JP2006522605A - Time-lapse cell analysis - Google Patents

Abstract

It is an object of the present invention to provide a method and system for accurately presenting the actual state of a cell. It is another object of the present invention to provide a system and method for presenting intracellular information over time and / or in real time as it is or directly from the viewpoint of a complex system.
According to the present invention, there is provided a method for determining a cell state, in which a) a transcription state associated with at least one transcription control sequence selected from a group of transcription control sequences derived from the cell is monitored over time. Obtaining a time course profile; and b) determining the cellular state from the time course profile of the transcriptional state.

Description

  The present invention is in the field of cell analysis technology. More specifically, the present invention relates to a method for observing and analyzing cells continuously or over time and a system therefor.

  The survival of an organism depends on their ability to recognize and respond to extracellular signals. At the molecular level, signals are recognized and transmitted through networks such as interacting proteins that act cooperatively to maintain cellular homeostasis and regulate activities such as proliferation, division and differentiation. The Signal transduction through biological signaling networks is primarily mediated by protein-protein interactions that can dynamically assemble and degrade in response to signals, allowing external events to occur in specific genes such as changes in gene expression. Create a transient circuit that connects to the internal output. Numerous strategies have been developed to map the protein-protein interactions that underlie these networks, and these studies have collectively been linked to genome-wide protein--for Saccharomyces cerevisiae and other organisms. It provides a wealth of data that outlines protein interactions. These means are very powerful, but only provide a partially completed image, and probably many interactions in subtle situations (there is an appropriate signal for those interactions) You will only be formed if you are overlooked).

  Disruption of protein-protein interactions by mutations or small molecules can create biological struts that allow small perturbations of the signaling network that trigger large changes in the cell phenotype, but in a given signaling pathway Not all protein-protein interactions appear to possess this force. Thus, artificially introducing a protein or peptide into the cell (which competes with the desired endogenous regulatory interaction and titrate-out), thereby linking the external signal to the cellular response. Interesting are complementary strategies aimed at identifying regulatory protein-protein interactions by disrupting the normal circuitry that causes them. By combining this strategy with functional assays (eg, gene activation in response to signals), screening for functional interference can be used to identify peptides that disrupt regulatory protein-protein interactions. Can be done. This strategy (often referred to as dominant interference genetics or dominant negative genetics) has been successfully used in several model organisms, where high-throughput screening methods are easily applied, And to a lesser extent in mammals (formerly mammals are less likely to be subject to this type of screening.) One capability of a dominant negative strategy is the protein-protein interaction to which this strategy is functionally related. The precise location of the “post points” of action, thereby revealing a small number of central points within a large network of protein networks that are susceptible to functional regulation by external factors. Therefore, the results of the dominant negative strategy are very specific for the regulatory components that define a particular pathway. Important proteins suitable for targeting by providing critical information obtained, and drug screening programs - may elucidate the protein interaction.

  Rosetta Infarmatics has proposed in several patent applications to provide cellular information as profiles (WO 10/006013, WO 01/005935, WO 00/39339, WO 00/39338, WO 00/39337, WO 00/24936, WO00 / 17402, WO99 / 66067, WO99 / 66024, WO99 / 58720 and WO99 / 59037). However, in such a profile, information from separate cells is treated as a collection of separate information fragments rather than as continuous information. Therefore, this technique is limited in that information analysis is not performed on one (same) cell. In particular, in such a technique, analysis is performed only at specific temporary points before and after a certain change, and a temporal change series taken by a certain point (gene) is not analyzed.

  With respect to profiling technology, recent advances in technology have made it possible to accurately measure cellular elements and hence to profile cellular information (eg, Schena et al., 1995, Quantitative monitoring of gene). expression pattern with a complementary DNA microarray, Science 270: 467-470; Lockhart et al., 1996, Exponential monitoring of the biomolecules. hard et al., 1996, Sequence to array: Probing the gene's secrets, Nature Biotechnology 14: 1649; and WO01 / 006013) In organisms where the entire genome is known, analyze transcripts of all genes in the cell. In the case of other organisms whose genome information is increasing, it is possible to simultaneously monitor a large number of genes in a cell.

  With the advancement of array technology, arrays are also used in the field of drug discovery (for example, Marton et al., 1998, Drug target validation and identification of secondary drug effects using Microarrays, Nat. 98, Nat. 1293-301 and Gray et al., 1998, Exploiting chemical libraries, structure, and genomics in the science for kinases, Science, 281: 533-538). Analysis using profiles (see, for example, US Pat. No. 5,777,888) and clustering of profiles can include cell status, transplantation, drug molecular targets and drug candidates and / or drug related functions, drug efficacy And gives information on drug toxicity. Such techniques can also be used to derive a common profile that represents ideal drug activity or disease state. Profile comparison helps to detect a patient's disease at an early stage and can provide improved clinical outcome prediction for patients diagnosed with the disease.

  However, there is still no example of technology that can provide information on the same cell in a new sense. In the above-described technique, data is presented as an average value of a heterogeneous cell population, and thus analysis and evaluation based on such data lack accuracy. Accordingly, there is an increasing demand for methods for providing information at the cellular level.

  An object of the present invention is to provide a method and system for accurately presenting the actual state of a cell. In particular, it is an object of the present invention to provide a system and method for presenting information at the cellular level, either directly or over time and / or in real time, without modification, where the cells are considered complex systems. .

  The object of the present invention is to monitor the transcriptional state related to at least one transcriptional control sequence selected from transcriptional regulatory sequences derived from cells over time, and present a temporal profile of the cell (transcriptional state). It was solved.

  Accordingly, the present invention provides the following.

(1) A method for presenting a cell state,
a) obtaining a time profile of the cell by monitoring over time a state of a gene related to at least one gene selected from genes derived from the cell; and b) presenting the time profile ;
Including the method.

  (2) The method according to item 1, further comprising the step of fixing the cell to a solid support.

  (3) The method according to item 1, wherein the temporal profile is presented in real time.

  (4) The method according to item 1, wherein the gene includes a transcriptional regulatory sequence, and the state of the gene includes expression of the gene.

(5) A method for determining a cell state,
a) obtaining a temporal profile of the cell by monitoring the status of a gene related to at least one gene selected from genes derived from the cell over time; and b) a temporal profile of the status of the gene. Determining the cell state based on
Including the method.

  (6) The method according to item 5, further comprising the step of fixing the cell to a solid support.

  (7) The method according to item 5, wherein the gene includes a transcriptional regulatory sequence, and the state of the gene includes expression of the gene.

  (8) The method according to item 5, further comprising a step of correlating the temporal profile with the cell state before obtaining the temporal profile.

  (9) The method according to item 7, wherein the transcription control sequence comprises selection from the group consisting of a promoter, an enhancer, a silencer, a flanking sequence of another structural gene in the genome, and a genomic sequence other than an exon.

  (10) The method according to item 7, wherein the transcription control sequence group comprises at least one promoter selected from the group consisting of a constitutive promoter, a specific promoter and an inducible promoter.

  (11) The method according to item 7, wherein the monitored transcription control sequence comprises at least two transcription control sequences.

  (12) The method according to item 4, wherein the monitored transcription control sequence comprises at least three transcription control sequences.

  (13) The method according to item 7, wherein the transcription control sequence monitored includes at least eight transcription control sequences.

  (14) The method according to item 7, further comprising the step of arbitrarily selecting at least one transcription control sequence from the transcription control sequence group.

  (15) The method according to item 5, wherein the temporal profile is presented in real time.

  (16) The method according to item 5, wherein the state of the cell is selected from the group consisting of a differentiated state, an undifferentiated state, a cellular response to a foreign factor, a cell cycle, and a proliferative state.

  (17) The method according to item 5, wherein the cells are selected from the group consisting of stem cells and somatic cells.

  (18) The method according to item 5, wherein the cell is selected from the group consisting of adherent cells, floating cells, tissue-forming cells, and mixtures thereof.

  (19) The method according to item 6, wherein the solid support includes a substrate.

  (20) The method according to item 7, wherein the cell is transfected with a nucleic acid molecule comprising the transcription control sequence and a reporter gene sequence operably linked to the transcription control sequence.

  (21) The method according to item 20, wherein the transfection is performed on a solid phase or in a liquid phase.

  (22) The method according to item 5, wherein the step b) includes comparing phases of the time-lapse profiles.

  (23) The method according to item 5, wherein the determination step b) includes a step of taking a difference between the time-lapse profile of the cell and the control profile.

(24) A method for correlating a foreign factor with a cellular response to the foreign factor,
a) exposing the cell to a foreign factor;
b) monitoring a transcriptional state related to at least one transcriptional regulatory factor selected from a group of transcriptional regulatory factors present in the cell over time to obtain a temporal profile of the cell; and c) the exogenous factor and Correlating the time-lapse profile;
Including the method.

  (25) A method according to item 24, wherein the cell is a cell immobilized on a solid support.

  (26) The method according to item 24, comprising obtaining a time-course profile for each foreign factor using at least two of the foreign factors.

  (27) The method according to item 26, comprising the step of classifying the exogenous factor corresponding to the time profile by classifying the at least two time profiles.

  (28) A method according to item 24, wherein the transcription control factor comprises a constitutive promoter.

  (29) A method according to item 24, wherein the transcription control factor comprises an inducible promoter.

  (30) The method according to item 24, wherein the temporal profile is presented in real time.

  (31) The method according to claim 24, wherein in the step c), the exogenous factor is related to a temporal profile based on a phase of the temporal profile.

  (32) A method according to item 24, wherein the cell is cultured on an array.

  (33) A method according to item 32, wherein the step (b) includes a step of obtaining image data from the array.

  (34) The method according to item 24, wherein the step (c) is a step of identifying phases of the time-lapse profiles from each other.

  (35) The exogenous factor is selected from the group consisting of temperature change, humidity change, electromagnetic wave, potential difference, visible ray, infrared ray, ultraviolet ray, X-ray, chemical substance, pressure, gravity change, gas partial pressure and osmotic pressure. 25. A method according to item 24.

  (36) A method according to item 35, wherein the chemical substance is a biomolecule, a chemical compound, or a culture medium.

  (37) A method according to item 36, wherein the biomolecule is selected from the group consisting of nucleic acids, proteins, lipids, sugars, proteolipids, lipoproteins, glycoproteins, and proteoglycans.

  (38) A method according to item 36, wherein the biomolecule is a hormone.

  (39) A method according to item 36, wherein the biomolecule is a cytokine.

  (40) A method according to item 36, wherein the biomolecule is a cell adhesion factor.

  (41) A method according to item 36, wherein the biomolecule is an extracellular matrix.

  (42) A method according to item 35, wherein the chemical substance is a receptor agonist or antagonist.

(43) A method for estimating an unidentified foreign factor given to a cell from a temporal profile,
a) exposing the cell to a plurality of known foreign factors;
b) monitoring the transcriptional state associated with at least one transcriptional control sequence selected from a group of transcriptional control sequences present in the cell over time to obtain a temporal profile of the cell for each of the known foreign factors;
c) correlating each of the known foreign factors with each of the time profiles;
d) exposing the cells to an unidentified foreign factor;
e) monitoring the transcriptional state associated with the selected transcription control sequences over time to obtain a time profile of the cells for unidentified foreign factors;
f) determining a profile corresponding to the temporal profile obtained in the step (e) from the temporal profile obtained in the step (b); and g) the unidentified foreign factor is the step Determining that it is the known exogenous factor corresponding to the profile determined in (f);
Including the method.

(44) A method for estimating an unidentified foreign factor given to a cell from a temporal profile,
a) With respect to at least one transcription control sequence group selected from the transcription control sequence group present in the cell, data relating to the correlation between a known foreign factor and the time-lapse profile of the cell corresponding to the known foreign factor Providing a process;
b) exposing the cells to an unidentified foreign factor;
c) monitoring the transcriptional state associated with the selected transcription control sequence over time to obtain a time profile of the cells;
d) determining a profile corresponding to the time profile obtained in step (c) from the time profile provided in step (a); and e) the unidentified foreign factor is: Determining that the known exogenous factor corresponds to the determined profile;
Including the method.

(45) A system for presenting a cell state,
a) means for monitoring a transcriptional state related to at least one transcriptional control sequence selected from a group of transcriptional control sequences derived from the cell over time to obtain a temporal profile of the cell; and b) presenting the temporal profile Means to do;
A system comprising:

(46) A system for determining a cell state,
a) means for monitoring a transcriptional state associated with at least one transcriptional control sequence selected from a group of transcriptional control sequences derived from the cell over time to obtain a temporal profile of the cell; and b) a time-lapse of the transcriptional state. Means for determining the cell state from a profile;
A system comprising:

(47) A system for correlating a foreign factor with a cellular response to the foreign factor,
a) means for exposing the cells to foreign factors;
b) means for monitoring a transcriptional state related to at least one promoter selected from a group of promoters present in the cell over time to obtain a time-lapse profile of the cell; and c) the exogenous factor and the time-lapse profile. Means to correlate with;
A system comprising:

(48) A system for estimating an unidentified foreign factor given to a cell from a time profile of the cell,
a) means for exposing the cells to a plurality of known foreign factors;
b) means for monitoring the transcriptional state associated with at least one promoter selected from the group of promoters present in the cell over time to obtain a temporal profile of the cell for each of the known foreign factors;
c) means for correlating each of the known foreign factors with each of the time profiles;
d) means for exposing the cells to an unidentified foreign factor;
e) means for monitoring the transcriptional state associated with the selected promoter over time to obtain a time profile of the cell for unidentified foreign factors;
f) means for determining a profile corresponding to the time profile obtained by the means (e) from the time profile obtained by the means (b); and g) the unidentified foreign factor is the means Means for determining the known foreign factor corresponding to the profile determined in (f);
A system comprising:

(49) A system for estimating an unidentified foreign factor given to a cell from a time profile of the cell,
a) means for providing data relating to a correlation between a known foreign factor and a time profile of said cell corresponding to said known foreign factor for at least one promoter selected from the group of promoters present in said cell;
b) means for exposing the cells to an unidentified foreign factor;
c) means for monitoring the transcriptional state associated with the selected promoter over time to obtain a time profile of the cells;
d) means for determining a profile corresponding to the temporal profile obtained in the means (c) from the temporal profile provided in the means (a); and e) the unidentified foreign factor is: Means for determining the known exogenous factor corresponding to the determined profile;
A system comprising:

  Hereinafter, preferred embodiments of the present invention will be described. However, those skilled in the art can appropriately implement the embodiments of the present invention based on the description of the present specification and the accompanying drawings, and methods generally used in the art. To understand the. Those skilled in the art will readily understand the operations and effects of the present invention.

(Embodiment of the Invention)
Hereinafter, preferred embodiments of the present invention will be described. Throughout this specification, it should be understood that the singular forms also include the plural concept unless specifically stated otherwise. Therefore, singular articles (for example, “a”, “an”, “the” in the case of English, “ein”, “der”, “das”, “die”, etc. in the case of German and their case changes) Corresponding articles in other languages such as "un", "une", "le", "la" in Spanish, "un", "una", "el", "la", etc. It is to be understood that the adjectives also include the plural concept unless otherwise stated. In addition, it is to be understood that the terms used in the present specification are used in the meaning normally used in the art unless otherwise specified. Thus, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present specification, including definitions, will control.

(Definition of terms)
Listed below are definitions of terms particularly used in the present specification.

(Cell biology)
A “cell” as used herein is defined in the same way as the broadest meaning used in the art, and is a structural unit of a tissue of a multicellular organism, surrounded by a membrane structure that isolates the outside world, Refers to a living organism having self-regenerative ability and having genetic information and its expression mechanism. The cells used herein may be naturally occurring cells or artificially modified cells (eg, fusion cells, genetically modified cells). The source of cells can be, for example, a single cell culture, or such as cells from a normally grown transgenic animal embryo, blood, or body tissue, or a normally grown cell line Examples include but are not limited to cell mixtures.

  The cells used in the present invention can be cells from any organism (eg, any type of unicellular organism (eg, bacteria, yeast) or multicellular organisms (eg, animals (eg, vertebrates, invertebrates), plants ( For example, monocotyledonous plants, dicotyledonous plants and the like))) may be used. For example, cells derived from vertebrates (eg, larvae, lampreys, cartilaginous fish, teleosts, amphibians, reptiles, birds, mammals, etc.) are used, and more particularly mammals (eg, single pores, Marsupial, rodent, winged, winged, carnivorous, carnivorous, long-nosed, odd-hoofed, cloven-hoofed, rodent, scale, sea cattle, cetacean, primate , Rodents, rabbit eyes, etc.). In one embodiment, cells derived from primates (eg, chimpanzees, Japanese monkeys, humans), particularly cells derived from humans, are used, but are not limited thereto. The cells used in the present invention may be stem cells or somatic cells. Such cells can also be adherent cells, suspension cells, tissue-forming cells, mixtures thereof, and the like. Such cells may be used for transplantation purposes.

  In the present invention, when an organ is a target, such an organ may be any organ, and the tissue or cell targeted by the present invention may be derived from any organ or organ of an organism. In the present specification, the term “organ” or “organ” is used interchangeably, and a function of an organism individual is localized and operated in a specific part of the individual, and that part has morphological independence. Is a structure. In general, in a multicellular organism (eg, animal, plant), an organ is composed of several tissues having a specific spatial arrangement, and the tissue is composed of many cells. Such organs or organs include organs or organs associated with the vascular system. In one embodiment, organs targeted by the present invention include skin, blood vessels, cornea, kidney, heart, liver, umbilical cord, intestine, nerve, lung, placenta, pancreas, brain, peripheral limbs, retina and the like. It is not limited to them. In the present specification, cells differentiated from the pluripotent cells of the present invention include epidermal cells, pancreatic parenchymal cells, pancreatic duct cells, hepatocytes, blood cells, cardiomyocytes, skeletal muscle cells, osteoblasts, and skeletal myoblasts. , Nerve cells, vascular endothelial cells, pigment cells, smooth muscle cells, fat cells, bone cells, chondrocytes and the like.

  As used herein, “tissue” refers to a population of cells having substantially the same function and / or morphology in a multicellular organism. A “tissue” usually has the same origin, but even cell populations with different origins can be referred to as a tissue if they have the same function and / or morphology. Therefore, when a tissue is regenerated using the stem cells of the present invention, a cell population having two or more different origins can constitute one tissue. Usually, tissue constitutes part of an organ. Animal tissues are classified into epithelial tissues, connective tissues, muscle tissues, nerve tissues, etc. based on morphological, functional or developmental basis. Plants are roughly classified into meristems and permanent tissues according to the stage of development of the constituent cells, and are classified into single tissues and composite tissues according to the types of constituent cells.

  As used herein, “stem cell” refers to a cell having a self-replicating ability and having pluripotency (ie, “pluripotency”). Stem cells are usually able to regenerate the tissue when the tissue is damaged. As used herein, stem cells can be embryonic stem (ES) cells or tissue stem cells (also referred to as tissue stem cells, tissue-specific stem cells or somatic stem cells), but are not limited thereto. In addition, as long as it has the above-mentioned ability, an artificially produced cell (for example, a fusion cell described herein, a reprogrammed cell, etc.) can also be a stem cell. Embryonic stem cells refer to pluripotent stem cells derived from early embryos. Embryonic stem cells were first established in 1981, and have been applied since 1989 to the production of knockout mice. In 1998, human embryonic stem cells were established and are being used in regenerative medicine. Unlike embryonic stem cells, tissue stem cells are cells in which the direction of differentiation is limited, are present at specific positions in the tissue, and have an undifferentiated intracellular structure. Therefore, tissue stem cells have a low level of pluripotency. Tissue stem cells have a high nucleus / cytoplasm ratio and poor intracellular organelles. Tissue stem cells generally have pluripotency, have a slow cell cycle, and maintain proliferative ability over the life of the individual. As used herein, a stem cell may be an embryonic stem cell or a tissue stem cell.

  When classified according to the site of origin, tissue stem cells are classified into, for example, the skin system, digestive system, myeloid system, and nervous system. Examples of skin tissue stem cells include epidermal stem cells and hair follicle stem cells. Examples of digestive tissue stem cells include pancreatic (common) stem cells and liver stem cells. Examples of myeloid tissue stem cells include hematopoietic stem cells and mesenchymal stem cells. Examples of nervous system tissue stem cells include neural stem cells and retinal stem cells.

  As used herein, “somatic cell” refers to all cells that are cells other than germ cells, such as eggs and sperm, and that do not directly pass the DNA to the next generation. Somatic cells usually have limited or disappeared pluripotency. The somatic cells used in the present specification may be naturally occurring or genetically modified.

  Cells can be classified into stem cells derived from ectoderm, mesoderm and endoderm by origin. Cells derived from ectoderm are mainly present in the brain and include neural stem cells. Cells derived from mesoderm are mainly present in bone marrow, and include vascular stem cells, hematopoietic stem cells, mesenchymal stem cells, and the like. Endoderm-derived cells are mainly present in organs, and include liver stem cells, pancreatic stem cells, and the like. As used herein, somatic cells may be derived from any germ layer. Preferably, somatic cells may be lymphocytes, spleen cells or testicular cells.

  As used herein, “isolated” means that the substances naturally associated with it in a normal environment are at least reduced, preferably substantially free. Thus, an isolated cell refers to a cell that is substantially free of other substances (eg, other cells, proteins, nucleic acids, etc.) that accompany it in its natural environment. When referring to a nucleic acid or polypeptide, “isolated” is, for example, substantially free of cellular material or culture medium when made by recombinant DNA technology, and precursor when chemically synthesized. Refers to a nucleic acid or polypeptide that is substantially free of somatic or other chemicals. An isolated nucleic acid preferably includes sequences that are naturally flanking the nucleic acid in the organism from which the nucleic acid is derived (ie, sequences located at the 5 'and 3' ends of the nucleic acid). Absent.

  As used herein, “established” or “established” cells maintain certain properties (eg, pluripotency) and the cells continue to grow stably under culture conditions. State. Thus, established stem cells maintain pluripotency.

  As used herein, “differentiated cells” refer to cells with specialized functions and morphology (eg, muscle cells, nerve cells, etc.), and unlike stem cells, there is no or almost no pluripotency. . Examples of differentiated cells include epidermal cells, pancreatic parenchymal cells, pancreatic duct cells, hepatocytes, blood cells, cardiomyocytes, skeletal muscle cells, osteoblasts, skeletal myoblasts, neurons, vascular endothelial cells, pigment cells, Examples include smooth muscle cells, fat cells, bone cells, chondrocytes.

  As used herein, the “state” of a cell refers to a situation relating to various parameters of the cell (eg, cell cycle, response to foreign factors, signal transduction, gene expression, gene transcription, etc.). Examples of such a state include, but are not limited to, a differentiated state, an undifferentiated state, a cellular response to a foreign factor, a cell cycle, a proliferative state, and the like. As used herein, “gene state” refers to any state (eg, expression state, transcription state, etc.) associated with a gene.

  As used herein, “differentiation” or “cell differentiation” refers to two or more morphologically and / or functionally qualitative differences among daughter cell populations derived from the division of a single cell. A phenomenon in which types of cells are generated. Therefore, the process in which a cell population (cell lineage) derived from cells that cannot originally detect special characteristics exhibits distinct characteristics such as production of a specific protein is also included in differentiation. At present, it is common to consider cell differentiation as a state in which a specific gene group in the genome is expressed, and cell differentiation by searching for intracellular or extracellular factors or conditions that bring about such gene expression state. Can be identified. The result of cell differentiation is in principle stable, especially in animal cells, which differentiates into other types of cells only in exceptional cases. Therefore, the Stm gene of the present invention can be very useful as a marker for undifferentiated cells.

  As used herein, “pluripotency” or “pluripotency” is used interchangeably, refers to the nature of a cell, and refers to the ability to differentiate into one or more, preferably two or more, various tissues or organs. . Accordingly, “pluripotency” and “multipotency” are used interchangeably with “undifferentiated” unless otherwise specified herein. In general, cell pluripotency is limited as development progresses, and in adults, the constituent cells of one tissue or organ rarely change into another cell. Therefore, pluripotency is usually lost. In particular, epithelial cells are unlikely to change into other epithelial cells. When this happens, it is usually a pathological condition and is called metaplasia. However, mesenchymal cells have a high degree of pluripotency because they are likely to undergo metaplasia instead of other mesenchymal cells with relatively simple stimulation. Embryonic stem cells are pluripotent. Tissue stem cells are pluripotent. In the present specification, among pluripotency, the ability to differentiate into all types of cells constituting a living body like a fertilized egg is referred to as totipotency, and pluripotency can encompass the concept of totipotency. Whether or not a certain cell has pluripotency includes, but is not limited to, formation of an embryoid body or culture under differentiation-inducing conditions in an in vitro culture system. In addition, assay methods for the presence or absence of pluripotency using living organisms include the formation of teratomas by implantation into immunodeficient mice, the formation of chimeric embryos by injection into blastocysts, and transplantation into living tissues Examples include, but are not limited to, proliferation by injection into ascites. In the present specification, among pluripotency, the ability to differentiate into all types of cells constituting a living body like a fertilized egg is referred to as “totipotency”, and pluripotency can encompass the concept of totipotency. The ability to differentiate in only one direction is also referred to as unipotency.

(Biochemistry / Molecular biology)
As used herein, “gene” refers to a factor that defines a genetic trait. Usually arranged in a certain order on the chromosome. Those that define the primary structure of a protein are called structural genes, and those that influence the expression are called regulatory genes (for example, promoters). In the present specification, genes include structural genes and regulatory genes unless otherwise specified. Therefore, the cyclin gene usually includes both the cyclin structural gene and the cyclin promoter. As used herein, “gene” may refer to “polynucleotide”, “oligonucleotide” and “nucleic acid” and / or “protein”, “polypeptide”, “oligopeptide” and “peptide”. Also herein, “gene product” refers to “polynucleotide”, “oligonucleotide” and “nucleic acid” and / or “protein”, “polypeptide”, “oligopeptide” and “peptide” expressed by a gene. Is included. A person skilled in the art can understand what a gene product is, depending on the situation.

  As used herein, “homology” of sequences (eg, nucleic acid sequences, amino acid sequences, etc.) refers to the degree of identity of two or more gene sequences with each other. Therefore, the higher the homology between two genes, the higher the sequence identity or similarity. Whether two genes have homology can be examined by direct sequence comparison or, in the case of nucleic acids, hybridization methods under stringent conditions. When directly comparing two gene sequences, the DNA sequence between the gene sequences is typically at least 50% identical, preferably at least 70% identical, more preferably at least 80%, 90% , 95%, 96%, 97%, 98% or 99% are identical, the genes are homologous. In the present specification, “similarity” of sequences (for example, nucleic acid sequences, amino acid sequences, etc.) refers to two or more gene sequences when conservative substitutions are considered positive (identical) in the above homology. The degree of identity with each other. Thus, if there is a conservative substitution, identity and similarity differ depending on the presence of the conservative substitution. When there is no conservative substitution, identity and similarity indicate the same numerical value.

  In this specification, the comparison of similarity, identity and homology between amino acid sequences and base sequences is calculated using default parameters using FASTA, which is a sequence analysis tool.

  As used herein, “protein”, “polypeptide”, “oligopeptide” and “peptide” are used interchangeably herein and refer to a polymer of amino acids of any length. This polymer may be linear, branched, or cyclic. The amino acid may be natural or non-natural and may be a modified amino acid. The term can also encompass one assembled into a complex of multiple polypeptide chains. The term also encompasses natural or artificially modified amino acid polymers. Such modifications include, for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation or any other manipulation or modification (eg, conjugation with a labeling component). This definition also includes, for example, polypeptides containing one or more analogs of amino acids (eg, including unnatural amino acids, etc.), peptide-like compounds (eg, peptoids) and other modifications known in the art. Is included. The gene product of an extracellular matrix protein such as fibronectin usually takes the form of a polypeptide.

  As used herein, “polynucleotide”, “oligonucleotide”, “nucleic acid molecule” and “nucleic acid” are used interchangeably herein and refer to a polymer of nucleotides of any length. The term also includes “derivative oligonucleotide” or “derivative polynucleotide”. A “derivative oligonucleotide” or “derivative polynucleotide” refers to an oligonucleotide or polynucleotide that includes a derivative of a nucleotide or that has an unusual linkage between nucleotides and is used interchangeably. Specific examples of such an oligonucleotide include, for example, 2′-O-methyl-ribonucleotide, a derivative oligonucleotide in which a phosphodiester bond in an oligonucleotide is converted to a phosphorothioate bond, and a phosphodiester bond in an oligonucleotide. Is an N3′-P5 ′ phosphoramidate bond derivative oligonucleotide, a ribose and phosphodiester bond in the oligonucleotide converted to a peptide nucleic acid bond, uracil in the oligonucleotide is C− A derivative oligonucleotide substituted with 5-propynyluracil, a derivative oligonucleotide where uracil in the oligonucleotide is substituted with C-5 thiazole uracil, and cytosine in the oligonucleotide is C-5 propynylcytosine Substituted derivative oligonucleotides, derivative oligonucleotides in which the cytosine in the oligonucleotide is replaced with phenoxazine-modified cytosine, derivative oligonucleotides in which the ribose in the DNA is replaced with 2'-O-propylribose Examples thereof include derivative oligonucleotides in which ribose in the oligonucleotide is substituted with 2′-methoxyethoxyribose. Unless otherwise indicated, a particular nucleic acid sequence may also be conservatively modified (eg, degenerate codon substitutes) and complementary sequences, as well as those explicitly indicated. Is contemplated. Specifically, a degenerate codon substitute creates a sequence in which the third position of one or more selected (or all) codons is replaced with a mixed base and / or deoxyinosine residue. (Batzer et al., Nucleic Acid Res. 19: 5081 (1991); Ohtsuka et al., J. Biol. Chem. 260: 2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8: 91-). 98 (1994)). Genes such as extracellular matrix proteins such as fibronectin usually take this polynucleotide form. The molecule to be transfected is also this polynucleotide.

  In the present specification, the “corresponding” amino acid or nucleic acid has or has the same action as a predetermined amino acid in a reference polypeptide or polynucleotide in a polypeptide molecule or polynucleotide molecule, respectively. In particular, in the case of an enzyme molecule, it means an amino acid that is present at the same position in the active site and contributes to the catalytic activity in the same way. For example, a transcription control sequence of a certain polynucleotide may be a similar part in an ortholog corresponding to a specific part of the transcription control sequence.

  In the present specification, the “corresponding” gene refers to a gene having, or expected to have, the same action as that of a predetermined gene in a species as a reference for comparison in a certain species. When there are a plurality of genes having the same, those having the same origin evolutionarily. Thus, the corresponding gene of a gene can be an ortholog or species homologue of that gene. Therefore, the gene corresponding to the mouse cyclin gene can be found in other animals. Such corresponding genes can be identified using techniques well known in the art. Thus, for example, for a corresponding gene in an animal, the sequence database of that animal (eg, human, rat) is searched using the sequence of the gene that serves as a reference for the corresponding gene (eg, mouse cyclin gene) as a query sequence. Can be found by:

  In the present specification, the “fragment” refers to a polypeptide or polynucleotide having a sequence length of 1 to n−1 with respect to a full-length polypeptide or polynucleotide (length is n). The length of the fragment can be appropriately changed according to the purpose. For example, the lower limit of the length is 3, 4, 5, 6, 7, 8, 9, 10, Examples include 15, 20, 25, 30, 40, 50 and more amino acids, and lengths expressed in integers not specifically listed here (eg, 11 etc.) are also suitable as lower limits. obtain. In the case of polynucleotides, examples include 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100 and more nucleotides. Non-integer lengths (eg, 11 etc.) may also be appropriate as a lower limit. In the present specification, the lengths of polypeptides and polynucleotides can be represented by the number of amino acids or nucleic acids, respectively, as described above. However, the above numbers are not absolute and are limited as long as they have the same function. Alternatively, the above-mentioned number as an adjustment is intended to include a number above and below the number (or, for example, 10% above and below). In order to express such intention, in this specification, “about” may be added before the number. However, it should be understood herein that the presence or absence of “about” does not affect the interpretation of the value.

  As used herein, “biological activity” refers to an activity that a certain factor (eg, polypeptide or protein) may have in vivo, and exhibits various functions (eg, transcription promoting activity). Activity is included. For example, when a certain factor is an antisense molecule, its biological activity includes binding to a nucleic acid molecule of interest, thereby suppressing expression. For example, when a factor is an enzyme, the biological activity includes the enzyme activity. In another example, when an agent is a ligand, the ligand includes binding to the corresponding receptor. When the biological activity is a transcriptional regulatory activity, it refers to an activity that regulates the transcriptional state or its variation. Such biological activity can be measured by techniques well known in the art.

  In the present specification, “polynucleotide hybridizing under stringent conditions” refers to well-known conditions commonly used in the art. Such a polynucleotide can be obtained by using colony hybridization method, plaque hybridization method, Southern blot hybridization method or the like using a polynucleotide selected from among the polynucleotides of the present invention as a probe. Specifically, hybridization was performed at 65 ° C. in the presence of 0.7 to 1.0 M NaCl using a filter on which DNA derived from colonies or plaques was immobilized, and then 0.1 to 2 times the concentration. Means a polynucleotide that can be identified by washing the filter under conditions of 65 ° C. using a SSC (saline-sodium citrate) solution (composition of 1-fold concentration of SSC solution is 150 mM sodium chloride, 15 mM sodium citrate). To do. Hybridization was performed in Molecular Cloning 2nd ed. , Current Protocols in Molecular Biology, Supplements 1-38, DNA Cloning 1: Core Techniques, A Practical Approach, Second Edition, Oxford Universe. Here, the sequence containing only the A sequence or only the T sequence is preferably excluded from the sequences that hybridize under stringent conditions. The “hybridizable polynucleotide” refers to a polynucleotide that can hybridize to another polynucleotide under the above hybridization conditions. Specifically, the hybridizable polynucleotide is a polynucleotide having at least 60% homology with the base sequence of DNA encoding a polypeptide having the amino acid sequence specifically shown in the present invention, preferably 80% The polynucleotide which has the above homology, More preferably, the polynucleotide which has 95% or more of homology can be mentioned.

In this specification, "salt" is used by the same meaning as is normally used in the said field | area, and includes both inorganic salt and organic salt. The salt is usually produced by a neutralization reaction between an acid and a base. In addition to NaCl, K ₂ SO ₄ and the like produced by the neutralization reaction, there are various types of salts such as PbSO ₄ and ZnCl ₂ produced by the reaction between the metal and the acid. Even if it is not produced, it can be regarded as produced from a neutralization reaction between an acid and a base. Examples of the salt include a normal salt (having no acid H or base OH, for example, NaCl, NH ₄ Cl, CH ₃ COONa, Na ₂ CO ₃ ), an acid salt (acid H is converted into a salt). Classification is made into those remaining, for example, NaHCO ₃ , KHSO ₄ , CaHPO ₄ ), basic salts (those in which the base OH remains in the salt, for example, MgCl (OH), CuCl (OH)), etc. Although possible, their classification is not very important in the present invention. Preferred salts include salts that constitute the medium (for example, calcium chloride, sodium hydrogen phosphate, sodium hydrogen carbonate, sodium pyruvate, HEPES, calcium chloride, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids, vitamins, Salts constituting the buffer solution (for example, carium chloride, magnesium chloride, sodium hydrogen phosphate, sodium chloride) are preferable because they have a higher effect of maintaining or improving the affinity for cells. It is preferable to use a plurality of salts because they tend to have a higher affinity for cells, so that the salts contained in the medium than to use NaCl alone. (For example, calcium chloride, magnesium chloride, sodium hydrogen phosphate, chloride It is preferable to use a plurality of thorium), more preferably, in. In another preferred embodiment it may be advantageous to keep the whole salt contained in the medium, it may be added glucose.

  As used herein, the term “probe” refers to a substance to be searched for in biological experiments such as screening in vitro and / or in vivo. For example, a nucleic acid molecule containing a specific base sequence or a specific Examples include, but are not limited to, peptides containing amino acid sequences.

  Examples of nucleic acid molecules that are usually used as probes include those having a nucleic acid sequence of at least 8 consecutive nucleotides that is homologous or complementary to the nucleic acid sequence of the target gene. Such a nucleic acid sequence is preferably at least 9 contiguous nucleotides long, more preferably 10 contiguous nucleotides long, even more preferably 11 contiguous nucleotides long, 12 contiguous nucleotides long, 13 14 contiguous nucleotide lengths, 14 contiguous nucleotide lengths, 15 contiguous nucleotide lengths, 20 contiguous nucleotide lengths, 25 contiguous nucleotide lengths, 30 contiguous nucleotide lengths, 40 contiguous nucleotide lengths It can be a nucleic acid sequence that is 50 contiguous nucleotides in length. Nucleic acid sequences used as probes include nucleic acid sequences that are at least 70% homologous, more preferably at least 80% homologous, more preferably 90% homologous, 95% homologous to the sequences described above. It is.

  In the present specification, “search” refers to finding another nucleobase sequence having a specific function and / or property using a nucleobase sequence electronically or biologically or by other methods. Say. As an electronic search, BLAST (Altschul et al., J. Mol. Biol. 215: 403-410 (1990)), FASTA (Pearson & Lipman, Proc. Natl. Acad. Sci., USA 85: 2444-). 2448 (1988)), the Smith and Waterman method (Smith and Waterman, J. Mol. Biol. 147: 195-197 (1981)), and the Needleman and Wunsch method (Needleman and Wunsch, J. Mol. Biol. 48:44:44). -453 (1970)) and the like. Biological searches include stringent hybridization, macroarrays with genomic DNA affixed to nylon membranes, microarrays affixed to glass plates (microarray assays), PCR, and in situ hybridization. It is not limited to.

  In the present specification, the “primer” refers to a substance necessary for initiation of a reaction of a polymer compound to be synthesized in a polymer synthase reaction. In the synthesis reaction of a nucleic acid molecule, a nucleic acid molecule (for example, DNA or RNA) complementary to a partial sequence of a polymer compound to be synthesized can be used.

  Examples of nucleic acid molecules that are usually used as primers include those having a nucleic acid sequence of at least 8 consecutive nucleotides that is complementary to the nucleic acid sequence of the target gene. Such a nucleic acid sequence is preferably at least 9 contiguous nucleotides long, more preferably 10 contiguous nucleotides long, even more preferably 11 contiguous nucleotides long, 12 contiguous nucleotides long, 13 19 contiguous nucleotide lengths, 14 contiguous nucleotide lengths, 15 contiguous nucleotide lengths, 16 contiguous nucleotide lengths, 17 contiguous nucleotide lengths, 18 contiguous nucleotide lengths, 19 contiguous lengths It can be a nucleic acid sequence of nucleotide length, 20 contiguous nucleotide lengths, 25 contiguous nucleotide lengths, 30 contiguous nucleotide lengths, 40 contiguous nucleotide lengths, 50 contiguous nucleotide lengths. Nucleic acid sequences used as probes include nucleic acid sequences that are at least 70% homologous, more preferably at least 80% homologous, more preferably 90% homologous, 95% homologous to the sequences described above. It is. A sequence suitable as a primer may vary depending on the nature of the sequence intended for synthesis (amplification), but those skilled in the art can appropriately design a primer according to the intended sequence. Such primer design is well known in the art, and may be performed manually or using a computer program (eg, LASERGENE, PrimerSelect, DNAStar).

  As used herein, “epitope” refers to an antigenic determinant with a clear structure. Thus, an epitope is required for a set of amino acid residues involved in recognition by a particular immunoglobulin, or in the case of T cells, for recognition by T cell receptor proteins and / or major histocompatibility complex (MHC) receptors. A set of amino acid residues is included. This term is also used interchangeably with “antigenic determinant” or “antigenic determinant site”. In the immune system field, in vivo or in vitro, an epitope is a molecular feature (eg, primary peptide structure, secondary peptide structure or tertiary peptide structure and charge) and is recognized by an immunoglobulin, T cell receptor or HLA molecule. Form a site. An epitope comprising a peptide can comprise more than two amino acids in a spatial conformation unique to the epitope. In general, an epitope consists of at least 5 such amino acids, typically consisting of at least 6, 7, 8, 9, or 10 such amino acids. Longer epitope lengths are generally preferred because they are more similar to the antigenicity of the original peptide, but may not necessarily be so when considering conformation. Methods for determining the spatial conformation of amino acids are known in the art and include, for example, X-ray crystallography and two-dimensional nuclear magnetic resonance spectroscopy. Furthermore, identification of epitopes in a given protein is readily accomplished using techniques well known in the art. See, for example, Geysen et al. (1984) Proc. Natl. Acad. Sci. USA 81: 3998 (a general method for rapidly synthesizing peptides to determine the location of immunogenic epitopes in a given antigen); US Pat. No. 4,708,871 (identifying epitopes of antigens, and See Procedure for Chemical Synthesis); and Geysen et al. (1986) Molecular Immunology 23: 709 (a technique for identifying peptides with high affinity for a given antibody). Antibodies that recognize the same epitope can be identified in a simple immunoassay. Thus, methods for determining epitopes comprising peptides are well known in the art, and once such epitopes are provided with the primary sequence of a nucleic acid or amino acid, one skilled in the art will use such well known techniques. Can be determined.

  Thus, for use as an epitope comprising a peptide, a sequence of at least 3 amino acids in length is required, preferably this sequence is at least 4 amino acids, more preferably 5 amino acids, 6 amino acids, 7 amino acids, 8 A sequence of amino acids 9 amino acids 10 amino acids 15 amino acids 20 amino acids 25 amino acids long may be required.

  As used herein, a “factor that specifically binds to a nucleic acid molecule or polypeptide” means that the binding level of the factor to the nucleic acid molecule or polypeptide is to a nucleic acid molecule or polypeptide other than the nucleic acid molecule or polypeptide. A factor that is equal to or higher than the binding level of the factor. As such factors, for example, when the target is a nucleic acid molecule, a nucleic acid molecule having a sequence complementary to the target nucleic acid molecule, a polypeptide that binds to the target nucleic acid sequence (for example, a transcription factor) When the target is a polypeptide, examples include, but are not limited to, antibodies, single-chain antibodies, receptor-ligand pairs, enzyme-substrates, and the like.

  As used herein, an “antibody” is a polyclonal antibody, monoclonal antibody, human antibody, humanized antibody, multispecific antibody, chimeric antibody, and anti-idiotype antibody, and fragments thereof such as F (ab ′) 2 And Fab fragments, as well as other recombinantly produced conjugates. In addition, such antibodies may be covalently linked or recombinantly fused to enzymes such as alkaline phosphatase, horseradish peroxidase, alpha galactosidase, and the like.

  As used herein, “monoclonal antibody” refers to an antibody composition having a homogeneous antibody population. This term is not limited by the manner in which it is made. The term includes whole immunoglobulin molecules as well as Fab molecules, F (ab ') 2 fragments, Fv fragments, and other molecules that exhibit the immunological binding properties of the original monoclonal antibody molecule. Methods for making polyclonal and monoclonal antibodies are known in the art and are described more fully below.

  Monoclonal antibodies are prepared using standard techniques well known in the art (eg, Kohler and Milstein, Nature (1975) 256: 495) or modifications thereof (eg, Buck et al. (1982) In Vitro 18: 377). Is done. Typically, a mouse or rat is immunized with a protein coupled to a protein carrier, boosted, and the spleen (and several large lymph nodes if necessary) is removed and single cells are dissociated. If desired, the spleen cells can be screened by applying a cell suspension to a plate or well coated with antigen after removal of non-specific adherent cells. B cells expressing immunoglobulins specific for the antigen bind to the plate and are not rinsed away with the residue of the suspension. The resulting B cells (ie, all detached spleen cells) are then fused with myeloma cells to obtain a hybridoma, which is used to produce a monoclonal antibody.

  As used herein, “antigen” refers to any substrate that can be specifically bound by an antibody molecule. As used herein, “immunogen” refers to an antigen capable of initiating lymphocyte activation that produces an antigen-specific immune response.

  In certain protein molecules, certain amino acids contained in the sequence can be replaced with other amino acids in the protein structure, such as, for example, the cationic region or the binding site of a substrate molecule, without an apparent reduction or loss of interaction binding capacity. . It is the protein's ability to interact and the nature that defines the biological function of a protein. Thus, specific amino acid substitutions can be made in the amino acid sequence or at the level of its DNA coding sequence, resulting in proteins that still retain their original properties after substitution. Thus, various modifications can be made in the peptide disclosed herein or in the corresponding DNA encoding this peptide without any apparent loss of biological utility.

  In designing such modifications, the hydrophobicity index of amino acids can be considered. The importance of the hydrophobic amino acid index in conferring interactive biological functions in proteins is generally recognized in the art (Kyte. J and Doolittle, RFJ. Mol. Biol. 157 ( 1): 105-132, 1982). The hydrophobic nature of amino acids contributes to the secondary structure of the protein produced and then defines the interaction of the protein with other molecules (eg, enzymes, substrates, receptors, DNA, antibodies, antigens, etc.). Each amino acid is assigned a hydrophobicity index based on their hydrophobicity and charge properties. They are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine / cystine (+2.5); methionine (+1.9); alanine (+1 .8); Glycine (−0.4); Threonine (−0.7); Serine (−0.8); Tryptophan (−0.9); Tyrosine (−1.3); Proline (−1.6) ); Histidine (-3.2); glutamic acid (-3.5); glutamine (-3.5); aspartic acid (-3.5); asparagine (-3.5); lysine (-3.9) And arginine (-4.5)).

  It is well known in the art that one amino acid can be replaced by another amino acid having a similar hydrophobicity index and still result in a protein having a similar biological function (eg, an equivalent protein in enzymatic activity). It is. In such amino acid substitution, the hydrophobicity index is preferably within ± 2, more preferably within ± 1, and even more preferably within ± 0.5. It is understood in the art that such amino acid substitutions based on hydrophobicity are efficient. As described in US Pat. No. 4,554,101, the following hydrophilicity indices have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartic acid (+3. 0 ± 1); glutamic acid (+ 3.0 ± 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (−0.4); proline ( Alanine (−0.5); histidine (−0.5); cysteine (−1.0); methionine (−1.3); valine (−1.5); leucine (−0.5 ± 1); -1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); and tryptophan (-3.4). It is understood that an amino acid can be substituted with another that has a similar hydrophilicity index and can still provide a biological equivalent. In such amino acid substitution, the hydrophilicity index is preferably within ± 2, more preferably within ± 1, and even more preferably within ± 0.5.

(Profile and related technologies)
As used herein, a “profile” for a cell refers to a collection of measurements of the biological state of the cell. In particular, in the case of a cell profile, the profile may be a set or a continuous set of measurement values obtained by quantitatively measuring the level of “cell component”. Cell components include the level of gene expression in biological systems, the transcriptional state (activity level of transcriptional regulatory sequences), the abundance of mRNA encoding a particular gene, and the protein expression level. It is known that the levels of various cellular components such as mRNA and / or protein expression levels encoding genes change in response to drug treatment or perturbation or vibration of other cell biological conditions. ing. Therefore, this profile is increasingly important in cell analysis and detailed analysis, as multiple such “cell component” measurements contain a wealth of information on the effects of stimuli on the biological state of the cell. It has become. In mammalian cells, there are over 30,000 different cellular components. Individual cell profiles are usually complex. The profile of a given state of a biological system is often measured after the biological system has been subjected to a stimulus. Such stimuli include experimental or environmental conditions associated with the biological system, such as exposure of biological systems to drug candidates, introduction of exogenous genes, passage of time, genes from the system. Deletion, or changes in culture conditions. Extensive measurements of cellular components, ie, gene replication or transcription in cells, and the expression of proteins and their response to stimuli, in addition to investigating the cells themselves, comparing and examining the effects of drugs, diagnosing diseases It has broad utility, including patient dosage optimization. They are also useful in basic life science research.

  In the present specification, the term “time-lapse profile” refers to a profile that indicates a change over time of a certain parameter related to a specific cell. Examples of such a temporal profile include, but are not limited to, a temporal profile of a transcriptional state, a temporal profile of an expression state (translation state), a temporal profile of signal transmission, and a temporal profile of a nerve potential. In order to generate a temporal profile, it is necessary to continuously record a certain parameter (for example, a signal due to a label related to the transcription state) and generate the profile. Since measuring over time is measuring continuously, a “time profile” herein may also be referred to as a continuous profile.

  As used herein, “transcription control sequence” refers to a sequence capable of regulating the transcriptional state of a gene. Such a sequence has a length of at least 2 nucleotides. Such sequences typically include, but are not limited to, promoters, enhancers, silencers, terminators, flanking sequences of structural genes in other genomic structures and genomic sequences other than exons, and sequences in exons. Not. The transcription control sequence used in the present invention is not related to a specific type. Rather, information that is important as a transcription control sequence is its variation over time. Such variation is also referred to as a (cell state change) process. Therefore, in the present invention, such a transcription control sequence can be arbitrarily selected. Such transcription control sequences may include those not conventionally used as markers. Preferably, the transcription control sequence has the ability to bind to a transcription factor.

  As used herein, “transcription factor” refers to a factor that regulates the process of gene transcription. The transcription factor mainly refers to a factor that regulates the transcription initiation reaction. Various transcriptional regulatory factors that regulate the frequency of RNA synthesis initiation by binding to basic transcription factors required to place RNA polymerase in the promoter region on DNA and cis-acting elements existing upstream or downstream of the transcriptional region It is divided roughly into.

  Basic transcription factors are prepared according to the type of RNA polymerase, but TATA binding protein is said to be common to all transcription systems. There are various types of transcription factors, but in many cases, the transcription factor is usually composed of a part necessary for DNA binding and a part necessary for transcriptional activation or repression. Factors having a DNA binding site and capable of binding to cis-acting elements are collectively referred to as trans-acting factors.

  The part necessary for transcriptional activation or repression is involved in the interaction with other transcription factors and basic transcription factors, and is thought to play a transcriptional regulation through structural changes of DNA and transcription initiation complex. . Transcriptional regulatory factors are classified into several groups or families based on the structural characteristics of these parts, and many factors have an important role in development or cell differentiation.

  Examples of such transcription factors include STAT1, STAT2, STAT3, GAS, NFAT, Myc, AP1, CREB, NFκB, E2F, Rb, p53, RUNX1, RUNX2, RUNX3, Nkx-2, CF2-II, Skn−. 1, SRY, HFH-2, Oct-1, Oct-3 Sox-5, HNF-3b, PPARγ, and the like, but are not limited thereto.

  In the present specification, the terminator refers to a sequence that is located downstream of a region encoding a protein of a normal gene and is involved in termination of transcription when DNA is transcribed into mRNA and addition of a poly A sequence. It is known that the terminator is involved in the stability of mRNA and affects the expression level of the gene.

  In this specification, “promoter” refers to a region on DNA that determines the transcription start site of a gene and directly regulates its frequency, and is usually a base sequence that initiates transcription upon binding of RNA polymerase. . Therefore, in this specification, a part having a promoter function of a gene is referred to as a “promoter part”. Since the promoter region is usually a region within about 2 kbp upstream of the first exon of the putative protein coding region, if the protein coding region in the genomic nucleotide sequence is predicted using DNA analysis software, The promoter region can be estimated. The putative promoter region varies for each structural gene, but is usually upstream of the structural gene, but is not limited thereto, and may be downstream of the structural gene. Preferably, the putative promoter region is present within about 2 kbp upstream from the first exon translation start. Examples of promoters include, but are not limited to, constitutive promoters, specific promoters and inducible promoters.

  As used herein, “enhancer” refers to a sequence used to increase the expression efficiency of a target gene. Such enhancers are well known in the art. A plurality of enhancers may be used, but one may be used or may not be used.

  As used herein, “silencer” refers to a sequence having a function of suppressing and resting gene expression. In the present invention, any silencer may be used as long as it has the function, and the silencer may not be used.

  As used herein, “operably linked” means under the control of a transcriptional translational regulatory sequence (eg, promoter, enhancer, silencer, etc.) or translational regulatory sequence that has the expression (operation) of a desired sequence. To be placed. In order for a promoter to be operably linked to a gene, the promoter is usually placed immediately upstream of the gene, but need not necessarily be adjacent.

  As used herein, flanking sequences of other structural structural genes and genomic sequences other than exons, and sequences in exons may also be important. For example, flanking sequences of structural genes other than the sequences with the specific names described above are also expected to be related to transcriptional control in terms of “process”. Accordingly, such flanking sequences are also included herein in transcription control sequences. Genomic sequences other than exons and sequences in exons are also well expected to be involved in transcriptional control in terms of “process”. Accordingly, genomic sequences other than exons and sequences in exons are also included herein in the transcriptional control sequences.

  In the present specification, “RNAi” is an abbreviation for RNA interference, and by introducing a factor causing RNAi such as double-stranded RNA (also referred to as dsRNA) into cells, homologous mRNA is specifically degraded, It refers to a phenomenon in which the synthesis of a gene product is suppressed and the technology used for it. As used herein, RNAi can also be used interchangeably with an agent that causes RNAi in some cases.

  As used herein, “factor causing RNAi” refers to any factor capable of causing RNAi. In the present specification, the “factor causing RNAi” with respect to “gene” means that RNAi related to the gene is caused and an effect brought about by RNAi (for example, suppression of expression of the gene) is achieved. Factors that cause such RNAi include, for example, at least 10 nucleotides, including sequences having at least about 70% homology to a portion of the nucleic acid sequence of the target gene or sequences that hybridize under stringent conditions Examples include, but are not limited to, RNAs containing long double-stranded portions or variants thereof. Here, the factor preferably comprises a 3 'overhang, more preferably the 3' overhang can be 2 or more nucleotides long DNA (eg 2 to 4 nucleotides long DNA).

  Without being bound by theory, one of the possible mechanisms for RNAi to work is that when a molecule that causes RNAi, such as dsRNA, is introduced into a cell, helicase is used in the case of relatively long (eg, 40 base pairs or more) RNA. In the presence of ATP, an RNaseIII-like nuclease called Dicer having a domain excises the molecule from the 3 ′ end by about 20 base pairs to produce a short dsRNA (also called siRNA). As used herein, “siRNA” is an abbreviation for short interfering RNA, which is artificially chemically synthesized, biochemically synthesized, synthesized in an organism, or about 40 This refers to a short double-stranded RNA of 10 base pairs or more formed by decomposing a double-stranded RNA of bases or more in the body, and usually has a 5′-phosphate, 3′-OH structure. 'The end protrudes about 2 bases. A protein specific to this siRNA binds to form RISC (RNA-induced-silencing-complex). This complex recognizes and binds to mRNA having the same sequence as siRNA, and cleaves mRNA at the center of siRNA by RNaseIII-like enzyme activity. The relationship between the siRNA sequence and the mRNA sequence cleaved as a target is preferably 100% identical. However, with respect to the base mutation at a position off the center of siRNA, the cleavage activity by RNAi is not completely lost, but a partial activity remains. On the other hand, the mutation of the base at the center of siRNA has a large effect, and the cleavage activity of mRNA by RNAi is extremely reduced. Utilizing such properties, for mRNA having a mutation, only the mRNA containing the mutation can be specifically decomposed by synthesizing siRNA having the mutation in the center and introducing it into the cell. Therefore, in the present invention, siRNA itself can be used as a factor that causes RNAi, and a factor that generates siRNA (for example, a dsRNA typically having about 40 bases or more) can be used as such a factor. .

  Although not wishing to be bound by theory, siRNA is synthesized by dsRNA in addition to the pathway described above, where the antisense strand of siRNA binds to mRNA and acts as a primer for RNA-dependent RNA polymerase (RdRP). It is also contemplated that this dsRNA becomes Dicer's substrate again, generating new siRNA and amplifying the action. Thus, in the present invention, siRNA itself and factors that produce siRNA are also useful. Actually, in insects and the like, for example, 35 dsRNA molecules almost completely degrade the mRNA in a cell having 1,000 copies or more, so it is understood that siRNA itself and factors that generate siRNA are useful. Is done.

  In the present invention, double-stranded RNA having a length of about 20 bases (for example, typically about 21 to 23 bases in length) or less than that called siRNA can be used. Such siRNA can be used for treatment, prevention, prognosis, etc. of a disease because it suppresses gene expression by expressing in a cell and suppresses expression of a pathogenic gene targeted by the siRNA.

  The siRNA used in the present invention may take any form as long as it can cause RNAi.

  In another embodiment, the factor causing RNAi of the present invention may be a short hairpin structure (shRNA; short hairpin RNA) having an overhang at the 3 'end. As used herein, “shRNA” is a single-stranded RNA that includes a partially palindromic base sequence, and thus has a double-stranded structure within the molecule, resulting in a hairpin-like structure. The above molecules. Such shRNA is artificially chemically synthesized. Alternatively, such shRNA can be produced by synthesizing RNA in vitro with T7 RNA polymerase, which has a hairpin structure in which the DNA sequences of the sense strand and antisense strand are ligated in the reverse orientation. Although not wishing to be bound by theory, such shRNAs are approximately 20 bases in length (typically 21 bases, 22 bases, 23 bases, for example) after being introduced into the cell. It should be understood that it is degraded to cause RNAi as well as siRNA and has the therapeutic effect of the present invention. It should be understood that such an effect is exerted in a wide range of organisms such as insects, plants, animals (including mammals). Thus, since shRNA causes RNAi like siRNA, it can be used as an active ingredient of the present invention. The shRNA can also preferably have a 3 'overhang. The length of the double-stranded part is not particularly limited, but may preferably be about 10 nucleotides or more, more preferably about 20 nucleotides or more. Here, the 3 'protruding end may be preferably DNA, more preferably DNA having a length of at least 2 nucleotides, and further preferably DNA having a length of 2 to 4 nucleotides.

  The factor causing RNAi used in the present invention can be either artificially synthesized (for example, chemical or biochemical) or naturally occurring, and the effect of the present invention can be achieved between the two. There is no essential difference. Those chemically synthesized are preferably purified by liquid chromatography or the like.

  The factor that causes RNAi used in the present invention can also be synthesized in vitro. In this synthesis system, antisense and sense RNAs are synthesized from template DNA using T7 RNA polymerase and T7 promoter. When these are annealed in vitro and then introduced into cells, RNAi is caused through the mechanism described above, and the effects of the present invention are achieved. Here, for example, such RNA can be introduced into cells by the calcium phosphate method.

  Factors that cause RNAi of the present invention also include factors such as single strands that can hybridize to mRNA, or all similar nucleic acid analogs thereof. Such factors are also useful in the treatment methods and compositions of the invention.

  As used herein, “time-dependent” refers to associating some action or phenomenon with the passage of time.

  In this specification, “monitor” refers to observing a cell state using at least one parameter (for example, a labeling signal resulting from transcription) as an index. Preferably, the monitoring is performed using a device such as a detection device or a measurement device. More preferably, such equipment is connected to a computer for recording and / or processing data. The monitor can include obtaining image data of a solid support (eg, array, plate, etc.).

  As used herein, “real time” means that a state is displayed in a different form at substantially the same time (eg, as an image on a display or as a data processed graph). In such a case, the real time has a time lag for the time required for data processing, but such a time lag is included in the real time if it can be substantially ignored. Such a time lag is usually within 10 seconds, preferably within 1 second, but is not limited thereto, and depending on the application, it may also be referred to as real time when it exceeds 10 seconds.

  In this specification, the “determination” of the cell state can be performed using various methods. Such methods include, but are not limited to, mathematical processing (eg, signal processing, multivariate analysis, etc.), empirical processing, phase change, and the like.

  In this specification, “difference” refers to a mathematical process in which a certain profile is presented by subtracting the value of a control profile (for example, when there is no stimulus).

  As used herein, “phase” refers to a profile over time, determines whether the profile is increasing or decreasing from a reference point (usually 0), and expressing each as + or − This is the analysis.

  As used herein, “correlation” between a profile (eg, a time-lapse profile) and a cell state refers to associating a certain profile (eg, a time-lapse profile) or specific information on the change thereof with a cell state. Such a relationship is called a correlation. Conventionally, it has been virtually impossible to correlate between a profile (eg, a time-lapse profile) and a cellular state, and such a relationship has not been known, so in the present invention such a correlation. It can be said that it is a special effect.

  As used herein, correlation refers to associating at least one profile (eg, a time-lapse profile) or variation thereof with a change in the state of a cell, tissue, organ or organism (eg, drug resistance), eg, a profile (For example, a temporal profile) or a variation thereof and at least one parameter of the cell state can be quantitatively or qualitatively associated with each other. The number of at least one profile (eg, time profile) used for correlation may be as small as correlation can be performed, usually at least one, preferably at least two, more preferably at least There may be three, but it is not limited to them. In the present invention, it has been found that identifying at least two, preferably at least three, at least one profile (eg, a time-lapse profile) is sufficient to identify almost all cells. Such an effect was unpredictable by the conventional profiling or assay that was seen in the point, and can be said to be an exceptional effect brought about by the present invention for the first time. In such a case, when at least one profile (for example, a time-lapse profile) is associated with a cell state, a mathematical process may be performed using a determinant. In one preferred embodiment, it may be advantageous that the number of at least one profile (eg, time profile) used for correlation is at least eight. This is because by observing the eight types of increase / decrease, it is theoretically possible to correlate 256 types of changes, and the number of about 300 types of cells that are said to constitute a living body can be almost covered. In that sense, at least nine types or at least ten types of such sugar chain structures may be further advantageous.

  Specific methods for correlating include, but are not limited to, methods using signal processing methods (such as wavelets) and multivariate analysis (such as cluster analysis).

  The correlation may be performed in advance, or may be performed using a control for each cell determination.

  As used herein, “foreign factor” refers to a factor (eg, substance, energy, etc.) that is not normally present in the cell when referring to the cell. As used herein, the “factor” may be any substance or other element (for example, energy such as ionizing radiation, radiation, light, and sound waves) as long as the intended purpose can be achieved. Such substances include, for example, proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (eg, DNA such as cDNA, genomic DNA, or RNA such as mRNA, RNAi). ), Polysaccharides, oligosaccharides, lipids, small organic molecules (for example, hormones, ligands, signaling substances, small organic molecules, molecules synthesized by combinatorial chemistry, small molecules that can be used as pharmaceuticals (for example, small molecule ligands, etc.) ))), And the like, but are not limited thereto. One exogenous factor may be used, but a combination of two or more may be used. In the present specification, exogenous factors include temperature change, humidity change, electromagnetic wave, potential difference, visible light, infrared ray, ultraviolet ray, X-ray, chemical substance, pressure, gravity change, gas partial pressure and osmotic pressure. It is not limited. In one preferred embodiment, the exogenous factor can be a biomolecule or a chemical composition.

  As used herein, “biomolecule” refers to a molecule related to a living body. In this specification, “living body” refers to a biological organism, and includes, but is not limited to, animals, plants, fungi, viruses and the like. Therefore, in this specification, a biomolecule includes a molecule extracted from a living body, but is not limited thereto, and any molecule that can affect a living body falls within the definition of a biomolecule. Therefore, molecules synthesized by combinatorial chemistry, and small molecules that can be used as pharmaceuticals (for example, small molecule ligands, etc.) also fall within the definition of biomolecules as long as effects on the living body can be intended. Such biomolecules include proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (eg, DNA such as cDNA, genomic DNA, RNA such as mRNA), polysaccharides. , Oligosaccharides, lipids, small molecules (eg, hormones, ligands, signaling substances, organic small molecules, etc.), complex molecules thereof (glycolipids, glycoproteins, lipoproteins, etc.) and the like. . Biomolecules can also include the cell itself, or a portion of tissue, as long as introduction into the cell is contemplated. Usually, biomolecules can be nucleic acids, proteins, lipids, sugars, proteolipids, lipoproteins, glycoproteins, proteoglycans and the like. Preferably, the biomolecule comprises a nucleic acid (DNA or RNA) or protein. In another preferred embodiment, the biomolecule is a nucleic acid (eg, genomic DNA or cDNA, or DNA synthesized by PCR, etc.). In other preferred embodiments, the biomolecule can be a protein. Preferably, such a biomolecule can be a hormone or a cytokine.

  As used herein, “chemically synthesized product” refers to all substances that can be synthesized using ordinary chemical techniques. Such synthesis techniques are well known in the art, and those skilled in the art can appropriately combine such techniques to produce chemical compounds.

  As used herein, “cytokine” is defined in the same manner as the broadest meaning used in the art, and refers to a physiologically active substance produced from a cell and acting on the same or different cells. Cytokines are generally proteins or polypeptides, and have a suppressive action on the immune response, regulation of the endocrine system, regulation of the nervous system, antitumor action, antiviral action, regulation of cell proliferation, regulation of cell differentiation, etc. . As used herein, cytokines can be in protein or nucleic acid form or other forms, but at the point of action, cytokines usually mean protein forms. As used herein, “growth factor” refers to a substance that promotes or regulates cell growth. Growth factors are also referred to as growth factors or growth factors. Growth factors can be added to the medium in cell or tissue culture to replace the action of serum macromolecules. Many growth factors have been found to function as regulators of the differentiation state in addition to cell growth. Cytokines typically include interleukins, chemokines, hematopoietic factors such as colony stimulating factors, tumor necrosis factors, and interferons. Typically, growth factors include platelet derived growth factor (PDGF), epidermal growth factor (EGF), fibroblast growth factor (FGF), hepatocyte growth factor (HGF), vascular endothelial growth factor (VEGF). Those having a proliferative activity such as

  As used herein, “hormone” is used in the same meaning as the broadest meaning normally used in the art, and refers to an organ that is made of a specific organ or cell of animals and plants and separated from the site where it is produced. It refers to a physiological organic compound that exhibits its specific physiological action. Such hormones include, but are not limited to, growth hormone, sex hormone, thyroid hormone and the like. Such hormones may partially overlap with the above cytokines.

  As used herein, “actin acting substance” refers to a substance having a function of changing the form or state of actin by directly or indirectly interacting with intracellular actin. Examples of such substances include, but are not limited to, extracellular matrix proteins (for example, fibronectin, vitronectin, laminin, etc.). Such actin acting substances include substances identified by the following assays. In this specification, the interaction with actin is evaluated by visualizing actin with an actin staining reagent (Molecular Probes, Texas Red-X phalloidin), etc., and then microscopically observing actin aggregation and cell extension. This is determined by confirming the phenomenon of aggregation, reconstitution and / or improvement of cell spreading rate. These determinations can be made quantitatively or qualitatively. Such actin acting substances are utilized in the present invention to increase the efficiency of transfection. When the actin acting substance used in the present invention is derived from a living body, the origin may be anything, and examples thereof include mammalian species such as human, mouse and cow.

  As used herein, “cell adhesion factor” or “cell adhesion molecule” or “adhesion factor” or “adhesion molecule” are used interchangeably and refer to the proximity of two or more cells (cells). Adhesion) or a molecule that mediates adhesion between a substrate and a cell. Generally, a molecule (cell-cell adhesion molecule) relating to cell-cell adhesion (cell-cell adhesion) and a molecule (cell-substrate adhesion molecule) involved in adhesion between cells and extracellular matrix (cell-substrate adhesion). Divided. In the method of the present invention, any molecule is useful and can be used effectively. Therefore, in the present specification, the cell adhesion molecule includes a protein on the substrate side during cell-substrate adhesion, but in this specification, a protein on the cell side (for example, integrin etc.) is also included. Even so, as long as it mediates cell adhesion, it falls within the concept of cell adhesion molecules or cell adhesion molecules herein.

  Regarding cell-cell adhesion, cadherin, many molecules belonging to the immunoglobulin superfamily (NCAM, L1, ICAM, fasciclin II, III, etc.), selectins, etc. are known, and each binds the cell membrane by a unique molecular reaction. Is also known.

  On the other hand, the main cell adhesion molecule that works for cell-substrate adhesion is integrin, which recognizes and binds various proteins contained in the extracellular matrix. These cell adhesion molecules are all on the cell membrane surface and can be regarded as a kind of receptor (cell adhesion receptor). Thus, such receptors in the cell membrane can also be used in the methods of the invention. Examples of such receptors include, but are not limited to, α integrin, β integrin, CD44, syndecan and aggrecan. As for the technology relating to cell adhesion, other findings other than those described above are also well known, and are described in, for example, extracellular matrix-clinical application-medical review.

  Whether a certain molecule is a cell adhesion molecule is determined by biochemical quantification (SDS-PAG method, labeled collagen method), immunological quantification (enzyme antibody method, fluorescent antibody method, immunohistological examination), PDR method, hybrid It can be determined by determining that it is positive in an assay such as a hybridization method. Examples of such cell adhesion molecules include collagen, integrin, fibronectin, laminin, vitronectin, fibrinogen, immunoglobulin superfamily (eg, CD2, CD4, CD8, ICM1, ICAM2, VCAM1), selectin, cadherin and the like. It is not limited. Many of such cell adhesion molecules transmit an auxiliary signal of cell activation by cell-cell interaction into the cell simultaneously with adhesion to the cell. Whether such auxiliary signals can be transmitted into cells is determined by biochemical quantification (SDS-PAG method, labeled collagen method), immunological quantification (enzyme antibody method, fluorescent antibody method, immunohistochemistry). Examination) It can be determined by determining that it is positive in an assay called PDR method or hybridization method.

  Examples of cell adhesion molecules include cadherin, immunoglobulin superfamily molecules (CD2, LFA-3, ICAM-1, CD2, CD4, CD8, ICM1, ICAM2, VCAM1, etc.); integrin family molecules (LFA-1, Mac -1, gpIIbIIIa, p150, 95, VLA1, VLA2, VLA3, VLA4, VLA5, VLA6, etc.); selectin family molecules (L-selectin, E-selectin, P-selectin, etc.) and the like.

  As used herein, “extracellular matrix protein” refers to a protein that is a protein among “extracellular matrix”. In the present specification, “extracellular matrix” (ECM) is also referred to as “extracellular matrix”, and is used in the same meaning as commonly used in the art, somatic cells (whether epithelial cells or non-epithelial cells) A substance existing between somatic cells). The extracellular matrix is responsible not only for tissue support, but also for the construction of the internal environment necessary for the survival of all somatic cells. The extracellular matrix is generally produced from connective tissue cells, but some are also secreted from the cells themselves that possess a basement membrane, such as epithelial cells and endothelial cells. The fiber component is roughly classified into a fiber component and a matrix filling the space, and the fiber component includes collagen fiber and elastic fiber. The basic component of the substrate is glycosaminoglycan (acid mucopolysaccharide), most of which binds to non-collagenous protein to form a polymer of proteoglycan (acid mucopolysaccharide-protein complex). In addition, laminin of the basement membrane, microfibril around the elastic fiber, fiber, and glycoprotein such as fibronectin on the cell surface are included in the substrate. The basic structure is the same in specially differentiated tissues, for example, hyaline cartilage produces chondrocytes that contain a large amount of proteoglycan, characteristically by chondroblasts, and bone produces bone matrix that causes calcification by osteoblasts. . Accordingly, examples of the extracellular matrix used in the present invention include, but are not limited to, collagen, elastin, proteoglycan, glycosaminoglycan, fibronectin, vitronectin, laminin, elastic fiber, collagen fiber and the like.

  As used herein, the term “receptor” refers to a molecule that is present on a cell or in the nucleus, has a binding ability to an external factor or an intracellular factor, and a signal is transmitted by the binding. The receptor is usually in the form of a protein. The binding partner of a receptor is usually called a ligand.

  As used herein, “agonist” refers to a factor that binds to the receptor of a biologically active substance (for example, a ligand) and exhibits the same (or similar) action as that substance.

  As used herein, the term “antagonist” refers to a factor that acts antagonistically on the binding of a biologically active substance (eg, ligand) to a receptor and does not itself exhibit a physiological effect via the receptor. Antagonists, blockers (blockers), inhibitors (inhibitors) and the like are also encompassed by this antagonist.

(Device / Solid support)
In this specification, “device” refers to a part that can constitute part or all of the apparatus, and is composed of a support (preferably a solid support) and a target substance to be supported on the support. Is done. Such devices include, but are not limited to, chips, arrays, microtiter plates, cell culture plates, petri dishes, films, beads, and the like.

  As used herein, “support” refers to a material that can immobilize a substance such as a biomolecule. Support materials can be either covalently bonded or non-covalently bonded to a substance such as a biomolecule used in the present invention or derivatized to have such characteristics. Any solid material to be obtained is mentioned.

  As such a material for use as a support, any material capable of forming a solid surface can be used, for example, glass, silica, silicon, ceramic, silicon dioxide, plastic, metal (including alloys) ), Natural and synthetic polymers such as, but not limited to, polystyrene, cellulose, chitosan, dextran, and nylon. The support may be formed from a plurality of layers of different materials. For example, an inorganic insulating material such as glass, quartz glass, alumina, sapphire, forsterite, silicon oxide, silicon carbide, or silicon nitride can be used. Polyethylene, ethylene, polypropylene, polyisobutylene, polyethylene terephthalate, unsaturated polyester, fluorine-containing resin, polyvinyl chloride, polyvinylidene chloride, polyvinyl acetate, polyvinyl alcohol, polyvinyl acetal, acrylic resin, polyacrylonitrile, polystyrene, acetal resin, polycarbonate Organic materials such as polyamide, phenol resin, urea resin, epoxy resin, melamine resin, styrene / acrylonitrile copolymer, acrylonitrile butadiene styrene copolymer, silicone resin, polyphenylene oxide, and polysulfone can be used. In the present invention, a membrane used for blotting, such as a nitrocellulose membrane, a nylon membrane, or a PVDF membrane, can also be used. When the material constituting the support is a solid phase, it is particularly referred to herein as “solid support”. In the present specification, it may take the form of a plate, microwell plate, chip, slide glass, film, bead, metal (surface) and the like. The support may be coated or uncoated.

  In the present specification, the “liquid phase” is used in the same meaning as commonly used in the art, and usually refers to a state in a solution.

  In the present specification, the “solid phase” is used in the same meaning as used in the art, and usually refers to a solid state. In this specification, liquid and solid may be collectively referred to as fluid.

  As used herein, “substrate” refers to the material (preferably solid) on which the chips or arrays of the invention are constructed. Therefore, the substrate is included in the concept of a plate. The material of the substrate can be any solid, either covalently or noncovalently, that has the property of binding to the biomolecules used in the present invention or that can be derivatized to have such properties. Materials.

  Such materials for use as plates and substrates can be any material that can form a solid surface, for example, glass, silica, silicon, ceramic, silicon dioxide, plastics, metals (including alloys) Natural and synthetic polymers such as, but not limited to, polystyrene, cellulose, chitosan, dextran, and nylon. The substrate may be formed from a plurality of layers of different materials. For example, inorganic insulating materials such as glass, quartz glass, alumina, sapphire, forsterite, silicon carbide, silicon oxide, and silicon nitride can be used. Polyethylene, ethylene, polypropylene, polyisobutylene, polyethylene terephthalate, unsaturated polyester, fluorine-containing resin, polyvinyl chloride, polyvinylidene chloride, polyvinyl acetate, polyvinyl alcohol, polyvinyl acetal, acrylic resin, polyacrylonitrile, polystyrene, acetal resin Organic materials such as polycarbonate, polyamide, phenol resin, urea resin, epoxy resin, melamine resin, styrene / acrylonitrile copolymer, acrylonitrile butadiene styrene copolymer, silicone resin, polyphenylene oxide, and polysulfone can be used. A preferable material for the substrate varies depending on various parameters such as a measuring instrument, and those skilled in the art can appropriately select an appropriate material from the various materials described above. Glass slides are preferred for transfection arrays. Preferably, such a substrate can be coated.

  As used herein, “coating”, when used on a solid support or substrate, refers to the formation of a film of material on the surface of the solid support or substrate and such a film. The coating is performed for various purposes, for example, improving the quality of the solid support and the substrate (for example, improving the lifetime, improving the environmental resistance such as acid resistance), the substance to be bonded to the solid support or the substrate. In many cases, the purpose is to improve the affinity. Various materials can be used as the material for such coating. In addition to the materials used for the solid phase support and the substrate itself, biological materials such as DNA, RNA, protein, and lipid, polymers ( For example, poly-L-lysine, MAS (available from Matsunami Glass, Kishiwada, Japan), hydrophobic fluororesin), silane (APS (eg, γ-aminopropylsilane)), metal (eg, gold, etc.) are used. Can be, but is not limited to. The selection of such materials is within the skill of the artisan and can be selected on a case-by-case basis using techniques well known in the art. In one preferred embodiment, such coatings are poly-L-lysine, silane (eg, epoxy silane or mercapto silane, APS (γ-aminopropyl silane)), MAS, hydrophobic fluororesin, gold and the like. It may be advantageous to use a simple metal. As such a substance, it is preferable to use a substance that is compatible with a cell or an object including the cell (eg, a living body, an organ, etc.).

  In this specification, “chip” or “microchip” is used interchangeably and refers to a micro integrated circuit that has various functions and is a part of a system. Examples of the chip include, but are not limited to, a DNA chip and a protein chip.

As used herein, the term “array” refers to a substrate having a pattern or pattern in which compositions (eg, DNA, protein, transfection mixture) including one or more (eg, 1000 or more) target substances are arranged and arranged. For example, the chip itself. Among the arrays, those patterned on a small substrate (eg, 10 × 10 mm) are referred to as microarrays. In this specification, microarrays and arrays are used interchangeably. Accordingly, even a pattern that is larger than the above-described substrate may be called a microarray. For example, an array is composed of a set of desired transfection mixtures that are themselves immobilized on a solid surface or membrane. Array preferably comprises at least 10 ^two identical or different antibodies, at least 10 ³ and more preferably, and more preferably at least 10 ^4, even more preferably at least 10 ⁵ a. These antibodies are preferably arranged on a surface of 125 × 80 mm, more preferably 10 × 10 mm. As the format, a microtiter plate of a size such as a 96-well microtiter plate or a 384-well microtiter plate or a size of a slide glass is contemplated. The composition containing the target substance to be immobilized may be one kind or plural kinds. The number of such types can be any number from 1 to the number of spots. For example, a composition containing about 10 types, about 100 types, about 500 types, and about 1000 types of target substances can be immobilized.

Any number of target substances (eg, proteins such as antibodies) can be placed on a solid surface or membrane such as a substrate as described above, but typically 10 ⁸ biomolecules per substrate. Up to 10 ⁷ biomolecules, up to 10 ⁶ biomolecules, up to 10 ⁵ biomolecules, up to 10 ⁴ biomolecules, up to 10 ³ biomolecules, or 10 ² in other embodiments. Individual biomolecules up to one biomolecule can be arranged, but a composition containing a target substance exceeding 10 ⁸ biomolecules may be arranged. In these cases, the size of the substrate is preferably smaller. In particular, the spot size of a composition comprising a target substance (eg, a protein such as an antibody) can be as small as the size of a single biomolecule (this can be on the order of 1-2 nm). The minimum substrate area is determined in some cases by the number of biomolecules on the substrate. In the present invention, a composition containing a target substance intended to be introduced into a cell is usually arrayed and fixed in a spot shape of 0.01 mm to 10 mm by covalent bonding or physical interaction.

  A “spot” of biomolecules can be placed on the array. As used herein, “spot” refers to a certain set of compositions containing a target substance. As used herein, “spotting” refers to producing a spot of a composition containing a target substance on a substrate or plate. Spotting can be done by any method, for example, it can be accomplished by pipetting or the like, or it can be done by automated equipment, such methods are well known in the art.

  As used herein, an “address” refers to a unique location on a substrate and may be distinguishable from other unique locations. The address is suitable for associating with a spot with that address, and can take any shape, with entities at all each address being distinguishable from entities at other addresses (eg, optical). The shape defining the address can be, for example, a circle, an ellipse, a square, a rectangle, or an irregular shape. Therefore, “address” indicates an abstract concept, and “spot” can be used to indicate a specific concept, but in the present specification, if it is not necessary to distinguish between the two, “Spot” may be used interchangeably.

  The size defining each address is, among other things, the size of the substrate, the number of addresses on a particular substrate, the amount of composition containing the target substance and / or available reagents, the size of the microparticles and the array thereof. Depends on the degree of resolution required for any method. The size can range, for example, from 1-2 nm to several centimeters, but can be any size consistent with the application of the array.

  The spatial arrangement and shape defining the address is designed to suit the particular application in which the microarray is used. The addresses can be densely distributed, widely distributed, or subgrouped into a desired pattern appropriate for a particular type of analyte.

  Microarrays are widely reviewed in the genome function research protocol (experimental medicine separate volume, experimental lecture 1 in the post-genomic era), genomic medicine science and future genomic medicine (experimental medicine extra number).

  Since the data obtained from the microarray is enormous, data analysis software for managing the correspondence between clones and spots, data analysis, etc. is important. As such software, software attached to various detection systems can be used (Ermolaeva O et al. (1998) Nat. Genet. 20: 19-23). The database format includes, for example, a format called GATC (Genetic Analysis Technology Consortium) proposed by Affymetrix.

  For microfabrication, see, for example, Campbell, S .; A. (1996). The Science and Engineering of Microelectronic Fabrication, Oxford University Press; Zaut, P. et al. V. (1996). Micromicroarray Fabrication: a Practical Guide to Semiconductor Processing, Semiconductor Services; Madou, M .; J. et al. (1997). Fundamentals of Microfabrication, CRC1 5 Press; Rai-Chudhury, P .; (1997). Handbook of Microlithography, Micromachining, & Microfabrication: Microlithography, etc., which are incorporated by reference in the relevant portions herein.

(detection)
In the cell analysis or determination method of the present invention, various detection methods and detection means can be used as long as information resulting from cells or substances interacting with the cells can be detected. Such detection methods and means include, for example, visual observation, confocal microscopes, readers using laser light sources, surface plasmon resonance (SPR) imaging, electrical signals, methods and means using chemical or biochemical markers But are not limited to these. Examples of such a detection device include, but are not limited to, a fluorescence analyzer, a spectrophotometer, a scintillation counter, a CCD, a luminometer, and the like. Any means capable of detecting biomolecules can be used.

  As used herein, “marker” refers to a biological agent that indicates a level or frequency for a target substance or condition. Examples of such markers include, but are not limited to, nucleic acids encoding genes, gene products, metabolites, receptors, ligands, antibodies and the like.

  Therefore, in this specification, the “marker” related to the cell state includes not only a transcriptional regulatory factor but also an intracellular factor indicating the cell state (eg, a nucleic acid encoding a gene, a gene product (eg, mRNA, protein, post-translation) Modified proteins, etc.), metabolites, receptors, etc.) (eg, ligands, antibodies, complementary nucleic acids, etc.). In the present invention, such markers can be used to generate and analyze a temporal profile. Such markers are preferably capable of interacting with the factor of interest. As used herein, “specificity” for a marker refers to the property of a marker that has a significantly higher degree of interaction with a molecule of interest than a similar molecule. In the present invention, such a marker is present inside the cell, but may be present outside the cell.

In the present specification, the “label” refers to a factor (for example, a substance, energy, electromagnetic wave, etc.) that distinguishes a target molecule or substance from others. Examples of such labeling methods include, but are not limited to, RI (radioisotope) method, fluorescence method, biotin method, chemiluminescence method and the like. When the above-described nucleic acid fragment and the complementary oligonucleotide are labeled by a fluorescence method, fluorescent substances having different fluorescence emission maximum wavelengths are used for labeling. It is preferable that the difference of each fluorescence emission maximum wavelength can be 10 nm or more. Any fluorescent substance can be used as long as it can bind to the base moiety of the nucleic acid, but preferably a cyanine dye (for example, CyDye ^™ series Cy3, Cy5, etc.), rhodamine 6G reagent, N-acetoxy- N2-acetylaminofluorene (AAF), AAIF (iodine derivative of AAF) and the like can be mentioned. Examples of the fluorescent substance having a difference in fluorescence emission maximum wavelength of 10 nm or more include a combination of Cy5 and rhodamine 6G reagent, a combination of Cy3 and fluorescein, a combination of rhodamine 6G reagent and fluorescein, and the like. In the present invention, by using such a label, the target object can be modified so that it can be detected by the detection means used. Such modifications are known in the art, and one of ordinary skill in the art can perform such modifications using methods appropriate to the label and the subject of interest.

  In the present specification, “interaction” includes hydrophobic interaction, hydrophilic interaction, hydrogen bond, van der Waals force, ionic interaction, nonionic interaction, electrostatic interaction and the like. It is not limited to them.

  As used herein, “level of interaction” refers to the degree or frequency of interaction between two substances when referring to the interaction between the two substances (including cells). The level of such interaction can be measured by methods well known in the art. As such a method, for example, the number of cells that actually interact and are in a fixed state is not limited, for example, using an optical microscope, a fluorescence microscope, a phase contrast microscope, etc. By directly staining cells with a typical marker, antibody, fluorescent label, etc. and measuring their intensities, they are counted directly or indirectly (eg, reflected light intensity). These levels can be displayed directly from the marker or indirectly through a label. From the measured value at such a level, for example, the number or frequency of genes that are actually transcribed or expressed in a certain spot can be calculated.

(Presentation and display)
In the present specification, “display” and “presentation” are used interchangeably and embody a profile obtained according to the method of the present invention or information derived therefrom directly or indirectly or in a form of information processing. That means. Such display forms include, but are not limited to, various methods such as graphs, photographs, tables, and animations. Such techniques are described, for example, in METHODS IN CELL BIOLOGY, VOL. 56, ed. 1998, pp: 185-215, A High-Resolution Multimode Digital Microscope System (Sluder & Wolf, Salmon), together with application software for automating and controlling cameras, automatic optical microscopes, cameras, and Z The design of a hardware system including an axis focus device is discussed and can be used in the present invention. Image acquisition by a camera is described in Inoue and Spring, Video Miroscope, 2d. Edition, 1997, which is incorporated herein by reference.

  Real-time display can also be performed using techniques well known in the art. For example, after all images have been acquired and stored in semi-permanent memory, or at substantially the same time as image acquisition, the images can be processed with suitable application software to obtain processed data. For example, the data can be processed by a method for playing back a sequence where the images are not interrupted, displaying the images in real time, or displaying them as a “movie” that shows the illumination light as changes and continuations in the focal plane. it can.

  In another embodiment, the measurement and display application software includes software for setting conditions for applying a normal stimulus or recording conditions for a detection signal. With this measurement and display application, the computer not only has means for stimulating the cells and means for processing the signals detected from the cells, but also optical observation means (SIT cameras and image file devices) and / or The cell culture means can also be controlled.

  On the parameter setting screen, a desired complicated stimulation condition can be set by inputting the stimulation condition using a keyboard, a touch panel, a mouse, or the like. In addition, various conditions such as cell culture temperature and pH can be set using a keyboard, mouse or the like.

  On the display screen, the time-lapse profile detected from the cells or information derived therefrom is displayed in real time or after recording. Further, another recorded profile or information derived therefrom can be displayed superimposed on the microscopic image of the cell. Along with the display of the recorded information, the measurement parameters at the time of recording (stimulation conditions, recording conditions, display conditions, processing conditions, cell conditions, temperature, pH, etc.) can also be displayed in real time. An alarm function may also be provided when the temperature or pH is outside the acceptable range.

  On the data analysis screen, it is possible to set conditions for various mathematical analyzes (for example, Fourier transform, cluster analysis, FFT analysis, coherence analysis, correlation analysis, etc.). A temporary profile display function and a topography display function may also be provided. These analysis results can be displayed superimposed on a microscopic image stored in a recording medium.

(Gene transfer)
As used herein, any technique can be used to introduce a nucleic acid molecule into a cell, including, for example, transformation, transduction, transfection, and the like. Transfection is preferred herein.

  As used herein, “transfection” refers to genetic DNA, plasmid DNA, viral DNA, viral RNA, etc. that are substantially naked (excluding viral particles) or such genetic material suspended in cells. In addition to the solution, it means that the gene is introduced into cells and transfected. Usually, a gene introduced by transfection is transiently expressed in cells, but may be permanently taken up.

  Such a technique for introducing a nucleic acid molecule is well known in the art and commonly used. For example, Ausubel F. et al. A. (1988), Current Protocols in Molecular Biology, Wiley, New York, NY; Sambrook J, et al. (1987) Molecular Cloning: A Laboratory Manual, Third Edition NY, a separate volume of experimental medicine “Gene Transfer & Expression Analysis Experimental Method”, Yodosha, 1997, and the like. Gene transfer can be confirmed using the methods described herein, such as Northern blot analysis and Western blot analysis, or other well known conventional techniques.

In this specification, when referring to genetic manipulation, “vector” or “recombinant vector” refers to a vector for transferring a target polynucleotide sequence to a target cell. Such vectors can be autonomously replicated in host cells such as prokaryotic cells, yeast, animal cells, plant cells, insect cells, individual animals and individual plants, or can be integrated into chromosomes. It contains a promoter at a position suitable for nucleotide transcription. A vector suitable for cloning is called a “cloning vector”. Such cloning vectors usually contain multiple cloning sites that contain multiple restriction enzyme sites. Such restriction enzyme sites and multiple cloning sites are well known in the art, and those skilled in the art can appropriately select according to the purpose according to the literature described in this specification (for example, Sambrook et al., Supra). Can be used. Such technology is
As used herein, the term “expression vector” refers to a nucleic acid sequence containing various regulatory elements in a state capable of operating in a host cell, in addition to a structural gene and a promoter that regulates its expression. Regulatory elements can preferably include terminators, selectable markers such as drug resistance genes, and enhancers.

Examples of “recombinant vectors” for prokaryotic cells include pcDNA3 (+), pBluescript-SK (+/−), pGEM-T, pEF-BOS, pEGFP, pHAT, pUC18, pFT-DEST ^™ 42GATEWAY (Invitrogen), etc. However, it is not limited to these.

  “Recombinant vectors” for animal cells include pcDNAI / Amp, pcDNAI, pCDM8 (all commercially available from Funakoshi), pAGE107 [Japanese Patent Laid-Open No. 3-229 (Invitrogen), pAGE103 [J. Biochem. , 101, 1307 (1987)], pAMo, pAMoA [J. Biol. Chem. , 268, 22782-2787 (1993)], retroviral expression vectors based on mouse stem cell virus (MSCV), pEF-BOS, pEGFP, and the like, but are not limited thereto.

  Recombinant vectors for plant cells include, but are not limited to, pPCVICEn4HPT, pCGN1548, pCGN1549, pBI221, pBI121 and the like.

  Moreover, as a method for introducing a vector, any of the above-described methods for introducing DNA into cells can be used. For example, transfection, transduction, transformation, etc. (for example, calcium phosphate method, liposome method, DEAE dextran method, electroporation method, method using particle gun (gene gun), etc.), lipofection method, spheroplast method (Proc. Natl. Acad. Sci. USA, 84, 1929 (1978)), lithium acetate method (J. Bacteriol., 153, 163 (1983)) and Proc. Natl. Acad. Sci. USA, 75, 1929 (1978)).

In the present specification, the “gene introduction reagent” refers to a reagent used for promoting the introduction efficiency in the gene introduction method. Examples of such gene introduction reagents include, but are not limited to, cationic polymers, cationic lipids, polyamine reagents, polyimine reagents, calcium phosphate, and the like. Specific examples of reagents used during transfection include reagents commercially available from various sources, such as Effectene Transfection Reagent (cat. No. 301425, Qiagen, CA), TransFast ^™ Transfection Reagent ( E2431, Promega, WI), Tfx ^™ -20 Reagent (E2391, Promega, WI), SuperFect Transfection Reagent (301305, Qiagen, CA), PolyFect Transfection Reagent (301105, ReGentE16, AM9E11, Q9, E9, Q9, E9, Q9, E9, Q9, E9, Q9, E9, Q9, E9, Q9, Q9, Q9, Q9, Q9, Q9, Q9, Q9, Q9, Q9, Q9, Q11, Q9, Q9, Q9, Q9, Q9, Q9, Q9, Q9, Q9, Q9, Q9, Q9, Q9, Q9, Q9, Q9, Q9, Q9, Q1, E1 Invitro en corporation, CA), JetPEI (× 4) conc. (101-30, Polyplus-translation, France) and ExGen 500 (R0511, Fermentas Inc., MD) and the like.

  “Detection” or “quantification” of gene expression (eg, mRNA expression, polypeptide expression) can be accomplished using suitable methods, including, for example, mRNA measurement and immunoassay methods. Examples of molecular biological measurement methods include Northern blotting, dot blotting, and PCR. Examples of the immunological measurement method include ELISA method using a microtiter plate, RIA method, fluorescent antibody method, Western blot method, immunohistochemical staining method and the like. Examples of the quantitative method include an ELISA method and an RIA method. Genetic analysis methods using arrays (eg, DNA arrays, protein arrays) can also be used. The DNA array is widely outlined in (edited by Shujunsha, separate volume of cell engineering "DNA microarray and latest PCR method"). For protein arrays, see Nat Genet. 2002 Dec; 32 Suppl: 526-32. Examples of gene expression analysis methods include, but are not limited to, RT-PCR, RACE method, SSCP method, immunoprecipitation method, two-hybrid system, in vitro translation and the like in addition to the above-described techniques. Other analysis methods are described in, for example, Genome Analysis Experimental Method / Yusuke Nakamura Lab Manual, Editing / Yusuke Nakamura Yodosha (2002), etc., all of which are incorporated herein by reference. .

  As used herein, “expression level” refers to the amount of polypeptide or mRNA expressed in a target cell. “Expression level” is determined by any appropriate method including immunological measurement methods using the antibody of the present invention (eg, ELISA method, RIA method, fluorescent antibody method, Western blot method, immunohistochemical staining method, etc.). The protein expression level of the polypeptide to be evaluated, or the mRNA expression level of the polypeptide to be evaluated by an appropriate method including a molecular biological measurement method (eg, Northern blot method, dot blot method, PCR method, etc.) . “Change in expression level” means an increase or decrease in the protein level or mRNA expression level of the polypeptide of the present invention evaluated by any appropriate method including the above immunological measurement method or molecular biological measurement method. Means that.

(screening)
As used herein, “screening” refers to selecting a target such as a target organism or substance having a specific property from a large number of populations by a specific operation / evaluation method. For screening, substances of the invention (eg antibodies), polypeptides or nucleic acid molecules can be used.

  In the present specification, screening using an immune reaction is also referred to as “immunophenotyping”. In this case, antibodies or single chain antibodies can be utilized for immunophenotyping of cell lines and biological subjects. Gene transcripts / translation products may be useful as cell-specific markers or, more particularly, as cell markers that are differentially expressed at various stages of differentiation and / or maturation of a particular cell type. Monoclonal antibodies directed against specific epitopes or combinations of epitopes allow screening of cell populations that express the marker. Various techniques are utilized with monoclonal antibodies to screen cell populations that express the marker. Such techniques include magnetic separation using antibody-coated magnetic beads, “panning” using antibodies attached to a solid matrix (ie, a plate), and flow cytometry. Without limitation (see, eg, US Pat. No. 5,985,660; and Morrison et al., Cell, 96: 737-49 (1999)).

  These techniques allow cell proliferation and / or differentiation as can be found in human umbilical cord blood, or have undergone modification treatment to an undifferentiated state (eg, embryonic stem cells, tissue stem cells, etc. ) Can be utilized to screen for cell populations.

(Diagnosis)
As used herein, “diagnosis” refers to identifying various parameters related to a disease, disorder, or condition in a subject and determining the current state of such a disease, disorder, or condition. By using the methods, devices, and systems of the present invention, glycan structures can be analyzed and correlated with drug resistance levels, and such information should be used to treat diseases, disorders, conditions, and subjects in a subject. Various parameters can be selected such as a formulation or method for treatment or prevention.

  The diagnostic method of the present invention is industrially useful because, in principle, the diagnostic method of the subject can be used from the body of the subject and can be carried out with the hands of medical personnel such as doctors away.

(Treatment)
As used herein, “treatment” refers to preventing the deterioration of a certain disease or disorder, preferably maintaining the current state of a certain disease or disorder, more preferably alleviating a certain disease or disorder, and more preferably reducing a certain disease or disorder. It means to make it.

  In the present specification, the “subject” refers to an organism to which the treatment of the present invention is applied, and is also referred to as a “patient”. The patient or subject may preferably be a human.

  As used herein, “cause” or “etiology” relating to a disease, disorder or condition in a subject refers to factors associated with the disease, disorder or condition (collectively referred to as “lesions” or “ Also referred to as “lesion”), a causative or pathogenic substance (pathogenic factor), a disease factor, a diseased cell, a pathogenic virus, and the like.

  The “disease” targeted by the present invention can be any disease associated with a pathogenic gene. Such diseases include cancer, viral or bacterial infections, allergies, hypertension, hyperlipidemia, diabetes, heart disease, cerebral infarction, dementia, obesity, arteriosclerotic diseases, infertility, neuropsychiatric disorders, Examples include, but are not limited to, cataracts, progeria, and ultraviolet radiation hypersensitivity.

  A “disorder” targeted by the present invention may be any disorder associated with a pathogenic gene.

  Specific examples of such diseases, disorders or conditions include, for example, cardiovascular diseases (anemia (eg, aplastic anemia (particularly severe aplastic anemia), renal anemia, cancerous anemia, secondary anemia) Anemia, refractory anemia, etc.), cancer or tumor (eg, leukemia, multiple myeloma), etc .; nervous system disease (dementia, stroke and its sequelae, brain tumor, spinal cord injury, etc.); immune system disease (T cells) Deficiency, leukemia, etc.); motor organ / skeletal disease (fracture, osteoporosis, joint dislocation, subluxation, sprain, ligament injury, osteoarthritis, osteosarcoma, Ewing sarcoma, osteogenesis dysplasia, osteochondral dysplasia Skin disease (hairiness, melanoma, cutaneous malignant lymphoma, angiosarcoma, histiocytosis, bullous disease, pustulosis, dermatitis, eczema, etc.); endocrine disease (hypothalamic / pituitary disease, Thyroid disease, parathyroid (parathyroid) disease, adrenal gland And medullary diseases, abnormal sugar metabolism, abnormal lipid metabolism, abnormal protein metabolism, abnormal nucleic acid metabolism, inborn error of metabolism (phenylketonuria, galactosemia, homocystinuria, maple syrup urine), abuminemia, Deficiency in ascorbic acid synthesis, hyperbilirubinemia, hyperbilirubinuria, kallikrein deficiency, mast cell deficiency, diabetes insipidus, vasopressin secretion abnormality, mania, Walmann's disease (acid lipase deficiency), mucopolysaccharidosis Type VI); respiratory disease (lung disease (eg, pneumonia, lung cancer), bronchial disease, lung cancer, bronchial cancer); digestive system disease (esophageal disease (eg, esophageal cancer), stomach / duodenum) Disease (eg, stomach cancer, duodenal cancer), small intestine disease / colon disease (eg, colon polyp, colon cancer, rectal cancer), gallbladder Road disease, liver disease (eg cirrhosis, hepatitis (A, B, C, D, E, etc.), fulminant hepatitis, chronic hepatitis, primary liver cancer, alcoholic liver disorder, drug-induced liver Disorder), pancreatic disease (acute pancreatitis, chronic pancreatitis, pancreatic cancer, cystic pancreatic disease), peritoneal / abdominal wall / diaphragm disease (hernia, etc.), Hirschsprung disease, etc .; Urinary system diseases (renal disease (renal failure, primary disease) Glomerular diseases, renal vascular disorders, renal tubular dysfunction, interstitial renal diseases, renal disorders due to systemic diseases, renal cancer, etc.), bladder diseases (cystitis, bladder cancer, etc.)); reproductive system diseases (Male genital diseases (male infertility, benign prostatic hyperplasia, prostate cancer, testicular cancer, etc.), female genital diseases (female infertility, ovarian dysfunction, uterine fibroids, adenomyosis, uterine cancer, endometriosis, Ovarian cancer, chorionic disease, etc.); cardiovascular diseases (heart failure, angina) , Myocardial infarction, arrhythmia, valvular disease, myocardial / pericardial disease, congenital heart disease (eg, atrial septal defect, ventricular septal defect, patent ductus arteriosus, tetralogy of Fallot), arterial disease (eg, arteriosclerosis, Aneurysms), venous diseases (eg, varicose veins), lymphatic vessel diseases (eg, lymphedema), and the like, but are not limited thereto.

  As used herein, “cancer” refers to a malignant tumor that has strong atypia, grows faster than normal cells, can invade surrounding tissues destructively, or can metastasize to a new body site, or such a malignant tumor The state to do. In the present invention, cancer includes, but is not limited to, solid cancer and hematopoietic tumor.

  In the present specification, “solid cancer” refers to cancer having a solid shape, and is a concept confronting hematopoietic tumors such as leukemia. Examples of such solid cancers include breast cancer, liver cancer, stomach cancer, lung cancer, head and neck cancer, cervical cancer, prostate cancer, retinoblastoma, malignant lymphoma, esophageal cancer, brain tumor, Examples include, but are not limited to, bone tumors.

  As used herein, “cancer treatment” includes surgical treatment performed by administration of an anticancer agent (eg, chemotherapeutic agent, radiotherapy, etc.) or surgical removal.

  The chemotherapeutic agents used in the present specification are well known in the art and are described in the anticancer drug manual second edition Shigeru Tsukagoshi et al., Chugai Medical Co .; Pharmalogy; Lippincott Williams & Wilkins, Inc. It is described in. Such chemotherapeutic agents include, for example, the following: 1) alkylating agents (alkylating cell components such as DNA and protein) to show cytotoxicity, such as cyclophosphamide, busulfan, thiotepa, dacarbazine 2) antimetabolite (mainly an agent that inhibits nucleic acid synthesis (for example, pyrimidine antimetabolite such as methotrexate as antifolate, 6-mercaptopurine as antipurine antimetabolite, etc.) 3) DNA topoisomerase inhibitors (eg, camptothecin, etoposide (inhibits topoisomerase I, II, respectively)); 4) tubulin agonists (inhibits microtubule formation and cell division) Vinblastine, vincristine, etc.); ) Platinum compound (shows cytotoxicity due to binding to DNA and protein; cisplatin, carboplatin, etc.); 6) Anticancer antibiotic (binds DNA and inhibits DNA synthesis, RNA synthesis. Adriamycin, dactinomycin, Mitomycin C, bleomycin, etc.); 7) Hormonal agents (adapted to hormone-dependent cancers such as breast cancer, uterine cancer, prostate cancer, etc. Tamoxifen, leuprorelin (LH-RH), etc.); 8) Biologics (Asparagine) Asparaginase effective against requirement hematologic malignancy, interferon showing direct antitumor action and indirect action by immune enhancement, etc.); 9) Immunostimulant (enhance immune response ability and indirectly antitumor) Lentinan, a polysaccharide derived from Shiitake, Vesta, a peptide derived from microorganisms Such as down).

  As used herein, the term “anticancer agent” selectively suppresses the growth of cancer (tumor) cells, and includes both cancer drugs and radiation therapy. Such anticancer agents are well known in the art and are described, for example, in the anticancer agent manual second edition Shigeru Tsukagoshi et al., Chugai Medical Co .; Pharmalogy; Lippincott Williams & Wilkins, Inc. It is described in.

  As used herein, “radiotherapy” refers to treatment of diseases utilizing ionizing radiation or radioactive substances. Typical radiotherapy includes, but is not limited to, X-rays, γ-rays, electron beams, proton beams, heavy particle beams, and neutron capture therapy. For example, heavy particle radiotherapy is preferable. However, heavy ion radiotherapy requires a large device and is not generally used. Radiation therapy is well known in the art, for example, the basics of radiation examination and treatment; radiation treatment and multidisciplinary treatment: Kei Keizen (Shiga Medical University, Radiation): General Gastroenterology Care, Vol. 6, No. 6, Page 79-89, 6-7 (2002.02). Although the drug resistance identified in the present invention is usually envisaged as chemotherapy, radiation therapy falls within the concept of drugs herein since resistance by radiation therapy is also associated with a time-course profile.

  As used herein, “pharmaceutically acceptable carrier” refers to a substance that is used when producing agricultural chemicals such as pharmaceuticals or animal drugs, and does not adversely affect active ingredients. Such pharmaceutically acceptable carriers include, for example, but are not limited to: antioxidants, preservatives, colorants, flavors, and diluents, emulsifiers, suspending agents, solvents , Fillers, bulking agents, buffering agents, delivery vehicles, excipients, agricultural or pharmaceutical adjuvants and the like.

  The type and amount of the drug used in the treatment method of the present invention is determined based on the information obtained by the method of the present invention (for example, information related to the drug resistance level) ), And can be easily determined by those skilled in the art with reference to the patient's age, weight, sex, medical history, cell morphology or type, and the like. The frequency with which the treatment method of the present invention is applied to a subject (or patient) also depends on the purpose of use, target disease (type, severity, etc.), patient age, weight, sex, medical history, treatment course, etc. In view of this, it can be easily determined by those skilled in the art. Examples of the frequency include administration every day to once every several months (for example, once a week to once a month). It is preferable to administer once a week to once a month while observing the course.

  In the present specification, the “instruction” describes the tailor-made treatment method of the present invention and the like for a person who performs administration such as a doctor or a patient. This instruction describes when to administer the medicament of the present invention (for example, immediately after radiotherapy or immediately before (for example, within 24 hours)). This instruction is prepared in accordance with the format prescribed by the national supervisory authority (for example, the Ministry of Health, Labor and Welfare in Japan and the Food and Drug Administration (FDA) in the United States, etc. in the United States) where the present invention is implemented, and is approved by the supervisory authority. It is clearly stated that it has been received. The instruction is a so-called package insert and is usually provided as a paper medium, but is not limited thereto. For example, a form such as an electronic medium (for example, a homepage or e-mail provided on the Internet) is used. But it can be provided.

  If desired, more than one drug may be used in the treatment of the present invention. When two or more drugs are used, substances with similar properties or origins may be used, or drugs with different properties or origins may be used. Information regarding drug resistance levels for methods of administering such two or more drugs can also be obtained by the methods of the present invention.

  In the present invention, gene therapy can also be performed based on the obtained information on drug resistance. Gene therapy refers to treatment performed by administration of a nucleic acid that is expressed or expressible to a subject. In this embodiment of the invention, the nucleic acids produce their encoded protein, which mediates a therapeutic effect.

  In the present invention, once an analysis result of a specific time-lapse profile and a cell state are correlated with an organism of a similar kind (for example, a mouse against a human), the analysis result of the corresponding time-lapse profile and the cell Those skilled in the art will readily understand that the state can be correlated. Such matters are described and supported by, for example, the Animal Culture Cell Manual, edited by Seno et al., Kyoritsu Shuppan, 1993, etc., all of which are incorporated herein by reference.

  The present invention can also be applied to gene therapy based on such specific temporal profiles.

  Any method for gene therapy available in the art can be used in accordance with the present invention. An exemplary method is as follows.

  For a general review of methods of gene therapy, see Goldspiel et al., Clinical Pharmacy 12: 488-505 (1993); Wu and Wu, Biotherapy 3: 87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol. 32: 573-596 (1993); Mulligan, Science 260: 926-932 (1993); and Morgan and Anderson, Ann. Rev. Biochem. 62: 191-217 (1993); May, TIBTECH 11 (5): 155-215 (1993). Commonly known recombinant DNA techniques used in gene therapy are described in Ausubel et al. (Eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); and Kriegler, Gene TransferMand Transfer and ExplorMorL. , Stockton Press, NY (1990).

(Basic technology)
The techniques used herein are within the scope of the invention unless specifically indicated otherwise. These techniques are commonly used in fluidics, microfabrication, organic chemistry, biochemistry, genetic engineering, molecular biology, microbiology, genetics and related fields. Such techniques are well described, for example, in the documents listed below and in references cited elsewhere herein.

  For microfabrication, see, for example, Campbell, S .; A. (1996). The Science and Engineering of Microelectronic Fabrication, Oxford University Press; V. (1996). Micromicroarray Fabrication: a Practical Guide to Semiconductor Processing, Semiconductor Services; Madou, M .; J. et al. (1997). Fundamentals of Microfabrication, CRC1 5 Press; Rai-Chudhury, P .; (1997). Handbook of Microlithography, Micromachining, & Microfabrication: Microlithography, etc., which are relevant herein (or may be wholly) are hereby incorporated by reference.

  Molecular biological techniques, biochemical techniques, and microbiological techniques used in this specification are well known and commonly used in the art, and are described in, for example, Sambrook J. et al. et al. (1989). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor and its 3rd Ed. (2001); Ausubel, F .; M.M. (1987). Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Ausubel, F .; M.M. (1989). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Innis, M .; A. (1990). PCR Protocols: A Guide to Methods and Applications, Academic Press; Ausubel, F .; M.M. (1992). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Ausubel, F .; M.M. (1995). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Innis, M .; A. et al. (1995). PCR Strategies, Academic Press; Ausubel, F .; M.M. (1999). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, and annual updates; Sninsky. J. et al. et al. (1999). PCR Applications: Protocols for Functional Genomics, Academic Press, “Experimental Methods for Gene Transfer & Expression Analysis”, Yodosha, 1997, etc., which are related in this specification (may be all) Is incorporated by reference.

  For DNA synthesis technology and nucleic acid chemistry for producing artificially synthesized genes, see, for example, Gait, M. et al. J. et al. (1985). Oligonucleotide Synthesis: A Practical Approach, IRLPpress; Gait, M .; J. et al. (1990). Oligonucleotide Synthesis: A Practical Approach, IRL Press; Eckstein, F .; (1991). Oligonucleotides and Analogues: A Practical Approac, IRL Press; Adams, R .; L. et al. (1992). The Biochemistry of the Nucleic Acids, Chapman &Hall; Shabarova, Z. et al. et al. (1994). Advanced Organic Chemistry of Nucleic Acids, Weinheim; Blackburn, G .; M.M. et al. (1996). Nucleic Acids in Chemistry and Biology, Oxford University Press; Hermanson, G .; T.A. (I996). Bioconjugate Technologies, Academic Press, etc., which are incorporated herein by reference in the relevant part.

(Analysis of simultaneous gene regulation)
As the mathematical processing used in the present specification, for example, well-known techniques described in mathematics for life system analysis, Corona Corp., Yuki Shimizu (1999) and the like can be applied. Below, typical analysis methods will be described.

  In one embodiment, such mathematical processing can be regression analysis. Examples of the regression analysis include, but are not limited to, linear regression (including single regression analysis, multiple regression analysis, and robust estimation), and nonlinear estimation.

In the single regression analysis, n sets of data (x ₁ , y ₁ ) to (x _n , y _n )
fitted to y _i = ax _i + b + e _i (i = 1, 2... n), a and b are model parameters, and e _i represents deviation or error from a straight line. The parameters a and b are typically determined so that the average value of the sum of squares of the distance between the data point and the straight line is minimized. The analysis of determining a and b is usually done. In such a case, partial differentiation is performed to form simultaneous linear equations, and these equations are solved for a and b so as to minimize the square error. Such a value is called a least square estimated value.

  Next, a regression line is obtained based on the value obtained by subtracting the average value from each data.

AS _i X _i + B = SY _i
Assuming a regression line expressed as Assuming B = 0, average values (x _ave and y _ave ) are obtained from (x _i , y _i ) (i = 1, 2,... N), and the variance s _xx and x, y of x The covariance s _xy of The above regression line can be obtained by the following equation.

y−y _ave = (s _xy / s _xx ) ( _{xx ave} ).

The correlation coefficient r _xy is expressed by r _xy = s _xy / √ (s _xy s _yy ).
In this case, since there is a relationship of Se _i ² / n = s _yy (1−r _xy ² ), the closer to | r _xy |, the smaller the error and the better the data can be represented by the regression line. . Where.

The multiple regression analysis method used in another embodiment considers y to be a function of two or more variables rather than one independent variable, for example,
y = a ₀ + a ₁ x ₁ + a ₂ x ₂ +. . . + A _n x _n
It is expressed by an expression such as

This is called a multiple regression equation. Here, a _{0 and the} like are called (bias) regression coefficients. In the multiple regression analysis method, weighted least square estimation is obtained by applying a least square method and solving a normal equation. Here, it is possible to perform the same evaluation as in the single regression analysis.

  In another embodiment, a robust estimation method is used. The least square method is based on the premise that there is no bias in measured values, the measurement error is normally distributed, and the model has no approximation error. However, in the actual case, there may be a measurement error. In the robust estimation method, unreliable data is detected as an outlier from the majority of reliable data, or is subjected to statistical processing. Such a robust estimation method may also be utilized in the present invention.

  Non-linear estimation methods can also be used herein. In such a nonlinear estimation method, a solution can be obtained by representing a nonlinear model as a vector equation.

  In addition to this, there are principal component analysis methods as mathematical processing used in the present invention, which utilize principal component analysis of two-dimensional data, principal component analysis of multidimensional data, singular value decomposition, and generalized inverse matrix. Alternatively, canonical correlation analysis methods, factor analysis methods, discriminant analysis methods, cluster analysis methods, and the like can be used.

(Gene set classification by cluster analysis)
For many applications, it may be desirable to find a set of reference transcription control sequences that are jointly controlled over a wide range of conditions. Embodiments for identifying such a set of reference transcriptional control sequences include clustering algorithms (for review of clustering algorithms, see, eg, Funkunaga, 1990, Statistical Pattern Recognition, 2nd ed., Academic Press, San Diego; Anderberg, 1973, Cluster Analysis for Applications, Academic Press: New York; Everit, 1974, Cluster Analysis, London: Heinemann Educ. al, 1973, Numerical Taxonomy, see Freeman).

  A transcription control sequence set can also be defined based on a transcription control mechanism. Transcriptional control sequences having transcription factor binding sites of the same or similar sequence in the regulatory region are likely to be co-regulated. In one preferred embodiment, the regulatory regions of the transcriptional regulatory sequence of interest can be compared using multiple alignment analysis to decipher possible covalent transcription factor binding sites (Stormo and Hartzell, 1989, Identifying protein binding sites). from unaligned DNA fragments, Proc Natl Acad Sci 86: 1183-1187; Zing gaps, Proc of 3rd Intl Conf on Bioinformatics and Genome Research, Edited by Lim and Cantor, World Scientific Publishing Co., Ltd. 201, Singapore.

It may be desirable to obtain a set of basic transcription control sequences that are co-regulated over a variety of conditions. As a result, the method of the present invention functions sufficiently and efficiently in the determination based on the profile. Preferred embodiments for identifying such a basic transcription control sequence set include clustering algorithms. In an embodiment using cluster analysis, the transcriptional status of multiple transcription control sequences while subjecting biological subjects to various stimuli. Can be monitored. A table of data including measurements of the transcriptional state of transcription control sequences is used for cluster analysis. In order to obtain a basic transcription control sequence set comprising transcriptional control sequences that change simultaneously over various conditions, usually at least 2, preferably at least 3, more preferably at least 10, more preferably more than 50, most preferably 100 Use more than a stimulus or condition. Cluster analysis is performed on a table of data having m × k dimensions, where m is the total number of conditions or stimuli and k is the number of transcription control sequences to be measured.

  Many clustering algorithms are useful for clustering analysis. Clustering algorithms use differences or distances between objects for cluster formation. In some embodiments, the distance used is Euclidean distance in multidimensional space:

(X, y) is the distance between gene X and gene Y (or any other cellular component (eg, transcriptional regulatory sequence) X and Y); X _i and Y _i are Represents gene expression in response to stimulus i. The Euclidean distance can be squared and further weighted with increasing distance. Alternatively, the distance criterion may be, for example, the distance between transcription control sequence X and transcription control sequence Y, or the Manhattan distance, which is:

Given by. Again, X _i and Y _i represent transcriptional regulatory sequence responses or gene expression responses when stimulus i is applied. Some other distance definitions include Chebyshev distance, power distance and mismatch rate. If the dimension data is classified without modification, a mismatch rate defined as I (x, y) = (number of X _i ≠ Y _i ) / i may be utilized in the method of the present invention. Such a method is particularly useful in connection with cellular responses. Another useful distance definition is I = 1−r, where r is the correlation coefficient between response vectors X and Y (eg, normalized dot product X · Y / | X || Y |). Specifically, the inner product X · Y is given by the formula:

And | X | = (X · X) ^1/2 and | Y | = (Y · Y) ^1/2 .

Most preferably, the distance criterion is adapted to a biological issue, eg, to identify cellular components (eg, transcription control sequences, etc.) that are co-variant and / or co-regulated. For example, in a particularly preferred embodiment, the distance is referenced to I = 1−r with a correlation coefficient that includes a weighted dot product of genes X and Y. Specifically, in this preferred embodiment, r _η is the formula shown below:

Defined by Where σ _l ^(X) and σ _l ^(Y) represent the standard error of the measurement of genes X and Y in experiment i.

  The normalization and weighted inner product (correlation coefficient) are values +1 (the two response vectors are completely correlated (ie essentially the same)) and -1 (the two response vectors are not correlated). Or they are constrained between not facing the same direction (that is, facing the opposite direction). These correlation coefficients are particularly preferred for embodiments of the invention that seek a set or cluster of cellular components (eg, transcriptional regulatory sequences, etc.) that have the same indication or response.

  In another embodiment, cellular components (eg, transcriptional regulatory sequences) that co-regulate the same biological response or pathway or are involved in such regulation but contain similar or uncorrelated responses. It is preferred to identify a set or cluster of In such an embodiment, it is preferable to use the absolute value of any of the above-mentioned normalization or weighted dot product, i.e., | r | as the correlation coefficient.

In yet other embodiments, the relationship between cellular components (such as transcriptional regulatory sequences) that are co-regulated and / or co-variant is more complex, and multiple biological pathways (eg, signal transduction pathways) It can involve the same cellular components (eg, transcriptional regulatory sequences) and produce different results. In such embodiments, a co-variant and / or co-regulated cellular component (another transcriptional control sequence as a control that does not participate in the change) can be identified with a correlation coefficient r = r ^{(change )} Is preferably used. The correlation coefficient specified in the following equation (Equation 5) is particularly useful in such embodiments:

Various cluster association laws are useful in the method of the present invention.

  Such methods include, for example, the single association method, the closest point method, etc. These methods measure the distance between two closest objects. Alternatively, a fully associative method that can be used herein measures the maximum distance between two objects in different clusters. This method is particularly useful when genes or other cellular components naturally form distinct “clumps”.

  Alternatively, the average of unweighted pairs is used to define the average distance between all object pairs in two different clusters. This method is also useful for clustering genes or other cellular components that naturally form distinct “aggregations”. Finally, a weighted pair average method is also available. This method is the same as the unweighted pair average method except that the size of each cluster is used as a weight. This method is particularly useful for embodiments where the size of clusters, such as transcriptional regulatory sequences, are suspected to be very variable (Sneath and Sokal, 1973, Numerical taxonomy, San Francisco: WH Freeman & Co.). Other cluster association laws, such as unweighted and weighted pair group centroid and word methods, are also useful in some embodiments of the present invention. For example, Ward, 1963, J.A. Am. Stat Assn. 58: 236; Hartigan, 1975, Clustering algorithms, New York: Wiley.

  In one preferred embodiment, cluster analysis is performed using well-known techniques of hclust (see, for example, the well-known procedure of “hclust” from the program S-Plus, MathSoft, Inc., Cambridge, MA). Can do.

  Even if the diversity of stimuli in the clustered set is increased according to the present invention, when analyzed using the present invention, the cell state can be substantially changed by analyzing at least two, preferably at least three profiles. It was found that it can be evaluated. Stimulation conditions include drug treatment at different concentrations, different measurement times after treatment, response to genetic mutations in various genes, combinations of drug treatment and mutation, and changes in growth conditions (temperature, density, and calcium Concentration).

  As used herein, “significantly different” means that when two statistics are mentioned, the two statistics differ from each other with statistical significance. In an embodiment of the present invention, an objective test can be defined by randomizing a set of experimental data on cellular component responses with the Monte Carlo method.

In one embodiment, an objective test can be defined in the following manner: Let p _ki be the response of component k in experiment i. II Let _{(i) be} a random permutation of the experimental index. Then, for a large number (approximately 100-1000) of different random permutations, _{pkΠ (i)} is established. For each branch and permutation of the original tree: (1) Perform hierarchical clustering using the same algorithm (in this case “hclust”) used for the original unsorted data;
(2) Calculate the fractional improvement f in the total variance with respect to the cluster center when moving from one cluster to two clusters;

Where D _k is the square of the distance criterion (average) of component k with respect to the center of the cluster to which the component belongs. The superscript 1 or 2 indicates the center of all branches or the more preferred center of the two sub-clusters. The distance function D used in this clustering method has a considerable degree of freedom. In these examples, D = 1−r, where r is the phase relationship between the responses of one component across the experimental set to another response (or to the average cluster response). Is a number.

  In particular, preferably statistical statistical tests can be used to determine the statistical reliability of any clustering method or algorithm grouping decision. Preferably, similar tests can be used for both hierarchical and non-hierarchical clustering methods. The compactness of the cluster is, for example, as the mean of the square of the distance of the elements of the cluster from the “mean value of the cluster”, and more preferably as the reciprocal of the mean of the square of the distance of the element from the mean value of the cluster, Defined quantitatively. The cluster average value for a particular cluster is generally defined as the average value of the response vectors of all elements of the cluster. However, in certain embodiments (such as when the definition of the mean value of the cluster is questionable), the distance function of the clustering algorithm (ie, I = 1− | r | ). In general, the definition of the mean value can be problematic in embodiments where the response vector is oriented in the opposite direction and the cluster mean value defined above is zero. Therefore, in such an embodiment, it is preferable to select different definitions of the compactness of the cluster, such as, but not limited to, the mean squared distance between all pairs of elements in the cluster. Alternatively, cluster compactness may be defined to mean the average distance (or more preferably the reciprocal of the average distance) between each element of the cluster (e.g., a cellular component) and other elements of the cluster. it can.

  Other definitions that may also be used in the statistical methods used in the present invention will be apparent to those skilled in the art.

  In another embodiment, the profiles of the present invention can be analyzed using signal processing techniques. In such signal processing techniques, by defining correlation functions, calculating correlation coefficients, defining autocorrelation functions and cross-correlation functions, and calculating these functions so that the sum of weights is 1. The moving average can be obtained.

  In signal processing, it is important to consider the time domain and the frequency domain. Rhythm is often important in natural phenomena, especially in analyzing the dynamic characteristics of life and living organisms. When a certain time function f (t) satisfies the following condition, this function is called a periodic function.

f (t) = f (t + T)
At time 0, the value of the function is f (0), and after taking various values, f (0) is taken again at time T. Such a function is called a periodic function, and as such a function, a sinusoidal wave can be cited again. Here, T is called a period. Here, the function has one cycle in T time. Alternatively, even if it is expressed as 1 / T (cycle / time), which means the number of cycles per unit time, the information is not lost. The concept expressed by the number of cycles per unit time is called frequency. Here, if the frequency is expressed as f,
f = 1 / T
Can be expressed as

  Here, the frequency is the reciprocal of time, and time is handled in the time domain, and frequency is handled in the frequency domain. The frequency can also be expressed in electrical engineering. For example, the period is represented by an angle and corresponds to 360 ° or 2π radians. In such a case, f (cycle / second) is 2πf (radian / second), which is generally expressed as ω (= 2πf) and is called an angular frequency.

  Here, when the sine wave is compared with the cosine wave, the cosine wave is obtained by translating the sine wave by 90 ° or π / 2 radians. Here, the sine wave can be expressed as a time delay of the cosine wave, and this time delay is referred to as a phase. For example, if the phase is 0 in a pure cosine wave, the phase is 90 ° in a sine wave. For example, the sum of a sine wave and a cosine wave increases the amplitude of the generated wave by √2 and the phase becomes π / 4.

  In such analysis, Fourier series and frequency analysis techniques can be used. It is also possible to use Fourier transform, discrete Fourier transform and power spectrum. In the Fourier series expansion, a wavelet transform method or the like can be used. Such techniques are well known in the art and are described in Mathematics for Life System Analysis, Corona, Yuki Shimizu (1999), Wavelet Analysis for Clinical Medicine, Medical Publishing, Yasuhiro Ishikawa.

(Description of Preferred Embodiment)
Hereinafter, the present invention will be described by embodiments. The embodiments described below are for illustrative purposes only, and therefore the scope of the present invention is not limited by the embodiments except the appended claims.

(Presentation of cell status)
In one aspect, the present invention provides a method for presenting a cellular state. Such a method comprises: a) a genetic state (eg, including at least one gene selected from the group of genes derived from the cell (eg, including a transcription control sequence) (eg, including the transcription control sequence) (eg, Gene expression (transcription, translation, etc.)) is monitored over time to obtain a time profile of the cells; and b) the time profile is presented. Here, for example, a function of change can be obtained and displayed by differentiating the profile of the signal intensity obtained as a result of monitoring. In this case, preferably, such a temporal profile can be obtained by taking a difference based on a transcription control sequence assumed to be unchanged, such as a constitutive promoter, but is not limited thereto. As a gene group, it is preferable to use a group containing different transcription control sequences, but it is not limited thereto.

  Any method may be used to display the temporal profile, for example, it may be displayed visually using a display device (for example, time on the x-axis and signal strength on the y-axis), or a numerical value. It may be displayed as a table. Alternatively, the signal intensity can be displayed on the display as the light intensity.

  Preferably, the cells are fixed and monitored on a solid support (eg, array, plate, microtiter plate, etc.). Such immobilization can be performed based on methods known in the art or as described herein.

  In a preferred embodiment, such a time profile can be presented in real time. Here, the real-time display may cause a certain time lag as long as it can be displayed substantially simultaneously. The allowable time lag depends on the required real-time simultaneity, but is, for example, at most 10 seconds, more preferably at most 1 second.

(Determination of cell status)
In another aspect, the present invention provides a method for determining a cell state. Such determination of the cell state monitors changes in the state of a gene (for example, transcriptional regulatory factor) (for example, the state of expression of the gene (for example, transcription, translation, etc.)) that has never been observed in the past. Therefore, the cell state determination method of the present invention makes it possible to determine various states that could not be observed conventionally. Such a method comprises: a) a genetic state (eg, comprising at least one gene selected from the group of genes (eg, comprising a transcription control sequence) derived from the cell (eg, comprising the transcription control sequence) A step of monitoring a gene expression (transcription, translation, etc.) over time to obtain a time profile of the cell; and b) a step of determining the cell state from the time profile of the transcription state. As a gene group, it is preferable to use a group containing different transcription control sequences, but it is not limited thereto.

  Preferably, the cells are monitored while immobilized on a solid support (eg, array, plate, microtiter plate, etc.). Such a fixing method can be performed using a method known in the art or a method described in the present specification.

  In a preferred embodiment, the cell state determination method of the present invention may advantageously further include a step of correlating the time-lapse profile and the cell state before obtaining the time-lapse profile. Alternatively, known information of such correlation information may be provided in advance. Such a correlation process allows correlation information to be stored as a database and used when needed.

  In a preferred embodiment, the transcriptional control sequence can be, but is not limited to, a promoter, enhancer, silencer, flanking sequence of other structural genes in the genome and genomic sequences other than exons. A promoter is preferred. This is because the transfer state can be directly measured.

  In certain embodiments, transcriptional control sequences can be constitutive promoters, specific promoters, inducible promoters, and the like. Here, any promoter can be used, and the present invention is characterized by the ability to use any type of promoter. Since the profile can be analyzed from the viewpoint of “process” by using the method of the present invention, it becomes possible to determine the cell state using any promoter or any set of promoters. It was. Such a determination is impossible with the prior art, and the present invention is highly useful because it has achieved what was not possible with the prior art.

  In preferred embodiments, at least two transcription control sequences are monitored. By observing at least two transcription control sequences, typically 80% of the cellular state can be identified. More preferably, at least three transcription control sequences are monitored. By observing at least three transcription control sequences, it is typically possible to identify at least 90% of the cellular state. In the most preferred embodiment, at least 8 transcription control sequences are monitored. By observing at least eight transcription control sequences, it is usually possible to identify almost all cellular states. Thus, it is expected that almost any cell state can be determined by selecting only a small number as described above and monitoring it, despite selecting any transcriptional control sequence. This is to provide a much simpler, more precise and accurate judgment compared to the conventional judgment method that observes every time point and statistically processes it as a heterogeneous group. Become.

  Therefore, the determination method of the present invention further includes a step of arbitrarily selecting at least one gene (for example, including the transcription control sequence) from the group of genes (for example, including the transcription control sequence) before monitoring. It is preferable to do. One important feature of the present invention is that genes that do not show specificity in point-by-point studies can be used as genes (for example, including specific transcriptional regulatory sequences).

  In a preferred embodiment, such a time profile can be presented in real time. Here, as long as real time can be displayed substantially simultaneously, a certain amount of time lag may occur. The allowable time lag depends on the required real time (simultaneity), but may be, for example, a maximum of 10 seconds, more preferably a maximum of 1 second. For example, in a treatment that requires real-time diagnosis, the time lag may be, for example, 30 seconds at the maximum.

  In a preferred specific embodiment, the state determined by the cell state determination method of the present invention includes, for example, a differentiated state, an undifferentiated state, a cellular response to a foreign factor, a cell cycle, a proliferative state, and the like. More specifically, such states include, for example, the response of cancer cells to anticancer drugs, drug resistance, response to biological time, the differentiation state of stem cells (eg, mesenchymal stem cells, neural stem cells, etc.), Another example is an undifferentiated state of purified stem cells (eg, embryonic stem cells), but is not limited thereto.

  Therefore, in a preferred embodiment, cells determined by the cell state determination method of the present invention include, but are not limited to, stem cells, somatic cells, or a mixture thereof.

  Alternatively, such cells may be adherent cells, suspension cells, tissue forming cells and mixtures thereof.

  In one preferred embodiment, the cell state determination method of the present invention can be performed on cells fixed on a substrate as a solid support. In such cases, the solid support is referred to as a chip, and if the cells are arranged in alignment on the substrate, the substrate is also referred to as an array.

  In a particularly preferred embodiment, in the cell state determination method of the present invention, it is advantageous that the transcriptional control sequence subjected to the determination is operably linked and transfected into the cell of interest. This is because in such a form, the transcriptional state of the transcriptional regulatory factor can be measured as a reporter gene signal.

  Such transfection can be performed on a solid phase or in a liquid phase. Here, a method for increasing the efficiency of introducing a target substance into cells may be used for transfection. The present invention presents a target substance (for example, DNA, RNA, polypeptide, sugar chain, or a complex thereof) that is hardly introduced into a cell under normal conditions together with an actin acting substance such as fibronectin. By utilizing (preferably contacting), the effect that the target substance is efficiently introduced into cells is utilized. Thus, the transfection method comprises, in random order, A) providing a target substance (ie, DNA comprising a transcriptional regulatory sequence); B) providing an actin acting substance (eg, fibronectin); The method further includes a step of bringing the target substance and the actin acting substance into contact with the cells. Here, the target substance and the actin acting substance may be provided together or separately. As the actin acting substance, the form detailed in the composition for increasing the efficiency of introduction of the target substance of the present invention into the cells described above can be applied. Those skilled in the art can implement an appropriate form based on the description in this specification. Therefore, such an actin acting substance can be implemented in a form that is applied in a composition for increasing the efficiency of introduction of the target substance of the present invention into cells. Preferably, the actin acting substance may be an extracellular matrix protein (eg, fibronectin, vitronectin, laminin, etc.) or a variant thereof. More preferably, fibronectin or a variant or fragment thereof can be used.

  In one embodiment, the transcription control sequence used in the present invention has the ability to bind to a transcription factor. Examples of such transcription factors include, but are not limited to, ISRE, RARE, STAT3, GAS, NFAT, MIC, AP1, SRE, GRE, CRE, NFκB, ERE, TRE, E2F, Rb, p53, and the like. . As such a transcription factor, those commercially available from BD Biosciences Clonetech, CA, USA can be used. Here, ISRE is associated with STAT1 / 2 and RARE is associated with retinoic acid. STAT3 is associated with differentiation control and GRE is associated with glucose metabolism. CRE is related to cAMP and TRE is related to thyroid hormone. E2F is associated with the cell cycle and p53 is associated with the G1 checkpoint. Therefore, it is possible to determine the cell state based on such information.

  In a preferred embodiment, the determination step b) in the present invention includes comparing the phases of the time-lapse profiles. The phase can be calculated appropriately by those skilled in the art in consideration of the general method described above in this specification and the method described in the examples.

  In another preferred embodiment, the determination step b) in the present invention includes a step of taking the difference between the time-lapse profile of the cells and the control profile. The calculation of the difference can be appropriately performed by a person skilled in the art in consideration of the general method described above in this specification and the method described in the examples.

  In another preferred embodiment, the determination step b) in the present invention includes a mathematical process selected from the group consisting of signal processing methods and multivariate analysis. Such a mathematical process can be easily performed by those skilled in the art with reference to the description of the present specification.

(Data generation)
In one aspect, the present invention provides a method of generating profile data relating to cellular information. The method comprises the steps of: a) providing and fixing a cell on a support; and b) monitoring a biological factor or collection thereof on or within the cell over time to determine the profile of the cell. Generating data. One important feature of the present invention of this aspect is that the cells are fixed at substantially the same location on the support so that information can be obtained continuously (eg, over time) for the same cells. It is in. This allowed the biological factors of the cells and their aggregates to be monitored over time. Since it became possible to monitor over time, it was possible to obtain cell profiles and construct digital cells. In order to fix the cells to the support, the present invention can use a fixing agent such as a salt in the support. A cell can be fixed to a support by a combination of a salt, a complex of a positively charged substance and a negatively charged substance, and a cell. Any salt can be used, such as calcium chloride, sodium hydrogen phosphate, sodium bicarbonate, sodium pyruvate, HEPES, calcium chloride, sodium chloride, potassium chloride, magnesium sulfide, nitric acid. Iron, amino acids, vitamins, and the like can be used, but are not limited thereto. As a combination of such a positively charged substance and a negatively charged substance, for example, a negatively charged substance selected from the group consisting of DNA, RNA, PNA, polypeptide, chemical compound, and complex thereof And a complex of a positively charged substance selected from the group consisting of a cationic polymer, a cationic lipid, a cationic polyamino acid and a complex thereof, but is not limited thereto. In the present invention, in a preferred embodiment, the biological factor of interest can be a nucleic acid molecule or a molecule derived from the nucleic acid molecule. This is because a nucleic acid molecule often controls genetic information, and cell information can be obtained with respect to such genetic information.

  In another aspect, the present invention provides: a) providing and fixing a cell on a support; and b) monitoring a biological agent or collection thereof on or within the cell over time. Generating data for the cell profile. Such data is data obtained by an unprecedented method and is new. Therefore, the present invention provides a recording medium including such data.

  In another aspect, the present invention relates to a method for generating profile data relating to information of a plurality of cells in the same environment. The method comprises the steps of: a) providing a plurality of cells on a support capable of keeping the same environment; and b) monitoring biological factors or aggregates thereof on or within the cells over time. And generating data of the cell profile. One of the important features of the present invention of this aspect is that profile data relating to information of a plurality of cells in the same environment can be obtained. Techniques that provide such an environment are also within the scope of the present invention. In order to provide the same environment to a plurality of cells, the present invention can use an immobilizing agent such as a salt in the support. A cell can be fixed to a support by a combination of a salt, a complex of a positively charged substance and a negatively charged substance, and a cell. In the present invention, any salt can be used. For example, calcium chloride, sodium hydrogen phosphate, sodium hydrogen carbonate, sodium pyruvate, HEPES, calcium chloride, sodium chloride, potassium chloride, Magnesium sulfide, iron nitrate, amino acids, vitamins and the like can be used, but are not limited thereto. As a combination of such a positively charged substance and a negatively charged substance, for example, a negatively charged substance selected from the group consisting of DNA, RNA, PNA, polypeptide, chemical compound, and complex thereof And a complex of a positively charged substance selected from the group consisting of a cationic polymer, a cationic lipid, a cationic polyamino acid and a complex thereof, but is not limited thereto. In the present invention, in a preferred embodiment, the biological factor of interest can be a nucleic acid molecule or a molecule derived from the nucleic acid molecule. This is because a nucleic acid molecule often controls genetic information, and cell information can be obtained with respect to such genetic information.

  In a preferred embodiment, in the method of the present invention, the target cell is preferably provided with an actin acting substance. The actin acting substance acts on actin in the cell, has an effect that it becomes easy to introduce a foreign factor by deforming the inner skeleton of the cell. The presence of such an actin acting substance makes it possible to examine the effect of the target foreign factor in the cell.

  In one embodiment, the biological factor targeted in the present invention includes at least one factor selected from the group consisting of nucleic acids, proteins, sugar chains, lipids, small molecules, and complex molecules thereof.

  In a preferred embodiment, in the present invention, the target cells are preferably cultured without stimulation for a certain period of time before monitoring. This is to synchronize the target cells. As a period necessary for the synchronization, for example, it may be advantageous to culture for at least 1 day, more preferably at least 2 days, even more preferably at least 3 days, even more preferably at least 5 days. However, as the culture becomes longer, the need to maintain the culture conditions increases. For synchronization, it is preferable that the medium supplied to each cell is the same. Therefore, it is preferable that the culture medium in culture is always the same or at least similarly changed. Therefore, preferably, a means for convection of the medium may be provided and used for this purpose.

  In a more preferred embodiment, the biological agent provided to the cell in the present invention may comprise a nucleic acid molecule encoding a gene. The nucleic acid molecule encoding the gene is preferably transfected into the cell. Preferably, such a biological agent can be provided together with a transfection reagent (gene transfer reagent). More preferably, the nucleic acid molecule encoding the gene can be provided to the cell together with the gene transfer reagent and the actin acting substance. At this time, the cells are preferably provided together with a complex of a salt, a positively charged substance, and a negatively charged substance (here, a nucleic acid molecule and a gene introduction reagent). This allowed the cell and the molecule of interest to be immobilized on the support, and separate biological factors (eg, nucleic acid molecules) to be introduced into the cell without any walls. Since a substantially wall-free state is used, a plurality of cells can be monitored under substantially the same environment. In addition, since different biological factors can be introduced into cells, it is possible to obtain a profile of the cell state affected by such biological factors. Such a profile can be stored as data, and since such data is data made according to a certain standard, it can be reproduced and compared with conventional biology. It can be said that it has an effect that was not obtained by the experimental assay. In addition, once data generated according to such a certain standard is stored, it can be extracted and used for a variety of purposes any number of times. For example, for researchers to perform various analyzes It was also possible to conduct a “virtual experiment” in consideration of the difference between virtually infinite conditions under exactly the same conditions. In addition, because virtual experiments and results are stored in raw form, biological university and graduate students who have traditionally had to spend most of their student life with wet work are truly true. It became possible to receive data analysis education in the sense of. In addition, since the above cell profile data can be easily standardized, it has become possible to conduct research based on data that may be considered to have been conducted under the same conditions all over the world. Such data may be distributed in a standardized form. Such a standardized form is in a form readable by an ordinary computer (for example, one equipped with an OS which can be usually obtained such as Windows (registered trademark), Mac, UNIX (registered trademark), LINUX)). possible. The data generated by the present invention may include generated cell profile data, information on experimental conditions used at the time of generation, information on cells, information on the environment, and the like.

  In a preferred embodiment, the profile targeted by the present invention is that of a gene expression profile, an apoptotic signal profile, a stress signal profile, a molecule (preferably labeled with fluorescence, phosphorescence, radioactive material or a combination thereof). Localization profiles, cell shape changes, promoter profiles, specific drug (eg, antibiotics, ligands, toxins, nutrients, vitamins, hormones, cytokines, etc.) dependent promoter profiles, intermolecular interaction profiles, etc. Can be included. Here, in embodiments where the subject of the invention comprises a profile of a specific drug-dependent promoter, the present invention may preferably further comprise the step of administering the specific drug.

  In preferred embodiments, the present invention may further comprise the step of providing an external stimulus to the cell. Such external stimuli may or may not be biological factors. The exogenous factor can be any factor, including but not limited to substances or other elements (eg, energy such as ionizing radiation, radiation, light, sound waves, etc.).

  In one embodiment, the exogenous factor used in the present invention may comprise RNAi. Since RNAi can examine the suppression of virtually any gene, RNAi for all existing genes can be prepared to examine the effect on that gene. RNAi can be prepared by methods well known in the art.

  In another embodiment. The foreign factor used in the present invention may include a chemical substance that does not exist in the living body. Thus, various information can be collected by providing a cell with a chemical substance that does not exist in the living body. In addition, since the data once collected can be reused, even if it is almost impossible to obtain chemical substances that do not exist in the living body, if the data can be obtained once in the present invention, the availability is reduced. You can continue your research without worrying.

  In one embodiment, an exogenous factor that may be targeted by the present invention may include a ligand for a cellular receptor. By analyzing the ligand, it is possible to investigate various signaling pathways. Thus, in such cases, the profile obtained by the present invention includes a profile of receptor ligand interaction.

  In a preferred embodiment, the profile obtained by the present invention is a cellular morphology, wherein the method of the present invention is selected from the group consisting of gene overexpression, underexpression knockdown, addition of foreign factors and environmental changes. It may further comprise the step of providing the cell with a stimulus that can be performed.

  In a more preferred embodiment, the profile obtained by the present invention comprises an interaction profile between molecules present in the cell. Examples of such interaction profiles between molecules include interactions between molecules that appear in signal transduction pathways, interactions between receptors and ligands, and interactions between transcription factors and transcription factor sequences. But are not limited to these profiles.

  In another preferred embodiment, the profile obtained by the present invention comprises a profile of interaction between molecules present in said cells, wherein the present invention is selected from the group consisting of two-hybrid method, FRET and BRET The method further includes a step of performing observation using a technique. Here, the two-hybrid method detects intermolecular interactions in cells. For details, see Protein-Protein Interactions, A MOLECULAR CLONING MANUAL, Edited by Erica Molemis, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. FRET is a technique for detecting intermolecular and intramolecular resonance energy transfer as a change in fluorescence wavelength. Protein-Protein Interactions, supra, Miyawaki A., et al. Visualization of the spatial and temporal dynamics of intracellular signaling. Dev Cell. 2003 Mar; 4 (3): 295-305. Described in Review. BRET is an intermolecular interaction assay system and is described in BOUT N, The use of resonance energy transfer in high-throughput screening: BRET versus FRET. Trends Pharmacol Sci. 2002 Aug; 23 (8): 351-4.

  In one preferable embodiment, in the present invention, it is preferable that the cells of interest are arranged in an array on a support. In this case, preferably, the plurality of cells of interest in the present invention are arranged with an interval of a maximum of 10 cm, more preferably a maximum of 1 cm, still more preferably a maximum of 1 mm, most preferably a maximum of 0.1 mm. obtain. It is necessary to leave a minimum gap between cells. Such spacing is preferably kept to a level that does not substantially interact.

  In one embodiment, the profile obtained with the present invention may or may not be obtained in real time. Real-time profiles can be advantageous. In situations where simultaneity is important, it is important to obtain such a profile in real time. Alternatively, when the purpose is storage, real-time characteristics are not necessarily required.

  In a further embodiment, the present invention further comprises the step of fixing the cell to a solid support. Here, the fixation of the cells to the solid support is performed together with a salt, a complex, an actin acting substance and the like.

  In one embodiment, the data generated by the present invention may include information regarding the profile. In a preferred embodiment, the data generated by the present invention may include information regarding conditions in the monitor, information regarding cell status, information regarding foreign factors, information regarding the environment, and the like.

  In preferred embodiments, the biological factors monitored in the present invention comprise at least two biological factors, more preferably at least three biological factors, and even more preferably at least eight biological factors. Of biological factors. Alternatively, it is preferable to monitor all biological factors in a particular category (eg, all olfactory receptors, all taste receptors).

  Alternatively, in another preferred embodiment, the present invention may further comprise the step of optionally selecting such biological factors.

  In a preferred embodiment, the cells targeted by the present invention can be selected from the group consisting of stem cells and somatic cells.

  In one embodiment, the support used in the present invention is preferably a solid support. This is because it is easy to fix the cells to such a support. As such a solid support, any substance known in the art can be used as a material. Here, the support may take the form of a base.

  In one embodiment, in the present invention, the biological agent is a nucleic acid, and the cell can be transfected with the nucleic acid. By transfecting with nucleic acids in this way, the effects of the nucleic acids on cells can be collected as data or profiles in real time or in a defined and storable manner. Such a thing was not realizable with the prior art. In preferred embodiments, the transfection can be performed on a solid phase or in a liquid phase. More preferably, the transfection is advantageously performed on a solid phase. This is because data collection and standardization are easier.

  In a preferred embodiment of the present invention, the profile may be processed by a process selected from the group consisting of phase comparison, difference calculation with control profile, signal processing method and multivariate analysis. Data so processed is also within the scope of the present invention.

  In another aspect, the present invention provides a method for presenting profile data related to information on a plurality of cells in the same environment. The method comprises the steps of: a) providing a plurality of cells on a support capable of keeping the same environment; b) monitoring biological factors or aggregates thereof on or within the cells over time. Generating data for the cell profile; and c) presenting the data.

  Here, the support capable of keeping a plurality of cells in the same environment can be carried out as detailed elsewhere in this specification. The step of generating data can also be performed as detailed elsewhere herein. The step of presenting data can also be performed as detailed elsewhere herein. Examples of such data presentation methods include, but are not limited to, methods using various sensory means such as visual, auditory, olfactory, tactile, and taste. Preferably, visual presentation means are used. For example, although a computer display etc. may be illustrated, it is not limited to these.

  Preferably, in the presentation method of the present invention, the presentation can be performed in real time. Alternatively, the stored data may be recalled and presented later. If the presentation is to be made in real time, the data signal can be sent directly to eg a display.

  In another aspect, the present invention provides a method for determining a cell state in the same environment. Wherein the method comprises the steps of: a) providing a plurality of cells on a support capable of maintaining the same environment; b) providing biological factors or aggregates thereof on or within the cells over time. Monitoring to generate profile data of the cells; and c) determining the cell status from the data.

  Here, the support capable of keeping a plurality of cells in the same environment can be carried out as detailed elsewhere in this specification. The step of generating data can also be performed as detailed elsewhere herein. The step of determining the cell state can be performed, for example, by correlating the generated data with information about the cell or comparing it with standard data. In this case, statistical processing may be performed.

  Accordingly, in certain embodiments, the present invention further comprises the step of correlating the profile obtained by the present invention with the cellular state prior to obtaining a time-lapse profile. In order to make the determination smoothly, it is advantageous that the target cells in the present invention include cells whose state is known. This is because it is possible to quickly hold the data by comparing the data of the known cell and the unknown cell because the data regarding the cell whose state is already known can be already held.

  In the determination, preferably, there are at least two types of biological factors of interest. When there are a plurality of such biological factors, the biological factors may be heterogeneous categories (eg, proteins and nucleic acids, etc.) or homogeneous categories.

  Preferably, the present invention further includes the step of optionally selecting a biological agent. No matter what biological agent is chosen and used, the present invention is unimaginable from the prior art because the cellular state can be characterized to some extent and in some cases identified. There is an effect.

  Here, in the determination method of the present invention, the data is preferably generated in real time. This is because determination of an unknown substance or a cell whose state is unknown can be performed in real time by generating data in real time.

  Here, in the determination method of the present invention, examples of the cell state to be targeted include, but are not limited to, a differentiated state, an undifferentiated state, a cell response to a foreign factor, a cell cycle, and a proliferation state.

  The cells targeted in the present invention may be stem cells or somatic cells. The somatic cell may be any cell. A person skilled in the art can appropriately select the cells according to the purpose of using the cells.

  The solid support used in the determination method of the present invention includes a substrate. By using a board, the present invention can automatically make a determination by using the board as part of the computer system. An example of the system configuration is shown in FIG.

  In a preferred embodiment, in the determination method of the present invention, the biological agent is a nucleic acid molecule, and the cell is transfected with the nucleic acid molecule. Any material can be used, but preferably it is preferably transfected on a solid support using a gene transfer reagent, more preferably a salt, an actin acting substance or the like. Transfection may be performed on a solid phase or in a liquid phase, but preferably may be performed on a solid phase.

  In the determination method of the present invention, the target biological factor may be capable of binding to another biological factor. By examining biological factors having such properties, network mechanisms in cells can be elucidated.

  Also in the determination method of the present invention, the determination step may include performing a mathematical process selected from the group consisting of comparison of profile phases, difference collection with a control profile, signal processing method and multivariate analysis. Such processing methods are well known in the art and are described in detail herein.

  In another aspect, the present invention provides a method for correlating a foreign factor with a cellular response to the foreign factor. Wherein the method comprises: a) exposing a plurality of cells to a foreign factor on a support capable of keeping the cells in the same environment; b) a biological factor on or within the cell or Monitoring the aggregate over time to generate profile data for the cells; and c) correlating the foreign factor with the profile. Here, exposure of a cell to a foreign factor is achieved by placing the cell in an environment where the foreign factor is in contact. For example, when a cell is immobilized on a support, exposure is achieved by adding the exogenous factor on the support. Data generation and correlation methods are also well known in the art and can be used alone or in combination. Preferably, statistical processing is performed to generate statistically significant data and information.

  In a preferred embodiment, in the correlation method of the present invention, the cell may be fixed to a support. By being fixed, standardization of data becomes easy and data processing can be made much more efficient.

  In a preferred embodiment, the correlation method of the present invention may further include the step of obtaining a profile for each foreign factor using at least two of the foreign factors. Techniques for obtaining such a profile are fully described herein.

  More preferably, the correlating step may further include a step of classifying the foreign factor corresponding to the profile by classifying at least two profiles. By categorizing, more standardized data processing becomes possible.

  In a preferred embodiment, the profile obtained in the present invention can be presented in real time, but not particularly in real time for the purpose of storing data.

  In a preferred embodiment, the cells used in the present invention can be cultured on an array. Therefore, in such a case, the cells are preferably covered with a medium. As the medium, any medium that is usually used for cells can be used.

  In a preferred embodiment of the invention, monitoring the profile includes obtaining image data from the array. In particular, when the profile is visual information (for example, fluorescence emission due to gene expression), the profile can be obtained by obtaining image data.

  In the correlation method of the present invention, the step of correlating the external factor with the profile may include the step of identifying the phase of the profile. Profile phase discrimination is a feature achieved by the present invention by providing a temporal profile obtained in the same environment.

  The exogenous factor targeted by the present invention is selected from the group consisting of temperature change, humidity change, electromagnetic wave, potential difference, visible ray, infrared ray, ultraviolet ray, X-ray, chemical substance, pressure, gravity change, gas partial pressure and osmotic pressure. obtain. Preferably, the chemical substance may be a biomolecule, a chemical composition or a medium. Examples of such biomolecules include, but are not limited to, nucleic acid molecules, proteins, lipids, sugars, proteolipids, lipoproteins, glycoproteins and proteoglycans. Biomolecules can also be, for example, hormones, cytokines, cell adhesion factors and extracellular matrices. Alternatively, the chemical may be a receptor agonist or antagonist.

  In another aspect, the present invention relates to a method for identifying an unidentified foreign factor given to a cell from a cell profile. The method comprises the steps of: a) exposing a cell to a plurality of known foreign factors on a support capable of maintaining the same environment; b) a biological factor on or within the cell or a collection thereof Monitoring over time to obtain a profile of the cell for each known foreign factor and generating profile data for the cell; c) correlating each of the known foreign factor with each of the profiles D) exposing the cell to an unidentified foreign factor; e) monitoring a biological factor or collection thereof on or within the cell exposed to the foreign factor over time, Obtaining a profile of the cell with respect to an unidentified foreign factor; f) determining a profile corresponding to the profile obtained in the step (e) from the profiles obtained in the step (b); Fine g) yet-external factor identification determines step that the external factor said known which corresponds to the profile it is determined in said step (f); encompasses. Here, exposure of foreign factors, data generation, correlation, exposure of unidentified foreign factors, etc. are detailed elsewhere herein, and those skilled in the art can refer to these descriptions for purposes of Appropriate forms can be selected according to the situation.

  In another aspect, the present invention provides a method for identifying an unidentified foreign factor given to a cell from a cell profile. The method provides a) data on the correlation between a known foreign factor and the profile of the cell corresponding to the known foreign factor for a biological factor on or in the cell or a collection thereof. B) exposing the cell to an unidentified foreign factor; c) monitoring a biological factor or collection thereof on or within the cell to obtain a profile of the cell; d ) Determining a profile corresponding to the profile obtained in step (c) from among the profiles provided in step (a); and e) the unidentified foreign factor is the step ( d) determining that it is the known exogenous factor corresponding to the profile determined in d). Here, methods such as exposure to foreign factors, data generation, correlation, exposure to unidentified foreign factors are detailed elsewhere herein, and those skilled in the art refer to these descriptions. Thus, an appropriate form can be selected as appropriate according to the purpose.

  In another aspect, the present invention provides a method for obtaining a profile related to information of a plurality of cells in the same environment. The method comprises the steps of: a) providing a plurality of cells on a support capable of keeping the same environment; and b) monitoring biological factors or aggregates thereof on or within the cells over time. And obtaining a profile of the cell. Here, methods such as exposure of foreign factors, data generation, correlation, exposure of unidentified foreign factors are detailed elsewhere herein, and those skilled in the art can refer to these descriptions. An appropriate form can be appropriately selected according to the purpose.

  In another aspect, the present invention relates to a recording medium on which data generated by the method for generating cell profile data of the present invention is stored. Data may be stored in any storage format, and any recording medium may be used. Examples of such a recording medium include, but are not limited to, a CD-ROM, a flexible disk, a CD-R, a CD-RW, an MO, a mini disk, a DVD-ROM, a DVD-R, a memory stick, and a hard disk. . The present invention also relates to a transmission medium in which data generated by the method for generating cell profile data of the present invention is stored. Examples of the transmission medium include, but are not limited to, networks such as an intranet and the Internet.

  The recording medium or transmission medium of the present invention is data relating to at least one information fragment selected from the group consisting of information relating to conditions in the monitor, information relating to the profile, information relating to the cell state, and information relating to the biological factor. May further be included. Data regarding such information may be stored in a mutually linked form. Preferably, it may be advantageous that these data are normalized. By being standardized, it becomes possible to put on a certain distribution channel. The link may be linked for each cell, linked for each biological agent, or both.

  In another aspect, the present invention relates to data generated by the method for generating cell profile data of the present invention. Such data is new because it cannot be generated by the prior art.

  In another aspect, the present invention provides a system for generating profile data relating to information of a plurality of cells in the same environment. The system comprises: a) a support capable of keeping a plurality of cells in the same environment; b) a means for monitoring biological factors or aggregates thereof on or within the cells over time; and c) the Means for generating profile data of the cell from a signal obtained from the monitoring means. Supports that can keep cells in the same environment can be implemented by one of ordinary skill in the art using the techniques first provided by the present invention. Such a technique stems from the discovery that the cells can be fixed and arranged without walls. Examples of the monitoring means include a microscope (for example, an optical microscope, a fluorescence microscope, a phase contrast microscope, etc.), an electron microscope, a scanner, a naked eye, an infrared camera, a confocal / non-confocal microscope, a CCD camera, etc. It is not limited to. An example of the configuration of such a system is shown in FIG.

  In the system of the present invention, the system does not need to contain cells from the beginning, but preferably contains a plurality of cells and is fixed to a support. In such a case, the fixation is preferably standardized. In the case of fixation, examples of the distance between cells include, but are not limited to, 1 mm.

  In a preferred embodiment, the support is preferably attached with at least one substance selected from the group consisting of a salt and an actin acting substance. The effect of fixation and / or introduction of intracellular substances is enhanced by the adhesion of the cells to a support to which either or both of the salt and the actin acting substance are attached.

  Monitoring means that can be used in the system of the present invention include any of an optical microscope, a fluorescence microscope, a phase microscope, a reader using a laser light source, surface plasmon resonance (SPR) imaging, an electrical signal, a chemical or biochemical marker. Alternatively, means using a plurality of types, synchrotron radiation, confocal microscope, non-confocal microscope, differential interference microscope, stereomicroscope, video monitor, infrared camera, and the like can be mentioned, but not limited thereto. Preferably, a scanner (for example, a scanner that scans the substrate surface with a white light source or a laser) can be used. The scanner is preferable because it is easy to transmit excitation energy efficiently and divert microscopic techniques to fluorescence. Furthermore, it has the advantage that it can measure without giving a big damage with respect to a cell. An example of the system configuration is shown in FIG.

  In another aspect, the present invention provides a system for presenting a profile relating to information of a plurality of cells in the same environment. The system comprises: a) a support capable of maintaining a plurality of cells in the same environment; b) means for monitoring biological factors or aggregates thereof on or within the cells over time; c) the monitoring Means for generating data of the cell profile from the signal obtained from the means; and d) means for presenting the data. Here, the support, monitoring means, and data generating means can be implemented as described elsewhere herein. The means for presenting data can also utilize means well known in the art. Examples of such data presentation means include, but are not limited to, computer displays and speakers. An example of the system configuration is shown in FIG.

  The presentation system of the present invention further includes a plurality of cells, and the plurality of cells are preferably fixed to the support. In such a case, preferably, at least one substance selected from the group consisting of a salt and an actin acting substance is attached to the support. This is because adhesion can be enhanced and / or intracellular introduction of foreign substances can be enhanced by adhering the cells to a support having a salt or an actin acting substance or preferably both.

  The monitoring means may be any type, for example, an optical microscope, a fluorescence microscope, a phase microscope, a reader using a laser light source, surface plasmon resonance (SPR) imaging, an electrical signal, a chemical or biochemical It may be a means using any one or plural kinds of markers.

  The data presentation means may be any type, and examples thereof include a display and a speaker.

  In another aspect, the present invention provides a system for determining a cell state. The system comprises: a) a support capable of maintaining a plurality of cells in the same environment; b) means for monitoring biological factors or aggregates thereof on or within the cells over time; c) the monitoring Means for generating data from the signal obtained from the means; and d) means for extrapolating the cell state from the data. Here, the support, monitoring means and data generating means can be implemented by those skilled in the art as described elsewhere herein. Means for extrapolating the cell state from the data can also be made and used using techniques well known in the art. For example, extrapolation is achieved by comparing measured data with standard data for known cells, and a device storing a program for such extrapolation or a computer capable of executing the same is installed. It can be used as such extrapolation means. An example of the system configuration is shown in FIG.

In another aspect, the present invention provides a system that correlates a foreign factor with a cellular response to the foreign factor. The system comprises: a) a support capable of keeping a plurality of cells in the same environment; b) means for exposing the cells to a foreign factor; c) a biological factor on or in the cell or a collection thereof. Means for monitoring over time; d) generating profile data of the cells from the signal from the monitoring means; and e) means for correlating the foreign factor with the profile;
Is provided. Here, the support, monitoring means, and data generating means can be implemented as described elsewhere herein. Means for exposing cells to a foreign factor can also be appropriately designed and implemented by those skilled in the art depending on the nature of the foreign factor. As the correlation means, a recording medium storing a program for the correlation or a computer capable of executing the recording medium can be used. Preferably, the system of the present invention comprises a plurality of cells. An example of the system configuration is shown in FIG.

  In another aspect, the present invention provides a system for identifying an unidentified foreign factor given to a cell from the cell profile. The system comprises: a) a support capable of keeping a plurality of cells in the same environment; b) a means of exposing a known foreign factor; c) a biological factor on or in the cell or a collection thereof. Means for monitoring over time; d) means for obtaining a profile of the cells for each of the foreign factors and generating profile data for the cells; e) correlating each of the known foreign factors with each of the profiles Means for attaching; f) means for exposing the cells to an unidentified foreign factor; g) comparing the profile of the known foreign factor obtained by said means (d) with the profile of the unknown foreign factor; A means for determining a profile of an unknown foreign factor from a profile of a foreign factor, wherein the determined unidentified foreign factor is the known foreign factor corresponding to the determined profile. That, comprising means. Here, the support, the exposure means, the monitoring means, the data generation means, the correlation means, and the other exposure means are appropriately implemented by those skilled in the art in consideration of the description elsewhere in this specification. be able to. The means for determining the corresponding profile can also be implemented by using a recording medium storing a program that can execute such a determination process and a computer that can execute the program. Preferably, the system of the present invention comprises a plurality of cells. An example of the system configuration is shown in FIG.

  In another aspect, the present invention provides a system for identifying an unidentified foreign factor given to a cell from the cell profile. The system stores data relating to the correlation between a known foreign factor and the cell profile corresponding to the known foreign factor for a) a biological factor on or in the cell or a collection thereof. Recorded medium; b) means for exposing the cells to an unidentified foreign factor; c) a support capable of keeping a plurality of cells in the same environment; d) a biological factor on or in the cells Or means for monitoring the aggregate over time; e) means for obtaining a profile of the cell from the signal obtained from the monitoring means; f) among the profiles stored in the recording medium (a); Means for determining a profile corresponding to the profile obtained for an unknown foreign factor, wherein the unidentified foreign factor is the known foreign factor corresponding to the determined profile That means; comprises. Here, the support, the exposure means, the monitoring means, the data generation means, the correlation means, and the other exposure means are appropriately implemented by those skilled in the art in consideration of the description elsewhere in this specification. be able to. The means for determining the corresponding profile can also be implemented by using a recording medium storing a program that can execute such a determination process and a computer that can execute the program. Preferably, the system of the present invention comprises a plurality of cells. An example of the system configuration is shown in FIG.

  In another aspect, the present invention relates to a support capable of maintaining the same environment of a plurality of cells. Such a support was first provided by the present invention. By using such a support, a plurality of cells can be analyzed in the same environment.

  Preferably, the cells on the support are arranged in an array. This is because standardized analysis is possible. In this case, the support preferably contains a salt or an actin acting substance. More preferably, the support advantageously comprises a complex of a positively charged material and a negatively charged material. This is because the cells can be easily fixed to the support. An actin acting substance is particularly preferable when analyzing the inside because it increases the efficiency of introducing foreign factors into cells. Therefore, in a preferred embodiment of the present invention, the support contains a salt and an actin acting substance, and more preferably contains a complex of a positively charged substance and a negatively charged substance.

  The support of the present invention is characterized in that cells are provided and can be arranged at 1 mm intervals. It has been impossible in the past to present an environment without walls at such intervals. Therefore, the present invention has a surprising effect and practicality.

  In a preferred embodiment, the support of the present invention may further comprise fixed cells. In a more preferred embodiment, the support of the present invention may further comprise an immobilized biological agent.

  In a preferred embodiment, at least two kinds of the biological agent are immobilized on the support. Such biological factors are selected from the group consisting of nucleic acid molecules, proteins, sugars, fats, metabolites, small molecules, complexes thereof, and factors with physical and / or temporal factors. It may be a factor.

  In a more preferred embodiment, cells and biological factors are mixed and fixed to the support of the present invention. Biological factors and cells can now be provided so that they can interact with each other. Although such interactions vary with biological factors, those skilled in the art can understand how to interact and how to interact by looking at their nature.

  In one preferred embodiment, the support of the present invention has a salt, a complex of a positively charged substance and a negatively charged substance, and an actin acting substance fixed together with cells and biological factors. .

  In a more preferred embodiment, the support of the present invention has an array of salts, complexes of positively charged and negatively charged substances, and actin acting substances together with cells and biological factors. Is done. By adopting such a configuration, a cell chip capable of generating cell profile data is provided. The support is configured in such a manner that a salt, a complex of a positively charged substance and a negatively charged substance, and an actin acting substance are immobilized in an array together with cells and biological factors. The support is also referred to as a “transfection array”.

  Here, examples of the salt used in the support of the present invention include calcium chloride, sodium hydrogen phosphate, sodium hydrogen carbonate, sodium pyruvate, HEPES, sodium chloride, potassium chloride, magnesium sulfide, iron nitrate, amino acids, vitamins, and the like. But are not limited thereto. Preferred examples of the salt include, but are not limited to, sodium chloride.

  The gene introduction reagent used in the support of the present invention is a cationic polymer, cationic lipid, polyamine reagent, polyimine reagent, calcium phosphate, oligofectamine; SureFECTOR EM-101-001, UniFECTOR EM-101- 002 and siFECTOR1 EM-101-004 (B-Bridge) and the like. Preferred examples of the gene introduction reagent include Lipofectamine, Oligofectamine, SureFECTOR EM-101-001, UniFECTOR EM-101-002, and siFECTOR1 EM-101-004 (B-Bridge). It is not limited.

  Examples of actin acting substances used in the support of the present invention include, but are not limited to, fibronectin, laminin, and vitronectin. This actin acting substance preferably includes, but is not limited to, fibronectin.

  Nucleic acid molecules used in the support of the present invention include transcription control sequences (eg, promoters, enhancers, etc.), gene coding sequences, genomic sequences including untranslated regions, and nucleic acid sequences not encoded in the host genome (fluorescent proteins Nucleic acid molecules including genes, E. coli / yeast self-replication origins, GAL4 domains, etc.), but are not limited thereto. The nucleic acid molecule preferably includes, but is not limited to, a transcription control sequence (for example, promoter, enhancer, etc.), a gene coding sequence, and a genomic sequence including an untranslated region.

  Cells used in the support of the present invention include, but are not limited to, stem cells, established cell lines, primary cultured cells, insect cells, and bacterial cells. The cells preferably include, but are not limited to, stem cells, established cell lines, and primary cultured cells.

  Examples of the material of the support of the present invention include, but are not limited to, glass, silica, and plastic. This material preferably includes, but is not limited to, the above coated material.

  In another aspect, the present invention provides a method for producing a support comprising a plurality of fixed cells and capable of maintaining the same environment of the cells. The method includes A) providing a support; and B) immobilizing cells on the support using a complex of salt and a positively charged and negatively charged substance. Providing the support can be achieved by obtaining a commercially available product or molding the support material. When it is necessary to prepare the support material, it can be prepared by mixing raw materials of the required material. The fixing step can also be performed using a technique known in the art. Examples of such a fixing technique include, but are not limited to, an inkjet printing method, a pin array method, and a stamp method. Such techniques are well known and can be appropriately implemented by those skilled in the art.

  In a preferred embodiment, the immobilization step in the present invention comprises a complex of the salt, the gene introduction reagent, the actin acting substance as the positively charged substance, and the nucleic acid molecule as the negatively charged substance, and Fixing the mixture with the cells in an array. Such fixation can be achieved using printing techniques.

  In another aspect, the present invention provides an apparatus for producing a support comprising a plurality of fixed cells and capable of maintaining the same environment of the cells. The apparatus comprises A) means for providing a support; and B) means for immobilizing cells on the support using a salt and a complex of positively charged and negatively charged substances. The support can be obtained using means capable of performing the above-described method. Examples of such means include, but are not limited to, a support molding means, a material preparation means (for example, a mixing means), and the like. A technique well known in the art can be used as the molding means. The fixing means includes a printing means, and a commercially available ink jet printer can be used as such means.

(Correlation of foreign factors)
In another aspect, the present invention provides a method for correlating a foreign factor with a cellular response to the foreign factor. In this method, a) exposing the cell to a foreign factor; b) monitoring a transcriptional state associated with at least one transcriptional regulatory factor selected from a group of transcriptional regulatory factors derived from the cell over time, Obtaining a time profile of the cell; and c) correlating the exogenous factor with the time profile.

  The foreign factor used in the present invention is not particularly limited. Such foreign factors are preferably those that can be applied directly or indirectly to the cells. Methods for exposing cells to foreign factors are well known in the art and vary depending on the type of foreign factor. If it is a substance, the cell can be exposed to a foreign gene by dissolving the substance in a solvent and dropping the solution into a medium containing the cell.

  In the correlation method of the present invention, the generation of the temporal profile can be performed as described above.

  In the correlation method of the present invention, the correlation between the external factor and the time-lapse profile can be performed by various methods. Conveniently, the already obtained time-lapse profile when a foreign factor is dropped is patterned, and if the difference from the profile is substantially small, it can be estimated that the foreign factor has been identified.

  Preferably, the cells are monitored while immobilized on a solid support (eg, array, plate, microtiter plate, etc.). Such a fixing method can be performed based on a method known in the art or a method described in the present specification.

  In a preferred embodiment, the correlation method of the present invention may further comprise the step of obtaining a time-course profile for each foreign factor using at least two foreign factors. In certain embodiments, preferably, at least 3, more preferably 4, and even more preferably, at least 10 such exogenous factors may be used, but are not limited thereto.

  In certain embodiments, the correlation methods of the present invention include the step of categorizing foreign factors corresponding to the time profile by categorizing at least two time profiles. Such classification can be easily performed by those skilled in the art with reference to the description of the present specification. By such a categorization, the method of the present invention can be used to achieve correlation and identification of unknown foreign factors.

  In a preferred embodiment, the transcription control sequence used in the present invention may be, but is not limited to, a promoter, an enhancer, a silencer, a flanking sequence of a structural gene in other genome, a genomic sequence other than an exon, and the like. A promoter is preferred. This is because the transfer state can be directly measured.

  In certain embodiments, the transcription control sequences used in the present invention can be constitutive promoters, specific promoters, inducible promoters, and the like. Here, the promoter may be any type, but rather it is a feature of the present invention that the type is not selected. By using the method of the present invention, it became possible to analyze the profile from the viewpoint of “process”, and thus it became possible to determine the cell state using an arbitrary promoter or a set thereof. Such a determination is impossible with the prior art, and the present invention is highly useful in the sense that it has achieved what was not possible with the prior art.

  In preferred embodiments, the transcriptional control sequences monitored are at least two transcriptional control sequences. By observing at least two transcription control sequences, it is usually possible to identify more than 80% of the cellular state. More preferably, the transcriptional control sequence monitored is at least three transcriptional control sequences. By observing at least three transcription control sequences, it is usually possible to identify more than 90% of the cellular state. In a most preferred embodiment, the monitored transcription control sequence comprises at least 8 transcription control sequences. By observing at least eight transcription control sequences, it is usually possible to identify almost all cellular states. Thus, despite the fact that an arbitrary transcription control sequence has been selected, by selecting only a small number as described above and monitoring it, it is possible to determine almost all cell states. Previously, this was not expected, which is much simpler, more precise, and more accurate than conventional methods that were observed at each time point and statistically processed as a heterogeneous population. .

  Therefore, it is preferable that the determination method of the present invention further includes a step of arbitrarily selecting at least one transcription control sequence from the transcription control sequence group before monitoring. One important feature of the present invention is that transcription control sequences that do not show specificity in point-by-point investigations can also be used.

  In a preferred embodiment, such a time profile can be presented in real time. Here, as long as real time can be displayed substantially simultaneously, a certain amount of time lag may occur. The allowed time lag depends on the required real-time simultaneity, but may be for example up to 10 seconds, more preferably up to 1 second. For example, in an environmental measurement that requires real-time external factor identification, the allowable time lag may be, for example, a maximum of 1 second or a maximum of 0.1 second.

  In a preferred embodiment, in the correlation step c) of the present invention, the phase of the temporal profile is used as information of the temporal profile for correlation with an external factor. The phase is displayed in two types of signal intensity in a certain period, plus and minus, and the cells of the present invention can be identified or foreign factors can be identified using such a simplified method. The precision of is demonstrated.

  Preferably, in the method of the invention, the cells are advantageously cultured on the array. This is because many cells can be observed at one time by culturing on the array.

  In a preferred embodiment, monitoring transcription status over time includes obtaining image data from the array. By providing the image data, visual observation is also possible, and it becomes easy to obtain a judgment by the eyes of a human (particularly a person skilled in the art such as a doctor).

  In a preferred embodiment of the present invention, the step of correlating the external factor with the time profile can include identifying the phase of the time profile. As described above, the phase is a simple parameter, and the information processing is simple. Therefore, the cells can be sufficiently identified by the simple information processing.

  In a preferred embodiment, external factors to be identified in the method of the present invention include temperature change, humidity change, electromagnetic wave, potential difference, visible light, infrared ray, ultraviolet ray, X-ray, chemical substance, pressure, gravity change, gas partial pressure. Examples thereof include, but are not limited to, osmotic pressure. Such factors could not be sufficiently identified by the conventional method, but by using the cell determination method of the present invention with emphasis on the process, it is possible to sufficiently investigate the influence of the factors on the cells. It is.

  In a particularly preferred embodiment, the exogenous factor to be identified in the method of the present invention can be a chemical substance, which includes but is not limited to biomolecules, chemical compounds or media. .

  Examples of such biomolecules include, but are not limited to, nucleic acids, proteins, lipids, sugars, proteolipids, lipoproteins, glycoproteins, and proteoglycans. Such biomolecules are known to affect living organisms, and even unknown biomolecules have a sufficiently high possibility, and are considered to be important for investigation.

  Particularly preferably, hormones, cytokines, cell adhesion factors, extracellular matrix, receptor agonists, antagonists, etc. that are expected to affect cells are used as biomolecules to be investigated.

(External factor estimation)
In another aspect, the present invention provides a method for estimating an unidentified foreign factor given to a cell from the time-lapse profile of the cell. The method of the present invention comprises: a) exposing the cell to a plurality of known foreign factors; b) determining the transcriptional state associated with at least one transcription control sequence selected from a group of transcription control sequences derived from the cell over time. Monitoring to obtain a time profile of the cells for each of the known foreign factors; c) correlating the known foreign factors with each of the time profiles; d) unidentified the cells Exposing to a foreign factor; e) monitoring the transcriptional state associated with the selected transcriptional regulatory sequence over time to obtain a time profile of the cell with respect to an unidentified foreign factor; f) step (b) ) Determining a profile corresponding to the temporal profile obtained in step (e) from the temporal profile obtained in step (e); and g) the unidentified foreign factor Determines step that the above known external factor corresponding to the profile is determined in the step (f); encompasses.

  In the methods of the invention, exposure of cells to foreign factors can be performed as described herein above and illustrated in the examples below. Acquisition of a time profile can also be performed as described herein above and illustrated in the following examples. Correlation can also be performed as described herein above and illustrated in the examples below. When information about known foreign genes is available, similar monitoring is performed for unidentified foreign factors, and information fragments are compared to determine whether the unidentified foreign factors are known. Is possible. In this case, if the profiles are exactly the same, it can naturally be determined that they are the same, but if they are substantially the same, it can also be determined that they are the same. Such a determination depends on the amount and quality of information about the known foreign factor. Such a determination is easy for those skilled in the art and can be determined in consideration of various factors.

(Estimation of unidentified foreign factors)
In another aspect, the present invention provides a method for estimating an unidentified foreign factor given to a cell from the time-lapse profile of the cell. Such a method comprises: a) Correlation between a known foreign factor and a temporal profile of the cell corresponding to the known foreign factor with respect to at least one transcriptional control sequence selected from a group of promoters present in the cell. Providing data regarding: b) exposing the cell to an unidentified foreign factor; c) monitoring the transcriptional state associated with the selected promoter over time to obtain a temporal profile of the cell. D) determining a profile corresponding to the time profile obtained in step (c) from the time profile provided in step (a); and e) the unidentified foreign factor is , Including the step of determining that the known exogenous factor corresponds to the profile determined in step (d). .

  Here, exposure of foreign factors, profile generation, correlation, etc. can be performed using techniques such as those described herein above and exemplified in the following examples.

(Cell state presentation system)
In another aspect, the present invention provides a system for presenting a cellular state. Such a system comprises: a) means for monitoring the transcriptional state associated with at least one transcription control sequence selected from the group of transcription control sequences derived from the cell over time to obtain a time profile of the cell; and b And a means for presenting the time-lapse profile.

  An example of a computer configuration that executes the cell state presentation method of the present invention or an example of a system that implements the same will be described with reference to FIG. FIG. 17 shows a configuration example of a computer 500 that executes the cell state presentation method of the present invention.

  The computer 500 includes an input unit 501, a CPU 502, an output unit 503, a memory 504, and a bus 505. The input unit 501, the CPU 502, the output unit 503, and the memory 504 are connected by a bus 505. The input unit 501 and the output unit 503 are connected to the input / output device 506.

  An outline of a cell state presentation process executed by the computer 500 will be described.

  A program for executing the cell state presentation method (hereinafter referred to as “cell state presentation program”) is stored in the memory 502, for example. Alternatively, in the cell state presentation program, the constituent components thereof may be any type of recording medium such as a floppy (registered trademark) disk, an MO, a CD-ROM, a CD-R, or a DVD-ROM, independently or together. Can be recorded. Alternatively, it may be stored in the application server. The cell state presentation program recorded in such a recording medium is loaded into the memory 504 of the computer 500 via the input / output device 506 (for example, a disk drive, a network (for example, the Internet)). When the CPU 502 executes the cell state presentation program, the computer 500 functions as an apparatus that executes the processing of the cell state presentation method of the present invention.

  Information related to cells is input via the input unit 501. The obtained profile data is also input. Information related to known information may be input as necessary.

  The CPU 502 generates display data from profile data and cell information input by the input unit 501, and stores the display data in the memory 504. Thereafter, the CPU 502 can store these pieces of information in the memory 504. Thereafter, the output unit 503 outputs the cell state selected by the CPU 502 as display data. The output data can be output from the input / output device 506.

(Cell status judgment system)
In another aspect, the present invention provides a system for determining a cell state. Such a system comprises: a) means for monitoring the transcriptional state associated with at least one transcription control sequence selected from the group of transcription control sequences derived from the cell over time to obtain a time profile of the cell; and b And a means for determining the cell state from the time-lapse profile.

  FIG. 17 shows a computer configuration for executing the cell state determination method of the present invention or a system for realizing it. FIG. 17 shows a configuration example of a computer 500 that executes the cell state determination method of the present invention.

  The computer 500 includes an input unit 501, a CPU 502, an output unit 503, a memory 504, and a bus 505. The input unit 501, the CPU 502, the output unit 503, and the memory 504 are connected to each other via a bus 505. The input unit 501 and the output unit 503 are connected to the input / output device 506.

  An outline of the cell state determination process executed by the computer 500 will be described.

  A program for executing the cell state determination method (hereinafter referred to as a cell state determination program) is stored in the memory 502, for example. Alternatively, the cell state determination program may be stored on any type of recording medium such as a floppy (registered trademark) disk, an MO, a CD-ROM, a CD-R, or a DVD-ROM. Can be recorded. Alternatively, it may be stored in the application server. The cell state determination program recorded in such a recording medium is loaded into the memory 504 of the computer 500 via the input / output device 506 (for example, a disk drive or a network (for example, the Internet)). When the CPU 502 executes the cell state presentation program, the computer 500 functions as a device that executes the cell state determination method of the present invention.

  Information related to cells is input via the input unit 501. The obtained profile data is also input. If necessary, known information may also be input.

  The CPU 502 determines the cell state from the profile data and cell information input by the input unit 501, generates the result as determination result data, and stores the determination result data in the memory 504. Thereafter, the CPU 502 can store these pieces of information in the memory 504. Thereafter, the output unit 503 outputs the cell state selected by the CPU 502 as determination result data. The output data can be output from the input / output device 506.

(External factor correlation system)
In another aspect, the present invention provides a system for correlating a foreign factor with a cellular response to the foreign factor. The system comprises: a) means for exposing the cell to a foreign factor; b) monitoring the transcriptional state associated with at least one promoter selected from a group of promoters derived from the cell over time, Means for obtaining a profile; and c) means for correlating the exogenous factor with the time-lapse profile. Such a system can also be realized using a computer in the same manner as the above-described system.

(External factor estimation system)
In another aspect, the present invention provides a system for estimating an unidentified foreign factor given to a cell from a temporal profile. Such a system comprises: a) a means for exposing the cell to a plurality of known foreign factors; b) a transcriptional state associated with at least one transcriptional regulatory factor selected from a group of transcriptional regulatory factors derived from the cell over time. Means for monitoring and obtaining a time profile of the cells for each of the known foreign factors; c) means for correlating the known foreign factors with each of the time profiles; d) unidentified the cells Means for exposing to a foreign factor; e) means for monitoring the transcriptional state associated with the selected transcription control sequence over time to obtain a time profile of the cell for an unidentified foreign factor; f) the means (b ) A means for determining a profile corresponding to the time profile obtained by the means (e) from the time profile obtained by the above method (e); and g) the unidentified outside Factor comprises means for determining that the above known external factor corresponding to the profile determined in said means (f). Such a system can also be realized using a computer in the same manner as the above-described system.

(Unidentified foreign factor estimation system)
In another aspect, the present invention provides a system for estimating an unidentified foreign factor given to a cell from a temporal profile. Such a system comprises: a) for at least one transcriptional regulatory factor selected from a group of transcriptional regulatory sequences present in the cell, a known foreign factor and a time profile of the cell corresponding to the known foreign factor. Means for providing data on correlation; b) means for exposing the cells to unidentified foreign factors; c) monitoring the transcriptional state associated with the selected transcriptional control sequence over time, so that the time course of the cells Means for obtaining a profile; d) means for determining a profile corresponding to the temporal profile obtained in the means (c) from the temporal profile obtained in the means (a); and e) the unidentified Means for determining that the foreign factor is the known foreign factor corresponding to the profile determined in the means (d). . Such a system can also be realized using a computer in the same manner as the above-described system.

  When the present invention is provided as a system form as described above, each component can be implemented by applying a detailed or preferred embodiment of the method of the present invention and the preferred of such a system. Selection of an embodiment is easy for those skilled in the art, and a person skilled in the art can easily perform a preferred embodiment of such a system in consideration of the description of this specification.

(Program recording medium)
In another aspect, the present invention provides a computer-readable recording medium recording a program for causing a computer to execute a process of presenting a cell state. In this recording medium, at least a) a transcription state related to at least one transcription control sequence selected from the group of transcription control sequences derived from the cells is monitored over time, and a time profile of the cells is obtained. A program for executing a procedure for obtaining; and b) a procedure for presenting the time-lapse profile is recorded.

  In another aspect, the present invention provides a computer-readable recording medium recording a program for causing a computer to execute a process for determining a cell state. In such a recording medium, at least a) a procedure for obtaining a temporal profile of the cell by monitoring over time a transcription state associated with at least one transcription control sequence selected from the group of transcription control sequences derived from the cell. And b) a program for executing the procedure for determining the cell state from the temporal profile of the transcription state.

  In another aspect, the present invention provides a computer-readable recording medium in which a program for executing a process for correlating a foreign factor with a cell response to the foreign factor is recorded. In this recording medium, at least a) a step of exposing the cell to a foreign factor; b) a transcriptional state related to at least one transcriptional regulatory factor selected from a group of transcriptional regulatory factors derived from the cell is monitored over time. A program for executing a procedure for obtaining a time-lapse profile of the cells; and c) a procedure for correlating the exogenous factor with the time-lapse profile is recorded.

  In another aspect, the present invention provides a computer-readable recording medium that records a program for causing a computer to execute a process for estimating an unidentified foreign factor given to a cell from a time-lapse profile of the cell. provide. The recording medium includes at least a) a procedure for exposing the cells to a plurality of known foreign factors; b) a transcription state associated with at least one transcriptional control factor selected from a group of transcriptional control factors derived from the cells. A procedure for monitoring over time to obtain a time profile of the cells for each of the known foreign factors; c) a procedure for correlating the known foreign factors with each of the time profiles; d) an unidentified cell. E) a step of monitoring the transcriptional state of the selected transcription control sequence over time to obtain a temporal profile of an unidentified foreign factor; f) obtained in step (b) above. Determining a profile corresponding to the time-lapse profile obtained in the step (e) from among the time-lapse profiles; and g) the unidentified foreign factor Procedure for determining that the determined profile is the known external factor corresponding program for executing the, are recorded in f).

  In another aspect, the present invention provides a computer-readable recording medium recording a program for executing a process for estimating an unidentified foreign factor given to a cell from a time-lapse profile. The recording medium includes at least a) a known exogenous factor and a time-lapse profile of the cell corresponding to the known exogenous factor with respect to at least one transcription control sequence selected from a group of transcription control sequences present in the cell. B) exposing the cell to an unidentified foreign factor; c) monitoring the transcriptional state associated with the selected transcriptional control sequence over time, and A procedure for obtaining a time profile; d) a procedure for determining a profile corresponding to the time profile obtained in step (c) from the time profiles obtained in step (a); and e) Procedure for determining that the identified foreign factor is the known foreign factor corresponding to the profile determined in step (d). It is recorded a program for causing execution.

  When the present invention is provided as a recording medium form as described above, each constituent element can be implemented by applying a detailed or preferred embodiment of the method of the present invention, and such a recording medium. Selection of the preferred embodiment is easy for those skilled in the art, and a person skilled in the art can make a preferred embodiment of such a recording medium in consideration of the description of this specification.

(program)
In another aspect, the present invention provides a program for causing a computer to execute a process of presenting a cell state. Wherein the program comprises: a) a procedure for obtaining a time profile of the cell by monitoring a transcriptional state associated with at least one transcription control sequence selected from the group of transcription control sequences derived from the cell over time; and b) A procedure for presenting the time-lapse profile is executed.

  In another aspect, the present invention provides a program for causing a computer to execute processing for determining a cell state. Wherein the program comprises: a) a procedure for obtaining a time profile of the cell by monitoring a transcriptional state associated with at least one transcription control sequence selected from the group of transcription control sequences derived from the cell over time; and b) A procedure for determining the cell state from the temporal profile of the transcription state is executed.

  In another aspect, the present invention provides a program for executing a process for correlating a foreign factor with a cellular response to the foreign factor. The program comprises: a) a step of exposing the cell to a foreign factor; b) monitoring over time a transcriptional state associated with at least one promoter selected from a group of transcriptional control factors derived from the cell; And c) a step of correlating the exogenous factor with the time profile.

  In another aspect, the present invention provides a program for executing a process for estimating an unidentified foreign factor given to a cell from a temporal profile. The program includes: a) a step of exposing the cell to a plurality of known foreign factors; b) a transcriptional state associated with at least one transcription control sequence selected from a group of transcription control factors derived from the cell over time. Monitoring to obtain a time profile of the cell for each of the known foreign factors; c) correlating the known foreign factor with each of the time profiles; d) an unidentified foreign factor for the cell. E) a procedure for monitoring the transcriptional state of the selected transcription control sequence over time to obtain a time profile of an unidentified foreign factor; f) a time profile obtained in step (b) above. A procedure for determining a profile corresponding to the time-lapse profile obtained in the procedure (e), and g) the unidentified foreign factor is determined in the procedure (f). Procedure for determining that the determined profile is the known external factor corresponding Te, is the execution.

  In another aspect, the present invention provides a program for executing a process for estimating an unidentified foreign factor given to a cell from a temporal profile. The program includes: a) a correlation between a known foreign factor and a temporal profile of the cell corresponding to the known foreign factor with respect to at least one transcription control sequence selected from a group of transcription control sequences present in the cell. B) exposing the cell to an unidentified foreign factor; c) monitoring the transcriptional state associated with the selected transcription control sequence over time to determine a time profile of the cell. D) a procedure for determining a profile corresponding to the temporal profile obtained in the procedure (c) from the temporal profile obtained in the procedure (a); and e) the unidentified external A step of determining that the factor is the known foreign factor corresponding to the profile determined in step (d). That.

When the present invention is provided as a program form as described above, each constituent element can be implemented by applying a detailed or preferred embodiment of the present invention, and such a program is preferably used in the preferred embodiment. Selection is easy for those skilled in the art, and those skilled in the art can easily perform a preferred embodiment of such a program in consideration of the description of this specification. Such a program description format is well known to those skilled in the art, and for example, a C ⁺⁺ language can be applied.

(Diagnosis)
In another aspect, the present invention provides a method and system for diagnosing a subject. In this diagnostic method, a) a step of monitoring a transcription state associated with at least one transcription control sequence selected from a group of transcription control sequences derived from the cell over time to obtain a time profile of the cell; b) Determining the cell state from a time-lapse profile of the transcriptional state; and c) determining the state, disorder or disease of the subject from the cell state. When this diagnostic method is provided as a system, the system of the present invention a) monitors the transcription state associated with at least one transcription control sequence selected from the group of transcription control sequences derived from the cells over time. Means for obtaining a time profile of the cell; b) means for determining the cell state from the time profile of the transcription state; and c) means for determining a state, disorder or disease of the subject from the cell state. Thus, the present invention can be applied to tailor-made diagnosis and treatment such as drug resistance, selection of an appropriate anticancer agent, and selection of an appropriate transplanted cell. Preferably, the diagnosis method of the present invention is provided as a treatment or prevention method including a step of applying to a subject a treatment or prevention selected according to the diagnosis result. In another preferred embodiment, the diagnostic system of the present invention may be provided as a therapeutic or prophylactic system comprising means for providing a selected therapeutic or prophylactic depending on the diagnostic result.

  FIG. 17 shows an example of a computer configuration for executing the diagnosis method or treatment method of the present invention or a system for realizing the computer configuration. FIG. 17 shows a configuration example of a computer 500 that executes the cell state determination method of the present invention.

  The computer 500 includes an input unit 501, a CPU 502, an output unit 503, a memory 504, and a bus 505. The input unit 501, the CPU 502, the output unit 503, and the memory 504 are connected by a bus 505. The input unit 501 and the output unit 503 are connected to the input / output device 506.

  An outline of the correlation processing executed by the computer 500 will be described.

  Programs for executing the correlation method and / or treatment or prevention selection (hereinafter referred to as “correlation program” and “selection program”, respectively) are stored in the memory 502, for example. Alternatively, the correlation program and the selection program are recorded on any type of recording medium such as a floppy disk, MO, CD-ROM, CD-R, or DVD-ROM, either independently or together. obtain. Alternatively, it may be stored in the application server. The correlation program and the selection program recorded in such a recording medium are loaded into the memory 504 of the computer 500 via the input / output device 506 (for example, a disk drive, a network (for example, the Internet)). When the CPU 502 executes the correlation program and the selection program, the computer 500 functions as an apparatus that executes the processing of the correlation method and the selection method of the present invention.

  Via the input unit 501, a result of analysis of a time-lapse profile (for example, a phase, etc.), information on cells, and the like are input. Optionally, secondary information such as conditions, disorders or diseases, treatment and / or prevention information correlated with the time-course profile may also be entered.

  The CPU 502 correlates information on the temporal profile with information on the cellular state or the state of the subject, information on the disorder or disease, and a prevention or treatment method as necessary based on the information input by the input unit 501, In 504, correlation data is stored. Thereafter, the CPU 502 can store these pieces of information in the memory 504. Thereafter, the output unit 503 outputs information relating to the cell state selected by the CPU 502, the state of the subject, information relating to a disorder or disease, and a prevention or treatment method as necessary, as diagnostic information. The output data can be output from the input / output device 506.

  All patents, patent applications and references cited herein are hereby incorporated by reference in their entirety to the same extent as described.

  For ease of understanding, preferred embodiments of the invention have been shown and described. The present invention will be described below based on examples, but the following examples are provided for illustrative purposes only. Accordingly, the scope of the invention is not limited and is limited only by the scope of the appended claims. A person skilled in the art can appropriately select cells, supports, biological factors, salts, positively charged substances, negatively charged substances, actin acting substances, etc. from the following examples to carry out the present invention. Understand what you can do.

  The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to the following examples. Reagents, supports and the like are commercially available from Sigma (St. Louis, USA), Wako Pure Chemical (Osaka, Japan), Matsunami Glass (Kishiwada, Japan), etc., with exceptions.

(Example 1: Reagent)
The formulation prepared in Example 1 is as follows.

Various extracellular matrix proteins and variants or fragments thereof were prepared as candidates for actin acting substances. What was prepared in this Example 1 is as follows. Fibronectin and the like were commercially available, and fragments and variants were obtained by genetic manipulation.
1) Fibronectin (SEQ ID NO: 11);
2) a fibronectin 29 kDa fragment;
3) a fibronectin 43 kDa fragment;
4) a fibronectin 72 kDa fragment;
5) Modified fibronectin (in SEQ ID NO: 11, alanine at position 152 is changed to leucine);
6) Pronectin F (Sanyo Kasei, Kyoto, Japan);
7) Pronectin L (Sanyo Kasei);
8) Pronectin Plus (Sanyo Kasei);
9) Laminin (SEQ ID NO: 6);
10) RGD peptide (tripeptide);
11) A 30 kDa peptide containing RGD;
12) 5 amino acids of laminin (IKVAV, SEQ ID NO: 28);
13) Gelatin.

  Plasmid for transfection was prepared as DNA. As plasmids, pEGFP-N1 and pDsRed2-N1 (both BD Biosciences, Clontech, CA, USA) were used. In these plasmids, gene expression is under the control of cytomegalovirus (CMV). Plasmid DNA was obtained from E. coli. Plasmid DNA amplified and amplified in E. coli (XL1 blue, Stratgene, TX, USA) was used as one of the complex partners. DNA was dissolved in distilled water containing neither DNase nor RNase.

The transfection reagents used were as follows: Effectene Transfection Reagent (cat. No. 301425, Qiagen, CA), TransFast ^™ Transfection Reagent (E2431, Promega, WI), Tfx ^™ -20 Reagent (E239, E239 ), SuperFect Transfection Reagent (301305, Qiagen, CA), PolyFect Transfection Reagent (301105, Qiagen, CA), LipofectAMINE 2000 Reagent (11668-019, Invitrogen corporation, CA4) c. (101-30, Polyplus-translation, France) and ExGen 500 (R0511, Fermentas Inc., MD). The transfection reagent was added in advance to the DNA and actin acting substance, or the DNA and the complex were previously generated.

  The solution thus prepared was used in the following assay using a transfection array.

(Example 2: Transfection array-demonstration using mesenchymal stem cells)
In this example, an improvement in transfection efficiency in the solid phase was observed. The protocol in Example 2 is shown below.

(protocol)
The final concentration of DNA was adjusted to 1 μg / μL. Actin agonists were stored as stocks at a concentration of 10 μg / μL in ddH ₂ O. All dilutions were made using PBS, ddH ₂ O or Dulbecco's MEM medium. Examples of dilution series include 0.2 μg / μL, 0.27 μg / μL, 0.4 μg / μL, 0.53 μg / μL, 0.6 μg / μL, 0.8 μg / μL, 1.0 μg / μL, and 1. 07 μg / μL, 1.33 μg / μL, and the like were prepared.

  Transfection reagents were used according to the instructions provided by each manufacturer.

  Plasmid DNA was removed from the glycerol stock, grown overnight in 100 mL L-amp, and purified by standard protocols provided by the manufacturer using Qiaprep Miniprep or Qiagen Plasmid Purification Maxi.

  In Example 2, the effect was confirmed using the following five types of cells: human mesenchymal stem cells (hMSCs, PT-2501, Cambrex BioScience Walkersville, Inc., MD), human embryonic kidney cells (HEK293) RCB1637, RIKEN Cell Bank, JPN), NIH3T3-3 cells (RCB0150, RIKEN Cell Bank, JPN), HeLa cells (RCB0007, RIKEN Cell Bank, Japan) and HepG2 (RCB1648, RIKEN Cell Bank, JPN). These cells were cultured in DMEM / 10% IFS containing L-glut and pen / strep.

(Dilution and DNA spots)
The transfection reagent and DNA are mixed to form a DNA-transfection reagent complex. Since some time was required for complex formation, the mixture was spotted on a solid support (eg, a poly-L-lysine slide) using an array maker. In Example 2, as a solid support, in addition to a poly-L-lysine slide, an APS slide, a MAS slide, and an uncoated slide were used. These slides are available from Matsunami Glass (Kishiwada, Japan).

  The slides were dried overnight in a vacuum dryer for complex formation and spot fixation. The range of drying time was 2 hours to 1 week.

  An actin acting substance may be used at the time of formation of the complex, but in Example 2, a form used immediately before spotting was also tested.

(Preparation of mixed solution and application to solid support)
The Eppendorf tube was mixed with 300 μL of DNA concentration buffer (EC buffer) +16 μL of enhancer. This was mixed by vortexing and incubated for 5 minutes. 50 μL of transfection reagent (such as Effectene) was added and mixed by pipetting. To apply the transfection reagent, a wax annular barrier was drawn around the spot of the slide. 366 μL of the mixture was added to the spot waxed area and incubated at room temperature for 10-20 minutes. This achieved manual fixation to the support.

(Cell distribution)
Next, a protocol for adding cells is shown. Cells were distributed for transfection. This distribution was usually performed by vacuum suction in a hood. Slides were placed on dishes and a solution containing cells was added for transfection. The cell distribution is as follows.

Concentration such that 10 ⁷ cells 25 mL, was dispensed growing cells. Cells were plated on slides in square 100 × 100 × 15 mm Petri dishes or 100 mm × 15 mm round dishes. Transfection was allowed to proceed for approximately 40 hours. This corresponds to approximately 2 cell cycles. Slides were processed for immunofluorescence.

(Evaluation of gene transfer)
Evaluation of gene transfer was achieved by detection using, for example, immunofluorescence, fluorescence microscopy, laser scanning, radiolabeling and sensitive films or emulsions.

  If the expressed proteins to be visualized are fluorescent proteins, they can be viewed and photographed with fluorescent microscopy. For large expression arrays, slides can be scanned with a laser scanner for data storage. If the expressed protein can be detected by a fluorescent antibody, an immunofluorescence protocol can be followed. If detection is based on radioactivity, slides can be attached as indicated above, and radioactivity can be detected by autoradiography using films or emulsions.

(Laser scanning and fluorescence intensity determination)
To quantify transfection efficiency, we used a DNA microarray scanner (GeneTAC UC4x4, Genomic Solutions Inc., MI). After measuring the total fluorescence intensity (arbitrary units), the fluorescence intensity per surface area was calculated.

(Section observation with a confocal microscope)
The used cells are seeded in a tissue culture dish at a final concentration of 1 × 10 ⁵ cells / well and using an appropriate medium (in the case of human mesenchymal cells, human mesenchymal cell basal medium (MSCGM, BulletKit PT-3001). , Cambrex BioScience Walkersville, Inc., MD). After fixing the cell layer with 4% paraformaldehyde solution, SYTO and Texas Red-X phalloidin (Molecular Probes Inc., OR, USA) were added to the cell layer to observe nuclei and F-actin. Using a confocal laser microscope (LSM510, Carl Zeiss Co., Lrd, pinhole size = Ch1 = 123 μm, Ch2 = 108 μm; image interval = 0.4) using a confocal laser microscope (LSM510, Carl Zeiss Co., Lrd) I got a statue.

(result)
FIG. 1 shows the results of using various actin acting substances and gelatin as a control when HEK293 cells are used.

  As is apparent from the results, the transfection was not very successful in the gelatin-based system, whereas in the fibronectin, pronectin which is a variant of fibronectin (pronectin F, pronectin L, pronectin plus) and laminin, In, remarkable transfection occurred. Thus, such molecules have been demonstrated to significantly increase transfection efficiency. The effect was hardly visible with the RGD peptide alone.

  2 and 3 show the transfection efficiency when using a fibronectin fragment. FIG. 4 summarizes the results. The 29 kDa and 72 kDa fragments showed significant transfection activity, while the 43 kDa fragment was active, but to a lesser extent. Therefore, it is suggested that the amino acid sequence contained in 29 kDa plays a role in increasing transfection efficiency. The 29 kDa fragment showed little contamination, whereas the other two fragments (43 kDa and 72 kDa) showed contamination. Therefore, it may be preferable to use only the 29 kDa domain as an actin acting substance. In addition, the RGD peptide alone showed no transfection efficiency increasing activity, but the 29 kDa peptide showed activity. Transfection activity was also observed in a system with 6 amino acids of laminin and a high molecular weight. Therefore, these peptide sequences may also play an important role in transfection efficiency increasing activity, but are not limited thereto. In such cases, a molecular weight of at least 5 kDa, preferably at least 10 kDa, more preferably at least 15 kDa may be required for increased transfection efficiency.

  Next, the results of examining the transfection efficiency in cells are shown in FIG. In FIG. 5, the transfer of the present invention using HEK293 cells, HeLa cells, 3T3 cells, and HepG2 cells and mesenchymal stem cells (MSCs) that were previously considered almost impossible to transfect as the cells that can be transfected. The effect of the injection method is shown. The vertical axis represents the strength of GFP.

  In FIG. 5, the conventional liquid phase transfection method was shown as a comparison control with the transfection method using the solid support of the present invention. The conventional liquid phase transfection method was performed according to the method recommended by the manufacturer of the kit.

  As is apparent from FIG. 5, transfection efficiency comparable to that of HeLa and 3T3 was achieved not only with HEK293, HeLa, and 3T3, which had been conventionally allowed to be transfected, but also with HepG2 and MSC, which had not been allowed to be transfected. . These effects were never achieved with conventional transfection systems, can increase transfection efficiency for virtually any cell, and provide practical transfection for all cells This is the first time in history. In addition, the use of solid phase conditions significantly reduced mutual contamination. Thus, when using a solid support, the present invention has proven to be a suitable method for producing integrated bioarrays.

  Next, FIG. 6 provides results showing the state of transfection with various plates. As is clear from the results of FIG. 6, it was found that the case where the coating was performed was less contaminated than the case where the coating was not performed, and the transfection efficiency was also increased.

  Next, FIG. 7 shows the results when transfection was performed with fibronectin concentrations of 0, 0.27, 0.53, 0.8, 1.07, and 1.33 (μg / μL, respectively). FIG. 7 shows a slide coated with PLL (poly-L-lysine) and APS and an uncoated slide.

  As is clear from the results in FIG. 7, it was revealed that the transfection efficiency increases with an increase in fibronectin concentration. However, in the case of PLL coating and no coating, it can be seen that the efficiency reaches a plateau when it exceeds 0.53 μg / μL. On the other hand, in the case of APS, an increase in the effect was observed even when it exceeded 1.07 μg / μL.

  Next, FIG. 8 shows a photograph showing a cell adhesion profile with and without fibronectin. FIG. 9 shows a section photograph. It was revealed that the shape of the adherent cells was significantly different (FIG. 8). In the first 3 hours of cell culture, cells with fibronectin expanded completely, whereas those without fibronectin had limited extension (FIG. 9). Considering the results of FIG. 9 in which the behavior of actin filaments was observed over time, an actin acting substance such as fibronectin deposited on a solid support has an influence on the shape and direction of actin filaments. This is thought to increase the efficiency of substance introduction into cells, such as the efficiency of ejection. Specifically, in the presence of fibronectin, actin filaments rapidly relocate and disappear from the cytoplasmic space beneath the nucleus with cell extension. Actin depletion around the nucleus induced by an actin acting substance such as fibronectin is considered to transfer a target substance such as DNA into the nucleus and, if necessary, into the nucleus. Without being bound by theory, it is believed that this is due to the reduced cytoplasmic viscosity and the effect of preventing positively charged DNA particles from being trapped by negatively charged actin filaments. Further, since the surface area of the nucleus is significantly increased in the presence of fibronectin (FIG. 10), it is considered that the transfer of the target substance such as DNA to the nucleus is facilitated.

(Example 3: Application to bioarray)
Next, in order to confirm whether or not the above-described effect was demonstrated even when the array was used, an experiment was performed with the scale expanded.

(Experiment protocol)
(Cell source, culture medium, and culture conditions)
In this example, five different cell lines were used: human mesenchymal stem cells (hMSC, PT-2501, Cambrex BioScience Walkersville, Inc., MD), human embryonic kidney cells HEK293 (RCB1637, RIKEN Cell Bank, JPN), NIH3T3-3 (RCB0150, RIKEN Cell Bank, Japan), HeLa (RCB0007, RIKEN Cell Bank, Japan), and HepG2 (RCB1648, RIKEN Cell Bank, Japan). In the case of human MSC cells, the cells were maintained in commercial human mesenchymal cell basal medium (MSCGM BulletKit PT-3001, Cambrex BioScience Walkersville, Inc., MD). In the case of HEK293 cells, NIH3T3-3 cells, HeLa cells and HepG2 cells, these cells were treated with 10% fetal calf serum (FBS, 29-167-54, Lot No. 2025F, Dainippon Pharmaceutical CO., LTD., JPN). Maintained in Dulbecco's modified Eagle's medium (DMEM, high glucose with L-glutamine and sodium pyruvate (4.5 g / L); 14246-25, Nakarai Tesque, JPN). All cell lines were cultured in an incubator controlled at 37 ° C. and 5% CO ₂ . In experiments involving hMSCs, we used hMSCs below passage 5 to avoid phenotypic changes.

(Plasmid and transfection reagent)
To evaluate the efficiency of transfection, pEGFP-N1 and pDsRed2-N1 vectors (Catalog Nos. 6085-1, 6973-1, BD Biosciences Clontech, CA) were used. Both gene expression was under the control of the cytomegalovirus (CMV) promoter. Transfected cells continuously expressed EGFP or DsRed2, respectively. Plasmid DNA was amplified using Escherichia coli, XL1-blue strain (200409, Stratagene, TX) and purified by EndoFree Plasmid Kit (EndoFree Plasmid Max Kit 12362, QIAGEN, CA). In all cases, plasmid DNA was dissolved in water without DNase and RNase. Transfection reagents were obtained as follows: Effectene Transfection Reagent (catalog number 301425, Qiagen, CA), TransFast ™ Transfection Reagent (E2431, Promega, WI), TfxTM-20 Reagent (E2391, PromegaS, PromegaS, PromegaS, PromegaS, Promega S Reagent (301305, Qiagen, CA), PolyFect Transfection Reagent (301105, Qiagen, CA), LipofectAMINE 2000 Reagent (11668-019, Invitrogen corporation, CA), JetPEI (× 4) conc. (101-30, Polyplus-translation, France), and ExGen 500 (R0511, Fermentas Inc., MD).

(Solid-phase transfection array (SPTA) generation)
Details of the protocol for “reverse transfection” can be found at the website http: // stuffa. wi. mit. edu / sabatini_public / reverse_transfect. html “Reverse Transform Homepage”; Ziauddin, D.C. M.M. Sabatini, Nature, 411, 2001, 107; W. Zu, S .; N. Bailey, D.M. M.M. Sabatini, Trends in Cell Biology, Vol 12, No. 10,485. In our solid-phase transfection (SPTA method), three types of glass slides (Silane-treated glass slides; APS slides) with 48 square patterns (3 mm x 3 mm) separated by a hydrophobic fluororesin coating; And slides coated with poly-L-lysine; PLL slides, and slides coated with MAS; Matsunami Glass Ind., LTD., JPN) were studied.

(Preparation of plasmid DNA printing solution)
Two different methods have been developed for generating SPTA. The main difference is in the preparation of plasmid DNA printing solution.

(Method A)
When the Effectene Transfection Reagent was used, the printing solution contained plasmid DNA and cell adhesion molecules (bovine plasma fibronectin (catalog number 16042-41, Nakarai Tesque, Japan) dissolved in ultrapure water at a concentration of 4 mg / mL). . The above solution was applied to the surface of the slide using an ink jet printer (synQUAD ™, Cartian Technologies, Inc., CA) or manually using a 0.5-10 μL tip. The printed slide glass was dried inside the safety cabinet for 15 minutes at room temperature. Prior to transfection, total Effectene reagent was gently poured onto a DNA printed glass slide and incubated for 15 minutes at room temperature. Excess Effectene solution was removed from the glass slide using a suction aspirator and allowed to dry at room temperature for 15 minutes inside the safety cabinet. The resulting DNA printed glass slide was placed on the bottom of a 100 mm culture dish and approximately 25 mL of cell suspension (2-4 × 10 ⁴ cells / mL) was gently poured onto the dish. The dish was then transferred to an incubator at 37 ° C., 5% CO ₂ and incubated for 2-3 days.

(Method B)
In the case of other transfection reagents (TransFastTM, TfxTM-20, SuperFect, PolyFect, LipofectAMINE 2000, JetPEI (x4) conc. Or ExGen), instructions for the manufacturer to distribute plasmid DNA, fibronectin, and transfection reagent Mix evenly in a 1.5 mL microtube according to the ratio indicated in the letter and incubate for 15 minutes at room temperature before printing on the chip. The printing solution was applied on the surface of the glass slide using an inkjet printer or a 0.5-10 μL chip. The printed glass slide was completely dried for 10 minutes at room temperature inside the safety cabinet. The printed glass slide was placed on the bottom of a 100 mm culture dish and approximately 3 mL of cell suspension (2-4 × 10 ⁴ cells / mL) was added and incubated inside the safety cabinet for 15 minutes at room temperature. After incubation, fresh medium was gently poured into the dish. The dish was then transferred to an incubator at 37 ° C., 5% CO ₂ and incubated for 2-3 days. After incubation, we used the fluorescence microscope (IX-71, Olympus PROMARKETING, INC., JPN) to transfect the transfectants based on the expression of enhanced fluorescent proteins (EFP, EGFP, and DsRed2). Observed. Phase contrast images were taken using the same microscope. In both protocols, cells were fixed by using the paraformaldehyde (PFA) fixation method (4% PFA in PBS, treatment time 10 minutes at room temperature).

(Laser scanning and fluorescence intensity determination)
To quantify transfection efficiency, we used a DNA microarray scanner (GeneTAC UC4x4, Genomic Solutions Inc., MI). After measuring the total fluorescence intensity (arbitrary unit), the fluorescence intensity per unit surface area was calculated.

(result)
(Fibronectin-supported local transfection)
A transfection array chip was constructed as shown in FIG. The transfection array chip was constructed by microprinting a cell culture containing DNA / transfection reagent and fibronectin on a PLL-coated slide glass.

  Various cells were used in this example. These cells were cultured under commonly used culture conditions. Since these cells attached to the glass slide, the cells were efficiently taken up and expressed a gene corresponding to the DNA printed at a given location on the array. Compared to conventional transfection methods (eg, cationic lipid or cationic polymer mediated transfection), the transfection efficiency using the method of the present invention was significantly higher. It is particularly important that tissue stem cells such as HepG2, hMSC, etc., which have been difficult to transfect, have been found to be efficiently transfected. In the case of hMSC, an efficiency increase of about 40 times or more of the conventional method was observed. The high degree of integration required for high density arrays was also achieved (ie, the contamination between adjacent spots on the array was significantly reduced). This was confirmed by generating an array of checked patterns of EGFP and Ds-RED. Human MSCs were cultured in this array and the corresponding fluorescent proteins were expressed so that substantially all spatial resolution was shown. As a result, as shown in FIG. 12, it became clear that there was almost no contamination. Based on this study on the role of the individual components of the print mixture, transfection efficiency can be optimized.

(Solid phase transfection array of human mesenchymal stem cells)
The ability of human mesenchymal stem cells (hMSCs) to differentiate into a wide variety of cells has been of particular interest for studies targeting tissue regeneration and tissue revival. In particular, genetic analysis of the transformation of these cells is of increasing interest in elucidating factors that control pluripotency of hMSC. Conventional hMSC studies are incapable of transfection with the desired genetic material.

  To achieve this, conventional methods include either viral vector or electroporation techniques. By using the complex-salt system developed by the present inventors, it is possible to obtain high transfection efficiency for various cell lines (including hMSC) and spatial localization in a dense array. Solid phase transfection was achieved. An outline of solid phase transfection is shown in FIG. 13A.

  Solid phase transfection enables the technical achievement of “transfection patches” that can be used for in vivo gene delivery as well as solid phase transfection arrays (SPTA) for high-throughput gene function studies in hMSCs Turned out to be.

  There are many standard methods for transfecting mammalian cells, but the introduction of genetic material into hMSCs is known to be inconvenient and difficult compared to cell lines such as HEK293 and HeLa. ing. Either previously used viral vector delivery or electroporation is important, but potential toxicity (viral methods), insensitive to high-throughput analysis at the genome scale, and limited applications for in vivo studies There are inconveniences like sex (with respect to electroporation).

  The development of a solid phase support immobilization system that can be easily immobilized on a solid phase support and that retains sustained release and cell affinity has overcome most of these drawbacks.

  An example of the results of the above experiment is shown in FIG. 13B. Using our technique using microprinting techniques, a mixture containing selected genetic material, transfection reagents and appropriate cell adhesion molecules, and salts could be immobilized on a solid support. Cell culture on the support on which the mixture was immobilized allowed the uptake of genes in the mixture for the cultured cells. As a result, it was possible to take up spatially separated DNA in the support-adherent cells (FIG. 13B).

  As a result of this example, several important effects were achieved: high transfection efficiency (so that statistically significant cell populations can be studied), low reciprocity between regions supporting different DNA molecules Contamination (so that the effects of individual genes can be studied separately), long-term survival of transfected cells, high-throughput compatible formats and convenient detection methods. An SPTA that meets all of these criteria provides an appropriate basis for further research.

In order to clearly establish the achievement of these objectives, as described above, we have developed five different cell lines (HEK293, HeLa, NIH3T3, HepG2 and hMSC) from our methodology (fixed). Phase system transfection) (see FIGS. 13A and 13C) and conventional solution phase transfection were used to study under a range of transfection conditions. In the case of SPTA, to assess mutual contamination, we used DNA encoding red fluorescent protein (RFP) and green fluorescent protein (GFP) printed on a glass support in a checkered pattern; On the other hand, in the case of experiments involving conventional liquid phase transfection (here, spontaneous spatial separation of transfected cells cannot be achieved by nature), we use DNA encoding GFP. did. Several transfection reagents were evaluated: four liquid transfection reagents (Effectene, TransFast ^™ , Tfx ^™ -20, LopfectAMINE 2000), two polyamines (SuperFect, PolyFect), and two types of polyimines (JetPEI (× 4) and ExGen 500).

  Transfection efficiency: Transfection efficiency was determined as the total fluorescence intensity per unit area (FIG. 14A, FIG. 14B shows the image). Depending on the cell line used, optimal liquid phase results were obtained with different transfection reagents (see FIGS. 14C-D). These efficient transfection reagents were then used to optimize the solid phase protocol. Several trends were observed: For easily transfectable cell lines (eg, HEK293, HeLa, NIH3T3), the transfection efficiency observed with the solid phase protocol was comparable to that of the standard liquid phase protocol. Although slightly better compared, it has been achieved at an essentially similar level (FIG. 14).

  However, by using conditions optimized for SPTA methodology in cases where it is difficult to transfect cells (eg, hMSC and HepG2), we have achieved transfection efficiency while maintaining cell characteristics. An increase of 40-fold was observed (see protocol above and FIGS. 14C-D). In the specific case of hMSC (FIG. 15), the best conditions included the use of polyethyleneimine (PEI) transfection reagent. As expected, an important factor for achieving high transfection efficiency is the charge balance between the number of nitrogen atoms (N) in the polymer and the number of phosphate residues (P) in the plasmid DNA ( N / P ratio), as well as DNA concentration. In general, an increase in N / P ratio and concentration results in an increase in transfection efficiency. In parallel, we observed a significant reduction in cell viability for high DNA and high N / P ratio in hMSC solution transfection experiments. Due to these two antagonists, the efficiency of liquid phase transfection of hMSC was very poor and very low cell viability (observed with N / P ratio> 10). However, the SPTA protocol tolerates very high (fixed to a solid support) N / P ratio and DNA concentration (possibly relative to the cell membrane) without significantly affecting cell viability or cell morphology. This is probably responsible for a dramatic improvement in transfection efficiency) (due to the stabilizing effect of the solid support). In the case of SPTA, an N / P ratio of 10 has been found to be optimal and provides sufficient transfection levels while minimizing cytotoxicity. An additional reason for the increase in transfection efficiency observed in the SPTA protocol is the high local DNA concentration / transfection reagent concentration (which produces cell death when used in liquid phase transfection experiments). Achievement.

  An important point for achieving high transfection efficiency on the chip is the coating agent used. When using glass chips, it was found that PLL provides the best results in terms of both transfection efficiency and mutual contamination (discussed below). In the absence of fibronectin coating, a few transfectants were observed (all other experimental conditions were kept constant). Although not fully established, the role of fibronectin is probably to accelerate the cell adhesion process (data not shown) and thus limit the time allowed for DNA diffusion off the surface.

  Low reciprocal contamination: Apart from the higher transfection efficiency observed with the SPTA protocol, an important advantage of this technology is the realization of a separately isolated cell array, at each position where the selected gene is expressed. We printed JetPEI (see “Experimental Protocol”) and two different reporter genes (RFP and GFP) mixed with fibronectin on a glass surface coated with fibronectin. The resulting transfection chip was provided for appropriate cell culture. Under the experimental conditions found to be best, the expressed GFP and RFP were localized in the region where the respective cDNA was spotted. Almost no mutual contamination was observed (FIG. 16). However, in the absence of fibronectin or PLL, reciprocal contamination was observed that interfered with solid phase transfection, and transfection efficiency was significantly lower (see FIG. 6). This confirms the hypothesis that cell adhesion and the relative proportion of plasmid DNA that diffuses away from the support surface are important factors for both high transfection efficiency and high reciprocal contamination.

  A further cause of mutual contamination may be the mobility of the transfected cells on the solid support. We measured both the cell adhesion rate (FIG. 16C) and the diffusion rate of plasmid DNA on several supports. As a result, DNA diffusion hardly occurred under the optimum conditions. However, under high reciprocal conditions, a considerable amount of plasmid DNA diffused during the time until cell adhesion was completed, resulting in depletion of plasmid DNA from the solid surface.

  This established technique is particularly important in the context of economical high-throughput gene function screening. Indeed, the small amount of transfection reagent and DNA required and the possibility of automating the entire process (from plasmid isolation to detection) increases the usefulness of the above method.

  In conclusion, we have successfully realized an hMSC transfection array in a complex-salt system. This will enable high-throughput studies in various studies using solid-phase transfection, such as elucidating the genetic mechanisms that control the differentiation of pluripotent stem cells. The detailed mechanism of solid-phase transfection as well as the methodology relating to the use of this technique for high-throughput real-time gene expression monitoring has been found to be applicable for various purposes.

(Example 4: Mathematical analysis)
Next, a time-lapse profile was generated based on the data obtained using the methods of Examples 2 and 3.

(Differentiation induction)
Each reporter was immobilized on a solid support, cultured for 2 days in an undifferentiated mesenchymal stem cell maintenance medium (MSCGM, PT-3001, PT-3238, PT-4105, Cambrex, BioWhittaker, USA), and then induced to differentiate. The medium was changed to a medium (hMSC Differentiation, PT-3002, PT-4120, Cambrex, BioWhittaker, USA), and the response profile of each reporter was measured.

(Mathematical analysis)
The mathematical analysis method used is shown in FIG. 18 (FIG. 18A-B).

(Transcription factor used)
As shown in FIGS. 19 and 24, 17 types of transcription factors (ISRE, RARE, STAT3, GAS, NFAT, MIC, AP1, SRE, GRE, CRE, NFκB, ERE, TRE, E2F, Rb, p53) Osteoblast differentiation of mesenchymal stem cells was observed using a plasmid operably linked to GFP (commercially available from Clontech). The time-lapse profile obtained at this time is shown in FIG. The transcription factor reporter was constructed as shown in FIG.

  A transcription factor reporter assay was performed. This was performed according to control conditions (cells, additive factors, culture conditions, etc.) published by Clontech.

  The result is shown in FIG. Thus, when compared with DNA alone, it has been demonstrated that induction occurs when an inducer is added to most transcription factors.

  Next, the transcription factor activity during the induction of bone differentiation was measured over time. This is a comparison of profiles over time when differentiation is induced according to the above-mentioned conditions. For the time-lapse profile, each reporter gene was introduced using a solid phase transfection method, cultured for 2 days in an undifferentiated maintenance medium, and replaced with an osteoblast differentiation induction medium. This time was defined as osteoblast differentiation start time. Regarding the added factors, etc., the recommended concentrations were used in the osteoblast differentiation induction medium. Other cultures were performed according to the instructions of Cambrex.

  The results are shown in FIG. From 10 to 30 hours after the medium change, the profile pattern shown on the left was shown in FIG. 26, whereas on the 5th to 6th days after the medium change, the profile pattern shown on the right was shown and changed significantly. It became clear that The phase was calculated using the equation shown in FIG. 27, and the results are summarized in the table on the right side of FIG. Thus, phase inversion was observed in ISRE, RARE, STAT3, GRE, CRE, TRE, E2F, and p53, which are particularly deeply related to differentiation. Therefore, it has become clear that determining the phase can determine that a process change has occurred, that is, transfer control has occurred.

(Optional reporter)
Next, the identifiability when changing the combination arbitrarily extracted in the early stage of differentiation induction was demonstrated. The analysis was performed by changing the combination arbitrarily extracted in the early stage of differentiation induction. Briefly, an arbitrary number of reporters are extracted from a group of 17 reporters, and an average profile is calculated as shown in FIG. Evaluations were made at intervals of time, 0-17.5 hours and 17.5-31.5 hours.

  The result is shown in FIG. From this analysis, it was found that differentiation induction cannot be grasped in the very early stages of differentiation (it is considered that there is other noise), but it can be confirmed after about 15 hours. In this example, the change can be identified as 100%, which is 8 or more. Even when the number of extractions is 3, the identification rate already exceeds 90%. However, since 88% and 1 were 82%, it became clear that one, two, or at least three were sufficient to determine or identify the cell state.

(Maintaining undifferentiated)
Next, regarding the undifferentiation maintenance, the combination of arbitrarily extracted transcriptional regulatory factors was changed and analyzed. The analysis was performed according to that described in FIG.

  The result is shown in FIG. Compared with the results at the time of differentiation induction, this comparison makes it possible to determine whether the stem cells are in the process of induction of differentiation or are not differentiated by the processing in this example. Such a determination could be made by using at least one transcription control sequence. The fact that the cell state can be determined sufficiently even with such a small number cannot be achieved by the prior art, and it can be said that the present invention has achieved an excellent effect.

  By analyzing the process in this way, it can be seen that the formation of cell functions can be described as a cocktail party process of various factors, as shown in FIG. With this process description, the present invention has made it possible to analyze a drug response process and a differentiation induction process.

(Example 5: Real-time measurement of multiple genes using cells)
Next, using a device that measures signals from cells in real time, data over time was acquired, and a profile was generated from the data.

  As the cells, HeLa cells (available from RIKEN, etc.) were used. Nacalai DMEM high Glucose was used as the medium, and serum (10% FBS from Dainippon Pharmaceutical) was used. As described in the above examples, transfection arrays were constructed and 24 gene expression and signaling reporters were introduced into HeLa cells. The cells were cultured for 48 hours, and the culture unit was set up and observed over time. The measurement was performed by obtaining the expression of the reporter as fluorescence intensity with a measuring machine as shown in FIGS. The measurement was performed using a procedure as shown in FIG.

  As the array used, a 570 grid array having a format as shown in FIG. 31 was used. Illustratively, real-time monitoring was performed in serum-free medium 2 days after transfection. Image acquisition was performed every 30 minutes. About 24 genes used (reporter vector), what was confirmed about the activity by measuring on control conditions was used. An example of image acquisition is shown in FIG.

  The temporal data obtained from the acquired images are shown for each gene. FIG. 38A shows a graph summarizing all the genes. FIG. 33B shows the raw data. FIG. 38C shows the calculation result after polynomial approximation. FIG. 33D shows data after the first and second derivatives. Fig. 34-1 to Fig. 34-54 are shown separately for each gene. FIGS. 34-1 to 34-54 include data collected for the same gene at different points. The vertical axis represents the fluorescence intensity (Arbitrary Unit = unit output from the device used), and the horizontal axis represents time (the unit is time (hr)).

  FIG. 34-1 shows the time-lapse data of EGFP-N1.

  FIG. 34-2 shows the time course data of AP1.

  FIG. 34-3 shows the temporal data of AP1 (PMA).

  FIG. 34-4 shows CRE data over time.

  Figure 34-5 shows the time course data for E2F.

  FIG. 34-6 shows the time-lapse data of none.

  FIG. 34-7 shows time-lapse data of EGFP-N1.

  FIG. 34-8 shows the time course data of AP1.

  FIG. 34-9 shows the time course data of AP1 (PMA).

  Figure 34-10 shows CRE data over time.

  Figure 34-11 shows the time course data of E2F.

  Figure 34-12 shows time-lapse data of ERE.

  Figure 34-13 shows data over time for GAS.

  Figure 34-14 shows data over time for GRE.

  Figure 34-15 shows time-lapse data for HSE.

  Figure 34-16 shows ISRE time course data.

  Figure 34-17 shows none time-lapse data.

  Figures 34-18 show time-lapse data of ERE.

  Figures 34-19 show data over time for GAS.

  Figure 34-20 shows time-lapse data of GRE.

  FIGS. 34-21 show HSE data over time.

  Figure 34-22 shows the time-lapse data of ISRE.

  FIG. 34-23 shows data over time for Myc.

  Figures 34-24 show NFAT data over time.

  Figures 34-25 show NFkB data over time.

  Figures 34-26 show time-lapse data of RARE.

  Figures 34-27 show the time course data of Rb.

  Figure 34-28 shows data over time for none.

  Figures 34-29 show time-lapse data for Myc.

  Figure 34-30 shows NFAT data over time.

  Figures 34-31 show time-lapse data of NFkB.

  Figures 34-32 show RARE data over time.

  Figures 34-33 show time-lapse data of Rb.

  Figures 34-34 show time-lapse data for STAT3.

  Figures 34-35 show time-lapse data of SRE.

  Figures 34-36 show data over time for TRE.

  Figures 34-37 show p53 time course data.

  Figures 34-38 show time-lapse data for Caspase3.

  Figures 34-39 show data over time for none.

  Figures 34-40 show time-lapse data for STAT3.

  Figures 34-41 show time-lapse data of SRE.

  Figures 34-42 show data over time for TRE.

  Figures 34-43 show p53 time course data.

  Figures 34-44 show time-lapse data of Caspase3.

  Figures 34-45 show time-lapse data of CREB-EGFP.

  Figures 34-46 show time-lapse data of IkB-EGFP.

  Figures 34-47 show time course data of pp53-EGFP.

  Figures 34-48 show data over time for none.

  Figures 34-49 show time-lapse data of none.

  Figures 34-50 show data of none over time.

  Figures 34-51 show time-lapse data of CREB-EGFP.

  Figure 34-52 shows time course data of IkB-EGFP.

  Figure 34-53 shows time course data for pp53-EGFP.

  Figures 34-54 show data over time for none.

  Figures 34-55 show time-dependent data for none.

  In the above, “none” indicates a negative control.

  As described above, it was possible to simultaneously acquire data over time for various genes.

(Example 6: Anticancer agent)
In this example, cisplatin was mixed with a medium as an example of an anticancer agent and exposed to cells. As the concentration used, 1 μM, 5 μM, 10 μM and the like were appropriately adopted to observe the cell reaction. Cisplatin was applied to cisplatin-resistant cells and sensitive cells, and the time-lapse profile was observed in the same manner as in the above-described Examples. As a result, it was revealed that the time-lapse profile fluctuated significantly due to the difference in cisplatin concentration and tolerance / sensitivity.

(Example 7: RNAi transfection microarray)
Arrays were made as described in Example 3. As genetic material, plasmid DNA and shRNA were mixed and used. The composition is shown in Table 2 below.

  The results are shown in FIG. Data obtained by quantifying the results in this figure are summarized in FIGS. 36A to 36E for five types of cells.

  Thus, it has been found that the technique of the present invention can be applied regardless of the type of cells used.

(Example 8: RNAi microarray = when siRNA is used)
Using a protocol similar to that in Example 3, an RNAi transfection microarray was constructed this time using siRNA instead of shRNA.

  28 types of siRNA for each transcription factor were synthesized using 18 types of transcription factor reporters and actin promoter vectors in Table 3. As a control, siRNA against EGFP was used to evaluate whether siRNA knocks down the target transcription factor. As a negative control, scrambled RNA was used to evaluate these ratios.

  After solid phase transfection into each cell, the cells were cultured for 2 days, and after acquiring images with a fluorescence image scanner, the amount of fluorescence was quantified.

(result)
The results are shown in FIG. A summary of the results for each gene is shown in FIGS.

  As is clear from FIGS. 37 and 38A to 38D, it was shown that the expression of each gene was specifically suppressed when RNAi was used. It has been found that an array of a plurality of genetic materials using RNAi can be realized, and the effect of RNAi on cells can be analyzed over time.

(Example 9: Transfection array using PCR fragments)
Next, it was demonstrated that the present invention can be realized even when PCR fragments are used as genetic material. The procedure is shown below.

  Nucleic acid fragments as shown in FIG. 39 were obtained by PCR and used as genetic material for use in the transfection microarray. The procedure is shown below.

As PCR primers,
PEGFP-N1 was used as a template using GG ATAACCGTAT TACCGCCATG CAT (SEQ ID NO: 12) and CCCTATCTCGTCTCATTCTTTTG CAAAAGATAATA GACCGAGATA GGG (SEQ ID NO: 13) (see FIG. 40). The conditions of PCR are as shown in the table.

Cycle conditions: 94 ° C. for 2 minutes → (94 ° C., 15 seconds → 60 ° C., 30 seconds → 68 ° C., 3 minutes) → 4 ° C. (30 cycles in parentheses).

  The obtained PCR fragment was subjected to phenol / chloroform extraction and purified by ethanol precipitation. The sequence of the PCR fragment is

It is as described in.

  MCF7 was seeded on a chip produced using this, and images were acquired with a fluorescence image scanner two days later. The result is shown in FIG. In FIG. 41, the circular DNA and the PCR fragment are compared. In both cases, transfection was successful, and it was revealed that even when PCR fragments were used as genetic material, the cells were transfected in the same manner as the full-length plasmid, and the cells could be analyzed over time.

(Example 10: Regulation of gene expression using a tetracycline-dependent promoter)
Similar to the above example, it was demonstrated that a gene expression regulation can be generated as a profile using a tetracycline-dependent promoter. The sequences used are as follows.

  As the tetracycline-dependent promoter (and its gene vector construct), the pTet off and pTeton vector systems (BD Biosciences) were used (see http://www.clontech.com/techinfo/vectors/cattet.sml). . The vector used was pTRE-d2EGFP (SEQ ID NO: 29) (described in http://www.clontech.com/techinfo/vectors/vectorsT-Z/pTRE-d2EGFP.shtml).

pTet-Off (BD Clonetech K1620-A)
Fragment containing the P _CMV: 86-673
Tetracycline-responsive transcriptional activator (tTA): 774-1781
Col E1 origin of replication: 2604-3247
Ampicillin resistance gene: β-lactamase coding sequence: 4255-3395
SV40 poly A signal-containing fragment: 1797-2254
Neomycin / kanamycin resistance gene: 6462-5668
SV40 promoter (P _SV40 ) that controls expression of the neomycin / kanamycin resistance gene: 7125-6782
pTet-ON (BD Clonetech K1621-A)
Fragment containing the P _CMV: 86-673
Reverse tetracycline-responsive transcriptional activator (rtTA): 774-1781
pUC origin of replication: 2604-3247
Ampicillin resistance gene: β-lactamase coding sequence: 4255-3395
SV40 poly A signal-containing fragment: 1797-2254
Neomycin / kanamycin resistance gene: 6462-5668
SV40 promoter (P _SV40 ) that controls expression of the neomycin / kanamycin resistance gene: 7125-6782
pTRE-d2EGFP (BD Clonetech 6242-1)
PhCMV _{* -1} Tet responsive promoter: 1-438
Tet responsive element (TRE): 1-318
7 tetO 18mer positions: 15-33; 57-75; 99-117; 141-159; 183-201; 225-243; and 257-275
P _minCMV- containing fragment: 319-438
TATA box 341-348
Instability promoting green fluorescent protein (d2EGFP) gene start codon: 445-447; stop codon: 1288-1290
Insertion of Val at position 2: 448-450
GFPmut1 mutation (Phe-64-Leu, Ser-65-Thr): 634-639
His-231-Leu: 1137
Mouse ornithine decarboxylase (MODC) PEST sequence: 1167-1290
SV40 poly A signal-containing fragment: 1330-1787 (poly A signal: approximately the same coordinates as 1448-1453)
Col E1 replication origin fragment: 2137-2780
Ampicillin resistance gene β-lactamase coding sequence: 2928-3788
Start codon: 3788-3786
Stop codon: 2928-2930
(protocol)
PTet off and pTet on (SEQ ID NOs: 26 and 27) were printed on the array substrate, and it was measured in real time whether gene expression was regulated by tetracycline on the same substrate. The result is shown in FIG. As shown in FIG. 42, changes in gene expression were measured only with dependent promoters. In FIG. 43, the actual state of the expression in independence and dependence is shown as a photograph. In this way, the change can be measured so that it can be compared with the naked eye.

(Measurement of profile data)
Based on images acquired in real time, graph changes in intensity per cell and area, and after applying primary transformations such as noise removal, apply multivariate analysis and signal processing methods to present profile data Can do. By comparing this for each phenomenon and for each cell, it is possible to obtain cell-specific responses and identities.

(Example 11: Gene expression)
Next, cell profiles were created using nucleic acid molecules encoding structural genes. Here, the olfactory receptor I7 (SEQ ID NOs: 15 and 16) was used as the structural gene. The protocol was in accordance with the above example.

  As a result, it was demonstrated that a cell profile can be created by measuring the amount of a gene product and the like, similar to a promoter.

(Example 12: Apoptosis signal)
Next, it was investigated that a cell profile could be created even by monitoring the activation of caspase 3 in the cell. Transfections and array preparations were performed as in the above examples.

  Here, pCaspase3-Sensor Vector (BD Biosciences Clontech, 1020 East Meadow Circle, Palo Alto, CA 94303; catalog number 8185-1) was used to monitor caspase 3, which is an apoptotic signal.

  As a result, it was demonstrated that a cellular profile can be created by measuring apoptotic signals and the like, similar to a promoter.

(Example 13: Stress signal)
Next, it was examined that apoptotic signals such as JNK, ERK, and p38 in cells can be used to create cell profiles for stress signals using transcription factor reporters. Transfections and array preparations were performed as in the above examples.

  Here, stress signals JNK, ERK, and p38 were monitored using pAP1-EGFP, pCRE-EGFP, and pSRE-EGFP obtained from BD Bioscience Clontech.

  As a result, it was demonstrated that a cell profile can be created by measuring a stress signal or the like, as in the above-described example.

(Example 14: Molecular localization)
Next, it was demonstrated that a fluorescent protein can be fused to a gene of interest to visualize its expression profile and intracellular localization.

  Here, GFP, RFP, CFP, and BFP were used as fluorescent proteins, KIAA clones, cDNA libraries, and the like were used as target genes, and gene constructs were prepared using these. Specifically used are as follows.

KIAA cDNA clone (available from KIAA = Kazusa DNA Research Institute, Kazusa, Chiba)
Invitrogen cDNA commercial library. Transfections and array preparation were performed as described in the previous examples.

  Here, KIAA1474 of the KIAA clones was used to monitor expression profile and localization.

  As a result, it was demonstrated that a cell profile can be created for an intended index using a gene construct intentionally constructed, as in the above-described Examples.

(Example 15: Cell shape change)
Next, a gene is expressed or knocked down, or a profile is generated that changes the cell morphology of an additive (here, glycerophosphate is used as a chemical and dexamethasone is used as a cytokine) Prove that it can. As cell morphology, cell multinucleation, extension state, extension of extension process, etc. were acquired and analyzed as three-dimensional data.

  Here, the specific sequence of the introduced nucleic acid molecule is as follows.

KIAA clone (supra); and RNAi for transcription factors (CBFA-1, AP1).

  Transfections and array preparations were performed as in the above examples.

  Here, using the mesenchymal stem cells used in the above-described Examples, the cell morphology when inducing osteoblast differentiation was monitored.

  As a result, it was demonstrated that a cell profile can be created for an intended index using a gene construct intentionally constructed, as in the above-described Examples. Then, based on the profile data, an event descriptor can be created by using processing such as that used in the above embodiment.

(Example 16: Intermolecular interaction)
Next, it was demonstrated that cell profiles can be generated using techniques such as two-hybrid systems, FRET, and BRET.

  Here, the specific sequence of the introduced nucleic acid molecule is as follows.

Olfactory receptor (SEQ ID NO: 15-18) and G protein (SEQ ID NO: 19-24)
Transfections and array preparations were performed as in the above examples.

  Here, dissociation of the olfactory receptor and G protein was monitored by induction of odorous substances, and this was used as a change in fluorescence wavelength to monitor cells.

  The two-hybrid system, FRET, and BRET used here were specifically performed as follows.

  The two-hybrid system was available from Clontech (http://www.clontech.co.jp/product/catalog/0070030006.shtml). FRET and BRET were measured using equipment available from Bertoled Japan.

  As a result, it was demonstrated that a cell profile can be created by a two-hybrid system, FRET, BRET, and the like using a gene construct intentionally constructed, as in the above-described Examples.

(Example 17: Micro RNA)
Next, a cellular profile is created using nucleic acid molecules encoding microRNA (miRNA). Here, miRNA-23 is used as miRNA. The protocol conforms to the above embodiment.

  MicroRNA is a small non-coding RNA of 18-25 bases (RNA that is not protein-translated) and has been found for the first time in nematodes and has been found to be widely conserved in animals and plants. In nematodes and plants, it has been reported that miRNAs are involved in development and differentiation, and similar functions have been suggested in animals. To date, over 200 types of miRNA have been reported.

  In Nature 423, 838-842 (2003), it is reported that the target of miRNA-23 is the Hes1 (repressor transcription factor that suppresses differentiation of stem cells into neurons) gene. miRNA-23 is present near the translation termination codon of this gene and forms incomplete complementary base pairs (77%). This incomplete complementary base pair is important for the function of miRNA, and it has been found that the expression of Hes1 is suppressed when synthetic miR-23 is actually introduced into human embryonic tumor cell NT2 cells. Such activity can also be knocked down using siRNA or the like.

  Based on this principle, an miRNA as shown in SEQ ID NO: 25 was actually prepared.

  Using such a system, it is demonstrated that a cell profile can be created by generating a miRNA behavior profile and measuring the amount of the relevant gene product and the like.

Example 18: Biological system-ribozyme
Next, a cell profile is created using ribozymes. Here, a ribozyme as described in 305 YAKUGAKU ZASSHI 123 (5) 305-313 (2003) is used as a ribozyme. The protocol conforms to the first embodiment.

  Ribozymes are discovered because Tetrahymena group I introns catalyze site-specific cleavage and binding reactions of RNA strands and refer to RNAs having such enzymatic activity. Examples of ribozymes include hammerhead ribozymes and hairpin ribozymes.

  Using such a system, it is demonstrated that a profile of a cell can be created by generating a profile of ribozyme behavior and measuring the amount of related gene transcription, gene product, and the like.

  As mentioned above, although this invention has been illustrated using preferable embodiment of this invention, this invention should not be limited and limited to this embodiment. It is understood that the scope of the present invention should be construed only by the claims. It is understood that those skilled in the art can implement an equivalent range based on the description of the present invention and the common general technical knowledge from the description of specific preferred embodiments of the present invention. Patents, patent applications, and documents cited herein should be incorporated by reference in their entirety, as if the contents themselves were specifically described herein. Understood.

  The present invention has made it possible to determine the cell state by observing surprisingly few factors. Such determination makes it possible to apply to diagnosis, prevention, and treatment, and the application range covers not only medical treatment but also various fields such as food, cosmetics, agriculture, and environment.

FIG. 1 shows an example of the results using various actin acting substances and gelatin as a control when HEK293 cells are used. FIG. 1 shows the effect of each adherent on transfection efficiency (HEK cells). HEK cells were transfected with pEGFP-N1 using Effectene reagent. FIG. 2 shows an example of the results of transfection efficiency when a fibronectin fragment was used. FIG. 3 shows an example of the results of transfection efficiency when a fibronectin fragment was used. FIG. 4 shows an example of the results of transfection efficiency when the fibronectin fragments summarized from FIGS. 2 and 3 were used. FIG. 5 shows an example of the results of examining the transfection efficiency in various cells. FIG. 6 shows an example of the results showing the state of transfection using various plates. FIG. 7 shows the results when transfection was performed on various plates with fibronectin concentrations of 0, 0.27, 0.53, 0.8, 1.07 and 1.33 (μg / μL, respectively). Show. FIG. 7 shows the effect of fibronectin concentration and surface modification on the transfection of HEK293 cells. Data show 4 different averages. FIG. 8 shows an example of a photograph showing a cell adhesion profile with and without fibronectin. FIG. 9 shows an example of a section photograph showing a cell adhesion profile with and without fibronectin. A section of human mesenchymal stem cells (hMSC) was observed using a confocal scanning microscope. hMSCs were stained with SYTO61 (blue fluorescence) and Texas red-x phalloidin (red fluorescence) and fixed with 4% PFA. Blue fluorescence (nucleus: SYTO61) and red fluorescence (nucleus: Texas red-x phalloidin) were observed using a confocal scanning microscope (LSM510, Carl Zeiss Co., Ltd., pinhole size = 1.0, image). Interval = 0.4). FIG. 10 shows the transition of the surface area of the nucleus. Relative nuclear surface area was determined by hMSC sections observed with a confocal scanning microscope. hMSCs were fixed with 4% PFA. FIG. 11 shows an example of the result of a transfection experiment when constructed and used as a transfection array chip. FIG. 12 is an example showing a state of contamination between spots on the array. 13A and 13B are diagrams showing the uptake of DNA spatially separated by solid phase transfection of the present invention in Example 4 into cells. FIG. 13A is a diagram schematically showing a method for preparing a solid phase transfection array (SPTA). This figure shows the solid phase transfection methodology. 13A and 13B are diagrams showing the uptake of DNA spatially separated by solid phase transfection of the present invention in Example 4 into cells. FIG. 13B shows the results of solid phase transfection. The result of producing SPTA using HEK293 cell line is shown. The green part shows transfected adherent cells. From this result, the method of the present invention made it possible to prepare a population of cells that were spatially separated and transfected with different genes. FIG. 13C shows the difference between conventional liquid phase transfection and SPTA. FIG. 14A and FIG. 14B are results showing a comparison between solution phase transfection and SPTA. FIG. 14A shows the results of measuring GFP intensity / mm ² for the five cell lines used in the experiment. FIG. 14A shows a method for determining transfection efficiency as total fluorescence intensity per unit area. FIG. 14A and FIG. 14B are results showing a comparison between solution phase transfection and SPTA. FIG. 14B is a fluorescence image of cells expressing EGFP corresponding to the data shown in FIG. 14A. In FIG. 14B, a region indicated by a white circle indicates a region where plasmid DNA is immobilized. In the region other than the region where the plasmid DNA was immobilized, cells expressing EGFP were not observed even though the cells were immobilized on the solid phase. The white bar indicates 500 μm. FIG. 14C shows an example of the transfection method of the present invention. FIG. 14D shows an example of the transfection method of the present invention. FIG. 15A and FIG. 15B show the result of reduced mutual contamination by chip coating. FIGS. 15A and 15B show the results of solution phase transfection and SPTA using HEK293 cells, HeLa cells, NIT3T3 cells (shown as “3T3”), HepG2 cells, and hMSC. Transfection efficiency is expressed as GFP intensity. FIG. 15A and FIG. 15B show the result of reduced mutual contamination by chip coating. FIGS. 15A and 15B show the results of solution phase transfection and SPTA using HEK293 cells, HeLa cells, NIT3T3 cells (shown as “3T3”), HepG2 cells, and hMSC. Transfection efficiency is expressed as GFP intensity. FIG. 16A and FIG. 16B are diagrams showing a state related to mutual contamination between spots. As a result of immobilizing a nucleic acid mixture containing a predetermined concentration of fibronectin on a chip coated with APS or PLL (poly-L-lysine) and cell transfection using the immobilized chip, mutual contamination was observed. None (upper and interrupted). On the other hand, when the chip was not coated, significant mutual contamination of the immobilized nucleic acid was observed (lower row). FIG. 16A and FIG. 16B are diagrams showing a state related to mutual contamination between spots. As a result of immobilizing a nucleic acid mixture containing a predetermined concentration of fibronectin on a chip coated with APS or PLL (poly-L-lysine) and cell transfection using the immobilized chip, mutual contamination was observed. None (upper and interrupted). On the other hand, when the chip was not coated, significant mutual contamination of the immobilized nucleic acid was observed (lower row). FIG. 16C and FIG. 16D show the correlation between the type of substance used in the mixture used in immobilization of nucleic acid and the cell adhesion rate. The graph in FIG. 16D shows an increase in the percentage of adherent cells over time. When the slope of the graph is gentle, it indicates that more time is required for cell adhesion than when the slope of the graph is steep. FIG. 16C and FIG. 16D show the correlation between the type of substance used in the mixture used in immobilization of nucleic acid and the cell adhesion rate. The graph in FIG. 16D shows an increase in the percentage of adherent cells over time. When the slope of the graph is gentle, it indicates that more time is required for cell adhesion than when the slope of the graph is steep. FIG. 17 shows a configuration example when the method of the present invention is executed in a computer. 18A and 18B show an example of the mathematical analysis method of the present invention. A promoter profile was obtained by measuring changes in fluorescence intensity. The profile was normalized using cell or medium specific fluorescence. Thereafter, the amplitudes of the reporter expression waves were compared, where an expression wave having an amplitude of 5 or greater (TH ≧ 5) was considered to indicate the presence of a change. After the differentiation induction was started, the above measurement was performed during the initial period (0 hour to 17.5 hours) and the late period (17.5 hours to 31.5 hours) and the entire time period (0 hours to 31.5 hours). Expression variation having an amplitude of 5 or more (TH ≧ 5) is represented by (+), and expression variation having an amplitude of less than 5 (TH <5) is represented by (−). When extracting an arbitrary reporter (A + B + ... + n), n waves were integrated and the sum was divided by n to form an average wave. Waves above the threshold were considered changes. In FIG. 18B, the two reporter profiles are integrated and the average profile is shown in red. Waves with an average profile of 5 or more were considered expression waves. Waves can be detected by two reporters. 18A and 18B show an example of the mathematical analysis method of the present invention. A promoter profile was obtained by measuring changes in fluorescence intensity. The profile was normalized using cell or medium specific fluorescence. Thereafter, the amplitudes of the reporter expression waves were compared, where an expression wave having an amplitude of 5 or greater (TH ≧ 5) was considered to indicate the presence of a change. After the differentiation induction was started, the above measurement was performed during the initial period (0 hour to 17.5 hours) and the late period (17.5 hours to 31.5 hours) and the entire time period (0 hours to 31.5 hours). Expression variation having an amplitude of 5 or more (TH ≧ 5) is represented by (+), and expression variation having an amplitude of less than 5 (TH <5) is represented by (−). When extracting an arbitrary reporter (A + B + ... + n), n waves were integrated and the sum was divided by n to form an average wave. Waves above the threshold were considered changes. In FIG. 18B, the two reporter profiles are integrated and the average profile is shown in red. Waves with an average profile of 5 or more were considered expression waves. Waves can be detected by two reporters. FIG. 19 shows an example of a promoter-containing plasmid used in the present invention and an example of the analysis of the present invention. FIG. 20 shows an example of a mathematical analysis result in the early stage of differentiation induction. The results were obtained by changing the combination of arbitrarily extracted reporters in the early stages of differentiation induction. An arbitrary number of reporters were extracted from the 17 reporters. The average profile was determined by the method shown in FIGS. 18A and 18B. Profiles having a wave amplitude of 5 or more were evaluated at intervals of 0-31.5 hours, 0-17.5 hours, and 17.5-31.5 hours. Under each extraction condition, the number of extractions was 17 (an exemplary combination with 17 extractions is shown). FIG. 18A and FIG. 18B show the ratios of combinations that are considered to generate waves. By analysis, differentiation induction was not detected at an early stage, but was detected after 15 hours. The number of reporters extracted was 8, and the ratio of the combinations that surely generated waves was 100%. FIG. 21 shows an example of a mathematical analysis result in maintaining undifferentiation. The arbitrarily extracted reporter was changed under undifferentiated state maintenance conditions. The result was significantly different from the case where differentiation induction was performed in FIG. By comparing with FIG. 20, it is considered possible to determine whether a cell is induced to differentiate or is maintained in an undifferentiated state. FIG. 22 shows a schematic diagram of the cocktail party process. FIG. 23 shows a construction example of a gene transcription switch reporter (transfection plasmid used in the present invention). FIG. 24 shows an example of construction of a transcription factor reporter set. FIG. 25 shows an example of a transcription factor reporter assay. FIG. 26 shows an example of time-dependent measurement of transcription factor activity during the bone differentiation process. Human mesenchymal stem cells (available from Osiris) and hMSC Osteogenic SingleQuots (available from BioWhittaker) were used for the measurements. FIG. 27 shows an example of oscillation phenomenon and phase analysis of transcription factor activity. FIG. 28 shows an example of a cell real-time measurement apparatus. FIG. 29 shows an enlarged schematic diagram of the cell measuring apparatus. FIG. 30 shows an exemplary scheme for cell measurement. FIG. 31 shows an example of a grid array used in the present invention. The gene name used is shown below. FIG. 32 shows raw data obtained using a grid array in the present invention. FIG. 33A shows a graph of raw data obtained in Example 5. The horizontal axis represents fluorescence intensity (Arbitrary Unit), and the horizontal axis represents time (unit: minutes). The genes used were pEGFP-N1, pAP1-EGFP, pAP1 (PMA) -EGFP, pE2F-EGFP, pGAS-EGFP, pHSE-EGFP, pMyc-EGFP, pNFkB-EGFP, pRb-EGFP, pSRE-P EGFP, pCRE-EGFP, pERE-EGFP, pGRE-EGFP, pISRE-EGFP, pNFAT-EGFP, pRARE-EGFP, pSTAT3-EGFP, pTRE-EGFP, pCREB-EGFP, pIkB-EGFP, pIkB-p53 pCaspase3-Sensor. 33B to 33E show raw data of data acquired in the fifth embodiment. 33B to 33E show raw data of data acquired in the fifth embodiment. 33B to 33E show raw data of data acquired in the fifth embodiment. 33B to 33E show raw data of data acquired in the fifth embodiment. 33F to 33I show calculation results after polynomial approximation of the data acquired in the fifth embodiment. 33F to 33I show calculation results after polynomial approximation of the data acquired in the fifth embodiment. 33F to 33I show calculation results after polynomial approximation of the data acquired in the fifth embodiment. 33F to 33I show calculation results after polynomial approximation of the data acquired in the fifth embodiment. 33J to 33U show data after first-order differentiation and second-order differentiation of the data acquired in the fifth embodiment. 33J to 33U show data after first-order differentiation and second-order differentiation of the data acquired in the fifth embodiment. 33J to 33U show data after first-order differentiation and second-order differentiation of the data acquired in the fifth embodiment. 33J to 33U show data after first-order differentiation and second-order differentiation of the data acquired in the fifth embodiment. 33J to 33U show data after first-order differentiation and second-order differentiation of the data acquired in the fifth embodiment. 33J to 33U show data after first-order differentiation and second-order differentiation of the data acquired in the fifth embodiment. 33J to 33U show data after first-order differentiation and second-order differentiation of the data acquired in the fifth embodiment. 33J to 33U show data after first-order differentiation and second-order differentiation of the data acquired in the fifth embodiment. 33J to 33U show data after first-order differentiation and second-order differentiation of the data acquired in the fifth embodiment. 33J to 33U show data after first-order differentiation and second-order differentiation of the data acquired in the fifth embodiment. 33J to 33U show data after first-order differentiation and second-order differentiation of the data acquired in the fifth embodiment. 33J to 33U show data after first-order differentiation and second-order differentiation of the data acquired in the fifth embodiment. FIGS. 34-1 to 34-55 show the raw data obtained in Example 5 for each gene (the negative control is represented by “none”). FIG. 34-1 shows the time-lapse data of EGFP-N1. FIG. 34-2 shows the time course data of AP1. FIG. 34-3 shows the temporal data of AP1 (PMA). FIG. 34-4 shows CRE data over time. Figure 34-5 shows the time course data for E2F. FIG. 34-6 shows time-lapse data for none (none). FIG. 34-7 shows time-lapse data of EGFP-N1. Figure 34-8 shows further time course data for AP1. Figure 34-9 shows further time course data for AP1 (PMA). Figure 34-10 shows further time-lapse data for CRE. Figures 34-11 show additional time course data for E2F. Figure 34-12 shows time-lapse data of ERE. Figure 34-13 shows data over time for GAS. Figure 34-14 shows data over time for GRE. Figure 34-15 shows time-lapse data for HSE. Figure 34-16 shows ISRE time course data. Figures 34-17 show further time-lapse data of none (none). Figures 34-18 show additional time-lapse data for ERE. Figures 34-19 show further time-lapse data for GAS. Figure 34-20 shows further time-lapse data for GRE. FIGS. 34-21 show HSE data over time. Figure 34-22 shows the time-lapse data of ISRE. FIG. 34-23 shows data over time for Myc. Figures 34-24 show NFAT data over time. Figures 34-25 show NFkB data over time. Figures 34-26 show time-lapse data of RARE. Figures 34-27 show the time course data of Rb. Figures 34-28 show further time-lapse data of none (none). Figures 34-29 show time-lapse data for Myc. Figures 34-30 show additional time course data for NFAT. Figures 34-31 show further time course data for NFkB. Figures 34-32 show further time-lapse data for RARE. Figures 34-33 show further time course data for Rb. Figures 34-34 show time-lapse data for STAT3. Figures 34-35 show time-lapse data of SRE. Figures 34-36 show data over time for TRE. Figures 34-37 show p53 time course data. Figures 34-38 show time-lapse data for Caspase3. Figures 34-39 show further time-lapse data of none (none). Figures 34-40 show time-lapse data for STAT3. Figures 34-41 show further time-lapse data of SRE. Figures 34-42 show further time-lapse data for TRE. Figures 34-43 show additional time course data for p53. Figures 34-44 show further time course data for Caspase3. Figures 34-45 show time-lapse data of CREB-EGFP. Figures 34-46 show time-lapse data of IkB-EGFP. Figures 34-47 show time course data of pp53-EGFP. Figures 34-48 show further time-lapse data of none. Figures 34-49 show further time-lapse data for none. Figures 34-50 show further time-lapse data for none. Figures 34-51 show additional time-lapse data for CREB-EGFP. Figures 34-52 show further time course data of IkB-EGFP. Figures 34-53 show further time course data for pp53-EGFP. Figures 34-54 show further time-lapse data for none. Figures 34-55 show further time-lapse data for none. FIG. 35 shows the transfection results of the RNAi transfection array in Example 7. Each reporter gene is printed on a solid phase substrate so that there are 4 spots per gene, and after drying, siRNA (28 types) for each transcription factor is printed on the coordinates where the corresponding reporter genes are printed. , Dried. Moreover, siRNA for EGFP was used as a control, and scramble RNA was used as a negative control. Thereafter, LipofectAMINE2000 was printed on the same coordinates as each gene print and dried. Thereafter, the fibronectin solution was printed on the same coordinates and dried. HeLa-K cells were seeded on this and cultured for 2 days, and then images were acquired with a fluorescent image scanner. 36A to 36E show the transfection results of the RNAi transfection array in Example 7 for each cell. After quantifying the fluorescence intensity of each reporter by image analysis, the ratio to the intensity of each reporter printed with scrambled RNA as a negative control was calculated. The results are shown for all reporters and cells. D: pDsRed2-1 (promoter-free vector: negative control for shRNA). G: pEGEP-N1 (green fluorescent protein expression vector: shRNA target gene used herein). sh: pPUR6iGFP272 (vector RNAi that suppresses the expression of the EGFP gene). D + G etc .: D is printed before G is printed (printing order is written). D + G (7: 3) etc .: D to G ratio, where the total amount of D gene and G gene was 2 μg, and the D gene to G gene ratio was 7: 3. 36A to 36E show the transfection results of the RNAi transfection array in Example 7 for each cell. After quantifying the fluorescence intensity of each reporter by image analysis, the ratio to the intensity of each reporter printed with scrambled RNA as a negative control was calculated. The results are shown for all reporters and cells. D: pDsRed2-1 (promoter-free vector: negative control for shRNA). G: pEGEP-N1 (green fluorescent protein expression vector: shRNA target gene used herein). sh: pPUR6iGFP272 (vector RNAi that suppresses the expression of the EGFP gene). D + G etc .: D is printed before G is printed (printing order is written). D + G (7: 3) etc .: D to G ratio, where the total amount of D gene and G gene was 2 μg, and the D gene to G gene ratio was 7: 3. 36A to 36E show the transfection results of the RNAi transfection array in Example 7 for each cell. After quantifying the fluorescence intensity of each reporter by image analysis, the ratio to the intensity of each reporter printed with scrambled RNA as a negative control was calculated. The results are shown for all reporters and cells. D: pDsRed2-1 (promoter-free vector: negative control for shRNA). G: pEGEP-N1 (green fluorescent protein expression vector: shRNA target gene used herein). sh: pPUR6iGFP272 (vector RNAi that suppresses the expression of the EGFP gene). D + G etc .: D is printed before G is printed (printing order is written). D + G (7: 3) etc .: D to G ratio, where the total amount of D gene and G gene was 2 μg, and the D gene to G gene ratio was 7: 3. 36A to 36E show the transfection results of the RNAi transfection array in Example 7 for each cell. After quantifying the fluorescence intensity of each reporter by image analysis, the ratio to the intensity of each reporter printed with scrambled RNA as a negative control was calculated. The results are shown for all reporters and cells. D: pDsRed2-1 (promoter-free vector: negative control for shRNA). G: pEGEP-N1 (green fluorescent protein expression vector: shRNA target gene used herein). sh: pPUR6iGFP272 (vector RNAi that suppresses the expression of the EGFP gene). D + G etc .: D is printed before G is printed (printing order is written). D + G (7: 3) etc .: D to G ratio, where the total amount of D gene and G gene was 2 μg, and the D gene to G gene ratio was 7: 3. 36A to 36E show the transfection results of the RNAi transfection array in Example 7 for each cell. After quantifying the fluorescence intensity of each reporter by image analysis, the ratio to the intensity of each reporter printed with scrambled RNA as a negative control was calculated. The results are shown for all reporters and cells. D: pDsRed2-1 (promoter-free vector: negative control for shRNA). G: pEGEP-N1 (green fluorescent protein expression vector: shRNA target gene used herein). sh: pPUR6iGFP272 (vector RNAi that suppresses the expression of the EGFP gene). D + G etc .: D is printed before G is printed (printing order is written). D + G (7: 3) etc .: D to G ratio, where the total amount of D gene and G gene was 2 μg, and the D gene to G gene ratio was 7: 3. FIG. 37 shows the transfection results of the RNAi transfection array in Example 8. Each reporter gene expression unit PCR fragment shown on the solid phase substrate is printed so that there are 4 spots per gene, and after drying, reporter genes corresponding to siRNA (28 types) for each transcription factor are printed. Printed on the coordinates and dried. Moreover, siRNA for EGFP was used as a control, and scrambled RNA was used as a negative control. Thereafter, LipofectAMINE2000 was printed on the same coordinates as each gene print and dried. Thereafter, the fibronectin solution was printed in the same coordinates. HeLa-K cells were seeded on this and cultured for 2 days, and then images were acquired with a fluorescent image scanner. 38A to 38D show the transfection results of the RNAi transfection array in Example 7 for each cell. After quantifying the fluorescence intensity of each reporter by image analysis, the ratio to the intensity of each reporter printed with scrambled RNA as a negative control was calculated. This shows the results of all the reporters for each cell. 38A to 38D show the transfection results of the RNAi transfection array in Example 7 for each cell. After quantifying the fluorescence intensity of each reporter by image analysis, the ratio to the intensity of each reporter printed with scrambled RNA as a negative control was calculated. This shows the results of all the reporters for each cell. 38A to 38D show the transfection results of the RNAi transfection array in Example 7 for each cell. After quantifying the fluorescence intensity of each reporter by image analysis, the ratio to the intensity of each reporter printed with scrambled RNA as a negative control was calculated. This shows the results of all the reporters for each cell. 38A to 38D show the transfection results of the RNAi transfection array in Example 7 for each cell. After quantifying the fluorescence intensity of each reporter by image analysis, the ratio to the intensity of each reporter printed with scrambled RNA as a negative control was calculated. This shows the results of all the reporters for each cell. FIG. 39 shows the structure of the PCR fragment obtained in Example 9. FIG. 40 shows the structure of pEGFP-N1. FIG. 41 shows a comparison of transfection efficiency of transfection microarrays using circular DNA and PCR fragments. FIG. 42 shows changes when a tetracycline-dependent promoter is used. FIG. 43 is a diagram showing the state of expression when a tetracycline-dependent promoter and a tetracycline-independent promoter are used. FIG. 44 shows an example of the system configuration of the present invention for generating cell profile data.

(Explanation of sequence listing)
SEQ ID NO: 1: Fibronectin nucleic acid sequence (human)
SEQ ID NO: 2: amino acid sequence of fibronectin (human)
SEQ ID NO: 3: nucleic acid sequence of vitronectin (mouse)
SEQ ID NO: 4: Amino acid sequence of vitronectin (mouse)
SEQ ID NO: 5: Laminin nucleic acid sequence (mouse α chain)
SEQ ID NO: 6: amino acid sequence of laminin (mouse α chain)
SEQ ID NO: 7: Laminin nucleic acid sequence (mouse β chain)
SEQ ID NO: 8: amino acid sequence of laminin (mouse β chain)
SEQ ID NO: 9: Laminin nucleic acid sequence (mouse γ chain)
SEQ ID NO: 10: amino acid sequence of laminin (mouse γ chain)
SEQ ID NO: 11: Amino acid sequence of fibronectin (bovine)
SEQ ID NO: 12: Primer 1 used in Example 9
SEQ ID NO: 13: Primer 2 used in Example 9
SEQ ID NO: 14: PCR fragment obtained by PCR reaction of Example 9 SEQ ID NO: 15: Nucleic acid of mouse olfactory receptor I7 (Heptanal-sensitive) (Genbank accession number (Accession Number) AF106007)
SEQ ID NO: 16: protein encoded by the nucleic acid described in SEQ ID NO: 15 SEQ ID NO: 17: Nucleic acid of mouse olfactory receptor S46 (Genbank accession number AF121979)
SEQ ID NO: 18: Protein encoded by the nucleic acid described in SEQ ID NO: 17 SEQ ID NO: 19: Nucleic acid of mouse G protein α subunit (Genbank accession number M36778)
SEQ ID NO: 20: protein encoded by the nucleic acid described in SEQ ID NO: 19 SEQ ID NO: 21: Nucleic acid of mouse G protein β subunit (Genbank accession number M87286)
SEQ ID NO: 22: Protein encoded by the nucleic acid described in SEQ ID NO: 21 SEQ ID NO: 23: Nucleic acid of mouse G protein γ subunit (Genbank accession number U37527)
SEQ ID NO: 24: protein encoded by the nucleic acid described in SEQ ID NO: 23 SEQ ID NO: 25: Example of miRNA shown in Example 16 SEQ ID NO: 26: Tet-Off sequence used in Example 10 SEQ ID NO: 27: Implementation Sequence of Tet-on used in Example 10 SEQ ID NO: 28: 5 amino acid molecule of laminin (Example 1)
SEQ ID NO: 29: Sequence of pTRE-d2EGFP used in Example 10

Claims (49)

A method for presenting a cell state comprising:
a) obtaining a time profile of the cell by monitoring over time a gene state associated with at least one gene selected from genes derived from the cell; and b) presenting the time profile;
Including the method.   The method of claim 1, further comprising fixing the cells to a solid support.   The method of claim 1, wherein the time profile is presented in real time. The method of claim 1, wherein the gene comprises a transcriptional regulatory sequence and the gene state comprises expression of the gene. A method of determining a cell state,
a) obtaining a time profile of the cell by monitoring over time a gene status associated with at least one gene selected from genes derived from the cell; and b) based on the time profile of the gene status Determining the cell state,
Including the method.   6. The method of claim 5, further comprising fixing the cells to a solid support. 6. The method of claim 5, wherein the gene includes a transcriptional regulatory sequence and the gene state includes expression of the gene.   6. The method of claim 5, further comprising correlating the time course profile and the cellular state prior to obtaining the time course profile.   8. The method of claim 7, wherein the transcription control sequence comprises a selection from the group consisting of promoters, enhancers, silencers, other flanking sequences of structural genes in the genome, and genomic sequences other than exons.   8. The method of claim 7, wherein the transcription control sequence comprises at least one promoter selected from the group consisting of a constitutive promoter, a specific promoter and an inducible promoter.   8. The method of claim 7, wherein the monitored transcription control sequence comprises at least two transcription control sequences.   8. The method of claim 7, wherein the monitored transcription control sequence comprises at least three transcription control sequences.   8. The method of claim 7, wherein the monitored transcription control sequence comprises at least 8 transcription control sequences.   The method according to claim 7, further comprising the step of optionally selecting at least one transcription control sequence from the transcription control sequence.   The method of claim 5, wherein the time profile is presented in real time.   6. The method of claim 5, wherein the state of the cell is selected from the group consisting of a differentiated state, an undifferentiated state, a cellular response to a foreign factor, a cell cycle, and a proliferative state.   6. The method of claim 5, wherein the cell is selected from the group consisting of stem cells and somatic cells.   6. The method of claim 5, wherein the cells are selected from the group consisting of adherent cells, floating cells, tissue forming cells, and mixtures thereof.   The method of claim 6, wherein the solid support comprises a substrate.   8. The method of claim 7, wherein the cell is transfected with a nucleic acid molecule comprising the transcription control sequence and a reporter gene sequence operably linked to the transcription control sequence.   21. The method of claim 20, wherein the transfection is performed on a solid phase or in a liquid phase.   6. The method of claim 5, wherein step b) comprises a mathematical process selected from the group consisting of phase comparison, signal processing method and multivariate analysis of the temporal profile.   6. The method of claim 5, wherein step b) comprises calculating a difference between the time profile of the cell and a control profile. A method for correlating a foreign factor and a cellular response to the foreign factor, the method comprising:
a) exposing the cell to the exogenous factor;
b) obtaining a temporal profile of the cell by monitoring over time a transcriptional state associated with at least one transcriptional regulatory factor selected from the group consisting of transcriptional regulatory factors derived from the cell; and c) Correlating the exogenous factor with the time course profile;
Including the method.   25. The method of claim 24, wherein the cells are immobilized on a solid support.   25. The method of claim 24, further comprising exposing the cells to at least two foreign factors to obtain a time profile of the cells for each of the foreign factors.   27. The method of claim 26, further comprising dividing the at least two time-lapse profiles into types and classifying the exogenous factor corresponding to each time-lapse profile into types.   25. The method of claim 24, wherein the transcriptional regulatory factor comprises a constitutive promoter.   25. The method of claim 24, wherein the transcriptional regulatory factor comprises an inducible promoter.   25. The method of claim 24, wherein the time profile is presented in real time.   25. The method of claim 24, wherein in step c), the exogenous factor is associated with a temporal profile based on the phase of the temporal profile.   25. The method of claim 24, wherein the cells are cultured on an array.   The method of claim 32, wherein step (b) includes obtaining image data from the array.   27. The method of claim 26, wherein (c) comprises distinguishing the phase of the time profile from the phase of another time profile.   25. The exogenous factor is selected from the group consisting of temperature change, humidity change, electromagnetic wave, potential difference, visible light, infrared ray, ultraviolet ray, X-ray, chemical substance, pressure, gravity change, gas partial pressure and osmotic pressure. The method described in 1.   36. The method of claim 35, wherein the chemical substance is a biomolecule, a chemical composition, or a culture medium.   37. The method of claim 36, wherein the biomolecule is selected from the group consisting of nucleic acids, proteins, lipids, sugars, proteolipids, lipoproteins, glycoproteins and proteoglycans.   38. The method of claim 36, wherein the biomolecule is a hormone.   38. The method of claim 36, wherein the biomolecule is a cytokine.   37. The method of claim 36, wherein the biomolecule is a cell adhesion factor.   38. The method of claim 36, wherein the biomolecule is an extracellular matrix.   36. The method of claim 35, wherein the chemical is a receptor agonist or antagonist. A method for estimating an unidentified foreign factor given to a cell based on a temporal profile,
a) exposing the cell to a plurality of known foreign factors;
b) obtaining a temporal profile of the cell for each of the known foreign factors by monitoring over time the transcriptional state associated with at least one transcriptional regulatory factor selected from the group consisting of transcriptional regulators derived from the cell Process;
c) correlating the known foreign factor with each of the time profiles;
d) exposing the cell to the unidentified foreign factor;
e) obtaining a temporal profile of the unidentified foreign factor by monitoring the transcriptional state of the selected transcription control sequence over time;
f) determining a profile corresponding to the time profile obtained in step (e) from the time profile obtained in step (b); and g) the unidentified foreign factor is the step (f Determining the known exogenous factor corresponding to the profile determined in
Including the method. A method for estimating an unidentified foreign factor given to a cell based on a temporal profile,
a) for at least one transcriptional control sequence selected from the transcriptional control sequences present in the cell, data relating to the correlation between the known foreign factor and the time profile of the cell corresponding to the known foreign factor Providing a process;
b) exposing the cell to the unidentified foreign factor;
c) obtaining a temporal profile of the cell by monitoring the transcriptional state associated with the selected transcriptional control sequence over time;
d) determining from the time profile provided in step (a) a profile corresponding to the time profile obtained in step (c); and e) the unidentified foreign factor is the step determining the known exogenous factor corresponding to the determined profile in d);
Including the method. A system for presenting a cell state,
a) means for obtaining a time profile of the cell by monitoring over time the transcriptional state associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; and b ) Means for presenting the time-lapse profile;
A system comprising: A system for determining a cell state,
a) means for obtaining a time profile of the cell by monitoring over time the transcriptional state associated with at least one transcription control sequence selected from the group consisting of transcription control sequences derived from the cell; and b ) Means for determining the cellular state based on the time profile;
A system comprising: A system for correlating a foreign factor with a cellular response to the foreign factor,
a) means for exposing the cells to the exogenous factor;
b) means for obtaining a time profile of the cell by monitoring over time the transcriptional state associated with at least one promoter selected from the group consisting of promoters from the cell; and c) the exogenous factor; Means for correlating the time profile;
A system comprising: A system for estimating an unidentified foreign factor given to a cell based on a temporal profile,
a) means for exposing the cells to a plurality of known foreign factors;
b) obtaining a temporal profile of the cell for each of the known foreign factors by monitoring over time the transcriptional state associated with at least one transcriptional regulatory factor selected from the group consisting of transcriptional regulators derived from the cell Means for:
c) means for correlating the known foreign factor with each of the time profiles;
d) means for exposing the cells to the unidentified foreign factor;
e) means for obtaining a time profile of the unidentified foreign factor by monitoring the transcriptional state of the selected transcription control sequence over time;
f) means for determining a profile corresponding to the time profile obtained by the means (e) from the time profile obtained by the means (b); and g) the unidentified foreign factor is: Means for determining that it is the known foreign factor corresponding to the profile determined in said means (f);
A system comprising: A system for estimating an unidentified foreign factor given to a cell based on a temporal profile,
a) for at least one transcriptional control sequence selected from the transcriptional control sequences present in the cell, data relating to the correlation between the known foreign factor and the time profile of the cell corresponding to the known foreign factor Means for providing;
b) means for exposing the cells to the unidentified foreign factor;
c) means for obtaining a time profile of the cell by monitoring the transcriptional state associated with the selected transcription control sequence over time;
d) a means for determining a profile corresponding to the time profile obtained in the means (c) from the time profile obtained in the means (a); and e) the unidentified foreign factor is: Means for determining the known exogenous factor corresponding to the determined profile in said means d);
A system comprising: