of SEQ ID NO: 425, the putative signal peptide was at about amino acids 1 to 13 of SEQ ID NO: 425. The transmembrane domain was at amino acids 719 to 739 in SEQ ID NO: 425. N-glycosylation sites were at 415-418, 582-586, 659-662, 662-665 and 857-860 in SEQ ID NO: 425. Cadherin extracellular repeat domain features were at about amino acids 123-133, 232-242, 340-350, 448-458 and 553-563 in SEQ ID NO: 425. Corresponding nucleotides can be generally determined from the sequences provided herein.

Example 69 Isolation of cDNA Clones Encoding Human PRO218

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA17411. Two EST sequences owned by Genentech were used for consensus assembly and these are shown in FIGS. 174 and 175. Based on the DNA17411 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR and 2) as a probe to isolate a clone of the full-length coding sequence of PRO218.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-AAGTGGAGCCGGAGCCTTCC-3 '(SEQ ID NO: 433)

Reverse PCR Primer 5'-TCGTTGTTTATGCAGTAGTCGG-3 '(SEQ ID NO: 434)

In addition, synthetic oligonucleotide hybridization probes with the following nucleotide sequences were prepared from consensus sequence DNA17411.

Hybridization probe

5'-ATTGTTTAAAGACTATGAGATACGTCAGTATGTTGTACAGG-3 '(SEQ ID NO: 435)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO218 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB28).

DNA sequence analysis of clones isolated as described above gave the full length DNA sequence of PRO218 (herein referred to as UNQ192 (DNA30867-1335)) (SEQ ID NO: 429) and the protein sequence of PRO218 derived therefrom.

The full nucleotide sequence of UNQ192 (DNA30867-1335) is shown in FIG. 172 (SEQ ID NO: 429). Clone UNQ192 (DNA30867-1335) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 150-152 and terminates at the stop codon at nucleotide positions 1515-1517 (FIG. 172). The expected polypeptide precursor is 455 amino acids long (FIG. 173). The full-length PRO218 protein shown in FIG. 173 has an estimated molecular weight of about 52,917 Daltons and a pi of about 9.5. Clone UNQ192 (DNA30867-1335) was deposited with the ATCC on April 28, 1998. With respect to this sequence, it is understood that the clones deposited contain the correct sequence and the sequences provided herein are based on known sequencing techniques.

Amino acid sequence analysis of the full length PRO218 polypeptide suggests that PRO218 may be a novel transmembrane protein.

As a result of analyzing the amino acid sequence of SEQ ID NO: 430, the putative signal peptide was at about amino acids 1 to 23 of SEQ ID NO: 430. Potential transmembrane domains were at about amino acids 37-55, 81-102, 150-168, 288-311, 338-356, 375-398 and 425-444 in SEQ ID NO: 430. The N-glycosylation site was at about amino acids 67, 180 and 243 in SEQ ID NO: 430. Eukaryotic cob albumin-binding proteins were at about amino acids 151-160 in SEQ ID NO: 430. Corresponding nucleotides can be generally determined from the sequences provided herein.

Example 70 Isolation of cDNA Clones Encoding Human PRO768

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA43448. Based on the DNA43448 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO768.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-GGCTGACACCGCAGTGCTCTTCAG-3 '(SEQ ID NO: 438)

Reverse PCR primer 5'-GCTGCTGGGGACTGCAATGTAGCTG-3 '(SEQ ID NO: 439)

Additionally, synthetic oligonucleotide hybridization probes with the following nucleotide sequences were prepared from consensus sequence DNA43448.

Hybridization probe

5'-CATCCTCCATGTCTCCCATGAGGTCTCTATTGCTCCACGAAGCATC-3 '(SEQ ID NO: 440)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO768 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from human bone marrow tissue (LIB255).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO768 (herein referred to as UNQ406 (DNA55737-1345)) (SEQ ID NO: 436) and the protein sequence of PRO768 derived therefrom.

The full nucleotide sequence of UNQ406 (DNA55737-1345) is shown in FIG. 176 (SEQ ID NO: 436). Clone UNQ406 (DNA55737-1345) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 20-22 and terminates at the stop codon at nucleotide positions 3443-3445 (FIG. 176). The expected polypeptide precursor is 1141 amino acids long (FIG. 177). The full-length PRO768 protein shown in FIG. 177 has an estimated molecular weight of about 124,671 Daltons and a pi of about 5.82. Clone UNQ406 (DNA55737-1345) was deposited with the ATCC on April 6, 1998. With respect to this sequence, it is understood that the clones deposited contain the correct sequence and the sequences provided herein are based on known sequencing techniques.

Amino acid sequence analysis of the full-length PRO768 polypeptide suggests that the PRO768 polypeptide has significant sequence identity and similarity to integrin 7.

As a result of analyzing the amino acid sequence of SEQ ID NO: 437, the putative signal peptide was at about amino acids 1 to 33 of SEQ ID NO: 437. The transmembrane domain was at amino acids 1039 to 1064 in SEQ ID NO: 437. N-glycosylation sites were at amino acids 86-89, 746-749, 949-952, 985-988 and 1005-1008 in SEQ ID NO: 437. Integrin alpha chain protein domains comprise about amino acids 1064 to 1071, 384 to 409, 1041 to 1071, 317 to 346, 443 to 465, 385 to 407, 215 to 224, 643 to 647, 85 to 99, 322 to 346 in SEQ ID NO: 437. , 470-479, 442-466, 379-408 and 1031-1047. Corresponding nucleotides can be generally determined from the sequences provided herein.

Example 71 Isolation of cDNA Clones Encoding Human PRO771

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA43330. Based on the DNA43330 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO771.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-CAGCAATATTCAGAAGCGGCAAGGG-3 '(SEQ ID NO: 443)

Reverse PCR primer 5'-CATCATGGTCATCACCACCATCATCATC-3 '(SEQ ID NO: 444)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA43330.

Hybridization probe

5'-GGTTACTACAAGCCAACACAATGTCATGGCAGTGTTGGACAGTGCTGG-3 '(SEQ ID NO: 445)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO771 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB28).

DNA sequence analysis of clones isolated as described above gave the full length DNA sequence of PRO771 (herein referred to as UNQ409 (DNA49829-1346)) (SEQ ID NO: 419) and the protein sequence of PRO771 derived therefrom.

The full nucleotide sequence of UNQ409 (DNA49829-1346) is shown in FIG. 178 (SEQ ID NO: 441). Clone UNQ409 (DNA49829-1346) contains a single open reading frame that has a clear translation initiation site at nucleotide positions 134-136 and terminates at the stop codon at nucleotide positions 1442-1444 (FIG. 178). The expected polypeptide precursor is 436 amino acids in length (FIG. 179). The full-length PRO771 protein shown in FIG. 179 has an estimated molecular weight of about 49,429 Daltons and a pi of about 4.8. Clone UNQ409 (DNA49829-1346) was deposited with the ATCC on April 7, 1998. With respect to this sequence, it is understood that the clones deposited contain the correct sequence and the sequences provided herein are based on known sequencing techniques.

Amino acid sequence analysis of the full-length PRO771 polypeptide suggests that some of this sequence has significant homology with testican proteins, thus indicating that PRO771 may be a novel testan homologue.

Analyzing the amino acid sequence of SEQ ID NO: 442, putative signal peptide, leucine zipper pattern, N-myristoylation site, and tyroglobulin type-I repeats are also shown in FIG. Corresponding nucleotides can be generally determined from the sequences provided herein.

Example 72 Isolation of cDNA Clones Encoding Human PRO733

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA45600. Based on the DNA45600 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO733.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-CCCAGCAGGGATGGGCGACAAGA-3 '(SEQ ID NO: 448)

Reverse PCR Primer 5'-GTCTTCCAGTTTCATATCCAATA-3 '(SEQ ID NO: 449)

Additionally, synthetic oligonucleotide hybridization probes with the following nucleotide sequences were prepared from consensus sequence DDNA45600.

Hybridization probe

5'-CCAGAAGGAGCACGGGGAAGGGCAGCCAGATCTTGTCGCCCAT-3 '(SEQ ID NO: 450)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO733 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from human bone marrow tissue (LIB255).

DNA sequence analysis of clones isolated as described above yielded the full-length DNA sequence of PRO733 (herein referred to as UNQ411 (DNA52196-1348)) (SEQ ID NO: 446) and the protein sequence of PRO733 derived therefrom.

The full nucleotide sequence of UNQ411 (DNA52196-1348) is shown in FIG. 180 (SEQ ID NO: 446). Clone UNQ411 (DNA52196-1348) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 106-108 and terminates at the stop codon at nucleotide positions 793-795 (Figure 180). The expected polypeptide precursor is 229 amino acids long (FIG. 181). The full-length PRO733 protein shown in FIG. 181 was estimated to have a molecular weight of about 26,107 Daltons and a pi of about 4.73. Clone UNQ411 (DNA52196-1348) was deposited with the ATCC on April 7, 1998. With respect to this sequence, it is understood that the clones deposited contain the correct sequence and the sequences provided herein are based on known sequencing techniques.

Amino acid sequence analysis of the full-length PRO733 polypeptide suggests that some of these sequences have significant sequence identity and similarity with the T1 / ST2 receptor binding protein precursors, and thus may have similar functions in cellular signaling. In the case of cytokines, they may be useful for the treatment of inflammation and cancer.

Analyzing the amino acid sequence of SEQ ID NO: 447, putative signal peptide, transmembrane domain, N-myristoylation site and tyrosine kinase site are also shown in FIG. Corresponding nucleotides can be generally determined from the sequences provided herein.

Example 73 Isolation of cDNA Clones Encoding Human PRO162

The expressed sequence tag (EST) DNA database (Merck / Washington University) was examined to confirm that EST AA397543 exhibits homology with human pancreas-related proteins. EST AA397543 Western rape was purchased, its insert was sequenced, and the obtained sequence was shown in FIG. 182 (SEQ ID NO: 451).

The total nucleotide sequence of PRO162 is shown in FIG. 182 (SEQ ID NO: 541). DNA clones of this clone gave the full length DNA sequence of PRO162 (herein referred to as UNQ429 (DNA56965-1356)) (SEQ ID NO: 451) and the protein sequence of PRO162 derived therefrom. Clone UNQ429 (DNA56965-1356) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 86-88 and terminates at the stop codon at nucleotide positions 611-613 (Figure 182). The expected polypeptide precursor is 175 amino acids long (FIG. 183). The full-length PRO162 protein shown in FIG. 183 has an estimated molecular weight of about 19,330 Daltons and a pI of about 7.25. Clone UNQ429 (DNA56965-1356) was deposited with the ATCC. With respect to this sequence, it is understood that the clones deposited contain the correct sequence and the sequences provided herein are based on known sequencing techniques.

Amino acid sequence analysis of the full-length PRO162 polypeptide suggests that some of these sequences have significant homology with human pancreas-related proteins, thus indicating that PRO162 may be a novel pancreas-related protein.

As a result of analyzing the amino acid sequence of SEQ ID NO: 452, the putative signal peptide was at about amino acids 1 to 26 of SEQ ID NO: 452. The C-type lectin domain feature was at about amino acids 146-171 in SEQ ID NO: 452. Corresponding nucleotides can be generally determined from the sequences provided herein.

Example 74 Isolation of cDNA Clones Encoding Human PRO788

A phrap was used to assemble a consensus DNA sequence (referred to herein as DNA49308) for another EST sequence as described in Example 1 above. Based on the homology observed between the DNA49308 consensus sequence and Insight EST clone number 2777282, Insight EST clone number 2777282 was purchased and obtained by sequencing thereof, referred to as PRO788 (UNQ430 (DNA56405-1357) herein). Full length DNA sequence (SEQ ID NO: 453) and protein sequence of PRO788 derived therefrom.

Clone UNQ430 (DNA56405-1357) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 84-86 and terminates at the stop codon at nucleotide positions 459-461 (FIG. 184). The expected polypeptide precursor is 125 amino acids long (Figure 185). The full-length PRO788 protein shown in FIG. 185 has an estimated molecular weight of about 13,115 Daltons and a pi of about 5.90. Clone UNQ430 (DNA56405-1357) was deposited with the ATCC. With respect to this sequence, it is understood that the clones deposited contain the correct sequence and the sequences provided herein are based on known sequencing techniques.

As a result of the analysis of FIG. 185, the signal peptide is shown at about amino acids 1-17 of SEQ ID NO: 454. The N-glycosylation site was at about amino acids 46-49 in SEQ ID NO: 454.

Example 75 Isolation of cDNA Clones Encoding Human PRO1008

Consensus DNA sequences were assembled for other EST sequences using phraps as described in Example 1 above. This consensus sequence is referred to herein as DNA49804. Genentech's proprietary EST was used for this consensus assembly, referred to herein as DNA16508 (FIG. 188, SEQ ID NO: 457). Based on the homology observed between the DNA49804 sequence and Merck EST clone number AA143670, Merck EST clone number AA143670 was purchased and its insert obtained and sequenced. This sequence is shown in FIG. 186 (SEQ ID NO: 455) herein.

The full length sequence of PRO1008 (herein referred to as UNQ492 (DNA57530-1375)) (FIG. 455) was sequenced and the protein sequence of PRO1008 derived therefrom was identified.

The full nucleotide sequence of UNQ492 (DNA57530-1375) is shown in FIG. 186 (SEQ ID NO: 455). Clone UNQ492 (DNA57530-1375) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 138-140 and terminates at the stop codon at nucleotide positions 936-938 (FIG. 186). The expected polypeptide precursor is 266 amino acids in length (FIG. 187). The full-length PRO1008 protein shown in FIG. 187 has an estimated molecular weight of about 28,672 Daltons and a pI of about 8.85. Clone UNQ492 (DNA57530-1375) was deposited with the ATCC on 20 May 1998. With respect to this sequence, it is understood that the clones deposited contain the correct sequence and the sequences provided herein are based on known sequencing techniques.

Analysis of the amino acid sequence of full-length PRO1008 suggests that some of this sequence has significant sequence identity and / or similarity with mdkk-1, and therefore PRO1008 may be a novel member of this family and includes activity It has a head.

As a result of analyzing the amino acid sequence of SEQ ID NO: 456, the putative signal peptide was at about amino acids 1 to 23 of SEQ ID NO: 456. The N-glycosylation site was at about amino acids 256 to 259 in SEQ ID NO: 456, and the zn- (2) -cys (6) binuclear cluster domain of the fungus was at about amino acids 110 to 126 in SEQ ID NO: 456. Corresponding nucleotides can be generally determined from the sequences provided herein.

Example 76 Isolation of cDNA Clones Encoding Human PRO1012

Consensus sequences were obtained for other EST sequences as described in Example 1 above, which is referred to herein as DNA49313. Based on the DNA49313 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO1012.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-ACTCCCCAGGCTGTTCACACTGCC-3 '(SEQ ID NO: 460)

Reverse PCR primer 5'-GATCAGCCAGCCAATACCAGCAGC-3 '(SEQ ID NO: 461)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA49313.

Hybridization probe

5'-GTGGTGATGATAGAATGCTTTGCCGAATGAAAGGAGTCAACAGCTATCCC-3 '(SEQ ID NO: 462)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO1012 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above yielded the full-length DNA sequence of PRO1012 (herein referred to as UNQ495 (DNA56439-1376)) (SEQ ID NO: 458) and the protein sequence of PRO1012 derived therefrom.

The full nucleotide sequence of UNQ495 (DNA56439-1376) is shown in FIG. 189 (SEQ ID NO: 458). Clone UNQ495 (DNA56439-1376) contains a single open reading frame that has a clear translation initiation site at nucleotide positions 404-406 and terminates at the stop codon at nucleotide positions 2645-2647 (FIG. 189). The expected polypeptide precursor is 747 amino acids long (FIG. 190). The full-length PRO1012 protein shown in FIG. 190 has an estimated molecular weight of about 86,127 Daltons and a pi of about 7.46. Clone UNQ495 (DNA56439-1376) was deposited with the ATCC on 14 May 1998. With respect to this sequence, it is understood that the clones deposited contain the correct sequence and the sequences provided herein are based on known sequencing techniques.

Amino acid sequence analysis of the full-length PRO1012 polypeptide indicates that some of this sequence has significant sequence identity with disulfide isomerase and therefore PRO1012 may be a novel disulfide isomerase related protein.

Analysis of the amino acid sequence of SEQ ID NO: 459 showed that the heme-binding site features of the cytochrome C group were at about amino acids 158-163 of SEQ ID NO: 459. The Nt-DNAJ domain feature was at about amino acids 77-96 in SEQ ID NO: 459. The N-glycosylation site was at about amino acids 484-487 in SEQ ID NO: 459. The ER target sequence was at about amino acids 744-747 in SEQ ID NO: 459. The disclosed polypeptides and nucleic acids may be produced in a conventional manner, with or without a portion thereof, in alternative embodiments. For example, it may be desirable to produce PRO1012 lacking an ER target sequence. Corresponding nucleotides can be generally determined from the sequences provided herein.

Example 77 Isolation of cDNA Clones Encoding Human PRO1014

A consensus DNA sequence was assembled for another EST sequence using phrap as described in Example 1 above, and the resulting consensus sequence is referred to herein as DNA49811. Based on the homology observed between the DNA49811 sequence and Insight EST clone number 2612207, Insight EST clone number 2612207 was purchased and obtained by sequencing thereof, which sequence is shown herein in FIG. 191 (SEQ ID NO: 463). It was.

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence (SEQ ID NO: 463) of PRO1014 (herein referred to as UNQ497 (DNA56409-1377)) and the protein sequence of PRO1014 derived therefrom.

The full nucleotide sequence of UNQ497 (DNA56409-1377) is shown in FIG. 191 (SEQ ID NO: 463). Clone UNQ497 (DNA56409-1377) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 66-68 and terminates at the stop codon at nucleotide positions 966-968 (FIG. 191). The expected polypeptide precursor is 300 amino acids long (FIG. 192). The full-length PRO1014 protein shown in FIG. 192 has an estimated molecular weight of about 33,655 Daltons and a pi of about 9.31. Clone UNQ497 (DNA56409-1377) was deposited with the ATCC on 20 May 1998. With respect to this sequence, it is understood that the clones deposited contain the correct sequence and the sequences provided herein are based on known sequencing techniques.

Analysis of the amino acid sequence of the full-length PRO1014 polypeptide suggests that some of this sequence has significant sequence identity with the reductase, and therefore PRO1014 may be a novel member of this reductase family.

Analysis of the amino acid sequence of SEQ ID NO: 464 showed the putative signal peptide at about amino acids 1-19 of SEQ ID NO: 464. cAMP and cGMP dependent protein kinase phosphorylation sites were at about amino acids 30-33 and 58-61 in SEQ ID NO: 464. Short-chain alcohol dehydrogenase family proteins were at about amino acids 165-202, 37-49, 112-122 and 210-219 in SEQ ID NO: 464. Corresponding nucleotides of these domains and any other amino acids provided herein can be generally determined from the sequences provided herein.

Example 78 Isolation of cDNA Clones Encoding Human PRO1017

Consensus DNA sequences were assembled for other EST sequences using phraps as described in Example 1 above, which is referred to herein as DNA53235. Based on the homology observed between the DNA53235 sequence and Merck EST clone number AA243086, Merck EST clone number AA243086 was purchased and obtained by sequencing thereof, and the obtained sequence was shown in FIG. 193 (SEQ ID NO: 465) herein. Shown. DNA sequence analysis yielded the full-length DNA sequence of PRO1017 (herein referred to as UNQ500 (DNA56112-1379)) (SEQ ID NO: 465) and the protein sequence of PRO1017 derived therefrom.

The full nucleotide sequence of UNQ500 (DNA56112-1379) is shown in FIG. 193 (SEQ ID NO: 465). Clone UNQ500 (DNA56112-1379) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 128-130 and terminates at the stop codon at nucleotide positions 1370-1372 (FIG. 193). The expected polypeptide precursor is 414 amino acids long (FIG. 194). The full-length PRO1017 protein shown in FIG. 194 has an estimated molecular weight of about 48,414 Daltons and a pi of about 9.54. Clone UNQ500 (DNA56112-1379) was deposited with the ATCC. With respect to this sequence, it is understood that the clones deposited contain the correct sequence and the sequences provided herein are based on known sequencing techniques.

Analysis of the amino acid sequence of full length PRO1017 suggests that some of this sequence has significant sequence identity with HNK-1 sulfotransferase, and thus PRO1017 may be a novel sulfotransferase.

Analysis of the amino acid sequence of SEQ ID NO: 466 showed the putative signal peptide at about amino acids 1-31 of SEQ ID NO: 466. The N-glycosylation sites were at about amino acids 134 to 137, 209 to 212, 280 to 283, and 370 to 237 in SEQ ID NO: 466. The TNFR / NGFR family cysteine-rich region protein was at about amino acids 329-332 in SEQ ID NO: 466. Corresponding nucleotides can be generally determined from the sequences provided herein. Proteins can be secreted.

Example 79 Isolation of cDNA Clones Encoding Human PRO474

Consensus DNA sequences were assembled for other EST sequences using phraps as described in Example 1 above, which is referred to herein as DNA49818. Based on the homology observed between the DNA49818 consensus sequence and Merck EST clone number H77889, Merck EST clone number H77889 was purchased and its insert obtained and sequenced, which sequence is shown herein in FIG. 195 (SEQ ID NO: 467). Shown. DNA sequence analysis yielded the full-length DNA sequence of PRO474 (herein referred to as UNQ502 (DNA56045-1380)) (SEQ ID NO: 467) and the protein sequence of PRO474 derived therefrom.

The full nucleotide sequence of UNQ502 (DNA56045-1380) is shown in FIG. 195 (SEQ ID NO: 467). Clone UNQ502 (DNA56045-1380) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 106-108 and terminates at the stop codon at nucleotide positions 916-918 (FIG. 195). The expected polypeptide precursor is 270 amino acids long (FIG. 196). The full-length PRO474 protein shown in FIG. 196 has an estimated molecular weight of about 28,317 Daltons and a pI of about 6.0. Clone UNQ502 (DNA56045-1380) was deposited with ATCC. With respect to this sequence, it is understood that the clones deposited contain the correct sequence and the sequences provided herein are based on known sequencing techniques.

As a result of analyzing the amino acid sequence of SEQ ID NO: 468, the N-glycosylation site was at about amino acids 138 to 141 of SEQ ID NO: 468. Short-chain alcohol dehydrogenase family proteins were at about amino acids 10-22, 81-91, 134-171 and 176-185 in SEQ ID NO: 468. Corresponding nucleotides can be generally determined from the sequences provided herein.

Example 80 Isolation of cDNA Clones Encoding Human PRO1031

An initial consensus DNA sequence was assembled for another EST sequence using phrap as described in Example 1 above, which is referred to herein as DNA47332. Based on the homology observed between the DNA47332 sequence and Merck EST clone number W74558, Merck EST clone number W74558 was purchased and its insert obtained and sequenced, which sequence is shown herein in FIG. 197 (SEQ ID NO: 469). It was. DNA sequence analysis yielded the full length DNA sequence of PRO1031 (herein referred to as UNQ516 (DNA59294-1381)) (SEQ ID NO: 469) and the protein sequence of PRO1031 derived therefrom.

The full nucleotide sequence of UNQ516 (DNA59294-1381) is shown in FIG. 197 (SEQ ID NO: 469). Clone UNQ516 (DNA59294-1381) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 42-44 and terminates at the stop codon at nucleotide positions 582-584 (FIG. 197). The expected polypeptide precursor is 180 amino acids long (FIG. 198). The protein of the full-length PRO1031 shown in FIG. 198 has an estimated molecular weight of about 20,437 Daltons and a pI of about 9.58. Clone UNQ516 (DNA59294-1381) was deposited with the ATCC. With respect to this sequence, it is understood that the clones deposited contain the correct sequence and the sequences provided herein are based on known sequencing techniques.

Analysis of the amino acid sequence of the full-length PRO1031 polypeptide suggests that this sequence is a novel cytokine.

As a result of analyzing the amino acid sequence of SEQ ID NO: 470, the putative signal peptide was at about amino acids 1 to 20 of SEQ ID NO: 470. The N-glycosylation site was at about amino acids 75-78 of SEQ ID NO: 470. The region that was sequence identical to IL-17 was at about amino acids 96-180. Corresponding nucleotides can be generally determined from the sequences provided herein.

Example 81 Isolation of cDNA Clone Encoding Human PRO938

Consensus sequences were obtained for other EST sequences as described in Example 1 above, which is referred to herein as DNA49798. Based on the DNA49798 DNA consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO938.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-GTCCAGCCCATGACCGCCTCCAAC-3 '(SEQ ID NO: 473)

Reverse PCR primer 5'-CTCTCCTCATCCACACCAGCAGCC-3 '(SEQ ID NO: 474)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA49798.

Hybridization probe

5'-GTGGATGCTGAAATTTTACGCCCCATGGTGTCCATCCTGCCAGC-3 '(SEQ ID NO: 475)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO938 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of the clones isolated as described above yielded the full length DNA sequence (SEQ ID NO: 471) of PRO938 (herein referred to as UNQ475 (DNA56433-1406)) and the protein sequence of PRO938 derived therefrom.

The full nucleotide sequence of UNQ475 (DNA56433-1406) is shown in FIG. 199 (SEQ ID NO: 471). Clone UNQ475 (DNA56433-1406) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 134-136 and terminates at the stop codon at nucleotide positions 1181-1183 (FIG. 199). The expected polypeptide precursor is 349 amino acids long (FIG. 200). The full-length PRO938 protein shown in FIG. 200 has an estimated molecular weight of about 38,952 Daltons and a pi of about 4.34. Analysis of the full length PRO938 sequence shown in FIG. 200 (SEQ ID NO: 472) revealed a signal peptide of about amino acids 1 to about amino acid 22, the transmembrane domain of about amino acids 191 to about amino acids 211, and the potential of about amino acids 46 to about amino acids 49. The presence of an N-glycosylation site, a region homologous to disulfide isomerase of about amino acids 56 to about amino acid 72, and a region having sequence identity to the flavodoxin protein of about amino acids 173 to about amino acid 187 was demonstrated.

The clone UNQ475 (DNA56433-1406) was deposited with the ATCC on May 12, 1998, assigned the ATCC accession number 209857.

Amino acid sequence analysis of the full-length PRO938 polypeptide suggests that this sequence has significant sequence similarity with protein disulfide isomerase, thus indicating that PRO938 may be a novel protein disulfide isomerase. Analysis of the Dayhof database (version 35.45 Swiss Prot 35) revealed significant homology between the PRO938 amino acid sequence and the Dayhof sequence of P_W03626, P_W03627, P_R70491, GARP_PLAFF, XLU85970_1, ACADISPROA_1, IE68_HSVSA, KSU52064_1, U93872_83, and P_R97866. Proven.

Example 82: Isolation of cDNA Clones Encoding Human PRO1082

Consensus sequences were obtained for other EST sequences as described in Example 1 above, which is referred to herein as DNA38097. Based on this consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR and 2) as a probe to isolate a clone of the full-length coding sequence of PRO1082.

One set of PCR primers (forward and reverse) was synthesized:

Omnidirectional primer 1 5'-GTCCACAGACAGTCATCTCAGGAGCAG-3 '(SEQ ID NO: 478)

Omnidirectional primer 2 5'-ACAAGTGTCTTCCCAACCTG-3 '(SEQ ID NO: 479)

Reverse primer 1 5'-ATCCTCCCAGAGCCATGGTACCTC-3 '(SEQ ID NO: 480)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA38097.

Hybridization probe

5'-CCAAGGATAGCTGTTGTTTCAGAGAAAGGATCGTGTGCTGCATCTCCTCCT-3 '(SEQ ID NO: 481)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Thereafter, clones encoding the PRO1082 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence of PRO1082 (herein referred to as UNQ539 (DNA53912-1457)) (SEQ ID NO: 476) and the protein sequence of PRO1082 derived therefrom.

The full nucleotide sequence of UNQ539 (DNA53912-1457) is shown in FIG. 201 (SEQ ID NO: 476). Clone UNQ539 (DNA53912-1457) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 160-162 and terminates at the stop codon at nucleotide positions 763-765 (FIG. 201). The expected polypeptide precursor is 201 amino acids in length (FIG. 202). The full-length PRO1082 protein shown in FIG. 202 has an estimated molecular weight of about 22,563 Daltons and a pi of about 4.87. Clone UNQ539 (DNA53912-1457) was deposited with the ATCC. With respect to this sequence, it is understood that the clones deposited contain the correct sequence and the sequences provided herein are based on known sequencing techniques.

Analysis of the amino acid sequence of SEQ ID NO: 477 revealed that the transmembrane domain was at about amino acids 45-65 of SEQ ID NO: 477. The cAMP- and cGMP-dependent protein kinase phosphorylation sites were at about amino acids 197-200 in SEQ ID NO: 477. The N-myristoylation site was at about amino acids 35-40 and 151-156 in SEQ ID NO: 477. The regions sharing sequence identity with the LDL receptor were at about amino acids 34-67 and 70-200 in SEQ ID NO: 477. Corresponding nucleotides can be generally determined from the sequences provided herein.

Example 83 Isolation of cDNA Clones Encoding Human PRO1083

Amylase screening described in Example 2 above was used to confirm the cDNA sequence, which cDNA sequence is referred to herein as DNA24256 (FIG. 205, SEQ ID NO: 484). This cDNA sequence was then compared and aligned against other known EST sequences as described in Example 1 to obtain consensus DNA sequences, referred to herein as DNA43422. Based on the DNA43422 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR and 2) as a probe to isolate a clone of the full-length coding sequence of PRO1083.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-GGCATTGGAGCAGTGCTGGGTG-3 '(SEQ ID NO: 485)

Reverse PCR primer 5'-TGGAGGCCTAGATGCGGCTGGACG-3 '(SEQ ID NO: 486)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Thereafter, clones encoding the PRO1083 gene were isolated with one of the probe oligonucleotides and PCR primers by using a positive library. RNA for preparing cDNA library was isolated from kidney tissue of human fetus (LIB227).

DNA sequence analysis of clones isolated as described above yielded the full length DNA sequence (SEQ ID NO: 482) of PRO1083 (herein referred to as UNQ540 (DNA50921-1458)) and the protein sequence of PRO1083 derived therefrom.

The full nucleotide sequence of UNQ540 (DNA50921-1458) is shown in FIG. 203 (SEQ ID NO: 482). Clone UNQ540 (DNA50921-1458) contains a single open reading frame that has an apparent translation initiation site at nucleotide positions 214-216 and terminates at the stop codon at nucleotide positions 2293-2295 (FIG. 203). The expected polypeptide precursor is 693 amino acids long (FIG. 204). The full-length PRO1083 protein shown in FIG. 204 has an estimated molecular weight of about 77,783 Daltons and a pI of about 8.87. Clone UNQ540 (DNA50921-1458) was deposited with the ATCC. With respect to this sequence, it is understood that the clones deposited contain the correct sequence and the sequences provided herein are based on known sequencing techniques.

As a result of analyzing the amino acid sequence of SEQ ID NO: 483, the putative signal peptide was at about amino acids 1 to 25 of SEQ ID NO: 483. The transmembrane domain was at about amino acids 382 to 398, 402 to 420, 445 to 468, 473 to 491, 519 to 537, 568 to 590 and 634 to 657 in SEQ ID NO: 483. The microsomal C-terminal target signal was at about amino acids 691 to 693 in SEQ ID NO: 483. The cAMP- and cGMP-dependent protein kinase phosphorylation sites were at about amino acids 198 to 201 and 370 to 373 in SEQ ID NO: 483. The N-glycosylation sites were at about amino acids 39-42, 148-151, 171-174, 234-237, 303-306, 324-227 and 341-344 in SEQ ID NO: 483. The G-protein coupled receptor family domain was at about amino acids 475-504 in SEQ ID NO: 483. Corresponding nucleotides can be generally determined from the sequences provided herein.

Example 84 Isolation of cDNA Clone Encoding Human PRO200

Probes based on expressed sequence tags (EST) identified from Insight Pharmacological databases homologous to VEGF were used to screen cDNA libraries derived from human glioma cell line G61. In particular, the following four probes were generated using the insight clone “INC1302516”.

(SEQ ID NO: 489) ACTTCTCAGTGTCCATAAGGG;

(SEQ ID NO: 490) GAACTAAAGAGAACCGATACCATTTTCTGGCCAGGTTGTC;

(SEQ ID NO: 491) CACCACAGCGTTTAACCAGG; And

(SEQ ID NO: 492) ACAACAGGCACAGTTCCCAC.

Nine positives were identified and characterized. Three clones contained the full length coding region and showed sequence identity. Some clones were also identified from the fetal lung library and were identical to glioma-derived sequences except for the change of one nucleotide that did not alter the encoded amino acid.

Example 85 Expression Constructs for PRO200

For mammalian protein expression, the entire open reading frame (ORF) was cloned into a CMV-based expression vector. Epitope-tags (FALG, Kodak) and histidine-tags (His8) were inserted between the ORF and stop codons. VEGF-E-His8 and VEGF-E-FLAG were transferred to kidney 293 cells of human embryos using SuperFect (Qiagen) and pulse-labeled for 3 hours with [ ³⁵ S] methionine and [ ³⁵ C] cysteine. label). When 20 μl of 15-fold concentrated serum free condition medium was electrophoresed on polyacrylamide gel (Novex) in sodium dodecyl sulfate sample buffer (SDS-PAGE), both epitope-tagged proteins were transferred together. . VEGF-E-IgG expression plasmids were constructed by cloning the ORF in front of the human F _c (IgG) sequence.

Hink's TNM-FH medium (JRH Bioscience) supplemented with 10% fetal bovine serum with VEGF-E-IgG plasmid with baculogold baculovirus DNA (Pharmingen) using lipofectin (GibcoBRL) Co-transfected 10 ⁵ Sf9 cells propagated in Cells were incubated at 28 ° C. for 5 days. The supernatants were collected and used to amplify the first virus by infecting Sf9 cells at a Multiplicity Of Infection (MOI) of about 10. Cells were incubated for 3 days, then the supernatants were collected, 1 ml of supernatant bound to 30 μl of protein-A Sepharose CL-4B beads (Pharmacia) followed by SDS-PAGE analysis followed by expression of the recombinant plasmid. Measured. The first amplified supernatant was used to infect 500 ml of spin culture of Sf9 cells grown in ESF-921 medium (Expression System LLC) at a MOI of about 0.1. The cells were treated as described above except that the collected supernatants were sterile filtered. Specific proteins were purified by binding to Protein-A Sepharose 4 Fast Flow (Famacia).

Example 86 Northern Blot Analysis for PRO200

Blots of human poly (A) + RNA from various adult and fetal tissue and tumor cell lines were obtained from Clontech (Palo Alto, Calif.). Hybridization was performed using ³² P-labeled probes containing the entire coding region and washed at 63 ° C. with 0.1 × SSC, 0.1% SDS.

VEGF-E mRNA was detected in fetal lung, kidney, brain, liver and adult heart, placenta, liver, skeletal muscle, kidney and pancreas. VEGF-E mRNA has also been found in A549 lung adenocarcinoma and HeLa cervical adenocarcinoma cell lines.

Example 87: In Situ Hybridization of Human Fetal Tissue Sections to PRO200

The brain, lower extremities, small intestine, thyroid, lymph nodes, thymus, stomach, organs, skin, spleen, spinal cord, adrenal gland, placenta, ligaments and livers of the human fetus fixed in formalin and buried in paraffin, pancreas, lungs, spleen, lymph nodes, Adrenal, heart, aortic and skin cuts, paraffin removed, protein removed with proteinase K (20 μg / ml) at 37 ° C. for 15 minutes, and Lu LH and Gillett NA (Cell Vision 1 : 169-176, 1994) for further treatment for in situ hybridization. [α- ^33- P] UTP-labeled antisense riboprobes were generated from 980 bp PCR products (primers GGCGGAATCCAACCTGAGTAG and GCGGCTATCCTCCTGTGCTC, respectively, of SEQ ID NOs: 493 and 494). The slides were immersed in Kodak NTB2 nuclear track emulsion and exposed for 4 weeks.

VEGF-E mRNA expression was concentrated around the proliferation plate area and myocytes of the fetus.

Example 88: Myocyte Hypertrophy Assay for PRO200

Myocytes from ventricles (23 days of gestation) of neonate Harlan Sprague Dawley rats were plated twice at 75000 cells / ml in 96-well plates. Cells were treated with 2000, 200, 20 or 2 ng / ml of VEGF-E-IgG for 48 hours. Myocytes were stained with crystal violet to visualize morphology and scored on a 3 to 7 scale, with 3 indicating no stimulation and 7 indicating complete hypertrophy.

VEGF-E at 2000 ng / ml and 200 ng / ml enlarged with a score of 5 points.

Example 89 Cell Proliferation Assay for PRO200

Mouse embryonic fibroblasts C3HlOT1 / 2 cells (ATCC) were grown in 50:50 Ham's F-12, low glucose DMEM medium containing 10% fetal calf serum (FCS). Cells were plated in duplicate at 1000, 2000 and 4000 cells / well in 24-well plates. After 48 hours, cells were transferred to medium containing 2% FCS and incubated for 72 hours with 200, 800 or 2000 ng / ml of VEGF-E or no growth factor added.

Of all three cell densities, the number of cells in the presence of 200 ng / ml of VEGF-E was determined to be approximately 1.5 times greater than the number of cells in the absence of VEGF-E.

Example 90 Endothelial Cell Viability Assay for PRO200

Human umbilical vein endothelial cells (HUVEC, Cell Systems) were maintained in complete medium (cell system) and contained serum-free medium (cell system, 0.1% BSA at 20,000 cells / well in 48-well plates). 3 times) on a basic badge). Cells were incubated with 200 or 400 ng / ml VEGF-E-IgG, 100 ng / ml VEGF, 20 ng / ml base FGF or without addition for 5 days.

Survival was 2-3 times higher with VEGF-E added compared to no growth factor added. VEGF and basal FGF were included as positive controls.

Example 91 Isolation of cDNA Clone Encoding Human PRO285

A folk expressed sequence tag (EST) DNA database (LIFESEQ ^™ , Insight Pharmaceutical, Palo Alto, CA) was examined to confirm that EST (# 2243209) shows homology with the Drosophila Toll protein.

Based on the EST, a pair of primers (forward and reverse):

TAAAGACCCAGCTGTGACCG (SEQ ID NO: 499)

ATCCATGAGCCTCTGATGGG (SEQ ID NO: 500), and

Probe: ATTTATGTCTCGAGGAAAGGGACTGGTTACCAGGGCAGCCAGTTC (SEQ ID NO: 501)

Was synthesized.

mRNA for cDNA library construction was isolated from human placental tissue. The cDNA library used to isolate the cDNA clone was prepared by standard methods using commercially available reagents such as Invitrogen (Fast Track 2, San Diego, Calif.). The cDNA was primed with oligo dT with a NotI site, ligated to a hemikinase treated SalI adapter, cleaved with NotI, appropriately sized by gel electrophoresis, Life in Gettersburg, Maryland Cloning in the direction determined for the cloning vector pCR2.1 (Invitrogen Inc.) was carried out using reagents and protocols from Technology. Double stranded cDNAs were made larger than 100 bp and cloned into vectors cleaved by BamHI / NotI. pCR2.1 is a commercial plasmid designed to easily clone PCR fragments, which has the AmpR and KanR genes for selection and the LacZ gene for blue-white selection.

To screen several libraries for the source of full length clones, DNA from this library was screened via PCR amplification using the PCR primer pairs defined above. Positive libraries were then used to isolate clones encoding PRO285 using probe oligonucleotides and one of the PCR primers.

The entire cDNA clone was sequenced. The full nucleotide sequence of DNA40021-1154 (coding PRO285) is shown in FIG. 208 (SEQ ID NO: 495). Clone DNA40021-1154 contains a single open reading frame with an explicit translation initiation site at nucleotide positions 61-63 (FIG. 208). The predicted polypeptide precursor is 1049 amino acids in length and includes putative signal peptides at amino acid positions 1 to 29, putative transmembrane domains at amino acid positions 837 to 860, and leucine zipper patterns at amino acid positions 132 to 153 and 704 to 725, respectively. do. Note that the indicated boundaries are approximate and the practical limits of the indicated region motifs may differ by several amino acid differences. The clone DNA40021-1154 was deposited with the ATCC under the name DNA40021-1154, and assigned the ATCC deposit number 209389.

BLAST and FastA sequence alignment analysis of the full length sequence (using the ALIGN computer program) shows that this full length sequence is a human analogue of the Drosophila Toll protein and Toll1 (DNAX # HSU88540-1, randomly sequenced full length cDNA # HUMRSC786-1 The same); Toll2 (DNAX # HSU88878-1); Toll3 (DNAX # HSU88879-1); And Toll4 (DNAX # HSU88880-1).

Example 92 Isolation of cDNA Clone Encoding Human PRO286

A folk expressed sequence tag (EST) DNA database (LIFESEQ ^™ , Insight Pharmaceutical, Palo Alto, CA) was examined to confirm that EST (# 694401) shows homology with the Drosophila Toll protein.

Based on the EST, a pair of primers (forward and reverse):

GCCGAGACAAAAACGTTCTCC (SEQ ID NO: 502)

CATCCATGTTCTCATCCATTAGCC (SEQ ID NO: 503), and

Probe: TCGACAACCTCATGCAGAGCATCAACCAAAGCAAGAAAACAGTATT (SEQ ID NO: 504)

Was synthesized.

mRNA for cDNA library construction was isolated from human placental tissue. This RNA was used to generate cDNAs primed with oligo dT in vector pRK5D using reagents and pronocols from Life Technologies, Gettersburg, Maryland. pRK5D is a cloning vector with a sp6 transcription initiation site followed by a SfiI restriction enzyme site followed by an XhoI / NotI cDNA cloning site. The cDNA was primed with oligo dT with a NotI site, ligated to the hemikinase treated SalI adapter, cleaved with NotI, appropriately sorted to size greater than 1000 bp depending on size by gel electrophoresis, XhoI / Cloned pRK5D cleaved by NotI in the direction indicated.

To screen several libraries for the source of full length clones, DNA from this library was screened via PCR amplification using the PCR primer pairs defined above. Positive libraries were then used to isolate clones encoding the PRO286 gene using probe oligonucleotides and one of the PCR primers.

The entire cDNA clone was sequenced. The total nucleotide sequence of DNA42663-1154 (coding PRO286) is shown in FIG. 210 (SEQ ID NO: 497). Clone DNA42663-1154 contains a single open reading frame with an explicit translation initiation site at nucleotide positions 57 to 59 (FIG. 211). The expected polypeptide precursor is 1041 amino acids in length, with putative signal peptides at amino acid positions 1-26, potential transmembrane domains at amino acid positions 826-848, and amino acid positions 130-151, 206-227, 662-684, 669, respectively. To 690 and 693 to 614 leucine zipper patterns. Note that the indicated boundaries are approximate and the practical limits of the indicated region motifs may differ by several amino acid differences. The clone DNA42663-1154 was deposited with the ATCC under the name DNA42663-1154, and assigned the ATCC deposit number 209386.

BLAST and FastA sequence alignment analysis of the full length sequence (using the ALIGN computer program) shows that this full length sequence is a human analogue of the Drosophila Toll protein and Toll1 (DNAX # HSU88540-1, randomly sequenced full length cDNA # HUMRSC786-1 The same); Toll2 (DNAX # HSU88878-1); Toll3 (DNAX # HSU88879-1); And Toll4 (DNAX # HSU88880-1).

Example 93: NF-κB Analysis for PRO285 and PRO286

Depending on the Toll protein signal through the NF-κB pathway, its biological activity can be tested by NF-κB assay. In this assay, Jurkat cells were transiently transfected using lipofectamine reagent (Gibco BRL) according to the manufacturer's instructions. 1 μg of pB2XLuc plasmid containing luciferase gene induced by NF-κB was transfected with 1 μg of pSRαN expression vector with or without an insert encoding PRO285 or PRO286. As a positive control, cells were treated with PMA (phorbol myristyl acetate; 20 ng / ml) and PHA (phytohaemaglutinin; 2 μg / ml) for 3-4 days. After 2-3 days, cells were lysed to measure luciferase activity using a reagent from Promega.

Example 94: Isolation of cDNA Clones Encoding Human PRO213-1, PRO1330 and PRO1449

Consensus sequences were obtained for various EST sequences as described in Example 1 above, which is referred to herein as DNA28735. Based on the DNA28735 consensus sequence, 1) a cDNA library comprising the sequence of interest is identified by PCR and 2) used as a probe to isolate a clone of the full length coding sequence of PRO213-1, PRO1330 and / or PRO1449. Oligonucleotides were synthesized. A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR Primer 5'-TGGAGCAGCAATATGCCAGCC-3 '(SEQ ID NO: 511)

Reverse PCR Primer 5'-TTTTCCACTCCTGTCGGGTTGG-3 '(SEQ ID NO: 512)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA28735.

Hybridization probe

5'-GGTGACACTTGCCAGTCAGATGTGGATGAATGCAGTGCTAGGAGGG-3 '(SEQ ID NO: 513)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Thereafter, clones encoding the PRO213-1, PRO1330 and / or PRO1449 genes were isolated with one of the probe oligonucleotides and PCR primers by using a positive library. RNA for preparing cDNA library was isolated from lung tissue of a human fetus.

DNA sequencing of the clones isolated as described above was performed using PRO213-1, PRO1330 and / or PRO1449 (DNA30943-1-1163-1 (SEQ ID NO: 505), DNA64907-1163-1 (SEQ ID NO: 507) and DNA64908, respectively). The full length DNA sequence of -1163-1 (SEQ ID NO: 509) was obtained.

The total nucleotide sequence corresponds to DNA30943-1-1163-1 (SEQ ID NO: 505), DNA64907-1163-1 (SEQ ID NO: 507) and DNA64908-1163-1 (SEQ ID NO: 509), respectively. DNA30943-1-1163, DNA64907-1163-1, and DNA64908-1163-1 have distinct translation initiation sites at nucleotide positions 336 to 338, 488 to 490, and 326 to 328, respectively, and the nucleotide positions 1221 to 1223, 1307 to 1309, and It includes a single open reading frame terminating at stop codons of 1145-1147 (FIGS. 212, 214 and 216). Prospective polypeptide precursors are 295, 273 and 273 amino acids in length, respectively (FIGS. 213, 215 and 217). DNA30943-1-1163-1, DNA64907-1163-1, and DNA64908-1163-1 were deposited with ATCC and assigned ATCC accession numbers 209791, 203242, and 203243, respectively.

Amino acid sequence analysis of the full-length PRO213-1 polypeptide suggests that some of these sequences have significant homology with human growth arrest-specific gene 6 proteins. More specifically, analysis of the Dayhof database (version 35.45 Swiss Prot 35) demonstrated significant homology between the PRO213 amino acid sequence and the Dayhof sequences of HSMHC3W5A_6 and B48089.

In addition, analysis of the full-length PRO1330 and PRO1449 polypeptides shows significant identity with notch4. More specifically, analysis of the Dayhof database (version 35.130 Swiss Prot 35) demonstrated significant homology between the PRO1330 amino acid sequence and the Dayhof sequences of D86566_1 and NEL_HUMAN.

Example 95: Isolation of cDNA Clone Encoding Human PRO298

The cDNA isolated from the amylase screen described in Example 2 above is referred to herein as DNA26832 (FIG. 220, SEQ ID NO: 516). The DNA26832 sequence was then used to examine the expressed sequence tag (EST) database. The EST database included public EST databases (eg, Genbank) and private EST databases (LIFESEQ ^™ , Insight Pharmaceuticals, Palo Alto, CA). The investigation was performed using the computer programs BLAST or BLAST-2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparatives with BLAST scores of 70 (or in some cases 90) or higher that do not encode known proteins were clustered and the program "phrap" (Phil Green, University of Washington, Seattle, Washington, http: // bozeman. mbt.washington.edu/phrap.docs/phrap.html) to assemble into consensus DNA sequences.

Consensus DNA sequences were assembled for other EST sequences using phrap. This consensus sequence was stretched using repeated cycles of BLAST or BLAST-2 and phrap to stretch the consensus sequence as long as possible using the source of EST sequences described above. This extended assembly sequence is referred to as DNA35861. Based on the DNA35861 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library comprising the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO298. Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to provide PCR products of about 100 to 1000 bp in length. The length of the probe sequence is typically 40 to 55 bp. In some cases, additional oligonucleotides were synthesized when the consensus sequence was greater than about 1-1.5 kbp. To screen several libraries for full-length clones, DNA from these libraries was screened by PCR amplification using PCR primer pairs according to Ausubel et al., Current Protocols in Molecular Biology . Thereafter, clones encoding genes of interest were isolated using one of the probe oligonucleotides and primer pairs by using a positive library.

PCR primer pairs (forward and reverse) and hybridization probes were synthesized:

Omnidirectional PCR Primer 1 CAACGTGATTTCAAAGCTGGGCTC (SEQ ID NO: 517)

Omnidirectional PCR Primer 2 GCCTCGTATCAAGAATTTCC (SEQ ID NO: 518)

Omnidirectional PCR Primer 3 AGTGGAAGTCGACCTCCC (SEQ ID NO: 519)

Reverse PCR Primer 1 CTCACCTGAAATCTCTCATAGCCC (SEQ ID NO: 520)

Hybridization Probe 1

CGCAAAACCCATTTTGGGAGCAGGAATTCCAATCATGTCTGTGATGGTGG (SEQ ID NO: 521)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Thereafter, clones encoding the PRO298 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library.

RNA for preparing cDNA library was isolated from lung tissue of human fetus (LIB25). The cDNA library used to isolate cDNA clones was constructed in a standard manner using commercial reagents such as reagents from Invitrogen (San Diego, CA, USA). The cDNA is primed with oligo dT with a NotI site, ligated to the hemikinase treated SalI adapter, cleaved with NotI, appropriately sized by gel electrophoresis, and appropriate cloning vector (e.g., pRKB or pRKD; pRK5B is a precursor of pRK5D without the SfiI site; see Holmes et al., Science , 253 : 1278-1280 (1991) and cloned in a defined direction to the only XhoI and NotI sites.

DNA sequence analysis of clones isolated as described above yields the full-length DNA sequence of PRO298 (herein referred to as UNQ261 [DNA39975-1210]) (SEQ ID NO: 514) and the protein sequence of PRO298 derived therefrom (SEQ ID NO: 515). did.

The full nucleotide sequence of UNQ261 (DNA39975-1210) is shown in FIG. 218 (SEQ ID NO: 514). Clone UNQ261 (DNA39975-1210) contains a single open reading frame with an explicit translation initiation site at nucleotide positions 375 to 377. The expected polypeptide precursor is 364 amino acids in length. The protein has four putative transmembrane domains at amino acid positions 36-55 (type II ™), 65-84, 188-208 and 229-245, respectively. Putative N-linked glycosylation site starts at amino acid position 253. In addition, cAMP- and cGMP-dependent protein kinase phosphorylation sites starting at position 8, N-myristoylation sites starting at positions 173 and 262, and ZP domains at amino acid positions 45-60 were identified in the protein sequence. The clone DNA39975-1210 was deposited with the ATCC on April 21, 1998 and assigned the accession number 209783 to the ATCC.

Example 96 Isolation of cDNA Clone Encoding Human PRO337

The cDNA sequence isolated on the amylase screen described in Example 2 above is referred to herein as DNA42301 (FIG. 223, SEQ ID NO: 524). The DNA42301 sequence was then compared with other EST sequences using phrap as described in Example 1 above, and the consensus sequence referred to herein as DNA28761 was identified. Based on this consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full length coding sequence. The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO337 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library. RNA for preparing cDNA library was isolated from the brain of a human fetus.

The entire cDNA clone was sequenced. The full length nucleotide sequence of DNA43316-1237 is shown in FIG. 221 (SEQ ID NO: 522). Clone DNA43316-1237 contains a single open reading frame with a clear initiation site at nucleotide positions 134-136 (FIG. 221, SEQ ID NO: 522). The expected polypeptide precursor is 344 amino acids long. Clone DNA43316-1237 was deposited with ATCC and assigned ATCC Accession No. 209487.

Full length sequence analysis by BLAST and FastA sequence alignment revealed that PRO337 showed amino acid sequence identity (97%) with rat neurotrimin.

Example 97: Isolation of cDNA Clone Encoding Human PRO403

Introduction:

Human thrombopoietin (THPO) is a 352 amino acid glycosylation hormone consisting of two domains. N-terminal domains with 50% similarity to erythropoietin performed biological activity. C-terminus is required for secretion. The gene for thrombopoietin (THPO) is on human chromosome 3q27-q28, and six exons of this gene span 7 kilobase base pairs of genomic DNA (Gurney et al., Blood 85 : 981-988 (1995) ). Genomic DNA fragments in this region were identified and sequenced to determine if there were any genes encoding THPO homologs located near THPO. Three P1 clones containing one THPO locus and one PAC clone (Genome Systems Inc., St. Louis, MO, Cat. No. P1-2535 and PAC-6539) are isolated and 140 kb regions are filled by gaps using PCR. The study was performed in parallel with the ordered shotgun strategy. Assays show that this region contains four additional genes located very close to THPO (protein 2 (TRAP2) associated with tumor necrosis factor receptor type 1, renal initiation factor gamma (elF4g), chloride channel 2 (CLCN2) and RNA polymerase. Gene-rich region with 2 subunits hRP17). Although no THPO homologues were found in this region, four new genes were computer-assisted gene detection (GRAIL) (Xu et al., Gen. Engin. 16 : 241-253 (1994)), the presence of CpG degrees (Cross, S and Bird, A., Curr. Opin.Gen . & Devel. 5 : 109-314 (1995) and homology with known genes (as detected by WU-BLAST-2.0) (Altschul and Gish, Methods Enzymol. 266 : 460-480 (1996)) (http://blast.wustl.edu/blast/README.html).

step:

P1 and PAC clones:

The first human P1 clones were isolated from genomic P1 libraries screened with PCR primers designed from THPO genomic sequences (ALGurney et al., Blood 85 : 981-88 (1995)). After designing PCR primers from terminal sequences derived from the P1 clones, duplicate clones (PAC1, p1.t and P1.u) were identified for screening P1 and PAC libraries (Genome Systems, Catalog numbers P1-2535 and PAC-6539. Primers used to screen human BAC libraries were identified using the 3'-end from PAC.z (Genome Systems Inc., St. Louis, Cat. No. BDTW-4533A).

Sequential Shotgun Strategy:

Sequential shotgun strategy (OSS) (Chen et al., Genomics 17 : 651-656 (1993)) involved the mapping and sequencing of large genomic DNA clones in a systematic manner. P1 or PAC clones were sonicated to digest and fragments were subcloned into lambda vectors (λBluestar) (Novagen, Inc., Madison, WI, Cat. No. 69242-3). Lambda subclonal inserts were isolated by long length PCR and their ends were sequenced (Barnes, W., Proc. Natl. Acad. Sci. USA 91 : 2216-2220 (1994)). A partial map of the original clones was created by overlapping lambda-terminal sequences. Identifying these lambda clones with duplicate end-sequences and inserting the plasmid vectors (pUC9 or pUC18, Hopper Pharmacia Biotech, Inc. San Francisco, Calif.), Catalog numbers 27-4949-01 and 27- 4951-01) and the ends of the plasmid subclones were sequenced and assembled to generate contiguous sequences. This directed sequence strategy minimized the extra experimentation required while still being able to investigate and focus the area of interest.

In order to better define the THPO locus and study other genes related to the hematopoietin family, four genomic clones were isolated from this region by PCR screening the human P1 and PAC libraries (Genome System, Inc., catalog number Pl). -2535 and PAC6539).

The genomic fragments were Pl.t 40 kb, Pl.g 70 kb, Pl.u 70 kb, PAC.z 200 kb and BAC.1 80 kb. 190 kb genomic sequence is a shotgun strategy (OSS) (Chen et al, Genomic s 17.: 651-56 (1993)) of about 75% (140 kb) of the DNA region was sequenced by the automatic assembler ^TM (AutoAssembler ^TM) ( Applied Biosystems, Perkin Elmer, Foster City, CA, Cat. No. 903227) was used to assemble into contiguous sequences (contigs). The preliminary order of the contigs was determined by manual analysis. In the 140 kb region, contigs were 47 species. PCR was used to order the contigs and fill the gaps. The number and size of gaps are summarized below. The only 50 kb sequence for BAC.1 was sequenced in 10-fold excess by the total shotgun method.

Gap size Number <50 bp 13 50-150 bp 7 150-300 bp 7 300-1000 bp 10 1000-5000 bp 7 > 5000 bp 2 (15,000 bp)

DNA sequencing:

The ends of the lambda and plasmid subclones were sequenced using ABI DYE-Primer ^™ Chemistry (PE Applied Biosystems, Foster City, CA; Cat. No. 402112). PCR products with their respective PCR primers were sequenced using ABI DYE-terminator ^™ chemistry (PE Applied Biosystems, Foster City, CA, Cat. No. 403044). This sequence was collected using an ABI377 device. Working primers were used for PCR products of 1 kb or more. To duplicate the sequence checking and editing, auto assembler ^TM sequencing trace files to fill the Conti His sequence, and the gap created by the OSS strategy (PE Applied Biosystems, California, Foster City, materials, catalog number 903227) Sequencer ^TM (Sequencher ^TM ) (Gene Codes Corp., Ann Arbor, MI). Sequences generated by the full shotgun strategy were assembled using Phred and Phrap, Consed (http://chimera.biotech.washington.edu/uwgc/projects.htm) and GFP (GenomeReconstruction Manager for Phrap), version 1.2 ( It was edited using http://stork.cellb.bcm.tmc.edu/gfp/).

Gap Filling Strategies Using PCR-:

Primers were designed based on the 5'- and 3'-terminal sequences of each contig, avoiding repetitive, low quality sequence regions. All primers were designed to be 19-24 dimers with 50-70% G / C content. Oligos were synthesized and gel-purified by standard methods.

Since the direction and order of the contigs are unknown, the combination of primers was used sequentially in the amplification reaction. Two PCR kits were used. That is, the XL PCR kit (Perkin Elmer, Norwalk, CT, Cat. No. N8080205) with a synthesis time of about 10 minutes and the XL PCR kit under stringent conditions are used when the band of PCR product is attracted or when a large number of products are observed. Taq) polymerase PCR kit (Qiagen Inc., Valencia, CA, catalog # 201223). The main PCR product of the two of the well-reacted reactions was extracted from 0.9% cold melt agarose gel and purified with Geneclean DNA purification kit prior to sequencing.

analysis:

Identification and characterization of the coding region was performed as follows. First, RepeatMasker (AFA Smit & P. Green, http://ftp.genome.washington.edu/RM), which screens DNA sequences in FastA format against a library of repeat elements and recovers the masked query sequences. /RM_details.html) to shield the repeat sequence. GenBank with this sequence using WUBLAST 2.0 (Altschul, S. and Gish, W., Methods Enzymol . 266 : 460-480 (1996); http://blast.wust1.edu/blast/README.html) Databases were compared to identify unshielded repeat sequences and were manually masked.

Next, genome regions are compared against Genentech's protein database using the WUBLAST2.0 algorithm to identify known genes, and then the annotated genomes and cDNA sequences for each gene are each annotated, and the Needleman-Wunch algorithm ( Needleman and Wunsch, J. Mol. Biol . 48 : 443453 (1970) were used to find locally identical regions between nearly dissimilar sequences. The strategy detected all exons of the five known genes of this region, THPO, TRAP2, elF4g, CLCN2 and hRPB17 (see below).

Known genes Position on the map Eukaryotic Translation Initiation Factor 4 Gamma 3q27-qter Thrombopoietin 3q26-q27 Chloride channel 2 3q26-qter TNF Receptor Related Protein 2 Not mapped conventionally RNA polymerase 2 subunit hRPB17 Not mapped conventionally

Finally, many studies have predicted new warrior units. The CpG diagram (S. Cross and Bird, A., Curr. Opin. Genet. Dev. 5 : 109-314 (1995)) was used to define a promoter region, which is a GC-rich, 6-8-mer. It was confirmed by fragmentation of the cleavage site by an enzyme that recognizes palindromic sequences (NotI, NarI, BssHII, XhoI). CpG degrees are usually associated with a promoter region of a gene. Analysis of the short genomic region (10-20 kb) for GenBank with WBLAST 2.0 revealed the corresponding portion of the EST. Each EST sequence (or possibly its sequence chromatogram file) was recovered and assembled into a sequencer to provide a theoretical cDNA sequence (referred to herein as DNA36443). GRAIL2 (command line version for ApoCom Inc., Knoxville, TN, DEC Alpha) was used to predict new exons. Five known genes in this region served as internal controls in the performance of the GRAIL algorithm.

Isolation:

A portion of the endothelin converting enzyme-2 (ECE-2) cDNA clone was isolated by first slicing the expected ECE-2 exon in the genomic sequence in silico to generate the putative sequence (DNA36443). Oligonucleotide Probe: GAAGCAGTGCAGCCAGCAGTAGAGAGGCACCTGCTAAGA) (SEQ ID NO: 530) was designed and used to screen the small intestine library (LIB110) of the human fetus, internal PCR primers (36443f1) (ECE2.f: ACGCAGCTGGAGCTGGTCTTAGCA) (SEQ ID NO: 531) and (36443r1) Clones hybridizing to the probes were identified prior to sequencing using (ECE2.r) (GGTACTGGACCCCTAGGGCCACAA) (SEQ ID NO: 532). One positive clone was obtained, but this cDNA (DNA49830) showed some spliced transcript comprising approximately spliced exons 1-6 followed by intron 6 sequences. Oligo dT primers were annealed with the polyA-stretch inside the Alu element present in Intron 6. Additional ECE-2 cDNA fragment (DNA49831) was obtained by PCR from human fetal kidney library (LIB227) using primers devised from hypothetical cDNA sequences [36443f3: CCTCCCAGCCGAGACCAGTGG (SEQ ID NO: 533) and 36443r2: GGTCCTATAAGGGCCAAGACC (SEQ ID NO: 534)]. Obtained. This PCR product was extended from exon 13 to the 3 'untranslated region of exon 18.

Full length endothelin converting enzyme 2 (ECE-2) cDNA clone (DNA55800-1263) was raised and isolated from brain libraries of human embryos primed with dT. RNA from human fetal brain tissue (20 weeks gestation, number 283005) (SRC175) was isolated by guanidine thiocyanate and 5 μg was used to generate double stranded cDNA cloned into vector pRK5E. 3'-primers (pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT) (SEQ ID NO: 535) and 5-linker (pCGGACGCGTGGGTCGA) (SEQ ID NO: 536) were designed to introduce XhoI and NotI restriction sites. This library was screened using PCR primers [36443pcrf1: CGGCCGTGATGGCTGGTGACG (SEQ ID NO: 537) and 36443r3: GGCAGACTCCTTCCTATGGG (SEQ ID NO: 538) designed from a portion of human ECE-2 cDNA sequences (DNA49830 and DNA49831). PCR products were cloned into vector pCR2.1-TOPO (Invitrogen Corp., Carlsbad, Calif., Cat. No. K4500-01) and sequenced using DYE-terminator chemistry as described above.

Example 98 Northern Blot and In Situ RNA Hybridization Analysis of PRO403

Northern blot analysis analyzed the expression of PRO403 mRNA derived from human tissue. Polyadenylation RNA blots derived from human fetal and adult tissues (Clontech, Palo Alto, CA, Cat. No. 7760-1 and 7756-1) were [32P-α] dATP-labeled based on full-length PRO403 cDNA. Hybridized to cDNA fragments. Incubate the probe in blots at 42 ° C. for 18 hours in hybridization buffer (5XSSPE, 2X Denhardt's solution, 100 mg / mL denatured salmon sperm DNA, 50% formamide and 2% SDS) and highly stringent (0.1XSSC, 0.1% SDS, 50 DEG C) was washed and autoradiographed. After overnight exposure, blots were followed by phosphorimager analysis (Fuji).

PRO403 mRNA transcript was detected. Expression pattern analysis revealed strong signals of the expected 3.3 kb transcript in the adult brain (high in the cerebellum, dural, soft and temporal lobes, low in the cerebral cortex, occipital and frontal lobes), spinal cord, lungs and pancreas, and fetal brain and kidneys. High levels of 4.5 kb transcripts.

Example 99: Use of Nucleic Acids Encoding PRO Polypeptides as Hybridization Probes

The following method describes the use of a nucleotide sequence encoding a PRO polypeptide as a hybridization probe.

A probe for screening homologous DNA (eg, encoding a naturally occurring variant of a PRO polypeptide) in a human tissue cDNA library or human tissue genome library, comprising a coding sequence of a PRO polypeptide of interest as disclosed herein DNA is used.

Hybridization and washing of filters comprising these library DNAs is performed under the following high stringency conditions. Hybridization of a radiolabeled probe derived from a gene encoding a PRO polypeptide into a filter was performed at 42 ° C. with 50% formamide, 5 × SSC, 0.1% SDS, 0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH 6.8, 2 20 hours in × Denhardt solution and 10% dextran sulfate solution. Washing of the filter is carried out at 42 ° C. in an aqueous solution of 0.1 × SSC and 0.1% SDS.

Thereafter, the DNA encoding the full-length native sequence and the DNA having the desired sequence identity are identified by standard methods known in the art.

Example 100: Expression of PRO Polypeptides in E. coli

In this embodiment, Recombinant expression in E. coli shows a method for producing aglycosylated forms of PR polypeptides.

Initially, the DNA sequence encoding the PRO polypeptide was amplified using the selected PCR primers. The primer must include a restriction enzyme site corresponding to the restriction enzyme site on the selected expression vector. Several expression vectors can be used. Examples of suitable vectors include pBR322, which includes ampicillin and tetracycline resistance genes. From coli; Bolivar et al., Gene 2 : 95 (1977). The vector was digested with restriction enzymes and dephosphorylated. PCR amplified sequences were then ligated to the vector. The vector preferably contains an antibiotic resistance gene, a trp promoter, a poly-His leader (including the first six STII codons, a poly-His sequence and an enterokinase cleavage site), a specific PRO polypeptide coding site, a lambda transcription terminator and an argU gene. Will include the coding sequence.

The ligation mixture was then selected using the method described by Sambrook et al., Supra. E. coli strains were used to transform. Transformants capable of growing in LB medium were identified and colonies with antibiotic resistance were selected. Plasmid DNA was isolated and identified using restriction assays and DNA sequencing.

Selected clones were incubated overnight in liquid culture medium such as LB broth supplemented with antibiotics. This culture was used for inoculation of larger seedlings. The cells were then incubated to the desired optical density while the expression promoter was running.

After culturing the cells for several hours or more, the cells can be recovered by centrifugation. The cell pellet obtained by centrifugation can be lysed using various reagents known in the art, and the lysed PRO polypeptide protein can be purified using a metal chelating column under conditions in which the protein is strongly bound.

PRO181, PRO195, PRO200, PRO237, PRO273, PRO540, PRO322, PRO1017, PRO938, PRO162, PRO1114, PRO827 and PRO1008 can be obtained using the following procedure. It has been successfully expressed in E. coli with poly-His tags. The primers selected were initially amplified with the DNA encoding the PRO polypeptide. Primers included restriction enzyme sites corresponding to restriction enzyme sites on selected expression vectors and other useful sequences that provide efficient and reliable translation initiation, rapid purification on metal chelate columns, and proteolytic removal with enterokinase. The PCR amplified, poly-His tagged sequence was then ligated into the expression vector and then transformed into E. coli host based on strain 52 (W3110 fuhA (tonA) lon galE rpoHts (htpRts) clpP (lacIq). The transformants were first shaken in LB medium containing 50 mg / ml carbenicillin at 30 ° C. until the OD ₆₀₀ reached 3-5. 3.57 g (NH ₄ ) ₂ SO ₄ , 0.71 g sodium citrate.2H ₂ O, 1.07 g KCl, 5.36 g Difco yeast extract, 5.36 g Sheffield hycase SF, and in 500 ml of water, and 50-100 fold in 110 mM MPOS, pH 7.3, 0.55% (w / v) glucose and 7 mM MgSO ₄ mixed) and shake incubated at 30 ° C. for about 20-30 hours. Confirm expression by SDS-PAGE assay and centrifuge the bulk culture to pellet the cells. They were were kept frozen until purification and refolding to the cell pellet.

0.5 to 1 L of E. E. coli paste fermentation (6-10 g pellets) was resuspended in 10-fold volume (w / v) of 7 M guanidine, 20 mM Tris, pH 8 buffer. Solid sodium sulfite and sodium sationate were added to final concentrations of 0.1 M and 0.02 M, respectively, and the solution was stirred at 4 ° C. overnight. At this stage, sulfite produced a denatured protein that blocked all cysteine residues. This solution was centrifuged for 30 minutes at 40,000 rpm in a Beckman ultracentrifuge. The supernatant was diluted with 3-5 volumes of metal chelate column buffer (6 M guanidine, 20 mM Tris, pH 7.4) and filtered through a 0.22 μm filter to make clear. The clear extract was loaded into 5 ml of Qiagen Ni-NTA metal chelate column equilibrated with metal chelate column buffer. The column was washed with additional buffer (pH 7.4) containing 50 mM imidazole (Calbiochem, Utrol grade). Proteins were eluted with a buffer containing 250 mM imidazole, and fractions containing the desired protein were collected and stored at 4 ° C. Protein concentration was measured by absorbance at 280 nm using the extinction coefficient calculated according to the amino acid sequence.

The protein was refolded by slow dilution of the sample in freshly prepared refolding buffer consisting of 20 mM Tris, pH 8.6, 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 mM glycine and 1 mM EDTA. The refolding volume was set to a final protein concentration of 50-100 μg / ml. The refolding solution was slowly stirred at 4 ° C. for 12-36 hours. The refolding reaction was stopped by adding TFA to a final concentration of 0.4% (about pH 3). Before further purification of the protein, the solution was filtered through a 0.22 μm filter and acetonitrile was added to a final concentration of 2-10%. Refolded proteins were analyzed in Poros R1 / H reversed phase column chromatography using a shift buffer of 0.1% TFA, eluting with acetonitrile concentration gradient of 10-80%. Aliquots of fractions showing A ₂₈₀ absorbance were analyzed on an SDS polyacrylamide gel to collect fractions containing homogeneously refolded protein. In general, properly refolded proteins form most tightly to the hydrophobic inner portion that is protected from interaction with the reverse phase resin, so in most proteins the properly refolded protein form elutes at the lowest concentration of acetonitrile. Aggregated proteins are usually eluted at high acetonitrile concentrations. The reverse phase step not only separates the misfolded form of protein from the desired form of protein but also removes endotoxins from the sample.

Each fraction, preferably containing folded PRO protein, was recovered and the acetonitrile was removed using a gentle nitrogen stream in solution. Proteins were formulated with 20 mM Hepes, pH 6.8, containing 0.14 M sodium chloride and 4% mannitol, by gel filtration using dialysis or sterile filtered G25 Superfine (Pharmacia) resin equilibrated with formulation buffer.

Several PRO polypeptides described herein have been successfully expressed by this procedure.

Example 101 Expression of PRO Polypeptides in Mammalian Cells

This example illustrates a method for producing possible glycosylated forms of the desired PRO polypeptide by recombinant expression in mammalian cells.

Vector pRK5 (see EP 307,247 published March 15, 1989) was used as the expression vector. Optionally, PRO polypeptide DNA was ligated to pRK5 using the restriction enzyme of choice using the ligation method described by Sambrook et al. (Supra) to insert PRO polypeptide DNA. The resulting vectors were named pRK5-PRO polypeptides, respectively.

In an embodiment, 293 cells can be selected as host cells. Human 293 cells (ATCC CCL 1573) were cultured to be confluent in tissue culture plates in medium such as fetal calf serum and optionally DMEM supplemented with nutrients and / or antibiotics. About 10 μg pRK5-PRO polypeptide DNA was mixed with about 1 μg of DNA encoding the VA RNA gene (Thimmappaya et al., Cell, 31: 543 (1982)), 500 μl of 1 mM Tris-HCl, 0.1 mM EDTA. And 0.227 M CaCl ₂ . 500 μl of 50 mM HEPES (pH 7.35), 280 mM NaCl, 1.5 mM NaPO ₄ was added dropwise to the mixture to form a precipitate at 25 ° C. for 10 minutes. The precipitate was suspended and added to 293 cells and left at about 4 hours at 37 ° C. The medium was aspirated off and 2 ml of 20% glycerol in PBS was added for 30 seconds. 293 cells were then washed with serum free medium, fresh medium was added and the cells were cultured for about 5 days.

About 24 hours after transfection, the medium was removed and replaced with medium (only) or medium containing 200 μCi / ml ³⁵ S-cysteine and 200 μCi / ml ³⁵ S-methionine. After 12 hours of incubation, the conditioned medium was recovered, concentrated in a rotary filter and loaded onto a 15% SDS gel. The treated gel was dried and exposed to the film for a selected period of time to confirm the presence of PRO polypeptide. Cultures containing transfected cells were further cultured (in serum free medium) and the medium was tested by selected bioassays.

Or Somparyrac et al., Proc. Natl. Acad. Sci. USA , 12 : 7575 (1981), using the dextran sulfate method described above, was able to transiently introduce PRO polypeptides into 293 cells. 293 cells were cultured to the highest density in a rotating flask and 700 μg of pRK5-PRO polypeptide DNA was added. Cells were first centrifuged, concentrated from a rotary flask and washed with PBS. DNA-dextran precipitates were incubated on cell pellets for 4 hours. Cells were treated with 20% glycerol for 90 seconds and washed with tissue culture medium and then placed in a rotating flask containing tissue culture medium, 5 μg / ml bovine insulin and 0.1 μg / ml bovine transferrin. After about 4 days the conditioned media was centrifuged and filtered to remove cells and debris. Samples containing the expressed PRO polypeptide were concentrated and purified by any selected method such as dialysis and / or column chromatography.

In other embodiments, the PRO polypeptide can be expressed in CHO cells. The pRK5PRO polypeptide can be transfected into CHO cells using known reagents such as CaPO ₄ or DEAE dextran. As mentioned above, the cell cultures were incubated and the cultures replaced with medium containing radiolabels such as medium (only) or ³⁵ S-methionine. After confirming the presence of the expressed PRO polypeptide, the culture medium was replaced with serum free medium. Preferably, the cultures were incubated for about 6 days and the conditioned medium was recovered. The medium containing the expressed PRO polypeptide was concentrated and purified by any chosen method.

In addition, epitope tagged PRO polypeptides can be expressed in CHO host cells. PRO polypeptide can be subcloned from the pRK5 vector. Insertion of the subclones can be fused to baculovirus expression vectors in the form with selected epitope tags, such as poly-His tags, by PCR. The poly-His tagged PRO polypeptide insert can be subcloned into an SV40 induction vector containing a selection marker such as DHFR to select stable clones. Finally, CHO cells can be transfected with an SV40 induction vector (as above). It can be labeled in the same manner as above to confirm expression. The culture medium comprising the expressed poly-His tagged PRO polypeptide can then be concentrated and purified by selected methods such as Ni ²⁺ -chelate affinity chromatography.

The following experimental procedure was used to stably express in CHO cells. The coding sequence of each protein's soluble form (eg, extracellular domain) is expressed as an IgG construct (immunoadhesine) fused to an IgG1 constant region sequence comprising a hinge, CH2 and CH2 domains, and / or poly-His tags. The protein was expressed in the attached form.

Following PCR amplification, each DNA was subcloned into a CHO expression vector using standard methods described in Ausubel et al., Current Protocols of Molecular Biology, Unit 3.16, Johnn Wiley and Sons (1997). CHO expression vectors are prepared to have restriction sites suitable for 5 'and 3' of the desired DNA so that the restriction sites of the cDNA can be conveniently shuttled. Vectors used for expression in CHO cells are described by Lucas et al., Nucl. Acids Res. 24 : 9 1774-1779 (1996), an SV40 early promoter / enhancer was used to express the desired cDNA and dihydrofolate reductase (DHFR). DHFR expression allows selection of cells that remain stable in the plasmid after transfection.

Using a commercially available transfection reagent, Superfect, Qiagen, Dosper or Fugene, Boehringer Mannheim, approximately 12 μg of the desired plasmid DNA was obtained. It was introduced into 10 million CHO cells. Cells were cultured according to the method described by Lucas et al., Supra. About 3 × 10 ⁻⁷ cells were frozen in ampoules according to the method described below for later culturing and producing cells.

Ampoules containing the plasmid DNA were dissolved in a water bath and vortexed and mixed. The contents were pipetted into a centrifuge tube containing 10 ml of medium and centrifuged at 1000 rpm for 5 minutes. The supernatant was aspirated off and cells were resuspended in 10 ml selection medium (PS20 filtered through 0.2 μm filter paper, containing 5% bovine serum of 0.2 μm diafiltration filtered). Cells were aliquoted into a 100 ml rotating flask containing 90 ml of selection medium. After 1-2 days, cells were transferred to a 250 ml rotating flask filled with 150 ml of selection medium and incubated at 37 ° C. After 2-3 days 250 ml, 500 ml and 2000 ml rotating flasks were seeded with 3 × 10 ⁵ cells per ml. Cell cultures were centrifuged, exchanged with fresh medium and resuspended in production medium. Any suitable CHO medium may be used, but the production medium described in US Pat. No. 5,122,469 (June 16, 1992) was actually used. 3 L production rotary flasks were seeded at 1.2 × 10 ⁶ cells / ml. On day 0, cell number and pH were measured. On day 1 samples were taken from a rotating flask to initiate sparging of filtered air. On day 2, samples were taken from the rotating flasks and the temperature was changed to 33 ° C. and 30 ml of 500 g / L-glucose and 0.6 ml of 10% defoamer (eg 35% polydimethyl siloxane emulsion, Dow Corning 365 Medicinal grade emulsion). During the entire production period, the pH was adjusted to maintain about 7.2 as needed. After 10 days or by the time the viability dropped below 70%, the cell culture was recovered by centrifugation and filtered through a 0.22 μm filter. The filtrate was stored at 4 ° C. or immediately loaded onto a preparative column.

For poly-His tagged constructs, the protein was purified using a Ni-NTA column (Qiagen). Imidazole was added to the conditioned medium at 5 mM concentration before purification. 6 ml of Ni-NTA column equilibrated with 20 mM Hepes, pH 7.4 buffer containing 0.3 M NaCl and 5 mM imidazole was injected with conditioned medium at a flow rate of 4-5 ml / min at 4 ° C. After loading the column was washed with additional equilibration buffer and the protein was eluted with equilibration buffer containing 0.25 M imidazole. The highly purified protein was then desalted through 25 ml G25 superpine (Pharmacia) column in storage buffer (pH 6.8) containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol and stored at -80 ° C. .

The immunoadhesin (including F _c ) constructs from the conditioned media were purified as follows. Conditioned media was injected into 5 ml of Protein A column (Pharmacia) equilibrated with 20 mM sodium phosphate buffer (pH 6.8). After loading, the column was washed with equilibration buffer and eluted with 100 mM citric acid, pH 3.5. The eluted protein was recovered in 1 ml fractions in a tube containing 275 μl of 1 M Tris buffer (pH 9) and immediately neutralized. The highly purified protein was then removed to salt in storage buffer as described above for the case of poly-His tagged proteins. N-terminal amino acid sequencing performed by SDS-polyacrylamide gel and Edman digestion confirmed the homogeneity of the protein.

Several PRO polypeptides described herein have been successfully expressed by the methods described above.

Example 102 Expression of PRO Polypeptides in Yeast

The following method describes recombinant expression of the desired PRO polypeptide in yeast.

First, yeast expression vectors for intracellular production or secretion of PRO polypeptides were prepared from the ADH2 / GAPDH promoter. For direct intracellular expression of the PRO polypeptide, the PRO polypeptide encoding DNA and promoter were inserted at the appropriate restriction enzyme site of the selected plasmid. For secretion, for expression of the PRO polypeptide DNA, the DNA encoding the PRO polypeptide is selected together with the DNA encoding the ADH2 / GAPDH promoter, yeast alpha-factor or invertase secretion signal / leader sequence and linker sequence (if required). Can be cloned into plasmids.

Yeast cells, for example yeast strain AB110, can be transformed with the expression plasmids described above and cultured in selected fermentation medium. Transformed yeast supernatants can be precipitated with 10% trichloroacetic acid and separated by SDS-PAGE and analyzed by staining the gel with Coomassie Blue.

Subsequently, the yeast cells can be recovered from the fermentation medium by centrifugation and the medium can be concentrated using a selected cartridge filter to isolate and purify the recombinant PRO polypeptide. Concentrates containing the PRO polypeptide can be further purified using selected column chromatography resins.

Several PRO polypeptides described herein have been successfully expressed by the methods described above.

Example 103 Expression of PRO Polypeptides in Insect Cells Infected with Baculovirus

The following method describes recombinant expression in insect cells infected with baculovirus.

The coding sequence of the PRO polypeptide was fused upstream of the epitope tag included in the baculovirus expression vector. Such epitope tags include poly-His tags and immunoglobulin tags (such as the F _c region of IgG). Various plasmids can be used, including plasmids derived from commercially available plasmids such as pVL1393 (Novagen). Briefly, a PRO polypeptide or a desired portion of a PRO polypeptide (e.g., the extracellular domain of a transmembrane protein or the sequence encoding the mature protein in the case of an extracellular protein) is subjected to PCR using primers complementary to the 5 'and 3' regions. Amplified. The 5 'primer may comprise contiguous (selected) restriction enzyme sites. The product was then cleaved with the selected restriction enzyme and subcloned into the expression vector.

Recombinant baculoviruses utilize the lipofectin (gibbo-BRL) to plasmid and BaculoGold ™ viral DNA (Pharmingen) from Spodoptera frugiperda ("Sf9") cells (ATCC CRL 1711). And transfection at the same time. After 4-5 days of incubation at 28 ° C., the released virus was recovered and used for subsequent amplification. Viral infection and protein expression were performed according to O'Reilley et al., Baculovirus Expression vectors: A laboratory Manual , Oxford: Oxford University Press (1994).

The expressed poly-his tagged tagged PRO polypeptide can then be purified, for example by Ni ²⁺ -chelate affinity chromatography. Extracts are prepared from Sf9 cells infected with recombinant virus according to Rupert et al., Nature , 362 : 175-179 (1993). Briefly, Sf9 cells were washed and resuspended in sonication buffer (25 mL Hepes, pH 7.9; 12.5 mM MgCl ₂ ; 0.1 mM EDTA; 10% glycerol; 0.1% NP-40; 0.4 M KCl) for 20 seconds on ice. Sonication was performed twice. The sonication was removed by centrifugation and the supernatant diluted 50-fold in loading buffer (50 mM phosphate, 300 mM NaCl, 10% glycerol, pH 7.8) and filtered through a 0.45 μm filter. Ni ²⁺ -NTA agarose column (purchased from Qiagen) was prepared in 5 ml bed volume, washed with 25 ml of water and equilibrated with 25 ml of loading buffer. The filtered cell extracts were loaded into the column at 0.5 ml per minute. At the start of point fraction recovery, the column was washed with loading buffer to the A ₂₈₀ baseline. Next, the column was washed with secondary wash buffer (50 mM phosphate; 300 mM NaCl, 10% glycerol, pH 6.0) to elute nonspecifically bound protein. Once A ₂₈₀ reached baseline again, the column was developed with a 0 to 500 mM imidazole gradient in secondary wash buffer. 1 ml fractions were collected and analyzed by Western blot with SDS-PAGE and silver staining or Ni ²⁺ -NTA (Qiagen) bound to alkaline phosphatase. Fractions containing the eluted His ₁₀ tag attached PRO polypeptide were pooled and dialyzed against loading buffer.

Alternatively, purification of an IgG tagged (or F _c tagged) PRO polypeptide was performed using known chromatography techniques such as Protein A or Protein G column chromatography.

PRO195, PRO526, PRO540, PRO846, PRO362, PRO363, PRO700, PRO707, PRO322, PRO719, PRO1083, PRO868, PRO866, PRO768, PRO788, PRO938, PRO827 and PRO1031 were successfully expressed in Sf9 insect cells infected by baculovirus. . Although expression was actually performed at the 0.5-2 L scale, it can easily be performed at a larger scale (eg 8 L). The protein was expressed as an IgG construct (immunoadhesin), and this protein extracellular region was fused to an IgG1 constant region sequence comprising hinge, CH2 and CH3 domains, and / or poly-His targeted forms.

After PCR amplification of each coding sequence, it was subcloned into a baculovirus expression vector (pb.PH.IgG for IgG fusions and pb.PH.His.c for poly-His tagged proteins) and lipofectin ( Vectors and BaculoGold ™ baculovirus DNA (Pharmingen) were simultaneously transfected into 105 Spodoptera pruperferda (Sf9) cells (ATCC CRL 1711) using GIBCO-BRL). pb.PH.IgG and pb.PH.His are variants of commercially available baculovirus expression vector pVL1393 (Pharmingen) comprising a modified polylinker site comprising a His sequence or an F _c tag sequence. Cells were cultured in Hink's TNM-FH medium supplemented with 10% FBS (Hyclone). Cells were incubated at 28 ° C. for 5 days. The supernatant was recovered and subsequently infected with Sf9 cells in Hinx TNM-FH medium supplemented with 10% FBS to a degree of multiinfection (MOI) of about 10 and used for first virus amplification. Cells were incubated at 28 ° C. for 3 days. The supernatant was recovered and batch bound 1 ml of supernatant to 25 ml Ni-NTA beads (QIAGEN) for histidine tagged protein or protein A Sepharose CL-4B beads (Pharmacia) for IgG added protein. SDS-PAGE analysis was then performed to measure the expression of the constructs in the baculovirus expression vectors as compared to the standard protein at a concentration already known by Coomassie blue staining.

The first virus amplified supernatant was used to infect the spin culture (500 mL) of Sf9 cells incubated in ESF-921 medium (Expression Systems LLC) with a MOI of about 0.1. Cells were incubated at 28 ° C. for 3 days. The supernatant was recovered and filtered. Batch binding and SDS-PAGE analysis were repeated as necessary until expression of the rotating culture was confirmed.

Conditioned medium of transfected cells (0.5-3) was centrifuged to remove cells and filtered with a 0.22 μm filter. Poly-His tagged addition constructs were purified using a Ni-NTA column (Qiagen). Imidazole was added to the conditioned medium to a concentration of 5 mM before purification. Conditional medium was loaded into a 6 ml Ni-NTA column equilibrated with 20 mM Hepes buffer (pH 7.4) containing 0.3 M NaCl and 5 mM imidazole at 4 ° C. at a flow rate of 4-5 ml / min. After loading the column was washed with additional equilibration buffer and the protein was eluted with equilibration buffer containing 0.25 M imidazole. The highly purified protein was then removed with salt in 25 mL G25 superfine (Pharmacia) column in storage buffer (pH6.8) containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol and stored at -80 ° C.

The immunoadhesin (including F _c ) constructs of the protein were purified from conditioned media as follows. Conditioned media was loaded onto a 5 ml Protein A column (Pharmacia) equilibrated with 20 mM sodium phosphate buffer, pH 6.8. After loading, it was extensively washed with equilibration buffer and eluted with 100 mM citric acid (pH 3.5). The eluted protein was recovered in a 1 ml fraction into a tube containing 275 ml of 1 M Tris buffer (pH 9) and immediately neutralized. The highly purified protein was then removed from the storage buffer as in the case of the poly-His tagged protein described above. The homogeneity of the protein was confirmed by N-terminal amino acid sequence analysis performed by SDS polyacrylamide gel (PEG) and Edman digestion.

PRO181, PRO195, PRO200, PRO320, PRO237, PRO273, PRO285, PRO337, PRO526, PRO540, PRO846, PRO362, PRO363, PRO617, PRO322, PRO1083, PRO868, 768, PRO792, PRO788, PRO162, PRO1114, PRO827, PRO1075 and PRO1031 It was successfully expressed in Hi5 insect cells infected by baculovirus. Although expression was actually performed at the 0.5-2 L scale, it can easily be performed at a larger scale (eg 8 L).

For expression in Hi5 insect cells infected by baculovirus, the DNA encoding the PRO polypeptide can be amplified using a suitable system such as Pfu (Stratagene), or an epitope contained in a baculovirus expression vector Fusion with the upstream 5 'of the tag. Various plasmids can be used, including plasmids derived from commercially available plasmids such as pVL1393 (Novagen). Briefly, a sequence that encodes the desired sequence or desired portion of the sequence, eg, the extracellular domain of the transmembrane protein, was amplified by PCR using primers complementary to the 5 'and 3' regions. The 5 'primer may comprise contiguous (selected) restriction enzyme sites. The product was then cleaved with the selected restriction enzyme and subcloned into the expression vector. For example, derivatives of pEI1-1 may comprise an F _c region or 8 histitin (pb.PH.His) tags of human IgG (pb.PH.IgG) downstream (3 ′) of the desired sequence. Preferably, the vector construct is sequenced to identify.

Hi5 cells were incubated with 50% confluency under conditions of 27 ° C. without CO ₂ , NO penicillin / streptomycin. For each 150 mm plate, a PIE substrate vector containing 30 μg of sequence was added with 1 ml of Ex-Cell medium (Ex-Cell 401 + 1/100 L-Glu JRH Biosciences # 14401-78P, noteworthy). 100 μl of Celfectin (CellFECTIN, purchased from GIBCO-BRL # 10362-010, vortex mixed) was mixed with 1 ml of Ex-Cell medium in separate test tubes. Both solutions were mixed and incubated for 15 minutes at room temperature. 8 ml of Ex-Cell medium was added to 2 ml of DNA / Secfectin mixture and covered on high-5 cells washed once with Ex-Cell medium. The plates were then incubated in the dark for 1 hour at room temperature. The DNA / Selfectin mixture was then removed with an aspirator and the cells washed once with Ex-Cell to remove excess Celfectin. 30 ml of fresh Ex-Cell medium was added and cells were incubated at 28 ° C. for 3 days. The supernatant was recovered and batch bound 1 ml of supernatant to 25 ml Ni-NTA beads (QIAGEN) for histidine tagged protein or protein A Sepharose CL-4B beads (Pharmacia) for IgG added protein. SDS-PAGE analysis was then performed to determine the expression of the sequences in the baculovirus expression vectors compared to standard proteins of concentrations already known by Coomassie blue staining.

Conditioned medium of transfected cells (0.5-3 L) was centrifuged to remove cells and filtered with a 0.22 μm filter. Poly-His tagged constructs were purified using a Ni ²⁺ -NTA column (Qiagen) to contain the protein containing the sequence. Imidazole was added to the conditioned medium to 5 mM concentration before purification. The conditioned medium was loaded into a 6 ml Ni ²⁺ -NTA column equilibrated with 20 mM Hepes buffer (pH 7.4) containing 0.3 M NaCl and 5 mM imidazole at a flow rate of 4-5 ml / min at 48 ° C. After loading the column was washed with additional equilibration buffer and the protein was eluted with equilibration buffer containing 0.25 M imidazole. The highly purified protein was then removed with salt in 25 mL G25 superfine (Pharmacia) column in storage buffer (pH6.8) containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol and stored at -80 ° C.

The immunoadhesin (including F _c ) construct of the protein was purified from the conditioned medium as follows. Conditioned media was loaded onto a 5 ml Protein A column (Pharmacia) equilibrated with 20 mM sodium phosphate buffer, pH 6.8. After loading, it was extensively washed with equilibration buffer and eluted with 100 mM citric acid (pH 3.5). The eluted protein was recovered in a 1 ml fraction into a tube containing 275 ml of 1 M Tris buffer (pH 9) and immediately neutralized. The highly purified protein was then removed from the storage buffer as in the case of the poly-His tagged protein described above. The homogeneity of the protein was confirmed by N-terminal amino acid sequencing performed by SDS polyacrylamide gel and Edman digestion and other analytical methods if desired or if necessary.

Several PRO polypeptides described herein have been successfully expressed as described above.

Example 104 Preparation of Antibodies Binding to PRO Polypeptides

This example is a method for producing a monoclonal antibody that can specifically bind to a PRO polypeptide.

Techniques for producing monoclonal antibodies are known in the art and are described, for example, in Goding, supra. Immunogens that can be used include purified PRO polypeptides of the invention, fusion proteins comprising PRO polypeptides, and cells expressing recombinant PRO polypeptides on cell surfaces. The skilled person can select an immunogen without unnecessary experimentation.

Mice, eg Balb / c, were immunized subcutaneously or intraperitoneally with 1-100 μg of PRO polypeptide immunogen emulsified in Freund's complete adjuvant. Alternatively, the immunogen was emulsified in MPL-TDM adjuvant (Ribi Immunochemical Research, Hamilton, MT) and injected into the hind paw of the animal for immunization. Immunized mice were then boosted with additional immunogen emulsified in selected adjuvant after 10-12 days. Afterwards, the mice can be boosted with further immunization for several weeks. Serum samples were taken periodically from mice by reverse bleeding, and ELISA assays were tested to detect anti-PRO polypeptide antibodies.

Once a suitable antibody titer was detected, the animal was "positive" to the antibody and the final polypeptide was injected intravenously. After 3-4 days, the mice are sacrificed to recover the spleen cells. The spleen cells were then fused with P3X63AgU.1 available from selected murine myeloma cell lines, for example ATCC No. CRL 1597 (using 35% polyethylene glycol). The fusion produced hybridoma cells, which were then played on 96 well tissue culture plates containing HAT (Hypoxanthine, aminopterin and thymidine) media that inhibit the proliferation of non-fusion cells, myeloma hybrids and splenocyte hybrids. Can be set.

Hybridoma cells can be screened by ELISA for reactivity to PRO polypeptide. Methods of determining "positive" hybridoma cells that secrete the desired monoclonal antibodies against PRO polypeptides are well known to those skilled in the art.

Positive hybridoma cells can be injected intraperitoneally such that syngeneic Balb / c mice produce ascites containing anti-PRO polypeptide monoclonal antibodies. Alternatively, hybridoma cells can be cultured in tissue culture flasks or roller bottles. Monoclonal antibodies generated in the ascites can be purified using ammonium sulfate precipitation followed by gel exclusion chromatography. Alternatively, affinity chromatography based on protein A or protein G binding of an antibody can also be used.

Example 105 Chimeric PRO Polypeptides

PRO polypeptide can be expressed as a chimeric protein with one or more additional polypeptide domains added to facilitate protein purification. Such domains that facilitate purification include metal chelating peptides such as histidine-tryptophan modules, which allow purification on immobilized metals, protein A domains, which enable purification on immobilized immunoglobulins, and FLAGS. Domains used in the ^TM stretch / affinity system (Immunex Corp., Seattle Wash.), But are not limited to these. Inserting Factor XA or Enterokinase (San Diego, Calif.) Between the purification domain and the PRO polypeptide sequence may be useful for promoting expression of the DNA encoding the PRO polypeptide.

Example 106 Purification of PRO Polypeptides Using Specific Antibodies

Natural or recombinant PRO polypeptides can be purified by various standard techniques in the field of protein purification. For example, pro-PRO polypeptides, mature PRO polypeptides, or pre-PRO polypeptides are purified by immunoaffinity chromatography using antibodies specific for the PRO polypeptide of interest. In general, immunoaffinity columns are constructed by covalently coupling an anti-PRO polypeptide antibody to an activated chromatography resin.

Polyclonal immunoglobulins were prepared by precipitating with ammonium sulfate from immune serum or by purification on immobilized protein A (Pharmacia LKB Biotechnology, Fitzkataway, NJ). Similarly, monoclonal antibodies were prepared by ammonium sulphate precipitation or chromatography on immobilized Protein A from mouse ascites. Partially purified immunoglobulin was covalently attached to a chromatographic resin such as CnBr-activated SEPHAROSE ™ (Pharmacia LKB Biotechnology). The antibody was coupled to the resin, the resin blocked and the derived resin was washed according to the manufacturer's instructions.

Such immunoaffinity columns are used for purification of PRO polypeptide by preparing fractions from cells comprising the PRO polypeptide in soluble form. This agent is derived by the addition of detergent or by the solubilization of subcellular fractions obtained through solubilization or differential centrifugation of whole cells by other methods well known in the art. Alternatively, soluble PRO polypeptides comprising a signal sequence may be secreted into the medium in which the cells grow in useful amounts.

The soluble PRO polypeptide containing agent was passed over an immunoaffinity column and the column was washed under conditions that allow for differential absorption of the PRO polypeptide (eg, high ion concentration buffer in the presence of detergent). The column is then eluted under conditions that disrupt antibody / PRO polypeptide binding (e.g., a low pH buffer such as about pH 2-3 or a high concentration of chaotrope, such as urea or thiocyanate ions), PRO polypeptide was recovered.

Example 107: Drug Screening

The present invention is particularly useful for screening compounds with any of various drug screening techniques using PRO polypeptides or binding fragments thereof. The PRO polypeptide or fragment used in this test may be free in solution, adhered to a solid support, maintained at the cell surface, or located within the cell. One method of drug screening utilizes eukaryotic or prokaryotic host cells stably transformed using recombinant nucleic acids expressing PRO polypeptides or fragments. Drugs were screened for such transformed cells in a competitive binding assay. Such cells, either live or fixed, can be used for standard binding assays. For example, the formation of a conjugate between a PRO polypeptide or fragment and the substance being tested can be measured. Alternatively, a decrease in the formation of conjugates between the PRO polypeptide and its target cells or target receptors caused by the substance being tested can be examined.

Accordingly, the present invention provides a method for screening a drug or any other active agent that may affect a PRO polypeptide-related disease or disorder. These methods contact such active substances with PRO polypeptides or fragments thereof, and methods well known in the art include (i) the presence of a conjugate between a substance and a PRO polypeptide or fragment or (ii) a conjugate between a PRO polypeptide or fragment and a cell. Analyzing for the presence of a. In this competitive binding assay, the PRO polypeptide or fragment is usually labeled. After suitable incubation, the free PRO polypeptide or fragment is isolated from being present in bound form, and the amount of free or uncomplexed label is a measure of the ability to bind a PRO polypeptide of a particular substance or inhibit the PRO polypeptide / cell conjugate. .

Other drug screening techniques provide high throughput screening for compounds with binding affinity suitable for polypeptides and are described in detail in WO84 / 03564 (published Sep. 13, 1984). In brief, many different small peptide test compounds are synthesized on solid substrates such as plastic pins or some other surface. Applying to a PRO polypeptide, the peptide test compound is reacted with and washed with the PRO polypeptide. Bound PRO polypeptides are detected by methods well known in the art. Purified PRO polypeptides can also be coated directly onto a plate for use in the aforementioned drug screening techniques. Non-neutralized antibodies can also be used to capture peptides and immobilize them on solid support.

The present invention also contemplates the use of competitive drug screening assays in which neutralizing antibodies capable of binding a PRO polypeptide specifically compete with a test compound in binding to the PRO polypeptide or fragment thereof. In this way, the antibody can be used to detect the presence of any peptide that shares one or more antigenic determinants with the PRO polypeptide.

Example 108: Rational Drug Design

The goal of rational drug design is to produce structural homologues of the biologically active polypeptides of interest (ie, PRO polypeptides) or small molecules with which they interact, such as agonists, antagonists or inhibitors. Any of these examples can be used to form drugs that are more active or more stable forms of PRO polypeptides, or drugs that enhance or inhibit the function of PRO polypeptides in vivo (Hodson, Bio / Technology , 9 : 1921 (1991)).

In one study, the three-dimensional structure of a PRO polypeptide or PRO polypeptide-inhibitor conjugate is determined by x-ray crystallography, computer modeling or most typically a combination of the two methods. Both the form and the charge of the PRO polypeptide should be identified to elucidate the structure of the molecule and determine the active site (s). Less frequently, useful information about the structure of the PRO polypeptide can be obtained by modeling it based on the structure of the homologous protein. In both cases, relevant structural information is used to design cognate PRO polypeptide like molecules or to identify valid inhibitors. Useful examples of rational drug design include molecules that enhance activity or stability, as shown in Braxton and Wells, Biochemistry, 31 : 7796-7801 (1992), or Athauda. ), J. Biochem. , 113 : 742-746 (1993), may include molecules that act as inhibitors, agonists or antagonists of natural peptides.

It is also possible to isolate target-specific antibodies, select them by functional analysis as described above, and then interpret their crystal structure. In this way, a pharmacore can be obtained, in principle, on which subsequent drug design can be based. Protein Determination It is also possible to avoid all protein determination methods by producing anti-genetic antibodies (anti-ids) against functional pharmacologically active antibodies. As a mirror image, the binding site of the anti-id will be expected to be the homologue of the original receptor. Anti-ids may then be used to identify and isolate peptides from chemically or biologically produced peptide banks. The isolated peptide will then act as a Pharmacore.

By the present invention, a sufficient amount of PRO polypeptide can be made available for conducting analytical studies such as x-ray crystallography. In addition, the PRO polypeptide amino acid sequence knowledge provided herein will provide guidance in using computer modeling techniques in place of or in addition to x-ray determination.

Example 109: Inhibiting Endothelial Cell Proliferation Stimulated by Vascular Endothelial Growth Factor (VEGF) Capacity of PRO Polypeptides (Analysis 9)

Inhibition of several PRO polypeptides against endothelial cell proliferation stimulated by VEGF was tested. Polypeptides tested positive in this assay are useful for inhibiting endothelial cell proliferation in mammals, and such effects would be advantageous for inhibiting tumor growth, for example.

Specifically, bovine adrenal capillary endothelial cells (ACE) (initial culture, up to 12-14 passages) were plated in 96-well plates at a concentration of 500 cells / well per 100 μl. Assay medium contained low glucose DMEM, 10% calf serum, 2 mM glutamine and 1 × penicillin / streptomycin / fungizone. Control wells include (1) no ACE cells added, (2) ACE cells only, (3) ACE cells + 5 ng / ml FGF, (4) ACE cells + 3 ng / ml VEGF, and (5) ACE Cells + 3 ng / ml VEGF + 1 ng / ml TGF-beta, and (6) ACE cells + 3 ng / ml VEGF + 5 ng / ml LIF. The test sample, poly-his tagged tagged PRO polypeptide (in 100 μl volume) was then added to the wells (added in dilutions of 1%, 0.1% and 0.01%, respectively). Cell cultures were incubated at 37 ° C./5% CO ₂ for 6-7 days. After incubation the medium of the wells was aspirated off and the cells were washed with 1 x PBS. An acid phosphatase reaction mixture (100 μl, 0.1 M sodium acetate, pH 5.5, 0.1% Triton X-100, 10 mM p-nitrophenyl phosphate) was added to each well. After incubation at 37 ° C. for 2 hours, 10 μl of 1N NaOH was added to stop the reaction. The absorbance (OD) at 405 nm was measured with a microplate reader.

The activity of the PRO polypeptide was calculated as percent inhibition of VEGF (3 ng / ml) stimulation proliferation (determined by measuring acid phosphatase activity at OD 405 nm) against unstimulated cells. Since TGF-beta blocks 70-90% of VEGF stimulated ACE cell proliferation, it was used as an active reference at 1 ng / ml. The results indicate the utility of PRO polypeptides to treat cancer and specifically to inhibit tumor angiogenesis. The numerical value (relative inhibition) calculates the percent inhibition of proliferation stimulated by VEGF by PRO polypeptide on cells that have not been stimulated and this percentage value is known to inhibit 70-90% of VEGF stimulated cell proliferation. ng / ml Calculated by dividing by the percentage inhibition obtained by TGF-beta. If the PRO polypeptide inhibits at least 30% VEGF stimulation of endothelial cell growth (relative inhibition of at least 30%), the result is considered positive.

In this assay, the PRO200, PRO322 and PRO320 polypeptides were tested to be positive.

Example 110 Survival of Retinal Neurons (Analysis 52)

This example is directed to the therapeutic treatment of retinal disease or injury, including the treatment of vision loss in mammals due to, for example, pigment retinitis, AMD, etc., as certain PRO polypeptides are effective in improving survival of retinal neurons. It is useful.

Seven-day-old Sprague Dawley rat pups (mixed population: glial and retinal neuronal cell types) were CO ₂ anesthetized and then chopped and removed eyes under sterile conditions. Retinal nerves were excised from pigmented epithelium and other ocular tissues and then separated into single cell suspensions using 0.25% trypsin in PBS without Ca ²⁺ , Mg ²⁺ . The retina was incubated at 37 ° C. for 7-10 minutes, after which 1 ml of soy trypsin inhibitor was added to inactivate the trypsin. Cells were supplemented with N2 at a concentration of 100,000 cells per well in 96 well plates and plated in DMEM / F12 with or without specific test PRO polypeptides. Cells for all experiments were incubated at 37 ° C. in a water saturated atmosphere of 5% CO ₂ . After incubation for 2-3 days, cells were stained with calcein AM and then fixed using 4% paraformaldehyde and stained using DAPI to determine total cell number. Total cells (fluorescence) were quantified at 20 × objective magnification using a CCD camera for MacIntosh and NIH imaging software. Fields in the wells were randomly selected.

The effects of various concentrations of PRO polypeptides are reported herein, and survival was calculated by dividing the total number of calcein AM positive cells on days 2 to 3 by the total number of DAPI-labeled cells on days 2 to 3 of culture.

In this assay using polypeptide concentrations ranging from 0.01% to 1.0%, the PRO200, PRO322, PRO540, PRO846 and PRO617 polypeptides were tested to be positive.

Example 111: Rod Photoreceptor Cell Survival (assay 56)

This assay is useful for the therapeutic treatment of retinal disease or injury because certain polypeptides of the present invention act to enhance the survival / proliferation of rod photoreceptor cells, for example visual acuity in mammals due to pigment retinitis, AMD, etc. It is useful for dealing with loss. Seven-day-old Sprague Dawley rat pups (mixed population: glial and retinal neuronal cell types) were CO ₂ anesthetized and then chopped and removed eyes under sterile conditions. Retinal nerves were excised from pigmented epithelium and other ocular tissues and then separated into single cell suspensions using 0.25% trypsin in PBS without Ca ²⁺ , Mg ²⁺ . The retina was incubated at 37 ° C. for 7-10 minutes, after which 1 ml of soy trypsin inhibitor was added to inactivate the trypsin. Cells were plated in DMEM / F12 supplemented with N2 at a concentration of 100,000 cells per well in 96 well plates. Cells for all experiments were incubated at 37 ° C. in a water saturated atmosphere of 5% CO ₂ . After incubation for 2-3 days, cells were fixed using 4% paraformaldehyde and then stained using CellTracker Green CMFDA. The rod photoreceptor cells were detected by indirect immunofluorescence using Rho 4D2 (plural or IgG 1: 100), a monoclonal antibody to visual pigment rhodopsin. Results are calculated as% Survival: Total Calcein-Rhodopsin positive cells on days 2-3 after culture divided by Total Number of Rhodopsin positive cells on days 2-3. Total cells (fluorescence) were quantified at 20 × objective magnification using a CCD camera for MacIntosh and NIH imaging software. Fields in the wells were randomly selected.

In this assay the PRO200, PRO322, PRO540, PRO846 and PRO617 polypeptides were tested positive.

Example 112: Ability of PRO Polypeptides to Promote Release of Proteoglycans from Cartilage (Analysis 97)

The ability of PRO polypeptides to promote the release of proteoglycans from cartilage was tested as follows.

Pigmented metacarpophalangeal joints of 4 to 6 months old were sterilely dissected and articular cartilage was removed by free hand slicing while carefully avoiding the bone beneath it. Chondrocytes were chopped and 24 in serum free (SF) medium (DME / F12 1: 1) containing 0.1% BSA and 100 U / ml penicillin and 100 μg / ml streptomycin under an atmosphere of 95% atmosphere and 5% CO ₂ . Incubated in large quantities for hours. After three washes, about 100 mg of articular cartilage was aliquoted into a micronics tube and further incubated for 24 hours in the SF medium. The PRO polypeptide was then added at 1% alone or in combination with 18 ng / ml interleukin-1α (known promoter that promotes the release of proteoglycans from cartilage tissue). The supernatants were then harvested and analyzed for the amount of proteoglycans using 1,9-dimethyl-methylene blue (DMB) colorimetric assay (Farndale and Buttle, Biochem. Biophys. Acta 883: 173-177 (1985)). Positive results in this analysis indicate that the test polypeptide can be used to treat, for example, joint problems due to exercise, articular cartilage deficiency, osteoarthritis or rheumatoid arthritis.

When assayed for PRO polypeptides in the assay, the polypeptides demonstrated prominent ability to promote the release of proteoglycans from cartilage tissue 24 hours and 72 hours after treatment, both basically or after stimulation with interleukin-1α, This means that the PRO polypeptide is useful for promoting proteoglycan release from cartilage tissue. PRO polypeptides are therefore useful for the treatment of joint problems due to exercise, articular cartilage deficiency, osteoarthritis or rheumatoid arthritis. In this assay, the PRO200 polypeptide was tested as positive.

Example 113: In Vitro Antiproliferation Assays (Analysis 161)

The antiproliferative activity of the PRO polypeptide essentially consists of sulforhodamine B (SRB) dye binding assays as described in Skehan et al., J. Natl. Cancer Inst. 82: 1107-1112 (1990). Using the National Institute of Cancer Research (NCI), a research disease orientated in vitro anticancer drug development analysis. 60 tumor cell lines used in this study (NCI panel) and their in vitro maintenance and culture conditions are described in Monks et al., J. Natl. Cancer Inst. 83: 757-766 (1991). . The purpose of this screening is to first evaluate the cytotoxic and / or cytostatic activity of test compounds against various types of tumors (Monks et al., Supra; Boyd, Cancer: Princ. Pract. Oncol. Update 3 (10): 1-12 1989).

Trypsin / EDTA (Gibco) was used to harvest cells from approximately 60 human tumor cell lines, washed once, resuspended in IMEM and determined their viability. Cell suspension was added to a separate 96-well microtiter plate in a pipette (100 μl volume). Cell densities during 6 days of incubation were less than those of 2 days of incubation that prevented overgrowth. Inoculum was stabilized by placing at 37 ° C. for a 24-hour preincubation period. Two-fold dilutions of the intended test concentration were added to the microtiter plate wells (1: 2 dilution) at 0 o'clock in 100 μl aliquots. Test compounds were evaluated at 5 1 / 2-log dilutions (1000 to 100,000 fold). Incubate for 2 days and 6 days in 5% CO ₂ atmosphere and 100% humidity.

After incubation, the medium was removed and the cells were fixed in 0.1 ml of 10% trichloroacetic acid at 40 ° C. The plate was rinsed five times with deionized water, dried and stained with 0.1 ml of 0.4% sulforhodamine B dye (Sigma) dissolved in 1% acetic acid for 30 minutes, rinsed four times with 1% acetic acid to remove unbound dye, The stain was extracted for 5 minutes with 0.1 ml (pH 10.5) of 10 mM Tris base (tris (hydroxymethyl) aminomethane). The absorbance (OD) of sulforhodamine B at 492 nm was measured using a 96-well microtiter plate reader connected to a computer.

A test sample is considered positive if it exhibits at least 50% growth inhibitory effect at one or more concentrations. The PRO polypeptide tested as positive in this assay is shown in Table 7, where the abbreviations are as follows.

NSCL = non-small cell lung carcinoma

CNS = central nervous system

The results of this assay demonstrate that PRO polypeptides are useful for inhibiting neoplastic growth in many different tumor cell types and can be used therapeutically there. Antibodies against PRO polypeptides are useful for affinity purification of such useful polypeptides. Nucleic acids encoding PRO polypeptides are useful for the recombinant preparation of these polypeptides.

Example 114 Gene Amplification in Tumors

This example shows that the gene encoding a particular PRO polypeptide is amplified in the genomes of certain human lung cancers, colon cancers, and / or breast cancers, and / or cell lines. Amplification is associated with overexpression of gene products, which means that the polypeptides are useful targets for treating and determining the presence of certain cancers, such as colon cancer, lung cancer, breast cancer and other cancers. The therapeutic agent may take the form of an antagonist of the PRO polypeptide, eg, a murine-human chimeric antibody, humanized antibody or human antibody against the PRO polypeptide.

The starting material for screening was genomic DNA isolated from several cancers. This DNA is accurately quantified, for example, by fluorometry. As negative control, DNA was isolated from 10 healthy healthy cells selected and used as analytical control for gene copy of healthy people (results not shown). 5 'nuclease assay (e.g. TaqMan ^TM ) and real-time quantitative PCR (e.g. ABI Prizm 7700 Sequence Detection System ^TM (Perkin Elmer, Applied Biosystems Division, Foster City, CA)) I found a gene that could be amplified. The results were used to determine whether the DNA encoding the PRO polypeptide was excessive in screened primary lung or colon cancer, or cancer cell lines or breast cancer cell lines. Primary lung cancers were obtained from subjects with tumors of the types and stages shown in Table 8. A description of the abbreviations used to refer to the primary tumors listed in Table 8 and the primary tumors and cell lines named throughout this example are given below.

Results of TaqMan ^™ are shown in delta (Δ) Ct units. One unit corresponds to one cycle of PCR or approximately two times amplification compared to normal, two units correspond to four times and three units to eight times amplification. For quantification, primers derived from genes encoding PRO polypeptides and TaqMan ^™ fluorescent probes were used. Regions most likely to contain a unique nucleic acid sequence of the PRO polypeptide region and least likely to have been spliced introns (eg 3 ′ untranslated regions) are preferred for induction of primers and probes. The sequences of the primers and probes (forward, reverse primers and probes) used in the PRO polypeptide gene amplification assay are as follows.

PRO853 (DNA48227-1350)

48227.tm.f1

5'-GGCACTTCATGGTCCTTGAAA-3 '(SEQ ID NO: 539)

48227.tm.p1

5'-CGGATGTGTGTGAGGCCATGCC-3 '(SEQ ID NO: 540)

48227.tm.r1

5'-GAAAGTAACCACGGAGGTCAAGAT-3 '(SEQ ID NO: 541)

PRO1017 (DNA56112-1379) :

56112.tm.f1

5'-CCTCCTCCGAGACTGAAAGCT-3 '(SEQ ID NO: 542)

56112.tm.p1

5'-TCGCGTTGCTTTTTCTCGCGTG-3 '(SEQ ID NO: 543)

56112.tm.r1

5'-GCGTGCGTCAGGTTCCA-3 '(SEQ ID NO: 544)

PRO213-1 (DNA30943-1163-1) :

30943.tm.f3:

5'-CGTTCGTGCAGCGTGTGTA-3 '(SEQ ID NO: 545)

30943.tm.p3:

5'-CTTCCTCACCACCTGCGACGGG-3 '(SEQ ID NO: 546)

30943.tm.r3:

5'-GGTAGGCGGTCCTATAGATGGTT-3 '(SEQ ID NO: 547)

30943.tm.f1:

5'-AGATGTGGATGAATGCAGTGCTA-3 '(SEQ ID NO: 548)

30943.tm.p1:

5'-ATCAACACCGCCGGCAGTTACTGG-3 '(SEQ ID NO: 549)

30943.tm.r1:

5'-ACAGAGTGTACCGTCTGCAGACA-3 '(SEQ ID NO: 550)

30943.3trn-5:

5'-AGCCTCCTGGTGCACTCCT-3 '(SEQ ID NO: 551)

30943.3trn-probe:

5'-CGACTCCCTGAGCGAGCAGATTTCC-3 '(SEQ ID NO: 552)

30943.3trn-3:

5'-GCTGGGCAGTCACGAGTCTT-3 '(SEQ ID NO: 553)

PRO237 (DNA34353-1428) :

34353.tm.f:

5'-AATCCTCCATCTCAGATCTTCCAG-3 '(SEQ ID NO: 554)

34353.tm.p:

5'-CCTCAGCGGTAACAGCCGGCC-3 '(SEQ ID NO: 555)

34353.tm.r:

5'-TGGGCCAAGGGCTGC-3 '(SEQ ID NO: 556)

PRO324 (DNA36343-1310) :

36343.tmf1:

5'-TGGTGGATAACCAACAAGATGG-3 '(SEQ ID NO: 557)

36343.tmp1:

5'-GAGTCTGCATCCACACCACTCTTAAAGTTCTCAA-3 '(SEQ ID NO: 558)

36343.tmr1:

5'-CAGGTGCTCTTTTCAGTCATGTTT-3 '(SEQ ID NO: 559)

PRO351 (DNA40571-1315) :

40571.tm.f1:

5'-TGGCCATTCTCAGGACAAGAG-3 '(SEQ ID NO: 560)

40571.tm.p1:

5'-CAGTAATGCCATTTGCCTGCCTGCAT-3 '(SEQ ID NO: 561)

40571.tm.r1:

5'-TGCCTGGAATCACATGACA-3 '(SEQ ID NO: 562)

PRO362 (DNA45416-1251) :

45416.tm.f1:

5'-TGTGGCACAGACCCAATCCT-3 '(SEQ ID NO: 563)

45416.tm.p1:

5'-GACCCTGAAGGCCTCCGGCCT-3 '(SEQ ID NO: 564)

45416.tm.r1:

5'-GAGAGAGGGAAGGCAGCTATGTC-3 '(SEQ ID NO: 565)

PRO615 (DNA48304-1323) :

48304.tm.f1:

5'-CAGCCCCTCTCTTTCACCTGT-3 '(SEQ ID NO: 566)

48304.tm.p1:

5'-CCATCCTGTGCAGCTGACACACAGC-3 '(SEQ ID NO: 567)

48304.tm.r1:

5'-GC CAGGCTATGA GGCTCCTT-3 '(SEQ ID NO: 568)

PRO531 (DNA48314-1320) :

48314.tm.f1:

5'-TTCAAGTTCCTGAAGCCGATTAT-3 '(SEQ ID NO: 569)

48814.tm.p1:

5'-CCAACTTCCCTCCCCAGTGCCCT-3 '(SEQ ID NO: 570)

48814.tm.r1:

5'-TTGGGGAAGGTAGAATTTCCTTGTAT-3 '(SEQ ID NO: 571)

PRO618 (DNA49152-1324) :

49152.tm.f1:

5'-CCCTTCTGCCTCCCAATTCT-3 '(SEQ ID NO: 572)

49152.tm.p1:

5'-TCTCCTCCGTCCCCTTCCTCCACT-3 '(SEQ ID NO: 573)

49152.tm.r1:

5'-TGAGCCACTGCCTTGCATTA-3 '(SEQ ID NO: 574)

PRO772 (DNA49645-1347) :

49645.tm.f2:

5'-TCTGCAGACGCGATGGATAA-3 '(SEQ ID NO: 575)

49645.tm.p2:

5'-CCGAAAATAAAACATCGCCCCTTCTGC-3 '(SEQ ID NO: 576)

49645.tm.r2:

5'-CACGTGGCCTTTCACACTGA-3 '(SEQ ID NO: 577)

49645.tm.f1:

5'-ACTTGTGACAGCAGTATGCTGTCTT-3 '(SEQ ID NO: 578)

49645.tm.p1:

5'-AAGCTTCTGTTCAATCCCAGCGGTCC-3 '(SEQ ID NO: 579)

49645.tm.r1:

5'-ATGCACAGGCTTTTTCTGGTAA-3 '(SEQ ID NO: 580)

PRO703 (DNA50913-1287) :

50913.tm.f1:

5'-GCAGGAAACCTTCGAATCTGAG-3 '(SEQ ID NO: 581)

50913.tm.p1:

5'-ACACCTGAGGCACCTGAGAGAGGAACTCT-3 '(SEQ ID NO: 582)

50913.tm.r1:

5'-GACAGCCCAGTACACCTGCAA-3 '(SEQ ID NO: 583)

PRO792 (DNA56352-1358) :

56352.tm.f1:

5'-GACGGCTGGATCTGTGAGAAA-3 '(SEQ ID NO: 584)

56352.tm.p1:

5'-CACAACTGCTGACCCCGCCCA-3 '(SEQ ID NO: 585)

56352.tm.r1:

5'-CCAGGATACGACATGCTGCAA-3 '(SEQ ID NO: 586)

PRO474 (DNA56045-1380) :

56045.tm.f1:

5'-AAACTCCAACCTGTATCAGATGCA-3 '(SEQ ID NO: 587)

56045.tm.p1:

5'-CCCCCAAGCCCTTAGACTCTAAGCCC-3 '(SEQ ID NO: 588)

56045.tm.r1:

5'-GACCCGGCACCTTGCTAAC-3 '(SEQ ID NO: 589)

PRO274 (DNA39987-1184):

39987.tm.f:

5'-GGACGGTCAGTCAGGATGACA-3 '(SEQ ID NO: 590)

39987.tm.p:

5'-TTCGGCATCATCTCTTCCCTCTCCC-3 '(SEQ ID NO: 591)

39987.tm.r:

5'-ACAAAAAAAAGGGAACAAAATACGA-3 '(SEQ ID NO: 592)

PRO381 (DNA44194-1317)

44194.tm.f:

5'-CTTTGAATAGAAGACTTCTGGACAATTT-3 '(SEQ ID NO: 593)

44194.tm.p:

5'-TTGCAACTGGGAATATACCACGACATGAGA-3 '(SEQ ID NO: 594)

44194.tm.r:

5'-TAGGGTGCTAATTTGTGCTATAACCT-3 '(SEQ ID NO: 595)

44194.tm.f2:

5'-GGCTCTGAGTCTCTGCTTGA-3 '(SEQ ID NO: 596)

44194.tm.p2:

5'-TCCAACAACCATTTTCCTCTGGTCC-3 '(SEQ ID NO: 597)

44194.tm.r2:

5'-AAGCAGTAGCCATTAACAAGTCA-3 '(SEQ ID NO: 598)

PRO717 (DNA50988-1326) :

50988.tm.f3:

5'-CAAGCGTCCAGGTTTATTGA-3 '(SEQ ID NO: 599)

50988.tm.r3:

5'-GACTACAAGGCGCTCAGCTA-3 '(SEQ ID NO: 600)

50988.tm.p3:

5'-CCGGCTGGGTCTCACTCCTCC-3 '(SEQ ID NO: 601)

PRO1330 and PRO1449 (DNA64907-1163 and DNA64908-1163, respectively) :

30943.tm.f3:

5'-CGTTCGTGCAGCGTGTGTA-3 '(SEQ ID NO: 602)

30943.tm.p3:

5'-CTTCCTCACCACCTGCGACG GG-3 '(SEQ ID NO: 603)

30943.tm.r3:

5'-GGTAGGCGGTCCTATAGATGGTT-3 '(SEQ ID NO: 604)

30943.tm.f1:

5'-AGATG TGGATGAATG CAGTGCTA-3 '(SEQ ID NO: 605)

30943.tm.p1:

5'-ATCAACACCGCCGGCAGTTACTGG-3 '(SEQ ID NO: 606)

30943.tm.r1:

5'-ACAGAGTGTACCGTCTGCAGACA-3 '(SEQ ID NO: 607)

30943.3trn-5:

5'-AGCCTCCTGGTGCACTCCT-3 '(SEQ ID NO: 608)

30943.3trn-probe:

5'-CGACTCCCTGAGCGAGCAGATTTCC-3 '(SEQ ID NO: 609)

30943.3trn-3:

5'-GCTGGGCAGTCACGAGTCTT-3 '(SEQ ID NO: 610)

The 5 'nuclease assay reaction is a fluorescent PCR based technique that monitors amplification in real time using the 5' exonuclease activity of Taq DNA polymerase. Two oligonucleotide primers (forward [.f] and reverse [.r]) are used to generate amplicons conventional for PCR reactions. A third oligonucleotide, or probe (.p), is designed to detect nucleotide sequences located between two PCR primers. Probes cannot be extended by Taq DNA polymerase and are labeled with reporter fluorescent dyes and quencher fluorescent dyes. Release from the laser induced reporter dye is quenched by the quenching dye when the two dyes are placed close together on the probe. During the amplification reaction, Taq DNA polymerase cleaves the probe in a template-dependent manner. The probe fragment thus produced is separated in solution and the signal from the released reporter dye is not affected by the quenching of the second fluorophore. One reporter dye molecule is released for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data.

The 5 'nuclease method is performed with a real-time quantitative PCR device such as the ABI Prism 7700 ™ Sequence Detector. The system consists of a periodic heater, a laser, a charge-coupled device (CCD) camera and a computer. The system amplifies the sample in 96 well format in a periodic heater. During amplification, laser induced fluorescence signals are collected in real time via fiber optic cables for all 96 wells and detected at the CCD. The system includes software for operating the device and analyzing the data.

5 ′ nuclease assay data is initially expressed in Ct or threshold cycle. This is defined as the cycle at which the reporter signal accumulates above the background level of fluorescence. The ΔCt value is used as a quantitative measure of the relative starting copy number of a particular target sequence in a nucleic acid sample when comparing cancer DNA results with normal human DNA results.

Table 8 describes the stages, stages T and N of the various primary tumors used to screen the PRO polypeptide compounds of the present invention.

DNA manufacturing

DNA was purified from cultured cell lines, primary tumors, normal human blood. This DNA isolation was performed using the Qiagen Purification Kit, Buffer Set, and Protease according to the manufacturer's instructions and as described below.

Cell Culture Lysis:

Cells were washed to treat trypsin at a concentration of 7.5 × 10 ⁸ per tip, centrifuged at 1000 rpm at 4 ° C. for 5 minutes, pelleted, and then re-centrifuged by washing again with 1/2 volume of PBS. . The pellet was washed a third time, the suspended cells were collected and washed twice with PBS. The cells were then suspended in 10 ml of PBS. Buffer C1 was equilibrated at 4 ° C. Qiagen protease # 19155 was diluted to 6.25 ml of cold ddH ₂ O to a final concentration of 20 mg / ml and equilibrated at 4 ° C. 10 ml of G2 buffer was prepared by diluting Qiagen RNAse A stock solution (100 mg / ml) to a final concentration of 200 μg / ml.

Buffer C1 (10 ml, 4 ° C.) and ddH ₂ O (40 ml, 4 ° C.) were then added to 10 ml of the cell suspension, mixed upside down and incubated on ice for 10 minutes. Cell nuclei were pelleted by centrifugation at 2500 rpm for 15 minutes at 4 ° C. with a Beckman swing bucket rotor. The supernatant was decanted and vortexed to suspend nuclei in 2 ml buffer C1 (4 ° C.) and 6 ml ddH ₂ O, followed by a second centrifugation at 2500 rpm for 15 minutes at 4 ° C. The nuclei were then resuspended in 200 μl per tip in residual buffer. The suspension was slowly vortexed with the addition of G2 buffer (10 ml). After completing the buffer addition, it was vigorously vortexed for 30 seconds. Qiagen protease (200 μl, prepared as above) was added and incubated at 50 ° C. for 60 minutes. Incubation and centrifugation were repeated until the lysate became clear (e.g., 30 to 60 minutes more incubated and pelleted at 3000 xg for 10 minutes at 4 ° C).

Human Fidelity Tumor Sample Preparation and Dissolution:

Tumor samples were weighed and placed in 50 ml conical tubes on ice. Treatment was limited to not more than 250 mg of tissue in a single preparation (one tip / 1 preparation). The protease solution was freshly prepared by diluting to a final concentration of 20 mg / ml in 6.25 ml of cold ddH ₂ O and stored at 4 ° C. DNAse A was diluted to a final concentration of 200 mg / ml (diluted from 100 mg / ml of the mother solution) to prepare G2 buffer (20 ml). Tumor tissue was homogenized for 60 seconds in 19 ml of G2 buffer and left at room temperature using a large polytron tip in a Lamina-Flow TC hood to prevent inhalation of the aerosol. Between the samples and between samples, the polytrons were washed by spinning twice for 30 seconds in ddH ₂ O 2 L and then removed by washing with G2 buffer (50 ml). For tissue remaining on the generator tip, the instrument was disassembled and removed.

Qiagen protease (prepared as above, 1.0 ml) was added and then vortexed and incubated at 50 ° C. for 3 hours. Incubation and centrifugation were repeated until the lysate became clear (eg, further incubation for 30 to 60 minutes and pelleted at 3000 × g for 10 minutes at 4 ° C.).

Preparation and Dissolution of Human Blood:

Blood from healthy volunteers was drawn using standard infectious material protocols to citrate 10 ml of sample per tip. The Qiagen protease was freshly prepared by diluting to a final concentration of 20 mg / ml in 6.25 ml of cold ddH2O and stored at 4 ° C. G2 buffer was prepared by diluting 100 mg / ml RNAse A stock solution to a final concentration of 200 μg / ml. Blood (10 ml) was placed in a 50 ml conical tube and 10 ml C1 buffer and 30 ml ddH ₂ O (both previously equilibrated to 4 ° C.) were inverted, the components mixed and left on ice for 10 minutes. The nuclei were pelleted and decanted by centrifugation at 2500 rpm for 15 minutes at 4 ° C. with a Beckman swing bucket rotor. The vortex was suspended in nuclei in 2 ml C1 buffer (4 ° C.) and 6 ml ddH ₂ O (4 ° C.). The vortexing was repeated until the pellets turned white. The nuclei were then resuspended in residual buffer using a 200 μl tip. G2 buffer (10 ml) was slowly vortexed with addition to the suspended nuclei and then vigorously vortexed for 30 seconds. Qiagen protease (200 μl) was added and incubated at 50 ° C. for 60 minutes. Incubation and centrifugation were repeated until the lysate became clear (e.g., 30 to 60 minutes further incubated and pelleted at 3000 xg for 10 minutes at 4 ° C).

Purification of Transparent Melt:

(1) Isolation of Genomic DNA

Genomic DNA was equilibrated with 10 ml QBT buffer (1 sample preparation per maximal tip). QF elution buffer was equilibrated at 50 ° C. The sample was vortexed for 30 seconds, then loaded into the equilibrated tip and drained using gravity. The tip was washed twice with 15 ml QC buffer. DNA was eluted using 15 ml QF buffer (50 ° C.) to obtain 30 ml silanized autoclaved 30 ml Corex tubes. Isopropanol (10.5 ml) was added to each sample and the tubes were covered with paraffin and mixed by repeating flipping until DNA precipitated. The sample was pelleted by centrifugation at 15,000 rpm for 10 minutes at 4 ° C. with an SS-34 rotor. The pellet position was marked and the supernatant decanted and 10 ml of 70% ethanol (4 ° C.) was added. The sample was repellet by centrifugation at 10,000 rpm for 10 minutes at 4 ° C with an SS-34 rotor. The pellet position was marked and the supernatant was decanted. These tubes were again placed in a drying rack and dried at 37 ° C. for 10 minutes, taking care not to overdry the samples.

After drying, the pellets were dissolved in 1.0 ml TE (pH 8.5) and placed at 50 ° C. for 1-2 hours. The sample was left overnight at 4 ° C. with continued dissolution. The DNA solution was then transferred to a 1.5 ml tube using a tuberculin syringe with a 26 gauge needle. This DNA solution transfer was repeated five times to remove the DNA. The sample was then left at 50 ° C. for 1-2 hours.

(2) Preparation for Quantitative and Gene Amplification Analysis of Genomic DNA

DNA levels in each tube were quantified for 1:20 dilutions (5 μl DNA + 95 μl ddH ₂ O) using standard A ₂₆₀ , A ₂₈₀ spectrophotometry using 0.1 ml quartz cuvettes in a Beckman DU640 spectrophotometer. . The A ₂₆₀ / A ₂₈₀ ratio ranged from 1.8 to 1.9. Each DNA sample was then further diluted to a concentration of about 200 ng / ml in TE (pH 8.5). If the original material was highly concentrated (about 700 ng / μl), the material was left at 50 ° C. for several hours until resuspended.

Next, DNA quantitation by fluorometry was performed on the diluted material (20-600 ng / ml) using the manufacturer's instructions modified as follows. This was done by warming up the Hoeffer DyNA Quant 200 fluorometer for about 15 minutes. Hoechst dye treatment solution (# H33258, 10 μl, prepared within 12 hours before use) was diluted in 100 ml of 1 × TNE buffer. A 2 ml cuvette was filled with the solution for the fluorometer, placed in the fluorometer, and the machine was set to zero. pGEM 3Zf (+) (2 μl, lot # 360851026) was added to 2 ml of the solution for the fluorometer and measured at 200 units. Thereafter, 2 μl of other pGEM 3Zf (+) DNA was tested and the measurement results were confirmed at 400 +/- 10 units. Each sample was then measured at least three times. When the results of measuring the samples three times were within 10% of each other, their average was calculated and this value was used as the quantitative value.

Each sample was diluted to 10 ng / μl in ddH ₂ O using the concentration determined by fluorometry. For a single TaqMan plate assay, the dilution was performed simultaneously on all template samples, and the material was sufficient to perform 500 to 1000 assays. Three tests were performed using probes for both B-actin and GAPDH on a single plate with Taqman ^™ primers, and normal human DNA template control. Diluted samples were used if the CT value of normal human DNA minus the test DNA was +/- 1 Ct. Diluted genomic DNAs labeled and stored were stored at −80 ° C. in 1.0 ml portions. Aliquots for later use in gene amplification assays were stored at 4 ° C. Each 1 ml of aliquot was sufficient for use on 8-9 plates or for 64 tests.

Gene Amplification Assay:

The PRO polypeptide compounds of the invention were screened in the following primary tumors, and the resulting ΔCt values of at least 1.0 are shown in Table 9 below.

summary

Since amplification of various DNAs as described above occurs in various tumors, such amplification is likely to be related to tumor formation and / or growth. As a result, it is expected that antagonists (eg, antibodies) associated with these polypeptides will be useful in the treatment of cancer.

Example 115: Induction of c-fos in endothelial cells (assay 34)

This assay was designed to determine whether PRO polypeptide exhibits the ability to induce c-fos in endothelial cells. PRO polypeptides tested to be positive in this assay are expected to be useful for the treatment of symptoms or diseases in which angiogenesis is beneficial (eg, wound treatment, etc.). Antagonists of PRO polypeptides tested positive in this assay are expected to be useful in the treatment of cancer tumors.

Human umbilical vein endothelial in growth medium (50% Ham F12 w / o GHT: low concentration glucose, and glycine free 50% DMEM: NaHCO ₃ , 1% glutamine, 10 mM HEPES, 10% FBS, 10 ng / ml bFGF) Cells (HUVEC, cell system) were plated on 96-well microtiter plates at a cell density of 1 × 10 ⁴ cells / well. The day after plating, growth medium was removed and cells were treated with 100 μl / well of test sample and control (positive control = growth medium, negative control = protein 32 buffer = 10 mM HEPES, 140 mM NaCl, 4% (w / v)). Asathan was treated with mannitol, pH 6.8). Cells were incubated for 30 minutes at 37 ° C. in 5% CO ₂ . Samples were removed and part 1 of the bDNA kit protocol (Chiron Diagnostics, Cat. No. 6005-037) was performed (each reagent / buffer indicated in capital letters below is available from this kit).

In summary, the amount of TM Lysis Buffer and Probe required for the test was calculated according to the information provided by the manufacturer. Appropriate amount of thawed probe (Probe) was added to TM Lysis Buffer. Capture Hybridization Buffer was warmed to room temperature. The bDNA strip was fixed in a metal strip holder and 100 μl of Capture Hybridization Buffer was added to each required b-DNA well and incubated for at least 30 minutes. The test plate with cells was removed from the incubator and the medium was slowly removed using a vacuum branch. 100 μl of Lysis Hybridization Buffer with Probe was quickly pipetted into each well of the microtiter plate. The plate was then incubated at 55 ° C. for 15 minutes. After removal from the incubator, the plate was placed in a vortex mixer equipped with a microtiter adapter and vortexed by setting it twice for 1 minute. 80 μl of lysate was removed and added to the bDNA wells containing Capture Hybridization Buffer and mixed by pipetting up and down. Plates were incubated at 53 ° C. for at least 16 hours.

The next day, part 2 of the bDNA kit protocol was performed. Specifically, the plate was removed from the incubator and left on the bench for 10 minutes to cool. The required volume addition amount was calculated according to the information provided by the manufacturer. Amplifier Working Solution was prepared by preparing a 1: 100 dilution of Amplifier Concentrate (20 fm / μl) in AL Hybridization Buffer. The hybridization mixture was removed from the plate and washed twice with Wash A. 50 μl of Amplifier Working Solution was added to each well and the wells were incubated at 53 ° C. for 30 minutes. The plate was then removed from the incubator and cooled for 10 minutes. Label Probe Working Solution was prepared by preparing a 1: 100 dilution of Label Concentrate (40 pmole / μl) in AL Hybridization Buffer. After cooling for 10 minutes, the amplification hybridization mixture was removed and the plate washed twice with Wash A. 50 μl of Label Probe Working Solution was added to each well and the wells were incubated at 53 ° C. for 15 minutes. After cooling for 10 minutes, the substrate was allowed to warm to room temperature. After addition of 3 μl Substrate Enhancer per ml of Substrate Required for Assay, the plate is cooled for 10 minutes, the label hybridization mixture is removed, and the plate is washed twice with Wash A. And three washes with Wash D. 50 μl Substrate Solution with Enhancer was added to each well. Plates were incubated at 37 ° C. for 30 minutes and RLUs were read with an appropriate light meter.

The repeated experimental results were averaged and the coefficient of variation was measured. Measurement folds of increased activity relative to negative control (protein 32 / HEPES buffer described above) values are expressed as chemiluminescent units (RLUs). The results were considered positive if the PRO polypeptide showed at least two times that of the negative buffer control. Negative control = 1.00 RLU at 1.00% dilution. Positive control = 8.39 RLU at 1.00% dilution.

PRO938, PRO200, PRO865, PRO788 and PRO1013 polypeptides were tested positive in this assay.

Example 116: Proliferation of vesicle support cells in rats (assay 54)

This analysis indicates that certain polypeptides of the invention are useful for inducing regeneration of auditory hair cells and treating hearing loss in mammals by acting as potent mitogens for inner ear support cells, the origin of hearing hair cells. This analysis is performed as follows. Rat UEC-4 follicular epithelial cells were aliquoted into 200 μl serum containing medium at 33 ° C. at a density of 3000 cells per well in 96 well plates. Cells were incubated overnight and then transferred to serum-free medium at 37 ° C. Subsequently, various concentrations of the diluted PRO polypeptide (or the control did not contain this polypeptide) were added to the culture and the cells were incubated for 24 hours. After 24 hours of incubation, ³ H-thymidine (1 μCi / well) was added and the cells were further incubated for 24 hours. Thereafter, the cultures were washed to remove unincorporated radiolabels and cells were harvested to determine Cpm per well. In this assay, the Cpm of the culture treated with the PRO polypeptide was considered to be 30% or more higher than the control culture.

In this assay, the PRO337, PRO363 and PRO1012 polypeptides were tested positive.

Example 117: Detection of PRO Polypeptides Influencing Glucose or FFA Uptake by Primary Rat Adipocytes (Analysis 94)

This assay was designed to determine whether the PRO polypeptide exhibited the ability to affect glucose or FFA uptake by adipocytes. PRO polypeptides tested positive in this assay are expected to be useful for the treatment of diseases where stimulation or inhibition of glucose uptake by adipocytes is beneficial, including obesity, diabetes, hyperinsulinemia or hypoinsulinemia.

In 96 well format, the PRO polypeptide to be analyzed was added to primary rat adipocytes and incubated overnight. Samples were injected at 4 and 16 hours and evaluated for glycerol, glucose and FFA uptake. After incubation for 16 hours, insulin was added to the medium and incubated for 4 hours. At this time, a sample was injected and glycerol, glucose and FFA uptake were measured. Media containing insulin without PRO polypeptide was used as a positive reference control. The PRO polypeptide to be tested was able to stimulate or inhibit glucose and FFA uptake, and the results were recorded as positive if at least 1.5 times or less than 0.5 times the insulin control.

In this assay, the PRO181, PRO200, PRO337, PRO362, PRO363, PRO731, PRO534, PRO1114 and PRO1075 polypeptides were tested to be positive as stimulators of glucose and / or FFA absorption.

In this assay, the PRO195, PRO322, PRO862, PRO868, PRO865 and PRO162 polypeptides were tested as inhibitors of glucose and / or FFA uptake.

Example 118: Detection of Polypeptides Affecting Glucose and / or FFA Uptake in Skeletal Muscle (Analysis 106)

This assay was designed to determine if the PRO polypeptide exhibited the ability to affect glucose or FFA uptake by skeletal muscle. PRO polypeptides tested positive in this assay are expected to be useful in the treatment of diseases in which stimulation or inhibition of glucose uptake by skeletal muscle is beneficial, including diabetes, hyperinsulinemia or hypoinsulinemia.

In a 96 well format, the PRO polypeptide to be analyzed was added to the differentiated skeletal muscle of the primary rat and incubated overnight. Next, fresh medium containing PRO polypeptide and +/- insulin was added to the wells. This sample medium was then monitored to measure glucose and FFA uptake by skeletal muscle. Insulin will stimulate glucose and FFA uptake by skeletal muscle and insulin in medium without PRO polypeptide was used as a limit for score recording as a positive control. Since the PRO polypeptide to be tested can stimulate or inhibit glucose and FFA uptake, the results were recorded as positive if at least 1.5 times or less than 0.5 times the insulin control.

In this assay, the PRO181, PRO200, PRO1083, PRO865, PRO162, PRO1008 and PRO1330 polypeptides were tested as positive as stimulants or inhibitors of glucose and / or FFA uptake.

Example 119: Stimulation of Cardiac Hypertrophy in Newborns (Analysis 1)

This assay was designed to determine the ability of PRO polypeptides to stimulate neonatal cardiac hypertrophy. PRO polypeptides tested positive in this assay are expected to be useful in the treatment of various heart failure diseases.

Cardiomyocytes were obtained from Harlan Sprague Dawley rats of a day. Cells (180 μl at 7.5 × 10 ⁴ / ml, serum <0.1%, freshly isolated) were added to 96-well plates precoated with DMEM / F12 + 4% FCS on the first day. Test samples or growth medium containing the test PRO polypeptide (negative control) were added directly to the wells on the first day (at 20 μl / well). PGF (20 μl / well) was then added at a final concentration of 10 ⁻⁶ M on the second day. Next, the cells were stained on day 4 and scored visually on day 5, with 0.0 cells that did not increase in size compared to the negative control, 1.0 cells that increased slightly compared to the negative control, and 1.0 for the negative control. Cells that increased in size significantly scored 2.0. In this analysis, a score of 1.0 or higher is positive.

In this assay, the PRO195, PRO200, PRO526 and PRO792 polypeptides were tested positive.

Example 120: Improvement of Cardiac Hypertrophy in Neonates Induced by F2a (Analysis 37)

This assay was designed to determine the ability of PRO polypeptides to stimulate neonatal cardiac hypertrophy. PRO polypeptides tested positive in this assay are expected to be useful in the treatment of various heart failure diseases.

Cardiomyocytes were obtained from Harlan's Sprague Dawley rats. Cells (180 μl at 7.5 × 10 ⁴ / ml, serum <0.1%, freshly isolated) were added to 96-well plates precoated with DMEM / F12 + 4% FCS on the first day. Test samples containing test PRO polypeptide (20 μl / well) were added directly to the wells on the first day. Next, PGF (20 μl / well) was added at a final concentration of 10 ⁻⁶ M on the second day. Cells were then stained on day 4 and scored visually on day 5. The visual evaluation was based on the cell size, with 0.0 for cells that did not increase in size compared to the negative control, 1.0 for cells that slightly increased in size compared to the negative control, and 2.0 for cells that increased significantly compared to the negative control. Recorded. In this analysis, a score of 1.0 or higher is positive.

In this analytical reaction, PBS was not included because calcium concentration was critical. Plates were coated with DMEM / F12 + 4% FCS (20 μl / well). Assay medium contains DMEM / F12 (containing 2.44 gm of bicarbonate), 10 μg / ml transferrin, 1 μg / ml insulin, 1 μg / ml aprotinin, 2 mmol / L glutamine, 100 U / ml penicillin G, 100 μg / ml strepto Mycin was included. Protein buffer containing mannitol (4%) showed a positive signal (score 3.5) at 1/10 (0.4%) and 1/100 (0.04%), but not at 1/1000 (0.004%). Thus, test sample buffer containing mannitol did not work.

In this assay, the PRO195 polypeptide was tested positive.

Example 121 Vascular Leakage of Guinea Pigs (Analysis 32 and 51)

This assay was designed to determine whether the PRO polypeptides of the present invention exhibited the ability to induce vascular permeation. Polypeptides tested to be positive in this assay are expected to be beneficial for the treatment of symptoms that would be beneficial for increased vascular permeation, including, for example, symptoms that would be beneficial to increase local infiltration of immune system cells.

Hairless guinea pigs weighing more than 350 grams were anesthetized by intramuscular administration of ketamine (Ketamine, 75-80 mg / kg) and xylazine (Xylazine, 5 mg / kg). Test samples containing PRO polypeptides or physiological buffers containing no test polypeptides were injected intradermally into the back of test animals at 100 μl per injection site. About 16 to 24 injections per animal. Next, 1 ml of Evans blue dye (1% in PBS) was injected into the heart. Visually record the score by measuring the diameter (in mm) of the blue pigmented leak from the injection site 1 and 6 hours after administration of the test substance for cutaneous vascular permeation (ie, spot at the injection site) in response to this compound. It was. The diameter of the blue part of the injection site (mm) was observed and the severity of vascular leakage was also recorded. In this analysis, when purified protein is tested, spot diameters greater than 5 mm are considered positive, indicating that blood vessel leakage or permeation can be induced. For conditioned media samples, diameters greater than 7 mm are considered positive. 0.1 μg / 100 μl of human VEGF, which induces a response with a diameter of 15 to 23 mm, was used as a positive control.

In this assay, the PRO200 polypeptide was tested as positive.

Example 122: Permeability Analysis of Skin Vessels (Analysis 64)

This analysis indicates that certain polypeptides of the present invention stimulate inflammation and induce inflammation by inducing mononuclear cells, eosinophils, and PMN infiltration at the injection site of a subject animal. Where it is beneficial to stimulate an immune response, compounds that stimulate the immune response are useful in therapy. Permeability analysis of skin vessels was performed as follows. Ketamine (75-80 mg / kg) and xylazine 5 mg / kg were intramuscularly injected (IM) to anesthetize hairless guinea pigs weighing 350 g or more. Purified polypeptide samples or conditioned medium test samples of the invention were injected intradermally into the back of test animals in an amount of 100 μl per injection site. It can be injected at about 10-30, preferably about 16-24 sites per subject animal. 1 μl of Evans blue dye (1% in physiological buffered saline) was injected intracardiac. Subsequently, the diameter (mm) of the injury site due to the injection was measured 1 to 6 hours after the injection. Animals were slaughtered 6 hours after injection. Each injection site of the skin was biopsied and fixed in formalin. Thereafter, skin was prepared for histopathological evaluation. Infiltration of inflammatory cells into the skin at each site was assessed. Visible areas of inflammation in inflammatory cells were recorded as positive. Inflammatory cells may be neutrophils, eosinophils, monocytes or lymphocytes. Any invasion around the blood vessels at the injection site was recorded as positive, and no infiltration at the injection site was recorded as negative.

In this assay, the PRO200, PRO362 and PRO1031 polypeptides were tested as positive.

Example 123: Induction of c-fos in cortical neurons (analysis 83)

This assay was designed to determine whether PRO polypeptide exhibits the ability to induce c-fos in cortical neurons. PRO polypeptides tested to be positive in this assay are expected to be useful in the treatment of neurological diseases and injuries where neuronal proliferation is beneficial.

Cortical neurons were isolated and placed in growth medium at 10,000 cells per well in 96 well plates. After dividing into approximately 2 cells, cells were treated with PRO polypeptide for 30 minutes or no treatment (negative control). Cells were then fixed with cold methanol for 5 minutes and stained with antibodies to phosphorylated CREB. Next, mRNA levels were calculated using chemiluminescence. In this analysis, any factor that was more than doubled in the c-fos message was positive compared to the negative control.

In this assay, the PRO200 polypeptide was tested as positive.

Example 124 Analysis of Proliferation of Hemangioblasts of Mouse Kidney (Analysis 92)

This assay suggests that Berger's disease, Schöleinlein-Henoch purpura, Chronic Digestive Disorder, and Herpes, because certain polypeptides of the invention act to induce proliferation of hepatic stem cells in mammalian kidneys. It has been shown to be useful for treating renal disease associated with impaired function of hepatic stem cells, such as sexual dermatitis or other neuropathy associated with Crohn's disease. The analysis is performed as follows. On day 1, hepatoblasts of mouse kidneys were grown in 96-well plates in a 3: 1 mixture of growth medium [Dulbecco's modified Eagle's medium and Ham F12 medium, 95% fetal bovine serum, 5% 14 mM HEPES Supplemented] and incubated overnight. On day 2, PRO polypeptide was diluted to two concentrations (1% and 0.1%) in serum-free medium and added to cells. The control sample is serum-free medium alone. On day 4, Cell Titer 96 Aqueous One-Component Solution Reagent (Promega) was added to each well and the color reaction was allowed to proceed for 2 hours. Then, absorbance (OD) was measured at 490 nm. Positive in these assays are those with absorbance values that are at least 15% higher than control readings.

In this assay, the PRO200, PRO363, PRO731, PRO534, PRO866 and PRO1031 polypeptides were tested as positive.

Example 125 c-Fos Induction in Perivascular Cells (Analysis 93)

This assay is useful for the treatment of tumors associated with perivascular cells as well as diagnostic markers of perivascular cells associated with certain types of perivascular cells because certain polypeptides of the invention act to induce the expression of c-fos in perivascular cells. It is also useful for generating antagonists that are expected to be useful for Specifically, perivascular cells are obtained from VEC Technologies on day 1 and removed with only 5 ml of medium in the flask. Peripheral cells were trypsinized, washed, spun and plated in 96 well plates on day 2. On day 7 the medium is removed and perivascular cells are treated with PRO polypeptide test sample and 100 μl of control (positive control = DME + 5% serum +/- PDGF (500 ng / ml), negative control = protein 32). Repeated test results are averaged and SD / CV determined. The product multiplication over frequency is shown as a bar graph over the value of Protein 32 (buffer control) shown in the chemiluminescence unit (RLU) luminometer reading. Two times greater than the value of protein 32 is considered positive in this assay. ASY Matrix: Growth Medium = Low Glucose DMEM = 20% FBS + 1 X Pen Strep + 1 X Fungi Zone, Assay Medium = Low Glucose DMEM + 5% FBS.

In this assay, the PRO200 polypeptide was tested as positive.

Example 126: Chondrocyte Redifferentiation Assay (Analysis 110)

This analysis indicates that certain polypeptides of the present invention are thought to be useful in the treatment of various bone and / or cartilage diseases such as, for example, sports injury and arthritis because they act to induce differentiation of chondrocytes. The analysis is performed as follows. Porcine chondrocytes were isolated by digesting the articular cartilage of the metacarpal joints of sows 4-6 months of age with collagenase overnight. Isolated cells were then seeded at 25,000 cells / cm ² in Ham F-12 containing 10 μg FBS and 4 μg / ml of gentamycin. The culture medium was exchanged every 3 days and cells were seeded at 5,000 cells per well in 100 μl of the same medium without serum in 96 well plates and tested PRO polypeptide, sturosporin (positive control) or medium alone (negative). 100 μl of control) was added to make a total volume of 200 μl per well. After incubation at 37 ° C. for 5 days, photographs of each well were taken to determine the differentiation state of chondrocytes. In this assay, positive regeneration of chondrocytes was determined to be more similar in the positive control than in the negative control.

In this assay, the PRO200, PRO285, PRO337, PRO526, PRO362, PRO363, PRO531, PRO1083, PRO862, PRO733, PRO1017, PRO792, PRO788, PRO1008, PRO1075, PRO725 and PRO1031 polypeptides were tested as positive.

Example 127: Fetal Hemoglobin Induction in Erythrocyte Cell Line (Analysis 107)

This assay is useful for screening whether PRO polypeptides can induce the transition from adult hemoglobin to fetal hemoglobin in erythroid cell lines. If the molecule tested in this assay is positive, it is expected to be useful for the therapeutic treatment of various mammalian hemoglobin-related diseases such as thalassemia. This analysis is performed as follows. Erythrocyte cells are plated in standard growth medium at 1000 cells per well in 96 well format. PRO polypeptide is added to the growth medium at a concentration of 0.2% or 2% and the cells are incubated at 37 ° C. for 5 days. Cells are treated with 100 μM hemin as a positive control and cells are not treated as a negative control. After 5 days, cell lysates are prepared and analyzed for expression of gamma globin (fetal marker). Positive in this assay means an amount of gamma globin that is at least two times higher than that of the negative control.

In this assay, the PRO237, PRO381, PRO362, PRO724, PRO866, PRO1114, PRO725 and PRO1071 polypeptides were tested as positive.

Example 128: Induction of Proliferation of Pancreatic β-Progenitor Cells (Analysis 117)

This analysis indicates that certain polypeptides of the invention are useful for the treatment of various insulin deficiency symptoms, including diabetes mellitus, in mammals because they induce an increase in the number of progenitor cells of pancreatic β-cells. The analysis is performed as follows. The analysis utilizes primary cultures of pancreatic cells in mouse fetuses and the primary readings show that the expression of markers representing β-progenitor cells or mature β-cells is altered. Expression of the marker is measured by real time quantitative PCR (RTQ-PCR), where the marker measured is a transcription factor called Pdx1.

The pancreas was excised from E14 embryos (CD1 mice). The pancreas was then digested by treatment with collagenase / dispase in F12 / DMEM for 40-60 minutes at 37 ° C. (collagenase / dispase, 1.37 mg / ml, Boehringer Mannheim, # 1097113). Thereafter, an equal volume of 5% BSA was used to neutralize lysates and the cells were washed once with RPMI1640. On day 1, cells were seeded in 12-well tissue culture plates (pre-coated with 20 μg / ml laminin in PBS, Boehringer Mannheim, # 124317). Cells from the pancreas of 1-2 embryos were distributed per well. The culture medium for this primary culture was 14F / 1640. On day 2, the medium was removed and the adhered cells were washed out using RPMI / 1640. In addition to the protein to be tested, a minimum of 2 ml of medium was added. On day 4, the media was removed and RNA was prepared from the cells to analyze the expression of markers by real time quantitative RT-PCR. In this assay, the protein was considered to be active when the protein increased the expression of related β-cell markers as compared to the untreated control.

14F / 1640 added the following component to RPMI1640 (Gibco).

Group A 1: 1000

Group B 1: 1000

10 μg / ml recombinant human insulin

Aprotinin (50 μg / ml) 1: 2000 (Boehringer Mannheim # 981532)

60 ㎍ / ml bovine pituitary extract (BPE)

Gentamicin 100 ng / ml

Group A: (in 10 ml PBS)

Transferrin, 100 mg (Sigma T2252)

Epidermal growth factor, 100 μg (BRL 100004)

10 μl of 5 × ^10-6 M triiodothyronine (Sigma T5516)

100 μl 10 ⁻¹ M ethanolamine (Sigma E0135)

100 μl 10 ⁻¹ M phosphoethanolamine (Sigma P0503)

4 μl of 10 ^-1 M selenium (Aesar # 12574)

Group C: (in 10 ml of 100% ethanol)

2 μl of 5 × 10 ⁻³ M hydrocortisone (Sigma # H0135)

100 μl of 1 × ^10-3 M progesterone (Sigma # P6149)

20 500 μl of mM forskolin (calbiochem # 344270)

Minimal medium: RPMI 1640, and transferrin (10 μg / ml), insulin (1 μg / ml), gentamycin (100 ng / ml), aprotinin (50 μg / ml) and BPE (15 μg / ml).

Restriction medium: RPMI 1640, and transferrin (10 μg / ml), insulin (1 μg / ml), gentamycin (100 ng / ml) and aprotinin (50 μg / ml).

The PRO237 and PRO731 polypeptides were positive in this assay.

Example 129: Stimulating Activity in Mixed Lymphocyte Response (MLR) Assay (Analysis 24)

This example shows that certain polypeptides of the invention are active as stimulators of stimulated T-lymphocyte proliferation. Compounds that stimulate lymphocyte proliferation are therapeutically useful when enhancing the immune response is beneficial. The therapeutic agent may be an antagonist form of a polypeptide of the invention, eg, a murine-human chimeric antibody, humanized antibody or human antibody against said polypeptide.

Basic protocols for this analysis are described in Current Portocols in Immunology , unit 3.12; edited by JE Coligan, AM Kruisbeek, DH Marglies, EM Shevach, W. Strober, National Institutes of Health, Published by John Wiley & Sons, Inc. It is described in.

More specifically, in one assay variant, peripheral blood mononuclear cells (PBMCs), for example, leukopheresis (one donor will supply stimulating cell PBMCs) in an individual mammal, such as a human volunteer, and the other donor responds. Cell PBMCs). If necessary, these cells are frozen in fetal bovine serum and DMSO after isolation. Frozen cells were thawed overnight in assay medium (37 ° C., 5% CO ₂ ), then washed and washed with assay medium (RPMI; 10% fetal bovine serum, 1% penicillin / streptomycin, 1% glutamine, 1% HEPES, 1 % Non-essential amino acids, 1% pyruvate) cells can be resuspended at 3 × 10 ⁶ cells / ml. The cells were irradiated (˜3000 Rads) to prepare stimulator cells PBMCs.

This analysis

100: 1 test sample diluted to 1% or 0.1%,

Irradiated stimulant cells 50: 1 and

Responsive cell PBMC 50: 1

Was prepared by plating three times in a well. 100 μl of cell culture medium or 100 μl of CD4-IgG was used as a control. These wells were then incubated at 37 ° C., 5% CO ₂ for 4 days. On day 5 each well was pulsed with tritiated thymidine (1.0 mC / well; Amersham). After 6 hours, the cells were washed three times, and then the amount of label uptake was measured.

In another variation of this assay, PBMCs were isolated from the spleen of Balb / c mice and C57B6 mice. Remove these cells from freshly harvested spleen and place in assay medium (RPMI; 10% fetal bovine serum, 1% penicillin / streptomycin, 1% glutamine, 1% HEPES, 1% non-essential amino acid, 1% pyruvate), These cells were placed on Lympholyte M (Organon Teknika), centrifuged at 2000 rpm for 20 minutes, the mononuclear cell layers were collected and washed in assay medium, and these cells were placed in assay medium. It was isolated by resuspending at 1 x 10 ⁷ pieces / ml. This assay was then performed as described above.

The results of this assay for the compounds of the present invention are shown below. If the positive increase for the control increased preferably by at least 180%, it is considered positive. However, any value greater than the control indicates a stimulatory effect of the test protein.

In this assay, the PRO273, PRO526, PRO381, PRO719, PRO866 and PRO1031 polypeptides were tested as positive.

Example 130: Inhibitory Activity Assay in Mixed Lymphocyte Response (MLR) Assay (Analysis 67)

This example shows that one or more polypeptides of the invention are active as inhibitors of proliferation of stimulated T-lymphocytes. Compounds that inhibit the proliferation of lymphocytes are useful therapeutically when inhibition of the immune response is advantageous.

The basic protocol for this analysis is described in Current Protocols in Immunology, unit 3.12; edited by JE Coligan, AM Kruisbeek, DH Marglies, EM Shevach, W Strober, National Insitutes of Health, Published by John Wiley & Sons, Inc. It is.

More specifically, in one modified assay, peripheral blood mononuclear cells (PBMCs) are isolated via leukopheresis from a mammalian subject, such as a human volunteer (one donor will supply stimulating cell PBMCs and the other donor Will supply reactive cell PBMC). If necessary, these cells are isolated and frozen in fetal bovine serum and DMSO. Frozen cells are thawed overnight in assay medium (37 ° C., 5% CO ₂ ) and washed and assay medium (RPMI; 10% fetal bovine serum, 1% penicillin / streptomycin, 1% glutamine, 1% HEPES, 1% non-essential) Amino acid, 1% pyruvate), at a concentration of 3 × 10 ⁶ cells / ml. The cells were irradiated (about 3000 Rads) to prepare stimulating cells PBMCs.

This analysis

100: 1 test sample diluted to 1% or 0.1%,

Irritant cells irradiated 50: 1 and

Responsive cell PBMC 50: 1

Was prepared by plating three times in a well.

As a control, 100 μl of cell culture medium or 100 μl of CD4-IgG is used. The wells are then incubated at 37 ° C., 5% CO ₂ for 4 days. On day 5 each well is pulsed with tritiated thymidine (1.0 mC / well, Amersham). After 6 hours the cells are washed three times and the amount of uptake of this label is measured.

In another variation of this assay, PBMCs are isolated from the spleen of Balb / c mice and C57B6 mice. Remove these cells from freshly harvested spleen and place in assay medium (RPMI; 10% fetal bovine serum, 1% penicillin / streptomycin, 1% glutamine, 1% HEPES, 1% non-essential amino acids, 1% pyruvate), PBMCs are placed on Lympholyte M (Organon Teknika) and centrifuged at 2000 rpm for 20 minutes, collected and the mononuclear cell layers are washed in assay medium and these cells are recreated in assay medium at a concentration of 1 x 10 ⁷ cells / ml. Isolate by turbidity. This analysis is then performed as described above.

A reduction below the control is considered a positive result for the inhibitory compound, with a reduction of 80% or less being preferred. Any value below the control, however, indicates an inhibitory effect of the test protein.

In this assay, PRO273, PRO526, PRO381, PRO701, PRO363, PRO531, PRO1083, PRO865, PRO788 and PRO1114 were tested positive.

Example 131: Fibroblast (BHK-21) Proliferation (assay 98)

This analysis indicates that certain polypeptides of the invention act as useful growth factors in the mammalian system because they act to induce the proliferation of mammalian fibroblasts in culture. The analysis is performed as follows. BHK-21 fibroblasts were plated in a standard growth medium with a total volume of 100 μl at 2500 cells per well. The total volume was then made 200 μl by adding PRO polypeptide or β-FGF (positive control) or none (negative control) to the wells in the presence of 1 μl / ml of heparin. Cells were then incubated at 37 ° C. for 6-7 days. After incubation, the medium was removed and the cells washed with PBS, followed by addition of the acid phosphatase substrate reaction mixture (100 μl per well). Next, cells were incubated at 37 ° C. for 2 hours. The acid phosphatase reaction was then stopped by adding 10 μl of 1 N NaOH per well. The plate was then read at OD 405 nm. Positive in this assay are those in which the acid phosphatase activity is at least 50% higher than the negative control.

In this assay, the PRO273 and PRO731 polypeptides were tested positive.

Example 132: Induction of endothelial cell apoptosis (ELISA) (assay 109)

The ability of the PRO polypeptide to induce apoptosis in endothelial cells was evaluated using human umbilical vein cells (HUVEC) using 96-well format in 1% serum medium supplemented with 100 ng / ml VEGF, 0.1% BSA, 1X penicillin / streptomycin. , Cell system). Positive results in this assay indicate that the polypeptide can be used to treat any of a variety of symptoms associated with undesirable endothelial cell growth, including, for example, tumor growth inhibition. The 96-well plates used were made in Falcon (No. 3072). 96 well plates were coated by gelatin for more than 30 minutes with 100 μl of 0.2% gelatin in PBS solution. After thoroughly inhaling the gelatin mixture, HUVEC cells were plated at a final concentration of 2 × 10 ⁴ cells / ml in a volume of 10% serum containing medium (100 μl per well). After growing the cells for 24 hours, a test sample containing the PRO polypeptide of interest was added.

To all wells, 100 μl of 0% serum medium (cell system) supplemented with 100 ng / ml VEGF, 0.1% BSA, 1 × penicillin / streptomycin was added. Test samples containing PRO polypeptide were added in three dilutions of 1%, 0.33% and 0.11%. Cell-free wells were used as blanks and cell-only wells were used as negative controls. As a positive control, 50 μl of 1 × 3 dilution of 3 × stock solution of staurosporin was used. Cells were incubated for 24 to 35 hours prior to ELISA.

ELISA was used to measure the degree of apoptosis by preparing a solution according to the Boehringer Manual [Boehringer Manual, cell death detection ELISA + Catalog No. 1 920 685]. Sample Preparation: The 96 well plate was spun at 1 krpm for 10 minutes, the supernatant was quickly inverted and removed, and the balance was removed by placing the plate upside down on paper towels. To each well, 200 μl of 1 × Lysis Buffer was added and incubated for 30 minutes at room temperature without shaking. The plate was spun at 1 krpm for 10 minutes and 20 μl of lysate (cytoplasmic fraction) was transferred to MTP coated with streptavidin. 80 μl of the immunoreagent mixture was added to 20 μl of lysate in each well. MTP was covered with sticky foil and placed on an orbital shaker (200 rpm) to incubate for 2 hours at room temperature. After 2 hours, the supernatant was removed by inhalation and the wells were rinsed three times with 250 μl 1 × incubation buffer per well (removed by inhalation). 100 μl of substrate solution was added to each well and incubated on a 250 rpm orbital shaker until fully developed in photometric analysis at room temperature. Plates were read at 405 nm, reference wavelength, 492 nm using a 96 well reader. The value obtained for PIN 32 (control) was set to 100%. Samples with values> 130% were considered positive for induction of apoptosis.

In this assay, the PRO846 polypeptide was tested as positive.

Example 133: Induction of endothelial cell apoptosis (assay 73)

The ability of PRO polypeptides to induce apoptosis in endothelial cells was tested in human umbilical vein cells (HUVEC, cell system). Positive results in this assay indicate that the polypeptide can be used to treat vascular diseases where it is beneficial to induce apoptosis as well as tumors.

100 wells of cells in 10% serum (CSG-medium, cell system) in 96 well microtiter plates (Amersham Life Science, Cytostar-T scintillation) at a density of 2 × 10 ⁴ cells per well at 100 μl total volume Microplates, RPNQ160, sterile, tissue-cultured, individually enclosed). On the second day, test samples containing PRO polypeptide were added in three dilutions of 1%, 0.33% and 0.11%. Cell-free wells were used as blanks and cell-only wells were used as negative controls. As a positive control, 50 μl of 1 × 3 dilution of 3 × stock solution of staurosporin was used. The ability of PRO polypeptides to induce apoptosis was determined by detecting apoptosis by processing 96 well plates for the detection of Annexin V, a member of calcium and phospholipid binding proteins.

0.2 ml of Annexin V-Biotin stock solution (100 μg / ml) was diluted in 4.6 ml of 2 × Ca ²⁺ binding buffer and 2.5% BSA (1:25 dilution). 50 μl of diluted Annexin V-Biotin solution was added to each well (excluding the control) to a final concentration of 1.0 μg / ml. Samples with Annexin-Biotin were incubated for 10-15 minutes before ³⁵ S-streptavidin was added directly. ³⁵ S-streptavidin was diluted with 2 × Ca ²⁺ binding buffer, 2.5% BSA and added to all wells to a final concentration of 3 × 10 ⁴ cpm / well. The plate was then sealed, centrifuged at 1000 rpm for 15 minutes and placed on an orbital shaker for 2 hours. Analysis on 1450 Microbeta Trilux (Wallac). Excess percentages for background represent a percentage of the number per minute greater than the negative control. A percentage of 30% or more above the background is considered positive.

In this assay, the PRO719 polypeptide was tested as positive.

Example 134: Analysis of Calcium Flow in Human Venous Endothelial Cells (Analysis 68)

This assay was designed to determine if the PRO polypeptides of the present invention exhibited the ability to stimulate calcium flow in human umbilical vein endothelial cells (HUVEC, cell system). Calcium influx is a well proven response to the binding of certain ligands to their receptors. It can be said that the test compound that results in a positive reaction in this calcium influx assay binds to specific receptors and activates biological signaling pathways in human endothelial cells. This can ultimately lead to, for example, endothelial cell division, inhibition of endothelial cell proliferation, endothelial tube formation, cell migration, apoptosis, and the like.

Human umbilical vein endothelial cells (HUVEC, cell system) in growth medium (50:50, glycine free, 1% glutamine, 10 mM HEPES, 10% ng / ml bFGF) at a cell density of 2 × 10 ⁴ cells / well Plated on 96-well microtiter Viewplate-96 (ViewPlates-96, Packard Instrument Company Part No. 6005182) microtiter plates. The day after plating, cells were washed three times with buffer (HBSS + 10 mM Hepes) to leave 100 μl / well. Next, 100 μl / well of 8 μM Fluor-3 was added twice. Cells were incubated at 37 ° C./5% CO ₂ for 1.5 hours. After incubation, cells were washed three times with buffer (described above), leaving 100 μl / well. Test samples of PRO polypeptides were prepared on other 96-well plates at 5-fold concentration in buffer. Positive controls corresponded to 50 μM ionomycin (5 ×) and negative controls corresponded to protein 32. Cell plates and sample plates were operated in FLIPR (Molecualr Devices) apparatus. 25 μl of the test sample was added to the cells in the FLIPR apparatus and read every second for 1 minute and then every 3 seconds for the next 3 minutes.

The fluorescence change amount (Δchange amount) from the baseline to the maximum rise value in the curve was calculated to average the repeated experimental results. Fluorescence increase rate was monitored and only samples with Δchange greater than 1000 and elevated within 60 seconds were considered positive.

The PRO771 polypeptide was tested positive in this assay.

Example 135: Induction of c-fos in endothelial cells (assay 34)

This assay was designed to determine whether PRO polypeptide exhibits the ability to induce c-fos in endothelial cells. PRO polypeptides tested to be positive in this assay are expected to be useful for the treatment of symptoms or diseases in which angiogenesis is beneficial (eg, wound treatment, etc.). Antagonists of PRO polypeptides tested positive in this assay are expected to be useful in the treatment of cancer tumors.

Human umbilical vein endothelial in growth medium (50% Ham F12 w / o GHT: low concentration glucose, and glycine free 50% DMEM: NaHCO ₃ , 1% glutamine, 10 mM HEPES, 10% FBS, 10 ng / ml bFGF) Cells (HUVEC, cell system) were plated on 96-well microtiter plates at a cell density of 1 × 10 ⁴ cells / well. The day after plating, growth medium was removed and cells were treated with 100 μl / well of test sample and control (positive control = growth medium, negative control = protein 32 buffer = 10 mM HEPES, 140 mM NaCl, 4% (w / v)). Asathan was treated with mannitol, pH 6.8). Cells were incubated for 30 minutes at 37 ° C. in 5% CO ₂ . Samples were removed and the first part of the bDNA kit protocol (Kyron Diagnosis, Cat. No. 6005-037) was performed (each reagent / buffer indicated in capital letters below is available from this kit).

In summary, the amount of TM Lysis Buffer and Probe required for the test was calculated according to the information provided by the manufacturer. Appropriate amount of thawed probe (Probe) was added to TM Lysis Buffer. Capture Hybridization Buffer was warmed to room temperature. The bDNA strip was fixed in a metal strip holder and 100 μl of Capture Hybridization Buffer was added to each required b-DNA well and incubated for at least 30 minutes. The test plate with cells was removed from the incubator and the medium was slowly removed using a vacuum branch. 100 μl of Lysis Hybridization Buffer with Probe was quickly pipetted into each well of the microtiter plate. The plate was then incubated at 55 ° C. for 15 minutes. After removal from the incubator, the plate was placed in a vortex mixer equipped with a microtiter adapter and vortexed by setting it twice for 1 minute. 80 μl of lysate was removed and added to the bDNA wells containing Capture Hybridization Buffer and mixed by pipetting up and down. Plates were incubated at 53 ° C. for at least 16 hours.

The next day, part 2 of the bDNA kit protocol was performed. Specifically, the plate was removed from the incubator and left on the bench for 10 minutes to cool. The required volume addition amount was calculated according to the information provided by the manufacturer. Amplifier Working Solution was prepared by preparing a 1: 100 dilution of Amplifier Concentrate (20 fm / μl) in AL Hybridization Buffer. The hybridization mixture was removed from the plate and washed twice with Wash A. 50 μl of Amplifier Working Solution was added to each well and the wells were incubated at 53 ° C. for 30 minutes. The plate was then removed from the incubator and cooled for 10 minutes. Label Probe Working Solution was prepared by preparing a 1: 100 dilution of Label Concentrate (40 pmole / μl) in AL Hybridization Buffer. After cooling for 10 minutes, the amplification hybridization mixture was removed and the plate washed twice with Wash A. 50 μl of Label Probe Working Solution was added to each well and the wells were incubated at 53 ° C. for 15 minutes. After cooling for 10 minutes, the substrate was allowed to warm to room temperature. After addition of 3 μl Substrate Enhancer per ml of Substrate Required for Assay, the plate is cooled for 10 minutes, the label hybridization mixture is removed, and the plate is washed twice with Wash A. And three washes with Wash D. 50 μl Substrate Solution with Enhancer was added to each well. Plates were incubated at 37 ° C. for 30 minutes and RLUs were read with an appropriate light meter.

The repeated experimental results were averaged and the coefficient of variation was measured. Measured folds of increased activity relative to negative control (protein 32 / HEPES buffer described above) values are expressed as chemiluminescent units (RLU). The results were considered positive if the PRO polypeptide showed at least two times that of the negative buffer control. Negative control = 1.00 RLU at 1.00% dilution. Positive control = 8.39 RLU at 1.00% dilution.

In this assay, the PRO474 polypeptide was tested as positive.

Example 136: Induction of differentiation of pancreatic β-progenitor cells (analysis 89)

This analysis indicates that certain polypeptides of the present invention are useful for the treatment of various insulin deficiency symptoms, including diabetes mellitus, in mammals because they act to induce differentiation of pancreatic β-cells into progenitor pancreatic β-cells. . The analysis is performed as follows. The analysis utilizes primary cultures of pancreatic cells in mouse fetuses and the primary readings show that the expression of markers representing β-progenitor cells or mature β-cells is altered. Expression of the marker is measured by real time quantitative PCR (RTQ-PCR), where the marker measured is insulin.

The pancreas was excised from E14 embryos (CD1 mice). The pancreas was then digested by treatment with collagenase / dispase in F12 / DMEM for 40-60 minutes at 37 ° C. (collagenase / dispase, 1.37 mg / ml, Boehringer Mannheim (# 1097113). Volume 5% BSA was used to neutralize digests and cells washed once with RPMI1640. On day 1, cells were pre-coated with 12-well tissue culture plates (20 μg / ml laminin in PBS, Boehringer Mannheim, # Seed from the pancreas of 1 to 2 embryos was distributed per well The culture medium for this primary culture was 14 F / 1640. On day 2, the medium was removed and attached using RPMI / 1640. In addition to the protein to be tested, at least 2 ml of medium was added, on day 4, the medium was removed and RNA was prepared from the cells to analyze the expression of the markers by real-time quantitative RT-PCR. This untreated stand Case of increasing the expression of a cell marker associated β- than the sphere, the protein was considered to be active.

14F / 1640 added the following component to RPMI1640 (Gibco).

Group A 1: 1000

Group B 1: 1000

10 μg / ml recombinant human insulin

Aprotinin (50 μg / ml) 1: 2000 (Boehringer Mannheim # 981532)

60 ㎍ / ml bovine pituitary extract (BPE)

Gentamicin 100 ng / ml

Group A: (in 10 ml PBS)

Transferrin, 100 mg (Sigma T2252)

Epidermal growth factor, 100 μg (BRL 100004)

10 μl of 5 × ^10-6 M triiodothyronine (Sigma T5516)

100 μl 10 ⁻¹ M ethanolamine (Sigma E0135)

100 μl 10 ⁻¹ M phosphoethanolamine (Sigma P0503)

4 μl of 10 ^-1 M selenium (Aesar # 12574)

Group C: (in 10 ml of 100% ethanol)

2 μl of 5 × 10 ⁻³ M hydrocortisone (Sigma # H0135)

100 μl of 1 × ^10-3 M progesterone (Sigma # P6149)

20 500 μl of mM forskolin (calbiochem # 344270)

Minimal medium: RPMI 1640, and transferrin (10 μg / ml), insulin (1 μg / ml), gentamycin (100 ng / ml), aprotinin (50 μg / ml) and BPE (15 μg / ml).

Restriction medium: RPMI 1640, and transferrin (10 μg / ml), insulin (1 μg / ml), gentamycin (100 ng / ml) and aprotinin (50 μg / ml).

The PRO788 and PRO162 polypeptides were positive in this assay.

Example 137: Stimulation of Endothelial Cell Proliferation (Analysis 8)

This assay was designed to determine whether the PRO polypeptides of the present invention exhibited the ability to stimulate capillary endothelial cell (ACE) growth in the adrenal cortex. PRO polypeptides tested to be positive in this assay are expected to be useful for the treatment of symptoms or diseases in which angiogenesis is beneficial (eg, wound treatment, etc.). Antagonists of PRO polypeptides tested positive in this assay are expected to be useful in the treatment of cancer tumors.

Bovine adrenal cortical capillary endothelial (ACE) cells (obtained from initial culture, 12-14 passages) were plated in 96-well plates at 500 cells / well per 100 microliters. Assay medium contained low glucose DMEM, 10% calf serum, 2 mM glutamine and 1 × penicillin / streptomycin / fungizone. Control wells were (1) no ACE cells added, (2) only ACE cells, (3) ACE cells + 5 ng / ml VEGF, and (4) ACE cells + 5 ng / ml FGF. A control or test sample (100 microliters volume) was then added to the wells (added in dilutions of 1%, 0.1% and 0.01%, respectively). Cell cultures were incubated at 37 ° C./5% CO ₂ for 6-7 days. After incubation the medium of the wells was aspirated off and the cells were washed with 1 x PBS. An acid phosphatase reaction mixture (100 μl, 0.1 M sodium acetate, pH 5.5, 0.1% Triton X-100, 10 mM p-nitrophenyl phosphate) was added to each well. After incubation at 37 ° C. for 2 hours, the reaction was stopped by the addition of 10 μl of 1N NaOH. The absorbance (OD) at 405 nm was measured with a microplate reader.

The activity of the PRO polypeptide was calculated as (1) increased fold of proliferation against the background value of the cells alone and (2) the rate of increase of proliferation for maximal stimulation by VEGF (proliferation was measured by OD by measuring acid phosphatase activity at 405 nm Determined). VEGF (3-10 ng / ml) and TGF (1-5 ng / ml) were used as the activity reference for maximum stimulation rate. If the stimulation rate observed in the results of this analysis is a 50% increase or more relative to the background value, it was considered "positive". The 1% diluted VEGF (5 ng / ml) control showed 1.24 fold stimulation and FGF (5 ng / ml) showed 1.46 fold stimulation.

In this assay, the PRO1075 polypeptide was tested positive.

Example 138: Glomerular Stromal Cell Inhibition Assay in Mice (Analysis 114)

This assay was designed to determine whether the PRO polypeptides of the present invention exhibited the ability to inhibit the proliferation of glomerular stromal cells in mice in culture. PRO polypeptides tested as positive in this assay may be used to treat a disease or condition in which inhibition of glomerular stromal cell proliferation is beneficial, such as cystic nephropathy, polycystic kidney disease, or abnormal glomerular stromal cell proliferation, other kidney disease associated with renal tumors, and the like. It is expected to be useful.

On day 1, mouse glomerular stromal cells were plated on 96 well plates in growth medium (Dulbecco's Modified Eagle Medium and Ham F12 medium, 95% supplemented with fetal bovine serum, 5% with 14 mM HEPES) and then overnight Grown. On the second day, the PRO polypeptide was diluted to two different concentrations (1%, 0.1%) in serum free medium and added to the cells. Negative control was growth medium without adding PRO polypeptide. After incubating the cells for 48 hours, 20 μl of Cell Titer 96 Aqueous One-Component Solution Reagent (Promega) was added to each well and the color reaction was allowed to proceed for 2 hours. Then, absorbance (OD) was measured at 490 nm. Positive in these assays are those that exhibit absorbance values that are at least 10% higher than negative control readings.

In this assay, the PRO200 and PRO697 polypeptides were tested to be positive.

Example 139: Chondrocyte Proliferation Assay (Analysis 111)

This assay was designed to determine whether the PRO polypeptides of the present invention exhibited the ability to induce proliferation and / or regeneration of chondrocytes in culture. PRO polypeptides tested positive in this assay are expected to be useful for the treatment of various bone diseases and / or cartilage diseases such as sports injury and arthritis.

Porcine chondrocytes were isolated by digesting the articular cartilage of the metacarpal joints of sows 4-6 months of age with collagenase overnight. Isolated cells were then seeded at 25,000 cells / cm ² in Ham F-12 containing 10 μg FBS and 4 μg / ml of gentamycin. Culture medium was changed every 3 days and cells were reseeded at 25,000 cells / cm 2 every 5 days. On day 12, cells were seeded into 96 well plates at 5,000 cells / well in 100 μl of the same medium without serum, and serum-free medium (negative control), staurosporin (final concentration 5 nM, positive control) or test PRO polypeptide 100 μl of either was added to a final volume of 200 μl / well. After 5 days at 37 ° C., 20 μl of Alamar blue was added to each well and the plate was incubated for another 3 hours at 37 ° C. The fluorescence value of the plate containing 200 µl of serum-free medium was measured to determine the background value. This assay produces a positive result when the fluorescence value of the sample treated with the PRO polypeptide is close to that of the positive control compared to the negative control.

In this assay, the PRO181, PRO200, and PRO322 polypeptides were tested to be positive.

Example 140 Rat DRG Neuronal Survival Inhibition Assay

This assay was designed to determine whether the PRO polypeptides of the present invention exhibited the ability to inhibit neuronal survival in culture. Polypeptides tested positive in this assay are expected to be useful for the treatment of neuropathy symptoms associated with undesirable neuronal cell proliferation, including, for example, neuroblastoma, glioma, glioblastoma, and the like.

A heterogeneous group of neurons newly isolated from the dorsal root of E14 rat embryos were diluted in complete medium and plated at 5,000 cells / well on a plate pretreated with polyurethane containing 50 μl of F12 complete medium. Test PRO polypeptide (50 μl, one concentration) with 50 μl of additional assay medium was added to test for survival inhibition activity. Negative controls were treated with only 100 μl of complete medium. After 3 days of incubation, cells were stained with CMFDA and fixed 1% after 4% paraformaldehyde. Cells were then quantified via NIH image analysis. In this assay, cell numbers in treated well (s) were positive if less than 0.5 compared to untreated control well (s).

In this assay, the PRO195 and PRO701 polypeptides were tested positive.

Example 141 Tissue Expression Distribution

Oligonucleotide probes were constructed from portions of nucleic acid sequences encoding PRO polypeptides as shown in the accompanying figures for use in quantitative PCR amplification reactions. Oligonucleotide probes were chosen to amplify fragments of approximately 200 to 600 base pairs from the 3 'end of the relevant template in a standard PCR reaction. These oligonucleotide probes are used for standard quantitative PCR amplification reactions with cDNA libraries isolated from sources of various human adult and / or fetal tissues, encoding PRO polypeptides in various tissues analyzed and tested by agarose gel electrophoresis. The expression level of the nucleic acid was measured quantitatively. Expression patterns or differences in expression of nucleic acids encoding PRO polypeptides in a variety of different human tissue types can be used to determine tissue types, such as with or without other tissue specific markers, in determining primary tissue members of metastatic tumors, and the like. Diagnostic markers may be provided. The results of this analysis are shown below.

DNA molecule Tissue where significant expression occurs Tissue without significant expression DNA40954-1233 Liver, lungs brain DNA41404-1352 Lung, kidney Liver, retina, pancreas DNA44179-1362 liver Lungs, brain DNA45234-1277 kidney Liver, placenta, brain DNA45415-1318 Thyroid gland, brain and kidneys Liver, bone marrow DNA45417-1432 Thyroid, brain, kidneys, bone marrow liver DNA45493-1349 Liver, kidney brain DNA48306-1291 Brain kidney Pancreas, liver DNA48328-1355 Thyroid, brain, liver and kidneys marrow DNA48329-1290 Brain, bone marrow, kidney Liver thyroid gland DNA49624-1279 placenta Liver, lungs, kidneys, brain DNA50911-1288 brain placenta DNA50914-1289 Brain, kidney, liver placenta DNA53906-1368 Lung, kidney brain DNA53912-1457 Lung, liver, kidney, pancreas brain DNA53977-1371 Lung, liver, kidney, bone marrow Brain pancreas DNA54002-1367 Bone marrow, liver, kidney Lungs, thyroid gland, brain DNA55737-1345 Bone marrow, kidney Liver brain DNA57039-1402 Pigmented epithelium Lung, brain, liver, kidney DNA57253-1382 Lung, brain, liver, kidney placenta DNA58747-1384 Lung, brain, kidney, liver Pancreas, thyroid gland DNA23318-1211 Spleen, Brain, Heart, Colon Tumor, Prostate cartilage DNA39975-1210 Brain, colon tumor, heart THP-1 macrophages DNA39979-1213 Branch cells, cartilage, heart Spleen, black matter, uterus, prostate DNA41386-1316 HUVEC, cartilage, branch cell Melanoma, colon tumor, uterus DNA50919-1361 HUVEC, brain, spleen, colon tumor Prostate, cartilage, heart, uterus DNA52185-1370 Cell Black matter, hippocampus, uterus DNA42663-1154 Uterus, Spleen, Bone Marrow Cartilage, HUVEC, colon tumor DNA50980-1286 Placenta, adrenal gland, prostate Bone marrow, uterus, cartilage

Example 142 Hybridization in situ

In situ hybridization is a powerful and versatile technique for the detection and localization of nucleic acid sequences in cell and tissue samples. For example, it may be useful for identifying gene expression sites, analyzing tissue distribution of transcription, identifying and locating viral infections, tracking changes in specific mRNA synthesis, and chromosome mapping.

In situ hybridization was performed using ³³ P-labeled riboprobes generated by PCR with an optimal version of the protocol according to Lu and Gillett, Cell Vision 1: 169-176 (1994). Briefly, human tissues immobilized with formalin and cleaved in paraffin are cleaved, paraffin removed, and proteins removed with proteinase K (20 g / ml) at 37 ° C. for 15 minutes, as described in Lu and Gillett, Further treatment was carried out for hybridization in situ as described above. [ ^33- P] UTP-labeled antisense riboprobe generated as a PCR product was hybridized overnight at 55 ° C. The slides were immersed in Kodak NTB2 ™ nuclear track emulsion and exposed for 4 weeks.

³³ P-riboprobe synthesis

6.0 μl (125 mCi) of ³³ P-UTP (Amersham BF 1002, SA <2000 Ci / mmol) was dried at high speed vac. The following ingredients were added to each tube of dried ³³ P-UTP:

2.0 μl 5x transcription buffer

1.0 μl DTT (100 mM)

2.0 μl NTP mixture (2.5 mM: 10 μl + 10 μl H ₂ O, respectively, 10 mM GTP, CTP and ATP)

1.0 μl UTP (50 μM)

1.0 μl RNasin

1.0 μl DNA template (l μg)

1.0 μl H ₂ 0

1.0 μl RNA polymerase (PCR products typically T3 = AS, T7 = S)

The tube was incubated at 37 ° C. for 1 hour. 1.0 μl of RQ1 DNase was added and then incubated at 37 ° C. for 15 minutes. 90 μl of TE (10 mM Tris, pH 7.6) / 1 mM EDTA, pH 8.0) was added and the mixture was pipetted into DE81 paper. The remaining solution was loaded into a Microcon-50 ultrafiltration unit and spun for 6 minutes with program 10. The filtration unit was transferred to the second tube and spun with program 2 for 3 minutes. After the last recovery spin, a total of 100 μl of TE was added, then 1 μl of the final product was pipetted onto DE81 paper and counted with 6 ml Bioflour II (tradename).

Probes were electrophoresed on TBE / urea gel. To 3 μl of loading buffer a total of 1-3 μl of probe or 5 μl of RNA Mrk III was added. After heating for 3 minutes in a 95 ° C. heat block, the gel was immediately transferred to ice. After washing the wells of the gel, the samples were loaded and electrophoresed for 45 minutes at 180-250 volts. The gel was wrapped in a saran wrap and exposed to XAR film on an enhancement screen for 1 hour to overnight in a freezer at -70 ° C.

³³ P-hybridization

A. Pretreatment of Frozen Sections

The slides were removed from the freezer and placed in an aluminum tray and melted for 5 minutes at room temperature. To reduce condensation, the trays were placed in a 55 ° C. incubator for 5 minutes. The slides were fixed in a fume hood for 10 minutes in ice sheet 4% paraformaldehyde and at room temperature 0.5 × SSC (25 ml 20x SSC + 975 ml SQ H ₂ O) for 5 minutes. Protein was removed for 10 minutes at 37 ° C. with 0.5 μg / ml proteinase K (12.5 μl of 10 mg / ml stock solution in 250 ml of RNase preheated RNase buffer) followed by 0.5 × SSC for 10 minutes at room temperature. Sections were washed. Sections were dehydrated for 2 minutes with 70%, 95% and 100% ethanol, respectively.

B. Pretreatment of sections buried in paraffin

Paraffins on the slides were removed, placed in SQ H ₂ O and rinsed with ₂ × SSC for 5 min each at room temperature. 20 μl / ml proteinase K (10 mg / ml in 250 ml RNase buffer without RNase, 500 μl, 37 ° C., 15 min) (human embryos), or 8 × proteinase K (250 ml RNase buffer) 100 μl, 37 ° C., 30 min) (formalin tissue) to remove the proteins of the sections. Then rinsed with 0.5 × SSC and dehydrated as described above.

C. Prehybridization

The slides were placed in a plastic box with filter paper saturated with Box buffer (4 × SSC, 50% formamide). Tissues were covered with 50 μl of hybridization buffer (3.75 g of dextran sulfate + 6 ml of SQ H ₂ O) and vortexed, then heated in microwave for 2 minutes with the lid loosened. After ice cooling, 18.75 ml of formamide, 3.75 ml of 20 × SSC and 9 ml of SQ H ₂ O were added and the tissue well vortexed and then incubated at 42 ° C. for 1 to 4 hours.

D. Hybridization

1.0 x 10 ⁶ cpm probe and 1.0 μl of tRNA (50 mg / ml stock) were added per slide and heated at 95 ° C. for 3 minutes. After ice cooling, 48 μl of hybridization buffer was added per slide. After vortexing, 50 μl of ³³ P mixture was added to 50 μl of prehybridization sample on the slide. This slide was incubated at 55 ° C. overnight.

E. Wash

After washing 2x SSC, EDTA twice for 10 minutes at room temperature (400 ml 20x SSC + 16 ml 0.25 M EDTA, final volume = 4 L), RNase A was treated for 30 minutes at 37 ° C (RNase buffer 250 10 mg / ml in ml, 500 μl = 20 μg / ml). Slides were washed twice with 2 × SSC, EDTA for 10 minutes at room temperature. Stringent washing conditions are as follows: 2 hours at 55 ° C. with 0.1 × SSC and EDTA (20 ml 20 × SSC + 16 ml EDTA, final volume = 4 L).

F. Oligonucleotides

In situ analysis was performed on the various DNA sequences disclosed herein. Oligonucleotides used in the analysis were derived from the nucleotide sequences disclosed herein and are generally in the range of about 40 to 55 nucleotides in length.

G. Results

In situ analysis was performed on the various DNA sequences disclosed herein. The results of this analysis are as follows.

(1) DNA29101-1122 (PRO200)

Fetus : In the case of lower extremity, it was expressed in the developing lower extremity bone of the cartilage primordial (ie, around the lateral margin), in the developing tendon, in vascular smooth muscle, and in the developing skeletal muscle myocytes and cells around the root canal. Expression was also observed in epiphyseal growth plates. In the case of lymph nodes, they were expressed in developing lymph nodes. In the case of the thymus, it was expressed in the subcapsular region of the thymus cortex, which may refer to subcapsular epithelial cells or proliferating double negative thymus cells found in this region. The spleen was negative. In the case of the airways it was expressed in smooth muscle. In the case of the brain (cerebral cortex) focal, they were expressed in cortical neurons. The spinal cord was negative. The small intestine was expressed in smooth muscle. Thyroid gland was commonly expressed in thyroid epithelium. The adrenal glands were negative. In the case of liver it was expressed in tubular plate cells. In the above cases, it was expressed in smooth muscle. Fetal skin was expressed in the basal layer of the squamous epithelium. The placenta was expressed in stromal cells of the trophoblast. Ligaments were expressed in the walls of arteries and veins.

Opinion : Expression patterns suggest that PRO200 may be associated with differentiation / proliferation of cells.

High expression was observed at the following additional sites: chimpanzee ovary-granulocytes of mature follicles, found with low intensity signals in follicular membrane cells. Parathyroid gland-high expression in chimpanzees. Testicles in the human fetus-moderate expression in the interstitial cells around the developing lavage. High expression in the lung-developing bronchial chondrocytes of the human fetus and low levels in branching bronchial epithelium. No specific expression was observed for renal cell carcinoma, gastric carcinoma and colon carcinoma. The tissues of the fetus tested (E12-E16 weeks) include: placenta, umbilical cord, liver, kidney, adrenal gland, thyroid gland, lung, heart, large blood vessel, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, Eyes, spinal cord, body wall, pelvis and lower extremities. Tissues of tested adults: liver, kidneys, adrenal glands, myocardium, aorta, spleen, lymph nodes, pancreas, lungs, skin, cerebral cortex (rm), hippocampus (rm), cerebellum (rm), penis, eyes, bladder, stomach, Gastric carcinoma, colon, colon carcinoma and chondrosarcoma. In addition, hepatic damage and cirrhosis tissue induced by acetoaminophen were also investigated.

(2) DNA30867-1335 (PRO218)

It was expressed at low levels in various epithelia, including the small intestine of the fetus, the thyroid of the fetus, and the gastric epithelium of chimpanzees. Expression was also observed in malignant cells of renal cell carcinoma. Expressed in the fetal brain cortex. This distribution does not suggest a clear function. Tissues of the tested human fetus (week E12-E16) include: placenta, umbilical cord, liver, kidney, adrenal gland, thyroid gland, lung, heart, large vessel, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain , Eyes, spinal cord, body wall, pelvis and lower extremities. Tissues of tested human adults: kidneys (normal and terminal), bladder, adrenal glands, spleen, lymph nodes, pancreas, lungs, skin, eyes (including retina), colon, bladder, liver (normal, cirrhosis, acute liver failure), heart, Clear cell carcinoma of the kidney, gastric adenocarcinoma, colorectal carcinoma. Testing tissues of non-human primates; Chimpanzee tissue: salivary glands, stomach, thyroid gland, parathyroid gland, tongue, thymus, ovary, lymph nodes, peripheral nerves. Rhesus macaque tissue: cerebral cortex, hippocampus, cerebellum and penis.

(3) DNA40021-1154 (PRO285)

Low levels of expression were observed in hematopoietic cells of the mouse fetus and in placenta. No expression was detected in the lymph nodes of the human fetus, adult or chimpanzees, and no expression was detected in the spleen of the human fetus or human adult. Fetal (test E12-E16) tissues tested include: placenta, umbilical cord, liver, kidney, adrenal gland, thyroid gland, lung, heart, large blood vessel, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye , Spinal cord, body wall, pelvis and lower extremities. Tissues of tested adults: liver, kidney, adrenal gland, myocardium, aorta, spleen, lymph node, pancreas, lung, skin, cerebral cortex (rm), hippocampus (rm), cerebellum (rm), cerebral infarction (human), encephalitis ( Human), penis, eyes, bladder, stomach, gastric carcinoma, colon, colon carcinoma, thyroid gland (chimpanzee), parathyroid gland (chimpanzee), ovary (chimpanzee) and chondrosarcoma. In addition, hepatic damage and cirrhosis tissue induced by acetoaminophen were also investigated.

(4) DNA39523-1192 (PRO273)

It was expressed in epithelial cells of mouse embryo skin as well as basal epithelium and dermis of human fetal skin. The basal epithelial lobes of the squamous mucosa in the chimpanzee tongue were also positive. Expression was also observed in a subset of cells in the developing glomeruli of fetal kidneys, tubules in adults, and in the "thyroidized" epithelium of terminal kidney disease, with low levels in renal cell carcinoma, possibly epithelial cells. It was expressed as. It was expressed at low levels in stromal cells of fetal lung. Expression in stromal cells at the tip of the gastric gland was also observed. High expression in the stromal cells of fetal small intestine villi, normal colon mucosa and colon cancer was shown. Strong expression occurred in the benign connective tissue cells in the sarcoma's hylanized epilepsy. Expression also occurred in splenic red pulp and interstitial cells of placental villi. In the brain, expression occurred in cortical neurons. It was also expressed in connective tissue around developing fetal bone and nerve sheath cells. Fetal (test E12-E16) tissues tested include: placenta, umbilical cord, liver, kidney, adrenal gland, thyroid gland, lung, heart, large blood vessel, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye , Spinal cord, body wall, pelvis and lower extremities. Adult tissues tested: liver, kidney, adrenal gland, myocardium, aorta, spleen, lymph node, pancreas, lung, skin, cerebral cortex (rm), hippocampus (rm), eyes, stomach, gastric carcinoma, colon, colon carcinoma, thyroid gland ( Chimpanzees), parathyroid glands (chimpanzees), ovaries (chimpanzees), and cartilage sarcomas. In addition, hepatic damage and cirrhosis tissue induced by acetoaminophen were also investigated.

It was expressed in several cells in the outer layers of monkey cerebral cortex (I and II). In addition, a small subset of cells in the deep cortical layer expressed mRNA for chemokine homologues. Scattered cells in the molecular layer of the hippocampus and adjacent to the inner margin of the dentate gyrus contained homologous mRNA. No expression was detected in the cerebellar cortex. No chemokine homologues were observed in infarcted brains, where cell death occurred in normally expressed regions. This probe can, if possible, serve as a marker for a subset of neurons in the cortical outer layer and, if possible, to reveal neuronal migration disorders. Abnormal neuronal migration may be responsible for some seizure disorders and schizophrenia. To obtain a better assessment of the distribution of these mRNAs, we will test whether the probes cross-hybridize with mouse brain tissue.

In addition, an interesting and specific hybridization pattern was seen in the adult mouse brain within 10 days of age (P). In one sagittal section of the P10 mouse brain, a strong signal was observed dispersed in the inner margin of the dentate gyrus in the molecular layer of the hippocampus. Progenitor cells were appropriately labeled; The signal extended through the outer layer of the posterior root cortex to a strong band to the laryngeal cortex, and the signal in the laryngeal cortex was reduced to the background level. A subset of benign neurons was detected in the deep region of the P10 motor cortex; Neurons in the outer layer of the P10 cortex showed no signal greater than background values. In addition, a medium hybridization signal was detected in the estuary. Chemokine homologue signals in the adult mouse brain were evaluated at three coronal sections with different values. Strong signals were detected in septum and distributed neurons in the glial nucleus and motor muscle of the trigeminal nerve; Moderate signals were seen in the molecular layer of the hippocampus and the outer layer of the posterior cortical posterior cortex.

(5) DNA39979-1213 (PRO296)

It is widely expressed in fetal and adult tissues. Epithelial, skeletal muscle, myocardium, developing (including retina) and adult CNS, thymus of various fetuses and adults were expressed in hepatocytes with toxicity induced by epithelium, placental villi, cirrhosis and acetominophene. It was highly expressed in developing hypertrophic chondrocytes. Although not completely overlapping, the overall expression pattern (not expressed in glomerulitis, but more widely expressed in the CNS) is similar to VEGF. Therefore, possible roles in angiogenesis should be considered. Human fetal (week E12-E16) tissues tested include: placenta, umbilical cord, liver, kidney, adrenal gland, thyroid gland, lung, large blood vessel, stomach, small intestine, spleen, thymus, pancreas, brain, eyes, spinal cord, Body wall, pelvis, testicles and lower extremities. Human adult tissues tested: kidneys (normal and late), adrenal glands, spleen, lymph nodes, pancreas, lungs, eyes (including retina), bladder, liver (normal, cirrhosis, acute liver failure). Tissues of non-human primates tested: Chimpanzee tissue: Adrenal gland. Rhesus monkey tissue: cerebral cortex, hippocampus, cerebellum.

(6) DNA52594-1270 (PRO868)

It was expressed in fetal extermination, spinal cord, developing enteric neurons, and cortical neurons. It is also expressed at low levels in the trophoblast of the placenta. In adult tissues, pronounced expression was observed only in the prostate of normal adults; This may thus indicate that it may be a receptor target antigen on the prostate cell surface. Studies to further characterize expression in adult tissues have been warranted. Low levels of expression have also been observed in liposarcomas. Fetal (test E12-E16) tissues tested include: placenta, umbilical cord, liver, kidney, adrenal gland, thyroid gland, lung, heart, large blood vessel, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye , Spinal cord, body wall, pelvis and lower extremities. Adult tissues tested: liver, kidney, adrenal gland, myocardium, aorta, spleen, lung, skin, chondrosarcoma, eye, stomach, gastric carcinoma, colon, colon carcinoma, renal cell carcinoma, prostate, bladder mucosa and gallbladder. Hepatic injury and cirrhosis tissue induced by acetominophene were also investigated. Rhesus monkey tissue tested: cerebral cortex (rm), hippocampus (rm), cerebellum. Chimpanzee tissue tested: thyroid, parathyroid, ovary, nerve, tongue, thymus, adrenal gland, gastric mucosa and salivary glands. WIG-1 (WISP-1), WIG-2 (WISP-2) and WIG-5 (WISP-3) in human breast carcinoma and normal breast tissue, Wig-2 in lung carcinoma, Wig- in colon carcinoma 5 was expressed.

(7) DNA64907-1163 (PRO1330)

In the tissues of human fetuses, strong specific expression was observed in arteries, veins, capillaries and oriental endothelium in all tissues tested except the fetal brain. Normal tissues showed low or no expression at normal adult tissues, but expression appeared to be limited to pulmonary system. The local maximum expression was observed in blood vessels flowing inside the white matter of the rhesus monkey brain in adult tissues, and the meaning of this pattern is unclear. Elevated expression has been observed in the pulmonary system of various inflammatory and diseased tissues, including the tumor vasculature. In some of the tissues, it is unclear whether expression is limited to vascular endothelium only. In the 15 lung tumors tested, no expression was observed in malignant epithelium, but expression in blood vessels in several tumors and adjacent lung tissue. Moderately obvious nonspecific background values were observed with this probe at the site of helanated collagen and tissue necrosis. However, in the absence of a sense control, it is not absolutely certain that all these signals are nonspecific. Some signals that are considered nonspecific have been observed in the gastric mucosa of chimpanzees and the transitional epithelial cells of human adult bladder and fetal retina.

(8) DNA49624-1279 (PRO545)

Expression of the ADAM family of molecules, ADAM 12 (DNA49624-1279), has been observed in normal human lung, lung tumor, normal colon and colon carcinoma.

(9) DNA59294-1381 (PRO1031)

Expression of this IL17 homologue was evaluated in a panel consisting of tissues of normal adults and fetuses, and tissues with inflammation, mainly chronic lymphocytic inflammation. This panel was designed to specifically assess the pattern of expression of immune proteins in immune mediated inflammatory diseases that modulate (stimulate or inhibit) the function of T lymphocytes. This protein, when expressed as an Ig-fusion protein, exhibits immunostimulatory in a dose-dependent manner in human mixed lymphocyte response (MLR), which is an indicator of stimulation when used at two different concentrations (1.0% and 0.1% of 560 nM stock) There was a 285% and 147% increase over baseline. Summary: Expression was limited to muscle, certain types of adult smooth muscle, and skeletal muscle and smooth muscle of the human fetus. In adults, they were expressed in smooth muscle of tubular organs, including the colon and gallbladder. It was not expressed in vascular or bronchial smooth muscle. Adult skeletal muscle was not examined. In the case of fetal tissues, moderate to high diffuse expression was observed in the skeletal muscles of the hypoaxial axis and the extremities. Weak expression was observed in smooth muscle of the small intestinal wall, but not in myocardium. Tissues of observed adult adults: Colon: Low levels of diffuse expression in smooth muscles (muscle layer) of 5 specimens with chronic inflammatory bowel disease. Gallbladder: Mild to low levels of expression were observed in the smooth muscle of the gallbladder. Tissues of human fetus observed expression: moderate diffuse expression was observed in skeletal muscle and mild to low expression was observed in smooth muscle; It is not expressed in the heart of the fetus or any other organ of the fetus, including liver, spleen, CNS, kidney, intestine, lung. Unexpressed human tissue: lungs with chronic granulomatous inflammation and chronic bronchitis (5 patients), peripheral nerves, prostate, heart, placenta, liver (multiblock disease), brain (cerebral and cerebellum), tonsil (Reactive hyperplasia), peripheral lymph nodes, thymus.

(10) DNA45416-1251 (PRO362)

The expression of these novel proteins in various human and non-human primate tissues was evaluated and found to be very limited. It was expressed only in alveolar macrophages of the lung and Cooper cells of the hepatic oriental blood vessels. Expression in these cells was significantly increased when these distinct cell populations were activated. Although the subgroups of these two tissue macrophages are concentrated in different organs, they have similar biological functions. These two types of phagocytes act as biological filters to remove substances, including pathogens, aging cells and proteins, from the bloodstream or airways, both of which can secrete a wide variety of important pre-inflammatory cytokines. In inflammatory lungs (7 patient samples), they were predominantly expressed in macrophages of various reactive alveoli, defined as large, thin and often vacuole cells present alone or as aggregates in alveolitis, and in normal non-reactive macrophages ( Weakly expressed or negative in single dispersed cells of average size). Expression in alveolar macrophages is increased during inflammation, which increases (activates) both the number and size of these cells. Despite the presence of histiocytes at sites of interstitial inflammation and per bronchial lymphatic hyperplasia of these tissues, expression was limited to alveolar macrophages. Several inflammatory lungs also showed some degree of purulent inflammation and no expression in neutrophil granulocytes. In the liver, strong expression was observed in liver / reactive cooper cells with acute central lobular necrosis (acetominophene toxicity) or well-represented periportal inflammation. However, mild expression or no expression was observed in Cooper cells in the settling liver, or in livers with mild inflammation or mild or moderate lobular hyperplasia / hyperplasia. Thus, in the lung, increased expression was observed in activated / reactive cells. It was not expressed in tissues / macrophages present in the inflammatory bowel, hyperplasia / reactive tonsils or molecules in normal lymph nodes. The lack of expression in these tissues with both histocytic inflammation or residual macrophage groups strongly supports the limited expression in only certain macrophage subset groups defined by alveolar macrophages and liver cells of the liver. Spleen or bone marrow was not useful for evaluation. Evaluated human tissues that were unable to detect expression include: inflammatory bowel disease (seven patients with moderate to severe disease), tonsils with reactive hyperplasia, peripheral lymph nodes, psoriasis skin (light to moderate) 2 patients with the disease), heart, peripheral nerves. Evaluated chimpanzee tissues that were unable to detect expression include: tongue, stomach, thymus.

(11) DNA52196-1348 (PRO733)

Generally low levels of signal have been observed in various tissues and in various cell types. Epithelial cell expression was observed, but no salient features were observed in normal or diseased tissue of the fetus. Human tissue: Medium expression in fetal liver (primarily hepatocytes), lungs, skin, adrenal glands and heart. The spleen, small intestine, brain and eyes of the fetus were negative. Normal kidneys, bladder epithelium, lungs, adrenal glands, pancreas and skin were all negative. It has been expressed in adult liver (normal and diseased liver), renal tubules with end-stage renal disease, adipose tissue, sarcomas, colon, renal cell carcinoma, hepatocellular carcinoma, squamous cell carcinoma. Non-human primate tissue: chimpanzee salivary glands, blood vessels, stomach, tongue, peripheral nerves, thymus, lymph nodes, thyroid and parathyroid gland. The spinal cord of rhesus monkeys was negative, and cortical and hippocampal neurons were positive.

Example 143: Isolation of cDNA Clone Encoding Human PRO4993

Consensus sequences were obtained for other EST sequences as described in Example 1 above, which is referred to herein as DNA85042. In some cases, the DNA85042 consensus sequence is derived from an intermediate consensus DNA sequence stretched using repeated cycles of BLAST and phrap if a source of EST sequences discussed above is available. Based on the DNA85042 consensus sequence, oligonucleotides were synthesized for use as 1) a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO4993.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer 5'-AGATGTGAAGGTGCAGGTGTGCCG-3 '(SEQ ID NO: 619)

Reverse PCR Primer 5'-GAACATCAGCGCTCCCGGTAATTCC-3 '(SEQ ID NO: 620)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA85042.

Hybridization probe

5'-CCAGCCTTTGAATGGTACAAAGGAGAGAAGAAGCTCTTCAATGGCC-3 '(SEQ ID NO: 621)

RNA for preparing cDNA library was isolated from brain tissue of a human fetus.

DNA sequence analysis of clones isolated as described above yielded the full-length DNA sequence of PRO4993 polypeptide (herein referred to as DNA94832-2659 [FIG. 229, SEQ ID NO: 611]) and the protein sequence of PRO4993 derived therefrom.

The full length clone identified above comprises a single open reading frame that has an apparent translation initiation site at nucleotide positions 305-307 and terminates at the stop codon at nucleotide positions 1361-1363 (Figure 229, SEQ ID NO: 611). The expected polypeptide precursor is 352 amino acids long, the molecular weight is calculated to be approximately 38,429 and the pi is estimated to be approximately 6.84. Analysis of the full length PRO4993 shown in FIG. 230 (SEQ ID NO: 612) demonstrated the presence of the various important polypeptide domains shown in FIG. 230, and the positions given for these important polypeptide domains are approximate as described above. The clone DNA94832-2659 was deposited with the ATCC on June 15, 1999 to be assigned the ATCC accession number 240-PTA.

Analysis of the Dayhof database (Version 35.45 Swiss Prot 35) for the full length sequence shown in FIG. 230 (SEQ ID NO: 612) using ALIGN-2 sequence alignment analysis, wherein the PRO4993 amino acid sequence and P_W05152; LAMP_HUMAN; P_W05157; P_W05155; I56551; OPCM_RAT; AMAL_DROME; DMU78177_1; I37246; And sequence identity between the dayhof sequences of NCA1_HUMAN was demonstrated.

Example 144: Isolation of cDNA Clones Encoding Human PRO1559, PRO725 and PRO739

Consensus sequences were obtained for various EST sequences as described in Example 1 above. Based on the observation of homology between these consensus sequences and Insight EST clone number 4242090, Insight EST clone number 4242090 was purchased and its insert was obtained and sequenced. The full length protein encoding the insert sequence is referred to herein as PRO1559 (FIG. 232; SEQ ID NO: 614). The DNA sequence of the insert (DNA68886) is shown in FIG. 231 (SEQ ID NO: 613).

The cDNA sequence isolated on the amylase screen described in Example 2 above is referred to herein as DNA43301. Next, the DNA43301 sequence is compared with various expressed sequence tag (EST) databases, including public EST databases (e.g., Genbank) and private EST DNA databases (LIFESEQ ™, Insight Pharmaceutical, Palo Alto, CA). To confirm whether homology exists. Homology investigations were performed using the computer programs BLAST or BLAST-2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparatives with BLAST scores of 70 (or in some cases 90) or greater that do not encode known proteins are clustered and consensus DNA sequences using the program "phrap" (Phil Green, University of Washington, Seattle, WA) Assembled. The consensus sequence obtained therefrom is referred to herein as DNA45458. Based on the DNA45458 consensus sequence, oligonucleotide probes were prepared and used to screen the brain (LIB153) libraries of human fetuses prepared as described in Examples 1 and 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D without the SfiI site; see Holmes et al., Science , 253 : 1278-1280 (1991)) and the cDNA was cut to a size less than 2800 bp.

A pair of PCR primers (forward and reverse) were synthesized:

Omnidirectional PCR primer (45458.f1) 5'-CCAAACTCACCCAGTGAGTGTGAGC-3 '(SEQ ID NO: 619)

Reverse PCR Primer (45458.r1) 5'-TGGGAAATCAGGAATGGTGTTCTCC-3 '(SEQ ID NO: 620)

In addition, synthetic oligonucleotide hybridization probes having the following nucleotide sequences were prepared from consensus sequence DNA45458.

Hybridization Probe (45458.p1)

5'-CTTGTTTTCACCATTGGGCTAACTTTGCTGCTAGGAGTTCAAGCCATGCC-3 '(SEQ ID NO: 621)

The DNA of the library was screened by PCR amplification using the PCR primer pairs identified above to screen several libraries for the purpose of finding a source of full length clones. Then, clones encoding the PRO725 gene with one of the probe oligonucleotides and PCR primers were isolated by using a positive library.

The full length clone identified above comprises a single open reading frame that has an apparent translation initiation site at nucleotide positions 161 to 163 and terminates at the stop codon at nucleotide positions 455 to 457 (FIG. 233, SEQ ID NO: 615). The expected polypeptide precursor is 98 amino acids long, the molecular weight was calculated to be approximately 11,081 and the pi was estimated to be approximately 6.68. Analysis of the full length PRO725 sequence shown in FIG. 234 (SEQ ID NO: 616) shows a signal peptide of about amino acid 1 to about amino acid 20, a potential N-glycosylation site of about amino acid 72 to about amino acid 75, and about amino acid 63 to about The presence of the tyrosine kinase phosphorylation site of amino acid 70 has been demonstrated. Clones DNA52758-1399 were deposited with the ATCC on April 14, 1998, assigned the ATCC accession no. 209773.

Analysis of the amino acid sequence of the full length PRO725 polypeptide suggested that this sequence had no significant sequence similarity with any known protein. However, analysis of the Dayhof database (version 35.45 Swiss Prot 35) shows some degree of homology between the PRO725 amino acid sequence and the Dayhof sequences of POL_BLVAU, PSSP_RAT, CELC36C5_7, AF019234_1, I48862, P_R12498, P_P10125, P_R26861, A64527 and P_W20495. This has been proven.

DNA52756 shown in FIG. 235 (SEQ ID NO: 617) encoding the native PRO739 polypeptide (FIG. 236, SEQ ID NO: 618) was obtained from Genbank.

Example 145: Confirmation of Receptor / Legal Interaction

In this assay, various PRO polypeptides were tested for their ability to bind to a panel of potential receptor molecules for the purpose of identifying receptor / ligand interactions. Identification of ligands for known receptors, receptors for known ligands, or novel receptor / ligand pairs can be achieved by, for example, bioactive molecules (linked with these ligands or receptors) to cells known to express the receptor or ligands. Targeting of; Use of these receptors or ligands as reagents for detecting the presence of these ligands or receptors in compositions suspected of containing a ligand or receptor, wherein the composition may comprise cells suspected of expressing the ligand or receptor ); Modulation of other biological or immunological activities or their growth of cells known to express or respond to receptors or ligands; Cells expressing these receptors or ligands or those which allow the preparation of agonists, antagonists and / or antibodies to the receptors or ligands that control their growth or biological or immunological activity of cells expressing receptors or ligands or Regulation of the immune response of cells; And various other methods apparent to those skilled in the art.

The analysis was performed as follows. The PRO polypeptides of the invention suspected of being ligands for the receptor were expressed as fusion proteins containing the F _c domain of human IgG (Immunoadhesin). Cells expressing candidate PRO polypeptide receptor by interacting (e.g., Cos cells) and the immunometric adjuster hesin polypeptide and, using the visible put the immunometric adjuster H. The combination of a fluorescent reagent for the F _c fusion domain and evaluated microscopically Receptor-ligand binding was detected. Cells expressing candidate receptors were prepared by transiently transfecting a limited subset of a library of cDNA expression vectors encoding PRO polypeptides that could act as receptor molecules. Cells were then incubated for 1 hour in the presence of PRO polypeptide immunoadhesin to be tested for possible receptor binding. Cells were then washed and fixed with paraformaldehyde. Cells were then incubated with fluorescently bound antibodies (eg, FITC bound goat anti-human-Fc antibodies) to the F _c portion of the PRO polypeptide immunoadhesin. Next, the cells were rewashed and observed under a microscope. Positive interactions were assessed by the presence of the type and label of cells transfected with cDNA encoding a particular PRO polypeptide receptor or group of receptors and the absence of similar fluorescent labels of similarly prepared cells transfected with another cDNA or cDNA population. If a definite population of cDNA expression vectors is determined to be positive for interaction with PRO polypeptide immunoadhesin, individual cDNA species comprising the cDNA population are tested individually ("destructing" the population), so that the PRO polypeptide Specific cDNA encoding receptors capable of interacting with munadhesin were measured.

In another embodiment of this assay, the epitope-tagged potential ligand PRO polypeptide (eg, 8 histidine “His” tag) is a potential expressed as a fusion with the F _c domain of human IgG (immunoadhesin). Interact with a panel of phosphorus receptor PRO polypeptides. After co-incubation with epitope-tagged PRO polypeptide for 1 hour, candidate receptors were each immunoprecipitated with Protein A beads and these beads washed. Potential ligand interactions were determined by Western blot analysis of immunoprecipitated conjugates with antibodies to epitope tags. If a band of expected molecular weight of the epitope tagged protein was observed in Western blot analysis using the candidate gene, it was determined that the interaction occurred, but no interaction with other members of the panel of potential receptors was observed.

Using this assay, receptor / ligand interactions in which PRO337 binds to PRO4993, PRO1559 binds to PRO725, PRO1559 binds to PRO700, and PRO1559 binds to PRO739 have been identified in this analysis.

<Material deposit>

The following materials have been deposited in the American Type Culture Collection, Rockville Parkron Drive 12301, Maryland, USA.

matter ATCC Deposit Number Deposit date

DNA39987-1184ATCC 209786 April 21, 1998

DNA40625-1189ATCC 209788 April 21,1998

DNA23318-1211ATCC 209787 April 21,1998

DNA39979-1213ATCC 209789 April 21, 1998

DNA40594-1233ATCC 209617 February 5,1998

DNA45416-1251ATCC 209620 February 5, 1998

DNA45419-1252ATCC 209616 Feb 5, 1998

DNA52594-1270ATCC 209679 March 17,1998

DNA45234-1277ATCC 209654 March 5, 1998

DNA49624-1279ATCC 209655 March 5, 1998

DNA48309-1280ATCC 209656 March 5, 1998

DNA46776-1284ATCC 209721 March 31, 1998

DNA50980-1286ATCC 209717 March 31,1998

DNA50913-1287ATCC 209716 March 31,1998

DNA50914-1289ATCC 209722 March 31,1998

DNA48296-1292ATCC 2096681998 March 11

DNA32284-1307ATCC 209670 March 11, 1998

DNA36343-1310ATCC 209718 March 31,1998

DNA40571-1315ATCC 209784 April 21,1998

DNA41386-1316ATCC 209703 March 26, 1998

DNA44194-1317ATCC 2098081998 28 April

DNA45415-1318ATCC 209810 April 28, 1998

DNA44189-1322ATCC 209699 March 26,1998

DNA48304-1323ATCC 209811 April 28,1998

DNA49152-1324ATCC 209813 April 28,1998

DNA49646-1327ATCC 209705 March 26

DNA49631-1328ATCC 209806 April 28, 1998

DNA49645-1347ATCC 209809 April 28

DNA45493-1349ATCC 209805 April 28, 1998

DNA48227-1350ATCC 209812 April 28,1998

DNA41404-1352ATCC 209844 May 6,1998

DNA44196-1353ATCC 209847 May 6, 1998

DNA52187-1354ATCC 2098451998 6 May 1998

DNA48328-1355ATCC 209843 May 6,1998

DNA56352-1358ATCC 2098461998 6 May 1998

DNA53971-1359ATCC 209750 April 7, 1998

DNA50919-1361ATCC 209848 May 6,1998

DNA44179-1362ATCC 209851 May 6,1998

DNA54002-1367ATCC 209754 April 7, 1998

DNA53906-1368ATCC 209747 April 7, 1998

DNA52185-1370ATCC 2098611998 14 May

DNA53977-1371ATCC 209862 May 14,1998

DNA57253-1382ATCC 209867 May 14,1998

DNA58847-1383ATCC 209879 May 20,1998

DNA58747-1384ATCC 209868 May 14,1998

DNA57689-1385ATCC 209869 May 14,1998

DNA23330-1390ATCC 209775 April 14,1998

DNA26847-1395ATCC 209772 April 14,1998

DNA53974-1401ATCC 209774 April 14,1998

DNA57039-1402ATCC 209777 April 14, 1998

DNA57033-1403ATCC 2099051998 May 27

DNA34353-1428ATCC 209855 May 12,1998

DNA45417-1432ATCC 209910 May 27, 1998

DNA39523-1192ATCC 209424 October 31,1997

DNA44205-1285ATCC 209720 March 31,1998

DNA50911-1288ATCC 209714 March 31,1998

DNA48329-1290ATCC 209785 April 21,1998

DNA48306-1291ATCC 209911 May 27, 1998

DNA48336-1309ATCC 209669 March 11,1998

DNA44184-1319ATCC 209704 March 26, 1998

DNA48314-1320ATCC 209702 March 26,1998

DNA48333-1321ATCC 20970119 March 26

DNA50920-1325ATCC 209700 March 26, 1998

DNA50988-1326ATCC 209814 April 28,1998

DNA48331-1329ATCC 209715 March 31,1998

DNA30867-1335ATCC 209807 April 28,1998

DNA55737-1345ATCC 209753 April 7, 1998

DNA49829-1346ATCC 209749 April 7, 1998

DNA52196-1348ATCC 209748 April 7, 1998

DNA56965-1356ATCC 209842 May 6,1998

DNA56405-1357ATCC 209849 May 6,1998

DNA57530-1375ATCC 209880 May 20, 1998

DNA56439-1376ATCC 209864 May 14,1998

DNA56409-1377ATCC 209882 May 20,1998

DNA56112-1379ATCC 209883 May 20, 1998

DNA56045-1380ATCC 209865 May 14,1998

DNA59294-1381ATCC 209866 May 14,1998

DNA56433-1406ATCC 209857 May 12,1998

DNA53912-1457ATCC 209870 May 14,1998

DNA50921-1458ATCC 209859 May 12,1998

DNA29101-1122ATCC 209653 March 5,1998

DNA40021-1154ATCC 209389 October 17,1997

DNA42663-1154ATCC 209386 October 17,1997

DNA30943-1-1163-1ATCC 209791 April 21, 1998

DNA64907-1163-1ATCC 203242 September 9, 1998

DNA64908-1163-1ATCC 203243 September 9,1998

DNA39975-1210ATCC 209783 April 21, 1998

DNA43316-1237ATCC 209487 November 21,1997

DNA55800-1263ATCC 209680 March 17, 1998

DNA94832-2659240-PTA June 15, 1999

DNA52758-1399ATCC 209773 April 14,1998

These deposits were made under the provisions of the Budapest Treaty and its rules (Budapest Treaty) on the international approval of microbial deposits under the patent procedure. This ensures maintenance of the viable culture of the deposit for 30 years from the date of deposit. The deposits will be distributed from ATCC under the Convention of the Budapest Treaty in accordance with the agreement between Genentech Inc and ATCC, which shall be deposited with the public upon the granting of the relevant US patent or upon publication of the US or foreign patent application, whichever comes first. To ensure the permanent and non-limiting distribution of water culture progeny, and to the US Patent and Trademark Commissioner in 35 USC §122 and the rules of the US Patent and Trademark Commissioner (including 37 CFR §1.14, in particular see 886 OG 638). Progenie's sale is assured to those who have the right to do so.

The assignee of the present application agrees that upon incubation under appropriate conditions, if the culture of the deposited material is killed, lost or damaged, the material will be replaced immediately with another identical material upon notification. The sale of deposited materials should not be construed as an authorization of the governments to carry out the invention in violation of the rights granted under the patent law.

The foregoing description is considered to be sufficient to enable one skilled in the art to practice the invention. The present invention is not limited to the scope of the deposited structure as the deposited embodiment is intended as an illustration of certain aspects of the present invention, and any structure that is functionally equivalent is within the scope of the present invention. The deposit of a substance herein does not mean that the disclosure contained herein is inappropriate for carrying out any aspect, including the best mode of the invention, and is intended to limit the scope of the claims to the specific description set forth in the specification. It should not be interpreted. Indeed, various modifications of the invention in addition to those shown and described herein above are apparent to those skilled in the art and will be within the scope of the appended claims.

Claims (57)

Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 7), Figure 9 (SEQ ID NO: 19), Figure 11 (SEQ ID NO: 28), Figure 15 (SEQ ID NO: 36), Figure 20 (SEQ ID NO: 45), Figure 22 (SEQ ID NO: 52), Figure 24 (SEQ ID NO: 59), FIG. 26 (SEQ ID NO: 64), FIG. 28 (SEQ ID NO: 69), FIG. 30 (SEQ ID NO: 74), FIG. 33 (SEQ ID NO: 85), FIG. 35 (SEQ ID NO: 90), FIG. 37 (SEQ ID NO: 97), FIG. (SEQ ID NO: 102), FIG. 41 (SEQ ID NO: 109), FIG. 43 (SEQ ID NO: 114), FIG. 45 (SEQ ID NO: 119), FIG. 47 (SEQ ID NO: 124), FIG. 49 (SEQ ID NO: 132), FIG. 51 (SEQ ID NO: 137), FIG. SEQ ID NO: 145, FIG. 55 (SEQ ID NO: 150), FIG. 59 (SEQ ID NO: 157), FIG. 61 (SEQ ID NO: 162), FIG. 63 (SEQ ID NO: 169), FIG. 66 (SEQ ID NO: 178), FIG. 68 (SEQ ID NO: 183), FIG. 190, FIG. 73 (SEQ ID NO: 196), FIG. 75 (SEQ ID NO: 206), FIG. 77 (SEQ ID NO: 211), FIG. 79 (SEQ ID NO: 216), FIG. 81 (SEQ ID NO: 221), FIG. 83 (SEQ ID NO: 226), FIG. 85 (SEQ ID NO: 231). ), FIG. 87 (SEQ ID NO: 236), FIG. 89 (SEQ ID NO: 245), FIG. 91 (SEQ ID NO: 254), FIG. 93 (SEQ ID NO: 259), FIG. 95 (SEQ ID NO: 264), FIG. 98 (SEQ ID NO: 270), FIG. 109 (SEQ ID NO: 284). 118 (SEQ ID NO: 296), FIG. 120 (SEQ ID NO: 301), FIG. 122 (SEQ ID NO: 303), FIG. 125 (SEQ ID NO: 309), FIG. 129 (SEQ ID NO: 322), FIG. 32 (SEQ ID NO: 330), Figure 136 (SEQ ID NO: 337), Figure 139 (SEQ ID NO: 346), Figure 142 (SEQ ID NO: 352), Figure 145 (SEQ ID NO: 358), Figure 147 (SEQ ID NO: 363), Figure 149 (SEQ ID NO: 370), Figure 151 (SEQ ID NO: 375), Figure 153 (SEQ ID NO: 380), Figure 155 (SEQ ID NO: 385), Figure 157 (SEQ ID NO: 390), Figure 159 (SEQ ID NO: 395), Figure 161 (SEQ ID NO: 400), Figure 163 (SEQ ID NO: 405), Figure 165 ( SEQ ID NO: 410, FIG. 167 (SEQ ID NO: 415), FIG. 169 (SEQ ID NO: 420), FIG. 171 (SEQ ID NO: 425), FIG. 173 (SEQ ID NO: 430), FIG. 177 (SEQ ID NO: 437), FIG. 179 (SEQ ID NO: 442), FIG. 447, FIG. 183 (SEQ ID NO: 452), FIG. 185 (SEQ ID NO: 454), FIG. 187 (SEQ ID NO: 456), FIG. 190 (SEQ ID NO: 459), FIG. 192 (SEQ ID NO: 464), FIG. 194 (SEQ ID NO: 466), FIG. 196 (SEQ ID NO: 468). ), FIG. 198 (SEQ ID NO: 470), FIG. 200 (SEQ ID NO: 472), FIG. 202 (SEQ ID NO: 477), FIG. 204 (SEQ ID NO: 483), FIG. 207 (SEQ ID NO: 488), FIG. 209 (SEQ ID NO: 496), FIG. 211 (SEQ ID NO: 498). 213 (SEQ ID NO: 506), FIG. 215 (SEQ ID NO: 508), FIG. 217 (SEQ ID NO: 510), FIG. 219 (SEQ ID NO: 515), FIG. 222 (SEQ ID NO: 523), FIG. 225 (SEQ ID NO: 526), FIG. 230 (SEQ ID NO: 612), 232 (SEQ ID NO: 614), FIG. 234 (SEQ ID NO: 616), and FIG. An isolated nucleic acid having at least 80% nucleic acid sequence identity with a nucleotide sequence encoding an amino acid sequence selected from the group consisting of amino acid sequences set forth in column 618). Figure 1 (SEQ ID NO: 1), Figure 3 (SEQ ID NO: 6), Figure 8 (SEQ ID NO: 18), Figure 10 (SEQ ID NO: 27), Figure 14 (SEQ ID NO: 35), Figure 19 (SEQ ID NO: 44), Figure 21 (SEQ ID NO: 51), Figure 23 (SEQ ID NO: 58), Figure 25 (SEQ ID NO: 63), Figure 27 (SEQ ID NO: 68), Figure 29 (SEQ ID NO: 73), Figure 32 (SEQ ID NO: 84), Figure 34 (SEQ ID NO: 89), Figure 36 (SEQ ID NO: 96), Figure 38 (SEQ ID NO: 101), Figure 40 (SEQ ID NO: 108), Figure 42 (SEQ ID NO: 113), Figure 44 (SEQ ID NO: 118), Figure 46 (SEQ ID NO: 123), Figure 48 (SEQ ID NO: 131), Figure 50 (SEQ ID NO: 136), Figure 52 ( SEQ ID NO: 144, FIG. 54 (SEQ ID NO: 149), FIG. 58 (SEQ ID NO: 156), FIG. 60 (SEQ ID NO: 161), FIG. 62 (SEQ ID NO: 168), FIG. 65 (SEQ ID NO: 177), FIG. 67 (SEQ ID NO: 182), FIG. 189), FIG. 72 (SEQ ID NO: 195), FIG. 74 (SEQ ID NO: 205), FIG. 76 (SEQ ID NO: 210), FIG. 78 (SEQ ID NO: 215), FIG. 80 (SEQ ID NO: 220), FIG. 82 (SEQ ID NO: 225), FIG. 84 (SEQ ID NO: 230). ), Figure 86 (SEQ ID NO: 235), Figure 88 (SEQ ID NO: 244), Figure 90 (SEQ ID NO: 253), Figure 92 (SEQ ID NO: 258), Figure 94 (SEQ ID NO: 263), Figure 97 (SEQ ID NO: 269), Figure 108 (SEQ ID NO: 283) 117 (SEQ ID NO: 295), 119 (SEQ ID NO: 300), FIG. 121 (SEQ ID NO: 302), FIG. 124 (SEQ ID NO: 308), FIG. 128 (SEQ ID NO: 321), FIG. 31 (SEQ ID NO: 329), FIG. 135 (SEQ ID NO: 336), FIG. 138 (SEQ ID NO: 345), FIG. 141 (SEQ ID NO: 351), FIG. 144 (SEQ ID NO: 357), FIG. 146 (SEQ ID NO: 362), FIG. 148 (SEQ ID NO: 369), FIG. (SEQ ID NO: 374), FIG. 152 (SEQ ID NO: 379), FIG. 154 (SEQ ID NO: 384), FIG. 156 (SEQ ID NO: 389), FIG. 158 (SEQ ID NO: 394), FIG. 160 (SEQ ID NO: 399), FIG. 162 (SEQ ID NO: 404), FIG. SEQ ID NO: 409), FIG. 166 (SEQ ID NO: 414), FIG. 168 (SEQ ID NO: 419), FIG. 170 (SEQ ID NO: 424), FIG. 172 (SEQ ID NO: 429), FIG. 176 (SEQ ID NO: 436), FIG. 178 (SEQ ID NO: 441), FIG. 446, FIG. 182 (SEQ ID NO: 451), FIG. 184 (SEQ ID NO: 453), FIG. 186 (SEQ ID NO: 455), FIG. 189 (SEQ ID NO: 458), FIG. 191 (SEQ ID NO: 463), FIG. 193 (SEQ ID NO: 465), FIG. 195 (SEQ ID NO: 467). ), FIG. 197 (SEQ ID NO: 469), FIG. 199 (SEQ ID NO: 471), FIG. 201 (SEQ ID NO: 476), FIG. 203 (SEQ ID NO: 482), FIG. 206 (SEQ ID NO: 487), FIG. 208 (SEQ ID NO: 495), FIG. 210 (SEQ ID NO: 497). 212 (SEQ ID NO: 505), 214 (SEQ ID NO: 507), FIG. 216 (SEQ ID NO: 509), FIG. 218 (SEQ ID NO: 514), FIG. 221 (SEQ ID NO: 522), FIG. 224 (SEQ ID NO: 525), FIG. 229 (SEQ ID NO: 611), 231 (SEQ ID NO: 613), FIG. 233 (SEQ ID NO: 615), and FIG. An isolated nucleic acid having at least 80% nucleic acid sequence identity with a nucleotide sequence selected from the group consisting of nucleotide sequences set forth in column 617). Figure 1 (SEQ ID NO: 1), Figure 3 (SEQ ID NO: 6), Figure 8 (SEQ ID NO: 18), Figure 10 (SEQ ID NO: 27), Figure 14 (SEQ ID NO: 35), Figure 19 (SEQ ID NO: 44), Figure 21 (SEQ ID NO: 51), Figure 23 (SEQ ID NO: 58), Figure 25 (SEQ ID NO: 63), Figure 27 (SEQ ID NO: 68), Figure 29 (SEQ ID NO: 73), Figure 32 (SEQ ID NO: 84), Figure 34 (SEQ ID NO: 89), Figure 36 (SEQ ID NO: 96), Figure 38 (SEQ ID NO: 101), Figure 40 (SEQ ID NO: 108), Figure 42 (SEQ ID NO: 113), Figure 44 (SEQ ID NO: 118), Figure 46 (SEQ ID NO: 123), Figure 48 (SEQ ID NO: 131), Figure 50 (SEQ ID NO: 136), Figure 52 ( SEQ ID NO: 144, FIG. 54 (SEQ ID NO: 149), FIG. 58 (SEQ ID NO: 156), FIG. 60 (SEQ ID NO: 161), FIG. 62 (SEQ ID NO: 168), FIG. 65 (SEQ ID NO: 177), FIG. 67 (SEQ ID NO: 182), FIG. 189), FIG. 72 (SEQ ID NO: 195), FIG. 74 (SEQ ID NO: 205), FIG. 76 (SEQ ID NO: 210), FIG. 78 (SEQ ID NO: 215), FIG. 80 (SEQ ID NO: 220), FIG. 82 (SEQ ID NO: 225), FIG. 84 (SEQ ID NO: 230). ), Figure 86 (SEQ ID NO: 235), Figure 88 (SEQ ID NO: 244), Figure 90 (SEQ ID NO: 253), Figure 92 (SEQ ID NO: 258), Figure 94 (SEQ ID NO: 263), Figure 97 (SEQ ID NO: 269), Figure 108 (SEQ ID NO: 283) 117 (SEQ ID NO: 295), FIG. 119 (SEQ ID NO: 300), FIG. 121 (SEQ ID NO: 302), FIG. 124 (SEQ ID NO: 308), FIG. 128 (SEQ ID NO: 321), FIG. 1 (SEQ ID NO: 329), Figure 135 (SEQ ID NO: 336), Figure 138 (SEQ ID NO: 345), Figure 141 (SEQ ID NO: 351), Figure 144 (SEQ ID NO: 357), Figure 146 (SEQ ID NO: 362), Figure 148 (SEQ ID NO: 369), Figure 150 (SEQ ID NO: 374), FIG. 152 (SEQ ID NO: 379), FIG. 154 (SEQ ID NO: 384), FIG. 156 (SEQ ID NO: 389), FIG. 158 (SEQ ID NO: 394), FIG. 160 (SEQ ID NO: 399), FIG. 162 (SEQ ID NO: 404), FIG. SEQ ID NO: 409), FIG. 166 (SEQ ID NO: 414), FIG. 168 (SEQ ID NO: 419), FIG. 170 (SEQ ID NO: 424), FIG. 172 (SEQ ID NO: 429), FIG. 176 (SEQ ID NO: 436), FIG. 178 (SEQ ID NO: 441), FIG. 446, FIG. 182 (SEQ ID NO: 451), FIG. 184 (SEQ ID NO: 453), FIG. 186 (SEQ ID NO: 455), FIG. 189 (SEQ ID NO: 458), FIG. 191 (SEQ ID NO: 463), FIG. 193 (SEQ ID NO: 465), FIG. 195 (SEQ ID NO: 467). ), FIG. 197 (SEQ ID NO: 469), FIG. 199 (SEQ ID NO: 471), FIG. 201 (SEQ ID NO: 476), FIG. 203 (SEQ ID NO: 482), FIG. 206 (SEQ ID NO: 487), FIG. 208 (SEQ ID NO: 495), FIG. 210 (SEQ ID NO: 497). 212 (SEQ ID NO: 505), 214 (SEQ ID NO: 507), FIG. 216 (SEQ ID NO: 509), FIG. 218 (SEQ ID NO: 514), FIG. 221 (SEQ ID NO: 522), FIG. 224 (SEQ ID NO: 525), FIG. 229 (SEQ ID NO: 611), 231 (SEQ ID NO: 613), FIG. 233 (SEQ ID NO: 615), and FIG. 617.) An isolated nucleic acid having a selected nucleotide sequence with at least 80% nucleic acid sequence identity from the group consisting of full-length coding sequence of the nucleotide sequence shown in. ATCC Accession No. 209791, ATCC Accession No. 209786, ATCC Accession No. 209788, ATCC Accession No. 209787, ATCC Accession No. 209789, ATCC Accession No. 209617, ATCC Accession No. 209620, ATCC Accession No. 209616, ATCC Accession No. 209679, ATCC Accession No. 209654, ATCC Accession No. 209655, ATCC Accession No. 209656, ATCC Accession No. 209721, ATCC Accession No. 209717, ATCC Deposition No. 209716, ATCC Accession No. 209722, ATCC Accession No. 209668, ATCC Accession No. 209670, ATCC Accession No. 209718, ATCC Accession No. 209784, ATCC Accession No. 209703, ATCC Accession No. No. 209808, ATCC Accession No. 209810, ATCC Accession No. 209699, ATCC Accession No. 209811, ATCC Accession No. 209813, ATCC Accession No. 209705, ATCC Accession No. 209806, ATCC Accession No. 209809, ATCC Accession No. 209805, ATCC Accession No. 209812, ATCC Accession No. 209844, Accession No. 209847, Accessory Accession No. 209845, ATCC Accession No. 209843, Accession No. 209846, ATCC Accession No. 209846, Accession No. 209750, ATCC Accession No. 209848, ATCC Deposition No. 209851, ATCC Accession No. 209754, ATCC Accession No. 209747, ATCC Accession No. 209861, ATCC Accession No. 209862, ATCC Accession No. 209867, ATCC Accession No. 209879, ATCC Accession No. No. 209868, ATCC Accession No. 209869, ATCC Accession No. 209775, ATCC Accession No. 209772, ATCC Accession No. 209774, ATCC Accession No. 209777, ATCC Accession No. 209905, ATCC Accession No. 209855, ATCC Accession No. 209910, ATCC Accession No. 209424, ATCC Accession No. 209720, ATCC Accession No. 209714, ATCC Accession No. 209785, ATCC Accession No. 209911, ATCC Accession No. 209669 ATCC Accession No. 209704, ATCC Accession No. 209702, ATCC Accession No. No. 209701, ATCC Accession No. 209700, ATCC Accession No. 209814, ATCC Accession No. 209715, ATCC Accession No. 209807, ATCC Accession No. 209753, ATCC Accession No. 209749, ATCC Accession No. 209748, ATCC Accession No. 209842, ATCC Accession No. 209849, ATCC Accession No. 209880, ATCC Accession No. 209864, ATCC Accession No. 209882, ATCC Accession No. 209883, ATCC Accession No. 209865 ATCC Accession No. 209866, ATCC Accession No. 209857, ATCC Accession No. 209870, ATCC Accession No. 209859, ATCC Accession No. 209653, ATCC Accession No. 209389, ATCC Accession No. 209386 Of DNA deposited with ATCC Accession No. 203242, ATCC Accession No. 203243, ATCC Accession No. 209783, ATCC Accession No. 209487, ATCC Accession No. 209680, 240-PTA or ATCC Accession No. 209773. Isolated nucleus with at least 80% nucleic acid sequence identity with the full-length coding sequence mountain. A vector comprising the nucleic acid of any one of claims 1 to 4. The vector of claim 5, operably linked to regulatory sequences recognized by the host cell transformed with the vector. A host cell comprising the vector of claim 5. 8. The host cell of claim 7, which is a CHO cell. 8. The method of claim 7, wherein Host cell that is E. coli. The host cell of claim 7 which is a yeast cell. A method of producing a PRO polypeptide comprising culturing the host cell of claim 7 under conditions suitable for the expression of the PRO polypeptide and recovering the PRO polypeptide from a cell culture. Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 7), Figure 9 (SEQ ID NO: 19), Figure 11 (SEQ ID NO: 28), Figure 15 (SEQ ID NO: 36), Figure 20 (SEQ ID NO: 45), Figure 22 (SEQ ID NO: 52), Figure 24 (SEQ ID NO: 59), FIG. 26 (SEQ ID NO: 64), FIG. 28 (SEQ ID NO: 69), FIG. 30 (SEQ ID NO: 74), FIG. 33 (SEQ ID NO: 85), FIG. 35 (SEQ ID NO: 90), FIG. 37 (SEQ ID NO: 97), FIG. (SEQ ID NO: 102), FIG. 41 (SEQ ID NO: 109), FIG. 43 (SEQ ID NO: 114), FIG. 45 (SEQ ID NO: 119), FIG. 47 (SEQ ID NO: 124), FIG. 49 (SEQ ID NO: 132), FIG. 51 (SEQ ID NO: 137), FIG. SEQ ID NO: 145, FIG. 55 (SEQ ID NO: 150), FIG. 59 (SEQ ID NO: 157), FIG. 61 (SEQ ID NO: 162), FIG. 63 (SEQ ID NO: 169), FIG. 66 (SEQ ID NO: 178), FIG. 68 (SEQ ID NO: 183), FIG. 190, FIG. 73 (SEQ ID NO: 196), FIG. 75 (SEQ ID NO: 206), FIG. 77 (SEQ ID NO: 211), FIG. 79 (SEQ ID NO: 216), FIG. 81 (SEQ ID NO: 221), FIG. 83 (SEQ ID NO: 226), FIG. 85 (SEQ ID NO: 231). ), FIG. 87 (SEQ ID NO: 236), FIG. 89 (SEQ ID NO: 245), FIG. 91 (SEQ ID NO: 254), FIG. 93 (SEQ ID NO: 259), FIG. 95 (SEQ ID NO: 264), FIG. 98 (SEQ ID NO: 270), FIG. 109 (SEQ ID NO: 284). 118 (SEQ ID NO: 296), FIG. 120 (SEQ ID NO: 301), FIG. 122 (SEQ ID NO: 303), FIG. 125 (SEQ ID NO: 309), FIG. 129 (SEQ ID NO: 322), FIG. 32 (SEQ ID NO: 330), Figure 136 (SEQ ID NO: 337), Figure 139 (SEQ ID NO: 346), Figure 142 (SEQ ID NO: 352), Figure 145 (SEQ ID NO: 358), Figure 147 (SEQ ID NO: 363), Figure 149 (SEQ ID NO: 370), Figure 151 (SEQ ID NO: 375), Figure 153 (SEQ ID NO: 380), Figure 155 (SEQ ID NO: 385), Figure 157 (SEQ ID NO: 390), Figure 159 (SEQ ID NO: 395), Figure 161 (SEQ ID NO: 400), Figure 163 (SEQ ID NO: 405), Figure 165 ( SEQ ID NO: 410, FIG. 167 (SEQ ID NO: 415), FIG. 169 (SEQ ID NO: 420), FIG. 171 (SEQ ID NO: 425), FIG. 173 (SEQ ID NO: 430), FIG. 177 (SEQ ID NO: 437), FIG. 179 (SEQ ID NO: 442), FIG. 447, FIG. 183 (SEQ ID NO: 452), FIG. 185 (SEQ ID NO: 454), FIG. 187 (SEQ ID NO: 456), FIG. 190 (SEQ ID NO: 459), FIG. 192 (SEQ ID NO: 464), FIG. 194 (SEQ ID NO: 466), FIG. 196 (SEQ ID NO: 468). ), FIG. 198 (SEQ ID NO: 470), FIG. 200 (SEQ ID NO: 472), FIG. 202 (SEQ ID NO: 477), FIG. 204 (SEQ ID NO: 483), FIG. 207 (SEQ ID NO: 488), FIG. 209 (SEQ ID NO: 496), FIG. 211 (SEQ ID NO: 498). 213 (SEQ ID NO: 506), FIG. 215 (SEQ ID NO: 508), FIG. 217 (SEQ ID NO: 510), FIG. 219 (SEQ ID NO: 515), FIG. 222 (SEQ ID NO: 523), FIG. 225 (SEQ ID NO: 526), FIG. 230 (SEQ ID NO: 612), 232 (SEQ ID NO: 614), FIG. 234 (SEQ ID NO: 616), and FIG. An isolated polypeptide having at least 80% amino acid sequence identity with an amino acid sequence selected from the group consisting of amino acid sequences set forth in column 618). Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 7), Figure 9 (SEQ ID NO: 19), Figure 11 (SEQ ID NO: 28), Figure 15 (SEQ ID NO: 36), Figure 20 (SEQ ID NO: 45), Figure 22 (SEQ ID NO: 52), Figure 24 (SEQ ID NO: 59), FIG. 26 (SEQ ID NO: 64), FIG. 28 (SEQ ID NO: 69), FIG. 30 (SEQ ID NO: 74), FIG. 33 (SEQ ID NO: 85), FIG. 35 (SEQ ID NO: 90), FIG. 37 (SEQ ID NO: 97), FIG. (SEQ ID NO: 102), FIG. 41 (SEQ ID NO: 109), FIG. 43 (SEQ ID NO: 114), FIG. 45 (SEQ ID NO: 119), FIG. 47 (SEQ ID NO: 124), FIG. 49 (SEQ ID NO: 132), FIG. 51 (SEQ ID NO: 137), FIG. SEQ ID NO: 145, FIG. 55 (SEQ ID NO: 150), FIG. 59 (SEQ ID NO: 157), FIG. 61 (SEQ ID NO: 162), FIG. 63 (SEQ ID NO: 169), FIG. 66 (SEQ ID NO: 178), FIG. 68 (SEQ ID NO: 183), FIG. 190, FIG. 73 (SEQ ID NO: 196), FIG. 75 (SEQ ID NO: 206), FIG. 77 (SEQ ID NO: 211), FIG. 79 (SEQ ID NO: 216), FIG. 81 (SEQ ID NO: 221), FIG. 83 (SEQ ID NO: 226), FIG. 85 (SEQ ID NO: 231). ), FIG. 87 (SEQ ID NO: 236), FIG. 89 (SEQ ID NO: 245), FIG. 91 (SEQ ID NO: 254), FIG. 93 (SEQ ID NO: 259), FIG. 95 (SEQ ID NO: 264), FIG. 98 (SEQ ID NO: 270), FIG. 109 (SEQ ID NO: 284). 118 (SEQ ID NO: 296), FIG. 120 (SEQ ID NO: 301), FIG. 122 (SEQ ID NO: 303), FIG. 125 (SEQ ID NO: 309), FIG. 129 (SEQ ID NO: 322), FIG. 2 (SEQ ID NO: 330), Figure 136 (SEQ ID NO: 337), Figure 139 (SEQ ID NO: 346), Figure 142 (SEQ ID NO: 352), Figure 145 (SEQ ID NO: 358), Figure 147 (SEQ ID NO: 363), Figure 149 (SEQ ID NO: 370), Figure 151 (SEQ ID NO: 375), Figure 153 (SEQ ID NO: 380), Figure 155 (SEQ ID NO: 385), Figure 157 (SEQ ID NO: 390), Figure 159 (SEQ ID NO: 395), Figure 161 (SEQ ID NO: 400), Figure 163 (SEQ ID NO: 405), Figure 165 ( SEQ ID NO: 410, FIG. 167 (SEQ ID NO: 415), FIG. 169 (SEQ ID NO: 420), FIG. 171 (SEQ ID NO: 425), FIG. 173 (SEQ ID NO: 430), FIG. 177 (SEQ ID NO: 437), FIG. 179 (SEQ ID NO: 442), FIG. 447, FIG. 183 (SEQ ID NO: 452), FIG. 185 (SEQ ID NO: 454), FIG. 187 (SEQ ID NO: 456), FIG. 190 (SEQ ID NO: 459), FIG. 192 (SEQ ID NO: 464), FIG. 194 (SEQ ID NO: 466), FIG. 196 (SEQ ID NO: 468). ), FIG. 198 (SEQ ID NO: 470), FIG. 200 (SEQ ID NO: 472), FIG. 202 (SEQ ID NO: 477), FIG. 204 (SEQ ID NO: 483), FIG. 207 (SEQ ID NO: 488), FIG. 209 (SEQ ID NO: 496), FIG. 211 (SEQ ID NO: 498). 213 (SEQ ID NO: 506), FIG. 215 (SEQ ID NO: 508), FIG. 217 (SEQ ID NO: 510), FIG. 219 (SEQ ID NO: 515), FIG. 222 (SEQ ID NO: 523), FIG. 225 (SEQ ID NO: 526), FIG. 230 (SEQ ID NO: 612), 232 (SEQ ID NO: 614), FIG. 234 (SEQ ID NO: 616), and FIG. 618) polypeptide was isolated that is written to more than 80% positive when compared to the amino acid sequence selected from the group consisting of the amino acid sequence set forth in. ATCC Accession No. 209791, ATCC Accession No. 209786, ATCC Accession No. 209788, ATCC Accession No. 209787, ATCC Accession No. 209789, ATCC Accession No. 209617, ATCC Accession No. 209620, ATCC Accession No. 209616, ATCC Accession No. 209679, ATCC Accession No. 209654, ATCC Accession No. 209655, ATCC Accession No. 209656, ATCC Accession No. 209721, ATCC Accession No. 209717, ATCC Deposition No. 209716, ATCC Accession No. 209722, ATCC Accession No. 209668, ATCC Accession No. 209670, ATCC Accession No. 209718, ATCC Accession No. 209784, ATCC Accession No. 209703, ATCC Accession No. No. 209808, ATCC Accession No. 209810, ATCC Accession No. 209699, ATCC Accession No. 209811, ATCC Accession No. 209813, ATCC Accession No. 209705, ATCC Accession No. 209806, ATCC Accession No. 209809, ATCC Accession No. 209805, ATCC Accession No. 209812, ATCC Accession No. 209844, Accession No. 209847, Accessory Accession No. 209845, ATCC Accession No. 209843, Accession No. 209846, ATCC Accession No. 209846, Accession No. 209750, ATCC Accession No. 209848, ATCC Deposition No. 209851, ATCC Accession No. 209754, ATCC Accession No. 209747, ATCC Accession No. 209861, ATCC Accession No. 209862, ATCC Accession No. 209867, ATCC Accession No. 209879, ATCC Accession No. No. 209868, ATCC Accession No. 209869, ATCC Accession No. 209775, ATCC Accession No. 209772, ATCC Accession No. 209774, ATCC Accession No. 209777, ATCC Accession No. 209905, ATCC Accession No. 209855, ATCC Accession No. 209910, ATCC Accession No. 209424, ATCC Accession No. 209720, ATCC Accession No. 209714, ATCC Accession No. 209785, ATCC Accession No. 209911, ATCC Accession No. 209669 ATCC Accession No. 209704, ATCC Accession No. 209702, ATCC Accession No. No. 209701, ATCC Accession No. 209700, ATCC Accession No. 209814, ATCC Accession No. 209715, ATCC Accession No. 209807, ATCC Accession No. 209753, ATCC Accession No. 209749, ATCC Accession No. 209748, ATCC Accession No. 209842, ATCC Accession No. 209849, ATCC Accession No. 209880, ATCC Accession No. 209864, ATCC Accession No. 209882, ATCC Accession No. 209883, ATCC Accession No. 209865 ATCC Accession No. 209866, ATCC Accession No. 209857, ATCC Accession No. 209870, ATCC Accession No. 209859, ATCC Accession No. 209653, ATCC Accession No. 209389, ATCC Accession No. 209386 Of DNA deposited with ATCC Accession No. 203242, ATCC Accession No. 203243, ATCC Accession No. 209783, ATCC Accession No. 209487, ATCC Accession No. 209680, 240-PTA or ATCC Accession No. 209773. 80% or more of the amino acid sequence encoded by the full length coding sequence The isolated polypeptide having an acid sequence identity. A chimeric molecule comprising the polypeptide of claim 12 fused with a heterologous amino acid sequence. The chimeric molecule of claim 15, wherein the heterologous amino acid sequence is an epitope tag sequence. The chimeric molecule of claim 15, wherein said heterologous amino acid sequence is an F _c region of an immunoglobulin. An antibody that specifically binds to a polypeptide according to any one of claims 12-14. The antibody of claim 18, which is a monoclonal antibody, humanized antibody or single chain antibody. (a) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 7), Figure 9 (SEQ ID NO: 19), Figure 11 (SEQ ID NO: 28), Figure 15 (SEQ ID NO: 36), Figure 20 (SEQ ID NO: 45) ), Figure 22 (SEQ ID NO: 52), Figure 24 (SEQ ID NO: 59), Figure 26 (SEQ ID NO: 64), Figure 28 (SEQ ID NO: 69), Figure 30 (SEQ ID NO: 74), Figure 33 (SEQ ID NO: 85), Figure 35 (SEQ ID NO: 90) 37 (SEQ ID NO: 97), FIG. 39 (SEQ ID NO: 102), FIG. 41 (SEQ ID NO: 109), FIG. 43 (SEQ ID NO: 114), FIG. 45 (SEQ ID NO: 119), FIG. 47 (SEQ ID NO: 124), FIG. 49 (SEQ ID NO: 132), Figure 51 (SEQ ID NO: 137), Figure 53 (SEQ ID NO: 145), Figure 55 (SEQ ID NO: 150), Figure 59 (SEQ ID NO: 157), Figure 61 (SEQ ID NO: 162), Figure 63 (SEQ ID NO: 169), Figure 66 (SEQ ID NO: 178), Figure 68 (SEQ ID NO: 183), FIG. 70 (SEQ ID NO: 190), FIG. 73 (SEQ ID NO: 196), FIG. 75 (SEQ ID NO: 206), FIG. 77 (SEQ ID NO: 211), FIG. 79 (SEQ ID NO: 216), FIG. 81 (SEQ ID NO: 221), FIG. (SEQ ID NO: 226), FIG. 85 (SEQ ID NO: 231), FIG. 87 (SEQ ID NO: 236), FIG. 89 (SEQ ID NO: 245), FIG. 91 (SEQ ID NO: 254), FIG. 93 (SEQ ID NO: 259), FIG. 95 (SEQ ID NO: 264), FIG. SEQ ID NO: 270), Figure 109 (SEQ ID NO: 284), Figure 118 (SEQ ID NO: 296), Figure 120 (SEQ ID NO: 301), Figure 122 (SEQ ID NO: 303), Figure 125 (SEQ ID NO: 309), Figure 129 (SEQ ID NO: 322), Figure 132 (SEQ ID NO: 330), Figure 136 (SEQ ID NO: 337), Figure 139 (SEQ ID NO: 346), Figure 142 (SEQ ID NO: 352), Figure 145 (SEQ ID NO: 358), Figure 147 ( SEQ ID NO: 363), FIG. 149 (SEQ ID NO: 370), FIG. 151 (SEQ ID NO: 375), FIG. 153 (SEQ ID NO: 380), FIG. 155 (SEQ ID NO: 385), FIG. 157 (SEQ ID NO: 390), FIG. 159 (SEQ ID NO: 395), FIG. 400, 163 (SEQ ID NO: 405), FIG. 165 (SEQ ID NO: 410), FIG. 167 (SEQ ID NO: 415), FIG. 169 (SEQ ID NO: 420), FIG. 171 (SEQ ID NO: 425), FIG. 173 (SEQ ID NO: 430), FIG. 177 (SEQ ID NO: 437). ), Figure 179 (SEQ ID NO: 442), Figure 181 (SEQ ID NO: 447), Figure 183 (SEQ ID NO: 452), Figure 185 (SEQ ID NO: 454), Figure 187 (SEQ ID NO: 456), Figure 190 (SEQ ID NO: 459), Figure 192 (SEQ ID NO: 464). 194 (SEQ ID NO: 466), FIG. 196 (SEQ ID NO: 468), FIG. 198 (SEQ ID NO: 470), FIG. 200 (SEQ ID NO: 472), FIG. 202 (SEQ ID NO: 477), FIG. 204 (SEQ ID NO: 483), FIG. 207 (SEQ ID NO: 488), Figure 209 (SEQ ID NO: 496), Figure 211 (SEQ ID NO: 498), Figure 213 (SEQ ID NO: 506), Figure 215 (SEQ ID NO: 508), Figure 217 (SEQ ID NO: 510), Figure 219 (SEQ ID NO: 515), Figure 222 (SEQ ID NO: 523), Figure 225 (SEQ ID NO: 526), FIG. 230 (SEQ ID NO: 612), FIG. 232 (SEQ ID NO: 61 4), a nucleotide sequence encoding the polypeptide described in FIG. 234 (SEQ ID NO: 616) or 236 (SEQ ID NO: 618), (b) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 7), Figure 9 (SEQ ID NO: 19), Figure 11 (SEQ ID NO: 28), Figure 15 (SEQ ID NO: 36), Figure 20 (SEQ ID NO: 45). ), Figure 22 (SEQ ID NO: 52), Figure 24 (SEQ ID NO: 59), Figure 26 (SEQ ID NO: 64), Figure 28 (SEQ ID NO: 69), Figure 30 (SEQ ID NO: 74), Figure 33 (SEQ ID NO: 85), Figure 35 (SEQ ID NO: 90) 37 (SEQ ID NO: 97), FIG. 39 (SEQ ID NO: 102), FIG. 41 (SEQ ID NO: 109), FIG. 43 (SEQ ID NO: 114), FIG. 45 (SEQ ID NO: 119), FIG. 47 (SEQ ID NO: 124), FIG. 49 (SEQ ID NO: 132), Figure 51 (SEQ ID NO: 137), Figure 53 (SEQ ID NO: 145), Figure 55 (SEQ ID NO: 150), Figure 59 (SEQ ID NO: 157), Figure 61 (SEQ ID NO: 162), Figure 63 (SEQ ID NO: 169), Figure 66 (SEQ ID NO: 178), Figure 68 (SEQ ID NO: 183), FIG. 70 (SEQ ID NO: 190), FIG. 73 (SEQ ID NO: 196), FIG. 75 (SEQ ID NO: 206), FIG. 77 (SEQ ID NO: 211), FIG. 79 (SEQ ID NO: 216), FIG. 81 (SEQ ID NO: 221), FIG. (SEQ ID NO: 226), FIG. 85 (SEQ ID NO: 231), FIG. 87 (SEQ ID NO: 236), FIG. 89 (SEQ ID NO: 245), FIG. 91 (SEQ ID NO: 254), FIG. 93 (SEQ ID NO: 259), FIG. 95 (SEQ ID NO: 264), FIG. SEQ ID NO: 270), Figure 109 (SEQ ID NO: 284), Figure 118 (SEQ ID NO: 296), Figure 120 (SEQ ID NO: 301), Figure 122 (SEQ ID NO: 303), Figure 125 (SEQ ID NO: 309), Figure 129 (SEQ ID NO: 322), Figure 132 (SEQ ID NO: 330), Figure 136 (SEQ ID NO: 337), Figure 139 (SEQ ID NO: 346), Figure 142 (SEQ ID NO: 352), Figure 145 (SEQ ID NO: 358), Figure 147 ( SEQ ID NO: 363), FIG. 149 (SEQ ID NO: 370), FIG. 151 (SEQ ID NO: 375), FIG. 153 (SEQ ID NO: 380), FIG. 155 (SEQ ID NO: 385), FIG. 157 (SEQ ID NO: 390), FIG. 159 (SEQ ID NO: 395), FIG. 400, 163 (SEQ ID NO: 405), FIG. 165 (SEQ ID NO: 410), FIG. 167 (SEQ ID NO: 415), FIG. 169 (SEQ ID NO: 420), FIG. 171 (SEQ ID NO: 425), FIG. 173 (SEQ ID NO: 430), FIG. 177 (SEQ ID NO: 437). ), Figure 179 (SEQ ID NO: 442), Figure 181 (SEQ ID NO: 447), Figure 183 (SEQ ID NO: 452), Figure 185 (SEQ ID NO: 454), Figure 187 (SEQ ID NO: 456), Figure 190 (SEQ ID NO: 459), Figure 192 (SEQ ID NO: 464). 194 (SEQ ID NO: 466), FIG. 196 (SEQ ID NO: 468), FIG. 198 (SEQ ID NO: 470), FIG. 200 (SEQ ID NO: 472), FIG. 202 (SEQ ID NO: 477), FIG. 204 (SEQ ID NO: 483), FIG. 207 (SEQ ID NO: 488), Figure 209 (SEQ ID NO: 496), Figure 211 (SEQ ID NO: 498), Figure 213 (SEQ ID NO: 506), Figure 215 (SEQ ID NO: 508), Figure 217 (SEQ ID NO: 510), Figure 219 (SEQ ID NO: 515), Figure 222 (SEQ ID NO: 523), Figure 225 (SEQ ID NO: 526), FIG. 230 (SEQ ID NO: 612), FIG. 232 (SEQ ID NO: 61 4), a nucleotide sequence encoding the extracellular domain of the polypeptide described in FIG. 234 (SEQ ID NO: 616) or 236 (SEQ ID NO: 618), or (c) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 7), Figure 9 (SEQ ID NO: 19), Figure 11 (SEQ ID NO: 28), Figure 15 (SEQ ID NO: 36), Figure 20 (SEQ ID NO: 45). ), Figure 22 (SEQ ID NO: 52), Figure 24 (SEQ ID NO: 59), Figure 26 (SEQ ID NO: 64), Figure 28 (SEQ ID NO: 69), Figure 30 (SEQ ID NO: 74), Figure 33 (SEQ ID NO: 85), Figure 35 (SEQ ID NO: 90) 37 (SEQ ID NO: 97), FIG. 39 (SEQ ID NO: 102), FIG. 41 (SEQ ID NO: 109), FIG. 43 (SEQ ID NO: 114), FIG. 45 (SEQ ID NO: 119), FIG. 47 (SEQ ID NO: 124), FIG. 49 (SEQ ID NO: 132), Figure 51 (SEQ ID NO: 137), Figure 53 (SEQ ID NO: 145), Figure 55 (SEQ ID NO: 150), Figure 59 (SEQ ID NO: 157), Figure 61 (SEQ ID NO: 162), Figure 63 (SEQ ID NO: 169), Figure 66 (SEQ ID NO: 178), Figure 68 (SEQ ID NO: 183), FIG. 70 (SEQ ID NO: 190), FIG. 73 (SEQ ID NO: 196), FIG. 75 (SEQ ID NO: 206), FIG. 77 (SEQ ID NO: 211), FIG. 79 (SEQ ID NO: 216), FIG. 81 (SEQ ID NO: 221), FIG. (SEQ ID NO: 226), FIG. 85 (SEQ ID NO: 231), FIG. 87 (SEQ ID NO: 236), FIG. 89 (SEQ ID NO: 245), FIG. 91 (SEQ ID NO: 254), FIG. 93 (SEQ ID NO: 259), FIG. 95 (SEQ ID NO: 264), FIG. SEQ ID NO: 270), Figure 109 (SEQ ID NO: 284), Figure 118 (SEQ ID NO: 296), Figure 120 (SEQ ID NO: 301), Figure 122 (SEQ ID NO: 303), Figure 125 (SEQ ID NO: 309), Figure 129 (SEQ ID NO: 322), Figure 132 (SEQ ID NO: 330), Figure 136 (SEQ ID NO: 337), Figure 139 (SEQ ID NO: 346), Figure 142 (SEQ ID NO: 352), Figure 145 (SEQ ID NO: 358), Figure 147 ( SEQ ID NO: 363), FIG. 149 (SEQ ID NO: 370), FIG. 151 (SEQ ID NO: 375), FIG. 153 (SEQ ID NO: 380), FIG. 155 (SEQ ID NO: 385), FIG. 157 (SEQ ID NO: 390), FIG. 159 (SEQ ID NO: 395), FIG. 400, 163 (SEQ ID NO: 405), FIG. 165 (SEQ ID NO: 410), FIG. 167 (SEQ ID NO: 415), FIG. 169 (SEQ ID NO: 420), FIG. 171 (SEQ ID NO: 425), FIG. 173 (SEQ ID NO: 430), FIG. 177 (SEQ ID NO: 437). ), Figure 179 (SEQ ID NO: 442), Figure 181 (SEQ ID NO: 447), Figure 183 (SEQ ID NO: 452), Figure 185 (SEQ ID NO: 454), Figure 187 (SEQ ID NO: 456), Figure 190 (SEQ ID NO: 459), Figure 192 (SEQ ID NO: 464). 194 (SEQ ID NO: 466), FIG. 196 (SEQ ID NO: 468), FIG. 198 (SEQ ID NO: 470), FIG. 200 (SEQ ID NO: 472), FIG. 202 (SEQ ID NO: 477), FIG. 204 (SEQ ID NO: 483), FIG. 207 (SEQ ID NO: 488), Figure 209 (SEQ ID NO: 496), Figure 211 (SEQ ID NO: 498), Figure 213 (SEQ ID NO: 506), Figure 215 (SEQ ID NO: 508), Figure 217 (SEQ ID NO: 510), Figure 219 (SEQ ID NO: 515), Figure 222 (SEQ ID NO: 523), Figure 225 (SEQ ID NO: 526), FIG. 230 (SEQ ID NO: 612), FIG. 232 (SEQ ID NO: 614). ), Nucleotide sequence encoding the extracellular domain of the polypeptide described in FIG. 234 (SEQ ID NO: 616) or 236 (SEQ ID NO: 618). And an isolated nucleic acid having at least 80% nucleic acid sequence identity with. (a) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 7), Figure 9 (SEQ ID NO: 19), Figure 11 (SEQ ID NO: 28), Figure 15 (SEQ ID NO: 36), Figure 20 (SEQ ID NO: 45) ), Figure 22 (SEQ ID NO: 52), Figure 24 (SEQ ID NO: 59), Figure 26 (SEQ ID NO: 64), Figure 28 (SEQ ID NO: 69), Figure 30 (SEQ ID NO: 74), Figure 33 (SEQ ID NO: 85), Figure 35 (SEQ ID NO: 90) 37 (SEQ ID NO: 97), FIG. 39 (SEQ ID NO: 102), FIG. 41 (SEQ ID NO: 109), FIG. 43 (SEQ ID NO: 114), FIG. 45 (SEQ ID NO: 119), FIG. 47 (SEQ ID NO: 124), FIG. 49 (SEQ ID NO: 132), Figure 51 (SEQ ID NO: 137), Figure 53 (SEQ ID NO: 145), Figure 55 (SEQ ID NO: 150), Figure 59 (SEQ ID NO: 157), Figure 61 (SEQ ID NO: 162), Figure 63 (SEQ ID NO: 169), Figure 66 (SEQ ID NO: 178), Figure 68 (SEQ ID NO: 183), FIG. 70 (SEQ ID NO: 190), FIG. 73 (SEQ ID NO: 196), FIG. 75 (SEQ ID NO: 206), FIG. 77 (SEQ ID NO: 211), FIG. 79 (SEQ ID NO: 216), FIG. 81 (SEQ ID NO: 221), FIG. (SEQ ID NO: 226), FIG. 85 (SEQ ID NO: 231), FIG. 87 (SEQ ID NO: 236), FIG. 89 (SEQ ID NO: 245), FIG. 91 (SEQ ID NO: 254), FIG. 93 (SEQ ID NO: 259), FIG. 95 (SEQ ID NO: 264), FIG. SEQ ID NO: 270), Figure 109 (SEQ ID NO: 284), Figure 118 (SEQ ID NO: 296), Figure 120 (SEQ ID NO: 301), Figure 122 (SEQ ID NO: 303), Figure 125 (SEQ ID NO: 309), Figure 129 (SEQ ID NO: 322), Figure 132 (SEQ ID NO: 330), Figure 136 (SEQ ID NO: 337), Figure 139 (SEQ ID NO: 346), Figure 142 (SEQ ID NO: 352), Figure 145 (SEQ ID NO: 358), Figure 147 ( SEQ ID NO: 363), FIG. 149 (SEQ ID NO: 370), FIG. 151 (SEQ ID NO: 375), FIG. 153 (SEQ ID NO: 380), FIG. 155 (SEQ ID NO: 385), FIG. 157 (SEQ ID NO: 390), FIG. 159 (SEQ ID NO: 395), FIG. 400, 163 (SEQ ID NO: 405), FIG. 165 (SEQ ID NO: 410), FIG. 167 (SEQ ID NO: 415), FIG. 169 (SEQ ID NO: 420), FIG. 171 (SEQ ID NO: 425), FIG. 173 (SEQ ID NO: 430), FIG. 177 (SEQ ID NO: 437). ), Figure 179 (SEQ ID NO: 442), Figure 181 (SEQ ID NO: 447), Figure 183 (SEQ ID NO: 452), Figure 185 (SEQ ID NO: 454), Figure 187 (SEQ ID NO: 456), Figure 190 (SEQ ID NO: 459), Figure 192 (SEQ ID NO: 464). 194 (SEQ ID NO: 466), FIG. 196 (SEQ ID NO: 468), FIG. 198 (SEQ ID NO: 470), FIG. 200 (SEQ ID NO: 472), FIG. 202 (SEQ ID NO: 477), FIG. 204 (SEQ ID NO: 483), FIG. 207 (SEQ ID NO: 488), Figure 209 (SEQ ID NO: 496), Figure 211 (SEQ ID NO: 498), Figure 213 (SEQ ID NO: 506), Figure 215 (SEQ ID NO: 508), Figure 217 (SEQ ID NO: 510), Figure 219 (SEQ ID NO: 515), Figure 222 (SEQ ID NO: 523), Figure 225 (SEQ ID NO: 526), FIG. 230 (SEQ ID NO: 612), FIG. 232 (SEQ ID NO: 61 4), the polypeptide described in FIG. 234 (SEQ ID NO: 616) or 236 (SEQ ID NO: 618), (b) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 7), Figure 9 (SEQ ID NO: 19), Figure 11 (SEQ ID NO: 28), Figure 15 (SEQ ID NO: 36), Figure 20 (SEQ ID NO: 45). ), Figure 22 (SEQ ID NO: 52), Figure 24 (SEQ ID NO: 59), Figure 26 (SEQ ID NO: 64), Figure 28 (SEQ ID NO: 69), Figure 30 (SEQ ID NO: 74), Figure 33 (SEQ ID NO: 85), Figure 35 (SEQ ID NO: 90) 37 (SEQ ID NO: 97), FIG. 39 (SEQ ID NO: 102), FIG. 41 (SEQ ID NO: 109), FIG. 43 (SEQ ID NO: 114), FIG. 45 (SEQ ID NO: 119), FIG. 47 (SEQ ID NO: 124), FIG. 49 (SEQ ID NO: 132), Figure 51 (SEQ ID NO: 137), Figure 53 (SEQ ID NO: 145), Figure 55 (SEQ ID NO: 150), Figure 59 (SEQ ID NO: 157), Figure 61 (SEQ ID NO: 162), Figure 63 (SEQ ID NO: 169), Figure 66 (SEQ ID NO: 178), Figure 68 (SEQ ID NO: 183), FIG. 70 (SEQ ID NO: 190), FIG. 73 (SEQ ID NO: 196), FIG. 75 (SEQ ID NO: 206), FIG. 77 (SEQ ID NO: 211), FIG. 79 (SEQ ID NO: 216), FIG. 81 (SEQ ID NO: 221), FIG. (SEQ ID NO: 226), FIG. 85 (SEQ ID NO: 231), FIG. 87 (SEQ ID NO: 236), FIG. 89 (SEQ ID NO: 245), FIG. 91 (SEQ ID NO: 254), FIG. 93 (SEQ ID NO: 259), FIG. 95 (SEQ ID NO: 264), FIG. SEQ ID NO: 270), Figure 109 (SEQ ID NO: 284), Figure 118 (SEQ ID NO: 296), Figure 120 (SEQ ID NO: 301), Figure 122 (SEQ ID NO: 303), Figure 125 (SEQ ID NO: 309), Figure 129 (SEQ ID NO: 322), Figure 132 (SEQ ID NO: 330), Figure 136 (SEQ ID NO: 337), Figure 139 (SEQ ID NO: 346), Figure 142 (SEQ ID NO: 352), Figure 145 (SEQ ID NO: 358), Figure 147 ( SEQ ID NO: 363), FIG. 149 (SEQ ID NO: 370), FIG. 151 (SEQ ID NO: 375), FIG. 153 (SEQ ID NO: 380), FIG. 155 (SEQ ID NO: 385), FIG. 157 (SEQ ID NO: 390), FIG. 159 (SEQ ID NO: 395), FIG. 400, 163 (SEQ ID NO: 405), FIG. 165 (SEQ ID NO: 410), FIG. 167 (SEQ ID NO: 415), FIG. 169 (SEQ ID NO: 420), FIG. 171 (SEQ ID NO: 425), FIG. 173 (SEQ ID NO: 430), FIG. 177 (SEQ ID NO: 437). ), Figure 179 (SEQ ID NO: 442), Figure 181 (SEQ ID NO: 447), Figure 183 (SEQ ID NO: 452), Figure 185 (SEQ ID NO: 454), Figure 187 (SEQ ID NO: 456), Figure 190 (SEQ ID NO: 459), Figure 192 (SEQ ID NO: 464). 194 (SEQ ID NO: 466), FIG. 196 (SEQ ID NO: 468), FIG. 198 (SEQ ID NO: 470), FIG. 200 (SEQ ID NO: 472), FIG. 202 (SEQ ID NO: 477), FIG. 204 (SEQ ID NO: 483), FIG. 207 (SEQ ID NO: 488), Figure 209 (SEQ ID NO: 496), Figure 211 (SEQ ID NO: 498), Figure 213 (SEQ ID NO: 506), Figure 215 (SEQ ID NO: 508), Figure 217 (SEQ ID NO: 510), Figure 219 (SEQ ID NO: 515), Figure 222 (SEQ ID NO: 523), Figure 225 (SEQ ID NO: 526), FIG. 230 (SEQ ID NO: 612), FIG. 232 (SEQ ID NO: 61 4), the extracellular domain of the polypeptide described in FIG. 234 (SEQ ID NO: 616) or 236 (SEQ ID NO: 618), or (c) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 7), Figure 9 (SEQ ID NO: 19), Figure 11 (SEQ ID NO: 28), Figure 15 (SEQ ID NO: 36), Figure 20 (SEQ ID NO: 45). ), Figure 22 (SEQ ID NO: 52), Figure 24 (SEQ ID NO: 59), Figure 26 (SEQ ID NO: 64), Figure 28 (SEQ ID NO: 69), Figure 30 (SEQ ID NO: 74), Figure 33 (SEQ ID NO: 85), Figure 35 (SEQ ID NO: 90) 37 (SEQ ID NO: 97), FIG. 39 (SEQ ID NO: 102), FIG. 41 (SEQ ID NO: 109), FIG. 43 (SEQ ID NO: 114), FIG. 45 (SEQ ID NO: 119), FIG. 47 (SEQ ID NO: 124), FIG. 49 (SEQ ID NO: 132), Figure 51 (SEQ ID NO: 137), Figure 53 (SEQ ID NO: 145), Figure 55 (SEQ ID NO: 150), Figure 59 (SEQ ID NO: 157), Figure 61 (SEQ ID NO: 162), Figure 63 (SEQ ID NO: 169), Figure 66 (SEQ ID NO: 178), Figure 68 (SEQ ID NO: 183), FIG. 70 (SEQ ID NO: 190), FIG. 73 (SEQ ID NO: 196), FIG. 75 (SEQ ID NO: 206), FIG. 77 (SEQ ID NO: 211), FIG. 79 (SEQ ID NO: 216), FIG. 81 (SEQ ID NO: 221), FIG. (SEQ ID NO: 226), FIG. 85 (SEQ ID NO: 231), FIG. 87 (SEQ ID NO: 236), FIG. 89 (SEQ ID NO: 245), FIG. 91 (SEQ ID NO: 254), FIG. 93 (SEQ ID NO: 259), FIG. 95 (SEQ ID NO: 264), FIG. SEQ ID NO: 270), Figure 109 (SEQ ID NO: 284), Figure 118 (SEQ ID NO: 296), Figure 120 (SEQ ID NO: 301), Figure 122 (SEQ ID NO: 303), Figure 125 (SEQ ID NO: 309), Figure 129 (SEQ ID NO: 322), Figure 132 (SEQ ID NO: 330), Figure 136 (SEQ ID NO: 337), Figure 139 (SEQ ID NO: 346), Figure 142 (SEQ ID NO: 352), Figure 145 (SEQ ID NO: 358), Figure 147 ( SEQ ID NO: 363), FIG. 149 (SEQ ID NO: 370), FIG. 151 (SEQ ID NO: 375), FIG. 153 (SEQ ID NO: 380), FIG. 155 (SEQ ID NO: 385), FIG. 157 (SEQ ID NO: 390), FIG. 159 (SEQ ID NO: 395), FIG. 400, 163 (SEQ ID NO: 405), FIG. 165 (SEQ ID NO: 410), FIG. 167 (SEQ ID NO: 415), FIG. 169 (SEQ ID NO: 420), FIG. 171 (SEQ ID NO: 425), FIG. 173 (SEQ ID NO: 430), FIG. 177 (SEQ ID NO: 437). ), Figure 179 (SEQ ID NO: 442), Figure 181 (SEQ ID NO: 447), Figure 183 (SEQ ID NO: 452), Figure 185 (SEQ ID NO: 454), Figure 187 (SEQ ID NO: 456), Figure 190 (SEQ ID NO: 459), Figure 192 (SEQ ID NO: 464). 194 (SEQ ID NO: 466), FIG. 196 (SEQ ID NO: 468), FIG. 198 (SEQ ID NO: 470), FIG. 200 (SEQ ID NO: 472), FIG. 202 (SEQ ID NO: 477), FIG. 204 (SEQ ID NO: 483), FIG. 207 (SEQ ID NO: 488), Figure 209 (SEQ ID NO: 496), Figure 211 (SEQ ID NO: 498), Figure 213 (SEQ ID NO: 506), Figure 215 (SEQ ID NO: 508), Figure 217 (SEQ ID NO: 510), Figure 219 (SEQ ID NO: 515), Figure 222 (SEQ ID NO: 523), Figure 225 (SEQ ID NO: 526), FIG. 230 (SEQ ID NO: 612), FIG. 232 (SEQ ID NO: 61 4), the extracellular domain of the polypeptide described in FIG. 234 (SEQ ID NO: 616) or 236 (SEQ ID NO: 618) And an isolated polypeptide having at least 80% amino acid sequence identity with. Contacting a sample suspected of containing a PRO4993 polypeptide with a PRO337 polypeptide and identifying the formation of a PRO4993 / PRO337 polypeptide conjugate in the sample, which indicates the presence of a PRO4993 polypeptide in the sample Method for detecting a PRO4993 polypeptide. The method of claim 22, wherein said sample comprises cells suspected of expressing said PRO4993 polypeptide. The method of claim 22, wherein said PRO337 polypeptide is labeled with a detectable label. The method of claim 22, wherein said PRO337 polypeptide is bound to a solid support. Contacting a sample suspected of containing a PRO337 polypeptide with a PRO4993 polypeptide and identifying the formation of a PRO4993 / PRO337 polypeptide conjugate in the sample, which indicates the presence of a PRO337 polypeptide in the sample Method for detecting a PRO337 polypeptide. The method of claim 26, wherein said sample comprises cells suspected of expressing said PRO337 polypeptide. The method of claim 26, wherein the PRO4993 polypeptide is labeled with a detectable label. The method of claim 26, wherein the PRO4993 polypeptide is bound to a solid support. Contacting a sample suspected of containing a PRO1559 polypeptide with a PRO725, PRO700, or PRO739 polypeptide and confirming the formation of a PRO1559 / PRO725, PRO700, or PRO739 polypeptide conjugate in the sample, indicating the presence of the PRO1559 polypeptide in the sample And detecting the PRO1559 polypeptide in the sample. The method of claim 30, wherein said sample comprises cells suspected of expressing said PRO1559 polypeptide. The method of claim 30, wherein said PRO725, PRO700 or PRO739 polypeptide is labeled with a detectable label. The method of claim 30, wherein said PRO725, PRO700 or PRO739 polypeptide is bound to a solid support. Contacting a sample suspected of containing a PRO725, PRO700, or PRO739 polypeptide with a PRO1559 polypeptide and forming a PRO1559 / PRO725, PRO700, or PRO739 polypeptide conjugate in the sample, indicating that the sample has a PRO725, PRO700, or PRO739 polypeptide Method of detecting a PRO725, PRO700 or PRO739 polypeptide in the sample. The method of claim 34, wherein said sample comprises cells suspected of expressing said PRO725, PRO700 or PRO739 polypeptide. The method of claim 34, wherein said PRO1559 polypeptide is labeled with a detectable label. The method of claim 34, wherein the PRO1559 polypeptide is bound to a solid support. Contacting a cell expressing a PRO337 polypeptide with a PRO4993 polypeptide bound to a bioactive molecule and binding the PRO337 and PRO4993 polypeptide to each other such that the bioactive molecule is linked to the cell. How to link active molecules. The method of claim 38, wherein said bioactive molecule is a toxin, radiolabel or antibody. The method of claim 38, wherein said bioactive molecule kills said cell. Contacting a cell expressing a PRO4993 polypeptide with a PRO337 polypeptide bound to a bioactive molecule and binding the PRO4993 and PRO337 polypeptide to each other such that the bioactive molecule is linked to the cell. How to link active molecules. 42. The method of claim 41, wherein said bioactive molecule is a toxin, radiolabel or antibody. The method of claim 41, wherein the bioactive molecule kills the cell. Contacting a cell expressing a PRO1559 polypeptide with a PRO725, PRO700, or PRO739 polypeptide bound to a bioactive molecule and binding the PRO1559 and PRO725, PRO700, or PRO739 polypeptide to each other such that the bioactive molecule is linked to the cell Comprising, connecting the bioactive molecule to the cell. 45. The method of claim 44, wherein said bioactive molecule is a toxin, radiolabel or antibody. 45. The method of claim 44, wherein said bioactive molecule kills said cell. Contacting a cell expressing a PRO725, PRO700 or PRO739 polypeptide with a PRO1559 polypeptide bound to a bioactive molecule and binding the PRO1559 and PRO725, PRO700 or PRO739 polypeptide to each other such that the bioactive molecule is linked to the cell Comprising the bioactive molecule linked to the cell. 48. The method of claim 47, wherein said bioactive molecule is a toxin, an anti-label or an antibody. 48. The method of claim 47, wherein said bioactive molecule kills said cell. Contacting a cell expressing a PRO337 polypeptide with a PRO4993 polypeptide or an anti-PRO337 antibody such that the PRO4993 polypeptide or the anti-PRO337 antibody binds to the PRO337 polypeptide to modulate one or more biological activities of the cell A method of modulating one or more biological activities of. 51. The method of claim 50, wherein said cells are killed. Contacting a cell expressing a PRO4993 polypeptide with a PRO337 polypeptide or an anti-PRO4993 antibody such that the PRO337 polypeptide or the anti-PRO4993 antibody binds to the PRO4993 polypeptide to modulate one or more biological activities of the cell A method of modulating one or more biological activities of. The method of claim 52, wherein said cell is killed. By contacting a cell expressing a PRO1559 polypeptide with a PRO725, PRO700 or PRO739 polypeptide or an anti-PRO1559 antibody, the PRO725, PRO700 or PRO739 polypeptide or the anti-PRO1559 antibody binds to the PRO1559 polypeptide to effect one or more biological activities of the cell. A method of modulating one or more biological activities of the cell, comprising modulating. 55. The method of claim 54, wherein said cells are killed. By contacting a cell expressing a PRO725, PRO700 or PRO739 polypeptide with a PRO1559 polypeptide or an anti-PRO725, anti-PRO700 or anti-PRO739 antibody, the PRO1559 polypeptide or the anti-PRO725, anti-PRO700 or anti-PRO739 antibody may be Binding to a PRO700 or PRO739 polypeptide to modulate one or more biological activities of the cell. The method of claim 56, wherein said cell is killed.