JP2005532052A - Antisense regulation of LRH1 expression - Google Patents

Abstract

Antisense compounds, compositions and methods for modulating the expression of liver related homolog 1 (LRH1) are provided. The composition comprises an antisense compound, particularly an antisense oligonucleotide, that targets a nucleic acid encoding LRH1. Methods of using these compounds for the modulation of LRH1 expression and the treatment of diseases associated with LRH1 expression are provided.

Description

  This application claims priority from US Provisional Application No. 60 / 392,813 filed on July 1, 2002, based on 35 USC § 119 (which is hereby incorporated by reference) Which is hereby incorporated by reference in its entirety as if described).

  The present invention provides compositions and methods for modulating the expression of Liver Related Homolog-1 (LRH1). In particular, the present invention relates to antisense compounds, particularly oligonucleotides, that can specifically hybridize with a nucleic acid encoding LRH1. Such oligonucleotides have been shown to regulate LRH1 expression.

  Cholesterol is essential for many cellular processes such as membrane biogenesis, steroid hormones and bile acid biosynthesis. Cholesterol is the building block for each of the major classes of lipoproteins found in human somatic cells. Thus, cholesterol biosynthesis and catabolism are highly regulated and coordinate processes. A number of illnesses and / or disorders are associated with modulation in cholesterol metabolism or catabolism, including atherosclerosis, gallstone formation, and ischemic heart disease. Understanding the pathways involved in cholesterol homeostasis is essential to develop useful therapies for the treatment of these diseases and disorders.

  Metabolism of cholesterol to bile acids is the main pathway for cholesterol excretion from the body, accounting for almost half of daily excretion. These cholesterol metabolites are formed in the liver and secreted into the duodenum of the intestine, where the cholesterol metabolites have an important role in the solubilization and absorption of fats and vitamins in food. Subsequently, most bile acids (about 95%) are reabsorbed in the ileum and return to the liver via the intestinal circulatory system.

  Cytochrome 2450 7A (CYP7A) is a liver-specific enzyme that catalyzes the first rate-limiting step in one of the two pathways for bile acid biosynthesis (Chiang, JYL 1998, Front. Biosci. 3: 176-193; Russell, D.W. and KD Sethell.1992, Biochemistry 31: 4737-4749). The gene encoding CYP7A is regulated by various endogenous low molecular weight lipophilic molecules such as steroid hormones, thyroid hormones, cholesterol, bile acids and the like. In particular, CYP7A expression is stimulated by cholesterol intake and suppressed by bile acids. Thus, CYP7A expression is positively regulated (stimulated or induced) and negatively regulated (inhibited or suppressed).

  CYP7A expression is regulated by several members of the nuclear receptor family of ligand-activated transcription factors (Chiang, JYL 1998, Front. Biosci. 3: 176-193; Gustafsson, J.A. 1999, Science 284: 1285-1286; Russell, D.W. 1999, Cell 97: 539-542). Recently, two nuclear receptors, liver X receptor (LXR; NR1H3; Apfel, R. et al., 1994, Mol. Cell. Biol. 14: 7025-7035; Willy, PJ et al., 1995, Genes Devel. 9: 72-85) are considered to be involved in the positive and negative regulation of CYP7A (Peet, DJ et al., 1998, Curr. Opin. Genet. Develop. 8: 571-575; Russell; , D. W. 1999, Cell 97: 539-542). Both LXR and FXR are abundantly expressed in the liver and bind to their cognate hormone response elements to form heterodimers with the 9-cis retinoic acid receptor RXR (Mangelsdorf, DJ and R.). M. Evans. 1995, Cell 83: 841-850).

  LXR is activated by the cholesterol derivative 24,25 (S) epoxycholesterol and binds to the reactive element of the CYP7A promoter (Lehmann, JM et al., 1997, J. Bol. Chem. 272: 3137-3140). . In LXR-deficient mice, CYP7A is not induced in response to cholesterol feeding (Peet, DJ et al., 1998, Cell 93: 693-704). In addition, these animals accumulate large amounts of cholesterol in the liver when fed with a high cholesterol diet. These studies establish that LXR is a cholesterol sensor involved in positive regulation of CYP7A expression.

  Bile acids stimulate the expression of genes involved in bile acid transport, such as intestinal bile acid binding protein (I-BABP), and CYP7A and other genes involved in bile acid biosynthesis, such as CYP8B (chenodeoxycholic acid). And CYP27, which catalyzes the first step in an alternative pathway of bile acid synthesis (Javitt, NB 1994, FASEB J. 8: 1308-1311; Russell, D W. and KD Setchell., 1992, Biochemistry 31: 4737-4749). Recently, it has been shown that FXR is a bile acid receptor (Makishima, M. et al., 1999, Science 284: 1362-1365; Parks, DJ et al., 1999, Science 284: 1365-1368. Wang, H. 1999, Mol. Cell 3: 543-553). Several different bile acids such as chenodeoxycholic acid and its glycine and taurine conjugates have been shown to bind to and activate FXR at physiological concentrations. In addition, DNA response elements of FXR / RXR heterodimers have been identified in both human and mouse I-BABP promoters, indicating that FXR mediates the positive effect of bile acids on I-BABP expression (Grober, J. et al., 1999, J. Biol. Chem. 274: 29749-29754; Makishima, M. et al., 1999, Science 284: 1362-1365). Furthermore, in hepatocyte-derived cell lines, the order of bile acids that activate FXR is correlated with the order for CYP7A suppression (Makishima, M. et al., 1999, Science 284: 1362-1365). Therefore, these studies indicate that FXR also has a role in the negative effect of bile acids on gene expression.

  However, the molecular mechanism of CYP7A suppression mediated by bile acids, particularly the role of FXR, is still unclear. The CYP7A promoter lacks a potent FXR / RXR binding site (Chiang, JY and D. Stroop. 1994, J. Biol. Chem. 269: 17502-17507; Chiang, JY et al., 2000 Year, J. Biol. Chem. 275: 10918-10924), the effect is unlikely to be due to direct FXR interaction.

Additional nuclear receptors involved in CYP7A expression include α1-fetoprotein transcription factor (FTF), Cyp7a promoter binding factor (CPF), human B1-binding factor (hB1F, B1F, HB1F, HB1F-2), liver receptor homologues -1 (also referred to as LRH1, or NR5A2), a monomeric orphan nuclear receptor that functions as a tissue-specific transcription factor (Becker-Andre et al., 1993, Biochem. Biophys. Res. Co.
mm. 194: 1371-1379, Galarneau et al., 1996; Mol. Cell. Biol. 16: 3853-3865, Li et al., 1998, J. MoI. Biol. Chem. 273: 29022-29031, Nita et al., 1999, Proc. Natl. Acad. Sci. USA 96: 6660-6665). LRH1 has multiple isoforms, which arise from alternative splicing and / or alternative translation initiation. The major isoform of LRH1 consists of 495 amino acids and is derived from Genbank provisional mRNA (NM003822). Provisional sequences have been obtained from a clone identified by Nita et al. In 1999 (CPF: AF146343) and a clone identified by Li et al. In 1998 (hB1F: U80251). Further protein isoforms have been described, for example “CPF variant 1” consisting of 541 amino acids with the same peptide sequence as CPF (with 46 amino acids inserted at the amino terminus), and 369 There is a “CPF variant 2” consisting of amino acids (172 amino acids deleted in the D and E domains) (Nitta et al., 1998). In 1998, Galalaneau et al. (Cytogenet. Cell Genet. 82, (3-4), 269-270) also described another LRH1 isoform called FTP (U93553) consisting of 500 amino acids. CPF / hB1F, CPF variant 1 and FTF have been shown to be transcriptionally active when CPF variant 2 is transcriptionally inactive. Furthermore, hB1F / CPF and CPF variants were originally cloned from human liver mRNA libraries, and hB1F has been shown to be expressed in fetal liver, adult liver, and HepG2 cells. (Nitta et al., 1999, Li et al., 1998). LRH1 has been shown to be expressed at high levels in the liver, pancreas and ovary, but not very abundantly in the colon, intestine and adrenal gland (Nitta et al., 1999, Li et al., 1998, Repa and Mangelsdorf) Ann Rev. Cell. Dev. 2000, Wang et al., 2001, J. Mol. Endo. 27, 255-258). Although the biological role of each isoform has not yet been clarified, the transcriptional isoform of LRH1 is required for CYP7A expression in the liver, and this expression can be maximized by synergy with LXR. (Nita et al., 1999, Lu et al., 2000, Mol. Cell. 6: 507-517). LRH1 is also required for the expression of short heterodimer partners (SHP, NR0B2), orphan nuclear receptors, which suppress the transcription of other nuclear receptors and inhibit their function (Seol et al., 1996, Science 272: 1336-1339, Johansson et al., 1999, J: Biol. Chem. 274: 345-353, Lee et al., 1999, J. Biol. Chem. 274: 20869-20873). SHP is also a direct gene target of FXR, and SHP expression is up-regulated in large quantities by FXR agonist compounds such as bile acid CDCA and synthetic FXR agonist GW4064 (Lu et al., 2000, Goodwin et al., 2000 Year, Mol.Cell 6: 517-526). Therefore, FXR agonists indirectly repress CYP7 by inducing repressor SHP, followed by repressor SHP binding to LRH1 at the CYP7A promoter and repressing its transcriptional activity (Lu et al., 2000). , Goodwin et al., 2000). These findings indicate that there is a complex regulatory cascade for LRH1 and four other nuclear receptors that cooperate to manage bile acid synthesis and cholesterol and lipid homeostasis.

  LRH1 has also been shown to bind to the enhancer II (ENII) region of hepatitis B virus (HBV) and the transcriptional regulatory region essential for liver-specific expression of HBV (Li et al., 1998, J. Biol. Chem. 273: 29022-29031). HBV is a major cause of acute and chronic hepatitis and is closely related to the development of hepatocellular carcinoma (Ranye and McLachian (1991), Molecular Biology of the Hepatitis B Virus, pp 1-37, CRC Press). , Boca Raton, Florida). LRH1 has been shown to promote transcription from the ENII element of HBV, and to further reduce transcription significantly by mutation of the ENII cis element to which LRH1 binds. Therefore, LRH1 and ENII have an important role in the regulation of transcriptional activity and consequently affect overall HBV gene expression (Li et al., 1998).

  Recently, LRH1 has also been shown to be expressed in large amounts in human tissues such as preadipocytes and early breast cancer biopsies, as well as in human cell lines HepG2 and MCF7. LRH1 has also been shown to promote the expression of aromatase cytochrome P450 promoter II in the preadipocyte fraction of mouse 3T3-L1 preadipocytes (Clyne et al., 2002, J Biol. Chem. Papers in Press. , April 1). Breast tumors secrete soluble factors that stimulate aromatase expression by promoter II in breast adipose tissue, thereby increasing estrogen biosynthesis from C19 steroids. Thus, modulating LRH1 expression or activity in adipose tissue may have a significant effect on local estrogen production with downstream relevance in the development and progression of estrogen-dependent breast cancer and carcinogenesis. is there.

  At present, there is no known therapeutic agent that effectively inhibits LRH1 synthesis. Thus, there remains a long-felt need for additional therapeutic agents that can effectively inhibit LRH1 function. Demonstrate that antisense technology is a new technology as an effective means of reducing the expression of specific gene products and is therefore particularly useful in various therapeutic, diagnostic and research applications related to the modulation of LRH1 expression Can do.

  Antisense technology is a new technology that has emerged as an effective means to reduce the expression of specific gene products and is thus unmatchedly useful in many therapeutic, diagnostic and research applications to modulate LRH1 expression. It can be shown. Systemically administered antisense has been shown to predominately accumulate and exert its effect in the liver, but to a lesser extent in fat (RS Geary, RZ Yu and AA). Levin, “Pharmacokinetics of phosphorothioate antisense oligodeoxynucleotides”, Curr. Opin. Investig. Drugs, Volume 2, No. 4, pages 562-573). Because of liver-specific LRH control in CYP7A expression, this relative antisense tissue specificity is considered useful in the treatment of metabolic diseases.

  The present invention relates to antisense compounds, particularly oligonucleotides, that target a nucleic acid encoding LRH1 and modulate the expression of LRH1 and its splice variants. Also provided are pharmaceutical compositions and other compositions comprising the antisense compounds of the invention. Further provided is a method of modulating LRH1 expression in a cell or tissue, the method comprising contacting said cell or tissue with one or more antisense compounds or compositions of the invention. An animal, particularly a human, who is administered a therapeutically or prophylactically effective amount of one or more of the antisense compounds or compositions of the invention to have or are susceptible to a disease or condition associated with the expression of LRH1 Further provided are methods of treating.

The present invention uses oligomeric antisense compounds, particularly oligonucleotides, that are used to modulate the function of nucleic acid molecules encoding LRH1 and ultimately to regulate the amount of LRH1 produced. This is accomplished by providing an antisense compound that specifically hybridizes with a nucleic acid encoding one or more LRH1. As used herein, the terms “target nucleic acid” and “nucleic acid encoding LRH1” refer to DNA encoding LRH1, RNA transcribed from such DNA (including pre-mRNA and mRNA), and such RNA. CDNA obtained from Specific hybridization between the oligomeric compound and its target nucleic acid interferes with the normal function of the nucleic acid. Such regulation of the function of a target nucleic acid by a compound that specifically hybridizes to the target nucleic acid is generally referred to as “antisense”. Examples of DNA functions that can be interfered with include replication and transcription. RNA functions that can be interfered with include all biological functions such as RNA transfer to protein translation sites, RNA to protein translation, RNA splicing to produce one or more mRNA species, and RNA Or catalytic activity that may be promoted by RNA. Such interference with the function of the target nucleic acid has an overall effect on the regulation of LRH1 expression. In the present invention, “modulation” means either increase (stimulation) or decrease (inhibition) of gene expression. In the present invention, the preferred form of regulation of gene expression is inhibition, and the preferred target is mRNA.

  It is preferred to target the antisense to a specific nucleic acid. In the present invention, “targeting” an antisense compound to a specific nucleic acid is a multi-step process. This process usually begins with the identification of a nucleic acid sequence that seeks to regulate function. Such a nucleic acid sequence can be, for example, a cellular gene (or mRNA transcribed from that gene) whose expression is associated with a particular disease or condition, or a nucleic acid molecule from an infectious agent. In the present invention, the target is a nucleic acid molecule encoding LRH1. The targeting process also includes the determination of a site or group of sites within this gene that are involved in possible antisense interactions that produce the desired effect (eg, detection or modulation of protein expression). In the present invention, a preferable intragenic site is a region including the translation start codon or stop codon of the open reading frame (ORF) of the gene. As is known in the art, the translation initiation codon is typically 5'-AUG (in the transcribed mRNA molecule; 5'-ATG in the corresponding DNA molecule), so the translation initiation codon is It is also referred to as “AUG codon”, “start codon” or “AUG start codon”. A few genes have translation start codons for RNA sequences 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5'-ACG and 5'-CUG function in vivo Has been shown to do. Thus, in either case, the starting amino acid is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes), although the terms “translation start codon” and “start codon” are many codon sequences. Can be included. Also known in the art, eukaryotic and prokaryotic genes may have two or more alternative initiation codons, any one of which initiates translation in a particular cell type or tissue Can be preferentially used for or for a specific set of conditions. In the present invention, “start codon” and “translation start codon” mean a codon used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding LRH1, and the sequence of such codon is It can be anything.

  Also, as is known in the art, the translation stop codon (or “stop codon”) of a gene has three sequences: 5′-UAA, 5′-UAG, and 5′-UGA (the corresponding DNA sequence is , 5′-TAA, 5′-TAG, and 5′-TGA, respectively). The terms “start codon region” and “translation start codon region” encompass from about 25 to about 50 contiguous nucleotides in either direction (ie, 5 ′ or 3 ′) from such mRNA or translation start codon. It means a part of a gene. Similarly, the terms “stop codon region” and “translation stop codon region” refer to about 25 to about 50 consecutive in either direction (ie, 5 ′ or 3 ′) from such mRNA or translation stop codon. The part of a gene that includes nucleotides.

An open reading frame (ORF) or “coding region” is known in the art to mean the region between the translation start codon and translation stop codon, and is also a region that can be effectively targeted. Other target regions include a 5 ′ untranslated region (5′UTR) (this region is a portion of the mRNA 5 ′ direction from the translation initiation codon, and thus the nucleotide between the 5 ′ cap site and the translation initiation codon of the mRNA. Or 3 ′ untranslated region (3′UTR), which is meant to include the corresponding nucleotide on the gene, and this region is the 3 ′ direction of the mRNA from the translation stop codon. Part, and thus known to be meant to include the nucleotide between the translation stop codon and the 3 ′ end of the mRNA, or the corresponding nucleotide on the gene). The 5 ′ cap of an mRNA contains an N7-methylated guanosine residue linked to the 5 ′ most terminal residue of the mRNA via a 5′-5 ′ triphosphate bond. The 5 ′ cap region of an mRNA is considered to include the 5 ′ cap structure itself and the first 50 nucleotides adjacent to the cap. The 5 ′ cap region can also be a preferred target region.

  Some eukaryotic mRNA transcripts are directly translated, but often contain one or more regions known as “introns”, which are excised from the transcript before the transcript is translated. The remaining (and therefore translated) regions are known as “exons” and are spliced together to form a continuous mRNA sequence. mRNA splice sites, or intron-exon junctions, are also preferred target regions, especially in situations where abnormal splicing is involved in the disease, or in situations where overproduction of a particular mRNA splice product is involved in the disease. Useful. Abnormally fused junctions due to rearrangements or deletions are also preferred targets. It has also been found that introns are also effective and therefore can be preferred target regions for antisense compounds targeted to, for example, DNA or pre-mRNA.

  Once one or more target sites have been identified, an oligonucleotide is selected that is sufficiently complementary to the target, ie, that is sufficiently good and with sufficient specificity to hybridize to the target and provide the desired effect. be able to.

  In the present invention, “hybridization” means a hydrogen bond, which is a Watson-Crick hydrogen bond, Hoogsteen hydrogen bond, or reverse Hoogsteen hydrogen bond between complementary nucleoside or nucleotide bases. Bonding is possible. For example, adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds. As used herein, “complementary” refers to the ability to form an exact pair between two nucleotides. For example, if a nucleotide at a given position of an oligonucleotide can hydrogen bond with a nucleotide at the same position of a DNA or RNA molecule, the oligonucleotide and DNA or RNA are considered to be complementary to each other at that position. . Oligonucleotides and DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen bond with each other. Thus, “specifically hybridizable” and “complementary” are complementary or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target. A term used to indicate a sufficient degree. As is apparent in the art, the sequence of an antisense compound need not be 100% complementary so that it can specifically hybridize to the sequence of its target nucleic acid. The binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, thereby losing its usefulness, or under conditions where specific binding is desired due to sufficient complementarity (Ie, under physiological conditions for in vivo analysis or therapeutic treatment, and under conditions under which analysis is performed for in vitro analysis) to prevent non-specific binding between the antisense compound and the non-target sequence. The antisense compound is capable of specifically hybridizing.

Antisense compounds are generally used as research reagents and diagnostics. For example, antisense oligonucleotides that can inhibit gene expression with excellent specificity are often used by those skilled in the art to clarify the function of a particular gene. Antisense compounds are also used, for example, to distinguish the functions of various types of biological pathways. Antisense modulation has therefore been utilized in research applications.

  Antisense specificity and sensitivity are also utilized by those skilled in the art in therapeutic applications. Antisense oligonucleotides have been used as therapeutic ingredients in treating disease states in animals and humans. Antisense oligonucleotides have been safely and effectively administered to humans and numerous clinical trials are currently underway. Thus, it has been demonstrated that oligonucleotides can be useful therapeutic modalities that can be set to be useful in treatment regimes for treating cells, tissues and animals, particularly humans. In the present invention, the term “oligonucleotide” means a ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetic oligomer or polymer thereof. The term includes oligonucleotides composed of naturally occurring nucleobases, sugars, and internucleoside (backbone) covalent bonds, as well as oligonucleotides that contain non-naturally occurring moieties that function similarly. Such modified or substituted oligonucleotides have desirable properties such as increased cellular uptake, increased affinity for nucleic acid targets, and increased stability in the presence of nucleases, which in some cases may be native. More preferred.

  Antisense oligonucleotides are the preferred form of antisense compounds, but the invention also encompasses other oligomeric antisense compounds, such as, but not limited to, oligonucleotide mimetics as described below. Is mentioned. Antisense compounds according to the present invention preferably comprise about 8 to about 30 nucleobases (ie about 8 to about 30 linked nucleosides). Particularly preferred antisense compounds are antisense oligonucleotides, even more preferably antisense oligonucleotides comprising from about 12 to about 25 nucleobases. As is known in the art, a nucleoside is a combination of base and sugar. Usually, the base portion of the nucleoside is a heterocyclic base. The two most common classes of such heterocyclic bases are purines and pyrimidines. A nucleotide is a nucleoside that further comprises a phosphate group covalently linked to the sugar portion of the nucleoside. For nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2 ', 3' or 5 'hydroxyl moiety of the sugar. In forming the oligonucleotide, the phosphate groups are covalently bonded to adjacent nucleosides to form a linear polymer compound. In turn, each end of this linear polymer structure can be further joined to form a cyclic structure, but a linear structure with an open ring is generally preferred. In the oligonucleotide structure, the phosphate group is generally considered to form the internucleoside backbone of the oligonucleotide. The normal I linkage or backbone of RNA and DNA is a 3 'and 5' phosphodiester linkage.

  Particular examples of preferred antisense compounds useful in the present invention include modified backbones or oligonucleotides containing non-natural internucleoside linkages. As defined herein, oligonucleotides having a modified backbone include oligonucleotides that retain a phosphorus atom in the backbone and oligonucleotides that do not have a phosphorus atom in the backbone . For purposes of this specification, as often referred to in the art, modified oligonucleotides that do not have a phosphorus atom in the internucleoside backbone are also considered oligonucleosides.

Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates, such as 3 ′ alkylene phosphonates and chiral phosphonates, phosphinates Phosphoramidates, such as 3'-aminophosphoramidates and aminoalkyl phosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and normal 3'-5 ' Boranophosphates with bonds, their 2'-5 'linked analogs, and poles reversed (adjacent nucleoside unit pairs are 5'-3' instead of 3'-5 ', or 2' -5 'instead of 5' -2 '). Various salts, mixed salts, and free acid forms are also included.

  Representative US patents that teach the production of the phosphorus-containing linkages include, but are not limited to, US Pat. Nos. 3,687,808; 4,469,863; 4,476,301; No. 5,023,243; No. 5,177,196; No. 5,188,897; No. 5,264,423; No. 5,276,019; No. 5,278,302; No. 286,717; No. 5,321,131; No. 5,399,676; No. 5,405,939; No. 5,453,496; No. 5,455,233; No. 5,466, No. 677; No. 5,476,925; No. 5,519,126; No. 5,536,821; No. 5,541,306; No. 5,550,111; No. 5,563,253 No. 5,571,799; No. 5,587,361; and No. 5,625,050, all of which are incorporated by reference. To join the present invention.

Preferred modified oligonucleotide backbones that do not contain phosphorus atoms are short alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short heteroatoms or It has a main chain formed by a heterocyclic internucleoside bond. These backbones include morpholino-bonded backbones (partially formed from the sugar portion of the nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methyleneformacetyl And thioform acetyl backbone; backbone containing alkene; sulfamate backbone; methyleneimino and methylenehydrazino backbone; sulfonate and sulfonamide backbone; amide backbone; and N, O, S and CH ₂ constituents A mixed main chain can be mentioned.

  Representative US patents that teach the preparation of the above oligonucleosides include, but are not limited to, US Pat. Nos. 5,034,506; 5,166,315; 5,185,444; No. 5,216,141; No. 5,235,033; No. 5,264,562; No. 5,264,564; No. 5,405,938; No. 5,434 No. 5,466,677; No. 5,470,967; No. 5,489,677; No. 5,541,307; No. 5,561,225; No. 5,596,086 No. 5,602,240; No. 5,610,289; No. 5,602,240; No. 5,608,046; No. 5,610,289; No. 5,618,704; No. 5,623,070; No. 5,663,312; No. 5,633,360; No. 5,677,437; , It includes No. 439, they are both, to join the present invention by reference.

  Other preferred oligonucleotide mimetics are those in which both the sugar and the internucleoside linkage, ie the backbone of the nucleotide unit, is replaced with a new group. Base units are maintained for hybridization with the appropriate nucleic acid target compound, and oligonucleotide mimetics, one such oligomeric compound, have been shown to have excellent hybridization properties. , Referred to as peptide nucleic acid (PNA). In the PNA compound, the sugar-backbone of the oligonucleotide is substituted with a main chain containing an amide, particularly an aminoethylglycine main chain. The nucleobase is retained and is bound directly or indirectly to the aza nitrogen atom of the main chain amide moiety. Representative US patents that teach the preparation of PNA compounds include, but are not limited to, US Pat. Nos. 5,539,082; 5,714,331; and 5,719,262. Any of which is incorporated herein by reference. Further teachings of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.

The most preferred embodiments of the present invention are oligonucleotides having a phosphorothioate backbone, and oligonucleosides having a heteroatom backbone, particularly —CH ₂ —NH—O—CH ₂ —, —CH ₂ —N (CH ₃ ) —O—CH ₂ — [known as methylene (methylimino) or MMI backbone], —CH ₂ —O—N (CH ₃ ) —CH ₂ , —CH ₂ N (CH ₃ ) —N (CH ₃ ) —CH ₂ —, and —O—N (CH ₃ ) —CH ₂ —CH ₂ —, where the natural phosphodiester backbone is designated as —O—P—O—CH ₂ —, which is In U.S. Pat. No. 5,489,677, referenced above, and having the amide backbone of U.S. Pat. No. 5,602,240, referenced above. Also preferred are oligonucleotides having a morpholino backbone structure of US Pat. No. 5,034,506 referenced above.

Modified oligonucleotides may also include one or more substituted sugar moieties. Preferred oligonucleotides comprise at the 2 'position any one of the following: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N- alkynyl; or, in O- alkyl -O--alkyl (where the alkyl, alkenyl and alkynyl, substituted or unsubstituted C ₁ -C ₁₀ alkyl, or C ₂ -C ₁₀ may be alkenyl and alkynyl ). Particularly preferably, O [(CH ₂ ) _n O] _m CH ₃ , O (CH ₂ ) _n , OCH ₃ , O (CH ₂ ) _n NH ₂ , O (CH ₂ ) _n CH _3, O (CH ₂ ) _n ONH _2, and _{O (CH 2n ON [(CH} 2) n CH 3]) _2, where, n and m are from 1 to about 10. Other preferred oligonucleotides comprise any one of the following at the 2 ′ position: C ₁ -C ₁₀ lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH ₃ , OCN, Cl, Br, CN, CF ₃ , OCF ₃ , SOCH ₃ , SO ₂ CH ₃ , ONO ₂ , NO ₂ , N ₃ , NH ₂ , heterocycloalkyl, heterocycloalkaryl, aminoalkyl Amino, polyalkylamino, substituted silyls, groups that cleave RNA, reporter groups, intercalators, groups to improve the pharmacokinetic properties of oligonucleotides, or to improve the pharmacodynamic properties of oligonucleotides And other substituents with similar properties. Preferred modifications include 2′-methoxyethoxy (2′-O—CH ₂ CH ₂ OCH ₃ , also known as 2′-O- (2-methoxyethyl), or 2′-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504) That is, an alkoxyalkoxy group is mentioned. A further preferred modification is 2′-dimethylaminooxyethoxy, ie an O (CH ₂ ) ₂ ON (CH ₃ ) ₂ group (also known as 2′-DMAOE as described in the examples below). And 2′-dimethylaminoethoxyethoxy (also known in the art as 2′-O-dimethylaminoethoxyethyl, or 2′-DMAEOE), ie, 2′-O—CH ₂ —O— CH ₂ —N (CH ₂ ) ₂ (also described in the examples below).

Other preferred modifications include 2'-methoxy (2'-OCH ₃ ), 2'-aminopropoxy (2'-OCH ₂ CH ₂ CH ₂ NH ₂ ), and 2'-fluoro (2'-F). Can be mentioned. Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3 ′ position of the sugar on the 3 ′ terminal nucleotide or in the 2′-5 ′ linked oligonucleotide and the 5 ′ position of the 5 ′ terminal nucleotide. Good. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties instead of pentofuranosyl sugars. Representative US patents that teach the production of such modified sugar structures include, but are not limited to, US Pat. Nos. 4,981,957; 5,118,800; 5,319, No. 080; No. 5,359,044; No. 5,393,878; No. 5,446,137; No. 5,466,786; No. 5,514,785; No. 5,519,134 No. 5,567,811; No. 5,576,427; No. 5,591,722; No. 5,597,909; No. 5,610,300; No. 5,627,053; No. 5,639,873; No. 5,646,265; No. 5,658,873; No. 5,670,633; and No. 5,700,920, all of which are in their entirety. To the present invention by reference.

  Oligonucleotides may also include modifications or substitutions of nucleobases (sometimes referred to in the art as simply “bases”). The “unmodified” or “natural” nucleobases used in the present invention include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil ( U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, adenine and guanine. Methyl and other alkyl derivatives, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, Cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, and other 8-substituted adenine and guanine, 5-halo, especially 5-bu , 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3 -Deazaadenine. Additional nucleobases include those disclosed in U.S. Pat. No. 3,687,808, The Concise Encyclopedia Of Polymer And Engineering (p. 858-859, edited by Kroschwitz, J.I., John 19/90). ), Disclosed by Englisch et al., Angelwandte Chemie (International Edition, 1991, 30, 613), and Sanghvi, Y. et al. S. 15 (Antisense Research and Applications), pp. 289-302, Crooke, ST and Leble, B., CRC Press, 1993). Some of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. Such as 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6 and O-6 substituted purines such as 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine Is mentioned. Substitution of 5-methylcytosine has been shown to increase nucleic acid duplex stability at 0.6-1.2 ° C (Sangvi, YS, Crooke, ST, and Lebleu, B. Edition, Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278), currently preferred as a base substitution, especially when combined with 2'-O-methoxyethyl sugar modification preferable.

  Representative US patents that teach the manufacture of some of the above modified nucleobases and other modified nucleobases include, but are not limited to, the aforementioned US Pat. No. 3,687,808, U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272. No. 5,457,187; No. 5,459,255; No. 5,484,908; No. 5,502,177; No. 5,525,711; No. 5,552,540; No. 5,587,469; No. 5,594,12 ′, 5,596,091; No. 5,614,617; No. 5,750,692; and No. 5,681,941 All of which are incorporated herein by reference.

Other modifications of the oligonucleotides of the invention also include chemically linking one or more components or complexes to the oligonucleotide, which increase the activity, cell distribution or cellular uptake of the oligonucleotide. Such components include, but are not limited to, lipid components such as cholesterol components (Lessinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg Med. Chem. Let., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Mananoharan et al., Ann. NY Acad. Sci., 1992, 660, 306- 309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), fatty chain For example, dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993) , 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 365'-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manc aran et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 365'-3654), palmitic component (Mishra et al., Biochim. Biophys. Biophys. Biophys. Biophys. Biophys. Biophys. Biophy. 1995, 1264, 229-237), or octadecylamine or hexylamino-carbonyl-oxycholesterol components (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).

  Representative US patents that teach the production of such oligonucleotide conjugates include, but are not limited to, US Pat. Nos. 4,828,979; 4,948,882; 5,218,105. No. 5,525,465; No. 5,541,313; No. 5,545,730; No. 5,552,538; No. 5,578,717; No. 5,580,731; No. 5,580,731; No. 5,591,584; No. 5,109,124; No. 5,118,802; No. 5,138,045; No. 5,414,077; No. 5,486,603; No. 5,512,439; No. 5,578,718; No. 5,608,046; No. 4,587,044; No. 4,605,735; No. 4,667 No. 4,025; No. 4,762,779; No. 4,789,737; No. 4,824,941; No. 4,835,263; No. 4,874,335; No. 4,904,582; No. 4,958,013; No. 5,082,830; No. 5,112,963; No. 5,214,136; No. 5,082 No. 5,112,963; No. 5,214,136; No. 5,245,022; No. 5,254,469; No. 5,258,506; No. 5,262,536 No. 5,272,250; No. 5,292,873; No. 5,317,098; No. 5,371,241; No. 5,391,723; No. 5,416,203; No. 5,451,463; No. 5,510,475; No. 5,512,667; No. 5,514,785; No. 5,565,552; No. 5,567,810; No. 5,585,481; No. 5,587,371; No. 5,595,726; No. 5,597,696; No. 5,599,923; No. 5,59 , 928, and 5,688,941, and these are both, to join the present invention by reference.

Not all positions of a given compound need be uniformly modified, in fact more than one of the above modifications need only be included in one compound, and one position in an oligonucleotide It may only be contained in the nucleoside. The present invention also includes antisense compounds that are chimeric compounds. A “chimeric” antisense compound or “chimera” in the present invention is an antigen comprising two or more chemically distinct regions each composed of at least one monomer unit (ie, nucleotide in the case of an oligonucleotide compound). Sense compounds, especially oligonucleotides. These oligonucleotides are typically at least modified in such a way that the oligonucleotide is imparted with increased resistance to nuclease degradation, increased cellular uptake, and / or increased binding affinity for the target nucleic acid. Includes one region. Additional regions of the oligonucleotide can serve as substrates for enzymes that can cleave RNA: DNA or RNA: RNA hybrids. As an example, RNase H is a cellular endonuclease that cleaves RNA strands of RNA: DNA duplexes. Therefore, activating RNase H causes cleavage of the RNA target, thereby greatly increasing the oligonucleotide inhibition efficiency of gene expression. As a result, in some cases, when using chimeric oligonucleotides, comparable results can be obtained using shorter oligonucleotides than phosphorothioate deoxyoligonucleotides that hybridize to the same target region. RNA target cleavage can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

  The chimeric antisense compounds of the present invention can also be formed as a composite structure of two or more oligonucleotides, modified oligonucleotides, oligonucleosides, and / or oligonucleotide mimetics as described above. In the art, such compounds are also referred to as hybrids or gapmers. Representative US patents that teach the manufacture of such hybrid structures include, but are not limited to, US Pat. Nos. 5,013,830; 5,149,797; 5,220,007; No. 5,256,775; No. 5,366,878; No. 5,403,711; No. 5,491,133; No. 5,565,350; No. 5,623,065; No. 5,652,355; No. 5,652,356; and No. 5,700,922, all of which are incorporated herein by reference in their entirety.

  Antisense compounds used in accordance with the present invention can be conveniently and routinely produced by well-known solid phase synthesis techniques. Equipment for such synthesis is commercially available from a number of manufacturers, such as Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art can additionally or alternatively be used. It is well known to produce oligonucleotides such as phosphorothioates and alkylated derivatives using similar techniques.

  The antisense compounds of the present invention are synthesized in vitro and do not include antisense compositions of biological origin or gene vector constructs designed to direct in vivo synthesis of antisense molecules. The compounds of the present invention may also be mixed, encapsulated, complexed or combined with other molecules, molecular structures or mixtures of compounds, eg liposomes to aid in uptake, distribution and / or absorption A receptor-targeted molecule, oral formulation, rectal formulation, topical formulation or other formulation. Representative US patents that teach the manufacture of formulations that assist in such uptake, distribution, and / or absorption include, but are not limited to, US Pat. Nos. 5,108,921; 5,354,844. No. 5,416,016; No. 5,459,127; No. 5,521,291; No. 5,543,158; No. 5,547,932; No. 5,583,020; No. 5,591,721; No. 4,426,330; No. 4,534,899; No. 5,013,556; No. 5,108,921; No. 5,213,804; No. 227,170; No. 5,264,221; No. 5,356,633; No. 5,395,619; No. 5,416,016; No. 5,417,978; No. 5,462, No. 854; No. 5,469,854; No. 5,512,295; No. 5,527,528; No. 5,534,259; No. 5,5 No. 3,152; No. 5,556,948; No. 5,580,575; include and EP 5,595,756, which are both, is subscribed to the present invention by reference.

  The antisense compounds of the present invention can be any pharmaceutically acceptable salt, ester, or salt of such an ester, or a biologically active metabolite or residue (directly or directly) when administered to an animal such as a human. Indirectly includes any other compound that can be provided. Accordingly, the present disclosure also includes, for example, prodrugs and pharmaceutically acceptable salts of the compounds of the present invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. It reaches.

  The term “prodrug” refers to a therapeutic agent that has been produced in an inactive form, which is treated in the body or in their cells by the action of endogenous enzymes or other chemicals and / or the environment. To convert to active form (ie drug). In particular, the prodrug form of the oligonucleotide of the present invention is a SATE [(S-acetyl-2-thioethyl) phosphate] derivative, such as Gosselin et al., WO 93/24510 (published on Dec. 9, 1993), In accordance with the method disclosed in WO 94/26764.

  The term “pharmaceutically acceptable salt” refers to a physiologically and pharmaceutically acceptable salt of a compound of the invention, ie, retains the desired biological activity of the parent compound and does not impart undesired toxicological effects. Means salt.

  Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals, or organic amines. Examples of metals used as cations are sodium, potassium, magnesium, calcium and the like. Examples of suitable amines are N, N′-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine (see, eg, Berge et al., “Pharmaceutical Salts”, J .. of Pharma Sci., 1977, 66, 119). Base addition salts of the acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to form a salt in the conventional manner. The free acid form can be regenerated by contacting the salt form with the acid and separating the free acid in a conventional manner. Although the free acid forms and their respective salt forms differ somewhat in certain physical properties (eg, solubility in polar solvents), for the purposes of the present invention, the salts It is equivalent. The “pharmaceutical addition salt” used in the present invention includes a pharmaceutically acceptable salt in the form of one acid among the components of the composition of the present invention. Such salts include amine organic or inorganic acid salts. Preferred acid salts are hydrochloride, acetate, salicylate, nitrate, and phosphate. Other suitable pharmaceutically acceptable salts are well known to those skilled in the art and include, for example, the base salts of various inorganic and organic acids, such as inorganic acids such as hydrochloric acid, odors, and the like. Hydrofluoric acid, sulfuric acid or phosphoric acid; organic carboxylic acid, sulfonic acid, sulfonic acid or phosphoric acid, or N-substituted sulfamic acid such as acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid Acid, fumaric acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic acid, 2-phenoxybenzoic acid, 2-acetoxybenzoic acid, embonic acid, nicotinic acid or isonicotinic acid; and amino acids such as natural protein synthesis 20 α-amino acids involved, such as glutamic acid or aspartic acid, and also phenylacetic acid, methanesulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, ethane-1,2-disulfonic acid, benzenesulfonic acid, 4 -Methylbenzene sulfonic acid, naphthalene-2-sulfonic acid, naphthalene-1,5-disulfonic acid, 2- or 3-phosphoglyceric acid, glucose-6-phosphate, N-cyclohexylsulfamic acid (formation of cyclamate Or other organic compounds of acids such as ascorbic acid. Pharmaceutically acceptable salts of the compounds can also be prepared using pharmaceutically acceptable cations. Suitable pharmaceutically acceptable cations are well known to those skilled in the art and include, for example, alkali, alkaline earth, ammonium and quaternary ammonium cations. Carbonates or bicarbonates are also possible.

  Regarding oligonucleotides, preferred examples of pharmaceutically acceptable salts include, but are not limited to, (a) salts formed with cations, cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine (B) acid addition salts formed with inorganic acids, inorganic acids include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, etc .; (c) salts formed with organic acids, organic Examples of the acid include acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, and naphthalene sulfone. Acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalene Sulfonic acids, such as polygalacturonic acid; and, (d) a chlorine, bromine, and anionic salts formed with elements such as iodine.

  The antisense compounds of the present invention can be used for diagnosis, treatment, prevention and as research reagents and kits. With respect to treatment, animals (preferably humans) that may have a disease or disorder treatable by modulating LRH1 expression are treated by administering an antisense compound according to the present invention. The compounds of the invention can be utilized in pharmaceutical compositions and are made by adding an effective amount of an antisense compound to a suitable pharmaceutically acceptable diluent or carrier. The use of the antisense compounds and methods of the invention can also be useful in prevention, for example to prevent or delay infection, inflammation or tumor formation, for example.

  The antisense compounds of the present invention are useful for research and diagnostics because they can hybridize to nucleic acids encoding LRH1 and readily assemble sandwiches and other assays to take advantage of this phenomenon. This is because it can. Hybridization between the antisense oligonucleotide of the present invention and a nucleic acid encoding LRH1 can be detected by means known in the art. Such means include enzyme-oligonucleotide binding, oligonucleotide radiolabeling, or any other suitable detection means. Kits using detection means for detecting LRH1 levels in such samples can also be manufactured.

  The present invention also includes pharmaceutical compositions and formulations comprising the antisense compounds of the present invention. The pharmaceutical compositions of the present invention can be administered in a variety of ways depending on whether local or systemic treatment is desired and where the area to be treated is. Administration is topical (eg, intraocular, mucosal, intravaginal and rectal delivery), eg, pulmonary administration by inhalation or insufflation of powder or aerosol (eg, by nebulizer); intratracheal, intranasal, epidermis Administration and transdermal administration, oral administration or parenteral administration are possible. Parenteral administration includes intravenous, arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, eg, intrathecal, or intraventricular. Oligonucleotides with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration.

  Pharmaceutical compositions and formulations for topical administration include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous bases, powder bases or oil bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves, etc. may also be useful.

  Compositions and formulations for oral administration include powders or granules, suspensions or aqueous or non-aqueous vehicle solutions, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersants or binders may be desirable.

  Compositions and formulations for parenteral, intrathecal or intraventricular administration include sterile aqueous solutions, which are not limited to buffers, diluents, and other suitable additives, such as May include penetration enhancers, carrier compounds, and other pharmaceutically acceptable carriers or excipients.

  The pharmaceutical composition of the present invention includes, but is not limited to, formulations comprising solutions, emulsions, and liposomes. These compositions can be made from a variety of components such as, but not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semi-solids.

  The pharmaceutical formulations of the present invention can be conveniently provided in a single dose and can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredient with a pharmaceutical carrier or excipient. In general, such formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both and, if necessary, shaping the product.

  The compositions of the invention can be formulated into any of a variety of possible dosage forms, including but not limited to tablet capsules, liquid syrups, soft gels, suppositories and enemas. The compositions of the present invention can also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further comprise substances that increase the viscosity of the suspension, such substances including, for example, sodium carboxymethylcellulose, sorbitol, and / or dextran. The suspension may also contain stabilizers.

  In one embodiment of the invention, the pharmaceutical composition can be formulated and used as a foam. Pharmaceutical foams include, but are not limited to, formulations such as emulsions, microemulsions, creams, jellies and liposomes. The end products and concentration components of these formulations vary as long as their properties are basically similar. The manufacture of such compositions and formulations is generally known to those skilled in the pharmaceutical and pharmaceutical arts and can be applied to the formulation of the composition of the present invention.

Emulsions The compositions of the present invention can be manufactured and formulated as emulsions. Emulsions are typically heterogeneous systems in which one liquid is dispersed in the other liquid in the form of liquid particles (usually greater than 0.1 μm in diameter). (Idson's “Pharmaceutical Dosage Forms”, Lieberman, Rieger and Banker (eds.), 1988, Marcel Dekker, Inc., New York, New York, Vol. 1, 199; Lieberman, Rieger and Banker (eds.), 1988, Marcel Decker, New York, New York, Vol. 1, page 245; Block, “Pharmaceutical Dosage Forms”, Lieberman, Rieger and Banker (eds.), 1988. , Marcel Decker, New York, New York, Vol. 2, p. 335 Higuchi et al., “Remington's Pharmaceutical Sciences”, Mac Publishing, Easton, Pennsylvania, 1985, p. 301). An emulsion is a two-phase system that optionally includes two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions can be either water-in-oil (w / o) or oil-in-water (o / w) types. A composition obtained by refining the aqueous phase into fine liquid particles and dispersing it in most oily phases as fine liquid particles is referred to as a water-in-oil (w / o) emulsion. Alternatively, a composition obtained by refining the oily phase into fine liquid particles and dispersing the fine liquid particles in most of the aqueous phase is referred to as an oil-in-water (o / w) emulsion. The emulsion may contain additional ingredients added to the dispersed phase, and the active drug, and can be present as a solution in itself either as an aqueous phase, an oily phase or a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes and antioxidants may also be present in the emulsion as required. The pharmaceutical emulsion may also be a multiple emulsion of three or more phases, for example oil-in-water-in-oil (o / w / o) and water-in-oil-in-water (w / o / w) emulsions. Can be mentioned. Such complex formulations often offer certain advantages over simple two-phase emulsions. A w / o / w emulsion is composed of multiple emulsions in which individual oil droplet particles of the o / w emulsion are coated with smaller water droplet particles. Similarly, an o / w / o emulsion is provided by a system of oil droplet particles coated with water droplets stabilized in an oily continuous phase.

  Emulsions are characterized by low or no thermodynamic stability. In some cases, the dispersed or discontinuous phase of the emulsion is well dispersed in the external or continuous phase, and this form is maintained by the viscosity of the emulsifier and the formulation. Any of the phases of the emulsion may be semi-solid or solid, for example in the case of emulsion ointment bases and creams. Other means of stabilizing the emulsion require the use of emulsifiers that can be incorporated into any of the emulsion phases. Emulsifiers can generally be divided into four categories: synthetic surfactants, naturally occurring emulsifiers, absorbent bases, and finely divided solids (Idson “Pharmaceutical Dosage Forms”, Lieberman, Rieger and Banker). (Eds.), 1988, Marcel Decker, New York, New York, Vol. 1, page 199).

  Synthetic surfactants, also known as surfactants, have found wide applicability in emulsion formulations and are reviewed in the following literature (Rieger's “Pharmaceutical Dosage Forms”, Lieberman, Rieger). And Banker (eds.), 1988, Marcel Decker, New York, New York, Vol. 1, page 285; New York, 1988, Volume 1, 199). Surfactants are typically amphiphilic and include a hydrophilic portion and a hydrophobic portion. The ratio of surfactant to hydrophilic hydrophobicity is referred to as the hydrophilic / lipophilic balance (HLB) and is a useful tool for classifying and selecting surfactants in the manufacture of formulations. Surfactants can be classified into various classes based on the characteristics of the hydrophilic groups: nonionic, anionic, cationic, and amphoteric (Rieger's “Pharmaceutical Dosage Forms”, Lieberman, Rieger and Banker ( Ed.), 1988, Marcel Decker, New York, New York, Vol. 1, page 285).

  Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin, and gum arabic. Absorbent substrates have hydrophilic properties and can absorb water to form w / o emulsions and still retain their semi-solid consistency, such as anhydrous lanolin or hydrophilic petrolatum. Finely divided solids have also been used as excellent emulsifiers, especially in combination with surfactants and in viscous formulations. These are polar inorganic solids such as heavy metal hydroxides, non-swelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids For example carbon or glyceryl tristearate.

  A wide variety of non-emulsifying substances are also included in the emulsion formulation and contribute to the emulsion properties. Such materials include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, lubricants, hydrophilic colloids, preservatives, and antioxidants (Block's “Pharmaceutical Dosage Forms”, Lieberman, Rieger and Banker (eds.), 1988, Marcel Decker, New York, New York, Vol. 1, p. 335; Company, New York, New York, Vol. 1, page 199).

  Hydrophilic colloids or hydrocolloids include naturally occurring rubbers and synthetic polymers such as polysaccharides (eg, gum arabic, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (eg, carboxymethylcellulose, and Carboxypropylcellulose), and synthetic polymers such as carbomers, cellulose ethers, and carboxyvinyl polymers. These can be dispersed in water or swollen to form a colloidal solution, which forms a strong interfacial film around the liquid particles in the dispersed phase and increases the viscosity of the external phase. The emulsion can be stabilized.

  Because emulsions may contain various ingredients (eg, carbohydrates, proteins, sterols, and phosphatides) that may easily assist in the growth of microorganisms, emulsion formulations may optionally contain preservatives. Good. Commonly used preservatives included in emulsion formulations include methylparaben, propylparaben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also generally added to emulsion formulations and can prevent alteration of the formulation. Antioxidants used include active oxygen scavengers such as tocopherol, alkyl gallate, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergies Agents such as citric acid, tartaric acid, and lecithin are possible.

  The application of emulsion formulations by the integumental, oral and parenteral routes and methods for their preparation are reviewed in the following literature (Idson's “Pharmaceutical Dosage Forms”, Lieberman, Rieger and Banker (eds.), 1988, Marcel. Decker, New York, New York, Vol. 1, page 199). Emulsion preparations for oral delivery are used in a very wide range in terms of ease of formulation, effectiveness after absorption, and bioavailability. (Rosoff's “Pharmaceutical Dosage Forms”, Lieberman, Rieger and Banker (eds.), 1988, Marcel Decker, New York, New York, Vol. 1, page 245; Banker (eds.), 1988, Marcel Decker, New York, New York, Vol. 1, 199). Among the substances commonly administered orally as o / w emulsions are mineral oil based laxatives, oil soluble vitamins, and high fat nutritional formulations.

  In one embodiment of the invention, the oligonucleotide and nucleic acid composition is formulated as a microemulsion. A microemulsion, which can be defined as a system of water, oil and amphiphile, is a uniform optically isotropic, thermodynamically stable liquid solution (Rosoff's “Pharmaceutical Dosage Forms”). Lieberman, Rieger and Banker (eds.), 1988, Marcel Decker, New York, NY, Vol. 1, page 245). Typically, microemulsions are made by first dispersing the oil in an aqueous surfactant solution, followed by the addition of a sufficient amount of a fourth component (generally a medium chain alcohol) to form a clear system. System. Therefore, microemulsions are also described as thermodynamically stable, isotropically transparent dispersions of two immiscible liquids stabilized by an interfacial film of surface-active molecules (Leung And Shah, “Controlled Release of Drugs: Polymers and Aggregate Systems,” Rosoff, M. Ed., 1989, VCH Publishers, New York, 1852′5). Generally, microemulsions are made by combining 3 to 5 components such as oil, water, surfactant, cosurfactant, and electrolyte. Whether the microemulsion is a water-in-oil (w / o) or oil-in-water (o / w) type, characteristics of the oil and surfactant used and the structure of the polar head of the surfactant molecule Depending on the geometrical filling and the tail of the hydrocarbon (Schott's “Remington's Pharmaceutical Sciences”, Mac Publishing, Easton, Pennsylvania, 1985, 271).

  Phenomenological approaches utilizing phase equilibria have been extensively studied, and one skilled in the art has gained comprehensive knowledge on how to formulate microemulsions (Rosoff's “Pharmaceutical Dosage Forms”). Lieberman, Rieger and Banker (eds.), 1988, Marcel Decker, New York, New York, Vol. 1, page 245; Block, “Pharmaceutical Dosage Forms”, Lieberman, Rieger and Banker (eds.), 1988. Marcel Decker, New York, New York, Vol. 1, page 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in spontaneously formed thermodynamically stable liquid particle formulations.

  Surfactants used for the production of microemulsions are not limited to, but are ionic surfactants, nonionic surfactants, Brij96, polyoxyethylene oleyl ether, polyglycerol fatty acid esters, tetraglycerol monolaurate ( ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), sesquiolein Examples include acid decaglycerol (S0750) and decaglycerol acid decaglycerol (DAO750) (alone or in combination with a cosurfactant). Cosurfactants are usually short chain alcohols such as ethanol, 1-propanol, and 1-butanol, which help to increase interfacial fluidity by penetrating the surfactant membrane, resulting in surfactants. Because of the space between molecules, an irregular film is formed. However, microemulsions can be made without the use of cosurfactants, and alcohol-free self-emulsifying microemulsion systems are known in the art. Aqueous phases typically include, but are not limited to, water, drugs, glycerol, PEG300, PEG400, polyglycerol, propylene glycol, and aqueous solutions of ethylene glycol derivatives. Oil phases include, but are not limited to Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and triglycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides , Saturated polyglycolated C8-C10 glycerides, vegetable oils, and silicone oils.

  Microemulsions are of particular interest in terms of drug solubilization and enhanced drug absorption. Lipid-based microemulsions (both o / w and w / o) have been proposed to increase the oral bioavailability of drugs such as peptides (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsion improves drug solubilization, protects the drug from enzymatic hydrolysis, enhances drug absorption possible by modifying surfactant-induced membrane fluidity and permeability, ease of manufacture, Provides advantages for ease of oral administration over solid dosage forms, improved clinical efficacy, and reduced toxicity (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm). Sci., 1996, 85, 138-143). In some cases, microemulsions can spontaneously form when their components are combined at ambient temperature. This can be particularly advantageous when formulating thermolabile drugs, peptides, or oligonucleotides. Microemulsions are also effective for transdermal delivery of active ingredients in both cosmetic and pharmaceutical applications. The microemulsion compositions and formulations of the present invention are believed to readily enhance systemic absorption of oligonucleotides and nucleic acids from the gastrointestinal tract, as well as in the gastrointestinal tract, vagina, oral cavity, and other areas of administration. It is thought to improve local cellular uptake of oligonucleotides and nucleic acids.

  The microemulsions of the present invention may also include additional components and additives such as sorbitan monostearate (Grill3), Labrasol, and penetration enhancers to improve the properties of the formulation, Nucleic acid absorption can be increased. The penetration enhancer used in the microemulsions of the present invention can be classified as belonging to one of five broad categories: surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants. (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes is described above.

In addition to liposomal microemulsions, there are many systematic surfactant structures that have been studied and are used in drug formulations. Such surfactant structures include monolayers, micelles, bilayers, and vesicles. Vesicles, such as liposomes, have been of great interest from a drug delivery point of view because of their specificity and the duration of action they provide. The term “liposome” used in the present invention means a vesicle composed of a spherical bilayer or an amphipathic lipid arranged in a bilayer.

  Liposomes are unilamellar or multilamellar vesicles having a membrane formed of a lipophilic substance and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes have the advantage of being able to fuse to the cell wall. Non-cationic liposomes cannot be efficiently fused with the cell wall, but are absorbed by macrophages in vivo.

  In order to pass through intact mammalian skin, lipid vesicles must pass through a series of fine pores, each less than 50 nm in diameter, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use liposomes that are extremely deformable and can pass through such fine pores.

  Further advantages of liposomes: liposomes derived from natural phospholipids are biocompatible, biodegradable; liposomes can incorporate a variety of water and fat-soluble drugs; In the compartment, it can be mentioned that the encapsulated drug can be protected from metabolism and degradation (Rosoff's “Pharmaceutical Dosage Forms”, Lieberman, Rieger and Banker (eds.), 1988, Marcel Decker, New York, New York, Vol. 1, page 245). Important considerations in the production of liposome formulations are the lipid surface charge of the liposomes, the size of the vesicles, and the amount of aqueous components.

  Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Since liposome membranes are structurally similar to biological membranes, when liposomes are applied to tissue, the liposomes begin to fuse to the cell membrane. As fusion of liposomes and cells proceeds, the contents of the liposomes migrate to cells where the active substance can act.

  Liposome formulation has been the focus of extensive research as a delivery mode for various drugs. For topical administration, evidence has developed that liposomes have several advantages over other formulations. Such benefits include reduced side effects associated with systemic absorption of the administered drug in large quantities, increased accumulation of administered drug at the desired target, and a wide variety of both hydrophilic and hydrophobic Ability to administer drugs to the skin.

  Numerous reports detail the ability of liposomes to deliver substances containing high molecular weight DNA to the skin. Compounds such as analgesics, antibodies, hormones, and high molecular weight DNA were administered to the skin. Most applications resulted in targeting of the upper epidermis.

  Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes that interact with negatively charged DNA molecules to form stable and stable complexes. The positively charged DNA / liposome complex binds to the negatively charged cell surface and is internalized in the endosome. Due to the acidic pH within the endosome, the liposomes rupture and release their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).

  Liposomes are pH sensitive or negatively charged and capture DNA rather than complex with DNA. Since both DNA and lipid have similar charges, repulsion occurs and complex formation does not occur. Nevertheless, some DNA is trapped within the aqueous interior of these liposomes. PH-sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to the cell monolayer in the medium. Exogenous gene expression was detected in target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).

  One major type of liposomal composition includes phospholipids in addition to the naturally occurring phosphatidylcholine. For example, a natural liposome composition can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). In general, anionic liposome compositions are formed from dimyristoyl phosphatidylglycerol, while anionic membrane fusion liposomes are first formed from dioleoylphosphatidylethanolamine (DOPE). Other types of liposome compositions are formed from phosphatidylcholine (PC), such as soy PC or egg PC. Other types are formed from mixtures of phospholipids and / or phosphatidylcholines and / or cholesterol.

  Numerous studies have evaluated the topical delivery of liposomal drug formulations to the skin. Application of liposomes containing interferon to guinea pig skin reduced cutaneous herpes ulcers, but interferon delivery by other means (eg as a solution or emulsion) was not effective (Weiner et al., Journal of Drug Targeting, 1992, 2,405-410). In addition, further studies have tested the effectiveness of interferon administered as part of a liposomal formulation versus interferon administration using an aqueous system and concluded that the liposomal formulation is superior to administration in an aqueous system. (Du Pressis et al., Antibiotic Research, 1992, 18, 259-265).

Nonionic liposome systems, particularly those containing nonionic surfactants and cholesterol, were also tested to determine the usefulness of drug delivery to the skin. Using a nonionic liposome formulation containing Novasome ^™ I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and Novasome ^™ II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) Cyclosporin-A was delivered to the dermis of the mouse skin. The results show that such nonionic liposome systems are effective in facilitating the deposition of cyclosporin-A on various layers of the skin (Hu et al., ST. P. Pharma. Sci., 1994, 4, 6, 466).

Liposomes also include “stereoconstitutively stable” liposomes, which as used in the present invention means liposomes comprising one or more specialized lipids, and such specialized When lipids are incorporated into liposomes, the circulation lifetime is increased compared to liposomes that do not contain such specialized lipids. Examples of conformationally stable liposomes include that part of the lipid portion (A) that forms the vesicles of the liposome contains one or more glycolipids, such as monosialoganglioside G _M1 , or (B) One that is derivatized with one or more hydrophilic polymers, such as polyethylene glycol (PEG) components. While not intending to be limited to any particular theory, the industry is concerned with such configurationally stable liposomes, including at least sterically stabilized liposomes comprising lipids derivatized with gangliosides, sphingomyelin, or PEG. The increased circulating half-life of conjugated liposomes is thought to be caused by a decrease in uptake into reticuloendothelial (RES) cells (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al. , Cancer Research, 1993, 53, 3765).

Various liposomes containing one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann.NY Acad. Sci., 1987, 507, 64) reported the ability of monosialoganglioside G _M1 , galactocerebroside sulfate, and phosphatidylinositol to improve the blood half-life of liposomes. It was. These discoveries are described by Gabizon et al. (Proc. Natl. Acad. Sci. USA, 1988, 85, 6949). U.S. Pat. No. 4,837,028 and WO88 / 04924 (all Allen et al.) Disclose liposomes containing (1) sphingomyelin and (2) ganglioside Gjor, galactocerebroside sulfate. US Pat. No. 5,543,152 (Webb et al.) Discloses liposomes containing sphingomyelin. WO 97/13499 (Lim et al.) Discloses liposomes containing 1,2-sn-dimyristoylphosphatidylcholine.

Various liposomes comprising lipids derivatized with one or more hydrophilic polymers and methods for their production are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) describe liposomes containing a non-ionic surfactant, 2C ₁₂ 15G (which contains a PEG component). Illum et al. (FEBS Lett., 1984, 167, 79) describe that the hydrophilic half-life of polystyrene particles with a polymeric glycol can significantly increase blood half-life. Synthetic phospholipids modified by attaching a carboxy group of a polyalkylene glycol (eg PEG) have been described by Sears (US Pat. Nos. 4,426,330 and 4,534,899). . Klibanov et al. (FEBS Lett., 1990, 268, 235) demonstrated a significant increase in circulating half-life with liposomes containing phosphatidylethanolamine (PE) derivatized with PEG or PEG stearate. Explains the experiment to do. Blume et al. (Biochimica et Biophysica Acta, 1990, 1029, 91) made such observations from other PEG-derivatized phospholipids, such as DSPE-PEG (distearoylphosphatidylethanolamine (DSPE) and PEG). Also formed). Liposomes having a PEG moiety covalently attached to the outer surface are described in EP 0445131 (B1) and Fisher WO 90/04384. Liposome compositions comprising 1 to 20 mole percent of PE derivatized with PEG and methods for their use are described by Woodle et al. (US Pat. Nos. 5,013,556 and 5,356,633), and Martin et al. ( U.S. Pat. No. 5,213,804 and European Patent No. 0 496813 (B1)). Liposomes containing many other lipid-polymer complexes are disclosed in WO 91/05545 and US Pat. No. 5,225,212 (both Martin et al.) And WO 94/20073 (Zalipsky et al.). Liposomes containing ceramide lipids modified with PEG are described in WO 96/10391 (Choi et al.). US Pat. Nos. 5,540,935 (Miyazaki et al.) And 5,556,948 (Tagawa et al.) Describe liposomes containing PEG, whose surfaces may be further derivatized with functional components. .

  Liposomes containing nucleic acids are slightly known in the art. Thierry et al. WO 96/40062 discloses a method of encapsulating high molecular weight nucleic acids in liposomes. Tagawa et al., US Pat. No. 5,264,221, discloses protein-bound liposomes, and claims that the contents of such liposomes can contain antisense RNA. US Pat. No. 5,665,710 to Rahman et al. Describes a method of encapsulating oligodeoxynucleotides in liposomes. Love et al., WO 97/04787 discloses liposomes comprising antisense oligonucleotides that target the raf gene.

  Transfersomes are yet another type of liposome, which is a highly deformable lipid assembly and an attractive candidate as a vehicle for drug delivery. Transfersomes can be described as lipid particles of lipids that are extremely deformable enough to easily penetrate through pores smaller than liquid particles. Transfersomes are applicable to the environment in which they are used, for example, transfersomes self-optimize (adapt to skin pore shape), self-repair, and frequently target without fragmentation And in some cases self-loading. To produce transfersomes, a surface edge activator (usually a surfactant) can be added to a standard liposome composition. Transfersomes have been used to deliver serum albumin to the skin. Transfersome-mediated delivery of serum albumin has been found to be effective as a subcutaneous injection of a solution containing serum albumin.

Surfactants have found wide application in formulations such as emulsions (such as microemulsions) and liposomes. The most common way to classify and rank the properties of many different types of surfactants (including both natural and synthetic) is the hydrophilic / lipophilic balance (HLB)
Is to use. The nature of the hydrophilic group (or known as the “head”) provides the most useful means to classify the various surfactants used in the formulation (Rieger “Pharmaceutical Dosage Forms”, Marcel Decker). (New York, New York, 1988, p. 285))

  If the surfactant molecule is not ionized, the surfactant is classified as a nonionic surfactant. Nonionic surfactants have found wide application in pharmaceuticals and cosmetics and are suitable for use over a variety of pH values. In general, their HLB values range from 2 to about 18 depending on their structure, and nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryls. Examples include esters, sorbitan esters, sucrose esters, and ethoxylated esters. This class also includes nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated / propoxylated block polymers. Polyoxyethylene surfactants are the most common member of the nonionic surfactant class.

  If the surfactant molecule has a negative charge when dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, amino acid acylamides, sulfuric esters such as alkyl sulfates, and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates. And sulfosuccinates and phosphates. The most important members of the anionic surfactant class are alkyl sulfates and soaps.

  If the surfactant molecule has a positive charge when dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. Quaternary ammonium salts are the most commonly used members of this class.

  A surfactant is classified as amphoteric if it has the ability to have either a positive charge or a negative charge. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines, and phosphatides.

  The use of surfactants in pharmaceuticals, formulations, and emulsions has been reviewed (Rieger's “Pharmaceutical Dosage Forms”, Marcel Decker, New York, NY, 1988, 285).

Penetration enhancers In one embodiment, the present invention can achieve efficient delivery of nucleic acids (especially oligonucleotides) to animal skin using various penetration enhancers. Most drugs exist in ionized or non-ionized form in solution. However, normally only fat-soluble or lipophilic drugs can easily cross cell membranes. It has been discovered that when the membrane to be passed is treated with a penetration enhancer, even non-lipophilic drugs can pass through the cell membrane. In addition to assisting the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also increase the permeability of lipophilic drugs.

  Penetration enhancers can be classified as belonging to one of five broad categories: surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical. Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of the aforementioned penetration enhancer classes is described in more detail below.

Surfactant : In the context of the present invention, a surfactant (or “surfactant”), when dissolved in an aqueous solution, reduces the surface tension of the solution, or the interfacial tension between the aqueous solution and other liquids, and thereby mucosa. Is a chemical that can enhance the absorption of oligonucleotides that pass through. In addition to bile salts and fatty acids, such penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether, and polyoxyethylene-20-cetyl ether (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92); and emulsions of perfluoro compounds such as FC-43 (Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).

Fatty acids : Various fatty acids and their derivatives that act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, Dicaprate, tricaprate, monoolein (1-monooleyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitine, acylcholine, those _C1-10 alkyl esters (e.g. methyl, isopropyl and t-butyl) and their mono- and di-glycerides (i.e. oleate, laurate, caprate, myristic ester, palmitic Acid S (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92; Muranishi, Critical Review 3 in Therapeutics 3). El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).

Bile salts : Physiological roles of bile include simplifying the dispersion and absorption of lipids and fat-soluble vitamins (Brunton's “Goodman &Gilman's Theological Basis of Therapeutics”, Chapter 38, 9th edition. , Hardman et al., McGraw-Hill, New York, 1996, pages 934-935). Various natural bile salts and their synthetic derivatives act as penetration enhancers. Thus, the term “bile salt” includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. Examples of the bile salt of the present invention include cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucolin Acid (glucholic acid) (sodium glucophosphate), glycophosphoric acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (taurodeoxycholic acid) Sodium deoxycholate), chenodeoxycholic acid (sodium chenodeoxycholic acid), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidic acid (STDHF) Examples include sodium glycodihydrofusidate, and polyoxyethylene-9-lauryl ether (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92; Swinard's “Remington's Pharma” Chapter 39, 18th edition, edited by Gennaro, Mac Publishing, Easton, Pennsylvania, 1990, pp. 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carriers, 1990, 7, 1-30; J. Pharm.Exp.Ther., 1992, 263. 25;. Yamashita, etc., J.Pharm.Sci, 1990 years, 79,579～583).

Chelating agent : A chelating agent used in the present invention can be defined as a compound that can remove metal ions from a solution by forming a complex with the metal ions and increase the absorption of oligonucleotides that pass through the mucosa. . Since most characteristic DNA nucleases require divalent metal ions for catalysis and are inhibited by chelating agents, the use of chelating agents as penetration enhancers in the present invention further reduces the DNase Has the advantage as an inhibitor. (Jarrett, J. Chromatogr., 1993, 618, 315-339). Chelating agents of the present invention include, but are not limited to, ethylenediaminetetraacetate disodium (EDTA), citric acid, salicylates (eg, sodium salicylate, 5-methoxysalicylate, and homovanillate), collagen N-acyl. Derivatives, Laureth-9, and N-aminoacyl derivatives (enamines) of β-diketones (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92; Murashishi, Critical Reviews Year, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).

  Non-chelating non-surfactant penetration enhancing compounds used in the present invention are defined as those that exhibit little activity as compound chelators or surfactants, but enhance absorption of oligonucleotides through the gastrointestinal mucosa. (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers includes, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and Non-steroidal anti-inflammatory drugs such as diclofenac sodium, indomethacin, and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).

  Substances that enhance the uptake of oligonucleotides at the cellular level may be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids such as lipofectin (Junichi et al., US Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules such as polylysine (Lollo et al., PCT application WO 97/30731) are also oligonucleotides It is known to increase cell uptake.

  Other substances may be utilized to increase the permeability of the administered nucleic acid, such as glycols such as ethylene glycol and propylene glycol, pyrroles such as 2-pyrrole, azone, and terpenes such as limonene and menthone. Is mentioned.

Carrier Certain compositions of the present invention also incorporate a carrier compound in the formulation. A “carrier compound” or “carrier” as used in the present invention is inactive (ie, has no biological activity per se), but may be, for example, from degradation or cycling of biologically active nucleic acids. By in vivo processes that reduce the bioavailability of nucleic acids having biological activity by promoting the removal of the nucleic acids, it may mean nucleic acids that are recognized as nucleic acids or analogs thereof. By administering the nucleic acid and the carrier compound together (typically an excess of the latter), perhaps the carrier compound and the nucleic acid compete for a common receptor other than the liver, kidney or other cardiovascular system The amount of nucleic acid recovered in the storage organ can be substantially reduced. For example, administration with polyinosinic acid, dextran sulfate, polycytidic acid, or 4-acetamido-4isothiocyano-stilbene-2,2 ′ disulfonic acid reduces the recovery of partially phosphorothioate oligonucleotides in liver tissue (Miyao et al., Antisense Res. Dev., 1995, 5, 115-121; Takakura et al., Antisense & Nucl. Acid Drug Dev., 1996, 6, 177-183).

Apart from an excipient carrier compound, a “pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent, or any other drug for delivering one or more nucleic acids to an animal. It is a physically inert carrier. Excipients may be liquid or solid and are selected using a planned mode of administration that takes into account that the desired combination of nucleic acid and other components of a given pharmaceutical composition provides the desired volume, concentration, etc. . Typical pharmaceutical carriers include, but are not limited to, binders (such as pregelatinized corn starch, polyvinyl pyrrolidone, or hydroxypropyl methylcellulose); fillers (such as lactose and other sugars, microcrystalline cellulose). Pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylate, or calcium hydrogen phosphate); lubricant (eg, magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metal stearate, hydrogenated vegetable oil, Corn starch, polyethylene glycol, sodium benzoate, sodium acetate, etc.); disintegrants (eg, starch, sodium starch glycolate, etc.); and wetting agents (eg, sodium lauryl sulfate) Etc.) and the like.

  Pharmaceutically acceptable organic or inorganic excipients that are suitable for parenteral administration and do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohol, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone Etc.

  Formulations for topical administration of nucleic acids include sterile and non-sterile aqueous solutions, non-aqueous solutions of common solvents such as alcohols, or liquid or solid oil-based nucleic acid solutions. Such a solution may also include buffers, diluents, and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for parenteral administration that do not adversely react with nucleic acids may be used.

  Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, And polyvinyl pyrrolidone.

Other Ingredients The compositions of the present invention may further comprise other adjunct ingredients that are conventionally present in pharmaceutical compositions, at levels of use established in the art. Thus, for example, the composition may contain additional compatible pharmaceutically active substances such as antipruritics, astringents, local anesthetics or anti-inflammatory agents, or various dosages of the compositions of the invention Additional materials useful for physically formulating the form may include, for example, dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickeners, and stabilizers. However, such substances should not unduly interfere with the biological activity of the components of the composition of the present invention when added. The preparation may be sterilized and, if necessary, adjuvants such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts to affect osmotic pressure, buffers, colorants, flavoring It may be mixed with drugs, and / or fragrances, etc. (which do not adversely interact with the nucleic acids of the formulation).

  Aqueous suspensions may contain substances that increase the viscosity of the suspension and include, for example, sodium carboxymethylcellulose, sorbitol, and / or dextran. The suspension may also contain a stabilizer.

  Certain embodiments of the present invention provide pharmaceutical compositions comprising (a) one or more antisense compounds and (b) one or more other chemotherapeutic agents that function in a non-antisense mechanism. To do. Examples of such chemotherapeutic agents include, but are not limited to, anticancer agents such as daunorubicin, dactinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard, chlorambucil, melphalan, cyclophosphamide, 6- Mercaptopurine, 6-thioguanine, cytarabine (CA), 5-fluorouracil (5-FU), flocciuridine (5-FUdR), methotrexate (MTX), colchicine, vincristine, vinblastine, etoposide, teniposide, cisplatin, and diethylstil Best roll (DES). See, generally, The Merck Manual of Diagnostics and Therapy, 15th edition, edited by Berkow et al., 1987, Rahway, NJ, pp. 1206-1228. Anti-inflammatory drugs include, but are not limited to, non-steroidal anti-inflammatory drugs, and corticosteroids, and antiviral drugs include, but are not limited to, ribibirin, vidarabine, acyclovir, and ganciclovir. Can be used together in the composition of the present invention. See generally The Merck Manual of Diagnostics and Therapy, 15th Edition, Berkow et al., 1987, Rahway, NJ, pages 2499-2506 and pages 46-49, respectively). Other non-antisense chemotherapeutic agents are also within the scope of the present invention. Two or more combined compounds may be used together or sequentially.

  In other related embodiments, the composition of the invention comprises one or more antisense compounds (especially oligonucleotides) that target a first nucleic acid and one or more that target a second nucleic acid target. Further additional antisense compounds may be included. Many examples of antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially.

The formulation of therapeutic compositions and their subsequent administration is considered to be within the skill in the art. Administration is a course of treatment that lasts for days to months, depending on the severity and responsiveness of the condition being treated, or until treatment is achieved or a reduction in condition is achieved It is done until it is done. The optimal dosing schedule can be calculated by measuring the amount of drug accumulated in the patient's body. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimal dosages may vary depending on the relative potency of individual oligonucleotides and are generally estimated based on EC _{50 s} found to be effective in in vitro and in vivo animal models be able to. In general, dosage is from 0.01 μg to 100 g / kg body weight and can be administered once or more per day, week, month or year, or every 2 to 20 years It may be once. One of ordinary skill in the art can easily estimate repetition rates for administration based on measured residence times and concentrations of the drug in bodily fluids or tissues. After successful treatment, it may be desirable to have the patient receive maintenance therapy to prevent recurrence of the condition, in which case the oligonucleotide is 0.01 μg-100 g / kg body weight, once or more daily. It is administered in a maintenance dose once every 20 years.

  While the invention will be specifically described in accordance with certain preferred embodiments, the following examples are provided merely to illustrate the invention and do not limit the invention.

Example 1
Oligonucleotide synthesized deoxy and nucleoside phosphoramidites for 2′-alkoxyamidites 2′-deoxy and 2′-methoxy β-cyanoethyldiisopropyl phosphoramidites are available from commercial sources (eg Chem Jeans ( ChemGenes), Needham, Massachusetts, or Glenn Research, Stirling, Virginia). Other 2′-O-alkoxy substituted nucleoside amidites were prepared as described in US Pat. No. 5,506,351 (incorporated by reference). For oligonucleotides synthesized with 2′-alkoxy amidites, the standard cycle for unmodified oligonucleotides was utilized (but the waiting step after pulse output of tetrazole and base was increased to 360 seconds).

  Oligonucleotides containing 5-methyl-2'-deoxycytidine (5-Me-C) nucleotides were used with commercially available phosphoramidites (Glen Research, Sterling, VA, or Chem Jeans, Needham, MA). [Sangvi et al., Nucleic Acids Research, 1993, 21, 3197-3203].

2'-Fluoramidite
2′-Fluorodeoxyadenosine amidite 2′-fluoro oligonucleotides were synthesized as previously described [Kawasaki et al., J. Biol. Med. Chem., 1993, 36, 831-841, and US Pat. No. 5,670,633 (incorporated by reference). Briefly, the protected nucleoside N6-benzoyl-2′-deoxy-2′-fluoroadenosine utilizes commercially available 9-β-D-arabinofuranosyladenine as a starting material and is further described in literature methods. Was synthesized by introducing a 2′-α-fluoro atom by _SN 2 substitution of the 2′-β-trityl group. Thus, N6-benzoyl-9-β-D-arabinofuranosyl adenine was selectively protected and obtained in moderate yield as a 3 ′, 5′-ditetrahydropyranyl (THP) intermediate. Deprotection of the THP and N6-benzoyl groups is achieved using standard methods, and 5′-dimethoxytrityl- (DMT), and 5′-DMT-3′-phosphoramidite using standard methods. An intermediate was obtained.

Using 9-β-D-arabinofuranosylguanine protected with 2′-fluorodeoxyguanosine tetraisopropyldisiloxanyl (TPDS) as a starting material and converting to the intermediate diisobutyrylarabinofuranosylguanosine 2'-deoxy-2'-fluoroguanosine was synthesized. After deprotecting the TPDS group, the hydroxyl group was protected with THP to give diisobutyryl di-THP protected arabinofuranosylguanine. After selective O-deacylation and triflation, the crude product was treated with fluoride to deprotect the THP group. 5'-DMT- and 5'-DMT-3'-phosphoramidites were obtained using standard methods.

Synthesis of 2'-fluoro uridine 2'-deoxy-2'-fluorouridine is modified literature methods, 2,2 'anhydro -1-beta-D-arabinofuranosyl uracil a 70% hydrogen fluoride -Achieved by treatment with pyridine. Standard methods were used to obtain 5′-DMT and 5′-DMT-3′-phosphoramidites.

2′-fluorodeoxycytidine 2′-deoxy-2′-fluorocytidine was synthesized by amination of 2′-deoxy-2′-fluorouridine followed by selective protection to give N4-benzoyl-2 ′. -Deoxy-2'-fluorocytidine was obtained. Standard methods were used to obtain 5′-DMT and 5′-DMT-3′-phosphoramidites.

Amidites modified with 2'-O- (2-methoxyethyl) 2'-O-methoxyethyl-substituted nucleoside amidites can be prepared as follows or alternatively, Martin, P., Helvetica Chimica Acta, 1995, 78, Prepared as described in 486-504.

2,2′-anhydro [1- (β-D-arabinofuranosyl) -5-methyluridine]
5-methyluridine (ribosylthymine; commercially available from Yamasa, Choshi, Japan) (72.0 g, 0.279 M), diphenyl carbonate (90.0 g, 0.420 M), and sodium bicarbonate (2. 0 g, 0.024 M) was added to DMF (300 mL). This mixture was heated with stirring under reflux, and the generated carbon dioxide gas was released under control. After 1 hour, the slightly darkened solution was concentrated under reduced pressure. The resulting syrup was poured into diethyl ether (2.5 L) with stirring. A rubbery product was obtained. The ether was decanted and the residue was dissolved in a minimum amount of methanol (ca. 400 mL). This solution was poured into fresh ether (2.5 L) to give a hard gum. The ether was decanted and the rubber was dried in a vacuum oven (60 ° C. for 24 hours at 1 mm Hg) to give a solid that was crushed into a light tan powder. This material was used as such for further reactions (or may be further purified by column chromatography using a gradient of methanol in ethyl acetate (10-25%)) to give a white solid.

2′-O-methoxyethyl-5-methyluridine 2,2′-anhydro-5-methyluridine (195 g, 0.81 M), tris (2-methoxyethyl) borate (231 g, 0.98 M), and 2 -Methoxyethanol (1.2 L) was added to a 2 L stainless steel pressure vessel and placed in an oil bath preheated to 160 ° C. After heating at 155-160 ° C. for 48 hours, the container was opened and the solution was dried by evaporation and triturated with MeOH (200 mL). The residue was suspended in hot acetone (1 L). The insoluble salt was filtered and washed with acetone (150 mL) and the filtrate was evaporated. The residue (280 g) was dissolved in CH ₃ CN (600 mL) and evaporated. A silica gel column (3 kg) was packed in CH ₂ Cl ₂ / acetone / MeOH (20: 5: 3) containing 0.5% Et ₃ NH. The residue was dissolved in CH ₂ Cl ₂ (250 mL), adsorbed onto silica (150 g) and loaded onto the column. Elution with product filled solvent gave the title product. Additional material could be obtained by reprocessing the impure components.

2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methyluridine 2′-O-methoxyethyl-5-methyluridine (160 g, 0.506 M) was co-evaporated with pyridine (250 mL) and dried The residue was dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) was added and the mixture was stirred at room temperature for 1 hour. A second aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) was added and the reaction was stirred for an additional hour. Next, methanol (170 mL) was added to stop the reaction. The solvent was evaporated and triturated with CH ₃ CN (200 mL). The residue was dissolved in CHCl ₃ (1.5 L) and extracted with saturated NaHCO ₃ (2 × 500 mL) and saturated NaCl (2 × 500 mL). The organic phase was dried over Na ₂ SO ₄ , filtered and evaporated. The residue was purified on a packed silica gel column (3.5 kg) eluting with EtOAc / hexane / acetone (5: 5: 1) containing 0-5% Et ₃ NH. Pure fractions were evaporated to give the title product.

3′-O-acetyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methyluridine 2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methyluridine (106 g, 0.167M), DMF / pyridine (750 mL; 3: 1 mixture prepared with DMF (562 mL) and pyridine (188 mL)), and acetic anhydride (24.38 mL, 0.258 M) for 24 hours at room temperature. Stir. The TLC sample was first quenched with additional MeOH and the reaction was monitored by TLC. After the reaction was complete as judged by TLC, MeOH (50 mL) was added and the mixture was evaporated at 35 ° C. The residue was dissolved in CHCl ₃ (800 mL) and extracted with saturated sodium bicarbonate (2 × 200 mL) and saturated NaCl (2 × 200 mL). The aqueous layer was back extracted with CHCl ₃ (200 mL). The combined organics were dried over sodium sulfate and evaporated to give a residue. The residue was purified on a silica gel column (3.5 kg) eluting with EtOAc / hexane (4: 1). Pure product fractions were evaporated to give the title compound.

3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-triazoleuridine

To the first solution, 3′-O-acetyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) is dissolved in CH ₃ CN (700 mL). Manufactured and stored. Triethylamine (189 mL, 1.44 M) was added to a solution of triazole (90 g, 1.3 M) in CH ₃ CN (1 L), cooled to −5 ° C. and stirred with an overhead stirrer for 0.5 h. POCl ₃ was added dropwise over 30 minutes to the stirred solution maintained at 0-10 ° C. and the resulting mixture was stirred for an additional 2 hours. The first solution was added dropwise to the latter solution over 45 minutes. The resulting reaction mixture was stored overnight in a cold room. Salts were filtered from the reaction mixture and the solution was evaporated. The residue was dissolved in EtOAc (1 L) and the insoluble solid was removed by filtration. The filtrate was washed with NaHCO ₃ (1 × 300 mL) and saturated NaCl (2 × 300 mL), dried over sodium sulfate and evaporated. The residue was triturated with EtOAc to give the title compound.

2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine 3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-triazole A solution of uridine (103 g, 0.141 M) in dioxane (500 mL) and NH ₄ OH (30 mL) was stirred at room temperature for 2 hours. The dioxane solution was evaporated and the residue azeotroped with MeOH (2 × 200 mL). The residue was dissolved in MeOH (300 mL) and transferred to a 2 liter stainless steel pressure vessel. MeOH (400 mL) saturated with NH ₃ gas was added and the vessel was heated to 100 ° C. for 2 h (TLC showed complete conversion). The contents of the vessel were dried by evaporation and the residue was dissolved in EtOAc (500 mL) and washed once with saturated NaCl (200 mL). The organics were dried over sodium sulfate and the solvent was evaporated to give the title compound.

N4-benzoyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methylcytidine 2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methylcytidine (85 g, 0.134 M ) Was dissolved in DMF (800 mL) and benzoic anhydride (37.2 g, 0.165 M) was added with stirring. After stirring for 3 hours, TLC showed the reaction was about 95% complete. The solvent was evaporated and the residue azeotroped with MeOH (200 mL). The residue was dissolved in CHCl ₃ (700 mL), extracted with saturated NaHCO ₃ (2 × 300 mL) and saturated NaCl (2 × 300 mL), dried over MgSO ₄ and evaporated to give a residue. The residue was chromatographed on a silica column (1.5 kg) using EtOAc / hexane (1: 1) containing 0-5% Et ₃ NH as the eluting solvent. Pure product fractions were evaporated to give the title compound.

N4-benzoyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methylcytidine-3′-amidite N4-benzoyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5 - cytidine (74 g, 0.10 M) was dissolved in CH ₂ Cl ₂ (1L), tetrazole diisopropylamine (7.1 g), and phosphorous acid 2-cyano-ethoxy - tetra (isopropyl) (40.5 mL , 0.123M) was added with stirring under nitrogen. The resulting mixture was stirred at room temperature for 20 hours (TLC showed the reaction was 95% complete). The reaction mixture was extracted with saturated NaHCO ₃ (1 × 300 mL) and saturated NaCl (3 × 300 mL). The aqueous washes were back extracted with CH ₂ Cl ₂ (300 mL) and the extracts were combined, dried over MgSO ₄ and concentrated. The resulting residue was chromatographed on a silica column (1.5 kg) using EtOAc / hexane (3: 1) as the eluting solvent. Pure fractions were combined to give the title compound.

2'-O- (aminooxyethyl) nucleoside amidite and 2'-O- (dimethylaminooxyethyl) nucleoside amidite
2 ′-(dimethylaminooxyethoxy) nucleoside amidite 2 ′-(dimethylaminooxyethoxy) nucleoside amidite [also known in the art as 2′-O- (dimethylaminooxyethyl) nucleoside amidite] Produced according to paragraph description. Adenosine, cytidine, and guanosine nucleoside amidites were prepared in the same manner as thymidine (5-methyluridine), except that the exocyclic amine was protected with a benzoyl moiety in the case of adenosine and cytidine and isobutyryl in the case of guanosine. .

5'-O-tert-butyldiphenylsilyl -O ^{2-2'-anhydro-5-methyluridine} O ^{2-2'-anhydro-5-methyluridine} (Pro.Bio.Sint., Varese, Italy, 100.0 g , 0.46 mmol), dimethylaminopyridine (0.66 g, 0.013 eq, 0.0054 mmol) was dissolved in dry pyridine (500 ml) with mechanical stirring at ambient temperature under an argon atmosphere. It was. A portion of tert-butyldiphenylchlorosilane (125.8 g, 119.0 mL, 1.1 eq, 0.458 mmol) was added. The reaction was stirred at ambient temperature for 16 hours. TLC (Rf 0.22, ethyl acetate) indicated that the reaction was complete. The solution was concentrated under reduced pressure to give a viscous oil. This was separated with dichloromethane (1 L), saturated sodium bicarbonate (2 × 1 L) and brine (1 L). The organic layer was dried over sodium sulfate and concentrated under reduced pressure to give a viscous oil. The oil was dissolved in a 1: 1 mixture of ethyl acetate and ethyl ether (600 mL) and the solution was cooled to −10 ° C. The resulting crystalline product was collected by filtration, washed with ethyl ether (3 × 200 mL) and dried (40 ° C., 1 mmHg, 24 h) to give a white solid.

5′-O-tert-butyldiphenylsilyl-2′-O- (2-hydroxyethyl) -5-methyluridine 2 L of stainless steel in a pressure reactor without stirring was added to a tetrahydrofuran solution of borane (1.0 M, 2.0 equivalents, 622 mL) was added. First, ethylene glycol (350 mL, excessive amount) was carefully added in a fume hood with manual stirring until hydrogen gas evolution subsided. 5′-O-tert-butyldiphenylsilyl-O ² -2 ′ anhydro-5-methyluridine (149 g, 0.31 mol) and sodium bicarbonate (0.074 g, 0.003 equiv.) Were stirred manually. Added while. The reactor was sealed and heated in an oil bath until the internal temperature reached 160 ° C. and maintained for 16 hours (pressure <100 psig). The reaction vessel was cooled to ambient temperature and opened. TLC (Rf for the desired product was 0.67 and Rf for ethyl ara-T by-product was 0.82) showed that about 70% was converted to product. To prevent further byproduct formation, the reaction was stopped and concentrated under reduced pressure (10-1 mm, Hg) in a warm water bath (40-100 ° C.) using stronger conditions to remove ethylene glycol. . [Alternatively, if the low boiling solvent evaporates, the remaining solution can be partitioned between ethyl acetate and water. The product is present in the organic phase. The residue was purified by column chromatography (silica gel 2 kg, ethyl acetate-hexane gradient 1: 1 to 4: 1). Appropriate fractions were combined, stripped, and dried to give the product (white, finely crimped foam), contaminated starting material, and pure reusable starting material.

2'-O-([2-phthalimidooxy] ethyl) -5'-t-butyldiphenylsilyl-5-methyluridine 5'-O-tert-butyldiphenylsilyl-2'-O- (2-hydroxyethyl) -5-Methyluridine (20 g, 36.98 mmol) was mixed with triphenylphosphine (11.63 g, 44.36 mmol) and N-hydroxyphthalimide (7.24 g, 44.36 mmol). This was then dried with P ₂ O ₅ under high vacuum at 40 ° C. for 2 days. The reaction mixture was flushed with argon and dry THF (369.8 mL, Aldrich sealable bottle) was added to give a clear solution. Diethyl-azodicarboxylate (6.98 mL, 44.36 mmol) was added dropwise to the reaction mixture. The addition rate was maintained so that the deep red color resulting from the addition was just removed before the next drop was added. After the addition was complete, the reaction was stirred for 4 hours. TLC then showed that the reaction was complete (ethyl acetate: hexane, 60:40). The solvent was evaporated in vacuo. The resulting residue was loaded onto a flash column and eluted with ethyl acetate: hexane (60:40) and eluted with 2'-O-[(2-phthalimidooxy) ethyl] -5'-t-butyldiphenylsilyl-5- Methyluridine was obtained as a white foam.

5'-O-tert-butyldiphenylsilyl- 2'-O-[(2-formadoxyiminooxy) ethyl] -5 -methyluridine 2'-O-[(2-phthalimidooxy) ethyl] -5 ' -T-Butyldiphenylsilyl-5-methyluridine (3.1 g, 4.5 mmol) was dissolved in dry CH ₂ Cl ₂ (4.5 mL), then methyl hydrazine (300 mL, 4.64 mmol) was added − It was added dropwise at 10 ° C to 0 ° C. After 1 hour, the mixture was filtered, the filtrate was washed with ice-cold CH ₂ Cl ₂ and the combined organic phases were washed with water and brine and dried over anhydrous Na ₂ SO ₄ . The solution was concentrated to give 2′-O (aminooxyethyl) thymidine, which was then dissolved in MeOH (67.5 mL). To this was added formaldehyde (20% aqueous solution, w / w, 1.1 eq) and the resulting mixture was stirred for 1 hour. The solvent was removed in vacuo; the residue was chromatographed to give 5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoxyiminooxy) ethyl] -5-methyluridine. Obtained as a white foam.

5'-O-tert-butyldiphenylsilyl-2'-O- [N, N-dimethylaminooxyethyl] -5-methyluridine 5'-O-tert-butyldiphenylsilyl-2'-O-[(2 -Formadoximinooxy) ethyl] -5-methyluridine (1.77 g, 3.12 mmol) was dissolved in a solution of 1 M pyridinium p-toluenesulfonate (PPTS) in dry MeOH (30.6 mL). Sodium cyanoborohydride (0.39 g, 6.13 mmol) was added to this solution at 10 ° C. under an inert atmosphere. The reaction mixture was stirred at 10 ° C. for 10 minutes. The reaction vessel was then removed from the ice bath and stirred at room temperature for 2 hours, and the reaction was monitored by TLC (5% MeOH in CH ₂ Cl ₂ ). Aqueous NaHCO ₃ solution (5%, 10 mL) was added and extracted with ethyl acetate (2 × 20 mL). The ethyl acetate phase was dried over anhydrous Na ₂ SO ₄ and dried by evaporation. The residue was dissolved in 1M PPTS in MeOH (30.6 mL). Formaldehyde (20% w / w, 30 mL, 3.37 mmol) was added and the reaction mixture was stirred at room temperature for 10 minutes. The reaction mixture was cooled to 10 ° C. in an ice bath, sodium cyanoborohydride (0.39 g, 6.13 mmol) was added and the reaction mixture was stirred at 10 ° C. for 10 minutes. After 10 minutes, the reaction mixture was removed from the ice bath and stirred at room temperature for 2 hours. To the reaction mixture was added 5% NaHCO ₃ (25 mL) solution and extracted with ethyl acetate (2 × 25 mL). The ethyl acetate layer was dried over anhydrous Na ₂ SO ₄ and dried by evaporation. The resulting residue was purified by flash column chromatography eluting with 5% MeOH in CH ₂ Cl ₂ to give 5′-O-tert-butyldiphenylsilyl-2′-O— [N, N— Dimethylaminooxyethyl] -5-methyluridine was obtained as a white foam.

2′-O- (dimethylaminooxyethyl) -5-methyluridine triethylamine trihydrofluoride (3.91 mL, 24.0 mmol) was added to dry THF and triethylamine (1.67 mL, 12 mmol, dried, stored in KOH). Dissolved. This mixture of triethylamine-2HF was then added to 5'-O-tert-butyldiphenylsilyl-2'-O- [N, N-dimethylaminooxyethyl] -5-methyluridine (1.40 g, 2.4). Mmol) and stirred at room temperature for 24 hours. The reaction was monitored by TLC (5% MeOH in CH ₂ Cl ₂ ). The solvent was removed in vacuo, loaded onto the residue was flash column, eluted with 10% MeOH in CH ₂ Cl _2, to give 2'-O- (dimethylamino-oxyethyl) -5-methyluridine.

5′-O-DMT-2′-O- (dimethylaminooxyethyl) -5-methyluridine 2′-O- (dimethylaminooxyethyl) -5-methyluridine (750 mg, 2.17 mmol) was added to P Dry with ₂ O ₅ under high vacuum at 40 ° C. overnight. This was then co-evaporated with anhydrous pyridine (20 mL). The resulting residue was dissolved in pyridine (11 mL) under an argon atmosphere. 4-Dimethylaminopyridine (26.5 mg, 2.60 mmol), 4,4′-dimethoxytrityl chloride (880 mg, 2.60 mmol) was added to the mixture and the reaction mixture was allowed to cool at room temperature until all starting material was gone. Stir. Pyridine is removed in vacuo and the residue is chromatographed, eluting with 10% MeOH (containing a few drops of pyridine) in CH ₂ Cl ₂ , 5′-O-DMT-2′-O— ( Dimethylamino-oxyethyl) -5-methyluridine was obtained.

5′-O-DMT-2′-O- (2-N, N-dimethylaminooxyethyl) -5-methyluridine-3 ′-[(2-cyanoethyl) -N, N-diisopropyl phosphoramidite]
5′-O-DMT-2′-O- (dimethylaminooxyethyl) -5-methyluridine (1.08 g, 1.67 mmol) was co-evaporated with toluene (20 mL). To the residue was added N, N-diisopropylamine tetrazonide (0.29 g, 1.67 mmol) and dried over P ₂ O ₅ at 40 ° C. under high vacuum overnight. The reaction mixture was then dissolved in anhydrous acetonitrile (8.4 mL) and 2-cyanoethyl-N, N, N ′, N′-tetraisopropyl phosphoramidite (2.12 mL, 6.08 mmol) was added. The reaction mixture was stirred at ambient temperature for 4 hours under an inert atmosphere. The progress of the reaction was monitored by TLC (hexane: ethyl acetate = 1: 1). The solvent was evaporated and the residue was dissolved in ethyl acetate (70 mL) and washed with 5% aqueous NaHCO ₃ (40 mL). The ethyl acetate layer was dried over anhydrous Na ₂ SO ₄ and concentrated. The resulting residue was chromatographed (ethyl acetate as eluent), 5'-O-DMT-2'-O- (2-N, N-dimethylaminooxyethyl) -5-methyluridine-3 '. -[(2-Cyanoethyl) -N, N-diisopropyl phosphoramidite] was obtained as a foam.

2 ′-(aminooxyethoxy) nucleoside amidites 2 ′-(aminooxyethoxy) nucleoside amidites [or known in the art as 2′-O- (aminooxyethyl) nucleoside amidites] are described in the following paragraphs Manufactured to. Adenosine, cytidine, and thymidine nucleoside amidites were prepared similarly.

N2-isobutyryl-6-O-diphenylcarbamoyl-2'-O- (2-ethylacetyl) -5'-O- (4,4'-dimethoxytrityl) guanosine-3 '-[(2-cyanoethyl) -N , N-Diisopropylphosphoramidite]
2'-O-aminooxyethyl guanosine analogs can be obtained by selective 2'-O-alkylation of diaminopurine riboside. Several grams of diaminopurine riboside was purchased from Schering AG (Berlin) to give 2'-O- (2-ethylacetyl) diaminopurine riboside with a small amount of 3'-O-isomer. 2'-O- (2-ethylacetyl) diaminopurine riboside was decomposed by treatment with adenosine deaminase and converted to 2'-O- (2-ethylacetyl) guanosine. (McGee, D.P.C., Cook, P.D., Guinosso, C.J., WO 94/02501 (A1) 940203). Standard protection methods include 2'-O- (2-ethylacetyl) -5'-O- (4,4'-dimethoxytrityl) guanosine and 2-N-isobutyryl-6-O-diphenylcarbamoyl-2 '-O- (2-ethylacetyl) -5'-O- (4,4'-dimethoxytrityl) guanosine is formed and reduced to give 2-N-isobutyryl-6-O-diphenylcarbamoyl-2. '-O- (2-ethylacetyl) -5'-O- (4,4'-dimethoxytrityl) guanosine was obtained. As described above, the Mitsunobu reaction replaces the hydroxyl group with N-hydroxyphthalimide, and the protected nucleoside is phosphorylated as usual to yield 2-N-isobutyryl-6-O-diphenylcarbamoyl-2 ′. -O- (2-ethylacetyl) -5'-O- (4,4'-dimethoxytrityl) guanosine-3 '-[(2-cyanoethyl) -N, N-diisopropyl phosphoramidite] was obtained.

2'-dimethylaminoethoxyethoxy (2'-DMAEOE) nucleoside amidites 2'-dimethylaminoethoxyethoxy nucleoside amidites (or, in the art, 2'-O-dimethylaminoethoxyethyl, i.e., 2'-O-CH _{2 -O-CH 2 -N (CH 2} ) 2, or it was prepared as follows known) as 2'-DMAEOE nucleoside amidites. Other nucleoside amidites were prepared similarly.

2′-O- [2 (2-N, N-dimethylaminoethoxy) ethyl] -5-methyluridine 2 [2- (dimethylamino) ethoxy] ethanol (Aldrich, 6.66 g, 50 mmol) was added to borane. To the tetrahydrofuran solution (1M, 10 mL, 10 mmol) was slowly added with stirring in a 100 mL bomb. Hydrogen gas evolved as the solid dissolved. O ² −, 2′-Anhydro-5-methyluridine (1.2 g, 5 mmol) and sodium bicarbonate (2.5 mg) were added, the bomb was sealed, placed in an oil bath and heated at 155 ° C. for 26 hours. did. The bomb was cooled to room temperature and opened. The crude solution was concentrated and the residue was partitioned between water (200 mL) and hexane (200 mL). Excess phenol was extracted into the hexane layer. The aqueous layer was extracted with ethyl acetate (3 × 200 mL) and the combined organic layers were washed once with water, dried over anhydrous sodium sulfate and concentrated. The residue was treated on a silica gel column with 1:20 methanol / methylene chloride (containing 2% triethylamine) as eluent. When the column fractions were concentrated, a colorless solid was formed and collected to give the title compound as a white solid.

5'-O-dimethoxytrityl-2'-O- [2 (2-N, N-dimethylaminoethoxy) ethyl] -5-methyluridine 0.5 g (1.3 mmol) of 2'-O- [2 (2-N, N-dimethylaminoethoxy) ethyl] -5-methyluridine in anhydrous pyridine (8 mL), triethylamine (0.36 mL), and dimethoxytrityl chloride (DMT-C1, 0.87 g, 2 equivalents) Was added and stirred for 1 hour. The reaction mixture was poured into water (200 mL) and extracted with CH ₂ Cl ₂ (2 × 200 mL). The combined CH ₂ Cl ₂ layers were washed with saturated NaHCO ₃ solution followed by saturated NaCl solution and dried over anhydrous sodium sulfate. After evaporation of the solvent, the title compound was obtained by silica gel chromatography using MeOH: CH ₂ Cl ₂ : Et ₃ N (20: 1, v / v, containing 1% triethylamine).

5'-O-dimethoxytrityl-2'-O- [2 (2-N, N-dimethylaminoethoxy) ethyl)]-5-methyluridine-3'-O- (cyanoethyl-N, N-diisopropyl) phospho Loamidite diisopropylaminotetrazolide (0.6 g) and 2-cyanoethoxy N, N-diisopropyl phosphoramidite (1.1 mL, 2 eq) were added to 5′-O-dimethoxytrityl-2′-O— [ 2 (2-N, N-dimethylaminoethoxy) ethyl] -5-methyluridine (2.17 g, 3 mmol) was added to a solution of CH ₂ Cl ₂ (20 mL) under an argon atmosphere. The reaction mixture was stirred overnight and the solvent was evaporated. The resulting residue was purified by silica gel flash column chromatography using ethyl acetate as eluent to give the title compound.

Example 2
Oligonucleotide synthesis Unsubstituted and substituted phosphodiester (P = O) oligonucleotides were synthesized on an automated DNA synthesizer using standard phosphoramidite chemistry by oxidation with iodine (Applied Biosystems model 380B).

  Phosphorothioate (P = S) was synthesized in the same manner as the phosphodiester oligonucleotides, except that a standard oxidation vessel was used for 0.2M 3H for stepwise thiolation of the phosphite bond. -1,2-benzodithiol-3-one 1,1-dioxide in acetonitrile solution). The waiting step for thiolation was increased to 68 seconds, followed by a capping step. After decoupling from the CPG column and deblocking with concentrated ammonium hydroxide at 55 ° C. (18 hours), the oligonucleotide was purified by precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCl solution. Phosphinate oligonucleotides were prepared as described in US Pat. No. 5,508,270 (incorporated by reference).

  Alkyl phosphonate oligonucleotides were prepared as described in US Pat. No. 4,469,863 (incorporated by reference).

  3'-deoxy-3'-methylene phosphonate oligonucleotides were prepared as described in US Pat. Nos. 5,610,289 or 5,625,050 (incorporated by reference).

  Phosphoramidite oligonucleotides were prepared as described in US Pat. No. 5,256,775 or US Pat. No. 5,366,878 (incorporated by reference).

  Alkylphosphonothioate oligonucleotides were prepared as described in WO94 / 17093 and WO94 / 02499, which are incorporated by reference into the present invention.

  3'-deoxy-3'-amino phosphoramidate oligonucleotides were prepared as described in US Pat. No. 5,476,925 (incorporated by reference).

  Phosphotriester oligonucleotides were prepared as described in US Pat. No. 5,023,243 (incorporated by reference).

  Boranophosphate oligonucleotides were prepared as described in US Pat. Nos. 5,130,302 and 5,177,198, both of which are incorporated herein by reference.

Example 3
Oligonucleoside synthesis Methylenemethylimino-linked oligonucleosides (or identified as MMI-linked oligonucleosides), methylenedimethylhydrazo-linked oligonucleosides (or identified as MDH-linked oligonucleosides), and methylenecarbonylamino-linked oligonucleosides ( Or an amide-3-linked oligonucleoside), and a methyleneaminocarbonyl-linked oligonucleoside (or identified as an amide-4-linked oligonucleoside), as well as alternative MMI and P = 0 or P = Mixed main chain compounds having S bonds are described in US Pat. Nos. 5,378,825; 5,386,023; 5,489,677; 5,602,240; 610,289 (see all) In the present invention).

  Formacetal and thioformacetal-linked oligonucleosides were prepared as described in US Pat. Nos. 5,264,562 and 5,264,564 (incorporated by reference).

  Ethylene oxide linked oligonucleosides were prepared as described in US Pat. No. 5,223,618 (incorporated by reference).

Example 4
PNA synthetic peptide nucleic acids (PNA) are described in various methods of Peptide Nucleic Acids (PNA): Synthesis, Properties and Potential Applications, Bioorganic & Medicinal Chemistry, 1996, 4, 523. Peptide nucleic acids may also be prepared according to US Pat. Nos. 5,539,082; 5,700,922; and 5,719,262 (incorporated by reference).

Example 5
Synthesis of Chimeric Oligonucleotides Chimeric oligonucleotides, oligonucleosides, or mixed oligonucleotides / oligonucleosides of the present invention can be of several different types. These include the first type (where the “gap” segment of the attached nucleoside is located between the 5 ′ and 3 ′ “wing” segments of the attached nucleoside), and the second “open end” type ("Gap" segments are located at either the 3 'or 5' end of the oligomeric compound). The first type of oligonucleotide is also known in the art as a “gapmer” or a gapped oligonucleotide. The second type of oligonucleotide is also known in the art as “hemimer” or “wingmer”.

[2'-O-Me]-[2'-Deoxy]-[2'-O-Me] Chimeric Phosphorothioate Oligonucleotide 2'-O-alkyl phosphorothioate and chimeric oligonucleotide having 2'-deoxyphosphorothioate oligonucleotide segment Was synthesized using an Applied Biosystems automated DNA synthesizer model 380B as described above. Using an automatic synthesizer, 2'-deoxy-5'-dimethoxytrityl-3'-O-phosphoramidite for the DNA portion and 5'-dimethoxytrityl-2'-O- for the 5 'and 3' wings Oligonucleotides were synthesized using methyl-3′-O-phosphoramidite. The standard synthesis cycle was modified (the waiting step after the introduction of tetrazole and base was increased to 600 seconds and repeated 4 times for RNA and 2 times for 2′-O-methyl). The fully protected oligonucleotide was cleaved from the support and the phosphate group was deprotected overnight at room temperature in 3: 1 ammonia / ethanol, lyophilized and dried. Next, all bases were protected by treatment in methanol / ammonia at room temperature for 24 hours, and the sample was again lyophilized and dried. The pellet was resuspended in 1M TBAF in THF at room temperature for 24 hours to deprotect the 2 'position. The reaction was then stopped with 1M TEAA and the sample was reduced to 1/2 volume with rotovac and then desalted on a G25 size exclusion column. The oligos recovered by capillary electrophoresis and mass spectrometry were then analyzed spectrophotometrically for yield and purity.

[2'-O- (2-methoxyethyl)]-[2'-deoxy]-[2'-O- (methoxyethyl)] chimeric phosphorothioate oligonucleotide [2'-O- (2-methoxyethyl)]- A [2′-deoxy]-[-2′-O- (methoxyethyl)] chimeric phosphorothioate oligonucleotide was prepared in the same manner as the 2′-O-methyl chimeric oligonucleotide method described above, and the phosphorothioate oligonucleotide was replaced. Prepared in the same manner as the above 2′-O- (methoxyethyl) amidite and 2′-O-methylamidite methods.

[2′-O- (2-methoxyethyl) phosphodiester]-[2′-deoxyphosphorothioate]-[2′-O- (2-methoxyethyl)] phosphodiester] chimeric oligonucleotide [2′-O— ( 2-methoxyethyl) phosphodiester]-[2′-deoxyphosphorothioate]-[2′-O- (methoxyethyl) phosphodiester] chimeric oligonucleotides are prepared by the method of 2′-O-methyl chimeric oligonucleotides described above. Like, except that 2'-O- (methoxyethyl) amidite is replaced with 2'-O-methylamidite and oxidized with iodine to form phosphodiester internucleotide linkages within the wing portion of the chimeric structure; Sulfurized with 3, H-1,2 benzodithiol-3-one 1,1 dioxide (Beaucage reagent) , It was made by forming a phosphorothioate internucleotide linkages in the middle of the gap.

  Other chimeric oligonucleotides, chimeric oligonucleotides, and mixed chimeric oligonucleotides / oligonucleosides were synthesized according to US Pat. No. 5,623,065 (incorporated by reference).

Example 6
Oligonucleotide Isolation Control After separation from a porous glass column (Applied Biosystems) and deblocking in concentrated ammonium hydroxide at 55 ° C. for 18 hours, the oligonucleotide or oligonucleotide is reduced from 0.5 M NaCl to 2.5. It was purified by precipitating twice with double volume of ethanol. The synthesized oligonucleotides were analyzed on a denaturing gel by polyacrylamide gel electrophoresis and judged to be at least 85% full length material. The relative amounts of phosphorothioate and phosphodiester linkages obtained in the synthesis were periodically checked with ³² P nuclear magnetic resonance spectroscopy, and oligonucleotides were analyzed by HPLC, Chiang et al., J. Biol. Biol. Chem. Purified as described in 1991, 266, 18162-18171.

Example 7
Oligonucleotide synthesis—96-well plate format Oligonucleotide synthesis was performed on a solid phase P (III) phosphoramidite chemistry method with an automated synthesizer capable of simultaneously assembling 96 sequences in a standard 96-well format. The phosphodiester internucleotide linkage was formed by oxidation with aqueous iodine. The phosphorothioate internucleotide linkage was formed by sulfurization using 3H-1,2 benzodithiol-3-one 1,1 dioxide (Beaucage reagent) in anhydrous acetonitrile. Standard base-protected β-cyanoethyldiisopropyl phosphoramidites were purchased from manufacturers (eg, PE-Applied Biosystems, Foster City, Calif., Or Pharmacia, Piscataway, NJ). Non-standard nucleosides were synthesized as per known literature or patented methods. These utilize β-cyanoethyldiisopropyl phosphoramidite protected as a base.

The oligonucleotide was cleaved from the support, deprotected with concentrated NH ₄ OH at elevated temperature (55-60 ° C.) for 12-16 hours, and the released product was dried in vacuo. The dried product was then suspended in sterile water to obtain a master plate from which all analysis and test plate samples were diluted using a robotic pipettor.

Example 8
Oligonucleotide analysis-96-well plate format Oligonucleotide concentration in each well was assessed by sample dilution and UV absorption spectroscopy. The full-length integrity of individual products is in 96-well format (Beckman P / ACE ^™ MDQ), or individually produced samples on a commercially available CE instrument (eg, Beckman P / ACE ^™ 5000, ABI270). And evaluated by capillary electrophoresis (CE). The composition of the base and the main chain was confirmed by mass spectrometry of the compound using electrospray mass spectrometry. All analytical test plates were diluted from the master plate using single and multichannel robotic pipettes. Plates were judged acceptable if at least 85% of the compounds on the plate were at least 85% full length.

Example 9
The effect of antisense compounds on cell culture and oligonucleotide-treated target nucleic acid expression can be tested in any of a variety of cell types where the target nucleic acid is present at a measurable level. This effect can be measured as usual using, for example, PCR or Northern blot analysis. The following six cell types are provided for illustrative purposes, but other cell types in which the target is expressed in the selected cell type may be used as usual. This effect can easily be measured by methods routine in the art, such as Northern blot analysis, ribonuclease protection analysis, or RT-PCR.

T-24 cells :
Human transitional cell bladder cancer cell line T-24 was purchased from American Type Culture Collection (ATCC) (Manassas, VA). Complete with 10% fetal bovine serum (Gibco / Life Technologies, Gaithersburg, MD), penicillin 100 units / mL, and streptomycin 100 μg / mL (Gibco / Life Technologies, Gaithersburg, MD) T-24 cells were cultured as usual in McCoy's 5A basal medium (Gibco / Life Technologies, Gaithersburg, MD). When cells reached 90% density, they were trypsinized and diluted as usual. To use RT-PCR analysis, cells were seeded at a density of 7000 cells / well in 96-well plates (Falcon-Primaria # 3872).

  For Northern blots or other analyses, cells were seeded in 100 mm tissue culture plates or other standard tissue culture plates and similarly treated with appropriate amounts of media and oligonucleotides.

A549 cells :
Human lung cancer cell line A549 was purchased from American Type Culture Collection (ATCC) (Manassas, VA). DMEM supplemented with 10% fetal bovine serum (Gibco / Life Technologies, Gaithersburg, MD), penicillin 100 units / mL, and streptomycin 100 μg / mL (Gibco / Life Technologies, Gaithersburg, MD) A549 cells were cultured as usual in basal medium (Gibco / Life Technologies, Gaithersburg, MD). When cells reached 90% density, they were trypsinized and diluted as usual.

NHDF cells ;
Human neonatal skin fibroblasts (NHDF) were purchased from Clonetics Corporation (Walkersville, MD). NHDF was maintained as usual in fibroblast growth medium (Clontics, Walkersville, Md.) Added according to manufacturer's recommendations. Cells were maintained for up to 10 generations based on manufacturer's recommendations.

HEK cells :
Human fetal keratinocytes (HEK) were purchased from Clontics (Walkersville, MD). HEK was maintained as usual with keratinocyte growth medium (Clontics, Walkersville, Md.) Formulated according to manufacturer's recommendations. Cells were maintained up to 10 generations as usual based on manufacturer's recommendations.

MCF-7 cells :
Human breast cancer cell line MCF-7 was purchased from the American Type Culture Collection (Manassas, VA). Normal culture of MCF-7 cells in DMEM low glucose (Gibco / Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco / Life Technologies, Gaithersburg, MD) did. When cells reached 90% density, they were trypsinized and diluted as usual. Cells were seeded in 96-well plates (Falcon-Primaria # 3872) at a density of 7000 cells / well for use in RT-PCR analysis.

For Northern blots or other analyses, cells were seeded in 100 mm or other standard tissue culture plates and treated similarly using appropriate amounts of media and oligonucleotides.

LA4 cells :
Mouse lung epithelial cell line LA4 was purchased from American Type Culture Collection (Manassas, VA). LA4 cells were cultured as usual in F12K medium (Gibco / Life Technologies, Gaithersburg, MD) supplemented with 15% fetal calf serum (Gibco / Life Technologies, Gaithersburg, MD). When cells reached 90% density, they were trypsinized and diluted as usual. Cells were seeded at a density of 3000-6000 cells / well in 96-well plates (Falcon-Primaria # 3872) for use in RT-PCR analysis.

  For Northern blots or other analyses, cells were seeded in 100 mm or other standard tissue culture plates and treated similarly with appropriate amounts of media and oligonucleotides.

Treatment with antisense compounds :
When the cells reached 80% density, the cells were treated with oligonucleotide. For cells cultured in 96-well plates, the wells are washed once with 200 μL OPTI-MEM ^™ -1 reduced serum usage medium (Gibco BRL), 3.75 μg / mL LIPOFECTIN ^™ (Gibco BRL) and desired concentration Were treated with OPTI-MEMTM ^™ -1 (130 μL). Four to seven hours after treatment, the medium was replaced with fresh medium. Cells were harvested 16-24 hours after oligonucleotide treatment.

  Different oligonucleotide concentrations were used depending on the cell line. To determine the optimal oligonucleotide concentration for a particular cell line, cells were treated with a range of positive control oligonucleotide concentrations.

Example 10
Analysis of oligonucleotide inhibition of LRH1 expression Antisense modulation of LRH1 expression can be analyzed in various ways known in the art. For example, LRH1 mRNA levels can be quantified, for example, by Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Currently, real-time quantitative PCR is preferred. RNA analysis can be performed on total cellular RNA or poly (A) + mRNA. RNA isolation methods are described, for example, in Ausubel, F .; M.M. Et al., Current Protocols in Molecular Biology, Volume 1, 4.1.1-4.2.9 and 4.5.1-4.5.3, John Wiley & Sons, 1993. ing. Northern blot analysis is routine in the art and is described, for example, in Ausubel, F .; M.M. Et al., Current Protocols in Molecular Biology, Vol. 1, 4.2.1-4.2.9, John Wiley & Sons, 1996. Real-time quantification (PCR) can be successfully accomplished using a commercially available ABI PRISM ^™ 7700 sequence detection system (available from PE-Applied Biosystems, Foster City, Calif.) According to the manufacturer's instructions. Prior to quantitative PCR analysis, primer-probe sets specific for the target gene to be measured are evaluated for their ability to be “multiplexed” in the GAPDH amplification reaction. In multiplexing, both the target gene and the internal standard gene GAPDH are amplified simultaneously in one sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of a primer-probe set specific for GAPDH only, target gene only ("singleplex"), or both (multiplex). After PCR amplification, a standard curve of GAPDH and target mRNA signal as a function of dilution is generated from both singleplex and multiplex samples. If the slope and correlation coefficient of the GAPDH signal and target signal obtained from the multiplex sample are both within the corresponding value of 10% obtained from the single plex sample, the primer-probe specific to that target The set is considered multiplex capable. Other PCR methods are also known in the art.

  The protein level of LRH1 can be quantified by various methods well known in the art, such as immunoprecipitation, Western blot analysis (immunoblot), ELISA, or fluorescence activated cell sorting (FACS). Antibodies directed to LRH1 can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Michigan), or manufactured using conventional antibody production methods. Also good. A method for producing a polyclonal antiserum is described in, for example, Ausubel, F .; M.M. Et al., Current Protocols in Molecular Biology, Vol. 2, 11.12.1-11.12.9, John Wiley & Sons, 1997. The production of monoclonal antibodies is described, for example, in Ausubel, F .; M.M. Et al., Current Protocols in Molecular Biology, Vol. 2, 11.4.1-11.111.5, John Wiley & Sons, 1997.

  Immunoprecipitation is a standard method in the art and is described, for example, in Ausubel, F .; M.M. Et al., Current Protocols in Molecular Biology, Vol. 2, 10.16.1-10.16.11, John Wiley & Sons, 1998. Western blot (immunoblot) analysis is a standard method in the art and is described, for example, in Ausubel, F .; M.M. Et al., Current Protocols in Molecular Biology, Volume 2, 10.8.1 to 10.8.21, John Wiley & Sons, 1997. Enzyme-linked immunosorbent assay (ELISA) is a standard method in the art and is described, for example, in Ausubel, F .; M.M. Et al., Current Protocols in Molecular Biology, Volume 2, 11.2.1-11.22, John Wiley & Sons, 1991.

Example 11
Isolation of poly (A) + mRNA Poly (A) + mRNA is described in Miura et al., Clin. Chem. , 1996, 42, 1758-1764. Other poly (A) + mRNA isolation methods are described, for example, in Ausubel, F .; M.M. Et al., Current Protocols in Molecular Biology, Vol. 1, pages 4.5.1-4.5.3, John Wiley & Sons, 1993. Briefly, for cell culture in 96-well plates, the growth medium was removed from the cells and each well was washed with cold PBS (200 μL). 60 μL of lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) is added to each well and the plate gently And incubated at room temperature for 5 minutes. Lysate (55 μL) was transferred to a 96-well plate (AGCT, Irvine, Calif.) Coated with oligo d (T). Plates were incubated for 60 minutes at room temperature and washed 3 times with 200 μL wash buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.3 M NaCl). After the last wash, the plate was blotted onto a paper towel to remove excess wash buffer and air dried for 5 minutes. 60 pL of elution buffer (5 mM Tris-HCl, pH 7.6) heated to 70 ° C. is added to each well, the plate is incubated on a 90 ° C. hot plate for 5 minutes, and the eluate is transferred to a new 96-well plate. did.

  Cells cultured in 100 mm plates or other standard plates can be similarly treated using all solutions in appropriate amounts.

Example 12
Total RNA Isolation Total mRNA was isolated using the RNEASY96 ^™ kit and buffer purchased from Qiagen (Valencia, Calif.) According to the method recommended by the manufacturer. Briefly, for cells cultured in 96-well plates, the growth medium was removed from the cells and each well was washed with cold PBS (200 μL). Buffer RLT (100 μL) was added to each well and the plate was thoroughly agitated for 20 seconds. Next, 70% ethanol (100 μL) was added to each well, and the contents were mixed by pipetting up and down three times. The samples were then transferred to a QIAVAC ^™ manifold with a waste collection tray and a RNEASY 96 ^™ well plate attached to a vacuum source. Vacuum was applied for 15 seconds. Buffer RW1 (1 mL) was added to each well of the RNEASY 96 ^™ plate and evacuated again for 15 seconds. Buffer RPE (1 mL) was then added to each well of the RNEASY 96 ^™ plate and evacuated for 15 seconds. Next, the washing with the buffer RPE was repeated and further evacuated for 10 minutes. The plate was then removed from the QIAVAC ^™ manifold and blotted dry on a paper towel. The plate was then reattached to a QIAVAC ^™ manifold equipped with a collection tube rack containing 1.2 mL collection tubes. Next, water (60 μL) was pipetted into each well to elute the RNA, incubated for 1 minute, and evacuated for 30 seconds. Further, the elution process was repeated using water (60 μL).

  The repeated pipetting and elution process may be automated using a Qiagen BioRobot 9604 (Qiagen, Valencia, Calif.). In effect, after the cells on the culture plate are lysed, the plate is transferred to a robot deck where pipetting, DNase treatment, and exit steps are performed.

Example 13
Real Time Quantitative PCR Analysis of LRH1 mRNA Levels Quantification of LRH1 mRNA levels was performed using ABI PRISM ^™ 7700 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) According to the manufacturer's instructions. Measured by. This is a closed-tube, non-gel-based fluorescence detection system that allows real-time, high-throughput quantification of polymerase chain reaction (PCR) products. In contrast to standard PCR where amplification products are quantified after PCR is complete, real-time quantitative PCR products are quantified as they accumulate. This is accomplished by specifically annealing between the forward and reverse PCR primers and including in the PCR reaction an oligonucleotide probe containing two fluorescent dyes. Reporter dyes (e.g., purchased from either JOE, FAM, or VIC; Operon Technologies Inc., Alameda, CA, or PE-Applied Biosystems, Foster City, CA) Attached to the 5 'end of the probe and a quencher dye (eg purchased from either TAMRA; Operon Technologies, Alameda, CA or PE-Applied Biosystems, Foster City, CA) Is attached to the 3 ′ end of the probe. If the probe and dye remain intact, the color of the reporter dye is extinguished by approaching the 3 ′ quencher dye. During amplification, the probe and target sequence anneal to form a substrate, which can be cleaved by the 5′-exonuclease activity of Taq polymerase. At the extension stage of the PCR amplification cycle, the probe is cleaved by Taq polymerase, releasing the reporter dye from the remaining probe (ie from the quencher component) and generating a sequence-specific fluorescent signal. With each cycle, additional reporter dye molecules are cleaved from their respective probes and the fluorescence intensity is monitored at regular intervals with a laser optic installed in the ABI PRISM ^™ 7700 sequence detection system. In each analysis, a standard curve was generated from a series of parallel reactions containing a series of mRNA dilutions from an untreated control sample, which was used to treat the test sample after antisense oligonucleotide treatment. % Inhibition can be quantified.

PCR reagents were purchased from PE-Applied Biosystems, Foster City, CA. 25 μL PCR cocktail (1 × TAQMAN ^™ buffer A, 5.5 mM MgCl ₂ , 300 μM dATP, dCTP and dGTP, 600 μM dUTP, 100 nM forward primer, reverse primer and probe, 20 units RNase inhibitor, RT-PCR reactions were performed by adding 1.25 units of AMPLITAQ GOLD ^™ and 12.5 units of MuLV reverse transcriptase to a 96 well plate containing poly (A) mRNA solution (25 μL). RT reaction was performed by incubating at 48 ° C. for 30 minutes. After activating AMPLITAQ GOLD ^™ by incubating at 95 ° C. for 10 minutes, 40 cycles of the two-step PCR protocol were performed: 15 seconds at 95 ° C. (denaturation) followed by 1.5 minutes at 60 ° C. (anneal / extension) .

Probes and primers for human LRH1 were designed using published sequence information (GenBank accession number NM_003822, included in the present invention as FIG. 1) to hybridize to the human LRH1 sequence. PCR primers for human LRH1 are as follows:
Forward primer: LRH1 CCT GGT GCT CTT TAG TTT
AGA TGT CAA (SEQ ID NO: 3445),
Reverse primer: TCT GCT GCG GGT AGT TAC AC (SEQ ID NO: 3446) A and PCR probe are as follows:
FAM-AAT GCC GCC CTG CTG GAC TAC ACA (SEQ ID NO: 3447) -BH1,
Here, FAM (PE-Applied Biosystems, Foster City, Calif.) Is a fluorescent reporter dye, and BH1 (PE-Applied Biosystems, Foster City, Calif.) Is a quencher dye. PCR primers for human cyclophilin are as follows:

  Forward primer: CCCACCGTGTTCTCGACAT (SEQ ID NO: 3448)

Reverse primer: TTTCTGCTGTCTTTGGGACCTT (SEQ ID NO: 3449), and
The PCR probes are as follows:
5'JOE-CGCGTCTCCTTTGAGCTGTTTGCA (SEQ ID NO: 3450) -TAMRA 3 ',
Here, JOE (PE-Applied Biosystems, Foster City, Calif.) Is a fluorescent reporter dye, and TAMRA (PE-Applied Biosystems, Foster City, Calif.) Is a quencher dye.

Example 15
Antisense inhibition of human LRH1 expression by chimeric phosphorothioate oligonucleotides with 2′-MOE wings and deoxy gaps In the present invention, a series of oligonucleotides have been published to target various regions of human LRH1 RNA. Designed using an array (NM_003822, included in the present invention as FIG. 1). The oligonucleotides are shown in Table 1. “Target site” indicates the first (5′-most) nucleotide number of the particular target sequence to which the oligonucleotide binds. The parameters shown for each oligo are David H. et al. Mathews, Michael Zuker, and Douglas H. Inferred using Turner RNA structure 3.7 (RNAstructure 3.7). All compounds listed in Table 1 are 20 nucleotide long chimeric oligonucleotides (“gapmers”), which are composed of a central “gap” region consisting of 10 2 ′ deoxynucleotides. With 4 nucleotide “wings” on both sides (5 ′ and 3 ′ directions). The wing is composed of 2'-methoxyethyl (2'-MOE) nucleotides. The internucleoside (backbone) linkage is phosphorothioate (P = S) for all oligonucleotides. The cytidine residue of the 2′-MOE wing is 5-methylcytidine. All cytidine residues are 5-methylcytidine.

Example 17
Western blot analysis of LRH1 protein levels Western blot analysis (immunoblot analysis) was performed using standard methods. Cells were harvested 16-20 hours after oligonucleotide treatment, washed once with PBS, suspended in Remley buffer (100 μl / well), boiled for 5 minutes, and loaded onto a 16% SDS-PAGE gel. . The gel was run at 150V for 1.5 hours and transferred to a Western blot membrane. Appropriate primary antibodies directed against LRH1 were used with secondary antibodies directed against radiolabeled or fluorescently labeled primary antibody species. Bands were visualized using PHOSPHORIMAGER ^™ (Molecular Dynamics, Sunnyvale, Calif.).

Probe and primer sequences for human LRH1. It is a continuation of FIG.

Claims (18)

  An antisense compound consisting of 8 to 30 nucleobases targeting a nucleic acid molecule encoding LRH1, which specifically hybridizes to LRH1 and inhibits the expression of LRH1.   The antisense compound of claim 1 which is an antisense oligonucleotide.   The antisense compound of claim 2, wherein the antisense oligonucleotide comprises at least one modified internucleoside linkage.   4. The antisense compound of claim 3, wherein the modified internucleoside linkage is a phosphorothioate linkage.   The antisense compound of claim 2, wherein the antisense oligonucleotide comprises at least one modified sugar moiety.   6. The antisense compound of claim 5, wherein the modified sugar component is a 2'-O-methoxyethyl sugar component.   The antisense compound of claim 2, wherein the antisense oligonucleotide comprises at least one modified nucleobase.   The antisense compound of claim 7, wherein the modified nucleobase is 5-methylcytosine.   The antisense compound according to claim 2, wherein the antisense oligonucleotide is a chimeric oligonucleotide.   A composition comprising the antisense compound of claim 1 and a pharmaceutically acceptable carrier or diluent.   The composition of claim 10 further comprising a colloidal dispersion.   The composition of claim 11, wherein the antisense compound is an antisense oligonucleotide.   A method of inhibiting LRH1 expression in a cell or tissue comprising contacting the cell or tissue with the antisense compound of claim 1 such that LRH1 expression is inhibited.   A method of treating a human having a disease or condition associated with LRH1, comprising administering to the animal a therapeutically or prophylactically effective amount of the antisense compound of claim 1 such that LRH1 expression is inhibited. .   15. The method of claim 14, wherein the disease or condition is associated with aromatase activity and / or breast cancer, and / or carcinogenesis.   15. The disease or condition is dyslipidemia and symptoms thereof, such as atherosclerosis, low HDL, high LDL, hypercholesterolemia, gallstones, hypertriglyceridemia and obesity The method described.   15. The method of claim 14, wherein the disease or condition is acute or chronic hepatitis mediated by hepatitis B virus (HBV), or hepatocellular carcinoma.   15. The method of claim 14, wherein the disease or condition is ischemic / reperfusion injury.

Images