JP2007190016A - Method for discriminating peanut variety by using microsatellite marker - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for discriminating variety of peanut. <P>SOLUTION: Main varieties of domestic peanut are discriminated by using either one or more microsatellite markers selected from a group composed of PM15, PM32, PM50, PM137, PM204 and PM238 or a group composed of PM204, PM3, PM137, PM238, pPGSseq-16F10, pPGSseq-11G07, pPGSseq-11G03 and AH2TC7C6. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a method for identifying peanut varieties.

  Peanuts (Arachis hypogaea L) are generally classified into four types, Spanish, Valencia, Virginia, and Southeast Runner, according to various traits. In Japan, cultivars belonging to the Virginia type, which is a large grain variety, are the most cultivated and have a good taste, so they are used for green beans, butter peanuts and the like.

  There are 14 peanuts currently registered in Japan (Ministry of Agriculture, Forestry and Fisheries: New crop registration number: Rakasei Norin 1-14), but other well-known domestic cultivars that are not currently registered. There is “Chiba Hanate”. In addition, a line known as “Kanto 56” that resembles Chiba Hanate in form is established. It is said that almost all major varieties currently cultivated in the country are Virginia type or a hybrid of Virginia type and other types.

  It is very important to identify these varieties from the viewpoint of producer protection and classification of genetic resources. Peanut varieties are currently classified and identified by morphological characteristics such as the number of branches, leaf color, grass shape, cocoon size, number of grains per cocoon, and seed coat color. However, such morphological determination not only requires skill, but mainly depends on the experience and subjectivity of the determiner, so it is difficult to say that the same determination result is obtained regardless of when and where. Also, especially when many varieties belonging to the same type are cultivated as in Japan, morphological identification is difficult even for a skilled person.

  From the above situation, there is a need for a method for identifying peanut varieties that is clear, objective and highly reproducible. In the future, it is considered that the necessity will further increase in the confirmation of the origin of food, the identification of varieties for the purpose of protecting domestic peanut varieties, and the seed test.

  On the other hand, a method using DNA base sequence information is known as one of plant classification and variety identification methods. Biological genomic DNA is interspersed with repetitive sequences called microsatellites, and it has a relatively high frequency of polymorphisms depending on the number of repeats of a specific base sequence, so it can be used as a DNA marker (microsatellite marker). It is used for various purposes. In recent years, it has been found that this microsatellite marker can be applied to plant classification and variety identification. For example, various plant classification and variety identification methods including crops such as rice, soybean, peach, pear and citrus are being established. . As a general rule, DNA analysis using microsatellite markers is effective as a clear and objective breed identification method because the DNA base sequence is universal regardless of the cell type and developmental stage of the same individual. is there.

There are a few microsatellite analysis reports on peanuts (see Non-Patent Documents 1 to 5). In these reports, genetic analysis of several peanut varieties from South America has been carried out and several microsatellites have been found. Further, some of them are suggested to be used for identifying the South American variety.
Guohao He, et al., BMC Plant Biology, 3, 3 (2003) Marcio de Carvalho Moretzsohn, et al., BMC Plant Biology, 4, 11 (2004) ME Ferguson, et al., Theor. Appl. Genet., 108, 1064-1070 (2004) MC Moretzsohn, et al., Theor. Appl. Genet., 111, 1060-1071 (2005) Guohao He, et al., Euphytica, 142, 131-136 (2005)

  However, in general, in order to clarify what kind of microsatellite exists in a certain plant, it is necessary to perform exhaustive analysis by spending time and labor. Moreover, even if the existence of a microsatellite is simply known, it is completely unknown whether it can be a suitable microsatellite marker for identifying the intended variety, so that each polysatellite polymorphism and a specific variety In order to determine whether or not it can be used for identification and identification of a specific variety, it is necessary to further analyze the relationship with the above.

  In particular, groundnut has not been subjected to genetic analysis and classification so far, and there has been a problem that the number of microsatellite reported is very small compared to other plants. Since peanuts are heterotetraploid, there is a high possibility that partial duplication of the genome will occur, and it is assumed that one of the reasons is that the analysis is complicated compared to diploid plants .

  In particular, there were no reports on the analysis and discovery of microsatellite for domestic peanut varieties. For example, even in the above non-patent documents 1 to 5, although microsatellite analysis of South American varieties is performed, Japanese domestic varieties are not studied at all. In Japan, there is a feature that many kinds of peanuts are cultivated even though they are closely related to each other, and it is assumed that these varieties are similar to each other in genomic DNA itself and microsatellite base sequences. It is expected that it is very difficult to identify varieties. Furthermore, many of the microsatellite reported in the above-mentioned literature have polymorphisms based on the repetition of two bases, and it is considered that it is very difficult to distinguish a large number of similar varieties based on such slight differences. It was.

  From such a plurality of findings, it has been considered that it is unclear whether peanut varieties can be identified using microsatellite as a marker for cultivar identification of Japanese varieties, in particular. Moreover, even if some candidate microsatellite was found, it was thought that the probability that it could be immediately used to identify domestic varieties was low.

  As described above, establishment of a method for identifying peanut varieties, particularly a method for identifying varieties of domestic varieties, has been a major issue. The present invention has been made in view of these problems.

  That is, the present invention has been made to provide a method for identifying peanut varieties that is clear, objective, and highly reproducible. More specifically, an object of the present invention is to provide a simple and reliable method for identifying varieties of a large number of Japanese varieties belonging to the same type and having highly similar DNA sequences.

  As a result of intensive studies in view of the current situation as described above, the present inventors unexpectedly identified Japanese domestic varieties among the microsatellite discovered in the overseas varieties described in Non-Patent Document 1. Also found that it contains effective microsatellite. Further investigations have been made, and it has been found that if a plurality of these microsatellites are used as markers in a specific combination, the main peanut varieties can be easily and reliably identified. The present invention has been accomplished based on these findings.

That is, according to the present invention, the following is provided.
(1) It is characterized in that the following major Japanese peanut varieties are identified using one or more microsatellite markers selected from the group consisting of microsatellite markers PM15, PM32, PM50, PM137, PM204, and PM238. To identify peanut variety;
Azuma Handa Chite Konawa Sedai Ryusachi Homare Tachimasariazumayutakanacateyutakasayaka yudelacka incense incense in Chikahanchi Kanto No. 56

(2) A method for identifying Azuma handkerchief or Chiba peninsula, characterized by using microsatellite marker PM50.
(3) A method for identifying Tecona, comprising using the microsatellite marker PM50 or PM204.
(4) A method for identifying Wasedai Ryu, which uses a microsatellite marker PM204.
(5) A method for identifying Sachihomare, which uses a microsatellite marker PM204 or a combination of PM50 and PM238.
(6) A method for identifying Tachimasari, which uses a combination of microsatellite markers PM15, PM137, and PM204, or a combination of PM204 and PM238.
(7) A method for identifying Azuma Yutaka, which uses a combination of microsatellite markers PM50, PM137, and PM204.
(8) A method for identifying a Nacateyutaka, characterized by using a combination of microsatellite markers PM15, PM50, PM137, and PM238, or a combination of PM15, PM32, PM50, and PM238.
(9) A method for identifying Sayaka, comprising using a combination of microsatellite markers PM50 and PM137.
(10) A method for identifying Udelacka, comprising using a combination of microsatellite markers PM15 and PM137, a combination of PM15 and PM32, or a combination of PM15 and PM238.
(11) A method for identifying soil incense, comprising using a microsatellite marker PM238.
(12) A method for discriminating local incense, which uses a combination of microsatellite markers PM50 and PM238.
(13) A method for identifying crowds, comprising using a combination of microsatellite markers PM15 and PM32, a combination of PM32 and PM238, or a combination of PM50, PM137 and PM238.
(14) A method for identifying Kanto No. 56, which uses a combination of microsatellite markers PM204 and PM238 or a combination of PM50 and PM238.

(15) The following Japan using one or more microsatellite markers selected from the group consisting of microsatellite markers PM204, PM3, PM137, PM238, pPGSseq-16F10, pPGSseq-11G07, pPGSseq-11G03, and AH2TC7C6 A method for identifying peanut varieties characterized by identifying domestic peanut varieties;
Azuma Handa Chite Konawa Sedai Ryu Beni Handa Sachi Homare Tachimasariazumayutakanacateyutakadaiichisayakayuderakka incense fragrance Chiba Hanritsu Kanto No. 56

(16) A method for identifying azuma solder, characterized by using a microsatellite marker PM3.
(17) A method for identifying Tecona, comprising using a microsatellite marker PM204.
(18) Microsatellite marker PM204, or pPGSseq-11G07, or a combination of PM238 and pPGSseq-11G03, or a combination of pPGSseq-16F10 and AH2TC7C6, or a combination of pPGSseq-11G03 and AH2TC7C6, or PM3, PM137 and A method for identifying Wasedai Ryu, which uses a combination of pPGSseq-11G03.
(19) A method for discriminating benihandati, comprising using a microsatellite marker pPGSseq-16F10 or AH2TC7C6.
(20) A method for identifying Sachihomare, characterized by using a microsatellite marker PM204, a combination of PM238 and AH2TC7C6, a combination of PM137 and pPGSseq-16F10, or a combination of PM238 and pPGSseq-16F10.
(21) A combination of microsatellite markers PM204 and PM238, a combination of PM3 and pPGSseq-11G07, a combination of PM3 and pPGSseq-11G03, a combination of PM204 and AH2TC7C6, or a combination of PM3 and pPGSseq-16F10, Or a combination of AH2TC7C6 and pPGSseq-11G03, a combination of AH2TC7C6 and pPGSseq-11G07, a combination of PM238 and pPGSseq-11G03, or a combination of pPGSseq-16F10 and pPGSseq-11G03. Identification method.
(22) Identification of Azuma yutaka characterized by using microsatellite marker pPGSseq-16F10, a combination of PM238 and pPGSseq-11G07, a combination of PM238 and pPGSseq-11G03, or a combination of PM238, AH2TC7C6 and PM137 Method.
(23) A method for distinguishing Nacateyutaka, comprising using a combination of microsatellite markers PM3, PM137, PM238 and AH2TC7C6, or a combination of PM3, PM137, PM238 and pPGSseq-11G03.
(24) A method for discriminating daichi, comprising using a combination of microsatellite markers pPGSseq-16F10 and pPGSseq-11G07, a combination of PM238 and pPGSseq-11G03, or a combination of PM238 and pPGSseq-11G07.
(25) A combination of microsatellite markers PM238 and pPGSseq-11G03, a combination of PM137 and AH2TC7C6, a combination of PM137 and pPGSseq-11G03, or a combination of PM238, pPGSseq-11G07 and AH2TC7C6, or PM238, pPGSseq- 16F10 and AH2TC
A method for identifying Sayaka, comprising using a combination of 7C6 or a combination of pPGSseq-11G07, pPGSseq-11G03 and AH2TC7C6.
(26) A combination of microsatellite markers PM3 and pPGSseq-11G03, a combination of PM3 and AH2TC7C6, a combination of PM3 and pPGSseq-11G07, a combination of PM3 and PM238, a combination of PM3 and PM137, or A method for identifying Yudelacka, which uses a combination of PM204, PM3 and pPGSseq-16F10.
(27) A method for identifying soil incense, comprising using a microsatellite marker PM238, a combination of PM137 and pPGSseq-16F10, or a combination of PM204 and pPGSseq-16F10.
(28) A combination of microsatellite markers PM137, PM238 and pPGSseq-11G07, a combination of PM137, PM238 and pPGSseq-11G03, or a combination of pPGSseq-11G03 and AH2TC7C6, or PM137, pPGSseq-16F10, AH2TC7C6 and pPGSseq- A method for discriminating incense, which uses a combination of 11G03.
(29) A method for identifying crowds, characterized by using a combination of microsatellite markers PM238 and pPGSseq-11G07 or a combination of pPGSseq-11G07 and AH2TC7C6.
(30) A method for identifying Chiba Haneri characterized by using a combination of microsatellite markers PM204, PM3, PM238, pPGSseq-11G07 and AH2TC7C6.
(31) A combination of microsatellite markers PM204 and PM238, a combination of PM238 and pPGSseq-16F10, a combination of PM238 and AH2TC7C6, a combination of AH2TC7C6 and pPGSseq-11G03, or PM137, pPGSseq-16F10 and pPGSseq- An identification method of Kanto No. 56, characterized by using a combination of 11G03.

(32) The method according to any one of (1) to (31), wherein the identification method includes the following steps.
a) Using DNA extracted from peanuts whose varieties should be identified as a template, PCR is performed using two types of primers for amplifying a base sequence specific to the microsatellite marker to be used,
b) measuring the length of the DNA fragment amplified in step a) above,
c) Identifying peanut varieties based on the length of the DNA fragment measured in step b) above.
(33) The method according to (32), wherein the length of the DNA fragment in step b) is measured using a capillary electrophoresis apparatus.
(34) For use in the method according to any one of (1) to (33), comprising at least two kinds of primers for amplifying a base sequence specific to the microsatellite marker to be used Reagent kit.

  According to the peanut variety identification method of the present invention, variety identification can be easily performed clearly, objectively, with high reproducibility.

  Hereinafter, the present invention will be described in more detail. However, the following description of the constituent elements is a representative example of the embodiment of the present invention, and the present invention is not limited only to these contents.

1. Peanut Variety Identification Method of the Present Invention The peanut variety identification method of the present invention is characterized by identifying a Japanese peanut main variety using a specific microsatellite marker.

The main Japanese peanut varieties identified by the present invention are Azuma Handicati (Ministry of Agriculture, Forestry and Fisheries, New crop registration number: Rakasei Agricultural Forest No. 1), Tecona (Rakasei Agricultural Forest No. 2), Wasedai Ryu (Rakasei Agricultural Forest No. 3) , Sachihomare (Rakasei Agricultural Forestry No. 5), Tachimasari (Rakasei Agricultural Forestry No.6), Azuma Yutaka (Rakasei Agricultural Forestry No.7), Nacate Yutaka (Rakasei Agricultural Forestry No.8), Sayaka (Rakasei Agricultural Forestry No.8) Agricultural forest No. 11), soil incense (Rakasei agricultural forest No. 12), town incense (Rakasei agricultural forest No. 13), Fukumasari (Rakasei agricultural forest No. 14), Chiba Hanidachi (unregistered), and main systems It is Kanto 56 which is one of the. The main varieties may also include benihandachi (Rakasesai No. 4) and Daiichi (Rakase No. 9). Hereinafter, for convenience, these 13 varieties or 15 varieties and one line may be collectively referred to as “domestic peanut main varieties”. Of these, the Chiba peninsula and Nacateyutaka are the most important varieties, and their identification is particularly important in Japan.

  Note that the varieties here are those that can be distinguished from the collection of other plants by all or part of the characteristics related to important traits, and can be propagated while retaining all of the characteristics. Means a collection of plants. The line means a group of individuals sharing a parent and having a common trait and genetic characteristics, and includes those in the breeding stage before being established as varieties.

  In the present specification, “identifying peanut varieties” means that one or more peanuts whose varieties are unspecified are analyzed to identify varieties. For example, for one or a large number of Japanese peanuts whose varieties are unspecified, it is possible to specify which of the main varieties they are. Another example is determining whether a groundnut is a specific variety. Further, the method includes identifying whether the groundnut is the main variety or not.

  The breed identification method of the present invention is characterized by using a microsatellite marker. A microsatellite is a repetitive sequence scattered in the genomic DNA of an organism as described above. Among them, a polymorphism that depends on the difference in the number of repetitions of a specific base sequence (that is, the difference in length). What you have is selected. Furthermore, the relationship between the polymorphism of each microsatellite and the target variety is associated with each other, and a microsatellite suitable for identifying each variety, that is, a microsatellite marker is specified. Microsatellite is characterized in that the length of the base sequence varies depending on the type of polymorphism, but in principle, it does not change in one variety, so if an appropriate marker is selected, the variety is selected based on the length. Can be identified. That is, the type identification can be performed by analyzing the length of the base sequence of one or a plurality of target microsatellite and determining to which polymorphic type each microsatellite belongs.

A microsatellite is, for example, a repetitive sequence of a specific base sequence of about 2 to several bp such as GA and CT, and is itself expressed as (GA) _n or (CT) _n (G is guanine). , A represents adenine, C represents cytosine, and T represents thymine). n is an integer of 2 or more, and a polymorphism is generated when the number of repeats represented by n varies depending on the variety or strain. A microsatellite is such a simple repetitive sequence, but usually an array that can identify each microsatellite located in the vicinity of the microsatellite (mainly adjacent to both sides of the microsatellite) (hereinafter referred to as “microsatellite-specific”). It may be specified by using a “sequential sequence”. Also in the gene database GenBank and the like, the sequence of each microsatellite is registered as a microsatellite marker together with a microsatellite-specific sequence capable of specifying this. In this specification, “microsatellite” means a repetitive sequence portion of a specific base sequence, and “microsatellite marker” includes a microsatellite and a microsatellite-specific sequence and is used as a DNA marker. A possible (identifiable) sequence is meant. For example, when trying to amplify the desired microsatellite by PCR (Polymerase Chain Reaction), the repeat sequence of the microsatellite itself is not specific, and only specific ones cannot be amplified. Microsatellite can be amplified by setting primers based on the sequence. That is, in the present specification, “amplifying microsatellite” means that amplification is performed using a primer set based on a microsatellite-specific sequence as described above. May contain sequences other than microsatellite.

  Examples of the microsatellite markers used in the present invention include PM15 (GenBank accession number: AY237742), PM32 (AY237747), PM50 (AY237756), PM137 (AY237766), PM204 (AY237780), and PM238 (AY237791). These microsatellite markers were reported as existing in South American groundnut varieties in Guohao He, et al., BMC Plant Biology, 3, 3 (2003). However, it has been unexpectedly found by the present inventors that they exist in the main domestic peanut varieties, and it has been clarified that they can be used in the method for identifying these varieties. Furthermore, examples of microsatellite markers used in the present invention include pPGSseq-16F10 (BZ999879), pPGSseq-11G07 (BZ999490), pPGSseq-11G03 (BZ999487), and AH2TC7C6 (DQ099141). pPGSseq-16F10 (BZ999879), pPGSseq-11G07 (BZ999490), and pPGSseq-11G03 (BZ999487) are ME Ferguson, et al., Theor Appl Genet (2004) 108: 1064-1070, AH2TC7C6 (DQ099141) is Moretzsohn, et al., Theor Appl Genet (2005) 111: 1060-1071. In the present specification, the same notation disclosed in the above-mentioned document is used for the notation of the microsatellite marker.

In the present invention, six types of PM15, PM32, PM50, PM137, PM204 and PM238, or eight types of microsatellite markers PM204, PM3, PM137, PM238, pPGSseq-16F10, pPGSseq-11G07, pPGSseq-11G03 and AH2TC7C6 The main domestic peanut variety is identified using one or more of the above. As long as at least one of these is used, another microsatellite marker may be used in combination. For example, the above document Guohao He, et al., BMC
When combined with those established as markers in overseas varieties, such as microsatellite markers, which are suggested to be used for identification of South American peanut varieties in Plant Biology, 3, 3 (2003), Overseas varieties can be identified more clearly. In addition, if there are other DNA markers that are clearly useful for identifying varieties such as SNPs (single nucleotide polymorphisms) and RAPD (random amplified polymorphic DNA), they can also be used in combination. However, in principle, it is desirable to be able to identify varieties using fewer markers.

  When performing the method for identifying a variety of the present invention based on the analysis of a microsatellite marker, usually, first, peanut DNA to be identified for the variety is extracted and used as a sample. As long as DNA can be obtained, DNA can be extracted from any part of the plant body, but can be extracted from seeds, leaves, roots, stems, seedlings (seed rings), and the like. Among these, it is preferable to extract from seeds. Moreover, as seeds, in addition to harvested seeds, processed products can also be targeted. Examples of processed products include cooked products such as peas, peas, butter peanuts and confectionery.

As a DNA extraction method, a commonly used method known per se can be applied. For example, a method of obtaining DNA by pulverizing seeds and performing operations such as solubilization with a surfactant and deproteinization with a deproteinizing agent can be mentioned. In the case of seeds containing a large amount of oil, a degreasing step using an organic solvent may be further included. In the case of leaves, the CTAB method (Cetyl trimethyl ammonium bromide method: Murray, GC and Thompson, WF, Nucl. Acid Res., 8, 4321-4325 (1980)) is preferably used. Furthermore, a commercially available kit (eg, “ISOPLANT” (manufactured by Nippon Gene Co., Ltd.)) can be arbitrarily selected. In the case of seedlings, there is an advantage that a special extraction method is not necessary because the tissue is soft and the inhibitory substance is small. When using a processed product, it is preferable to perform a normal extraction operation through steps such as washing and degreasing. In addition, when extracting from seed, crudely purified DNA can also be used.

  As described above, DNA extracted from any site can be used as long as it can analyze the microsatellite marker described later. For example, in the case of subsequent amplification by PCR, inhibition of the PCR reaction is possible. It is preferable to prepare in a state not containing a substance. For example, it is preferable to remove inhibitors such as polysaccharides and polyphenols. In particular, when extracting from leaves, it is known that a large amount of polyphenol is contained. The removal of polyphenol can be performed by a method known per se, and examples thereof include a method of adding PVPP (polyvinyl polypyrrolidone) (Japanese Patent Laid-Open No. 2005-168308).

  As the DNA extraction amount, an amount capable of analyzing the next microsatellite marker may be extracted. When subjected to the PCR method, for example, it is 1 ng or more per reaction.

  Using the extracted DNA, microsatellite markers are analyzed. Microsatellite markers are analyzed by first amplifying a target microsatellite marker using the extracted DNA as a template by the PCR method, and length of the amplified DNA fragment (hereinafter referred to as “amplified fragment length”). It can be done by analyzing. Alternatively, for example, each microsatellite-specific sequence can be used as a probe, reacted with extracted DNA, and the intensity of a signal generated by hybridization can be detected. In the present invention, a method using a PCR method is particularly preferably used.

  Amplification of the microsatellite marker by the PCR method is performed according to a commonly used method known per se. The reaction conditions may be any as long as the target base sequence is amplified.

  For amplification, a primer set capable of amplifying a base sequence specific to the target microsatellite marker is appropriately selected and used. Any primer can be used as long as it can amplify the target microsatellite, but it is preferably set based on the microsatellite-specific sequence. The sequence of the primer may partially include a repeating sequence of microsatellite. The length of the primer can be set to, for example, a length of 10 bp or more, preferably about 20 to 30 bp. Examples of such primers include a primer having the base sequence described in SEQ ID NOs: 1 and 2 for amplification of the marker PM15, a primer having the base sequence described in SEQ ID NOs: 3 and 4 for amplification of the marker PM32, For amplification of marker PM50, a primer having the base sequence described in SEQ ID NOs: 5 and 6, for amplification of marker PM137, a primer having the base sequence described in SEQ ID NOs: 7 and 8, and for amplification of marker PM204, SEQ ID NO: : Primers having the base sequences described in 9 and 10 and amplification of the marker PM238 include primers having the base sequences described in SEQ ID NOs: 11 and 12. Furthermore, a primer having the base sequence described in SEQ ID NOs: 22 and 23 is used for amplification of the marker PM3, a primer having a base sequence described in SEQ ID NOs: 14 and 15 is used for the amplification of the marker pPGSseq-16F10, and a marker pPGSseq-11G07. A primer having the base sequence set forth in SEQ ID NOs: 18 and 19, a primer having the base sequence set forth in SEQ ID NOs: 20 and 21 for amplification of the marker pPGSseq-11G03, and a sequence number set for amplification of the marker AH2TC7C6 : Primers having the base sequences described in 16 and 17 and the like.

Next, the length of the amplified DNA fragment is analyzed. Examples of the method for analyzing the amplified fragment length include an electrophoresis method, a sequencing method (a method for decoding the base sequence of the obtained amplified fragment), a mass spectrometry method (mass spectrum method), and the like. Is preferably used. Examples of the electrophoresis method include agarose gel electrophoresis, denaturing or non-denaturing acrylamide gel electrophoresis, capillary electrophoresis, and the like. Peanut microsatellite markers used in the present invention contain many polymorphisms with 2 base repeats, so it is possible to reliably detect slight differences in mobility based on a very short length difference of 2 bases. It is necessary to. Therefore, in the present invention, a high-resolution capillary electrophoresis method is particularly preferably used, but if a high-resolution gel for sequencing (acrylamide gel) or the like is used, it can also be performed by a gel plate electrophoresis method or the like. . However, it is important to allow sufficient time for electrophoresis to ensure separation of amplification products.

  When gel plate electrophoresis is used, the amplified fragment length derived from each sample is analyzed using the gel after electrophoresis. Examples of the analysis method include a labeling method in which a PCR method is performed using a pre-labeled primer, an ethidium bromide method, a silver staining method, and the like. Among these, a labeling method is preferably used, and as the labeling substance, a fluorescent dye, a radioactive substance or the like is used. Particularly preferred is a labeling method using a fluorescent dye, and the fluorescent dye can be arbitrarily selected from known ones. In the labeling method, the fluorescent dye is introduced into the amplification product obtained by carrying out the reaction after previously labeling the 5 ′ end of any primer used in the PCR method with a fluorescent dye. Such a primer can be synthesized by a known chemical synthesis method or the like. By using the primer, the amplified fragment length can be analyzed based on fluorescence after electrophoresis. In the case of using capillary electrophoresis, a method suitable for the apparatus to be used may be appropriately selected. For example, a labeling method using fluorescence is preferably used.

  Specifically, in the case of capillary electrophoresis, for example, a combination of a capillary electrophoresis apparatus “3730 DNA Analyzer” and an analysis software “Gene Mapper” manufactured by Applied Biosystems (ABI) is used. Electrophoresis and analysis of amplified fragment length can be performed. In the case of gel plate electrophoresis, the amplified gel product can be detected by subjecting the gel plate after electrophoresis to a fluorescence image analyzer such as FMBIO (manufactured by Hitachi Software Engineering Co., Ltd.). The technique using fluorescence is particularly suitable for the method for identifying a variety of the present invention because it can detect separated amplified fragments with very high sensitivity.

  Thus, the microsatellite marker can be analyzed using DNA obtained from peanuts whose varieties should be specified, and cultivars can be identified based on the obtained results. When the sequence information of the portion including the microsatellite marker of peanut DNA to be cultivated is available, the microsatellite marker may be analyzed based on the sequence information. Further, when the analysis result of the microsatellite marker is available for the groundnut for which the variety is to be specified, the variety identification can be performed based on the result.

  Tables 1A and 1B show the relationship between the microsatellite markers used and the varieties that can be identified by the microsatellite markers. The amplified fragment length class (polymorphic type) of each marker is shown in Tables 2A and 2B.

  From Table 2A, it can be seen that, for example, the marker PM50 is a microsatellite marker showing polymorphisms of six types of 103 to 113 bp. This marker PM50 is analyzed for a peanut unspecified, and if the detected amplified fragment length is 109 bp, the polymorphism in PM50 of the peanut variety can be determined to be class C.

  Next, according to Table 1A, since the cultivar whose polymorphism in the marker PM50 is class C is only azuma handkerchief, it can be specified that this groundnut is azuma handkerchief.

  Here, the microsatellite marker PM238 indicates a polymorphic class by combining two alphabets. This is presumed to be due to the presence of two identical microsatellite having different repeat numbers in the genome.

  In this way, among the 14 domestic peanut main varieties, the varieties can be identified as shown in Table 1A. Specifically, by using the microsatellite marker PM50, it is possible to identify Azuma handkerchief or Chiba peninsula. Tecona can be identified by using the microsatellite marker PM50 or PM204. By using the microsatellite marker PM204, Wasedai Ryu can be identified. By using a microsatellite marker PM204 or a combination of PM50 and PM238, Sachihomare can be identified. By using a combination of the microsatellite markers PM15, PM137, and PM204, or a combination of PM204 and PM238, it is possible to identify the tachimasari. By using a combination of microsatellite markers PM50, PM137, and PM204, Azuma yutaka can be identified. By using a combination of microsatellite markers PM15, PM50, PM137, and PM238, or a combination of PM15, PM32, PM50, and PM238, Nacateyutaka can be identified. By using a combination of microsatellite markers PM50 and PM137, Sayaka can be identified. By using a combination of microsatellite markers PM15 and PM137, a combination of PM15 and PM32, or a combination of PM15 and PM238, it is possible to identify a Yudelacka. By using the microsatellite marker PM238, the earthen scent can be identified. By using a combination of microsatellite markers PM50 and PM238, the incense of the village can be identified. By using a combination of microsatellite markers PM15 and PM32, a combination of PM32 and PM238, or a combination of PM50, PM137, and PM238, the crowd can be identified. Kanto No. 56 can be identified by using a combination of microsatellite markers PM204 and PM238 or a combination of PM50 and PM238.

In addition, among the 16 domestic peanut main varieties, the varieties can be identified as shown in Table 1B. Specifically, azuma solder can be identified by using the microsatellite marker PM3. Tecona can be identified by using the microsatellite marker PM204. Microsatellite marker PM204, or pPGSseq-11G07, or a combination of PM238 and pPGSseq-11G03, or a combination of pPGSseq-16F10 and AH2TC7C6, or a combination of pPGSseq-11G03 and AH2TC7C6, or PM3, PM137 and pPGSseq-11G03 By using the combination of, Wasedai Ryu can be identified. By using the microsatellite marker pPGSseq-16F10 or AH2TC7C6, it is possible to discriminate the beni hand-held. By using a microsatellite marker PM204, a combination of PM238 and AH2TC7C6, a combination of PM137 and pPGSseq-16F10, or a combination of PM238 and pPGSseq-16F10, the Sachihomale can be identified. A combination of microsatellite markers PM204 and PM238, a combination of PM3 and pPGSseq-11G07, a combination of PM3 and pPGSseq-11G03, a combination of PM204 and AH2TC7C6, a combination of PM3 and pPGSseq-16F10, or AH2TC7C6 And pPGSseq
By using a combination of -11G03, a combination of AH2TC7C6 and pPGSseq-11G07, a combination of PM238 and pPGSseq-11G03, or a combination of pPGSseq-16F10 and pPGSseq-11G03, the Tachimasari can be identified. By using the microsatellite marker pPGSseq-16F10, a combination of PM238 and pPGSseq-11G07, a combination of PM238 and pPGSseq-11G03, or a combination of PM238, AH2TC7C6 and PM137, Azuma yutaka can be identified. By using a combination of the microsatellite markers PM3, PM137, PM238 and AH2TC7C6, or a combination of PM3, PM137, PM238 and pPGSseq-11G03, the nacateyutaka can be identified. By using the combination of the microsatellite markers pPGSseq-16F10 and pPGSseq-11G07, the combination of PM238 and pPGSseq-11G03, or the combination of PM238 and pPGSseq-11G07, the diches can be identified. A combination of microsatellite markers PM238 and pPGSseq-11G03, or a combination of PM137 and AH2TC7C6, or a combination of PM137 and pPGSseq-11G03, or a combination of PM238, pPGSseq-11G07 and AH2TC7C6, or PM238, pPGSseq-16F10 and AH2TC7C6 Sayaka can be identified by using a combination of pPGSseq-11G07, pPGSseq-11G03, and AH2TC7C6. A combination of microsatellite markers PM3 and pPGSseq-11G03, a combination of PM3 and AH2TC7C6, a combination of PM3 and pPGSseq-11G07, a combination of PM3 and PM238, a combination of PM3 and PM137, or a PM204, PM3 And pPGSseq-16F10 can be used to identify the Yudelacca. By using the microsatellite marker PM238, the combination of PM137 and pPGSseq-16F10, or the combination of PM204 and pPGSseq-16F10, the scent of soil can be identified. A combination of microsatellite markers PM137, PM238 and pPGSseq-11G07, a combination of PM137, PM238 and pPGSseq-11G03, or a combination of pPGSseq-11G03 and AH2TC7C6, or a combination of PM137, pPGSseq-16F10, AH2TC7C6 and pPGSseq-11G03 By using, the incense of the village can be identified. By using a combination of microsatellite markers PM238 and pPGSseq-11G07, or a combination of pPGSseq-11G07 and AH2TC7C6, the crowd can be identified. By using a combination of the microsatellite markers PM204, PM3, PM238, pPGSseq-11G07 and AH2TC7C6, the Chiba peninsula can be identified. A combination of microsatellite markers PM204 and PM238, a combination of PM238 and pPGSseq-16F10, a combination of PM238 and AH2TC7C6, a combination of AH2TC7C6 and pPGSseq-11G03, or a combination of PM137, pPGSseq-16F10 and pPGSseq-11G03 By using, Kanto 56 can be identified.

  These markers or combinations thereof are shown in Tables 3A and 3B. For example, when determining whether or not a certain groundnut is a specific variety, a marker corresponding to the target variety may be analyzed according to this table.

  On the other hand, when identifying all 14 main types, or when determining which of 14 types of unspecified varieties, the six types of markers may be used in appropriate combination. Table 6A shows preferable examples of combinations of the six types of markers. Table 4A can be specified by a combination of a plurality of markers as shown in Table 3A depending on the variety, but in view of various factors such as the number of markers, the stability, the number of repetitive bases among them, the Japanese peanut variety The combinations considered to be particularly preferable for identifying are shown by shading. By analyzing according to such a table, it is possible to easily and reliably identify a large number of peanut varieties. Of course, in Table 4A, for example, PM50 instead of PM204 is used to identify Tecona. In addition, when identifying all 16 major types or determining which of the 16 unspecified varieties, the eight types of markers may be used in appropriate combination. Table 4B shows preferable examples of combinations of the eight types of markers.

2. Reagent kit The reagent kit of the present invention is a kit for use in the method for identifying peanut varieties described in detail in 1 above, and two kinds of primers for amplifying a base sequence specific to the target microsatellite marker It is characterized by including at least.

  As the primer, those described in 1 above are used. In addition to these primers, the kit may further contain standard DNA, PCR reaction reagents, and the like. Examples of standard DNA include genomic DNA obtained from a specific variety, a DNA fragment obtained by amplifying a specific microsatellite marker, a plasmid vector obtained by cloning the amplified sequence, and the like. In addition, a primer in which the 5 ′ end of any one of two kinds of primers used in the set is previously labeled with a fluorescent dye or the like is also preferably used.

  The reagent kit thus constructed has a great effect that the use of this reagent kit makes it possible to easily identify major Japanese peanut varieties.

3. Use of the present invention The present invention provides a method for identifying major Japanese peanut varieties. According to the present invention, for the first time in the world, the existence of a microsatellite marker effective for identifying major Japanese peanut varieties has been clarified, and an identification method has been established.

  The method for identifying varieties of the present invention utilizes the difference in DNA base sequence recognized between varieties, so that it is extremely clear, objective and highly reproducible, unlike the method for identifying by morphological features. It is a method that can be easily performed by anyone without learning special techniques.

  In addition, all parts of the plant body such as roots, leaves, stems, and seeds can be used as inspection targets, and the required amount is also very small. Moreover, since the analysis is possible as long as the extracted DNA is not severely damaged, it can be applied to many processed products (butter peanut, seasoned peanut, etc.).

  Further, it can be used not only for the identification of varieties in the distribution stage of peanuts and processed products thereof, but also for the purity test of seeds, the inspection of the mixing rate of seeds other than hybrids to a certain hybrid seed population, and the like. This can make a great contribution to the identification and identification of Japanese peanut varieties.

  EXAMPLES Hereinafter, although an Example demonstrates this invention, this invention is not limited at all by these Examples.

  In the following examples, “TE” represents a general TE buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA).

  In addition, general techniques related to DNA manipulation and the like should be performed according to known techniques described in Molecular Cloning, A Laboratory Manual, 2nd ed. (Sambrook, J. et al., 1989), unless otherwise specified. Can do.

Was carried out search of microsatellite markers to identify the search domestic peanut main varieties of microsatellite markers.

As main domestic peanut varieties, Azuma Handachi (Ministry of Agriculture, Forestry and Fisheries, New crop registration number: Rakasei Agricultural Forest No. 1), Tecona (Rakasei Agricultural Forest No. 2), Wasedai Ryu (Rakasei Agricultural Forest No. 3), Sachihomare (Rakasei Agricultural Forest No. 5) ), Tachimasari (Rakasei Agricultural Forestry No. 6), Azuma Yutaka (Rakasei Agricultural Forestry No.7), Nacate Yutaka (Rakasei Agricultural Forestry No.8), Sayaka (Rakasei Agricultural Forestry No.10), Yuderakka (Rakasei Agricultural Forestry No.11), Scent of Soil (Rakasei Agricultural Forestry No. 12), Township Incense (Rakasei Agricultural Forestry No. 13), Fukumasari (Rakasei Agricultural Forestry No. 14), Chiba Hanate (not registered)
And, 13 varieties of Kanto 56, which is a line similar to Chiba Hanate, was selected. These seeds were obtained from Chiba Prefectural Agricultural Research Center peanut test site and used as standard products.

(1) Extraction of DNA of reference product 10 seeds of the reference product were prepared, incubated at 70 ° C. for 3 hours, and then cooled to room temperature to remove thin skin. The seeds from which the skin was removed were pulverized for each variety and line, placed in a 15 ml tube, 2700 μl of extraction buffer (10 mM Tris-HCl, 10 mM EDTA-2Na, 0.1% SDS, 5 M NaCl 30 ml / L), 5 M guanidine hydrochloride 300 μl and 50 μl of 20 mg / ml proteinase K were added. This was heated at 55 ° C. for 3 hours while stirring with a rotator, and then centrifuged at 3,000 rpm for 10 minutes. Each 800 μl of the supernatant after centrifugation was transferred to a 1.5 ml capacity microtube, and centrifuged again at 15,000 rpm for 3 minutes using a microtube centrifuge.

  After separation, 500 μl of each supernatant was transferred to a 2 ml capacity microtube, and DNA was purified using a commercially available nucleic acid purification kit (Wizard DNA Cleanupsystem: Promega). All purification was performed according to the protocol included in the kit, and DNA solutions were obtained in 1.5 ml microtubes for each variety and strain.

For the 14 DNA solutions thus obtained, a commercially available DNA quantification kit (Quant-iT PicoGreen
The concentration was measured using dsDNA Assay Kit (Molecular Probes). 2 μl of each kind of DNA solution was fractioned and mixed with 98 μl of TE, and a total of 100 μl was dispensed into wells of a 96-well microplate as a sample for concentration measurement. In addition to the samples, 100 μl of standard solutions (2000, 200, 20, 2 ng / ml) and Blank (TE) attached to the kit were used for the measurement. To each well, 100 μl of the reagent PicoGreen Reagent attached to the kit diluted 200-fold with TE was added and stirred, and then incubated at room temperature for 2 to 5 minutes. Measure this plate using a fluorescence plate reader (Excitation 485 nm, Emission 530 nm), and use the calibration curve obtained from the measurement results of the standard solution to determine the concentration of each DNA solution extracted from the 14 types of reference products. Calculated.

(2) Amplification of base sequence specific to each microsatellite by PCR method Next, by using the DNA solution of each variety obtained in (1) above, what kind of microsatellite is contained in the genome of the main domestic peanut variety. Was analyzed.

  Microsatellite includes Guohao He, et al., BMC Plant Biology, 3, 3 (2003) (hereinafter referred to as “Reference 1”), and Marcio de Carvalho Moretzsohn, et al., BMC Plant Biology, 4, 11 (2004) The microsatellite found in South American varieties reported in two documents (hereinafter referred to as “Document 2”) was selected as a candidate. In these documents, the presence of a total of 123 microsatellite is reported, but if there is a microsatellite that is also present in Japanese varieties, and if it is included, No knowledge has been obtained as to whether it is useful for cultivar identification of peanut major varieties. Therefore, it was first decided to conduct an exhaustive analysis of these markers and examine whether they could be suitable markers for Japanese varieties.

  The 14 DNA solutions obtained in the above (1) were adjusted to a concentration of 10 ng / μl with TE (pH 8.0), and used as a template DNA for PCR reaction.

  As a primer used for the PCR reaction, a primer set disclosed in the above-mentioned two documents and capable of amplifying a base sequence specific to each microsatellite was appropriately selected and used. At this time, the forward primer was previously fluorescently labeled at the 5 ′ end for analysis described later. As fluorescently labeled primers, those labeled with VIC and PET were outsourced (manufactured by ABI). As the reverse primer, an unlabeled one was used.

PCR reaction was performed using a GeneAmp9600 system (Roche diagnostics) in a reaction volume of 20 μl. Prepare 20 μl of the reaction solution so that 1 μl of template DNA (10 ng / μl), 0.75 units of AmpliTaq Gold (ABI), 4 nmole of dNTP, forward primer and reverse primer each contain 0.625 pmole. The one attached to AmpliTaq Gold was used. The PCR reaction conditions were 95 ° C for 10 minutes, 95 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 1 minute for one cycle. This was repeated 40 cycles. Minutes.
The amplification product obtained as a result of the PCR reaction was subjected to the next step and analyzed.

(3) Analysis of amplified fragment length using capillary electrophoresis 2 μl of the PCR amplification product obtained in (2) above was added to a 96-well plate into which 100 μl of pure water had been dispensed in advance to make a 50-fold dilution. . 1/500 molecular weight marker (500 LIZ Size Standard: ABI) was added to Hi-di Formamid (ABI). Ten μl of Hi-di Formamid was dispensed into a 96-well plate (TCll Reaction Plate) for detection, 1 μl of the 50-fold diluted solution was added, and the lid was capped. After mixing, the mixture was centrifuged and heated at 95 ° C. for 5 minutes, then immediately placed in ice and cooled for 10 minutes. The plate was set in a capillary electrophoresis apparatus “3730 DNA Analyzer” (manufactured by ABI) and the Run button was pressed to start electrophoresis. Analysis software “GeneMapper” (manufactured by ABI) was started, and the size (length) of the amplified fragment was measured using the fragment analysis function. For each marker, it was detected what kind of amplified fragment was obtained in each of the 14 species, and classified into the alphabet A from the alphabet based on the length.

(4) Determination of marker A total of 123 microsatellites disclosed in the above two documents were sequentially analyzed by the above method, and among them, the main peanut varieties existed in the above, and the polymorphism was observed between the varieties. Searched for microsatellite. As a result, it was revealed that the main peanut varieties can be identified by appropriately combining six of the microsatellite with polymorphism. That is, it has been found that the combinations of polymorphic types in these six microsatellite are all different combinations among the 14 species.

  The six microsatellite markers found here are PM15 (GenBank accession number: AY237742), PM32 (AY237747), PM50 (AY237756), PM137 (AY237766), PM204 (AY237780), and PM238 (AY237791). It was. Each of these microsatellite markers was a microsatellite whose sequence and a primer sequence for amplifying the sequence were disclosed in Document 1.

  It should be noted that the microsatellite other than the six selected here was not considered to be present in the 14 species (amplification products could not be obtained by PCR reaction), and even though it was present, there were many among the 14 species. No type found (no difference in amplification product amplified in each variety), no polymorphism among 14 species but useful for variety identification (between any of 14 types) Although there were differences in the amplification products, all 14 species could not be identified even when combined).

In particular, it was a surprising result that none of the microsatellite disclosed in Document 2 was useful for distinguishing major domestic peanut varieties. Since the microsatellite disclosed in this document showed a 3 bp repeat sequence, it was assumed that the difference in length of the amplified fragment was larger than that of the 2 bp repeat sequence, and polymorphisms in overseas varieties Therefore, it was initially considered that these markers are more suitable for domestic peanut varieties. However, as a result, none of the markers reported in this document and the primers for amplifying them were readily available for polymorphism analysis of domestic varieties. Satellite markers were analyzed and useful markers were identified. This indicated that polymorphisms were seen in overseas varieties, and even microsatellite markers considered important could not be used for domestic varieties. Conventionally, microsatellite having a long repeated sequence has been considered useful, but it has been found that even a 2 bp repetitive sequence showing a minute difference can serve as a marker if sufficient analysis is performed.

  The results obtained here were summarized in a list of polymorphisms of each marker in the 14 species (Table 1A) and a class of polymorphisms in each marker (Table 2A). Moreover, the specific marker used for specifying it for every kind or its combination was listed (Table 3A). Furthermore, depending on the variety, there were a plurality of markers or combinations thereof that could identify them, but a particularly preferred marker or combination thereof was determined from among them, and Table 4A was created (those that are shaded in Table 4A, Preferred markers or combinations thereof). By using these tables, it is possible to easily identify major Japanese peanut varieties.

Analysis of amplified fragment using fluorescent image analyzer In Example 1 above, a capillary electrophoresis apparatus and analysis software were used for analysis of the amplified fragment. Therefore, with respect to the obtained 6 microsatellite markers, the amplified fragment was analyzed by detecting the electrophoresis pattern by gel plate electrophoresis and fluorescence image analyzer, and which method would give the same result? I confirmed. Gel plate electrophoresis is known to have lower resolution and sensitivity than capillary electrophoresis, but is useful in terms of high versatility.

  Since the six microsatellite markers contained a plurality of 2-bp repetitive microsatellites that were considered to be difficult to determine because of differences in the length of amplified fragments, a sequence gel with high resolution was used as the gel.

  For the 14 DNA solutions prepared in (1) of Example 1 above, a set of primers that amplify base sequences specific to the six microsatellite markers (hereinafter referred to as forward primer (F) and reverse primer) (Indicated by (R)), and amplification by PCR was performed in the same manner as described above. As primers, PM15 (F) (SEQ ID NO: 1) and PM15 (R) (SEQ ID NO: 2) are used for amplification of the marker PM15, and PM32 (F) (SEQ ID NO: 3) and PM32 are used for amplification of the marker PM32. (R) (SEQ ID NO: 4), PM50 (F) (SEQ ID NO: 5) and PM50 (R) (SEQ ID NO: 6) for amplification of the marker PM50, PM137 (F) (sequence for amplification of the marker PM137 No. 7) and PM137 (R) (SEQ ID NO: 8), for amplification of marker PM204 PM204 (F) (SEQ ID NO: 9) and PM204 (R) (SEQ ID NO: 10), for amplification of marker PM238 PM238 (F) (SEQ ID NO: 11) and PM238 (R) (SEQ ID NO: 12) were used. Each forward primer was outsourced with the 5 ′ end fluorescently labeled with FITC as in Example 1.

  After completion of the PCR reaction, the denaturing solution (40% formamide, 5.6 M Urea) and the amplification product (PCR reaction completion solution) are mixed at a ratio of 4: 1, heat-treated at 95 ° C. for 10 minutes, and each 5 μl subjected to electrophoresis. did. Electrophoresis was performed using a 40 cm long denaturing gel (6% denaturing polyacrylamide gel: 50% urea, acrylamide (monomer: bis = 19: 1)) to achieve sufficient separation. A commercially available molecular weight marker labeled with fluorescence was subjected to the same heating and denaturing treatment and simultaneously subjected to electrophoresis.

  After the completion of electrophoresis, the fragment length of the reaction product was analyzed using a fluorescence image analyzer FMBIO (manufactured by Hitachi Software Engineering). The amplified fragment length was detected as a difference in band position based on the molecular weight marker.

The correspondence table created based on the difference in amplified fragment length completely matched the contents of Tables 1A and 2A created in Example 1, and the results obtained in Example 1 were reconfirmed. In addition, this confirms that the same identification can be made even if the difference in the fragment length of the amplified product by the PCR method is detected as the difference in the band position of the gel plate electrophoresis, and the effectiveness of this method is demonstrated. It was done.

Variety Identification of Japanese Ground Peanuts Using the Method of the Present Invention In order to confirm the usefulness of the variety identification method of the present invention, variety identification was performed using commercially available butter peanuts.

  Although it was thought that domestic peanuts were used for this commercially available butter peanut, it was not described what kind of peanut was used. Therefore, it was decided to analyze all six microsatellite markers obtained in Example 1 above.

In the same manner as in Example 1, DNA was extracted from the three butter peanuts.
Next, a PCR reaction was performed in the same manner as in Example 1, and the amplified fragment lengths of the six microsatellite markers were analyzed by capillary electrophoresis. As a result, peanuts used in this butter peanut were found to exhibit a class A polymorphism at PM50. PM204 had class C, PM15 had class B, PM137 had class D, PM32 had class B, and PM238 had class AE polymorphism.

  This result is consistent with the combination of polymorphisms indicating that it is Chiba peninsula in Table 1A, and it was confirmed that the peanut used in the butter peanut is Chiba penis. In addition, this result shows that even if the groundnut to which this method is applied is a processed product, it is possible to identify the variety without any problem.

Search for microsatellite markers 2
In addition to “Benihandachi” and “Daichi”, which were not targeted in the search described in Examples 1 to 3, a total of 16 species were searched for a microsatellite marker for identifying domestic peanut major varieties. went. By targeting these 16 types in total, it is possible to cover approximately 98% of the domestic varieties distributed in Japan (from the cropping area in 2002), further enhancing practical utility. it can.

  The 16 domestic peanut varieties are Azuma Handicati (Ministry of Agriculture, Forestry and Fisheries, New crop registration number: Rakasei Agricultural Forestry No. 1), Tecona (Rakasei Agricultural Forestry No.2), Wasedai Ryu (Rakasei Agricultural Forestry No.3), Benihandachi (Rakasei Agricultural Forestry) No.4), Sachihomare (Lakasei Agriculture and Forestry No.5), Tachimasari (Lakasesai Agriculture and Forestry No.6), Azuma Yutaka (Lakasesai Agriculture and Forestry No.7), Nacateyutaka (Lakasesai Agriculture and Forestry No.8), Daiichi (Lakasesai Agriculture and Forestry No.9), Sayaka (Rakasei Agriculture and Forestry No. 10), Yuderakka (Rakasei Agriculture and Forestry No.11), Soil Incense (Lakasei Agriculture and Forestry No.12), Township Incense (Rakasesai Agriculture and Forestry No.13), Fukumasari (Lakasesai Agriculture and Forestry No.14), Chiba There are 15 varieties and one line of Kanto 56, which is a line similar to the half standing (unregistered) and Chiba half standing. These seeds were obtained from Chiba Prefectural Agricultural Research Center peanut test site and used as reference products.

(1) Extraction of DNA of reference product 10 seeds of 16 types of reference product were prepared, each incubated at 70 ° C. for 3 hours, and then cooled to room temperature to remove thin skin. The seeds from which the skin was removed were pulverized for each variety and line, placed in a 15 ml tube, and extracted buffer (10 mM Tris-HCl, 10 mM EDTA-2Na, 0.1% SDS, 5 M NaCl 30 ml).
2700 μl, 5 M guanidine hydrochloride 300 μl, and 20 mg / ml proteinase K 50 μl were added. This was heated at 55 ° C. for 3 hours while stirring with a rotator, and then centrifuged at 3,000 rpm for 10 minutes. Each 800 μl of the supernatant after centrifugation was transferred to a 1.5 ml capacity microtube, and centrifuged again at 15,000 rpm for 3 minutes using a microtube centrifuge.

  After separation, 500 μl of each supernatant was transferred to a 2 ml capacity microtube, and DNA was purified using a commercially available nucleic acid purification kit (Wizard DNA Cleanupsystem: Promega). All purification was performed according to the protocol included in the kit, and DNA solutions were obtained in 1.5 ml microtubes for each variety and strain.

For the 16 DNA solutions thus obtained, a commercially available DNA quantification kit (Quant-iT PicoGreen
The concentration was measured using dsDNA Assay Kit (Molecular Probes). 2 μl of each kind of DNA solution was fractioned and mixed with 98 μl of TE, and a total of 100 μl was dispensed into wells of a 96-well microplate as a sample for concentration measurement. In addition to the samples, 100 μl of standard solutions (2000, 200, 20, 2 ng / ml) and Blank (TE) attached to the kit were used for the measurement. To each well, 100 μl of the reagent PicoGreen Reagent attached to the kit diluted 200-fold with TE was added and stirred, and then incubated at room temperature for 2 to 5 minutes. Measure this plate using a fluorescent plate reader (Excitation 485 nm, Emission 530 nm), and use the calibration curve obtained from the standard solution measurement results to determine the concentration of each DNA solution extracted from the 16 types of reference products. Calculated.

(2) Amplification of base sequence specific to each microsatellite by PCR Next, by using all 16 kinds of DNA solutions obtained in (1) above, what kind of micro sequence is included in the genome of domestic peanut major varieties. We analyzed whether satellites existed. Since "Benihandachi" and "Daichi" newly added to the subject this time could not be distinguished from "Chiba Hanate" when applying the method of identifying all 14 domestic peanut major varieties established in Examples 1-3 above, We aimed to find a new microsatellite marker that can distinguish these three types.

As the microsatellite, Guohao He, et al., BMC Plant used also in Example 1 was used.
Biology, 3, 3 (2003) (hereinafter referred to as “Reference 1”), ME Ferguson, et al., Theor Appl Genet (2004) 108: 1064-1070 (hereinafter referred to as “Reference 3”), MC Moretzsohn , et al., Theor Appl Genet (2005) 111: 1060-1071 (hereinafter referred to as “Literature 4”) and Guohao He, et al., Euphytica (2005) 142: 131-136 (hereinafter referred to as “Literature 5”) The microsatellite found in foreign varieties reported in 4 references) was selected as a candidate.

  Regarding 56 markers from Document 1, markers effective for identification have been analyzed in Example 1 above. References 3, 4 and 5 reported the presence of a total of 188 microsatellites, excluding duplicates (References 3 to 110, References 4 to 59, References 5 to 19) . First of all, in order to select microsatellite showing polymorphism in Chiba Peninsula, Daiichi, and Benihandati, for which the identification method has not yet been established, it was decided to conduct comprehensive analysis (screening). Analysis was performed on the DNA of one individual of each variety.

In Example 1, each marker was amplified by PCR using a non-fluorescent primer, and comprehensive screening was carried out by examining the presence or absence of a polymorphism by electrophoresis using a polyacrylamide gel. However, the method performed in Example 1 has room for improvement in that the resolution of PCR amplified fragments is relatively low, and the difference in length of several bases may be overlooked. In comprehensive screening, there are many markers reported in the literature, but there are very few markers that show polymorphism in Japanese peanuts that have many genetically related varieties. As a result, it was desired to select all markers indicating polymorphism in screening. However, it is not practical to prepare fluorescently labeled primers for all the markers and perform high-sensitivity analysis by capillary electrophoresis with high resolution, since the fluorescent labeling costs enormous costs. To solve this problem, 20bp
PCR is performed using a specific forward primer and a specific reverse primer for each microsatellite to which an arbitrary sequence (GCTACGGACTGACCTCGGAC (SEQ ID NO: 13)) is added, and the PCR product is used as a template to fluorescently label the above arbitrary sequence The PCR amplification product was fluorescently labeled by performing a second PCR with a forward primer and a specific reverse primer. According to this method, it is possible to fluorescently label PCR products of all markers at low cost by fluorescently labeling only the arbitrary sequence. Furthermore, if PCR is performed twice, it becomes more complicated than PCR using a normal marker-specific fluorescently labeled primer, so the specific forward primer, the specific reverse primer, and the fluorescently labeled arbitrary sequence primer are the same. It was put into a PCR reaction solution, and it was improved so that many kinds of PCR products could be fluorescently labeled at a low cost with a single PCR.

  As a primer used in the PCR reaction, since the primer sequence of the marker described in the above-mentioned document 4 was not disclosed in the document, primer design free software Primer3 (Rozen S, Skaletsky) based on the information of the DNA base sequence database H (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp 365-386) And created it independently. For other markers, a set of specific primers capable of amplifying a base sequence specific to each microsatellite disclosed in the literature was appropriately selected and used.

The composition of 20 μl of PCR reaction solution is 2 μl of 10 × PCR buffer, 2 μl of 2 mM d-NTP, 25 mM MgCl ₂
0.4 μl, fluorescently labeled arbitrary sequence primer (25 pmol / μl) 0.1 μl, specific forward primer (25 pmol / μl) for each microsatellite marker with an arbitrary sequence added, 0.1 μl, specific reverse primer (25 pmol / μl) μl) was 0.2 μl, Taq DNA polymerase (5 U / μl) was 0.1 μl, MQ water was 14.1 μl, and DNA (10 ng / μl) was 1 μl. The temperature conditions were 95 ° C for 10 minutes, 95 ° C for 0.5 minutes, 55 ° C for 0.5 minutes, 72 ° C for 1 minute 40 times, and finally 72 ° C for 3 minutes. PCR amplified fragment length was detected according to the procedure of capillary electrophoresis described later.

  As a result of screening, 3 to 14 markers and 4 to 13 markers showing polymorphism were found in Chiba Hanada, Daiichi, and Benihandachi. None of the markers from Ref. 5 could distinguish three varieties. Each document analyzed multiple foreign peanut varieties and reported a large number of markers. However, there are only a few markers applicable to domestic peanut varieties, the trends are not consistent, and the search is steady. It was confirmed once again that is necessary.

  Next, detailed analysis using all 16 varieties was sequentially performed on all 27 markers selected as a result of the above comprehensive screening.

  The 16 DNA solutions obtained in the above (1) were adjusted to a concentration of 10 ng / μl with TE (pH 8.0), and used as a template DNA for PCR reaction. Analysis was performed on 10 individuals of each variety.

  As the primer, a specific forward primer and a specific reverse primer for each microsatellite marker used in the above screening were used. At this time, the forward primer was previously fluorescently labeled at the 5 ′ end for analysis by a fluorescence image analyzer described later. As fluorescently labeled primers, those labeled with VIC, PET, NED and FAM were outsourced (manufactured by ABI). The reverse primers for pPGSseq-16F10, AH2TC7C6, pPGSseq-11G07, and PM3 were outsourced to ABI as tailed-reverse primers. Others were normal reverse primers.

PCR reaction was performed using a GeneAmp9600 system (Roche diagnostics) in a reaction volume of 20 μl. Prepare 20 μl of the reaction solution to contain 1 μl of template DNA (10 ng / μl), 0.75 units of AmpliTaq Gold (ABI), 0.2 μmole of dNTP, forward primer and reverse primer each containing 0.625 pmole. The one attached to AmpliTaq Gold was used. PCR reaction conditions were 95 ° C for 10 minutes, 95 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 1 minute for one cycle. This was repeated 40 cycles, and finally 72 ° C was set at 30 ° C. Minutes.
The amplification product obtained as a result of the PCR reaction was subjected to the next step and analyzed.

(3) Analysis of amplified fragment length using capillary electrophoresis 2 μl of the PCR amplification product obtained in (2) above was added to a 96-well plate into which 100 μl of pure water had been dispensed in advance to make a 50-fold dilution. . A 1/200 amount of molecular weight marker (500 LIZ Size Standard: manufactured by ABI) was added to Hi-di Formamid (manufactured by ABI). Ten μl of Hi-di Formamid was dispensed into a 96-well plate (TCll Reaction Plate) for detection, 1 μl of the 50-fold diluted solution was added, and the lid was capped. After mixing, the mixture was centrifuged and heated at 95 ° C. for 5 minutes, then immediately placed in ice and cooled for 10 minutes. The plate was set in a capillary electrophoresis apparatus “3730 DNA Analyzer” (manufactured by ABI) and the Run button was pressed to start electrophoresis. Analysis software “GeneMapper” (manufactured by ABI) was started, and the size (length) of the amplified fragment was measured using the fragment analysis function. For each marker, it was detected what kind of amplified fragment was obtained in each of the 16 species, and classified into the alphabet A from the alphabet based on the length.

(4) Determination of markers When analysis of 16 types of markers that were effective in screening by the above method was sequentially carried out, 3 markers from Reference 3 and 1 from Reference 4 out of the 27 markers previously selected. By appropriately combining the markers and a total of 8 markers of 4 markers from literature 1 already known to be effective in the method for identifying all 14 species, 16 major peanut varieties can be identified. It became clear that it can be done. That is, it has been found that combinations of polymorphic types in these 8 microsatellites are all different combinations among the 16 species.

Eight microsatellite markers found here are PM204 (GenBank
accession number: AY237780), PM3 (AY237738), PM137 (AY237766), PM238 (AY237791), pPGSseq-16F10 (BZ999879), pPGSseq-11G07 (BZ999490), pPGSseq-11G03 (BZ999487), and literature 4. AH2TC7C6 (DQ099141) described in 4.

  Although all 27 markers selected previously were not analyzed in detail, as a result of sequential marker analysis, it was possible to identify these 8 markers.

  The results obtained here were summarized in a list of polymorphisms of each marker in the 16 species (Table 1B) and a polymorphism class in each marker (Table 2B). Moreover, the specific marker used for specifying it for every kind or its combination was made into the list (Table 3B). Furthermore, depending on the variety, there were a plurality of markers or combinations thereof that could identify them, but a particularly preferred marker or combination thereof was determined from among them, and Table 4B was created (those that are shaded in Table 4B, Preferred markers or combinations thereof). By using these tables, it is possible to easily identify major Japanese peanut varieties.

Analysis of amplified fragments using a fluorescence image analyzer In Example 4 above, a capillary electrophoresis apparatus and analysis software were used to analyze the amplified fragments. Therefore, for the 8 microsatellite markers obtained, the amplified fragment was analyzed by detecting the electrophoresis pattern by gel plate electrophoresis and fluorescence image analyzer, and which method would give the same result? I confirmed. Gel plate electrophoresis is known to have lower resolution and sensitivity than capillary electrophoresis, but is useful in terms of high versatility of the apparatus.

  Since the 8 microsatellite markers contained a plurality of 2-bp repetitive microsatellites that are considered to be difficult to judge because of differences in the length of amplified fragments, a sequence gel with high resolution was used as the gel.

  For the 16 DNA solutions prepared in (1) of Example 4 above, a set of primers (hereinafter referred to as forward primer (F) and reverse primer) that amplify base sequences specific to the eight microsatellite markers. (Indicated by (R)), and amplification by PCR was performed in the same manner as described above. As primers, PM204 (F) (SEQ ID NO: 1) and PM204 (R) (SEQ ID NO: 2) are used for amplification of the marker PM204, and PM3 (F) (SEQ ID NO: 22) and PM3 are used for amplification of the marker PM3. (R) (SEQ ID NO: 23), PM137 (F) (SEQ ID NO: 5) and PM137 (R) (SEQ ID NO: 6) for the amplification of marker PM137 and PM238 (F) (SEQ ID NO: 6) for the amplification of marker PM238. : 7) and PM238 (RT) (SEQ ID NO: 8), pPGSseq-16F10 (F) (SEQ ID NO: 14) and pPGSseq-16F10 (RT) (SEQ ID NO: 15), marker for amplification of the marker pPGSseq-16F10 pPGSseq-11G07 (F) (SEQ ID NO: 18) and pPGSseq-11G07 (RT) (SEQ ID NO: 19) for amplification of pPGSseq-11G07, AH2TC7C6 (F) (SEQ ID NO: 16) for amplification of marker AH2TC7C6 and For amplification of AH2TC7C6 (RT) (SEQ ID NO: 17) and marker pPGSseq-11G03, pPGSseq-11G03 (F) (SEQ ID NO: 20) and pPGSseq-11G03 (RT) (SEQ ID NO: 21) were used. Each forward primer was outsourced with a fluorescently labeled 5 ′ end as in Example 1.

  After completion of the PCR reaction, the denaturing solution (40% formamide, 5.6 M Urea) and the amplification product (PCR reaction completion solution) are mixed at a ratio of 4: 1, heat-treated at 95 ° C. for 10 minutes, and each 5 μl subjected to electrophoresis. did. Electrophoresis was performed using a 40 cm long denaturing gel (6% denaturing polyacrylamide gel: 50% urea, acrylamide (monomer: bis = 19: 1)) to achieve sufficient separation. A commercially available molecular weight marker labeled with fluorescence was subjected to the same heating and denaturing treatment and simultaneously subjected to electrophoresis.

  After the completion of electrophoresis, the fragment length of the reaction product was analyzed using a fluorescence image analyzer FMBIO (manufactured by Hitachi Software Engineering). The amplified fragment length was detected as a difference in band position based on the molecular weight marker.

  The correspondence table created based on the difference in amplified fragment length completely matched the contents of Tables 1B and 2B created in Example 4, and the results obtained in Example 4 were reconfirmed. In addition, this confirms that the same identification can be made even if the difference in the fragment length of the amplified product by the PCR method is detected as the difference in the band position of the gel plate electrophoresis, and the effectiveness of this method is demonstrated. It was done.

Variety Identification of Japanese Ground Peanuts Using the Method of the Present Invention In order to confirm the usefulness of the variety identification method of the present invention, variety identification was performed using commercially available butter peanuts.

  Although it was thought that domestic peanuts were used for this commercially available butter peanut, it was not described what kind of peanut was used. Therefore, it was decided to analyze all the eight microsatellite markers obtained in Example 4 above.

In the same manner as in Example 4 above, DNA extraction was performed from 3 grains of the butter peanut.
Next, a PCR reaction was performed in the same manner as in Example 4 above, and the amplified fragment lengths of the eight microsatellite markers were analyzed by capillary electrophoresis. As a result, peanuts used in this butter peanut are class C for PM204, class AE for PM3, class D for PM137, class AE for PM238, class E for pPGSseq-16F10, class D for pPGS seq-11G07, AH2TC7C6 It had class B polymorphism in class B and pPGS seq-11G03.

  This result is consistent with the combination of polymorphisms indicating that it is Chiba Hanzen in Table 1B, and it was confirmed that the peanut used in the butter peanut is Chiba Hanzen. In addition, this result shows that even if the groundnut to which this method is applied is a processed product, it is possible to identify the variety without any problem.

  According to the present invention, identification of Japanese peanut main varieties can be performed clearly, objectively and with high reproducibility. Moreover, it can be performed by a very simple method as compared with a method based on a conventional morphological feature.

Claims (34)

Peanuts characterized by identifying the following major Japanese peanut varieties using one or more microsatellite markers selected from the group consisting of microsatellite markers PM15, PM32, PM50, PM137, PM204, and PM238 Variety identification method;
Azuma Handa Chite Konawa Sedai Ryusachi Homare Tachimasariazumayutakanacateyutakasayaka yudelacka incense incense in Chikahanchi Kanto No. 56 A method for identifying Azuma handkerchief or Chiba peninsula, comprising using a microsatellite marker PM50. A method for identifying Tecona, comprising using a microsatellite marker PM50 or PM204. A method for identifying Wasedai Ryu, comprising using a microsatellite marker PM204. A method for identifying Sachihomare, characterized by using a microsatellite marker PM204 or a combination of PM50 and PM238. A method for identifying a tachimasari characterized by using a combination of microsatellite markers PM15, PM137, and PM204, or a combination of PM204 and PM238. A method for identifying Azuma yutaka, which uses a combination of microsatellite markers PM50, PM137 and PM204. A method for identifying a categorized hawk, which uses a combination of microsatellite markers PM15, PM50, PM137, and PM238, or a combination of PM15, PM32, PM50, and PM238. A method for identifying Sayaka, comprising using a combination of microsatellite markers PM50 and PM137. A method for identifying a Udelacka, comprising using a combination of microsatellite markers PM15 and PM137, a combination of PM15 and PM32, or a combination of PM15 and PM238. A method for identifying soil incense, comprising using a microsatellite marker PM238. A method for discriminating local incense, which uses a combination of microsatellite markers PM50 and PM238. A method for identifying crowds, comprising using a combination of microsatellite markers PM15 and PM32, a combination of PM32 and PM238, or a combination of PM50, PM137 and PM238. A method for identifying Kanto No. 56, comprising using a combination of microsatellite markers PM204 and PM238, or a combination of PM50 and PM238. The following major Japanese peanuts using one or more microsatellite markers selected from the group consisting of microsatellite markers PM204, PM3, PM137, PM238, pPGSseq-16F10, pPGSseq-11G07, pPGSseq-11G03, and AH2TC7C6 A method for identifying peanut varieties, characterized by identifying varieties;
Azuma Handa Chite Konawa Sedai Ryu Beni Handa Sachi Homare Tachimasariazumayutakanacateyutakadaiichisayakayuderakka incense fragrance Chiba Hanritsu Kanto No. 56 A method for identifying azuma handkerchief, comprising using a microsatellite marker PM3. A method for identifying Tecona, comprising using a microsatellite marker PM204. Microsatellite marker PM204, or pPGSseq-11G07, or a combination of PM238 and pPGSseq-11G03, or a combination of pPGSseq-16F10 and AH2TC7C6, or a combination of pPGSseq-11G03 and AH2TC7C6, or PM3, PM137 and pPGSseq-11G03 A method for identifying Wasedai Ryu, comprising using a combination of A method for identifying benihandati, comprising using a microsatellite marker pPGSseq-16F10 or AH2TC7C6. A method for identifying Sachihomare, characterized by using a microsatellite marker PM204, a combination of PM238 and AH2TC7C6, a combination of PM137 and pPGSseq-16F10, or a combination of PM238 and pPGSseq-16F10. A combination of microsatellite markers PM204 and PM238, a combination of PM3 and pPGSseq-11G07, a combination of PM3 and pPGSseq-11G03, a combination of PM204 and AH2TC7C6, or a combination of PM3 and pPGSseq-16F10, or AH2TC7C6 And a combination of pPGSseq-11G03, a combination of AH2TC7C6 and pPGSseq-11G07, a combination of PM238 and pPGSseq-11G03, or a combination of pPGSseq-16F10 and pPGSseq-11G03 . A method for identifying Azuma yutaka, comprising using a microsatellite marker pPGSseq-16F10, a combination of PM238 and pPGSseq-11G07, a combination of PM238 and pPGSseq-11G03, or a combination of PM238, AH2TC7C6 and PM137. A method for discriminating Nakacateyutaka, comprising using a combination of microsatellite markers PM3, PM137, PM238 and AH2TC7C6, or a combination of PM3, PM137, PM238 and pPGSseq-11G03. A method for discriminating diches, comprising using a combination of microsatellite markers pPGSseq-16F10 and pPGSseq-11G07, a combination of PM238 and pPGSseq-11G03, or a combination of PM238 and pPGSseq-11G07. A combination of microsatellite markers PM238 and pPGSseq-11G03, or a combination of PM137 and AH2TC7C6, or a combination of PM137 and pPGSseq-11G03, or a combination of PM238, pPGSseq-11G07 and AH2TC7C6, or PM238, pPGSseq-16F10 and AH2TC7C6 Or a combination of pPGSseq-11G07, pPGSseq-11G03, and AH2TC7C6. A combination of microsatellite markers PM3 and pPGSseq-11G03, a combination of PM3 and AH2TC7C6, a combination of PM3 and pPGSseq-11G07, a combination of PM3 and PM238, a combination of PM3 and PM137, or a PM204, PM3 And a combination of pPGSseq-16F10. A method for identifying soil incense, comprising using a microsatellite marker PM238, a combination of PM137 and pPGSseq-16F10, or a combination of PM204 and pPGSseq-16F10. A combination of microsatellite markers PM137, PM238 and pPGSseq-11G07, a combination of PM137, PM238 and pPGSseq-11G03, or a combination of pPGSseq-11G03 and AH2TC7C6, or a combination of PM137, pPGSseq-16F10, AH2TC7C6 and pPGSseq-11G03 A method of identifying a local incense, characterized in that A method for identifying crowds, comprising using a combination of microsatellite markers PM238 and pPGSseq-11G07, or a combination of pPGSseq-11G07 and AH2TC7C6. A method for identifying Chiba Haneri characterized by using a combination of microsatellite markers PM204, PM3, PM238, pPGSseq-11G07 and AH2TC7C6. A combination of microsatellite markers PM204 and PM238, a combination of PM238 and pPGSseq-16F10, a combination of PM238 and AH2TC7C6, a combination of AH2TC7C6 and pPGSseq-11G03, or a combination of PM137, pPGSseq-16F10 and pPGSseq-11G03 An identification method of Kanto No. 56, characterized in that The method according to claim 1, wherein the identification method includes the following steps.
a) Using DNA extracted from peanuts whose varieties should be identified as a template, PCR is performed using two types of primers for amplifying a base sequence specific to the microsatellite marker to be used,
b) measuring the length of the DNA fragment amplified in step a) above,
c) Identifying peanut varieties based on the length of the DNA fragment measured in step b) above. The method according to claim 32, wherein the length of the DNA fragment in step b) is measured using a capillary electrophoresis apparatus. The reagent kit for use in the method according to any one of claims 1 to 33, comprising at least two kinds of primers for amplifying a base sequence specific to the microsatellite marker to be used.