JP2007225574A - Method for producing solid-phase carrier - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for producing solid-phase carriers and capable of suppressing the nonspecific adsorption and binding of objects to be detected, and uniformly fixing biologically active substances to the surface of a solid phase. <P>SOLUTION: The method for producing solid-phase carriers, in which biologically active substances are fixed to a surface of a solid phase, includes a process for applying a polymer having biologically active substances and a phosphoryl choline group to the surface of the solid phase. The polymer, having the biologically active substances and the phosphoryl choline group, is acquired by the reaction between biologically active substances, having a first functional group and a polymer having a second functional group and a phosphoryl choline group at the first functional group and the second functional group. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

    The present invention relates to a method for producing a solid phase carrier in which a physiologically active substance is immobilized on a solid phase surface.

In medicine, biology, and molecular biology, a method of quantifying a physiologically active substance such as a specific nucleic acid or protein from a sample to be examined is a very important technique. In recent years, a test for quantifying a physiologically active substance that exists only in a trace amount in a sample has become important.
When measuring a small amount of physiologically active substance, the sample to be tested for presence often contains a large number of types of proteins and peptides. It is particularly required to be able to distinguish accurately from other proteins to be measured), good quantitativeness (how accurately it can be measured up to a minute amount), and good reproducibility (how much variation in measurement can be suppressed).

Examples of testing methods that meet such purposes include enzyme immunoassay (ELISA) utilizing antigen-antibody reaction, DNA microarray method, protein array method, and the like. In these methods, it is one of important techniques to immobilize proteins, nucleic acids, or molecules that capture them on a solid phase surface such as a plastic tube or a well of a microplate. Further, non-specific adsorption of the detection target to the solid phase surface causes a decrease in the S / N ratio, thereby reducing the detection accuracy (for example, Non-Patent Document 1). The S / N ratio is a value obtained by dividing the original signal amount (signal) obtained from the sample specimen by the signal amount (noise) generated from a site other than the signal substance obtained from the sample specimen. When the N ratio is high, the detection sensitivity becomes high. In order to prevent non-specific adsorption, an anti-adsorption agent is coated, but these non-specific adsorption capacities are not sufficient, and this also reduces the ability to capture the target substance. There is a problem that.

As a method for improving these problems, a method of coating a polymer having a phosphorylcholine group and an active ester group has been developed (Patent Document 1). According to this method, there is provided a biochip with high detection sensitivity that suppresses non-specific adsorption / binding of the detection target substance without coating with an adsorption inhibitor and has a high ability to capture the detection target substance. However, this method has not solved the good reproducibility (measurement variation).
In general, there are several possible causes of dispersion in a solid phase substrate in which a substance having affinity for a physiologically active substance is immobilized on the surface of the solid phase, and the problem of the immobilization reaction of the substance having affinity for the physiologically active substance And a problem in introducing a functional group necessary for immobilizing the substance on the substrate surface. Even if the coating is performed uniformly, if the physiologically active substance is not fixed uniformly, it causes a variation, which is a big problem.

"DNA Microarray Practice Manual", Hayashizaki Yoshihide, Okazaki Koji edited, Yodosha, 2000, p.57 International Publication WO2005 / 029095

  The present invention provides a method for producing a solid phase carrier that can suppress nonspecific adsorption / binding of a detection target and can easily and uniformly immobilize a physiologically active substance on the surface of the solid phase. With the goal.

The present invention
(1) A method for producing a solid phase carrier in which a physiologically active substance is immobilized on a solid surface, comprising a step of applying a physiologically active substance and a polymer having a phosphorylcholine group to the solid phase surface. Method for producing solid phase carrier,
(2) The physiologically active substance and the polymer having a phosphorylcholine group include a physiologically active substance having a first functional group and a polymer having a second functional group and a phosphorylcholine group, the first functional group and the second functional group. A method for producing a solid phase carrier according to (1), which is obtained by reacting in a group,
(3) The method for producing a solid phase carrier according to (2), wherein the first functional group is an amino group,
(4) The method for producing a solid phase carrier according to (2) or (3), which is at least one functional group selected from a second functional group, an aldehyde group, an active ester group, and an acid anhydride group,
(5) The method for producing a solid phase carrier according to (2) or (3), wherein the second functional group is a p-nitrophenyl ester group or an N-hydroxysuccinimide ester group,
(6) The method for producing a solid phase carrier according to any one of (1) to (5), wherein the polymer is a copolymer containing a butyl methacrylate group,
(7) The method for producing a solid phase carrier according to any one of (1) to (6), wherein the phosphorylcholine group is a 2-methacryloyloxyethyl phosphorylcholine group,
(8) The method for producing a solid phase carrier according to any one of (1) to (7), wherein the solid phase carrier is any one of a flat substrate, a microplate, a microtube, a microbead, and a substrate having a fine channel. ,
(9) The method for producing a solid phase carrier according to any one of (1) to (8), wherein the solid phase carrier is made of plastic.
(10) The method for producing a solid phase carrier according to (9), wherein the plastic is a saturated cyclic polyolefin,
(11) The physiologically active substance is at least one selected from nucleic acids, peptide nucleic acids, aptamers, oligopeptides, sugar chains, and derivatives thereof, or a complex containing at least one of these A method for producing a solid phase carrier according to any one of (1) to (10),
(12) The method for producing a solid phase carrier according to any one of (1) to (10), wherein the physiologically active substance is a nucleic acid derivative,
(13) The method for producing a solid phase carrier according to (12), wherein the nucleic acid derivative comprises a thymine multimer,
It is.

    According to the present invention, it is possible to obtain a solid phase carrier in which non-specific adsorption / binding of a detection target is suppressed and a physiologically active substance is simply and uniformly immobilized on a solid phase surface.

When trying to immobilize a physiologically active substance on the surface of a solid phase, variation in the amount of immobilization becomes a very big problem.
The cause of the variation includes a problem of an immobilization reaction of a substance having affinity with a physiologically active substance, a problem when a functional group necessary for immobilizing the substance on a solid surface is introduced, and the like. Even if the functional group is uniformly introduced onto the surface of the solid phase, it is difficult to immobilize the physiologically active substance uniformly.

    In the method for producing a solid phase carrier in the present invention, a physiologically active substance and a polymer having a phosphorylcholine group are coated on the surface of the solid phase, thereby uniformly immobilizing the physiologically active substance on the surface of the solid phase and reducing variations. For the purpose.

  The physiologically active substance and the polymer having a phosphorylcholine group used in the present invention include a physiologically active substance having a first functional group, a second functional group and a polymer having a phosphorylcholine group, the first functional group and the second functional group. A polymer obtained by reacting in a functional group is preferable.

    The first functional group present in the physiologically active substance is preferably an amino group.

    Examples of the second functional group that reacts with the first functional group present in the physiologically active substance include an amino group, an aldehyde group, an active ester group, and an acid anhydride, and an active ester group is preferable.

    The “active ester group” used in the present invention means an ester group having an electron-withdrawing group with high acidity on the alcohol side of the ester group to activate the nucleophilic reaction, that is, an ester group with high reaction activity. As such, it is commonly used in various chemical synthesis fields such as polymer chemistry and peptide synthesis. In practice, phenol esters, thiophenol esters, N-hydroxyamine esters, esters of heterocyclic hydroxy compounds, etc. are known as active ester groups having much higher activity than alkyl esters and the like. .

  Examples of such an active ester group include a p-nitrophenyl ester group, an N-hydroxysuccinimide ester group, a succinic acid imide ester group, a phthalic acid imide ester group, and a 5-norbornene-2,3-dicarboximide ester group. However, a p-nitrophenyl ester group or an N-hydroxysuccinimide ester group is preferable.

    Examples of the phosphorylcholine group used in the present invention include 2-methacryloyloxyethyl phosphorylcholine group, 2-methacryloyloxyethoxyethyl phosphorylcholine group, 6-methacryloyloxyhexyl phosphorylcholine group, 10-methacryloyloxyethoxynonylphosphorylcholine group, allylphosphorylcholine group, butenyl. A phosphorylcholine group, a hexenylphosphorylcholine group, an octenylphosphorylcholine group, a decenylphosphorylcholine group, and the like can be mentioned, and a 2-methacryloyloxyethylphosphorylcholine group is preferable. A polymer having a phosphorylcholine group is a polymer having a structure similar to a biological membrane (phospholipid bilayer membrane), and has an effect of suppressing adsorption of a physiologically active substance (for example, Ishihara K, Tsuji T, Kurosaki T Nakabayashi N, Journal of Biomedical Materials Research, 28 (2), pp.225-232, (1994)).

  The polymer used in the present invention may contain other groups in addition to the physiologically active substance and the phosphorylcholine group, and is preferably a copolymer with a monomer containing a butyl methacrylate group.

  The solid surface can be bonded to the polymer in any bond mode such as covalent bond, electrostatic interaction, hydrogen bond, or hydrophobic effect, but from the viewpoint of simplicity of surface treatment, the substrate The surface and the polymer are preferably bonded by a hydrophobic effect.

  The solid phase carrier used in the present invention is not particularly limited as long as it is a solid phase carrier, but is preferably a flat substrate, a microplate, a microtube, a microbead, or a substrate having a fine channel shape.

    As the material for the solid phase carrier, glass, plastic, metal, or the like can be used, but the effect of the present invention is most exhibited in the case of plastic. As the plastic, a thermoplastic resin with a small amount of fluorescence generation is preferable in order to suppress the background. For example, linear polyolefins such as polyethylene and polypropylene, cyclic polyolefins, fluorine-containing resins, and the like are preferably used, and saturated cyclic polyolefins that are particularly excellent in heat resistance, chemical resistance, low fluorescence, and moldability are more preferably used. Here, the saturated cyclic polyolefin refers to a saturated polymer obtained by hydrogenating a polymer having a cyclic olefin structure or a copolymer of a cyclic olefin and an α-olefin.

  The physiologically active substance used in the present invention is at least one selected from nucleic acids, peptide nucleic acids, aptamers, oligopeptides, sugar chains, and derivatives thereof, or a complex containing at least one of these. Examples include but are not limited to bodies.

    The present invention will be specifically described by the following examples, but the present invention is not limited to the scope of the examples.

Example 1
(Production of bioactive substance and polymer having phosphorylcholine group)
1000 μl of 10.0 wt% ethanol solution of 2-methacryloyloxyethyl phosphorylcholine / butyl methacrylate / p-nitrophenyloxycarbonyl polyethylene glycol methacrylate copolymer (each group is 21: 76: 3 in mol%) and 5 ′ end A 50-bp oligo DNA (ATAGAAGTTTGTCCATTTGTAAACTCCCGGATTGCGCTCCCTCCCGCCTT (SEQ ID NO: 1)) having an amino group introduced therein was reacted with 283 μl of an aqueous solution at room temperature for 3 hours.
(Introduction of polymer into the plate)
A solution obtained by diluting the polymer obtained above to 0.3% by weight with ethanol is immersed in a well of an ELISA 96-well plate (polystyrene, MS-896F manufactured by Sumitomo Bakelite), so that a physiologically active substance is contained in the well. In addition, a polymer having a phosphorylcholine group was introduced.

(Comparative Example 1)
2-Methacryloyloxyethyl phosphorylcholine / butyl methacrylate / p-nitrophenyloxycarbonylpolyethylene glycol methacrylate copolymer (each group is in mol%) in the well of a 96-well plate for ELISA (made of polystyrene, MS-8496F made by Sumitomo Bakelite) The polymer having an active ester and a phosphorylcholine group was introduced into the well by immersing a 0.3 wt% ethanol solution of 21: 76: 3). Next, an aqueous solution of 10 μM oligo DNA having a chain length of 50 bp having an amino group introduced at the 5 ′ end was injected into the well as in Example 1 and reacted at 80 ° C. for 3 hours.

(Blocking, hybridization)
The active ester was inactivated by immersing a 0.1N sodium hydroxide aqueous solution in the wells of the plates of Example 1 and Comparative Example 1 for 5 minutes, and a blocking treatment was performed. Subsequently, after washing with pure water, a hybridization reaction was performed at 65 ° C. for 3 hours. The hybridization reaction was performed with a solution in which a 50 bp long oligo DNA (AAGGCGGGAGGGAGCGCAATCCGGGAGTTTACAAATGGACAAACTTCTAT (SEQ ID NO: 2)) in which biotin was introduced at the 5 ′ end was dissolved in a 5 × SSC, 0.3% SDS buffer solution. After completion of hybridization, the cells were immersed in 2 × SSC and 0.1% SDS for 10 minutes. Thereafter, washing was performed in the order of 0.2 × SSC and 0.02 × SSC. The substrate was then dried by centrifuging.

(Coloring reaction)
A phosphate buffer (pH 7.4) obtained by diluting a stock solution of Streptavidin-Horseradish Peroxidase Conjugate (Amersham Biosciences Corp. RPN1231) 1000 times was applied to the hybridized plate and immersed at 37 ° C. for 30 minutes. After washing with a phosphate buffer, the peroxidase remaining in the well was colored by using a peroxidase coloring kit (ML-1120T manufactured by Sumitomo Bakelite Co., Ltd.). The absorbance was measured with a plate reader. The absorption wavelength was 450 nm.

Table 1 shows the absorbance values and CV values obtained in Example 1 and Comparative Example 1. The CV value is a value obtained by dividing the average value of each absorbance value in 96 wells by the standard deviation of each absorbance value in 96 wells, and represents a variation in signal.
In Example 1, a significant decrease in CV value was observed as compared with Comparative Example 1. A slight increase was also observed in the absorbance signal value. This result supported the effect of the present invention.

Claims (13)

A method for producing a solid phase carrier in which a physiologically active substance is immobilized on the surface of the solid phase, the method comprising a step of applying a physiologically active substance and a polymer having a phosphorylcholine group to the solid phase surface. Manufacturing method. The bioactive substance and the polymer having a phosphorylcholine group react a bioactive substance having a first functional group with a polymer having a second functional group and a phosphorylcholine group at the first functional group and the second functional group. The method for producing a solid phase carrier according to claim 1, wherein the solid phase carrier is obtained. The method for producing a solid phase carrier according to claim 2, wherein the first functional group is an amino group. The method for producing a solid phase carrier according to claim 2 or 3, wherein the second functional group is at least one functional group selected from an aldehyde group, an active ester group, and an acid anhydride group. The method for producing a solid phase carrier according to claim 2 or 3, wherein the second functional group is a p-nitrophenyl ester group or an N-hydroxysuccinimide ester group. The method for producing a solid phase carrier according to any one of claims 1 to 5, wherein the polymer is a copolymer containing a butyl methacrylate group. The method for producing a solid phase carrier according to any one of claims 1 to 6, wherein the phosphorylcholine group is a 2-methacryloyloxyethyl phosphorylcholine group. The method for producing a solid phase carrier according to any one of claims 1 to 7, wherein the solid phase carrier is any one of a flat substrate, a microplate, a microtube, a microbead, and a substrate having a fine channel. The method for producing a solid phase carrier according to any one of claims 1 to 8, wherein the solid phase carrier is made of plastic. The method for producing a solid phase carrier according to claim 9, wherein the plastic is a saturated cyclic polyolefin. The bioactive substance is at least one selected from nucleic acids, peptide nucleic acids, aptamers, oligopeptides, sugar chains, and derivatives thereof, or a complex including at least one of these. The manufacturing method of the solid-phase carrier in any one of 1-10. The method for producing a solid phase carrier according to any one of claims 1 to 10, wherein the physiologically active substance is a derivative of a nucleic acid. The method for producing a solid phase carrier according to claim 12, wherein the derivative of the nucleic acid comprises a thymine multimer.