JP2008136383A - Novel gene expression inhibitor - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide an inhibitor in which the expression of transglutaminase 1 to be considered as involved in keratotic disorder of skin and the differentiation of keratinocyte are conveniently, inexpensively and effectively inhibited by using RNA interference as a gene expression inhibitory means. <P>SOLUTION: Disclosed are a vasoactive intestinal contractor (VIC) gene to be considered as involved in the disorder, an expression inhibitor for the gene which targets the partial sequence of ET-2/VIC mRNA and contains siRNA or shRNA (short hairpin RNA) as an active ingredient, and a drug composition thereof to be used for the prevention/treatment of keratotic disorder, the prevention/treatment of cancer and the like. <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

  The present invention relates to an ET-2 / VIC gene expression inhibitor comprising ET-2 / VIC siRNA as an active ingredient, a transglutaminase 1 expression inhibitor using the expression inhibitor, suppression of differentiation induction of keratinocytes, The present invention relates to a preventive or therapeutic agent for keratinization disorder and cancer.

  In recent years, attention has been focused on RNA interference technology that examines the function of a gene by specifically suppressing the expression of the target gene. Until now, in order to investigate the function of these genes, it was necessary to create knockout mice. However, creating and rearing a knockout mouse takes a long time and enormous costs. RNA interference technology has made it possible to investigate the function of the gene at the cellular level without creating knockout mice. In addition, when a certain gene expression is involved in diseases such as cancer, it has been found that suppressing the gene expression by RNA interference is useful for treatment and prevention.

  RNA interference (RNAi) is a phenomenon in which mRNA is cleaved in a sequence-specific manner by double-stranded RNA (dsRNA), resulting in suppression of gene expression, and is a defense system at the nucleic acid level common to living organisms. Has been reported. In RNAi, dsRNA is processed by the action of Dicer to form siRNA (short interfering RNA), siRNA recognizes the target sequence as a guide RNA, and cleaves the target mRNA, thereby suppressing gene expression. The

  Vasoactive intestinal contractor (VIC) is one of the endothelin (ET) family peptides and is considered to be a mouse / rat orthologue of human ET-2 and is called ET-2 / VIC (Non-patent Document 1). See). However, because the expression level of ET-2 / VIC in the living body is very small, and because the creation of ET-2 / VIC knockout mice has not been successful, It is still unknown.

  The ET-2 / VIC gene is highly expressed in the intestinal tract (see non-patent document 2), and is also highly expressed in the uterus, testis, cerebellum, etc. (see non-patent document 3). Furthermore, expression increases with fetal development, which may be an important factor involved in birth (see Non-Patent Document 4). Recently, in human breast cancer cells, ET-2 expression was high in hypoxic sites, suggesting that ET-2 acts as a survival factor (see Non-Patent Document 5). In general, hypoxic cancer cell sites are known to metastasize easily (see Non-Patent Documents 6 and 7) and have high telomerase activity (see Non-Patent Document 8). The effect of both radiation therapy is reduced.

Genomics, 10, 236-242 (1991) J. Biol. Chem., 264, 14613-14616 (1989) J. Biotechnol., 84, 187-192 (2001) Genomics, 64, 51-61 (2000) Mol. Cancer Ther., 1, 1273-1281 (2002) Int. J. Cancer, 80, 617-623 (1999) Cancer Res., 64, 2461-2468 (2004) Biochem. Biophys. Res. Commun., 260, 365-370 (1999)

  An object of the present invention is to provide a simple, inexpensive, and effective gene suppressor that uses RNA interference as a means for suppressing gene expression.

  As mentioned above, the creation of ET-2 / VIC knockout mice has not been successful, and the amount of ET-2 / VIC expressed in vivo is very small. It was not fully understood. Furthermore, when trying to create a knockout mouse, the creation and breeding of the knockout mouse is not easy because it takes enormous time and cost.

  The present inventors have conducted intensive studies considering that there is a possibility of being useful for anticancer treatment by specifically suppressing ET-2 / VIC gene expression by RNA interference. As a result, it was newly found that ET-2 / VIC gene expression is increased during differentiation of keratinocytes, which are one type of skin cell. Furthermore, it was clarified that the expression of transglutaminase 1 is suppressed and differentiation is suppressed by using ET-2 / VIC siRNA. Differentiation of keratinocytes is keratinization in the skin, and because ET-2 / VIC is highly expressed in the above-mentioned keratinocyte differentiation and cancer cells, ET-2 / VIC siRNA is a skin disease caused by abnormal keratinization. The present inventors have found that it becomes a therapeutic / preventive agent for fish scales, fish eyes, follicular keratosis, etc., and has completed the present invention.

That is, the present invention is as follows.
[1] An ET-2 / VIC gene expression inhibitor comprising, as an active ingredient, siRNA or shRNA that uses a partial sequence of ET-2 / VIC mRNA as a target sequence.
[2] The ET-2 / VIC gene expression inhibitor of [1], comprising the RNA represented by SEQ ID NO: 1 and SEQ ID NO: 2.

[3] A transglutaminase 1 expression inhibitor containing, as an active ingredient, siRNA or shRNA having a partial sequence of ET-2 / VIC mRNA as a target sequence.
[4] The transglutaminase 1 expression inhibitor of [3], wherein the siRNA or shRNA comprises the RNA represented by SEQ ID NO: 1 and SEQ ID NO: 2.

[5] A keratinocyte differentiation induction inhibitor containing, as an active ingredient, siRNA or shRNA having a partial sequence of ET-2 / VIC mRNA as a target sequence.
[6] The keratinocyte differentiation induction inhibitor according to [5], wherein the siRNA or shRNA comprises the RNA represented by SEQ ID NO: 1 and SEQ ID NO: 2.

[7] A pharmaceutical composition comprising, as an active ingredient, siRNA or shRNA having a partial sequence of ET-2 / VIC mRNA as a target sequence.
[8] The pharmaceutical composition according to [7], wherein the siRNA or shRNA comprises RNA represented by SEQ ID NO: 1 and SEQ ID NO: 2.

[9] The pharmaceutical composition according to [7] or [8], which is a preventive or therapeutic agent for abnormal keratinization disorder.
[10] The pharmaceutical composition according to [7] or [8], which is a preventive or therapeutic agent for cancer.
[11] The pharmaceutical composition according to [7] or [8], which is a hair restorer for preventing or treating hair loss caused by abnormal keratinization.

[12] A keratinocyte differentiation marker consisting of all or part of the ET-2 / VIC gene.
[13] A method for determining the degree of keratinocyte differentiation, comprising measuring the expression of the ET-2 / VIC gene using the ET-2 / VIC gene as a keratinocyte differentiation marker.
[14] A detection reagent for determining the degree of keratinocyte differentiation, using the ET-2 / VIC gene as a keratinocyte differentiation marker, comprising the ET-2 / VIC gene fragment as a probe or primer.

  The present invention is the first discovery of a gene expression inhibitor of ET-2 / VIC peptide, which is a causative agent of hypertension, myocardial infarction, cancer and skin differentiation. Developed siRNA for the first time (design / search / evaluation / demonstration) and developed an ET-2 / VIC gene expression inhibitor using it as an active ingredient. According to the present invention, gene expression of ET-2 / VIC can be effectively suppressed using ET-2 / VIC siRNA which is an extremely simple nucleic acid sequence. In addition, ET-2 / VIC siRNA is not only useful as a keratinocyte differentiation inhibitor or keratinocyte differentiation induction inhibitor, but also a new keratinocyte disorder or cancer prevention or treatment agent based on the results of the research. It has extremely important significance.

Hereinafter, the present invention will be described in detail.
The present invention is an ET-2 / VIC gene expression inhibitor containing ET-2 / VIC siRNA as an active ingredient.
“SiRNA” means a double-stranded RNA molecule that blocks translation of a target mRNA.

  The siRNA of the present invention targets a partial sequence of ET-2 / VIC mRNA. In the present invention, siRNA having a partial sequence of ET-2 / VIC mRNA as a target sequence may be referred to as ET-2 / VIC siRNA. The target sequence may be a non-coding region. The number of bases in the target sequence is not limited and is selected in the range of 15 to 500 bases. Preferably 15 to 50, 15 to 45, 15 to 40, 15 to 35 or 15 to 30 bases, more preferably 20 to 35 bases, more preferably 19 to 30 bases, particularly preferably 19 to 29 bases, 19 to 28 Base or 19-25 bases. For the target sequence of the target gene, for example, a portion having a large expression suppression effect may be selected depending on the target gene. Various design methods of siRNA that effectively suppresses expression are known, and they may be designed according to these methods.

  The siRNA of the present invention is a double strand, and is formed by hybridizing a sense strand that is complementary to the target sequence of the target gene DNA and an antisense strand that is complementary to the sense strand. Each strand of the duplex contains a 3 'protruding end. The 3 ′ protruding end consists of 1 to 6 bases, preferably 1 to 3 bases, more preferably 2 bases. The length of the protruding end is irrelevant between the two strands, i.e. the length of the protruding end of one strand does not depend on the length of the protruding end of the other strand.

  The siRNA of the present invention and the target sequence are desirably the same, but may be substantially the same, that is, a homologous sequence. That is, as long as the sense strand sequence of the siRNA of the present invention and the target sequence are hybridized, there may be one or more, ie, 1 to 3, 2 or 1 mismatches. The hybridization conditions in this case are in vivo conditions when the siRNA of the present invention is administered in vivo and used as a medicament, and moderate stringent when the siRNA of the present invention is used as a reagent in vitro. These conditions include, for example, 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, and hybridization conditions at 50 ° C. to 70 ° C. for 12 to 16 hours. It is done. Further, the sense strand sequence and the target sequence of the shRNA of the present invention have a sequence homology of 90% or more, preferably 95% or more, more preferably 95, 96, 97, 98 or 99% or more.

  The sequence of the 3 ′ protruding end of siRNA is not limited, and examples thereof include sequences such as AG, UA, AUG, UUGG, and AAGCUU from the 5 ′ side.

  The invention also includes short hairpin RNA (shRNA) that is processed in vivo by Dicer to produce the siRNA of the invention. The shRNA has a stem-loop structure that includes a double-stranded part and in which a sense strand and an antisense strand are linked via a loop sequence. In shRNA, the 3 'end of the sense strand and the 5' end of the antisense strand are linked via a loop (hairpin loop sequence). The hairpin loop sequence is not limited, and examples thereof include a sequence starting with UU consisting of 5 to 12 bases, such as UUCAAGAGA. Other loop sequences include Lee NS. Et al. (2002) Nat. Biotech. 20, 500-505, Paddison PJ. Et al. (2002) Genes and Dev. 16, 948-958, Sui G. et al. (2002) Proc. Natl. Acad. Sci. USA 99, 5515-5520, Paul CP. Et al. (2002) Nat. Biotech. 20, 505-508, Kawasaki H. et al. (2003) Nucleic Acids Res 31, 700-707, etc. can be employed.

  The siRNA of the present invention can be synthesized in vitro by chemical synthesis or a transcription system using a promoter and RNA polymerase. In the synthesis by chemical synthesis, RNAs having sequences complementary to each other as reverse sequences and having self-complementarity may be synthesized and combined at the self-complementary part. In addition, synthesis using a promoter and RNA polymerase synthesizes a template DNA having a structure in which a sense strand and an antisense strand are linked by a loop downstream of one promoter, transcribes RNA using RNA polymerase, and synthesizes as siRNA1 or shRNA. May be. As the promoter, in the case of in vitro production, T3 promoter, T7 promoter, etc. are used. The template DNA of the double-stranded RNA of the present invention is introduced into a vector, the vector is administered in vivo, and 2 in vivo. When synthesizing a double-stranded RNA, PolIII promoters such as U6 promoter and H1 promoter are used. When using a vector, a plasmid vector, a viral vector, etc. can be used as a vector. As a plasmid vector, a pBAsi vector, a pSUPER vector or the like may be used, and as a virus vector, an adenovirus vector, a lentivirus vector, a retrovirus vector or the like can be used.

  SEQ ID NO: 10 shows the sequence of the mouse ET-2 / VIC gene. The siRNA of the present invention can be designed based on the sequence information.

  As an example of the ET-2 / VIC siRNA of the present invention, siRNA containing a sense strand GGCUUGACAAGGAAUGUGUGUACUU (SEQ ID NO: 1) and an antisense strand AAGUACACAUUCCUUGUCAAGCC (SEQ ID NO: 2) can be mentioned. In addition, as an example of siRNA containing a 3 ′ protruding end, siRNA containing a sense strand GGCUUGACAAGGAAUGUGUGUAUACUU-AG (SEQ ID NO: 3) and an antisense strand AAGUACACAUUCCUUGUCAAGCC-AU (SEQ ID NO: 4) can be mentioned.

  In the present invention, to suppress (silencing) the expression of a target gene by RNA interference is when the expression of the gene is determined using the expression level of mRNA or protein of the gene as an index, and the siRNA of the present invention is not introduced. On the other hand, not only the case where it is suppressed 100% but also the case where it is suppressed 75% or more, 50% or more, or 20% or more is included. The degree of expression suppression may be compared between the amount of gene mRNA or protein produced before and after the introduction of siRNA. In the case of mRNA, it can be measured by Northern hybridization, RT-PCR, in situ hybridization, etc. In the case of protein, Western blotting, ELISA, measurement using a protein chip to which an antibody is bound, measurement of protein activity It can measure by.

In the present invention, the ET-2 / VIC gene inhibitory action of ET-2 / VIC siRNA was found in a differentiation induction experiment system using mouse keratinocytes. Keratinocytes are cells isolated from newborn mice and are used as skin cell models. Mouse keratinocytes are known to stop cell proliferation and differentiate by adding high concentrations of Ca ^2+. Yes. ET-2 / VIC siRNA inhibits mouse keratinocyte differentiation. In the present invention, it has been confirmed that ET-2 / VIC siRNA suppresses the expression of transglutaminase 1 (TGase 1) in the cell differentiation induction experimental system using the mouse keratinocytes.

  TGase 1 is involved in keratinocyte differentiation and is known to form a cornified envelope by cross-linking involucrin, etc. The ET-2 / VIC siRNA differentiation inhibition mechanism ultimately suppresses TGase 1 expression It can be said that.

  Vasoactive intestinal contractor (VIC) is one of the endothelin (ET) family peptides and is considered to be the mouse / rat orthologue of human ET-2 (Genomics, Vol. 10, 236-242 (1991)). . The ET-2 / VIC gene is highly expressed in the intestinal tract (J. Biol. Chem., 264, 14613-14616 (1989)), and is also highly expressed in the uterus, testis, cerebellum, etc. ( J. Biotechnol., 84, 187-192 (2001)). Furthermore, expression increases with fetal development and may be an important factor involved in birth (Genomics, 64, 51-61 (2000)). Recently, in human breast cancer cells, ET-2 expression was high in hypoxic sites, suggesting that ET-2 acts as a survival factor (Mol. Cancer Ther., Vol. 1, paragraphs 1273-1281). (2002)). In general, hypoxic cancer cell sites are likely to metastasize (Int. J. Cancer, 80, 617-623 (1999), Cancer Res., 64, 2461-2468 (2004)), and also have telomerase activity. It is known to be high (Biochem. Biophys. Res. Commun., 260, 365-370 (1999)), and the effects of both chemotherapy and radiation therapy on hypoxic sites are reduced. Therefore, a substance that suppresses the expression of ET-2 / VIC in cancer cells can be a cancer therapeutic / prophylactic agent. The suppression of ET-2 / VIC siRNA expression of ET-2 / VIC gene, TGase 1, suggests that these expressions are closely related to keratinocyte differentiation. Such knowledge is important in elucidating the mechanism of keratinocyte differentiation and in the research and development of new drug development through the elucidation. The keratinosis inhibitor, cancer therapeutic agent, ET-2 / VIC of the present invention Gene expression inhibitors and TGase 1 expression inhibitors can be useful reagents in such studies.

  That is, the present invention includes a transglutaminase 1 expression inhibitor and a keratinocyte differentiation induction inhibitor containing ET-2 / VIC siRNA capable of suppressing the expression of the ET-2 / VIC gene as an active ingredient. Furthermore, the present invention includes a therapeutic or prophylactic agent for keratinosis disorder and cancer comprising ET-2 / VIC siRNA capable of suppressing ET-2 / VIC gene expression as an active ingredient. The keratinized disorder includes alopecia and the like, and the present invention includes a hair restorer containing ET-2 / VIC siRNA capable of suppressing the expression of ET-2 / VIC gene as an active ingredient.

  The siRNA of the present invention is introduced into a subject whose expression is to be suppressed. The subject is not limited and is a cell, tissue, or individual. For animals, it can be used as a pharmaceutical for the prevention and treatment of diseases such as cancer. Furthermore, the siRNA of the present invention can be used as a research reagent. In this case, the siRNA of the present invention suppresses gene expression. It can be used as an agent, RNAi reagent and the like.

  Moreover, you may administer the vector which can express siRNA or shRNA. shRNA can be processed in the body to generate siRNA and suppress ET-2 / VIC expression.

  In the present invention, ET-2 / VIC siRNA suppresses the expression of ET-2 / VIC siRNA by, for example, bringing mouse keratinocytes into contact with a culture solution in which ET-2 / VIC siRNA is conjugated to a transfection reagent. The concentration of ET-2 / VIC siRNA is 0.1 to 200 μM / L, preferably 10 to 150 μM / L, more preferably 50 to 100 nM / L in the cultured cell-containing medium.

  When added in this concentration range, as transfection reagents that can suppress the expression of ET-2 / VIC gene and TGase 1 and suppress the differentiation of keratinocytes, Lipofectamine (registered trademark), Lipofectamine plus (registered trademark) , Jet PEI (registered trademark), Oligofectamine (registered trademark), siLentFect (registered trademark), DMRIE-C (registered trademark), Transfectin-Lipid (registered trademark), Effectene (registered trademark), and the like can be used.

  In addition, the agent for preventing or treating keratinization abnormalities or cancer diseases of the present invention suppresses keratinocyte differentiation and regresses excessive keratinization. In the case of cancer cells, the cancer cells are killed by suppressing the expression of ET-2 / VIC, which is involved in the survival and metastasis of cancer cells.

  Specific examples of the target keratinosis disorder of the drug of the present invention include fish scales, fish eyes, and follicular keratosis. Although follicular keratosis inhibits hair growth in the scalp, the present invention can also be a hair restorer in these cases.

  The method of administration of ET-2 / VIC siRNA as a keratosis disorder or cancer preventive or therapeutic agent, hair restorer of the present invention to humans is intravenous, intramuscular, subcutaneous and intraperitoneal injection or parenteral. A parenteral route such as a route is preferred. ET-2 / VIC siRNA is used in combination with a commonly used pharmaceutical carrier. Carriers include, but are not limited to, physiological saline, phosphate buffered saline, phosphate buffered saline glucose solution and buffered saline. When blended with a carrier, the content of ET-2 / VIC siRNA may be appropriately selected depending on the preparation, and varies depending on the preparation, but is preferably 0.001 to 1% by weight. The dosage is determined by the patient's age, sex, weight, symptoms, therapeutic purpose, etc. Generally, for parenteral administration, 0.0001-1 mg is divided into once to several times a day for parenteral administration. Can be administered. This dose can be appropriately increased or decreased depending on the type of disease, patient age, weight, symptoms and the like.

  The ET-2 / VIC siRNA of the present invention can be used as a culture additive in neuronal cell culture or tissue culture.

  Furthermore, the present invention includes a method for evaluating the degree of keratinocyte differentiation using the ET-2 / VIC gene or a part thereof as a marker. In this method, the degree of expression of the ET-2 / VIC gene in keratinocytes may be measured. The degree of expression of the ET-2 / VIC gene can be determined, for example, by measuring mRNA, and can be measured by RT-PCR, quantitative PCR, Northern blotting, or the like. In this case, when the degree of expression of the ET-2 / VIC gene is large in keratinocytes, it can be determined that the degree of differentiation of the keratinocytes is large. The animal species of the target keratinocytes is not limited, and keratinocytes of all animals such as humans and mice are targeted. The present invention also includes a fragment of the ET-2 / VIC gene for measuring the degree of expression of the ET-2 / VIC gene, and the fragment can be used as a primer, for example. The base length of the fragment is 5 to 50, preferably 10 to 30, and more preferably 15 to 25. For example, the degree of expression of the ET-2 / VIC gene can be measured using a primer set consisting of the sequences represented by SEQ ID NOs: 5 and 7.

  Furthermore, the present invention includes a keratinocyte differentiation marker comprising the ET-2 / VIC gene or a part thereof. “Differentiation marker” refers to a marker that can be used to determine the degree of differentiation.

  The present invention will be specifically described by the following examples, but the present invention is not limited to these examples.

(1) Gene expression in mouse keratinocyte differentiation 9% fetal bovine serum with a reduced Ca concentration was added to a purchased sterilized S-MEM medium (Ca-free). Keratinocytes were added to a 6 cm dish and cultured at 37 ° C. under 5% CO ₂ . After the cells reached a semi-confluent state, they were replaced with MEM medium supplemented with 10% fetal calf serum, and differentiation was started. Keratinocytes proliferate cells without differentiation at a low Ca concentration (about 0.05 mM), but when Ca concentration is high (from 1.2 mM), growth is stopped and differentiation begins. The culture was further continued for 0, 20, 40, and 60 minutes without changing the medium. The culture thus obtained was washed 3 times with PBS, then solubilized twice with 0.5 ml (per 6 cm dish) ISOGEN (Nippon Gene), mixed, and then at -80 ° C. saved. RNA extraction was performed according to the manufacturer's recommendation (Nippon Gene). An RNA PCR Kit (Takara) was used for 0.5 μg of RNA reverse transcription per condition. The primer sequences, cycle numbers and annealing temperatures are shown in Table 1 below.

  Next, electrophoresis using 3% agarose gel was performed. After electrophoresis, the gel was stained with ethidium bromide and photographed under UV. Amplified products were identified by size, and the fluorescence intensity of ethidium bromide in each band was quantified using NIH Image. FIG. 1 shows the evaluation of ET-2 / VIC gene expression by RT-PCR when MEM medium was replaced and differentiation was started. Data were normalized to 18S rRNA expression level. Immediately after the start of differentiation, ET-2 / VIC was remarkably induced.

  This result indicates that the ET-2 / VIC gene is greatly involved in the regulation of keratinocyte differentiation.

(2) Method of adding ET-2 / VIC siRNA (final concentration 100 nM) to cells Mix 4.5 μL of transfection reagent (SiLent Fect Lipid Reagent, BIO-RAD) with 150 μL of the purchased sterile S-MEM medium (solution 1) Separately, 150 μL of S-MEM medium was mixed with 1.8 μL of 100 μM siRNA stock solution (solution 2). Further, Solution 1 and Solution 2 were mixed and left at room temperature for 20 minutes. The sequence of siRNA is shown in Table 2.

(3) Suppression of gene expression Keratinocytes were added to a 6 cm dish in the same manner as in (1) above, and cultured at 37 ° C. under 5% CO ₂ . When the cells reached 50% confluence, half of the medium was removed, the siRNA solution prepared in (2) above was added, and the culture was continued for 24 hours. After 24 hours, differentiation was started by exchanging with MEM medium in the same manner as in (1) above. One hour later, gene expression was analyzed in the same manner as in (1) above. FIG. 2 shows RT-PCR evaluation of ET-2 / VIC gene expression when ET-2 / VIC siRNA was added and replaced with MEM medium and differentiation was started. Data were normalized to 18S rRNA expression level. After differentiation was initiated, ET-2 / VIC was remarkably suppressed by ET-2 / VIC siRNA.
This result shows that ET-2 / VIC siRNA surely suppresses the increase in ET-2 / VIC gene expression.

(4) Inhibition of keratinocyte differentiation The siRNA solution prepared in (2) above was added in the same manner as in (3) above, and the culture was continued for 24 hours. After 24 hours, differentiation was started by exchanging with MEM medium in the same manner as in (1) above. The culture was performed without changing the medium for 2 days, and the morphology was observed with a phase contrast microscope. The results of evaluating the state of differentiation by microscopic observation are shown in FIG. By adding 100 nM ET-2 / VIC siRNA, inhibition of keratinocyte differentiation was observed (FIG. 3). Furthermore, the cells were cultured without changing the medium for 5 days from the start of differentiation, and examined for the formation of cornified envelope (CE) and TGase 1 expression, which are differentiation indicators. The formation of CE was measured as follows. The resulting culture was washed twice with PBS and then dissolved in 0.5 mL of lysate (50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100 at pH 8.0, 1 mM PMSF). Recovered with a scraper. This was treated with a homogenizer to make a uniform solution, and then the protein amount was measured by BCA Protein assay kit (Pierce Biotechnology) (total protein amount). Thereafter, centrifugation (10000 g, 15 minutes) was performed, and the supernatant solution was recovered and stored for Western blot (WB) analysis. From the insoluble matter obtained after centrifugation, the lysate was removed twice with a 100 ° C lysate (100 mM Tris-HCl, 1% 2-mercaptoethanol, 2% SDS at pH 9.0), and the remaining insoluble matter was removed. CE. Further, it was washed 3 times with a solubilizing solution (50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100 at pH 8.0, 1 mM PMSF), further treated with a homogenizer, made into a uniform solution, and the same as above. The amount of protein was measured (CE protein amount). CE formation was calculated as the ratio of CE / TP. The result is shown in FIG. By adding 100 nM ET-2 / VIC siRNA, the amount of CE formed was suppressed (FIG. 4). Furthermore, TGase 1 expression was measured by Western blot. The recovered WB sample was similarly measured for the amount of protein, a fixed amount (50 μg) was applied to a 10% acrylamide gel, and SDS-PAGE was performed. After transferring to PVDF membrane, blocking, primary antibody reaction (anti-TGase 1 polyclonal, 1: 200, Santa Cruz), and reaction with alkaline phosphatase secondary antibody were allowed to develop color. The color intensity in the band was quantified using NIH Image. FIG. 5 shows the evaluation by WB of TGase 1 expression when ET-2 / VIC siRNA is added. Data was normalized to the expression level of scramble-negative control. Expression of TGase 1 was suppressed.

  The siRNA targeting the partial sequence of ET-2 / VIC mRNA of the present invention is an ET-2 / VIC gene expression inhibitor, transglutaminase 1 expression inhibitor, keratinocyte differentiation induction inhibitor, etc. Can be used. Furthermore, it can be used as a preventive or therapeutic agent for keratotic disorder cancer.

It is the electrophoresis photograph (A) which shows the ET-2 / VIC gene after a mouse | mouth keratinocyte differentiation start, and the graph (B) quantified. In the graph, the vertical bar and its tip protrusion indicate the average value and standard deviation value of a group of 3 dishes, respectively. When a statistically significant difference is recognized between each treatment group, it shows with a different alphabet (P <0.05, Scheffe's F-test). FIG. 2 is an electrophoretic photograph (A) and a quantified graph (B) showing an ET-2 / VIC gene 1 hour after the start of differentiation of mouse keratinocytes into which ET-2 / VIC siRNA was introduced. In the graph, the vertical bar and its tip protrusion indicate the average value and standard deviation value of a group of 3 dishes, respectively. If there is a statistically significant difference between treatment groups, it is indicated with an asterisk (P <0.05, Student's t-test). It is a photograph which shows the result of having observed the morphological change 48 hours after the keratinocyte differentiation start which introduce | transduced ET-2 / VIC siRNA into the microscope. It is a graph which shows the CE formation amount 120 hours after the start of mouse keratinocyte differentiation introduced with ET-2 / VIC siRNA. In the graph, the vertical bar and its tip protrusion indicate the average value and standard deviation value of a group of 3 dishes, respectively. If there is a statistically significant difference between treatment groups, it is indicated with an asterisk (P <0.05, Student's t-test). FIG. 2 shows a WB photograph (A) and a quantified graph (B) showing the expression level of TGase 1 120 hours after the start of differentiation of mouse keratinocytes introduced with ET-2 / VIC siRNA. In the graph, the vertical bar and its tip protrusion indicate the average value and standard deviation value of a group of 3 dishes, respectively. If there is a statistically significant difference between treatment groups, it is indicated with an asterisk (P <0.05, Student's t-test).

SEQ ID NOs: 1-10 synthesis

Claims (14)

  An ET-2 / VIC gene expression inhibitor comprising, as an active ingredient, siRNA or shRNA targeting a partial sequence of ET-2 / VIC mRNA as a target sequence.   The ET-2 / VIC gene expression inhibitor according to claim 1, comprising the RNA represented by SEQ ID NO: 1 and SEQ ID NO: 2.   A transglutaminase 1 expression inhibitor containing, as an active ingredient, siRNA or shRNA targeting a partial sequence of ET-2 / VIC mRNA as a target sequence.   The transglutaminase 1 expression inhibitor according to claim 3, wherein the siRNA or shRNA contains RNA represented by SEQ ID NO: 1 and SEQ ID NO: 2.   A keratinocyte differentiation induction inhibitor containing, as an active ingredient, siRNA or shRNA targeting a partial sequence of ET-2 / VIC mRNA as a target sequence.   The keratinocyte differentiation induction inhibitor according to claim 5, wherein the siRNA or shRNA comprises RNA represented by SEQ ID NO: 1 and SEQ ID NO: 2.   A pharmaceutical composition comprising, as an active ingredient, siRNA or shRNA targeting a partial sequence of ET-2 / VIC mRNA as a target sequence.   The pharmaceutical composition according to claim 7, wherein the siRNA or shRNA comprises RNA represented by SEQ ID NO: 1 and SEQ ID NO: 2.   The pharmaceutical composition according to claim 7 or 8, which is a prophylactic or therapeutic agent for abnormal keratosis disorder.   The pharmaceutical composition according to claim 7 or 8, which is a preventive or therapeutic agent for cancer.   The pharmaceutical composition according to claim 7 or 8, which is a hair restorer for preventing or treating inhibition of hair growth caused by abnormal keratinization.   A keratinocyte differentiation marker consisting of all or part of the ET-2 / VIC gene.   A method for determining the degree of keratinocyte differentiation, comprising measuring the expression of ET-2 / VIC gene using ET-2 / VIC gene as a keratinocyte differentiation marker.   A detection reagent for determining the degree of keratinocyte differentiation using the ET-2 / VIC gene as a keratinocyte differentiation marker, comprising an ET-2 / VIC gene fragment as a probe or primer.

Images