JP2006507808A - Antisense regulation of Nav1.3 expression - Google Patents

Abstract

Antisense compounds, compositions, and methods that modulate the expression of type III sodium channel Nav1.3 are provided. The composition comprises an antisense compound, particularly an antisense oligonucleotide, that targets a nucleic acid encoding Nav1.3. Methods are provided for using these compounds to modulate Nav1.3 expression and to treat diseases associated with Nav1.3 expression.

Description

  This application claims priority from US Provisional Application No. 60 / 403,416, filed on August 14, 2002, under 35 USC §119, and is the application described herein? As is fully incorporated herein by reference.

FIELD OF THE INVENTION [001] The present invention provides compositions and methods for modulating the expression of type III sodium channels (Nav1.3). In particular, the present invention relates to antisense compounds, particularly oligonucleotides, that can specifically hybridize to nucleic acids encoding type III sodium channels (Nav1.3). Such oligonucleotides have been shown to regulate the expression of type III sodium channels (Nav1.3).

BACKGROUND OF THE INVENTION [002] Voltage-gated sodium channels play an important role in the control of neuronal membrane excitability. They are responsible for the increased action potential in neurons. Neuropathic pain is the result of damaged and / or reconstructed neurons that show increased excitability for both primary afferent fibers and synaptic contacts in the central pain processing pathway It is believed that. Thus, it is not surprising that three of the four drug options used in the treatment of neuropathic pain syndrome are sodium channel blockers. These include carbamazepine, lamotrigine, and phenytoin. In addition, lidocaine, another sodium channel blocker, has recently been approved for the treatment of certain types of neuropathic pain. However, although sodium channel blockers are currently an option for the treatment of neuropathic pain, they have had only moderate success in treating these conditions. A major factor in the weak potency of these compounds is their lack of specificity and low affinity for their various sodium channels, resulting in many side effects including vomiting, dizziness, ataxia and cardiotoxicity.

  [003] Many of the recent achievements have focused on determining and describing which sodium channels are actively involved in the development and maintenance of neuropathic pain. The alpha subunit is a pore-forming subunit and to date, 11 alpha subunits have been identified, including 7 neuronal, 2 glial, 1 muscular, and 1 cardiac subunit . Alpha subunits can be divided into three classes based on their sensitivity to tetrodotoxin (TTX): TTX sensitivity (TTXs), TTX resistance (TTXr), and TTX insensitivity (TTXi). TTXs channels are sensitive to the TTX in the nM (nanomolar) range and have a low threshold for activation and rapid inactivation kinetics. These channels include the skeletal muscle channels previously shown, the two channels found primarily in peripheral neurons, and all brain-type channels.

  [004] Recent reports suggest that type III sodium channels (Nav1.3) may also be involved in the development and maintenance of neuropathic pain. This particular channel is found in the brain, peripheral nerves, and neuroendocrine cells. Importantly, it is not present in the heart and many other peripheral organs. Nav1.3 mRNA is increased in small and large DRG neurons following axotomy in animal models (Dib-Hajj, S., et al., Proc. Natl. Acad. Sci., 1996; 93; 14950-14955). ), Which suggests a link of Nav1.3 to neuropathic pain. It has recently been demonstrated that peripheral nerve injury has resulted in a large increase in the expression of tetrodotoxin (TTX) -sensitive Nav1.3 sodium channels (Boucher TJ, et al., Science 2000; 290: 124-127). They have also established several laboratories that have established that the occurrence of neuropathic pain is associated with increased spontaneous activity following nerve injury, and that this ectopic activity is sensitive to TTX. The past experiment was retested. Finally, Wood group studies also show that glial-derived neurotrophic factor (GDNF) prevents the induction of Nav1.3 and reduces the spontaneous activity of damaged nerves, thus preventing the resulting neuropathic pain I found. These studies imply that the TTX-sensitive sodium channel group, and in particular Nav1.3, plays a role in the development and maintenance of neuropathic pain following nerve injury.

  [005] Despite various sodium channel inhibitors disclosed in the art, there is still a need for therapeutic agents that effectively and specifically inhibit the function of type III sodium channels (Nav1.3). . Furthermore, antisense technology can specifically target neonatal-versus-adult types for Nav1.3. Exon 6 of the Nav1.3 gene is found in humans (Lu CM, Brown GB. J. Mol. Neurosci. 1988; 10: 67-70) and in rodents (Gustafson TA, et al., J. Biol. Chem. 1993; 268: 18648-53) undergoes alternative splicing. The two alternative exon 6 sequences are very similar, differing only at a single amino acid at the protein level, but can be individually targeted by sequence-specific antisense oligonucleotides. This is useful for the treatment of certain pediatric disorders, such as neonatal, infantile, or infantile epilepsy.

  [006] Antisense technology has emerged as an effective means to reduce the expression of specific gene products, and thus several therapeutic applications, diagnostic applications, and to regulate Nav1.3 expression, and It can prove to be uniquely useful in research applications.

SUMMARY OF THE INVENTION [007] The present invention relates to antisense compounds, particularly oligonucleotides, that target a nucleic acid encoding Nav1.3 and modulate the expression of Nav1.3. Also provided are pharmaceutical compositions and other compositions comprising the antisense compounds of the invention. A method of modulating the expression of Nav1.3 in a cell or tissue, further comprising contacting said cell or tissue with one or more antisense compounds or compositions of the present invention. To do. A method of treating an animal, particularly a human, suspected of having or suspected of having a disease or condition associated with expression of Nav1.3, therapeutically or prophylactically Further provided is the above method by administering an effective amount of one or more antisense compounds or compositions of the invention.

DETAILED DESCRIPTION OF THE INVENTION [008] The present invention regulates the function of a nucleic acid molecule encoding Nav1.3 and, ultimately, for use in regulating the amount of Nav1.3 produced. Sense compounds, especially oligonucleotides are used. This is accomplished by providing an antisense compound that specifically hybridizes with one or more nucleic acids encoding Nav1.3. As used herein, the terms “target nucleic acid” and “nucleic acid encoding Nav1.3” refer to DNA encoding Nav1.3, RNA transcribed from such DNA (including pre-mRNA and mRNA), and also such Includes cDNA derived from RNA. Specific hybridization of an oligomeric compound with its target nucleic acid interferes with the normal function of the nucleic acid. This regulation of the function of a target nucleic acid by a compound that specifically hybridizes to the target nucleic acid is commonly referred to as “antisense”. DNA functions to be interfered with include replication and transcription. RNA functions to be interfered with include all functions necessary for the maintenance of life, such as RNA translocation to protein translation sites, protein translation from RNA, RNA splicing resulting in one or more mRNA species, And catalytic activity that may involve or promote RNA. The overall effect of such interference on target nucleic acid function is the regulation of Nav1.3 expression. In the context of the present invention, “modulation” means either an increase (stimulation) or a decrease (inhibition) of the expression of a gene. In the context of the present invention, inhibition is a preferred type of gene expression regulation and mRNA is a preferred target.

  [009] For antisense, it is preferred to target specific nucleic acids. In the context of the present invention, “targeting” an antisense compound to a specific nucleic acid is a multi-step process. The process usually begins with the identification of a nucleic acid sequence whose function is to be regulated. This can be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In the present invention, the target is a nucleic acid molecule encoding Nav1.3. The targeting process also includes the determination of the site or sites within the gene for an antisense interaction to occur such that a desired effect, such as detection or modulation of protein expression, will occur. Within the context of the present invention, the preferred intragenic site is the region containing the translation initiation or termination codon of the open reading frame (ORF) of the gene. As is known in the art, the translation initiation codon is typically 5'-AUG (in the transcribed mRNA molecule; 5'-ATG in the corresponding DNA molecule), so the translation initiation codon is also , “AUG codon”, “start codon” or “AUG start codon”. A few genes have translation initiation codons with the RNA sequence 5′-GUG, 5′-UUG or 5′-CUG, and 5′-AUA, 5′-ACG and 5′-CUG function in vivo It has been shown to do. Thus, the terms “translation start codon” and “start codon” refer to many codon sequences, even though the initiator amino acid in each example is typically methionine (eukaryotic) or formylmethionine (prokaryotic). May be included. It is also possible for eukaryotic and prokaryotic genes to have two or more alternative start codons, any one of which overrides translation initiation in a particular cell type or tissue or under a set of specific conditions. It is also known in the art that it can be used in an automated manner. In the context of the present invention, “start codon” and “translation start codon” initiate the translation of an mRNA molecule transcribed from a gene encoding Nav1.3, regardless of the sequence (s) of such codons. Refers to one or more codons used in vivo.

  [0010] The translation termination codon (or “stop codon”) of a gene has three sequences: 5′-UAA, 5′-UAG and 5′-UGA (the corresponding DNA sequences are 5′-TAA, It is also known in the art to have one of 5'-TAG and 5'-TGA). The terms “start codon region” and “translation start codon region” refer to a portion of an mRNA or gene comprising from about 25 to about 50 contiguous nucleotides in either direction (ie, 5 ′ or 3 ′) from the translation start codon. . Similarly, the terms “stop codon region” and “translation stop codon region” refer to mRNA or gene comprising about 25 to about 50 contiguous nucleotides in either direction (ie, 5 ′ or 3 ′) from the translation stop codon. Refers to the part.

  [0011] An open reading frame (ORF) or “coding region”, known in the art to refer to the region between the translation initiation codon and translation termination codon, can also be effectively targeted. It is an area. Other target regions are known in the art to refer to the portion of the mRNA 5 ′ from the translation initiation codon, and thus the nucleotide or genetic correspondence between the 5 ′ cap site of the mRNA and the translation initiation codon. 5 ′ untranslated region (5′UTR) containing the nucleotides to be recognized, as well as the part of the mRNA 3 ′ direction from the translation termination codon, and thus the translation termination codon and 3 ′ end of the mRNA. A 3 ′ untranslated region (3′UTR) is included that includes between or the corresponding nucleotide on the gene. The 5 'cap of mRNA comprises an N7-methylated guanosine residue linked to the 5'-most residue of the mRNA via a 5'-5' triphosphate linkage. The 5 'cap region of an mRNA is considered to include the first 50 nucleotides adjacent to the cap, along with the 5' cap structure itself. The 5 'cap region may also be a preferred target region.

  [0012] Some eukaryotic mRNA transcripts are translated directly, but many contain one or more regions known as "introns" that are excised from the transcript before being translated. The remaining (and therefore translated) regions are known as “exons” and are spliced together to form a continuous mRNA sequence. mRNA splicing sites, i.e. intron-exon junctions, can also be preferred target regions and situations where aberrant splicing is associated with the disease, or overexpression of specific mRNA splicing products is associated with the disease It is particularly useful in situations where Abnormal fusion junctions due to rearrangements or deletions are also preferred targets. It has also been found that introns can also be effective and thus preferred target regions of antisense compounds targeting eg DNA or pre-mRNA.

  [0013] Once one or more target sites have been identified, an oligonucleotide is selected that is sufficiently complementary to the target, ie, sufficiently good and hybridizes with sufficient specificity to have the desired effect.

  [0014] In the context of the present invention, "hybridization" means a hydrogen bond, which can also be a Watson-Crick, Hoogsteen or reverse Hoogsteen hydrogen bond, between complementary nucleoside or nucleotide bases. For example, adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds. “Complementary” as used herein refers to the ability of precise pairing between two nucleotides. For example, if a nucleotide at a particular position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a DNA or RNA molecule, the oligonucleotide and the DNA or RNA are complementary to each other at that position. It is considered to be. In each molecule, an oligonucleotide and DNA or RNA are complementary to each other if a sufficient number of corresponding positions are occupied by nucleotides capable of hydrogen bonding to each other. Thus, “specifically hybridizable” and “complementary” are stable and have a sufficient degree of complementarity or accuracy such that specific binding occurs between the oligonucleotide and the DNA or RNA target. A term used to indicate pairing. It is understood in the art that the sequence of an antisense compound need not be 100% complementary to the sequence of its target nucleic acid in order to be specifically hybridizable. Antisense compounds are those under conditions where binding of the compound to a target DNA molecule or target RNA molecule interferes with the normal function of the target DNA or target RNA causing loss of utility, and specific binding is desired, i.e. in A sufficient degree to avoid non-specific binding of an antisense compound to a non-target sequence under physiological conditions in the case of a vivo assay or therapeutic treatment and in the case of an in vitro assay under the conditions under which the assay is performed Are specifically hybridizable.

  [0015] Antisense compounds are commonly used as research reagents and diagnostic agents. For example, antisense oligonucleotides capable of inhibiting gene expression with full specificity are often used by those of ordinary skill in the art to elucidate the function of a particular gene. Antisense compounds are also used, for example, to distinguish the functions of various members of a biological pathway. Antisense modulation has therefore been utilized for research use.

  [0016] The specificity and sensitivity of antisense is also utilized by those skilled in the art for therapeutic use. Antisense oligonucleotides have been used as therapeutic moieties in the treatment of disease states in animals and humans. Antisense oligonucleotides have been safely and effectively administered to humans, and many clinical trials are currently underway. Thus, it has been demonstrated that oligonucleotides can be a useful modality that can also be usefully designed in therapeutic procedures for the treatment of cells, tissues and animals, particularly humans. In the context of the present invention, the term “oligonucleotide” refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. The term includes oligonucleotides having non-naturally occurring moieties that function in a similar manner as well as oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages. Such modified or substituted oligonucleotides are often preferred over the natural form because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid targets, and increased stability in the presence of nucleases.

  [0017] Although antisense oligonucleotides are a preferred type of antisense compound, the present invention includes other oligomeric antisenses including, but not limited to, oligonucleotide mimetics such as those described below. Contains compounds. Antisense compounds according to the present invention preferably comprise from about 8 to about 30 nucleobases (ie from about 8 to about 30 linked nucleosides). Particularly preferred antisense compounds are antisense oligonucleotides, even more preferred are those comprising about 12 to about 25 nucleobases. As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is usually a heterocyclic base. The two most common types of such heterocyclic bases are purines and pyrimidines. A nucleotide is a nucleoside that further comprises a phosphate group covalently linked to the sugar portion of the nucleoside. For nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2 ', 3' or 5 'hydroxyl moiety of the sugar. In forming the oligonucleotide, the phosphate groups are covalently bonded to adjacent nucleosides to form a linear polymer compound. The respective ends of this linear polymer structure can then be further linked to form a cyclic structure, although open linear structures are generally preferred. Within the oligonucleotide structure, the phosphate group is commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal I-linkage or backbone of RNA and DNA is a 3'-5 'phosphodiester linkage.

  [0018] Particular examples of preferred antisense compounds useful in the present invention include oligonucleotides containing modified backbones or unnatural internucleoside linkages. As defined herein, oligonucleotides having a modified backbone include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. Modified oligonucleotides that do not have a phosphorus atom in the internucleoside backbone, for the purposes of this specification and as sometimes referred to in the art, can also be considered oligonucleosides.

  [0019] Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, 3 'alkylene phosphonates and chiral phosphonates Phosphoramidates, thionophosphoroamidates, thionoalkylphosphonates, including methyl and other alkyl phosphonates, phosphinates, 3'-amino phosphoramidates and aminoalkyl phosphoramidates , Thionoalkylphosphotriesters, and boranophosphates having conventional 3′-5 ′ linkages, their 2′-5 ′ linked analogs, and adjacent nucleoside units Pair is 3'-5 'To, or 2'-5' 5'-3 include those having inverted polarity coupled to 5'-2 'from. Various salts, mixed salts and free acid forms are also included.

  [0020] Representative US patents describing the preparation of the above phosphorus-containing linkages include, but are not limited to: U.S. Pat. S. 4,687,808; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 278, 302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,525,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050 Each of which is incorporated herein by reference.

[0021] Preferred modified oligonucleotide backbones that do not contain a phosphorus atom are short alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short heteroatoms or It has a main chain formed by heterocycle internucleoside linkages. These include morpholino linkages (partially formed from the sugar portion of the nucleoside); siloxane backbone; sulfide backbone, sulfoxide backbone and sulfone backbone; formacetyl backbone and thioformacetyl backbone; methyleneformacetyl Main chain and thioform acetyl main chain; alkene-containing main chain; sulfamate main chain; methyleneimino main chain and methylene hydrazino main chain; sulfonate main chain and sulfonamide main chain; amide main chain; , S and others with CH ₂ component parts are included.

  [0022] Representative US patents describing the preparation of the above oligonucleosides include, but are not limited to U.S. Pat. S. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is incorporated herein by reference.

  [0023] In other preferred oligonucleotide mimetics, the sugar and internucleoside linkages, or backbones, of the nucleotide units are both exchanged for new groups. Base units are maintained for hybridization with the appropriate nucleic acid target compound. One such oligomeric compound is an oligonucleotide mimetic that has been shown to have excellent hybridization properties and is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of the oligonucleotide is exchanged for an amide-containing backbone, in particular an aminoethylglycine backbone. The nucleobase is retained and is bound directly or indirectly to the aza nitrogen atom of the backbone amide moiety. Representative US patents describing the preparation of PNA compounds include, but are not limited to U.S. Pat. S. 5,539,082; 5,714,331; and 5,719,262, each of which is incorporated herein by reference. Further explanation of PNA compounds can also be found in Nielsen et al., Science, 1991, 254, 1497-1500.

[0024] Most preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones, and heteroatom backbones, and in particular, _-CH 2 of U.S. Patent 5,489,677 cited above -NH-O-CH _2- , —CH ₂ —N (CH ₃ ) —O—CH ₂ — [known as methylene (methylimino) or MMI backbone], —CH ₂ —O—N (CH ₃ ) —CH ₂ —, —CH _2- N (CH ₃ ) —N (CH ₃ ) —CH ₂ — and —O—N (CH ₃ ) —CH ₂ —CH ₂ — [natural phosphodiester backbone is —O—P—O—CH ₂ — And oligonucleosides having the amide backbone of US Pat. No. 5,602,240, cited above. Also preferred are oligonucleotides having the morpholino backbone structure of US Pat. No. 5,034,506, cited above.

[0025] Modified oligonucleotides can also contain one or more substituted sugar moieties. Preferred oligonucleotides comprise one of the following at the 2 'position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N- alkynyl; or O- alkyl -O- alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted _C 1 _{-C 10} alkyl or _C 2 _{-C 10} alkenyl and alkynyl. Particularly preferred are O [(CH ₂ ) _n O] _m CH ₃ , O (CH ₂ ) _n OCH ₃ , O (CH ₂ ) _n NH ₂ , O (CH ₂ ) _n CH ₃ , O (CH ₂ ). _n ONH _2, and _{O (CH 2) n ON [} (CH 2) n CH 3)] a _2, and n and m are from 1 to about 10. Other preferred oligonucleotides comprise one of the following at the 2 ′ position: C ₁ -C ₁₀ (lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH ₃ , OCN, Cl, Br, CN, CF ₃ , OCF ₃ , SOCH ₃ , SO ₂ CH ₃ , ONO ₂ , NO ₂ , N ₃ , NH ₂ , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino , Substituted silyls, RNA cleaving groups, reporter groups, intercalators, groups for improving the pharmacokinetic properties of oligonucleotides, or groups for improving the pharmacodynamic properties of oligonucleotides, and similar properties Other substituents, preferred modifications include 2'-methoxyethoxy (2'-O-CH _{2 CH 2 OCH 3, 2'-} O- (2- methoxyethyl) or also known as 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995 , 78, 486-504), i.e. alkoxyalkoxy group Further preferred modifications include 2′-dimethylaminooxyethoxy, also known as 2′-DMAOE, ie O (CH ₂ ) ₂ ON (CH, as described herein below in the Examples. ₃ ) ₂ 'and 2'-dimethylaminoethoxyethoxy (also referred to in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE, as also described in the examples herein below) known), i.e. _{2'-O-CH 2 -O-} CH 2 -N (CH 2) include _2.

[0026] Other preferred modifications include 2'-methoxy _(2'-OCH 3), 2'-aminopropoxy _{(2'-OCH 2 CH 2 CH} 2 NH 2), and 2'-fluoro (2 '-F) is included. Similar modifications should be made at other positions on the oligonucleotide, especially the 3 'position of the sugar on the 3' terminal nucleotide or in the 2'-5 'linked oligonucleotide and the 5' position of the 5 'terminal nucleotide. Is also possible. Oligonucleotides can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative US patents describing the preparation of such modified sugar structures include, but are not limited to: U.S. Pat. S. 5,981,957; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646 265; 5,658,873; 5,670,633; and 5,700,920, each of which is incorporated herein by reference.

  [0027] Oligonucleotides can also include nucleobase (often referred to in the art as simply “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include purine bases, adenine (A) and guanine (G), and pyrimidine bases, thymine (T), cytosine (C) and uracil (U). included. Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, adenine and 6-methyl and other alkyl derivatives of guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6 Azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5 -Halo, in particular 5-bromo, 5 Trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine is there. Additional nucleobases include those disclosed in US Pat. No. 3,687,808, The Concise Encyclopedia of Polymer Science and Engineering, pages 858-859, Kroschwitz, J. et al. I. Supervised, disclosed in John Wiley & Sons, 1990, disclosed in Englisch et al., Agewandte Chemie, International Edition, 1991, 30, 613, and Sanghvi, Y. et al. S. , Chapter 15, Antisense Research and Applications, pp. 289-302, Crooke, S .; T.A. And Lebleu, B.A. Includes those disclosed in Supervision, CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine Is included. 5-Methylcytosine substitution has been shown to increase nucleic acid duplex stability by 0.6-1.2 ° C. (Sangvi, YS, Crooke, ST, and Lebleu, B. et al. Supervision, Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278), and currently preferred base substitution, even more preferred when combined with 2'-O-methoxyethyl sugar modification.

  [0028] Representative US patents that describe the preparation of other modified nucleobases along with certain of the above-described modified nucleobases include, but are not limited to, the U.S. Pat. S. 3,687,808 and U.S. Pat. S. 5,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 484, 908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,750, 692; and 5,681,941, each of which is incorporated herein by reference.

  [0029] Another modification of the oligonucleotides of the present invention involves chemically linking the oligonucleotide with one or more moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. Such moieties include, but are not limited to, lipid moieties such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), thioethers such as hexyl-S-trityl thiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan; Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 199). , 20, 533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327- 330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glyceryl or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3. 83), polyamine or polyethylene glycol chains (Mancharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 365'ra til (Mil 'til 3654). Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Biol. Pharmacol. Exp. Ther. , 1996, 277, 923-937).

  [0030] Representative US patents describing the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Pat. S. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717; 580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 1 5,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,371,241; 5,391,723; 5,416,203; 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5, 688, 941, each of which is incorporated herein by reference.

  [0031] It is not necessary for all positions of a given compound to be uniformly modified, and in fact one or more of the modifications described above can be on a single compound or on a single nucleoside in an oligonucleotide. Even it is possible to be captured. The present invention also includes antisense compounds that are chimeric compounds. In the context of the present invention, a “chimeric” antisense compound or “chimera” contains two or more chemically distinct regions each composed of at least one monomer unit, ie, in the case of oligonucleotide compounds, nucleotides. Antisense compounds, especially oligonucleotides. These oligonucleotides are typically modified to provide the oligonucleotide with increased resistance to nuclease degradation, increased cellular uptake, and / or increased binding affinity for the target nucleic acid, at least one Contains one region. Additional regions of the oligonucleotide can also serve as substrates for enzymes capable of cleaving RNA: DNA hybrids or RNA: RNA hybrids. As an example, RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA: DNA duplex. Activation of RNase H thus results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression. As a result, when using chimeric oligonucleotides, comparable results can often be obtained using shorter oligonucleotides compared to phosphorothioate deoxyoligonucleotides that hybridize to the same target region. Cleavage of the RNA target can also be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

  [0032] The chimeric antisense compounds of the invention can also be formed as a hybrid structure of two or more oligonucleotides, modified oligonucleotides, oligonucleosides, and / or oligonucleotide mimics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative US patents describing the preparation of such hybrid structures include, but are not limited to U.S. Pat. S. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 623,065; 5,652,355; 5,652,356; and 5,700,922, each of which is fully incorporated herein by reference.

  [0033] It is also possible to make antisense compounds used according to the present invention, suitably and routinely, through the well-known techniques of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means known in the art for such synthesis may additionally or alternatively be used. It is well known to use similar techniques to prepare oligonucleotides such as phosphorothioates and alkylated derivatives.

  [0034] Antisense compounds of the present invention include antisense compositions of biological origin and gene vector constructs designed to direct in vivo synthesis of antisense molecules, in vitro. Absent. Also, other molecules such as liposomes, receptors targeting molecules, oral formulations, rectal formulations, topical formulations or other formulations, or molecular structures or to assist in uptake, distribution and / or absorption It is also possible to mix the compounds of the invention with the compounds of the invention, encapsulate them, conjugate them with them or otherwise associate them. Representative US patents describing such uptake, distribution, and / or preparation of absorption aid formulations include, but are not limited to, U.S. Pat. S. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356 633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756, each of which is incorporated herein by reference.

  [0035] The antisense compounds of the present invention can be any pharmaceutically acceptable salt, ester, or salt of such an ester, or a metabolite thereof that is biologically active when administered to animals, including humans. It includes any other compound capable of providing a residue (directly or indirectly). Thus, for example, the present disclosure also relates to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other biological equivalents.

  [0036] The term "prodrug" is prepared in an inactive form that is converted to the active form (ie, drug) in the body or cells of the body by the action of endogenous enzymes or other chemicals and / or conditions. The therapeutic agent that is present. In particular, the prodrug forms of the oligonucleotides of the invention may be prepared according to the methods disclosed in WO 93/24510 to Gosselin et al., Published December 9, 1993, or WO 94/26764 to Imbach et al. Acetyl-2-thioethyl) phosphate] derivative.

  [0037] The term "pharmaceutically acceptable salt" refers to a physiologically and pharmaceutically acceptable salt of a compound of the invention: ie, retains the desired biological activity of the parent compound and its undesirable toxic effects. Refers to salt that does not give.

  [0038] Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines. Examples of metals used as cations are sodium, potassium, magnesium, calcium and the like. Examples of suitable amines are N, N′-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine (see, eg, Berge et al., “Pharmaceutical Salts,” J. of Pharma Sci., 1977, 66, 119). The base addition salts of the acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional manner. The free acid form can also be regenerated by contacting the acid with the salt form and isolating the free acid in a conventional manner. The free acid forms differ somewhat from their respective salt forms in certain physical properties, such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acids for purposes of the present invention. . As used herein, “pharmaceutical addition salt” includes a pharmaceutically acceptable salt of one acid form of a component of the composition of the invention. These include organic or inorganic acid salts of amines. Preferred acid salts are hydrochloride, acetate, salicylate, nitrate and phosphate. Other suitable pharmaceutically acceptable salts are well known to those skilled in the art and are basic salts of various inorganic and organic acids, such as hydrochloric acid, hydrobromic acid, sulfuric acid or phosphoric acid, etc. Organic carboxylic acids, sulfonic acids, sulfonic acids or phosphonic acids or N-substituted sulfamic acids such as acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid Acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic acid, 2-phenoxybenzoic acid, 2-acetoxy With benzoic acid, embonic acid, nicotinic acid or isonicotinic acid; and for natural protein synthesis 20 alpha-amino acids, such as amino acids such as glutamic acid or aspartic acid, and also phenylacetic acid, methanesulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, ethane-1,2-disulfonic acid, benzenesulfone Acid, 4-methylbenzenesulfonic acid, naphthalene-2-sulfonic acid, naphthalene-1,5-disulfonic acid, 2- or 3-phosphoglyceric acid, glucose-6-phosphate, N-cyclohexylsulfamic acid (formation of cyclamate) And the basic salts using other acidic organic compounds such as ascorbic acid. Pharmaceutically acceptable salts of the compounds can also be prepared using pharmaceutically acceptable cations. Suitable pharmaceutically acceptable cations are well known to those skilled in the art and include alkali, alkaline earth, ammonium and quaternary ammonium cations. Carbonates or bicarbonates can also be used.

  [0039] With respect to oligonucleotides, preferred examples of pharmaceutically acceptable salts include, but are not limited to, (a) polyamines such as sodium, potassium, ammonium, magnesium, calcium, spermine and spermidine, etc. Salts formed using cations; (b) acid addition salts formed using inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, etc .; (c) such as acetic acid, oxalic acid, Tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid , Salts formed with organic acids such as naphthalene disulfonic acid, polygalacturonic acid; and d) chlorine, salts formed from elemental anions such as bromine, and iodine.

  [0040] The antisense compounds of the present invention can also be utilized for diagnostic, therapeutic, prophylactic agents, and as research reagents and kits. With therapeutic agents, animals suspected of having a disease or disorder treatable by modulating the expression of Nav1.3, preferably humans, are treated by administering an antisense compound according to the present invention. It is also possible to utilize the compounds of the present invention in pharmaceutical compositions by adding an effective amount of an antisense compound to a suitable pharmaceutically acceptable diluent or carrier. The use of the antisense compounds and methods of the invention may also be useful prophylactically, for example to prevent or delay infection, inflammation or tumor formation.

  [0041] Antisense compounds of the present invention allow these compounds to hybridize to nucleic acids encoding Nav1.3, allowing sandwiches and other assays to be readily constructed taking advantage of this fact. Therefore, it is useful for research agents and diagnostic agents. Hybridization of the antisense oligonucleotide of the present invention and a nucleic acid encoding Nav1.3 can also be detected by means known in the art. Such means may include conjugation of the enzyme to the oligonucleotide, radiolabeling of the oligonucleotide or any other suitable detection means. It is also possible to prepare a kit using such a detection means for detecting the level of Nav1.3 in a sample.

  [0042] The present invention also includes pharmaceutical compositions and formulations comprising the antisense compounds of the present invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration is topical (including to the mucous membranes including ocular and vaginal and rectal delivery), eg pulmonary, intratracheal, by powder or aerosol inhalation or insufflation, including by nebulizer Administration, intranasal administration, epithelial and transdermal administration, oral administration or parenteral administration can also be used. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial administration such as intrathecal administration or intraventricular administration. Oligonucleotides with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration.

  [0043] Intraventricular drug administration for direct delivery of drugs to the patient's brain may be desirable for the treatment of patients with diseases or conditions affecting the brain. To accomplish this mode of oligonucleotide administration, a subcutaneous infusion pump (SynchroMed 0 and IsoMee infusion system, Medtronic Inc.) in which a silicone catheter is surgically introduced into the ventricle of a human patient and surgically implanted in the abdominal region. , Minneapolis, Minnesota) (Zinnu et al., Cancer Research, 1984, 44, 1698). The pump is used to inject the oligonucleotides and allows precise dosage adjustments and dosing regime changes with the aid of an external programming device. The capacity of the pump reservoir is 18-20 mL and the infusion rate may vary from 0.1 mL / h to 1 mL / h. The pump reservoir may be refilled at intervals of 3-10 weeks, depending on the frequency of administration ranging from daily to monthly, and depending on the dose of drug administered in the range of 0.01 microg to 100 g per kg body weight. Pump refilling is accomplished by percutaneous puncture of the pump's self-sealing diaphragm.

  [0044] Intrathecal, epidural, subdural drug administration for the introduction of drugs into the patient's spinal column may be desirable for the treatment of patients with central nervous system disorders. In order to achieve this mode of oligonucleotide administration, a silicone catheter is surgically implanted in the subarachnoid spinal interspace of a human patient (eg, implantation in the L3-4 lumbar spinal cord targets the leg) And connected to a subcutaneous infusion pump surgically implanted in the upper abdominal region (Luer and Hatton, The Annals of Pharmacotherapy, 1993, 27, 912; Ettinger et al., 1978, Cancer, 41, 1270, 1978; Yaida et al., Regul Pept., 1995, 59, 193). The pump is used to inject the oligonucleotides and allows precise dosage adjustments and dosing regime changes with the aid of an external programming device. The capacity of the pump reservoir is 18-20 mL, the infusion rate may vary from 0.1 mL / h to 1 mL / h, and depending on the frequency of administration ranging from daily to monthly and 0.00 per kg body weight. Depending on the dose of drug administered in the 01 microg to 100 g range, the pump reservoir may be refilled at 3-10 week intervals. Pump refilling is accomplished by a single percutaneous puncture of the pump's self-sealing diaphragm. Oligonucleotide distribution, stability, and pharmacokinetics in the central nervous system may be followed by known methods. Subdural administration is also envisioned elsewhere by pump mechanism or direct infusion.

  [0045] To achieve delivery of oligonucleotides to areas other than the brain or spinal column via this method, a silicone catheter is configured to couple a subcutaneous infusion pump, eg, to a liver artery for delivery to the liver. . Infusion pumps may also be used to achieve systemic delivery of oligonucleotides (Ewel et al., Cancer Research, 1992, 52, 3005; Rubenstein et al., J. Surg. Oncol., 1996, 62, 194). . [0046] Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves, etc. may also be useful.

  [0047] Compositions and formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickening agents, flavoring agents, diluents, emulsifiers, dispersion aids or binders may be desirable.

  [0048] Compositions and formulations for parenteral, intrathecal or intraventricular administration include buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers. Sterile aqueous solutions can also be included, which can also contain carrier compounds and other pharmaceutically acceptable carriers or excipients.

  [0049] The pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. It is also possible to produce these compositions from a variety of components, including but not limited to preformed liquids, self-emulsifying solids and self-emulsifying semisolids.

  [0050] Pharmaceutical formulations of the present invention, preferably also present in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredient with the pharmaceutical carrier (s) or excipient (s). In general, the formulations are prepared by uniformly and fundamentally bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

  [0051] The compositions of the present invention can be formulated in any of a number of possible dosage forms, including but not limited to tablets, capsules, liquid syrups, soft gels. Suppositories, and enemas. The compositions of the present invention can be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions can further contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol and / or dextran. The suspension can also contain stabilizers.

  [0052] In one embodiment of the present invention, the pharmaceutical composition may be formulated and used as a foam. Pharmaceutical foams include, but are not limited to, formulations such as emulsions, microemulsions, creams, jellies and liposomes. Although the properties are basically similar, these formulations vary in the components and consistency of the final product. The preparation of such compositions and formulations is generally known to those skilled in the pharmaceutical and formulation arts, and such preparations can be applied to the formulation of the compositions of the present invention.

Emulsions [0053] Compositions of the invention can also be prepared and formulated as emulsions. Emulsions are typically a hybrid system in which one liquid is dispersed in another liquid, usually in the form of droplets with a diameter exceeding 0.1 μm (Idson, Pharmaceutical Dosage Forms, Lieberman, Rieger). And Banker (supervised), 1988, Marcel Dekker, Inc., New York, NY, Vol. 1, p. 199; , New York, NY, Volume 1, p. 245; Block, Pharmaceutical Dosage Forms, Lieberman Rieger and Banker (supervised), 1988, Marcel Dekker, Inc., New York, New York, Volume 2, p. 335; , P. 301). Emulsions are often two-phase systems composed of two immiscible liquid phases that are well mixed and dispersed with each other. In general, the emulsion can be either a water-in-oil (w / o) species or an oil-in-water (o / w) species. When the aqueous phase is subdivided into a bulk oily phase and dispersed as microdroplets, the resulting composition is called a water-in-oil (w / o) emulsion. Alternatively, if the oily phase is subdivided into a bulk aqueous phase and dispersed as microdroplets, the resulting composition is referred to as an oil-in-water (o / w) emulsion. Emulsions can contain additional components in addition to the dispersed phase and the active agent which can also be present as a solution in the aqueous phase, the oily phase, or as a separate phase itself. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and antioxidants can also be present in the emulsion, if desired. The drug emulsion is also a multiple emulsion composed of more than two phases, as in the case of oil-in-water-in-oil (o / w / o) emulsions and water-in-oil-in-water (w / o / w) emulsions, for example. It is also possible. Such complex formulations often offer certain advantages that simple binary emulsions do not provide. Multiple emulsions in which individual oil droplets of an o / w emulsion encapsulate small water droplets constitute a w / o / w emulsion. Similarly, a system of oil droplets encapsulated in water globules stabilized in an oily continuous phase provides an o / w / o emulsion.

  [0054] Emulsions are characterized by little or no thermodynamic stability. Often the dispersed or intermittent phase of the emulsion is well dispersed in the external or continuous phase and is maintained in this form by the emulsifier or by the viscosity of the formulation. It is possible for either phase of the emulsion to be semi-solid or solid, as is the case with emulsion-type ointment bases and creams. Another means of stabilizing the emulsion involves the use of emulsifiers that can be incorporated into either phase of the emulsion. Emulsifiers can be broadly classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorbent bases, and finely dispersed solids (Idson, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (supervised), 1988, Marcel Dekker, Inc., New York, NY, Middle, Volume 1, p. 199).

  [0055] Synthetic surfactants, also known as surfactants, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (Rieger, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (supervised), 1988, Marcel Dekker, Inc., New York, New York, Volume 1, p. 285; New York, New York, 1988, middle, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic portion and a hydrophobic portion. The ratio of hydrophilic to hydrophobic properties of surfactants has been termed hydrophilic / lipophilic balance (HLB), and in preparing and formulating surfactants in classifying and selecting surfactants, It is a valuable tool. Surfactants can also be classified into different types based on the nature of the hydrophilic groups: nonionic, anionic, cationic and amphoteric (Rieger, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker). (Supervised), 1988, Marcel Dekker, Inc., New York, NY, Middle, Volume 1, p.285).

  [0056] Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and gum acacia. Absorbent bases, such as anhydrous lanolin and hydrophilic petrolatum, have hydrophilic properties such that they can absorb water and form a w / o emulsion but maintain its semi-solid consistency. Finely divided solids have also been used as excellent emulsifiers, especially when combined with surfactants and in viscous preparations. These include polar inorganic solids such as heavy metal hydroxides, non-expandable clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, dyes and non- Polar solids such as carbon or glyceryl tristearate are included.

  [0057] A wide variety of non-emulsifying materials are also included in the emulsion formulation and contribute to the properties of the emulsion. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker ( Supervision), 1988, Marcel Dekker, Inc., New York, NY, Volume 1, p.335; Idson, Pharmaceutical Dosage Forms, Liberman, Rieger and Banker, Supervision, 1988, Marker, New York New York, Middle, Volume 1, p.199).

  [0058] Hydrophilic colloids or hydrocolloids include naturally occurring rubbers and synthetic polymers such as polysaccharides (eg, gum arabic, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth gum), cellulose derivatives (eg, carboxymethylcellulose and Carboxypropylcellulose), and synthetic polymers such as carbomers, cellulose ethers, and carboxyvinyl polymers. These disperse or swell in water to form a colloidal solution that forms a strong interfacial film around the dispersed phase droplets and by increasing the viscosity of the external phase. Stabilize the emulsion.

  [0059] Because emulsions often contain several ingredients, such as carbohydrates, proteins, sterols and phosphatides, that can also easily support microbial growth, these formulations often incorporate preservatives. . Commonly used preservatives included in emulsion formulations include methylparaben, propylparaben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also typically added to emulsion formulations to prevent formulation degradation. Antioxidants used are free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergies Agents such as citric acid, tartaric acid, and lecithin can also be used.

  [0060] The application of emulsion formulations via the dermal, oral and parenteral routes and their method of manufacture has been reviewed in the literature (Idson, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (supervised), 1988, Marcel Dekker, Inc., New York, NY, Middle, Volume 1, p. 199). Emulsion formulations for oral delivery have been very widely used because they are simple to formulate and effective in terms of absorption and bioavailability (Rosoff, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (supervised), 1988, Marcel Dekker, Inc., New York, NY, Vol. 1, p. 245; Idson, Pharmaceutical Dosage Forms, Lieberman, Rieger, Bank, e.D. New York, NY, Middle, Volume 1, p. 199). Among the substances commonly administered orally as o / w emulsions are laxatives based on mineral oil, oil-soluble vitamins and high fat nutritional preparations.

  [0061] In one embodiment of the invention, the oligonucleotide and nucleic acid composition is formulated as a microemulsion. A microemulsion can also be defined as a system of water, oil and amphiphile that is a single, optically isotropic and thermodynamically stable liquid solution (Rosoff, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (supervised), 1988, Marcel Dekker, Inc., New York, NY, Volume 1, p. 245). Typically, a microemulsion is obtained by first dispersing the oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally a medium chain alcohol, to create a clear system. Is a system prepared by forming Thus, microemulsions have also been described as two immiscible liquid, thermodynamically stable, isotropic transparent dispersions that are stabilized by an interfacial film of surface active molecules (Leung And Shah: Controlled Release of Drugs: Polymers and Aggregate Systems, supervised by Rosoff, M., 1989, VCH Publishers, New York, Medium, pages 1852-5). Microemulsions are usually prepared via a combination of 3 to 5 components including oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is water-in-oil (w / o) or oil-in-water (o / w) is a function of the oil and surfactant used and the polar head and carbonization of the surfactant molecule. Depending on the structure and geometric packing of the hydrogen tail (Schott, Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

  [0062] Phenomenological approaches utilizing phase diagrams have been studied in detail and have provided comprehensive knowledge to those skilled in the art on how to formulate microemulsions (Rosoff, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (supervised), 1988, Marcel Dekker, Inc., New York, NY, Volume 1, p.245; Marcel Dekker, Inc., New York, NY, Middle, Volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in the formulation of spontaneously formed, thermodynamically stable droplets.

  [0063] Surfactants used in the preparation of the microemulsion include, but are not limited to, ionic surfactants, nonionic surfactants, Brij 96, alone or in combination with co-surfactants. , Polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), Decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioate (SO750), decaglycerol decaoleate (DAO750) are included. Co-surfactants are usually short chain alcohols such as ethanol, 1-propanol, and 1-butanol, which penetrate into the surfactant film and as a result, the empty space that is generated between the surfactant molecules. It acts to increase the interfacial fluidity by producing a disordered film because of the space. However, microemulsions can also be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase can typically be, but is not limited to, water, aqueous drug solutions, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. . Oil phases include, but are not limited to Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters , Fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oils can also be included.

  [0064] Microemulsions are of particular interest in terms of drug solubilization and enhanced drug absorption. Lipid-based microemulsions (both o / w and w / o) have been proposed to enhance the oral bioavailability of drugs, including peptides (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385- 1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions are easy to prepare, with improved drug solubilization, drug protection from enzymatic hydrolysis, and the ability of surfactants to enhance membrane fluidity and permeability, thereby enhancing drug absorption Resulting in advantages such as ease of oral administration compared to solid dosage forms, improved clinical efficacy, and reduced toxicity (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often, microemulsions can also form spontaneously when the components are brought together at ambient temperature. This can be particularly advantageous when formulating thermolabile drugs, peptides or oligonucleotides. Microemulsions are also effective for transdermal delivery of active ingredients in both cosmetic and pharmaceutical applications. The microemulsion compositions and formulations of the present invention promote increased systemic absorption of oligonucleotides and nucleic acids from the gastrointestinal tract and local cellular uptake of oligonucleotides and nucleic acids in the gastrointestinal tract, vagina, buccal cavity and other areas of administration. Is also expected to improve.

  [0065] The microemulsions of the present invention also provide additional components and additives such as sorbitan monostearate (Grill 3) to improve the properties of the formulation and to enhance the absorption of the oligonucleotides and nucleic acids of the present invention. ), Labrasol, and penetration enhancers can also be included. The penetration enhancers used in the microemulsions of the present invention can also be classified as belonging to one of five broad categories: surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants. (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these types has been discussed above.

Liposomes [0066] In addition to microemulsions, there are many organized surfactant structures that have been studied and used for pharmaceutical formulations. These include monolayers, micelles, bilayers and vesicles. Vesicles such as liposomes have attracted great interest from the perspective of drug delivery due to their specificity and duration of action they provide. In the present invention, the term “liposome” means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer (s) or bilayer (s).

  [0067] Liposomes are unilamellar or multilamellar vesicles with a lipophilic component and a membrane formed from the aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes have the advantage that they can be fused to the cell wall. Non-cationic liposomes cannot efficiently fuse with the cell wall, but are taken up by macrophages in vivo.

  [0068] In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each less than 50 nm in diameter, under the influence of an appropriate transdermal gradient. It is therefore desirable to use liposomes that are very deformable and can pass through such fine pores.

  [0069] Further advantages of liposomes; liposomes derived from natural phospholipids are biocompatible and biodegradable; liposomes can also incorporate a wide range of water and fat-soluble drugs; It is included that liposomes can also protect encapsulated drugs from metabolism and degradation in their internal compartment (Rosoff, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (supervised), 1988, Marcel Dekker, Inc., New York, NY, Medium, Volume 1, p.245). Important in the preparation of liposome formulations is the lipid surface charge, vesicle size and aqueous volume of the liposomes.

  [0070] Liposomes are useful for transporting and delivering active ingredients to the site of action. Because the liposome membrane is structurally similar to a biological membrane, when the liposome is applied to tissue, the liposome begins to coalesce with the cell membrane. As the liposome and cell coalescence progresses, the contents of the liposome are transferred into the cell where the active agent can act.

  [0071] Liposome formulations have been the focus of extensive research as a delivery mode for many drugs. There is increasing evidence that liposomes offer several advantages over other formulations for topical administration. These benefits include reduced side effects associated with high systemic absorption of the administered drug, increased dose drug accumulation at the desired target, and the ability to administer a wide variety of both hydrophilic and hydrophobic drugs to the skin. Sex is included.

  [0072] Several reports have detailed the ability of liposomes to deliver agents containing high molecular weight DNA to the skin. Compounds including analgesics, antibodies, hormones and high molecular weight DNA have been administered to the skin. Most of the applications resulted in targeting of the upper epidermis.

  [0073] Liposomes belong to two broad types. Cationic liposomes are positively charged liposomes that interact with negatively charged DNA molecules to form stable complexes. The positively charged DNA / liposome complex binds to the negatively charged cell surface and enters the endosome. Due to the acidic pH within the endosome, the liposomes rupture and release the contents into the cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).

  [0074] pH-sensitive liposomes or negatively charged liposomes capture DNA rather than complex with DNA. Since both DNA and lipid are similarly charged, repulsion occurs rather than complex formation. Nevertheless, some DNA is entrapped within the aqueous interior of these liposomes. PH sensitive liposomes were used to deliver the DNA encoding the thymidine kinase gene to cell monolayers in culture. Exogenous gene expression was detected in target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).

  [0075] One major type of liposomal composition includes phospholipids other than naturally derived phosphatidylcholines. Neutral liposome compositions can also be formed, for example, with dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions are generally formed with dimyristoyl phosphatidylglycerol, whereas anionic fusogenic liposomes are primarily formed with dioleoylphosphatidylethanolamine (DOPE). The Another type of liposome composition is formed with phosphatidylcholine (PC) such as soybean PC and egg PC. Another type is formed with a mixture of phospholipids and / or phosphatidylcholines and / or cholesterol.

  [0076] Several studies have evaluated the topical delivery of liposomal drug formulations to the skin. Application of liposomes containing interferon to guinea pig skin resulted in reduction of skin eruption wounds, but delivery of interferon via other means (eg, as a solution or as an emulsion) was ineffective (Weiner et al. , Journal of Drug Targeting, 1992, 2, 405-410). In addition, further studies have tested the efficacy of interferon administered as part of a liposomal formulation versus interferon administration using an aqueous system and concluded that the liposomal formulation is superior to aqueous administration. (Du Plessis et al, Anti-Research, 1992, 18, 259-265).

[0077] Certain systems comprising nonionic liposome systems, nonionic surfactants and cholesterol have also been investigated to determine their usefulness in drug delivery to the skin. Using a nonionic liposome formulation comprising Novasome ^™ I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and Novasome ^™ II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) Thus, cyclosporin-A was delivered to the dermis of mouse skin. Results have shown that such nonionic liposome systems are effective in promoting cyclosporin-A deposition in different layers of the skin (Hu et al., STP Pharma. Sci., 1994). , 4, 6, 466).

[0078] Liposomes also include “sterically stable” liposomes, where the term refers to one or more specialized lipids that, when incorporated into the liposomes, have these specialized lipids. It refers to a liposome comprising the specialized lipid that causes an increase in circulation compared to a lacking liposome. Examples of sterically stabilized liposomes part (A) 1 or more glycolipids vesicle-forming lipid portion of the liposome, for example, or comprise monosialoganglioside G _M1, or (B) 1 or more hydrophilic Functional polymers such as those derivatized with polyethylene glycol (PEG) moieties. While not desirable to be bound by any particular theory, at least for sterically stable liposomes containing gangliosides, sphingomyelin, or PEG derivatized lipids, the enhancement of these sterically stable liposomes Circulating half-life is believed in the art to be due to decreased cellular uptake of the reticuloendothelial cell line (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer. Research, 1993, 53, 3765).

[0079] A variety of liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. NY Acad. Sci., 1987, 507, 64) reported the ability of monosialoganglioside G _M1 , galactocerebroside sulfate, and phosphatidylinositol to improve the blood half-life of liposomes. These findings were described in detail by Gabizon et al. (Proc. Natl. Acad. Sci. USA, 1988, 85, 6949). Both for Allen et al., U.S. Pat. 4,837,028 and WO 88/04924 discloses liposomes comprising (1) sphingomyelin and (2) the ganglioside _{G j} or galactocerebroside sulfate ester. US Pat. No. 5,543,152 (Webb et al.) Discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al.).

[0080] Many liposomes comprising lipids derivatized with one or more hydrophilic polymers and methods for their preparation are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described a liposome comprising a non-ionic surfactant 2C ₁₂ 15G containing a PEG moiety. Illum et al. (FEBS Lett., 1984, 167, 79) noted that hydrophilic coating of polystyrene particles with polymeric glycols resulted in a significantly enhanced blood half-life. Synthetic phospholipids that are modified by attachment of a carboxyl group of a polyalkylene glycol (eg, PEG) are described in Sears (US Pat. Nos. 4,426,330 and 4,534,899). Klibanov et al. (FEBS Lett., 1990, 268, 235) demonstrated a significant increase in blood circulation half-life of liposomes comprising phosphatidylethanolamine (PE) derivatized with PEG or PEG stearate. The experiment to be described was described. Blume et al. (Biochimica et Biophysica Acta, 1990, 1029, 91) made these observations on DSPE-PEG, formed from a combination of other PEG-derivatized phospholipids, such as distearoylphosphatidylethanolamine (DSPE) and PEG. Expanded to. Liposomes with PEG moieties covalently attached on the outer surface are described in European Patent No. EP 0 445 131 B1 to Fisher and WO 90/04384. Liposome compositions containing 1-20 mole percent PEG-derivatized PE, and methods of use thereof are described by Woodle et al. (US Pat. Nos. 5,013,556 and 5,356,633) and Martin et al. (US Pat. No. 5,213,804 and European Patent No. EP 0 496 813 B1). Liposomes comprising several other lipid-polymer conjugates are disclosed in WO 91/05545 and US Pat. No. 5,225,212 (both to Martin et al.) And WO 94/20073 (Zalipsky et al.). The Liposomes comprising PEG-modified ceramide lipids are described in WO 96/10391 (Choi et al.). US Pat. Nos. 5,540,935 (Miyazaki et al.) And 5,556,948 (Tagawa et al.) Describe PEG-containing liposomes that can be further derivatized with functional moieties on the surface.

  [0081] A limited number of liposomes comprising nucleic acids are known in the art. WO 96/40062 to Thierry et al. Discloses a method of encapsulating high molecular weight nucleic acids in liposomes. US Pat. No. 5,264,221 to Tagawa et al. Discloses protein-bound liposomes and claims that the contents of such liposomes can also include antisense RNA. US Pat. No. 5,665,710 to Rahman et al. Describes a particular method of encapsulating oligodeoxynucleotides in liposomes. WO 97/04787 to Love et al. Discloses liposomes comprising antisense oligonucleotides that target the raf gene.

  [0082] Transfersomes are yet another type of liposome and are highly deformable lipid aggregates that are attractive as drug delivery vehicles. Because transfersomes are very deformable, they can also be described as lipid droplets that can easily penetrate through smaller pores. Transfersomes are adaptable to the environment in which they are used, eg self-optimizing (adapts to the shape of the skin pores), self-repairs, often reaches the target without fragmentation, and often autoloads. For the production of transfersomes, it is possible to add a surface edge activator, usually a surfactant, to a standard liposome composition. Transfersomes have been used to deliver serum albumin to the skin. Transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of serum albumin-containing solutions.

  [0083] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common method of classifying and positioning the attributes of many different types of surfactants, both natural and synthetic, is through the use of hydrophilic / lipophilic balance (HLB). The nature of the hydrophilic group (also known as the “head”) provides the most useful means to classify the different surfactants used in the formulation (Rieger, Pharmaceutical Dosage Forms, Marcel Dekker, Inc.). , New York, New York, 1988, middle, p. 285).

  [0084] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and can be used over a wide range of pH values. In general, the HLB value ranges from 2 to about 18, depending on the structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. . Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated / propoxylated block polymers are also included in this class. Polyoxyethylene surfactants are the most common member of nonionic surfactant species.

  [0085] When a surfactant molecule is dissolved or dispersed in water and the molecule has a negative charge, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acylamides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkylbenzene sulfonates, Acyl isethionates, acyl taurates and sulfosuccinates, and phosphates are included. The most important members of the anionic surfactant species are alkyl sulfates and soaps.

  [0086] When a surfactant molecule is dissolved or dispersed in water and the molecule has a positive charge, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. Quaternary ammonium salts are the most used members of this type.

  [0087] A surfactant is classified as amphoteric if it has the ability to have either a positive charge or a negative charge. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.

[0088] The use of surfactants in pharmaceutical products, formulations and emulsions has been reviewed (Rieger, Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, Medium, p. 285).
Penetration enhancers [0089] In one embodiment, the present invention uses a variety of penetration enhancers to achieve efficient delivery of nucleic acids, particularly oligonucleotides, to animal skin. Most drugs are present in solution in both ionized and non-ionized forms. However, usually only fat-soluble or lipophilic drugs easily pass through the cell membrane. It has been discovered that even non-lipophilic drugs can cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to assisting the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also increase the permeability of lipophilic drugs.

  [0090] Penetration enhancers can also be classified as belonging to one of five broad categories: surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee). Et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of the aforementioned penetration enhancer types is described in more detail below.

  [0091] Surfactant: In the context of the present invention, a surfactant (or “surfactant”), when dissolved in an aqueous solution, is the surface tension of the solution or the interface between the aqueous solution and another liquid. A chemical entity that reduces tension and, consequently, enhances the absorption of oligonucleotides through the mucosa. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl-ether (Lee et al., Critical Reviews in Therapeutic Drug. Carrier Systems, 1991, p. 92); and perfluorochemical emulsions such as FC-43 (Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).

[0092] Fatty acids: Various fatty acids and their derivatives that act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, Linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acyl Carnitines, acylcholines, their C _1-10 alkyl esters (eg methyl, isopropyl and t-butyl), and their mono- and di-glycerides (ie oleate, laurate, caprate, myristate, palmitate, stear) Rate, linolea (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92; Muranishi, Critical Reviews in Therapeutics, 19). Pharmacol., 1992, 44, 651-654).

  [0093] Bile salts: The physiological role of bile includes facilitating the dispersion and absorption of lipids and fat-soluble vitamins (Brunton, Chapter 38: Goodman & Gilman's Thepharmacological Basis of Therapeutics, 9th edition. Supervised by Hardman et al., McGraw-Hill, New York, 1996, middle, pp. 934-935). A variety of natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus, the term “bile salt” includes any naturally occurring component of bile as well as any synthetic derivative thereof. The bile salts of the present invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), Glucholic acid (sodium glycolate), glycolic acid (sodium glycolate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (Sodium chenodeoxycholic acid), ursodeoxycholic acid (UDCA), tauro-24,25-dihydro-sodium fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9- Uryl ether (POE) is included (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92, Swinard, Chapter 39: Remington's Pharmaceutical Sci., 18th edition, Remington's Pharmaceutical Sci. Easton, 1990, p. 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. hita et al., J. Pharm. Sci., 1990, 79, 579-583).

  [0094] Chelating agents: Chelating agents, such as those used in connection with the present invention, remove the ions from solution by forming a complex with metallic ions, resulting in absorption of the oligonucleotide through the mucosa. Can also be defined as compounds that enhance. With regard to its use as a penetration enhancer of the present invention, most characterized DNA nucleases require a divalent metal ion for catalysis and are therefore inhibited by the chelator, so that the chelator is It has the further advantage of acting as a DNase inhibitor (Jarrett, J. Chromatogr., 1993, 618, 315-339). Chelating agents of the present invention include, but are not limited to, disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (eg, sodium salicylate, 5-methoxysalicylate and homovanillate), collagen N-acyl derivatives, Laureth-9, and N-aminoacyl derivatives of beta-diketones (enamines) are included (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, pages 92; Muraniswish; Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J Control Rel., 1990, 14, 43-51).

  [0095] Non-chelating non-surfactant: As used herein, non-chelating non-surfactant penetration enhancing compounds do not exhibit significant activity as chelating agents or surfactants, but nevertheless through the gastrointestinal mucosa It can also be defined as a compound that enhances the absorption of oligonucleotides (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This type of penetration enhancer includes, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92); and non-steroids Sex anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).

  [0096] Agents that enhance uptake of oligonucleotides at the cellular level can also be added to the agents and other compositions of the invention. For example, cationic lipids such as lipofectin (Junichi et al., US Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules such as polylysine (Lollo et al., PCT application WO 97/30731). It is also known to enhance cellular uptake of oligonucleotides.

  [0097] Other agents may be utilized to enhance the penetration of the administered nucleic acid, including glycols such as ethylene glycol and propylene glycol, pyrroles such as 2-pyrrole, and azone. And terpenes such as limonene and menthone.

carrier:
[0098] Certain compositions of the present invention also incorporate a carrier compound in the formulation. As used herein, a “carrier compound” or “carrier” is inactive (ie, has no biological activity per se), but may, for example, degrade a biologically active nucleic acid, Or it can refer to a nucleic acid, or analog thereof, recognized as a nucleic acid in an in vivo process that reduces its bioavailability by having its biological activity removed by promoting its removal from the circulation It is. Co-administration of nucleic acid and carrier compound is typically in excess of the latter substance, possibly in the liver, kidney or other extracirculatory storage organs, possibly due to competition between the carrier compound and nucleic acid for a common receptor. It is also possible to substantially reduce the amount of nucleic acid recovered. For example, recovery in the liver tissue of oligonucleotides that are partially phosphorothioate when co-administered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid It can also be reduced (Miyao et al., Antisense Res. Dev., 1995, 5: 115-121; Takakura et al., Antisense & Nucl. Acid Drug Dev., 1996, 6: 177-183).

Excipient:
[0099] In contrast to a carrier compound, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspension or other drug for delivering one or more nucleic acids to an animal. Either a physically inert vehicle. Excipients can be liquid or solid and are designed to provide the desired bulk, consistency, etc. when combined with nucleic acids and other components of a given pharmaceutical composition. Select with the mode of administration. Typical pharmaceutical carriers include, but are not limited to, binders such as pre-gelatinized corn starch, polyvinyl pyrrolidone or hydroxypropyl methylcellulose; fillers such as lactose and other sugars, microcrystals Cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate); lubricants (eg, magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, Hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc .; disintegrants (eg starch, sodium starch glycolate, etc.); and wetting agents (eg sodium lauryl sulfate) Umm, etc.) are included.

  [00100] It is also possible to formulate the compositions of the invention using pharmaceutically acceptable organic or inorganic excipients suitable for parenteral administration that do not adversely react with nucleic acids. It is. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, Hydroxymethyl cellulose, polyvinyl pyrrolidone and the like are included.

  [00101] Formulations for topical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohol, or nucleic acid solutions in liquid or solid oil bases. Is possible. The solution can also contain buffers, diluents and other suitable additives. It is also possible to use pharmaceutically acceptable organic or inorganic excipients suitable for parenteral administration that do not adversely react with nucleic acids.

  [00102] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid , Viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

Other Components [00103] The compositions of the present invention may further contain other accessory components commonly found in pharmaceutical compositions, at their level of use established in the art. is there. Thus, for example, the composition can contain additional compatible and pharmaceutically active ingredients such as antipruritics, astringents, local anesthetics or anti-inflammatory agents, or the composition of the invention Additional ingredients, such as pigments, flavors, preservatives, antioxidants, opacifiers, thickeners and stabilizers, that are useful in physically formulating various dosage forms of It can also be contained. However, such ingredients should not unduly interfere with the biological activity of the components of the composition of the invention when added. Auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, penetrations that sterilize the formulation and, if desired, do not adversely interact with the nucleic acid (s) of the formulation It is also possible to mix with a salt, a buffer, a colorant, a flavoring agent and / or a fragrance which affects the pressure.

  [00104] Aqueous suspensions can also contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol and / or dextran. The suspension can also contain stabilizers.

  [00105] Certain embodiments of the invention provide pharmaceutical compositions comprising (a) one or more antisense compounds and (b) one or more other chemotherapeutic agents that function by a non-antisense mechanism. . Examples of such chemotherapeutic agents include, but are not limited to, anticancer drugs such as daunorubicin, dactinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard, chlorambucil, melphalan, cyclophosphamide, 6- Mercaptopurine, 6-thioguanine, cytarabine (CA), 5-fluorouracil (5-FU), floxuridine (5-FUdR), methotrexate (MTX), colchicine, vincristine, vinblastine, etoposide, teniposide, cisplatin and diethylstilbest Role (DES) is included. See generally, The Merck Manual of Diagnosis and Therapy, 15th edition, supervised by Berkow et al., 1987, Rahway, NJ, pages 1206-1228. Anti-inflammatory drugs, including but not limited to non-steroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs including but not limited to ribavirin, vidarabine, acyclovir and ganciclovir are also compositions of the present invention. It is also possible to combine with things. See generally, The Merck Manual of Diagnostics and Therapy, 15th edition, supervised by Berkow et al., 1987, Rahway, NJ, pages 2499-2506 and pages 46-49, respectively. Other non-antisense chemotherapeutic agents are also within the scope of the present invention. Two or more combination compounds can be used together or sequentially.

  [00106] In another related embodiment, the composition of the invention comprises one or more antisense compounds that target a first nucleic acid, in particular an oligonucleotide, and one or more additional that target a second nucleic acid target. It is also possible to contain an antisense compound. Many examples of antisense compounds are known in the art. Two or more combination compounds can be used together or sequentially.

[00107] The formulation and subsequent administration of therapeutic compositions is considered to be within the skill of the artisan. Dosing depends on the severity and responsiveness of the disease state to be treated, and the course of treatment lasts for days to months, or until cure is achieved, or until reduction of the disease state is achieved. Optimal dosing schedules can also be calculated from measurements of drug accumulation in the patient's body. One of ordinary skill in the art can also readily determine optimal dosages, dosing methodologies and repetition rates. Optimal dosing may vary depending on the relative strength of the individual oligonucleotides and should be estimated based on EC ₅₀ found to be generally effective in in vitro and in vivo animal models Is also possible. In general, dosage is from 0.01 μg to 100 g per kg of body weight, and can be administered daily, weekly, monthly or more than once a year, or once every 2 to 20 years. One of ordinary skill in the art can also easily estimate the repetition rate of medication based on the measured residence time and concentration of the drug in bodily fluids or tissues. After successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent recurrence of the disease state, where the oligonucleotide is administered at least 0.1 daily per kg of body weight from once a day to once every 20 years. It is administered at a maintenance dose ranging from 01 μg to 100 g.

  [00108] While this invention has been described with specificity and certain specific preferred embodiments thereof, the following examples are provided only to illustrate the invention and limit the invention. Not intended.

Example (Example 1)
Nucleoside phosphoramidites, deoxy and 2′-alkoxyamidites for oligonucleotide synthesis [00109] 2′-deoxy and 2′-methoxy beta-cyanoethyldiisopropyl phosphoramidites are commercially available from sources such as Chemgenes, Mass. Needham or Glen Research, Inc., Stirling, VA). Other 2′-O-alkoxy substituted nucleoside amidites are prepared as described in US Pat. No. 5,506,351, incorporated herein by reference. For oligonucleotides synthesized using 2'-alkoxyamidites, the standard cycle of unmodified oligonucleotides is utilized, except that the waiting step after pulse delivery of tetrazole and base is increased to 360 seconds.

  [00110] Published methods using commercially available phosphoramidites (Glen Research, Stirling, VA or ChemGenes, Needham, Mass.) [Sangvi et al., Nucleic Acids Research, 1993, 21, 3197-3203. ] To synthesize oligonucleotides containing 5-methyl-2'-deoxycytidine (5-Me-C) nucleotides.

2'-Fluoramidite
2′-Fluorodeoxyadenosine amidite [00111] as previously described (Kawasaki et al., J. Med. Chem., 1993, 36, 831-841 and US Pat. No. 5,670,633, incorporated herein). A 2'-fluoro oligonucleotide is synthesized. Briefly, by utilizing commercially available 9-beta-D-arabinofuranosyl adenine as a starting component and modifying the literature method, by S _N 2 substitution of the 2′-beta-trityl group A 2'-alpha-fluoro atom is introduced to synthesize protected nucleoside N6-benzoyl-2'-deoxy-2'-fluoroadenosine. Thus, N6-benzoyl-9-beta-D-arabinofuranosyl adenine is selectively protected as a 3 ', 5'-ditetrahydropyranyl (THP) intermediate with moderate yield. Deprotection of the THP and N6-benzoyl groups is accomplished using standard methodologies and using standard methods, 5′-dimethoxytrityl- (DMT) and 5′-DMT-3′-phosphoramidite intermediates Get.

2′- Fluorodeoxyguanosine [00112] tetraisopropyldisiloxanyl (TPDS) protected 9-beta-D-arabinofuranosylguanine as a starting component and to the intermediate diisobutyrylarabinofuranosylguanosine The transformation is used to achieve the synthesis of 2'-deoxy-2'-fluoroguanosine. Following deprotection of the TPDS group, the hydroxyl group is protected with THP to give diisobutyryl-diTHP protected arabinofuranosylguanine. Selective O-deacylation and triflation is followed by treatment of the crude product with fluoride followed by deprotection of the THP group. Standard methodologies are used to obtain 5′-DMT- and 5′-DMT-3′-phosphoramidites.

The 2'-fluorouridine [00113] Modification of literature methods to achieve the synthesis of 2'-deoxy-2'-fluorouridine, wherein 2,2'-anhydro-1-beta -D- arabinofuranosyl Uracil is treated with 70% hydrogen fluoride-pyridine. Standard methods are used to obtain 5′-DMT and 5′-DMT-3 ′ phosphoramidites.

2′- Fluorodeoxycytidine [00114] 2′-Deoxy-2′-fluorocytidine was synthesized via amination of 2′-deoxy-2′-fluorouridine followed by N4-benzoyl by selective protection. -2'-deoxy-2'-fluorocytidine is obtained. Standard methods are used to obtain 5′-DMT and 5′-DMT-3 ′ phosphoramidites.

2′-O- (2-methoxyethyl) modified amidite [00115] or as described in Martin, P. et al. , Helvetica Chimica Acta, 1995, 78, 486-504, to prepare a 2′-O-methoxyethyl substituted nucleoside amidite.

2,2′-anhydro [1- (beta-D-arabinofuranosyl) -5-methyluridine]
[00116] 5-Methyluridine (ribosythymine, Yamasa, commercially available through Isogo, Japan) (72.0 g, 0.279 M), diphenyl carbonate (90.0 g, 0.420 M) and sodium bicarbonate (2. 0 g, 0.024 M) is added to DMF (300 ml). The mixture is heated to reflux with stirring and the generated carbon dioxide gas is released in a controlled manner. After 1 hour, the slightly darkened solution is concentrated under reduced pressure. The resulting syrup is poured into diethyl ether (2.5 l) with stirring. The product formed a gum. The ether is decanted and the residue is dissolved in a minimum amount of methanol (approximately 400 ml). Pour the solution into fresh ether (2.5 l) to obtain a hard viscous material. The ether is decanted and the viscous material is dried in a vacuum oven (60 ° C., 1 mm Hg for 24 hours) to give a solid, which is ground to a light brown powder. The component is used as such for further reactions (or can be further purified by column chromatography using a gradient of methanol in ethyl acetate (10-25%) to give a white solid).

2′-O-methoxyethyl-5-methyluridine [00117] 2,2′-anhydro-5-methyluridine (195 g, 0.81 M), tris (2-methoxyethyl) borate (231 g, 0.98 M) and 2-Methoxyethanol (1.2 l) is added to a 2 l stainless steel pressure vessel and placed in an oil bath preheated to 160 ° C. After heating at 155-160 ° C. for 48 hours, the container is opened and the solution is evaporated to dryness and triturated with MeOH (200 ml). The residue is suspended in hot acetone (1 l). The insoluble salt is filtered, washed with acetone (150 ml) and the filtrate is evaporated. The residue (280 g) is dissolved in CH ₃ CN (600 ml) and evaporated. A silica gel column (3 kg) is packed in CH ₂ Cl ₂ / acetone / MeOH (20: 5: 3) containing 0.5% Et ₃ NH. The residue is dissolved in CH ₂ Cl ₂ (250 ml) and adsorbed onto silica (150 g) before loading onto the column. The product is eluted with packing solvent to give the title compound. It is also possible to obtain further components by reprocessing the impure fraction.

2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methyluridine [00118] 2′-O-methoxyethyl-5-methyluridine (160 g, 0.506 M) co-evaporated with pyridine (250 ml) And the dry residue is dissolved in pyridine (1.3 l). A first aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) is added and the mixture is stirred at room temperature for 1 hour. A second aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) is added and the reaction is stirred for an additional hour. Thereafter, methanol (170 ml) is added to stop the reaction. Evaporate the solvent and triturate with CH ₃ CN (200 ml). The residue is dissolved in CHCl (1.5 l) and extracted with 2 × 500 ml saturated NaHCO ₃ and 2 × 500 ml saturated NaCl. The organic phase is dried over Na ₂ SO ₄ , filtered and evaporated. The residue is purified on a 3.5 kg silica gel column packed and eluted with EtOAc / hexane / acetone (5: 5: 1) containing 0-5% Et ₃ NH. The pure fractions are evaporated to give the title product.

3′-O-acetyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methyluridine [00119] 2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methyluridine (106 g, 0.167 M), DMF / pyridine (3: 1 mixture prepared from 562 ml DMF and 188 ml pyridine, 750 ml) and acetic anhydride (24.38 ml, 0.258 M) and stirred at room temperature for 24 hours To do. The reaction is monitored by TLC by first adding MeOH to the TLC sample to quench the reaction. Upon completion of the reaction as judged by TLC, MeOH (50 ml) is added and the mixture is evaporated at 35 ° C. The residue is dissolved in CHCl ₃ (800 ml) and extracted with 2 × 200 ml saturated sodium bicarbonate and 2 × 200 ml saturated NaCl. The aqueous layer is back extracted with 200 ml CHCl ₃ . The combined organics are dried over sodium sulfate and evaporated to give a residue. The residue is purified on a 3.5 kg silica gel column and eluted with EtOAc / hexane (4: 1). The pure product fraction is evaporated to give the title compound.

3′-O-acetyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methyl-4-triazoleuridine [00120] CH ₃ CN (700 ml) with 3′-O-acetyl-2 ′ A first solution is prepared and set aside by dissolving -O-methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M). Triethylamine (189 ml, 1.44 M) is added to a solution of triazole (90 g, 1.3 M) in CH ₃ CN (1 l), cooled to −5 ° C., and 0.5 mL using an overhead stirrer. Stir for hours. POCl ₃ is added dropwise over 30 minutes to the stirred solution maintained at 0-10 ° C. and the resulting mixture is stirred for an additional 2 hours. The first solution is added dropwise to the latter solution over 45 minutes. Store the resulting reaction mixture in a cold room overnight. Filter the salt from the reaction mixture and evaporate the solution. The residue is dissolved in EtOAc (1 l) and the insoluble solid is removed by filtration. The filtrate is washed with 1 × 300 ml NaHCO ₃ and 2 × 300 ml saturated NaCl, dried over sodium sulphate and evaporated. EtOAc is added and the residue is triturated to give the title compound.

2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methylcytidine [00121] 3′-O-acetyl-2′-O-methoxyethyl in dioxane (500 ml) and NH ₄ OH (30 ml) A solution of −5′-O-dimethoxytrityl-5-methyl-4-triazoleuridine (103 g, 0.141 M) is stirred at room temperature for 2 hours. The dioxane solution is evaporated and the residue is azeotroped with MeOH (2 × 200 ml). The residue is dissolved in MeOH (300 ml) and transferred to a 2 liter stainless steel pressure vessel. MeOH (400 ml) saturated with NH ₃ gas is added and the vessel is heated to 100 ° C. for 2 h (TLC showed complete conversion). The vessel contents are evaporated to dryness and the residue is dissolved in EtOAc (500 ml) and washed once with saturated NaCl (200 ml). The organics are dried over sodium sulfate and the solvent is evaporated to give the title compound.

N4-benzoyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methylcytidine [00122] 2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methylcytidine (85 g, 0.134M) is dissolved in DMF (800 ml) and benzoic anhydride (37.2 g, 0.165 M) is added with stirring. After stirring for 3 hours, TLC showed the reaction was approximately 95% complete. The solvent is evaporated and the residue is azeotroped with MeOH (200 ml). The residue is dissolved in CHCl ₃ (700 ml) and extracted with saturated NaHCO ₃ (2 × 300 ml) and saturated NaCl (2 × 300 ml), dried over MgSO ₄ and evaporated to give a residue. Chromatograph the residue on a 1.5 kg silica column using EtOAc / hexane (1: 1) containing 0-5% Et ₃ NH as the eluting solvent. The pure product fraction is evaporated to give the title compound.

N4-benzoyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methylcytidine-3′-amidite [00123] N4-benzoyl-2′-O-methoxyethyl-5′-O-dimethoxy Trityl-5-methylcytidine (74 g, 0.10 M) is dissolved in CH ₂ Cl ₂ (1 l). Tetrazole diisopropylamine (7.1 g) and 2-cyanoethoxy-tetra (isopropyl) phosphite (40.5 ml, 0.123 M) are added with stirring under a nitrogen atmosphere. The resulting mixture is stirred at room temperature for 20 hours (TLC indicated the reaction was 95% complete). The reaction mixture is extracted with saturated NaHCO ₃ (1 × 300 ml) and saturated NaCl ( ₃ × 300 ml). The aqueous washings are back extracted with CH ₂ Cl ₂ (300 ml) and the extracts are combined, dried over MgSO ₄ and concentrated. The residue obtained is chromatographed on a 1.5 kg silica column using EtOAc / hexane (3: 1) as the eluting solvent. Pure fractions are combined to give the title compound.

2'-O- (aminooxyethyl) nucleoside amidites and 2'-O- (dimethylaminooxyethyl) nucleoside amidites
2 ′-(dimethylaminooxyethoxy) nucleoside amidite [00124] 2 ′-(dimethylaminooxyethoxy) nucleoside amidite [in the art, 2′-O- (dimethylaminooxyethyl), as described in the following paragraphs. ), Also known as a nucleoside amidite]. In the case of adenosine and cytidine, adenosine, cytidine and guanosine nucleoside amidites are prepared similarly to thymidine (5-methyluridine) except that the exocyclic amine is protected with a benzoyl moiety and in the case of guanosine with isobutyryl.

5'-O-tert-butyldiphenylsilyl ^-O 2-2'-anhydro-5-methyluridine ^[00125] O 2 -2'- anhydro-5-methyluridine (Pro. Bio. Sint., Italy Varese, 100.0 g, 0.4'6 mmol), dimethylaminopyridine (0.66 g, 0.013 eq, 0.0054 mmol) in dry pyridine (500 ml) under argon atmosphere and with mechanical stirring. Dissolves at temperature. tert-Butyldiphenylchlorosilane (125.8 g, 119.0 ml, 1.1 eq, 0.458 mmol) was added in one portion. The reaction is stirred at ambient temperature for 16 hours. TLC (Rf 0.22, ethyl acetate) showed complete reaction. Concentrate the solution under reduced pressure to a thick oil. This is partitioned between dichloromethane (1 l) and saturated sodium bicarbonate (2 × 1 l) and brine (1 l). The organic layer is dried over sodium sulfate and concentrated under reduced pressure to a thick oil. The oil is dissolved in a 1: 1 mixture of ethyl acetate and ethyl ether (600 ml) and the solution is cooled to -10 ° C. The resulting crystalline product is collected by filtration, washed with ethyl ether (3 × 200 ml) and dried (40 ° C., 1 mm Hg, 24 hours) to give a white solid.

A 5'-O-tert-butyldiphenylsilyl-2'-O- (2-hydroxyethyl) -5-methyluridine [00126] 2 l stainless steel non-stirred pressure reactor was charged with borane (1.0 M) in tetrahydrofuran. , 2.0 eq., 622 ml). Ethylene glycol (350 ml, excess) is added carefully, initially with stirring in a fume hood and manually until hydrogen gas evolution ceases. 5'-O-tert-butyldiphenylsilyl ^-O 2-2'-anhydro-5-methyluridine (149g, 0.3'1mol) and sodium bicarbonate (0.074 g, 0.003 eq), manually Add with stirring. The reactor is sealed and heated in an oil bath until the internal temperature reaches 160 ° C. and then maintained for 16 hours (pressure <100 psig). The reaction vessel is cooled to ambient temperature and opened. TLC (Rf 0.67 for the desired product, and Rf 0.82 for the ara-T byproduct, ethyl acetate) showed about 70% conversion of the product. To avoid further by-product formation, the reaction is stopped and concentrated in a hot water bath (40-100 ° C.) under reduced pressure (10-1 mm Hg) using more severe conditions to remove ethylene glycol. [Alternatively, when the low boiling solvent is gone, the remaining solution can be partitioned between ethyl acetate and water. The product will be in the organic phase. The residue is purified by column chromatography (2 kg silica gel, ethyl acetate-hexane gradient 1: 1 to 4: 1). Appropriate fractions are combined, stripped and dried to give the product as a white, hard foam, which is contaminated with starting components and pure reusable starting components.

2'-O-[(2-phthalimidooxy) ethyl] -5'-t-butyldiphenylsilyl-5-methyluridine [00127] 5'-O-tert-butyldiphenylsilyl-2'-O- (2- Hydroxyethyl) -5-methyluridine (20 g, 36.98 mmol) is mixed with triphenylphosphine (11.63 g, 44.36 mmol) and N-hydroxyphthalimide (7.24 g, 44.36 mmol). It is then dried for 2 days at 40 ° C. over P ₂ O ₅ under high vacuum. The reaction mixture is flushed with argon and dry THF (369.8 ml, Aldrich, true seal bottle) is added to give a clear solution. Diethyl-azodicarboxylate (6.98 ml, 44.36 mmol) is added dropwise to the reaction mixture. The addition rate is maintained so that the resulting crimson color disappears just prior to the addition of the next drop. After the addition is complete, the reaction is stirred for 4 hours. By that time, TLC showed complete reaction (ethyl acetate: hexane, 60:40). The solvent is evaporated in vacuum. The resulting residue was placed on a flash column and eluted with ethyl acetate: hexane (60:40) to give 2'-O-[(2-phthalimidooxy) ethyl] -5'-t-butyldiphenylsilyl as a white foam. -5-methyluridine is obtained.

5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy) ethyl] -5-methyluridine [00128] 2'-O-[(2-phthalimidooxy) ethyl]- 5′-t-butyldiphenylsilyl-5-methyluridine (3.1 g, 4.5 mmol) was dissolved in dry CH ₂ Cl ₂ (4.5 ml) and methyl hydrazine (300 ml, 4.64 mmol) was −10 Add dropwise, between 0 ° C and 0 ° C. After 1 hour, the mixture is filtered, the filtrate is washed with ice cold CH ₂ Cl ₂ and the combined organic phases are washed with water, brine and dried over anhydrous Na ₂ SO ₄ . The solution is concentrated to give 2′-O (aminooxyethyl) thymidine, which is then dissolved in MeOH (67.5 ml). To this is added formaldehyde (20% aqueous solution, w / w, 1.1 eq) and the resulting mixture is stirred for 1 hour. The solvent is removed in vacuo; the residue is chromatographed as a white foam with 5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy) ethyl] -5-methyluridine. Get.

5′-O-tert-butyldiphenylsilyl-2′-O— [N, N-dimethylaminooxyethyl] -5-methyluridine [00129] 5′-O-tert-butyldiphenylsilyl-2′-O— [(2-Formadoximinooxy) ethyl] -5-methyluridine (1.77 g, 3.12 mmol) is dissolved in a solution of 1 M pyridinium p-toluenesulfonate (PPTS) in dry MeOH (30.6 ml). . To this solution is added sodium cyanoborohydride (0.39 g, 6.13 mmol) at 10 ° C. under inert atmosphere. The reaction mixture is stirred at 10 ° C. for 10 minutes. The reaction vessel is then removed from the ice bath and stirred for 2 hours at room temperature, and the reaction is monitored by TLC (5% MeOH in CH ₂ Cl ₂ ). Add aqueous NaHCO ₃ solution (5%, 10 ml) and extract with ethyl acetate (2 × 20 ml). The ethyl acetate phase is dried over anhydrous Na ₂ SO ₄ and evaporated to dryness. The residue is dissolved in a solution of 1M PPTS in MeOH (30.6 ml). Formaldehyde (20% w / w, 30 ml, 3.37 mmol) is added and the reaction mixture is stirred at room temperature for 10 minutes. The reaction mixture is cooled to 10 ° C. in an ice bath, sodium cyanoborohydride (0.39 g, 6.13 mmol) is added and the reaction mixture is stirred at 10 ° C. for 10 minutes. After 10 minutes, the reaction mixture is removed from the ice bath and stirred for 2 hours at room temperature. To the reaction mixture is added 5% NaHCO ₃ (25 ml) solution and extracted with ethyl acetate (2 × 25 ml). The ethyl acetate layer is dried over anhydrous Na ₂ SO ₄ and evaporated to dryness. The resulting residue was purified by flash column chromatography, and _CH 2 and eluted with 5% MeOH in Cl _2, 5'-O-tert- butyldiphenylsilyl -2'-O- [N as a white foam, N -Dimethylaminooxyethyl] -5-methyluridine is obtained.

2′-O- (dimethylaminooxyethyl) -5-methyluridine [00130] triethylamine trihydrofluoride (3.91 ml, 24.0 mmol) was dried over THF and triethylamine (1.67 ml, 12 mmol, dried, KOH). Maintenance). This mixture of triethylamine-2HF was then added to 5'-O-tert-butyldiphenylsilyl-2'-O- [N, N-dimethylaminooxyethyl] -5-methyluridine (1.40 g, 2.4 mmol). And stir at room temperature for 24 hours. The reaction is monitored by TLC (5% MeOH in CH ₂ Cl ₂ ). The solvent was removed in vacuo and the residue was taken into a flash column and eluted with 10% MeOH in _CH 2 Cl _2, to obtain 2'-O- (dimethylamino-oxyethyl) -5-methyluridine.

5′-O-DMT-2′-O- (dimethylaminooxyethyl) -5-methyluridine [00131] 2′-O- (dimethylaminooxyethyl) -5-methyluridine (750 mg, 2.17 mmol). Dry overnight at 40 ° C. over P ₂ O ₅ under high vacuum. It is then coevaporated with anhydrous pyridine (20 ml). The resulting residue is dissolved in pyridine (11 ml) under an argon atmosphere. 4-Dimethylaminopyridine (26.5 mg, 2.60 mmol), 4,4′-dimethoxytrityl chloride (880 mg, 2.60 mmol) was added to the mixture and the reaction mixture was allowed to cool at room temperature until all starting components disappeared. Stir. Pyridine was removed under vacuum and the residue was chromatographed and eluted with 10% MeOH (containing a few drops of pyridine) in CH ₂ Cl ₂ to give 5′-O-DMT-2′-O. (Dimethylamino-oxyethyl) -5-methyluridine is obtained.

5′-O-DMT-2′-O- (2-N, N-dimethylaminooxyethyl) -5-methyluridine-3 ′-[(2-cyanoethyl) -N, N-diisopropyl phosphoramidite]
[00132] 5'-O-DMT-2'-O- (dimethylaminooxyethyl) -5-methyluridine (1.08 g, 1.67 mmol) is coevaporated with toluene (20 ml). To the residue is added N, N-diisopropylamine tetrazonide (0.29 g, 1.67 mmol) and dried over P ₂ O under high vacuum at 40 ° C. overnight. The reaction mixture is then dissolved in anhydrous acetonitrile (8.4 ml) and 2-cyanoethyl-N, N, N ¹ , N ¹ -tetraisopropyl phosphoramidite (2.12 ml, 6.08 mmol) is added. The reaction mixture is stirred for 4 hours at ambient temperature under an inert atmosphere. The reaction progress is monitored by TLC (hexane: ethyl acetate 1: 1). The solvent is evaporated, then the residue is dissolved in ethyl acetate (70 ml) and washed with 5% aqueous NaHCO ₃ (40 ml). The ethyl acetate layer is dried over anhydrous Na ₂ SO ₄ and concentrated. The residue obtained was chromatographed (eluent is ethyl acetate) and 5'-O-DMT-2'-O- (2-N, N-dimethylaminooxyethyl) -5-methyluridine-3 'as a foam. -[(2-cyanoethyl) -N, N-diisopropyl phosphoramidite] is obtained.

2 ′-(aminooxyethoxy) nucleoside amidites [00133] 2 ′-(aminooxyethoxy) nucleoside amidites [in the art 2′-O- (aminooxyethyl) nucleoside amidites Also known as]. Adenosine, cytidine and thymidine nucleoside amidites are prepared similarly.

N2-isobutyryl-6-O-diphenylcarbamoyl-2'-O- (2-ethylacetyl) -5'-O- (4,4'-dimethoxytrityl) guanosine-3 '-[(2-cyanoethyl) -N , N-diisopropyl phosphoramidite]
[00134] Selective 2'-O-alkylation of diaminopurine riboside can also provide 2'-O-aminooxyethyl guanosine analogs. Purchasing diaminopurine riboside in multigram quantities from Schering AG (Berlin) to provide 2'-O- (2-ethylacetyl) diaminopurine riboside containing a small amount of 3'-O-isomer. Is also possible. It is also possible to dissolve 2'-O- (2-ethylacetyl) diaminopurine riboside and convert it to 2'-O- (2-ethylacetyl) guanosine by treatment with adenosine deaminase (McGee, D.P.C., Cook, P.D., Guinosso, C.J., WO 94/02501 A1 940203). Standard protection methods include 2'-O- (2-ethylacetyl) -5'-O- (4,4'-dimethoxytrityl) guanosine and 2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-. It should yield O- (2-ethylacetyl) -5'-O- (4,4'-dimethoxytrityl) guanosine, which is reduced to 2-N-isobutyryl-6-O-diphenylcarbamoyl-2 It is also possible to provide '-O- (2-ethylacetyl) -5'-O- (4,4'-dimethoxytrityl) guanosine. As before, it is also possible to replace the hydroxyl group with N-hydroxyphthalimide via the Mitsunobu reaction, and the protected nucleoside is phosphitylated as usual to give 2-N-isobutyryl-6-O-diphenyl. Carbamoyl-2′-O- (2-ethylacetyl) -5′-O- (4,4′-dimethoxytrityl) guanosine-3 ′-[(2-cyanoethyl) -N, N-diisopropyl phosphoramidite] It is also possible to obtain.

2′-dimethylaminoethoxyethoxy (2′-DMAEOE) nucleoside amidite [00135] 2′-dimethylaminoethoxyethoxy nucleoside amidite (in the art 2′-O-dimethylaminoethoxyethyl, ie 2′-O—CH _{2 -O-CH 2 -N (CH} 2) 2, or also known) is prepared as follows as a 2'-DMAEOE nucleoside amidites. Other nucleoside amidites are prepared similarly.

2′-O- [2- (2-N, N-dimethylaminoethoxy) ethyl] -5-methyluridine [00136] 2 [2- (dimethylamino) ethoxy] in a 100 ml bomb with stirring Ethanol (Aldrich, 6.66 g, 50 mmol) is slowly added to a borane solution in tetrahydrofuran (1M, 10 ml, 10 mmol). Hydrogen gas is generated as the solid dissolves. O ² -2′-Anhydro-5-methyluridine (1.2 g, 5 mmol) and sodium bicarbonate (2.5 mg) are added and the bomb is sealed, placed in an oil bath and 155 ° C. for 26 hours. Heat. The bomb is cooled to room temperature and opened. The crude solution is concentrated and the residue is partitioned between water (200 ml) and hexane (200 ml). Excess phenol is extracted into the hexane layer. The aqueous layer is extracted with ethyl acetate (3 × 200 ml) and the combined organic layers are washed once with water, dried over anhydrous sodium sulfate and concentrated. The residue is columned on silica gel using methanol / methylene chloride 1:20 (with 2% triethylamine) as eluent. As the column fraction is concentrated, a colorless solid is formed and collected to give the title compound as a white solid.

5′-O-dimethoxytrityl-2′-O- [2 (2-N, N-dimethylaminoethoxy) ethyl] -5-methyluridine [00137] 2′-O- [2 in anhydrous pyridine (8 ml) (2-N, N-dimethylaminoethoxy) ethyl] -5-methyluridine (0.5 g, 1.3 mmol), triethylamine (0.36 ml) and dimethoxytrityl chloride (DMT-Cl, 0.87 g, 2 equivalents) And stir for 1 hour. The reaction mixture is poured into water (200 ml) and extracted with CH ₂ Cl ₂ ( ₂ × 200 ml). The combined CH ₂ Cl ₂ layers are washed with saturated NaHCO ₃ solution, then with saturated NaCl solution and dried over anhydrous sodium sulfate. After evaporation of the solvent, silica gel chromatography with MeOH: CH ₂ Cl ₂ : Et ₃ N (20: 1, v / v, containing 1% triethylamine) gives the title compound.

5′-O-dimethoxytrityl-2′-O- [2 (2-N, N-dimethylaminoethoxy) ethyl] -5-methyluridine-3′-O- (cyanoethyl-N, N-diisopropyl) phosphoro amidite [00138] under an argon _atmosphere, it was dissolved in _{CH 2 Cl 2 (20ml) 5'} -O- dimethoxytrityl -2'-O- [2 (2- N, N- dimethylamino) ethyl] -5 To a solution of methyluridine (2.17 g, 3 mmol) diisopropylaminotetrazolide (0.6 g) and 2-cyanoethoxy N, N-diisopropyl phosphoramidite (1.1 ml, 2 eq) are added. The reaction mixture is stirred overnight and the solvent is evaporated. The resulting residue is purified by silica gel flash column chromatography using ethyl acetate as eluent to give the title compound.

(Example 2)
Oligonucleotide Synthesis [00139] Synthesis of unsubstituted and substituted phosphodiester (P = O) oligonucleotides on an automated DNA synthesizer (Applied Biosystems model 380B) using standard phosphoramidite chemistry with oxidation by iodine. To do.

  [00140] Standard vin oxide exchanged with 0.2 M solution of 3H-1,2-benzodithiol-3-one 1,1-dioxide in acetonitrile for stepwise thiation of phosphite linkages. Otherwise, phosphorothioate (P = S) is synthesized in the same manner as the phosphodiester oligonucleotide. The thiolation waiting step is increased to 68 seconds, followed by a capping step. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55 ° C. (18 hours), the oligonucleotides are purified by precipitating twice from 2.5 M NaCl solution with 2.5 volumes of ethanol. Phosphinate oligonucleotides are prepared as described in US Pat. No. 5,508,270, incorporated herein.

[00141] Alkyl phosphonate oligonucleotides are prepared as described in US Pat. No. 4,469,863, incorporated herein.
[00142] 3'-deoxy-3'-methylene phosphonate oligonucleotides are prepared as described in US Pat. No. 5,610,289 or 5,625,050, incorporated herein by reference.

  [00143] Phosphoramidite oligonucleotides are prepared as described in US Pat. No. 5,256,775 or US Pat. No. 5,366,878, incorporated herein by reference.

  [00144] Alkylphosphonothioate oligonucleotides are prepared as described in WO 94/17093 and WO 94/02499, incorporated herein.

[00145] 3'-deoxy-3'-amino phosphoramidate oligonucleotides are prepared as described in US Pat. No. 5,476,925, incorporated herein by reference.
[00146] Phosphotriester oligonucleotides are prepared as described in US Pat. No. 5,023,243, incorporated herein by reference.

  [00147] Boranophosphate oligonucleotides are prepared as described in US Pat. Nos. 5,130,302 and 5,177,198, both incorporated herein.

(Example 3)
Oligonucleoside Synthesis [00148] Methylenemethylimino-linked oligonucleosides are also identified as MMI-linked oligonucleosides, methylenedimethylhydrazo-linked oligonucleosides, and are also identified as MDH-linked oligonucleosides and methylenecarbonylamino-linked oligonucleosides, and amide- Identified as a tri-linked oligonucleoside and a methyleneaminocarbonyl-linked oligonucleoside, also identified as an amide-4-linked oligonucleoside, but with the oligonucleoside, for example, alternately with MMI and P = O or P = S linkages. US Pat. Nos. 5,378,825; 5,386,023; 5,489,677; 5,602,240; and 5, which are all incorporated herein by reference. It is prepared to be described 10,289.

  [00149] Form acetal and thioform acetal linked oligonucleosides are prepared as described in US Pat. Nos. 5,264,562 and 5,264,564, incorporated herein by reference.

  [00150] Ethylene oxide linked oligonucleosides are prepared as described in US Pat. No. 5,223,618, incorporated herein.

Example 4
PNA Synthesis [00151] Peptide Nucleic Acids (PNA): Synthesis, Properties and Potential Applications, Bioorganic & Medicinal Chemistry, 1996, 523 . They can also be prepared according to US Pat. Nos. 5,539,082; 5,700,922; and 5,719,262, incorporated herein by reference.

(Example 5)
Synthesis of Chimeric Oligonucleotides [00152] The chimeric oligonucleotides, oligonucleosides or mixed oligonucleotides / oligonucleosides of the present invention can be of several different types. These include a first type in which the “gap” segment of the linking nucleoside is located between the 5 ′ and 3 ′ “wing” segments of the linking nucleoside, and the “gap” segment is an oligomeric compound A second “open end” type located at either the 3 ′ end or the 5 ′ end is included. The first type of oligonucleotide is also known in the art as a “gapmer” or gapped oligonucleotide. The second type of oligonucleotide is also known in the art as “hemimer” or “wingmer”.

[2'-O-Me]-[2'-deoxy]-[2'-O-Me] chimeric phosphorothioate oligonucleotide [00153] As described above, using an Applied Biosystems automated DNA synthesizer, model 380B , 2′-O-alkyl phosphorothioate and 2′-deoxy phosphorothioate oligonucleotide segments are synthesized. Automated synthesizer, and 2'-deoxy-5'-dimethoxytrityl-3'-O-phosphoramidite for DNA moieties, and 5'-dimethoxytrityl-2'-O for 5 'and 3' wings -Oligonucleotides are synthesized using methyl-3'-O-phosphoramidite. The standard synthesis cycle is modified by increasing the waiting step after delivery of tetrazole and base by 4 repetitions of 600 seconds for RNA and 2 for 2′-O-methyl. The fully protected oligonucleotide is cleaved from the support and the phosphate group is deprotected in 3: 1 ammonia / ethanol at room temperature overnight and then lyophilized. Thereafter, in order to deprotect all the bases, it is treated in methanolic ammonia for 24 hours at room temperature and the sample is lyophilized again. Resuspend the pellet in 1M TBAF in THF at room temperature for 24 hours to deprotect the 2 'position. The reaction is then stopped with 1M TEAA, and the sample is then reduced to 1/2 volume by rotovac before desalting on a G25 size exclusion column. The recovered oligo is then analyzed spectrophotometrically for yield and purity, by capillary electrophoresis, and by mass spectrometry.

[2'-O- (2-methoxyethyl)]-[2'-deoxy]-[2'-O- (methoxyethyl)] chimeric phosphorothioate oligonucleotide [00154] Instead of 2'-O-methylamidite In accordance with the method described above for 2′-O-methyl chimeric oligonucleotides, with substitution of phosphorothioate oligonucleotides prepared using 2′-O- (methoxyethyl) amidite in [2′-O- (2- Methoxyethyl)]-[2'-deoxy]-[-2'-O- (methoxyethyl)] chimeric phosphorothioate oligonucleotides are prepared.

[2'-O- (2-methoxyethyl) phosphodiester]-[2'-deoxyphosphorothioate]-[2'-O- (2-methoxyethyl) phosphodiester] chimeric oligonucleotide [00155] 2'- Using 2'-O- (methoxyethyl) amidite instead of O-methylamidite, oxidized with iodine to produce a phosphodiester internucleotide linkage in the wing portion of the chimeric structure, and 3, H-1,2 -Sulfidation utilizing benzodithiol-3-one 1,1-dioxide (Beaucage Reagent) to produce a phosphorothioate internucleotide linkage in the central gap as described above for 2'-O-methyl chimeric oligonucleotides According to the method, [2′-O- (2-methoxyethyl phosphodiester] - [2'-deoxy phosphorothioate] - preparing [2'-O-(methoxyethyl) phosphodiester] chimeric oligonucleotides.

  [00156] Other chimeric oligonucleotides, chimeric oligonucleotides and mixed chimeric oligonucleotides / oligonucleosides are synthesized according to US Pat. No. 5,623,065, incorporated herein.

(Example 6)
Oligonucleotide isolation [001574] After cutting from a controlled pore glass column (Applied Biosystems) and deblocking in concentrated ammonium hydroxide at 55 ° C. for 18 hours, then using 2.5 volumes of ethanol, 0.5 M NaCl The oligonucleotide or oligonucleoside is purified by two precipitations from. The synthesized oligonucleotide is analyzed by polyacrylamide gel electrophoresis on a denaturing gel and judged to be at least 85% full length component. The relative amounts of phosphorothioate and phosphodiester linkages obtained in the synthesis are regularly confirmed by “P nuclear magnetic resonance spectroscopy, and in some studies, Chiang et al., J. Biol. Chem. 1991, 266, 18162 The oligonucleotide is purified by HPLC as described in 18171.

(Example 7)
Oligonucleotide synthesis-96 well plate format [00158] Oligonucleotides via solid phase P (III) phosphoramidite chemistry on an automated synthesizer capable of simultaneously assembling 96 sequences in a standard 96 well format. Synthesize nucleotides. Oxidation with aqueous iodine provides the phosphodiester internucleotide linkage. Phosphorothioate internucleotide linkages are generated by sulfurization using 3, H-1,2, benzodithiol-3-one 1,1-dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard base-protected beta-cyanoethyldiisopropyl phosphoramidites can also be purchased from commercial vendors (eg, PE-Applied Biosystems, Foster City, Calif., Or Pharmacia, Piscataway, NJ). Non-standard nucleosides are synthesized according to known literature or patent methods. These are utilized as base-protected beta cyanoethyldiisopropyl phosphoramidites.

[00159] Oligonucleotides are cleaved from the support and deprotected for 12-16 hours at elevated temperature (55-60 ° C) with concentrated NH ₄ OH and then the freed product is dried in vacuo Let The dried product is then resuspended in sterile water to obtain a master plate from which all analysis and test plate samples are then diluted using a robotic pipettor.

(Example 8)
Oligonucleotide analysis-96 well plate format [00160] Oligonucleotide concentration in each well is assessed by sample dilution and UV absorption spectroscopy. Individually by capillary electrophoresis (CE) in 96-well format (Beckman P / ACE ^™ MDQ) or, for individually prepared samples, on a commercial CE instrument (eg Beckman P / ACE ^™ 5000, ABI 270) Assess the integrity of the product. The base and backbone composition is confirmed by mass analysis of the compound using electrospray mass spectrometry. Dilute all assay test plates from the master plate using single and multi-channel robotic pipettors. A plate is deemed acceptable if at least 85% of the compounds on the plate are at least 85% full length.

Example 9
Cell culture and oligonucleotide treatment [00161] The effect of antisense compounds on target nucleic acid expression can be tested in any of a variety of cell types as long as the target nucleic acid is present at measurable levels. This can also be routinely measured using, for example, PCR or Northern blot analysis. The following six cell types are provided for illustrative purposes, but other cell types can be routinely used as long as the target is expressed in the selected cell type. It can also be routinely measured by methods routine in the art, such as Northern blot analysis, ribonuclease protection assay, or RT-PCR.

T-24 cells:
[00162] Human transitional epithelial bladder cancer cell line T-24 is obtained from American Type Culture Collection (ATCC) (Manassas, VA). Completely supplemented with 10% fetal calf serum (Gibco / Life Technologies, Geysersburg, MD), penicillin 100 units / ml, and streptomycin 100 micrograms / ml (Gibco / Life Technologies, Geysersburg, MD) T-24 cells are routinely cultured in McCoy's 5A basal medium (Gibco / Life Technologies, Geysersburg, MD). When cells reach 90% confluence, they are routinely passaged by trypsinization and dilution. For use in RT-PCR analysis, cells are seeded in 96-well plates (Falcon-Primaria # 3872) at a density of 7000 cells / well.

  [00163] For Northern blotting or other analyses, cells can be plated on 100 mm or other standard tissue culture plates and treated similarly using appropriate volumes of media and oligonucleotides.

A549 cells:
[00164] Human lung cancer cell line A549 can also be obtained from the American Type Culture Collection (ATCC) (Manassas, VA). DMEM supplemented with 10% fetal bovine serum (Gibco / Life Technologies, Geysersburg, MD), penicillin 100 units / ml, and streptomycin 100 micrograms / ml (Gibco / Life Technologies, Geysersburg, MD) A549 cells are routinely cultured in basal media (Gibco / Life Technologies, Geysersburg, MD). When cells reach 90% confluence, they are routinely passaged by trypsinization and dilution.

NHDF cells:
[00165] Human newborn dermal fibroblasts (NHDF) can also be obtained from Clonetics Corporation (Walkersville, MD). NHDF is routinely maintained in fibroblast growth medium (Clonetics Corporation, Walkersville, MD) supplemented as recommended by the supplier. Cells are maintained for up to 10 passages as recommended by the supplier.

HEK cells:
[00166] Human embryonic keratinocytes (HEK) can also be obtained from Clonetics Corporation (Walkersville, MD). HEK is routinely maintained in keratinocyte growth medium (Clonetics Corporation, Walkersville, MD) formulated as recommended by the supplier. Cells are routinely maintained for up to 10 passages as recommended by the supplier.

MCF-7 cells:
[00167] The human breast cancer cell line MCF-7 is obtained from the American Type Culture Collection (Manassas, VA). MCF-7 cells are routinely cultured in DMEM low glucose (Gibco / Life Technologies, Geysersburg, MD) supplemented with 10% fetal bovine serum (Gibco / Life Technologies, Geysersburg, MD). To do. When cells reach 90% confluence, they are routinely passaged by trypsinization and dilution. For use in RT-PCR analysis, cells are seeded in 96-well plates (Falcon-Primaria # 3872) at a density of 7000 cells / well.

  [00168] For Northern blotting or other analyses, cells can be plated on 100 mm or other standard tissue culture plates and treated similarly using appropriate volumes of media and oligonucleotides.

LA4 cells:
[00169] The mouse lung epithelial cell line LA4 is obtained from the American Type Culture Collection (Manassas, VA). LA4 cells are routinely cultured in F12K medium (Gibco / Life Technologies, Geysersburg, MD) supplemented with 15% fetal calf serum (Gibco / Life Technologies, Geysersburg, MD). When cells reach 90% confluence, they are routinely passaged by trypsinization and dilution. For use in RT-PCR analysis, cells are seeded in 96-well plates (Falcon-Primaria # 3872) at a density of 3000-6000 cells / well.

  [00170] For Northern blotting or other analyses, cells can be plated on 100 mm or other standard tissue culture plates and treated similarly using appropriate volumes of media and oligonucleotides.

Treatment with antisense compounds:
[00171] When cells reach 80% confluence, they are treated with oligonucleotides. For cells grown in 96-well plates, the wells are washed once with 200 μl OPTI-MEM ^tm −1 serum reduction medium (Gibco BRL) and then 3.75 μg / ml LIPOFECTIN ^™ (Gibco BRL) and containing the desired concentration of oligonucleotide is treated with ^OPTI-MEMTM TM -1 of 130 [mu] l. After 4-7 hours of treatment, the medium is replaced with fresh medium. Cells are harvested 16-24 hours after oligonucleotide treatment.

  [00172] The concentration of oligonucleotide used varies between cell lines. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a range of positive control oligonucleotides.

(Example 10)
Analysis of oligonucleotide inhibition of Nav1.3 expression [00173] Antisense modulation of Nav1.3 expression can also be assayed by a variety of methods known in the art. For example, Nav1.3 mRNA levels can be quantified by Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Real-time quantitative PCR is currently preferred. RNA analysis can also be performed on total cellular RNA or poly (A) + mRNA. RNA isolation methods are described, for example, in Ausubel, F .; M.M. Et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.1.1-4.2.9 and 4.5.1-1.5.3, John Wiley & Sons, Inc. , 1993. Northern blot analysis is routine in the art and is described, for example, in Ausubel, F .; M.M. Et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.2.1-4.2.9, John Wiley & Sons, Inc. , 1996. PE-Applied Biosystems, available from Foster City, Calif., And used in accordance with the manufacturer's instructions, preferably achieves real-time quantitative PCR using a commercially available ABI PRISM ^™ 7700 sequence detection system It is also possible to do. Prior to quantitative PCR analysis, primer-probe sets specific for the target gene to be measured are evaluated for their ability to “multiplex” with the GAPDH amplification reaction. When multiplexed, both the target gene and the internal standard gene GAPDH are amplified simultaneously in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of a primer-probe set specific for GAPDH only, target gene only ("single-plexing"), or both (multiplexing). After PCR amplification, standard curves of GAPDH signal and target mRNA signal as a function of dilution are generated from both singulated and multiplexed samples. If both the GAPDH signal generated from the multiplexed sample and the slope and correlation coefficient of the target signal are within 10% of the corresponding value generated from the singulated sample, then the target-specific primer-probe set is Is considered to be multiplexable. Other methods of PCR are also known in the art.

  [00174] Nav1.3 protein levels can also be quantified by various methods well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), ELISA or fluorescence activated cell sorting (FACS) It is. Antibodies directed against Nav1.3 can be identified and obtained from a variety of sources, such as the MSRS antibody catalog (Aerie Corporation, Birmingham, Mich.), Or via conventional antibody generation methods It is also possible to prepare them. Methods for preparing polyclonal antisera are described, for example, in Ausubel, F .; M.M. Et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.11.2.9, John Wiley & Sons, Inc. , 1997. Preparation of monoclonal antibodies is described, for example, in Ausubel, F .; M.M. Et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.4.1-11.11.5, John Wiley & Sons, Inc. , 1997.

  [00175] Immunoprecipitation is standard in the art and is described, for example, in Ausubel, F .; M.M. Et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.110.16.11, John Wiley & Sons, Inc. , 1998. Western blot (immunoblot) analysis is standard in the art and is described, for example, in Ausubel, F .; M.M. Et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1-10.8.21, John Wiley & Sons, Inc. , 1997. Enzyme linked immunosorbent assays (ELISAs) are standard in the art and are described, for example, in Ausubel, F., et al. M.M. Et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley & Sons, Inc. , 1991.

(Example 11)
Poly (A) + mRNA isolation [00176] Miura et al., Clin. Chem. , 1996, 42, 1758-1764, poly (A) + mRNA is isolated. Other methods for poly (A) + mRNA isolation are described, for example, in Ausubel, F .; M.M. Et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.5.1-4.5.3, John Wiley & Sons, Inc. , 1993. Briefly, for cells grown on 96-well plates, the growth medium is removed from the cells and each well is washed with 200 μl cold PBS. 60 μl of lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) is added to each well and the plate gently Stir and then incubate for 5 minutes at room temperature. Transfer 55 μl of lysate to a 96-well plate (AGCT Inc., Irvine, Calif.) Coated with oligo d (T). Plates are incubated for 60 minutes at room temperature and washed 3 times with 200 μl wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl). After the last wash, blot the plate moisture on a paper towel to remove excess wash buffer and then air dry for 5 minutes. 60 pl of elution buffer (5 mM Tris-HCl, pH 7.6) pre-heated to 70 ° C. is added to each well, the plate is incubated on a 90 ° C. hot plate for 5 minutes, and the eluate is then freshly added. Transfer to a clean 96-well plate.

  [00177] Cells grown on 100 mm or other standard plates can be similarly treated using all solutions in appropriate volumes.

(Example 12)
Total RNA isolation [00178] Qiagen Inc. Total mRNA is isolated using the RNEASY 96 ^™ kit and buffer purchased from (Valencia, Calif.) According to the manufacturer's recommended method. Briefly, for cells grown on 96-well plates, the growth medium is removed from the cells and each well is washed with 200 μl cold PBS. 100 μl Buffer RLT is added to each well and the plate is vortexed vigorously for 20 seconds. The contents are then mixed by adding 100 μl of 70% ethanol to each well and pipetting up and down 3 times. The sample was then transferred to an RNEASY 96 ^TM well plate connected to a QIAVAC ^TM manifold fitted with a waste water collection tray and a vacuum source was attached. Apply vacuum for 15 seconds. 1 ml of buffer RW1 is added to each well of the RNEASY 96 ^™ plate and the vacuum is again applied for 15 seconds. Thereafter, 1 ml of Buffer RPE is added to each well of the RNEASY 96 ^™ plate and a vacuum is applied for 15 seconds. The buffer RPE wash is then repeated and a vacuum is applied for an additional 10 minutes. The plate is then removed from the QIAVAC ^TM manifold and blotted with a paper towel. The plate is then connected again to the QIAVAC ^™ manifold fitted with a collection tube rack containing 1.2 ml collection tubes. The RNA is then diluted by pipetting 60 μl of water into each well, incubating for 1 minute, and then applying a vacuum for 30 seconds. Repeat the elution step with an additional 60 μl of water.

  [00179] QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia, Calif.) Can be used to automate repetitive pipetting and elution steps. In essence, after lysing the cells on the culture plate, the plate is transferred to a robot deck where the pipetting, DNase treatment and elution steps are performed.

(Example 13)
Follow the instructions of the real-time quantitative PCR analysis of Nav1.3 mRNA levels [00180] Manufacturer, ABI ^PRISM TM 7700 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) by using a real-time quantitative PCR, NAV1. 3 Measure the amount of mRNA levels. This is a fluorescence detection system that is not based on a closed-tube gel, allowing high-throughput quantification of polymerase chain reaction (PCR) products in real time. In contrast to standard PCR, where amplification products are quantified after completion of PCR, the products of real-time quantitative PCR are quantified as they accumulate. This is accomplished by including an oligonucleotide probe that specifically anneals between the forward and reverse PCR primers and contains two fluorescent dyes during the PCR reaction. A reporter dye (eg, JOE, FAM ^™ , or VIC, obtained from either Operon Technologies Inc., Alameda, Calif., Or PE-Applied Biosystems, Foster City, Calif.) Is attached to the 5 ′ end of the probe, and A quenching dye (eg, TAMRA, obtained from either Operon Technologies Inc., Alameda, Calif., Or PE-Applied Biosystems, Foster City, Calif.) Is attached to the 3 ′ end of the probe. If the probe and dye are intact, reporter dye emission is quenched by the proximity of the 3 ′ quenching dye. During amplification, the probe anneals to the target sequence, generating a substrate that can be cleaved by the 5′-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the reporter dye from the remaining probe (and thus from the quencher moiety) and a sequence-specific fluorescent signal is generated. At each cycle, additional reporter dye molecules are cleaved from each probe and the fluorescence intensity is monitored at regular intervals by laser optics attached to the ABI PRISM ^™ 7700 sequence detection system. In each assay, a series of parallel reactions containing serial dilutions of mRNA from an untreated control sample generate a standard curve that is used to quantify the percent inhibition after antisense oligonucleotide treatment of the test sample.

[00181] PCR reagents can also be obtained from PE-Applied Biosystems, Foster City, CA. 25 μl PCR cocktail (1 × TAQMAN ^™ buffer A, 5.5 mM MgCl ₂ , 300 μM each dATP, dCTP and dGTP, 600 μM dUTP, each 100 nM forward primer, reverse primer, and probe, 20 units RNase inhibition The RT-PCR reaction is performed by adding the agent, 1.25 units AMPLITAQ GOLD ^™ , and 12.5 units MuLV reverse transcriptase) to a 96 well plate containing 25 μl of poly (A) mRNA solution. . The RT reaction is performed by incubating for 30 minutes at 48 ° C. Incubate at 95 ° C. for 10 minutes to activate AMPLITAQ GOLD ^™ , followed by 40 cycles of two-step PCR protocol: 15 seconds at 95 ° C. (denaturation) followed by 1.5 minutes at 60 ° C. (annealing / extension) ).

[00182] Probes and primers for human Nav1.3 to hybridize to human Nav1.3 sequences using published sequence information (GenBank accession number NM_006922, incorporated herein as FIG. 1) Designed. For human Nav1.3, the PCR primers are: forward primer: TTGACTTTGTGGTGGTGTATTCTCT (SEQ ID NO: 9097), reverse primer: CGTAGGATTCGGCCAATCCCT (SEQ ID NO: 9098), and the PCR probe is: FAM-ACCTGTTCCGAGTGATCTCTGTCTG Where FAM ^™ (PE-Applied Biosystems, Foster City, Calif.) Is a fluorescent reporter dye and TAMRA (PE-Applied Biosystems, Foster City, Calif.) Is a quenching dye. For human cyclophilin, the PCR primers are: forward primer: CCCACCGTGTTCTCTGCAT (SEQ ID NO: 9100), reverse primer: TTTCTGCTGTCTTTGGGACCTT (SEQ ID NO: 9101), and the PCR probe is: 5'JOE-CGCGTCTCCTTTGAGCTGTT102 (SEQ ID NO: 9100) -TAMRA 3 'where JOE (PE-Applied Biosystems, Foster City, CA) is a fluorescent reporter dye and TAMRA (PE-Applied Biosystems, Foster City, CA) is a quenching dye.

(Example 14)
Antisense inhibition of human Nav1.3 expression by chimeric phosphorothioate oligonucleotides with 2′-MOE wings and deoxy gaps [00183] In accordance with the present invention, using the published sequence (NM — 006922) incorporated herein as FIG. Design a series of oligonucleotides that target different regions of human Nav1.3 RNA. The oligonucleotides are shown in Table 1. “Position” indicates the first (most 5 ′) nucleotide number on the particular target sequence to which the oligonucleotide binds. The parameters shown for each oligo are David H. et al. Mathews, Michael Zuker, and Douglas H.M. Predicted using Turner RNAstructure 3.7. All of the compounds in Table 1 are composed of a central “gap” region of 10 2 ′ deoxynucleotides, 20 nucleotides in length, flanked by 4 nucleotide “wings” on either side (5 ′ and 3 ′ directions). A chimeric oligonucleotide ("gapmer"). The wing is composed of 2'-methoxyethyl (2'-MOE) nucleotides. The internucleoside (backbone) linkage is phosphorothioate (P = S) throughout the oligonucleotide. The cytidine residue in the 2'-MOE wing is 5-methylcytidine. All cytidine residues are 5-methylcytidine.

(Example 15)
Western blot analysis of Nav1.3 protein levels [00184] Western blot analysis (immunoblot analysis) is performed using standard methods. After treatment with oligonucleotide for 16-20 hours, cells are harvested, washed once with PBS, suspended in Laemmli buffer (100 μl / well), boiled for 5 minutes, and loaded onto a 4% SDS-PAGE gel. . The gel is run at 150V for 1.5 hours and transferred to a membrane for Western blotting. An appropriate primary antibody directed against Nav1.3 is used together with a radiolabeled or fluorescently labeled secondary antibody directed against the primary antibody species. The bands are visualized using PHOSPHORIMAGER ^™ (Molecular Dynamics, Sunnyvale, Calif.).

Published sequence information (GenBank deposit number NM 006922) Published sequence information (GenBank deposit number NM 006922) Published sequence information (GenBank deposit number NM 006922) Published sequence information (GenBank deposit number NM 006922) Published sequence information (GenBank deposit number NM 006922) Published sequence information (GenBank deposit number NM 006922) Published sequence information (GenBank deposit number NM 006922) Published sequence information (GenBank deposit number NM 006922) Published sequence information (GenBank deposit number NM 006922) Published sequence information (GenBank deposit number NM 006922)

Claims (21)

  An antisense compound that targets a nucleic acid molecule that encodes Nav1.3, wherein the antisense compound specifically hybridizes with Nav1.3 and inhibits expression of Nav1.3.   An antisense compound of 8 to 30 nucleobases in length that targets a nucleic acid molecule encoding Nav1.3, wherein the antisense compound specifically hybridizes with Nav1.3 and causes expression of Nav1.3 Said antisense compound that inhibits.   The antisense compound according to claim 2, wherein the antisense compound is an antisense oligonucleotide.   The antisense compound of claim 3, comprising a nucleic acid sequence selected from the group consisting of at least 8 contiguous bases of SEQ ID NO: 1 to SEQ ID NO: 9094.   The antisense compound of claim 3, comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 9094.   The antisense compound of claim 2, 3, 4, or 5, wherein the antisense oligonucleotide comprises at least one modified internucleoside linkage.   7. The antisense compound of claim 6, wherein the modified internucleoside linkage is a phosphorothioate linkage.   6. An antisense compound according to claim 2, 3, 4 or 5, wherein the antisense oligonucleotide comprises at least one modified sugar moiety.   The antisense compound of claim 8, wherein the modified sugar moiety is a 2'-O-methoxyethyl sugar moiety.   The antisense compound of claim 2, 3, 4, or 5, wherein the antisense oligonucleotide comprises at least one modified nucleobase.   The antisense compound of claim 10, wherein the modified nucleobase is 5-methylcytosine.   The antisense compound according to claim 2, 3, 4, or 5, wherein the antisense oligonucleotide is a chimeric oligonucleotide.   A composition comprising the antisense compound of claim 2 and a pharmaceutically acceptable carrier or diluent.   14. The composition of claim 13, further comprising a colloidal dispersion system.   14. The composition of claim 13, wherein the antisense compound is an antisense oligonucleotide.   A method of inhibiting the expression of Nav1.3 in a cell or tissue comprising contacting the cell or tissue with an antisense compound according to claim 2 such that the expression of Nav1.3 is inhibited. Said method.   A method of treating a human having a disease or condition associated with Nav1.3, wherein the animal has a therapeutically or prophylactically effective amount of anti-antibodies according to claim 2 such that expression of Nav1.3 is inhibited. Said method comprising administering a sense compound.   Disease or condition is neuropathic pain, postherpetic neuralgia, chronic pain, low back pain, diabetic neuropathy, trigeminal neuropathy, arthritic pain, acute pain, burn pain, migraine, cluster headache, mild 18. The method of claim 17, wherein the pain is including but not limited to moderate headache.   19. A method according to claim 18, wherein the disease or condition is a seizure disorder.   18. The method of claim 17, wherein the disease or condition is a pediatric seizure disorder including but not limited to neonatal or infantile epilepsy.   18. A method according to claim 17, wherein the disease or condition is ataxia.

Images