JP2006166759A - Method and apparatus for collecting data predicting senile pneumonia onset risk - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To solve the problem that although senile pneumonia has increased along with the change in Japan's social environment and increase in elderly population, prediction of the onset risk has been difficult so far. <P>SOLUTION: A method for collecting data predicting senile pneumonia onset risk of a subjects is provided, which comprises determining the repetition number of GT repetitive sequences located upstream of a gene encoding heme oxygenase-1 as the onset factor of senile pneumonia. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

The present invention relates to a method for collecting data for predicting the risk of developing senile pneumonia.

Senile pneumonia is increasing with changes in Japan's social environment and aging. Elderly pneumonia, unlike pneumonia in young people, has a high mortality rate even with the progress of antibiotics. Elucidation of factors and prevention methods is urgent.

Although cerebrovascular disorder is considered to be a major risk factor for senile pneumonia, environmental factors such as smoking, complications such as hyperlipidemia, and genetic factors that are likely to cause arteriosclerosis are involved in the development of senile pneumonia. It is estimated that

As an etiology of senile pneumonia, an angiotensin converting enzyme gene polymorphism has been reported.

However, since these gene polymorphisms are applicable only to about 10% of senile pneumonia, it is difficult to understand that the polymorphism of angiotensin converting enzyme is the main etiology of senile pneumonia at least in Japan. . Since active oxygen is involved in the development of cerebrovascular disorders deeply related to senile pneumonia, the activity of antioxidant enzymes is thought to be involved in the development of senile pneumonia. However, the relationship between polymorphisms of antioxidant enzymes that inactivate active oxygen and senile pneumonia was unclear.

The present invention is a data for predicting the risk that a subject will develop senile pneumonia by measuring the number of repeats of the GT repeat sequence located upstream of the gene encoding heme oxygenase-1 which is the onset factor of senile pneumonia. On how to collect. The present invention further relates to a device for predicting the risk of a subject developing senile pneumonia by measuring the number of repeats of the GT repeat of the heme oxygenase-1 gene.

In order to solve the above problems, the present invention is a method for collecting data for predicting the risk that a subject will develop senile pneumonia, comprising: (a) a GT repeat sequence located upstream of a heme oxygenase-1 gene; Preparing a sample containing the subject from the subject, (b) determining the number of repetitions of the GT repeat sequence in the sample, and (c) if the number of repetitions is 33 or more, the subject is senile pneumonia And a step of predicting that the risk of developing is high.

The present invention relates to a method for collecting data predicting the risk of developing lung cancer in a subject.

The present invention reveals that a GT repeat polymorphism located upstream of the gene of heme oxygenase-1 (hereinafter abbreviated as HO-1) that catalyzes the initial reaction of heme metabolism is involved in the development of lung cancer. It was made based on the epidemiological study of the present inventors.

More specifically, the method of the present invention predicts the risk that a subject will develop lung cancer by measuring the number of GT repeat repeats located upstream of the HO-1 gene.

Here, “GT repeat sequence” refers to a repeat sequence in which repeat units consisting of guanine (G) and thymine (T) are present repeatedly, and “number of repeats” refers to the repeat unit GT present in the GT repeat sequence. The number of

In the method of the present invention, first, a sample containing a GT repeat sequence located in the upstream region of the HO-1 gene is prepared. Such a sample can be any biological component collected from a subject to which the method of the present invention is applied, such as blood, and is preferably subjected to a nucleic acid extraction process. Methods for extracting nucleic acids from biological components are well known to those skilled in the art, for example, phenol extraction, ethanol precipitation, and the like.

“Subjects” to which the method of the present invention should be applied are preferably mammals including humans, but since GT sequence polymorphisms are known for many species other than mammals, All included in “subject”.

In this specification, “preparing a sample” includes not only a case where a person who performs the method prepares the sample by himself but also a case where an already prepared sample is obtained.

After the sample is prepared, a step of determining the number of repeats of the GT repeat sequence located upstream of the HO-1 gene is performed. Since a method for measuring the number of repeats of the sequence upstream of the HO-1 gene (SEQ ID NO: 1) and any repetitive sequence is well known, those skilled in the art can easily determine the number of repeats of the GT repeat sequence.

As a method for measuring the number of repeats of a repetitive sequence, a method using a polymerase chain reaction (hereinafter referred to as PCR) is preferable. To measure the number of repeats of a GT repeat using PCR, amplify the GT repeat using a primer pair consisting of a unique sequence upstream and downstream of the GT repeat, and then electrophores the PCR product. To measure the mobility. Alternatively, when the number of samples to be measured is large, the number of GT repeat repeats may be determined by a DNA chip.

In the case of using a DNA chip, after injecting a sample containing a GT repetitive sequence into a chip on which a probe composed of CA repeating units is immobilized, dissociation conditions (dissociation temperature, etc.) according to the difference in the number of repetitions The difference can be measured to determine the number of GT repeat repeats.

Furthermore, if necessary, the number of repetitions may be determined by determining the base sequence of the GT repetitive sequence.

As detailed in the examples below, subjects with an allele whose GT repeats upstream of the HO-1 gene have 33 or more repeats are at increased risk of developing senile pneumonia. Therefore, the risk of developing senile pneumonia in a subject can be predicted by measuring the number of repetitions of the GT repeat sequence. More specifically, when the subject included smokers and non-smokers, an odds ratio of 2.3 was found in an epidemiological study that investigated the association between the presence of alleles with 33 or more repeats and the development of senile pneumonia. (I.e., those who have alleles with 33 or more repeats are about 2.3 times more likely to suffer from chronic emphysema).

The present invention further relates to a method of collecting data for predicting a subject's risk of developing chronic emphysema. The operation of the method is the same as the operation of the method for predicting the risk of developing chronic emphysema in a subject. Since the method is a method of collecting data, a person who performs the method is not limited to a medical institution.

In addition, the present invention provides DNA amplification means for specifically PCR-amplifying a GT repeat sequence located upstream of the HO-1 gene, and DNA size determination means for determining the number of repeats of the amplified repeat sequence There is also provided an apparatus comprising:

The DNA amplification means includes a reaction cell for accommodating a sample collected from a subject, a heating means for heating the reaction cell, and a temperature adjusting means for adjusting the temperature of the reaction means. The DNA amplification means and the method for using the same are the same as the thermal cyclers usually used in PCR, and are well known to those skilled in the art.

The size of the amplified GT repeat sequence is determined by DNA sizing means. The DNA sizing means can be, but is not limited to, gels for electrophoresis, gel filtration, and automated nucleotide sequencers. From the determined size, the number of GT repeat repeats can be determined.

Hereinafter, the present invention will be described in more detail with reference to examples.

[Example 1] In this example, a method for collecting data for predicting the risk of developing senile pneumonia will be described.

Peripheral blood was collected from subjects (200 senile pneumonia patients, 200 non-senile pneumonia patients with similar smoking history and gender ratio), and DNA was extracted, and PCR was performed using this as a template.

Primers pl-s (249 to 268 of SEQ ID NO: 1) and pl-as (SEQ ID NO: 1) were used as primers for amplifying the GT repeat sequence (285 to 344 of SEQ ID NO: 1) located upstream of the HO-1 gene. 356 to 375), primer p2-s (GACGCGTGCAAGCAGTCAGCAGAGGAT) and primer p2-as (591 to 611 of SEQ ID NO: 1) were prepared.

After amplification by PCR, the PCR product was amplified using electrophoresis on a 15% polyacrylamide gel to determine the number of repeats in the GT repeat sequence.

Table 1 shows the results.

The distribution had peaks at three locations of 23, 30, and 33. Therefore, the number of repeats of the GT repeat sequence is classified into three groups of less than 27, more than 27 and less than 33, and more than 33 (hereinafter referred to as S, M, and L, respectively), and the relationship with senile pneumonia I investigated. Furthermore, group I (L / L, L / M, L / S) where at least one L-type allele is present and group II (M / M, M / S, S / S) where no L-type gene is present S) and examined the relationship with senile pneumonia.

As shown in Table 1, in non-senile pneumonia patients (control), the odds of the L-type gene and other genes (ie, M-type gene and S-type gene) are 38 / (189 + 173) = 38/362, in senile pneumonia patients (cases), 79/159 + 162 = 79/321, odds ratio was (79/321) / (38/362) = 2.3 (p <0.0001) . Thus, those with the L-type gene are about 2.3 times more likely to have senile pneumonia than those who do not.

From the above results, if the subject has at least one allele having the number of repeats of the GT repeat sequence located upstream of HO-1 of 33 or more, the subject is at risk of developing senile pneumonia. Can be predicted to be large.

Senile pneumonia is increasing with changes in the Japanese social environment and aging, but according to the data collection method for predicting the risk of developing senile pneumonia according to the present invention, the risk of the subject developing senile pneumonia is increased. Easy and accurate prediction.

Claims (4)

A method of collecting data for predicting the risk that a subject will develop senile pneumonia, comprising: (a) preparing a sample containing a GT repeat located upstream of the heme oxygenase-1 gene from the subject; (B) determining the number of repetitions of the GT repeat sequence in the sample, and (c) predicting that the subject is at high risk of developing lung cancer if the number of repetitions is 33 or more. A data collection method for predicting the risk of developing senile pneumonia.  A method for collecting data for predicting the risk of a subject developing senile pneumonia, comprising: (a) preparing a sample containing a GT repeat sequence located upstream of the heme oxygenase-1 gene from the subject And (b) determining the number of repetitions of the GT repeat sequence in the sample, and a data collection method for predicting the risk of developing senile pneumonia. The method according to claim 1 or 2, wherein the determination of the number of GT repeat repeats in step (b) is performed by subjecting the PCR amplified GT repeat sequences to electrophoresis. Data collection method to predict the risk of developing pneumonia.  A device for predicting the risk of a subject developing senile pneumonia, comprising: (a) a DNA amplification means for amplifying a GT repeat sequence located upstream of the heme oxygenase-1 gene; and (b) the GT And a DNA size determining means for determining the number of repetitions of the repetitive sequence, and a data collection device for predicting the risk of developing senile pneumonia.