JP5263730B2 - Preventive and therapeutic agent for feline infectious peritonitis virus (FIPV) - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a double strand RNA (dsRNA) molecule for specifically inhibiting the proliferation of feline infectious peritonitis virus (FIPV), and to provide a composition for inhibiting the proliferation of FIPV therewith. <P>SOLUTION: Provided is the dsRNA molecule targeting the mRNA of the protease (3CLpro) of FIPV, wherein one strand of the dsRNA molecule is a sense strand having the same base sequence as the 3CLpro gene sequence of the FIPV or as one part thereof, and the other strand is an antisense strand having a base sequence complementary to the base sequence of the sense strand; and the composition using the dsRNA molecule and used for inhibiting the proliferation of the FIPV. <P>COPYRIGHT: (C)2009,JPO&amp;INPIT

Description

The present invention relates to a double-stranded RNA (dsRNA) molecule targeting the mRNA of feline infectious peritonitis virus (FIPV) 3C-like protease (3CLpro). The present invention also relates to a composition for inhibiting FIPV replication comprising the dsRNA molecule.

  Feline Infectious Peritonitis (FIP) is a disease caused by feline infectious peritonitis virus (FIPV) in which coronavirus has been mutated in the cat. It is a high and terrible disease.

There are two types of symptoms of FIP: “wet type” and “dry type”. The “wet type”, which has many cases, causes severe vasculitis in the abdomen and chest along with fever, diarrhea, anemia, etc., ascites and pleural effusion accumulate, abdomen swells, and difficulty breathing. The “dry type” has a large lump like lymphoma in the abdomen. In addition, this type may cause inflammation in the brain, causing neurological symptoms such as paralysis and convulsions.

  At present, there is no radical cure for FIP, and once FIP develops, there is only symptomatic treatment to relieve symptoms by administering interferon or steroids, and in most cases it does not help. Moreover, since there is no effective vaccine, it is difficult to obtain a sufficient therapeutic effect (Non-patent Document 1).

Niels C. Pedersen, Feline Infectious Disease, American Veterinary Publications, Inc.

  In the conventional method, since FIP could not be sufficiently prevented and / or treated, a new method capable of effectively treating FIP has been desired. Thus, the present invention provides dsRNA molecules that target FIPV 3CLpro mRNA, which inhibits FIPV proliferation. Also provided is a composition for inhibiting FIPV replication comprising the dsRNA molecule.

FIPV is a positive-sense single-stranded RNA virus having the structure shown in FIG. The replicase involved in genomic RNA replication and transcription is encoded as two overlapping polyproteins, pp1a (ORF1a) and pp1ab (ORF1b). Several different proteins are linked in the polyprotein, and individual proteins are cleaved site-specifically by proteases from this precursor to exert their functions. A protease involved in the excision of this protein is 3CLpro. That is, 3CLpro is directly involved in the formation of capsids of FIPV and the formation of infectious mature virus particles (Journal of General Virology, 2002 vol.83 595-599, Journal of General Virology, 2002, vol. 83 581 -593.)

Therefore, as a result of intensive investigations to solve the above problems, the inventors of the present application have found that the sense strand having the same base sequence as the 3CLpro gene sequence of FIPV or a part thereof and a base sequence complementary to the base sequence of the sense strand The present inventors have found that a dsRNA molecule comprising an antisense strand having a specific suppression of 3CLpro gene expression has led to the completion of the present invention.

That is, the present invention is as follows.
[1] Double-stranded RNA (dsRNA) molecule targeting feline infectious peritonitis virus (FIPV) 3C-like protease (3CLpro) mRNA, one strand of which is represented by SEQ ID NO: 1 A dsRNA molecule, wherein the dsRNA molecule is a sense strand identical to a sequence having at least 19 consecutive bases therein, and the other strand is an antisense strand having a base sequence complementary to the base sequence of the sense strand.

[2] The dsRNA molecule is 138 to 1 of the 3CLpro gene sequence, one strand of which is represented by SEQ ID NO: 1.
Any base sequence selected from the group consisting of a sequence having the 60th base, a sequence having the 171st to 193rd bases, a sequence having the 363rd to 385th bases, and a sequence having the 815th to 837th bases The dsRNA molecule of [1], wherein the other strand is an antisense strand having a base sequence complementary to the base sequence of the sense strand.

[3] A dsRNA molecule comprising a sense strand represented by SEQ ID NO: 2 and an antisense strand represented by SEQ ID NO: 3, a sense strand represented by SEQ ID NO: 4 and an antisense strand represented by SEQ ID NO: 5 Any one selected from the group consisting of the sense strand represented by No. 6 and the antisense strand represented by SEQ ID No. 7, and the sense strand represented by SEQ ID No. 8 and the antisense strand represented by SEQ ID No. 9 [2] dsRNA molecule consisting of

[4] The dsRNA molecule according to any one of [1] to [3], wherein the sense strand and the antisense strand are linked via a linker molecule.
[5] A vector comprising the template DNA of the dsRNA molecule of [4] and expressing the dsRNA molecule.
[6] A composition comprising one or more dsRNA molecules according to any one of [1] to [4] for inhibiting FIPV replication.
[7] A composition comprising the vector of [5] for inhibiting FIPV replication.

The dsRNA molecule according to the present invention can be used to specifically suppress FIPV 3CLpro gene expression, thereby inhibiting FIPV replication. The dsRNA of the present invention can be used as a prophylactic or therapeutic agent for cat FIP.

In one embodiment, the present invention relates to a dsRNA molecule that targets FIPV 3CLpro mRNA, comprising:
One strand of the dsRNA molecule is a sense strand having the same base sequence as the FIPV 3CLpro gene sequence or a part thereof, and the other strand is an antisense strand having a base sequence complementary to the base sequence of the sense strand To the above dsRNA molecule.

The dsRNA molecules of the present invention can cleave FIPV 3CLpro mRNA in a sequence-specific manner, resulting in RNA interference (RNAi) that suppresses 3CLpro gene expression.

When the dsRNA molecule of the present invention is provided with a length of 30 bases or more, it is processed by the action of an RNase III-like enzyme called Dicer and has 21 to 27 bases having a 2 base overhang at the 3 ′ end. Can generate siRNA (small interfering RNA) molecules. This siRNA
Molecules are incorporated into a protein complex called RISC (RNA-induced silencing complex), and 3CLpro mRNA is recognized and degraded by homology with siRNA molecules to suppress expression.

In the present invention, the dsRNA molecule includes an siRNA molecule.
The number of bases of the dsRNA molecule of the present invention is not particularly limited, but is 15 to 50 bases, preferably 19 to 35.
A base, particularly preferably 21 bases.

  In the present invention, the sense strand identical to the 3CLpro gene sequence means an RNA sequence having a base sequence in which thymine in the 3CLpro gene sequence represented by SEQ ID NO: 1 is substituted with uracil. The sense strand constituting the dsRNA molecule of the present invention is preferably identical to the 3CLpro gene sequence, but may be substantially the same, ie, a homologous sequence. That is, as long as the sense strand of the dsRNA molecule and the mRNA sequence of the 3CLpro actually targeted are hybridized, one or more, that is, 1 to 10, preferably 1 to 5, more preferably 1 to 2, There may be one or one mismatch. Therefore, the sense strand sequence of the dsRNA molecule of the present invention and the gene sequence of 3CLpro have a sequence homology of 90% or more, preferably 95% or more, more preferably 95, 96, 97, 98 or 99% or more.

  In the present invention, the sense strand preferably has a sequence having the 138th to 160th bases of the 3CLpro gene sequence represented by SEQ ID NO: 1, a sequence having the 171st to 193rd bases, and a sequence having the 363th to 385th bases And preferably the same as the base sequence selected from the group consisting of the sequences having the 815th to 837th bases, particularly the same as the sequence having the 138th to 160th bases and the sequence having the 815th to 837th bases. Preferably there is.

The sense strand and antisense strand constituting the dsRNA molecule can be synthesized in vitro by chemical synthesis or a transcription system using a promoter and RNA polymerase based on a known method. It is also possible to synthesize in vivo by introducing the antisense strand and the template DNA of the sense strand into an appropriate expression vector and administering the vector into an appropriate host cell. Annealing of the synthesized sense strand and antisense strand can be performed by a general method known to those skilled in the art. Dissolve the synthesized sense strand and antisense strand in dsRNA annealing buffer, mix the same amount (equal number of moles), heat the temperature until the double strands dissociate, and then gradually cool and incubate. Do by. Annealing conditions are performed, for example, by leaving still at 90 ° C. for 1 minute and then at 37 ° C. for 1 hour. Then, dsRNA molecules can be obtained by phenol / chloroform extraction / ethanol precipitation.

In one embodiment, the dsRNA molecule of the present invention is represented by the sense strand represented by SEQ ID NO: 2 and the antisense strand represented by SEQ ID NO: 3, the sense strand represented by SEQ ID NO: 4 and SEQ ID NO: 5. An antisense strand, a sense strand represented by SEQ ID NO: 6 and an antisense strand represented by SEQ ID NO: 7, and a sense strand represented by SEQ ID NO: 8 and an antisense strand represented by SEQ ID NO: 9 It consists of any selected base pair, and in particular, it is represented by the sense strand represented by SEQ ID NO: 2 and the antisense strand represented by SEQ ID NO: 3 or the sense strand represented by SEQ ID NO: 8 and SEQ ID NO: 9 A dsRNA molecule consisting of an antisense strand is preferred.

In addition, the dsRNA molecule of the present invention is provided as a folded shRNA (short hairpin RNA) molecule in which the sense strand and the antisense strand defined above are linked via a linker molecule and a loop structure is formed at the linker portion. Can be done. shRNA molecules can also be processed by Dicer to produce siRNA molecules.

The linker molecule contained in the shRNA molecule may be a polynucleotide linker or a non-polynucleotide linker as long as it can link the sense strand and the antisense strand to form a stem loop structure, and is not particularly limited. Polynucleotide linkers known to those skilled in the art are preferred.

  shRNA molecules can also be synthesized in vitro or in vivo based on known methods as described above. When synthesizing, a single RNA strand containing the sense strand and antisense strand as reverse sequences is synthesized, and then a single strand of RNA is formed by self-complementary binding to obtain an shRNA molecule. Can do.

The sense strand or antisense strand constituting the dsRNA molecule may optionally have an overhang at the 3 ′ end, and the type and number of bases of the overhang are not limited. For example, 1-5 , Preferably 1 to 3, more preferably 1 or 2 base sequences, for example, TTT, UU and TT. In the present invention, the term “overhang” refers to a base that is added to the end of one strand of a dsRNA molecule and does not have a base that can complementarily bind to the corresponding position of the other strand. The overhang may be a base constituting DNA. Furthermore, the sense strand or the antisense strand constituting the dsRNA molecule has 1 to 3 bases as necessary within a range not affecting siRNA activity in order to smoothly perform various experimental operations such as gene sequencing. More preferably, it may further include substitution, addition or deletion of 1 or 2 bases.

Further, the sense strand or the antisense strand may be phosphorylated at the 5 ′ end as necessary, and for the shRNA molecule, triphosphate (ppp) may be bound to the 5 ′ end.
In one embodiment, the present invention also relates to a vector that expresses the shRNA molecule.

  As vectors that can be used in the present invention, plasmid vectors, viral vectors, non-viral vectors, and the like can be used. As a plasmid vector, a pBAsi vector, a pSUPER vector, or the like can be used. As a viral vector, an adenovirus vector, a retrovirus vector, a lentivirus vector, or the like can be used. As the non-viral vector, a liposome vector or the like can be used, and a Sendai virus-liposome vector is particularly preferable.

The vector may be inserted with a promoter and / or other regulatory sequences linked in a functional manner. “Functionally linked and inserted” means that in the cell into which the vector has been introduced, under the control of a promoter and / or other regulatory sequences, the shRNA molecule is expressed and the target 3CLpro mRNA is expressed. It means that a promoter and / or other regulatory sequences are linked and incorporated into the vector so as to be degraded. Promoters and / or other regulatory sequences that can be incorporated into the vector are not particularly limited, but promoters and / or other known in the art such as constitutive promoters, tissue-specific promoters, time-specific promoters, other regulatory elements, etc. These control sequences can be appropriately selected.

  The thus-produced vector expressing the shRNA molecule expresses the shRNA molecule in the introduced cell and specifically degrades 3CLpro mRNA.

In one embodiment, the present invention also provides a dsRNA of the present invention for inhibiting FIPV replication.
It relates to a composition comprising a molecule and a composition comprising a vector of the invention. The composition of the present invention may contain one or a combination of the dsRNA molecules or vectors of the present invention. For example, the sense strand represented by SEQ ID NO: 2 and the antisense strand represented by SEQ ID NO: 3, the sense strand represented by SEQ ID NO: 4 and the antisense strand represented by SEQ ID NO: 5, represented by SEQ ID NO: 6 1 type, 2 types, 3 types of dsRNA molecules consisting of the sense strand and the antisense strand represented by SEQ ID NO: 7, or the sense strand represented by SEQ ID NO: 8 and the antisense strand represented by SEQ ID NO: 9, Or four kinds may be included. The compositions of the present invention may also contain suitable carriers, diluents, emulsions and the like with the dsRNA molecules or vectors of the present invention. For example, physiological saline, phosphate buffered saline, phosphate buffered saline glucose solution, buffered saline, and the like can be included in the composition. When the composition of the present invention is used as a pharmaceutical composition, the composition is suitable for administration by the oral route, as well as intravenous, intramuscular, subcutaneous and intraperitoneal injection or parenteral route. Can be prepared in different forms.

The present invention can provide a prophylactic or therapeutic agent for FIP comprising the above dsRNA molecule or expression vector as an active ingredient. The prophylactic or therapeutic agent is a normal cat, a cat infected with FIPV, or FIP
Is administered to cats that are developing FIPV to prevent infection of FIPV, inhibit the growth of infected FIPV, prevent the development of FIPV, or treat FIPV infection. The dose of the prophylactic or therapeutic agent is not limited. For example, in the case of intestinal epithelial cells, macrophages, etc., it can be administered such that at least one copy of dsRNA molecule is introduced per cell, for example, per dosage unit. The molecular weight of dsRNA is 1 nM to 100 μM, preferably 10 nM to 50 μM, more preferably 100 nM to 20 μM. The dose can be changed according to the condition, age, sex, severity, etc. of the patient cat, and is determined by the judgment of a specialist veterinarian. Furthermore, the present invention provides the above dsRNA.
A molecule or expression vector can be administered to a cat to provide a method for preventing or treating feline FIPV.

  The composition of the present invention can suppress 3CLpro expression of FIPV and, as a result, inhibit FIPV replication by the action of the dsRNA molecule or vector contained as a component thereof.

  Moreover, this invention can provide the replication inhibition method of FIPV using the said composition. In this method, the composition is administered to a cell, tissue or individual infected with FIPV to deliver the dsRNA molecules and expression vectors of the invention contained in the composition. The delivered dsRNA molecules and expression vectors can suppress the expression of 3CLpro of FIPV and consequently inhibit FIPV replication.

dsRNA molecules and expression vectors include nucleic acid introduction methods known to those skilled in the art, such as, but not limited to, Hydrodynamic method, method using calcium ions, electroporation method, spheroplast method, lithium acetate method, calcium phosphate method It can be introduced into cells and tissues using a lipofection method, a microinjection method, a method using a gene gun, and the like. If the subject is an animal individual, the dsRNA molecule and expression vector are in the form of a composition comprising appropriate carriers, diluents, emulsions, and the like in the oral route, as well as intravenous, intramuscular, subcutaneous and intraperitoneal. It can be administered by injection or parenteral route.

The effect of the dsRNA molecule of the present invention is that cells and tissues into which dsRNA molecules have been introduced, and cells or tissues in which the expression level of 3CLpro mRNA or protein in the individual has not been introduced (or before introduction), In addition, it can be evaluated by using as an index a decrease in the expression level of 3CLpro mRNA or protein in an individual. The 3CLpro measured here may be expressed from an expression vector that expresses 3CLpro introduced in advance and / or simultaneously, or may be detected by FIPV infection. The expression level is reduced not only when the expression level is reduced by 90% or more compared to the control, but also by 50% or more or 1
This includes cases where the expression level is reduced by more than 20%. When the measurement target is mRNA, it can be measured by Northern hybridization, RT-PCR, in situ hybridization, and the like. If the measurement target is protein, Western blotting or ELISA
It can be measured by measurement using a protein chip to which an antibody is bound, protein activity measurement, or the like. When the detected 3CLpro is derived from a vector introduced in advance and / or simultaneously, a detectable label (eg, EGFP) gene is incorporated into the vector together with 3CLpro, and expression comprising 3CLpro and the label The resulting fusion proteins can be detected and compared by appropriate means.

The present invention will be specifically described by the following examples, but the present invention is not limited to these examples.
Example 1. Construction of 3CLpro-EGFP expression vector
FIPV is a mutant strain of intestinal coronavirus, many of which are known. Of these, FIPV 79-
The 1146 strain is highly infectious and is considered to have the same serotype as the causative virus of FIP that is most commonly developed in Japan. Therefore, in this example, an experiment was conducted using the FIPV79-1146 strain gene, which is highly infectious and frequently occurs in Japan, and the same serotype as the causative virus of FIP. Based on the sequence of the 3CLpro gene (SEQ ID NO: 1: AY994055) of FIPV79-1146 strain, the following primers containing a FLAG tag sequence and restriction enzyme (NheI and BamHI) recognition sequences were prepared:
FIP 3CLpro Bam-V2: 5'-GCGGGATCCCTGAAGATTAACACCATACAT-3 '(SEQ ID NO: 10)
FIP 3CLpro FW Nhe: 5'-CCCGCTAGCATGGACTACAAGGACGACGATGACAAGTCCGGATTGAGAAAAATGGC-3 '(SEQ ID NO: 11)
PCR was performed using these primers and pMal-FIPV-3CLpro (provided by Dr. John Ziebuh of University of Wurzburg) as a template DNA, and the 3CLpro gene was cloned. The cloned 3CLpro gene was treated with restriction enzymes with NheI and BamHI, the fragment was purified, and then cloned into the NheI-BamHI site of pEGFP-N3 vector (Takara Bio Inc.). Since the 3CLpro protein expressed from the vector is a fusion with EGFP, it can be visualized under a fluorescence microscope.

Example 2 siRNA selection and synthesis
Based on the 3CLpro gene sequence of FIPV79-1146 strain (SEQ ID NO: 1 AY994055), 4 types of siRNA consisting of the following sense strands and antisense strands specifically targeting the 3CLpro gene were selected by a computer program (RNAi) (Commissioned to PROLIGO).
siRNA1: Target gene region 138 to 160 bases Sense strand: CAUCGCGAGUGAUCAAUUAUG (SEQ ID NO: 2)
Antisense strand: UAAUUGAUCACUCGCGAUGUA (SEQ ID NO: 3)
siRNA2: Target gene region 171 to 193 bases Sense strand: CUAGUGUGCGUUUACAUAACU (SEQ ID NO: 4)
Antisense strand: UUAUGUAAACGCACACUAGAC (SEQ ID NO: 5)
siRNA3: Target gene region 363 to 385 bases Sense strand: GUAGUGUCUACGGUGUUAACA (SEQ ID NO: 6)
Antisense strand: UUAACACCGUAGACACUACCG (SEQ ID NO: 7)
siRNA4: Target gene region 815-837 bases Sense strand: GGAGGACGUACUAUACUGUCU (SEQ ID NO: 8)
Antisense strand: ACAGUAUAGUACGUCCUCCAA (SEQ ID NO: 9)
Negative control (scrambled siRNA): Target gene region is 438-460 bases from the 3 'side of N gene of FIP 7911-46 strain
Sense strand: AGUGAAGUUCGACUUUGACAC (SEQ ID NO: 12)
Antisense strand: UCACUUCAAGCUGAAACUGUG (SEQ ID NO: 13)

Example 3 Analysis of 3CLpro expression inhibitory effect by siRNA molecules The above four types of siRNA molecules were transfected into cultured cells together with the 3CLpro-EGFP expression vector, and the 3CLpro expression inhibitory effect of each siRNA molecule was examined using the following analysis system.

(I) Analysis of 3CLpro with confocal laser microscope
AD293 cell line containing 10% fetal bovine serum (FCS) and Dulbecco's modified Eagle's medium
The cells were cultured and maintained in (D-MEM) at 37 ° C. in a 5% CO ₂ environment. The cell line is seeded on a 12-well plate at a density of 5 × 10 ⁵ / well. After 20 hours, when the cells are 80-90% confluent, the medium is placed in 1 ml of 5% FCS-containing D-MEM. The 3CLpro-EGFP expression vector and various siRNAs were transfected. Transfection was performed as follows: 1.0 μg of 3CLpro-EGFP expression vector and 1.0 μl of various siRNA (final concentration 50 nM) and 0.5 μg of DsRed expression vector (pDsRed2-N1 vector, Clontech) were mixed with 50 μl of 0pti-MEM. Then, 4 μl of Lipofectamine 2000 (Invitrogen) and 50 μl of Opti-MEM medium were mixed, and the solution which was allowed to stand at room temperature for 5 minutes was added and mixed, and incubated at room temperature for 20 minutes. This mixed solution was added to each well and cultured at 37 ° C. for 24 hours.

  24 hours after transfection, 3CLpro-EGFP protein expression was confirmed by a confocal laser microscope. DsRed was used to compare transfection efficiency in each siRNA transfected cell.

(II) Western blotting analysis The cells analyzed by the confocal laser microscope as described above were collected, and 100 μl of cell lysis buffer (10 mM Tris, pH 8.0, 1 mM EDTA, 0.15 containing complete mini (Roche) was collected.
M NaCl, 1% NP40). After quantification of the protein with DC protein assay kit (Bio Rad), 6 μg of each protein was used and electrophoresis was performed in a 10% SDS-PAGE reducing state. Next, transfer to Immobilon P (Millipore) under constant voltage of 120V for 2 hours at 4 ° C, then TBST containing 1% BSA, 5% nonfat dry milk (DIFCO) (20 mM, 137 mM NaCl, 0.05% Tween20) Blocked overnight at 4 ° C. Then, after reacting for 1 hour at room temperature with a solution obtained by diluting an anti-GFP antibody (Clontech) as a primary antibody 1000 times with TBST, it was washed 3 times with TBST. Subsequently, the HRP-conjugated anti-mouse IgG antibody (Promega) was reacted with a solution diluted 5000 times with TBST for 1 hour at room temperature, and then washed 3 times with TBST.

  SuperSignal West Femto Maximum Sensitivity Substrate (Pierce) was used for signal detection. As the signal detector, Versa Doc 5000 (Bio Rad) was used, and quantitative analysis was performed using Quantity One (Bio Rad), which is a quantitative program.

  Subsequently, in order to correct the migration amount of the protein, the expression level of β-actin in the cells was analyzed. After removing the antibody from the transfer membrane and blocking again, the anti-β-actin antibody (Sigma-Aldrich) diluted 1: 500 as the primary antibody and the HRP-conjugated anti-mouse IgG antibody (Promega) diluted 5000 times as the secondary antibody Was used to detect and quantify β-actin as described above.

(III) Analysis results Analysis results by confocal laser microscope and Western blotting a. Confirmation of decreased expression level of 3CLpro protein by confocal laser scanning microscope
The result of examining the expression level of 3CLpro-EGFP fusion protein by analyzing the fluorescence intensity of EGFP with a confocal laser microscope is shown in FIG. It was observed that the fluorescence intensity decreased in the system into which various siRNA molecules were introduced, compared to the fluorescence intensity in the system into which the control siRNA molecules were introduced. In particular, the fluorescence intensity decreased significantly in the system in which one siRNA molecule was introduced. On the other hand, the various synthesized siRNA molecules did not suppress the expression of EGFP alone. This confirmed that siRNA molecules specifically suppressed the expression of the 3CLpro gene.

b. Confirmation of decreased expression level of 3CLpro protein by Western blotting
The results of quantitative analysis of the expression levels of 3CLpro-EGFP fusion protein and β-actin by Western blotting are shown in the following Table 1 and FIGS. 3, 4 and 5.

Table 1 shows the results of quantifying each band in FIGS. 3 and 4 and comparing the expression level of 3CLpro-EGFP fusion protein in each system. FIG. 5 is a graph showing the expression level of the 3CLpro-EGFP fusion protein in each system derived from Table 1. These quantitative analyzes showed that the amount of 3CLpro-EGFP fusion protein detected in the system into which various siRNA molecules were introduced was reduced as compared with the system into which the control siRNA molecules were introduced. In particular, the amount of 3CLpro-EGFP fusion protein was significantly reduced in the system in which siRNA1 and siRNA4 were introduced, and the expression level of 3CLpro-EGFP fusion protein was suppressed by about 75% compared to the system in which no siRNA molecule was introduced. It was done.

The dsRNA molecule targeting 3CLpro mRNA of FIPV of the present invention can effectively suppress the expression level of 3CLpro protein, thereby inhibiting FIPV replication. Moreover, feline infectious peritonitis can be effectively prevented and / or treated by inhibiting FIPV replication using the dsRNA molecule of the present invention.

It is a schematic diagram which shows single-stranded RNA of FIPV. It is a figure which shows the analysis result of 3CLpro-EGFP fusion protein by a confocal laser microscope. In the figure, a-d indicates the following introduction systems: a: 3CLpro-EGFP + siRNA1, b: 3CLpro-EGFP + siRNA2, c: 3CLpro-EGFP + siRNA3, d: 3CLpro-EGFP + siRNA4. Each photo on the left shows a fluorescent image of EGFP, and the photo on the right shows a fluorescent image of DsRed. It is a figure which shows the expression analysis result of 3CLpro-EGFP fusion protein by Western blotting. It is a figure which shows the expression analysis result of (beta) actin by Western blotting. It is a figure which shows the expression suppression effect of 3CLpro-EGFP fusion protein by each siRNA molecule. The expression level of 3CLpro-EGFP fusion protein in each system is shown relative to the expression level of 3CLpro-EGFP fusion protein when the 3CLpro-EGFP expression vector is introduced alone as 100%.

  SEQ ID NOs: 2-13 show synthetic oligonucleotide sequences.

Claims (3)

A double-stranded RNA (dsRNA) molecule that targets the mRNA of feline infectious peritonitis virus (FIPV) 3C-like protease (3CLpro), which is represented by the sense strand represented by SEQ ID NO: 2 and SEQ ID NO: 3 Antisense strand, sense strand represented by SEQ ID NO: 4 and antisense strand represented by SEQ ID NO: 5, sense strand represented by SEQ ID NO: 6 and antisense strand represented by SEQ ID NO: 7, and SEQ ID NO: 8 A dsRNA molecule consisting of any one of the base pairs selected from the group consisting of the sense strand represented by (2) and the antisense strand represented by SEQ ID NO: 9 . The dsRNA molecule according to claim 1, wherein the sense strand and the antisense strand are linked via a linker molecule. A vector comprising the template DNA of the dsRNA molecule according to claim 2 and expressing the dsRNA molecule.

Images