JP2008136455A - Identification of protein controlling creation of antibody functioning in cell and cell phenotype - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a gene therapeutic composition against malignant cancer cells by identifying a factor deciding the phenotype of cells such as the cancer cells and obtaining an intracellular antibody specific to the factor, and also an expression library and a method for screening the same. <P>SOLUTION: This intracellular antibody inhibiting (activating) the change of phenotype of the cells is obtained by a screening method comprising a process of constructing a heavy chain variable region (VHH) expression library by randomizing the part of sequence of the VHH of a camel heavy chain antibody, and determining the sequence of the randomized part by isolating the VHH in the cells of expressing the change of the phenotype in cultured cells transformed by using the expression library. By using the intracellular antibody, it is possible to identify an intracellular physiologically active substance controlling the phenotype of the cells, and provide a gene therapeutic composition of the cancer by using a vector expressing the intracellular antibody. <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

The present invention provides a single domain intrabody expression live consisting of an intracellular expression vector constructed by artificially randomizing the heavy chain variable region (VHH) of a camel heavy chain antibody that functions as an antibody in a single domain. And a phenotypic change cell was isolated from the cultured human-derived cultured cell, and then a single domain intra region was isolated from the cell. The present invention relates to a method for screening an intracellular antibody (intrabody) for controlling a phenotype of a cell and a method for producing an intracellular antibody, including the steps of isolating a body expression vector and identifying a random sequence site.
Here, an intracellular antibody (intrabody) means an antibody that exhibits the ability to recognize and bind to an antigen molecule in the cell, but even a part of the antibody is the same as the antibody. For example, a single domain intrabody (VHH) is also included.
The present invention also relates to a method for identifying an intracellular physiologically active substance that controls a cell phenotype using an isolated intracellular antibody, and a pharmaceutical composition that targets the identified intracellular active substance.
The present invention also relates to an isolated intracellular antibody itself and a peptide corresponding to the antigen recognition site thereof, which have chemotaxis inhibitory activity for metastatic cancer, and a gene encoding them, and expression thereof Vectors and pharmaceutical compositions for treating metastatic cancer using these are also included in the invention.

  Cancer cell metastasis occurs when tumor cells in a tissue move away from the primary focus, penetrate the vascular endothelium, travel to the bloodstream, move to various parts of the body, and then penetrate the vascular endothelium to other tissues. This is a phenomenon in which tumor formation occurs after migration. In addition to gene mutation, multiple positive and negative factors are involved in a complex manner. In the disease of cancer, it is clear that this phenomenon of metastasis is directly linked to the mortality rate of cancer patients, as well as the canceration of cells, and even if a tumor is found, if it can be suppressed, surgery The problem of metastasis suppression is one of the major problems of clinical cancer treatment because the mortality of patients is expected to be greatly reduced by combination with clinical treatment or radiotherapy (Non-Patent Documents 4 to 4). 7).

  In the metastasis of cancer cells, the activation of the cell migration ability itself is one of the essential phenotypes of metastatic cancer cells. In many studies to date, the ability of cells to migrate through the concerted reorganization of the actin skeleton, which controls cell shape, and the temporal and spatial activation of Rho family proteins that are GTP hydrolases Although it has become clear that changes are involved (Non-Patent Documents 8 to 12), the mechanism of action at the molecular level, upstream signal regulation, and potential target genes for metastasis are still fully elucidated. (Non-Patent Document 13). As one of various methodologies for identifying genes involved in metastasis, various methodologies for identifying genes involved in metastasis have been studied (Non-Patent Documents 14 and 15). The present inventors use an antibody (intrabody) that functions in a cell to inhibit the function of the protein inside the cell and thereby identify a metastasis-related protein from the association with the change in the function of the cell's metastatic ability. A method was developed. This “intrabody that inhibits the function of the target protein inside the cell” can also be considered as a therapeutic agent at the molecular level for metastatic malignant cancer cells (Non-patent Documents 16 and 17). If such an intrabody can be used, complex and diverse intracellular signal transduction pathways that could not be elucidated by the conventional gene knockout method or gene silencing method can be grasped more clearly and accurately.

  However, an excellent intrabody that can be a therapeutic agent at the molecular level for metastatic malignant cancer cells has not yet been provided, and an effective means for screening the intrabody has not been established.

  On the other hand, a general screening method is to create a group of mutants with different phenotypes by performing some artificial gene mutation operation on a certain cell or individual, and perform screening based on a specific phenotype. The method of analyzing gene function by isolating a mutant having the phenotype of the gene and then analyzing the relationship between the mutant and the phenotype has long been used as an analysis method for molecular biology. I came.

  Specifically, it is a technique of expressing a peptide having a random sequence in a cell and screening based on the change of the cell. For example, a peptide that blocks yeast signal transduction (Non-patent Document 1), an anticancer agent Peptides that confer resistance to certain Taxol (Non-patent Document 2), peptides that block IL-4 signaling (Non-patent Document 3), and the like have been reported.

  However, these methods of “identifying peptides that change the phenotype of a cell by expressing a short peptide expression library having a random sequence in the cell” identify the low water solubility of the peptide or the protein in the cell. Since it is difficult to cause immunoprecipitation by acting on cell extracts due to problems such as the effects of degrading enzymes, it is extremely difficult to identify target proteins that interact with each other.

Moreover, since a peptide having a simple random sequence is used as it is, it is difficult to stably maintain a specific tertiary structure, and there is a concern that specificity and affinity for interaction with a target molecule inside the cell may be reduced. It is.
From this point of view, it is desired to construct an expression library that has some meaningful three-dimensional structure as a basic skeleton as a whole, and only a part of it has various sequences, and antibody-like proteins (peptides) Candidate

  However, in the case of a recombinant antibody used inside a normal cell, a monoclonal antibody-producing hybridoma that recognizes the antigen is first prepared by a normal method, and then a single chain antibody (single chain Fv: scFv) is encoded from the cDNA. Since an intracellular expression vector containing DNA is constructed, it is an antibody derived from a mouse or rat of a standard immunized animal, and is basically a complex of heavy chain (VH) and light chain (VL).

  Since a single chain antibody (scFv) has its heavy chain and light chain connected by a flexible peptide linker, its three-dimensional structure is not necessarily as stable as the original antibody. In addition, since the selection criteria as to whether to function inside a cell is not reflected at the time of antibody production, even if it functions in a test tube, it does not always exhibit the expected function when expressed inside the cell.

  Another screening method that has been actively used in recent years is to identify genes that change the phenotype of cells using siRNA libraries that suppress gene function based on RNA interference. In the case of the target protein, it is only suppression at the gene level, so if the target protein has multiple functions and properties after translation (for example, enzyme activity, complex-forming ability, intracellular localization change, sugar chain modification, It is impossible to elucidate which function is important because of post-translational modifications such as phosphorylation.

Norman, T.C., etal., (1999) Science, 285, 591-595. Xu, X., et al., (2001) Nat. Genet. 27, 23-29. Kinsella, T.M., et al., (2002) J. Biol. Chem. 277, 37512-37518 Christofori, G. (2006) Nature 441, 444-450. Furuta, E., etal., (2006) Front. Biosci. 11, 2845-2860. Bird, N. C., etal., (2006) J. Surg. Oncol. 94, 68-80. Mehlen, P. and Puisieux, A. (2006) Nat. Rev. Cancer 6, 449-458. Arber, S., etal., (1998) Nature 393, 805-809. Sahai, E. and Marshall, C. J. (2003) Nat. Cell Biol. 5, 711-719. Lambrechts, A., et al., (2004) Int. J. Biochem. Cell Biol. 36, 1890-1909. Kassis, J., etal., (2001) Semin. Cancer Biol. 11, 105-117. Etienne-Manneville, S. and Hall, A. (2002) Nature 420, 629-635. Bogenrieder, T. and Herlyn, M. (2003) Oncogene 22, 6524-6536. Schneider, I.C. and Haugh, J. M. (2006) Cell Cycle 5, 1130-1134. Fok, S. Y., etal., (2006) BMC Cancer 6, 151. Lobato, M. N. and Rabbitts, T. H. (2003) Trends Mol. Med. 9, 390-396. Lobato, M. N. and Rabbitts, T. H. (2004) Curr. Mol. Med. 4, 519-528. Bomsztyk, K., etal., (2004) Bioessays 26, 629-638. Bomsztyk, K., etal., (1997) FEBS Lett. 403, 113-115. Laury-Kleintop, L. D., et al., (2005) J. Cell. Biochem. 95, 1042-1056. Hamers-Casterman, C., et al., (1993) Nature 363, 446-448. Dumoulin, M., etal., (2002) Protein Sci. 11, 500-515. De Genst, E., etal., (2006) Dev. Comp. Immunol. 30, 187-198. Desmyter, A., etal., (2001) J. Biol. Chem. 276, 26285-26290. Jobling, S.A., etal., (2003) Nat. Biotechnol. 21, 77-80. Marquardt, A., et al., (2006) Chem. Eur. J. 12, 1915-1923. Suyama, E., etal., (2003) Proc. Natl. Acad. Sci. USA 100, 5616-5621. Suyama, E., etal., (2003) Cancer Res. 63, 119-124. Krecic, A.M. and Swanson, M.S. (1999) Curr. Opin.Cell Biol. 11, 363-371. Ostrowski, J. andBomsztyk, K. (2003) Br. J. Cancer 89, 1493-1501. Weighardt, F., etal., (1996) Bioessays 18, 747-756. Nagano, K., etal., (2006) EMBO J. 25, 1871-1882. Michelotti, E.F., et al., (1996) Mol. Cell Biol. 16, 2350-2360. Michael, W.M., etal., (1997) EMBO J. 16, 3587-3598. Mikula, M., etal., (2006) Proteomics 6, 2395-2406. Taylor, S. J. and Shalloway, D. (1994) Nature 368, 867-871. Bustelo, X.R. (2001) Oncogene 20, 6372-6381. de Hoog, C.L., etal., (2004) Cell 117, 649-662. Habelhah, H., etal., (2001) Nat. Cell Biol. 3, 325-330. Albini, A., etal., (1987) Cancer Res. 47, 3239-3245. Edin, M.L., etal., (2001) Exp. Cell Res. 270, 214-222. Bittner, M., etal., (2000) Nature 406, 536-540. MacDonald, T.J., et al., (2001) Nat. Genet. 29, 143-152. Ramaswamy, S., etal., (2003) Nat. Genet. 33, 49-54. Albini, A., etal., (1987) Cancer Res. 47, 3239-3245. Edin, M.L., etal., (2001) Exp. Cell Res. 270, 214-222. Bittner, M., etal., (2000) Nature 406, 536-540. MacDonald, T.J., et al., (2001) Nat. Genet. 29, 143-152. Ramaswamy, S., etal., (2003) Nat. Genet. 33, 49-54.

An object of the present invention is to determine a factor that controls the phenotype of a cell such as a cancer cell, and at the same time to provide a specific intracellular antibody (intrabody) against the factor. In particular, it is an object of the present invention to provide an excellent intracellular antibody that can be a therapeutic agent at the molecular level against metastatic malignant cancer cells.
From another point of view, the present invention also provides an expression library itself capable of obtaining an antibody that exerts a function that causes a change in the phenotype of the cell in the cell, a screening method using the expression library, The object is to provide a method for identifying a factor that controls a phenotype.

As a result of intensive investigation of an expression library and a screening method that can achieve the above-mentioned object, the inventors have no heavy chain instead of a single chain antibody (scFv) that has been used as an intrabody. We focused on camel antibodies that recognize antigens (Non-patent Document 21).
The camel antibody heavy chain functions in the same way as the antibody with only the variable domain (VHH) responsible for antigen recognition, and its molecular weight is approximately 15 kDa. The molecular weight of general IgG (approximately 165 kDa) and the molecular weight of scFv (approximately 28 kDa) ) Is very small. Further, even if one part of the three hypervariable region (CDR) sequences was changed, it was predicted that the thermodynamically stable and post-translational holding error was low (Non-patent Document 22). Expected that the camel heavy chain antibody VHH would be easy to handle in terms of protein engineering, such as being difficult to be insolubilized by aggregation even when expressed in Escherichia coli or the like.

  And there are three CDRs in the camel antibody VHH, similar to the CDRs in the heavy chain variable region (VH) of general antibodies such as mice and humans, but the third CDR of VHH (CDR3) is VHH. Compared to that (around 10 amino acids), it is relatively long (16-24 amino acids). It has been reported that when the target molecule (antigen) is a type of enzyme having a substrate binding site in a hydrophobic depression or groove, a long CDR3 enters the depression and effectively inhibits the enzyme function (non-patented) From the literatures 23 and 24), the present inventors paid particular attention to the CDR3 region among the CDRs.

The fact that VHH acts as an intrabody is an enzyme (starch) in vitro and in plant cells.
An example in which the activity of branching enzyme A: SBE A) is suppressed has been reported, and when VHH is expressed as an intrabody, SBE A enzyme activity is detected in plant cell extracts as anti-antibody targeting the SBE A gene. It was more effectively suppressed than that due to suppression of SBE A expression by sense (Non-patent Document 25).

From the above, the present inventors decided to use the heavy chain variable region (VHH) of a camel heavy chain antibody in the construction of an effective expression library, and the three hypervariable regions (complementary) in VHH. A VHH expression vector library (single domain intrabody expression library) was constructed so that a recombinant antibody in which one of the sex determining regions (CDR) was randomly sequenced could be expressed inside the cell.
If all the VHH expression vectors are transfected into cultured cells and culture is continued, the properties of the cells will change depending on which single domain / intrabody is expressed. Select cells that showed type changes. In the examples, cultured cells derived from human fibrosarcoma with high metastatic potential are transfected, and cells having a reduced migration ability are selected from the cells. Intrabodies (cells) that have the function of changing the phenotype of cells by recovering expression vectors from the cells obtained by this screening and determining the random sequence portion of the single domain intrabody encoded therein. Internal antibody), for example, an intrabody having a function of reducing the migration ability of metastatic cancer cells without inducing cell death.

Since the peptide corresponding to the antigen recognition site of this intrabody is usually intact or has antigen binding properties by cyclization, not only the DNA encoding the intrabody but also the DNA encoding the peptide can be used, for example, in cancer cells. Can be used to inhibit factors that determine the phenotype of cancer cells, so that these DNAs can be expressed in cells, and the expression vectors should be used as pharmaceutical compositions for gene therapy. Can do.
Further, by selecting a factor that specifically binds when the cell type is changed using the intrabody obtained by the above screening method, a factor that determines the phenotype of the cell can be screened. .

  The present inventors actually applied an intracellular antibody (SD-iAb-47) that suppresses the chemotaxis of metastatic cancer cells by applying a screening method using this VHH expression library to metastatic cancer cells. Then, the intracellular protein hnRNP-K (heterogeneous nuclear ribonucleoprotein K) that specifically binds to the intracellular antibody to form a complex could be identified. This protein called hnRNP-K has a wide variety of functions, and not all of them have yet been elucidated (Non-patent Documents 18-20). However, the present inventors have used SD-iAb-47 in detail. As a result, we were able to prove for the first time in the world that hnRNP-K is deeply involved in cell motility and could be a potential target for cancer therapy.

The present invention has been completed as described above based on these findings, and these are summarized as follows.
(1) DNA comprising a base sequence encoding the heavy chain variable region (VHH) of a camel heavy chain antibody, wherein a part of the base sequence encoding the complementarity determining region (CDR) is randomized A VHH expression library comprising an intracellular expression vector into which is incorporated.
(2) One part of DNA to be randomized among base sequences encoding the complementarity determining region (CDR) is DNA corresponding to all or one part of the base sequence encoding the third CDR (CDR3). The VHH expression library according to (1), wherein the first and second CDRs (CDR1 and CDR2) are the same.
(3) DNA corresponding to all or part of the base sequence encoding the CDR3, wherein the randomized DNA has a base sequence corresponding to 5 to 24 codons, and is located at both ends of the DNA. Is a VHH expression library according to (2), wherein a restriction enzyme recognition sequence is introduced.
(4) The VHH expression library according to any one of (1) to (3), wherein the intracellular expression vector is a plasmid vector having a CMV promoter.
(5) The VHH expression library according to any one of (1) to (4), wherein the camel heavy chain antibody is derived from an anti-chicken lysozyme antibody.
(6) Using the VHH expression library according to any one of (1) to (5),
(A) transforming cultured cells with the VHH expression vector of the library and observing changes in the phenotype of the cultured cells;
(B) separating the cultured cells whose phenotype has changed in (a) and recovering the expression vector from the cultured cells;
(C) amplifying the DNA containing the randomized base sequence contained in the expression vector recovered in (b);
(D) analyzing the base sequence of the DNA amplified in (c) and determining the amino acid sequence of the antigen recognition site;
A method for screening an intracellular antibody having an antigen recognition site that promotes or reduces the activity of a physiologically active substance involved in phenotyping of a cell.
(7) The step of amplifying the DNA of (c) is to amplify by transforming Escherichia coli using the expression vector recovered in (b). The screening method according to (6), wherein the steps (a) to (c) are repeated.
(8) In the screening method according to (6) or (7), the cultured cell transformed in (a) is a cancer cell line, and the observation of the phenotypic change is the observation of decreased chemotaxis A method for screening an intracellular antibody having an antigen recognition site that suppresses the chemotaxis of cancer cells.
(9) Using the VHH expression library according to any one of (1) to (5),
(A) transforming cultured cells with the VHH expression vector of the library and observing changes in the phenotype of the cultured cells;
(B) separating the cultured cells whose phenotype has changed in (a) and recovering the expression vector from the cultured cells;
(C) amplifying the DNA containing the randomized base sequence contained in the expression vector recovered in (b);
(D) analyzing the base sequence of the DNA amplified in (c) and determining the amino acid sequence of the antigen recognition site;
(E) synthesizing a vector containing a DNA encoding a variable region having the amino acid sequence determined in (d) and expressed in a desired cell;
A method for producing an intracellular antibody expression vector that promotes or reduces the activity of a physiologically active substance involved in phenotyping of a cell.
(10) The step of amplifying the DNA of (c) is for transforming and amplifying Escherichia coli using the expression vector recovered in (b), and for the obtained pool of expression vectors. The method for producing an intracellular antibody expression vector according to (9), wherein the steps (a) to (c) are repeated.
(11) In the method for producing an intracellular antibody expression vector according to (9) or (10), the cultured cell transformed in (a) is a cancer cell line, and observation of its phenotypic change is chemotaxis A method for producing an intracellular antibody expression vector that suppresses cancer cell chemotaxis or metastasis, characterized by observing a decrease in sexiness.
(12) A cell obtained by the method for producing an intracellular antibody expression vector according to any one of (9) to (11), wherein the activity of a physiologically active substance involved in phenotyping of a cell is promoted or reduced. An internal antibody expression vector.
(13) An intracellular antibody expression vector having the activity of inhibiting the chemotaxis of metastatic cancer cells, obtained by the method for producing an intracellular antibody expression vector according to (11).
(14) The DNA encoding a variable region of an intracellular antibody expression vector contains a base sequence encoding “YLAGVEVWRRRVGLC (SEQ ID NO: 14)” in its heavy chain CDR3 (13) Intracellular antibody expression vectors.
(15) An intracellular antibody having a chemotactic inhibitory activity of metastatic cancer cells produced by transforming a cell with the intracellular antibody expression vector according to (13).
(16) Using the VHH expression library according to any one of (1) to (5),
(A) a step of transforming a cultured cell with the VHH expression vector of the library and observing a change in the phenotype of the cell due to the action of an intracellular antibody;
(B) a step of isolating a cultured cell having a changed phenotype and recovering an expression vector from the inside of the cultured cell;
(C) transforming the expression vector recovered in (b) into E. coli and amplifying it,
(D) repeating the steps (a) to (c) for the pool of expression vectors amplified in (c),
(E) identifying an antigen recognition site of an intracellular antibody that changes the expression type of the cell;
(F) a step of expressing an intracellular antibody in transformed cultured cells using an expression vector comprising a base sequence encoding an intracellular antibody having the antigen recognition site identified in (e) and a tag sequence;
(G) a step of precipitating a complex of the intracellular antibody and the endogenous protein expressed in (f), and collecting the tag of the intracellular antibody using as an index,
A method for identifying an intracellular physiologically active substance involved in determining a specific phenotype of a cell, comprising:
(17) In the step (f) described in the above (16), the tag sequence to be bound to the nucleotide sequence encoding the intracellular antibody encodes a specific binding molecule of streptavidin, and the step (g) Then, the complex of the specific binding molecule and intracellular antibody is affinity precipitated from the cell lysate using a streptavidin-immobilized carrier, followed by molecular weight fractionation by SDS-polyacrylamide gel electrophoresis and liquid chromatography. The method for identifying an intracellular physiologically active substance according to (16) above, which is a step of analyzing a specific binding molecule using a chromatography / tandem mass spectrometer.
(18) In the method for identifying an intracellular physiologically active substance according to (16) or (17), the cultured cell is a metastatic cancer cell line, and the observation of the phenotypic change is the observation of a decrease in chemotaxis. A method for identifying a protein involved in the chemotaxis of metastatic cancer cells, characterized in that it is.
(19) The cell according to (13) or (14) above, wherein an intracellular protein involved in the chemotaxis of metastatic cancer cells identified using the identification method according to (18) above is used as a target molecule for cancer treatment. A composition for cancer treatment for suppressing the chemotaxis of metastatic cancer, comprising an internal antibody expression vector as an active ingredient.
(20) The intracellular protein involved in the chemotaxis of metastatic cancer cells is hnRNP-K (heterogeneous nuclear ribonucleoprotein K), for suppressing the chemotaxis of metastatic cancer according to the above (19) A composition for cancer treatment.
(21) The composition for cancer treatment for suppressing the chemotaxis of metastatic cancer according to (20), which comprises the intracellular antibody expression vector of (14) as an active ingredient.
(22) A peptide comprising the amino acid sequence of “YLAGVEVWRRRVGLC (SEQ ID NO: 14)”.
(23) A peptide having an activity of suppressing the chemotaxis of metastatic cancer cells, comprising an amino acid sequence including “YLAGVEEVWRRRVGLC (SEQ ID NO: 14)”.
(24) DNA encoding the amino acid sequence of “YLAGVEVWRRRVGLC (SEQ ID NO: 14)”.
(25) DNA comprising a base sequence of “5′-TATTTGGCTGGGGTTGAGGTTTGGCGTAGGAGGGTTGGTTTGTGT-3 ′ (SEQ ID NO: 15)”.
(26) A DNA encoding a peptide comprising the base sequence of “5′-TATTTGGCTGGGGTTGAGGTTTGGCGTAGGAGGGTTGGTTTGTGT-3 ′” (SEQ ID NO: 15) and having a chemotactic inhibitory activity on metastatic cancer cells.
(27) An intracellular antibody having a heavy chain variable region having a chemotactic inhibitory activity of metastatic cancer cells, wherein the amino acid sequence of heavy chain CDR3 comprises the amino acid sequence consisting of SEQ ID NO: 14.
(28) The intracellular antibody according to (27) above, wherein the amino acid sequence of the intracellular antibody is an amino acid sequence derived from a camel heavy chain antibody other than the amino acid sequence of heavy chain CDR3.
(29) A DNA encoding an intracellular antibody comprising a heavy chain variable region containing an antigen recognition site having chemotactic inhibitory activity of metastatic cancer cells according to (27) or (28).
(30) A peptide comprising the DNA encoding the intracellular antibody according to any one of (24) to (26) or (29), which is expressed in metastatic cancer cells and suppresses chemotaxis of cancer cells Alternatively, an expression vector that produces intracellular antibodies.
(31) A composition for cancer treatment for suppressing the chemotaxis of metastatic cancer, comprising the expression vector according to (30) as an active ingredient.

  The single domain intrabody expression library according to the present invention, that is, the VHH expression library (SD-iAb expression library), is far more expensive than the genome-wide RNAi library that requires enormous cost, time and manpower. It can be constructed easily and at low cost.

In RNAi libraries, etc., when they are introduced into a cell, the target protein already exists cannot be suppressed, so the effect remains until they are metabolized by the original cell function. . Therefore, it cannot be effectively suppressed when the expression level of the target protein is large, stable and the degradation rate is low. In that respect, our SD-iAb expression library acts on the target protein at the protein level, so it can exert its inhibitory function even if it already exists when the library is acted on. It is advantageous.
In fact, only by using a screening method using this VHH expression library, an intracellular antibody (SD-iAb-47) that suppresses the chemotaxis of metastatic cancer cells has just been obtained. In addition, the intracellular protein hnRNP-K that specifically binds to and forms a complex with this SD-iAb-47 can be identified as a factor that controls cell chemotaxis. Factors could also be provided.

  In general, gene function screening based on RNAi phenomenon or gene knockdown based on homologous recombination is used for screening of gene function based on phenotypic change by suppressing cell function, but gene knockout and knockdown are lethal. Some factors like hnRNP-K cannot be obtained by the screening. If the method of the present invention using SD-iAb, which can suppress only a part of the function of the translation product (protein) of the target gene, analysis of the protein function that directly leads to lethal such expression suppression Can be realized.

  The methodologies using the SD-iAb expression library of the inventors can be said to be a method that supplements RNAi technology and conventional gene knockdown methods, and are very important in molecular biological analysis of future cell functions. It is a useful tool.

  In addition, the single domain intrabody SD-iAb-47 obtained in the Examples efficiently suppresses the chemotaxis of HT1080, which is a cancer cell that originally exhibits high chemotaxis, without causing cell death. Furthermore, the invasion ability of HT1080 based on it was also effectively suppressed. This means that introduction of single-domain intrabody SD-iAb-47 into malignant cancer cells with high metastasis can contribute to cancer treatment. When introduced as a protein, SD-iAb-47 itself is a cancer therapeutic agent.

Introducing single domain intrabody SD-iAb-47 into highly metastatic malignant cancer cells can contribute to cancer treatment. In the case of the technique of introducing the expression vector into the cell, it can be used in the form of gene therapy. At that time, a peptide comprising a selected random sequence in SD-iAb-47 is also effective in suppressing the chemotaxis of cancer cells, and an expression vector for the DNA encoding it can also be used as a cancer therapeutic agent.
A single domain intrabody obtained by the same screening method can be expected to have the same effect as SD-iAb-47.

  From the results of the Examples, as a result of screening based on the chemotaxis suppressing function of metastatic cancer cells using the SD-iAb expression library, an intracellular antibody SD that efficiently suppresses chemotaxis without inducing cell death. -iAb-47 was obtained, revealing that the interacting target protein was hnRNP-K. The fact that the target protein hnRNP-K is involved in cell chemotaxis is the first finding obtained in this example, and it can suppress the metastasis of cancer cells by reducing its cytoplasmic local concentration. Because it can, it can be considered as a new target for cancer treatment. Therefore, by further searching for a substance that binds to hnRNP-K, a substance that suppresses the chemotactic function of hnRNP-K can be obtained, and the substance thus obtained is used as a therapeutic agent for metastatic cancer. Can be used. When the substance that suppresses the chemotaxis function of hnRNP-K is a protein, the gene encoding it is a gene therapy drug.

  In the examples, screening is performed with a focus on the phenotype of chemotaxis of metastatic cancer cells, but changes in the antigen presentation pattern on the cell surface are detected with a labeled antibody and isolated by a machine such as a cell sorter. In combination with the latest screening technology, it is possible to perform screening based on various phenotypic changes other than those performed in the examples.

The present invention is a DNA comprising a base sequence encoding the heavy chain variable region (VHH) of a camel heavy chain antibody, wherein a part of the base sequence encoding the complementarity determining region (CDR) is randomized. The invention relates to a VHH expression library composed of an intracellular expression vector into which DNA is incorporated. Of the nucleotide sequence encoding the complementarity determining region (CDR), the DNA to be randomized may be any one of the three CDRs, but preferably the nucleotide sequence encoding the third CDR (CDR3). The DNA corresponding to all or one part is randomized, and the first and second CDRs (CDR1 and CDR2) are left as they are. More preferably, all or one part of the nucleotide sequence encoding CDR3 DNA having a nucleotide sequence corresponding to 5 to 24 codons (most preferably 15 codons) is randomized, and a restriction enzyme recognition sequence is introduced at both ends of the DNA. Is preferred.
The intracellular expression vector may be any vector that can be expressed in a cell (preferably in a mammalian cell), but is preferably a vector that can be expressed in E. coli at the same time, and in particular, a plasmid vector having a CMV promoter. Is preferred.
The camel heavy chain antibody may be any antibody that recognizes any antigen, but preferably has the entire base sequence determined, for example, an antibody derived from an anti-chicken lysozyme antibody.

The present invention uses the VHH expression library,
(A) transforming cultured cells with the VHH expression vector of the library and observing changes in the phenotype of the cultured cells;
(B) separating the cultured cells whose phenotype has changed in (a) and recovering the expression vector from the cultured cells;
(C) amplifying the DNA containing the randomized base sequence contained in the expression vector recovered in (b),
(D) analyzing the base sequence of the DNA amplified in (c) and determining the amino acid sequence of the antigen recognition site;
The present invention relates to a method for screening an intracellular antibody having an antigen recognition site that promotes or reduces the activity of a physiologically active substance involved in cell phenotype determination.
The steps (a) to (c) correspond to a single screening step, and this step may be performed only once, but preferably about 2 to 10 times for the obtained pool of expression vectors. It is desirable to repeat 4 or 5 times. As a method for amplifying DNA, random sequences in the obtained plasmid can be amplified by PCR method and directly sequenced, or the obtained expression vector can be used to transform Escherichia coli to colonize. Thus, after amplification, the base sequence of the random region can be determined.

The cells transformed in (a) that are targets of the screening method of the present invention may be any cells that can be cultured and can observe changes in their phenotype. Is a cancer cell line, and phenotypic changes include easy-to-observe chemotaxis changes (see Examples), adhesion changes, chromogenic changes, focus-forming ability changes, apoptosis-inducing drugs Changes in resistance to anticancer agents and anticancer agents, and changes in growth ability on agar medium are preferred.
In the examples, screening is performed with a focus on the phenotype of chemotaxis of metastatic cancer cells, but changes in the antigen presentation pattern on the cell surface are detected with a labeled antibody and isolated by a machine such as a cell sorter. In combination with the latest screening technology, screening based on various phenotypic changes is possible.

  In the examples, the intracellular antibody SD-iAb is delocalized inside the cytoplasm, but the function of the intracellular antibody is controlled by adding a signal peptide sequence that is localized in the nucleus, mitochondria, and endoplasmic reticulum. Is possible.

  In Examples, SD-iAb-47 to which VP-16, which is a nuclear localization signal, is added does not have a function of reducing cell chemotaxis. This means that there is an important correlation between the intracellular localization of intracellular antibodies and their influence on the phenotype of the cells. By using such additional sequences during screening, more diverse cell phenotype control is possible.

The present invention also uses the VHH expression library described above,
(A) transforming cultured cells with the VHH expression vector of the library and observing changes in the phenotype of the cultured cells;
(B) separating the cultured cells whose phenotype has changed in (a) and recovering the expression vector from the cultured cells;
(C) amplifying the DNA containing the randomized base sequence contained in the expression vector recovered in (b);
(D) analyzing the base sequence of the DNA amplified in (c) and determining the amino acid sequence of the antigen recognition site;
(E) synthesizing a vector containing a DNA encoding a variable region having the amino acid sequence determined in (d) and expressed in a desired cell;
A method for producing an intracellular antibody expression vector that promotes or reduces the activity of a physiologically active substance involved in cell phenotyping, preferably the DNA of (c) above Is amplified by transforming E. coli using the expression vector recovered in (b), and the above-mentioned pools of expression vectors are further subjected to the above (a) to (c). This process is repeated.
Typically, the cultured cell transformed in the above (a) is a cancer cell line, and the observation of the phenotypic change is the observation of the decrease in chemotaxis, The present invention relates to a method for producing an intracellular antibody expression vector that suppresses oxidization or metastasis.

  Furthermore, the present invention relates to an intracellular antibody expression vector itself that promotes or reduces the activity of a physiologically active substance involved in cell phenotype determination obtained by the above-described method for producing an intracellular antibody expression vector. It is. Preferably, it relates to an intracellular antibody expression vector having a chemotactic inhibitory activity of metastatic cancer cells, and more preferably, a DNA encoding a variable region of the intracellular antibody expression vector is The chain CDR3 contains a base sequence encoding “YLAGVEVWRRRVGLC (SEQ ID NO: 14)”.

  Further, the present invention is an invention relating to an intracellular antibody itself having a chemotaxis inhibitory activity of metastatic cancer cells produced by transforming cells using the intracellular antibody expression vector. . Preferably, it has a heavy chain variable region (VHH) derived from a camel heavy chain antibody as a basic skeleton, and has “YLAGVEVWRRRVGLC (SEQ ID NO: 14)” in the heavy chain CDR3, typically SD obtained in the Examples. -This is related to iAb-47.

The present invention uses the VHH expression library,
(A) a step of transforming a cultured cell with the VHH expression vector of the library and observing a change in the phenotype of the cell due to the action of an intracellular antibody;
(B) a step of isolating a cultured cell having a changed phenotype and recovering an expression vector from the inside of the cultured cell;
(C) transforming the expression vector recovered in (b) into E. coli and amplifying it,
(D) repeating the steps (a) to (c) for the pool of expression vectors amplified in (c),
(E) identifying an antigen recognition site of an intracellular antibody that changes the expression type of the cell;
(F) a step of expressing an intracellular antibody in transformed cultured cells using an expression vector comprising a base sequence encoding an intracellular antibody having the antigen recognition site identified in (e) and a tag sequence;
(G) a step of precipitating a complex of the intracellular antibody and the endogenous protein expressed in (f), and collecting the tag of the intracellular antibody using as an index,
The invention relates to a method for identifying an intracellular physiologically active substance involved in determination of a specific phenotype of a cell.
In the above step (f), the tag sequence to be bound to the base sequence encoding the intracellular antibody is a known tag sequence, for example, a general histidine tag, a FLAG tag manufactured by Sigma, Merck (formerly Novagen) T7 • tag, HSV • Tag, CBD • Tag, GST • Tag, S • Tag, etc., manufactured by the same company, can be used, but preferably encodes a specific binding molecule for streptavidin. In the step (g), SDS-polyacrylamide is used as a step after affinity-precipitation of the complex of the specific binding molecule and the intracellular antibody from the cell lysate using a streptavidin-immobilized carrier or the like. A step of performing molecular weight fractionation by gel electrophoresis and analyzing specific binding molecules using a liquid chromatography / tandem mass spectrometer may be provided.
The cultured cell is preferably a cancer cell line, and any phenotypic change may be observed. Typically, a metastatic cancer cell line is used to observe a decrease in chemotaxis. Thus, the invention relates to a method for identifying a protein involved in the chemotaxis of metastatic cancer cells.

  And this invention contains the said intracellular antibody expression vector which targets the intracellular protein identified by the said identification method as an active ingredient, The cancer treatment for suppressing the chemotaxis of metastatic cancer In particular, hnRNP-K is preferred as the target intracellular protein.

From another point of view, the present invention relates to a peptide having an amino acid sequence of “YLAVEVWRRRRGLC (SEQ ID NO: 14)” having a chemotactic inhibitory activity of metastatic cancer cells and a DNA encoding the amino acid sequence of SEQ ID NO: 14. It is such an invention. Preferably, both ends of the amino acid sequence of SEQ ID NO: 14 are connected and can be used as a cyclized peptide.
The present invention also relates to an intracellular antibody having a heavy chain variable region in which the amino acid sequence of heavy chain CDR3 comprises the amino acid sequence consisting of SEQ ID NO: 14, and has an activity of inhibiting chemotaxis of metastatic cancer cells. It is an invention related to intracellular antibodies. Preferably, an amino acid sequence derived from a camel heavy chain antibody other than the amino acid sequence of heavy chain CDR3.
The present invention also relates to a DNA encoding an intracellular antibody comprising a heavy chain variable region having chemotaxis suppressing activity of the metastatic cancer cell, and an expression vector containing the DNA, It is an invention relating to an expression vector that produces a peptide or intracellular antibody that is expressed in sex cancer cells and suppresses the chemotaxis of cancer cells.
Furthermore, the present invention is also an invention relating to a composition for cancer treatment for suppressing the chemotaxis of metastatic cancer, comprising the expression vector as an active ingredient.

EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples, but the present invention is not limited to these examples.
(Example 1)
VHH (cAb-Lys3) derived from the anti-chicken lysozyme antibody of the camel antibody whose gene sequence has already been reported is selected as the basic skeleton of the intrabody, and the expression vector is a site that performs strong gene expression in mammalian cells Invitrogen pcDNA3.1-Hygro having a CMV promoter derived from megalovirus was used (FIG. 1A). The DNA sequence of the plasmid “pcDNA3.1 / Hygro-cAb-Lys3” obtained by cloning the anti-chick sozyme-camel antibody cAb-Lys3 into the expression vector pcDNA3.1 / Hygro is shown as (SEQ ID NO: 1). The DNA sequence (having a histidine tag at the C terminus) corresponding to the ORF of the anti-chicken sozyme-camel antibody cAb-Lys3 contained in (SEQ ID NO: 1) is shown as (SEQ ID NO: 8), and the amino acid sequence (SEQ ID NO: 8) 11). The expression was confirmed by Western blotting with a FLAG tag sequence at the C-terminal of VHH. In actual screening, those having a histidine tag sequence instead of a FLAG tag sequence were used. A restriction enzyme Sfi I recognition site for cloning random sequences was introduced before and after CDR3 of cAb-Lys3 serving as the backbone (FIG. 1B). Among the pcDNA3.1 / Hygro plasmid vectors, the DNA sequence of the plasmid “pcDNA3.1 / Hygro-VHH-Sfi” in which the restriction enzyme Sfi I recognition site is introduced into the CDR3 part of pcDNA3.1 / Hygro is (SEQ ID NO: 2) Show. The DNA sequence corresponding to the VHH-Sfi ORF in (SEQ ID NO: 2) (having a histidine tag at the C-terminus) is shown as (SEQ ID NO: 9), and the amino acid sequence is shown as (SEQ ID NO: 12).
It was confirmed by Western blotting using an anti-FLAG antibody that VHH (VHH-Sfi) serving as the basic skeleton was expressed in mammalian cells (293T cells derived from human kidney) (FIG. 1C).
Since the result was good, a DNA having a sequence that can be cloned into the above Sfi I recognition site at both ends and a randomized sequence corresponding to 15 codons was chemically synthesized, and the restriction enzyme Sfi Ligated with the above expression vector digested with I. The random sequence part uses the general NNK codon method (N is one of A, G, C, T, K is limited to either G or T), and 20 types of amino acids appear relatively evenly. Therefore, it was decided to minimize the frequency of appearance of stop codons. The CDR3 derived from cAb-Lys3 has been reported to bind to the antigen chick lysozyme in the same manner as cAb-Lys3 when the N-terminus and C-terminus are linked by a disulfide bond and cyclized. (Non-patent Document 26), CDR1 and CDR2 of cAb-Lys3 as a skeleton were left as they were. The DNA sequence of the template DNA “dSD-iAb-lib” of the random DNA library introduced into the VHH-Sfi restriction site of the “pcDNA3.1 / Hygro-VHH-Sfi” plasmid vector is shown as (SEQ ID NO: 3). “DSD-iAb-lib” is a chemically synthesized single-stranded DNA, which is PCR-prepared using an upstream primer (SEQ ID NO: 4) and a downstream primer (SEQ ID NO: 5) to form a double-stranded DNA, and then Sfi I Digested and cloned into pcDNA3.1 / Hygro-VHH-Sfi plasmid vector. DNA of plasmid "pcDNA3.1 / Hygro-dSD-iAb-lib" in which a random DNA sequence of 15 codons is introduced into the restriction enzyme SfiI recognition site of VHH-Sfi of this pcDNA3.1 / Hygro-VHH-Sfi plasmid vector The sequence is shown as (SEQ ID NO: 6).

The chemically synthesized DNA consisting of a random sequence and the above expression vector digested with the restriction enzyme Sfi I were ligated by a conventional method, and then a general E. coli strain for genetic engineering was transformed and amplified using it. A portion of the E. coli pool was colonized, and the DNA sequence encoding the CDR3 region of the plasmid (expression vector) of each of 36 clones of E. coli was analyzed. As a result, a complete VHH was not expressed because it contained a stop codon. The ratio of products (stop codon content) was 33%. When a random sequence is created by the NNK codon method, since the appearance rate of stop codon is 3.125%, the probability that a stop codon does not appear per codon is 100−3.125 = 96.875%. Therefore, when 15 amino acids are consecutive, the probability that a stop codon does not appear therein is 0.96875 to the 15th power of 0.621, which is about 62%. From this, when 15 amino acids are consecutive, the existence probability of a plasmid containing a stop codon is 100-62 = 38%, and this value is almost equal to the actual stop codon content of 33%. Diversity of the expression vector library that expresses the complete VHH by estimating the diversity of the expression vector library including the random sequence as 2.7 × 10 ⁶ from the above transformation efficiency and calculating from the stop codon content 38% Was estimated to be 1.7 × 10 ⁶ species.

The VHH expression plasmid library constructed in this way was analyzed by Western blotting using a 293T cultured cell and an anti-FLAG tag antibody to determine whether a full-length VHH was expressed in mammalian cultured cells (FIG. 1C).
As a result, the VHH library expressed from an expression library with a random sequence is translated in the correct frame because it has a FLAG tag at its C-terminus in cultured mammalian cells, and its origin is anti-chicken lysozyme. It was confirmed that the molecular weight was almost the same as that of VHH-Sfi, which is VHH into which the antibody VHH (cAb-Lys3) and its basic skeleton Sfi I cloning site were introduced.
As described above, an expression plasmid library (SD-iAb expression live) consisting of “pcDNA3.1 / Hygro-dSD-iAb-lib” that can correctly express a VHH library in which only CDR3 is randomly arranged inside the cell. Rally) was successfully constructed.

(Example 2)
The SD-iAb expression library obtained as described above was transfected into a highly metastatic human fibrosarcoma-derived cancer cell line HT1080, and a cell chemotaxis assay was performed 24 hours later (Non-patent Document) 27, 28). FIG. 2A schematically shows the operation. Cells not affected by SD-iAb expressed inside the cells by transfection of the above-mentioned SD-iAb expression library are attracted to the chemotactic attractant in the lower chamber and pass through the membrane. Cells with reduced virulence remain in the upper chamber. These cells with reduced chemotaxis were collected, the expression vector was collected from the inside of the cell, and E. coli was transformed and amplified using it. This operation is a single screening.

The expression vector pool obtained by this screening has a higher content of “expression plasmid vector encoding SD-iAb that causes a decrease in chemotaxis of metastatic cancer cells” than the original SD-iAb expression library. It can be referred to as a plasmid population.
Here, the random sequence in the obtained plasmid can be amplified using the PCR method and directly sequenced, or amplified by transforming E. coli with the plasmid and colonized, and the nucleotide sequence of the random region Can also be determined. However, since it is considered that a single screening contains a large number of background cells, this screening procedure (cell chemotaxis assay) was repeated four times to increase the content of the target SD-iAb.
Although it was difficult to accurately quantify the amount of plasmid obtained after each screening, Escherichia coli transformed with the recovered plasmid was spread on a plate, colonized, and E. coli strains using the control VHH-Sfi expression vector. The tendency of change in the amount of plasmid obtained by screening was evaluated by comparing the standardized values using the conversion efficiency.

  As a result of evaluating the tendency of changes in the amount of plasmid obtained after each screening, it was found that the amount of plasmid recovered in each screening increased (FIG. 2B).

  In addition, when the chemotaxis decreased in each screening and the cells remaining on the membrane were stained, it was clearly observed that the number of the cells increased (FIG. 2C).

  Finally, 1535 E. coli clones were recovered, and 96 of them were recovered from plasmids and sequence analysis was performed. As a random region sequence, an amino acid sequence "YLAVEVWRRRVGLC (SEQ ID NO: 14)" was encoded. Only appeared multiple times. The DNA sequence also converged to the DNA sequence of “TATTTGGCTGGGGTTGAGGTTTGGCGTAGGAGGGTTGGTTTGTGT (SEQ ID NO: 15). I searched an existing database for DNA encoding this amino acid sequence, but I could not find a sequence with significant relevance or homology. Therefore, we found that this is a novel amino acid sequence that does not exist in nature, and we named the intracellular antibody (VHH) having this amino acid sequence in CDR3 as SD-iAb-47. The DNA sequence of ("pcDNA3.1 / Hygro-SD-iAb-47") is shown as (SEQ ID NO: 7). The DNA sequence corresponding to the ORF of SD-iAb-47 in (SEQ ID NO: 7) is (SEQ ID NO: 10), and the amino acid sequence is (SEQ ID NO: 13).

(Example 3)
To identify the target protein with which the intracellular antibody SD-iAb-47 interacts, a fusion protein with a tag sequence that specifically interacts with streptavidin at the C-terminus of SD-iAb-47 ( A mammalian cell expression vector containing DNA encoding SD-iAb-47-SBT) was constructed. At this time, a fusion protein (VHH-Sfi-SBT) expression vector in which the same tag was bound to VHH-Sfi was also prepared as a control.

  Prepare the eluate from metastatic cancer cells transfected with each intracellular expression vector, incubate with mixed agarose beads with immobilized streptavidin, and then SD based on the interaction between the tag and streptavidin. -iAb-47-SBT and the endogenous protein to which it binds were precipitated and recovered. Considering that the interaction between SD-iAb-47-SBT and the target protein is weak, washing of the agarose beads during the above operation was performed under the mildest conditions possible. A conceptual diagram of this series of operations is shown in FIG. 3A.

  The same operation was performed using the VHH-Sfi-SBT expression vector, and the affinity precipitated substances obtained from each were analyzed by SDS-denaturing polyacrylamide gel electrophoresis (SDS-PAGE) (FIG. 3B). Many endogenous proteins, including nonspecifically adsorbed proteins, were obtained, but there was a clear difference between the results of affinity precipitation with the control VHH-Sfi-SBT. There were two bands. They were cut out of the gel, analyzed by liquid chromatography / tandem mass spectrometry (LC-MS / MS), and identified by protein database search. (Keratin), hnRNP-K (heterogeneous nuclear ribonucleoprotein K), and vimentin.

  Keratin is considered to be a contamination derived from an experimenter that is frequently seen in this type of experimental method, and the target protein candidates are narrowed down to hnRNP-K and vimentin, and antibodies for these two candidate proteins are prepared. Western blotting analysis was performed on the affinity precipitated substance. In this case, the washing operation is performed under severe conditions in order to reduce non-specific interactions. As a result, hnRNP-K was found in the precipitated material using SD-iAb-47-SBT, but vimentin could not be detected. On the other hand, neither could be detected in the precipitated material prepared using VHH-Sfi-SBT as a control (FIG. 3C). Based on the above, a protein that specifically binds to the CDR3 portion (YLAGVEVWRRRVGLC) of SD-iAb-47-SBT was identified as hnRNP-K (heterogeneous nuclear ribonucleoprotein K).

  The identified hnRNP-K is basically one of many RNA-binding proteins that are present in the nucleus, from transcriptional regulation to messenger RNA (mRNA) splicing and nuclear processing, mRNA translation in the cytoplasm and its turnover. Furthermore, it has been reported that it is involved in extremely diverse cell functions such as chromatin remodeling in cell division (Non-patent Documents 18, 29 to 34). From these, hnRNP-K binds to various proteins involved in intracellular processes directly involved in DNA and RNA, and promotes cross-talk between them, thereby enhancing the efficiency of signal transduction (docking (Non-patent Document 35).

  The interaction and function of this protein has been increasing since its existence was discovered. For example, the SH3 binding region present from the C-terminus of hnRNP-K is known to interact with the Src family of non-receptor protein kinases (Non-patent Documents 36 and 37) and regulates cell adhesion. (Non-Patent Document 38), it has also been reported that translational inhibition is caused by phosphorylation and changing the localization in the cytoplasm (Non-Patent Document 39). These functional expression sites are in the nucleus or in the cytoplasm because hnRNP-K has a characteristic shuttling signal sequence that goes back and forth between the nucleus and the cytoplasm. It is thought that it is because it can change (nonpatent literature 34).

As described above, the protein called hnRNP-K has a variety of functions, and not all of them have been elucidated yet. The present inventors have performed a screening method using the VHH expression library of Example 1. Can be applied to metastatic cancer cells to obtain a single domain intrabody (SD-iAb-47) that has the chemotactic inhibitory activity of metastatic cancer cells and specifically binds to SD-iAb-47 As a result, hnRNP-K could be identified as an intracellular protein forming a complex. Furthermore, as a result of detailed experiments using SD-iAb-47 in the following Examples 4 to 5, the inventors found that hnRNP-K is deeply involved in cell motility, and potential cancer treatment It was the first time in the world that it could be a target factor for
This means that not only can SD-iAb-47 and the DNA encoding it be used as a metastatic cancer therapeutic agent, but also a substance that can bind to hnRNP-K and suppress its activity. This indicates that the substance can also be used as a therapeutic agent for metastatic cancer.

Example 4
Regarding chemotaxis suppression by the intracellular antibody SD-iAb-47 obtained in Example 2, a confirmation experiment was conducted as to whether or not it actually suppresses chemotaxis of metastatic cancer cells (HT1080). In addition to the intracellular antibody SD-iAb-47 expression vector, VHH-Sfi expression vector as a control, plasmid pool before screening (SD-iAb expression vector library), plasmid pool obtained by the fourth round screening ( SD-iAb5th expression vector library) was prepared for comparison. Perform chemotaxis assay using cells transfected with these expression vectors in the same manner as in the above screening, collect cells with reduced chemotaxis, transform E. coli with the resulting plasmid, and colony When the number was counted, the number of E. coli colonies harboring the SD-iAb-47 expression vector was clearly higher than the others (FIG. 4A). In chemotaxis assays, when cells that do not migrate to the lower chamber and remain on the filter are stained and observed, the number of cells transfected with the SD-iAb-47 expression vector is clearly greater than that of the control. (Figure 4B).

  Furthermore, an “invasion assay” (Non-patent Document 40) was performed, which can reproduce the situation closer to actual cancer cell metastasis using a layer in which an extracellular matrix is layered in addition to a membrane. In addition to the control (VHH-Sfi expression vector) similar to the above, compared to the plasmid pool (SD-iAb 5th expression vector library) obtained in the fourth round of screening, the SD-iAb-47 expression vector was transfected. The number of cells that could pass through the extracellular matrix (ie, cells that retained invasive ability) was clearly reduced both in the staining results (FIG. 4C left) and the cell counts (FIG. 4C right). I understood it.

  As a further confirmation, the control (VHH-Sfi expression vector-transfected cells) and SD-iAb-47 expression vector-transfected cells were cultivated in a dense state, and a groove was formed and observed ( Scratch assay), the ability of cells in the attached state to migrate was evaluated (Non-Patent Document 41). As a result of observing the state after 6 hours, SD-iAb-47 expression vector-transfected cells clearly had a lower ability to move to the groove than the control (FIG. 4D). The above experimental results show that the intracellular antibody SD-iAb-47 efficiently suppresses the chemotaxis of HT1080, which is a cancer cell that originally exhibits high chemotaxis, without causing cell death. It is clearly shown that it causes a decrease in the infiltration ability. From the above results, as a result of screening based on the chemotaxis suppressing function of metastatic cancer cells using the SD-iAb expression library, intracellular antibody SD- that efficiently suppresses chemotaxis without inducing cell death iAb-47 was obtained, revealing that the interacting target protein was hnRNP-K.

(Example 5)
Next, focusing on the relationship between cell chemotaxis and hnRNP-K, we conducted experiments based on the chemotaxis phenomenon induced by fibronectin, a chemotactic attractant, for cells in medium without serum. It was. Since it has already been reported that the distribution of hnRNP-K in cells changes from a state preferentially localized in the nucleus to a state dispersed in both the nucleus and cytoplasm due to the presence of serum (Non-patent Document 39). First, whether or not this report could be reproduced was examined over time using Western blotting with an anti-hnRNP-K antibody (FIG. 5A).

  In cells under serum-free medium, hnRNP-K shows a nuclear-preferred distribution, but it was confirmed that the abundance in the cytoplasm increases with the passage of time after addition of serum (FIG. 5A). ). Similar results were obtained when fibronectin, a chemotactic attractant, was used instead of serum (FIG. 5B). On the other hand, in cells expressing SD-iAb-47, no increase in the amount of hnRNP-K present in the cytoplasm was observed (FIGS. 5B and 5C).

  The above results indicate that the binding of SD-iAb-47 to hnRNP-K inhibits the increase in the cytosolic abundance of hnRNP-K by fibronectin, an attractant, due to some action. It shows that chemotaxis was suppressed. In other words, one of the functions of hnRNP-K in the cytoplasm is that it is deeply involved in signal transduction that positively regulates the motility of cells, so it is a powerful cancer by inhibiting that function only in the cytoplasm. An inhibitory effect on metastasis can be expected. Such intracellular local function inhibition is not possible with a technique that suppresses the expression of the entire target protein with siRNA or the like.

  In order to confirm this, suppression of hnRNP-K expression by siRNA using shRNA expression vector (gene knockdown) was attempted, and cell death was observed, indicating that hnRNP-K is essential for cell survival. I understood. In addition, there have been no reports of hnRNP-K knockout mice by gene knockout method. Therefore, administration of siRNA or the like targeting hnRNP-K is likely to cause cell death in normal cells, and may cause serious side effects.

Moreover, it was confirmed by immunostaining with an anti-histidine antibody using the histidine tag of SD-iAb-47 that SD-iAb-47 was delocalized throughout the cell. Furthermore, a fusion protein (SD-iAb-47-VP16) expression vector fused with a VP16 protein having a nuclear localization signal was constructed, and SD-iAb-47 was localized in the nucleus (FIG. 5D). Using these, the changes in the intracellular distribution of hnRNP-K by fibronectin as in FIG. 5B are observed. In SD-iAb-47-VP16 localized in the nucleus, the cytoplasmic abundance of hnRNP-K is increased. It was found that was not sufficiently suppressed (FIG. 5E). Moreover, when the influence on the chemotaxis by them was compared with the staining situation of the cells remaining on the membrane, it was found that the chemotaxis was not suppressed by SD-iAb-47-VP16 (FIG. 5F). This also indicates that it is difficult to suppress the chemotaxis of metastatic cancer cells with SD-iAb-47 (SD-iAb-47-VP16) localized in the nucleus.
On the other hand, if the intrabody (SD-iAb-47) obtained in the present invention is used, it is possible to inhibit the local function in the cell as described above, and the function of hnRNP-K in the nucleus can be inhibited. Without dropping, the function in the cytoplasm can be reduced, thereby making it possible to suppress only cancer cell metastasis without affecting normal cells around the cancer cell. This opens the way for anti-cancer therapy that does not require strict cancer cell-specific drug delivery and has few side effects.

  Thus, hnRNP-K is an important protein involved in cell chemotaxis, and this can be discovered for the first time by the screening method using the SD-iAb expression library of the present invention. -K new feature. Regarding cancer metastasis, many related genes have been identified by various independent screening methods, and the mechanism is considered to be based on extremely complicated intracellular signal transduction (Non-Patent Documents 42 to 44). ). Therefore, in order to link to effective cancer metastasis treatment, it is necessary to understand the molecular mechanism as detailed and accurate as possible. RNAi technology, which is commonly used for screening of gene function based on phenotypic changes by suppressing cell function, cannot identify factors such as hnRNP-K, which are lethal in gene knockdown. In particular, hnRNP-K is a function that cannot be found by a method based on the RNAi phenomenon in which the change in localization directly affects the phenotype (chemotaxis) of the cell and decreases the expression itself. The screening method of the present invention is an optimal method for searching for such factors.

  The single domain intrabody expression library (VHH expression library) in the present invention can be constructed easily and at low cost, and also acts on a target protein at the protein level. It is also possible to exert its inhibitory function against molecules already present in the gene, and it is also possible to suppress only a part of the function of the target gene translation product (protein). Analysis of protein function that knockout or knockdown directly leads to lethality can be realized. The methodology using the expression library can be said to be a method that complements RNAi technology and conventional gene knockdown methods, and will develop into a very important and useful tool for future molecular biological analysis of cell functions. Conceivable.

  In addition, the single domain intrabody obtained by using the screening method is also useful as a pharmaceutical composition for cancer gene therapy, and by identifying intracellular substances that interact with the intrabody, Target factors for cancer treatment can be obtained.

A: Schematic diagram of a gene expressing VHH. It is a figure about construction of a single domain intrabody (SD-iAb) expression vector. VHH has been cloned into pcDNA3.1-Hygro, a mammalian cell expression vector. This gene is regulated by the CMV promoter. B: CDR3 DNA sequence to be randomly sequenced. The DNA sequence of the origin anti-chicken lysozyme camel antibody (cAb-Lys3) is shown in the upper row, and the DNA sequence of VHH-Sfi, which is the basic skeleton of the SD-iAb library, is shown in the lower row. The one-letter amino acid sequence is that when the VHH-Sfi DNA sequence is translated in a regular frame. C: Confirmation of the function of the SD-iAb expression vector by Western blotting using an anti-FLAG tag antibody. When two clones of the VHH-Sfi and SD-iAb expression vector libraries were randomly selected and expressed in cultured human cells, they were translated in the correct frame and had the same molecular weight as the control cAb-Lys3 ( About 15 kDa) is obtained.

Chemotaxis assay screening (1): Conceptual diagram of chemotaxis assay screening Cells that have been inhibited in cell migration by intracellular antibodies expressed by transfection of the SD-iAb expression vector library FIG. 2 is a diagram for a method of isolating by assay (chemotaxis assay screening).

Chemotaxis assay screening (2): Amount of target plasmid recovered after each round. The graph which evaluated the amount of plasmid collect | recovered after the screening in each round by the relative comparison of the transformation efficiency of colon_bacillus | E._coli by it. Transformation was always performed as a set with the control VHH-Sfi, and the value normalized by the transformation efficiency was indicated by a white bar.

Chemotaxis assay screening (3): The amount of target cells remaining on the membrane after each round. Stained cells that cannot migrate and remain on the membrane after chemotaxis assay. A darker staining indicates that more cells remain. Results obtained when the plasmid pool obtained in each round was once transformed into Escherichia coli, amplified, re-transfected after adjusting the amount of plasmid to a constant value, and the chemotaxis assay was performed again. It can be seen that as the screening progresses, the proportion of cells with reduced mobility increased.

Identification of target protein to which SD-iAb-47 binds (1): Conceptual diagram of affinity purification of target protein using intracellular antibody SD-iAb-47 obtained by screening. SD-iAb-47-SBT with streptavidin binding sequence (SBT) is expressed inside the cell, and the target protein bound to it is captured with streptavidin-immobilized agarose beads and precipitated. After washing under mild conditions, it is denatured and recovered from the beads, and separated by SDS-PAGE according to the molecular weight.

Identification of target protein to which SD-iAb-47 binds (2): SDS-PAGE results. Compared to those obtained from cells expressing VHH-Sfi-SBT as a control, the three bands indicated by arrows appeared characteristically when SD-iAb-47-SBT was expressed.

Identification of target protein to which SD-iAb-47 binds (3): Results of transfer to a PVDF membrane and reanalysis by Western blot. When affinity precipitation was performed using SD-iAb-47-SBT, hnRNP-K was detected but no vimentin was detected among the proteins derived from the three bands identified above. When affinity precipitation was performed using VHH-Sfi-SBT, neither hnRNP-K nor vimentin was detected. Input is a migration of cell lysate used for affinity precipitation.

Confirmation of inhibitory effect on cell migration ability by intracellular antibody SD-iAb-47 (1): Comparison of number of colonies appearing when transformed with plasmid obtained after chemotaxis assay. A chemotaxis assay was performed on cells transfected with SD-iAb-47 and the plasmid pool after 4 rounds of screening, resulting in more cells compared to that with the control and the plasmid pool without any screening. Indirectly suggested that it lost its mobility and remained on the membrane.

Confirmation of inhibitory effect on cell migration ability by intracellular antibody SD-iAb-47 (2): Results of staining cells remaining on the membrane in the upper chamber. In cells expressing SD-iAb-47, more remains on the membrane (ie, it is darkly stained).

Confirmation of inhibitory effect on cell migration ability by intracellular antibody SD-iAb-47 (3): As a result of invasion assay, cells that migrated through the extracellular matrix to the lower chamber were stained.

Confirmation of inhibitory effect on cell migration ability by intracellular antibody SD-iAb-47 (4): As a result of invasion assay, the number of cells was counted and the relative value was compared. Cells transfected with the SD-iAb-47 expression vector and the plasmid pool obtained after 4 rounds of screening are more capable of permeating the extracellular matrix than those transfected with the control VHH-Sfi expression vector. You can see that it is decreasing.

Confirmation of inhibitory effect on cell migration ability by intracellular antibody SD-iAb-47 (5): Results of scratch assay. Grooves were formed in monolayer confluent cells of metastatic cancer cells HT1080 transfected with the VHH-Sfi expression vector and SD-iAb-47 expression vector, and the migration ability was evaluated. From the comparison of the groove filling after 6 hours, a decrease in cell migration ability by SD-iAb-47 was directly observed.

Relationship between the effects of intracellular antibody SD-iAb-47 on hnRNP-K present in the cytoplasm and decreased cell migration (1): Increase in cytoplasmic abundance of hnRNP-K by serum over time by Western blotting Results of analysis. The abundance ratio in the cytoplasm and nucleus of hnRNP-K varies with serum.

The relationship between the effect of intracellular antibody SD-iAb-47 on hnRNP-K present in the cytoplasm and the decrease in cell migration ability (2): Confirmation that cytoplasm and nucleus fractionation are performed correctly. As markers for the correct fractionation of cytoplasm and nucleus, hnRNP-A2 / B1 (localized in the nucleus) and GAPDH (localized in the cytoplasm) were detected by Western blotting. The increase in the cytoplasmic abundance of hnRNP-K caused by the chemotactic attractant fibronectin is suppressed by SD-iAb-47.

The result of having quantified and graphed the experimental result of FIG.

The relationship between the effects of intracellular antibody SD-iAb-47 on hnRNP-K in the cytoplasm and decreased cell migration (3): SD with SD-iAb-47 and nuclear localization signal VP-16 -Results obtained by visualizing the intracellular localization of iAb-47-VP16 by immunostaining using fluorescently labeled antibodies against their histidine tags. Nuclei were detected by Hoechst staining.

Relationship between the effect of intracellular antibody SD-iAb-47 on hnRNP-K present in the cytoplasm and the decrease in cell mobility (4): SD-iAb-47 localized in the nucleus similar to FIG. -Results of VP16. The inhibitory effect of SD-iAb-47-VP16 is weaker than that of SD-iAb-47.

The relationship between the effect of intracellular antibody SD-iAb-47 on hnRNP-K present in the cytoplasm and the decrease in cell migration ability (5): results of chemotaxis assay. When SD-iAb-47-VP16 is expressed, the mobility is reduced and the number of cells remaining on the membrane is lower than when SD-iAb-47 is expressed. The photo shows the results of two independent runs (upper row is the first and lower row is the second).

Claims (31)

  DNA comprising a base sequence encoding the heavy chain variable region (VHH) of a camel heavy chain antibody, wherein a portion of the base sequence encoding the complementarity determining region (CDR) is randomized VHH expression library composed of intracellular expression vectors.   Of the base sequence encoding the complementarity determining region (CDR), one part of the DNA to be randomized is DNA corresponding to all or one part of the base sequence encoding the third CDR (CDR3), The VHH expression library according to claim 1, wherein the first and second CDRs (CDR1 and CDR2) are intact.   DNA corresponding to all or part of the nucleotide sequence encoding CDR3, wherein the randomized DNA has a nucleotide sequence corresponding to 5 to 24 codons, and a restriction enzyme is present at both ends of the DNA. The VHH expression library according to claim 2, wherein a recognition sequence is introduced.   The VHH expression library according to any one of claims 1 to 3, wherein the intracellular expression vector is a plasmid vector having a CMV promoter.   The VHH expression library according to any one of claims 1 to 4, wherein the camel heavy chain antibody is derived from an anti-chicken lysozyme antibody. Using the VHH expression library according to any one of claims 1 to 5,
(A) transforming cultured cells with the VHH expression vector of the library and observing changes in the phenotype of the cultured cells;
(B) separating the cultured cells whose phenotype has changed in (a) and recovering the expression vector from the cultured cells;
(C) amplifying the DNA containing the randomized base sequence contained in the expression vector recovered in (b);
(D) analyzing the base sequence of the DNA amplified in (c) and determining the amino acid sequence of the antigen recognition site;
A method for screening an intracellular antibody having an antigen recognition site that promotes or reduces the activity of a physiologically active substance involved in phenotyping of a cell.   The step of amplifying the DNA of (c) is to amplify by transforming E. coli using the expression vector recovered in (b). The screening method according to claim 6, wherein the steps a) to (c) are repeated.   The screening method according to claim 6 or 7, wherein the cultured cell transformed in (a) is a cancer cell line, and the observation of phenotypic change is observation of decreased chemotaxis, A method for screening an intracellular antibody having an antigen recognition site that suppresses the chemotaxis of cancer cells. Using the VHH expression library according to any one of claims 1 to 5,
(A) transforming cultured cells with the VHH expression vector of the library and observing changes in the phenotype of the cultured cells;
(B) separating the cultured cells whose phenotype has changed in (a) and recovering the expression vector from the cultured cells;
(C) amplifying the DNA containing the randomized base sequence contained in the expression vector recovered in (b);
(D) analyzing the base sequence of the DNA amplified in (c) and determining the amino acid sequence of the antigen recognition site;
(E) synthesizing a vector containing a DNA encoding a variable region having the amino acid sequence determined in (d) and expressed in a desired cell;
A method for producing an intracellular antibody expression vector that promotes or reduces the activity of a physiologically active substance involved in phenotyping of a cell.   The step of amplifying the DNA of (c) is to amplify by transforming E. coli using the expression vector recovered in (b). The method for producing an intracellular antibody expression vector according to claim 9, wherein the steps a) to (c) are repeated.   The method for producing an intracellular antibody expression vector according to claim 9 or 10, wherein the cultured cell transformed in (a) is a cancer cell line, and the phenotypic change is observed by a decrease in chemotaxis. A method for producing an intracellular antibody expression vector that suppresses the chemotaxis or metastasis of cancer cells.   An intracellular antibody expression for promoting or reducing the activity of a physiologically active substance involved in phenotyping of a cell obtained by the method for producing an intracellular antibody expression vector according to any one of claims 9 to 11. vector.   An intracellular antibody expression vector having a chemotactic inhibitory activity of metastatic cancer cells, obtained by the method for producing an intracellular antibody expression vector according to claim 11.   The intracellular antibody according to claim 13, wherein the DNA encoding the variable region of the vector for expression of the intracellular antibody contains a base sequence encoding "YLAGVEVWRRRVGLC (SEQ ID NO: 14)" in its heavy chain CDR3. Expression vector.   An intracellular antibody having a chemotactic inhibitory activity of metastatic cancer cells produced by transforming a cell with the vector for expressing an intracellular antibody according to claim 13. Using the VHH expression library according to any one of claims 1 to 5,
(A) a step of transforming a cultured cell with the VHH expression vector of the library and observing a change in the phenotype of the cell due to the action of an intracellular antibody;
(B) a step of isolating a cultured cell having a changed phenotype and recovering an expression vector from the inside of the cultured cell;
(C) transforming the expression vector recovered in (b) into E. coli and amplifying it,
(D) repeating the steps (a) to (c) for the pool of expression vectors amplified in (c),
(E) identifying an antigen recognition site of an intracellular antibody that changes the expression type of the cell;
(F) a step of expressing an intracellular antibody in transformed cultured cells using an expression vector comprising a base sequence encoding an intracellular antibody having the antigen recognition site identified in (e) and a tag sequence;
(G) a step of precipitating a complex of the intracellular antibody and the endogenous protein expressed in (f), and collecting the tag of the intracellular antibody using as an index,
A method for identifying an intracellular physiologically active substance involved in determining a specific phenotype of a cell, comprising:   The step (f) according to claim 16, wherein the tag sequence to be bound to the base sequence encoding the intracellular antibody encodes a specific binding molecule of streptavidin, and the step (g) The conjugate of the binding molecule and intracellular antibody is affinity precipitated from the cell lysate using a streptavidin-immobilized carrier, followed by molecular weight fractionation by SDS-polyacrylamide gel electrophoresis, liquid chromatography / tandem mass The method for identifying an intracellular physiologically active substance according to claim 16, wherein the method is a step of analyzing a specific binding molecule using a spectrum analyzer.   The method for identifying an intracellular physiologically active substance according to claim 16 or 17, wherein the cultured cell is a metastatic cancer cell line, and the observation of the phenotypic change is an observation of a decrease in chemotaxis. , A method for identifying a protein involved in the chemotaxis of metastatic cancer cells.   The intracellular protein expression vector according to claim 13 or 14, wherein an intracellular protein involved in the chemotaxis of metastatic cancer cells identified using the identification method according to claim 18 is used as a target molecule for cancer treatment. A composition for cancer treatment for suppressing the chemotaxis of metastatic cancer, which is contained as an active ingredient.   The composition for cancer treatment for suppressing the chemotaxis of metastatic cancer according to claim 19, wherein the intracellular protein involved in the chemotaxis of metastatic cancer cells is hnRNP-K (heterogeneous nuclear ribonucleoprotein K). object.   The composition for cancer treatment for suppressing the chemotaxis of metastatic cancer according to claim 20, comprising the intracellular antibody expression vector of claim 14 as an active ingredient.   A peptide comprising the amino acid sequence of “YLAGVEVWRRRVGLC (SEQ ID NO: 14)”.   A peptide having an activity of inhibiting the chemotaxis of metastatic cancer cells, comprising an amino acid sequence including “YLAGVEVWRRRVGLC (SEQ ID NO: 14)”.   A DNA encoding the amino acid sequence of “YLAGVEVWRRRVGLC (SEQ ID NO: 14)”.   A DNA comprising the base sequence of “5′-TATTTGGCTGGGGTTGAGGTTTGGCGTAGGAGGGTTGGTTTGTGT-3 ′ (SEQ ID NO: 15)”.   A DNA comprising a base sequence of “5′-TATTTGGCTGGGGTTGAGGTTTGGCGTAGGAGGGTTGGTTTGTGT-3 ′ (SEQ ID NO: 15)” and encoding a peptide having a chemotactic inhibitory activity of metastatic cancer cells.   An intracellular antibody having a heavy chain variable region having a chemotactic inhibitory activity of metastatic cancer cells, wherein the amino acid sequence of heavy chain CDR3 comprises the amino acid sequence consisting of SEQ ID NO: 14.   The intracellular antibody according to claim 25, wherein the amino acid sequence of the intracellular antibody is an amino acid sequence derived from a camel heavy chain antibody other than the amino acid sequence of heavy chain CDR3.   30. A DNA encoding an intracellular antibody comprising a heavy chain variable region comprising an antigen recognition site having an activity of inhibiting chemotaxis of metastatic cancer cells according to claim 27 or 29.   30. A peptide or intracellular antibody comprising DNA encoding the intracellular antibody according to any one of claims 24 to 26 or 29, wherein the peptide or intracellular antibody is expressed in metastatic cancer cells and suppresses chemotaxis of cancer cells. An expression vector that produces   A composition for cancer treatment for suppressing the chemotaxis of metastatic cancer, comprising the expression vector according to claim 30 as an active ingredient.