EP1578927A2 - Antisense modulation of nav1.3 expression - Google Patents

Antisense modulation of nav1.3 expression

Info

Publication number
EP1578927A2
EP1578927A2 EP03749047A EP03749047A EP1578927A2 EP 1578927 A2 EP1578927 A2 EP 1578927A2 EP 03749047 A EP03749047 A EP 03749047A EP 03749047 A EP03749047 A EP 03749047A EP 1578927 A2 EP1578927 A2 EP 1578927A2
Authority
EP
European Patent Office
Prior art keywords
seq
kcal
mol
acid
antisense
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03749047A
Other languages
German (de)
French (fr)
Inventor
Steven L. Roberds
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pharmacia LLC
Original Assignee
Pharmacia LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pharmacia LLC filed Critical Pharmacia LLC
Publication of EP1578927A2 publication Critical patent/EP1578927A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/02Drugs for disorders of the nervous system for peripheral neuropathies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/04Centrally acting analgesics, e.g. opioids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/06Antimigraine agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/08Antiepileptics; Anticonvulsants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/18Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02PCLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00Technologies relating to chemical industry
    • Y02P20/50Improvements relating to the production of bulk chemicals
    • Y02P20/582Recycling of unreacted starting or intermediate materials

Definitions

  • the present invention provides compositions and methods for modulating the expression of Type III sodium channel (Navl.3).
  • this invention relates to antisense compounds, particularly oligonucleotides, specifically hybridizable with nucleic acids encoding Type III sodium channel (Navl.3). Such oligonucleotides have been shown to modulate the expression of Type III sodium channel (Navl.3).
  • Voltage-dependent sodium channels play a fundamental role in controlling neuronal membrane excitability. They are responsible for the upstroke of the action potential in neurons. Neuropathic pain is considered to be the result of injured and/or remodeled neurons, which exhibit an increase in excitability in both primary afferent fibers and synaptic contacts within the central pain processing pathway.
  • sodium channel blockers include carbamazepine, lamotrigine, and phenytoin.
  • lidocaine another sodium channel blocker, was recently approved for treatment of certain types of neuropathic pain.
  • sodium channel blockers are currently the treatment of choice for neuropathic pain, they have been only moderately successful in treating these conditions.
  • a primary factor in the weak efficacy of these compounds is their lack of selectivity and low affinity for the various sodium channels resulting in numerous side effects including emesis, dizziness, ataxia, and cardiotoxicity.
  • Many recent efforts have been focused on defining and describing which sodium channels are actively involved in the development and maintenance of neuropathic pain.
  • the alpha subunit is the pore forming subunit and to date, 11 alpha subunits have been identified including 7 neuronal, 2 glial, 1 muscular, 1 cardiac subunit.
  • the alpha subunits can be divided into three classes based on their sensitivity to tetrodotoxin (TTX): TTX sensitive (TTXs), TTX resistant (TTXr), and TTX insensitive (TTXi).
  • TTXs channels are sensitive to TTX in the nanomolar range, have a low threshold for activation and rapid inactivation kinetics. These channels include the skeletal muscle channel, two channels that are found primarily in peripheral neurons and all brain type channels described thus far. [004] Recent reports have suggested that the type III sodium channel
  • Navl.3 may also be involved in neuropathic pain development and maintenance. This particular channel is found in brain, peripheral nerve and, neuroendocrine cells. Critically, it is absent from heart and many other peripheral organs.
  • the mRNA for Navl .3 increases in small and large DRG neurons following axotomy in animal models (Dib-Hajj S, et al, Proc.Natl. Acad. Sci. 1996; 93:14950-14954), suggesting its involvement in neuropathic pain.
  • peripheral nerve damage produced a large increase in the expression of a tetrodotoxin (TTX)- sensitive Navl .3 sodium channel (Boucher TJ, et al, Science 2000; 290: 124- 127) They also replicated past experiments from several labs establishing that the development of neuropathic pain is linked to increased spontaneous activity following nerve damage and that this ectopic activity is sensitive to TTX. Finally, the study from Wood's group also found that glial-derived neurotrophic factor (GDNF) prevented the induction of Navl .3, reduced the spontaneous activity of the injured nerve, thus preventing the resulting neuropathic pain.
  • GDNF glial-derived neurotrophic factor
  • TTX- sensitive sodium channels and in particular Navl.3, as having a role in the development and maintenance of neuropathic pain that follows nerve damage.
  • Navl.3 Type III sodium channel
  • antisense technology could specifically target neonatal vs. adult forms of Navl .3.
  • Exon 6 of the Navl .3 gene is alternatively spliced in humans (Lu C-M, Brown GB. J. Mol. Neurosci. 1988; 10:67-70) and rodents (Gustafson TA, et al. J. Biol. Chem.
  • exon 6 sequences are very similar, differing by only a single amino acid at the protein level, but they could be targeted individually by sequence-specific antisense oligonucleotides. This could be useful in the treatment of certain pediatric disorders, such as neonatal, infantile, or childhood epilepsies.
  • Antisense technology is emerging as an effective means for reducing the expression of specific gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of Navl.3 expression.
  • the present invention is directed to antisense compounds, particularly oligonucleotides, which are targeted to a nucleic acid encoding Navl.3, and which modulate the expression of Navl.3.
  • Pharmaceutical and other compositions comprising the antisense compounds of the invention are also provided. Further provided are methods of modulating the expression of Navl .3 in cells or tissues comprising contacting said cells or tissues with one or more of the antisense compounds or compositions of the invention. Further provided are methods of treating an animal, particularly a human, suspected of having or being prone to a disease or condition associated with expression of Navl.3 by administering a therapeutically or prophylactically effective amount of one or more of the antisense compounds or compositions of the invention.
  • the present invention employs oligomeric antisense compounds, particularly oligonucleotides, for use in modulating the function of nucleic acid molecules encoding Navl.3, ultimately modulating the amount of Navl .3 produced. This is accomplished by providing antisense compounds, which specifically hybridize with one or more nucleic acids encoding Navl.3.
  • target nucleic acid and “nucleic acid encoding Navl .3” encompass DNA encoding Navl .3, RNA (including pre- mRNA and mRNA) transcribed from such DNA, and also cDNA derived from such RNA.
  • the specific hybridization of an oligomeric compound with its target nucleic acid interferes with the normal function of the nucleic acid.
  • This modulation of function of a target nucleic acid by compounds, which specifically hybridize to it, is generally referred to as "antisense".
  • the functions of DNA to be interfered with include replication and transcription.
  • the functions of RNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA.
  • the overall effect of such interference with target nucleic acid function is modulation of the expression of Navl.3.
  • modulation means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene.
  • inhibition is the preferred form of modulation, of gene expression and mRNA is a preferred target.
  • Targeting an antisense compound to a particular nucleic acid is a multistep process.
  • the process usually begins with the identification of a nucleic acid sequence whose function is to be modulated. This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent.
  • the target is a nucleic acid molecule encoding Navl.3.
  • the targeting process also includes determination of a site or sites within this gene for the antisense interaction to occur such that the desired effect, e.g., detection or modulation of expression of the protein, will result.
  • a preferred intragenic site is the region encompassing the translation initiation or termination codon of the open reading frame (ORF) of the gene. Since, as is known in the art, the translation initiation codon is typically 5'-AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon,” the “start codon” or the “AUG start codon”. A minority of genes have a translation initiation codon having the RNA sequence 5 '-GUG, 5 '-UUG or 5 '-CUG, and 5 '-
  • translation initiation codon and “start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions.
  • start codon and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding Navl.3, regardless of the sequence(s) of such codons.
  • a translation termination codon or "stop codon" of a gene may have one of three sequences, i.e. 5'-UAA, 5'- UAG and 5 '-UGA (the corresponding DNA sequences are 5 '-TAA, 5 '-TAG and 5'-TGA, respectively).
  • start codon region and “translation initiation codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation initiation codon.
  • stop codon region and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation termination codon.
  • Other target regions include the 5 ' untranslated region (5 'UTR), known in the art to refer to the portion of an mRNA in the 5 ' direction from the translation initiation codon, and thus including nucleotides between the 5 ' cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene, and the 3' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA or corresponding nucleotides on the gene.
  • 5 ' untranslated region 5 'UTR
  • 3' untranslated region known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination
  • the 5' cap of an mRNA comprises an N7-methylated guanosine residue joined to the 5'-most residue of the mRNA via a 5 '-5' triphosphate linkage.
  • the 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap.
  • the 5' cap region may also be a preferred target region.
  • mRNA splice sites i.e., intron-exon junctions
  • intron-exon junctions may also be preferred target regions, and are particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular mRNA splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred targets.
  • introns can also be effective, and therefore preferred, target regions for antisense compounds targeted, for example, to DNA or pre-mRNA.
  • oligonucleotides are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
  • hybridization means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases.
  • adenine and thymine are complementary nucleobases, which pair through the formation of hydrogen bonds.
  • “Complementary,” as used herein, refers to the capacity for precise pairing between two nucleotides.
  • oligonucleotide and the DNA or RNA are considered to be complementary to each other at that position.
  • the oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other.
  • “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target.
  • an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable.
  • An antisense compound is specifically hybridizable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed.
  • Antisense compounds are commonly used as research reagents and diagnostics.
  • antisense oligonucleotides which are able to inhibit gene expression with dazzling specificity, are often used by those of ordinary skill to elucidate the function of particular genes.
  • Antisense compounds are also used, for example, to distinguish between functions of various members of a biological pathway. Antisense modulation has, therefore, been harnessed for research use.
  • oligonucleotide refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof.
  • oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly.
  • modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.
  • antisense oligonucleotides are a preferred form of antisense compound, the present invention comprehends other oligomeric antisense compounds, including but not limited to oligonucleotide mimetics such as are described below.
  • the antisense compounds in accordance with this invention preferably comprise from about 8 to about 30 nucleobases (i.e. from about 8 to about 30 linked nucleo sides).
  • Particularly preferred antisense compounds are antisense oligonucleotides, even more preferably those comprising from about 12 to about 25 nucleobases.
  • a nucleoside is a base-sugar combination.
  • the base portion of the nucleoside is normally a heterocyclic base.
  • the two most common classes of such heterocyclic bases are the purines and the pyrimidines.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside.
  • the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar.
  • the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound.
  • the respective ends of this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred.
  • the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide.
  • the normal I linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.
  • oligonucleotides containing modified backbones or non-natural internucleoside linkages include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
  • modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
  • Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3 'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3 '-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'.
  • Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • morpholino linkages formed in part from the sugar portion of a nucleoside
  • siloxane backbones sulfide, sulfoxide and sulfone backbones
  • formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
  • alkene containing backbones sulfamate backbones
  • sulfonate and sulfonamide backbones amide backbones; and others having mixed N, O, S and CH 2 component parts.
  • both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups.
  • the base units are maintained for hybridization with an appropriate nucleic acid target compound.
  • an oligomeric compound an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA).
  • PNA peptide nucleic acid
  • the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
  • nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
  • Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.
  • Most preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular -CH -NH-O-CH -, -CH -N (CH 3 ) -O-CH 2 - [known as a methylene (methylimino) or MMI backbone] , - CH 2 -O-N (CH 3 ) -CH 2 -, -CH 2 N(CH 3 )-N(CH 3 )-CH 2 - and -O-N(CH 3 )-CH 2 - CH - [wherein the native phosphodiester backbone is represented as -O-P- O-CH -] of the above referenced U.S.
  • Modified oligonucleotides may also contain one or more substituted sugar moieties.
  • Preferred oligonucleotides comprise one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C] to C ]0 alkyl or C 2 to do alkenyl and alkynyl.
  • oligonucleotides comprise one of the following at the 2' position: Ci to Cio, ( lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, CI, Br, CN, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ON0 , NO , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
  • a preferred modification includes 2' -methoxyethoxy (T -O-CH 2 CH 2 OCH 3 , also known as 2'-O- (2- methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Ada, 1995, 78, 486- 504) i.e., an alkoxyalkoxy group.
  • a further preferred modification includes 2'-dimethylaminooxyethoxy, i.e., a O(CH ) ON(CH 3 ) 2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'- dimethylaminoethoxyethoxy (also known in the art as 2'-O- dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH 2 -O-CH 2 -N (CH ) , also described in examples herein below.
  • 2'-dimethylaminooxyethoxy i.e., a O(CH ) ON(CH 3 ) 2 group, also known as 2'-DMAOE, as described in examples herein below
  • 2'- dimethylaminoethoxyethoxy also known in the art as 2'-O- dimethylaminoethoxyethyl or 2'-DMAEOE
  • Oligonucleotides may also include nucleobase (often referred to in the art simply as "base”) modifications or substitutions.
  • unmodified or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5- halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5- substitute
  • nucleobases include those disclosed in United States Patent No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858- 859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al, Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S.T. and Lebleu, B. ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention.
  • 5-substituted pyrimidines include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
  • 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds, Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2 '-O- methoxy ethyl sugar modifications.
  • Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. 3,687,808, as well as U.S. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,750,692; and 5,681,941, each of which is herein inco ⁇ orated by reference.
  • oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates, which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide.
  • moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem.
  • a thioether e.g., hexyl-S- tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al, Nucl.
  • Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Mancharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 365'-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Ada, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).
  • antisense compounds which are chimeric compounds.
  • Chimeric antisense compounds or “chimeras,” in the context of this invention are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound.
  • oligonucleotides typically contain at least one region wherem the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid.
  • An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
  • RNase H is a cellular endonuclease, which cleaves the RNA strand of RNA:DNA duplex.
  • RNA target Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxyoligonucleotides hybridizing to the same target region.
  • Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
  • Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S.
  • the antisense compounds used in accordance with this invention may be conveniently, and routinely made tlirough the well-known technique of solid phase synthesis.
  • Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA). Any other means for such synthesis known in the art may additionally or alternatively be employed.
  • the antisense compounds of the invention are synthesized in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules.
  • the compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption.
  • the antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrags and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrags, and other bioequivalents.
  • prodrug indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.
  • prodrug versions of the oligonucleotides of the invention are prepared as SATE [(S-acetyl-2- thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al., published December 9, 1993 or in WO 94/26764 to Imbach et al.
  • pharmaceutically acceptable salts refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
  • Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines. Examples of metals used as cations are sodium, potassium, magnesium, calcium, and the like.
  • Suitable amines are N, N'- dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine (see, for example, Berge et al., "Pharmaceutical Salts," J. ofPharma Sci., 1911, 66, 119).
  • the base addition salts of said acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional manner.
  • the free acid form may be regenerated by contacting the salt form with an acid and isolating the free acid in the conventional manner.
  • a "pharmaceutical addition salt” includes a pharmaceutically acceptable salt of an acid form of one of the components of the compositions of the invention. These include organic or inorganic acid salts of the amines. Preferred acid salts are the hydrochlorides, acetates, salicylates, nitrates and phosphates.
  • Suitable pharmaceutically acceptable salts include basic salts of a variety of inorganic and organic acids, such as, for example, with inorganic acids, such as for example hydrochloric acid, hydrobromic acid, sulfuric acid or phosphoric acid; with organic carboxylic, sulfonic, sulfo or phospho acids or N-substituted sulfamic acids, for example acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic acid, 2- phenoxybenzoic acid, 2-acetoxybenzoic acid, embonic acid, nicotinic acid or isonicot
  • Pharmaceutically acceptable salts of compounds may also be prepared with a pharmaceutically acceptable cation.
  • Suitable pharmaceutically acceptable cations are well known to those skilled in the art and include alkaline, alkaline earth, ammonium and quaternary ammonium cations. Carbonates or hydrogen carbonates are also possible.
  • salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.
  • acid addition salts formed with inorganic acids for example hydrochloric acid, hydrobromic acid, sulfliric acid, phosphoric acid, nitric acid and the like
  • salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p- toluenesulfonic acid, naphthalenedisulf
  • the antisense compounds of the present invention can be utilized for diagnostics, therapeutics, prophylaxis, and as research reagents and kits.
  • an animal preferably a human, suspected of having a disease or disorder, which can be treated by modulating the expression of Navl .3, is treated by administering antisense compounds in accordance with this invention.
  • the compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of an antisense compound to a suitable pharmaceutically acceptable diluent or carrier.
  • Use of the antisense compounds and methods of the invention may also be useful prophylactically, e.g., to prevent or delay infection, inflammation or tumor formation, for example.
  • the antisense compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding Navl.3, enabling sandwich and other assays to easily be constructed to exploit this fact.
  • Hybridization of the antisense oligonucleotides of the invention with a nucleic acid encoding Navl .3 can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide or any other suitable detection means. Kits using such detection means for detecting the level of Navl.3 in a sample may also be prepared.
  • the present invention also includes pharmaceutical compositions and formulations, which include the antisense compounds of the invention.
  • the pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral.
  • Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.
  • Oligonucleotides with at least one 2'-O- methoxyethyl modification are believed to be particularly useful for oral administration.
  • Intraventricular drug administration for the direct delivery of drug to the brain of a patient, may be desired for the treatment of patients with diseases or conditions afflicting the brain.
  • a silicon catheter is surgically introduced into a ventricle of the brain of a human patient, and is connected to a subcutaneous infusion pump
  • the pump is used to inject the oligonucleotides and allows precise dosage adjustments and variation in dosage schedules with the aid of an external programming device.
  • the reservoir capacity of the pump is 18-20 mL and infusion rates may range from 0.1 mL/h to 1 mL/h.
  • the pump reservoir may be refilled at 3 -10 week intervals. Refilling of the pump is accomplished by percutaneous puncture of the self-sealing septum of the pump.
  • the pump is used to inject the oligonucleotides and allows precise dosage adjustments and variations in dose schedules with the aid of an external programming device.
  • the reservoir capacity of the pump is 18-20 mL, and infusion rates may vary from 0. 1 mL/h to 1 mL& Depending on the frequency of drug administration, ranging from daily to monthly, and dosage of drug to be administered, ranging from 0.01 micro g to 100 g per kg of body weight, the pump reservoir may be refilled at 3 -10 week intervals. Refilling of the pump is accomplished by a single percutaneous puncture to the self-sealing septum of the pump. The distribution, stability and pharmacokinetics of oligonucleotides within the central nervous system may be followed according to known methods. Subdural administration is also envisioned other by a pump mechanism or direct injection.
  • the silicon catheter is configured to connect the subcutaneous infusion pump to, e.g., the hepatic artery, for delivery to the liver.
  • Infusion pumps may also be used to effect systemic delivery of oligonucleotides (Ewel et al., Cancer Research, 1992, 52, 3005; Rubenstein et al., J. Surg. Oncol., 1996, 62, 194).
  • compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
  • Coated condoms, gloves and the like may also be useful.
  • compositions and formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
  • Compositions and formulations for parenteral, intrathecal or intraventricular administration may mclude sterile aqueous solutions, which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
  • compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that mclude, but are not limited to, preformed liquids, self- emulsifying solids and self-emulsifying semisolids.
  • the pharmaceutical formulations of the present invention may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques mclude the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
  • compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas.
  • the compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media.
  • Aqueous suspensions may further contain substances, which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
  • the suspension may also contain stabilizers.
  • the pharmaceutical compositions may be formulated and used as foams.
  • Emulsions are often biphasic systems comprising of two immiscible liquid phases intimately mixed and dispersed with each other.
  • emulsions may be either water-in-oil (w/o) or of the oil-in-water (o/w) variety.
  • Emulsions may contain additional components in addition to the dispersed phases and the active drug, which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants may also be present in emulsions as needed.
  • compositions may also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil- in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions.
  • Such complex formulations often provide certain advantages that simple binary emulsions do not.
  • Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion.
  • a system of oil droplets enclosed in globules of water stabilized in an oily continuous provides an o/w/o emulsion.
  • Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion may be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that may be incorporated into either phase of the emulsion.
  • Emulsifiers may broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y., volume 1 , p. 199).
  • Synthetic surfactants also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y., volume 1 , p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199).
  • Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion.
  • HLB hydrophile/lipophile balance
  • surfactants may be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).
  • Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia.
  • Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations.
  • non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives, and antioxidants (Block, in
  • Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed phase droplets and by increasing the viscosity of the external phase.
  • polysaccharides for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth
  • cellulose derivatives for example, carboxymethylcellulose and carboxypropylcellulose
  • synthetic polymers for example, carbomers, cellulose ethers, and carb
  • emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that may readily support the growth of microbes
  • these formulations often incorporate preservatives.
  • preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid.
  • Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation.
  • Antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulf ⁇ te, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.
  • free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulf ⁇ te
  • antioxidant synergists such as citric acid, tartaric acid, and lecithin.
  • compositions of oligonucleotides and nucleic acids are formulated as microemulsions.
  • a microemulsion may be defined as a system of water, oil and amphiphile, which is a single optically isofropic, and thermodynamically stable liquid solution (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N ., volume 1, p. 245).
  • microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain- length alcohol to form a transparent system.
  • microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 1852-5).
  • Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte.
  • microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington 's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985, p. 271).
  • microemulsions offer the advantage of solubilizing water-insoluble drags in a formulation of thermodynamically stable droplets that are formed spontaneously.
  • Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (S0750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants.
  • ionic surfactants non-ionic surfactants
  • Brij 96 polyoxyethylene oleyl ethers
  • polyglycerol fatty acid esters tetraglycerol monolaurate (ML310
  • the cosurfactant usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules.
  • Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art.
  • the aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol.
  • the oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and triglycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
  • materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and triglycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
  • Microemulsions are particularly of interest from the standpoint of drag solubilization and the enhanced absorption of drags.
  • Lipid based microemulsions have been proposed to enhance the oral bioavailability of drags, including peptides (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol, 1993, 13, 205).
  • Microemulsions afford advantages of improved drag solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm.
  • microemulsions may form spontaneously when their components are brought together at ambient temperature. This may be particularly advantageous when formulating thermolabile drugs, peptides or oligonucleotides.
  • Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of oligonucleotides and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of oligonucleotides and nucleic acids within the gastrointestinal tract, vagina, buccal cavity and other areas of administration.
  • Liposomes There are many organized surfactant stractures besides microemulsions that have been studied and used for the formulation of drugs. These include monolayers, micelles, bilayers and vesicles. Vesicles, such as liposomes, have attracted great interest because of their specificity and the duration of action they offer from the standpoint of drug delivery. As used in the present invention, the term "liposome” means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers. [0067] Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior.
  • the aqueous portion contains the composition to be delivered.
  • Cationic liposomes possess the advantage of being able to fuse to the cell wall.
  • Noncationic liposomes although not able to fuse as efficiently with the cell wall, are taken up by macrophages in vivo.
  • lipid vesicles In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome, which is highly deformable and able to pass through such fine pores.
  • liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can inco ⁇ orate a wide range of water and lipid soluble drags; liposomes can protect encapsulated drags in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, P. 245).
  • Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.
  • Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes. As the merging of the liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act. [0071] Liposomal formulations have been the focus of extensive investigation as the mode of delivery for many drags. There is growing evidence that for topical administration, liposomes present several advantages over other formulations. Such advantages mclude reduced side- effects related to high systemic abso ⁇ tion of the administered drug, increased accumulation of the administered drag at the desired target, and the ability to administer a wide variety of drags, both hydrophilic and hydrophobic, into the skin.
  • liposomes to deliver agents including high-molecular weight DNA into the skin.
  • Compounds including analgesics, antibodies, hormones and high-molecular weight DNAs have been administered to the skin. The majority of applications resulted in the targeting of the upper epidermis.
  • Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes, which interact with the negatively charged DNA molecules to form a stable complex. The positively charged DNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al, Biochem. Biophys. Res. Commun., 1987, 147, 980 - 985) [0074] Liposomes, which are pH-sensitive or negatively charged, entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs.
  • One maj or type of liposomal composition includes phospholipids other than naturally derived phosphatidylcholine.
  • Neutral liposome compositions for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC).
  • Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamme (DOPE).
  • DOPE dioleoyl phosphatidylethanolamme
  • Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC.
  • PC phosphatidylcholine
  • Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.
  • Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drags to the skin, in particular systems comprising non-ionic surfactant and cholesterol.
  • Non-ionic liposomal formulations comprising Novasome TM I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and NovasomeTM II (glyceryl distearate/ cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporin-A into different layers of the skin (Hu et al. S. T.P.Pharma. Sci., 1994, 4, 6, 466).
  • Liposomes also include "sterically stabilized" liposomes, a term, which, as used herein, refers to liposomes comprising one or more specialized lipids that, when inco ⁇ orated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such, specialized lipids.
  • sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside GM I , or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety.
  • PEG polyethylene glycol
  • Patent No. 5,213,804 and European Patent No. EP 0 496 813 Bl Liposomes comprising a number of other lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Patent No. 5,225,212 (both to Martin et al.) and in WO 94/20073 (Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids are described in WO 96/10391 (Choi et al.).
  • U.S. Patent Nos. 5,540,935 (Miyazaki et al.) and 5,556,948 (Tagawa et al.) describe PEG- containing liposomes that can be further derivatized with functional moieties on their surfaces.
  • a limited number of liposomes comprising nucleic acids are known in the art.
  • WO 96/40062 to Thierry et al. discloses methods for encapsulating high molecular weight nucleic acids in liposomes.
  • U.S. Patent No. 5,264,221 to Tagawa et al. discloses protein-bonded liposomes and asserts that the contents of such liposomes may include an antisense RNA.
  • U.S. Patent No. 5,665,710 to Rahman et al. describes certain methods of encapsulating oligodeoxynucleotides in liposomes.
  • Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes may be described as lipid droplets, which are so highly deformable that they are easily able to penetrate through pores, which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g. they are self-optimizing (adaptive to the shape of pores in the skin), self-repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge-activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of seram albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.
  • Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes.
  • HLB hydrophile/lipophile balance
  • the nature of the hydrophilic group also known as the "head" provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285)
  • the surfactant molecule is not ionized, it is classified as a nonionic surfactant.
  • Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about ⁇ 8 depending on their structure.
  • Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters.
  • Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class.
  • the polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.
  • Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates.
  • the most important members of the anionic surfactant class are the alkyl sulfates and the soaps.
  • Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.
  • the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric.
  • Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N- alkylbetaines and phosphatides.
  • the use of surfactants in drag products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).
  • Penetration Enhancers [0089] In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids particularly oligonucleotides, to the skin of animals.
  • Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating nonsurfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.
  • surfactants In connection with the present invention, surfactants
  • these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm.
  • Fatty acids Narious fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (l-monooleoyl-.rac- glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, l-dodecylazacycloheptan-2-one, acylcarnitines, acylchohnes, C,- ⁇ o alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di- glycerides thereof (i.e., oleate, laurate, caprate, myristate, palm
  • Bile salts The physiological role of bile includes the facilitation of dispersion and abso ⁇ tion of lipids and fat-soluble vitamins (Branton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds. McGraw-Hill, New York, 1996, pp. 934-935). Narious natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives.
  • the bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxy cholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxychohc acid (sodium gly codeoxy cholate), taurocholic acid (sodium taurocholate), taurodeoxychohc acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate'and polyoxyethylene-9-lauryl ether (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In:
  • Chelating agents as used in connection with the present invention, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that abso ⁇ tion of oligonucleotides through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J.
  • Chelating agents of the invention include but are not limited to disodium. ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines)(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical
  • Non-chelating non-surfactants can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance abso ⁇ tion of oligonucleotides through the alimentary mucosa (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33).
  • This class of penetration enhancers include, for example, unsaturated cyclic ureas, 1 -alkyl- and 1- alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in
  • oligonucleotides may also be added to the pharmaceutical and other compositions of the present invention.
  • cationic lipids such as lipofectin (Junichi et al, U.S. Patent No.
  • cationic glycerol derivatives include cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al, PCT Application WO 97/30731), are also known to enhance the cellular uptake of oligonucleotides.
  • nucleic acids include glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and te ⁇ enes such as limonene and menthone.
  • glycols such as ethylene glycol and propylene glycol
  • pyrrols such as 2-pyrrol
  • azones such as 2-pyrrol
  • te ⁇ enes such as limonene and menthone.
  • compositions of the present invention also inco ⁇ orate carrier compounds in the formulation.
  • carrier compound or “carrier” can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation.
  • a nucleic acid and a carrier compound can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor.
  • the recovery of a partially phosphorothioate oligonucleotide in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dexfran sulfate, polycytidic acid or 4-acetamido-4'isothiocyano-stilbene-2,2' disulfonic acid (Miyao et al., Antisense Res.
  • a "pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal.
  • the excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition.
  • Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc.).
  • binding agents e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxyprop
  • compositions of the present invention can also be used to formulate the compositions of the present invention.
  • suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
  • Formulations for topical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases.
  • the solutions may also contain buffers, diluents and other suitable additives.
  • Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration, which do not deleteriously react with nucleic acids, can be used.
  • Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
  • Other Components [00103]
  • the compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels.
  • Aqueous suspensions may contain substances, which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol, and/or dexfran.
  • the suspension may also contain stabilizers.
  • compositions containing (a) one or more antisense compounds and (b) one or more other chemotherapeutic agents which function by a non-antisense mechanism.
  • chemotherapeutic agents include, but are not limited to, anticancer drags such as daunorabicin, dactinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard, chlorambucil, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine (CA), 5-fluorouracil (5-FU), floxuridine (5-FUdR), methotrexate (MTX), colchicine, vincristine, vinblastine, etoposide, teniposide, cisplatin and diethylstilbestrol (DES).
  • anticancer drags such as daunorabicin, dactinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard, chloramb
  • Anti-inflammatory drags including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drags, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention.
  • compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target.
  • antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially.
  • the formulation of therapeutic compositions and their subsequent administration is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient.
  • Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC 50 S found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 ⁇ g to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues.
  • the oligonucleotide is administered in maintenance doses, ranging from 0.01 ⁇ g to 100 g per kg of body weight, once or more daily, to once every 20 years.
  • 2'-Deoxy and 2'-methoxy beta-cyanoethyldiisopropyl phosphoramidites are available from commercial sources (e.g. Chemgenes, Needham MA or Glen Research, Inc. Sterling VA).
  • Other 2'-O-alkoxy substituted nucleoside amidites are prepared as described in U.S. Patent 5,506,351, herein inco ⁇ orated by reference.
  • the standard cycle for unmodified oligonucleotides is utilized, except the wait step after pulse delivery of tetrazole and base is increased to 360 seconds.
  • Oligonucleotides containing 5-methyl-2'-deoxycytidine (5-Me- C) nucleotides are synthesized according to published methods [Sanghvi, et. al, Nucleic Acids Research, 1993, 21, 3197-3203] using commercially available phosphoramidites (Glen Research, Sterling NA or ChemGenes, ⁇ eedham MA). 2'-FIuoro amidites
  • 2'-fluoro oligonucleotides are synthesized as described previously [Kawasaki, et. al., J. Med. Chem., 1993, 36, 831-841] and United States patent 5,670,633, herein inco ⁇ orated by reference. Briefly, the protected nucleoside ⁇ 6-benzoyl-2'-deoxy-2'-fluoroadenosine is synthesized utilizing commercially available 9-beta-D- arabinofuranosyladenine as starting material and by modifying literature procedures whereby the 2'-alpha-fluoro atom is introduced by a S N 2- displacement of a 2'-beta-trityl group.
  • N6-benzoyl-9-beta-D- arabinofuranosylademne is selectively protected in moderate yield as the 3',5'-ditetrahydropyranyl (THP) intermediate.
  • THP 3',5'-ditetrahydropyranyl
  • Deprotection of the THP and N6-benzoyl groups is accomplished using standard methodologies and standard methods are used to obtain the 5'-dimethoxytrityl-(DMT) and 5'- DMT-3 '-phosphoramidite intermediates.
  • 2'-O-Methoxyethyl-substituted nucleoside amidites are prepared as follows, or alternatively, as per the methods of Martin, P., Helvetica Chimica Acta, 1995, 78, 486-504. 2,2'-Anhydro[l-(beta-D-arabinofuranosyl)-5-methyluridinel
  • the solution is poured into fresh ether (2.5 L) to yield a stiff gum.
  • the ether is decanted and the gum is dried in a vacuum oven (60°C at 1 mm Hg for 24 h) to give a solid that is crashed to a light tan powder.
  • the material is used as is for further reactions (or it can be purified further by column chromatography using a gradient of methanol in ethyl acetate (10-25%) to give a white solid.
  • 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine 160 g, 0.506 M is co- evaporated with pyridine (250 mL) and the dried residue dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) is added and the mixture stirred at room temperature for one hour. A second aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) is added and the reaction stirred for an additional one hour. Methanol (170 mL) is then added to stop the reaction.
  • a first solution is prepared by dissolving 3 '-O-acetyl-2'-O- methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in
  • N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (85 g, 0.134 M) is dissolved in DMF (800 mL) and benzoic anhydride (37.2 g, 0.165 M) is added with stirring. After stirring for 3 hours, TLC showed the reaction to be approximately 95% complete. The solvent-'is evaporated and the residue azeotroped with MeOH (200 mL).
  • 2'-O-(Aminooxyethyl) nucleoside amidites and 2'-O- (dimethylaminooxyethyl) nucleoside amidites 2'-(Dimethylaminooxyethoxy) nucleoside amidites [00124] 2'-(Dimethylaminooxyethoxy) nucleoside amidites [also known in the art as 2'-O-(dimethylaminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs.
  • O 2 -2'-anhydro-5-methyluridine (Pro. Bio. Sint, Narese, Italy, lOO.Og, 0.4'6 mmol), dimethylaminopyridine (0.66g, 0.013eq, 0.0054mmol) are dissolved in dry pyridine (500 ml) at ambient temperature under an argon atmosphere and with mechanical stirring, tert- Butyldiphenylchlorosilane (125.8g, 119.0mL, l.leq, 0.458mmol) is added in one portion. The reaction is stirred for 16 h at ambient temperature. TLC (Rf 0.22, ethyl acetate) indicated a complete reaction.
  • the solution is concentrated under reduced pressure to a thick oil. This is partitioned between dichloromethane (1 L) and saturated sodium bicarbonate (2x1 L) and brine (1 L). The organic layer is dried over sodium sulfate and concentrated under reduced pressure to a thick oil.
  • the oil is dissolved in a 1 :1 mixture of ethyl acetate and ethyl ether (600mL) and the solution is cooled to -10°C.
  • the resulting crystalline product is collected by filtration, washed with ethyl ether (3x200 mL), and dried (40°C, 1mm Hg, 24 h) to a white solid
  • 5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-methyluridine [00126] In a 2 L stainless steel, unstirred pressure reactor is added borane in tetrahydrofuran (1.0 M, 2.0 eq, 622 mL). In the fume hood and with manual stirring, ethylene glycol (350 mL, excess) is added cautiously at first until the evolution of hydrogen gas subsides. 5'-O-tert-Butyldiphenylsilyl- O 2 -2'anhydro-5-methyluridine (149 g, 0.3'1 mol) and sodium bicarbonate (0.074 g, 0.003 eq) are added with manual stirring.
  • the reactor is sealed and heated in an oil bath until an internal temperature of 160°C is reached and then maintained for 16 h (pressure ⁇ 100 psig).
  • the reaction vessel is cooled to ambient and opened.
  • TLC Rf 0.67 for desired product and Rf 0.82 for ara-T side product, ethyl acetate
  • the reaction is stopped, concentrated under reduced pressure (10 to 1mm, Hg) in a warm water bath (40-100°C) with the more extreme conditions used to remove the ethylene glycol. [Alternatively, once the low boiling solvent is gone, the remaining solution can be partitioned between ethyl acetate and water.
  • Aqueous NaHCO 3 solution (5%, lOmL) is added and extracted with ethyl acetate (2x20mL). Ethyl acetate phase is dried over anhydrous Na 2 SO , evaporated to dryness. Residue is dissolved in a solution of IM PPTS in MeOH (30.6mL). Formaldehyde (20% w/w, 30mL, 3.37mmol) is added and the reaction mixture is stirred at room temperature for 10 minutes. Reaction mixture cooled to 10°C in an ice bath, sodium cyanoborohydride (0.39g, 6.13mmol) is added, and reaction mixture stirred at 10°C for 10 minutes.
  • reaction mixture is removed from the ice bath and stirred at room temperature for 2 hrs.
  • 5% NaHCO 3 (25mL) solution is added and extracted with ethyl acetate (2x25mL).
  • Ethyl acetate layer is dried over anhydrous Na 2 SO and evaporated to dryness.
  • the residue obtained is purified by flash column chromatography and eluted with 5% MeOH in CH 2 C1 2 to get 5'-O- tertbutyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5- methyluridine as a white foam.
  • Triethylamine trihydrofluoride (3.91mL, 24.0mmol) is dissolved in dry THF and triethylamine (1.67mL, 12mmol, dry, kept over KOH). This mixture of triethylamine- 2HF is then added to 5'-O-tert-butyldiphenylsilyl- 2'-O-[N,N-dimethylaminooxyethyl]-5-methyluridine (1.40g, 2.4mmol) and stirred at room temperature for 24 hrs. Reaction is monitored by TLC (5% MeOH in CH 2 C1 2 ). Solvent is removed under vacuum and the residue placed on a flash column and eluted with 10% MeOH in CH 2 C1 2 to get 2'-O-
  • 5 '-O-DMT-2 '-O-(dimethylaminooxyethyl)-5-methyluridine (1.08g, 1.67mmol) is co-evaporated with toluene (20mL).
  • N,N-diisopropylamine tetrazonide (0.29g, 1.67mmol) is added and dried over P20, under high vacuum overnight at 40°C.
  • the reaction mixture is dissolved in anhydrous acetonitrile (8.4mL) and 2-cyanoethyl-N,N,N 1 ,N 1 - tetraisopropylphosphoramidite (2.12mL, 6.08mmol) is added.
  • reaction mixture is stirred at ambient temperature for 4 hrs under inert atmosphere.
  • the progress of the reaction is monitored by TLC (hexane: ethyl acetate 1:1).
  • the solvent is evaporated, then the residue is dissolved in ethyl acetate (70mL) and washed with 5% aqueous NaHCO 3 (40mL). Ethyl acetate layer is dried over anhydrous Na 2 SO and concentrated.
  • Residue obtained is chromatographed (ethyl acetate as eluent) to get 5'-O-DMT-2'-O-(2-N,N- dimethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoethyl)-N,N- diisopropylphosphoramidite] as a foam.
  • 2'-(Aminooxyethoxy) nucleoside amidites [also known in the art as 2'-O-(aminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs. Adenosine, cytidine and thymidine nucleoside amidites are prepared similarly. N2-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'- dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N- diisopr opylph osph or amidite]
  • the 2'-O-aminooxyethyl guanosine analog may be obtained by selective 2'-O-alkylation of diaminopurine riboside.
  • Multigram quantities of diaminopurine riboside may be purchased from Schering AG (Berlin) to provide 2'-O-(2-ethylacetyl) diaminopurine riboside along with a minor amount of the 3'-O-isomer.
  • 2'-O-(2-ethylacetyl) diaminopurine riboside may be resolved and converted to 2'-O-(2ethylacetyl)guanosine by treatment with adenosine deaminase.
  • Standard protection procedures should afford 2'-O-(2-ethylacetyl)-5 '-O-(4,4'-dimethoxytrityl)guanosine and 2-N-isobutyryl-6-O-diphenylcarbamoyl-2 ' -O-(2-ethylacetyl)-5 ' -O- (4,4'-dimethoxytrityl)guanosine which may be reduced to provide 2-N- isobutyryl-6-O-diphenylcarbamoyl-2 ' -O-(2-ethylacetyl)-5 ' -O-(4,4 ' - dimethoxvtrityl)guanosine.
  • the hydroxyl group may be displaced by N-hydroxyphthalimide via a Mitsunobu reaction, and the protected nucleoside may phosphitylated as usual to yield 2-N-isobutyryl-6-O- di ⁇ henylcarbamoyl-2 ' -O-(2-ethylacetyl)-5 '-O-(4,4 ' - dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N- diisopropylphosphoramiditel.
  • 2'-dimethylaminoethoxyethoxy (2'-DMAEOE) nucleoside amidites [00135] 2' -dimethylammoethoxyethoxy nucleoside amidites (also known in the art as 2'-O-dimethylaminoethoxyethyl, i.e., 2'O-CH 2 -O-CH 2 - N(CH 2 ) 2 , or 2'-DMAEOE nucleoside amidites) are prepared as follows. Other nucleoside amidites are prepared similarly.
  • the bomb is cooled to room temperature and opened.
  • the crade solution is concentrated and the residue partitioned between water (200 mL) and hexanes (200 mL).
  • the excess phenol is extracted into the hexane layer.
  • the aqueous layer is extracted with ethyl acetate (3x200 mL) and the combined organic layers are washed once with water, dried over anhydrous sodium sulfate and concentrated.
  • the residue is columned on silica gel using methanol/methylene chloride 1 :20 (which has 2% triethylamine) as the eluent. As the column fractions are concentrated a colorless solid forms which is collected to give the title compound as a white solid.
  • the thiation wait step is increased to 68 sec and is followed by the capping step.
  • the oligonucleotides are purified by precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCl solution.
  • Phosphinate oligonucleotides are prepared as described in U.S. Patent 5,508,270, herein inco ⁇ orated by reference.
  • Alkyl phosphonate oligonucleotides are prepared as described in U.S. Patent 4,469,863, herein inco ⁇ orated by reference.
  • 3 '-Deoxy-3 '-methylene phosphonate oligonucleotides are prepared as described in U.S. Patents 5,610,289 or 5,625,050, herein inco ⁇ orated by reference.
  • Phosphoramidite oligonucleotides are prepared as described in U.S. Patent, 5,256,775 or U.S. Patent 5,366,878, herein inco ⁇ orated by reference.
  • Alkylphosphonothioate oligonucleotides are prepared as described in WO 94/17093 and WO 94/02499 herein inco ⁇ orated by reference.
  • 3 '-Deoxy-3 '-amino phosphoramidate oligonucleotides are prepared as described in U.S. Patent 5,476,925, herein inco ⁇ orated by reference.
  • Phosphotriester oligonucleotides are prepared as described in U.S. Patent 5,023,243, herein inco ⁇ orated by reference.
  • Borano phosphate oligonucleotides are prepared as described in U.S. Patents 5,130,302 and 5,177,198, both herein inco ⁇ orated by reference.
  • Formacetal and thioformacetal linked oligonucleosides are prepared as described in U.S. Patents 5,264,562 and 5,264,564, herein inco ⁇ orated by reference.
  • Ethylene oxide linked oligonucleosides are prepared as described in U.S. Patent 5,223,618, herein inco ⁇ orated by reference.
  • PNAs Peptide nucleic acids
  • PNA Peptide Nucleic Acids
  • Chimeric oligonucleotides, oligonucleosides or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the "gap" segment of linked nucleosides is positioned between 5 ' and 3 ' "wing" segments of linked nucleosides and a second "open end” type wherein the "gap” segment is located at either the 3' or the 5' terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as “gapmers” or gapped oligonucleotides.
  • oligonucleotides or oligonucleosides are purified by precipitation twice out of 0.5 M NaCl with 2.5 volumes ethanol. Synthesized oligonucleotides are analyzed by polyacrylamide gel electrophoresis on denaturing gels and judged to be at least 85% full-length material.
  • Non-standard nucleosides are synthesized as per known literature or patented methods. They are utilized as base protected betacyanoethyldiisopropyl phosphoramidites.
  • Oligonucleotides are cleaved from support and deprotected with concentrated NH OH at elevated temperature (55-60°C) for 12-16 hours and the released product then dried in vacuo. The dried product is then resuspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.
  • the concentration of oligonucleotide in each well is assessed by dilution of samples and UN abso ⁇ tion spectroscopy.
  • the full-length integrity of the individual products is evaluated by capillary electrophoresis (CE) in either the 96 well format (Beckman P/ACETM MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACETM 5000, ABI 270).
  • Base and backbone composition is confirmed by mass analysis of the compounds utilizing electrospray-mass spectroscopy. All assay test plates are diluted from the master plate using single and multi-channel robotic pipettors. Plates are judged to be acceptable if at least 85% of the compounds on the plate are at least 85% full length.
  • cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
  • A549 cells A549 cells:
  • the human lung carcinoma cell line A549 can be obtained from the American Type Culture Collection (ATCC) (Manassas, VA).
  • A549 cells are routinely cultured in DMEM basal media (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence.
  • NHDF cells are routinely passaged by trypsinization and dilution when they reached 90% confluence.
  • Human neonatal dermal fibroblast can be obtained from the Clonetics Co ⁇ oration (Walkersville MD). NHDFs are routinely maintained in Fibroblast Growth Medium (Clonetics Co ⁇ oration, Walkersville MD) supplemented as recommended by the supplier. Cells are maintained for up to 10 passages as recommended by the supplier.
  • HEK cells can be obtained from the Clonetics Co ⁇ oration (Walkersville MD). NHDFs are routinely maintained in Fibroblast Growth Medium (Clonetics Co ⁇ oration, Walkersville MD) supplemented as recommended by the supplier. Cells are maintained for up to 10 passages as recommended by the supplier. HEK cells:
  • HEK Human embryonic keratmocytes
  • Clonetics Co ⁇ oration Walkersville MD
  • HEKs are routinely maintained in Keratinocyte Growth Medium (Clonetics Co ⁇ oration, Walkersville MD) formulated as recommended by the supplier.
  • Cells are routinely maintained for up to 10 passages as recommended by the supplier.
  • MCF-7 cells
  • the human breast carcinoma cell line MCF-7 is obtained from the American Type Culture Collection (Manassas, VA). MCF-7 cells are routinely cultured in DMEM low glucose (Gibco/Life Technologies,
  • LA4 cells [00169] The mouse lung epithelial cell line LA4 is obtained from the American Type Culture Collection (Manassas, VA).
  • LA4 cells are routinely cultured in F12K medium (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 15% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #3872) at a density of 3000-6000 cells/ well for use in RT-PCR analysis.
  • cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide. Treatment with antisense compounds:
  • oligonucleotide When cells reached 80% confluence, they are treated with oligonucleotide. For cells grown in 96-well plates, wells are washed once with 200 ⁇ L OPTI-MEM tm -l reduced-seram medium (Gibco BRL) and then treated with 130 ⁇ L of OPTI-MEMTMTM-l containing 3.75 ⁇ g/mL LIPOFECTINTM (Gibco BRL) and the desired concentration of oligonucleotide. After 4-7 hours of treatment, the medium is replaced with fresh medium. Cells are harvested 16-24 hours after oligonucleotide treatment. [00172] The concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations.
  • Buffer RW1 1 mL of Buffer RW1 is added to each well of the RNEASY 96 TM plate and the vacuum again applied for 15 seconds.
  • 1 mL of Buffer RPE is then added to each well of the RNEASY 96 TM plate and the vacuum applied for a period of 15 seconds.
  • the Buffer RPE wash is then repeated and the vacuum is applied for an additional 10 minutes.
  • the plate is then removed from the QIAVACTM manifold and blotted dry on paper towels. The plate is then re-attached to the QIAVACTM manifold fitted with a collection tube rack containing 1.2 mL collection tubes. RNA is then diluted by pipetting 60 ⁇ L water into each well, incubating one minute, and then applying the vacuum for 30 seconds.
  • Quantitation of Navl .3 mRNA levels is determined by real-time quantitative PCR using the ABI PRISM 7700 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions.
  • ABI PRISM 7700 Sequence Detection System PE-Applied Biosystems, Foster City, CA
  • PCR polymerase chain reaction
  • amplification products are quantitated after the PCR is completed
  • products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that amieals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes.
  • a reporter dye e.g., JOE, FAMTM, or VIC, obtained from either Operon Technologies Inc., Alameda, CA or PE- Applied Biosystems, Foster City, CA
  • a quencher dye e.g., TAMRA, obtained from either Operon Technologies Inc., Alameda, CA or PE-Applied Biosystems, Foster City, CA
  • reporter dye emission is quenched by the proximity of the 3' quencher dye.
  • annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5 '-exonuclease activity of Taq polymerase.
  • cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated.
  • additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISMTM 7700 Sequence Detection System.
  • a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples .
  • PCR reagents can be obtained from PE-Applied Biosystems, Foster City, CA.
  • RT-PCR reactions are carried out by adding 25 ⁇ L PCR cocktail (lx TAQMANTM buffer A, 5.5 MM MgCl 2 , 300 ⁇ M each of dATP, dCTP and dGTP, 600 ⁇ M of dUTP, 100 nM each of forward primer, reverse primer, and probe, 20 Units RNAse inhibitor, 1.25 Units AMPLITAQ GOLDTM, and 12.5 Units MuLV reverse franscriptase) to 96 well plates containing 25 ⁇ L poly(A) mRNA solution.
  • the RT reaction is carried out by incubation for 30 minutes at 48 °C.
  • Probes and primers to human Navl .3 were designed to hybridize to a human Navl .3 sequence, using published sequence, information (GenBank accession number NM_006922, inco ⁇ orated herein as Figure 1.
  • the PCR primers were: forward primer: TTGACTTTGTGGTGGTGATTCTCT SEQ ID NO : 9097
  • PCR probe is: FAM- ACCTTGTTCCGAGTGATCCGTCTTGC SEQ ID NO:
  • the PCR probe is: 5' JOE- CGCGTCTCCTTTGAGCTGTTTGCA SEQ ID NO: 1
  • oligonucleotides are designed to target different regions of the human Navl.3 RNA, using published sequences (NM_006922, incorporated herein as Figure 1.
  • the oligonucleotides are shown in Table 1. "Position" indicates the first (5 '-most) nucleotide number on the particular target sequence to which the oligonucleotide binds.
  • the indicated parameters for each oligo were predicted using RNAstructure 3.7 by David H. Mathews, Michael Zuker, and Douglas H. Turner.
  • All compounds in Table 1 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting often 2'deoxynucleotides, which is flanked on both sides (5' and 3' directions) by four-nucleotide "wings".
  • the wings are composed of 2 '-methoxyethyl (2'-MOE) nucleotides.
  • Cytidine residues in the 2' -MOE wings are 5- methylcytidines. All cytidine residues are 5-methylcytidines.
  • TGCTTTTAATTTGCCTTTGT 8650 SEQ ID NO:58 -21.9 -22.3 66.3 0.3 0 -3.6
  • GGGTAGTGCTCCATGGCCAT 2800 SEQ ID NO: 61 -21.5 -30 83.5 -7.4 -0.4 -10 AATTTGCCTTTGTTCTGTAG
  • TTGTTCTGTAGTACTGCTTG 8634 SEQ ID NO: 74 -21 -22.4 69.5 -0.7 0 -7.8
  • TTTTCTCTGACCTCTTTTCC 6445 SEQ ID NO: 86 -20.5 -24.6 73.4 -4.1 0 -2.2
  • TCCCCACGGTCTCCCTTAAC 5680 SEQ ID NO: 91 -20.4 -30.4 79.6 -9.4 -0.3 -3.5
  • AAAGTAGGAAGTGGTGTTGG 1337 SEQ ID NO: 94 -20.3 -20.7 63.1 1.7 0 -1.3
  • ATCCTTTGCCCGACCTCTGA 2210 SEQ ID NO: 112 -19.7 -29.7 78.8 -10 0 -3
  • GATTTCTATAACTTTTGGCT 3569 SEQ ID NO: 114 -19.7 -20.1 61.9 0 0 -3.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol kcal/mol
  • AATAGGTTTTGTCAGTAGGC 7784 SEQ ID NO: 116 -19.7 -21.9 67.8 -2.2 0 -2.8
  • CTTGTTCCTTTTTGGGCTTC 576 SEQ ID NO:121 -19.5 -25.6 75.8 -5.6 -0.2 -3.8
  • ATGTTTTCCCAGCAGCACGT 1650 SEQ ID NO: 122 -19.5 -27.8 77.3 -8.3 0 -5.4
  • CCCACGGTCTCCCTTAACTG 5678 SEQ ID NO: 124 -19.5 -28.9 76.4 -9.4 0.2 -3.5
  • ATCTTTTCATCCTGCACATT 454 SEQ ID NO:125 -19.4 -23.5 69.5 -4.1 0 -4.8
  • GCATCTGAGCCATTTCCACA 1480 SEQ ID NO: 130 -19.3 -27.1 76 -7.8 0 -3.8
  • ACCTACTCCACTGAAATCTC 1880 SEQ ID NO: 131 -19.3 -23 66.6 -3.7 0 -2.5
  • CAGTAGCAGCAAGGTTGTCT 3438 SEQ ID NO: 138 -19.2 -24.9 74.5 -5.7 0 -4.6
  • TTTTTCTGGTTTGTCTTTCT 6416 SEQ ID NO: 262 -18 -22.3 70.2 -4.3 0 -1.5
  • CTTCTCTTTCTGACTTCCGT 2506 SEQ ID NO: 272 -17.8 -25.3 74.3 -7.5 0 -2.6
  • TTCGAAGATTCCACCAGATC 4041 SEQ ID NO: 283 -17.7 -22.9 65.8 -4.5 -0.4 -6.2
  • CTTTTTCTGCTGGTTGAAGT 4880 SEQ ID NO:285 -17.7 -22.9 69.2 -5.2 0 -3.7
  • ACGTTTCAAAGTGGTTGTAA 6143 SEQ ID NO:288 -17.7 -20 60.6 -1.6 -0.4 -5.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol kcal/mol
  • TAAGCTGTTCGAGCATCTGC 1809 SEQ ID NO:291 -17.6 -24.4 71.1 -4.5 -2.3 -7.6
  • CTCACGGCTCTTTGCCTTCC 2572 SEQ ID NO:304 -17.5 -29.6 81.4 -9.9 -2.2 -5.7
  • TTCCCATCTCTAAGATAATT 3655 SEQ ID NO:309 -17.5 -20.5 61.5 -2.4 ⁇ -0.3 -4.3
  • TTTTCGAAGATTCCACCAGA 4043 SEQ ID NO: 311 -17.5 -22.7 65.1 -4.5 -0.4 -6.8
  • TAGCCAGCGCCAACATTATC 4672 SEQ ID NO:312 -17.5 -25.7 70.8 -7.5 -0.5 -7.6
  • GCAACTGCCTGAGCTTCTTC 1840 SEQ ID NO: 323 -17.4 -26.8 76.8 -8.2 -1.1 -5.2
  • CAGTACAGACAATCCCTCCA 3002 SEQ ID NO:327 -17.4 -25.7 71.8 -7.6 -0.4 -5.3
  • TTTCGAAGATTCCACCAGAT 4042 SEQ ID NO:328 -17.4 -22.6 64.7 -4.5 -0.4 -6.8
  • TCTAGCATGGTTTTGATAGT 4174 SEQ ID NO: 329 -17.4 -21.7 67.1 -3.4 -0.7 -4.3
  • GCCATTAAAGTAGGAAGTGG 1343 SEQ ID NO: 340 -17.3 -21.3 63 -4 0 -3.7
  • AGAATAGGTTTTGTCAGTAG 7786 SEQ ID NO: 350 -17.3 -19.5 62.1 -2.2 0 -2.7 TTGCCACTTTGTTCATGGCT
  • ATGTGCTGTGTTCATCATCA 2253 SEQ ID NO: 356 -17.2 -23.7 71.9 -6.5 0 -3.6
  • TCAGGGGCTCTGCACTTTCT 5808 SEQ ID NO:369 -17.2 -27.8 81.1 -9.6 -0.9 -4.8
  • TGTTCCTTTTTGGGCTTCTT 574 SEQ ID NO: 373 -17.1 -25.6 75.8 -8 -0.2 -3.8
  • TACAGACAATCCCTCCACAT 2999 SEQ ID NO:375 -17.1 -24.7 68.9 -7.6 0 -2.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol kcal/mol
  • ATAGCCAGCGCCAACATTAT 4673 SEQ ID NO:377 -17.1 -25.3 69.3 -7.5 -0.5 -7.6
  • AAGATTTTCCCAATAGTCTT 1616 SEQ ID NO: 383 -17 -20.9 62.8 -3.9 0 -3.5
  • TTCCTGTTGCTTTTTAAGCT 1823 SEQ ID NO:385 -17 -23.5 69.9 -3.9 -2.6 -7.1
  • CAGTCATGGGGTAGTGCTCC 2808 SEQ ID NO:390 -17 -27.8 81.4 -10.3 -0.1 -6.7
  • TTCTTTTTCTGCTGGTTGAA 4882 SEQ ID NO:396 -17 -22.2 67.5 -5.2 0 -3.7
  • ATTTGAATCCATTGTGCCAT 1358 SEQ ID NO:408 -16.9 -23 66.2 -6.1 0 -3.1
  • AGTACAGACAATCCCTCCAC 3001 SEQ ID NO:414 -16.9 -25.2 71.2 -7.6 -0.4 -5.3
  • TTTTGTCAGTAGGCAGTATC 7778 SEQ ID NO: 425 -16.9 -22.5 70.6 -5.1 -0.1 -4
  • CCAAACTTCTTTTTCTGCTG 4888 SEQ ID NO:430 -16.8 -22.2 65.3 -5.4 0 -3.6
  • AATAATCATGTCTTGTTTTA 6290 SEQ ID NO:433 -16.8 -17.2 55.6 1.3 0 -4.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol kcal/mol
  • CTTTTCATCCTGCACATTTA 452 SEQ ID NO: 435 -16.7 -22.9 67.7 -6.2 0 -4.8
  • AATTGCCTTTCCTTTATTCA 749 SEQ ID NO: 436 -16.7 -22.7 66.6 -6 0 -3
  • TTTAAGCTGTTCGAGCATCT 1811 SEQ ID NO: 441 -16.7 -22.8 67.6 -4.5 -1.5 -7.4
  • ATCAGTAGCAGCAAGGTTGT 3440 SEQ ID NO: 445 -16.7 -24 72.3 -7.3 0 -5.4
  • TTCTGCTGGTTGAAGTTATC 4876 SEQ ID NO: 48 -16.7 -21.9 67.4 -5.2 0 -3.7
  • TGTATTCGAAGGGCATCCAT 6070 SEQ ID NO: 450 -16.7 -24.1 68.5 -6.2 -1.1 -8.2
  • GGTATCTCATCCCTGTCAAA 266 SEQ ID NO:455 -16.6 -24.7 71.4 -8.1 0 -2.4
  • TTGAATCCATTGTGCCATTA 1356 SEQ ID NO:456 -16.6 -22.7 65.7 -6.1 0 -3.1
  • AAAGTGGTTGTAATAGGCTC 6136 SEQ ID NO: 463 -16.6 -20.5 62.9 -3.9 0 -3.7
  • TATCTCATTTATTCTTACAA 348 SEQ ID NO: 472 -16.5 -17.4 56.2 -0.7 0 -0.9
  • ATCATTATCTTGTTCCTTTT 584 SEQ ID NO: 473 -16.5 -21.2 65.6 -4.7 0 -1.9
  • TTTTCTGCTGGTTGAAGTTA 4878 SEQ ID NO:480 -16.5 -21.7 66.5 -5.2 0 -3.7
  • TTCCTTGGAATTTGTTTGCT 5004 SEQ ID NO:481 -16.5 -22.9 67.7 -5.6 -0.6 -6.3
  • ATCCATTGTGCCATTAAAGT 1352 SEQ ID NO: 491 -16.4 -22.5 65.3 -6.1 0 -3.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol kcal/mol
  • CCACCAGATCTTCCCTTTGC 4031 SEQ ID NO:498 -16.4 -28.9 78.9 -12.5 0 -5.6
  • CCTGTCTTCCATCTGTATTC 6083 SEQ ID NO: 501 -16.4 -25.3 75.2 -8.9 0 -1.6
  • ACCCTGCTTCACAGAGTTGC 6638 SEQ ID NO:502 -16.4 -27.6 78.4 -9.9 -1.2 -4.8
  • AAATGATCTAGGTTTGAGTG 8100 SEQ ID NO:507 -16.4 -18.6 58.5 -2.2 0 -4.9
  • GGTGGTTACTACTATTATTA 8731 SEQ ID NO:510 -16.4 -19.8 62.1 -2.9 -0.1 -3.9
  • TTCCTTTTTGGGCTTCTTGG 572 SEQ ID NO: 511 -16.3 -25.6 74.9 -8.8 -0.2 -3.8
  • TTTCCCAATAGTCTTGAGTC 1611 SEQ ID NO: 512 -16.3 -23.1 69.4 -6.8 0.3 -3.3
  • CTTCCTGTTGCTTTTTAAGC 1824 SEQ ID NO: 513 -16.3 -23.5 69.9 -5.4 -1.8 -6.1
  • GAAGATTCCACCAGATCTTC 4038 SEQ ID NO:518 -16.3 -23 67.5 -4.5 -2.2 -6.8
  • ATTCCTTGGAATTTGTTTGC 5005 SEQ ID NO: 520 -16.3 -22 65.7 -4.1 -1.5 -8.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol kcal/mol
  • GCAGCATAGGCAATATTAAC 7562 SEQ ID NO: 525 -16.3 -20.7 61.8 -2.7 -1.6 -6.7
  • TGAATCATGCACTAGTTTGT 8613 SEQ ID NO: 529 -16.3 -20.9 63.7 -4.6 0 -5.7
  • ATCTGAGCCATTTCCACAGA 1478 SEQ ID NO: 535 -16.2 -25.2 72.2 -7.8 -1.1 -4.9
  • ATCGCAGTACAGACAATCCC 3006 SEQ ID NO: 543 -16.2 -24.7 69.4 -7.8 -0.4 -5.3
  • GATACCCTGCTTCACAGAGT 6641 SEQ ID NO:549 -16.2 -26 74.4 -8.5 -1.2 -5.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol kcal/mol
  • TTGTCAGTAGGCAGTATCCA 7776 SEQ ID NO:551 -16.2 -25 75.1 -8.3 -0.2 -4
  • GAAGAATAGGTTTTGTCAGT 7788 SEQ ID NO:552 -16.2 -19.7 61.7 -3.5 0 -2.7
  • TGCTTGTTTTGCTATTGCGT 2181 SEQ ID NO: 564 -16.1 -24.6 71.7 -6.9 -1.5 -5.8
  • GTTCCATTCCCATCTCTAAG 3661 SEQ ID NO:567 -16.1 -25.2 72.6 -9.1 0 -1.6
  • TTAATACACCCTTCAGTAAA 3976 SEQ ID NO:568 -16.1 -19.5 58.5 -3.4 0 -3.6
  • ATACCCTGCTTCACAGAGTT 6640 SEQ ID NO: 570 -16.1 -25.5 73.5 -8.5 -0.7 -5.1
  • TTTATTCTTACAATATCCCT 341 SEQ ID NO: 571 -16 -20.3 61.4 -4.3 0 -2.6
  • TCCCATCTCTAAGATAATTA 3654 SEQ ID NO:578 -16 -20.1 60.7 -3.4 -0.5 -4.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol kcal/mol
  • ATCATGCACTAGTTTGTTGT 8610 SEQ ID NO:586 -16 -22.3 68.5 -6.3 0 -5.7
  • TTAAGCTGTTCGAGCATCTG 1810 SEQ ID NO:587 -15.9 -22.7 67.1 -4.5 -2.3 -7.3
  • TATTTCAATTCCAGTATTAT 3623 SEQ ID NO:590 -15.9 -18.2 57.6 -2.3 0 -2.5
  • TTGCTTATTTCAATTCCAGT 3628 SEQ ID NO: 591 -15.9 -21.6 65.2 -5.7 0 -3.6
  • TCATCCTCACTCAGGGGCTC 5818 SEQ ID NO: 594 -15.9 -28.4 82.4 -11.6 -0.8 -7.6
  • GCAGCACGTTTTTCGATAGC 541 SEQ ID NO: 600 -15.8 -24.9 71.1 -8.1 -0.9 -5.8
  • AATGTGCTGTGTTCATCATC 2254 SEQ ID NO: 602 -15.8 -22.3 68.1 -6.5 0 -3.1
  • CTGTTGCGTCGCTCTCCATG 2320 SEQ ID NO: 603 -15.8 -28.3 78.2 -12.5 0.4 -6.2
  • AGTTTACTTTCACGTTTTTC 4650 SEQ ID NO: 607 -15.8 -20.5 64 -4.7 0 -4.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol kcal/mol
  • TAAACATGACCAGGAAGAGC 5454 SEQ ID NO: 610 -15.8 -20.2 59.6 -4.4 0 -5.2
  • CGGTCTCCCTTAACTGAGCT 5674 SEQ ID NO: 611 -15.8 -27.3 75.6 -10.9 -0.3 -6.2
  • GACAGGGTTCTTGTATACTG 6933 SEQ ID NO: 616 -15.8 -22.3 68 -5.8 -0.4 -6.5
  • TTAATAGAAGTTGTTTATCA 7441 SEQ ID NO: 618 -15.8 -16.2 53.4 0.4 0 -2.9
  • GGTAGAAAATGATCTAGGTT 8106 SEQ ID NO: 622 -15.8 -18.7 58.3 -2.2 -0.4 -4.9
  • TTTTTTTTTTTCCACCTTAT 9086 SEQ ID NO: 624 -15.8 -21 63.7 -5.2 0 -0.5
  • CATGGATCACGAAGAAACGT 1021 SEQ ID NO: 625 -15.7 -19.9 57.7 -3.4 -0.6 -6
  • AGCAGCACGTAATGTCAACT 1640 SEQ ID NO: 628 -15.7 -22.9 66.3 -7.2 0 -5.4
  • CTTTGCTTATTTCAATTCCA 3630 SEQ ID NO: 633 -15.7 -21.4 64.1 -5.7 0 -3.6

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Genetics & Genomics (AREA)
  • Pain & Pain Management (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Psychiatry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Antisense compounds, compositions, and methods are provided for modulating the expression of Type III sodium channel Nav1.3. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding Nav1.3. Methods of using these compounds for modulation of Nav1.3 expression and for treatment of diseases associated with expression of Nav1.3 are provided.

Description

ANTISENSE MODULATION OF Navl.3 EXPRESSION
The present application claims priority under Title 35, United States Code, § 119 to United States Provisional application Serial No. 60/403,416, filed August 14, 2002, which is incorporated by reference in its entirety as if written herein.
FIELD OF THE INVENTION [001] The present invention provides compositions and methods for modulating the expression of Type III sodium channel (Navl.3). In particular, this invention relates to antisense compounds, particularly oligonucleotides, specifically hybridizable with nucleic acids encoding Type III sodium channel (Navl.3). Such oligonucleotides have been shown to modulate the expression of Type III sodium channel (Navl.3).
BACKGROUND OF THE INVENTION
[002] Voltage-dependent sodium channels play a fundamental role in controlling neuronal membrane excitability. They are responsible for the upstroke of the action potential in neurons. Neuropathic pain is considered to be the result of injured and/or remodeled neurons, which exhibit an increase in excitability in both primary afferent fibers and synaptic contacts within the central pain processing pathway. Thus it is not surprising that three of the four drugs of choice used in the treatment of neuropathic pain syndromes are sodium channel blockers. These include carbamazepine, lamotrigine, and phenytoin. In addition, lidocaine, another sodium channel blocker, was recently approved for treatment of certain types of neuropathic pain. However, although sodium channel blockers are currently the treatment of choice for neuropathic pain, they have been only moderately successful in treating these conditions. A primary factor in the weak efficacy of these compounds is their lack of selectivity and low affinity for the various sodium channels resulting in numerous side effects including emesis, dizziness, ataxia, and cardiotoxicity. [003] Many recent efforts have been focused on defining and describing which sodium channels are actively involved in the development and maintenance of neuropathic pain. The alpha subunit is the pore forming subunit and to date, 11 alpha subunits have been identified including 7 neuronal, 2 glial, 1 muscular, 1 cardiac subunit. The alpha subunits can be divided into three classes based on their sensitivity to tetrodotoxin (TTX): TTX sensitive (TTXs), TTX resistant (TTXr), and TTX insensitive (TTXi). TTXs channels are sensitive to TTX in the nanomolar range, have a low threshold for activation and rapid inactivation kinetics. These channels include the skeletal muscle channel, two channels that are found primarily in peripheral neurons and all brain type channels described thus far. [004] Recent reports have suggested that the type III sodium channel
(Navl.3) may also be involved in neuropathic pain development and maintenance. This particular channel is found in brain, peripheral nerve and, neuroendocrine cells. Critically, it is absent from heart and many other peripheral organs. The mRNA for Navl .3 increases in small and large DRG neurons following axotomy in animal models (Dib-Hajj S, et al, Proc.Natl. Acad. Sci. 1996; 93:14950-14954), suggesting its involvement in neuropathic pain. It has recently been demonstrated that peripheral nerve damage produced a large increase in the expression of a tetrodotoxin (TTX)- sensitive Navl .3 sodium channel (Boucher TJ, et al, Science 2000; 290: 124- 127) They also replicated past experiments from several labs establishing that the development of neuropathic pain is linked to increased spontaneous activity following nerve damage and that this ectopic activity is sensitive to TTX. Finally, the study from Wood's group also found that glial-derived neurotrophic factor (GDNF) prevented the induction of Navl .3, reduced the spontaneous activity of the injured nerve, thus preventing the resulting neuropathic pain. These studies implicated TTX- sensitive sodium channels, and in particular Navl.3, as having a role in the development and maintenance of neuropathic pain that follows nerve damage. [005] Despite the variety of sodium channel inhibitors disclosed in the art, there still remains a need for therapeutic agents capable of effectively and specifically inhibiting the function of the Type III sodium channel (Navl.3). Furthermore, antisense technology could specifically target neonatal vs. adult forms of Navl .3. Exon 6 of the Navl .3 gene is alternatively spliced in humans (Lu C-M, Brown GB. J. Mol. Neurosci. 1988; 10:67-70) and rodents (Gustafson TA, et al. J. Biol. Chem. 1993; 268:18648-53). The two alternative exon 6 sequences are very similar, differing by only a single amino acid at the protein level, but they could be targeted individually by sequence-specific antisense oligonucleotides. This could be useful in the treatment of certain pediatric disorders, such as neonatal, infantile, or childhood epilepsies.
[006] Antisense technology is emerging as an effective means for reducing the expression of specific gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of Navl.3 expression.
SUMMARY OF THE INVENTION
[007] The present invention is directed to antisense compounds, particularly oligonucleotides, which are targeted to a nucleic acid encoding Navl.3, and which modulate the expression of Navl.3. Pharmaceutical and other compositions comprising the antisense compounds of the invention are also provided. Further provided are methods of modulating the expression of Navl .3 in cells or tissues comprising contacting said cells or tissues with one or more of the antisense compounds or compositions of the invention. Further provided are methods of treating an animal, particularly a human, suspected of having or being prone to a disease or condition associated with expression of Navl.3 by administering a therapeutically or prophylactically effective amount of one or more of the antisense compounds or compositions of the invention.
DETAILED DESCRIPTION OF THE INVENTION
[008] The present invention employs oligomeric antisense compounds, particularly oligonucleotides, for use in modulating the function of nucleic acid molecules encoding Navl.3, ultimately modulating the amount of Navl .3 produced. This is accomplished by providing antisense compounds, which specifically hybridize with one or more nucleic acids encoding Navl.3. As used herein, the terms "target nucleic acid" and "nucleic acid encoding Navl .3" encompass DNA encoding Navl .3, RNA (including pre- mRNA and mRNA) transcribed from such DNA, and also cDNA derived from such RNA. The specific hybridization of an oligomeric compound with its target nucleic acid interferes with the normal function of the nucleic acid. This modulation of function of a target nucleic acid by compounds, which specifically hybridize to it, is generally referred to as "antisense". The functions of DNA to be interfered with include replication and transcription. The functions of RNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA. The overall effect of such interference with target nucleic acid function is modulation of the expression of Navl.3. In the context of the present invention, "modulation" means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene. In the context of the present invention, inhibition is the preferred form of modulation, of gene expression and mRNA is a preferred target. [009] It is preferred to target specific nucleic acids for antisense.
"Targeting" an antisense compound to a particular nucleic acid, in the context of this invention, is a multistep process. The process usually begins with the identification of a nucleic acid sequence whose function is to be modulated. This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In the present invention, the target is a nucleic acid molecule encoding Navl.3. The targeting process also includes determination of a site or sites within this gene for the antisense interaction to occur such that the desired effect, e.g., detection or modulation of expression of the protein, will result. Within the context of the present invention, a preferred intragenic site is the region encompassing the translation initiation or termination codon of the open reading frame (ORF) of the gene. Since, as is known in the art, the translation initiation codon is typically 5'-AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon," the "start codon" or the "AUG start codon". A minority of genes have a translation initiation codon having the RNA sequence 5 '-GUG, 5 '-UUG or 5 '-CUG, and 5 '-
AUA, 5'-ACG and 5'-CUG have been shown to function in vivo. Thus, the terms "translation initiation codon" and "start codon" can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions. In the context of the invention, "start codon" and "translation initiation codon" refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding Navl.3, regardless of the sequence(s) of such codons. [0010] It is also known in the art that a translation termination codon (or "stop codon") of a gene may have one of three sequences, i.e. 5'-UAA, 5'- UAG and 5 '-UGA (the corresponding DNA sequences are 5 '-TAA, 5 '-TAG and 5'-TGA, respectively). The terms "start codon region" and "translation initiation codon region "refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation initiation codon. Similarly, the terms "stop codon region" and "translation termination codon region "refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation termination codon. [0011] The open reading frame (ORF) or "coding region," which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is also a region which may be targeted effectively. Other target regions include the 5 ' untranslated region (5 'UTR), known in the art to refer to the portion of an mRNA in the 5 ' direction from the translation initiation codon, and thus including nucleotides between the 5 ' cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene, and the 3' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA or corresponding nucleotides on the gene. The 5' cap of an mRNA comprises an N7-methylated guanosine residue joined to the 5'-most residue of the mRNA via a 5 '-5' triphosphate linkage. The 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap. The 5' cap region may also be a preferred target region.
[0012] Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as "introns," which are excised from a transcript before it is translated. The remaining (and therefore translated) regions are known as "exons" and are spliced together to form a continuous mRNA sequence. mRNA splice sites, i.e., intron-exon junctions, may also be preferred target regions, and are particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular mRNA splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred targets. It has also been found that introns can also be effective, and therefore preferred, target regions for antisense compounds targeted, for example, to DNA or pre-mRNA. [0013] Once one or more target sites have been identified, oligonucleotides are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
[0014] In the context of this invention, "hybridization" means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases. For example, adenine and thymine are complementary nucleobases, which pair through the formation of hydrogen bonds. "Complementary," as used herein, refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a DNA or RNA molecule, then the oligonucleotide and the DNA or RNA are considered to be complementary to each other at that position. The oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other. Thus, "specifically hybridizable" and "complementary" are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target. It is understood in the art that the sequence of an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. An antisense compound is specifically hybridizable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed. [0015] Antisense compounds are commonly used as research reagents and diagnostics. For example, antisense oligonucleotides, which are able to inhibit gene expression with exquisite specificity, are often used by those of ordinary skill to elucidate the function of particular genes. Antisense compounds are also used, for example, to distinguish between functions of various members of a biological pathway. Antisense modulation has, therefore, been harnessed for research use.
[0016] The specificity and sensitivity of antisense is also harnessed by those of skill in the art for therapeutic uses. Antisense oligonucleotides have been employed as therapeutic moieties in the treatment of disease states in animals and man. Antisense oligonucleotides have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that oligonucleotides can be useful therapeutic modalities that can be configured to be useful in treatment regimes for treatment of cells, tissues and animals, especially humans. In the context of this invention, the term "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases. [0017] While antisense oligonucleotides are a preferred form of antisense compound, the present invention comprehends other oligomeric antisense compounds, including but not limited to oligonucleotide mimetics such as are described below. The antisense compounds in accordance with this invention preferably comprise from about 8 to about 30 nucleobases (i.e. from about 8 to about 30 linked nucleo sides). Particularly preferred antisense compounds are antisense oligonucleotides, even more preferably those comprising from about 12 to about 25 nucleobases. As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn the respective ends of this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal I linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage. [0018] Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
[0019] Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3 'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3 '-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included. [0020] Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of which is herein incorporated by reference. [0021] Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. [0022] Representative United States patents that teach the preparation of the above oligonucleosides mclude, but are not limited to, U.S. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference.
[0023] In other preferred oligonucleotide mimetics, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.
[0024] Most preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular -CH -NH-O-CH -, -CH -N (CH3) -O-CH2- [known as a methylene (methylimino) or MMI backbone] , - CH2-O-N (CH3) -CH2-, -CH2N(CH3)-N(CH3)-CH2- and -O-N(CH3)-CH2- CH - [wherein the native phosphodiester backbone is represented as -O-P- O-CH -] of the above referenced U.S. patent 5,489,677, and the amide backbones of the above referenced U.S. patent 5,602,240. Also preferred are oligonucleotides having morpholino backbone structures of the above- referenced U.S. patent 5,034,506.
[0025] Modified oligonucleotides may also contain one or more substituted sugar moieties. Preferred oligonucleotides comprise one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C] to C]0 alkyl or C2 to do alkenyl and alkynyl. Particularly preferred are O[(CH2)nO]mCH , O(CH2)n,OCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2nON[(CH2)nCH3)]2 where n and m are from 1 to about 10. Other preferred oligonucleotides comprise one of the following at the 2' position: Ci to Cio, ( lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, CI, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ON0 , NO , N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A preferred modification includes 2' -methoxyethoxy (T -O-CH2CH2OCH3, also known as 2'-O- (2- methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Ada, 1995, 78, 486- 504) i.e., an alkoxyalkoxy group. A further preferred modification includes 2'-dimethylaminooxyethoxy, i.e., a O(CH ) ON(CH3)2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'- dimethylaminoethoxyethoxy (also known in the art as 2'-O- dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N (CH ) , also described in examples herein below.
[0026] Other preferred modifications include 2'-methoxy (2'-O CH3), 2'-aminopropoxy (2'-O CH2 CH2 CH2NH2) and 2'-fluoro (2'-F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3 ' position of the sugar on the 3 ' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, each of which is herein incorporated by reference in its entirety. [0027] Oligonucleotides may also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5- halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5- substituted uracils and cytosines, 7-methylquanine and 7-methyladenine, 8- azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3- deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in United States Patent No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858- 859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al, Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S.T. and Lebleu, B. ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds, Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2 '-O- methoxy ethyl sugar modifications.
[0028] Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. 3,687,808, as well as U.S. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,750,692; and 5,681,941, each of which is herein incoφorated by reference. [0029] Another modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates, which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S- tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al, Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et a\., EMBOJ., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett, 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl- rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Mancharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 365'-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Ada, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).
[0030] Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S.
4,828,979; 4,948,882; 5,218,105; 5,525,465 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, each of which is herein incorporated by reference.
[0031] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligonucleotide. The present invention also includes antisense compounds, which are chimeric compounds. "Chimeric" antisense compounds or "chimeras," in the context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound. These oligonucleotides typically contain at least one region wherem the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease, which cleaves the RNA strand of RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxyoligonucleotides hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
[0032] Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of which is herein incorporated by reference in its entirety. [0033] The antisense compounds used in accordance with this invention may be conveniently, and routinely made tlirough the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives. [0034] The antisense compounds of the invention are synthesized in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules. The compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. Representative United States patents that teach the preparation of such uptake, distribution and/or absorption assisting formulations include, but are not limited to, U.S. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756, each of which is herein incorporated by reference.
[0035] The antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrags and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrags, and other bioequivalents. [0036] The term "prodrug" indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions. In particular, prodrug versions of the oligonucleotides of the invention are prepared as SATE [(S-acetyl-2- thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al., published December 9, 1993 or in WO 94/26764 to Imbach et al.
[0037] The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. [0038] Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines. Examples of metals used as cations are sodium, potassium, magnesium, calcium, and the like. Examples of suitable amines are N, N'- dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine (see, for example, Berge et al., "Pharmaceutical Salts," J. ofPharma Sci., 1911, 66, 119). The base addition salts of said acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional manner. The free acid form may be regenerated by contacting the salt form with an acid and isolating the free acid in the conventional manner. The free acid forms differ from their respective salt forms somewhat in certain physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acid for purposes of the present invention. As used herein, a "pharmaceutical addition salt" includes a pharmaceutically acceptable salt of an acid form of one of the components of the compositions of the invention. These include organic or inorganic acid salts of the amines. Preferred acid salts are the hydrochlorides, acetates, salicylates, nitrates and phosphates. Other suitable pharmaceutically acceptable salts are well known to those skilled in the art and include basic salts of a variety of inorganic and organic acids, such as, for example, with inorganic acids, such as for example hydrochloric acid, hydrobromic acid, sulfuric acid or phosphoric acid; with organic carboxylic, sulfonic, sulfo or phospho acids or N-substituted sulfamic acids, for example acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic acid, 2- phenoxybenzoic acid, 2-acetoxybenzoic acid, embonic acid, nicotinic acid or isonicotinic acid; and with amino acids, such as the 20 alpha-amino acids involved in the synthesis of proteins in nature, for example glutamic acid or aspartic acid, and also with phenylacetic acid, methanesulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, ethane- 1 ,2-disulfonic acid, benzenesulfonic acid, 4-methylbenzenesulfoic acid, naphthalene-2- sulfonic acid, naphthalene- 1,5-disulfonic acid, 2- or 3-phosphoglycerate, glucose-6-phosphate, N-cyclohexylsulfamic acid (with the formation of cyclamates), or with other acid organic compounds, such as ascorbic acid. Pharmaceutically acceptable salts of compounds may also be prepared with a pharmaceutically acceptable cation. Suitable pharmaceutically acceptable cations are well known to those skilled in the art and include alkaline, alkaline earth, ammonium and quaternary ammonium cations. Carbonates or hydrogen carbonates are also possible. [0039] For oligonucleotides, preferred examples of pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfliric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p- toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine. [0040] The antisense compounds of the present invention can be utilized for diagnostics, therapeutics, prophylaxis, and as research reagents and kits. For therapeutics, an animal, preferably a human, suspected of having a disease or disorder, which can be treated by modulating the expression of Navl .3, is treated by administering antisense compounds in accordance with this invention. The compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of an antisense compound to a suitable pharmaceutically acceptable diluent or carrier. Use of the antisense compounds and methods of the invention may also be useful prophylactically, e.g., to prevent or delay infection, inflammation or tumor formation, for example. [0041] The antisense compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding Navl.3, enabling sandwich and other assays to easily be constructed to exploit this fact. Hybridization of the antisense oligonucleotides of the invention with a nucleic acid encoding Navl .3 can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide or any other suitable detection means. Kits using such detection means for detecting the level of Navl.3 in a sample may also be prepared.
[0042] The present invention also includes pharmaceutical compositions and formulations, which include the antisense compounds of the invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2'-O- methoxyethyl modification are believed to be particularly useful for oral administration. [0043] Intraventricular drug administration, for the direct delivery of drug to the brain of a patient, may be desired for the treatment of patients with diseases or conditions afflicting the brain. To effect this mode of oligonucleotide administration, a silicon catheter is surgically introduced into a ventricle of the brain of a human patient, and is connected to a subcutaneous infusion pump
(SynchroMed 0 and IsoMee infusion systems, Medtronic Inc., Minneapolis, Minn.) that has been surgically implanted in the abdominal region (Zinnu et al., Cancer Research, 1984, 44, 1698. The pump is used to inject the oligonucleotides and allows precise dosage adjustments and variation in dosage schedules with the aid of an external programming device. The reservoir capacity of the pump is 18-20 mL and infusion rates may range from 0.1 mL/h to 1 mL/h. Depending on the frequency of administration, ranging from daily to monthly, and the dose of drug to he administered, ranging from 0.01 micro g to 100 g per kg of body weight, the pump reservoir may be refilled at 3 -10 week intervals. Refilling of the pump is accomplished by percutaneous puncture of the self-sealing septum of the pump.
[0044] Intrathecal Epidural, Subdural, drug administration, for the introduction of a drug into the spinal column of a patient may be desired for the treatment of patients with diseases of the central nervous system. To effect this route of oligonucleotides administration, a silicon catheter is surgically implanted subarachnoid spinal interspace of a human patient for example implantation into the L3-4 lumbar cord would target the legs), and is connected to a subcutaneous infusion pump which has been surgically implanted in the upper abdominal region (Luer and Hatton, The Annals ofPharmacotherapy, 1993, 27, 912; Ettinger et al., 1978, Cancer, 41, 1270, 1978; Yaida et al., Regal. Pept, 1995, 59, 193). The pump is used to inject the oligonucleotides and allows precise dosage adjustments and variations in dose schedules with the aid of an external programming device. The reservoir capacity of the pump is 18-20 mL, and infusion rates may vary from 0. 1 mL/h to 1 mL& Depending on the frequency of drug administration, ranging from daily to monthly, and dosage of drug to be administered, ranging from 0.01 micro g to 100 g per kg of body weight, the pump reservoir may be refilled at 3 -10 week intervals. Refilling of the pump is accomplished by a single percutaneous puncture to the self-sealing septum of the pump. The distribution, stability and pharmacokinetics of oligonucleotides within the central nervous system may be followed according to known methods. Subdural administration is also envisioned other by a pump mechanism or direct injection.
[0045] To effect delivery of oligonucleotides to areas other than the brain or spinal column via this method, the silicon catheter is configured to connect the subcutaneous infusion pump to, e.g., the hepatic artery, for delivery to the liver. Infusion pumps may also be used to effect systemic delivery of oligonucleotides (Ewel et al., Cancer Research, 1992, 52, 3005; Rubenstein et al., J. Surg. Oncol., 1996, 62, 194).
[0046] Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.
[0047] Compositions and formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. [0048] Compositions and formulations for parenteral, intrathecal or intraventricular administration may mclude sterile aqueous solutions, which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients. [0049] Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that mclude, but are not limited to, preformed liquids, self- emulsifying solids and self-emulsifying semisolids.
[0050] The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques mclude the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
[0051] The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances, which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers. [0052] In one embodiment of the present invention the pharmaceutical compositions may be formulated and used as foams. Pharmaceutical foams include formulations such as, but not limited to, emulsions, microemulsions, creams, jellies and liposomes. While basically similar in nature these formulations vary in the components and the consistency of the final product. The preparation of such compositions and formulations is generally known to those skilled in the pharmaceutical and formulation arts and may be applied to the formulation of the compositions of the present invention. Emulsions
[0053] The compositions of the present invention may be prepared and formulated as emulsions. Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 μm in diameter. (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1 , p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y, volume 2, p. 335; Higuchi et al., in Remington 's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985, p. 301). Emulsions are often biphasic systems comprising of two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions may be either water-in-oil (w/o) or of the oil-in-water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions may contain additional components in addition to the dispersed phases and the active drug, which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants may also be present in emulsions as needed. Pharmaceutical emulsions may also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil- in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous provides an o/w/o emulsion. [0054] Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion may be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that may be incorporated into either phase of the emulsion. Emulsifiers may broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y., volume 1 , p. 199).
[0055] Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y., volume 1 , p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants may be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).
[0056] Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These mclude polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.
[0057] A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives, and antioxidants (Block, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). [0058] Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed phase droplets and by increasing the viscosity of the external phase. [0059] Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that may readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. Antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfϊte, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.
[0060] The application of emulsion formulations via dermatological, oral, and parenteral routes and methods for their manufacture have been reviewed in the literature (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for oral delivery have been very widely used because of reasons of ease of formulation, efficacy from an absorption and bioavailability standpoint. (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral-oil base laxatives, oil-soluble vitamins and high fat nutritive preparations are among the materials that have commonly been administered orally as o/w emulsions. [0061] In one embodiment of the present invention, the compositions of oligonucleotides and nucleic acids are formulated as microemulsions. A microemulsion may be defined as a system of water, oil and amphiphile, which is a single optically isofropic, and thermodynamically stable liquid solution (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N ., volume 1, p. 245). Typically microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain- length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 1852-5). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington 's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985, p. 271).
[0062] The phenomenological approach utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drags in a formulation of thermodynamically stable droplets that are formed spontaneously.
[0063] Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (S0750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and triglycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil. [0064] Microemulsions are particularly of interest from the standpoint of drag solubilization and the enhanced absorption of drags. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drags, including peptides (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol, 1993, 13, 205). Microemulsions afford advantages of improved drag solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form spontaneously when their components are brought together at ambient temperature. This may be particularly advantageous when formulating thermolabile drugs, peptides or oligonucleotides. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of oligonucleotides and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of oligonucleotides and nucleic acids within the gastrointestinal tract, vagina, buccal cavity and other areas of administration. [0065] Microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absoφtion of the oligonucleotides and nucleic acids of the present invention. Penetration enhancers used in the microemulsions of the present invention may be classified as belonging to one of five broad categories - surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above. Liposomes [0066] There are many organized surfactant stractures besides microemulsions that have been studied and used for the formulation of drugs. These include monolayers, micelles, bilayers and vesicles. Vesicles, such as liposomes, have attracted great interest because of their specificity and the duration of action they offer from the standpoint of drug delivery. As used in the present invention, the term "liposome" means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers. [0067] Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes possess the advantage of being able to fuse to the cell wall. Noncationic liposomes, although not able to fuse as efficiently with the cell wall, are taken up by macrophages in vivo.
[0068] In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome, which is highly deformable and able to pass through such fine pores.
[0069] Further advantages of liposomes include; liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incoφorate a wide range of water and lipid soluble drags; liposomes can protect encapsulated drags in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, P. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.
[0070] Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes. As the merging of the liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act. [0071] Liposomal formulations have been the focus of extensive investigation as the mode of delivery for many drags. There is growing evidence that for topical administration, liposomes present several advantages over other formulations. Such advantages mclude reduced side- effects related to high systemic absoφtion of the administered drug, increased accumulation of the administered drag at the desired target, and the ability to administer a wide variety of drags, both hydrophilic and hydrophobic, into the skin.
[0072] Several reports have detailed the ability of liposomes to deliver agents including high-molecular weight DNA into the skin. Compounds including analgesics, antibodies, hormones and high-molecular weight DNAs have been administered to the skin. The majority of applications resulted in the targeting of the upper epidermis.
[0073] Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes, which interact with the negatively charged DNA molecules to form a stable complex. The positively charged DNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al, Biochem. Biophys. Res. Commun., 1987, 147, 980 - 985) [0074] Liposomes, which are pH-sensitive or negatively charged, entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs.
Nevertheless, some DNA is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274). [0075] One maj or type of liposomal composition includes phospholipids other than naturally derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamme (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.
[0076] Several studies have assessed the topical delivery of liposomal drag formulations to the skin. Application of liposomes containing interferon to guinea pig skin resulted in a reduction of skin heφes sores while delivery of interferon via other means (e.g. as a solution or as an emulsion) were ineffective (Weiner et al., Journal of Drug Targeting, 1992, 2, 405-410). Further, an additional study tested the efficacy of interferon administered as part of a liposomal formulation to the administration of interferon using an aqueous system, and concluded that the liposomal formulation was superior to aqueous administration (du Plessis et al., Antiviral Research, 1992, 18, 259-265).
[0077] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drags to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasome ™ I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome™ II (glyceryl distearate/ cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporin-A into different layers of the skin (Hu et al. S. T.P.Pharma. Sci., 1994, 4, 6, 466).
[0078] Liposomes also include "sterically stabilized" liposomes, a term, which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incoφorated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such, specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside GMI, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al, FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).
[0079] Various liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N. Y. Acad. Sci., 1987, 507, 64) reported the ability of monosialoganglioside GM1, galactocerebroside sulfate and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., 1988, 85, 6949). U.S. Patent No. 4,837,028 and WO 88/04924, both to Allen et al., disclose liposomes comprising (1) sphingomyelin and (2) the ganglioside Gjor a galactocerebroside sulfate ester. U.S. Patent No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimyristoylphosphatidylclιoline are disclosed in WO 97/13499 (Lim et al.).
[0080] Many liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of preparation thereof, are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2C1215G that contains a PEG moiety. Ilium et al. (FEBS Lett., 1984, 167, 79) noted that hydrophilic coating of polystyrene particles with polymeric glycols results in significantly enhanced blood half-lives. Synthetic phospholipids modified by the attachment of carboxylic groups of polyalkylene glycols (e.g., PEG) are described by Sears (U.S. Patent Nos. 4,426,330 and 4,534,899). Klibanov et al. (FEBS Lett, 1990, 268, 235) described experiments demonstrating that liposomes comprising phosphatidylethanolamme (PE) derivatized with PEG or PEG stearate have significant increases in blood circulation half-lives. Blume et al. (Biochimica et Biophysica Acta, 1990, 1029, 91) extended such observations to other PEG derivatized phospholipids, e.g., DSPE-PEG, formed from the combination of distearoylphosphatidylethanolamine (DSPE) and PEG. Liposomes having covalently bound PEG moieties on their external surface are described in European Patent No. EP 0 445 131 Bl and WO 90/04384 to Fisher. Liposome compositions containing 1-20 mole percent of PE derivatized with PEG, and methods of use thereof, are described by Woodle et al. (U.S. Patent Nos. 5,013,556 and 5,356,633) and Martin et al. (U.S. Patent No. 5,213,804 and European Patent No. EP 0 496 813 Bl). Liposomes comprising a number of other lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Patent No. 5,225,212 (both to Martin et al.) and in WO 94/20073 (Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids are described in WO 96/10391 (Choi et al.). U.S. Patent Nos. 5,540,935 (Miyazaki et al.) and 5,556,948 (Tagawa et al.) describe PEG- containing liposomes that can be further derivatized with functional moieties on their surfaces.
[0081] A limited number of liposomes comprising nucleic acids are known in the art. WO 96/40062 to Thierry et al. discloses methods for encapsulating high molecular weight nucleic acids in liposomes. U.S. Patent No. 5,264,221 to Tagawa et al. discloses protein-bonded liposomes and asserts that the contents of such liposomes may include an antisense RNA. U.S. Patent No. 5,665,710 to Rahman et al. describes certain methods of encapsulating oligodeoxynucleotides in liposomes. WO 97/04787 to Love et al. discloses liposomes comprising antisense oligonucleotides targeted to the rafgene. [0082] Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes may be described as lipid droplets, which are so highly deformable that they are easily able to penetrate through pores, which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g. they are self-optimizing (adaptive to the shape of pores in the skin), self-repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge-activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of seram albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.
[0083] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285) [0084] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about ϊ 8 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.
[0085] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.
[0086] If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.
[0087] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N- alkylbetaines and phosphatides. [0088] The use of surfactants in drag products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285). Penetration Enhancers [0089] In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids particularly oligonucleotides, to the skin of animals. Most drags are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drags readily cross cell membranes. It has been discovered that even non-lipophilic drugs may cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs. [0090] Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating nonsurfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.
[0091] Surfactants: In connection with the present invention, surfactants
(or "surface-active agents") are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absoφtion of oligonucleotides through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol, 1988, 40, 252). [0092] Fatty acids: Narious fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (l-monooleoyl-.rac- glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, l-dodecylazacycloheptan-2-one, acylcarnitines, acylchohnes, C,-ιo alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di- glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol, 1992, 44, 651-654). [0093] Bile salts: The physiological role of bile includes the facilitation of dispersion and absoφtion of lipids and fat-soluble vitamins (Branton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds. McGraw-Hill, New York, 1996, pp. 934-935). Narious natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. The bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxy cholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxychohc acid (sodium gly codeoxy cholate), taurocholic acid (sodium taurocholate), taurodeoxychohc acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate'and polyoxyethylene-9-lauryl ether (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington 's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583). [0094] Chelating Agents: Chelating agents, as used in connection with the present invention, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absoφtion of oligonucleotides through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Chelating agents of the invention include but are not limited to disodium. ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines)(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical
Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel, 1990, 14, 43-51).
[0095] Non-chelating non-surfactants: As used herein, nonchelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absoφtion of oligonucleotides through the alimentary mucosa (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers include, for example, unsaturated cyclic ureas, 1 -alkyl- and 1- alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti- inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol, 1987, 39, 621- 626). [0096] Agents that enhance uptake of oligonucleotides at the cellular level may also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Patent No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al, PCT Application WO 97/30731), are also known to enhance the cellular uptake of oligonucleotides.
[0097] Other agents may be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and teφenes such as limonene and menthone. Carriers
[0098] Certain compositions of the present invention also incoφorate carrier compounds in the formulation. As used herein, "carrier compound" or "carrier" can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate oligonucleotide in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dexfran sulfate, polycytidic acid or 4-acetamido-4'isothiocyano-stilbene-2,2' disulfonic acid (Miyao et al., Antisense Res. Dev., 1995, 5, 115-121; Takakura et al., Antisense & Nucl. Acid Drug Dev., 1996, 6, 177-183). Excipients [0099] In contrast to a carrier compound, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc.). [00100] Pharmaceutically acceptable organic or inorganic excipient suitable for non-parenteral administration, which does not deleteriously react with nucleic acids, can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like. [00101] Formulations for topical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions may also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration, which do not deleteriously react with nucleic acids, can be used. [00102] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like. Other Components [00103] The compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipraritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention.' The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation. [00104] Aqueous suspensions may contain substances, which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol, and/or dexfran. The suspension may also contain stabilizers.
[00105] Certain embodiments of the invention provide pharmaceutical compositions containing (a) one or more antisense compounds and (b) one or more other chemotherapeutic agents which function by a non-antisense mechanism. Examples of such chemotherapeutic agents include, but are not limited to, anticancer drags such as daunorabicin, dactinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard, chlorambucil, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine (CA), 5-fluorouracil (5-FU), floxuridine (5-FUdR), methotrexate (MTX), colchicine, vincristine, vinblastine, etoposide, teniposide, cisplatin and diethylstilbestrol (DES). See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al., eds., 1987, Rahway, N.J., pages 1206- 1228). Anti-inflammatory drags, including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drags, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al., eds., 1987, Rahway, N.J., pages 2499-2506 and 46-49, respectively), other non- antisense chemotherapeutic agents are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.
[00106] In another related embodiment, compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target. Numerous examples of antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially. [00107] The formulation of therapeutic compositions and their subsequent administration is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC50S found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 μg to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherem the oligonucleotide is administered in maintenance doses, ranging from 0.01 μg to 100 g per kg of body weight, once or more daily, to once every 20 years.
[00108] While the present invention has been described with specificity in accordance with certain of its preferred embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same.
EXAMPLES
Example 1 Nucleoside Phosphoramidites for Oligonucleotide Synthesis Deoxy and 2 '-alkoxy amidites
[00109] 2'-Deoxy and 2'-methoxy beta-cyanoethyldiisopropyl phosphoramidites are available from commercial sources (e.g. Chemgenes, Needham MA or Glen Research, Inc. Sterling VA). Other 2'-O-alkoxy substituted nucleoside amidites are prepared as described in U.S. Patent 5,506,351, herein incoφorated by reference. For oligonucleotides synthesized using 2 '-alkoxy amidites, the standard cycle for unmodified oligonucleotides is utilized, except the wait step after pulse delivery of tetrazole and base is increased to 360 seconds. [00110] Oligonucleotides containing 5-methyl-2'-deoxycytidine (5-Me- C) nucleotides are synthesized according to published methods [Sanghvi, et. al, Nucleic Acids Research, 1993, 21, 3197-3203] using commercially available phosphoramidites (Glen Research, Sterling NA or ChemGenes, Νeedham MA). 2'-FIuoro amidites
2'-Fluorodeoxyadenosine amidites
[00111] 2'-fluoro oligonucleotides are synthesized as described previously [Kawasaki, et. al., J. Med. Chem., 1993, 36, 831-841] and United States patent 5,670,633, herein incoφorated by reference. Briefly, the protected nucleoside Ν6-benzoyl-2'-deoxy-2'-fluoroadenosine is synthesized utilizing commercially available 9-beta-D- arabinofuranosyladenine as starting material and by modifying literature procedures whereby the 2'-alpha-fluoro atom is introduced by a SN2- displacement of a 2'-beta-trityl group. Thus N6-benzoyl-9-beta-D- arabinofuranosylademne is selectively protected in moderate yield as the 3',5'-ditetrahydropyranyl (THP) intermediate. Deprotection of the THP and N6-benzoyl groups is accomplished using standard methodologies and standard methods are used to obtain the 5'-dimethoxytrityl-(DMT) and 5'- DMT-3 '-phosphoramidite intermediates. 2'-Fluorodeoxyguanosine
[00112] The synthesis of 2'-deoxy-2'-fluoroguanosine is accomplished using tetraisopropyldisiloxanyl (TPDS) protected 9-beta-D- arabinofuranosylguanine as starting material, and conversion to the intermediate diisobutyrylarabinofuranosylguanosine. Deprotection of the TPDS group is followed by protection of the hydroxyl group with THP to give diisobutyryl di-THP protected arabinofuranosylguanine. Selective O- deacylation and triflation is followed by treatment of the crade product with fluoride, then deprotection of the THP groups. Standard methodologies are used to obtain the 5'-DMT- and 5 '-DMT-3 '-phosphoramidites. 2'-Fluorouridine
[00113] Synthesis of 2'-deoxy-2'-fluorouridine is accomplished by the modification of a literature procedure in which 2,2'anhydro-l-beta-D- arabinofuranosyluracil is treated with 70% hydrogen fluoride-pyridine. Standard procedures are used to obtain the 5' -DMT and 5'-DMT-3'- phosphoramidites. 2'-Fluorodeoxycytidine
[00114] 2'-deoxy-2'-fluorocytidine is synthesized via amination of 2'- deoxy-2'-fluorouridine, followed by selective protection to give N4- benzoyl-2'-deoxy-2'-fluorocytidine. Standard procedures are used to obtain the 5 '-DMT and 5 '-DMT-3 'phosphoramidites. 2'-O-(2-Methox ethyl) modified amidites
[00115] 2'-O-Methoxyethyl-substituted nucleoside amidites are prepared as follows, or alternatively, as per the methods of Martin, P., Helvetica Chimica Acta, 1995, 78, 486-504. 2,2'-Anhydro[l-(beta-D-arabinofuranosyl)-5-methyluridinel
[00116] 5-Methyluridme (ribosylthymine, commercially available through Yamasa, Choshi, Japan) (72.0 g, 0.279 M), diphenylcarbonate (90.0 g, 0.420 M) and sodium bicarbonate (2.0 g, 0.024 M) are added to DMF (300 mL). The mixture is heated to reflux, with stirring, allowing the evolved carbon dioxide gas to be released in a controlled manner. After 1 hour, the slightly darkened solution is concentrated under reduced pressure. The resulting syrup is poured into diethylether (2.5 L), with stirring. The product formed a gum. The ether is decanted and the residue is dissolved in a minimum amount of methanol (ca. 400 mL). The solution is poured into fresh ether (2.5 L) to yield a stiff gum. The ether is decanted and the gum is dried in a vacuum oven (60°C at 1 mm Hg for 24 h) to give a solid that is crashed to a light tan powder. The material is used as is for further reactions (or it can be purified further by column chromatography using a gradient of methanol in ethyl acetate (10-25%) to give a white solid. 2 '-O-Methoxyethyl-5-methyluridine [00117] 2,2'-Anhydro-5-methyluridine (195 g, 0.81 M), tris(2- methoxyethyl)borate (231 g, 0.98 M) and 2-methoxyethanol (1.2 L) are added to a 2 L stainless steel pressure vessel and placed in a pre-heated oil bath at 160°C. After heating for 48 hours at 155-160°C, the vessel is opened and the solution evaporated to dryness and triturated with MeOH (200 mL). The residue is suspended in hot acetone (1 L). The insoluble salts are filtered, washed with acetone (150 mL) and the filtrate evaporated. The residue (280 g) is dissolved in CH3CN (600 mL) and evaporated. A silica gel column (3 kg) is packed in CH2C12 /acetone /MeOH (20:5:3) containing 0.5% Et3NH. The residue is dissolved in CH2C 1 _ (250 mL) and adsorbed onto silica (150 g) prior to loading onto the column. The product is eluted with the packing solvent to give the title product. Additional material can be obtained by reworking impure fractions. 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine [00118] 2'-O-Methoxyethyl-5-methyluridine (160 g, 0.506 M) is co- evaporated with pyridine (250 mL) and the dried residue dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) is added and the mixture stirred at room temperature for one hour. A second aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) is added and the reaction stirred for an additional one hour. Methanol (170 mL) is then added to stop the reaction. The solvent is evaporated and triturated with CH3CN (200 mL) The residue is dissolved in CHC1 (1.5 L) and extracted with 2x500 mL of saturated NaHCO3 and 2x500 mL of saturated NaCl. The organic phase is dried over Na SO , filtered, and evaporated. The residue is purified on a 3.5 kg silica gel column, packed and eluted with EtOAc/hexane/ acetone (5:5:1) containing 0-5%) Et3NH. The pure fractions are evaporated to give the title product.
3'-O-Acetyl-2'-O-methoxyethy]-5'-O-dimethoxytrityl-5-methy]uridine [00119] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (106 g, 0.167 M), DMF/pyridine (750 mL of a 3 : 1 mixture prepared from 562 mL of DMF and 188 L of pyridine) and acetic anhydride (24.38 mL, 0.258 M) are combined and stirred at room temperature for 24 hours. The reaction is monitored by TLC by first quenching the TLC sample with the addition of MeOH. Upon completion of the reaction, as judged by TLC, MeOH (50 mL) is added and the mixture evaporated at 35°C. The residue is dissolved in CHC13 (800 mL) and extracted with 2x200 mL of saturated sodium bicarbonate and 2x200 mL of saturated NaCl. The water layers are back extracted with 200 mL of CHC13. The combined organics are dried with sodium sulfate and evaporated to a residue. The residue is purified on a 3.5 kg silica gel column and eluted using EtOAc hexane(4:l). Pure product fractions are evaporated to yield the title compounds. 3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4- triazoleuridine [00120] A first solution is prepared by dissolving 3 '-O-acetyl-2'-O- methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in
CH3CN (700 mL) and set aside. Triethylamine (189 L, 1.44 M) is added to a solution of triazole (90 g, 1.3 M) in CH3CN (1 L), cooled to -5°C and stirred for 0.5 h using an overhead stirrer. POCl3 is added dropwise, over a 30 minute period, to the stirred solution maintained at 0-10°C, and the resulting mixture stirred for an additional 2 hours. The first solution is added dropwise, over a 45 minute period, to the latter solution. The resulting reaction mixture is stored overnight in a cold room. Salts are filtered from the reaction mixture and the solution is evaporated. The residue is dissolved in EtOAc (1 L) and the insoluble solids are removed by filtration. The filtrate is washed with 1x300 mL of NaHCO and 2x300 mL of saturated NaCl, dried over sodium sulfate and evaporated. The residue is triturated with EtOAc to give the title compound. 2'-O-Methoxyethyl-5'-O~dimethoxytrityl-5-methylcytidine [00121] A solution of 3 '-O-acetyl-2'-O-methoxyethyl-5 '-O- dimethoxytrityl-5-methyl-4-triazoleuridine (103 g, 0.141 M) in dioxane (500 mL) and NH OH (30 mL) is stirred at room temperature for 2 hours. The dioxane solution is evaporated and the residue azeotroped with MeOH (2x200 mL). The residue is dissolved in MeOH (300 mL) and transferred to a 2 liter stainless steel pressure vessel. MeOH (400 mL) saturated with NH3 gas is added and the vessel heated to 100°C for 2 hours (TLC showed complete conversion). The vessel contents are evaporated to dryness and the residue is dissolved in EtOAc (500 mL) and washed once with saturated NaCl (200 mL). The organics are dried over sodium sulfate and the solvent is evaporated to give the title compound. N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine [00122] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (85 g, 0.134 M) is dissolved in DMF (800 mL) and benzoic anhydride (37.2 g, 0.165 M) is added with stirring. After stirring for 3 hours, TLC showed the reaction to be approximately 95% complete. The solvent-'is evaporated and the residue azeotroped with MeOH (200 mL). The residue is dissolved in CHC13 (700 mL) and extracted with saturated NaHCO, (2x300 mL) and saturated NaCl (2x300 mL) , dried over MgSO and evaporated to give a residue. The residue is chromatographed on a 1.5 kg silica column using EtOAc/hexane (1:1) containing 0-5% Et3NH as the eluting solvent. The pure product fractions are evaporated to give the title compound.
N4-Benzoyl-2'-O-methoxyethyI-5'-O-dimethoxytrityI-5-methyIcytidine-
3'-amidite
[00123] N4-Benzoyl-2'-O-methoxyethyl-5 '-O-dimethoxytrityl-5- methylcytidine (74 g, 0.10 M) is dissolved in CH2C12 (1 L) Tetrazole diisopropylamine (7.1 g) and 2-cyanoethoxy-tetra(isopropyl)phosphite (40.5 mL, 0.123 M) are added with stirring, under a nitrogen atmosphere. The resulting mixture is stirred for 20 hours at room temperature (TLC showed the reaction to be 95% complete). The reaction mixture is extracted with saturated NaHCO3 (1x300 mL) and saturated NaCl (3x300 mL). The aqueous washes are back-extracted with CH C12 (300 mL), and the extracts are combined, dried over MgSO4 and concentrated. The residue obtained is chromatographed on a 1.5 kg silica column using EtOAc/hexane (3:1) as the eluting solvent. The pure fractions were combined to give the title compound. 2'-O-(Aminooxyethyl) nucleoside amidites and 2'-O- (dimethylaminooxyethyl) nucleoside amidites 2'-(Dimethylaminooxyethoxy) nucleoside amidites [00124] 2'-(Dimethylaminooxyethoxy) nucleoside amidites [also known in the art as 2'-O-(dimethylaminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs. Adenosine, cytidine and guanosine nucleoside amidites are prepared similarly to the thymidine (5- methyluridine) except the exocyclic amines are protected with a benzoyl moiety in the case of adenosine and cytidine and with isobutyryl in the case of guanosine. 5'-O-tert-Butyldiphenylsilyl -O2 -2'-anhydro-5-methyluridine
[00125] O2 -2'-anhydro-5-methyluridine (Pro. Bio. Sint, Narese, Italy, lOO.Og, 0.4'6 mmol), dimethylaminopyridine (0.66g, 0.013eq, 0.0054mmol) are dissolved in dry pyridine (500 ml) at ambient temperature under an argon atmosphere and with mechanical stirring, tert- Butyldiphenylchlorosilane (125.8g, 119.0mL, l.leq, 0.458mmol) is added in one portion. The reaction is stirred for 16 h at ambient temperature. TLC (Rf 0.22, ethyl acetate) indicated a complete reaction. The solution is concentrated under reduced pressure to a thick oil. This is partitioned between dichloromethane (1 L) and saturated sodium bicarbonate (2x1 L) and brine (1 L). The organic layer is dried over sodium sulfate and concentrated under reduced pressure to a thick oil. The oil is dissolved in a 1 :1 mixture of ethyl acetate and ethyl ether (600mL) and the solution is cooled to -10°C. The resulting crystalline product is collected by filtration, washed with ethyl ether (3x200 mL), and dried (40°C, 1mm Hg, 24 h) to a white solid
5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-methyluridine [00126] In a 2 L stainless steel, unstirred pressure reactor is added borane in tetrahydrofuran (1.0 M, 2.0 eq, 622 mL). In the fume hood and with manual stirring, ethylene glycol (350 mL, excess) is added cautiously at first until the evolution of hydrogen gas subsides. 5'-O-tert-Butyldiphenylsilyl- O2-2'anhydro-5-methyluridine (149 g, 0.3'1 mol) and sodium bicarbonate (0.074 g, 0.003 eq) are added with manual stirring. The reactor is sealed and heated in an oil bath until an internal temperature of 160°C is reached and then maintained for 16 h (pressure < 100 psig). The reaction vessel is cooled to ambient and opened. TLC (Rf 0.67 for desired product and Rf 0.82 for ara-T side product, ethyl acetate) indicated about 70% conversion to the product. In order to avoid additional side product formation, the reaction is stopped, concentrated under reduced pressure (10 to 1mm, Hg) in a warm water bath (40-100°C) with the more extreme conditions used to remove the ethylene glycol. [Alternatively, once the low boiling solvent is gone, the remaining solution can be partitioned between ethyl acetate and water. The product will be in the organic phase.] The residue is purified by column cliromatography (2kg silica gel, ethyl acetate-hexanes gradient 1:1 to 4:1). The appropriate fractions are combined, stripped and dried to product as a white crisp foam, contaminated starting material, and pure reusable starting material.
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridine [00127] 5 '-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5- methyluridine (20g, 36.98mmol) is mixed with triphenylphosphine (11.63g, 44.36mmol) and N-hydroxyphthalimide (7.24g, 44.36mmol). It is then dried over P2O5 under high vacuum for two days at 40°C. The reaction mixture is flushed with argon and dry THF (369.8mL, Aldrich, sure seal bottle) is added to get a clear solution. Diethyl-azodicarboxylate (6.98mL, 44.36mmol) is added dropwise to the reaction mixture. The rate of addition is maintained such that resulting deep red coloration is just discharged before adding the next drop. After the addition is complete, the reaction is stirred for 4 hrs. By that time TLC showed the completion of the reaction (ethylacetate :hexane, 60:40). The solvent is evaporated in vacuum. Residue obtained is placed on a flash column and eluted with ethyl acetate-.hexane (60:40), to get 2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5- methyluridine as white foam.
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5- methyluridine [00128] 2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5- methyluridine (3.1g, 4.5mmol) is dissolved in dry CH2C12 (4.5mL) and methylhydrazine (300mL, 4.64mmol) is added dropwise at-10°C to 0°C. After 1 h the mixture is filtered, the filtrate is washed with ice cold CH2CI2 and the combined organic phase is washed with water, brine and dried over anhydrous Na2SO . The solution is concentrated to get 2'-O(aminooxyethyl) thymidine, which is then dissolved in MeOH (67.5mL). To this formaldehyde (20% aqueous solution, w/w, 1.1 eq.) is added and the resulting mixture is stirred for 1 h. Solvent is removed under vacuum; residue chromatographed to get 5'-O-tert-butyldiphenylsilyl-2'-O-[(2- formadoximinooxy) ethyl]-5-methyluridine as white foam. 5'-O-tert-Butyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5- methyluridine
[00129] 5 '-O-tert-butyldiphenylsilyl-2'-O-[(2- formadoximinooxy)ethyl]- 5-methyluridine (1.77g, 3.12mmol) is dissolved in a solution of IM pyridinium p-toluenesulfonate (PPTS) in dry MeOH (30.6mL). Sodium cyanoborohydride (0.39g, 6.13mmol) is added to this solution at 10°C under inert atmosphere. The reaction mixture is stirred for 10 minutes at 10°C. After that the reaction vessel is removed from the ice bath and stirred at room temperature for 2 h, the reaction monitored by TLC (5% MeOH in CH2CI2). Aqueous NaHCO3 solution (5%, lOmL) is added and extracted with ethyl acetate (2x20mL). Ethyl acetate phase is dried over anhydrous Na2SO , evaporated to dryness. Residue is dissolved in a solution of IM PPTS in MeOH (30.6mL). Formaldehyde (20% w/w, 30mL, 3.37mmol) is added and the reaction mixture is stirred at room temperature for 10 minutes. Reaction mixture cooled to 10°C in an ice bath, sodium cyanoborohydride (0.39g, 6.13mmol) is added, and reaction mixture stirred at 10°C for 10 minutes. After 10 minutes, the reaction mixture is removed from the ice bath and stirred at room temperature for 2 hrs. To the reaction mixture 5% NaHCO3 (25mL) solution is added and extracted with ethyl acetate (2x25mL). Ethyl acetate layer is dried over anhydrous Na2SO and evaporated to dryness. The residue obtained is purified by flash column chromatography and eluted with 5% MeOH in CH2C12 to get 5'-O- tertbutyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5- methyluridine as a white foam. 2'-O-(dimethylaminooxyethyl)-5-methyluridine [00130] Triethylamine trihydrofluoride (3.91mL, 24.0mmol) is dissolved in dry THF and triethylamine (1.67mL, 12mmol, dry, kept over KOH). This mixture of triethylamine- 2HF is then added to 5'-O-tert-butyldiphenylsilyl- 2'-O-[N,N-dimethylaminooxyethyl]-5-methyluridine (1.40g, 2.4mmol) and stirred at room temperature for 24 hrs. Reaction is monitored by TLC (5% MeOH in CH2C12). Solvent is removed under vacuum and the residue placed on a flash column and eluted with 10% MeOH in CH2C12 to get 2'-O-
(dimethylaminooxyethyl)-5-methyluridine. 5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine [00131] 2'-O-(dimethylaminooxyethyl)-5-methyluridine (750mg, 2.17mmol) is dried over P2O5 under high vacuum overnight at 40° C. It is then co-evaporated with anhydrous pyridine (20mL). The residue obtained is dissolved in pyridine (1 lmL) under argon atmosphere. 4- dimethylaminopyridine (26.5mg, 2.60mmol), 4,4'-dimethoxytrityl chloride (880mg, 2.60mmol) is added to the mixture and the reaction mixture is stirred at room temperature until all of the starting material disappeared. Pyridine is removed under vacuum and the residue chromatographed and eluted with 10% MeOH in CH2C12 (containing a few drops of pyridine) to get 5'-O-DMT-2'-0(dimethylamino-oxyethyl)-5-methyluridine. 5'-O-DMT-2'-O-(2-N,N-dimethy]aminooxyethyl)-5-methyluridine-3'- [(2-cyanoethyl)-N,N- diisopropylphosphoramidite]
[00132] 5 '-O-DMT-2 '-O-(dimethylaminooxyethyl)-5-methyluridine (1.08g, 1.67mmol) is co-evaporated with toluene (20mL). To the residue N,N-diisopropylamine tetrazonide (0.29g, 1.67mmol) is added and dried over P20, under high vacuum overnight at 40°C. Then the reaction mixture is dissolved in anhydrous acetonitrile (8.4mL) and 2-cyanoethyl-N,N,N1,N1- tetraisopropylphosphoramidite (2.12mL, 6.08mmol) is added. The reaction mixture is stirred at ambient temperature for 4 hrs under inert atmosphere. The progress of the reaction is monitored by TLC (hexane: ethyl acetate 1:1). The solvent is evaporated, then the residue is dissolved in ethyl acetate (70mL) and washed with 5% aqueous NaHCO3 (40mL). Ethyl acetate layer is dried over anhydrous Na2SO and concentrated. Residue obtained is chromatographed (ethyl acetate as eluent) to get 5'-O-DMT-2'-O-(2-N,N- dimethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoethyl)-N,N- diisopropylphosphoramidite] as a foam. 2'-(Aminooxyethoxy) nucleoside amidites
[00133] 2'-(Aminooxyethoxy) nucleoside amidites [also known in the art as 2'-O-(aminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs. Adenosine, cytidine and thymidine nucleoside amidites are prepared similarly. N2-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'- dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N- diisopr opylph osph or amidite]
[00134] The 2'-O-aminooxyethyl guanosine analog may be obtained by selective 2'-O-alkylation of diaminopurine riboside. Multigram quantities of diaminopurine riboside may be purchased from Schering AG (Berlin) to provide 2'-O-(2-ethylacetyl) diaminopurine riboside along with a minor amount of the 3'-O-isomer. 2'-O-(2-ethylacetyl) diaminopurine riboside may be resolved and converted to 2'-O-(2ethylacetyl)guanosine by treatment with adenosine deaminase. (McGee, D. P. C, Cook, P. D., Guinosso, C. J., WO 94/02501 Al 940203.) Standard protection procedures should afford 2'-O-(2-ethylacetyl)-5 '-O-(4,4'-dimethoxytrityl)guanosine and 2-N-isobutyryl-6-O-diphenylcarbamoyl-2 ' -O-(2-ethylacetyl)-5 ' -O- (4,4'-dimethoxytrityl)guanosine which may be reduced to provide 2-N- isobutyryl-6-O-diphenylcarbamoyl-2 ' -O-(2-ethylacetyl)-5 ' -O-(4,4 ' - dimethoxvtrityl)guanosine. As before the hydroxyl group may be displaced by N-hydroxyphthalimide via a Mitsunobu reaction, and the protected nucleoside may phosphitylated as usual to yield 2-N-isobutyryl-6-O- diρhenylcarbamoyl-2 ' -O-(2-ethylacetyl)-5 '-O-(4,4 ' - dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N- diisopropylphosphoramiditel.
2'-dimethylaminoethoxyethoxy (2'-DMAEOE) nucleoside amidites [00135] 2' -dimethylammoethoxyethoxy nucleoside amidites (also known in the art as 2'-O-dimethylaminoethoxyethyl, i.e., 2'O-CH2-O-CH2- N(CH2)2, or 2'-DMAEOE nucleoside amidites) are prepared as follows. Other nucleoside amidites are prepared similarly.
2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl ridine [00136] 2[2-(Dimethylamino)ethoxylethanol (Aldrich, 6.66 g, 50 mmol) is slowly added to a solution of borane in tetrahydrofuran (1 M, 10 mL, 10 mmol) with stirring in a 100 mL bomb. Hydrogen gas evolves as the solid dissolves. O2-, 2' - anhydro-5-methyluridine (1.2 g, 5 mmol), and sodium bicarbonate (2.5 mg) are added and the bomb is sealed, placed in an oil bath, and heated to 155°C for 26 hours. The bomb is cooled to room temperature and opened. The crade solution is concentrated and the residue partitioned between water (200 mL) and hexanes (200 mL). The excess phenol is extracted into the hexane layer. The aqueous layer is extracted with ethyl acetate (3x200 mL) and the combined organic layers are washed once with water, dried over anhydrous sodium sulfate and concentrated. The residue is columned on silica gel using methanol/methylene chloride 1 :20 (which has 2% triethylamine) as the eluent. As the column fractions are concentrated a colorless solid forms which is collected to give the title compound as a white solid.
5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy) ethyl)]-5- methyl uridine [00137] To 0.5 g (1.3 mmol) of 2'-O-[2(2-N,N- dimethylaminoethoxy)ethyl)l-5-methyl uridine in anhydrous pyridine (8 mL), triethylamine (0.36 mL) and dimethoxytrityl chloride (DMT-C1, 0.87 g, 2 eq.) are added and stirred for 1 hour. The reaction mixture is poured into water (200 mL) and extracted with CH2CI2 (2x200 mL). The combined CH2CI2 layers are washed with saturated NaHCO3 solution, followed by saturated NaCl solution and dried over anhydrous sodium sulfate. Evaporation of the solvent followed by silica gel chromatography using MeOH: CH2Cl2:Et3N (20:1, v/v, with 1% triethylamine) gives the title compound. 5'-O-Dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl)]-5- methyl uridine-3'-O-(cyanoethyl-N,N-diisopropyl)phosphoramidite [00138] Diisopropylaminotetrazolide (0.6 g) and 2-cyanoethoxyN,N- diisopropyl phosphoramidite (1.1 mL, 2 eq.) are added to a solution of 5'-O- dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl)]-5- methyluridine (2.17 g, 3 mmol) dissolved in CH2CI2 (20 mL) under an atmosphere of argon. The reaction mixture is stirred overnight and the solvent evaporated. The resulting residue is purified by silica gel flash column chromatography with ethyl acetate as the eluent to give the title compound. Example 2
Oligonucleotide synthesis
[00139] Unsubstituted and substituted phosphodiester (P=O) oligonucleotides are synthesized on an automated DNA synthesizer (Applied Biosystems model 380B) using standard phosphoramidite chemistry with oxidation by iodine.
[00140] Phosphorothioates (P=S) are synthesized as for the phosphodiester oligonucleotides except the standard oxidation bottle is replaced by 0.2 M solution of 3H-l,2-benzodithiole-3-one 1,1-dioxide in acetonitrile for the stepwise thiation of the phosphite linkages. The thiation wait step is increased to 68 sec and is followed by the capping step. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55 °C (18 h), the oligonucleotides are purified by precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCl solution. Phosphinate oligonucleotides are prepared as described in U.S. Patent 5,508,270, herein incoφorated by reference.
[00141] Alkyl phosphonate oligonucleotides are prepared as described in U.S. Patent 4,469,863, herein incoφorated by reference. [00142] 3 '-Deoxy-3 '-methylene phosphonate oligonucleotides are prepared as described in U.S. Patents 5,610,289 or 5,625,050, herein incoφorated by reference.
[00143] Phosphoramidite oligonucleotides are prepared as described in U.S. Patent, 5,256,775 or U.S. Patent 5,366,878, herein incoφorated by reference. [00144] Alkylphosphonothioate oligonucleotides are prepared as described in WO 94/17093 and WO 94/02499 herein incoφorated by reference.
[00145] 3 '-Deoxy-3 '-amino phosphoramidate oligonucleotides are prepared as described in U.S. Patent 5,476,925, herein incoφorated by reference.
[00146] Phosphotriester oligonucleotides are prepared as described in U.S. Patent 5,023,243, herein incoφorated by reference. [00147] Borano phosphate oligonucleotides are prepared as described in U.S. Patents 5,130,302 and 5,177,198, both herein incoφorated by reference.
Example 3 Oligonucleoside Synthesis [00148] Methylenemethylimino linked oligonucleosides, also identified as MMI linked oligonucleosides, methylenedimethylhydrazo linked oligonucleosides, also identified as MDH linked oligonucleosides, and methylenecarbonylamino linked oligonucleosides, also identified as amide-3 linked oligonucleosides, and methyleneaminocarbonyl linked oligonucleosides, also identified as amide-4 linked oligonucleosides, as well as mixed backbone compounds having, for instance, alternating MMI and P=O or P=S linkages are prepared as described in U.S. Patents 5,378,825; 5,386,023; 5,489,677; 5,602,240; and 5,610,289, all of which are herein incoφorated by reference. [00149] Formacetal and thioformacetal linked oligonucleosides are prepared as described in U.S. Patents 5,264,562 and 5,264,564, herein incoφorated by reference.
[00150] Ethylene oxide linked oligonucleosides are prepared as described in U.S. Patent 5,223,618, herein incoφorated by reference.
Example 4 PNA Synthesis
[00151] Peptide nucleic acids (PNAs) are prepared in accordance with any of the various procedures referred to in Peptide Nucleic Acids (PNA): Synthesis, Properties and Potential Applications, Bioorganic & Medicinal Chemistry, 1996, 4, 523. They may also be prepared in accordance with U.S. Patents 5,539,082; 5,700,922; and 5,719,262, herein incoφorated by reference.
Example 5
Synthesis of Chimeric Oligonucleotides [00152] Chimeric oligonucleotides, oligonucleosides or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the "gap" segment of linked nucleosides is positioned between 5 ' and 3 ' "wing" segments of linked nucleosides and a second "open end" type wherein the "gap" segment is located at either the 3' or the 5' terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as "gapmers" or gapped oligonucleotides. Oligonucleotides of the second type are also known in the art as "hemimers" or "wingmers". [2'-O-Me]-[2'-deoxy]-[2'-O-Me] Chimeric Phosphorothioate Oligonucleotides [00153] Chimeric oligonucleotides having 2'-O-alkyl phosphorothioate and 2 '-deoxy phosphorothioate oligonucleotide segments are synthesized using an Applied Biosystems automated DNA synthesizer Model 380B, as above. Oligonucleotides are synthesized using the automated synthesizer and 2'-deoxy-5'-dimethoxytrityl-3 '-O-phosphoramidite for the DNA portion and 5 '-dimethoxytrityl-2'-O-methyl-3 '-O-phosphoramidite for 5 ' and 3' wings. The standard synthesis cycle is modified by increasing the wait step after the delivery of tetrazole and base to 600 s repeated four times for RNA and twice for 2'-O-methyl. The fully protected oligonucleotide is cleaved from the support and the phosphate group is deprotected in 3:1 ammonia/ethanol at room temperature overnight then lyophilized to dryness. Treatment in methanolic ammonia for 24 hrs at room temperature is then done to deprotect all bases and sample is again lyophilized to dryness. The pellet is resuspended in IM TBAF in THF for 24 hrs at room temperature to deprotect the 2' positions. The reaction is then quenched with IM TEAA and the sample is then reduced to 1/2 volume by rotovac before being desalted on a G25 size exclusion column. The oligo recovered is then analyzed spectrophotometrically for yield and for purity by capillary electrophoresis and by mass spectrometry. [2'-O-(2-Methoxyethyl)]-[2'-deoxy]-[2'-O-(Methoxyethyl)] Chimeric Phosphorothioate Oligonucleotides [00154] [2'-O-(2-methoxyethyl)]-[2'-deoxy]— [-2'-O-(methoxyethyl)] chimeric phosphorothioate oligonucleotides are prepared as per the procedure above for the 2'-O-methyl chimeric oligonucleotide, with the substitution of phorothioate oligonucleotides are prepared as per the procedure above 2 '-O -(methoxyethyl) amidites for the 2'-O-methyl amidites.
[2'-O-(2-Methoxyethyl)Phosphodiester]--[2'-deoxy Phosphorothioate]-- [2'-O-(2-Methoxyethyl)] Phosphodiester] Chimeric Oligonucleotides [00155] [2'-O-(2-methoxyethyl phosphodiester]~[2'-deoxy phosphorothioate]— [2 '-O-(methcixyethyl) phosphodiester] chimeric oligonucleotides are prepared as per the above procedure for the 2'-O- methyl chimeric oligonucleotide with the substitution of 2'-O- (methoxy ethyl) amidites for the 2'-O-methyl amidites, oxidization with iodine to generate the phosphodiester internucleotide linkages within the wing portions of the chimeric structures and sulfurization utilizing 3 ,H- 1 ,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate internucleotide linkages for the center gap. [00156] Other chimeric oligonucleotides, chimeric oligonucleosides and mixed chimeric oligonucleotides/oligonucleosides are synthesized according to United States patent 5,623,065, herein incoφorated by reference.
Example 6 Oligonucleotide Isolation
[00157] After cleavage from the controlled pore glass column (Applied Biosystems) and deblocking in concentrated ammonium hydroxide at 55°C for 18 hours, the oligonucleotides or oligonucleosides are purified by precipitation twice out of 0.5 M NaCl with 2.5 volumes ethanol. Synthesized oligonucleotides are analyzed by polyacrylamide gel electrophoresis on denaturing gels and judged to be at least 85% full-length material. The relative amounts of phosphorothioate and phosphodiester linkages obtained in synthesis are periodically checked by "P nuclear magnetic resonance spectroscopy, and for some studies oligonucleotides are purified by HPLC, as described by Chiang et al., J. Biol. Chem. 1991, 266, 18162-18171.
Example 7
Oligonucleotide Synthesis - 96 Well Plate Format
[00158] Oligonucleotides are synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a standard 96 well format. Phosphodiester internucleotide linkages are afforded by oxidation with aqueous iodine. Phosphorothioate internucleotide linkages are generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard base-protected beta- cyanoethyldiisopropyl phosphoramidites can be purchased from commercial vendors (e.g. PE- Applied Biosystems, Foster City, CA, or Pharmacia, Piscataway, NJ). Non-standard nucleosides are synthesized as per known literature or patented methods. They are utilized as base protected betacyanoethyldiisopropyl phosphoramidites. [00159] Oligonucleotides are cleaved from support and deprotected with concentrated NH OH at elevated temperature (55-60°C) for 12-16 hours and the released product then dried in vacuo. The dried product is then resuspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.
Example 8
Oligonucleotide Analysis - 96 Well Plate Format
[00160] The concentration of oligonucleotide in each well is assessed by dilution of samples and UN absoφtion spectroscopy. The full-length integrity of the individual products is evaluated by capillary electrophoresis (CE) in either the 96 well format (Beckman P/ACE™ MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACE™ 5000, ABI 270). Base and backbone composition is confirmed by mass analysis of the compounds utilizing electrospray-mass spectroscopy. All assay test plates are diluted from the master plate using single and multi-channel robotic pipettors. Plates are judged to be acceptable if at least 85% of the compounds on the plate are at least 85% full length.
Example 9
Cell culture and oligonucleotide treatment
[00161] The effect of antisense compounds on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. The following 6 cell types are provided for illustrative puφoses, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, Ribonuclease protection assays, or RT- PCR.
T-24 cells:
[00162] The human transitional cell bladder carcinoma cell line T-24 is obtained from the American Type Culture Collection (ATCC) (Manassas, VA). T-24 cells are routinely cultured in complete McCoy's 5 A basal media (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis.
[00163] For Northern blotting or other analysis, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide. A549 cells:
[00164] The human lung carcinoma cell line A549 can be obtained from the American Type Culture Collection (ATCC) (Manassas, VA). A549 cells are routinely cultured in DMEM basal media (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. NHDF cells:
[00165] Human neonatal dermal fibroblast (NHDF) can be obtained from the Clonetics Coφoration (Walkersville MD). NHDFs are routinely maintained in Fibroblast Growth Medium (Clonetics Coφoration, Walkersville MD) supplemented as recommended by the supplier. Cells are maintained for up to 10 passages as recommended by the supplier. HEK cells:
[00166] Human embryonic keratmocytes (HEK) can be obtained from the Clonetics Coφoration (Walkersville MD). HEKs are routinely maintained in Keratinocyte Growth Medium (Clonetics Coφoration, Walkersville MD) formulated as recommended by the supplier. Cells are routinely maintained for up to 10 passages as recommended by the supplier. MCF-7 cells:
[00167] The human breast carcinoma cell line MCF-7 is obtained from the American Type Culture Collection (Manassas, VA). MCF-7 cells are routinely cultured in DMEM low glucose (Gibco/Life Technologies,
Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90%> confluence. Cells are seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis. [00168] For Northern blotting or other analyses, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide. LA4 cells: [00169] The mouse lung epithelial cell line LA4 is obtained from the American Type Culture Collection (Manassas, VA). LA4 cells are routinely cultured in F12K medium (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 15% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #3872) at a density of 3000-6000 cells/ well for use in RT-PCR analysis.
[00170] For Northern blotting or other analyses, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide. Treatment with antisense compounds:
[00171] When cells reached 80% confluence, they are treated with oligonucleotide. For cells grown in 96-well plates, wells are washed once with 200 μL OPTI-MEMtm-l reduced-seram medium (Gibco BRL) and then treated with 130 μL of OPTI-MEMTM™-l containing 3.75 μg/mL LIPOFECTIN™ (Gibco BRL) and the desired concentration of oligonucleotide. After 4-7 hours of treatment, the medium is replaced with fresh medium. Cells are harvested 16-24 hours after oligonucleotide treatment. [00172] The concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations.
Example 10
Analysis of oligonucleotide inhibition of Navl.3 expression
[00173] Antisense modulation of Navl .3 expression can be assayed in a variety of ways known in the art. For example, Navl .3 mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Real-time quantitative PCR is presently preferred. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.1.1-4.2.9 and 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Northern blot analysis is routine in the art and is taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.2.1- 4.2.9, John Wiley & Sons, Inc., 1996. Real-time quantitative (PCR) can be conveniently accomplished using the commercially available ABI PRISM™ 7700 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer's instructions. Prior to quantitative PCR analysis, primer-probe sets specific to the target gene being measured are evaluated for their ability to be "multiplexed" with a GAPDH amplification reaction. In multiplexing, both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only ("single-plexing"), or both (multiplexing). Following PCR amplification, standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples. If both the slope and correlation coefficient of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the primer-probe set specific for that target is deemed as multiplexable. Other methods of PCR are also known in the art. [00174] Protein levels of Navl .3 can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), ELISA or fluorescence-activated cell sorting (FACS). Antibodies directed to Navl .3 can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Coφoration,
Birmingham, MI), or can be prepared via conventional antibody generation methods. Methods for preparation of polyclonal antisera are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. Preparation of monoclonal antibodies is taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.4.1-11.11.5, John Wiley Sons, Inc., 1997.
[00175] Immunoprecipitation methods are standard in the art and can be found at, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.110.16.11, John Wiley & Sons, Inc., 1998. Western blot (immunoblot) analysis is standard in the art and can be found at, for example, Ausubel, F.M. et al., Current Protocols in Molecular- Biology, Volume 2, pp. 10.8.1-10.8.21, John Wiley Sons, Inc., 1997. Enzyme-linked immunosorbent assays (ELISA) are standard in the art and can be found at, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley & Sons, Inc., 1991.
Example 11 Poly(A)+ mRNA isolation
[00176] Poly(A)+ mRNA is isolated according to Miura et al., Clin. Chem., 1996, 42, 1758-1764. Other methods for poly(A)+ mRNA isolation are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Briefly, for cells grown on 96-well plates, growth medium is removed from the cells and each well is washed with 200 μL cold PBS. 60μL lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) is added to each well, the plate is gently agitated and then incubated at room temperature for five minutes. 55 μL of lysate is transferred to Oligo d(T) coated 96-well plates (AGCT Inc., Irvine CA). Plates are incubated for 60 minutes at room temperature, washed 3 times with 200 μL of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl). After the final wash, the plate is blotted on paper towels to remove excess wash buffer and then air-dried for 5 minutes. 60 pL of elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70°C is added to each well, the plate is incubated on a 90°C hot plate for 5 minutes, and the eluate is then transferred to a fresh 96-well plate.
[00177] Cells grown on 100 mm or other standard plates may be treated similarly, using appropriate volumes of all solutions.
Example 12 Total RNA Isolation
[00178] Total mRNA is isolated using an RNEASY 96™ kit and buffers purchased from Qiagen Inc. (Valencia CA) following the manufacturer's recommended procedures. Briefly, for cells grown on 96-well plates, growth medium is removed from the cells and each well is washed with 200 μL cold PBS. 100 μL Buffer RLT is added to each well and the plate vigorously agitated for 20 seconds. 100 μL of 10% ethanol is then added to each well and the contents mixed by pipetting three times up and down. The samples are then transferred to the RNEASY 96 well plate attached to a QIAVAC manifold fitted with a waste collection tray and attached to a vacuum source. Vacuum is applied for 15 seconds. 1 mL of Buffer RW1 is added to each well of the RNEASY 96 plate and the vacuum again applied for 15 seconds. 1 mL of Buffer RPE is then added to each well of the RNEASY 96 plate and the vacuum applied for a period of 15 seconds. The Buffer RPE wash is then repeated and the vacuum is applied for an additional 10 minutes. The plate is then removed from the QIAVAC™ manifold and blotted dry on paper towels. The plate is then re-attached to the QIAVAC™ manifold fitted with a collection tube rack containing 1.2 mL collection tubes. RNA is then diluted by pipetting 60μL water into each well, incubating one minute, and then applying the vacuum for 30 seconds. The elution step is repeated with an additional 60 μL water. [00179] The repetitive pipetting and elution steps may be automated using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia CA). Essentially, after lysing of the cells on the culture plate, the plate is transferred to the robot deck where the pipetting, DNase treatment and elution steps are carried out.
Example 13 Real-time Quantitative PCR Analysis of Navl.3 mRNA Levels
[00180] Quantitation of Navl .3 mRNA levels is determined by real-time quantitative PCR using the ABI PRISM 7700 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time. As opposed to standard PCR, in which amplification products are quantitated after the PCR is completed, products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that amieals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes. A reporter dye (e.g., JOE, FAM™, or VIC, obtained from either Operon Technologies Inc., Alameda, CA or PE- Applied Biosystems, Foster City, CA) is attached to the 5' end of the probe and a quencher dye (e.g., TAMRA, obtained from either Operon Technologies Inc., Alameda, CA or PE-Applied Biosystems, Foster City, CA) is attached to the 3' end of the probe. When the probe and dyes are intact, reporter dye emission is quenched by the proximity of the 3' quencher dye. During amplification, annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5 '-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated. With each cycle, additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISM™ 7700 Sequence Detection System. In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples .
[00181] PCR reagents can be obtained from PE-Applied Biosystems, Foster City, CA. RT-PCR reactions are carried out by adding 25 μL PCR cocktail (lx TAQMAN™ buffer A, 5.5 MM MgCl2, 300 μM each of dATP, dCTP and dGTP, 600 μM of dUTP, 100 nM each of forward primer, reverse primer, and probe, 20 Units RNAse inhibitor, 1.25 Units AMPLITAQ GOLD™, and 12.5 Units MuLV reverse franscriptase) to 96 well plates containing 25 μL poly(A) mRNA solution. The RT reaction is carried out by incubation for 30 minutes at 48 °C. Following a 10 minute incubation at 95°C to activate the AMPLITAQ GOLD™, 40 cycles of a two-step PCR protocol are carried out: 95 °C for 15 seconds (denaturation) followed by 60 °C for 1.5 minutes (annealing/extension).
[00182] Probes and primers to human Navl .3 were designed to hybridize to a human Navl .3 sequence, using published sequence, information (GenBank accession number NM_006922, incoφorated herein as Figure 1. For human Navl .3 the PCR primers were: forward primer: TTGACTTTGTGGTGGTGATTCTCT SEQ ID NO : 9097
reverse primer: CGTAGGATTCGGCCAATCCT SEQ ID NO : 9098 and the
PCR probe is: FAM- ACCTTGTTCCGAGTGATCCGTCTTGC SEQ ID
NO : 9099 - TAMRA where FAM™ (PE-Applied Biosystems, Foster City, CA) is the fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quencher dye. For human cyclophilin the PCR primers were: forward primer: CCCACCGTGTTCTTCGACAT SEQ ID NO : 9100
reverse primer: TTTCTGCTGTCTTTGGGACCTT SEQ ID NO : 9101 and
the PCR probe is: 5' JOE- CGCGTCTCCTTTGAGCTGTTTGCA SEQ ID
NO : 9102 - TAMRA 3 ' where JOE (PE-Applied Biosystems, Foster City, CA) is the fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quencher dye.
Example 14
Antisense inhibition of human Navl.3 expression by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy
gap [00183] In accordance with the present invention, a series of oligonucleotides are designed to target different regions of the human Navl.3 RNA, using published sequences (NM_006922, incorporated herein as Figure 1. The oligonucleotides are shown in Table 1. "Position" indicates the first (5 '-most) nucleotide number on the particular target sequence to which the oligonucleotide binds. The indicated parameters for each oligo were predicted using RNAstructure 3.7 by David H. Mathews, Michael Zuker, and Douglas H. Turner. All compounds in Table 1 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting often 2'deoxynucleotides, which is flanked on both sides (5' and 3' directions) by four-nucleotide "wings". The wings are composed of 2 '-methoxyethyl (2'-MOE) nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P=S) throughout the oligonucleotide. Cytidine residues in the 2' -MOE wings are 5- methylcytidines. All cytidine residues are 5-methylcytidines.
TABLE 1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
CTTTTCTTCCTCCGGTTCCT
1969 SEQ ID Nθ:l -28.5 -28.9 80.8 0 0 -6.6
TTTTCTTCCTCCGGTTCCTC
19G8 SEQ ID NO: 2 -28 -28.4 80.7 0 0 -6.6 TCTTTTCTTCCTCCGGTTCC
1970 SEQ ID NO: 3 -28 -28.4 80.7 0 0 -6.6 CCTCCGGTTCCTCCATTCTT
1961 SEQ ID NO: 4 -27.8 -30.5 82.5 -2.1 -0.3 -6.6
TTCTTCCTCCGGTTCCTCCA
1966 SEQ ID NO: 5 -27.8 -30.9 84.4 -2.1 -0.8 -6.6 TCCTCCGGTTCCTCCATTCT
1962 SEQ ID NO: 6 -27.7 -30.8 83.9 -2.1 -0.8 -6.6 TCTTCCTCCGGTTCCTCCAT
1965 SEQ ID NO: -27.7 -30.8 83.9 -2.1 -0.8 -6.6
CTTCCTCCGGTTCCTCCATT
1964 SEQ ID NO: 8 -27.4 -30.5 82.5 -2.1 -0.8 -6.6
TTTCTTCCTCCGGTTCCTCC
1967 SEQ ID NO: 9 -27 -30.3 83.8 -3.3 0 -6.6 TTCCTCCGGTTCCTCCATTC
1963 SEQ ID NO: 10 -26,9 -30 82.4 -2.1 -0.8 -6
TCTTCTTTTCTTCCTCCGGT
1973 SEQ ID NO: 11 -26.9 -27.3 79.1 0 0 -6.6 CTTCTTTTCTTCCTCCGGTT
1972 SEQ ID NO: 12 -26.6 -27 77.6 0 0 -6.6
TTCTTTTCTTCCTCCGGTTC
1971 SEQ ID NO: 13 -26.1 -26.5 77.4 0 0 -6.6 CTCCGGTTCCTCCATTCTTT
1960 SEQ ID NO: 14 -25.5 -28.6 79.5 -2.1 -0.8 -6.6 ACATCCTTTGCCCGACCTCT
2212 SEQ ID NO: 15 -24.3 -30 79.2 -5.7 0 -3
CTGTCTTCTTTTCTTCCTCC
1976 SEQ ID NO: 16 -24.1 -26.2 78.6 -2.1 0 0
GGGTCCCCACGGTCTCCCTT
5683 SEQ ID NO: 17 -24.1 -34.8 90.5 -9.4 -1.2 -7 GTCTTCTTTTCTTCCTCCGG
1974 SEQ ID NO: 18 -24 -27.3 79.1 -3.3 0 -6 TGTCTTCTTTTCTTCCTCCG
1975 SEQ ID NO: 19 -24 -26.1 76.1 -2.1 0 -2.2 TGCCTTTGTTCTGTAGTACT
8639 SEQ ID NO:20 -24 -24.4 73.7 0.3 0 -5.7 TATCTTGTTCCTTTTTGGGC
579 SEQ ID NO: 21 -23.8 -24.3 72.7 0.3 -0.2 -3.1 GTTCTGTAGTACTGCTTGGT
8632 SEQ ID NO: 22 -23.8 -24.7 76 -0.7 0 -7.1 GATTCCACCAGATCTTCCCT
4035 SEQ ID NO: 23 -23.5 -28 77.4 -4.5 0 -5.8
TGGGTCCCCACGGTCTCCCT
5684 SEQ ID NO: 24 -23.4 -34.7 89.8 -9.4 -1.9 -9.4
ATTTGCCTTTGTTCTGTAGT
8642 SEQ ID NO: 25 -23.4 -23.8 72.3 0.3 0 -3 ATCTTGTTCCTTTTTGGGCT
578 SEQ ID NO: 26 -23.3 -25.5 75.4 -1.6 -0.2 -3.8 TCCGGTTCCTCCATTCTTTA
1959 SEQ ID NO:27 -23.3 -27.4 76.9 -3.1 -0.8 -6.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GGTCCCCACGGTCTCCCTTA 5682 SEQ ID NO:28 -23.3 -33.3 87.4 -9.4 -0.3 -3.5
AGGAAGTGGTGTTGGTTTCA
1332 SEQ ID NO:29 -23.2 -23.7 71.8 1.7 -0.2 -4.1 ATGGGTCCCCACGGTCTCCC
5685 SEQ ID NO: 30 -23.2 -33.8 87.9 -9.4 -1.1 -9.1
TTGCCTTTGTTCTGTAGTAC
8640 SEQ ID NO:31 -23.2 -23.6 71.9 0.3 0 -4.7 GTAGGAAGTGGTGTTGGTTT
1334 SEQ ID NO: 32 -23.1 -23.5 71.8 1.7 0 -1.3 TTCCACCAGATCTTCCCTTT
4033 SEQ ID NO:33 -23.1 -27.6 76.9 -4.5 0 -5.8 TTTGCCTTTGTTCTGTAGTA
8641 SEQ ID NO: 34 -23.1 -23.5 71.7 0.3 0 -3 AGTAGGAAGTGGTGTTGGTT
1335 SEQ ID NO: 35 -23 -23.4 71.7 1.7 0 -1.3 CTCTGTCTTCTTTTCTTCCT
1978 SEQ ID NO: 36 -23 -25.1 76.8 -2.1 0 0 ATTCCACCAGATCTTCCCTT
4034 SEQ ID NO:37 -23 -27.5 76.5 -4.5 0 -5.8 GGGGTAGTGCTCCATGGCCA
2801 SEQ ID NO: 38 -22.9 -31.2 86.2 -7.4 -0.5 -9.3
AACATCCTTTGCCCGACCTC 2213 SEQ ID NO: 39 -22.7 -28.4 75.1 -5.7 0 -3
TCTGTCTTCTTTTCTTCCTC 1977 SEQ ID NO:40 -22.5 -24.6 76.6 -2.1 0 0
TCTCTGTCTTCTTTTCTTCC
1979 SEQ ID NO: 41 -22.5 -24.6 76.6 -2.1 0 0 TCTTGTTCCTTTTTGGGCTT
577 SEQ ID NO: 2 -22.4 -25.6 75.8 -2.7 -0.2 -3.8
CATCCTTTGCCCGACCTCTG 2211 SEQ ID NO: 43 -22.4 -29.8 78.5 -7.4 0 -3
GATTTTCTCTGACCTCTTTT
6447 SEQ ID NO: 44 -22.4 -22.8 69.1 0.6 0 -2.4 GGAAGTGGTGTTGGTTTCAA
1331 SEQ ID NO:45 -22.3 -23 69 1.7 -0.4 -4.1
TAGGAAGTGGTGTTGGTTTC
1333 SEQ ID NO: 6 -22.3 -22.7 69.9 1.7 0 -2.6 TGATTTTCTCTGACCTCTTT
6448 SEQ ID NO:47 -22.3 -22.7 68.6 0.6 0 -2.4 GGTTTTGTCAGTAGGCAGTA
7780 SEQ ID NO: 48 -22.3 -24.5 75.6 -2.2 0.2 -4 AAGTAGGAAGTGGTGTTGGT
1336 SEQ ID NO: 49 -22.2 -22.6 68.7 1.7 0 -1.2 TTATCTTGTTCCTTTTTGGG
580 SEQ ID NO: 50 -22.1 -22.6 68.5 0.3 -0.2 -3.1
AGATTCCACCAGATCTTCCC 4036 SEQ ID NO: 51 -22.1 -27.1 75.8 -4.5 -0.2 -5.8
AGGTTTTGTCAGTAGGCAGT
7781 SEQ ID NO: 52 -22.1 -24.8 76.6 -2.2 -0.1 -4 TGTTCTGTAGTACTGCTTGG
8633 SEQ ID NO: 53 -22.1 -23.5 71.9 -0.7 0 -7.8
GCCTTTGTTCTGTAGTACTG 8638 SEQ ID NO: 54 -22.1 -24.4 73.7 -2.3 0 -6
TTGATTTTCTCTGACCTCTT
6449 SEQ ID NO: 55 -22 -22.7 68.6 -0.4 0 -2.4 GCTTTTAATTTGCCTTTGTT
8649 SEQ ID NO: 56 -22 -22.4 66.7 0.3 0 -3.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GTTTTGTCAGTAGGCAGTAT 7779 SEQ ID NO:57 -21.9 -23.3 72.6 -0.7 -0.1 -4
TGCTTTTAATTTGCCTTTGT 8650 SEQ ID NO:58 -21.9 -22.3 66.3 0.3 0 -3.6
TGGGGTAGTGCTCCATGGCC 2802 SEQ ID NO: 59 -21.8 -30.5 85 -7.4 -1.2 -8.1
TTAATTTGCCTTTGTTCTGT 8645 SEQ ID NO:60 -21.6 -22 66.4 0.3 0 -3
GGGTAGTGCTCCATGGCCAT 2800 SEQ ID NO: 61 -21.5 -30 83.5 -7.4 -0.4 -10 AATTTGCCTTTGTTCTGTAG
8643 SEQ ID NO:62 -21.5 -21.9 66.3 0.3 0 -2.3 CTCTCTGTCTTCTTTTCTTC
1980 SEQ ID NO: 63 -21.4 -23.5 74.7 -2.1 0 0
GTCCCCACGGTCTCCCTTAA 5681 SEQ ID NO: 64 -21.4 -31.4 82.4 -9.4 -0.3 -3.5
CAACATCCTTTGCCCGACCT 2214 SEQ ID NO:65 -21.3 -28.7 74.6 -7.4 0 -3
CCATCTGTATTCGAAGGGCA
6075 SEQ ID NO: 66 -21.2 -25 70.4 -3.8 0 -7.1 CCATCTGTTTTTTCTGGAGT
6331 SEQ ID NO: 67 -21.2 -24 72 -2.8 0 -3.1
TTTGATTTTCTCTGACCTCT 6450 SEQ ID NO: 68 -21.2 -22.7 68.6 -1.4 0 -2.4
TAATTTGCCTTTGTTCTGTA
8644 SEQ ID NO:69 -21.2 -21.6 65.5 0.3 0 -3 GCCAGTTCCATGGATCACGA
1029 SEQ ID NO:70 -21.1 -27.4 75.4 -4.9 -0.8 -10.5
ATAGGTTTTGTCAGTAGGCA 7783 SEQ ID NO: 71 -21.1 -23.3 71.7 -2.2 0 -4
TTTGTTCTGTAGTACTGCTT 8635 SEQ ID NO:72 -21.1 -22.5 70 -0.7 0 -7.8
ATTATCTTGTTCCTTTTTGG 581 SEQ ID NO:73 -21 -21.4 65.8 0.3 0 -2.9
TTGTTCTGTAGTACTGCTTG 8634 SEQ ID NO: 74 -21 -22.4 69.5 -0.7 0 -7.8
TCCTTTGCCCGACCTCTGAA 2209 SEQ ID NO:75 -20.9 -29 76.4 -8.1 0 -3
CCCCACGGTCTCCCTTAACT 5679 SEQ ID NO: 76 -20.9 -30.9 79.8 -9.4 -0.3 -3.3
TCCATCTGTATTCGAAGGGC
6076 SEQ ID NO:77 -20.9 -24.7 70.9 -3.8 0 -7.1 GCTGTTCGAGCATCTGCTGA
1806 SEQ ID NO: 78 -20.8 -26.9 77.1 -4.5 -1.5 -7.9 TTTGACGCTGTCTTCAGATT
2051 SEQ ID NO:79 -20.6 -22.9 68.1 -0.6 -1.4 -7.6 TTTTGACGCTGTCTTCAGAT
2052 SEQ ID NO:80 -20.6 -22.9 68.1 -0.6 -1.4 -7.6 GATGGGTCCCCACGGTCTCC
5686 SEQ ID NO:81 -20.6 -32.4 86 -10.9 -0.6 -8.8
TCATGTCTTGTTTTATAGGT 6285 SEQ ID NO:82 -20.6 -21 66.3 1.3 0 -4.7
TAGGTTTTGTCAGTAGGCAG 7782 SEQ ID NO:83 -20.6 -23.3 72.1 -2.2 -0.1 -4
TTTTAATTTGCCTTTGTTCT
8647 SEQ ID NO: 84 -20.6 -21 64 0.3 0 -3 CTTTTAATTTGCCTTTGTTC
8648 SEQ ID NO:85 -20.6 -21 64 0.3 0 -3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TTTTCTCTGACCTCTTTTCC 6445 SEQ ID NO: 86 -20.5 -24.6 73.4 -4.1 0 -2.2
TTTAATTTGCCTTTGTTCTG 8646 SEQ ID NO: 87 -20.5 -20.9 63.5 0.3 0 -3
TCTCTCTGTCTTCTTTTCTT 1981 SEQ ID NO: 88 -20.4 -23.5 74.7 -3.1 0 0
CCCTCTGGGGGAAGTTGTCC 2473 SEQ ID NO: 89 -20.4 -29.8 82.2 -7.8 -1.5 -7.6
TCTATAACTTTTGGCTTTCT 3565 SEQ ID NO: 90 -20.4 -20.8 64.1 0 0 -3.7
TCCCCACGGTCTCCCTTAAC 5680 SEQ ID NO: 91 -20.4 -30.4 79.6 -9.4 -0.3 -3.5
CCATCTTTTCATCCTGCACA 456 SEQ ID NO: 92 -20.3 -26.1 74 -5.8 0 -4.8
GAAGTGGTGTTGGTTTCAAA 1330 SEQ ID NO: 93 -20.3 -21.1 64 1.7 -0.6 -3.5
AAAGTAGGAAGTGGTGTTGG 1337 SEQ ID NO: 94 -20.3 -20.7 63.1 1.7 0 -1.3
AGATAGCCAGCGCCAACATT 4675 SEQ ID NO: 95 -20.3 -26.2 71.3 -5.9 0.3 -7.6
TTTCTCTGACCTCTTTTCCT 6444 SEQ ID NO: 96 -20.3 -25.4 75 -5.1 0 -2.4
CCGGTTCCTCCATTCTTTAG 1958 SEQ ID NO: 97 -20.2 -27 75.5 -5.9 -0.8 -5.4
CAAGATAGCCAGCGCCAACA 4677 SEQ ID NO:98 -20.2 -26.1 69.9 -5.2 -0.5 -7.6
AAGCTGCTTTTAATTTGCCT 8654 SEQ ID NO: 99 -20.2 -22.9 66.6 -2.1 0 -8.6
TCCAACATCCTTTGCCCGAC
2216 SEQ ID NO: 100 -20.1 -28.2 74.4 -8.1 0 -3 CCTACTCCACTGAAATCTCT
1879 SEQ ID NO: 101 -20 -23.7 67.9 -3.7 0 -2.5
GGATTTCTATAACTTTTGGC 3570 SEQ ID NO: 102 -20 -20.4 62.5 0 0 -2.8
ATCCAACATCCTTTGCCCGA
2217 SEQ ID NO:103 -19.9 -28 73.8 -8.1 0 -3 ATCACAGCAGTCCCAGATCA
2684 SEQ ID NO: 104 -19.9 -26.5 76 -6.6 0 -5.4
CATGTCTTGTTTTATAGGTA 6284 SEQ ID NO: 105 -19.9 -20.3 64 1.3 0 -3.5
TGGCCTGCATCTGAGCCATT 1486 SEQ ID NO: 106 -19.8 -28.9 79.6 -6.9 -2.2 -7.5
CCTTTGCCCGACCTCTGAAA 2208 SEQ ID NO: 107 -19.8 -27.9 72.7 -8.1 0 -2.8
CCAACATCCTTTGCCCGACC 2215 SEQ ID NO: 108 -19.8 -29.8 76 -10 0 -3
GGTAGTGCTCCATGGCCATA 2799 SEQ ID NO:109 -19.8 -28.5 80.3 -7.4 -0.4 -10.4
CATGACCAGGAAGAGCAGGA 5450 SEQ ID NO: 110 -19.8 -24.2 68.7 -4.4 0 -4.1
AGCCAGTTCCATGGATCACG 1030 SEQ ID NO: 111 -19.7 -26.8 74.4 -6 -0.8 -9.7
ATCCTTTGCCCGACCTCTGA 2210 SEQ ID NO: 112 -19.7 -29.7 78.8 -10 0 -3
CTATAACTTTTGGCTTTCTA 3564 SEQ 'ID NO: 113 -19.7 -20.1 62 0 0 -3.7
GATTTCTATAACTTTTGGCT 3569 SEQ ID NO: 114 -19.7 -20.1 61.9 0 0 -3.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GTCTTGTTTTATAGGTAAGT 6281 SEQ ID NO: 115 -19.7 -20.1 64.2 1.3 0 -2.7
AATAGGTTTTGTCAGTAGGC 7784 SEQ ID NO: 116 -19.7 -21.9 67.8 -2.2 0 -2.8
CCATTTGAATCCATTGTGCC 1360 SEQ ID NO:117 -19.6 -25 69.7 -5.4 0 -3
CTTGTTTTGCTATTGCGTCT 2179 SEQ ID NO: 118 -19.6 -24.1 71.2 -2.9 -1.5 -4 TTCTATAACTTTTGGCTTTC
3566 SEQ ID NO:119 -19.6 -20 62.4 0 0 -3.7 GTGCCATCTTTTCATCCTGC
459 SEQ ID NO:120 -19.5 -27.5 79 -8 0 -3
CTTGTTCCTTTTTGGGCTTC 576 SEQ ID NO:121 -19.5 -25.6 75.8 -5.6 -0.2 -3.8
ATGTTTTCCCAGCAGCACGT 1650 SEQ ID NO: 122 -19.5 -27.8 77.3 -8.3 0 -5.4
AGCTGTTCGAGCATCTGCTG 1807 SEQ ID NO:123 -19.5 -26.3 76 -4.5 -2.3 -9.1
CCCACGGTCTCCCTTAACTG 5678 SEQ ID NO: 124 -19.5 -28.9 76.4 -9.4 0.2 -3.5
ATCTTTTCATCCTGCACATT 454 SEQ ID NO:125 -19.4 -23.5 69.5 -4.1 0 -4.8
ACATGACCAGGAAGAGCAGG 5451 SEQ ID NO: 126 -19.4 -23.8 68 -4.4 0 -5.2
ATCATGTCTTGTTTTATAGG 6286 SEQ ID NO:127 -19.4 -19.8 62.8 1.3 0 -4.7
TTCTCTGACCTCTTTTCCTT 6443 SEQ ID NO: 128 -19.4 -25.4 75 -6 0 -2.4
GAGCAGCATAGGCAATATTA 7564 SEQ ID NO: 129 -19.4 -21.8 64.8 -1.4 -0.8 -6.2
GCATCTGAGCCATTTCCACA 1480 SEQ ID NO: 130 -19.3 -27.1 76 -7.8 0 -3.8
ACCTACTCCACTGAAATCTC 1880 SEQ ID NO: 131 -19.3 -23 66.6 -3.7 0 -2.5
TTTCTATAACTTTTGGCTTT
3567 SEQ ID NO:132 -19.3 -19.7 61.3 0 0 -3.7 GTTTACGTTTCAAAGTGGTT
6147 SEQ ID NO: 133 -19.3 -20.9 63.5 -1.6 0 -4.8 TGTTTTCCCAGCAGCACGTA
1649 SEQ ID NO: 134 -19.2 -27.5 76.7 -8.3 0 -5.4
TTGACGCTGTCTTCAGATTC 2050 SEQ ID NO:135 -19.2 -23.2 69.4 -2.5 -1.4 -7.6
TGTTTTGCTATTGCGTCTTG 2177 SEQ ID NO: 136 -19.2 -23.2 69 -2.4 -1.5 -4
TCACAGCAGTCCCAGATCAA 2683 SEQ ID NO:137 -19.2 -25.8 73.5 -6.6 0 -5.4
CAGTAGCAGCAAGGTTGTCT 3438 SEQ ID NO: 138 -19.2 -24.9 74.5 -5.7 0 -4.6
ATTTCTATAACTTTTGGCTT
3568 SEQ ID NO: 139 -19.2 -19.6 60.9 0 0 -3.7 CATCTGTATTCGAAGGGCAT
6074 SEQ ID NO: 140 -19.2 -23 66.8 -3.8 0 -7.1
TTCCATCTGTATTCGAAGGG 6077 SEQ ID NO:141 -19.2 -23 67 -3.8 0 -7.1
TGTTTACGTTTCAAAGTGGT
6148 SEQ ID NO: 142 -19.2 -20.8 63 -1.6 0 -4.5 CTTGTTTTATAGGTAAGTCA
6279 SEQ ID NO: 143 -19.2 -19.6 62.1 1.3 0 -2.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex sstruct;; oligo oligo GTCAATAATCATGTCTTGTT
6293 SEQ ID NO: 144 -19.2 -19.6 61.4 1.3 0 -4.7 GTTTGTCAATAATCATGTCT
6297 SEQ ID NO: 145 -19.2 -19.6 61.4 1.3 0 -4.7 CATCTGTTTTTTCTGGAGTG
6330 SEQ ID NO: 146 -19.2 -22 67.9 -2.8 0 -2.7 ATTTTCTCTGACCTCTTTTC
6446 SEQ ID NO: 147 -19.2 -22.6 69.4 -3.4 0 -2.4 GATCTAGGTTTGAGTGTTTG
8096 SEQ ID NO: 148 -19.2 -21.4 67.1 -2.2 0 -4.1 TGATCTAGGTTTGAGTGTTT
8097 SEQ ID NO: 149 -19.2 -21.4 67.1 -2.2 0 -4.9 CATGGTTTGGCCAGCGACCT
3329 SEQ ID NO: 150 -19.1 -29.3 78.5 -8.4 -1.4 -11.4 TGTCAATAATCATGTCTTGT
6294 SEQ ID NO: 151 -19.1 -19.5 60.9 1.3 0 -4.7 ATGATCTAGGTTTGAGTGTT
8098 SEQ ID NO: 152 -19.1 -21.3 66.7 -2.2 0 -4.9 TGCCATCTTTTCATCCTGCA
458 SEQ ID NO: 153 -19 -27 76.5 -8 0 -4.7 TTGTTCCTTTTTGGGCTTCT
575 SEQ ID NO: 154 -19 -25.6 75.8 -6.6 0.4 -3.8 AAGTGGTGTTGGTTTCAAAA
1329 SEQ ID NO: 155 -19 -19.8 60.5 1.7 -0.6 -3.1 TGTCTTCCATCTGTATTCGA
6081 SEQ ID NO: 156 -19 -23.8 70.6 -4.8 0 -4.4 TTTTGATTTTCTCTGACCTC
6451 SEQ ID NO: 157 -19 -21.9 66.9 -2.9 0 -2.4 GAAGTTGTTTATCAGGCTAT
7435 SEQ ID NO: 158 -19 -21 64.8 -2 0 -5.2 AGAAGTTGTTTATCAGGCTA
7436 SEQ ID NO: 159 -19 -21 65.1 -2 0 -5.2 TAGAAGTTGTTTATCAGGCT
7437 SEQ ID NO: 160 -19 -21 65.1 -2 0 -5.2 AGAGCAGCATAGGCAATATT
7565 SEQ ID NO: 161 -19 -22.1 65.7 -1.4 -1.6 -6.7 CATCTTTTCATCCTGCACAT
455 SEQ ID NO: 162 -18.9 -24.1 70.3 -5.2 0 -4.8 GCCATCTTTTCATCCTGCAC
457 SEQ ID NO: 163 -18.9 -27.2 77.3 -8.3 0 -4.8 CATTATCTTGTTCCTTTTTG
582 SEQ ID NO: 164 -18.9 -20.9 64.3 -2 0 -1.3 CCCAGCAGCACGTAATGTCA
1643 SEQ ID NO: 165 -18.9 -27.2 74.2 -8.3 0 -5.4 TCTTGTTTTATAGGTAAGTC
6280 SEQ ID NO: 166 -18.9 -19.3 62.3 1.3 0 -2.7 CTTTGCCACTTTGTTCATGG
8276 SEQ ID NO: 167 -18.9 -24.5 71.3 -5.6 0.4 -4.7 TCTTTTCATCCTGCACATTT
453 SEQ ID NO: 168 -18.8 -23.6 69.9 -4.8 0 -4.8 TAAAGTAGGAAGTGGTGTTG
1338 SEQ ID NO: 169 -18.8 -19.2 59.8 1.7 0 -1.3 AAGCTGTTCGAGCATCTGCT
1808 SEQ ID NO: 170 -18.8 -25.6 73.7 -4.5 -2.3 -9.6 TTGTTTTGCTATTGCGTCTT
2178 SEQ ID NO: 171 -18.8 -23.3 69.5 -2.9 -1.5 -4 TCACGGCTCTTTGCCTTCCA
2571 SEQ ID NO: 172 -18.8 -29.4 80.5 -7.9 -2.7 -6.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
CACAGCAGTCCCAGATCAAG
2682 SEQ ID NO: 173 -18.8 -25.4 72.1 -6.6 0 -5.4 GCATGGTTTTGATAGTCTTT
4170 SEQ ID NO: 174 -18.8 -22.2 68.2 -3.4 0 -5 AAGATAGCCAGCGCCAACAT
4676 SEQ ID NO: 175 -18.8 -25.4 68.9 -5.9 -0.5 -7.6 AGTTGTTTATCAGGCTATAT
7433 SEQ ID NO: 176 -18.8 -20.8 65.1 -2 0 -5.2 CCAGTTCCATGGATCACGAA
1028 SEQ ID NO: 177 -18.7 -24.9 69 -4.9 -0.1 -10.5 GGCCTGCATCTGAGCCATTT
1485 SEQ ID NO: 178 -18.7 -29 80.2 -8.7 -1.5 -7.4 GCTTGTTTTGCTATTGCGTC
2180 SEQ ID NO: 179 -18.7 -25 73.6 -4.7 -1.5 -5.3 ACAGCAGTCCCAGATCAAGA
2681 SEQ ID NO: 180 -18.7 -25.3 72.3 -6.6 0 -5.4 GGCACATGGTTTGGCCAGCG
3333 SEQ ID NO: 181 -18.7 -29.5 79.6 -8.4 -2.4 -9.4 AAGATTCCACCAGATCTTCC
4037 SEQ ID NO: 182 -18.7 -24.4 69.9 -4.5 -1.1 -5.8 AGCATGGTTTTGATAGTCTT
4171 SEQ ID NO: 183 -18.7 -22.1 68.1 -3.4 0 -5 AGTGGTTGTAATAGGCTCAT
6134 SEQ ID NO: 184 -18.7 -22.6 68.7 -3.9 0 -3.7 TCCCAGCAGCACGTAATGTC
1644 SEQ ID NO: 185 -18.6 -26.9 74.8 -8.3 0 -4.9 CCTTCTCTTTCTGACTTCCG
2507 SEQ ID NO: 186 -18.6 -26.1 74.5 -7.5 0 -2.6 GCCTTCCAGAGGAATCCTCC
2559 SEQ ID NO: 187 -18.6 -29.3 80.1 -8.5 -2.2 -11.2 GCTCTTTGCCTTCCAGAGGA
2566 SEQ ID NO: 188 -18.6 -28.5 80.9 -8.5 -1.3 -5.6 ACATGGTTTGGCCAGCGACC
3330 SEQ ID NO: 189 -18.6 -28.6 77.2 -8.4 -1.4 -10.4 CTTCTTTTTCTGCTGGTTGA
4883 SEQ ID NO: 190 -18.6 -23.8 72.1 -5.2 0 -3.7 TAGAGCAGCATAGGCAATAT
7566 SEQ ID NO: 191 -18.6 -21.7 64.7 -1.4 -1.6 -6.7 ATAGAGCAGCATAGGCAATA
7567 SEQ ID NO: 192 -18.6 -21.7 64.7 -1.4 -1.6 -6.7 GCTTATGCCTCCGCTTCGCT
1 SEQ ID NO: 193 -18.5 -31.1 82.6 -11.7 -0.8 -4.9 GTTTTCCCAGCAGCACGTAA
1648 SEQ ID NO: 194 -18.5 -26.8 74.4 -8.3 0 -5.4 CTTTTGACGCTGTCTTCAGA
2053 SEQ ID NO: 195 -18.5 -23.8 70.2 -3.8 -1.4 -6.9 ACACCAAGGTGAGGTTTCCT
3117 SEQ ID NO: 196 -18.5 -26 74 -6.4 -0.8 -9.6 TCGAAGATTCCACCAGATCT
4040 SEQ ID NO: 197 -18.5 -23.7 67.3 -4.5 -0.4 -6 GTTTCTGAGGTTTCTTGGAT
4971 SEQ ID NO: 198 -18.5 -23.1 71.1 -4.6 0 -2.8 ACCTGTCTTCCATCTGTATT
6084 SEQ ID NO: 199 -18.5 -25.1 74 -6.6 0 -1.7 TTACGTTTCAAAGTGGTTGT
6145 SEQ ID NO: 200 -18.5 -20.8 63 -1.6 -0.4 -5.6 TGTCTTGTTTTATAGGTAAG
6282 SEQ ID NO: 201 -18.5 -18.9 60.7 1.3 0 -2.4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
ATGTCTTGTTTTATAGGTAA
6283 SEQ ID NO: 202 -18.5 -18.9 60.4 1.3 0 -2.1 GTTGTTTATCAGGCTATATA
7432 SEQ ID NO: 03 -18.5 -20.5 64.2 -2 0 -5.2 GAATAGGTTTTGTCAGTAGG
7785 SEQ ID NO: 204 -18.5 -20.7 64.7 -2.2 0 -2.6 TTCTGTAGTACTGCTTGGTG
8631 SEQ ID NO: 205 -18.5 -23.5 71.9 -4.5 0 -7.8 TTTTCCCAATAGTCTTGAGT
1612 SEQ ID NO: 206 -18.4 -22.8 68.1 -3.9 -0.2 -2.9 CTCTCTCTGTCTTCTTTTCT
1982 SEQ ID NO: 207 -18.4 -24.3 76.5 -5.9 0 0 GGCTCTTTGCCTTCCAGAGG
2567 SEQ ID NO: 208 -18.4 -29.1 82.2 -8.5 -2.2 -7.7 TCCACCAGATCTTCCCTTTG
4032 SEQ ID NO: 209 -18.4 -27.5 76.3 -9.1 0 -5.8 CATGTTACCCGTTGTCATGT
4568 SEQ ID NO: 210 -18.4 -25.5 72.4 -6.3 -0.6 -4.7 AACTTCTTTTTCTGCTGGTT
4885 SEQ ID NO: 211 -18.4 -22.7 68.9 -4.3 0 -3.7 GTGGTTGTAATAGGCTCATA
6133 SEQ ID NO: 212 -18.4 -22.3 67.8 -3.9 0 -3.7 TCACTGTCTTGTATAGGCAC
6600 SEQ ID NO: 213 -18.4 -23.3 70.9 -4.2 -0.5 -4 TTCACTGTCTTGTATAGGCA
6601 SEQ ID NO: 214 -18.4 -23.2 70.7 -4.1 -0.4 -4 ATCTAGGTTTGAGTGTTTGA
8095 SEQ ID NO: 215 -18.4 -21.4 67.1 -3 0 -4 ATTAAAGTAGGAAGTGGTGT
1340 SEQ ID NO: 216 -18.3 -19.2 59.9 -0.8 0 -3 CATTAAAGTAGGAAGTGGTG
1341 SEQ ID NO: 217 -18.3 -18.7 58.1 0.9 0 -3 TTCCCAGCAGCACGTAATGT
1645 SEQ ID NO: 218 -18.3 -26.6 73.5 -8.3 0 -5.4 CTGTTCGAGCATCTGCTGAA
1805 SEQ ID NO: 219 -18.3 -24.4 70.3 -4.5 -1.5 -9.5 GTTTTGCTATTGCGTCTTGG
2176 SEQ ID NO: 220 -18.3 -24.4 71.8 -5.2 -0.8 -4.2 GTACAGACAATCCCTCCACA
3000 SEQ ID NO: 221 -18.3 -25.9 72 -7.6 0 -4.6 TAGCATGGTTTTGATAGTCT
4172 SEQ ID NO: 222 -18.3 -21.7 67.1 -3.4 0 -5 CTCAGGGGCTCTGCACTTTC
5809 SEQ ID NO: 223 -18.3 -27.8 81.1 -8.5 -0.9 -4.8 GTCTTCCATCTGTATTCGAA
6080 SEQ ID NO: 224 -18.3 -23.1 68.4 -4.8 0 -6.8 AGTTTGTCAATAATCATGTC
6298 SEQ ID NO: 225 -18.3 -18.7 59.5 1.3 0 -4.7 AATGATCTAGGTTTGAGTGT
8099 SEQ ID NO: 226 -18.3 -20.5 63.9 -2.2 0 -4.9 CCATTAAAGTAGGAAGTGGT
1342 SEQ ID NO: 227 -18.2 -20.7 62 -2.5 0 -3.3 CACCAAGGTGAGGTTTCCTA
3116 SEQ ID NO: 228 -18.2 -25.5 72.8 -6.4 -0.5 -9 TGGATTTCTATAACTTTTGG
3571 SEQ ID NO: 229 -18.2 -18.6 58.3 0 0 -2.3 TGCTGTTGCCAAAGGTCTCA
5547 SEQ ID NO: 230 -18.2 -25.9 74.1 -6.8 -0.8 -4.4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
CGTTTCAAAGTGGTTGTAAT
6142 SEQ ID NO: 231 -18.2 -19.8 60 -1.6 0.2 -3.2 AATAGAGCAGCATAGGCAAT
7568 SEQ ID NO: 232 -18.2 -21.3 63.1 -1.4 -1.6 -6.7 TCATTATCTTGTTCCTTTTT
583 SEQ ID NO: 233 -18.1 -21.3 66 -3.2 0 -1.9 AGTTCCATGGATCACGAAGA
1026 SEQ ID NO: 234 -18.1 -22.8 65.9 -3.4 0 -10.5 CAGCCAGTTCCATGGATCAC
1031 SEQ ID NO: 235 -18.1 -26.7 75.6 -7.4 -0.8 -10 CGCTGAGACATTGCCCAGGT
1094 SEQ ID NO: 236 -18.1 -28.6 77.2 -10 -0.2 -4.1 TGCATCTGAGCCATTTCCAC
1481 SEQ ID NO: 237 -18.1 -26.4 74.7 -7.8 -0.1 -4.8 CAACTGCCTGAGCTTCTTCC
1839 SEQ ID NO: 238 -18.1 -27 76 -8.2 -0.4 -5.2 CTACTCCACTGAAATCTCTT
1878 SEQ ID NO: 239 -18.1 -21.8 64.6 -3.7 0 -2.5 TATAACTTTTGGCTTTCTAA
3563 SEQ ID NO: 240 -18.1 -18.5 58 0 0 -3.7 GATAGCCAGCGCCAACATTA
4674 SEQ ID NO: 241 -18.1 -25.9 70.5 -7.1 -0.5 -7.6 GCAGCGTGCGGATCCCCTTT
5385 SEQ ID NO: 242 -18.1 -32.2 83.3 -12.4 -1.4 -11.1 AGCAGCGTGCGGATCCCCTT
5386 SEQ ID NO: 243 -18.1 -32.1 83.3 -11.8 -2.2 -11.1 TTGTTTACGTTTCAAAGTGG
6149 SEQ ID NO: 244 -18.1 -19.7 60.3 -1.6 0 -4.8 TCAATAATCATGTCTTGTTT
6292 SEQ ID NO: 245 -18.1 -18.5 58.5 1.3 0 -4.7 TTTGTCAATAATCATGTCTT
6296 SEQ ID NO: 246 -18.1 -18.5 58.5 1.3 0 -4.7 AAGTTGTTTATCAGGCTATA
7434 SEQ ID NO: 247 -18.1 -20.1 62.8 -2 0 -5.2 ATAGAAGTTGTTTATCAGGC
7438 SEQ ID NO: 248 -18.1 -20.1 63 -2 0 -5 CCTTTTTGGGCTTCTTGGCT
570 SEQ ID NO: 249 -18 -27.8 79.3 -8.8 -0.9 -4.3 TCCTTTTTGGGCTTCTTGGC
571 SEQ ID NO: 250 -18 -27.3 79.1 -8.8 -0.2 -4 TATGTTTTCCCAGCAGCACG
1651 SEQ ID NO: 251 -18 -26.3 73.3 -8.3 0 -5.4 TACTGTTGCGTCGCTCTCCA
2322 SEQ ID NO: 252 -18 -28.2 78.4 -9.6 -0.3 -6.9 ACCTTCTCTTTCTGACTTCC
2508 SEQ ID NO: 253 -18 -25.5 75.3 -7.5 0 -2.6 GCAGTCCCAGATCAAGAACA
2678 SEQ ID NO: 254 -18 -24.6 69.7 -6.6 0 -5.4 GTAGTGCTCCATGGCCATAA
2798 SEQ ID NO: 255 -18 -26.6 75 -7.4 0.3 -10.4 TGGCCAACACCAAGGTGAGG
3123 SEQ ID NO: 256 -18 -26.3 71.8 -6.7 -1 -11.2 CAGGAAGGAGTGGAAGAAGT
3254 SEQ ID NO: 257 -18 -21 62.8 -3 0 -1.6 GCAAGATAGCCAGCGCCAAC
4678 SEQ ID NO: 258 -18 -27.2 72.8 -8.5 -0.5 -7.6 GGTTTCTGAGGTTTCTTGGA
4972 SEQ ID NO:259 -18 -24.3 74 -6.3 0 -2.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
AAGTGGTTGTAATAGGCTCA 6135 SEQ ID NO:260 -18 -21.9 66.4 -3.9 0 -3.7
TTGTCAATAATCATGTCTTG 6295 SEQ ID NO:261 -18 -18.4 58.1 1.3 0 -4.7
TTTTTCTGGTTTGTCTTTCT 6416 SEQ ID NO: 262 -18 -22.3 70.2 -4.3 0 -1.5
GTCATGGGGTAGTGCTCCAT
2806 SEQ ID NO:263 -17.9 -27.8 80.9 -7.9 -2 -8.9 AGTCATGGGGTAGTGCTCCA
2807 SEQ ID NO:264 -17.9 -27.8 81.4 -8.9 -0.9 -7.2 GCTGTTGCCAAAGGTCTCAA
5546 SEQ ID NO:265 -17.9 -25.2 71.8 -6.8 -0.1 -3.7
TCTCTGACCTCTTTTCCTTT
6442 SEQ ID NO:266 -17.9 -25.4 75 -7.5 0 -2.4
TTTGGTGTAGTTACAATGTT
6756 SEQ ID NO: 267 -17.9 -20 62.6 -2.1 0.3 -4.4
GATTTTCCCAATAGTCTTGA
1614 SEQ ID NO: 268 -17.8 -22.2 65.9 -3.9 -0.2 -2.7 AACTGCCTGAGCTTCTTCCT
1838 SEQ ID NO:269 -17.8 -27.2 76.8 -8.2 -1.1 -5.2
CACCTACTCCACTGAAATCT 1881 SEQ ID NO:270 -17.8 -23.3 66.2 -5.5 0 -2.5
TCTTTTGACGCTGTCTTCAG 2054 SEQ ID NO:271 -17.8 -23.6 70.5 -4.7 -1 -7.6
CTTCTCTTTCTGACTTCCGT 2506 SEQ ID NO: 272 -17.8 -25.3 74.3 -7.5 0 -2.6
CAGCAGTCCCAGATCAAGAA 2680 SEQ ID NO: 273 -17.8 -24.4 69.4 -6.6 0 -5.4
CCACAAGGTTTCCAATGACC 3375 SEQ ID NO:274 -17.8 -24.7 68.4 -6.2 -0.4 -4.7
CTAGCATGGTTTTGATAGTC 4173 SEQ ID NO: 275 -17.8 -21.7 67.1 -3.4 -0.1 -5
ACATGTTACCCGTTGTCATG 4569 SEQ ID NO:276 -17.8 -24.5 69.7 -5.4 -1.2 -7.1
CAATAATCATGTCTTGTTTT 6291 SEQ ID NO: 277 -17.8 -18.2 57.5 1.3 0 -4.7
CCCATCTGTTTTTTCTGGAG 6332 SEQ ID NO: 278 -17.8 -24.8 72.3 -7 0 -3.5
GTTCCATGGATCACGAAGAA 1025 SEQ ID NO:279 -17.7 -22.1 63.6 -3.4 0 -10
AGATTTTCCCAATAGTCTTG
1615 SEQ ID NO:280 -17.7 -21.6 64.8 -3.9 0 -2.8 ACCAAGGTGAGGTTTCCTAG
3115 SEQ ID NO: 281 -17.7 -24.8 72 -6.4 -0.5 -6.8
ATAACTTTTGGCTTTCTAAA 3562 SEQ ID NO:282 -17.7 -18.1 56.6 0 0 -3.8
TTCGAAGATTCCACCAGATC 4041 SEQ ID NO: 283 -17.7 -22.9 65.8 -4.5 -0.4 -6.2
ATGTTACCCGTTGTCATGTT 4567 SEQ ID NO: 284 -17.7 -24.9 71.7 -7.2 0 -4.7
CTTTTTCTGCTGGTTGAAGT 4880 SEQ ID NO:285 -17.7 -22.9 69.2 -5.2 0 -3.7
ACTCAGGGGCTCTGCACTTT 5810 SEQ ID NO:286 -17.7 -27.6 79.9 -8.9 -0.9 -4.8
AACCTGTCTTCCATCTGTAT 6085 SEQ ID NO:287 -17.7 -24.3 71.1 -6.6 0 -2.1
ACGTTTCAAAGTGGTTGTAA 6143 SEQ ID NO:288 -17.7 -20 60.6 -1.6 -0.4 -5.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TTAAAGTAGGAAGTGGTGTT 1339 SEQ ID NO:289 -17.6 -19.3 60.3 -1.7 0 -2
CATTTGAATCCATTGTGCCA 1359 SEQ ID NO:290 -17.6 -23.7 67.3 -6.1 0 -3
TAAGCTGTTCGAGCATCTGC 1809 SEQ ID NO:291 -17.6 -24.4 71.1 -4.5 -2.3 -7.6
TTTTGCTATTGCGTCTTGGG 2175 SEQ ID NO:292 -17.6 -24.4 71 -5.2 -1.5 -5
ACTGTTGCGTCGCTCTCCAT 2321 SEQ ID NO: 293 -17.6 -28.5 79 -10.3 -0.3 -6.9
AAACTTCTTTTTCTGCTGGT 4886 SEQ ID NO:294 -17.6 -21.9 66.2 -4.3 0 -3.7
CATCCTCACTCAGGGGCTCT 5817 SEQ ID NO: 295 -17.6 -28.9 82.5 -10.4 -0.8 -7.6
CTGTATTCGAAGGGCATCCA 6071 SEQ ID NO:296 -17.6 -25 70.4 -6.2 -1.1 -8
TTTACGTTTCAAAGTGGTTG 6146 SEQ ID NO:297 -17.6 -19.7 60.3 -1.6 -0.1 -5
TTGTTTTATAGGTAAGTCAA 6278 SEQ ID NO: 298 -17.6 -18 57.8 1.3 0 -2.4
TAGTTTGTCAATAATCATGT 6299 SEQ ID NO:299 -17.6 -18 57.5 1.3 0 -4.7
GTGTTTGGTGTAGTTACAAT 6759 SEQ ID NO:300 -17.6 -21.1 65.6 -3 -0.2 -4.6
CATCTGAGCCATTTCCACAG 1479 SEQ ID NO:301 -17.5 -25.3 72 -7.8 0 -3.7
CTGGCCTGCATCTGAGCCAT 1487 SEQ ID NO: 302 -17.5 -29.7 81.1 -9.9 -2.3 -7.5
TTTGCTATTGCGTCTTGGGG 2174 SEQ ID NO: 303 -17.5 -25.5 73.3 -6.4 -1.5 -5
CTCACGGCTCTTTGCCTTCC 2572 SEQ ID NO:304 -17.5 -29.6 81.4 -9.9 -2.2 -5.7
ACAGACAATCCCTCCACATT 2998 SEQ ID NO: 305 -17.5 -25.1 69.8 -7.6 0 -2.1
ATGATGGCCAACACCAAGGT 3127 SEQ ID NO:306 -17.5 -25.1 69 -6.7 -0.8 -6.3
ACGATGATGGCCAACACCAA 3130 SEQ ID NO:307 -17.5 -24.3 65.5 -5.9 -0.8 -6.3
TCAGTAGCAGCAAGGTTGTC 3439 SEQ ID NO:308 -17.5 -24.4 74.2 -6.9 0 -5.4
TTCCCATCTCTAAGATAATT 3655 SEQ ID NO:309 -17.5 -20.5 61.5 -2.4 ^ -0.3 -4.3
GTTCACCTTCTCGGGGTAGA 3912 SEQ ID NO:310 -17.5 -27.2 78.3 -8.7 -0.9 -4.9
TTTTCGAAGATTCCACCAGA 4043 SEQ ID NO: 311 -17.5 -22.7 65.1 -4.5 -0.4 -6.8
TAGCCAGCGCCAACATTATC 4672 SEQ ID NO:312 -17.5 -25.7 70.8 -7.5 -0.5 -7.6
TCTGCTGGTTGAAGTTATCT 4875 SEQ ID NO: 313 -17.5 -22.7 69.1 -5.2 0 -3.7
AACATGACCAGGAAGAGCAG 5452 SEQ ID NO:314 -17.5 -21.9 63.4 -4.4 0 -5.2
ATGCTGTTGCCAAAGGTCTC 5548 SEQ ID NO:315 -17.5 -25.2 72.9 -6.8 -0.8 -4.4
CCACGGTCTCCCTTAACTGA 5677 SEQ ID NO: 316 -17.5 -27.5 74.3 -9.4 -0.3 -3.5
AATCATGTCTTGTTTTATAG 6287 SEQ ID NO:317 -17.5 -17.9 57.8 1.3 0 -4.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
ATAATCATGTCTTGTTTTAT 6289 SEQ ID NO:318 -17.5 -17.9 57.6 1.3 0 -4.1
AAATAGAGCAGCATAGGCAA
7569 SEQ ID NO: 319 -17.5 -20.6 61.1 -1.4 -1.6 -6.7 AAAATAGAGCAGCATAGGCA
7570 SEQ ID NO: 320 -17.5 -20.6 61.1 -1.4 -1.6 -6.7 GTAAAATAGAGCAGCATAGG
7572 SEQ ID NO: 321 -17.5 -19 58.3 -1.4 0 -5.4
ATTGCCTTTCCTTTATTCAT 748 SEQ ID NO: 322 -17.4 -23.4 68.9 -6 0 -3
GCAACTGCCTGAGCTTCTTC 1840 SEQ ID NO: 323 -17.4 -26.8 76.8 -8.2 -1.1 -5.2
GATCCAACATCCTTTGCCCG 2218 SEQ ID NO: 324 -17.4 -28 73.8 -10.6 0 -3.3
TTACTGTTGCGTCGCTCTCC 2323 SEQ ID NO:325 -17.4 -27.6 77.8 -9.6 -0.3 -6.9
CAGACAATCCCTCCACATTT 2997 SEQ ID NO:326 -17.4 -25 69.6 -7.6 0 -2.1
CAGTACAGACAATCCCTCCA 3002 SEQ ID NO:327 -17.4 -25.7 71.8 -7.6 -0.4 -5.3
TTTCGAAGATTCCACCAGAT 4042 SEQ ID NO:328 -17.4 -22.6 64.7 -4.5 -0.4 -6.8
TCTAGCATGGTTTTGATAGT 4174 SEQ ID NO: 329 -17.4 -21.7 67.1 -3.4 -0.7 -4.3
GCTGAAGTTTAACATCTCGT
4758 SEQ ID NO:330 -17.4 -21.6 64.4 -4.2 0 -3.6 GGCTGAAGTTTAACATCTCG
4759 SEQ ID NO: 331 -17.4 -21.6 63.8 -4.2 0 -4.6 CACTCAGGGGCTCTGCACTT
5811 SEQ ID NO:332 -17.4 -28.2 80.5 -9.8 -0.9 -4.8
CCCTGCTTCACAGAGTTGCA 6637 SEQ ID NO: 333 -17.4 -28.1 78.8 -9.4 -1.2 -7
TGGTGTAGTTACAATGTTCA 6754 SEQ ID NO: 334 -17.4 -20.9 64.7 -3 -0.2 -4.6
AGCAGCATAGGCAATATTAA 7563 SEQ ID NO: 335 -17.4 -20.5 61.4 -1.4 -1.6 -6.7
TAAAATAGAGCAGCATAGGC
7571 SEQ ID NO:336 -17.4 -19.6 59.4 -1.4 -0.5 -5.4 GGTTATATTGAGGCAACCAT
8130 SEQ ID NO:337 -17.4 -22.5 65.7 -3.7 -1.3 -5.6
AGGTATCTCATCCCTGTCAA 267 SEQ ID NO:338 -17.3 -25.4 74.1 -8.1 0 -3.1
GCTGAGACATTGCCCAGGTC 1093 SEQ ID NO:339 -17.3 -28.2 79.3 -10.4 -0.2 -4.4
GCCATTAAAGTAGGAAGTGG 1343 SEQ ID NO: 340 -17.3 -21.3 63 -4 0 -3.7
TTTTCCCAGCAGCACGTAAT 1647 SEQ ID NO: 341 -17.3 -25.6 71.2 -8.3 0 -5.4
AGCAGTCCCAGATCAAGAAC 2679 SEQ ID NO: 342 -17.3 -23.9 68.9 -6.6 0 -5.4
ACCAAGCTCCATTAAACTGA 2972 SEQ ID NO: 343 -17.3 -22.1 63.1 -4.8 0 -5
CAATCAGGAAGGAGTGGAAG 3258 SEQ ID NO: 344 -17.3 -20.3 60.9 -3 0 -3.9
CGAAGATTCCACCAGATCTT 4039 SEQ ID NO:345 -17.3 -23.4 66.2 -4.5 -1.5 -5.8
AGCCAGCGCCAACATTATCA 4671 SEQ ID NO: 346 -17.3 -26.7 72.4 -8.7 -0.5 -6.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TTGTTTATCAGGCTATATAT 7431 SEQ ID NO: 347 -17.3 -19.3 60.9 -2 0 -5.2
CAGGATACATCCCTGTTGGA 7500 SEQ ID NO:348 -17.3 -25.5 72.3 -6.7 -1.4 -6.9
TTGAGTAAAATAGAGCAGCA 7576 SEQ ID NO:349 -17.3 -18.8 57.9 -1.4 0 -5.4
AGAATAGGTTTTGTCAGTAG 7786 SEQ ID NO: 350 -17.3 -19.5 62.1 -2.2 0 -2.7 TTGCCACTTTGTTCATGGCT
8274 SEQ ID NO: 351 -17.3 -26.2 75.3 -5.6 -3.3 -9.1 TTTGCCACTTTGTTCATGGC
8275 SEQ ID NO:352 -17.3 -25.4 73.7 -5.6 -2.5 -8.1 ATTTTCCCAATAGTCTTGAG
1613 SEQ ID NO: 353 -17.2 -21.6 64.8 -3.9 -0.2 -2.7
TTTCCCAGCAGCACGTAATG 1646 SEQ ID NO: 354 -17.2 -25.5 70.7 -8.3 0 -5.4
AACCCACCTACTCCACTGAA 1885 SEQ ID NO:355 -17.2 -26.2 70.3 -9 0 -1.7
ATGTGCTGTGTTCATCATCA 2253 SEQ ID NO: 356 -17.2 -23.7 71.9 -6.5 0 -3.6
GATGGCCAACACCAAGGTGA
3125 SEQ ID NO: 357 -17.2 -25.7 70.3 -6.7 -0.8 -11.7 TGATGGCCAACACCAAGGTG
3126 SEQ ID NO:358 -17.2 -25.1 68.9 -6.7 -0.8 -9.8 GATGATGGCCAACACCAAGG
3128 SEQ ID NO:359 -17.2 -24.5 67.3 -6.7 -0.3 -6.3 TCAGGAAGGAGTGGAAGAAG
3255 SEQ ID NO: 360 -17.2 -20.2 61.2 -3 0 -2.4 ATCAGGAAGGAGTGGAAGAA
3256 SEQ ID NO:361 -17.2 -20.2 60.9 -3 0 -2.9 AATCAGGAAGGAGTGGAAGA
3257 SEQ ID NO: 362 -17.2 -20.2 60.9 -3 0 -2.9 AGGTTGTCTGAGCTAAATGA
3427 SEQ ID NO: 363 -17.2 -21.2 64.4 -4 0 -5.1
ATTCCCATCTCTAAGATAAT 3656 SEQ ID NO:364 -17.2 -20.4 61.2 -2.5 -0.5 -3.9
CATGGTTTTGATAGTCTTTC 4169 SEQ ID NO:365 -17.2 -20.8 65.3 -3.6 0 -3.7
ATTCTAGCATGGTTTTGATA
4176 SEQ ID NO: 366 -17.2 -20.6 63.7 -3.4 0 -5 TATTCTAGCATGGTTTTGAT
4177 SEQ ID NO:367 -17.2 -20.6 63.7 -3.4 0 -5 GAGCAGCGTGCGGATCCCCT
5387 SEQ ID NO: 368 -17.2 -32.6 84.2 -13.2 -2.2 -11.1
TCAGGGGCTCTGCACTTTCT 5808 SEQ ID NO:369 -17.2 -27.8 81.1 -9.6 -0.9 -4.8
TAATCATGTCTTGTTTTATA 6288 SEQ ID NO:370 -17.2 -17.6 57 1.3 0 -4.7
TGAGTAAAATAGAGCAGCAT 7575 SEQ ID NO:371 -17.2 -18.7 57.6 -1.4 0 -5.4
TTGAGGCAACCATAGTTGGT 8123 SEQ ID NO:372 -17.2 -24 69.7 -4.4 -2.4 -7.5
TGTTCCTTTTTGGGCTTCTT 574 SEQ ID NO: 373 -17.1 -25.6 75.8 -8 -0.2 -3.8
AGTGGTGTTGGTTTCAAAAG 1328 SEQ ID NO: 374 -17.1 -20.5 62.9 -2.6 -0.6 -3.1
TACAGACAATCCCTCCACAT 2999 SEQ ID NO:375 -17.1 -24.7 68.9 -7.6 0 -2.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo AGGCACATGGTTTGGCCAGC 3334 SEQ ID NO:376 -17.1 -28.7 80.4 -8.4 -3.2 -9.6
ATAGCCAGCGCCAACATTAT 4673 SEQ ID NO:377 -17.1 -25.3 69.3 -7.5 -0.5 -7.6
CAAACTTCTTTTTCTGCTGG 4887 SEQ ID NO:378 -17.1 -21.4 64.2 -4.3 0 -3.7
GTTGCCAAAGGTCTCAAAGT 5543 SEQ ID NO:379 -17.1 -23 67 -5.9 0 -4
AGAGGAGGATCCAGGGCAGC 5923 SEQ ID NO: 380 -17.1 -28 79.9 -8.3 -2.6 -9
TGGACAGAGCAGGTTGAATT
7648 SEQ ID NO:381 -17.1 -22.3 66.1 -5.2 0 -4.1 TTTGAATCCATTGTGCCATT
1357 SEQ ID NO:382 -17 -23.1 66.6 -6.1 0 -3.1
AAGATTTTCCCAATAGTCTT 1616 SEQ ID NO: 383 -17 -20.9 62.8 -3.9 0 -3.5
CCTGTTGCTTTTTAAGCTGT 1821 SEQ ID NO:384 -17 -24.2 71.1 -4.6 -2.6 -7.1
TTCCTGTTGCTTTTTAAGCT 1823 SEQ ID NO:385 -17 -23.5 69.9 -3.9 -2.6 -7.1
CTCTTTCTGACTTCCGTTTC
2503 SEQ ID NO:386 -17 -24.5 72.6 -7.5 0 -2.7 TCTCTTTCTGACTTCCGTTT
2504 SEQ ID NO:387 -17 -24.5 72.6 -7.5 0 -2.6 TTCTCTTTCTGACTTCCGTT
2505 SEQ ID NO:388 -17 -24.5 72.6 -7.5 0 -2.6 TTGCCTTCCAGAGGAATCCT
2561 SEQ ID NO:389 -17 -27 75.1 -8.5 -1.3 -9.8
CAGTCATGGGGTAGTGCTCC 2808 SEQ ID NO:390 -17 -27.8 81.4 -10.3 -0.1 -6.7
AGGAAGGAGTGGAAGAAGTC 3253 SEQ ID NO: 391 -17 -20.7 63.1 -3.7 0 -1.8
ATGGATTTCTATAACTTTTG 3572 SEQ ID NO:392 -17 -17.4 55.7 0 0 -2.3
TGTTCACCTTCTCGGGGTAG 3913 SEQ ID NO: 393 -17 -26.6 76.8 -8.7 -0.7 -4.2
ATATTCTAGCATGGTTTTGA 4178 SEQ ID NO: 394 -17 -20.6 63.7 -3.6 0 -5
AACATGTTACCCGTTGTCAT 4570 SEQ ID NO:395 -17 -23.8 67.6 -6.3 0 -8.1
TTCTTTTTCTGCTGGTTGAA 4882 SEQ ID NO:396 -17 -22.2 67.5 -5.2 0 -3.7
TCTGAGGTTTCTTGGATCCA 4968 SEQ ID NO:397 -17 -24.8 73.6 -6.9 0.1 -9.7
TCAGACGTAGGATTCGGCCA 5355 SEQ ID NO:398 -17 -26.4 73.1 -8.8 -0.3 -7.2
AGATGGGTCCCCACGGTCTC 5687 SEQ ID NO:399 -17 -30.4 83 -12.5 -0.6 -8.8
CTGTCTTCCATCTGTATTCG 6082 SEQ ID NO:400 -17 -24.1 71.3 -7.1 0 -2.4
AAACCTGTCTTCCATCTGTA
6086 SEQ ID NO:401 -17 -23.6 68.8 -6.6 0 -2.1 TAAACCTGTCTTCCATCTGT
6087 SEQ ID NO:402 -17 -23.6 68.8 -6.6 0 -2 CAGGGTTCTTGTATACTGTT
6931 SEQ ID NO:403 -17 -22.8 69.9 -5.8 0 -6.5
ATGGACAGAGCAGGTTGAAT
7649 SEQ ID NO: 404 -17 -22.2 65.8 -5.2 0 -4.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo ATATTGAGGCAACCATAGTT 8126 SEQ ID NO: 405 -17 -21.3 63.4 -3.7 -0.3 -3.7
CCACTTTGTTCATGGCTAAA
8271 SEQ ID NO:406 -17 -22.6 65.6 -5.6 0 -4.7 CATGCACTAGTTTGTTGTAA
8608 SEQ ID NO:407 -17 -20.9 63.9 -3.9 0 -5.5
ATTTGAATCCATTGTGCCAT 1358 SEQ ID NO:408 -16.9 -23 66.2 -6.1 0 -3.1
GTCCCATTTGAATCCATTGT 1363 SEQ ID NO: 409 -16.9 -24.8 70.5 -7.9 0 -2.2
TCGACCAGCCTTCACACAGA 1523 SEQ ID NO:410 -16.9 -27 74.2 -10.1 0 -4.2
TCCTGTTGCTTTTTAAGCTG 1822 SEQ ID NO: 411 -16.9 -23.4 69.4 -3.9 -2.6 -7.1
TGCCTTCCAGAGGAATCCTC 2560 SEQ ID NO: 412 -16.9 -27.3 76.4 -8.5 -1.8 -10.8
GTGCTCCATGGCCATAAAGA 2795 SEQ ID NO: 413 -16.9 -25.6 71.2 -7.4 -0.4 -10.4
AGTACAGACAATCCCTCCAC 3001 SEQ ID NO:414 -16.9 -25.2 71.2 -7.6 -0.4 -5.3
GCACATGGTTTGGCCAGCGA 3332 SEQ ID NO:415 -16.9 -28.9 78.4 -10.4 -1.5 -8.8
TTTAATACACCCTTCAGTAA 3977 SEQ ID NO:416 -16.9 -20.3 60.7 -3.4 0 -3.6
TTTTTCTGCTGGTTGAAGTT 4879 SEQ ID NO:417 -16.9 -22.1 67.5 -5.2 0 -3.7
TCTTTTTCTGCTGGTTGAAG 4881 SEQ ID NO:418 -16.9 -22.1 67.4 -5.2 0 -4
TGTTGCCAAAGGTCTCAAAG 5544 SEQ ID NO: 419 -16.9 -21.8 63.8 -4.9 0 -4
CGTTGATACCCTGCTTCACA 6645 SEQ ID NO:420 -16.9 -26.3 72.6 -9.4 0 -3.6
GGTGTTTGGTGTAGTTACAA 6760 SEQ ID NO: 421 -16.9 -22.3 68.5 -4.9 -0.2 -4.6
GTTTATCAGGCTATATATAT
7429 SEQ ID NO: 422 -16.9 -18.9 60 -2 0 -5 TGTTTATCAGGCTATATATA
7430 SEQ ID NO: 423 -16.9 -18.9 59.9 -2 0 -4.5 GAGTAAAATAGAGCAGCATA
7574 SEQ ID NO:424 -16.9 -18.4 57.1 -1.4 0 -5.4
TTTTGTCAGTAGGCAGTATC 7778 SEQ ID NO: 425 -16.9 -22.5 70.6 -5.1 -0.1 -4
GCCACTTTGTTCATGGCTAA
8272 SEQ ID NO: 26 -16.9 -25.1 72 -5.6 -2.6 -8.3 TGCCACTTTGTTCATGGCTA
8273 SEQ ID NO: 427 -16.9 -25.8 74.3 -5.6 -3.3 -9.1 ATCTCATTTATTCTTACAAT
347 SEQ ID NO:428 -16.8 -17.7 56.8 -0.7 0 -1.6
ACTGCCTGAGCTTCTTCCTG 1837 SEQ ID NO: 429 -16.8 -27.9 79.2 -9.9 -1.1 -5.2
CCAAACTTCTTTTTCTGCTG 4888 SEQ ID NO:430 -16.8 -22.2 65.3 -5.4 0 -3.6
CAGGAAGAGCAGGAGGCCGA 5444 SEQ ID NO: 431 -16.8 -27.1 74.1 -9.4 -0.8 -7.7
AAACATGACCAGGAAGAGCA 5453 SEQ ID NO: 432 -16.8 -21.2 61.3 -4.4 0 -5.2
AATAATCATGTCTTGTTTTA 6290 SEQ ID NO:433 -16.8 -17.2 55.6 1.3 0 -4.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CACTGTCTTGTATAGGCACT 6599 SEQ ID NO:434 -16.8 -23.8 71.3 -6.3 -0.5 -4
CTTTTCATCCTGCACATTTA 452 SEQ ID NO: 435 -16.7 -22.9 67.7 -6.2 0 -4.8
AATTGCCTTTCCTTTATTCA 749 SEQ ID NO: 436 -16.7 -22.7 66.6 -6 0 -3
CCATGGATCACGAAGAAACG 1022 SEQ ID NO: 437 -16.7 -20.7 58.4 -3.4 0 -8.5
CCAGCCAGTTCCATGGATCA 1032 SEQ ID NO: 438 -16.7 -28.5 78.6 -10.6 -0.8 -10
GGTGTTGGTTTCAAAAGCAG 1325 SEQ ID NO:439 -16.7 -21.8 65.2 -4.3 -0.6 -0.8
ACTGGCCTGCATCTGAGCCA 1488 SEQ ID NO: 440 -16.7 -29.9 81.8 -11 -2.2 -7.5
TTTAAGCTGTTCGAGCATCT 1811 SEQ ID NO: 441 -16.7 -22.8 67.6 -4.5 -1.5 -7.4
CGGTTCCTCCATTCTTTAGC 1957 SEQ ID NO: 442 -16.7 -26.8 76.3 -9.2 -0.8 -3.6
CACGGCTCTTTGCCTTCCAG 2570 SEQ ID NO: 443 -16.7 -29 79.1 -9.6 -2.7 -6.2
TCCATGGCCATAAAGAGGGT 2791 SEQ ID NO: 444 -16.7 -25.3 70.7 -7.4 0 -10.4
ATCAGTAGCAGCAAGGTTGT 3440 SEQ ID NO: 445 -16.7 -24 72.3 -7.3 0 -5.4
TTCCATTCCCATCTCTAAGA 3660 SEQ ID NO: 446 -16.7 -24.6 70.6 -7.9 0 -2.8
GCTTGTTCACCTTCTCGGGG 3916 SEQ ID NO: 447 -16.7 -28.5 80.3 -11.3 -0.2 -3.4
TTCTGCTGGTTGAAGTTATC 4876 SEQ ID NO: 48 -16.7 -21.9 67.4 -5.2 0 -3.7
TTTCTGAGGTTTCTTGGATC 4970 SEQ ID NO: 449 -16.7 -22.3 69.2 -5.6 0 -4.7
TGTATTCGAAGGGCATCCAT 6070 SEQ ID NO: 450 -16.7 -24.1 68.5 -6.2 -1.1 -8.2
ATTGAGGCAACCATAGTTGG 8124 SEQ ID NO: 451 -16.7 -22.8 66.4 -3.7 -2.4 -6.8
GTTATATTGAGGCAACCATA 8129 SEQ ID NO:452 -16.7 -21 62.6 -3.7 -0.3 -4
AGGTTATATTGAGGCAACCA 8131 SEQ ID NO:453 -16.7 -22.5 65.9 -3.7 -2.1 -6.3
TCATGCACTAGTTTGTTGTA 8609 SEQ ID NO:454 -16.7 -22 67.9 -5.3 0 -5.7
GGTATCTCATCCCTGTCAAA 266 SEQ ID NO:455 -16.6 -24.7 71.4 -8.1 0 -2.4
TTGAATCCATTGTGCCATTA 1356 SEQ ID NO:456 -16.6 -22.7 65.7 -6.1 0 -3.1
GTTCGAGCATCTGCTGAAAT
1803 SEQ ID NO:457 -16.6 -22.8 66.2 -4.5 -1.7 -9.7 TGTTCGAGCATCTGCTGAAA
1804 SEQ ID NO:458 -16.6 -22.8 66.1 -4.5 -1.7 -9.7 CCAAGGTGAGGTTTCCTAGA
3114 SEQ ID NO: 459 -16.6 -25.2 72.7 -7.9 -0.5 -4.4
ATGGCCAACACCAAGGTGAG 3124 SEQ ID NO: 460 -16.6 -25.1 69.3 -6.7 -0.8 -11.7
CAAGGTTGTCTGAGCTAAAT 3429 SEQ ID NO: 461 -16.6 -20.6 62.2 -4 0 -5.5
GTCTTGACCTCCAAACTTCT 4898 SEQ ID NO: 462 -16.6 -24.5 70.5 -7.4 -0.1 -3.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
AAAGTGGTTGTAATAGGCTC 6136 SEQ ID NO: 463 -16.6 -20.5 62.9 -3.9 0 -3.7
TTTAGTTTGTCAATAATCAT
6301 SEQ ID NO: 464 -16.6 -17 55.2 1.3 0 -2.9 ATTTAGTTTGTCAATAATCA
6302 SEQ ID NO:465 -16.6 -17 55.2 1.3 0 -2.9 CTTTTGATTTTCTCTGACCT
6452 SEQ ID NO: 466 -16.6 -22.4 67.4 -5.8 0 -2.4
GGCAGATATGGAAGTTAAAA 6808 SEQ ID NO:467 -16.6 -18 55.5 0 -1.3 -5.5
ATTGAGTAAAATAGAGCAGC 7577 SEQ ID NO:468 -16.6 -18.1 56.7 -1.4 0 -4.1
TTTGTCAGTAGGCAGTATCC 7777 SEQ ID NO:469 -16.6 -24.4 74.3 -7.3 -0.1 -4
AAGAATAGGTTTTGTCAGTA 7787 SEQ ID NO: 470 -16.6 -18.8 59.7 -2.2 0 -2.7
TATATTGAGGCAACCATAGT 8127 SEQ ID NO: 471 -16.6 -20.9 62.5 -3.7 -0.3 -4
TATCTCATTTATTCTTACAA 348 SEQ ID NO: 472 -16.5 -17.4 56.2 -0.7 0 -0.9
ATCATTATCTTGTTCCTTTT 584 SEQ ID NO: 473 -16.5 -21.2 65.6 -4.7 0 -1.9
CGACCAGCCTTCACACAGAT 1522 SEQ ID NO: 474 -16.5 -26.6 72.6 -10.1 0 -3.2
GCTCCATGGCCATAAAGAGG 2793 SEQ ID NO: 475 -16.5 -25.6 70.9 -7.4 0 -11.5
CGATGATGGCCAACACCAAG 3129 SEQ ID NO: 476 -16.5 -24.1 65.2 -6.7 -0.8 -6.3
GGTTGTCTGAGCTAAATGAA 3426 SEQ ID NO: 77 -16.5 -20.5 62 -4 0 -5.1
CATGGATTTCTATAACTTTT 3573 SEQ ID NO: 478 -16.5 -18.1 57 -1.6 0 -3.7
TTCTAGCATGGTTTTGATAG 4175 SEQ ID NO: 79 -16.5 -20.6 64 -3.4 -0.4 -5
TTTTCTGCTGGTTGAAGTTA 4878 SEQ ID NO:480 -16.5 -21.7 66.5 -5.2 0 -3.7
TTCCTTGGAATTTGTTTGCT 5004 SEQ ID NO:481 -16.5 -22.9 67.7 -5.6 -0.6 -6.3
ATCCTCACTCAGGGGCTCTG 5816 SEQ ID NO:482 -16.5 -28.2 81.2 -10.8 -0.8 -7.6
GGTTGTAATAGGCTCATAAG
6131 SEQ ID NO:483 -16.5 -20.4 62.6 -3.9 0 -3.7 TGGTTGTAATAGGCTCATAA
6132 SEQ ID NO: 84 -16.5 -20.4 62.2 -3.9 0 -3.7 TTAGTTTGTCAATAATCATG
6300 SEQ ID NO:485 -16.5 -16.9 54.8 1.3 0 -4.1
CATTTAGTTTGTCAATAATC
6303 SEQ ID NO:486 -16.5 -17 55.2 -0.2 0 -2.9 TCCCATCTGTTTTTTCTGGA
6333 SEQ ID NO:487 -16.5 -25.2 73.7 -8.7 0 -3.5
TCTGTAGTACTGCTTGGTGA 8630 SEQ ID NO:488 -16.5 -24 73 -7 0 -7.8
TGCTTATGCCTCCGCTTCGC 2 SEQ ID NO: 489 -16.4 -30.2 80.5 -12.9 -0.8 -5
TTGCCTTTCCTTTATTCATT 747 SEQ ID NO: 490 -16.4 -23.5 69.3 -7.1 0 -3
ATCCATTGTGCCATTAAAGT 1352 SEQ ID NO: 491 -16.4 -22.5 65.3 -6.1 0 -3.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TGACGCTGTCTTCAGATTCG 2049 SEQ ID N0:492 -16.4 -23.9 69.1 -5.8 -1.7 -7.6 GTCCCAGATCAAGAACACAT
2675 SEQ ID N0:493 -16.4 -23 65.9 -6.6 0 -5.4 AGTCCCAGATCAAGAACACA
2676 SEQ ID NO:494 -16.4 -23 66.2 -6.6 0 -5.4 CAGTCCCAGATCAAGAACAC
2677 SEQ ID NO:495 -16.4 -23 66.2 -6.6 0 -5.4 CATCACAGCAGTCCCAGATC
2685 SEQ ID NO:496 -16.4 -26.5 76 -10.1 0 -4.1
CTCCATGGCCATAAAGAGGG 2792 SEQ ID NO:497 -16.4 -25 69.4 -7.4 0 -10.4
CCACCAGATCTTCCCTTTGC 4031 SEQ ID NO:498 -16.4 -28.9 78.9 -12.5 0 -5.6
TTTCTGCTGGTTGAAGTTAT 4877 SEQ ID NO: 99 -16.4 -21.6 66.1 -5.2 0 -3.4
CAGGGGCTCTGCACTTTCTT 5807 SEQ ID NO:500 -16.4 -27.5 79.6 -10.5 -0.3 -4.8
CCTGTCTTCCATCTGTATTC 6083 SEQ ID NO: 501 -16.4 -25.3 75.2 -8.9 0 -1.6
ACCCTGCTTCACAGAGTTGC 6638 SEQ ID NO:502 -16.4 -27.6 78.4 -9.9 -1.2 -4.8
ACGTTGATACCCTGCTTCAC 6646 SEQ ID NO: 503 -16.4 -25.8 72.1 -9.4 0 -4.4
GTTTGGTGTAGTTACAATGT
6757 SEQ ID NO:504 -16.4 -21.1 65.6 -4.2 -0.2 -4.6 TGTTTGGTGTAGTTACAATG
6758 SEQ ID NO:505 -16.4 -19.9 62.1 -3 -0.2 -4.6 TGGCAGATATGGAAGTTAAA
6809 SEQ ID NO:506 -16.4 -18.7 57.3 -0.8 -1.3 -5.5
AAATGATCTAGGTTTGAGTG 8100 SEQ ID NO:507 -16.4 -18.6 58.5 -2.2 0 -4.9
CCCAATAAGTGAAATGCAAT 8479 SEQ ID NO:508 -16.4 -19.2 56.2 -2.8 0 -5.6
GAATCATGCACTAGTTTGTT 8612 SEQ ID NO:509 -16.4 -21 64.2 -4.6 0 -5.7
GGTGGTTACTACTATTATTA 8731 SEQ ID NO:510 -16.4 -19.8 62.1 -2.9 -0.1 -3.9
TTCCTTTTTGGGCTTCTTGG 572 SEQ ID NO: 511 -16.3 -25.6 74.9 -8.8 -0.2 -3.8
TTTCCCAATAGTCTTGAGTC 1611 SEQ ID NO: 512 -16.3 -23.1 69.4 -6.8 0.3 -3.3
CTTCCTGTTGCTTTTTAAGC 1824 SEQ ID NO: 513 -16.3 -23.5 69.9 -5.4 -1.8 -6.1
CCTGCTTTCGCCGTCTTCAA 2273 SEQ ID NO: 514 -16.3 -28.6 76.9 -11.6 -0.5 -3.6
TGACTAACGTTACTGTTGCG 2332 SEQ ID NO: 515 -16.3 -21.7 62.9 -5.4 0.1 -7.8
TTTGCCTTCCAGAGGAATCC 2562 SEQ ID NO: 516 -16.3 -26.2 73.6 -8.5 -1.3 -6
AGTGCTCCATGGCCATAAAG 2796 SEQ ID NO: 517 -16.3 -25 70.2 -7.4 -0.4 -10.4
GAAGATTCCACCAGATCTTC 4038 SEQ ID NO:518 -16.3 -23 67.5 -4.5 -2.2 -6.8
TCCAGAATGAATATATAGGT 4213 SEQ ID NO:519 -16.3 -18.4 57 -2.1 0 -4.2
ATTCCTTGGAATTTGTTTGC 5005 SEQ ID NO: 520 -16.3 -22 65.7 -4.1 -1.5 -8.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AGGAAGAGCAGGAGGCCGAT 5443 SEQ ID N0:521 -16.3 -26.4 73 -9.2 -0.8 -7.7
CCAGGAAGAGCAGGAGGCCG 5445 SEQ ID N0:522 -16.3 -28.5 76.2 -11.3 -0.8 -7.7
ACAGGGTTCTTGTATACTGT 6932 SEQ ID NO: 523 -16.3 -22.9 70.1 -5.8 -0.6 -6.5
AGGATACATCCCTGTTGGAA 7499 SEQ ID NO: 524 -16.3 -24.1 68.9 -6.7 -1 -6.9
GCAGCATAGGCAATATTAAC 7562 SEQ ID NO: 525 -16.3 -20.7 61.8 -2.7 -1.6 -6.7
AGTAAAATAGAGCAGCATAG 7573 SEQ ID NO:526 -16.3 -17.8 56 -1.4 0 -5.4
AATGGACAGAGCAGGTTGAA 7650 SEQ ID NO: 527 -16.3 -21.5 ' 63.6 -5.2 0 -4.1
AAGGTTATATTGAGGCAACC 8132 SEQ ID NO: 528 -16.3 -21.1 62.6 -3.7 -1 -5
TGAATCATGCACTAGTTTGT 8613 SEQ ID NO: 529 -16.3 -20.9 63.7 -4.6 0 -5.7
GGTGAATCATGCACTAGTTT 8615 SEQ ID NO:530 -16.3 -22.1 66.5 -4.6 -1.1 -6.2
TTTTTTTTTTTTTCCACCTT
9088 SEQ ID NO:531 -16.3 -21.5 65 -5.2 0 0 TTTTTTTTTTTTTTCCACCT
9089 SEQ ID NO:532 -16.3 -21.5 65 -5.2 0 0 CCTGTGCCATCTTTTCATCC
462 SEQ ID NO: 533 -16.2 -27.7 78.1 -11.5 0 -2.7
ACGCTGAGACATTGCCCAGG 1095 SEQ ID NO: 534 -16.2 -27.6 74.5 -10.9 -0.2 -4.1
ATCTGAGCCATTTCCACAGA 1478 SEQ ID NO: 535 -16.2 -25.2 72.2 -7.8 -1.1 -4.9
CACTGGCCTGCATCTGAGCC 1489 SEQ ID NO: 536 -16.2 -29.9 81.8 -12.5 -1.1 -7.5
AAAGATTTTCCCAATAGTCT 1617 SEQ ID NO: 537 -16.2 -20.1 60.4 -3.9 0 -3
CCAGCAGCACGTAATGTCAA 1642 SEQ ID NO: 538 -16.2 -24.5 68.5 -8.3 0 -5.4
AGGCCATGGCCACCACAGCC 1731 SEQ ID NO: 539 -16.2 -33 85.5 -12.2 -2.8 -17.4
TGTGCTGTGTTCATCATCAG 2252 SEQ ID NO: 540 -16.2 -23.7 72.3 -6.5 -0.9 -4.4
GTCTTCAAATGTGCTGTGTT 2261 SEQ ID NO: 541 -16.2 -22.7 68.8 -6.5 0 -3.6
CGTTACTGTTGCGTCGCTCT 2325 SEQ ID NO:542 -16.2 -27.2 75.7 -10.4 -0.3 -6.9
ATCGCAGTACAGACAATCCC 3006 SEQ ID NO: 543 -16.2 -24.7 69.4 -7.8 -0.4 -5.3
GGAAACACTCCCGCATCTTA 3531 SEQ ID NO:544 -16.2 -25.2 69 -8.4 -0.3 -5.4
TCTGAGGGAAACGAGCTTCA 5195 SEQ ID NO:545 -16.2 -23 66.2 -6.2 -0.3 -5.2
GACGTAGGATTCGGCCAATC 5352 SEQ ID NO:546 -16.2 -25 69.5 -7.6 -0.7 -10
GATCAGACGTAGGATTCGGC 5357 SEQ ID NO:547 -16.2 -24.3 69.7 -7.6 -0.2 -6.6
GGTCGCATCGGGATCAAACT 5867 SEQ ID NO: 548 -16.2 -25.1 69.4 -8.9 0 -6.9
GATACCCTGCTTCACAGAGT 6641 SEQ ID NO:549 -16.2 -26 74.4 -8.5 -1.2 -5.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo AGGTGTTTGGTGTAGTTACA 6761 SEQ ID NO: 550 -16.2 -23 71.3 -6.8 0 -4.4
TTGTCAGTAGGCAGTATCCA 7776 SEQ ID NO:551 -16.2 -25 75.1 -8.3 -0.2 -4
GAAGAATAGGTTTTGTCAGT 7788 SEQ ID NO:552 -16.2 -19.7 61.7 -3.5 0 -2.7
TTATCTCATTTATTCTTACA
349 SEQ ID NO: 553 -16.1 -18.2 58.6 -2.1 0 -0.9 ATTATCTCATTTATTCTTAC
350 SEQ ID NO: 554 -16.1 -17.5 57.3 -1.3 0 -0.9 CTTTTTGGGCTTCTTGGCTT
569 SEQ ID NO:555 -16.1 -25.9 76 -8.8 -0.9 -3.7
CTAAGCAAAACCCTCTTGCC 993 SEQ ID NO:556 -16.1 -24.6 67.3 -6.5 -2 -6.2
GTGTTGGTTTCAAAAGCAGA 1324 SEQ ID NO: 557 -16.1 -21.2 64 -4.3 -0.6 -1.1
GTGGTGTTGGTTTCAAAAGC 1327 SEQ ID NO: 558 -16.1 -22.3 66.9 -5.4 -0.6 -3.8
TGCCATTAAAGTAGGAAGTG 1344 SEQ ID NO: 559 -16.1 -20.1 60.4 -4 0 -3.5
TCCATTGTGCCATTAAAGTA 1351 SEQ ID NO:560 -16.1 -22.2 64.8 -6.1 0 -3.1
CCTTCTGGACACTGGCCTGC 1498 SEQ ID NO: 561 -16.1 -29.8 81.6 -13.7 0 -7.2
CGCAACTGCCTGAGCTTCTT 1841 SEQ ID NO:562 -16.1 -27.2 74.8 -9.9 -1.1 -5.7
AGGGAGCCACGGATACTCAA 2149 SEQ ID NO:563 -16.1 -25.5 70.7 -8.1 -1.2 -4.5
TGCTTGTTTTGCTATTGCGT 2181 SEQ ID NO: 564 -16.1 -24.6 71.7 -6.9 -1.5 -5.8
CTCTTTGCCTTCCAGAGGAA 2565 SEQ ID NO: 565 -16.1 -26 73.9 -8.5 -1.3 -5.7
GCAGTCTGAATGATCGCAGT 3018 SEQ ID NO:566 -16.1 -24.4 70.8 -7.6 -0.4 -6.3
GTTCCATTCCCATCTCTAAG 3661 SEQ ID NO:567 -16.1 -25.2 72.6 -9.1 0 -1.6
TTAATACACCCTTCAGTAAA 3976 SEQ ID NO:568 -16.1 -19.5 58.5 -3.4 0 -3.6
GTCATGTATTTGCCCTGGTC 5116 SEQ ID NO:569 -16.1 -26.9 78.3 -10.8 0 -4.7
ATACCCTGCTTCACAGAGTT 6640 SEQ ID NO: 570 -16.1 -25.5 73.5 -8.5 -0.7 -5.1
TTTATTCTTACAATATCCCT 341 SEQ ID NO: 571 -16 -20.3 61.4 -4.3 0 -2.6
TCCATGGATCACGAAGAAAC 1023 SEQ ID NO: 572 -16 -20.3 59 -3.4 0 -9.5
GGCCATGGCCACCACAGCCA 1730 SEQ ID NO: 573 -16 -33.7 86 -13.4 -3.1 -16.7
GCTCTCTCTGTCTTCTTTTC 1983 SEQ ID NO: 574 -16 -25.2 79.4 -9.2 0 -2.8
CCATGGCCATAAAGAGGGTA 2790 SEQ ID NO: 575 -16 -24.6 68.6 -7.4 0 -10.4
TAGTGCTCCATGGCCATAAA 2797 SEQ ID NO: 576 -16 -24.7 69.4 -7.4 -0.4 -10.4
ACAATCAGGAAGGAGTGGAA 3259 SEQ ID NO:577 -16 -20.5 61.2 -3.7 -0.6 -4.5
TCCCATCTCTAAGATAATTA 3654 SEQ ID NO:578 -16 -20.1 60.7 -3.4 -0.5 -4.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TCCATTCCCATCTCTAAGAT 3659 SEQ ID NO: 579 -16 -24.5 70.2 -7.9 -0.3 -3.5
TGTTACCCGTTGTCATGTTA 4566 SEQ ID NO:580 -16 -24.6 71.1 -8.6 0 -4.7
ACTTCTTTTTCTGCTGGTTG 4884 SEQ ID NO:581 -16 -23.4 71.3 -7.4 0 -3.7
ATAAACCTGTCTTCCATCTG 6088 SEQ ID NO:582 -16 -22.4 65.6 -6.4 0 -2
TGGCATGGACCTCCTCTTGA 6549 SEQ ID NO: 583 -16 -27.9 77.8 -11.4 -0.1 -5.1
GTCTAGGTAGCCATTGGGTT
6713 SEQ ID NO: 584 -16 -26.6 78.7 -10 -0.3 -6.3 ATGGCAGATATGGAAGTTAA
6810 SEQ ID NO:585 -16 -19.4 59.2 -2 -1.3 -5.5
ATCATGCACTAGTTTGTTGT 8610 SEQ ID NO:586 -16 -22.3 68.5 -6.3 0 -5.7
TTAAGCTGTTCGAGCATCTG 1810 SEQ ID NO:587 -15.9 -22.7 67.1 -4.5 -2.3 -7.3
GTGCTGTGTTCATCATCAGC 2251 SEQ ID NO: 588 -15.9 -25.5 77.3 -6.5 -3.1 -7.7
AAGGTTGTCTGAGCTAAATG 3428 SEQ ID NO:589 -15.9 -19.9 60.9 -4 0 -5.5
TATTTCAATTCCAGTATTAT 3623 SEQ ID NO:590 -15.9 -18.2 57.6 -2.3 0 -2.5
TTGCTTATTTCAATTCCAGT 3628 SEQ ID NO: 591 -15.9 -21.6 65.2 -5.7 0 -3.6
CTTGTTCACCTTCTCGGGGT 3915 SEQ ID NO: 592 -15.9 -27.9 79.4 -11.1 -0.7 -4
CAGACGTAGGATTCGGCCAA 5354 SEQ ID NO: 593 -15.9 -25.3 69.4 -8.8 -0.3 -7.2
TCATCCTCACTCAGGGGCTC 5818 SEQ ID NO: 594 -15.9 -28.4 82.4 -11.6 -0.8 -7.6
GTTGTAATAGGCTCATAAGA 6130 SEQ ID NO: 595 -15.9 -19.8 61.3 -3.9 0 -3.8
AGTCTAGGTAGCCATTGGGT
6714 SEQ ID NO: 596 -15.9 -26.5 78.7 -10 -0.3 -6.7 GGGTTCTTGTATACTGTTTC
6929 SEQ ID NO: 597 -15.9 -22.6 70.5 -6.7 0 -6.3
TAGGTTTGAGTGTTTGACCA
8092 SEQ ID NO: 598 -15.9 -23 69.2 -5.8 -1.2 -5.9
TTTTTTTTTTTTCCACCTTA
9087 SEQ ID NO:599 -15.9 -21.1 64 -5.2 0 -0.2
GCAGCACGTTTTTCGATAGC 541 SEQ ID NO: 600 -15.8 -24.9 71.1 -8.1 -0.9 -5.8
TGAATCCATTGTGCCATTAA 1355 SEQ ID NO: 601 -15.8 -21.9 63.3 -6.1 0 -3.1
AATGTGCTGTGTTCATCATC 2254 SEQ ID NO: 602 -15.8 -22.3 68.1 -6.5 0 -3.1
CTGTTGCGTCGCTCTCCATG 2320 SEQ ID NO: 603 -15.8 -28.3 78.2 -12.5 0.4 -6.2
CATGGGGTAGTGCTCCATGG 2804 SEQ ID NO: 604 -15.8 -27.4 77.8 -7.9 -3.7 -12.3
AATACACCCTTCAGTAAAAC 39 4 SEQ ID NO: 605 -15.8 -19.2 57.4 -3.4 0 -3.6
CCAATGCACCACTACTGAGA 4122 SEQ ID NO: 606 -15.8 -24.5 68.2 -8.7 0 -5.9
AGTTTACTTTCACGTTTTTC 4650 SEQ ID NO: 607 -15.8 -20.5 64 -4.7 0 -4.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GCCAGCGCCAACATTATCAA 4670 SEQ ID N0:608 -15.8 -26 70 -9.7 0 -7.6
TTCTGAGGTTTCTTGGATCC 4969 SEQ ID NO: 609 -15.8 -24.2 72.8 -7.5 0 -9.6
TAAACATGACCAGGAAGAGC 5454 SEQ ID NO: 610 -15.8 -20.2 59.6 -4.4 0 -5.2
CGGTCTCCCTTAACTGAGCT 5674 SEQ ID NO: 611 -15.8 -27.3 75.6 -10.9 -0.3 -6.2
GGATCCAGGGCAGCTGCAAA 5917 SEQ ID NO: 612 -15.8 -27.6 75.7 -8.9 -0.7 -14
CTTCCATCTGTATTCGAAGG 6078 SEQ ID NO: 613 -15.8 -22.7 66.4 -6.9 0 -7.1
ACCTCCTCTTGAAGTCCAGT 6541 SEQ ID NO: 614 -15.8 -27.2 77.7 -11.4 0 -3
GGCATGGACCTCCTCTTGAA 6548 SEQ ID NO: 615 -15.8 -27.2 75.5 -11.4 0 -5
GACAGGGTTCTTGTATACTG 6933 SEQ ID NO: 616 -15.8 -22.3 68 -5.8 -0.4 -6.5
TATTTTTCTAGAATGGATTT 7255 SEQ ID NO: 617 -15.8 -17 55.1 -1.1 0 -7.4
TTAATAGAAGTTGTTTATCA 7441 SEQ ID NO: 618 -15.8 -16.2 53.4 0.4 0 -2.9
ATCCCTGTTGGAAGCTTGCA
7492 SEQ ID NO: 619 -15.8 -27 75.6 -10.1 -1 -7.6 CATCCCTGTTGGAAGCTTGC
7493 SEQ ID NO: 620 -15.8 -27 75.6 -10.1 -1 -7.2 ACATGCATTAGTGATAGCCT
7544 SEQ ID NO: 621 -15.8 -23.4 68.7 -7.6 0 -6.8
GGTAGAAAATGATCTAGGTT 8106 SEQ ID NO: 622 -15.8 -18.7 58.3 -2.2 -0.4 -4.9
ACTTTGCCACTTTGTTCATG 8277 SEQ ID NO: 623 -15.8 -23.5 69.2 -7.7 0 -4.1
TTTTTTTTTTTCCACCTTAT 9086 SEQ ID NO: 624 -15.8 -21 63.7 -5.2 0 -0.5
CATGGATCACGAAGAAACGT 1021 SEQ ID NO: 625 -15.7 -19.9 57.7 -3.4 -0.6 -6
CCATTGTGCCATTAAAGTAG 1350 SEQ ID NO: 626 -15.7 -21.8 63.6 -6.1 0 -3.1
TGTCCCATTTGAATCCATTG 1364 SEQ ID NO: 627 -15.7 -23.6 67.2 -7.9 0 -2.3
AGCAGCACGTAATGTCAACT 1640 SEQ ID NO: 628 -15.7 -22.9 66.3 -7.2 0 -5.4
CTTCAAATGTGCTGTGTTCA 2259 SEQ ID NO: 629 -15.7 -22.2 66.6 -6.5 0 -3.6
CCTCTGGGGGAAGTTGTCCA 2472 SEQ ID NO: 630 -15.7 -28.5 79.7 -10.8 -2 -6.3
GCCCTCTGGGGGAAGTTGTC 2474 SEQ ID NO: 631 -15.7 -29.6 83.2 -11.7 -2.2 -8.7
AGTAGCAGCAAGGTTGTCTG 3437 SEQ ID NO: 632 -15.7 -24.2 73.1 -8 -0.2 -7
CTTTGCTTATTTCAATTCCA 3630 SEQ ID NO: 633 -15.7 -21.4 64.1 -5.7 0 -3.6
TCACCTTCTCGGGGTAGAAC 3910 SEQ ID NO: 634 -15.7 -25.4 72.5 -8.7 -0.9 -4.9
GCACCACTACTGAGAAGGAT
4117 SEQ ID NO: 635 -15.7 -23.6 67.7 -7 -0.8 -4.7 TGCACCACTACTGAGAAGGA
4118 SEQ ID NO: 636 -15.7 -23.6 67.6 -7 -0.8 -6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo CTGAGGGAAACGAGCTTCAG 5194 SEQ ID NO: 637 -15.7 -22.6 65 -6.2 -0.5 -5.2
ATCAGACGTAGGATTCGGCC 5356 SEQ ID NO:638 -15.7 -25.7 72 -9.5 -0.2 -5.8
ACCAGGAAGAGCAGGAGGCC 5446 SEQ ID NO:639 -15.7 -27.9 77.1 -11.3 -0.8 -6.4
ACTGGGTCGCATCGGGATCA 5871 SEQ ID NO: 640 -15.7 -27.7 76.3 -12 0 -6.9
CCTCCTCTTGAAGTCCAGTT 6540 SEQ ID NO:641 -15.7 -27.1 77.4 -11.4 0 -3
CTTCACTGTCTTGTATAGGC 6602 SEQ ID NO:642 -15.7 -23.4 71.6 -7.7 0 -2.8
TACCCTGCTTCACAGAGTTG 6639 SEQ ID NO: 643 -15.7 -25.5 73.3 -8.5 -1.2 -5.1
CCCTATAGTCTAGGTAGCCA 6720 SEQ ID NO: 644 -15.7 -27.1 77.6 -10 -1.3 -5.6
GGTGTAGTTACAATGTTCAC 6753 SEQ ID NO:645 -15.7 -21.1 65.4 -4.9 -0.2 -4.6 AAAGGTGTTTGGTGTAGTTA
6763 SEQ ID NO: 646 -15.7 -20.7 64.4 -5 . 0 -1.9 TAAAGGTGTTTGGTGTAGTT
6764 SEQ ID NO: 647 -15.7 -20.7 64.4 -5 0 -2.2 TATGGCAGATATGGAAGTTA
6811 SEQ ID NO:648 -15.7 -19.8 60.7 -3.3 -0.6 -5.5
GGGTATTTAATTGACATAGA 7360 SEQ ID NO:649 -15.7 -18.4 57.7 -2.7 0 -2.9
TCAGGCTATATATATATTTG
7424 SEQ ID NO: 650 -15.7 -17.7 56.7 -2 0 -6.7 ATCAGGCTATATATATATTT
7425 SEQ ID NO:651 -15.7 -17.7 56.8 -2 0 -6.7 ACAGGATACATCCCTGTTGG
7501 SEQ ID NO:652 -15.7 -25.1 71.5 -6.7 -2.7 -8
CATGCATTAGTGATAGCCTT 7543 SEQ ID NO: 653 -15.7 -23.3 68.5 -7.6 0 -6.8
AAAATGATCTAGGTTTGAGT 8101 SEQ ID NO:654 -15.7 -17.9 56.6 -2.2 0 -4.2
TGGTAGAAAATGATCTAGGT 8107 SEQ ID NO:655 -15.7 -18.6 57.9 -2.2 -0.4 -4.9
AGGCAACCATAGTTGGTAGA 8120 SEQ ID NO:656 -15.7 -23.6 69.1 -5.5 -2.4 -8.7
GTGAATCATGCACTAGTTTG 8614 SEQ ID NO: 657 -15.7 -20.9 63.7 -4.6 -0.3 -5.7
GTGGTTACTACTATTATTAT 8730 SEQ ID NO: 658 -15.7 -18.6 59.4 -2.9 0 -3
CTCATTTATTCTTACAATAT 345 SEQ ID NO:659 -15.6 -17 54.9 -1.3 0 -2.4
GTGCCATTAAAGTAGGAAGT 1345 SEQ ID NO: 660 -15.6 -21.3 63.5 -5.7 0 -3.5
GTATGTTTTCCCAGCAGCAC 1652 SEQ ID NO:661 -15.6 -26.7 77 -11.1 0 -5.4
TGCTCCATGGCCATAAAGAG 2794 SEQ ID NO: 662 -15.6 -24.4 68.4 -7.4 -0.4 -10.8
TCGCAGTACAGACAATCCCT 3005 SEQ ID NO:663 -15.6 -25.6 71.3 -10 0.4 -4.5
GACGATGATGGCCAACACCA 3131 SEQ ID NO:664 -15.6 -25.6 68.6 -9.2 -0.6 -5.8
ACCACAAGGTTTCCAATGAC 3376 SEQ ID NO: 665 -15.6 -22.9 65.5 -6.2 -1 -4.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TCATGGATTTCTATAACTTT 3574 SEQ ID NO:666 -15.6 -18.4 58.1 -2.8 0 -5
TTTTAATACACCCTTCAGTA 3978 SEQ ID N0:667 -15.6 -21.1 63.1 -5.5 0 -3.4
CTGCTGGTTGAAGTTATCTA 4874 SEQ ID NO: 668 -15.6 -22 66.8 -6.4 0 -3.6
AAGCAAAGAGCAGCGTGCGG 5394 SEQ ID NO:669 -15.6 -25.1 68.5 -7.3 -2.2 -8.5
ATCTGTATTCGAAGGGCATC 6073 SEQ ID NO:670 -15.6 -22.7 67.2 -7.1 0 -7.1
TTGGTGTAGTTACAATGTTC 6755 SEQ ID NO: 671 -15.6 -20.3 63.8 -4.2 -0.2 -4.6
GGTTCTTGTATACTGTTTCT 6928 SEQ ID NO: 672 -15.6 -22.3 69.8 -6.7 0 -6.3
AGGGTATTTAATTGACATAG 7361 SEQ ID NO: 673 -15.6 -17.8 56.5 -2.2 0 -2.9
TCTAGGTTTGAGTGTTTGAC 8094 SEQ ID NO: 6 4 -15.6 -21.6 67.7 -6 0 -4
TATTGAGGCAACCATAGTTG 8125 SEQ ID NO: 675 -15.6 -21.3 63.3 -3.7 -2 -5.6
CCAATAAGTGAAATGCAATA 8478 SEQ ID NO: 676 -15.6 -16.9 52.3 -1.2 0 -5.6
ATGCACTAGTTTGTTGTAAA 8607 SEQ ID NO: 677 -15.6 -19.5 60.5 -3.9 0 -5.7
CTGCCTGAGCTTCTTCCTGT 1836 SEQ ID NO:678 -15.5 -28.9 82.3 -12.2 -1.1 -5.2
TACTCCACTGAAATCTCTTG 1877 SEQ ID NO: 679 -15.5 -20.9 62.6 -5.4 0 -2.5
GACGCTGTCTTCAGATTCGG 2048 SEQ ID NO:680 -15.5 -25.1 71.8 -8.1 -1.4 -6.8
TTGCTATTGCGTCTTGGGGA 2173 SEQ ID NO: 681 -15.5 -26 74.3 -8.9 -1.5 -6.6
CTTTGCCCGACCTCTGAAAC 2207 SEQ ID NO: 682 -15.5 -26.1 70.1 -10.6 0 -3
CTTTCGCCGTCTTCAAATGT 2269 SEQ ID NO:683 -15.5 -24.4 68.5 -8.9 0 -2.8
CACAATCAGGAAGGAGTGGA 3260 SEQ ID NO:684 -15.5 -21.9 64.5 -5.6 -0.6 -4.5
ATGGTTTGGCCAGCGACCTC 3328 SEQ ID NO:685 -15.5 -29 79.2 -11.7 -1.4 -11.4
TGTCTGAGCTAAATGAACTC 3423 SEQ ID NO: 686 -15.5 -19.5 59.9 -4 0 -5.1
GTTGTCTGAGCTAAATGAAC 3425 SEQ ID NO: 687 -15.5 -19.5 60 -4 0 -5.1
GCTTATTTCAATTCCAGTAT
3626 SEQ ID NO:688 -15.5 -21.2 64.4 -5.7 0 -2.8 TGCTTATTTCAATTCCAGTA
3627 SEQ ID NO:689 -15.5 -21.2 64.3 -5.7 0 -3.6 TTGTTCACCTTCTCGGGGTA
3914 SEQ ID NO:690 -15.5 -26.7 76.8 -10.2 -0.9 -4.2
AGCTTGTTCACCTTCTCGGG
3917 SEQ ID NO: 691 -15.5 -27.3 78 -11.3 -0.2 -4.5 CAGCTTGTTCACCTTCTCGG
3918 SEQ ID NO:692 -15.5 -26.8 76.4 -11.3 0 -4.5 TCTTGACCTCCAAACTTCTT
4897 SEQ ID NO: 693 -15.5 -23.4 67.6 -7.4 -0.1 -2.7
CAGCGTGCGGATCCCCTTTG 5384 SEQ ID NO: 694 -15.5 -30.4 79.1 -14.2 -0.4 -7.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ATCTGTTTTTTCTGGAGTGG 6329 SEQ ID NO:695 -15.5 -22.5 69.5 -7 0 -2.7
CTTTTTCTGGTTTGTCTTTC 6417 SEQ ID NO: 696 -15.5 -22.3 70.2 -6.8 0 -1.5
TTCTTTTTCTGGTTTGTCTT 6419 SEQ ID NO: 697 -15.5 -22.3 70.2 -6.8 0 -1.5
TTGGCATGGACCTCCTCTTG 6550 SEQ ID NO: 698 -15.5 -27.4 76.8 -11.4 -0.1 -5.1
AGGGTTCTTGTATACTGTTT 6930 SEQ ID NO: 699 -15.5 -22.2 69 -6.7 0 -6.3
TCCCTGTTGGAAGCTTGCAA 7491 SEQ ID NO: 700 -15.5 -26.3 73.2 -10.1 -0.5 -7.6
GGACAGAGCAGGTTGAATTC 7647 SEQ ID NO: 701 -15.5 -22.7 67.8 -7.2 0 -6.4
TTATATTGAGGCAACCATAG 8128 SEQ ID NO: 702 -15.5 -19.8 59.8 -3.7 -0.3 -4
TTTTTTTTTTTTTTTCCACC 9090 SEQ ID NO:703 -15.5 -20.7 63.3 -5.2 0 0
TTTTTTTTTTTTTGACCACA 103 SEQ ID NO: 704 -15.4 -19.6 60.4 -4.2 0 -2.1
ATGTCCCATTTGAATCCATT 1365 SEQ ID NO: 705 -15.4 -23.6 67.3 -8.2 0 -2.4
CAAATGTGCTGTGTTCATCA 2256 SEQ ID NO: 706 -15.4 -21.9 65.5 -6.5 0 -3.6
TCTTCAAATGTGCTGTGTTC 2260 SEQ ID NO:707 -15.4 -21.9 67 -6.5 0 -3.6
ACGTTACTGTTGCGTCGCTC 2326 SEQ ID NO:708 -15.4 -26.5 74.3 -10.4 -0.4 -7.1
CTTTGCCTTCCAGAGGAATC 2563 SEQ ID NO: 709 -15.4 -25.1 71.9 -8.5 -1.1 -6
GACCAAGCTCCATTAAACTG 2973 SEQ ID NO: 710 -15.4 -22.1 63.1 -6.7 0 -4.5
GGAAGGAGTGGAAGAAGTCG 3252 SEQ ID NO: 711 -15.4 -21.5 63.2 -5.6 -0.2 -2.7
CACATGGTTTGGCCAGCGAC 3331 SEQ ID NO: 712 -15.4 -27.3 74.8 -10.4 -1.4 -8.8
TATTGCCTTCATGGATTTCT 3582 SEQ ID NO: 713 -15.4 -23 68.2 -7.6 0.4 -4.7
TCTTTGCTTATTTCAATTCC 3631 SEQ ID NO: 714 -15.4 -21.1 64.4 -5.7 0 -2.9
CCTTTGCCTTCTTCTGTACT 4018 SEQ ID NO: 715 -15.4 -26.6 77 -11.2 0 -4.8
GCCAACATTATCAAAGTTTA 4664 SEQ ID NO: 716 -15.4 -19.3 58.4 -3.9 0 -4.1
GATGTCTTGACCTCCAAACT 4901 SEQ ID NO: 717 -15.4 -23.7 67.8 -7.4 -0.7 -4.9
TGACCAGGAAGAGCAGGAGG 5448 SEQ ID NO: 718 -15.4 -24.7 70.4 -9.3 0 -4.1
GGCATAGATAAACATGACCA 5462 SEQ ID NO: 719 -15.4 -20.7 60.5 -4.4 -0.8 -5.2
CCCAGCCAGCAGAGGTTGTA 5586 SEQ ID NO:720 -15.4 -29.7 82.1 -13.4 -0.8 -5.2
GAGGAGGATCCAGGGCAGCT 5922 SEQ ID NO: 721 -15.4 -28.9 81.6 -10.9 -2.6 -9.3
TTTTCTGGTTTGTCTTTCTC 6415 SEQ ID NO: 722 -15.4 -22.6 71.6 -7.2 0 -1.5
TCCCTATAGTCTAGGTAGCC 6721 SEQ ID NO: 723 -15.4 -26.8 78.3 -10 -1.3 -5.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular position oligo binding formation Duplex structure oligo oligo
TTTATCAGGCTATATATATA 7428 SEQ ID NO: 724 -15.4 -17.4 56.2 -2 0 -6
AGGTTTGAGTGTTTGACCAA 8091 SEQ ID NO: 725 -15.4 -22.6 67.4 -5.9 -1.2 -5.9
TGAGGCAACCATAGTTGGTA 8122 SEQ ID NO: 726 -15.4 -23.6 68.7 -5.8 -2.4 -8.7
CTTTGTTCTGTAGTACTGCT 8636 SEQ ID NO: 727 -15.4 -23.3 71.8 -7.4 0 -7.8
TTTTTTTTTTCCACCTTATA 9085 SEQ ID NO: 728 -15.4 -20.6 62.7 -5.2 0 -1.7
TCTCATTTATTCTTACAATA 346 SEQ ID NO: 729 -15.3 -17.4 56.2 -2.1 0 -2.2
AAATTGCCTTTCCTTTATTC 750 SEQ ID NO: 730 -15.3 -21.3 63.3 -6 0 -3.2
TTCCCAATAGTCTTGAGTCA 1610 SEQ ID NO: 731 -15.3 -23.7 70.2 -7.9 -0.2 -5.5
GGTTCCTCCATTCTTTAGCA 1956 SEQ ID NO: 732 -15.3 -26.7 77.7 -10.8 -0.3 -4.7
GCTGTCTTCAGATTCGGATT 2045 SEQ ID NO: 733 -15.3 -24.2 71.6 -7.4 -1.4 -5.7
CTGCTTTCGCCGTCTTCAAA 2272 SEQ ID NO: 734 -15.3 -25.9 71.3 -9.9 -0.5 -3.6
AACCTTCTCTTTCTGACTTC 2509 SEQ ID NO:735 -15.3 -22.8 68.9 -7.5 0 -2.6
ACATTGGCAAATCTATACCA 2659 SEQ ID NO:736 -15.3 -20.9 61.3 -5.1 -0.2 -4.4
TCCCAGATCAAGAACACATT 2674 SEQ ID NO: 737 -15.3 -21.9 63.3 -6.6 0 -4.6
ATGGGGTAGTGCTCCATGGC 2803 SEQ ID NO: 738 -15.3 -28.5 81.3 -11.2 -2 -8.9
CTCAGTCATGGGGTAGTGCT 2810 SEQ ID NO: 739 -15.3 -26.7 79.7 -11.4 0 -4.7
GCGGAACACAATCAGGAAGG 3266 SEQ ID NO: 40 -15.3 -22.2 62.9 -6.9 0 -3.4
TAATACACCCTTCAGTAAAA 3975 SEQ ID NO: 741 -15.3 -18.7 56.4 -3.4 0 -3.6
TTTTTAATACACCCTTCAGT 3979 SEQ ID NO:742 -15.3 -21.5 64 -6.2 0 -2.6
TCCAAACTTCTTTTTCTGCT 4889 SEQ ID NO:743 -15.3 -22.6 66.9 -7.3 0 -3.6
TGTCTTGACCTCCAAACTTC 4899 SEQ ID NO:744 -15.3 -23.6 68.4 -7.4 -0.7 -4.9
GGGTTTCTGAGGTTTCTTGG 4973 SEQ ID NO: 745 -15.3 -24.9 75.4 -9.6 0 -2.5
GGAAGAGCAGGAGGCCGATG 5442 SEQ ID NO: 746 -15.3 -26.4 72.6 -10.2 -0.8 -7.7
ATTTTTCTAGAATGGATTTA 7254 SEQ ID NO: 747 -15.3 -17 55.1 -1.1 0 -7.7
TAGGGTATTTAATTGACATA 7362 SEQ ID NO: 748 -15.3 -17.5 55.8 -2.2 0 -2.9
TATCAGGCTATATATATATT
7426 SEQ ID NO: 749 -15.3 -17.3 55.9 -2 0 -6.7 TTATCAGGCTATATATATAT
7427 SEQ ID NO: 750 -15.3 -17.3 55.9 -2 0 -6.5 GTTGGTAGAAAATGATCTAG
8109 SEQ ID NO: 751 -15.3 -17.5 55.7 -2.2 0.1 -4.9
TAGTTGGTAGAAAATGATCT 8111 SEQ ID NO: 752 -15.3 -17.5 55.7 -2.2 0 -4.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AGCCCAATAAGTGAAATGCA 8481 SEQ ID NO: 753 -15.3 -21.7 61.7 -6.4 0 -5.2
GTAGTACTGCTTGGTGAATC 8627 SEQ ID NO: 754 -15.3 -22.4 68.4 -7.1 0 -7
TTTTTTTTTCCACCTTATAT 9084 SEQ ID NO: 755 -15.3 -20.5 62.4 -5.2 0 -2
TCCAGCCAGTTCCATGGATC 1033 SEQ ID NO: 756 -15.2 -28.2 79.3 -11.7 -1 -10
CCTGCATCTGAGCCATTTCC 1483 SEQ ID NO:757 -15.2 -28.4 78.5 -12.7 -0.1 -4.9
CCAATAGTCTTGAGTCATGA 1607 SEQ ID NO: 758 -15.2 -21.8 65.6 -6.1 -0.2 -7.3
GGAGCCACGGATACTCAAGA 2147 SEQ ID NO: 759 -15.2 -24.9 69.5 -8.4 -1.2 -4.5
TCTTTGCCTTCCAGAGGAAT 2564 SEQ ID NO: 760 -15.2 -25.1 71.9 -8.5 -1.3 -6
ACGGCTCTTTGCCTTCCAGA 2569 SEQ ID NO: 761 -15.2 -28.9 79.4 -11 -2.7 -6.4
CCAACACCAAGGTGAGGTTT 3120 SEQ ID NO: 762 -15.2 -24.7 69.3 -8.4 -0.8 -9.7
TTGTCTGAGCTAAATGAACT 3424 SEQ ID NO: 763 -15.2 -19.2 58.9 -4 0 -5.1
TGGTTCCATTCCCATCTCTA 3663 SEQ ID NO: 764 -15.2 -27.1 77.3 -11.9 0 -4.8
TTCCAGAATGAATATATAGG 4214 SEQ ID NO: 765 -15.2 -17.3 54.4 -2.1 0 -4.2
AAACATGTTACCCGTTGTCA 4571 SEQ ID NO: 766 -15.2 -23.1 65.6 -7.2 0 -9
GTGCAAGATAGCCAGCGCCA 4680 SEQ ID NO: 767 -15.2 -28.9 77.5 -12.9 -0.6 -7.7
AGGCTGAAGTTTAACATCTC 4760 SEQ ID NO: 768 -15.2 -20.8 63.7 -5.6 0 -4.6
CTTGACCTCCAAACTTCTTT 4896 SEQ ID NO:769 -15.2 -23.1 66.5 -7.4 -0.1 -2.7
TGAGGGAAACGAGCTTCAGC 5193 SEQ ID NO: 770 -15.2 -23.5 67.2 -8.3 0.4 -5.3
GTCTGAGGGAAACGAGCTTC 5196 SEQ ID NO: 771 -15.2 -23.5 68.3 -8.3 0 -5.2
GTGCGGATCCCCTTTGCTCC 5380 SEQ ID NO: 772 -15.2 -32.2 85.1 -16.3 -0.4 -7.5
AGCAAAGAGCAGCGTGCGGA 5393 SEQ ID NO: 773 -15.2 -26.4 71.8 -9 -2.2 -8.5
GACCAGGAAGAGCAGGAGGC 5447 SEQ ID NO: 774 -15.2 -26.5 74.9 -10.6 -0.4 -4.8
TTCAAAGTGGTTGTAATAGG 6139 SEQ ID NO: 775 -15.2 -18.6 58.3 -2.7 -0.4 -3.8
GACCTCCTCTTGAAGTCCAG 6542 SEQ ID NO: 776 -15.2 -26.6 75.5 -11.4 0 -3.3
CTATAGTCTAGGTAGCCATT 6718 SEQ ID NO: 777 -15.2 -23.2 70.3 -7.4 -0.3 -4.6
ATATTTTTCTAGAATGGATT 7256 SEQ ID NO: 778 -15.2 -16.9 54.7 -1.1 0 -7.7
TCAGCTTTGCTGAGAGCAGA 7337 SEQ ID NO: 779 -15.2 -25 74 -6.7 -3.1 -11.4
TTTAATAGAAGTTGTTTATC 7442 SEQ ID NO: 780 -15.2 -15.6 52.4 0.4 0 -2.5
GGTTTGAGTGTTTGACCAAT 8090 SEQ ID NO: 781 -15.2 -22.6 67.1 -6.7 -0.4 -5.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GAGCCCAATAAGTGAAATGC 8482 SEQ ID NO: 782 -15.2 -21.6 61.8 -6.4 0 -3.3
CAGGTATCTCATCCCTGTCA 268 SEQ ID NO:783 -15.1 -26.8 77.9 -10.4 -1.2 -4.9
ATTTATTCTTACAATATCCC 342 SEQ ID NO: 784 -15.1 -19.4 59.4 -4.3 0 -2.6
GAATCCATTGTGCCATTAAA 1354 SEQ ID NO: 785 -15.1 -21.2 61.4 -6.1 0 -3.1
GACCAGCCTTCACACAGATG 1521 SEQ ID NO: 786 -15.1 -25.8 72.5 -10.7 0 -2.6
TCAAATGTGCTGTGTTCATC 2257 SEQ ID NO: 787 -15.1 -21.6 65.8 -6.5 0 -3.6
CGTCTTCAAATGTGCTGTGT 2262 SEQ ID NO: 788 -15.1 -23.4 68.6 -8.3 0 -3.6
CCAAGCTCCATTAAACTGAG 2971 SEQ ID NO: 789 -15.1 -21.9 62.8 -6.8 0 -5
TAACTTTTGGCTTTCTAAAA 3561 SEQ ID NO: 790 -15.1 -17.4 54.8 -1.6 -0.4 -4.3
ATTTCAATTCCAGTATTATT 3622 SEQ ID NO: 791 -15.1 -18.6 58.5 -3.5 0 -2.3
TTATTTCAATTCCAGTATTA 3624 SEQ ID NO: 792 -15.1 -18.3 57.9 -3.2 0 -2.5
ATACACCCTTCAGTAAAACA 3973 SEQ ID NO: 793 -15.1 -20.6 60.4 -5.5 0 -3.6
ATGCACCACTACTGAGAAGG 4119 SEQ ID NO: 794 -15.1 -23 66.3 -7 -0.8 -6.8
ATGGTTTTGATAGTCTTTCG 4168 SEQ ID NO: 795 -15.1 -20.9 64.3 -5.8 0 -2.9
CTGAGGTTTCTTGGATCCAA 4967 SEQ ID NO:796 -15.1 -23.7 69.4 -6.9 -0.2 -11.5
GCATAGATAAACATGACCAG 5461 SEQ ID NO: 797 -15.1 -19.5 58.3 -4.4 0 -5.2
ACGGTCTCCCTTAACTGAGC 5675 SEQ ID NO: 798 -15.1 -26.6 74.3 -10.9 -0.3 -3.7
GTCGCATCGGGATCAAACTT 5866 SEQ ID NO: 799 -15.1 -24 67.3 -8.9 0 -6.9
AATCCTCCCTTTAATTGCCT 6260 SEQ ID NO:800 -15.1 -25.9 71.2 -10.8 0 -3
CCATTTAGTTTGTCAATAAT 6304 SEQ ID NO: 801 -15.1 -18.6 57.8 -3.5 0 -2.9
TTTCTGGTTTGTCTTTCTCA 6414 SEQ ID NO: 802 -15.1 -23.2 72.5 -8.1 0 -1.7
TTGATACCCTGCTTCACAGA 6643 SEQ ID NO: 803 -15.1 -24.9 71 -8.5 -1.2 -3.8
CAGCTTTGCTGAGAGCAGAA 7336 SEQ ID NO: 804 -15.1 -23.9 69.8 -6.7 -2.1 -10.5
GAAAATGATCTAGGTTTGAG
8102 SEQ ID NO: 805 -15.1 -17.3 54.9 -2.2 0 -4.9 AGAAAATGATCTAGGTTTGA
8103 SEQ ID NO: 806 -15.1 -17.3 54.9 -2.2 0 -4.9 GTACTGCTTGGTGAATCATG
8624 SEQ ID NO: 807 -15.1 -22.2 66.4 -7.1 0 -4.6 AGTACTGCTTGGTGAATCAT
8625 SEQ ID NO: 808- -15.1 -22.2 66.8 -7.1 0 -5.5 GTTCAGCTTTTTTTTTTTTT
118 SEQ ID NO: 809 -15 -20.3 64.5 -5.3 0 -4.5
CGTGTAGCTTCTTGCATACG 428 SEQ ID NO: 810 -15 -24.3 69.7 -7.5 -1.8 -6.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
TATAAGTGACTCAAAGGTAT
965 SEQ ID NO : 811 -15 -17.4 55.3 -2.4 0 -3.3 GCCTGCATCTGAGCCATTTC
1484 SEQ ID NO : 812 -15 -28.2 79.4 -12.7 -0.1 -4.9
TAAAGATTTTCCCAATAGTC 1618 SEQ ID NO: 813 -15 -18.9 58 -3.9 0 -3.2
CCACCTACTCCACTGAAATC 1882 SEQ ID NO: 814 -15 -24.4 67.9 -9.4 0 -1.7
GTCTGAGCTAAATGAACTCA 3422 SEQ ID NO: 815 -15 -20.2 61.2 -4 -1.1 -4.6
GCTCTTTGCTTATTTCAATT 3633 SEQ ID NO: 816 -15 -21.4 65.3 -5.7 -0.4 -3.6
TTCGGGTTCAGTTTCAGCTT 3932 SEQ ID NO: 817 -15 -25.4 75.6 -10.4 0 -4.5
AAGTTTACTTTCACGTTTTT 4651 SEQ ID NO: 818 -15 -19.4 60.3 -3.9 -0.1 -4.9
TGCAAGATAGCCAGCGCCAA 4679 SEQ ID NO: 819 -15 -27 72.1 -11.2 -0.6 -7.7
GCGGATCCCCTTTGCTCCTT 5378 SEQ ID NO: 820 -15 -32 84.1 -16.3 -0.4 -7.5
GTTTCAAAGTGGTTGTAATA 6141 SEQ ID NO: 821 -15 -18.7 58.9 -3 -0.4 -3.8
TTTCTTTTTCTGGTTTGTCT 6420 SEQ ID NO: 822 -15 -22.3 70.2 -7.3 0 -1.5
TGATACCCTGCTTCACAGAG 6642 SEQ ID NO: 823 -15 -24.8 70.9 -8.5 -1.2 -3.7
AACGTTGATACCCTGCTTCA 6647 SEQ ID NO: 824 -15 -24.9 69.3 -9.9 0 -6.4
GGCAACCATAGTTGGTAGAA 8119 SEQ ID NO: 825 -15 -22.9 66.6 -5.5 -2.4 -8.7
GCTTGGTGAATCATGCACTA 8619 SEQ ID NO: 826 -15 -23.5 68.8 -7.2 -1.2 -5.5
AAAGCTGCTTTTAATTTGCC 8655 SEQ ID NO: 827 -15 -21.3 62.7 -5 -0.1 -10.6
ATATTGAAAGAAGATGAGTT 8798 SEQ ID NO: 828 -15 -15.4 50.7 0 0 -1.8
TGTTCAGCTTTTTTTTTTTT 119 SEQ ID NO: 829 -14.9 -20.2 64 -5.3 0 -4.3
TTATTCTTACAATATCCCTA 340 SEQ ID NO: 830 -14.9 -19.9 60.5 -5 0 -2.6
TCTTGCATACGAATTACCTT
419 SEQ ID NO: 831 -14.9 -21.5 62.7 -6.6 0 -5.1 TTCTTGCATACGAATTACCT
420 SEQ ID NO: 832 -14.9 -21.5 62.7 -6.6 0 -5.1 TTATAAGTGACTCAAAGGTA
966 SEQ ID NO: 833 -14.9 -17.5 55.7 -2.6 0 -3.5 CATTGTGCCATTAAAGTAGG
1349 SEQ ID NO: 834 -14.9 -21 62.4 -6.1 0 -3.4
TGATGCTGCCGCAACTGCCT 1850 SEQ ID NO:835 -14.9 -29.5 77.4 -13 -1.6 -8
ATGCTTCTGAAGAACTTTCC 1917 SEQ ID NO: 836 -14.9 -21.6 64.4 -6 -0.4 -8.3
AGCAGTCTGAATGATCGCAG 3019 SEQ ID NO: 837 -14.9 -23.2 67.8 -7.6 -0.4 -6.3
TTCATGGATTTCTATAACTT 3575 SEQ ID NO: 838 -14.9 -18.4 58.1 -3.5 0 -5
GTGGTTCCATTCCCATCTCT 3664 SEQ ID NO: 839 -14.9 -28.6 81.6 -13 -0.4 -5.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GGCTGGGGTTGTTTATGAAT 3747 SEQ ID NO:840 -14.9 -23.8 69.9 -8.9 0 -3.7 '
GTGAGGCTGGGGTTGTTTAT 3751 SEQ ID NO: 841 -14.9 -25.7 76.4 -10.8 0 -2.9
CTTCGGGTTCAGTTTCAGCT 3933 SEQ ID NO: 842 -14.9 -26.2 77.3 -11.3 0 -4.3
CAATACTGTAGCAGGTTTTT 4059 SEQ ID NO: 843 -14.9 -21 64.1 -6.1 0.2 -4.5
CATATTCTAGCATGGTTTTG 4179 SEQ ID N0:844 -14.9 -20.7 63.6 -5.8 0 -5
GTTTACTTTCACGTTTTTCC 4649 SEQ ID NO: 845 -14.9 -22.5 67.7 -7.6 0 -4.7
ATGTCTTGACCTCCAAACTT 4900 SEQ ID NO: 846 -14.9 -23.2 66.9 -7.4 -0.7 -4.9
GTGTCTGAGGGAAACGAGCT 5198 SEQ ID NO:847 -14.9 -24.2 69.5 -9.3 0.6 -5.5
TGCGGATCCCCTTTGCTCCT 5379 SEQ ID NO:848 -14.9 -31.9 83.5 -16.3 -0.4 -7.5
TGGCATAGATAAACATGACC 5463 SEQ ID NO: 849 -14.9 -20 59.3 -4.4 -0.4 -5.2
GTCATCCTCACTCAGGGGCT 5819 SEQ ID NO: 850 -14.9 -29.2 84.3 -13.8 -0.2 -7.6
CATAAACCTGTCTTCCATCT 6089 SEQ ID NO: 851 -14.9 -23.1 66.9 -8.2 0 -2
CTAGGTAGCCATTGGGTTTC
6711 SEQ ID NO: 852 -14.9 -25.5 75.4 -10 -0.3 -6.3 TCTAGGTAGCCATTGGGTTT
6712 SEQ ID NO: 853 -14.9 -25.5 75.4 -10 -0.3 -6.3 AGACAGGGTTCTTGTATACT
6934 SEQ ID NO: 854 -14.9 -22.3 68.4 -6.7 -0.4 -6.5
CCAAGACTTGTGAAGAATGG 7597 SEQ ID NO: 855 -14.9 -20 59.3 -4.6 -0.2 -5.4
ATTTATATCATGTTAGGTAA
8304 SEQ ID NO: 856 -14.9 -17.1 55.6 -2.2 0 -4.7 AATTTATATCATGTTAGGTA
8305 SEQ ID NO: 857 -14.9 -17.1 55.6 -2.2 0 -4.7 TTTTTTTTCCACCTTATATA
9083 SEQ ID NO: 858 -14.9 -20.1 61.4 -5.2 0 -3.2
TTCTTTCTCTGTGGATAAGA 51 SEQ ID NO: 859 -14.8 -20.8 64.7 -5.2 -0.6 -3.9
TTTTTTTTTTTTTTGACCAC 104 SEQ ID NO: 860 -14.8 -19 59.5 -4.2 0 -1.7
TCGGAAAATTGCCTTTCCTT 755 SEQ ID NO: 861 -14.8 -23.3 65.2 -6 -2.5 -7.5
GGAGGGTTGCTCAAGGTCAT 904 SEQ ID NO: 862 -14.8 -26.1 76.5 -9.3 -2 -4.7
CTTCTGGACACTGGCCTGCA 1497 SEQ ID NO: 863 -14.8 -28.5 79.2 -13.7 0 -7.2
CTGTTGCTTTTTAAGCTGTT 1820 SEQ ID NO:864 -14.8 -22.3 67.7 -5.6 -1.9 -6.4
CCCACCTACTCCACTGAAAT 1883 SEQ ID NO: 865 -14.8 -26 69.8 -11.2 0 -1.7
TTCAAATGTGCTGTGTTCAT 2258 SEQ ID NO: 866 -14.8 -21.3 64.6 -6.5 0 -3.6
GCCTGACTAACGTTACTGTT 2335 SEQ ID NO: 867 -14.8 -23.8 68.2 -8.5 0 -7.8
TCCTCCAGCATCTCCATTGA 2545 SEQ ID NO:868 -14.8 -28 78.5 -13.2 0 -4.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TCATGGGGTAGTGCTCCATG 2805 SEQ ID NO: 869 -14.8 -26.6 77 -7.9 -3.9 -12.7
GATCGCAGTACAGACAATCC 3007 SEQ ID NO:870 -14.8 -23.3 67.1 -7.8 -0.4 -5.3
CAACACCAAGGTGAGGTTTC 3119 SEQ ID NO: 871 -14.8 -23.1 67.2 -7.2 -0.8 -9.6
GCCAACACCAAGGTGAGGTT 3121 SEQ ID NO: 872 -14.8 -26.4 73 -10 -1.3 -10.8
G7AAACACTCCCGCATCTTAT 3530 SEQ ID NO: 873 -14.8 -24 66.6 -9.2 0 -3.6 TTGCCTTCATGGATTTCTAT
3580 SEQ ID NO:874 -14.8 -23 68.2 -7.6 -0.3 -5 ATTGCCTTCATGGATTTCTA
3581 SEQ ID NO: 875 -14.8 -23 68.2 -7.6 -0.3 -4.7 TTTGCTTATTTCAATTCCAG
3629 SEQ ID NO: 876 -14.8 -20.5 62.4 -5.7 0 -3.6
ATGAAAGTCTCAAACCAGTT 4087 SEQ ID NO: 877 -14.8 -19.6 59.2 -4.2 -0.3 -3.5
CAATGCACCACTACTGAGAA 4121 SEQ ID NO:878 -14.8 -21.8 62.7 -7 0 -5.9
AAAGTTGGACATCCCAAAGA 5483 SEQ ID NO: 879 -14.8 -20.9 60.5 -3.9 -2.2 -5.7
CTGGGTCGCATCGGGATCAA 5870 SEQ ID NO: 880 -14.8 -26.8 73.3 -12 0 -6.9
AGGATCCAGGGCAGCTGCAA 5918 SEQ ID NO: 881 -14.8 -28.3 78.5 -10.6 -1 -14
CCTGCTTCACAGAGTTGCAG 6636 SEQ ID NO:882 -14.8 -26.1 75.5 -9.4 -1.9 -7.4
GTAGTTACAATGTTCACTTT 6750 SEQ ID NO:883 -14.8 -19.8 62.2 -5 0 -5.6
TATATTTTTCTAGAATGGAT
7257 SEQ ID NO: 884 -14.8 -16.5 53.8 -1.1 0 -7.7 ATATATTTTTCTAGAATGGA
7258 SEQ ID NO: 885 -14.8 -16.5 53.8 -1.1 0 -7.7 GATATATTTTTCTAGAATGG
7259 SEQ ID NO: 886 -14.8 -16.5 53.8 -1.1 0 -7.7 ATTTAATAGAAGTTGTTTAT
7443 SEQ ID NO: 887 -14.8 -15.2 51.1 0.4 0 -2.5
CTAGGTTTGAGTGTTTGACC 8093 SEQ ID NO:888 -14.8 -23.2 70.1 -7.9 -0.1 -3.8
TACTGCTTGGTGAATCATGC 8623 SEQ ID NO: 889 -14.8 -22.8 67.4 -7.1 -0.8 -4.6
TAGTACTGCTTGGTGAATCA 8626 SEQ ID NO:890 -14.8 -21.9 66.3 -7.1 0 -6
GCTGCTTTTAATTTGCCTTT 8652 SEQ ID NO: 891 -14.8 -23.8 69.3 -9 0 -5.2
TTTTTTTTTTTTTTTGACCA 105 SEQ ID NO:892 -14.7 -18.9 59.3 -4.2 0 -1.7
TGCCTTTCCTTTATTCATTA 746 SEQ ID NO: 893 -14.7 -23.1 68.3 -8.4 0 -3
GAAAATTGCCTTTCCTTTAT 752 SEQ ID NO:894 -14.7 -20.7 60.9 -6 0 "3.2
CTGGACACTGGCCTGCATCT 1494 SEQ ID NO: 895 -14.7 -28.4 78.7 -13.7 0 -7.2
AGTCTTGAGTCATGAGTCGA 1602 SEQ ID NO: 896 -14.7 -23.1 70.4 -6.7 0 -11.6
AAATGTGCTGTGTTCATCAT 2255 SEQ ID NO: 897 -14.7 -21.2 64.2 -6.5 0 "3.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo άnding formation Duplex structure oligo oligo
AGGAGTGGAAGAAGTCGTTC 3249 SEQ ID NO: 898 -14.7 -22.1 66.5 -6.9 -0.2 -3.1
GGTTTGGCCAGCGACCTCCA
3326 SEQ ID NO: 899 -14.7 -31.7 83.8 -15.7 -0.3 -10.6 TGGTTTGGCCAGCGACCTCC
3327 SEQ ID NO: 900 -14.7 -31 82.6 -14.6 -1 -11.4 TTGGAAACACTCCCGCATCT
3533 SEQ ID NO: 901 -14.7 -25.5 69.4 -9.7 -1 -4.8
TCAGCTTGTTCACCTTCTCG 3919 SEQ ID NO: 902 -14.7 -26 75.5 -11.3 0 -4.5
CCAGAATGAATATATAGGTA 4212 SEQ ID NO: 903 -14.7 -17.7 55.2 -3 0 -4.2
CTGAGCTGCCAGGGTGAATT 5661 SEQ ID NO: 904 -14.7 -26.3 74.2 -11.1 0 -7.8
TCTGTATTCGAAGGGCATCC 6072 SEQ ID NO: 905 -14.7 -24.7 70.9 -10 0 -7.2
CTTGTTTACGTTTCAAAGTG 6150 SEQ ID NO: 906 -14.7 -19.4 59.6 -4.7 0 -4.8
TCTTTTTCTGGTTTGTCTTT 6418 SEQ ID NO: 907 -14.7 -22.3 70.2 -7.6 0 -1.5
GTTGATACCCTGCTTCACAG 6644 SEQ ID NO: 908 -14.7 -25.5 73 -9.9 -0.8 -3.6
GCAGATATGGAAGTTAAAAA 6807 SEQ ID NO:909 -14.7 -16.1 51.4 0 -1.3 -5.5
TTTAGATATATTTTTCTAGA 7263 SEQ ID NO: 910 -14.7 -15.9 53.4 -1.1 0 -5.4
GTTTGAGTGTTTGACCAATG 8089 SEQ ID NO: 911 -14.7 -21.4 64.4 -6.2 -0.2 -3.4
GTAGAAAATGATCTAGGTTT 8105 SEQ ID NO: 912 -14.7 -17.6 56 -2.2 -0.4 -4.9
AGTTGGTAGAAAATGATCTA 8110 SEQ ID NO: 913 -14.7 -17.5 55.7 -2.2 -0.2 -4.9
AAAGGTTATATTGAGGCAAC 8133 SEQ ID NO: 914 -14.7 -18.4 56.9 -3.7 0 -4
TGCTTGGTGAATCATGCACT 8620 SEQ ID NO: 915 -14.7 -23.8 69.2 -7.2 -1.9 -6.4
GAAGATGAGTTTAGATGCTT 8789 SEQ ID NO: 916 -14.7 -19.6 60.9 -4.9 0 -3.6
ACGTGTAGCTTCTTGCATAC 429 SEQ ID NO:917 -14.6 -23.7 70.2 -7.5 -1.5 0
CTGTGCCATCTTTTCATCCT 461 SEQ ID NO: 918 -14.6 -26.6 76.5 -12 0 -3
CTGCAAACATTTATTCCTCA 1289 SEQ ID NO: 919 -14.6 -21.3 62.7 -6.7 0 -4.9
TCATGTATGTTTTCCCAGCA 1656 SEQ ID NO: 920 -14.6 -25.1 73.1 -10.5 0 -4.7
GAGCTTCTTCCTGTTGCTTT 1830 SEQ ID NO: 921 -14.6 -26.3 78 -10.8 -0.7 -5.2
CCGCAACTGCCTGAGCTTCT 1842 SEQ ID NO: 922 -14.6 -29.1 77.8 -13.3 -1.1 -5.7
GGAGTGGAAGAAGTCGTTCA 3248 SEQ ID NO: 923 -14.6 -22.8 67.5 -6.9 -1.2 -4.1
AAGGCACATGGTTTGGCCAG 3335 SEQ ID NO: 924 -14.6 -26.2 73.5 -8.4 -3.2 -9.6
CTTATTTCAATTCCAGTATT 3625 SEQ ID NO: 925 -14.6 -19.5 60.5 -4.9 0 -2.5
CTCTTTGCTTTCTTCTAGTT 3845 SEQ ID NO: 926 -14.6 -23 71.7 -8.4 0 -4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo AAGAAATCTAGCCAGCACCA 4285 SEQ ID NO: 927 -14.6 -23.4 66 -8.8 0 -4.6
AGATGTCTTGACCTCCAAAC 4902 SEQ ID NO: 928 -14.6 -22.8 66.2 -7.4 -0.6 -4.9
GAGGATCATGATGCTGATAT
5057 SEQ ID NO: 929 -14.6 -21.1 63.6 -5.6 -0.6 -8.5 TGAGGATCATGATGCTGATA
5058 SEQ ID NO: 930 -14.6 -21.1 63.5 -5.6 -0.7 -7.9 GATAAACATGACCAGGAAGA
5456 SEQ ID NO: 931 -14.6 -19 56.9 -4.4 0 -5.2
TTGCCAAAGGTCTCAAAGTT 5542 SEQ ID NO: 932 -14.6 -21.9 64.3 -7.3 0 -4
TCCTCACTCAGGGGCTCTGC 5815 SEQ ID NO: 933 -14.6 -30 86 -13.3 -2.1 -7.7
GCATGGACCTCCTCTTGAAG 6547 SEQ ID NO: 934 -14.6 -26 73.2 -11.4 0 -5.1
GAGACAGGGTTCTTGTATAC 6935 SEQ ID NO: 935 -14.6 -22 67.8 -6.7 -0.4 -7.4
TACTTTAGATATATTTTTCT 7266 SEQ ID NO: 936 -14.6 -16.4 54.4 -1.8 0 -4.3
CCCTGTTGGAAGCTTGCAAA 7490 SEQ ID NO: 937 -14.6 -25.2 69.4 -10.1 -0.2 -7.2
TTGGTAGAAAATGATCTAGG 8108 SEQ ID NO: 938 -14.6 -17.5 55.3 -2.2 -0.4 -4.9
TAGGTGGTTACTACTATTAT 8733 SEQ ID NO: 939 -14.6 -19.7 62 -4.6 -0.1 -3.9
TATTGAAAGAAGATGAGTTT 8797 SEQ ID NO: 940 -14.6 -15.5 51 -0.8 0 -2.3
TATATTGAAAGAAGATGAGT 8799 SEQ ID NO: 941 -14.6 -15 49.9 0 0 -2.2
TTCATCCTGCACATTTAATT 449 SEQ ID NO: 942 -14.5 -21.2 63.2 -6.7 0 -4.8
CGGAAAATTGCCTTTCCTTT 754 SEQ ID NO: 943 -14.5 -23 64.2 -6 -2.5 -7.5
TAAGCAAAACCCTCTTGCCA 992 SEQ ID NO: 944 -14.5 -24.4 66.6 -7.9 -2 -6.2
CTGAGACATTGCCCAGGTCC 1092 SEQ ID NO: 945 -14.5 -28.4 78.4 -13.2 -0.5 -4.4
AATCCATTGTGCCATTAAAG 1353 SEQ ID NO: 946 -14.5 -20.6 60.4 -6.1 0 -3.1
AGCACGTAATGTCAACTGGT 1637 SEQ ID NO: 947 -14.5 -22.8 66.3 -8.3 0 -4.8
TGAGCTTCTTCCTGTTGCTT 1831 SEQ ID NO: 948 -14.5 -26.2 77.3 -10.8 -0.7 -5.2
CTCAACTTTGATGCTTCTGA 1927 SEQ ID NO: 949 -14.5 -21.9 65.6 -7.4 0 -5
AGATCCAACATCCTTTGCCC 2219 SEQ ID NO: 950 -14.5 -27.2 74.2 -12.2 -0.1 -4.5
TCCTGCTTTCGCCGTCTTCA 2274 SEQ ID NO: 951 -14.5 -29.7 81.1 -14.5 -0.5 -3.6
ACTAACGTTACTGTTGCGTC 2330 SEQ ID NO: 952 -14.5 -22.7 66.2 -7.2 -0.9 -7.8
GCATCACAGCAGTCCCAGAT 2686 SEQ ID NO: 953 -14.5 -27.9 78.7 -12.9 -0.1 -4.2
TCTTATTGCCTTCATGGATT 3585 SEQ ID NO: 954 -14.5 -23 68.2 -7.9 -0.3 -4.7
CATTCCCATCTCTAAGATAA 3657 SEQ ID NO: 955 -14.5 -21.1 62.4 -5.9 -0.5 -3.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CACCTTCTCGGGGTAGAACA 3909 SEQ ID NO:956 -14.5 -25.7 72 -10.2 -0.9 -4.9
AGACGTAGGATTCGGCCAAT 5353 SEQ ID NO: 957 -14.5 -24.6 68.3 -9.5 -0.3 -7.5
CATAGATAAACATGACCAGG 5460 SEQ ID NO: 958 -14.5 -18.9 56.9 -4.4 0 -5.2
CAGATGGGTCCCCACGGTCT 5688 SEQ ID NO: 959 -14.5 -30.7 82.2 -15.3 -0.6 -8.8
ACTTTTGATTTTCTCTGACC 6453 SEQ ID NO: 960 -14.5 -21.7 65.9 -7.2 0 -2.4
GACACATATACTTTACCTTC 6520 SEQ ID NO: 961 -14.5 -20.4 62.1 -5.9 0 -2.4
GTTGACACATATACTTTACC 6523 SEQ ID NO: 962 -14.5 -20.3 61.7 -5.8 0 -2.9
AAATTTATATCATGTTAGGT 8306 SEQ ID NO: 963 -14.5 -16.7 54.2 -2.2 0 -4.7
AGATGAGTTTAGATGCTTAT 8787 SEQ ID NO: 964 -14.5 -19.4 61.1 -4.9 0 -3.6
TTTTTTTTCTTTCTTTCTCT 61 SEQ ID NO: 965 -14.4 -20.3 65.4 -5.9 0 0
AGGGTATAACGTGTCTTCCT 147 SEQ ID NO: 966 -14.4 -24.4 71.2 -10 0 -5.3
GTATCTCATCCCTGTCAAAC 265 SEQ ID NO: 967 -14.4 -23.7 69.4 -9.3 0 -1.8
TTTTTGGGCTTCTTGGCTTT 568 SEQ ID NO: 968 -14.4 -25.1 74.3 -9.7 -0.9 -3.7
TTTATAAGTGACTCAAAGGT 967 SEQ ID NO: 969 -14.4 -17.9 56.6 -3.5 0 -4.7
CACTGCAAACATTTATTCCT 1291 SEQ ID NO: 970 -14.4 -21.1 61.9 -6.7 0 -4.9
GGACACTGGCCTGCATCTGA 1492 SEQ ID NO: 971 -14.4 -28.1 78.1 -13.7 0 -7.2
TAGTCTTGAGTCATGAGTCG 1603 SEQ ID NO: 972 -14.4 -22.2 68.3 -6.1 0 -11.5
GGGAGCCACGGATACTCAAG 2148 SEQ ID NO: 973 -14.4 -25.5 70.7 -9.8 -1.2 -4.5
GTCTGTGCGGCACAAACAGT 2301 SEQ ID NO:974 -14.4 -25.6 72.2 -8.6 -1.4 -13.2
TAACGTTACTGTTGCGTCGC 2328 SEQ ID NO:975 -14.4 -24.2 68.1 -8.8 -0.9 -7.6
TCAGTCATGGGGTAGTGCTC 2809 SEQ ID NO:976 -14.4 -26.2 79.5 -11.8 0 -4.1
TGCCTTCATGGATTTCTATA 3579 SEQ ID NO: 977 -14.4 -22.6 67.3 -7.6 -0.3 -5
ATCTTATTGCCTTCATGGAT 3586 SEQ ID NO: 978 -14.4 -22.9 67.8 -7.9 -0.3 -4.7
TCTTTGCTTTCTTCTAGTTC 3844 SEQ ID NO: 979 -14.4 -22.5 71.4 -8.1 0 -4
GTTACCCGTTGTCATGTTAA 4565 SEQ ID NO: 980 -14.4 -23.9 68.9 -9.5 0 -4.7
TGACCTCCAAACTTCTTTTT 4894 SEQ ID NO: 981 -14.4 -22.3 65 -7.9 0 -2.1
GAGGTATGGGTTTCTGAGGT 4980 SEQ ID NO:982 -14.4 -24.8 75.1 -10.4 0 -2.8
TGATCAGACGTAGGATTCGG 5358 SEQ ID NO:983 -14.4 -22.5 65.4 -7.6 -0.2 -6.6
ATAGATAAACATGACCAGGA 5459 SEQ ID NO: 984 -14.4 -18.8 56.9 -4.4 0 -5.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TCTGTTTTTTCTGGAGTGGA 6328 SEQ ID NO:985 -14.4 -23.1 71 -8.7 0 -2.7
CTCCCATCTGTTTTTTCTGG 6334 SEQ ID NO: 986 -14.4 -25.5 74.4 -11.1 0 -3.2
TAGTCTAGGTAGCCATTGGG 6715 SEQ ID NO: 987 -14.4 -25 74.3 -10 -0.3 -6.3
ATACATCCCTGTTGGAAGCT 7496 SEQ ID NO: 988 -14.4 -25 71.1 -9.9 -0.5 -6.8
GACATAATGGACAGAGCAGG 7655 SEQ ID NO: 989 -14.4 -21.5 63.6 -7.1 0 -4.1
ATAGTTGGTAGAAAATGATC 8112 SEQ ID NO: 990 -14.4 -16.6 53.7 -2.2 0 -3.9
TATTTGTAATAGCTTTAGTG 8232 SEQ ID NO: 991 -14.4 -17.6 57 -3.2 0 -4.6
CTGTAGTACTGCTTGGTGAA 8629 SEQ ID NO: 992 -14.4 -22.9 68.7 -8 0 -7.8
CTGCTTATGCCTCCGCTTCG 3 SEQ ID NO: 993 -14.3 -29.3 78.2 -14.1 -0.8 -5
TTTTTCTTTCTTTCTCTGTG 58 SEQ ID NO: 994 -14.3 -21.2 67.5 -6.9 0 0
TTTTTTTCTTTCTTTCTCTG 60 SEQ ID NO: 995 -14.3 -20.2 64.8 -5.9 0 0
GCAAACATTTATTCCTCAGA 1287 SEQ ID NO: 996 -14.3 -21 62.4 -6.7 0 -3.4
AAATATCATGTATGTTTTCC 1661 SEQ ID NO: 997 -14.3 -18.2 57.2 -3.9 0 -4.9
GGTGGCCTGATTCTGCTCCT 1754 SEQ ID NO: 998 -14.3 -30.3 84.8 -15.4 -0.3 -7.2
CAGGGAGCCACGGATACTCA 2150 SEQ ID NO:999 -14.3 -26.9 74 -11.3 -1.2 -4.5
TGCTGTGTTCATCATCAGCA 2250 SEQ ID NO:1000 -14.3 -25 74.7 -6.5 -4.2 -9.6
TAAGGCACATGGTTTGGCCA 3336 SEQ ID NO: 1001 -14.3 -25.9 72.7 -8.4 -3.2 -9.1
GGTTTCCAATGACCATGACC 3369 SEQ ID NO:1002 -14.3 -25.3 70.3 -10.1 -0.7 -5
CAATTCCAGTATTATTGGAC 3618 SEQ ID NO: 1003 -14.3 -20 60.8 -4.2 -1.4 -7.2
CTCTTTGCTTATTTCAATTC 3632 SEQ ID NO: 1004 -14.3 -20 62.5 -5.7 0 -3.6
AGCTCTTTGCTTATTTCAAT 3634 SEQ ID NO: 1005 -14.3 -21.3 65.2 -5.7 -1.2 -4.3
TTTTTCGAAGATTCCACCAG 4044 SEQ ID NO:1006 -14.3 -22.2 64.2 -7.2 -0.4 -6.8
GGTTTTTCGAAGATTCCACC 4046 SEQ ID NO:1007 -14.3 -23.9 68.3 -8.9 -0.4 -6.6
ACCACTACTGAGAAGGATCA
4115 SEQ ID NO:1008 -14.3 -22.2 65.1 -7 -0.8 -6.3 CACCACTACTGAGAAGGATC
4116 SEQ ID NO:1009 -14.3 -22.2 65.1 -7 -0.8 -5.1 GGGAAACGAGCTTCAGCACA
5190 SEQ ID NO:1010 -14.3 -24.5 68.6 -9.3 -0.7 -6.6
AGCGTGCGGATCCCCTTTGC 5383 SEQ ID NO: 1011 -14.3 -31.5 82.2 -16.5 -0.4 -7.5
CTGTTGCCAAAGGTCTCAAA 5545 SEQ ID NO: 1012 -14.3 -22.7 65.5 -8.4 0 -3.6
CCAGCCAGCAGAGGTTGTAA 5585 SEQ ID NO: 1013 -14.3 -27 75.9 -11.8 -0.8 -5.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GAGCTGCCAGGGTGAATTGT
5659 SEQ ID NO:1014 -14.3 -26.6 75.6 -12.3 0 -5.6 TGAGCTGCCAGGGTGAATTG
5660 SEQ ID NO:1015 -14.3 -25.4 72.1 -11.1 0 -5.6 CCTCACTCAGGGGCTCTGCA
5814 SEQ ID NO:1016 -14.3 -30.3 85 -14.4 -1.6 -5.1
AACTGGGTCGCATCGGGATC 5872 SEQ ID NO: 1017 -14.3 -26.3 72.8 -12 0 -6.9
TATAGTCTAGGTAGCCATTG 6717 SEQ ID NO:1018 -14.3 -22.3 68 -7.4 -0.3 -4
AGGCTATATATATATTTGCC 7422 SEQ ID NO:1019 -14.3 -20.4 62.2 -4 -1.3 -12.3
CAGTAGGCAGTATCCAGTGT 7772 SEQ ID NO:1020 -14.3 -25.7 76.9 -11.4 0.6 -4
CACTTTGTTCATGGCTAAAA 8270 SEQ ID NO:1021 -14.3 -19.9 59.9 -5.6 0 -4.7
TGGTGAATCATGCACTAGTT 8616 SEQ ID NO: 1022 -14.3 -22 66 -6.5 -1.1 -6.2
GCACGTTTTTCGATAGCAGC 538 SEQ ID NO: 1023 -14.2 -24.9 71.1 -9.6 -1 -5.6
AAAATTGCCTTTCCTTTATT 751 SEQ ID NO: 1024 -14.2 -20.2 60 -6 0 -3.2
TCTAAGCAAAACCCTCTTGC 994 SEQ ID NO:1025 -14.2 -23 65.3 -7.9 -0.8 -5
CAGTTCCATGGATCACGAAG 1027 SEQ ID NO: 1026 -14.2 -22.9 65.7 -7.4 0 -10.5
GTTTCAAAAGCAGAATCGCT 1318 SEQ ID NO:1027 -14.2 -20.7 60.9 -5.7 -0.6 -7
GTTGGTTTCAAAAGCAGAAT
1322 SEQ ID NO:1028 -14.2 -19.3 58.9 -4.3 -0.6 -1.1 TGTTGGTTTCAAAAGCAGAA
1323 SEQ ID NO: 1029 -14.2 -19.3 58.8 -4.3 -0.6 -1.1 TGGTGTTGGTTTCAAAAGCA
1326 SEQ ID NO:1030 -14.2 -21.8 64.9 -6.9 -0.4 -4.2
TCTGGACACTGGCCTGCATC 1495 SEQ ID NO:1031 -14.2 -27.9 78.6 -13.7 0 -7.2
ATAGTCTTGAGTCATGAGTC
1604 SEQ ID NO: 1032 -14.2 -21.4 68.2 -6.1 0 -10.1 AATAGTCTTGAGTCATGAGT
1605 SEQ ID NO: 1033 -14.2 -20.3 64 -6.1 0 -7.3 GCACGTAATGTCAACTGGTA
1636 SEQ ID NO:1034 -14.2 -22.5 65.5 -8.3 0 -4.8
GCCATGGCCACCACAGCCAG 1729 SEQ ID NO:1035 -14.2 -32.5 84 -15.5 -2.8 -11.7
TTTTAAGCTGTTCGAGCATC 1812 SEQ ID NO:1036 -14.2 -22 66 -5.5 -2.3 -7.3
GTTGCTTTTTAAGCTGTTCG 1818 SEQ ID NO:1037 -14.2 -22.6 67.6 -5.8 -2.6 -7.1
TCTTCCTGTTGCTTTTTAAG 1825 SEQ ID NO:1038 -14.2 -22.1 67.1 -7.9 0 -3.6
CTCCTAACCCACCTACTCCA 1890 SEQ ID NO:1039 -14.2 -29.1 77 -14.9 0 -0.3
TGTCTTCAGATTCGGATTTG
2043 SEQ ID NO:1040 -14.2 -21.6 65.4 -7.4 0 -4.4 CTGTCTTCAGATTCGGATTT
2044 SEQ ID NO: 1041 -14.2 -22.5 67.6 -7.4 -0.7 -5 ATCCTCCAGCATCTCCATTG
2546 SEQ ID NO: 1042 -14.2 -27.4 77.1 -13.2 0 -4.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CGCAGTACAGACAATCCCTC 3004 SEQ ID NO: 1043 -14.2 -25.6 71.3 -10.7 -0.4 -5.3
GTCTGAATGATCGCAGTACA 3015 SEQ ID NO:1044 -14.2 -22.5 66.3 -7.6 -0.4 -6.3
TTTCAATTCCAGTATTATTG 3621 SEQ ID NO: 1045 -14.2 -18.6 58.4 -4.4 0 -3.5
CCCTTTGCCTTCTTCTGTAC 4019 SEQ ID NO: 1046 -14.2 -27.7 78.7 -13.5 0 -3.8
ATTTCCAGAATGAATATATA 4216 SEQ ID NO: 1047 -14.2 -16.2 52.2 -2 0 -5.3
TCAAAGTTTACTTTCACGTT 4654 SEQ ID NO: 1048 -14.2 -19.5 59.9 -3.9 -1.3 -8.7
ATAAAGATGTCTTGACCTCC 4906 SEQ ID NO: 1049 -14.2 -21.6 63.9 -7.4 0.2 -6.8
CGAAGGGCATCCATCTCTCC 6064 SEQ ID NO:1050 -14.2 -27.7 76.1 -12.3 -1.1 -4.3
GTATTCGAAGGGCATCCATC 6069 SEQ ID NO: 1051 -14.2 -24.5 70.2 -9.1 -1.1 -8.2
ATATGGCAGATATGGAAGTT 6812 SEQ ID NO: 1052 -14.2 -20.1 61.2 -4.5 -1.3 -4.7
AACATGCATTAGTGATAGCC 7545 SEQ ID NO:1053 -14.2 -21.8 64.5 -7.6 0 -6.8
TTGTGAAGAATGGATTGAGT 7590 SEQ ID NO: 1054 -14.2 -18.8 58.3 -4.6 0 -2.9
TAGAAAATGATCTAGGTTTG 8104 SEQ ID NO: 1055 -14.2 -16.4 53.1 -2.2 0 -4.9
TAAAAGGTTATATTGAGGCA 8135 SEQ ID NO:1056 -14.2 -17.9 55.9 -3.7 0 -4
GCCCAATAAGTGAAATGCAA 8480 SEQ ID NO:1057 -14.2 -21 59.7 -6.8 0 -5.6
TTTCTTTCTCTGTGGATAAG 52 SEQ ID NO:1058 -14.1 -20.3 63.6 -6.2 0 -2.9
TTTTTTTTTTTTTTTTGACC 106 SEQ ID NO:1059 -14.1 -18.3 58.3 -4.2 0 -0.1
GTGTAGCTTCTTGCATACGA 427 SEQ ID NO:1060 -14.1 -24.1 71 -8.2 -1.8 -5.2
TCATCCTGCACATTTAATTA 448 SEQ ID NO: 1061 -14.1 -20.8 62.3 -6.7 0 -4.8
TTTTCATCCTGCACATTTAA 451 SEQ ID NO:1062 -14.1 -21.3 63.6 -7.2 0 -4.8
ACTGCAAACATTTATTCCTC 1290 SEQ ID NO: 1063 -14.1 -20.8 62.1 -6.7 0 -4.9
TTCGAGCATCTGCTGAAATT 1802 SEQ ID NO: 1064 -14.1 -21.7 63.5 -6.3 -1.2 -8.9
ACGCTGTCTTCAGATTCGGA 2047 SEQ ID NO:1065 -14.1 -25.1 71.8 -9.5 -1.4 -6.1
CCGTCTTCAAATGTGCTGTG 2263 SEQ ID NO: 1066 -14.1 -24.2 69 -10.1 0 -3.6
CCCATTTGCTGGAAGCCCTG 2378 SEQ ID NO:1067 -14.1 -29.4 77.4 -13.1 -2.2 -5.8
CGGAACACAATCAGGAAGGA 3265 SEQ ID NO:1068 -14.1 -21 60.4 -6.9 0 -2.9
TATCTTATTGCCTTCATGGA 3587 SEQ ID NO:1069 -14.1 -22.6 67.3 -7.9 -0.3 -4.7
CCATTCCCATCTCTAAGATA 3658 SEQ ID NO:1070 -14.1 -23.8 68.1 -9 -0.5 -3.9
AGGCTGGGGTTGTTTATGAA 3748 SEQ ID NO:1071 -14.1 -23.8 70.2 -9.7 0 -3.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TTCACCTTCTCGGGGTAGAA 3911 SEQ ID NO:1072 -14.1 -25.3 72.3 -9.7 -1.4 -5.4
GTTTAAAGTCTTCTTCGGGT 3945 SEQ ID NO: 1073 -14.1 -22.5 67.9 -8.4 0 -4.7
ACAATACTGTAGCAGGTTTT 4060 SEQ ID NO: 1074 -14.1 -21.1 64.3 -6.1 -0.7 -5.3
TTTCCAGAATGAATATATAG 4215 SEQ ID NO:1075 -14.1 -16.2 52.3 -2.1 0 -4.2
ATCAAAGTTTACTTTCACGT 4655 SEQ ID NO:1076 -14.1 -19.4 59.6 -3.9 -1.3 -7.1
TAAAGATGTCTTGACCTCCA 4905 SEQ ID NO: 1077 -14.1 -22.3 65.1 -7.4 -0.6 -6.8
AGAGCAGCGTGCGGATCCCC 5388 SEQ ID NO:1078 -14.1 -31.7 82.7 -15.4 -2.2 -11.1
AAGTTGGACATCCCAAAGAT 5482 SEQ ID NO: 1079 -14.1 -21.6 62.4 -5.3 -2.2 -5.8
AGGCAAAGTTGGACATCCCA 5487 SEQ ID NO:1080 -14.1 -25.4 70.8 -10.4 -0.8 -5.6
TTTCAAAGTGGTTGTAATAG 6140 SEQ ID NO: 1081 -14.1 -17.5 56 -2.7 -0.4 -3.8
CAATCCTCCCTTTAATTGCC 6261 SEQ ID NO: 1082 -14.1 -25.7 70.5 -11.6 0 -3.3
TCCCATTTAGTTTGTCAATA 6306 SEQ ID NO: 1083 -14.1 -21.7 65.1 -7.6 0 -2.9
CTCTGACCTCTTTTCCTTTG 6441 SEQ ID NO: 1084 -14.1 -25 73.1 -10.9 0 -2.4
ACTTCACTGTCTTGTATAGG 6603 SEQ ID NO:1085 -14.1 -21.8 67.6 -7.7 0 -2.4
ATCAGCTTTGCTGAGAGCAG 7338 SEQ ID NO:1086 -14.1 -24.4 72.6 -6.7 -3.6 -11.8
ACATAATGGACAGAGCAGGT 7654 SEQ ID NO:1087 -14.1 -22.1 65.4 -8 0 -4.1
GTAGGCAGTATCCAGTGTGT 7770 SEQ ID NO:1088 -14.1 -26.2 79.1 -11.6 -0.2 -4
TTTTTTTCCACCTTATATAA 9082 SEQ ID NO:1089 -14.1 -19.3 59.1 -5.2 0 -5
GAGACCTTTCCAGAATCCTC 24 SEQ ID NO: 1090 -14 -25.2 72 -11.2 0 -2.9
TTTTTTTTTTTTGACCACAG 102 SEQ ID NO: 1091 -14 -19.5 60.3 -5.5 0 -2.3
CTGTTCAGCTTTTTTTTTTT 120 SEQ ID NO: 1092 -14 -21 65.7 -7 0 -4.5
AGGGTTGCTCAAGGTCATAA
902 SEQ ID NO: 1093 -14 -23.3 69.2 -9.3 0 -3.6 GAGGGTTGCTCAAGGTCATA
903 SEQ ID NO: 1094 -14 -24.6 73.1 -9.3 -1.2 -4.1 CAGCACGTAATGTCAACTGG
1638 SEQ ID NO:1095 -14 -22.3 64.4 -8.3 0 -4.8
GGAACTCAACTTTGATGCTT 1931 SEQ ID NO: 1096 -14 -21.3 63.3 -7.3 0 -4.8
TGCTCTCTCTGTCTTCTTTT 1984 SEQ ID NO:1097 -14 -24.8 77.1 -10.8 0 -3.6
GTGTTCATCATCAGCAAAGT 2246 SEQ ID NO: 1098 -14 -22.1 67.1 -8.1 0 -4.1
CTGTGCATCTTCCCATTTGC 2389 SEQ ID NO:1099 -14 -27.1 77 -12.4 -0.4 -5.4
GAATCCTCCAGCATCTCCAT 2548 SEQ ID NO:1100 -14 -27.2 75.8 -13.2 0 -4.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GGAATCCTCCAGCATCTCCA 2549 SEQ ID NO: 1101 -14 -28.4 78.4 -13.2 -1.1 -6.5
GCTCACGGCTCTTTGCCTTC 2573 SEQ ID NO: 1102 -14 -29.4 82.4 -12.7 -2.7 -7.5
TTGACAGACCAAGCTCCATT
2979 SEQ ID NO: 1103 -14 -24.3 68.9 -10.3 0 -5 TTTGACAGACCAAGCTCCAT
2980 SEQ ID NO: 1104 -14 -24.3 68.9 -10.3 0 -5 ATTTGACAGACCAAGCTCCA
2981 SEQ ID NO: 1105 -14 -24.3 68.9 -10.3 0 -5 CATTTGACAGACCAAGCTCC
2982 SEQ ID NO: 1106 -14 -24.3 68.9 -10.3 0 -5 CAGTCTGAATGATCGCAGTA
3017 SEQ ID NO: 1107 -14 -22.3 66 -7.6 -0.4 -6.3
CACAAGGTTTCCAATGACCA 3374 SEQ ID NO: 1108 -14 -23.4 66.1 -8.5 -0.7 -5
GCAAGGTTGTCTGAGCTAAA 3430 SEQ ID NO:1109 -14 -22.4 66.4 -7.9 -0.1 -5.5
TTATTGCCTTCATGGATTTC 3583 SEQ ID NO: 1110 -14 -22.2 66.6 -7.6 -0.3 -4.7
AATGAAAGTCTCAAACCAGT 4088 SEQ ID NO: 1111 -14 -18.8 57 -4.2 -0.3 -3.4
GGTATGGGTTTCTGAGGTTT 4978 SEQ ID NO: 1112 -14 -24.4 74.1 -10.4 0 -2.8
CGAGGTATGGGTTTCTGAGG 4981 SEQ ID NO: 1113 -14 -24.4 71.3 -10.4 0 -2.8
TCATGTATTTGCCCTGGTCA 5115 SEQ ID NO: 1114 -14 -26.4 75.8 -12.4 0 -4.7
AGTGTCTGAGGGAAACGAGC 5199 SEQ ID NO: 1115 -14 -23.3 67.8 -9.3 3 -3.5
ATAAACATGACCAGGAAGAG 5455 SEQ ID NO: 1116 -14 -18.4 55.8 -4.4 0 -4.3
AGATAAACATGACCAGGAAG 5457 SEQ ID NO: 1117 -14 -18.4 55.8 -4.4 0 -5.2
GATGGCATAGATAAACATGA 5465 SEQ ID NO: 1118 -14 -18.4 56.4 -4.4 0 -5.2
TCGCATCGGGATCAAACTTT 5865 SEQ ID NO: 1119 -14 -22.9 64.7 -8.9 0 -6.9
GTAATAGGCTCATAAGAGAC 6127 SEQ ID NO: 1120 -14 -19.3 60 -3.9 -1.3 -4.7
TCAAAGTGGTTGTAATAGGC 6138 SEQ ID NO: 1121 -14 -20.3 62.1 -5.6 -0.4 -3.8
GGACCTCCTCTTGAAGTCCA 6543 SEQ ID NO: 1122 -14 -27.8 77.8 -11.4 -2.4 -6.5
CATGGACCTCCTCTTGAAGT 6546 SEQ ID NO: 1123 -14 -25.4 72.3 -11.4 0 -5.1
CTAAAGGTGTTTGGTGTAGT 6765 SEQ ID NO: 1124 -14 -21.5 66.1 -7.5 0 -2.2
GCTTTGCTGAGAGCAGAAGA 7334 SEQ ID NO: 1125 -14 -23.8 70 -6.7 -3.1 -8.6
CTATCAGCTTTGCTGAGAGC 7340 SEQ ID NO: 1126 -14 -24.3 72.5 -6.7 -3.6 -11.3
CAAGACTTGTGAAGAATGGA 7596 SEQ ID NO: 1127 -14 -18.6 56.9 -4.6 0.6 -4.1
CCCATTATCTAACTTTTATT 8017 SEQ ID NO: 1128 -14 -20 60.3 -6 0 -1.6
TTTGAGTGTTTGACCAATGT 8088 SEQ ID NO: 1129 -14 -21.4 64.4 -6.9 -0.2 -3.4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo ATATTTGTAATAGCTTTAGT 8233 SEQ ID NO:1130 -14 -17.6 57 -3.6 0 -4.6 TTTTCCACCTTATATAATTT
9079 SEQ ID NO:1131 -14 -19.2 58.8 -5.2 0 -5.3 TTTTTCCACCTTATATAATT
9080 SEQ ID NO:1132 -14 -19.2 58.8 -5.2 0 -5.3 TTTTTTCCACCTTATATAAT
9081 SEQ ID NO:1133 -14 -19.2 58.8 -5.2 0 -5.3 TTTTTTCTTTCTTTCTCTGT
59 SEQ ID NO: 1134 -13.9 -21.3 68.1 -7.4 0 0
TCAGCTTTTTTTTTTTTTTT
116 SEQ ID NO: 1135 -13.9 -19.2 61.4 -5.3 0 -4.5 TTCAGCTTTTTTTTTTTTTT
117 SEQ ID NO: 1136 -13.9 -19.2 61.4 -5.3 0 -4.5 GCTTCTTGCATACGAATTAC
422 SEQ ID NO: 1137 -13.9 -21.3 63 -6.5 -0.7 -5.1
CATCATTATCTTGTTCCTTT 585 SEQ ID NO:1138 -13.9 -21.8 66.5 -7.9 0 -1.9
TCTTATTGATATAGTAGGGA 714 SEQ ID NO:1139 -13.9 -19.1 60.6 -5.2 0 -2.7
GGAAAATTGCCTTTCCTTTA 753 SEQ ID NO:1140 -13.9 -21.9 63.3 -6 -2 -7.2
CTGCATCTGAGCCATTTCCA 1482 SEQ ID NO: 1141 -13.9 -27.1 76 -12.7 -0.1 -4.9
ACACTGGCCTGCATCTGAGC 1490 SEQ ID NO:1142 -13.9 -28.1 78.9 -14.2 0 -6.5
TTCTGGACACTGGCCTGCAT 1496 SEQ ID NO: 1143 -13.9 -27.6 77.2 -13.7 0 -7.2
ATCATGTATGTTTTCCCAGC 1657 SEQ ID NO: 1144 -13.9 -24.4 71.9 -10.5 0 -4.7
TAGGCCATGGCCACCACAGC 1732 SEQ ID NO: 1145 -13.9 -30.7 81.7 -12.2 -2.5 -17.4
ACTCCACTGAAATCTCTTGA 1876 SEQ ID NO: 1146 -13.9 -21.8 64.4 -7.9 0 -2.5
TGGAACTCAACTTTGATGCT 1932 SEQ ID NO:1147 -13.9 -21.2 62.8 -7.3 0 -5
TTTGCCCGACCTCTGAAACT 2206 SEQ ID NO:1148 -13.9 -26.1 70.1 -12.2 0 -3
CATCAGTAGCAGCAAGGTTG 3441 SEQ ID NO: 1149 -13.9 -23.5 70 -9.6 0 -5.4
TGGAAACACTCCCGCATCTT 3532 SEQ ID NO: 1150 -13.9 -25.5 69.4 -10.5 -1 -4.8
TCACAACCACCCTCATGCCT 4428 SEQ ID NO: 1151 -13.9 -29.1 76.9 -15.2 0 -4.4
CAAAGTTTACTTTCACGTTT 4653 SEQ ID NO: 1152 -13.9 -19.2 58.9 -3.9 -1.3 -8.7
AGGTATGGGTTTCTGAGGTT 4979 SEQ ID NO: 1153 -13.9 -24.3 74 -10.4 0 -2.8
GGGTCATGTATTTGCCCTGG 5118 SEQ ID NO:1154 -13.9 -27.7 78.2 -12.3 -1.4 -6.9
ATGACCAGGAAGAGCAGGAG 5449 SEQ ID NO:1155 -13.9 -23.5 67.9 -9.6 0 -4.1
GATCCAGGGCAGCTGCAAAA 5916 SEQ ID NO:1156 -13.9 -25.7 70.9 -8.9 -1 -14
TCGAAGGGCATCCATCTCTC 6065 SEQ ID NO:1157 -13.9 -26.1 74.2 -11.3 -0.8 -6.3
TAGGCTCATAAGAGACTTTG 6123 SEQ ID NO: 1158 -13.9 -20.2 62.1 -4.9 -1.3 -5.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo CCCATTTAGTTTGTCAATAA 6305 SEQ ID NO: 1159 -13.9 -20.6 61.5 -6.7 0 -2.9
ACTGTCTTGTATAGGCACTG 6598 SEQ ID NO: 1160 -13.9 -23.1 69.9 -8.5 -0.5 -4
TTAGATATATTTTTCTAGAA 7262 SEQ ID NO: 1161 -13.9 -15.1 51.1 -1.1 0 -7.4 TACAGGATACATCCCTGTTG
7502 SEQ ID NO: 1162 -13.9 -23.6 68.4 -6.7 -3 -8.4 ATACAGGATACATCCCTGTT
7503 SEQ ID NO:1163 -13.9 -23.6 68.5 -6.7 -3 -8.4 CTTGTGAAGAATGGATTGAG
7591 SEQ ID NO:1164 -13.9 -18.5 57.3 -4.6 0 -2.9
ACCAAGACTTGTGAAGAATG 7598 SEQ ID NO: 1165 -13.9 -19 57.4 -4.6 -0.2 -5.4
ACATTCTTTAACCAAGACTT 7608 SEQ ID NO: 1166 -13.9 -19.5 59.2 -4.6 -0.9 -3.4
CATTTATTCTTACAATATCC 343 SEQ ID NO:1167 -13.8 -18.1 56.9 -4.3 0 -2.6
GGGATCCAGGTCCTCCAGGG 698 SEQ ID NO:1168 -13.8 -31.3 86.2 -15.5 -2 -10.3
ATCGGAAAATTGCCTTTCCT 756 SEQ ID NO:1169 -13.8 -23.2 64.8 -6.9 -2.5 -7.5
GAGACATTGCCCAGGTCCAC 1090 SEQ ID NO:1170 -13.8 -28.4 78.4 -13.9 -0.5 -4.4
TGGACACTGGCCTGCATCTG 1493 SEQ ID NO: 1171 -13.8 -27.5 76.6 -13.7 0 -7.2
TCCTTCTGGACACTGGCCTG 1499 SEQ ID NO: 1172 -13.8 -28.4 79 -13.7 -0.8 -8.8
ACCCACCTACTCCACTGAAA 1884 SEQ ID NO:1173 -13.8 -26.2 70.3 -12.4 0 -1.7
ACAGGGAGCCACGGATACTC 2151 SEQ ID NO: 1174 -13.8 -26.4 73.5 -12 -0.3 -4.3
TGCTATTGCGTCTTGGGGAA 2172 SEQ ID NO:1175 -13.8 -25.2 71.5 -9.8 -1.5 -6.6
ATGCTTGTTTTGCTATTGCG 2182 SEQ ID NO:1176 -13.8 -23.4 68.3 -8 -1.5 -5.8
ATGTCTGTGCGGCACAAACA 2303 SEQ ID NO:1177 -13.8 -24.4 68.6 -8.6 0.6 -12.1
AACGTTACTGTTGCGTCGCT 2327 SEQ ID NO: 1178 -13.8 -25.4 70.5 -10.6 -0.9 -7.4
TCTCTTTGCTTTCTTCTAGT 3846 SEQ ID NO:1179 -13.8 -23.3 73.2 -9.5 0 -4
CAAACATGTTACCCGTTGTC 4572 SEQ ID NO:1180 -13.8 -23.1 65.6 -8.6 0 -9
CCAACATTATCAAAGTTTAC 4663 SEQ ID NO:1181 -13.8 -17.7 55 -3.9 0 -4.1
ATTTTCTTCATATACAGGCT 4775 SEQ ID NO:1182 -13.8 -21 64.7 -7.2 0 -3.7
TCCTTGGAATTTGTTTGCTG 5003 SEQ ID NO:1183 -13.8 -22.8 67.2 -9 0 -4.3
AGGGTCATGTATTTGCCCTG 5119 SEQ ID NO: 1184 -13.8 -26.5 75.9 -10.5 -2.2 -8.4
TTGATCAGACGTAGGATTCG 5359 SEQ ID NO:1185 -13.8 -21.4 63.3 -7.6 0 -6.6
GCGTGCGGATCCCCTTTGCT 5382 SEQ ID NO: 1186 -13.8 -32.4 83.6 -17.9 -0.4 -7.5
GCCAAAGGTCTCAAAGTTGA 5540 SEQ ID NO:1187 -13.8 -22.4 65.2 -8.6 0 -5.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TGTAATAGGCTCATAAGAGA 6128 SEQ ID NO:1188 -13.8 -19.1 59.3 -3.9 -1.3 -4.7
TACGTTTCAAAGTGGTTGTA 6144 SEQ ID NO: 1189 -13.8 -20.4 62.1 -5.9 -0.4 -5.6
AAGGTGTTTGGTGTAGTTAC 6762 SEQ ID NO: 1190 -13.8 -21.6 67.5 -7.8 0 -2.2
GGAGACTTTACAGGCACATA 7114 SEQ ID NO: 1191 -13.8 -22.6 67 -8.8 0 -4
GAGGAGACTTTACAGGCACA 7116 SEQ ID NO: 1192 -13.8 -23.5 69.2 -8.8 -0.7 -5.2
AGCTTTGCTGAGAGCAGAAG 7335 SEQ ID NO: 1193 -13.8 -23.2 68.9 -6.7 -2.7 -10.2
TATCAGCTTTGCTGAGAGCA 7339 SEQ ID NO: 1194 -13.8 -24.1 71.7 -6.7 -3.6 -11.8
GGCTATATATATATTTGCCC 7421 SEQ ID NO: 1195 -13.8 -22.4 65.7 -6.9 -0.9 -11.5
AAAAGGTTATATTGAGGCAA 8134 SEQ ID NO: 1196 -13.8 -17.5 54.6 -3.7 0 -4
TATATTTGTAATAGCTTTAG 8234 SEQ ID NO: 1197 -13.8 -16.1 53.3 -2.3 0 -4.6
CAATAAGTGAAATGCAATAA 8477 SEQ ID NO:1198 -13.8 -14.2 47.2 0 0 -5.6
AAGATGAGTTTAGATGCTTA 8788 SEQ ID NO: 1199 -13.8 -18.7 59 -4.9 0 -3.6
GGTTAGGGTATAACGTGTCT 151 SEQ ID NO:1200 -13.7 -23.2 69.2 -7.5 -2 -5.3
TTAATTACGTGTAGCTTCTT
435 SEQ ID NO: 1201 -13.7 -20.2 62 -6.5 0 -5 TTTAATTACGTGTAGCTTCT
436 SEQ ID NO: 1202 -13.7 -20.2 62 -6.5 0 -5 GTTCCTTTTTGGGCTTCTTG
573 SEQ ID NO: 1203 -13.7 -25.6 75.8 -11.4 -0.2 -3.8
ATGGATCACGAAGAAACGTA 1020 SEQ ID NO: 1204 -13.7 -18.9 56 -4.3 -0.8 -6
AACGCTGAGACATTGCCCAG 1096 SEQ ID NO:1205 -13.7 -25.7 69.9 -12 0 -4.1
TGCAAACATTTATTCCTCAG 1288 SEQ ID NO:1206 -13.7 -20.4 61.1 -6.7 0 -4.7
ACATTAACAAATGTCCCATT 1375 SEQ ID NO: 1207 -13.7 -19.9 58.6 -4.9 -1.2 -6
CAATAGTCTTGAGTCATGAG 1606 SEQ ID NO: 1208 -13.7 -19.8 61.9 -6.1 0 -7.4
TCCCAATAGTCTTGAGTCAT 1609 SEQ ID NO:1209 -13.7 -23.6 69.8 -9.4 -0.2 -5.8
GATGCTTCTGAAGAACTTTC 1918 SEQ ID NO: 1210 -13.7 -20.2 61.9 -6 0 -8.3
GATGAGGGGAGCAGAATTTT 2121 SEQ ID NO: 1211 -13.7 -22.1 65.5 -8.4 0 -4.1
CTCCTGCTTTCGCCGTCTTC 2275 SEQ ID NO: 1212 -13.7 -29.9 82.1 -16.2 0.2 -3.6
TGCCCTCTGGGGGAAGTTGT 2475 SEQ ID NO: 1213 -13.7 -29.2 81.1 -13.3 -2.2 -8.7
CCTCCAGCATCTCCATTGAA 2544 SEQ ID NO: 1214 -13.7 -26.9 74.4 -13.2 0 -4.1
GCCTTCATGGATTTCTATAA 3578 SEQ ID NO: 1215 -13.7 -21.9 65.2 -7.6 -0.3 -4.4
TCAATTCCAGTATTATTGGA 3619 SEQ ID NO:1216 -13.7 -20.2 61.7 -5.5 -0.9 -6.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GCTGGGGTTGTTTATGAATG 3746 SEQ ID NO:1217 -13.7 -22.6 67.1 -8.9 0 -2.8
TACACCCTTCAGTAAAACAA 3972 SEQ ID NO: 1218 -13.7 -19.9 58.5 -6.2 0 -3.1
AATACTGTAGCAGGTTTTTC 4058 SEQ ID NO: 1219 -13.7 -20.7 64.4 -6.1 -0.7 -5.3
CAAGAAATCTAGCCAGCACC 4286 SEQ ID NO: 1220 -13.7 -23.4 66 -9.7 0 -4.6
GTTTTTCCACCGAGCTTGCT 4637 SEQ ID NO: 1221 -13.7 -27.8 77.4 -14.1 0 -5.9 AAGATGTCTTGACCTCCAAA
4903 SEQ ID NO: 1222 -13.7 -21.9 63.6 -7.4 -0.6 -5.9 AAAGATGTCTTGACCTCCAA
4904 SEQ ID NO: 1223 -13.7 -21.9 63.6 -7.4 -0.6 -6.8 TTTTTTCTGTTCCTCTGTCA
4925 SEQ ID NO: 1224 -13.7 -24 73.6 -10.3 0 -1.7
AAAGCAAAGAGCAGCGTGCG 5395 SEQ ID NO: 1225 -13.7 -23.2 64.2 -7.3 -2.2 -8.5
TAGATAAACATGACCAGGAA 5458 SEQ ID NO: 1226 -13.7 -18.1 55.2 -4.4 0 -5.2
CAGCCAGCAGAGGTTGTAAT 5584 SEQ ID NO:1227 -13.7 -25 72.3 -10.7 -0.3 -4.7
GGGTCGCATCGGGATCAAAC 5868 SEQ ID NO: 1228 -13.7 -25.4 70 -11.7 0 -6.9
AGGGCAGCTGCAAAATCAGA 5911 SEQ ID NO:1229 -13.7 -23.7 67.7 -7.1 -0.7 -14
TTGTAATAGGCTCATAAGAG 6129 SEQ ID NO: 1230 -13.7 -18.6 58.3 -3.9 -0.9 -4.4
TGGACCTCCTCTTGAAGTCC 6544 SEQ ID NO: 1231 -13.7 -27.1 76.5 -11.4 -2 -5.7
CTGCTTCACAGAGTTGCAGT 6635 SEQ ID NO: 1232 -13.7 -25.3 75.4 - 9 . 9 -1.7 -6.6
GGAAGTTAAAAATAGAATGG 6799 SEQ ID NO:1233 -13.7 -14.1 47.4 0 0 -2.6
TTTTTCTAGAATGGATTTAT 7253 SEQ ID NO: 1234 -13.7 -17 55.1 -2.8 0 -7.7
ATACTTTAGATATATTTTTC 7267 SEQ ID NO: 1235 -13.7 -15.5 52.4 -1.8 0 -4.3
GATACATCCCTGTTGGAAGC 7497 SEQ ID NO: 1236 -13.7 -24.7 70.5 -9.9 -1 -5.4
CATTCTTTAACCAAGACTTG 7607 SEQ ID NO: 1237 -13.7 -19.3 58.6 -4.6 -0.9 -5.3
AACTTTGCCACTTTGTTCAT 8278 SEQ ID NO:1238 -13.7 -22.8 67.1 -9.1 0 -3.1
AGCTGCTTTTAATTTGCCTT 8653 SEQ ID NO: 1239 -13.7 -23.7 69.2 -10 0 -6.7
AGGTGGTTACTACTATTATT 8732 SEQ ID NO: 1240 -13.7 -20.1 63 -5.9 -0.1 -3.9
TCTTTCTCTGTGGATAAGAA 50 SEQ ID NO:1241 -13.6 -20 62.1 -5.7 -0.5 -3.8
TTTCTTTCTTTCTCTGTGGA 56 SEQ ID NO:1242 -13.6 -22.8 71.1 -9.2 0 -2.2
TAATTACGTGTAGCTTCTTG 434 SEQ ID NO: 1243 -13.6 -20.1 61.6 -6.5 0 -4.7
TGTGCCATCTTTTCATCCTG 460 SEQ ID NO: 1244 -13.6 -25.7 74.3 -12.1 0 -3
GGTTTGTTCTCATCATCATT 598 SEQ ID NO:1245 -13.6 -22.6 69.9 -9 0 -1.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
TTGGTTTGTTCTCATCATCA
600 SEQ ID NO: 1246 -13.6 -22.6 69.7 -9 0 -1.9 CATTAACAAATGTCCCATTT
1374 SEQ ID NO: 1247 -13.6 -19.8 58.5 -4.9 -1.2 -5.5 GTTACATTAACAAATGTCCC
1378 SEQ ID NO: 1248 -13.6 -20.1 59.8 -4.9 -1.5 -6.6 GCTGTGTTCATCATCAGCAA
2249 SEQ ID NO: 1249 -13.6 -24.3 72.2 -7.2 -3.5 -8.5 GCCGTCTTCAAATGTGCTGT
2264 SEQ ID NO: 1250 -13.6 -26 73.3 -12.4 0 -3.6 ATGCTCACGGCTCTTTGCCT
2575 SEQ ID NO: 1251 -13.6 -28.9 79.9 -12.6 -2.7 -8.3 CCATGCATCACAGCAGTCCC
2690 SEQ ID NO: 1252 -13.6 -29.3 80.3 -14.4 -1.2 -7.5 AGTCTGAATGATCGCAGTAC
3016 SEQ ID NO: 1253 -13.6 -21.8 65.3 -7.6 -0.3 -6.3 AGACGATGATGGCCAACACC
3132 SEQ ID NO: 1254 -13.6 -24.9 67.8 -11.3 0 -6.3 GCCAGCGACCTCCATACAGT
3320 SEQ ID NO: 1255 -13.6 -29.7 79.6 -16.1 0 -4.1 GGCCAGCGACCTCCATACAG
3321 SEQ ID NO: 1256 -13.6 -29.7 78.7 -16.1 0 -7 CACCAGATCTTCCCTTTGCC
4030 SEQ ID NO: 1257 -13.6 -28.9 78.9 -15.3 0 -5.8 CACAACCACCCTCATGCCTT
4427 SEQ ID NO: 1258 -13.6 -28.8 75.7 -15.2 0 -4.4 TTTTTCTGTTCCTCTGTCAT
4924 SEQ ID NO: 1259 -13.6 -23.9 73.2 -10.3 0 -1.8 AGGGAAACGAGCTTCAGCAC
5191 SEQ ID NO: 1260 -13.6 -23.8 67.7 -9.3 -0.7 -6.6 TCAAAGCAAAGAGCAGCGTG
5397 SEQ ID NO: 1261 -13.6 -21.7 62.4 -7.2 -0.8 -5.4 ATGGCATAGATAAACATGAC
5464 SEQ ID NO: 1262 -13.6 -18 55.6 -4.4 0 -5.2 GCCAGCAGAGGTTGTAATTT
5582 SEQ ID NO: 1263 -13.6 -24.5 71.6 -10.9 0 -5.7 TCCCAGCCAGCAGAGGTTGT
5587 SEQ ID NO: 1264 -13.6 -30.4 84.6 -15.9 -0.8 -5.2 TCTTGTTTACGTTTCAAAGT
6151 SEQ ID NO: 1265 -13.6 -19.8 61.1 -6.2 0 -4.8 CACTTCACTGTCTTGTATAG
6604 SEQ ID NO: 1266 -13.6 -21.3 66 -7.7 0 -2.6 GTTCTTGTATACTGTTTCTT
6927 SEQ ID NO: 1267 -13.6 -21.2 67.3 -7.6 0 -6.3 AGGAGACTTTACAGGCACAT
7115 SEQ ID NO: 1268 -13.6 -22.9 67.8 -8.8 -0.2 -4.3 AGATATATTTTTCTAGAATG
7260 SEQ ID NO: 1269 -13.6 -15.3 51.4 -1.1 0 -7.7 CTTTAGATATATTTTTCTAG
7264 SEQ ID NO: 1270 -13.6 -16.2 54 -2.6 0 -4.3 ATAGGGTATTTAATTGACAT
7363 SEQ ID NO: 1271 -13.6 -17.8 56.3 -4.2 0 -2.9 GCTATATATATATTTGCCCA
7420 SEQ ID NO: 1272 -13.6 -21.9 64.4 -7.8 0 -7.9 ACTTGTGAAGAATGGATTGA
7592 SEQ ID NO: 1273 -13.6 -18.7 57.6 -4.6 -0.2 -3.1 GACTTGTGAAGAATGGATTG
7593 SEQ ID NO: 1274 -13.6 -18.7 57.6 -4.6 -0.2 -3.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo AGACTTGTGAAGAATGGATT 7594 SEQ ID NO:1275 -13.6 -18.7 57.8 -4.6 -0.2 -3.1
AGTAGGCAGTATCCAGTGTG 7771 SEQ ID NO:1276 -13.6 -25 75.5 -10.9 -0.2 -3.7
ACTGCTTGGTGAATCATGCA 8622 SEQ ID NO: 1277 -13.6 -23.8 69.2 -8.3 -1.9 -6.4
TTTCCACCTTATATAATTTA 9078 SEQ ID NO: 1278 -13.6 -18.8 57.9 -5.2 0 -5.3 TTCTTTCTTTCTCTGTGGAT 55 SEQ ID NO:1279 -13.5 -22.7 70.7 -9.2 0 -2.3
TGGTTTGTTCTCATCATCAT 599 SEQ ID NO: 1280 -13.5 -22.5 69.3 -9 0 -1.8
TTGGCTTTGGTTTGTTCTCA 606 SEQ ID NO: 1281 -13.5 -24.5 74.1 -11 0 -3.7
ATAAGTGACTCAAAGGTATA 964 SEQ ID NO:1282 -13.5 -17.4 55.3 -3.9 0 -3.3
ATCCAGCCAGTTCCATGGAT 1034 SEQ ID NO: 1283 -13.5 -27.8 77.5 -12.6 -1.7 -10
CTGAGCCATTTCCACAGAGT 1476 SEQ ID NO: 1284 -13.5 -26 74.2 -12.5 0 -3.5
ACAGATGTATCCTTCTGGAC 1508 SEQ ID NO: 1285 -13.5 -23.1 69 -8 -1.6 -7.2
GTGGCCTGATTCTGCTCCTC 1753 SEQ ID NO:1286 -13.5 -29.5 84.1 -15.4 -0.3 -7.2
CCATTTGCTGGAAGCCCTGG 2377 SEQ ID NO: 1287 -13.5 -28.6 76.5 -12.9 -2.2 -8.6
AATCCTCCAGCATCTCCATT 2547 SEQ ID NO: 1288 -13.5 -26.7 74.8 -13.2 0 -4.1
TTTTTGGAAACACTCCCGCA 3536 SEQ ID NO:1289 -13.5 -24.5 67.2 -10.2 -0.6 -4.8
CTTCATGGATTTCTATAACT 3576 SEQ ID NO: 1290 -13.5 -19.2 59.7 -5.7 0 -5
CCCATCTCTAAGATAATTAA 3653 SEQ ID NO: 1291 -13.5 -19 57.4 -4.8 -0.5 -4.9
GGTTCCATTCCCATCTCTAA 3662 SEQ ID NO: 1292 -13.5 -26.4 75 -12.9 0 -3.5 TTTTGATAGTCTTTCGCTGT
4164 SEQ ID NO: 1293 -13.5 -22.4 68.1 -8.9 0 -3.4 GTTTTGATAGTCTTTCGCTG
4165 SEQ ID NO:1294 -13.5 -22.4 68.1 -8.9 0 -3.1 TGGTTTTGATAGTCTTTCGC
4167 SEQ ID NO: 1295 -13.5 -22.7 68.8 -9.2 0 -2.9
AAAGTTTACTTTCACGTTTT 4652 SEQ ID NO: 1296 -13.5 -18.6 58 -3.9 -1.1 -8.6
GATTTTCTTCATATACAGGC 4776 SEQ ID NO: 1297 -13.5 -20.7 64.1 -7.2 0 -2.8
TTGACCTCCAAACTTCTTTT 4895 SEQ ID NO: 1298 -13.5 -22.3 65 -8.8 0 -2.6
TAGGGTCATGTATTTGCCCT 5120 SEQ ID NO: 1299 -13.5 -26.2 75.5 -10.5 -2.2 -8.5
ACGTAGGATTCGGCCAATCC 5351 SEQ ID NO: 1300 -13.5 -26.4 71.7 -10.5 -1.7 -12.8
GCAAAGAGCAGCGTGCGGAT 5392 SEQ ID NO:1301 -13.5 -26.4 . 71.5 -10.7 -2.2 -8.5
CATCCCAAAGATGGCATAGA 5474 SEQ ID NO:1302 -13.5 -23 65 -8 -1.4 -6.9
AGCCAGCAGAGGTTGTAATT 5583 SEQ ID NO:1303 -13.5 -24.4 71.5 -10.9 0 -4.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TAACTGAGCTGCCAGGGTGA 5664 SEQ ID NO: 1304 -13.5 -26.1 73.8 -11.7 -0.6 -9.3
CACGGTCTCCCTTAACTGAG 5676 SEQ ID NO: 1305 -13.5 -25.5 71.2 -11.4 -0.3 -3.8
TCGGGATCAAACTTTTCCCA 5860 SEQ ID NO: 1306 -13.5 -24.4 67.8 -8.3 -2.6 -7.9
TCCTCTTGTTTACGTTTCAA 6154 SEQ ID NO: 1307 -13.5 -22.6 67.2 -9.1 0 -4.8
GTGTAGTTACAATGTTCACT 6752 SEQ ID NO:1308 -13.5 -20.8 64.7 -6.8 -0.2 -5.4
CAGATATGGAAGTTAAAAAT 6806 SEQ ID NO: 1309 -13.5 -14.3 47.8 0 -0.6 -4.9
AGAGACAGGGTTCTTGTATA 6936 SEQ ID NO: 1310 -13.5 -21.8 67.4 -7.6 -0.4 -4.5
GACTATCAGCTTTGCTGAGA 7342 SEQ ID NO: 1311 -13.5 -23.3 69.7 -6.7 -3.1 -10.3
CTTTAACCAAGACTTGTGAA 7603 SEQ ID NO: 1312 -13.5 -19.2 58 -5.7 0 -4.9
CCATTATCTAACTTTTATTT 8016 SEQ ID NO: 1313 -13.5 -18.1 56.9 -4.6 0 -1.6
ATAAAAGGTTATATTGAGGC 8136 SEQ ID NO: 1314 -13.5 -17.2 54.6 -3.7 0 -2.8
TTTGTAATAGCTTTAGTGCA 8230 SEQ ID NO: 1315 -13.5 -20.4 63.2 -6 -0.8 -5.2
CCCCAGAGCCCAATAAGTGA 8487 SEQ ID NO: 1316 -13.5 -27.9 73.6 -14.4 0 -3.3
AATCATGCACTAGTTTGTTG 8611 SEQ ID NO: 1317 -13.5 -20.4 62.7 -6.9 0 -5.7
TTGGTGAATCATGCACTAGT 8617 SEQ ID NO:1318 -13.5 -22 66 -7.3 -1.1 -6.2
TCCACCTTATATAATTTATT
9076 SEQ ID NO:1319 -13.5 -18.7 57.6 -5.2 0 -5.3 TTCCACCTTATATAATTTAT
9077 SEQ ID NO:1320 -13.5 -18.7 57.6 -5.2 0 -5.3 TATCTCATCCCTGTCAAACC
264 SEQ ID NO: 1321 -13.4 -24.5 69.7 -11.1 0 -2
TACGTGTAGCTTCTTGCATA 430 SEQ ID NO: 1322 -13.4 -23.2 69 -8.2 -1.5 -7.6
CTGCAGCACGTTTTTCGATA 543 SEQ ID NO: 1323 -13.4 -24 68.4 -9.6 -0.9 -8.7
GGATCCAGGTCCTCCAGGGG 697 SEQ ID NO: 1324 -13.4 -31.3 86.2 -16.5 -1.2 -9.7
TTCTTATTGATATAGTAGGG 715 SEQ ID NO:1325 -13.4 -18.6 59.5 -5.2 0 -2.7
TTGTTTTCAGTGCTCGGAGA 1131 SEQ ID NO: 1326 -13.4 -24.2 72 -10.3 -0.1 -6.4
AATCGCTTGGGGGCCACTGC 1305 SEQ ID NO: 1327 -13.4 -29.5 79 -15.2 -0.8 -6.8
GCAGCACGTAATGTCAACTG 1639 SEQ ID NO: 1328 -13.4 -22.9 65.9 -9.5 0 -4.9
TGTTGCTTTTTAAGCTGTTC 1819 SEQ ID NO: 1329 -13.4 -21.8 67.2 -5.8 -2.6 -7.1
TTCTTCCTGTTGCTTTTTAA 1826 SEQ ID NO: 1330 -13.4 -22.2 67.2 -8.8 0 -3.6
TGCCTGAGCTTCTTCCTGTT 1835 SEQ ID NO: 1331 -13.4 -28.1 80.7 -13.5 -1.1 -5.2
ACTCAACTTTGATGCTTCTG 1928 SEQ ID NO: 1332 -13.4 -21.5 64.8 -8.1 0 -5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TGTCTGTGCGGCACAAACAG 2302 SEQ ID NO: 1333 -13.4 -24.4 68.8 -8.6 -1.1 -12.9
CTAACGTTACTGTTGCGTCG 2329 SEQ ID NO: 1334 -13.4 -23.3 65.9 -8.9 -0.9 -7.8
TGTGCATCTTCCCATTTGCT 2388 SEQ ID NO:1335 -13.4 -27.1 77 -12.4 -1.2 -5.4
GAGTGGAAGAAGTCGTTCAT 3247 SEQ ID NO:1336 -13.4 -21.6 64.8 -6.9 -1.2 -4.1
AACTTTTGGCTTTCTAAAAA 3560 SEQ ID NO: 1337 -13.4 -17 53.5 -2.8 -0.6 -4.3
GGTTTAAAGTCTTCTTCGGG 3946 SEQ ID NO: 1338 -13.4 -22.5 67.2 -8.4 -0.5 -4.7
AATGCACCACTACTGAGAAG 4120 SEQ ID NO:1339 -13.4 -21.1 61.8 -7 -0.4 -6.3 TCAGCATATTCTAGCATGGT
4183 SEQ ID NO:1340 -13.4 -23.3 70.2 -8.9 -0.9 -5 GTCAGCATATTCTAGCATGG
4184 SEQ ID NO: 1341 -13.4 -23.3 70.2 -8.9 -0.9 -5 CTGAAGTTTAACATCTCGTG
4757 SEQ ID NO: 1342 -13.4 -19.8 60.2 -6.4 0 -3.5
GAGGGAAACGAGCTTCAGCA 5192 SEQ ID NO: 1343 -13.4 -24.2 68.4 -9.9 -0.7 -6.6
AGATGGCATAGATAAACATG 5466 SEQ ID NO: 1344 -13.4 -17.8 55.3 -4.4 0 -4.7
C7AAAGTGGTTGTAATAGGCT 6137 SEQ ID NO:1345 -13.4 -20.8 62.6 -7.4 0 -3.7
ACACCTCCTCTTGTTTACGT 6159 SEQ ID NO:1346 -13.4 -26 74 -12.6 0 -4.6
TTGACACATATACTTTACCT 6522 SEQ ID NO:1347 -13.4 -20 60.6 -6.6 0 -2.4
CCTATAGTCTAGGTAGCCAT 6719 SEQ ID NO: 1348 -13.4 -25.1 73.8 -10.8 -0.8 -5.4
ATCCCTATAGTCTAGGTAGC 6722 SEQ ID NO: 1349 -13.4 -24.8 74.4 -10 -1.3 -5.2
ATCCTTTAAATATTAGAGGA 7131 SEQ ID NO: 1350 -13.4 -17.7 55.7 -2.2 -2.1 -8
CATAGGCAATATTAACATGC 7558 SEQ ID NO: 1351 -13.4 -18.9 57.5 -5 -0.1 -5
CATAATGGACAGAGCAGGTT 7653 SEQ ID NO:1352 -13.4 -22 65.2 -8.6 0 -4.1
CATAGTTGGTAGAAAATGAT 8113 SEQ ID NO: 1353 -13.4 -16.9 53.8 -3.5 0 -2.5
AGAGCCCAATAAGTGAAATG 8483 SEQ ID NO:1354 -13.4 -19.8 58.3 -6.4 0 -3.3
CCTTTGTTCTGTAGTACTGC 8637 SEQ ID NO:1355 -13.4 -24.4 73.7 -11 0 -6.8
GTTAGGGTATAACGTGTCTT 150 SEQ ID NO: 1356 -13.3 -22.1 66.9 -7.5 -1.2 -5.3
TTCTCTAGTAAAAAGGCGGA 512 SEQ ID NO:1357 -13.3 -20.1 60 -6.8 0 -4
TCAGGAGGGTTGCTCAAGGT 907 SEQ ID NO:1358 -13.3 -26.1 76.9 -10.8 -2 -5.7
AAGCAAAACCCTCTTGCCAA 991 SEQ ID NO:1359 -13.3 -24 65.2 -8.7 -2 -6.2
ATTGTTTTCAGTGCTCGGAG 1132 SEQ ID NO:1360 -13.3 -23.6 70.5 -10.3 0 -5.9
ATCCTTCTGGACACTGGCCT 1500 SEQ ID NO:1361 -13.3 -28.4 79.2 -13.7 -1.3 -9.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Positioni oligo binding formation Duplex structure oligo oligo GTCTTGAGTCATGAGTCGAA
1601 SEQ ID NO: 1362 -13.3 -22.4 67.7 -7.6 0 -10.9 TTTTTAAGCTGTTCGAGCAT
1813 SEQ ID NO: 1363 -13.3 -21.7 64.8 -6.1 -2.3 -7.3 CTTCTTCCTGTTGCTTTTTA
1827 SEQ ID NO: 1364 -13.3 -23.8 71.7 -10.5 0 -3.6 CTGATGCTGCCGCAACTGCC
1851 SEQ ID NO: 1365 -13.3 -29.5 77.4 -14.6 -1.6 -8 TGATGCTTCTGAAGAACTTT
1919 SEQ ID NO:1366 -13.3 -19.8 60.4 -6 0 -7.6 TTGATGCTTCTGAAGAACTT
1920 SEQ ID NO: 1367 -13.3 -19.8 60.4 -6 0 -8.3 TTTGATGCTTCTGAAGAACT
1921 SEQ ID NO: 1368 -13.3 -19.8 60.4 -6 0 -8.3 TGAGGGGAGCAGAATTTTTT
2119 SEQ ID NO: 1369 -13.3 -21.7 64.9 -8.4 0 -4.1 GCTCAGTCATGGGGTAGTGC
2811 SEQ ID NO:1370 -13.3 -27.6 82.4 -14.3 0 -4.7 ATCCCAGTAAAGACCAGGTT
2857 SEQ ID NO: 1371 -13.3 -24.6 69.6 -11.3 0 -5.9 GAACACAATCAGGAAGGAGT
3263 SEQ ID NO: 1372 -13.3 -20.2 60.5 -6.9 0 -2.9 GGAACACAATCAGGAAGGAG
3264 SEQ ID NO: 1373 -13.3 -20.2 60 -6.9 0 -2.9 CGTTTTTCCACCGAGCTTGC
4638 SEQ ID NO: 1374 -13.3 -27.7 75.2 -14.4 0 -5.5 CACGTTTTTCCACCGAGCTT
4640 SEQ ID NO: 1375 -13.3 -26.8 72.9 -13.5 0 -5.2 ATGAGGATCATGATGCTGAT
5059 SEQ ID NO: 1376 -13.3 -21.4 64.1 -6.5 -1.5 -8.5 GAAGAGCAGGAGGCCGATGT
5441 SEQ ID NO: 1377 -13.3 -26.4 73.4 -12.5 -0.3 -7.7 CCCAACAGATGGGTCCCCAC
5693 SEQ ID NO: 1378 -13.3 -30.4 78.9 -14.5 -2.6 -8.8 TTCGAAGGGCATCCATCTCT
6066 SEQ ID NO: 1379 -13.3 -25.8 73 -11.3 -1.1 -7.9 CACCTCCTCTTGTTTACGTT
6158 SEQ ID NO: 1380 -13.3 -25.9 73.8 -12.6 0 -4.8 GTTTTATAGGTAAGTCAATC
6276 SEQ ID NO: 1381 -13.3 -18.3 59 -5 0 -2.3 TAGATATATTTTTCTAGAAT
7261 SEQ ID NO: 1382 -13.3 -15 50.8 -1.1 0 -7.7 GCATAGGCAATATTAACATG
7559 SEQ ID NO: 1383 -13.3 -18.9 57.5 -4.7 -0.8 -6.3 GACAGAGCAGGTTGAATTCA
7646 SEQ ID NO: 1384 -13.3 -22.2 66.4 -8.4 0 -8.1 TTGACATAATGGACAGAGCA
7657 SEQ ID NO: 1385 -13.3 -20.4 61.1 -7.1 0 -4.1 GAGGCAACCATAGTTGGTAG
8121 SEQ ID NO: 1386 -13.3 -23.6 69.1 -7.9 -2.4 -8.7 GCTCACCATTCTTTTTAGCA
8420 SEQ ID NO: 1387 -13.3 -24.7 72.6 -10.7 -0.4 -4.1 AAAGTTGGAACATGTGAACT
8702 SEQ ID NO: 1388 -13.3 -18.1 55.7 -4.1 -0.3 -8.3 GGTTACTACTATTATTATCA
8728 SEQ ID NO: 1389 -13.3 -18.5 59 -5.2 0 -2.3 ATTGAAAGAAGATGAGTTTA
8796 SEQ ID NO: 1390 -13.3 -15.5 51 -2.2 0 -2.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TCTGCTTATGCCTCCGCTTC 4 SEQ ID NO:1391 -13.2 -28.9 80.3 -14.8 -0.8 -5
TAGGGTATAACGTGTCTTCC 148 SEQ ID NO:1392 -13.2 -23.2 68.6 -10 0 -5.3
GAATTATCTCATTTATTCTT 352 SEQ ID NO:1393 -13.2 -17.5 56.6 -4.3 0 -4.1
ACATTTAATTACGTGTAGCT 439 SEQ ID NO:1394 -13.2 -19.7 60.1 -6.5 0 -5
TTTCGACCAGCCTTCACACA 1525 SEQ ID NO: 1395 -13.2 -26.6 73.3 -13.4 0 -4.6
CAGCAGCACGTAATGTCAAC 1641 SEQ ID NO:1396 -13.2 -22.7 65.5 -9.5 0 -5.4
GATGCTGCCGCAACTGCCTG 1849 SEQ ID NO:1397 -13.2 -29.5 77.4 -14.7 -1.6 -8
AACTCAACTTTGATGCTTCT 1929 SEQ ID NO: 1398 -13.2 -20.8 62.8 -7.6 0 -5
ATGAGGGGAGCAGAATTTTT 2120 SEQ ID NO:1399 -13.2 -21.6 64.6 -8.4 0 -4.1
TCTGTGCGGCACAAACAGTG 2300 SEQ ID NO:1400 -13.2 -24.4 68.8 -8.6 -1.4 -13.2
TGTTGCGTCGCTCTCCATGT 2319 SEQ ID NO: 1401 -13.2 -28.6 79.8 -14.8 -0.3 -6.9
GTGCTGTGCATCTTCCCATT 2392 SEQ ID NO: 1402 -13.2 -28.2 80.2 -13.9 -1 -5.5
TATGCTCACGGCTCTTTGCC 2576 SEQ ID NO:1403 -13.2 -27.7 77.4 -12.6 -1.9 -7.4
GGCCATAAAGAGGGTATTTA
2786 SEQ ID NO:1404 -13.2 -21.8 64.2 -8.6 0 -7 TGGCCATAAAGAGGGTATTT
2787 SEQ ID NO: 1405 -13.2 -22.1 64.6 -8.4 0 -8.3 GCAGTACAGACAATCCCTCC
3003 SEQ ID NO:1406 -13.2 -26.8 74.9 -12.9 -0.4 -5.3
CTGAATGATCGCAGTACAGA 3013 SEQ ID NO: 1407 -13.2 -21.5 63.2 -7.6 -0.4 -5.7
AACACCAAGGTGAGGTTTCC 3118 SEQ ID NO: 1408 -13.2 -24.4 69.7 -10.1 -0.8 -9.6
GAAGGAGTGGAAGAAGTCGT 3251 SEQ ID NO: 1409 -13.2 -21.5 63.8 -7.8 -0.2 -3
AATTCCAGTATTATTGGACA 3617 SEQ ID NO: 1410 -13.2 -20 60.8 -5.3 -1.4 -7.2
TTTTCTGTTCCTCTGTCATA 4923 SEQ ID NO:1411 -13.2 -23.5 72.1 -10.3 0 -1.8
GTATGGGTTTCTGAGGTTTC 4977 SEQ ID NO:1412 -13.2 -23.6 73 -10.4 0 -2.8
GCGAGGTATGGGTTTCTGAG 4982 SEQ ID NO: 1413 -13.2 -25 73.1 -11.8 0 -3.4
GGAATTTGTTTGCTGGGCGA 4998 SEQ ID NO:1414 -13.2 -25 70.6 -11 -0.6 -4.9
TGTCTGAGGGAAACGAGCTT 5197 SEQ ID NO:1415 -13.2 -23.1 66.6 -9.9 0 -5.7
TTTTACTTTTGATTTTCTCT 6457 SEQ ID NO:1416 -13.2 -18.9 60.6 -5.7 0 -2.2
AATCCTTTAAATATTAGAGG 7132 SEQ ID NO: 1417 -13.2 -16.4 52.7 -2.2 -0.9 -5.6
TGACATAATGGACAGAGCAG 7656 SEQ ID NO:1418 -13.2 -20.3 60.9 -7.1 0 -4.1
CATTTAATTACGTGTAGCTT 438 SEQ ID NO:1419 -13.1 -19.6 59.9 -6.5 0 -5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TCCTGCACATTTAATTACGT 445 SEQ ID NO: 1420 -13.1 -21.9 63.7 -8.8 0 -4.8
CATCCTGCACATTTAATTAC 447 SEQ ID NO: 1421 -13.1 -20.6 61.5 -7.5 0 -4.6
TTTGGCTTTGGTTTGTTCTC 607 SEQ ID NO: 1422 -13.1 -23.9 73.3 -10.8 0 -3.7
TCAAAAGCAGAATCGCTTGG 1315 SEQ ID NO: 1423 -13.1 -20.6 60 -5.7 -1.8 -9.3
TTACATTAACAAATGTCCCA 1377 SEQ ID NO: 1424 -13.1 -19.6 58.1 -4.9 -1.5 -6.6
AATATCATGTATGTTTTCCC 1660 SEQ ID NO: 1425 -13.1 -20.9 63.2 -7.8 0 -4.5
TGCTTCTGAAGAACTTTCCA 1916 SEQ ID NO: 1426 -13.1 -22.3 65.6 -8.5 -0.4 -8.3
GACTAACGTTACTGTTGCGT 2331 SEQ ID NO:1427 -13.1 -22.9 66.1 -9.3 -0.2 -7.8
AGTGCTGTGCATCTTCCCAT 2393 SEQ ID NO: 1428 -13.1 -28.1 80.2 -13.9 -1 -5.5
ACACTCCCGCATCTTATTTT 3527 SEQ ID NO: 1429 -13.1 -25.1 70.7 -12 0 -3.6
GGGTTGTTTATGAATGACAT 3742 SEQ ID NO: 1430 -13.1 -20.2 61.5 -6.3 -0.6 -5.4
CAGCATATTCTAGCATGGTT 4182 SEQ ID NO: 1431 -13.1 -23 68.9 -8.9 -0.9 -5
TCACGTTTTTCCACCGAGCT 4641 SEQ ID NO: 1432 -13.1 -27.1 74.1 -14 0 -5
CTTTCACGTTTTTCCACCGA 4644 SEQ ID NO: 1433 -13.1 -25.5 70.5 -12.4 0 -4.5
CGCCAACATTATCAAAGTTT 4665 SEQ ID NO: 1434 -13.1 -20.4 59.5 -7.3 0 -3.7
TGAAGTTTAACATCTCGTGA 4756 SEQ ID NO: 1435 -13.1 -19.5 59.6 -6.4 0 -3.6
GTAGTGTCTGAGGGAAACGA 5201 SEQ ID NO: 1436 -13.1 -22.4 66 -9.3 3 -3.5
TTTGATCAGACGTAGGATTC 5360 SEQ ID NO:1437 -13.1 -20.7 63.2 -7.6 0 -6.6
AACTGAGCTGCCAGGGTGAA 5663 SEQ ID NO:1438 -13.1 -25.7 72 -11.7 -0.6 -9.3
CCATGGGCAGATCCATGGCA 5976 SEQ ID NO: 1439 -13.1 -29 78.4 -11.5 -4.4 -11.4
ATAGGCTCATAAGAGACTTT 6124 SEQ ID NO: 1440 -13.1 -20.2 62.2 -5.9 -1.1 -4.5
ATGGACCTCCTCTTGAAGTC 6545 SEQ ID NO: 1441 -13.1 -25.1 72.9 -11.4 -0.3 -5.1
TAGGTAGCCATTGGGTTTCT 6710 SEQ ID NO: 1442 -13.1 -25.5 75.4 -11.8 -0.3 -6.3
GAAGTTAAAAATAGAATGGA 6798 SEQ ID NO: 1443 -13.1 -13.5 46.2 0 0 -2.8
AGAGGAGACTTTACAGGCAC 7117 SEQ ID NO: 1444 -13.1 -22.8 68.3 -8.8 -0.7 -5.2
TCTGCTTGACATAATGGACA 7662 SEQ ID NO: 1445 -13.1 -21.3 63.3 -8.2 0 -3.6
GCAACCATAGTTGGTAGAAA 8118 SEQ ID NO: 1446 -13.1 -21 62 -5.5 -2.4 -8.6
TTTATATCATGTTAGGTAAT 8303 SEQ ID NO: 1447 -13.1 -17.1 55.6 -4 0 -4.7
TGGTTACTACTATTATTATC 8729 SEQ ID NO: 1448 -13.1 -17.8 57.6 -4.7 0 -2.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TGTATACATAGGAGTTTATA 8886 SEQ ID NO:1449 13.1 -17.8 57.4 -4.7 0 -7.4
AGCTTCTTGCATACGAATTA 423 SEQ ID NO: 1450 -13 -21.1 62.7 -6.5 -1.5 -5.3
TTTGGTTTGTTCTCATCATC 601 SEQ ID NO: 1451 -13 -22 68.9 -9 0 -1.9
CAACGCTGAGACATTGCCCA 1097 SEQ ID NO: 1452 -13 -26.4 70.7 -13.4 0 -3.3
CCACTGCAAACATTTATTCC 1292 SEQ ID NO: 1453 -13 -22.2 63.6 -9.2 0 -4.9
TACATTAACAAATGTCCCAT 1376 SEQ ID NO: 1454 -13 -19.5 57.8 -4.9 -1.5 -6.6
TCCACAGAGTAAAGGGTCTT
1466 SEQ ID NO: 1455 -13 -23.1 68.4 -10.1 0 -3.6 TTCCACAGAGTAAAGGGTCT
1467 SEQ ID NO: 1456 -13 -23.1 68.4 -10.1 0 -3.6 GGCCTGATTCTGCTCCTCAT
1751 SEQ ID NO: 1457 -13 -29 81.6 -15.4 -0.3 -6.4 TGGCCTGATTCTGCTCCTCA
1752 SEQ ID NO: 1458 -13 -29 81.4 -15.4 -0.3 -7.2 CGCTGTCTTCAGATTCGGAT
2046 SEQ ID NO:1459 -13 -24.9 71.2 -10.4 -1.4 -5.7
TGATGAGGGGAGCAGAATTT 2122 SEQ ID NO: 1460 -13 -22 65.1 -9 0 -4.1
CTGTGTTCATCATCAGCAAA 2248 SEQ ID NO: 1461 -13 -21.8 65.4 -8.1 -0.4 -4.1
CCTGACTAACGTTACTGTTG 2334 SEQ ID NO: 1462 -13 -22 64.1 -8.5 -0.2 -7.8
GGCCTGACTAACGTTACTGT 2336 SEQ ID NO:1463 -13 -24.9 70.4 -11.4 0 -7.9
TCTGAATGATCGCAGTACAG 3014 SEQ ID NO: 1464 -13 -21.3 63.4 -7.6 -0.4 -6.3
GGCCAACACCAAGGTGAGGT 3122 SEQ ID NO: 1465 -13 -27.5 75.1 -12.9 -1.3 -10.8
TGGCCAGCGACCTCCATACA 3322 SEQ ID NO: 1466 -13 -29.7 78.2 -16.1 -0.1 -8.3
TCTGAGCTAAATGAACTCAA 3421 SEQ ID NO: 1467 -13 -18.3 56.4 -4 -1.2 -5.1
GTAGCAGCAAGGTTGTCTGA 3436 SEQ ID NO:1468 -13 -24.8 74.2 -10.4 -1.3 -8.2
GACCTCCAAACTTCTTTTTC 4893 SEQ ID NO: 1469 -13 -22.7 66.5 -9.7 0 -1.8
ATTTTTTCTGTTCCTCTGTC 4926 SEQ ID NO: 1470 -13 -23.3 72.3 -10.3 0 -0.6
TGCTGGGCGAGGTATGGGTT
4988 SEQ ID NO:1471 -13 -28.1 78.8 -14.3 -0.6 -4.3 TTGCTGGGCGAGGTATGGGT
4989 SEQ ID NO: 1472 -13 -28.1 78.8 -14.3 -0.6 -4.4 ACAGAATACTTTTCTATCAT
5296 SEQ ID NO: 1473 -13 -18 57.2 -4 -0.9 -4.4
ATCAAAGCAAAGAGCAGCGT 5398 SEQ ID NO: 1474 -13 -21.7 62.5 -7.1 -1.6 -5.7
ACTGAGCTGCCAGGGTGAAT 5662 SEQ ID NO:1475 -13 -26.4 74.4 -12.5 -0.6 -9.3
TTAACTGAGCTGCCAGGGTG 5665 SEQ ID NO: 1476 -13 -25.6 72.9 -11.7 -0.6 -9.3
AAGAGGAGGATCCAGGGCAG 59 4 SEQ ID NO: 1477 -13 -25.5 72.9 -9.9 -2.6 -9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TTCCCATTTAGTTTGTCAAT 6307 SEQ ID NO:1478 -13 -22.1 66 -9.1 0 -2.9
TTTGGCATGGACCTCCTCTT 6551 SEQ ID NO:1479 -13 -27.5 77.4 -14 -0.1 -5.1
GATAGCCTTTAAACTATGTT 7532 SEQ ID NO: 1480 -13 -19.6 59.8 -5.9 -0.4 -5.8
ATTTGTAATAGCTTTAGTGC 8231 SEQ ID NO:1481 -13 -19.7 61.9 -6.7 0 -4.6
TTCTTTTTAGCAATAGCAAT 8412 SEQ ID NO: 1482 -13 -18.8 58.6 -4.1 -1.7 -4.3
TGCACTAGTTTGTTGTAAAA 8606 SEQ ID NO:1483 -13 -18.8 58.4 -5.3 -0.2 -6.1
GATGAGTTTAGATGCTTATA 8786 SEQ ID NO:1484 -13 -19.1 60.3 -6.1 0 -3.6
TTATATTGAAAGAAGATGAG 8800 SEQ ID NO: 1485 -13 -13.9 47.5 -0.7 0 -2.2
GTGAATTATCTCATTTATTC 354 SEQ ID NO: 1486 -12.9 -17.7 57.3 -4.3 -0.1 -4
TTTCATCCTGCACATTTAAT 450 SEQ ID NO:1487 -12.9 -21.2 63.2 -8.3 0 -4.8
GTCAGGAGGGTTGCTCAAGG 908 SEQ ID NO:1488 -12.9 -26.1 76.9 -11.9 -1.2 -5
AGACATTGCCCAGGTCCACA 1089 SEQ ID NO:1489 -12.9 -28.5 78.1 -14.9 -0.5 -4.4
TTGGTTTCAAAAGCAGAATC 1321 SEQ ID NO:1490 -12.9 -18.5 57.3 -5.1 -0.1 -1.1
TCTGAGCCATTTCCACAGAG 1477 SEQ ID NO:1491 -12.9 -25.2 72.5 -11.4 -0.8 -4.6
GCTGTGCATCTTCCCATTTG 2390 SEQ ID NO:1492 -12.9 -27.1 77 -14.2 0 -5.4
TGCATCACAGCAGTCCCAGA 2687 SEQ ID NO: 1493 -12.9 -27.9 78.5 -14.1 -0.8 -4.8
ACACAATCAGGAAGGAGTGG 3261 SEQ ID NO: 1494 -12.9 -21.5 63.7 -7.8 -0.6 -4.8
GACGGTGAGGCTGGGGTTGT 3755 SEQ ID NO: 1495 -12.9 -28.6 80.6 -15.7 0 -3.7
GTGACGGTGAGGCTGGGGTT 3757 SEQ ID NO: 1496 -12.9 -28.6 80.6 -15.7 0 -3.7
ATACTGTAGCAGGTTTTTCG 4057 SEQ ID NO:1497 -12.9 -22.2 67 -8.4 -0.7 -5.3
GGTTTTGATAGTCTTTCGCT 4166 SEQ ID NO:1498 -12.9 -23.6 71 -10.7 0 -3.4
TCAAACATGTTACCCGTTGT 4573 SEQ ID NO:1499 -12.9 -23.1 65.6 -9.5 0 -9
ATCCCAAAGATGGCATAGAT 5473 SEQ ID NO: 1500 -12.9 -22.3 63.9 -8 -1.3 -5
GACATCCCAAAGATGGCATA 5476 SEQ ID NO:1501 -12.9 -23.2 65.4 -8 -2.3 -8
TAGGCAAAGTTGGACATCCC 5488 SEQ ID NO: 1502 -12.9 -24.4 69.1 -11.5 0 -4.9
GCAGATCATGCTGTTGCCAA 5555 SEQ ID NO:1503 -12.9 -26 73.6 -11.5 -1.6 -8.3
TCCCAACAGATGGGTCCCCA 5694 SEQ ID NO: 1504 -12.9 -30.6 80 -14.5 -3.2 -8.6
TCTTCCATCTGTATTCGAAG 6079 SEQ ID NO:1505 -12.9 -21.9 65.3 -8.5 -0.2 -7.1
ATATGGAAGTTAAAAATAGA 6803 SEQ ID NO:1506 -12.9 -13.3 46 0 0 "2.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
GATATGGAAGTTAAAAATAG
6804 SEQ ID NO:1507 -12.9 -13.3 46 0 0 -2.8 AGATATGGAAGTTAAAAATA
6805 SEQ ID NO: 1508 -12.9 -13.3 46 0 0 -2.8 TTGAGAGACAGGGTTCTTGT
6939 SEQ ID NO:1509 -12.9 -23.1 70.4 -9.7 -0.2 -5
CTTTGCTGAGAGCAGAAGAT
7333 SEQ ID NO: 1510 -12.9 -22 65.7 -6.7 -2.4 -8.2
ATAGACTATCAGCTTTGCTG
7345 SEQ ID NO: 1511 -12.9 -21.8 66.3 -6.7 -2.2 -8.1 CATAGACTATCAGCTTTGCT
7346 SEQ ID NO: 1512 -12.9 -22.5 67.7 -8.9 -0.4 -4.5 TGATAGCCTTTAAACTATGT
7533 SEQ ID NO: 1513 -12.9 -19.5 59.4 -5.9 -0.4 -5.8 GTGATAGCCTTTAAACTATG
7534 SEQ ID NO: 1514 -12.9 -19.5 59.4 -5.9 -0.4 -5.8 GTTGAATTCATTCTATCACC
7636 SEQ ID NO: 1515 -12.9 -20.8 63.4 -7.2 -0.4 -8.4
TTCAAATTATTCTGCTTGAC 7672 SEQ ID NO: 1516 -12.9 -18.6 58.1 -5.2 -0.2 -3.6
TGAAGAATAGGTTTTGTCAG 7789 SEQ ID NO:1517 -12.9 -18.5 58.4 -5.6 0 -2.7
TTATATTTGTAATAGCTTTA 8235 SEQ ID NO:1518 -12.9 -16.2 53.5 -3.3 0 -4.6
ACTTTGTTCATGGCTAAAAA 8269 SEQ ID NO: 1519 -12.9 -18.5 56.8 -5.6 0 -4.7
CCCAGAGCCCAATAAGTGAA 8486 SEQ ID NO:1520 -12.9 -25.2 68.2 -12.3 0 -3.3
CTGCTTTTAATTTGCCTTTG 8651 SEQ ID NO: 1521 -12.9 -22 65 -9.1 0 -3.6
9094 SEQ ID NO: 1522 -12.9 -16.2 54.7 -3.3 0 0
CTTTCTTTCTCTGTGGATAA 53 SEQ ID NO: 1523 -12.8 -21.2 65.5 -8.4 0 -2.3
ATTTAATTACGTGTAGCTTC 437 SEQ ID NO: 1524 -12.8 -19.3 60 -6.5 0 -5
GTGCCTGTGCCATCTTTTCA 465 SEQ ID NO: 1525 -12.8 -28.3 80.7 -14.7 -0.6 -3
TCATCATTATCTTGTTCCTT 586 SEQ ID NO: 1526 -12.8 -22.1 67.7 -9.3 0 -1.9
GGTTCTTTCCAGCTTCCAAG 633 SEQ ID NO: 1527 -12.8 -26.3 76.1 -13.5 0 -4.5
ACCCTCTTGCCAAGATTTTT 984 SEQ ID NO: 1528 -12.8 -25.3 71.1 -11.7 -0.6 -6.3
AATGTCCCATTTGAATCCAT 1366 SEQ ID NO: 1529 -12.8 -22.8 64.9 -9.5 -0.2 -3.6
CATAGGCCATGGCCACCACA 1734 SEQ ID NO: 1530 -12.8 -29.6 78.2 -12.2 -2.5 -17.4
GTGCTCTCTCTGTCTTCTTT 1985 SEQ ID NO:1531 -12.8 -25.9 80.7 -13.1 0 -3.6
TGTGTTCATCATCAGCAAAG 2247 SEQ ID NO: 1532 -12.8 -20.9 63.7 -8.1 0 -4.1
TGCATCTTCCCATTTGCTGG 2386 SEQ ID NO: 1533 -12.8 -27.1 76.1 -13 -1.2 -5.9
CTATGCTCACGGCTCTTTGC 2577 SEQ ID NO: 1534 -12.8 -26.6 75.7 -12.6 -1.1 -4.9
AGACCAAGCTCCATTAAACT 2974 SEQ ID NO: 1535 -12.8 -22.1 63.4 -9.3 0 -5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CCTCCACATTTGACAGACCA 2988 SEQ ID NO: 1536 -12.8 -26.1 71.9 -13.3 0 -2.4
TGATCGCAGTACAGACAATC 3008 SEQ ID NO: 1537 -12.8 -21.3 63.3 -7.8 -0.4 -5.7
CACTCCCGCATCTTATTTTT 3526 SEQ ID NO:1538 -12.8 -25 70.5 -12.2 0 -3.6
AAGCTCTTTGCTTATTTCAA 3635 SEQ ID NO: 1539 -12.8 -20.6 63 -5.7 -2.1 -5.8
TGTGACGGTGAGGCTGGGGT 3758 SEQ ID NO: 1540 -12.8 -28.5 80 -15.7 0 -3.7
ATTTAATTTCTCTTTGCTTT 3854 SEQ ID NO:1541 -12.8 -19.1 60.4 -6.3 0 -3.6
ACCAGATCTTCCCTTTGCCT 4029 SEQ ID NO: 1542 -12.8 -29.1 79.8 -16.3 0 -5.8
GCATATTCTAGCATGGTTTT 4180 SEQ ID NO:1543 -12.8 -22.5 68.2 -9.2 -0.1 -5
AGAAATCTAGCCAGCACCAG 4284 SEQ ID NO: 1544 -12.8 -24.1 68.3 -11.3 0 -4.6
TTTACTTTCACGTTTTTCCA 4648 SEQ ID NO: 1545 -12.8 -22 65.6 -9.2 0 -4.7
GACCATTCCTTGGAATTTGT 5009 SEQ ID NO: 1546 -12.8 -23.5 67.7 -9 -1.7 -8.4
GGTCATGTATTTGCCCTGGT 5117 SEQ ID N0:1547 -12.8 -27.7 79.1 -14.9 0 -4.7
GTTGGACATCCCAAAGATGG 5480 SEQ ID NO: 1548 -12.8 -23.5 66.5 -8.4 -2.3 -8.3
GACACCTCCTCTTGTTTACG 6160 SEQ ID NO:1549 -12.8 -25.4 72 -12.6 0 -3
GAAGGAGGAGGGGTGGTAGA 6358 SEQ ID NO:1550 -12.8 -25 73.3 -12.2 0 -0.7
TTGGAAAGCATTTGACCTAA 7222 SEQ ID NO:1551 -12.8 -19.9 59 -6.3 -0.6 -4.1
GATTTAATAGAAGTTGTTTA 7444 SEQ ID NO:1552 -12.8 -15.8 52.5 -3 0 -2.5
AAGACTTGTGAAGAATGGAT 7595 SEQ ID NO:1553 -12.8 -17.9 55.6 -4.6 -0.2 -3.5
TTGAGTGTTTGACCAATGTA 8087 SEQ ID NO:1554 -12.8 -21 63.5 -8.2 0 -3.4
CAGAGCCCAATAAGTGAAAT 8484 SEQ ID NO:1555 -12.8 -20.5 59.5 -7.7 0 -3.3
CCACCTTATATAATTTATTA 9075 SEQ ID NO:1556 -12.8 -18 55.8 -5.2 0 -5.1
TTAGGGTATAACGTGTCTTC 149 SEQ ID NO:1557 -12.7 -21.3 65.1 -8.6 0 -5.3
CCTGCACATTTAATTACGTG 444 SEQ ID NO:1558 -12.7 -21.5 62.3 -8.8 0 -5
TGGCTTTGGTTTGTTCTCAT 605 SEQ ID NO:1559 -12.7 -24.4 73.6 -11.7 0 -3.7
CTTATTGATATAGTAGGGAT 713 SEQ ID NO:1560 -12.7 -18.7 59.1 -6 0 -2.7
TTCCATGGATCACGAAGAAA 1024 SEQ ID NO:1561 -12.7 -20.2 58.9 -6.5 0 -10
TGAGACATTGCCCAGGTCCA 1091 SEQ ID NO:1562 -12.7 -28.2 77.6 -14.8 -0.5 -4.4
CCTCCATTCTTTAGCACCTT 1952 SEQ ID NO:1563 -12.7 -27 76 -14.3 0 -4.1
GCTATTGCGTCTTGGGGAAA 2171 SEQ ID NO: 1564 -12.7 -24.5 69.4 -10.9 -0.8 -5.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo jinding formation Duplex structure oligo oligo
GTCGCTCTCCATGTCTGTGC 2313 SEQ ID NO: 1565 -12.7 -29 83.9 -16.3 0 -4.3
GTGCATCTTCCCATTTGCTG 2387 SEQ ID NO:1566 -12.7 -27.1 77 -13.1 -1.2 -5.4
GTTTTACTTTTAACCATGCA 2703 SEQ ID NO:1567 -12.7 -21 63 -8.3 0 -5.2
GCCATAAAGAGGGTATTTAA 2785 SEQ ID NO:1568 -12.7 -19.9 59.6 -7.2 0 -3.7
AGACAATCCCTCCACATTTG 2996 SEQ ID NO:1569 -12.7 -24.3 68.3 -11.6 0 -2.9
GTTTGGCCAGCGACCTCCAT 3325 SEQ ID NO:1570 -12.7 -30.5 81.2 -17.1 -0.1 -8.8
ATAAGGCACATGGTTTGGCC 3337 SEQ ID NO:1571 -12.7 -25.2 71.6 -10.4 -2.1 -6.2
AGCAAGGTTGTCTGAGCTAA 3431 SEQ ID NO:1572 -12.7 -23.1 69 -9.4 -0.9 -5.5
CTTTTTGGAAACACTCCCGC 3537 SEQ ID NO: 1573 -12.7 -24.7 67.9 -10.9 -1 -4.6
ACTTTTGGCTTTCTAAAAAA 3559 SEQ ID NO: 1574 -12.7 -17 53.5 -3.5 -0.6 -4.3
TTTGATAGTCTTTCGCTGTT 4163 SEQ ID NO: 1575 -12.7 -22.4 68.1 -9.7 0 -3.4
CCCGTTGTCATGTTAACACA 4561 SEQ ID NO: 1576 -12.7 -24.5 68.8 -11.1 -0.3 -8.7
ACTTTCACGTTTTTCCACCG 4645 SEQ ID NO: 1577 -12.7 -25.1 69.8 -12.4 0 -4.7
CAACATTATCAAAGTTTACT 4662 SEQ ID NO:1578 -12.7 -16.6 53.2 -3.9 0 -4.1
ACATAATATCCATCCAGCCT 4722 SEQ ID NO: 1579 -12.7 -24.5 68.9 -11.8 0 -3.2
TTGGAATTTGTTTGCTGGGC 5000 SEQ ID NO:1580 -12.7 -23.7 69.4 -11 0 -4.4
AGGATCATGATGCTGATATC 5056 SEQ ID NO:1581 -12.7 -20.9 63.7 -7.3 -0.6 -8.5
ATTTGCCCTGGTCATCCGTT 5109 SEQ ID NO: 1582 -12.7 -28.9 79.1 -15 -1.1 -4.4
TGTATTTGCCCTGGTCATCC 5112 SEQ ID NO: 1583 -12.7 -27.7 78.3 -15 0 -4.2
ATCATGCTGTTGCCAAAGGT 5551 SEQ ID NO: 1584 -12.7 -24.6 70.4 -11.4 -0.1 -4.4
CCATAAACCTGTCTTCCATC 6090 SEQ ID NO: 1585 -12.7 -24.2 68.6 -11.5 0 -2
ACCTCCTCTTGTTTACGTTT 6157 SEQ ID NO: 1586 -12.7 -25.3 73.1 -12.6 0 -4.8
TGTTTTATAGGTAAGTCAAT 6277 SEQ ID NO:1587 -12.7 -17.9 57.5 -5.2 0 -2.3
TGGTTTTGTTACACTATCAT 6380 SEQ ID NO:1588 -12.7 -20.5 63.5 -7.8 0 -2.7
CTATCCCTATAGTCTAGGTA 6724 SEQ ID NO: 1589 -12.7 -23.6 70.9 -10 -0.8 -5.1
TAATCCTTTAAATATTAGAG
7133 SEQ ID NO: 1590 -12.7 -14.9 49.7 -2.2 0 -4.7 ATAATCCTTTAAATATTAGA
7134 SEQ ID NO: 1591 -12.7 -14.9 49.6 -2.2 0 -5.3 CTTTGTTCATGGCTAAAAAG
8268 SEQ ID NO: 1592 -12.7 -18.3 56.5 -5.6 0 -4.7
ATTTTTTTTCTTTCTTTCTC 62 SEQ ID NO: 1593 -12.6 -19.4 63.1 -6.8 0 -0.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ATCCTTGACAGGTATCTCAT 276 SEQ ID NO: 1594 -12 .6 -23.4 70 -9.8 -0.9 -3.5
TTACGTGTAGCTTCTTGCAT 431 SEQ ID NO: 1595 -12 .6 -23.6 70 -9.4 -1.5 -7.2
TCTGCAGCACGTTTTTCGAT 544 SEQ ID NO: 1596 -12 .6 -24.7 70.5 -10.9 -0.9 -9.8
GCCTTTCCTTTATTCATTAC 745 SEQ ID NO: 1597 -12 .6 -23.3 69.1 -10.7 0 -2
TTCTAAGCAAAACCCTCTTG 995 SEQ ID NO: 1598 -12 .6 -21.3 61.8 -8.7 0 -4.1
GTTCCTCCATTCTTTAGCAC 1955 SEQ ID NO:1599 -12, .6 -25.7 75.6 -13.1 0 -4.1
CGCCGTCTTCAAATGTGCTG 2265 SEQ ID NO:1600 -12 .6 -25.6 70.1 -13 0 -3.6
CCAGAGGAATCCTCCAGCAT 2554 SEQ ID NO:1601 -12, .6 -27.3 75 -12.5 -2.2 -11.2
TTCCAGAGGAATCCTCCAGC 2556 SEQ ID NO:1602 -12, .6 -27.1 76 -12.6 -1.9 -10.4
TGACAGACCAAGCTCCATTA 2978 SEQ ID NO: 1603 -12, .6 -23.9 68 -11.3 0 -5
CGCGGAACACAATCAGGAAG 3267 SEQ ID NO:1604 -12 .6 -21.8 61 -9.2 0 -6.4
TTCAGAACCACAAGGTTTCC 3382 SEQ ID NO:1605 -12, .6 -23.2 67.1 -8.6 -2 -6.8
CTGAGCTAAATGAACTCAAT 3420 SEQ ID NO:1606 -12, .6 -17.9 55.1 -4 -1.2 -5.1
CTATCTTATTGCCTTCATGG 3588 SEQ ID NO:1607 -12. .6 -22.9 67.9 -10.3 0 -4.7
TAAGCTCTTTGCTTATTTCA 3636 SEQ ID NO:1608 -12, .6 -21 64.6 -5.7 -2.7 -6.9
CTTTGCCTTCTTCTGTACTT 4017 SEQ ID NO: 1609 -12, .6 -24.7 73.6 -12.1 0 -4.8
GATCTTCCCTTTGCCTTCTT 4025 SEQ ID NO: 1610 -12. .6 -27.7 78.8 -15.1 0 -4.1
TATCAAAGTTTACTTTCACG 4656 SEQ ID NO: 1611 -12, .6 -17.9 56 -3.9 -1.3 -7.1
TGGAATTTGTTTGCTGGGCG 4999 SEQ ID NO: 1612 -12, .6 -24.4 69.2 -11 -0.6 -4.9
CATGTATTTGCCCTGGTCAT 5114 SEQ ID NO: 1613 -12. .6 -26 74 -13.4 0 -4.2
TCCCAAAGATGGCATAGATA 5472 SEQ ID NO: 1614 -12. .6 -22 63.4 -8 -1.3 -5
GAAGGGCATCCATCTCTCCA 6063 SEQ ID NO: 1615 -12, .6 -27.6 77.4 -13.8 -1.1 -4.5
CTGGTTTTGTTACACTATCA 6381 SEQ ID NO:1616 -12. .6 -21.4 65.6 -8.8 0 -2.7
AATACTTTAGATATATTTTT 7268 SEQ ID NO: 1617 -12, .6 -14.4 49.3 -1.8 0 -4.3
TAATAGAAGTTGTTTATCAG 7440 SEQ ID NO: 1618 -12. .6 -16.1 53.3 -3.5 0 -2.5
TACATCCCTGTTGGAAGCTT 7495 SEQ ID NO: 1619 -12, .6 -25.1 71.5 -11.4 -1 -7.4
TTTAACCAAGACTTGTGAAG 7602 SEQ ID NO: 1620 -12. .6 -18.3 56.3 -5.7 0 -4.9
AAAATTTATATCATGTTAGG 8307 SEQ ID NO:1621 -12. .6 -14.8 49.6 -2.2 0 -5.2
TCACCATTCTTTTTAGCAAT 8418 SEQ ID NO: 1622 -12. .6 -21.3 63.9 -8.7 0 -4.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GGAGTTTATATAATGCATTT
8876 SEQ ID NO:1623 -12.6 -18.3 57.6 -5 0 -8.8 AGGAGTTTATATAATGCATT
8877 SEQ ID NO: 1624 -12.6 -18.2 57.5 -5 0 -8.6 ATCTCATCCCTGTCAAACCT
263 SEQ ID NO: 1625 -12.5 -25.7 72.2 -13.2 0 -2
AATTATCTCATTTATTCTTA 351 SEQ ID NO:1626 -12.5 -16.6 54.7 -4.1 0 -2.3
GCCTGTGCCATCTTTTCATC 463 SEQ ID NO:1627 -12.5 -27.5 79 -15 0 -3
TCTCTAGTAAAAAGGCGGAA 511 SEQ ID NO: 1628 -12.5 -19.3 57.8 -6.8 0 -4
AGGTTCTTTCCAGCTTCCAA 634 SEQ ID NO:1629 -12.5 -26.3 76.1 -13.1 -0.4 -4.8
TGTTTTCAGTGCTCGGAGAA 1130 SEQ ID NO: 1630 -12.5 -23.4 69.1 -10.3 -0.3 -6.4
AGCTTCTTTACCGACTGGAT 1192 SEQ ID NO: 1631 -12.5 -24.5 70.1 -11.1 -0.7 -5.4
CAAACATTTATTCCTCAGAT 1286 SEQ ID NO:1632 -12.5 -19.2 58.4 -6.7 0 -2.5
ATCGCTTGGGGGCCACTGCA 1304 SEQ ID NO:1633 -12.5 -30.9 82.5 -16.5 -1.9 -6.9
GCTTTCGCCGTCTTCAAATG 2270 SEQ ID NO: 1634 -12.5 -25 69.4 -12.5 0 -3.2
GTTGCGTCGCTCTCCATGTC 2318 SEQ ID NO: 1635 -12.5 -29 81.8 -15.9 -0.3 -6.9
CTGACTAACGTTACTGTTGC 2333 SEQ ID NO:1636 -12.5 -21.8 64.5 -8.8 -0.2 -7.6
TCCCATTTGCTGGAAGCCCT 2379 SEQ ID NO: 1637 -12.5 -29.8 79.2 -15.1 -2.2 -5.6
TGGCTATGCTCACGGCTCTT 2580 SEQ ID NO:1638 -12.5 -27.7 78 -14 -1.1 -5.3
TTTTAACCATGCATCACAGC 2696 SEQ ID NO:1639 -12.5 -22.5 65.6 -10 0 -6.6
AATCCCAGTAAAGACCAGGT 2858 SEQ ID NO: 1640 -12.5 -23.8 67.1 -11.3 0 -5.7
CAATAATTCCATCAAAGATA 2946 SEQ ID NO:1641 -12.5 -16.2 51.5 -3.7 0 -3.5
TGAATGATCGCAGTACAGAC 3012 SEQ ID NO:1642 -12.5 -20.8 61.9 -7.6 -0.4 -5.7
CTGTGACGGTGAGGCTGGGG 3759 SEQ ID NO:1643 -12.5 -28.2 78,4 -15.7 0 -3.7
AGATCTTCCCTTTGCCTTCT 4026 SEQ ID NO:1644 -12.5 -27.6 78.7 -15.1 0 -5.6
ATGGGTTTCTGAGGTTTCTT 4975 SEQ ID NO:1645 -12.5 -23.7 72.5 -11.2 0 -2.8
AGTAGTGTCTGAGGGAAACG 5202 SEQ ID NO:1646 -12.5 -21.8 64.9 -9.3 3 -3.4
CAGAATACTTTTCTATCATC 5295 SEQ ID NO: 16 7 -12.5 -18.2 58 -4.7 -0.9 -4.4
CATCAAAGCAAAGAGCAGCG 5399 SEQ ID NO:1648 -12.5 -21.2 60.8 -7.1 -1.6 -5.7
TGATGCCATAAACCTGTCTT
6095 SEQ ID NO:1649 -12.5 -23.1 66 -10.6 0 -3 TTGATGCCATAAACCTGTCT
6096 SEQ ID NO: 1650 -12.5 -23.1 66 -10.6 0 -2.8 TCACTTCACTGTCTTGTATA
6605 SEQ ID NO: 1651 -12.5 -21.7 67.4 -9.2 0 -2.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo ACTATCCCTATAGTCTAGGT 6725 SEQ ID NO: 1652 -12.5 -24.1 72.2 -10 -1.5 -7.8
TGGAAGTTAAAAATAGAATG
6800 SEQ ID NO: 1653 -12.5 -12.9 45.1 0 0 -2.8 ATGGAAGTTAAAAATAGAAT
6801 SEQ ID NO: 1654 -12.5 -12.9 45.1 0 0 -2.8 AATATGGCAGATATGGAAGT
6813 SEQ ID NO: 1655 -12.5 -19.3 58.9 -5.4 -1.3 -5.2
ACACCTTTGTCTGATCATTT 6957 SEQ ID NO: 1656 -12.5 -22.6 67.6 -10.1 0 -6.2
CAGGTTGAATTCATTCTATC 7639 SEQ ID NO: 1657 -12.5 -19.8 61.8 -6.6 -0.4 -8.1
TTCTGCTTGACATAATGGAC 7663 SEQ ID NO: 1658 -12.5 -20.7 62.4 -8.2 0 -3.6
TATTCTGCTTGACATAATGG 7665 SEQ ID NO: 1659 -12.5 -19.6 60 -7.1 0 -3.6
AAAGTCCATGTTATATTTGT 8245 SEQ ID NO: 1660 -12.5 -19 59.1 -6.5 0 -4.3
TCATTTATTCTTACAATATC 344 SEQ ID NO: 1661 -12.4 -16.5 54.2 -4.1 0 -2.6
GTTTTCTTATTGATATAGTA 718 SEQ ID NO: 1662 -12.4 -17.6 57.7 -5.2 0 -2.7
TTCAAAAGCAGAATCGCTTG 1316 SEQ ID NO: 1663 -12.4 -19.5 58 -5.7 -1.3 -8.8
TGTATGTTTTCCCAGCAGCA 1653 SEQ ID NO: 1664 -12.4 -26.5 76.2 -14.1 0 -5.4
ATATCATGTATGTTTTCCCA 1659 SEQ ID NO: 1665 -12.4 -22.3 66.6 -9.9 0 -4.7
TCTCCTAACCCACCTACTCC 1891 SEQ ID NO: 1666 -12.4 -28.8 77.6 -16.4 0 -0.2
GTTACTGTTGCGTCGCTCTC 2324 SEQ ID NO: 1667 -12.4 -26.8 77.7 -13.8 -0.3 -6.9
TGCTGTGCATCTTCCCATTT 2391 SEQ ID NO:1668 -12.4 -27.1 77 -13.9 -0.6 -4.9
TGCTCACGGCTCTTTGCCTT 2574 SEQ ID NO:1669 -12.4 -29 80.3 -13.9 -2.7 -8.3
GCCAATGATCTTAATTAGCA 3080 SEQ ID NO:1670 -12.4 -21.1 62.3 -8.7 0 -4.4
GTGAGGTTTCCTAGAGCCCC 3109 SEQ ID NO:1671 -12.4 -29.8 83.3 -16.7 -0.5 -4.4
ATTCCAGTATTATTGGACAT 3616 SEQ ID NO: 1672 -12.4 -20.7 62.9 -6.8 -1.4 -7.2
ACGGTGAGGCTGGGGTTGTT 3754 SEQ ID NO: 1673 -12.4 -28.1 79.6 -15.7 0 -3.7
CCTTCTCGGGGTAGAACAAC 3907 SEQ ID NO: 1674 -12.4 -24.3 68.7 -11.3 -0.3 -3.8
CCAGCGCCAACATTATCAAA 4669 SEQ ID NO: 1675 -12.4 -23.5 64.3 -10.6 0 -7.6
GAAGTTTAACATCTCGTGAA 4755 SEQ ID NO: 1676 -12.4 -18.8 57.7 -6.4 0 -3.9
TTTCTGTTCCTCTGTCATAA 4922 SEQ ID NO: 1677 -12.4 -22.7 69.2 -10.3 0 -1.8
CTAGGGTCATGTATTTGCCC 5121 SEQ ID NO:1678 -12.4 -26.2 75.5 -12.3 -1.4 -6.9
GGAAACGAGCTTCAGCACAA 5189 SEQ ID NO:1679 -12.4 -22.6 64.1 -9.3 -0.7 -6.6
AAGAGCAGCGTGCGGATCCC 5389 SEQ ID NO: 1680 -12.4 -29 77 -14.4 -2.2 -11.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CGGGATCAAACTTTTCCCAA 5859 SEQ ID NO:1681 -12.4 -23.3 64.4 -8.3 -2.6 -7.9
CCTCTTGTTTACGTTTCAAA 6153 SEQ ID NO: 1682 -12.4 -21.5 63.5 -9.1 0 -4.8
TTTTATAGGTAAGTCAATCC 6275 SEQ ID NO: 1683 -12.4 -19.1 59.8 -6.7 0 -2.5
TTTTTACTTTTGATTTTCTC 6458 SEQ ID NO:1684 -12.4 -18.1 58.8 -5.7 0 -2.2
ATAGTCTAGGTAGCCATTGG 6716 SEQ ID NO: 1685 -12.4 -23.8 71.4 -10.8 -0.3 -5.6
GACTTTACAGGCACATAACT 7111 SEQ ID NO:1686 -12.4 -21.2 63.1 -8.8 0 -4
ACTTTAGATATATTTTTCTA 7265 SEQ ID NO:1687 -12.4 -16.4 54.4 -4 0 -4.3
ACTATCAGCTTTGCTGAGAG 7341 SEQ ID NO: 1688 -12.4 -22.7 68.6 -6.7 -3.6 -12
AGACTATCAGCTTTGCTGAG 7343 SEQ ID NO:1689 -12.4 -22.7 68.6 -6.7 -3.6 -10.8
TTGAATTCATTCTATCACCA 7635 SEQ ID NO: 1690 -12.4 -20.3 61.5 -7.2 -0.4 -8.4
GCTTGACATAATGGACAGAG
7659 SEQ ID NO:1691 -12.4 -20.6 61.8 -8.2 0 -3.3 TGCTTGACATAATGGACAGA
7660 SEQ ID NO: 1692 -12.4 -20.6 61.5 -8.2 0 -3.6 ACCCATTATCTAACTTTTAT
8018 SEQ ID NO: 1693 -12.4 -20.1 60.5 -7.7 0 -1.6
TTTGTTCATGGCTAAAAAGA 8267 SEQ ID NO: 1694 -12.4 -18 55.9 -5.6 0 -4.7
TTATATCATGTTAGGTAATT 8302 SEQ ID NO:1695 -12.4 -17.1 55.6 -4.7 0 -4.7
ATAAGTGAAATGCAATAAAA
8475 SEQ ID NO: 1696 -12.4 -12.8 44.6 0 0 -5.6 AATAAGTGAAATGCAATAAA
8476 SEQ ID NO:1697 -12.4 -12.8 44.6 0 0 -5.6 CTGCTTGGTGAATCATGCAC
8621 SEQ ID NO: 1698 -12.4 -23.8 69.2 -9.4 -2 -6.5
TGTAGTACTGCTTGGTGAAT 8628 SEQ ID NO:1699 -12.4 -22 66.7 -9.1 0 -7.8
CTTATGTATACATAGGAGTT 8890 SEQ ID NO: 1700 -12.4 -19 60.1 -5.1 -0.1 -10.9
GCTTTTTTTTTTTTTTTTTT 113 SEQ ID NO:1701 -12.3 -18.4 59.4 -6.1 0 -2.8
TGAATTATCTCATTTATTCT 353 SEQ ID NO: 1702 -12.3 -17.4 56.2 -4.3 -0.6 -4.8
TGCAGCACGTTTTTCGATAG 542 SEQ ID NO: 1703 -12.3 -23.1 66.8 -9.8 -0.9 -7.3
TTTTGGGCTTCTTGGCTTTC 567 SEQ ID NO: 1704 -12.3 -25.4 75.7 -12.1 -0.9 -3.7
TTTCTTATTGATATAGTAGG 716 SEQ ID NO: 1705 -12.3 -17.5 57.1 -5.2 0 -2.7
TTTTATAAGTGACTCAAAGG 968 SEQ ID NO: 1706 -12.3 -16.8 54 -4.5 0 -4.7
CCCTCTTGCC/AAGATTTTTA 983 SEQ ID NO: 1707 -12.3 -24.8 70 -11.7 -0.6 -6.3
TTTCAAAAGCAGAATCGCTT 1317 SEQ ID NO: 1708 -12.3 -19.6 58.4 -5.7 -1.6 -9
TCGAGCATCTGCTGAAATTC 1801 SEQ ID NO:1709 -12.3 -22 64.5 -8.7 -0.9 -7.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CTTTTTAAGCTGTTCGAGCA 1814 SEQ ID NO: 1710 -12.3 -22.6 66.8 -8 -2.3 -7.1
TCCATCCATGGAGAAAAGGA 2081 SEQ ID Nθ:1711 -12.3 -22.3 63.6 -8.4 -1.4 -10.4
ACAATAATTCCATCAAAGAT 2947 SEQ ID NO:1712 -12.3 -16.7 52.4 -4.4 0 -3.3
TTGGCCAGCGACCTCCATAC 3323 SEQ ID NO:1713 -12.3 -29.1 77.6 -16.1 -0.1 -8.8
GGTTGTTTATGAATGACATA 3741 SEQ ID NO:1714 -12.3 -18.7 58.4 -5.5 -0.8 -6
CGGTGAGGCTGGGGTTGTTT 3753 SEQ ID NO:1715 -12.3 -28 79.4 -15.7 0 -3.7
CTTTGCTTTCTTCTAGTTCT 3843 SEQ ID NO:1716 -12.3 -23 71.7 -10.7 0 -4
ACCTTCTCGGGGTAGAACAA 3908 SEQ ID NO: 1717 -12.3 -24.3 68.7 -11.1 -0.7 -4.7
TTTAAAGTCTTCTTCGGGTT 3944 SEQ ID NO:1718 -12.3 -21.4 64.9 -8.4 -0.5 -4
CAGATCTTCCCTTTGCCTTC 4027 SEQ ID NO:1719 -12.3 -27.4 77.8 -15.1 0 -5.8
GTTTTTCGAAGATTCCACCA 4045 SEQ ID NO:1720 -12.3 -23.4 67 -10.6 -0.1 -6.8
AGGTTTTTCGAAGATTCCAC 4047 SEQ ID NO: 1721 -12.3 -21.9 64.9 -8.9 -0.4 -7.4
TGAAAGTCTCAAACCAGTTG 4086 SEQ ID NO: 1722 -12.3 -19.6 59.2 -6.8 -0.1 -3.4
TATTTGCCCTGGTCATCCGT
5110 SEQ ID NO:1723 -12.3 -28.5 78.1 -15 -1.1 -4.2 GTATTTGCCCTGGTCATCCG
5111 SEQ ID NO: 1724 -12.3 -28.5 78.1 -15 -1.1 -4.4 ACATCCCAAAGATGGCATAG
5475 SEQ ID NO:1725 -12.3 -22.6 64.3 -8 -2.3 -8
GGCAAAGTTGGACATCCCAA 5486 SEQ ID NO: 1726 -12.3 -24.7 68.3 -10.4 -2 -8
GGTCTCCCTTAACTGAGCTG 5673 SEQ ID NO:1727 -12.3 -26.5 75.6 -14.2 0 -5
TATAAACTGGGTCGCATCGG 5876 SEQ ID NO: 1728 -12.3 -22.8 64.5 -10.5 0 -3.6
ATTTTTTAACCTTTGCTTTA
6218 SEQ ID NO: 1729 -12.3 -19.4 59.8 -7.1 0 -3.6 TATTTTTTAACCTTTGCTTT
6219 SEQ ID NO: 1730 -12.3 -19.4 59.8 -7.1 0 -3.6 ATCCTCCCTTTAATTGCCTC
6259 SEQ ID NO:1731 -12.3 -27 75.1 -14.7 0 -3
GAGGAGGGGTGGTAGAGGAA 6354 SEQ ID NO:1732 -12.3 -25 73.3 -12.7 0 -0.7
GTCACTTCACTGTCTTGTAT 6606 SEQ ID NO: 1733 -12.3 -23.2 71.7 -10.9 0 -2.6
TTTGAGAGACAGGGTTCTTG
6940 SEQ ID NO:1734 -12.3 -22 67.2 -9.7 0 -3.6 ATTTGAGAGACAGGGTTCTT
6941 SEQ ID NO:1735 -12.3 -22 67.4 -9.7 0 -3.6 TACTTTTTGGAAAGCATTTG
7228 SEQ ID NO: 1736 -12.3 -18.3 56.9 -4.4 -1.6 -5.5
TTTTCTAGAATGGATTTATT 7252 SEQ ID NO: 1737 -12.3 -17 55.1 -4.2 0 -7.7
TTTGCTGAGAGCAGAAGATG 7332 SEQ ID NO: 1738 -12.3 -21.1 63.6 -6.7 -2.1 -6.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TAGACTATCAGCTTTGCTGA 7344 SEQ ID NO: 1739 -12.3 -22.4 67.7 -6.7 -3.4 -10.5
GCTTGCAAAAGACACATACA 7479 SEQ ID NO:1740 -12.3 -20.2 59.6 -5.8 -2.1 -6.9
CTGCTTGACATAATGGACAG 7661 SEQ ID NO:1741 -12.3 -20.9 62.1 -8.6 0 -3.6
ATGTTATATTTGTAATAGCT 8238 SEQ ID NO: 1742 -12.3 -17.5 56.4 -5.2 0 -5.7
7AAGTTGGAACATGTGAACTT 8701 SEQ ID NO: 1743 -12.3 -18.9 57.9 -5.6 -0.8 -9.3
CTGAAAGTTGGAACATGTGA 8705 SEQ ID NO:1744 -12.3 -19.2 58.2 -6.1 -0.6 -7
GTAGGTGGTTACTACTATTA 8734 SEQ ID NO: 1745 -12.3 -20.9 65.4 -7.6 -0.9 -4.4
TTTTCTTTCTTTCTCTGTGG 57 SEQ ID NO:1746 -12.2 -22.3 70 -10.1 0 -1.3
TTTTTTTTTTTTTTTTTGAC 107 SEQ ID NO: 1747 -12.2 -16.4 54.6 -4.2 0 -0.1
CTTTTTTTTTTTTTTTTTTT 112 SEQ ID NO:1748 -12.2 -16.7 55.4 -4.5 0 0
TGGTTAGGGTATAACGTGTC 152 SEQ ID NO: 1749 -12.2 -22.3 67.1 -8.1 -2 -5.3
CTTCTTGCATACGAATTACC 421 SEQ ID NO:1750 -12.2 -21.5 62.7 -9.3 0 -4.8
CAGCACGTTTTTCGATAGCA 540 SEQ ID NO: 1751 -12.2 -23.8 68 -9.8 -1.8 -4.1
ATCATCATTATCTTGTTCCT 587 SEQ ID NO:1752 -12.2 -22 67.3 -9.8 0 -1.9
TGTGCCATTAAAGTAGGAAG 1346 SEQ ID NO: 1753 -12.2 -20.1 60.4 -7.9 0 -3.5
TTTCCACAGAGTAAAGGGTC 1468 SEQ ID NO: 1754 -12.2 -22.3 66.8 -10.1 0 -3.6
AATGCTTGTTTTGCTATTGC 2183 SEQ ID NO: 1755 -12.2 -21.9 65.9 -9 -0.4 -4.4
TCCATGTCTGTGCGGCACAA 2306 SEQ ID NO: 1756 -12.2 -27.3 75.3 -12.5 -1.4 -13.2
CCCAGATCAAGAACACATTG 2673 SEQ ID NO:1757 -12.2 -21.5 61.8 -9.3 0 -5.4
ATGGCCATAAAGAGGGTATT 2788 SEQ ID NO:1758 -12.2 -22 64.2 -8.8 0 -10
GTGCTTCCTTCAGATGAGCT 3880 SEQ ID NO:1759 -12.2 -26.4 77.5 -12.8 -1.3 -5
CTTTTTAATACACCCTTCAG 3980 SEQ ID NO:1760 -12.2 -21.2 62.8 -9 0 -2.5
ACAACCACCCTCATGCCTTC 4426 SEQ ID NO: 1761 -12.2 -28.5 76.3 -16.3 0 -4.4
TTCACAACCACCCTCATGCC 4429 SEQ ID NO: 1762 -12.2 -28.3 75.5 -16.1 0 -4.4
ACCCGTTGTCATGTTAACAC 4562 SEQ ID NO: 1763 -12.2 -24 68.2 -11.1 -0.3 -8.7
CATAATATCCATCCAGCCTT 4721 SEQ ID NO: 1764 -12.2 -24.4 68.6 -12.2 0 -3.2
CTTAACTGAGCTGCCAGGGT 5666 SEQ ID NO: 1765 -12.2 -26.5 75 -13.8 0.3 -8.4
ATCCCAACAGATGGGTCCCC 5695 SEQ ID NO: 1766 -12.2 -29.9 79 -14.5 -3.2 -8.6
CTATAAACTGGGTCGCATCG 5877 SEQ ID NO:1767 -12.2 -22.5 63.9 -10.3 0 -3.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo AGGCTCATAAGAGACTTTGG 6122 SEQ ID NO: 1768 -12.2 -21.7 65.4 -8.1 -1.3 -5
TATGGAAGTTAAAAATAGAA 6802 SEQ ID NO:1769 -12.2 -12.6 44.6 0 0 -2.8
GTATTTAATTGACATAGACT
7358 SEQ ID NO: 1770 -12.2 -17.1 55 -4.9 0 -2.9 GGTATTTAATTGACATAGAC
7359 SEQ ID NO: 1771 -12.2 -17.4 55.6 -5.2 0 -2.9 ATGATACAGGATACATCCCT
7506 SEQ ID NO: 1772 -12.2 -22.9 66.2 -9.7 -0.9 -6.9
ACAAAGTCCATGTTATATTT 8247 SEQ ID NO: 1773 -12.2 -18.7 58 -6.5 0 -4.3
GGAACATGTGAACTTGATCC 8696 SEQ ID NO:1774 -12.2 -21.3 62.7 -9.1 0 -7
TGTAGGTGGTTACTACTATT 8735 SEQ ID NO: 1775 -12.2 -21.2 65.9 -7.4 -1.6 -5.2
TTTTTTTTTTTTTTTTTTGA 108 SEQ ID NO:1776 -12.1 -16.3 54.4 -4.2 0 -0.1
GTATAACGTGTCTTCCTCTG 144 SEQ ID NO: 1777 -12.1 -23.3 69.1 -11.2 0 -4.8
AGTGCCTGTGCCATCTTTTC 466 SEQ ID NO:1778 -12.1 -27.6 79.9 -14.7 -0.6 -3.4
CTCTAGTAAAAAGGCGGAAG 510 SEQ ID NO: 1779 -12.1 -18.9 56.7 -6.8 0 -4
GTTTGTTCTCATCATCATTA 597 SEQ ID NO:1780 -12.1 -21.1 66.4 -9 0 -1.9
ACTATTTGGCTTTGGTTTGT 611 SEQ ID NO: 1781 -12.1 -22.9 69.3 -10.8 0 -3.7
AATCGGAAAATTGCCTTTCC 757 SEQ ID NO:1782 -12.1 -21.6 61.2 -7.8 -1.7 -6.6
ATCTTGATAGCAATTTTCCT 823 SEQ ID NO: 1783 -12.1 -21.1 63.7 -8.4 -0.3 -0.5
AACCCTCTTGCCAAGATTTT 985 SEQ ID NO: 1784 -12.1 -24.5 68.5 -11.7 -0.4 -6.1
TATCCTTCTGGACACTGGCC 1501 SEQ ID NO:1785 -12.1 -27.2 76.6 -13.7 -1.3 -8.7
ATAGGCCATGGCCACCACAG 1733 SEQ ID NO:1786 -12.1 -28.9 77.5 -12.2 -2.5 -17.4
GCCTGAGCTTCTTCCTGTTG 1834 SEQ ID NO:1787 -12.1 -28.1 80.7 -15.3 -0.4 -4.6
TTTCGCCGTCTTCAAATGTG 2268 SEQ ID NO:1788 -12.1 -23.5 66.6 -11.4 0 -2.8
GGGGAAGTTGTCCAGTAGGT 2466 SEQ ID NO: 1789 -12.1 -26.4 77.7 -12.3 -2 -5.6
CACATTGGCAAATCTATACC 2660 SEQ ID NO:1790 -12.1 -20.9 61.3 -8.8 0 -4.4
ACTTTTAACCATGCATCACA 2698 SEQ ID NO:1791 -12.1 -21.8 63.8 -9.7 0 -6.6
ATAATTCCATCAAAGATATT 2944 SEQ ID NO: 1792 -12.1 -16.3 52.2 -3.7 -0.2 -3.5
AAGGAGTGGAAGAAGTCGTT 3250 SEQ ID NO:1793 -12.1 -21 62.8 -8.4 -0.2 -3
CCCGCATCTTATTTTTCACA 3522 SEQ ID NO: 1794 -12.1 -24.8 69.7 -12.7 0 -3.6
CATTTAATTTCTCTTTGCTT 3855 SEQ ID NO:1795 -12.1 -19.7 61.3 -7.6 0 -3.6
GCTCTTAGAGGTCTTAAAGC 4393 SEQ ID NO:1796 -12.1 -22.3 68.1 -9.6 -0.3 -5.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TCCACCGAGCTTGCTTGCCA
4632 SEQ ID NO:1797 -12.1 -30.8 81.3 -18.2 -0.1 -5.9 TTCCACCGAGCTTGCTTGCC
4633 SEQ ID NO: 1798 -12.1 -30.2 80.7 -17.5 -0.3 -6.4 TTATCAAAGTTTACTTTCAC
4657 SEQ ID NO: 1799 -12.1 -17.2 55.6 -3.9 -1.1 -6.9
GTTTAACATCTCGTGAATCA 4752 SEQ ID NO:1?00 -12.1 -20 60.7 -7.9 0 -4.4
CATCATGGTGACCATGTTGA 5084 SEQ ID NO:1801 -12.1 -23.6 68.5 -8.3 -3.2 -11.5
ATAAACTGGGTCGCATCGGG 5875 SEQ ID NO:1802 -12.1 -24.3 67.4 -12.2 0 -3.6
CTGGACTTTGTTGGGTTTTG 5951 SEQ ID NO:1803 -12.1 -23.2 69.5 -11.1 0 -2.6
TATTCGAAGGGCATCCATCT 6068 SEQ ID NO:1804 -12.1 -24.2 68.9 -10.9 -1.1 -8.2
TCTGACCTCTTTTCCTTTGC 6440 SEQ ID NO:1805 -12.1 -25.9 75.6 -13.8 0 -2.6
GGAAAGCATTTGACCTAAAT 7220 SEQ ID N0:1806 -12.1 -19.1 57 -6.3 -0.4 -3.1
CATAGGGTATTTAATTGACA 7364 SEQ ID NO: 1807 -12.1 -18.5 57.6 -6.4 0 -2.9
TGATTTAATAGAAGTTGTTT 7445 SEQ ID NO:1808 -12.1 -16.1 53 -4 0 -2.5
GGATACATCCCTGTTGGAAG 7498 SEQ ID NO:1809 -12.1 -24.1 68.9 -10.9 -1 -5.7
GGTTGAATTCATTCTATCAC 7637 SEQ ID NO:1810 -12.1 -20 62.2 -7.2 -0.4 -8.4
TAGGCAGTATCCAGTGTGTT 7769 SEQ ID NO: 1811 -12.1 -25.1 75.6 -12.5 -0.2 -4
TTGTAATAGCTTTAGTGCAG 8229 SEQ ID NO: 1812 -12.1 -20.3 63.1 -7.3 -0.8 -5.6
GTTATATTTGTAATAGCTTT 8236 SEQ ID NO:1813 -12.1 -17.7 57.2 -5.6 0 -7.1
GAAATTTATTCTTTTGGCTC 8452 SEQ ID NO: 1814 -12.1 -19.1 59.6 -6.4 -0.3 -5.2
AGACCTTTCCAGAATCCTCT 23 SEQ ID NO: 1815 -12 -25.5 72.6 -13.5 0 -2.9
AGCTTTCAGGTCCTGGGGGT 492 SEQ ID NO: 1816 -12 -29.7 85.9 -17 -0.4 -6.8
CATCATCATTATCTTGTTCC 588 SEQ ID NO: 1817 -12 -21.8 66.5 -9.8 0 -1.9
CTATTTGGCTTTGGTTTGTT 610 SEQ ID NO:1818 -12 -22.8 69.1 -10.8 0 -3.7
TGATATAGTAGGGATCCAGG
708 SEQ ID NO: 1819 -12 -22.2 66.6 -9.4 -0.3 -8.9 TTGATATAGTAGGGATCCAG
709 SEQ ID NO: 1820 -12 -21.1 64.3 -8.3 -0.3 -8.9 ATTGATATAGTAGGGATCCA
710 SEQ ID NO: 1821 -12 -21.1 64 -8.3 -0.3 -8.9 TGGATCACGAAGAAACGTAA
1019 SEQ ID NO: 1822 -12 -18.2 54.4 -5.3 -0.8 -6
TCAACGCTGAGACATTGCCC 1098 SEQ ID NO: 1823 -12 -26.1 71.2 -14.1 0 -3.8
GGTTTCAAAAGCAGAATCGC 1319 SEQ ID NO: 1824 -12 -21 61.5 -9 0 -5
GTTTCGACCAGCCTTCACAC 1526 SEQ ID NO: 1825 -12 -27.1 75.6 -15.1 0 -4.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GTCTTCAGATTCGGATTTGG 2042 SEQ ID N0:1826 -12 -22.8 68.2 -10.8 0 -4.4
TGCGTCTTGGGGAAAACAGG 2166 SEQ ID NO:1827 -12 -23.4 66 -11.4 0 -5.2
CGCTCTCCATGTCTGTGCGG 2311 SEQ ID NO: 1828 -12 -29.4 80.3 -16.3 -1 -6.3
AGATCAAGAACACATTGGCA 2670 SEQ ID NO: 1829 -12 -20.5 61 -8.5 0 -5.4
TTTAACCATGCATCACAGCA 2695 SEQ ID NO:1830 -12 -23.1 66.4 -10 -1 -6.6
TGTTTTACTTTTAACCATGC 2704 SEQ ID NO:1831 -12 -20.3 61.6 -8.3 0 -4.2
CCAGTAAAGACCAGGTTTCC 2854 SEQ ID NO: 1832 -12 -24.7 70 -12.7 0 -5.9
TCCCAGTAAAGACCAGGTTT 2856 SEQ ID NO: 1833 -12 -24.7 70 -12.7 0 -5.9
AAGCAGTCTGAATGATCGCA 3020 SEQ ID NO: 1834 -12 -22.5 65.3 -9.8 -0.4 -6.3
AATTTCTCTTTGCTTTCTTC 3850 SEQ ID NO: 1835 -12 -21 65.9 -9 0 -3.6
CAGCACATTCATGATAGAGG 4469 SEQ ID NO:1836 -12 -21.4 64.2 -9.4 0 -6.4
TTTGTTTGCTGGGCGAGGTA 4994 SEQ ID NO:1837 -12 -26 74.8 -13.2 -0.6 -4.4
GAATTTGTTTGCTGGGCGAG 4997 SEQ ID NO:1838 -12 -23.8 68.3 -11 -0.6 -4.9
CAAAGTTGGACATCCCAAAG 5484 SEQ ID NO:1839 -12 -21 60.4 -7.3 -1.7 -5.2
ATCAATTCCAGCTTCCTTTT 5513 SEQ ID NO: 1840 -12 -24 70 -12 0 -4.5
AGCTGCCAGGGTGAATTGTG 5658 SEQ ID NO: 1841 -12 -26 74.1 -14 0 -5.6
TGGGTCGCATCGGGATCAAA 5869 SEQ ID NO: 1842 -12 -25.2 69.3 -13.2 0 -6.9
TATGAGTATTTGTTAAAACA 6576 SEQ ID NO: 1843 -12 -15.2 50.4 -3.2 0 -5.9
AGTGACATAGCATTATGAAT 6882 SEQ ID NO: 1844 -12 -18.6 57.9 -5.9 -0.5 -4
GAGAGACAGGGTTCTTGTAT 6937 SEQ ID NO: 1845 -12 -22.7 69.5 -10.7 0.2 -5
TGGAAAGCATTTGACCTAAA 7221 SEQ ID NO:1846 -12 -19.1 56.9 -6.3 -0.6 -4.1
CAAAGTCCATGTTATATTTG 8246 SEQ ID NO:1847 -12 -18.5 57.4 -6.5 0 -4.3
TGAAATTTATTCTTTTGGCT 8453 SEQ ID NO:1848 -12 -18.7 58.2 -5.6 -1 -5.2
GTGAAATGCAATAAAAAATG
8471 SEQ ID NO:1849 -12 -12.4 43.7 0 0 -5.6 AGTGAAATGCAATAAAAAAT
8472 SEQ ID NO:1850 -12 -12.4 43.7 0 0 -5.6 CTAGTTTGTTGTAAAATTCA
8602 SEQ ID NO:1851 -12 -17.3 55.5 -4.6 -0.4 -4.4
TCCTTGACAGGTATCTCATC 275 SEQ ID NO: 1852 -11.9 -23.8 71.7 -10.9 -0.9 -3.5
GCTTTCAGGTCCTGGGGGTA 491 SEQ ID NO: 1853 -11.9 -29.4 84.9 -17 -0.2 -6.2
ATTCTCTAGTAAAAAGGCGG 513 SEQ ID NO:1854 -11.9 -19.5 58.7 -7.6 0 -4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo ' CACGTTTTTCGATAGCAGCA 537 SEQ ID NO: 1855 -11.9 -23.8 68 -10.9 -0.9 -6.9
TTCTGCAGCACGTTTTTCGA 545 SEQ ID NO:1856 -11.9 -24.8 70.9 -11.7 -0.9 -9.8
GACATTGCCCAGGTCCACAA 1088 SEQ ID NO: 1857 -11.9 -27.8 75.4 -15.9 0 -4
AAACATTTATTCCTCAGATT 1285 SEQ ID NO: 1858 -11.9 -18.6 57. '5 -6.7 0 -2.5
CTGTGCGGCACAAACAGTGA 2299 SEQ ID NO:1859 -11.9 -24.6 68.6 -10.1 -1.5 -13.2
TCATCAGTAGCAGCAAGGTT 3442 SEQ ID NO: 1860 -11.9 -23.9 71.8 -12 0 -5.4
TTTTGGAAACACTCCCGCAT 3535 SEQ ID NO: 1861 -11.9 -24.4 66.9 -11.4 -1 -4.8
TAATTTCTCTTTGCTTTCTT
3851 SEQ ID NO:1862 -11.9 -20.3 63.6 -8.4 0 -3.6 TTAATTTCTCTTTGCTTTCT
3852 SEQ ID NO:1863 -11.9 -20.3 63.6 -8.4 0 -3.6 TTCAGCTTGTTCACCTTCTC
3920 SEQ ID NO:1864 -11.9 -25.3 76.2 -13.4 0 -4.5
TTAAAGTCTTCTTCGGGTTC 3943 SEQ ID NO:1865 -11.9 -21.7 66.1 -9.1 -0.5 -3.8
TGTCAGCATATTCTAGCATG 4185 SEQ ID NO:1866 -11.9 -22.1 67.3 -9.7 -0.1 -4.3
GCGCCAACATTATCAAAGTT 4666 SEQ ID NO:1867 -11.9 -22.1 62.9 -10.2 0 -6.4
TGGGTTTCTGAGGTTTCTTG 4974 SEQ ID NO:1868 -11.9 -23.7 72.4 -11.8 0 -2.8
TTTGCTGGGCGAGGTATGGG
4990 SEQ ID NO:1869 -11.9 -27 75.7 -14.3 -0.6 -4.4 GTTTGCTGGGCGAGGTATGG
4991 SEQ ID NO: 1870 -11.9 -27 76.6 -14.3 -0.6 -4.4 TAGTGTCTGAGGGAAACGAG
5200 SEQ ID NO: 1871 -11.9 -21.2 63.1 -9.3 3 -3.5
CAAAGCAAAGAGCAGCGTGC 5396 SEQ ID NO: 1872 -11.9 -23.1 64.9 -9.6 -1.6 -7.2
CATGCTGTTGCCAAAGGTCT 5549 SEQ ID NO: 1873 -11.9 -25.5 72.4 -12.7 -0.8 -4.4
AGCAGATCATGCTGTTGCCA 5556 SEQ ID NO: 1874 -11.9 -26.7 76.4 -12.4 -2.4 -9.8
CTCACTCAGGGGCTCTGCAC 5813 SEQ ID NO: 1875 -11.9 -28.5 82 -15.6 -0.9 -4.8
CAGGGCAGCTGCAAAATCAG 5912 SEQ ID NO: 1876 -11.9 -23.8 67.5 -9 -0.7 -14
TCAATCCTCCCTTTAATTGC 6262 SEQ ID NO: 1877 -11.9 -24.1 68.5 -11.6 -0.3 -3.8
AGTCAATCCTCCCTTTAATT 6264 SEQ ID NO: 1878 -11.9 -23.5 68 -11.6 0 -2.5
AAGGAGGAGGGGTGGTAGAG 6357 SEQ ID NO:1879 -11.9 -24.4 72.2 -12.5 0 -0.7
TTTCCTTGTCTGGTTTTGTT
6390 SEQ ID NO: 1880 -11.9 -24.1 73.4 -12.2 0 -3.2 TTTTCCTTGTCTGGTTTTGT
6391 SEQ ID NO:1881 -11.9 -24.1 73.4 -12.2 0 -3.2 TGACACATATACTTTACCTT
6521 SEQ ID NO: 1882 -11.9 -20 60.6 -8.1 0 -2.4
AGTTGACACATATACTTTAC 6524 SEQ ID NO: 1883 -11.9 -18.3 58 -5.9 -0.2 -3.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TGTAGTTACAATGTTCACTT 6751 SEQ ID NO: 1884 -11.9 -19.7 61.7 -7.8 0 -5.6
AACTATGAATTGGGGACCAT 6861 SEQ ID NO:1885 -11.9 -21.2 61.5 -6.9 -2.4 -7.2
ATTACAATTCTTTTTCTGGT 7007 SEQ ID NO: 1886 -11.9 -19.5 61.1 -7.6 0 -2.6
GAGACTTTACAGGCACATAA 7113 SEQ ID NO: 1887 -11.9 -20.7 62.2 -8.8 0 -4
AAATATAGAGCTCTGAAACT 7199 SEQ ID NO: 1888 -11.9 -16.9 53.6 -4 0 -10
TCTTTAACCAAGACTTGTGA 7604 SEQ ID NO: 1889 -11.9 -20.3 61.2 -7.6 -0.6 -5.6
ACAAAAATTTATATCATGTT 8310 SEQ ID NO:1890 -11.9 -14.1 47.7 -2.2 0 -5.2
CACCATTCTTTTTAGCAATA 8417 SEQ ID NO: 1891 -11.9 -20.6 61.9 -8.7 0 -4.1
TTTATTCTTTTGGCTCAATA 8448 SEQ ID NO: 1892 -11.9 -19.6 61.1 -7.7 0 -4.9
GTATACATAGGAGTTTATAT 8885 SEQ ID NO:1893 -11.9 -17.8 57.5 -5.9 0 -6.1
GTCAAACCTTGATGTGGCTT 252 SEQ ID NO: 1894 -11.8 -23.9 69 -10.9 -1.1 -5.7
TCTTTGCTCCTTTCCCAGTA 312 SEQ ID NO: 1895 -11.8 -27.7 79.5 -15.9 0 -2.9
TATTCTTACAATATCCCTAG 339 SEQ ID NO:1896 -11.8 -19.8 60.3 -8 0 -3.2
TGTGAATTATCTCATTTATT 355 SEQ ID NO:1897 -11.8 -17.3 55.9 -5 -0.1 -3.2
GGCTTTGGTTTGTTCTCATC 604 SEQ ID NO: 1898 -11.8 -24.8 75.7 -13 0 -3.7
AGTTGGTCAAAATAGTGCAC 876 SEQ ID NO: 1899 -11.8 -20.3 61.9 -7.9 0 -8.6
TAAGTGACTCAAAGGTATAG 963 SEQ ID NO: 1900 -11.8 -17.4 55.5 -5.6 0 -3.3
TCGGAGAACTCTGAATGTTC 1118 SEQ ID NO: 1901 -11.8 -20.9 62.7 -8.4 -0.4 -7.9
AATTGTTTTCAGTGCTCGGA 1133 SEQ ID NO: 1902 -11.8 -22.9 67.9 -11.1 0 -4.5
CTGTTTCCATCCATGGAGAA 2086 SEQ ID NO:1903 -11.8 -24.2 69.4 -10.8 -1.4 -10.4
GGGGAAAACAGGGAGCCACG 2158 SEQ ID NO:1904 -11.8 -25.5 68.5 -13.1 -0.3 -4.3
GCGTCTTGGGGAAAACAGGG 2165 SEQ ID NO:1905 -11.8 -24.6 68.5 -12.8 0 -3.5
GGAAGCCCTGGCACCATCCT 2368 SEQ ID NO: 1906 -11.8 -31.7 82.6 -19 -0.7 -9.1
TCTGGGGGAAGTTGTCCAGT 2470 SEQ ID NO:1907 -11.8 -26.8 78 -13 -2 -8.1
CCTTCCAGAGGAATCCTCCA 2558 SEQ ID NO: 1908 -11.8 -28.2 76.9 -14.2 -2.2 -11.2
AATAATTCCATCAAAGATAT 2945 SEQ ID NO: 1909 -11.8 -15.5 50.2 -3.7 0 -3.5
CCCTCCACATTTGACAGACC 2989 SEQ ID NO:1910 -11.8 -27.4 74.3 -15.6 0 -2.4
GACAATCCCTCCACATTTGA 2995 SEQ ID NO: 1911 -11.8 -24.9 69.3 -13.1 0 -3.2
GTTCAGAACCACAAGGTTTC 3383 SEQ ID NO:1912 -11.8 -22.4 66.6 -8 -2.6 -6.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GCTTTTTGGAAACACTCCCG 3538 SEQ ID NO: 1913 -11.8 -24.7 67.9 -11.8 -1 -5.3
CCAACAGCAATTGGCACTGT 3775 SEQ ID NO:1914 -11.8 -24.8 69.2 -11.4 -1.5 -9.3
TTCCCTTTGCCTTCTTCTGT 4021 SEQ ID NO:1915 -11.8 -28.3 80.9 -16.5 0 -3
CTCTTAGAGGTCTTAAAGCT 4392 SEQ ID NO:1916 -11.8 -21.4 65.7 -9.6 0 -4.8
CTTGGAATTTGTTTGCTGGG 5001 SEQ ID NO:1917 -11.8 -22.8 67.1 -11 0 -4.3
GGTGACCATGTTGAGGCAGA 5078 SEQ ID NO:1918 -11.8 -26.1 74.8 -13.8 -0.1 -4.3
AAGATGGCATAGATAAACAT 5467 SEQ ID NO:1919 -11.8 -17.1 53.5 -5.3 0 -4
AGGGCATCCATCTCTCCACT 6061 SEQ ID NO:1920 -11.8 -28.8 81.3 -15.8 -1.1 -4
GGAGGAGGGGTGGTAGAGGA 6355 SEQ ID NO: 1921 -11.8 -26.9 78.8 -15.1 0 -0.7
CAGTTGACACATATACTTTA 6525 SEQ ID NO:1922 -11.8 -18.8 58.8 -6.5 -0.2 -3.6
CTGTCTTGTATAGGCACTGA 6597 SEQ ID NO:1923 -11.8 -23.5 70.7 -11 -0.5 -4
AACACCTTTGTCTGATCATT
6958 SEQ ID NO: 1924 -11.8 -21.8 65 -9.3 -0.5 -8.3 AAACACCTTTGTCTGATCAT
6959 SEQ ID NO:1925 -11.8 -21 62.5 -8.5 -0.5 -8.3 AATATAGAGCTCTGAAACTT
7198 SEQ ID NO:1926 -11.8 -17.7 55.7 -5 0 -9.7
CTTTTTGGAAAGCATTTGAC
7226 SEQ ID NO:1927 -11.8 -19.2 58.8 -6.5 -0.7 -4.6 ACTTTTTGGAAAGCATTTGA
7227 SEQ ID NO: 1928 -11.8 -19.2 58.8 -5.8 -1.6 -5.5 GGATTGAGTAAAATAGAGCA
7579 SEQ ID NO:1929 -11.8 -18.1 56.3 -6.3 0 -4.1
GCACTAGTTTGTTGTAAAAT 8605 SEQ ID NO:1930 -11.8 -18.8 58.5 -6.3 -0.4 -6.3
CAAAGCTGCTTTTAATTTGC 8656 SEQ ID NO:1931 -11.8 -20 60.2 -6.7 -0.3 -10.9 GTTACAATTTTTTTTCTTTC 68 SEQ ID NO:1932 -11.7 -17.8 57.9 -6.1 0 -2.4
GGTATAACGTGTCTTCCTCT 145 SEQ ID NO: 1933 -11.7 -24.5 71.9 -12.8 0 -5.3
TCTCATCCCTGTCAAACCTT 262 SEQ ID NO:1934 -11.7 -25.8 72.6 -14.1 0 -2
ATTACGTGTAGCTTCTTGCA 432 SEQ ID NO: 1935 -11.7 -23.6 70 -10.3 -1.5 -7.1
AGCACGTTTTTCGATAGCAG 539 SEQ ID NO: 1936 -11.7 -23.1 67.1 -9.6 -1.8 -5
TATAGTAGGGATCCAGGTCC 705 SEQ ID NO:1937 -11.7 -25.2 74.4 -12.2 -1.2 -8.9
AATCCAGCCAGTTCCATGGA 1035 SEQ ID NO: 1938 -11.7 -27.1 75.1 -14 -1.3 -9.7
ATTAACAAATGTCCCATTTG 1373 SEQ ID NO: 1939 -11.7 -19.1 57.2 -4.9 -2.5 -9.5
CACGTAATGTCAACTGGTAA 1635 SEQ ID NO:1940 -11.7 -20 59.5 -8.3 0 -4.8
AAAATATCATGTATGTTTTC 1662 SEQ ID NO: 1941 -11.7 -15.5 51.4 -3 -0.6 -6.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TCATAGGCCATGGCCACCAC 1735 SEQ ID NO: 1942 -11.7 -29.3 78.8 -13.4 -1.7 -16.6
TTCCATCCATGGAGAAAAGG 2082 SEQ ID NO:1943 -11.7 -21.8 62.7 -8.4 -1.7 -9.9
AACAGGGAGCCACGGATACT 2152 SEQ ID NO: 1944 -11.7 -25.3 69.7 -13 -0.3 -3.7
CTTGGGGAAAACAGGGAGCC 2161 SEQ ID NO:1945 -11.7 -24.8 68.8 -13.1 0 -3.6
CGTCGCTCTCCATGTCTGTG 2314 SEQ ID NO: 1946 -11.7 -28 78.7 -16.3 0 -4.3
CTGGGGGAAGTTGTCCAGTA 2469 SEQ ID NO: 1947 -11.7 -26.1 75.6 -13 -1.3 -7.5
CTTTCTGACTTCCGTTTCAG 2501 SEQ ID NO:1948 -11.7 -23.9 70.4 -11.3 -0.8 -5.4
TCCAGAGGAATCCTCCAGCA 2555 SEQ ID NO: 1949 -11.7 -27.7 76.7 -13.8 -2.2 -11.2
AATTCCATCAAAGATATTCC 2942 SEQ ID NO: 1950 -11.7 -19 57.6 -6.6 -0.4 -3.9
TGCCAATGATCTTAATTAGC 3081 SEQ ID NO:1951 -11.7 -20.4 61.1 -8.7 0 -4.9
AATGAAGACGATGATGGCCA 3137 SEQ ID NO:1952 -11.7 -21.7 61.5 -9.3 0 -8.8
TCAGAACCACAAGGTTTCCA 3381 SEQ ID NO:1953 -11.7 -23.8 67.9 -9.5 -2.6 -7.6
TTAAGCTCTTTGCTTATTTC 3637 SEQ ID NO: 1954 -11.7 -20.4 63.7 -5.7 -3 -7.4
TGACGGTGAGGCTGGGGTTG 3756 SEQ ID NO: 1955 -11.7 -27.4 76.8 -15.7 0 -3.7
TTCTCTTTGCTTTCTTCTAG 3847 SEQ ID NO:1956 -11.7 -22.2 69.8 -10.5 0 -3.6
TTTAATTTCTCTTTGCTTTC 3853 SEQ ID NO:1957 -11.7 -19.5 61.9 -7.8 0 -3.6
ATTATCAAAGTTTACTTTCA
4658 SEQ ID NO: 1958 -11.7 -17 55.1 -3.9 -1.3 -7.1 CATTATCAAAGTTTACTTTC
4659 SEQ ID NO:1959 -11.7 -17 55.1 -3.9 -1.3 -7.1 ACATTATCAAAGTTTACTTT
4660 SEQ ID NO:1960 -11.7 -16.8 54.3 -3.9 -1.1 -6.9 AGATTTTCTTCATATACAGG
4777 SEQ ID NO: 1961 -11.7 -18.9 59.9 -7.2 0 -2.6
TGTACAGATTTTCTTCATAT
4782 SEQ ID NO: 1962 -11.7 -18.9 60.1 -7.2 0 -5.9 ATGTACAGATTTTCTTCATA
4783 SEQ ID NO:1963 -11.7 -18.9 60.1 -7.2 0 -6.7 CATTCCTTGGAATTTGTTTG
5006 SEQ ID NO: 1964 -11.7 -20.9 62.7 -7.5 -1.7 -8.4
AGACCATTCCTTGGAATTTG 5010 SEQ ID NO: 1965 -11.7 -22.3 64.8 -9 -1.5 -8.2
CAGCCTATAGTGAAGTAGTA 5218 SEQ ID NO:1966 -11.7 -21.7 66 -10 0 -5.1
ACCATGGGCAGATCCATGGC 5977 SEQ ID NO:1967 -11.7 -28.5 78 -11.5 -5.3 -13.1
CTCCTCTTGTTTACGTTTCA 6155 SEQ ID NO: 1968 -11.7 -24.2 71.6 -12.5 0 -4.8
CTTTTCCTTGTCTGGTTTTG 6392 SEQ ID NO: 1969 -11.7 -23.8 71.9 -12.1 0 -3.2
CACATATACTTTACCTTCAT 6518 SEQ ID NO:1970 -11.7 -20.3 61.4 -8.6 0 -2.4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GTGACATAGCATTATGAATA 6881 SEQ ID NO: 1971 -11.7 -18.3 57.1 -5.1 -1.4 -4.9
GATCATTTGAGAGACAGGGT 6945 SEQ ID NO:1972 -11.7 -22.2 67.1 -10.5 0 -4.7
GTTGGAAGCTTGCAAAAGAC 7486 SEQ ID NO:1973 -11.7 -20.4 60.6 -6.6 -2.1 -7
AGTGATAGCCTTTAAACTAT 7535 SEQ ID NO:1974 -11.7 -19.5 59.6 -7.3 -0.2 -5.8
CAATATTAACATGCATTAGT 7552 SEQ ID NO:1975 -11.7 -17.2 54.3 -5.5 0 -6.7
ACAGAGCAGGTTGAATTCAT 7645 SEQ ID NO:1976 -11.7 -21.6 65 -9.3 0 -8.4
ATGAAGAATAGGTTTTGTCA 7790 SEQ ID NO:1977 -11.7 -18.5 58.2 -6.8 0 -3
TAAGTGAAATGCAATAAAAA 8474 SEQ ID NO: 1978 -11.7 -12.1 43.2 0 0 -5.6
CCTTATGTATACATAGGAGT 8891 SEQ ID NO:1979 -11.7 -20.9 63.7 -7.6 -0.2 -11.1
TTTTTTTTTTTGACCACAGA 101 SEQ ID NO: 1980 -11.6 -20 61.2 -8.4 0 -2.3
TTTTTTTTTTTTTTTTTTTG 109 SEQ ID NO: 1981 -11.6 -15.8 53.3 -4.2 0 0
CTTGCATACGAATTACCTTA 418 SEQ ID NO: 1982 -11.6 -20.8 60.8 -9.2 0 -5.1
TGCCTGTGCCATCTTTTCAT 464 SEQ ID NO:1983 -11.6 -27.1 77 -14.7 -0.6 -3
AAGGTTCTTTCCAGCTTCCA 635 SEQ ID NO: 1984 -11.6 -26.3 76.1 -14 -0.4 -4.8
AGGGATCCAGGTCCTCCAGG 699 SEQ ID NO:1985 -11.6 -30.1 83.9 -16.5 -2 -10.3
CACAGTTGGTCAAAATAGTG 879 SEQ ID NO: 1986 -11.6 -19.2 59 -7.6 0 -3.8
AAATGTCCCATTTGAATCCA 1367 SEQ ID NO: 1987 -11.6 -22.1 62.9 -9.2 -1.2 -5.7
TGTTACATTAACAAATGTCC 1379 SEQ ID NO: 1988 -11.6 -18.1 56.1 -4.9 -1.5 -6.6
GCCGCAACTGCCTGAGCTTC 1843 SEQ ID NO: 1989 -11.6 -30 80.1 -17.2 -1.1 -5.8
TCAAGGTGCTCTCTCTGTCT 1990 SEQ ID NO: 1990 -11.6 -25.9 78.7 -14.3 0 -3.6
TCTGTTTCCATCCATGGAGA 2087 SEQ ID NO: 1991 -11.6 -25.3 73.4 -12 -1.7 -10.4
CTGATGAGGGGAGCAGAATT 2123 SEQ ID NO: 1992 -11.6 -22.8 66.7 -11.2 0 -4.1
CATTTGCTGGAAGCCCTGGC 2376 SEQ ID NO: 1993 -11.6 -28.4 77.3 -15.2 -1.5 -8.6
CGGCTCTTTGCCTTCCAGAG 2568 SEQ ID NO:1994 -11.6 -28.7 79.1 -14.4 -2.7 -7.3
TAATTCCATCAAAGATATTC 2943 SEQ ID NO: 1995 -11.6 -16.7 53.4 -4.4 -0.4 -3.5
GGTGAGGTTTCCTAGAGCCC 3110 SEQ ID NO: 1996 -11.6 -29 82.4 -16.7 -0.5 -4.4
ATGAAGACGATGATGGCCAA 3136 SEQ ID NO:1997 -11.6 -21.7 61.5 -9.3 0 -9.2
AGGTTTCCAATGACCATGAC 3370 SEQ ID NO:1998 -11.6 -23.3 67.1 -10.1 -1.5 -5.8
CCGCATCTTATTTTTCACAT 3521 SEQ ID NO: 1999 -11.6 -22.8 66.1 -11.2 0 -3.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GAGGCTGGGGTTGTTTATGA 3749 SEQ ID NO:2000 -11.6 -25.1 74.1 -13.5 0 -3.7
GCTAACCAAAGAAACATCAA 4310 SEQ ID NO:2001 -11.6 -17.7 53.6 -6.1 0 -2.9
ATAATATCCATCCAGCCTTT 4720 SEQ ID NO:2002 -11.6 -23.8 67.9 -12.2 0 -3.2
AACGAGCTTCAGCACAAATT 5186 SEQ ID NO: 2003 -11.6 -20.9 60.8 -9.3 0.1 -5.8
AAGAGCAGGAGGCCGATGTT 5440 SEQ ID NO:2004 -11.6 -25.9 72.4 -13.4 -0.8 -7.7
TCATGCTGTTGCCAAAGGTC 5550 SEQ ID NO:2005 -11.6 -25 72.1 -12.5 -0.8 -4.4
TAAACTGGGTCGCATCGGGA 5874 SEQ ID NO:2006 -11.6 -24.9 68.6 -13.3 0 -3.6
GAAGAGGAGGATCCAGGGCA 5925 SEQ ID NO:2007 -11.6 -26.1 73.9 -12.7 -1.8 -9
CTGTTTTTTCTGGAGTGGAG 6327 SEQ ID NO:2008 -11.6 -22.7 69.5 -11.1 0 -2.7
AGGAGGGGTGGTAGAGGAAC 6353 SEQ ID NO:2009 -11.6 -24.6 72.6 -13 0 -1.9
ACATATACTTTACCTTCATA 6517 SEQ ID NO:2010 -11.6 -19.3 59.6 -7.7 0 -2.4
CCAGTTGACACATATACTTT 6526 SEQ ID NO: 2011 -11.6 -21.1 63.2 -9 -0.2 -3.6
AGCCATTGGGTTTCTCCTCA 6705 SEQ ID NO: 2012 -11.6 -28.1 80.5 -15.6 -0.8 -6.3
AGCTTGCAAAAGACACATAC 7480 SEQ ID NO: 2013 -11.6 -19.5 58.6 -5.8 -2.1 -6.9
ATATTAACATGCATTAGTGA 7550 SEQ ID NO:2014 -11.6 -17.8 56.2 -6.2 0 -6.7
GATTGAGTAAAATAGAGCAG 7578 SEQ ID NO:2015 -11.6 -16.9 54 -5.3 0 -4.1
TCAGTAGGCAGTATCCAGTG 7773 SEQ ID NO:2016 -11.6 -24.9 75 -12.8 -0.2 -4
TTGTTCATGGCTAAAAAGAA 8266 SEQ ID NO:2017 -11.6 -17.2 53.8 -5.6 0 -4.1
TCTTTTTAGCAATAGCAATT 8411 SEQ ID N0:2018 -11.6 -18.8 58.6 -5.5 -1.7 -4.6
AAATTTATTCTTTTGGCTCA 8451 SEQ ID NO:2019 -11.6 -19.2 59.6 -7.6 0 -4.3
TTATGTATACATAGGAGTTT 8889 SEQ ID NO:2020 -11.6 -18.2 58.4 -5.1 -0.1 -10.9
CATTAATACCTTATGTATAC 8899 SEQ ID NO:2021 -11.6 -17.2 54.7 -5 -0.3 -5.3
TTTTTTTTTTTTTTTTTTCC 9093 SEQ ID NO:2022 -11.6 -18.1 58.6 -6.5 0 0
ATTTGGCTTTGGTTTGTTCT 608 SEQ ID NO: 2023 -11.5 -23.5 71.4 -12 0 -2.9
GCCTTCACACAGATGTATCC 1516 SEQ ID NO: 2024 -11.5 -25.6 73.6 -13.4 -0.5 -3.7
GCTTCTTCCTGTTGCTTTTT 1828 SEQ ID NO: 2025 -11.5 -25.9 77 -14.4 0 -3.6
CTCCACTGAAATCTCTTGAA 1875 SEQ ID NO:2026 -11.5 -20.9 61.8 -9.4 0 -2.5
TCAACTTTGATGCTTCTGAA 1926 SEQ ID NO:2027 -11.5 -20.3 61.5 -8.8 0 -5
CCATCCATGGAGAAAAGGAA 2080 SEQ ID NO:2028 -11.5 -21.2 60.4 -8.4 -0.4 -10.4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GAGCCACGGATACTCAAGAG 2146 SEQ ID NO: 2029 -11.5 -23.7 67.3 -11.5 -0.4 -4.9
TCTTTCTGACTTCCGTTTCA 2502 SEQ ID NO:2030 -11.5 -24.3 71.7 -12.8 0 -3.8
CTGGCTATGCTCACGGCTCT 2581 SEQ ID NO:2031 -11.5 -28.5 79.6 -15.8 -1.1 -5.3
TGAGCTAAATGAACTCAATA 3419 SEQ ID NO:2032 -11.5 -16.7 52.8 -4 -1.1 -5.1
CGCATCTTATTTTTCACATA 3520 SEQ ID NO:2033 -11.5 -20.5 61.8 -9 0 -3.6
CATCAACGATCAAGAAATCT 4296 SEQ ID NO:2034 -11.5 -17.6 54 -6.1 0 -4.9
AGTGCAAGATAGCCAGCGCC 4681 SEQ ID NO:2035 -11.5 -28.2 76.8 -15.5 -1.1 -7.7
TTTTCTTCATATACAGGCTG 4774 SEQ ID NO:2036 -11.5 -21 64.6 -9.5 0 -3.8
CGTAGGATTCGGCCAATCCT 5350 SEQ ID NO:2037 -11.5 -27.1 72.9 -11.9 -3.3 -15.2
CCCAAAGATGGCATAGATAA 5471 SEQ ID NO.-2038 -11.5 -20.9 60.2 -8 -1.3 -5
GTCACCACTGACCATGGGCA 5987 SEQ ID NO:2039 -11.5 -28.7 78.5 -15.7 -1.4 -8.9
GTGGATCCGGTCACCACTGA 5996 SEQ ID NO:2040 -11.5 -28.3 77.6 -14.5 -2.2 -12
TGCCATAAACCTGTCTTCCA 6092 SEQ ID NO:2041 -11.5 -25.6 71 -14.1 0 -3
AGGAGGAGGGGTGGTAGAGG 6356 SEQ ID NO:2042 -11.5 -26.3 77.7 -14.8 0 -0.7
ATCATAGGAAGGAGGAGGGG 6365 SEQ ID NO: 2043 -11.5 -23.1 68 -11.6 0 -3.4
CTTTCTTTTTCTGGTTTGTC 6421 SEQ ID NO:2044 -11.5 -22.3 70.2 -10.8 0 -1.5
AATAAACTATGAATTGGGGA
6865 SEQ ID NO: 2045 -11.5 -16.6 52.2 -5.1 0 -3.1 GAATAAACTATGAATTGGGG
6866 SEQ ID NO:2046 -11.5 -16.6 52.2 -5.1 0 -3.1 AGACTTTACAGGCACATAAC
7112 SEQ ID NO: 2047 -11.5 -20.3 61.4 -8.8 0 -4
GGCAATATTAACATGCATTA 7554 SEQ ID NO: 2048 -11.5 -19 57.7 -5.5 -2 -6.8
CATTCTATCACCAATATGTG 7628 SEQ ID NO:2049 -11.5 -20 60.5 -8.5 0 -3.8
AGGCAGTATCCAGTGTGTTT 7768 SEQ ID NO:2050 -11.5 -25.5 76.7 -13.5 -0.2 -4
GTTTTAGACATATTTTTAGC 7815 SEQ ID NO:2051 -11.5 -18.3 58.9 -6.8 0 -2.8
TATTTAAACAAGTTTTAGAC 7826 SEQ ID NO:2052 -11.5 -14.4 49 -2.9 0 -5.2
CCAGAGCCCAATAAGTGAAA 8485 SEQ ID NO:2053 -11.5 -22.5 62.9 -11 0 -2.4
ACTAGTTTGTTGTAAAATTC 8603 SEQ ID NO:2054 -11.5 -16.8 54.7 -4.6 -0.4 -6
TGAAAGTTGGAACATGTGAA 8704 SEQ ID NO:2055 -11.5 -17.6 54.6 -5.3 -0.6 -7
ATGTATACATAGGAGTTTAT 8887 SEQ ID NO:2056 -11.5 -18.1 58 -5.9 0 -9.1
TCTTTCTTTCTCTGTGGATA 54 SEQ ID NO: 2057 -11.4 -22.3 69.6 -10.9 0 -2.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
TACAATTTTTTTTCTTTCTT
66 SEQ ID NO:2058 -11.4 -17.5 56.8 -6.1 0 -2.6 TTACAATTTTTTTTCTTTCT
67 SEQ ID NO:2059 -11.4 -17.5 56.8 -6.1 0 -2.6 TTTGGGCTTCTTGGCTTTCT
566 SEQ ID NO: 2060 -11.4 -26.2 77.4 -14.3 -0.1 -3.7
AATCTTGATAGCAATTTTCC 824 SEQ ID NO:2061 -11.4 -19.5 59.7 -7.5 -0.3 -0.5
CTTCTTTACCGACTGGATCA 1190 SEQ ID NO:2062 -11.4 -23.8 68.4 -11.5 -0.7 -5.3
GCAGAATCGCTTGGGGGCCA 1309 SEQ ID NO:2063 -11.4 -29.7 79.3 -17.6 -0.5 -7.6
TTGTGCCATTAAAGTAGGAA 1347 SEQ ID NO:2064 -11.4 -20.2 60.5 -8.8 0 -3.5
ATGTATGTTTTCCCAGCAGC 1654 SEQ ID NO:2065 -11.4 -25.8 75 -14.4 0 -4.1
GCTGCTTCTTTTGACGCTGT 2060 SEQ ID NO:2066 -11.4 -26.6 76.3 -13.2 -2 -6.3
TGTTCATCATCAGCAAAGTC 2245 SEQ ID NO: 2067 -11.4 -21.3 65.3 -9.9 0 -4.1
ATTCCATCAAAGATATTCCA 2941 SEQ ID NO:2068 -11.4 -20.4 60.7 -8.3 -0.4 -3.9
AGCTAAATGAACTCAATAAT 3417 SEQ ID NO:2069 -11.4 -15.4 50 -4 0 -4.3
CTTATTGCCTTCATGGATTT 3584 SEQ ID NO: 2070 -11.4 -22.7 67 -10.7 -0.3 -4.7
GGTGGTTCCATTCCCATCTC 3665 SEQ ID NO:2071 -11.4 -28.9 82.3 -16.8 -0.4 -5.5
CCAGATCTTCCCTTTGCCTT 4028 SEQ ID NO:2072 -11.4 -29 79.5 -17.6 0 -5.8
GAAAGTCTCAAACCAGTTGT 4085 SEQ ID NO:2073 -11.4 -20.8 62.2 -8.7 -0.4 -3.4
GCCAGCACCAGGCATTAGTG 4275 SEQ ID NO:2074 -11.4 -28.6 79.4 -15.3 -1.9 -7.5
CTCATGCCTTCAAACCGGGA 4417 SEQ ID NO:2075 -11.4 -26.5 71.2 -15.1 0 -7.1
AACATTATCAAAGTTTACTT 4661 SEQ ID NO:2076 -11.4 -16 52.2 -3.9 -0.4 -5.5
ACAGATTTTCTTCATATACA 4779 SEQ ID NO:2077 -11.4 -18.6 58.9 -7.2 0 -2.6
ATCATGGTGACCATGTTGAG 5083 SEQ ID NO:2078 -11.4 -22.9 67.6 -8.3 -3.2 -11.5
TAGTAGTGTCTGAGGGAAAC 5203 SEQ ID NO:2079 -11.4 -20.7 64 -9.3 0 -3.2
AGTTGGACATCCCAAAGATG 5481 SEQ ID NO:2080 -11.4 -22.3 64.3 -8.7 -2.2 -8
CCAGCAGAGGTTGTAATTTG 5581 SEQ ID NO:2081 -11.4 -22.7 67.1 -11.3 0 -5.7
ATCCCAGCCAGCAGAGGTTG 5588 SEQ ID NO: 2082 -11.4 -29.2 80.9 -17.1 -0.5 -4.9
AGTCATCCTCACTCAGGGGC 5820 SEQ ID NO: 2083 -11.4 -28.3 82.6 -16 -0.8 -7.6
GATGCCATAAACCTGTCTTC 6094 SEQ ID NO:2084 -11.4 -23.5 67.6 -12.1 0 -3
GCCTCTTTGTTATAGTTACT 6244 SEQ ID NO:2085 -11.4 -23 70.1 -11.6 0 -2.5
GTCAATCCTCCCTTTAATTG 6263 SEQ ID NO:2086 -11.4 -23.5 67.6 -11.6 -0.1 -3.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GTTCCCATTTAGTTTGTCAA 6308 SEQ ID NO:2087 -11.4 -23.3 69.4 -11.9 0 -2.7
ACTTTTCCTTGTCTGGTTTT 6393 SEQ ID NO:2088 -11.4 -24 72.7 -12.6 0 -3.2
AAACTATGAATTGGGGACCA 6862 SEQ ID NO:2089 -11.4 -20.5 59.7 -6.9 -2.2 -7.2
ATAAACTATGAATTGGGGAC 6864 SEQ ID NO:2090 -11.4 -17.5 54.4 -6.1 0 -3.1
CTTTACAGGCACATAACTGT 7109 SEQ ID N0:2091 -11.4 -21.6 64.3 -8.8 -1.3 -5
AATAATCCTTTAAATATTAG 7135 SEQ ID NO:2092 -11.4 -13.6 46.8 -2.2 0 -5.3
CTTGACATAATGGACAGAGC 7658 SEQ ID NO: 2093 -11.4 -20.6 61.8 -9.2 0 -3.1
TTATTCTGCTTGACATAATG 7666 SEQ ID NO:2094 -11.4 -18.5 57.8 -7.1 0 -3.6
TCTAACTTTTATTTTAGGAA 8010 SEQ ID NO:2095 -11.4 -16.5 53.8 -5.1 0 -3.2
CAACTTTGCCACTTTGTTCA 8279 SEQ ID NO:2096 -11.4 -23.5 68.2 -12.1 0 -3.1
CAAAAATTTATATCATGTTA 8309 SEQ ID NO:2097 -11.4 -13.6 46.8 -2.2 0 -5.2
AGCTCACCATTCTTTTTAGC 8421 SEQ ID NO:2098 -11.4 -24 71.7 -12.1 -0.1 -4.3
TGAAATGCAATAAAAAATGA 8470 SEQ ID NO:2099 -11.4 -11.8 42.6 0 0 -5.1
ACCTTTCCAGAATCCTCTCT 21 SEQ ID NO: 2100 -11.3 -26.2 74.6 -14.9 0 -3.5
AGAGACCTTTCCAGAATCCT 25 SEQ ID NO: 2101 -11.3 -24.8 70.7 -13.5 0 -2.9
AGTTACAATTTTTTTTCTTT 69 SEQ ID NO: 2102 -11.3 -17.4 56.7 -6.1 0 -2.6
CTGCACATTTAATTACGTGT 443 SEQ ID N0:2103 -11.3 -20.7 61.6 -8.8 -0.3 -5.2
AGTCACTATTTGGCTTTGGT 615 SEQ ID NO: 2104 -11.3 -23.8 72 -11.8 -0.4 -3.7
GAACAGCTGCAGCCCAATGA 1259 SEQ ID NO: 2105 -11.3 -26.4 71.9 -13 0 -12.4
GTAAAGATTTTCCCAATAGT 1619 SEQ ID NO:2106 -11.3 -19.7 59.6 -8.4 0 -3.2
TCCTAACCCACCTACTCCAC 1889 SEQ ID NO:2107 -11.3 -28.4 75.7 -17.1 0 -0.3
CAAGGTGCTCTCTCTGTCTT 1989 SEQ ID NO:2108 -11.3 -25.6 77.2 -14.3 0 -3.6
GATCAAGAACACATTGGCAA 2669 SEQ ID NO:2109 -11.3 -19.8 58.9 -8.5 0 -4.7
CCCAGTAAAGACCAGGTTTC 2855 SEQ ID NO:2110 -11.3 -24.7 70 -13.4 0 -5.9
GAGCTAAATGAACTCAATAA 3418 SEQ ID NO:2111 -11.3 -16 51.2 -4 -0.4 -5.1
TTCAATTCCAGTATTATTGG 3620 SEQ ID NO:2112 -11.3 -19.7 60.7 -7.7 -0.4 -5
ATTAAGCTCTTTGCTTATTT 3638 SEQ ID NO:2113 -11.3 -20 62.2 -5.7 -3 -7.5
TGAGGCTGGGGTTGTTTATG 3750 SEQ ID NO: 2114 -11.3 -24.5 72.5 -13.2 0 -3.7
TTCACGTTTTTCCACCGAGC 4642 SEQ ID NO: 2115 -11.3 -26.3 72.6 -15 0 -4.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TAATATCCATCCAGCCTTTA 4719 SEQ ID NO:2116 -11.3 -23.5 67.4 -12.2 0 -3.2
CCTTGGAATTTGTTTGCTGG 5002 SEQ ID NO:2117 -11.3 -23.6 68.3 -12.3 0 -4.3
CCAAAGGTCTCAAAGTTGAA 5539 SEQ ID NO:2118 -11.3 -19.9 59.3 -8.6 0 -5.4
TGCCAAAGGTCTCAAAGTTG 5541 SEQ ID NO: 2119 -11.3 -21.8 63.8 -10.5 0 -4
AGGAGGATCCAGGGCAGCTG 5921 SEQ ID NO:2120 -11.3 -28.3 80 -14.3 -2.6 -12.5
AGTGGATCCGGTCACCACTG 5997 SEQ ID NO:2121 -11.3 -27.7 76.6 -13.3 -3 -13.5
GGCTCATAAGAGACTTTGGA 6121 SEQ ID NO: 2122 -11.3 -22.3 66.5 -9.6 -1.3 -5
TGCCTCTTTGTTATAGTTAC 6245 SEQ ID NO: 2123 -11.3 -22.1 67.8 -10.8 0 -3
GGTTTTGTTACACTATCATA 6379 SEQ ID NO:2124 -11.3 -20.2 63 -8.9 0 -2.7
TACTTTTGATTTTCTCTGAC 6454 SEQ ID NO: 2125 -11.3 -19.4 61.4 -8.1 0 -2.4
TCTTTTTACTTTTGATTTTC 6460 SEQ ID NO:2126 -11.3 -18.1 58.8 -6.8 0 -2
TATCCCTATAGTCTAGGTAG 6723 SEQ ID NO: 2127 -11.3 -22.7 69.1 -10 -1.3 -4.6
TCTTCAACGTAAACCTCATT
6911 SEQ ID NO:2128 -11.3 -20.6 60.7 -9.3 0 -5.3 TTCTTCAACGTAAACCTCAT
6912 SEQ ID NO: 2129 -11.3 -20.6 60.7 -9.3 0 -5.3 CATTTGAGAGACAGGGTTCT
6942 SEQ ID NO:2130 -11.3 -22.6 68.2 -11.3 0 -3.6
ATTAAATATAGAGCTCTGAA 7202 SEQ ID NO:2131 -11.3 -16.3 52.7 -4 0 -10
ATTCATTCTATCACCAATAT 7631 SEQ ID NO:2132 -11.3 -19.3 59.4 -8 0 -2.4
ATTCTGCTTGACATAATGGA 7664 SEQ ID NO:2133 -11.3 -20.5 61.8 -9.2 0 -3.3
CTTCAAATTATTCTGCTTGA 7673 SEQ ID NO: 2134 -11.3 -19.3 59.5 -8 0 -3.6
AAGTGAAATGCAATAAAAAA 8473 SEQ ID NO:2135 -11.3 -11.7 42.4 0 0 -5.6
ATTAATACCTTATGTATACA 8898 SEQ ID NO:2136 -11.3 -17.2 54.7 -5 -0.8 -7.9
TTTATTATGGGAGAATTATG
9062 SEQ ID NO:2137 -11.3 -16.4 53.2 -5.1 0 -3.2 ATTTATTATGGGAGAATTAT
9063 SEQ ID NO:2138 -11.3 -16.4 53.2 -5.1 0 -3.2 GACCTTTCCAGAATCCTCTC
22 SEQ ID NO: 2139 -11.2 -25.9 74 -14.7 0 -3.5
ACAGGTATCTCATCCCTGTC 269 SEQ ID NO:2140 -11.2 -26.3 77.4 -12.6 -2.5 -7.5
GTCACTATTTGGCTTTGGTT 614 SEQ ID NO: 2141 -11.2 -23.9 72 -12.7 0 -3.7
TTTTCTTATTGATATAGTAG 717 SEQ ID NO: 2142 -11.2 -16.4 54.7 -5.2 0 -2.7
GTTTTCAGTGCTCGGAGAAC 1129 SEQ ID NO: 2143 -11.2 -23.6 69.9 -11.8 -0.3 -6.4
GTGTAGCCATAGTTGGGGTT 1543 SEQ ID NO: 2144 -11.2 -26.5 78.3 -13.8 -1.4 -4.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
AGAGGAATCCTCCAGCATCT 2552 SEQ ID N0:2145 -11.2 -25.9 74 -12.5 -2.2 -11.2
CCATAAAGAGGGTATTTAAG 2784 SEQ ID NO:2146 -11.2 -18.1 55.9 -6.9 0 -3.1
CAAGGTGAGGTTTCCTAGAG 3113 SEQ ID NO: 2147 -11.2 -23.2 69.2 -11.3 -0.5 -4.4
ACAAGGTTTCCAATGACCAT 3373 SEQ ID NO:2148 -11.2 -22.7 64.9 -9.9 -1.5 -5.8
AACACTCCCGCATCTTATTT 3528 SEQ ID NO:2149 -11.2 -24.3 68.1 -13.1 0 -3.6
CATCGATTACGTATTTTTCA 3711 SEQ ID NO:2150 -11.2 -19.7 59.5 -7.6 -0.7 -6.3
ACACCCTTCAGTAAAACAAG 3971 SEQ ID NO:2151 -11.2 -20.2 59.2 -9 0 -2.9
AACAATACTGTAGCAGGTTT 4061 SEQ ID NO: 2152 -11.2 -20.3 61.8 -8.2 -0.7 -5.3
GGGATAAGGCTCTTAGAGGT 4401 SEQ ID NO:2153 -11.2 -24 71.5 -12.2 -0.3 -6.1
TTTTTCCACCGAGCTTGCTT 4636 SEQ ID NO:2154 -11.2 -26.7 74.3 -15 -0.2 -6.1
CAGATTTTCTTCATATACAG 4778 SEQ ID NO:2155 -11.2 -18.4 58.5 -7.2 0 -2.6
ATTTGTTTGCTGGGCGAGGT 4995 SEQ ID NO:2156 -11.2 -26.3 75.3 -14.3 -0.6 -4.4
GGATCATGATGCTGATATCA 5055 SEQ ID NO:2157 -11.2 -21.6 64.7 -9.5 -0.6 -8.5
TTGGACATCCCAAAGATGGC 5479 SEQ ID NO:2158 -11.2 -24.1 67.4 -11.2 -1.7 -7.8
TCATCAATTCCAGCTTCCTT 5515 SEQ ID NO:2159 -11.2 -24.9 72 -13.7 0 -4.5
ATCGGGATCAAACTTTTCCC 5861 SEQ ID NO:2160 -11.2 -23.7 66.7 -10.9 -1.5 -6.5
ACTCCCATCTGTTTTTTCTG 6335 SEQ ID NO:2161 -11.2 -24.5 72.3 -13.3 0 -2.1
TCCTTGTCTGGTTTTGTTAC 6388 SEQ ID NO:2162 -11.2 -23.8 72.6 -12.6 0 -3.2
GTTTGGCATGGACCTCCTCT 6552 SEQ ID NO:2163 -11.2 -28.6 80.6 -16.9 -0.1 -5.1
ATAGAATGGATGCAAGGACT 6788 SEQ ID NO:2164 -11.2 -20.1 60.2 -8.9 0 -5.6
AGGCACATAACTGTTCAGAT 7103 SEQ ID NO: 2165 -11.2 -21.7 65 -10 -0.2 -5.6
ACATAGACTATCAGCTTTGC 7347 SEQ ID NO:2166 -11.2 -21.8 66.2 -10.6 0 -4.5
TGTTGGAAGCTTGCAAAAGA 7487 SEQ ID NO:2167 -11.2 -20.2 60 -6.9 -2.1 -7
ATAGCCTTTAAACTATGTTT 7531 SEQ ID NO:2168 -11.2 -19.1 58.8 -7.3 -0.3 -5
ACCATTCTTTTTAGCAATAG 8416 SEQ ID NO:2169 -11.2 -19.9 60.9 -8.7 0 -4.1
TTGAAAGAAGATGAGTTTAG 8795 SEQ ID NO:2170 -11.2 -15.5 51.2 -4.3 0 -2.2
TTAATACCTTATGTATACAT 8897 SEQ ID NO:2171 -11.2 -17.2 54.7 -5 -0.8 -9.3
AGCTTTTTTTTTTTTTTTTT 114 SEQ ID NO: 2172 -11.1 -18.3 59.3 -7.2 0 -4.3
CGTGTCTTCCTCTGGCAGCT 138 SEQ ID NO:2173 -11.1 -29.6 83.9 -18.5 0 -5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TCATCCCTGTCAAACCTTGA 260 SEQ ID NO: 2174 -11.1 -25.1 70.3 -13 -0.9 -4.3
TCCAGGTCCCTTCTGTGAAT 368 SEQ ID NO:2175 -11.1 -27.3 77.1 -15.7 -0.2 -4.2
TAGTAAAAAGGCGGAAGCTT 507 SEQ ID NO:2176 -11.1 -19.5 57.8 -6 -2.4 -7
GTCATAAATACACAGTTGGT
889 SEQ ID NO:2177 -11.1 -19.8 60.9 -8.7 0 -2.6 GGTCATAAATACACAGTTGG
890 SEQ ID NO:2178 -11.1 -19.8 60.4 -8.7 0 -2.8 GGGTTGCTCAAGGTCATAAA
901 SEQ ID NO: 2179 -11.1 -22.6 66.7 -11.5 0 -3.4
TGTGTAGCCATAGTTGGGGT 1544 SEQ ID NO: 2180 -11.1 -26.4 77.6 -13.8 -1.4 -4.8
TAACCCACCTACTCCACTGA 1886 SEQ ID NO:2181 -11.1 -26.6 72 -15.5 0 -1.6
CCATGTCTGTGCGGCACAAA 2305 SEQ ID NO:2182 -11.1 -26.2 71.5 -12.5 -1.4 -13.2
TACTTTTAACCATGCATCAC 2699 SEQ ID NO:2183 -11.1 -20.8 62 -9.7 0 -6.6
GAATTGCTCAGTCATGGGGT 2816 SEQ ID NO:2184 -11.1 -24.9 73.2 -13.8 0 -4.7
TTTCCAATGACCATGACCAA
3367 SEQ ID NO:2185 -11.1 -22.9 64 -11.8 0 -4.5 GTTTCCAATGACCATGACCA
3368 SEQ ID NO:2186 -11.1 -24.8 69 -13.7 0 -4.5 TTTGGAAACACTCCCGCATC
3534 SEQ ID NO:2187 -11.1 -24.7 68 -12.5 -1 -5.7
CTCTAAGATAATTAAGCTCT 3648 SEQ ID NO:2188 -11.1 -17.9 56.6 -6.8 0 -5.1
GGTGAGGCTGGGGTTGTTTA 3752 SEQ ID NO:2189 -11.1 -26.9 79.2 -15.8 0 -3.7
CAACAGCAATTGGCACTGTG 3774 SEQ ID NO:2190 -11.1 -22.8 65.5 -10.1 -1.6 -9.6
TCTCGGGGTAGAACAACATC 3904 SEQ ID NO:2191 -11.1 -22.4 65.5 -11.3 0 -3.7
CTTCTCGGGGTAGAACAACA 3906 SEQ ID NO:2192 -11.1 -23 66.2 -11.3 -0.3 -3.8
TACTGTAGCAGGTTTTTCGA 4056 SEQ ID NO:2193 -11.1 -22.8 68.4 -10.8 -0.7 -5.5
AGCACATTCATGATAGAGGG 4468 SEQ ID NO:2194 -11.1 -21.9 65.7 -10.8 0 -6.4
TATGGGTTTCTGAGGTTTCT 4976 SEQ ID NO:2195 -11.1 -23.3 71.5 -12.2 0 -2.8
GGCGAGGTATGGGTTTCTGA 4983 SEQ ID NO:2196 -11.1 -26.2 75.5 -15.1 0 -4
TTTGCCCTGGTCATCCGTTT 5108 SEQ ID NO:2197 -11.1 -29 79.5 -16.7 -1.1 -4.4
GCTTCAGCACAAATTCTCCA 5181 SEQ ID NO:2198 -11.1 -24.4 70 -13.3 0 -5.9
CATCCCAGCCAGCAGAGGTT 5589 SEQ ID NO:2199 -11.1 -29.9 82.1 -18.8 0 -4.6
GCTGGACTTTGTTGGGTTTT 5952 SEQ ID NO:2200 -11.1 -25 74.2 -13.9 0 -2.8
TCCTCCCTTTAATTGCCTCT 6258 SEQ ID NO:2201 -11.1 -27.9 77.1 -16.8 0 -3
AAGTCAATCCTCCCTTTAAT 6265 SEQ ID NO:2202 -11.1 -22.7 65.5 -11.6 0 -2.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TTTATAGGTAAGTCAATCCT 6274 SEQ ID NO:2203 -11.1 -19.9 61.5 -8.8 0 -3.8
CCTCTTTTCCTTTGCTTTCT 6435 SEQ ID NO:2204 -11.1 -26.2 76.6 -15.1 0 -3.6
TAGTTACAATGTTCACTTTG 6749 SEQ ID NO:2205 -11.1 -18.6 58.9 -7.5 0 -5.6
AAAACACCTTTGTCTGATCA 6960 SEQ ID NO:2206 -11.1 -20.3 60.5 -8.5 -0.5 -6.8
ACTTTACAGGCACATAACTG 7110 SEQ ID NO:2207 -11.1 -20.6 61.8 -8.8 -0.5 -4
AAGCAATACTTTAGATATAT 7272 SEQ ID NO:2208 -11.1 -15.8 51.7 -4.7 0 -4.1
TTGATTTAATAGAAGTTGTT 7446 SEQ ID NO:2209 -11.1 -16.1 53 -5 0 -2.5
AGCATAGGCAATATTAACAT 7560 SEQ ID NO:2210 -11.1 -18.9 57.8 -6.2 -1.6 -6.7
AGGTTGAATTCATTCTATCA 7638 SEQ ID NO:2211 -11.1 -19.8 61.8 -8.2 0.3 -8.4
CCATATGATACTCATGTTGA 7728 SEQ ID NO:2212 -11.1 -20.8 62.5 -8.8 -0.8 -6
TATCCAGTGTGTTTCCTTGA 7762 SEQ ID NO: 2213 -11.1 -24.6 73.1 -13.5 0 -3.7
TTTAGGAAATTATCCATTGA 7998 SEQ ID NO:2214 -11.1 -17.9 55.8 -4.6 -2.2 -7.2
TATCTAACTTTTATTTTAGG 8012 SEQ ID NO:2215 -11.1 -16.3 53.8 -5.2 0 -3.2
TGAGTGTTTGACCAATGTAT 8086 SEQ ID NO:2216 -11.1 -20.9 63.1 -9.8 0 -3.4
CATGTTATATTTGTAATAGC 8239 SEQ ID NO:2217 -11.1 -17.3 55.7 -6.2 0 -3.5
AACAAAAATTTATATCATGT 8311 SEQ ID NO:2218 -11.1 -13.3 45.9 -2.2 0 -4.7
ATGAAATTTATTCTTTTGGC 8454 SEQ ID NO: 2219 -11.1 -17.8 56.2 -5.6 -1 -5.2
GAGTTTATATAATGCATTTA 8875 SEQ ID NO:2220 -11.1 -16.8 54.4 -5 0 -8.8
AGAGTTTGGTTTTGACCTCA 8974 SEQ ID NO:2221 -11.1 -23.5 70.6 -10.1 -2.3 -6.3
CTTTCTCTGTGGATAAGAAA 49 SEQ ID NO: 2222 -11 -18.9 58.6 -6.8 -1 -4.5
TTTTTTTTTTTTTTTTTTTT 111 SEQ ID NO: 2223 -11 -15.9 53.7 -4.9 0 0
ATTCTTTGCTCCTTTCCCAG 314 SEQ ID NO: 2224 -11 -26.9 76.8 -15.9 0 -3.6
TGTAGCTTCTTGCATACGAA 426 SEQ ID NO: 2225 -11 -22.2 65.4 -9.4 -1.8 -5.2
GTTGGTCAAAATAGTGCACA 875 SEQ ID NO:2226 -11 -21 62.9 -9 0 -9.9
AGCAAAACCCTCTTGCCAAG 990 SEQ ID NO:2227 -11 -24.7 67.4 -11.7 -2 -6.2
TTAACAAATGTCCCATTTGA 1372 SEQ ID NO: 2228 -11 -19.7 58.4 -4.9 -3.8 -10.4
CCTAACCCACCTACTCCACT 1888 SEQ ID NO:2229 -11 -28.9 75.9 -17.9 0 -0.3
TTGGAACTCAACTTTGATGC 1933 SEQ ID NO:2230 -11 -20.4 61.3 -9.4 0 -5
AAGGTGCTCTCTCTGTCTTC 1988 SEQ ID NO:2231 -11 -25.3 77.9 -14.3 0 -2.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TGGGGAAAACAGGGAGCCAC 2159 SEQ ID NO:2232 -11 -24.7 68.2 -13.1 -0.3 -4.3
TCGCTCTCCATGTCTGTGCG 2312 SEQ ID NO: 2233 -11 -28.6 79.6 -16.3 -1.2 -6.7
TGGAAGCCCTGGCACCATCC 2369 SEQ ID NO:2234 -11 -30.8 80.6 -18.2 -1.4 -10.4
CAGAGGAATCCTCCAGCATC 2553 SEQ ID NO:2235 -11 -25.7 73.1 -12.5 -2.2 -11.2
AAATGAAGACGATGATGGCC 3138 SEQ ID NO:2236 -11 -20.3 58.6 -9.3 0 -6.2
AACAGCAATTGGCACTGTGA 3773 SEQ ID NO: 2237 -11 -22.7 65.7 -10.1 -1.6 -9.6
TTTCAGCTTGTTCACCTTCT 3921 SEQ ID NO:2238 -11 -25 74.8 -14 0 -4.5
TCCCTTTGCCTTCTTCTGTA 4020 SEQ ID NO:2239 -11 -27.9 79.9 -16.9 0 -3
AGAAACATCAACGATCAAGA 4301 SEQ ID NO:2240 -11 -17.1 52.9 -6.1 0 -4.9
ATGTCAAACATGTTACCCGT 4576 SEQ ID NO:2241 -11 -23 65.2 -11.1 -0.6 -9
AGAATACTTTTCTATCATCT 5294 SEQ ID NO: 2242 -11 -18.4 58.7 -6.5 -0.8 -3.4
CTCCCTTAACTGAGCTGCCA 5670 SEQ ID NO: 2243 -11 -28.2 76.8 -17.2 0 -5.6
AGGTAAGTCAATCCTCCCTT 6269 SEQ ID NO:2244 -11 -25.7 73.4 -14.7 0 -4.7
TTTCTGGAGTGGAGTTCCCA 6321 SEQ ID NO: 2245 -11 -26.7 77.5 -14.6 -1 -8.7
GGAGGGGTGGTAGAGGAACT 6352 SEQ ID NO: 2246 -11 -25.5 74.3 -13.8 -0.5 -3.1
TTCTTTTTACTTTTGATTTT 6461 SEQ ID NO:2247 -11 -17.8 57.7 -6.8 0 -2.2
CAACGTTGATACCCTGCTTC 6648 SEQ ID NO:2248 -11 -24.9 69.3 -13 0 -9.8
TACAATGTTCACTTTGCACA 6745 SEQ ID NO:2249 -11 -21 63 -10 0 -5.4
ATTGGGGACCATGGAAATGC 6853 SEQ ID NO: 2250 -11 -23.4 65.9 -10 -2.4 -8.8
CAAAACACCTTTGTCTGATC 6961 SEQ ID NO:2251 -11 -20.3 60.5 -8.5 -0.6 -5.1
GAAAGCATTTGACCTAAATT 7219 SEQ ID NO: 2252 -11 -18 54.9 -6.3 -0.4 -4
TTACTTTTTGGAAAGCATTT 7229 SEQ ID NO: 2253 -11 -18.4 57.3 -5.8 -1.6 -5.5
TTATTAGATTACTTTTTGGA 7237 SEQ ID NO: 2254 -11 -17.3 56 -6.3 0 -2.4
GGATTTATTAGATTACTTTT 7241 SEQ ID NO: 2255 -11 -17.3 56.1 -6.3 0 -2.4
GATACAGGATACATCCCTGT 7504 SEQ ID NO: 2256 -11 -24.1 69.5 -10.3 -2.8 -8.2
AATATTAACATGCATTAGTG 7551 SEQ ID NO:2257 -11 -16.5 53 -5.5 0 -6.7
GCAATATTAACATGCATTAG 7553 SEQ ID NO: 2258 -11 -17.8 55.4 -5.5 -1.2 -6.7
ATAGGCAATATTAACATGCA 7557 SEQ ID NO:2259 -11 -18.9 57.5 -5.9 -2 -6.8
GACATTCTTTAACCAAGACT 7609 SEQ ID NO:2260 -11 -20 60.1 -8.2 -0.6 -3.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TTTTAGACATATTTTTAGCA 7814 SEQ ID NO:2261 -11 -17.8 57.1 -6.8 0 -4.1
TAGTTACAATTTTTTTTCTT
70 SEQ ID NO: 2262 -10.9 -17 55.7 -6.1 0 -2.6 TTAGTTACAATTTTTTTTCT
71 SEQ ID NO: 2263 -10.9 -17 55.7 -6.1 0 -2.6 ATTCTTACAATATCCCTAGA
338 SEQ ID NO:2264 -10.9 -20.7 62.2 -9.8 0 -3.8
AGGCGGAAGCTTTCAGGTCC 499 SEQ ID NO: 2265 -10.9 -27.7 77.9 -14.4 -2.4 -7.6
TTTGTTCTCATCATCATTAT 596 SEQ ID NO:2266 -10.9 -19.9 62.9 -9 0 -1.9
TCTTGATAGCAATTTTCCTA 822 SEQ ID NO: 2267 -10.9 -20.8 63.2 -9.3 -0.3 -0.5
TGGTTTCAAAAGCAGAATCG 1320 SEQ ID NO:2268 -10.9 -19.2 57.6 -8.3 0.4 -0.6
TGAGCCATTTCCACAGAGTA 1475 SEQ ID NO:2269 -10.9 -24.8 71.7 -13.9 0 -3.2
TTCGACCAGCCTTCACACAG 1524 SEQ ID NO: 2270 -10.9 -26.5 73.3 -15.6 0 -4.6
AAGGTGGCCTGATTCTGCTC 1756 SEQ ID NO:2271 -10.9 -26.7 76.8 -15.1 -0.4 -6.5
GCTTTTTAAGCTGTTCGAGC 1815 SEQ ID NO: 2272 -10.9 -23.7 70 -10.9 -1.9 -8.7
TTGGGGAAAACAGGGAGCCA 2160 SEQ ID NO: 2273 -10.9 -24.6 68 -13.1 -0.3 -4.7
TTGCGTCTTGGGGAAAACAG 2167 SEQ ID NO:2274 -10.9 -22.3 63.9 -11.4 0 -5.2
TTCGCCGTCTTCAAATGTGC 2267 SEQ ID NO:2275 -10.9 -25.2 70.2 -14.3 0 -2.8
GGGAAGTTGTCCAGTAGGTG 2465 SEQ ID NO:2276 -10.9 -25.2 74.8 -12.3 -2 -5.6
CAGTAAAGACCAGGTTTCCT 2853 SEQ ID NO:2277 -10.9 -23.6 68.3 -12.7 0 -5.9
CAGACCAAGCTCCATTAAAC 2975 SEQ ID NO: 2278 -10.9 -21.9 62.8 -11 0 -5
GACAGACCAAGCTCCATTAA 2977 SEQ ID NO:2279 -10.9 -23.2 66 -12.3 0 -5
TGCTTCCTTCAGATGAGCTG 3879 SEQ ID NO:2280 -10.9 -25.2 73.7 -12.9 -1.3 -5.3
CTTCTGTACTTACTTGACAG
4008 SEQ ID NO:2281 -10.9 -20.8 64.3 -8.8 -1 -4.6 TCTTCTGTACTTACTTGACA
4009 SEQ ID NO:2282 -10.9 -21.2 65.6 -10.3 0 -4.8 ' CAGGTTTTTCGAAGATTCCA
4048 SEQ ID NO:2283 -10.9 -22.4 65.5 -10.8 -0.4 -7.4
CAATGAAAGTCTCAAACCAG 4089 SEQ ID NO:2284 -10.9 -18.3 55.5 -6.8 -0.3 -3.4
CCCTCATGCCTTCAAACCGG 4419 SEQ ID NO: 2285 -10.9 -28.7 74.2 -17.8 0 -6.6
CATAAAGATGTCTTGACCTC 4907 SEQ ID NO:2286 -10.9 -20.3 61.4 -8.6 -0.6 -6.8
AACTAGGGTCATGTATTTGC 5123 SEQ ID NO: 2287 -10.9 -21.7 66 -10.8 0 -4.7
TCATCAAAGCAAAGAGCAGC 5400 SEQ ID NO:2288 -10.9 -20.8 61.7 -8.3 -1.6 -5.5
CACCACTGACCATGGGCAGA 5985 SEQ ID NO:2289 -10.9 -27.7 75 -15.7 -1 -8.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
AGGAAGGAGGAGGGGTGGTA
6360 SEQ ID NO:2290 -10.9 -25.6 74.7 -14.7 0 -0.6 TAGGAAGGAGGAGGGGTGGT
6361 SEQ ID NO:2291 -10.9 -25.6 74.7 -14.7 0 -0.2 AACTTTTCCTTGTCTGGTTT
6394 SEQ ID NO: 2292 -10.9 -23.2 69.7 -12.3 0 -3.2
GGCACTGACTATGAGTATTT 6585 SEQ ID NO:2293 -10.9 -21.9 66.1 -10.5 -0.1 -4.1
TGTTCACTTTGCACAACTAT
6740 SEQ ID NO:2294 -10.9 -21.2 63.8 -10.3 0 -5 ATGTTCACTTTGCACAACTA
6741 SEQ ID NO:2295 -10.9 -21.2 63.8 -10.3 0 -5 GTTACAATGTTCACTTTGCA
6747 SEQ ID NO:2296 -10.9 -21.4 64.8 -10.5 0 -5.4
ACTATGAATTGGGGACCATG 6860 SEQ ID NO:2297 -10.9 -21.9 63.4 -8.6 -2.4 -7.2
GGCACATAACTGTTCAGATA 7102 SEQ ID NO:2298 -10.9 -21.4 64.2 -10 -0.2 -5.6
TTTTTGGAAAGCATTTGACC 7225 SEQ ID NO: 2299 -10.9 -20.3 60.6 -8.7 -0.4 -4.1
TGGATTTATTAGATTACTTT 7242 SEQ ID NO:2300 -10.9 -17.2 55.7 -6.3 0 -2.4
ATTATTCTGCTTGACATAAT 7667 SEQ ID NO:2301 -10.9 -18.5 57.8 -7.1 -0.2 -4.2
TCCTCTCTGCTTATGCCTCC 9 SEQ ID NO: 2302 -10.8 -29.5 83.4 -17.8 -0.8 -4.6
110 SEQ ID NO: 2303 -10.8 -15.9 53.7 -5.1 0 0
TTGACAGGTATCTCATCCCT 272 SEQ ID NO:2304 -10.8 -25.4 73.8 -14.6 0 -3.1
GATTCTTTGCTCCTTTCCCA 315 SEQ ID NO:2305 -10.8 -27.5 77.9 -16.7 0 -3.6
CCAGGTCCCTTCTGTGAATT 367 SEQ ID NO:2306 -10.8 -27 75.8 -15.7 -0.2 -4.2
TCTCATCATCATTATCTTGT 591 SEQ ID NO:2307 -10.8 -21 65.8 -10.2 0 -1.9
TATTTGGCTTTGGTTTGTTC 609 SEQ ID NO:2308 -10.8 -22.3 68.7 -11.5 0 -3.7
ATATAGTAGGGATCCAGGTC 706 SEQ ID NO:2309 -10.8 -23.2 70.4 -11.6 -0.3 -8.9
TTTGTCCAGTCAGGAGGGTT 916 SEQ ID NO: 2310 -10.8 -26.3 78.4 -14.1 -1.3 -5.3
TCGCTTGGGGGCCACTGCAA 1303 SEQ ID NO:2311 -10.8 -30.2 80 -17.5 -1.9 -6.9
CCTGAGCTTCTTCCTGTTGC 1833 SEQ ID NO:2312 -10.8 -28.1 80.7 -17.3 0 -5.2
GCTTCTGAAGAACTTTCCAA 1915 SEQ ID NO: 2313 -10.8 -21.6 63.6 -10.1 -0.4 -8.3
CTCCATTCTTTAGCACCTTT 1951 SEQ ID NO: 2314 -10.8 -25.1 72.7 -14.3 0 -4.1
TTCAAGGTGCTCTCTCTGTC 1991 SEQ ID NO:2315 -10.8 -25.1 76.9 -14.3 0 -3.6
TCTCTCCTTTGTTGTTTCCT
2010 SEQ ID NO:2316 -10.8 -26.1 78.1 -15.3 0 0 CTCTCTCCTTTGTTGTTTCC
2011 SEQ ID NO:2317 -10.8 -26.1 78.1 -15.3 0 0 TTGCCCGACCTCTGAAACTG
2205 SEQ ID NO:2318 -10.8 -26 69.6 -15.2 0 -3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CTCCATGTCTGTGCGGCACA 2307 SEQ ID NO:2319 -10.8 -28.9 79.7 -15.6 -1.3 -13
TTCCCATTTGCTGGAAGCCC 2380 SEQ ID NO:2320 -10.8 -29 77.8 -16 -2.2 -6.6
CATTGCAATCCACAGTGCTG 2406 SEQ ID NO:2321 -10.8 -24.5 69.7 -12.1 -1.5 -9
GGTTTCCTAGAGCCCCCACA 3105 SEQ ID NO: 2322 -10.8 -31.6 84.2 -20.8 0 -3.8
ATCATCAGTAGCAGCAAGGT 3443 SEQ ID NO:2323 -10.8 -23.8 71.4 -13 0 -5.4
GGCTTTTTGGAAACACTCCC 3539 SEQ ID NO:2324 -10.8 -25.1 70.2 -13.2 -1 -5.8
ACTGTGACGGTGAGGCTGGG 3760 SEQ ID NO:2325 -10.8 -27.2 76.4 -16.4 0 -3.7
ATTTCTCTTTGCTTTCTTCT 3849 SEQ ID NO:2326 -10.8 -22.6 70.5 -11.8 0 -3.6
CATTTCCAGAATGAATATAT 4217 SEQ ID NO:2327 -10.8 -17.2 53.9 -5.4 -0.9 -5.7
ACATCAACGATCAAGAAATC 4297 SEQ ID NO:2328 -10.8 -16.9 ' 52.7 -6.1 0 -4.9
ACGTTTTTCCACCGAGCTTG 4639 SEQ ID NO:2329 -10.8 -26.1 71.7 -15.3 0 -5.3
ATTCTCCAGTGAACAGAACA 5169 SEQ ID NO:2330 -10.8 -21.3 63.3 -10 -0.2 -4.8
GCAGAGGTTGTAATTTGGAA 5578 SEQ ID NO:2331 -10.8 -21.1 63.6 -10.3 0 -5.7
GATGACCGCGATGTACATGT 5762 SEQ ID NO:2332 -10.8 -24.4 67.7 -12.9 0 -8.9
GGGCATCCATCTCTCCACTC 6060 SEQ ID NO:2333 -10.8 -29.2 82.9 -17.8 -0.3 -4
ATGCCATAAACCTGTCTTCC 6093 SEQ ID NO: 2334 -10.8 -24.9 69.9 -14.1 0 -3
TTTTCTGGAGTGGAGTTCCC 6322 SEQ ID NO:2335 -10.8 -26.1 76.8 -14.6 -0.5 -4.5
AGTTACAATGTTCACTTTGC 6748 SEQ ID NO:2336 -10.8 -20.7 63.8 -9.9 0 -5.3
AAGTTAAAAATAGAATGGAT 6797 SEQ ID NO:2337 -10.8 -12.9 45.1 -2.1 0 -2.8
TAAACTATGAATTGGGGACC 6863 SEQ ID NO:2338 -10.8 -19.5 58 -7.5 -1.1 -5.7
GCATTATGAATAAACTATGA 6873 SEQ ID NO:2339 -10.8 -15.9 51.2 -5.1 0 -3.5
ACAATTCTTTTTCTGGTTTT 7004 SEQ ID NO:2340 -10.8 -20 62.5 -9.2 0 -2.5
TTGGAAGCTTGCAAAAGACA 7485 SEQ ID NO:2341 -10.8 -19.9 59 -7 -2.1 -7
CCATAGTTGGTAGAAAATGA 8114 SEQ ID NO: 2342 -10.8 -18.9 57.5 -7.3 -0.6 -3.5
CCATGTTATATTTGTAATAG 8240 SEQ ID NO:2343 -10.8 -17.5 55.6 -6.7 0 -4.3
ATTCTTTTTAGCAATAGCAA
8413 SEQ ID NO: 2344 -10.8 -18.8 58.6 -6.3 -1.7 -4.5 CATTCTTTTTAGCAATAGCA
8414 SEQ ID NO: 2345 -10.8 -20.2 61.9 -7.7 -1.7 -4.5 AATTTATTCTTTTGGCTCAA
8450 SEQ ID NO: 2346 -10.8 -19.2 59.6 -8.4 0 -4.6
ACCCCAGAGCCCAATAAGTG 8488 SEQ ID NO:2347 -10.8 -27.5 72.9 -16.7 0 -3.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TTATATATATTTTAAACTGC 8533 SEQ ID NO:2348 -10.8 -14.4 48.9 -3.6 0 -5.2
TTGTAGGTGGTTACTACTAT 8736 SEQ ID NO:2349 -10.8 -21.2 65.9 -8.8 -1.6 -5.2
ATGAGTTTAGATGCTTATAG 8785 SEQ ID NO:2350 -10.8 -18.5 59.1 -7.7 0 -3.6 TACATAGGAGTTTATATAAT
8882 SEQ ID NO: 2351 -10.8 -15.9 52.5 -5.1 0 -5.5 ATACATAGGAGTTTATATAA
8883 SEQ ID NO:2352 -10.8 -15.9 52.5 -5.1 0 -5.2 AATTTTTTTTCTTTCTTTCT
63 SEQ ID NO:2353 -10.7 -18.3 59.3 -7.6 0 -2.3
GCTGTTCAGCTTTTTTTTTT 121 SEQ ID NO:2354 -10.7 -22.7 69.9 -10.9 -0.9 -9.3
GGGTATAACGTGTCTTCCTC 146 SEQ ID NO:2355 -10.7 -24.8 72.6 -14.1 0 -5.3
CCCTGTCAAACCTTGATGTG 256 SEQ ID NO:2356 -10.7 -24.8 69 -13.3 -0.6 -4.5
CTTTGCTCCTTTCCCAGTAA 311 SEQ ID NO: 2357 -10.7 -26.6 75.1 -15.9 0 -3.6
TTTCCGGAAAAGCTCCAGGT 381 SEQ ID NO:2358 -10.7 -25.3 69.7 -12.5 -1.9 -11.8
CAGTGCCTGTGCCATCTTTT 467 SEQ ID NO:2359 -10.7 -27.9 79.1 -16.4 -0.6 -5.2
TATTGATATAGTAGGGATCC
711 SEQ ID NO:2360 -10.7 -20.1 62.2 -8.9 0 -7.7 TTATTGATATAGTAGGGATC
712 SEQ ID NO:2361 -10.7 -18.2 58.5 -7.5 0 -4.1 AGAGCAAACACGCTCAGACA
1240 SEQ ID NO: 2362 -10.7 -22.9 65.3 -8.9 -3.3 -8.5
AGCAGAATCGCTTGGGGGCC 1310 SEQ ID NO:2363 -10.7 -29 78.7 -17.6 -0.5 -7.1
CCTTCACACAGATGTATCCT 1515 SEQ ID NO:2364 -10.7 -24.7 71.2 -13.4 -0.3 -3.7
TGTAGCCATAGTTGGGGTTT 1542 SEQ ID NO:2365 -10.7 -25.4 74.9 -13.8 -0.7 -4.8
CAAGGTGGCCTGATTCTGCT 1757 SEQ ID NO:2366 -10.7 -27 76.2 -15.6 -0.4 -7.2
GTCACTGGTCAGTCTGTTTC 2099 SEQ ID NO:2367 -10.7 -25.2 78.8 -14.5 0 -6.6
AGCCACGGATACTCAAGAGA 2145 SEQ ID NO:2368 -10.7 -23.7 67.3 -13 0 -5.4
GACAATAATTCCATCAAAGA 2948 SEQ ID NO:2369 -10.7 -17.3 53.6 -6.6 0 -2.9
AACACAATCAGGAAGGAGTG 3262 SEQ ID NO:2370 -10.7 -19.6 59.2 -8.4 -0.2 -4.7
AAGGTTTCCAATGACCATGA 3371 SEQ ID NO: 2371 -10.7 -22.4 64.4 -10.1 -1.5 -5.8
AACCACAAGGTTTCCAATGA 3377 SEQ ID NO:2372 -10.7 -22 62.9 -9.3 -2 -6.7
GGCCAATGCACCACTACTGA 4124 SEQ ID NO:2373 -10.7 -26.9 73.1 -14.7 -1.4 -7
AGCATATTCTAGCATGGTTT 4181 SEQ ID NO: 2374 -10.7 -22.4 68.1 -10.7 -0.9 -5
GAAATCTAGCCAGCACCAGG 4283 SEQ ID NO: 2375 -10.7 -25.3 70.6 -14.6 0 -4.6
TGAGGTTTCTTGGATCCAAG 4966 SEQ ID NO: 2376 -10.7 -22.8 67.7 -8.7 -1 -14.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo CACAGAATACTTTTCTATCA 5297 SEQ ID NO:2377 -10.7 -18.7 58.5 -7 -0.9 -4.6
GCAGGAGGCCGATGTTAAAC 5436 SEQ ID NO:2378 -10.7 -24.5 68.4 -13.2 -0.3 -7.7
TCAATTCCAGCTTCCTTTTT 5512 SEQ ID NO: 2379 -10.7 -24.1 70.4 -13.4 0 -4.5
TCTCCCTTAACTGAGCTGCC 5671 SEQ ID NO:2380 -10.7 -27.9 77.5 -17.2 0 -5.6
AAGGGCATCCATCTCTCCAC 6062 SEQ ID NO:2381 -10.7 -27.2 76.7 -15.3 -1.1 -4
AATAGGCTCATAAGAGACTT 6125 SEQ ID NO: 2382 -10.7 -19.4 59.8 -7.3 -1.3 -5.2
TCTGGAGTGGAGTTCCCATT
6319 SEQ ID NO:2383 -10.7 -26.6 77.1 -14.6 -1.2 -6.7 TTCTGGAGTGGAGTTCCCAT
6320 SEQ ID NO:2384 -10.7 -26.6 77.1 -14.6 -1.2 -8.7 TTCTGGTTTGTCTTTCTCAA
6413 SEQ ID NO:2385 -10.7 -22.4 69.4 -11.7 0 -2.7
CTTTTTACTTTTGATTTTCT 6459 SEQ ID NO: 2386 -10.7 -18.6 59.5 -7.9 0 -2.2
AGGCACTGACTATGAGTATT 6586 SEQ ID NO:2387 -10.7 -21.8 66 -10.5 -0.3 -4.1
TGCTTCACAGAGTTGCAGTG 6634 SEQ ID NO:2388 -10.7 -24.4 73.1 -13 -0.4 -5.3
CAGGCACATAACTGTTCAGA 7104 SEQ ID NO:2389 -10.7 -22.4 66.3 -11.7 0 -5.6
AAATAATCCTTTAAATATTA 7136 SEQ ID NO: 2390 -10.7 -12.9 45.2 -2.2 0 -5
TAAATATAGAGCTCTGAAAC 7200 SEQ ID NO:2391 -10.7 -15.7 51.2 -4 0 -10
TATTTAATTGACATAGACTA 7357 SEQ ID NO: 2392 -10.7 -15.6 51.5 -4.9 0 -2.7
TAGTGATAGCCTTTAAACTA 7536 SEQ ID NO:2393 -10.7 -19.2 59.1 -8.5 0 -4.2
TTAACCAAGACTTGTGAAGA 7601 SEQ ID NO:2394 -10.7 -18.8 57.2 -7.6 -0.2 -5.4
ATCCAGTGTGTTTCCTTGAA 7761 SEQ ID NO.-2395 -10.7 -24.2 71.2 -13.5 0 -3.7
GTCAGTAGGCAGTATCCAGT 7774 SEQ ID NO:2396 -10.7 -26.1 79.1 -14.9 -0.2 -4
TGTTCATGGCTAAAAAGAAC 8265 SEQ ID NO: 2397 -10.7 -17.3 54 -5.6 -0.9 -5.3
AAAAATTTATATCATGTTAG 8308 SEQ ID NO:2398 -10.7 -12.9 45.5 -2.2 0 -5.2
GAAATGCAATAAAAAATGAA 8469 SEQ ID NO:2399 -10.7 -11.1 41.3 0 0 -5.6
AACCCCAGAGCCCAATAAGT 8489 SEQ ID NO:2400 -10.7 -26.8 70.9 -16.1 0 -3.2
CCTGAAAGTTGGAACATGTG 8706 SEQ ID NO: 2401 -10.7 -20.6 60.6 -9.1 -0.6 -7
ATGGTTAGGGTATAACGTGT 153 SEQ ID NO: 2402 -10.6 -21.9 65.5 -9.3 -2 -5.3
TTCTTTGCTCCTTTCCCAGT 313 SEQ ID NO: 2403 -10.6 -28.1 80.5 -17.5 0 -3.6
AAGCTCCAGGTCCCTTCTGT 3 2 SEQ ID NO: 2404 -10.6 -29.4 82.9 -18.3 -0.2 -6.6
GGCGGAAGCTTTCAGGTCCT 498 SEQ ID NO:2405 -10.6 -28.6 79.6 -15.6 -2.4 -7.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GATCCAGGTCCTCCAGGGGC 696 SEQ ID NO:2406 -10.6 -31.9 88.2 -20 -1.2 -8.4
GGTCAAAATAGTGCACATGA 872 SEQ ID NO: 2407 -10.6 -20.3 60.8 -8.7 0 -9.9
ACATAAAAGTGACTGTCATC 1432 SEQ ID NO:2408 -10.6 -18.1 56.8 -6.8 -0.1 -8.8
TCGCCGTCTTCAAATGTGCT 2266 SEQ ID NO: 2409 -10.6 -26 71.7 -15.4 0 -3.6
ACATACTGGCCTGACTAACG 2343 SEQ ID NO:2410 -10.6 -23.3 65.5 -12.7 0 -7.2
CTCTGGGGGAAGTTGTCCAG 2471 SEQ ID NO: 2411 -10.6 -26.5 76.4 -13.9 -2 -7.8
AGAACACATTGGCAAATCTA 2664 SEQ ID NO: 2412 -10.6 -19.1 57.8 -8.5 0 -4.4
CCAATGATCTTAATTAGCAT 3079 SEQ ID NO:2413 -10.6 -19.3 58.4 -8.7 0 -4.2
TCCAATGACCATGACCAACA 3365 SEQ ID NO:2414 -10.6 -23.6 64.9 -13 0 -4.5
CAGCAAGGTTGTCTGAGCTA 3432 SEQ ID NO: 2415 -10.6 -24.5 72.7 -12.8 -1 -7.1
ACTCCCGCATCTTATTTTTC 3525 SEQ ID NO:2416 -10.6 -24.7 70.9 -14.1 0 -3.6
GGCTTTCTAAAAAAGGCTTT 3553 SEQ ID NO: 2417 -10.6 -19.7 59.1 -7.6 -1.4 -6.2
CCTTCATGGATTTCTATAAC 3577 SEQ ID NO:2418 -10.6 -20.3 61.6 -9.7 0 -5
TTCCAGTATTATTGGACATG 3615 SEQ ID NO:2419 -10.6 -20.7 62.8 -8.6 -1.4 -7.5
TCTCTAAGATAATTAAGCTC 3649 SEQ ID NO: 2420 -10.6 -17.4 55.9 -6.8 0 -5.1
TTGATAGTCTTTCGCTGTTC 4162 SEQ ID NO: 2421 -10.6 -22.7 69.4 -12.1 / 0 -3.4
TTGTCAGCATATTCTAGCAT 4186 SEQ ID NO:2422 -10.6 -22.2 67.8 -10.6 -0.9 -4.1
AGCCAGCACCAGGCATTAGT 4276 SEQ ID NO: 2423 -10.6 -28.6 79.9 -15.3 -2.7 -7.4
AACGATCAAGAAATCTAGCC 4292 SEQ ID NO: 2424 -10.6 -19.3 57.3 -8.7 0 -4.9
CAACCACCCTCATGCCTTCA 4425 SEQ ID NO: 2425 -10.6 -29 76.7 -18.4 0 -4.4
CCGTTGTCATGTTAACACAG 4560 SEQ ID NO:2426 -10.6 -22.5 65.4 -11.1 -0.5 -8.7
TTTCTTCATATACAGGCTGA 4773 SEQ ID NO: 2427 -10.6 -21.5 65.6 -10.9 0 -4.1
TCTGTTCCTCTGTCATAAAG 4920 SEQ ID NO:2428 -10.6 -21.8 66.3 -11.2 0 -1.8
AATTTGTTTGCTGGGCGAGG 4996 SEQ ID NO: 2429 -10.6 -24.4 69.6 -13 -0.6 -4.4
GTGACCATGTTGAGGCAGAT 5077 SEQ ID NO:2430 -10.6 -24.9 72.1 -13.8 -0.1 -4
TTCTCCAGTGAACAGAACAA 5168 SEQ ID NO: 2431 -10.6 -20.6 61.3 -10 0 -3.9
AGAGCAGGAGGCCGATGTTA 5439 SEQ ID NO: 2432 -10.6 -26.3 74.2 -14.8 -0.8 -7.7
GATCATGCTGTTGCCAAAGG 5552 SEQ ID NO: 2433 -10.6 -24 68.5 -12.5 -0.8 -5.9
ACAGATGGGTCCCCACGGTC 5689 SEQ ID NO:2434 -10.6 -30 80.9 -18.7 -0.3 -8.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GGATGACCGCGATGTACATG 5763 SEQ ID NO: 435 -10.6 -24.4 67.1 -12.9 -0.5 -9.4
TCTGCACTTTCTTCAGTAGC 5800 SEQ ID NO:2436 -10.6 -24.3 74.4 -13.1 -0.3 -4.8
CATGGGCAGATCCATGGCAA 5975 SEQ ID NO:2437 -10.6 -26.3 72.6 -12.9 -2.8 -9.7
TTTGATGCCATAAACCTGTC 6097 SEQ ID NO:2438 -10.6 -22.3 64.5 -11.7 0 -3
CTTTAATTGCCTCTTTGTTA 6252 SEQ ID NO:2439 -10.6 -21.4 64.7 -10.8 0 -3
GGAAGGAGGAGGGGTGGTAG 6359 SEQ ID NO:2440 -10.6 -25.6 74.7 -15 0 -0.7
TTCCTTGTCTGGTTTTGTTA 6389 SEQ ID NO: 2441 -10.6 -23.7 72.4 -13.1 0 -3.2
CTCCTCTTGAAGTCCAGTTG 6539 SEQ ID NO: 2442 -10.6 -25.1 73.6 -14.5 0 -3
TAGCCATTGGGTTTCTCCTC 6706 SEQ ID NO: 2443 -10.6 -27.1 78.8 -15.6 -0.8 -6.3
ACAATGTTCACTTTGCACAA 6744 SEQ ID NO: 2444 -10.6 -20.6 61.5 -10 0 -5.4
TTAAATATAGAGCTCTGAAA 7201 SEQ ID NO: 2445 -10.6 -15.6 51 -4 0 -10
CTATATATATATTTGCCCAA 7419 SEQ ID NO: 2446 -10.6 -19.4 58.4 -8.8 0 -6.7
AATAGAAGTTGTTTATCAGG 7439 SEQ ID NO:2447 -10.6 -17.6 56.5 -7 0 -2.9
AATGATACAGGATACATCCC 7507 SEQ ID NO:2448 -10.6 -21.3 62.3 -9.7 -0.9 -6.9
GCATTAGTGATAGCCTTTAA 7540 SEQ ID NO:2449 -10.6 -21.7 64.9 -11.1 0 -3.5
AACCCATTATCTAACTTTTA 8019 SEQ ID NO:2450 -10.6 -19.4 58.6 -8.8 0 -1.6
CAACCATAGTTGGTAGAAAA 8117 SEQ ID NO: 2451 -10.6 -18.5 56.2 -5.5 -2.4 -6.3
AACAAAGTCCATGTTATATT
8248 SEQ ID NO: 2452 -10.6 -17.9 55.8 -6.5 -0.6 -4.3 GAACAAAGTCCATGTTATAT
8249 SEQ ID NO:2453 -10.6 -18.4 56.7 -6.5 -1.2 -4.7 AGAACAAAGTCCATGTTATA
8250 SEQ ID NO:2454 -10.6 -18.4 56.9 -6.5 -1.2 -4.7 AATTTATTATGGGAGAATTA
9064 SEQ ID NO:2455 -10.6 -15.7 51.4 -5.1 0 -3.4 TAATTTATTATGGGAGAATT
9065 SEQ ID NO:2456 -10.6 -15.7 51.4 -5.1 0 -3.5
TTTTTTTTTTTTTTTTTCCA
9092 SEQ ID NO: 2457 -10.6 -18.7 59.5 -8.1 0 0
CAGTTTTCTTGCTCCATAAT
227 SEQ ID NO:2458 -10.5 -22.4 66.9 -11.9 0 -4.4
CCTTGACAGGTATCTCATCC 274 SEQ ID NO: 2459 -10.5 -25.4 73.8 -14.3 -0.3 -2.9
CTCATCATCATTATCTTGTT 590 SEQ ID NO:2460 -10.5 -20.7 64.6 -10.2 0 -1.9
GATATAGTAGGGATCCAGGT 707 SEQ ID NO: 2461 -10.5 -23.4 70.1 -12.1 -0.3 -8.9
CTTCTAAGCAAAACCCTCTT 996 SEQ ID NO: 2462 -10.5 -22.2 63.7 -11.7 0 -4.1
GGATCACGAAGAAACGTAAA 1018 SEQ ID NO: 2463 -10.5 -17.5 52.8 -6.2 -0.6 -6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CAAAAGCAGAATCGCTTGGG 1314 SEQ ID NO:2464 -10.5 -21.4 61.1 -9.1 -1.8 -9.3
ATTGTGCCATTAAAGTAGGA 1348 SEQ ID NO: 2465 -10.5 -20.9 62.5 -10.4 0 -3.5
GTAGCCATAGTTGGGGTTTC 1541 SEQ ID NO:2466 -10.5 -25.8 77 -13.8 -1.4 -4.8
TTCACCAAATAAAATGAGCC 1702 SEQ ID N0:2467 -10.5 -18.7 55.5 -8.2 0 -3.2
CTCTCCTTTGTTGTTTCCTT 2009 SEQ ID N0:2468 -10.5 -25.8 76.6 -15.3 0 0
CTCTCTCTCCTTTGTTGTTT 2013 SEQ ID NO:2469 -10.5 -25 76.3 -14.5 0 0
GAGGGGAGCAGAATTTTTTG 2118 SEQ ID NO:2470 -10.5 -21.7 64.9 -11.2 0 -4.1
ATGCATCACAGCAGTCCCAG 2688 SEQ ID NO:2471 -10.5 -27.3 77.1 -15.5 -1.2 -7.5
TGCTCAGTCATGGGGTAGTG 2812 SEQ ID NO: 2472 -10.5 -25.8 77.3 -15.3 0 -4.7
CAAGCTCCATTAAACTGAGG 2970 SEQ ID N0:2473 -10.5 -21.1 61.7 -10.1 -0.1 -5
TGAAGACGATGATGGCCAAC 3135 SEQ ID NO:2474 -10.5 -21.9 62 -10.6 0 -9.2
AGTGGAAGAAGTCGTTCATG 3246 SEQ ID NO:2475 -10.5 -21 63.4 -9.2 -1.2 -4.3
ACGCGGAACACAATCAGGAA 3268 SEQ ID NO:2476 -10.5 -22 61.3 -11 0 -7.9
TGGCTTTCTAAAAAAGGCTT
3554 SEQ ID NO:2477 -10.5 -19.6 58.7 -7.6 -1.4 -5.9 TTGGCTTTCTAAAAAAGGCT
3555 SEQ ID NO:2478 -10.5 -19.6 58.7 -7.6 -1.4 -5.9 AATTAAGCTCTTTGCTTATT
3639 SEQ ID NO:2479 -10.5 -19.2 59.7 -5.7 -3 -7.8
GGGGTTGTTTATGAATGACA 3743 SEQ ID NO:2480 -10.5 -21.4 64.1 -10.1 -0.6 -4.3
GCCAATGCACCACTACTGAG 4123 SEQ ID NO:2481 -10.5 -25.7 70.9 -14.4 -0.6 -5
GGCATTAGTGAAATATGTTT 4265 SEQ ID NO: 2482 -10.5 -19 58.9 -8.5 0 -4.1
TCAACGATCAAGAAATCTAG
4294 SEQ ID NO:2483 -10.5 -16.6 52.4 -6.1 0 -4.4 ATCAACGATCAAGAAATCTA
4295 SEQ ID NO: 2484 -10.5 -16.6 52.3 -6.1 0 -4.9 TTACCCGTTGTCATGTTAAC
4564 SEQ ID NO:2485 -10.5 -22.9 66.3 -12.4 0 -5.8
TTTAACATCTCGTGAATCAA 4751 SEQ ID NO:2486 -10.5 -18.1 55.9 -7.6 0 -4.6
CATGTACAGATTTTCTTCAT 4784 SEQ ID NO:2487 -10.5 -19.9 62 -9.4 0 -6.7
GGTTTCTTGGATCCAAGTTT 4963 SEQ ID NO:2488 -10.5 -23.6 70.4 -9.7 -0.7 -14.9
GACCATGTTGAGGCAGATGA 5075 SEQ ID NO:2489 -10.5 -24.3 70.1 -13.8 0 -4.3
TCTCCAGTGAACAGAACAAT 5167 SEQ ID NO: 2490 -10.5 -20.5 60.9 -10 0 -3.9
GAAACGAGCTTCAGCACAAA 5188 SEQ ID NO:2491 -10.5 -20.7 59.9 -9.3 -0.7 -6.6
CTTTTCTATCATCTCAGCCA 5288 SEQ ID NO: 2492 -10.5 -24.2 72.1 -13.7 0 -3.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CGTGCGGATCCCCTTTGCTC 5381 SEQ ID NO:2493 -10.5 -31 81.3 -19.8 -0.4 -7.3
CCCTTAACTGAGCTGCCAGG 5668 SEQ ID NO: 2494 -10.5 -28.1 76.1 -16.7 -0.6 -9.3
TTCTCCAGGATGACCGCGAT 5770 SEQ ID NO:2495 -10.5 -27.1 73 -15.2 -1.3 -6.7
GGGCAGCTGCAAAATCAGAG 5910 SEQ ID NO:2496 -10.5 -23.7 67.7 -10.3 -0.7 -14
GGCATCCATCTCTCCACTCT 6059 SEQ ID NO:2497 -10.5 -28.9 82.2 -18.4 0 -4
AGACACCTCCTCTTGTTTAC 6161 SEQ ID NO: 2498 -10.5 -24.6 72.3 -14.1 0 -3
CTATCATAGGAAGGAGGAGG 6367 SEQ ID NO:2499 -10.5 -21.3 64.2 -10.8 0 -3.4
CATATACTTTACCTTCATAG 6516 SEQ ID NO:2500 -10.5 -19.1 59.3 -8.6 0 -2.4
AGGTAGCCATTGGGTTTCTC 6709 SEQ ID NO:2501 -10.5 -26.2 77.9 -15.1 -0.3 -6.3
TGATCATTTGAGAGACAGGG 6946 SEQ ID NO: 2502 -10.5 -21 63.7 -10.5 0 -6
TTTATTAGATTACTTTTTGG 7238 SEQ ID NO:2503 -10.5 -16.8 55 -6.3 0 -2.4
TTTCTAGAATGGATTTATTA 7251 SEQ ID NO:2504 -10.5 -16.6 54.2 -5.6 0 -7.7
CAGGCTATATATATATTTGC 7423 SEQ ID NO:2505 -10.5 -19.1 59.5 -7.9 0 -8.7
TATTAACATGCATTAGTGAT 7549 SEQ ID NO:2506 -10.5 -17.8 56.2 -7.3 0 -6.7
GGCAGTATCCAGTGTGTTTC 7767 SEQ ID NO: 2507 -10.5 -25.9 78.3 -15.4 0 -4
AATACCTTATGTATACATAG 8895 SEQ ID NO:2508 -10.5 -17.1 54.5 -5 -0.8 -10.9
CAGGAGGGTTGCTCAAGGTC 906 SEQ ID NO:2509 -10.4 -26.1 76.9 -13.7 -2 -4.5
CTTTGTCCAGTCAGGAGGGT 917 SEQ ID NO:2510 -10.4 -27.1 80.2 -15.8 -0.8 -5.3
ATTTTTATAAGTGACTCAAA 970 SEQ ID NO: 2511 -10.4 -15.7 51.6 -5.3 0 -4.7
ATTCCTCAGATTGCCCATGA 1277 SEQ ID NO:2512 -10.4 -26.3 73.6 -15.9 0 -4.5
CCTTCCAGTTAAATGTGCTC 1401 SEQ ID NO:2513 -10.4 -24 69.6 -13.6 0 -5.1
AGGTGGCCTGATTCTGCTCC 1755 SEQ ID NO: 2514 -10.4 -29.4 83.2 -19 0 -7.2
CAGAATTTTTTGTCACTGGT 2110 SEQ ID NO:2515 -10.4 -20.9 63.9 -10.5 0 -3.5
TGGCCTGACTAACGTTACTG 2337 SEQ ID NO:2516 -10.4 -23.7 67.1 -12.8 0 -7.9
ACTGGCCTGACTAACGTTAC 2339 SEQ ID NO:2517 -10.4 -23.9 67.8 -13 0 -7.9
GTGCCCTCTGGGGGAAGTTG 2476 SEQ ID NO:2518 -10.4 -29.2 81.1 -16.6 -2.2 -8.7
GAGGGTATTTAAGACAATGC 2777 SEQ ID NO: 2519 -10.4 -19.7 60.2 -9.3 0 -2.9
TCCCGCATCTTATTTTTCAC 3523 SEQ ID NO:2520 -10.4 -24.5 70.1 -14.1 0 -3.6
CACCCTTCAGTAAAACAAGC 3970 SEQ ID NO:2521 -10.4 -21.8 62.5 -11.4 0 -2.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TGCCTTCTTCTGTACTTACT
4014 SEQ ID NO:2522 -10.4 -24.4 72.9 -14 0 -4.8 TTGCCTTCTTCTGTACTTAC
4015 SEQ ID NO:2523 -10.4 -23.6 71.2 -13.2 0 -4.8 AGGCATTAGTGAAATATGTT
4266 SEQ ID NO:2524 -10.4 -18.9 58.7 -8.5 0 -4
CAAAGAAACATCAACGATCA 4304 SEQ ID NO:2525 -10.4 -16.5 51.2 -6.1 0 -4.9
GGATAAGGCTCTTAGAGGTC 4400 SEQ ID NO:2526 -10.4 -23.2 70.5 -12.2 -0.3 -6.1
ATGGTGACCATGTTGAGGCA 5080 SEQ ID NO:2527 -10.4 -25.5 73 -14 -1 -7.1
GTAGTAGTGTCTGAGGGAAA 5204 SEQ ID NO:2528 -10.4 -21.7 66.8 -11.3 0 -2.9
CATCAATTCCAGCTTCCTTT 5514 SEQ ID NO:2529 -10.4 -24.6 70.7 -14.2 0 -4.5
GCTGCCAGGGTGAATTGTGT 5657 SEQ ID NO:2530 -10.4 -27.2 77.3 -16.8 0 -4.4
GTTCACCACAACCAGGAAGG 5744 SEQ ID NO:2531 -10.4 -24.7 69.1 -13.8 -0.2 -4
TCACTCAGGGGCTCTGCACT 5812 SEQ ID NO:2532 -10.4 -28.5 82 -17.5 -0.3 -4.8
ATGGGCAGATCCATGGCAAT 5974 SEQ ID NO:2533 -10.4 -25.6 71.5 -14 -1.1 -8
CTGGAGTGGAGTTCCCATTT 6318 SEQ ID NO:2534 -10.4 -26.3 75.7 -14.6 -1.2 -6.7
ACCTCTTTTCCTTTGCTTTC 6436 SEQ ID NO: 2535 -10.4 -25.5 75.2 -15.1 0 -3.6
TGACCTCTTTTCCTTTGCTT 6438 SEQ ID NO:2536 -10.4 -25.6 74.2 -15.2 0 -3.6
TCCAGTTGACACATATACTT 6527 SEQ ID NO: 2537 -10.4 -21.4 64.3 -10.5 -0.2 -3.6
GCCATCTAGAAAATGGAAGT 7043 SEQ ID NO: 2538 -10.4 -20.3 60 -8.3 -1.6 -8.3
AATTAAATATAGAGCTCTGA 7203 SEQ ID NO:2539 -10.4 -16.3 52.7 -4.9 0 -10
TGCATTAGTGATAGCCTTTA 7541 SEQ ID NO:2540 -10.4 -22.4 67.1 -12 0 -4.7
ATATTTAAACAAGTTTTAGA 7827 SEQ ID NO:2541 -10.4 -14.2 48.5 -3.8 0 -5.5
AATAAAAGGTTATATTGAGG 8137 SEQ ID NO: 2542 -10.4 -14.7 49 -3.7 -0.3 -2.8
CTACAGTAAATAGTTTTGTA 8367 SEQ ID NO: 2543 -10.4 -17.1 55.4 -6.7 0 -4.1
ATTTATTCTTTTGGCTCAAT 8449 SEQ ID NO:2544 -10.4 -19.9 61.6 -9.5 0 -4.9
GTTACTACTATTATTATCAA 8727 SEQ ID NO:2545 -10.4 -16.6 54.3 -6.2 0 -1.7
TAATACCTTATGTATACATA 8896 SEQ ID NO:2546 -10.4 -16.8 53.8 -5 -0.8 -10.5
TATCATTAATACCTTATGTA 8902 SEQ ID NO:2547 -10.4 -17.4 55.4 -7 0 -4.2
CAGCTTTTTTTTTTTTTTTT 115 SEQ ID NO:2548 -10.3 -18.9 60.3 -8.6 0 -4.5
TGTCAAACCTTGATGTGGCT 253 SEQ ID NO: 2549 -10.3 -23.8 68.5 -12.3 -1.1 -5.8
GTAGCTTCTTGCATACGAAT 425 SEQ ID NO:2550 -10.3 -22.2 65.5 -10.3 -1.5 -5.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ATCCTGCACATTTAATTACG 446 SEQ ID NO: 2551 -10.3 -20.7 60.8 -10.4 0 -4.8
ACAGTTGGTCAAAATAGTGC 878 SEQ ID NO: 2552 -10.3 -20.3 61.9 -10 0 -3.8
TCATAAATACACAGTTGGTC 888 SEQ ID NO:2553 -10.3 -19 59.2 -8.7 0 -2.8
CCTCTTGCCAAGATTTTTAT 982 SEQ ID NO:2554 -10.3 -22.8 66.3 -11.7 0.6 -6.3
AAATCCAGCCAGTTCCATGG 1036 SEQ ID NO:2555 -10.3 -25.8 71.5 -14.8 0.4 -7.7
TGAACAGCTGCAGCCCAATG 1260 SEQ ID NO:2556 -10.3 -25.8 70.5 -13 0 -13.2
CACAGATGTATCCTTCTGGA 1509 SEQ ID NO:2557 -10.3 -23.6 69.6 -11.7 1.6 -5.9
ACGTAATGTCAACTGGTAAA 1634 SEQ ID NO: 2558 -10.3 -18.6 56.5 -8.3 0 -4.4
TATCATGTATGTTTTCCCAG 1658 SEQ ID NO:2559 -10.3 -22.3 66.9 -12 0 -4.7
CTTTGATGCTTCTGAAGAAC 1922 SEQ ID NO: 2560 -10.3 -19.8 60.4 -9 0 -8.3
TGTCACTGGTCAGTCTGTTT
2100 SEQ ID NO:2561 -10.3 -24.8 76.5 -14.5 0 -6.6 TTGTCACTGGTCAGTCTGTT
2101 SEQ ID NO:2562 -10.3 -24.8 76.5 -14.5 0 -6.4 TTTGTCACTGGTCAGTCTGT
2102 SEQ ID NO:2563 -10.3 -24.8 76.5 -14.5 0 -6.6 AGAATTTTTTGTCACTGGTC
2109 SEQ ID NO:2564 -10.3 -20.6 64.2 -10.3 0 -3.3
CCAGCATCTCCATTGAAATC 2541 SEQ ID NO: 2565 -10.3 -23.3 66.7 -13 0 -4.1
TTTGGCTTTCTAAAAAAGGC 3556 SEQ ID NO:2566 -10.3 -18.8 57.2 -7.6 0.7 -4.5
TCTATCTTATTGCCTTCATG 3589 SEQ ID NO:2567 -10.3 -22.1 66.8 -11.8 0 -4.1
TCTAAGATAATTAAGCTCTT 3647 SEQ ID NO:2568 -10.3 -17.1 55 -6.8 0 -5.9
TTCTCGGGGTAGAACAACAT 3905 SEQ ID NO:2569 -10.3 -22.1 64.4 -11.3 0.1 -3.7
TTCTGTACTTACTTGACAGA 4007 SEQ ID NO:2570 -10.3 -20.5 63.6 -8.2 -2 -6.5
GAAACATCAACGATCAAGAA 4300 SEQ ID NO:2571 -10.3 -16.4 51.2 -6.1 0 -4.9
AGAGCATTCACAACCACCCT 4435 SEQ ID NO: 2572 -10.3 -26.5 72.5 -15.6 0.3 -4.1
ACAGCACATTCATGATAGAG 4470 SEQ ID NO: 2573 -10.3 -20.4 62.2 -10.1 0 -6.4
AATATCCATCCAGCCTTTAA 4718 SEQ ID NO:2574 -10.3 -23.1 65.8 -12.8 0 -3.2
CTGACCATGGGCAGATCCAT 5980 SEQ ID NO:2575 -10.3 -27 74.4 -15.5 1.1 -8.8
TCACCACTGACCATGGGCAG 5986 SEQ ID NO:2576 -10.3 -27.5 75.4 -15.7 1.4 -8.9
ATGATAGCGGCAGACACCTC 6172 SEQ ID NO:2577 -10.3 -25.6 71.9 -15.3 0 -6.6
TGTATAGGCACTGACTATGA 6591 SEQ ID NO:2578 -10.3 -21.4 64.6 -10.5 0.3 -4.8
AATAGAATGGATGCAAGGAC 6789 SEQ ID NO:2579 -10.3 -18.5 56.4 -8.2 0 -5.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TGAATAAACTATGAATTGGG 6867 SEQ ID NO:2580 -10.3 -15.4 49.9 -5.1 0 -3.1
GTATACTGTTTCTTCAACGT 6921 SEQ ID NO:2581 -10.3 -21.1 64.3 -9.7 -1 -7
TACAATTCTTTTTCTGGTTT 7005 SEQ ID NO:2582 -10.3 -19.6 61.5 -9.3 0 -2.6
AGCCATCTAGAAAATGGAAG 7044 SEQ ID NO:2583 -10.3 -19.1 57.4 -7.2 -1.6 -8.3
ATTAGAGGAGACTTTACAGG 7120 SEQ ID NO: 2584 -10.3 -19.9 61.8 -9.1 -0.1 -5.5
AAAATAATCCTTTAAATATT 7137 SEQ ID NO:2585 -10.3 -12.5 44.3 -2.2 0 -4.4
ATATAGAGCTCTGAAACTTA 7197 SEQ ID NO:2586 -10.3 -18.1 57 -6.8 0 -10
AAAGCATTTGACCTAAATTA 7218 SEQ ID NO:2587 -10.3 -17.1 53.2 -6.3 -0.1 -4
CTGTTGGAAGCTTGCAAAAG 7488 SEQ ID NO: 2588 -10.3 -20.5 60.6 -8.5 -1.7 -7
TGATACAGGATACATCCCTG 7505 SEQ ID NO:2589 -10.3 -22.9 66.2 -11.4 -1.1 -6.9
TTAGGAAATTATCCATTGAA 7997 SEQ ID NO:2590 -10.3 -17.1 53.7 -4.6 -2.2 -7.2
CTAACTTTTATTTTAGGAAA 8009 SEQ ID NO: 2591 -10.3 -15.4 50.8 -5.1 0 -2.8
ATCTAACTTTTATTTTAGGA 8011 SEQ ID NO: 2592 -10.3 -17.2 55.7 -6.9 0 -3.2
TGTAATAGCTTTAGTGCAGC 8228 SEQ ID NO:2593 -10.3 -22 67.2 -10.8 -0.8 -5.6
GTTCTTCAATACACTACAGT 8380 SEQ ID NO:2594 -10.3 -20.6 63.7 -10.3 0 -3.1
GAAAGTTGGAACATGTGAAC 8703 SEQ ID NO:2595 -10.3 -17.8 55.1 -6.7 -0.6 -7
AAGCTATTGTAGGTGGTTAC 8742 SEQ ID NO: 2596 -10.3 -21.5 66.2 -11.2 0 -5.1
AAGCTTTCAGGTCCTGGGGG 493 SEQ ID NO:2597 -10.2 -27.8 79.2 -16.8 -0.4 -9
AAGTGACTCAAAGGTATAGA 962 SEQ ID NO:2598 -10.2 -18.3 57.4 -8.1 0 -3.1
GCAAAACCCTCTTGCCAAGA 989 SEQ ID NO: 2599 -10.2 -25.3 68.3 -13.8 -1.2 -6.9
AACAGCTGCAGCCCAATGAG 1258 SEQ ID NO:2600 -10.2 -25.8 70.9 -13.1 0 -13.2
TAACAAATGTCCCATTTGAA 1371 SEQ ID NO:2601 -10.2 -18.9 56.4 -4.9 -3.8 -10.4
TCTTGAGTCATGAGTCGAAA 1600 SEQ ID NO:2602 -10.2 -20.5 62.2 -8.6 0 -11.6
CCCAATAGTCTTGAGTCATG 1608 SEQ ID NO:2603 -10.2 -23.2 68 -12.5 -0.2 -5.8
AGCTGCTTCTTTTGACGCTG 2061 SEQ ID NO:2604 -10.2 -25.4 73.2 -13.2 -2 -7.5
CAGATCCAACATCCTTTGCC 2220 SEQ ID NO:2605 -10.2 -25.9 71.8 -15.2 -0.1 -4.5
AAGAACACATTGGCAAATCT 2665 SEQ ID NO:2606 -10.2 -18.7 56.5 -8.5 0 -4.4
ATGATCGCAGTACAGACAAT 3009 SEQ ID NO:2607 -10.2 -20.9 61.9 -10 -0.4 -5.7
CTGTACTTACTTGACAGAAT 4005 SEQ ID NO:2608 -10.2 -19.3 59.6 -8.2 -0.8 -4.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TCTCAAACCAGTTGTGCTCA 4080 SEQ ID NO:2609 -10.2 -24.2 70.6 -13.3 -0.4 -5.2
AGTCTCAAACCAGTTGTGCT 4082 SEQ ID NO:2610 -10.2 -24.3 71.5 -14.1 0.2 -4.9
AGTGGTAGAACTTGCCAGCA 4542 SEQ ID NO:2611 -10.2 -25.4 73.3 -13.9 -1.2 -6.4
CTTTGATCAGACGTAGGATT 5361 SEQ ID NO: 2612 -10.2 -21.2 63.7 -11 0 -6.5
AAAGAGCAGCGTGCGGATCC
5390 SEQ ID NO:2613 -10.2 -26.3 71.4 -14.4 -1.4 -11.1 CAAAGAGCAGCGTGCGGATC
5391 SEQ ID NO: 2614 -10.2 -25 69.1 -12.6 -2.2 -8.5 AGCAGGAGGCCGATGTTAAA
5437 SEQ ID NO:2615 -10.2 -24.3 68.1 -13.2 -0.8 -7.7
TGGACTTTGTTGGGTTTTGC 5950 SEQ ID NO:2616 -10.2 -24.1 71.9 -13.9 0 -2.6
TTTAATTGCCTCTTTGTTAT 6251 SEQ ID NO:2617 -10.2 -20.5 62.7 -10.3 0 -3
GGTAAGTCAATCCTCCCTTT 6268 SEQ ID NO:2618 -10.2 -25.8 73.5 -15.6 0 -2.5
TTACTTTTGATTTTCTCTGA 6455 SEQ ID NO: 2619 -10.2 -19.3 61.2 -9.1 0 -2.2
GTATAGGCACTGACTATGAG 6590 SEQ ID NO:2620 -10.2 -21.4 65 -10.5 -0.4 -5.5
GTTCACTTTGCACAACTATC 6739 SEQ ID NO:2621 -10.2 -21.6 65.4 -11.4 0 -5
AGCATTATGAATAAACTATG 6874 SEQ ID NO:2622 -10.2 -15.3 50.1 -5.1 0 -4.1
CATAGCATTATGAATAAACT 6877 SEQ ID NO: 2623 -10.2 -16 51.4 -5.1 -0.5 -4.2
CTTGTATACTGTTTCTTCAA 6924 SEQ ID NO: 2624 -10.2 -19.9 62.3 -9.7 0 -6.3
CTGATCATTTGAGAGACAGG 6947 SEQ ID NO:2625 -10.2 -20.7 63.1 -10.5 0 -6.2
ATTACTTTTTGGAAAGCATT 7230 SEQ ID NO:2626 -10.2 -18.3 57 -6.5 -1.6 -5.5
TATTAGATTACTTTTTGGAA 7236 SEQ ID NO:2627 -10.2 -16.5 53.7 -6.3 0 -2.4
GACATAGACTATCAGCTTTG
7348 SEQ ID NO:2628 -10.2 -20.6 63.2 -10.4 0 -4.5 TGACATAGACTATCAGCTTT
7349 SEQ ID NO:2629 -10.2 -20.6 63.2 -10.4 0 -4.5 TTGACATAGACTATCAGCTT
7350 SEQ ID NO:2630 -10.2 -20.6 63.2 -10.4 0 -4.5 TGGAAGCTTGCAAAAGACAC
7484 SEQ ID NO:2631 -10.2 -20 59.1 -7.7 -2.1 -7
CCTGTTGGAAGCTTGCAAAA 7489 SEQ ID NO:2632 -10.2 -22.5 64 -12.3 0 -7.2
TTTAGACATATTTTTAGCAA 7813 SEQ ID NO:2633 -10.2 -17 54.8 -6.8 0 -4.1
AAGAACAAAGTCCATGTTAT 8251 SEQ ID NO: 2634 -10.2 -18 55.6 -6.5 -1.2 -4.7
TTTTAGCAATAGCAATTCCC 8408 SEQ ID NO:2635 -10.2 -21.8 63.8 -10.6 -0.9 -4.5
ATTATATTGAAAGAAGATGA 8801 SEQ ID NO:2636 -10.2 -13.9 47.4 -3.7 0 -2.2
CCTCACATAAATCCAAGGGT 8959 SEQ ID NO:2637 -10.2 -23.2 65.7 -13 0 -3.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TGTGGCTTGGCTTCAGTTTT 240 SEQ ID NO: 2638 -10.1 -25.8 76.9 -15 -0.4 -6
CTGTGAATTATCTCATTTAT 356 SEQ ID NO:2639 -10.1 -18.1 57.5 -8 0.4 -2.8
TAAAAGTTTTCTTATTGATA 723 SEQ ID NO: 2640 -10.1 -14.6 49.5 -3.4 -1 -6.3
CCAAAATCTTGATAGCAATT 828 SEQ ID NO:2641 -10.1 -18.2 55.3 -7.5 -0.3 -4.4
AGCCCAATGAGAGCAAACAC 1249 SEQ ID NO: 2642 -10.1 -23.2 65 -12.3 -0.6 -4.1
AACATTTATTCCTCAGATTG 1284 SEQ ID NO:2643 -10.1 -19.3 59.4 -9.2 0 -2.5
AACATAAAAGTGACTGTCAT 1433 SEQ ID NO: 2644 -10.1 -17 53.7 -6.2 -0.1 -8.8
CGTAATGTCAACTGGTAAAG 1633 SEQ ID NO: 2645 -10.1 -18.4 56.2 -8.3 0 -3.2
GGTGCTCTCTCTGTCTTCTT 1986 SEQ ID NO:2646 -10.1 -27 83.3 -16.9 0 -3.6
AAGCTGCTTCTTTTGACGCT 2062 SEQ ID NO:2647 -10.1 -24.7 70.9 -13.2 -1.3 -8.6
GGTCAGTCTGTTTCCATCCA 2093 SEQ ID NO: 2648 -10.1 -27.6 81.1 -17.5 0 -3.6
TCTTGGGGAAAACAGGGAGC 2162 SEQ ID NO:2649 -10.1 -23.2 66.7 -13.1 0 -2.8
CTATTGCGTCTTGGGGAAAA 2170 SEQ ID NO:2650 -10.1 -22 63.3 -11.9 0 -4.5
TCTCCTGCTTTCGCCGTCTT 2276 SEQ ID NO:2651 -10.1 -29.9 82.1 -19.1 -0.5 -3.6
GCATCTTCCCATTTGCTGGA 2385 SEQ ID NO: 2652 -10.1 -27.7 77.6 -16.5 -1 -5.2
CAGCATCTCCATTGAAATCT 2540 SEQ ID NO:2653 -10.1 -22.2 65 -12.1 0 -4.1
CTTTTAACCATGCATCACAG 2697 SEQ ID NO:2654 -10.1 -21.6 63.4 -11.5 0 -6.6
CTCCACATTTGACAGACCAA 2987 SEQ ID NO:2655 -10.1 -23.4 66.3 -13.3 0 -2.7
AGGTTTCCTAGAGCCCCCAC 3106 SEQ ID NO:2656 -10.1 -30.9 83.6 -20.8 0 -3.8 TCACATAATCAATTCCCTTT
3507 SEQ ID NO:2657 -10.1 -21 62 -10.9 0 -2.5 TTCACATAATCAATTCCCTT
3508 SEQ ID NO: 2658 -10.1 -21 62 -10.9 0 -2.5 TAATTAAGCTCTTTGCTTAT
3640 SEQ ID NO:2659 -10.1 -18.8 58.8 -5.7 -3 -8
TTGCTTTCTTCTAGTTCTGA 3841 SEQ ID NO:2660 -10.1 -22.6 70.4 -12.5 0 -4
TTTCTCTTTGCTTTCTTCTA 3848 SEQ ID NO:2661 -10.1 -22.3 69.9 -12.2 0 -3.6
CTTCTTCGGGTTCAGTTTCA 3936 SEQ ID NO:2662 -10.1 -24.9 74.6 -14.8 0 -3
ACCCTTCAGTAAAACAAGCT 3969 SEQ ID NO:2663 -10.1 -22 63.2 -11.9 0 -4.8
TCATATACAGGCTGAAGTTT
4768 SEQ ID NO:2664 -10.1 -20.6 63 -10.5 0 -4.1 TTCATATACAGGCTGAAGTT
4769 SEQ ID NO:2665 -10.1 -20.6 63 -10.5 0 -4.1 AGGTTTCTTGGATCCAAGTT
4964 SEQ ID NO:2666 -10.1 -23.5 70.3 -9.7 -1.3 -15.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TTTCTATCATCTCAGCCAGA 5286 SEQ ID NO:2667 -10.1 " -23.8 71.4 -13.7 0 -3.4
CAGCAGAGGTTGTAATTTGG 5580 SEQ ID NO:2668 -10.1 -21.9 65.9 -11.8 0 -5.7
AAACTGGGTCGCATCGGGAT 5873 SEQ ID NO:2669 -10.1 -25.2 69.1 -15.1 0 -3.6
CCTCCTCTTGTTTACGTTTC 6156 SEQ ID NO:2670 -10.1 -25.5 74.2 -15.4 0 -4.8
TAGGTAAGTCAATCCTCCCT 6270 SEQ ID NO: 2671 -10.1 -25.3 72.4 -14.7 -0.2 -4.8
GCTTTCTTTTTCTGGTTTGT 6422 SEQ ID NO:2672 -10.1 -23.7 73.2 -13.6 0 -2.8
CCTTTAAATATTAGAGGAGA 7129 SEQ ID NO:2673 -10.1 -17.9 55.9 -6.9 -0.7 -5.2
ACCATATGATACTCATGTTG 7729 SEQ ID NO:2674 -10.1 -20.4 61.7 -9.6 -0.5 -6
AATTACGTGTAGCTTCTTGC 433 SEQ ID NO: 2675 -10 -22.2 66.4 -11.5 -0.4 -5.8
GTTCTTTCCAGCTTCCAAGT 632 SEQ ID NO:2676 -10 -26.3 77 -16.3 0 -4.5
TCATTACTATAAAAGTTTTC 732 SEQ ID NO:2677 -10 -15.2 51 -5.2 0 -6.3
ATACACAGTTGGTCAAAATA 882 SEQ ID NO:2678 -10 -17.9 55.9 -7.9 0 -3.8
AAGATTTTTATAAGTGACTC 973 SEQ ID NO:2679 -10 -16.3 53.6 -6.3 0 -4.1
TGGGGGCCACTGCAAACATT 1298 SEQ ID NO:2680 -10 -26.5 72 -15.7 -0.6 -7.7
TTGTGTAGCCATAGTTGGGG 1545 SEQ ID NO:2681 -10 -25.3 74.4 -13.8 -1.4 -4.8
TGTCAACTGGTAAAGATTTT 1628 SEQ ID NO:2682 -10 -18.3 57.2 -8.3 0 -2.7
TGTTCTGCTTCTTCCAAGGT 1771 SEQ ID NO:2683 -10 -25.6 75.7 -15.1 -0.1 -3.6
GTCTCTCTCTCCTTTGTTGT 2015 SEQ ID NO:2684 -10 -26.4 81.5 -16.4 0 0
GTCTGTTTCCATCCATGGAG 2088 SEQ ID NO:2685 -10 -25.9 75.5 -14.2 -1.7 -10.4
TCTCCATGTCTGTGCGGCAC 2308 SEQ ID NO:2686 -10 -28.6 80.5 -17.1 -0.2 -10.9
TGGGGGAAGTTGTCCAGTAG 2468 SEQ ID NO:2687 -10 -25.2 73.9 -13.2 -2 -6.1
TTTCTGACTTCCGTTTCAGT 2500 SEQ ID NO:2688 -10 -24.2 71.8 -13 -1.1 -5.7
CAAGAACACATTGGCAAATC
2666 SEQ ID NO:2689 -10 -18.5 55.9 -8.5 0 -4.4 TCAAGAACACATTGGCAAAT
2667 SEQ ID NO:2690 -10 -18.5 55.9 -8.5 0 -4.4 ATCAAGAACACATTGGCAAA
2668 SEQ ID NO:2691 -10 -18.5 55.9 -8.5 0 -4.4 TTAACCATGCATCACAGCAG
2694 SEQ ID NO:2692 -10 -23 66.3 -11.7 -1.2 -6.6
AGGGTATTTAAGACAATGCA 2776 SEQ ID NO:2693 -10 -19.8 60.1 -9.3 -0.1 -5.2
ATTGCTCAGTCATGGGGTAG 2814 SEQ ID NO:2694 -10 -24.7 74.1 -14.7 0 -4.7
AATAAGGCACATGGTTTGGC 3338 SEQ ID NO:2695 -10 -22.5 65.7 -11.9 -0.3 -5.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TTCCAATGACCATGACCAAC 3366 SEQ ID NO:2696 -10 -23 64.2 -13 0 -4.5
TTCCCTTTTGCATTCTTCCT 3495 SEQ ID NO:2697 -10 -27 76.9 -17 0 -5.1
CTTTTGGCTTTCTAAAAAAG 3558 SEQ ID NO:2698 -10 -16.8 53.2 -5.7 -1 -5.7
ACTTTTTAATACACCCTTCA 3981 SEQ ID N0:2699 -10 -21.4 63.2 -11.4 0 -2.2
CTTCCCTTTGCCTTCTTCTG 4022 SEQ ID NO:2700 -10 -28 79.2 -18 0 -3
CCAGCACCAGGCATTAGTGA 4274 SEQ ID NO: 2701 -10 -27.4 76.3 -15.8 -1.5 -5.4
ACGATCAAGAAATCTAGCCA 4291 SEQ ID NO:2702 -10 -20.7 60.2 -10.7 0 -4.9
CTAACCAAAGAAACATCAAC 4309 SEQ ID NO:2703 -10 -16.1 50.6 -6.1 0 -2.9
AATGTCCGTAATGATTTGAT 4369 SEQ ID NO: 2704 -10 -19.3 58.1 -9.3 0 -2.6
TAAGGCTCTTAGAGGTCTTA 4397 SEQ ID NO:2705 -10 -22.1 68.1 -11.5 -0.3 -5.4
CATTCACAACCACCCTCATG 4431 SEQ ID NO:2706 -10 -25.2 69.2 -15.2 0 -4.1
CTCCAACAAGAGCATTCACA 4443 SEQ ID NO:2707 -10 -22.7 65.4 -12.1 -0.3 -4.1
GTCAAACATGTTACCCGTTG 4574 SEQ ID NO:2708 -10 -23.1 65.6 -12.4 0 -9
TTAACATCTCGTGAATCAAC 4750 SEQ ID NO:2709 -10 -18.2 56.1 -8.2 0 -4.6
TTGTTTGCTGGGCGAGGTAT 4993 SEQ ID NO:2710 -10 -25.9 74.3 -15.1 -0.6 -4.4
CCATTCCTTGGAATTTGTTT 5007 SEQ ID NO:2711 -10 -22.9 66.6 -11.2 -1.7 -8.4
AAGACCATTCCTTGGAATTT 5011 SEQ ID NO: 2712 -10 -21.6 62.9 -9.9 -1.7 -8.4
ACTTTTCTATCATCTCAGCC 5289 SEQ ID NO:2713 -10 -23.7 71.6 -13.7 0 -3.2
TGGACATCCCAAAGATGGCA 5478 SEQ ID NO:2714 -10 -24.7 68.2 -12.4 -2.3 -8
AGGATGACCGCGATGTACAT 5764 SEQ ID NO: 2715 -10 -24.4 67.5 -12.9 -1.3 -10.1
CTGCACTTTCTTCAGTAGCA 5799 SEQ ID NO:2716 -10 -24.6 73.8 -13.1 -1.4 -5.5
TCTCAAAGTCATCCTCACTC 5826 SEQ ID NO:2717 -10 -23.2 69.7 -13.2 0 -2.6
ATTCGAAGGGCATCCATCTC 6067 SEQ ID NO:2718 -10 -24.9 71 -13.7 -1.1 -8.2
CTCTTGTTTACGTTTCAAAG 6152 SEQ ID NO:2719 -10 -19.5 60 -9.5 0 -4.8
TATCATAGGAAGGAGGAGGG 6366 SEQ ID NO:2720 -10 -21.6 64.8 -11.6 0 -3.4
CACCTTTGTCTGATCATTTG 6956 SEQ ID NO:2721 -10 -22.4 66.9 -12.4 0 -6.2
CAATTCTTTTTCTGGTTTTG 7003 SEQ ID NO:2722 -10 -19.8 61.8 -9.8 0 -2.5
ATGCATTAGTGATAGCCTTT 7542 SEQ ID NO:2723 -10 -22.7 67.7 -12.7 0 -6.6
TTCTTTAACCAAGACTTGTG 7605 SEQ ID NO:2724 -10 -19.8 60.3 -8.8 -0.9 -5.4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structu: oligo oligo TTATCTAACTTTTATTTTAG
8013 SEQ ID NO: 2725 -10 -15.2 51.5 -5.2 0 -3 CCATTCTTTTTAGCAATAGC
8415 SEQ ID NO: 2726 -10 -21.5 64.5 -10.7 -0.6 -4.1 CTCACCATTCTTTTTAGCAA
8419 SEQ ID NO: 2727 -10 -22.2 65.9 -12.2 0 -4.1 AGTTGGAACATGTGAACTTG
8700 SEQ ID NO: 2728 -10 -19.6 59.8 -8.8 -0.6 -7.8 TTATTATGGGAGAATTATGA
9061 SEQ ID NO: 2729 -10 -16.9 54.1 -6.9 0 -3.2 TATAACGTGTCTTCCTCTGG
143 SEQ ID NO:2730 -9.9 -23.3 68.4 -13.4 0 -5.3 TCAGTTTTCTTGCTCCATAA
228 SEQ ID NO: 2731 -9.9 -22.8 68.5 -12.9 0 -4.4 CATTACTATAAAAGTTTTCT
731 SEQ ID NO: 2732 -9.9 -15.7 51.7 -5.2 -0.3 -6.3 AGGTCATAAATACACAGTTG
891 SEQ ID NO: 2733 -9.9 -18.6 58 -8.7 0 -2.8 TTTATTCCTCAGATTGCCCA
1280 SEQ ID NO: 2734 -9.9 -25.6 72.6 -15.7 0 -3 CAAATGTCCCATTTGAATCC
1368 SEQ ID NO: 2735 -9.9 -22.1 62.9 -9.3 -2.9 -8.9 ATGTCAACTGGTAAAGATTT
1629 SEQ ID NO:2736 -9.9 -18.2 56.9 -8.3 0 -3.2 GTAATGTCAACTGGTAAAGA
1632 SEQ ID NO: 2737 -9.9 -18.2 56.7 -8.3 0 -3.2 CTCATAGGCCATGGCCACCA
1736 SEQ ID NO: 2738 -9.9 -30 80.1 -15.5 -2.5 -17.4 GTTCTGCTTCTTCCAAGGTG
1770 SEQ ID NO:2739 -9.9 -25.6 75.7 -15.2 -0.1 -3.6 GTTCATCATCAGCAAAGTCA
2244 SEQ ID NO: 2740 -9.9 -22 66.7 -12.1 0 -4.1 GCGTCGCTCTCCATGTCTGT
2315 SEQ ID NO: 2741 -9.9 -29.8 83.4 -19.9 0 -6.1 TACTGGCCTGACTAACGTTA
2340 SEQ ID NO: 2742 -9.9 -23.4 66.7 -13 0 -7.8 CTGGAAGCCCTGGCACCATC
2370 SEQ ID NO: 2743 -9.9 -29.7 79.2 -18.2 -1.5 -10.6 ATTGCAATCCACAGTGCTGT
2405 SEQ ID NO: 2744 -9.9 -25 71.9 -13.5 -1.5 -9 TTACTTTTAACCATGCATCA
2700 SEQ ID NO: 2745 -9.9 -20.7 61.8 -10.8 0 -6.6 GAATTGCCAATGATCTTAAT
3085 SEQ ID NO: 2746 -9.9 -18.8 56.9 -8.9 0 -4.9 AGAATTGCCAATGATCTTAA
3086 SEQ ID NO: 2747 -9.9 -18.8 57 -8.9 0 -4.9 GAAGACGATGATGGCCAACA
3134 SEQ ID NO: 2748 -9.9 -22.6 63.2 -12.7 0 -6 GTGGAAGAAGTCGTTCATGT
3245 SEQ ID NO: 2749 -9.9 -22.2 66.4 -11 -1.2 -4.9 TGTGCTTCCTTCAGATGAGC
3881 SEQ ID NO: 2750 -9.9 -25.5 75.2 -14.9 -0.5 -4 TCTTCGGGTTCAGTTTCAGC
3934 SEQ ID NO: 2751 -9.9 -25.7 77.1 -15.8 0 -3 TAACCAAAGAAACATCAACG
4308 SEQ ID NO: 2752 -9.9 -16 49.8 -6.1 0 -3 GGCTAACCAAAGAAACATCA
4311 SEQ ID NO: 2753 -9.9 -19.6 57.5 -9 -0.5 -3.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex S ructu oligo oligo ACCCTCATGCCTTCAAACCG
4420 SEQ ID NO: 2754 -9.9 -27.7 72.4 -17.8 0 -3.8 AGTTTAACATCTCGTGAATC
4753 SEQ ID NO: 2755 -9.9 -19.3 59.7 -9.4 0 -3.9 TGACCATGTTGAGGCAGATG
5076 SEQ ID NO: 2756 -9.9 -23.7 68.7 -13.8 0 -4.3 AAACGAGCTTCAGCACAAAT
5187 SEQ ID NO: 2757 -9.9 -20.1 58.7 -9.3 -0.7 -6.6 GCAAAGTTGGACATCCCAAA
5485 SEQ ID NO:2758 -9.9 -22.8 64 -10.7 -2.2 -7.6 GGTGAATTGTGTCAGGGTCA
5649 SEQ ID NO: 2759 -9.9 -24.6 73.6 -14.7 0 -3.1 GTCTCCCTTAACTGAGCTGC
5672 SEQ ID NO: 2760 -9.9 -27.1 77.4 -17.2 0 -5.2 CAGGATGACCGCGATGTACA
5765 SEQ ID NO: 2761 -9.9 -25.1 68.5 -13.8 -1.3 -8.1 ACTGACCATGGGCAGATCCA
5981 SEQ ID NO:2762 -9.9 -27.2 75 -15.5 -1.8 -8.5 CTGAATGATAGCGGCAGACA
6176 SEQ ID NO: 2763 -9.9 -22.9 65.3 -13 0 -6.6 TATAGGTAAGTCAATCCTCC
6272 SEQ ID NO: 2764 -9.9 -22.1 66.1 -11.7 -0.2 -3.5 TTTCTTTTTACTTTTGATTT
6462 SEQ ID NO: 2765 -9.9 -17.8 57.7 -7.9 0 -2.2 AATGTTCACTTTGCACAACT
6742 SEQ ID NO: 2766 -9.9 -20.8 62.2 -10.9 0 -5 ACTAAAGGTGTTTGGTGTAG
6766 SEQ ID NO: 2767 -9.9 -20.5 63.4 -9.9 -0.5 -4.7 TTTCTTCAACGTAAACCTCA
6913 SEQ ID NO:2768 - 9 . 9 -20.7 61 -10.8 0 -5.3 GATTTATTAGATTACTTTTT
7240 SEQ ID NO: 2769 -9.9 -16.2 53.7 -6.3 0 -2.3 TTGCTGAGAGCAGAAGATGG
7331 SEQ ID NO:2770 -9.9 -22.2 65.8 -10.2 -2.1 -6.9 TTAGTGATAGCCTTTAAACT
7537 SEQ ID NO: 2771 -9.9 -19.6 60 -9.7 0 -4.2 TAGGCAATATTAACATGCAT
7556 SEQ ID NO:2772 -9.9 -18.9 57.5 -7 -2 -6.8 AATTGTGATGTCATCAACCT
7910 SEQ ID NO: 773 -9.9 -21 62.7 -10.4 -0.5 -7.2 GCTTTAGTGCAGCAGGAATT
8221 SEQ ID NO:2774 -9.9 -24 70.8 -13.2 -0.7 -6.6 ATATATATTTTAAACTGCCA
8531 SEQ ID NO: 775 -9.9 -17.3 54.3 -7.4 0 -4.8 TATATATATTTTAAACTGCC
8532 SEQ ID NO: 2776 -9.9 -16.3 52.5 -6.4 0 -5.2 GAACATGTGAACTTGATCCT
8695 SEQ ID NO: 2777 -9.9 -21 62.1 -11.1 0 -7 ACCTGAAAGTTGGAACATGT
8707 SEQ ID NO:2778 -9.9 -20.8 61.2 -10.1 -0.6 -6.7 AGTTTAGATGCTTATAGCCA
8782 SEQ ID NO: 2779 -9.9 -22.4 67.5 -11.2 -1.2 -4.6 ATCATTAATACCTTATGTAT
8901 SEQ ID NO:2780 -9.9 -17.7 56 -7 -0.6 -4.2 ATATCATTAATACCTTATGT
8903 SEQ ID NO: 2781 -9.9 -17.7 56 -7.8 0 -4 ATAATTTATTATGGGAGAAT
9066 SEQ ID NO: 2782 -9.9 -15.6 51.1 -5.1 -0.3 -4.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
TTTTTTTTTTGACCACAGAG 100 SEQ ID NO:2783 -9.8 -19.9 61.1 -10.1 0 -2.3
GTGTCTTCCTCTGGCAGCTG 137 SEQ ID NO: 2784 -9.8 -28.8 84.4 -18.5 0 -8.2
ATGTGGCTTGGCTTCAGTTT 241 SEQ ID NO:2785 -9.8 -25.7 76.4 -15.9 0.4 -4.4
AGATTCTTTGCTCCTTTCCC 316 SEQ ID NO:2786 -9.8 -26.8 77.1 -17 0 -3.6
GAAGCTTTCAGGTCCTGGGG 494 SEQ ID NO:2787 -9.8 -27.2 77.9 -16 -0.4 -10.8
CTTTCTCTTCTGCAGCACGT 552 SEQ ID NO:2788 -9.8 -26.3 76.6 -16 0 -8.3
GGGCTTCTTGGCTTTCTCTT 563 SEQ ID NO: 2789 -9.8 -27.4 81.3 -16.6 -0.9 -3.7
ATAAATGGAAGGTTCTTTCC 643 SEQ ID NO:2790 -9.8 -19.8 60.2 -8.4 -1.6 -6.5
AGTGACTCAAAGGTATAGAT 961 SEQ ID NO:2791 -9.8 -19 59.4 -9.2 0 -3.1
CCAATGAGAGCAAACACGCT 1246 SEQ ID NO:2792 -9.8 -22.9 63.4 -12.2 -0.7 -4.7
TTATTCCTCAGATTGCCCAT 1279 SEQ ID NO:2793 -9.8 -25.5 72.2 -15.7 0 -3
TCTCTCTCTCCTTTGTTGTT 2014 SEQ ID NO: 2794 -9.8 -25.3 77.9 -15.5 0 0
TGCAATCCACAGTGCTGTGC 2403 SEQ ID NO:2795 -9.8 -26.7 75.7 -14.7 -1.7 -12.4
TAACCTTCTCTTTCTGACTT 2510 SEQ ID NO:2796 -9.8 -22.1 66.7 -12.3 0 -2.6
CTTCCAGAGGAATCCTCCAG 2557 SEQ ID NO:2797 -9.8 -26.2 73.7 -14.2 -2.2 -11.2
CATAAAGAGGGTATTTAAGA 2783 SEQ ID NO:2798 -9.8 -16.7 53.4 -6.9 0 -3
TCCACATTTGACAGACCAAG 2986 SEQ ID NO:2799 -9.8 -22.5 64.7 -12.7 0 -2.9
GAAGTCGTTCATGTGCCACC 3239 SEQ ID NO:2800 -9.8 -26.6 74.6 -16.1 -0.4 -4.7
GGTTCAGAACCACAAGGTTT 3384 SEQ ID NO:2801 -9.8 -23.2 67.7 -10.8 -2.6 -11.3
ATAATCAATTCCCTTTTGCA 3503 SEQ ID NO: 2802 -9.8 -21.6 63.1 -11.8 0 -4.8
CAGTTTCAGCTTGTTCACCT 3924 SEQ ID NO:2803 -9.8 -25.5 75.6 -15.7 0 -4.5
ATATCTTCAAAGGCCAATGC 4135 SEQ ID NO: 2804 -9.8 -21.6 63.1 -11.2 -0.3 -7.7
ATAAGGCTCTTAGAGGTCTT 4398 SEQ ID NO:2805 -9.8 -22.4 68.7 -12 -0.3 -6.1
CGTTGTCATGTTAACACAGT 4559 SEQ ID NO:2806 -9.8 -21.7 64.9 -11.1 -0.5 -8.7
AGCGCCAACATTATCAAAGT 4667 SEQ ID NO:2807 -9.8 -22 62.8 -11.7 0 -7.6
TGGGCGAGGTATGGGTTTCT
4985 SEQ ID NO:2808 -9.8 -26.8 76.8 -17 0 -4 CTGGGCGAGGTATGGGTTTC
4986 SEQ ID NO:2809 -9.8 -26.8 76.8 -17 0 -4 ACCATTCCTTGGAATTTGTT
5008 SEQ ID NO:2810 -9.8 -23 66.8 -11.5 -1.7 -8.4
ATGTATTTGCCCTGGTCATC 5113 SEQ ID NO: 2811 -9.8 -25.7 74.6 -15.9 0 -4.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo ACGAGCTTCAGCACAAATTC 5185 SEQ ID NO:2812 -9.8 -22 64.2 -11.3 -0.7 -6.6
CCAGCCTATAGTGAAGTAGT 5219 SEQ ID NO:2813 -9.8 -24 70.5 -14.2 0 -4.6
CGGATCCCCTTTGCTCCTTT 5377 SEQ ID NO:2814 -9.8 -30.3 80.3 -19.8 -0.4 -7.5
GAGAACTCTATAAACTGGGT
5884 SEQ ID NO:2815 -9.8 -19.6 59.7 -9.8 0 -4.9 AGAGAACTCTATAAACTGGG
5885 SEQ ID NO:2816 -9.8 -18.4 57 -8.6 0 -6.4 AACTCCCATCTGTTTTTTCT
6336 SEQ ID NO:2817 -9.8 -23.8 70 -14 0 -3.1
TTGTCTTTCTCAAACTTTTC 6406 SEQ ID NO:2818 -9.8 -19.6 61.9 -9.8 0 -2.6
CCTTTGCTTTCTTTTTCTGG 6427 SEQ ID NO:2819 -9.8 -24.2 71.9 -14.4 0 -2.9
ATGAGTATTTGTTAAAACAG 6575 SEQ ID NO:2820 -9.8 -15.5 51.1 -5.7 0 -6.1
TTGGGTTTCTCCTCAGCAGT 6700 SEQ ID NO:2821 -9.8 -27.3 81 -16.6 -0.8 -4.9
TGACATAGCATTATGAATAA 6880 SEQ ID NO:2822 -9.8 -16.4 52.4 -5.1 -1.4 -4.9
TAGTGACATAGCATTATGAA 6883 SEQ ID NO: 2823 -9.8 -18.3 57.3 -7 -1.4 -4.9
ATTAGATTACTTTTTGGAAA 7235 SEQ ID NO: 2824 -9.8 -16.1 52.5 -6.3 0 -2.3
AATTATTCTGCTTGACATAA 7668 SEQ ID NO:2825 -9.8 -17.8 55.9 -8 0 -3.8
GAATAAAAGGTTATATTGAG
8138 SEQ ID NO:2826 -9.8 -14.1 47.9 -3.7 -0.3 -3 TGAATAAAAGGTTATATTGA
8139 SEQ ID NO:2827 -9.8 -14.1 47.8 -3.7 -0.3 -3 TGTTATATTTGTAATAGCTT
8237 SEQ ID NO: 2828 -9.8 -17.6 56.8 -7.8 0 -7.1
TTTAGCAATAGCAATTCCCT 8407 SEQ ID NO:2829 -9.8 -22.6 65.4 -11.1 -1.7 -4.6
CTTGGTGAATCATGCACTAG 8618 SEQ ID NO:2830 -9.8 -21.7 64.8 -10.7 -1.1 -6.2
GAGTTTAGATGCTTATAGCC 8783 SEQ ID NO:2831 -9.8 -22.3 67.6 -11.2 -1.2 -4.6
GTTTATATAATGCATTTAAG
8873 SEQ ID NO:2832 -9.8 -15.5 51.3 -5 0 -8.8 AGTTTATATAATGCATTTAA
8874 SEQ ID NO:2833 -9.8 -15.5 51.3 -5 0 -8.8 CTAGTAAAAAGGCGGAAGCT
508 SEQ ID NO:2834 -9.7 -20.3 59.2 -8.2 -2.4 -6.9
ACGTTTTTCGATAGCAGCAA 536 SEQ ID NO:2835 -9.7 -22.4 64.7 -11.7 -0.9 -6.9
CAAGATTTTTATAAGTGACT 974 SEQ ID NO:2836 -9.7 -16.6 53.6 -6.9 0 -4.1
GCTCGGAGAACTCTGAATGT 1120 SEQ ID NO: 2837 -9.7 -23.1 66.9 -12.7 -0.4 -8.2
TATTCCTCAGATTGCCCATG 1278 SEQ ID NO:2838 -9.7 -25.4 71.7 -15.7 0 -3.9
ACATTTATTCCTCAGATTGC 1283 SEQ ID NO:2839 -9.7 -21.8 65.8 -12.1 0 -2.6
TTTCCATCCATGGAGAAAAG 2083 SEQ ID NO: 2840 -9.7 -20.7 60.6 -9.1 -1.7 -11.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TGTTTCCATCCATGGAGAAA 2085 SEQ ID NO:2841 -9.7 -22.6 65.3 -10.8 -1.7 -12.1
AAACAGGGAGCCACGGATAC 2153 SEQ ID NO:2842 -9.7 -23.7 65.8 -14 0.5 -4.3
TTGCGTCGCTCTCCATGTCT 2317 SEQ ID NO: 2843 -9.7 -28.7 80.2 -18.4 -0.3 -6.9
TTTGCTGGAAGCCCTGGCAC 2374 SEQ ID NO:2844 -9.7 -28.6 77.9 -16.7 -2.2 -8.6
ACCATTGCAATCCACAGTGC 2408 SEQ ID NO:2845 -9.7 -25.8 72.1 -15.2 -0.7 -9
GGGGGAAGTTGTCCAGTAGG 2467 SEQ ID NO: 2846 -9.7 -26.4 76.8 -14.7 -2 -5.5
TTTGGCCAGCGACCTCCATA 3324 SEQ ID NO:2847 -9.7 -29 77.4 -18.6 -0.1 -8.8
TAGCAGCAAGGTTGTCTGAG 3435 SEQ ID NO:2848 -9.7 -23.6 70.9 -12.5 -1.3 -8.2
GTTGTTTATGAATGACATAT 3740 SEQ ID NO:2849 -9.7 -17.5 55.8 -6.7 -1 -6
TTGGCACTGTGACGGTGAGG 3765 SEQ ID NO:2850 -9.7 -25.9 73.3 -14.4 -1.8 -7.6
ACTGTAGCAGGTTTTTCGAA 4055 SEQ ID NO:2851 -9.7 -22.4 66.7 -11.8 -0.7 -7.5
AACATCAACGATCAAGAAAT 4298 SEQ ID NO:2852 -9.7 -15.8 50 -6.1 0 -4.9
AAGAAACATCAACGATCAAG 4302 SEQ ID NO: 2853 -9.7 -15.8 50.2 -6.1 0 -4.9
ATTGCATTGTAATATTTTTT 4939 SEQ ID NO:2854 -9.7 -17.1 55 -7.4 0 -5.2
GGTCATCCGTTTCCACCATC 5100 SEQ ID NO:2855 -9.7 -28.5 79 -18.1 -0.4 -4.1
CAGATCATGCTGTTGCCAAA 5554 SEQ ID NO:2856 -9.7 -23.5 67.1 -12.9 -0.8 -6.6
CCTTAACTGAGCTGCCAGGG 5667 SEQ ID NO:2857 -9.7 -27.3 75.1 -16.7 -0.6 -9.3
TGTTCACCACAACCAGGAAG 5745 SEQ ID NO: 2858 -9.7 -23.5 66.5 -13.8 0 -5.5
GGACTTTGTTGGGTTTTGCT 5949 SEQ ID NO:2859 -9.7 -25 74.2 -15.3 0 -3.6
GCGGCAGACACCTCCTCTTG
6166 SEQ ID NO: 2860 -9.7 -29.6 80.2 -19.4 -0.1 -5.9 AGCGGCAGACACCTCCTCTT
6167 SEQ ID NO:2861 -9.7 -29.6 80.8 -19.4 -0.1 -6.6 TGTTTTTTCTGGAGTGGAGT
6326 SEQ ID NO: 2862 -9.7 -23 71 -13.3 0 -2.7
CTATGAGTATTTGTTAAAAC 6577 SEQ ID NO: 2863 -9.7 -15.4 51 -5.7 0 -3.3
GCACTGACTATGAGTATTTG 6584 SEQ ID NO: 2864 -9.7 -20.7 63.3 -10.5 -0.1 -3.5
TTGTATAGGCACTGACTATG 6592 SEQ ID NO: 2865 -9.7 -20.9 63.6 -10.5 -0.4 -4.8
GGTAGCCATTGGGTTTCTCC 6708 SEQ ID NO:2866 -9.7 -28.2 81.3 -18 -0.2 -5.6
CTGTACTAAAGGTGTTTGGT 6770 SEQ ID NO:2867 -9.7 -21.4 65.2 -10.9 -0.6 -5.1
AGTTAAAAATAGAATGGATG 6796 SEQ ID NO:2868 -9.7 -13.6 46.6 -3.9 0 -2.8
TTCTTGTATACTGTTTCTTC 6926 SEQ ID NO:2869 -9.7 -20.4 65.4 -10.7 0 -5.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GCACATAACTGTTCAGATAG 7101 SEQ ID NO:2870 -9.7 -20.2 61.8 -10 -0.2 -5.6
TTATTTTAGGAAATTATCCA 8002 SEQ ID NO:2871 -9.7 -17.1 54.3 -5.2 -2.2 -7.2
AAACCCATTATCTAACTTTT 8020 SEQ ID NO: 2872 -9.7 -19 57.3 -9.3 0 -1.6
TCCATGTTATATTTGTAATA 8241 SEQ ID NO: 2873 -9.7 -17.9 56.7 -8.2 0 -4.3
TACACTACAGTAAATAGTTT 8371 SEQ ID NO: 2874 -9.7 -16.9 54.6 -6.7 -0.1 -3.3
TTTATTAGCCACCAAGTAAT 8836 SEQ ID NO:2875 -9.7 -20.6 61.1 -10.9 0 -3.2
TGTCTTCCTCTGGCAGCTGT 136 SEQ ID NO:2876 -9.6 -28.8 84.4 -18.5 0 -8.7
GGCTTGGCTTCAGTTTTCTT 237 SEQ ID NO:2877 -9.6 -26 78 -15.7 -0.4 -6
CACTATTTGGCTTTGGTTTG 612 SEQ ID NO:2878 -9.6 -22.4 67.1 -12.8 0 -3.7
GAAGGTTCTTTCCAGCTTCC 636 SEQ ID NO:2879 -9.6 -26.2 76.3 -15.9 -0.5 -4.7
CCTTTCCTTTATTCATTACT 744 SEQ ID NO:2880 -9.6 -22.4 66.7 -12.8 0 -0.7
AATACACAGTTGGTCAAAAT 883 SEQ ID NO:2881 -9.6 -17.5 54.6 -7.9 0 -3.8
TTTTTATAAGTGACTCAAAG 969 SEQ ID NO:2882 -9.6 -15.7 51.7 -6.1 0 -4.7
GCTTCTTTACCGACTGGATC 1191 SEQ ID NO: 2883 -9.6 -24.9 71.5 -14.4 -0.7 -4.1
GAATCGCTTGGGGGCCACTG 1306 SEQ ID NO:2884 -9.6 -28.3 76.1 -18 -0.4 -6.8
CCCATTTGAATCCATTGTGC 1361 SEQ ID NO:2885 -9.6 -25 69.7 -15.4 0 -2.6
GAACTCAACTTTGATGCTTC 1930 SEQ ID NO:2886 -9.6 -20.5 62.1 -10.9 0 -5
TTCCTCCATTCTTTAGCACC 1954 SEQ ID NO:2887 -9.6 -26.5 75.8 -16.9 0 -4.1
TTGCTGGAAGCCCTGGCACC 2373 SEQ ID NO:2888 -9.6 -30.5 80.9 -18.7 -2.2 -8.7
GGAAGTTGTCCAGTAGGTGA 2464 SEQ ID NO:2889 -9.6 -24.6 73.4 -13.7 -1.2 -4.8
TAAGCAGTCTGAATGATCGC 3021 SEQ ID NO:2890 -9.6 -21.5 63.6 -11.2 -0.4 -6.3
GTTTCCTAGAGCCCCCACAG 3104 SEQ ID NO:2891 -9.6 -30.4 82.1 -20.8 0 -3.3
ACCTCCATACAGTCCCACAT 3313 SEQ ID NO:2892 -9.6 -28 76.5 -18.4 0 -2.8
TCCCTTTTGCATTCTTCCTA 3494 SEQ ID NO:2893 -9.6 -26.6 75.9 -17 0 -5.1
ATCTCTAAGATAATTAAGCT 3650 SEQ ID NO:2894 -9.6 -17 54.6 -6.8 -0.3 -5.4
TTTGCTTTCTTCTAGTTCTG 3842 SEQ ID NO:2895 -9.6 -22.1 69.4 -12.5 0 -4
TTCTTCGGGTTCAGTTTCAG 3935 SEQ ID NO: 2896 -9.6 -24 72.8 -14.4 0 -2.4
TCTGTACTTACTTGACAGAA 4006 SEQ ID NO:2897 -9.6 -19.7 61 -8.2 -1.9 -6.3
TTTGCCTTCTTCTGTACTTA 4016 SEQ ID NO:2898 -9.6 -23.5 70.9 -13.9 0 -4.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ATCTTCCCTTTGCCTTCTTC 4024 SEQ ID NO:2899 -9.6 -27.5 79.2 -17.9 0 -3
CAACAATACTGTAGCAGGTT 4062 SEQ ID NO:2900 -9.6 -20.9 62.7 -10.4 -0.7 -5.3
GCATTCACAACCACCCTCAT 4432 SEQ ID NO:2901 -9.6 -27 73.3 -17.4 0 -3.4
TTACTTTCACGTTTTTCCAC 4647 SEQ ID NO:2902 -9.6 -22.1 65.8 -12.5 0 -4.7
ACATGTACAGATTTTCTTCA 4785 SEQ ID NO:2903 -9.6 -20.1 62.6 -10.5 0 -6.7
TTCCACCATCATGGTGACCA 5090 SEQ ID NO:2904 -9.6 -27.1 74.7 -13.8 -3.7 -11.1
TGGTCATCCGTTTCCACCAT 5101 SEQ ID NO:2905 -9.6 -28.1 77.1 -17.3 -1.1 -5.4
TTCAGCACAAATTCTCCAGT 5179 SEQ ID NO:2906 -9.6 -22.9 67.4 -13.3 0 -4.1
TTTTCTATCATCTCAGCCAG 5287 SEQ ID NO:2907 -9.6 -23.3 70.4 -13.7 0 -3.2
GGATCCCCTTTGCTCCTTTG 5376 SEQ ID NO:2908 -9.6 -29.5 80.5 -19.9 0 -6.9
CAGGAGGCCGATGTTAAACA 5435 SEQ ID NO:2909 -9.6 -23.4 65.6 -13.2 -0.3 -6.9
AAAGATGGCATAGATAAACA 5468 SEQ ID NO:2910 -9.6 -16.4 51.9 -6.8 0 -4
CCATCCCAGCCAGCAGAGGT 5590 SEQ ID NO:2911 -9.6 -31.8 85.1 -22.2 0 -4.6
AGCTGGACTTTGTTGGGTTT 5953 SEQ ID NO:2912 -9.6 -24.9 74.1 -15.3 0 -4.3
GGTCACCACTGACCATGGGC 5988 SEQ ID NO:2913 -9.6 -29.2 80 -15.7 -3.9 -10.6
TATATTTTTTAACCTTTGCT 6221 SEQ ID NO: 2914 -9.6 -18.9 58.6 -9.3 0 -3.6
TGGAGTGGAGTTCCCATTTA 6317 SEQ ID NO:2915 -9.6 -25.1 73.1 -14.6 -0.7 -6.7
GACCTCTTTTCCTTTGCTTT 6437 SEQ ID N0:2916 -9.6 -25.7 74.8 -16.1 0 -3.6
ACACATATACTTTACCTTCA 6519 SEQ ID NO:2917 -9.6 -20.5 62 -10.9 0 -2.2
CACTGACTATGAGTATTTGT 6583 SEQ ID NO:2918 -9.6 -20.1 62.2 -10.5 0.5 -4
GGTCACTTCACTGTCTTGTA 6607 SEQ ID NO:2919 -9.6 -24.4 74.7 -14.8 0 -2.6
GTTAAAAATAGAATGGATGC 6795 SEQ ID NO:2920 -9.6 -15.4 50.1 -5.8 0 -2.8
AAATATGGCAGATATGGAAG 6814 SEQ ID NO:2921 -9.6 -17.4 54.2 -6.4 -1.3 -5.2
AATTGGGGACCATGGAAATG 6854 SEQ ID NO: 2922 -9.6 -20.9 60.2 -8.9 -2.4 -8.8
CATTACAATTCTTTTTCTGG 7008 SEQ ID NO:2923 -9.6 -19 59.3 -9.4 0 -2.5
AAGCCATCTAGAAAATGGAA 7045 SEQ ID NO:2924 -9.6 -18.4 55.5 -7.2 -1.6 -8.3
AGAATGGATTTATTAGATTA 7246 SEQ ID NO:2925 -9.6 -15.8 52.1 -6.2 0 -2.4
TTTGATTTAATAGAAGTTGT 7447 SEQ ID NO: 2926 -9.6 -16.1 53 -6.5 0 -2.5
ATAATGGACAGAGCAGGTTG 7652 SEQ ID NO:2927 -9.6 -21.3 63.9 -11.7 0 -4.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GCTTCAAATTATTCTGCTTG 7674 SEQ ID NO:2928 -9.6 -20.5 62.3 -10.9 0 -3.6
TATTTTAGGAAATTATCCAT 8001 SEQ ID N0:2929 -9.6 -17 54 -5.2 -2.2 -7.2
ATACACTACAGTAAATAGTT 8372 SEQ ID NO:2930 -9.6 -16.8 54.2 -6.7 -0.1 -3.6
ACGTGTCTTCCTCTGGCAGC 139 SEQ ID NO:2931 -9.5 -28.9 82.6 -19.4 0 -4.4
TGGCTTGGCTTCAGTTTTCT 238 SEQ ID NO:2932 -9.5 -25.9 77.3 -15.7 -0.4 -6
TTTTCCGGAAAAGCTCCAGG 382 SEQ ID N0:2933 -9.5 -24.2 67.1 -11.9 -1.6 -13.8
CTTCTGCAGCACGTTTTTCG 546 SEQ ID N0:2934 -9.5 -25.1 71.5 -14.7 -0.5 -9.3
AAGTCACTATTTGGCTTTGG 616 SEQ ID N0:2935 -9.5 -21.9 66 -11 -1.3 -4.7
AGTCAGGAGGGTTGCTCAAG 909 SEQ ID NO:2936 -9.5 -24.9 74.4 -13.4 -2 -4.6
ATTGCCCAGGTCCACAAACT 1085 SEQ ID NO:2937 -9.5 -26.7 72.6 -17.2 0 -3.6
TCTCAACGCTGAGACATTGC • 1100 SEQ ID N0:2938 -9.5 -23.4 67.5 -11.4 -2.5 -8.4
CTCGGAGAACTCTGAATGTT 1119 SEQ ID NO:2939 -9.5 -21.4 63.2 -11.2 -0.4 -8.2
CCTCAGATTGCCCATGAACA 1274 SEQ ID NO:2940 -9.5 -26 71.1 -16.5 0 -4.5
CATAAAAGTGACTGTCATCT 1431 SEQ ID NO:2941 -9.5 -18.8 58.2 -8.6 -0.1 -8.8
GCTGATGCTGCCGCAACTGC 1852 SEQ ID NO:2942 -9.5 -29.3 78.2 -18.6 -1.1 -7.5
ATTTGCTGGAAGCCCTGGCA 2375 SEQ ID NO:2943 -9.5 -28.4 77.3 -16.7 -2.2 -8.6
TTGCTCAGTCATGGGGTAGT 2813 SEQ ID NO: 2944 -9.5 -25.9 77.9 -16.4 0 -4.7
ACACACTACTGAATTGCTCA 2826 SEQ ID NO:2945 -9.5 -21.5 63.8 -12 0 -3.6
GAGGTTTCCTAGAGCCCCCA 3107 SEQ ID NO:2946 -9.5 -31.3 84.3 -21.1 -0.5 -4.4
GCAGCAAGGTTGTCTGAGCT 3433 SEQ ID NO:2947 -9.5 -26.6 77.9 -15.7 -1.3 -8.2
CATAATCAATTCCCTTTTGC 3504 SEQ ID NO:2948 -9.5 -21.6 63.1 -12.1 0 -2.7
GCATCTTATTTTTCACATAA 3519 SEQ ID NO:2949 -9.5 -19 59.3 -9.5 0 -3.4
GCTTTCTAAAAAAGGCTTTT 3552 SEQ ID NO:2950 -9.5 -18.6 57 -7.6 -1.4 -7.2
CTAAGATAATTAAGCTCTTT 3646 SEQ ID NO:2951 -9.5 -16.8 54 -6.8 -0.1 -6.1
TCCAACAGCAATTGGCACTG 3776 SEQ ID NO:2952 -9.5 -24 67.6 -12.9 -1.5 -8.1
TGATTTGATGGCACCGAGTT 4358 SEQ ID NO: 2953 -9.5 -24 68.2 -14.5 0 -4
CGGGATAAGGCTCTTAGAGG 4402 SEQ ID NO: 2954 -9.5 -23.6 68.2 -13.5 -0.3 -5.6
GTGGTAGAACTTGCCAGCAA 4541 SEQ ID NO:2955 -9.5 -24.7 70.6 -13.9 -1.2 -7.3
CCACCGAGCTTGCTTGCCAA 4631 SEQ ID NO:2956 -9.5 -29.7 77.2 -19.6 -0.3 -6.4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ATATCCATCCAGCCTTTAAA 4717 SEQ ID NO:2957 -9.5 -23.1 65.8 -13.6 0 -4
TCCACCATCATGGTGACCAT 5089 SEQ ID NO:2958 -9.5 -27 74.3 -13.8 -3.7 -11.1
ACTAGGGTCATGTATTTGCC 5122 SEQ ID N0:2959 -9.5 -24.4 72.3 -14.9 0 -4.7
CAAAGGTCTCAAAGTTGAAC 5538 SEQ ID NO:2960 -9.5 -18.1 56.1 -8.6 0 -5.4
AATCCCAACAGATGGGTCCC 5696 SEQ ID NO:2961 -9.5 -27.2 73.4 -14.5 -3.2 -8.6
TTCACCACAACCAGGAAGGA 5743 SEQ ID NO: 2962 -9.5 -24.1 67.3 -13.8 -0.6 -4.3
GGATCAAACTTTTCCCAAAC 5857 SEQ ID NO:2963 -9.5 -20.8 60.4 -11.3 0 -5.3
ACCACTGACCATGGGCAGAT 5984 SEQ ID NO: 2964 -9.5 -27 74 -15.7 -1.8 -8.8
TCCATCTCTCCACTCTCACA 6055 SEQ ID N0:2965 -9.5 -27.2 78.5 -17.7 0 -0.5
CAAACTTTTCCTTGTCTGGT 6396 SEQ ID NO: 2966 -9.5 -23 67.8 -13.5 0 -3.2
CTGACCTCTTTTCCTTTGCT 6439 SEQ ID NO:2967 -9.5 -26.4 75.8 -16.9 0 -3.6
GTCCAGTTGACACATATACT 6528 SEQ ID NO:2968 -9.5 -22.5 67.2 -11.9 -1 -4.4
TTAAAAATAGAATGGATGCA 6794 SEQ ID NO:2969 -9.5 -14.9 48.7 -5.4 0 -5.2
TTGTATACTGTTTCTTCAAC 6923 SEQ ID NO: 2970 -9.5 -19.2 60.9 -9.7 0 -6.3
AAAAATAATCCTTTAAATAT 7138 SEQ ID NO:2971 -9.5 -11.7 42.7 -2.2 0 -4.3
TTTTGGAAAGCATTTGACCT 7224 SEQ ID NO: 2972 -9.5 -21.1 62.1 -10.8 -0.6 -4.1
ACATCCCTGTTGGAAGCTTG 7494 SEQ ID NO: 2973 -9.5 -25.4 71.9 -14.8 -1 -7.2
TGTCAGTAGGCAGTATCCAG 7775 SEQ ID NO: 2974 -9.5 -24.9 75 -14.9 -0.2 -4
TAGGAAATTATCCATTGAAA 7996 SEQ ID NO:2975 -9.5 -16.3 51.7 -4.6 -2.2 -7.2
GAGTGTTTGACCAATGTATC 8085 SEQ ID NO:2976 -9.5 -21.3 64.7 -11.8 0 -3.4
AAAGAACAAAGTCCATGTTA 8252 SEQ ID NO: 2977 -9.5 -17.3 53.8 -6.5 -1.2 -4.7
ACAACTTTGCCACTTTGTTC 8280 SEQ ID NO:2978 -9.5 -23 67.7 -13.5 0 -3.8
TATATCATGTTAGGTAATTG 8301 SEQ ID NO:2979 -9.5 -17 55.2 -7.5 0 -4.1
CACTACAGTAAATAGTTTTG 8369 SEQ ID NO.-2980 -9.5 -17.1 54.9 -7.1 -0.1 -3.3
ATGCAATAAAAAATGAAATT
8466 SEQ ID NO:2981 -9.5 -11.3 41.7 -1.8 0 -5.6 AATGCAATAAAAAATGAAAT
8467 SEQ ID NO:2982 -9.5 -10.5 40.3 -0.9 0 -5.6 CACTAGTTTGTTGTAAAATT
8604 SEQ ID NO:2983 -9.5 -17.1 54.8 -6.9 -0.4 -6.3
CAAACCTGAAAGTTGGAACA 8710 SEQ ID NO:2984 -9.5 -18.9 56.1 -8.7 -0.4 -4.8
TATGTATACATAGGAGTTTA 8888 SEQ ID NO:2985 -9.5 -17.8 57.4 -7.1 0 -10.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CCTCTCTGCTTATGCCTCCG 8 SEQ ID NO:2986 -9.4 -29.9 81 -19.6 -0.8 -4.6
TTCTTACAATATCCCTAGAA 337 SEQ ID NO:2987 -9.4 -20 60.2 -10.6 0 -3.8
AGCTCCAGGTCCCTTCTGTG 371 SEQ ID NO:2988 -9.4 -30.1 85.5 -20.7 0.3 -6.3
CTTTCAGGTCCTGGGGGTAC 490 SEQ ID NO:2989 -9.4 -27.8 80.8 -17.7 -0.4 -6.8
GAATCGGAAAATTGCCTTTC 758 SEQ ID NO:2990 -9.4 -20.2 59 -10.3 -0.2 -3.9
CAGTTGGTCAAAATAGTGCA 877 SEQ ID NO: 2991 -9.4 -20.8 62.6 -11.4 0 -5.2
ACACAGTTGGTCAAAATAGT 880 SEQ ID NO: 2992 -9.4 -19.4 59.6 -10 0 -3.8
CAGCCCAATGAGAGCAAACA 1250 SEQ ID NO:2993 -9.4 -23.7 65.5 -13.5 -0.6 -4.1
GGGGGCCACTGCAAACATTT 1297 SEQ ID NO: 2994 -9.4 -26.6 72.5 -15.7 -1.4 -7.7
AAAAATATCATGTATGTTTT 1663 SEQ ID NO:2995 -9.4 -14.4 48.6 -4 -0.9 -7.5
CCATGGCCACCACAGCCAGG 1728 SEQ ID NO:2996 -9.4 -31.9 82.3 -19.7 -2.8 -9.1
CTTCAAGGTGCTCTCTCTGT 1992 SEQ ID NO: 2997 -9.4 -25.6 77.2 -16.2 0 -3.6
TGCCCGACCTCTGAAACTGA 2204 SEQ ID NO:2998 -9.4 -26.5 70.5 -17.1 0 -3
AGTCTCTCCTGCTTTCGCCG 2280 SEQ ID NO:2999 -9.4 -29.8 82 -19.7 -0.5 -3.6
ATTCACAAGATGTTTTACTT 2714 SEQ ID NO:3000 -9.4 -18.4 58.1 -9 0 -3
AATTGCCAATGATCTTAATT 3084 SEQ ID NO:3001 -9.4 -18.3 56 -8.9 0 -4.9
AAGACGATGATGGCCAACAC 3133 SEQ ID NO:3002 -9.4 -22.2 62.5 -12.8 0 -6.3
AGTCCCACATGGTCTCTATC 3303 SEQ ID NO:3003 -9.4 -26.3 77.4 -16.9 0 -5.2
CAGAACCACAAGGTTTCCAA 3380 SEQ ID NO:3004 -9.4 -22.7 64.4 -10.7 -2.6 -7.6
AGCAGCAAGGTTGTCTGAGC 3434 SEQ ID NO:3005 -9.4 -25.7 76.2 -14.9 -1.3 -8.2
ATTGGCACTGTGACGGTGAG 3766 SEQ ID NO:3006 -9.4 -24.7 70.7 -14.1 -1.1 -6.9
TGCTTTCTTCTAGTTCTGAC 3840 SEQ ID NO:3007 -9.4 -22.7 70.7 -13.3 0 -4
GCATTTAATTTCTCTTTGCT 3856 SEQ ID NO:3008 -9.4 -21.4 65.3 -11.5 -0.2 -4
CCCTTCAGTAAAACAAGCTT 3968 SEQ ID NO:3009 -9.4 -21.9 63 -12.5 0 -6.2
TTCTTCTGTACTTACTTGAC 4010 SEQ ID NO:3010 -9.4 -20.6 64.7 -11.2 0 -4.8
ATGATTTGATGGCACCGAGT 4359 SEQ ID NO:3011 -9.4 -23.9 67.9 -14.5 0 -4
ATTCACAACCACCCTCATGC 4430 SEQ ID NO:3012 -9.4 -26.3 72.1 -16.9 0 -4.4
CTTGCCAGCAAACAAATTCA 4532 SEQ ID NO:3013 -9.4 -21.3 61.1 -11.9 0 -7.4
TTTTCCACCGAGCTTGCTTG 4635 SEQ ID NO: 3014 -9.4 -26.6 73.8 -16.7 -0.2 -6.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
TACATAATATCCATCCAGCC 4723 SEQ ID NO:3015 -9.4 -23.3 66.5 -13.9 0 -3.2
CTTCATATACAGGCTGAAGT 4770 SEQ ID NO:3016 -9.4 -21.4 64.6 -10.5 -1.4 -5.9
GTTTCTTGGATCCAAGTTTC 4962 SEQ ID NO:3017 -9.4 -22.8 69.3 -9.7 -1.3 -15.5
GAGGTTTCTTGGATCCAAGT 4965 SEQ ID NO:3018 -9.4 -24 71.3 -10.9 -1.3 -15.5
AATTCTCCAGTGAACAGAAC 5170 SEQ ID NO:3019 -9.4 -19.9 60 -10 -0.2 -4.8
GAATACTTTTCTATCATCTC 5293 SEQ ID NO:3020 -9.4 -18.8 60 -9.4 0 -2.6
ATAGGCAAAGTTGGACATCC 5489 SEQ ID NO: 3021 -9.4 -22.4 65.5 -13 0 -4.5
GTCATCAATTCCAGCTTCCT 5516 SEQ ID NO: 3022 -9.4 -26 75.1 -16.6 0 -4.5
TCACCACAACCAGGAAGGAT 5742 SEQ ID NO: 3023 -9.4 -24 66.9 -13.8 -0.6 -4.3
ATGACCGCGATGTACATGTT 5761 SEQ ID NO:3024 -9.4 -23.9 66.8 -13.8 0 -8.9
AGTTTGGCATGGACCTCCTC 6553 SEQ ID NO:3025 -9.4 -27.7 78.9 -18.3 0.1 -5.1
AAATAGAATGGATGCAAGGA 6790 SEQ ID NO:3026 -9.4 -17.6 54.2 -8.2 0 -5.6
ATAGTGACATAGCATTATGA 6884 SEQ ID NO:3027 -9.4 -19 59.3 -8.1 -1.4 -4.9
CTTCAACGTAAACCTCATTT 6910 SEQ ID NO:3028 -9.4 -20.3 59.7 -10.9 0 -4.8
TGAGAGACAGGGTTCTTGTA 6938 SEQ ID NO:3029 -9.4 -22.7 69.4 -12.6 -0.4 -5
ATAACTGTTCAGATAGAAAC 7097 SEQ ID NO:3030 -9.4 -16.2 52.6 -6.1 -0.5 -5.6
GGAAGCTTGCAAAAGACACA 7483 SEQ ID NO:3031 -9.4 -20.7 60.4 -9.8 -1.4 -7
ATTCTTTAACCAAGACTTGT 7606 SEQ ID NO:3032 -9.4 -19.8 60.3 -9.4 -0.9 -5.4
AATTCATTCTATCACCAATA 7632 SEQ ID NO:3033 -9.4 -18.6 57.4 -9.2 0 -2.3
TATGAAGAATAGGTTTTGTC 7791 SEQ ID NO:3034 -9.4 -17.5 56.3 -8.1 0 -1.9
TTAGACATATTTTTAGCAAA 7812 SEQ ID NO: 3035 -9.4 -16.2 52.6 -6.8 0 -4.1
CTTTTATTTTAGGAAATTAT
8005 SEQ ID NO:3036 -9.4 -15.1 50.5 -5.1 -0.3 -4.6 ACTTTTATTTTAGGAAATTA
8006 SEQ ID NO:3037 -9.4 -15.3 51 -5.1 -0.6 -4.6 AAATGCAATAAAAAATGAAA
8468 SEQ ID NO : 3038 -9.4 -9.8 39.1 0 0 -5.6
GTTGGAACATGTGAACTTGA 8699 SEQ ID NO:3039 -9.4 -20.2 60.9 -10 -0.6 -7
TCAAACCTGAAAGTTGGAAC 8711 SEQ ID NO:3040 -9.4 -18.6 56.1 -8.7 -0.1 -4.6
AAAGCTATTGTAGGTGGTTA 8743 SEQ ID NO: 3041 -9.4 -20.6 63.3 -11.2 0 -5.1
CTCACATAAATCCAAGGGTT 8958 SEQ ID NO: 3042 -9.4 -21.3 62.4 -11.9 0 -4.1
GTTTGGTTTTGACCTCACAT 8971 SEQ ID NO:3043 -9.4 -23.8 70.4 -12.1 -2.3 -6.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TATAATTTATTATGGGAGAA 9067 SEQ ID NO:3044 -9.4 -15.3 50.6 -5.1 -0.6 -4.9
AATCCTTGACAGGTATCTCA 277 SEQ ID NO: 3045 -9.3 -22.7 67.6 -12.4 -0.9 -3.4
TTGCTCCTTTCCCAGTAAGC 309 SEQ ID NO:3046 -9.3 -27.4 77.5 -17.4 -0.4 -4.1
TCACTATTTGGCTTTGGTTT 613 SEQ ID NO: 3047 -9.3 -22.8 68.9 -13.5 0 -3.7
ACCAAAATCTTGATAGCAAT 829 SEQ ID NO:3048 -9.3 -18.3 55.5 -8.4 -0.3 -0.5
CCAGTCAGGAGGGTTGCTCA 911 SEQ ID NO:3049 -9.3 -28.3 81.8 -17 -2 -5.1
CATTGCCCAGGTCCACAAAC 1086 SEQ ID NO:3050 -9.3 -26.5 71.8 -17.2 0 -3.6
CGGAGAACTCTGAATGTTCT 1117 SEQ ID NO: 3051 -9.3 -21.4 63.2 -9.8 -2.3 -8.4
GCTGCAGCCCAATGAGAGCA 1254 SEQ ID NO:3052 -9.3 -28.7 78 -17.4 -1 -12
GAGCCATTTCCACAGAGTAA 1474 SEQ ID NO:3053 -9.3 -24.1 69.5 -14.8 0 -3.2
GACACTGGCCTGCATCTGAG 1491 SEQ ID NO:3054 -9.3 -26.9 75.9 -17.6 0 -7.2
CGAGCATCTGCTGAAATTCG 1800 SEQ ID NO:3055 -9.3 -22.4 63.5 -12.1 -0.9 -7.9
ACTTTGATGCTTCTGAAGAA 1923 SEQ ID NO:3056 -9.3 -19.8 60.4 -10 0 -8.3
ACCATGCATCACAGCAGTCC 2691 SEQ ID NO:3057 -9.3 -27.5 77.4 -16.9 -1.2 -7.5
AATTGCTCAGTCATGGGGTA 2815 SEQ ID NO:3058 -9.3 -24 71.2 -14.7 0 -4.7
TGAATTGCTCAGTCATGGGG 2817 SEQ ID NO:3059 -9.3 -23.7 69.6 -14.4 0 -4.7
CCACATTTGACAGACCAAGC 2985 SEQ ID NO:3060 -9.3 -23.9 67.2 -14.6 0 -2.9
GTCCCACATGGTCTCTATCC 3302 SEQ ID NO:3061 -9.3 -28.3 80.8 -19 0 -5.2
CCTCCATACAGTCCCACATG 3312 SEQ ID NO:3062 -9.3 -27.8 75.8 -18.5 0 -4.7
ACATAATCAATTCCCTTTTG 3505 SEQ ID NO:3063 -9.3 -20 59.7 -10.7 0 -2.6
CATCTCTAAGATAATTAAGC 3651 SEQ ID NO:3064 -9.3 -16.8 54 -6.8 -0.5 -4.9
CTCGGGGTAGAACAACATCA 3903 SEQ ID NO:3065 -9.3 -22.7 65.2 -13.4 0 -3.5
TCAGTTTCAGCTTGTTCACC 3925 SEQ ID NO:3066 -9.3 -25 75.4 -15.7 0 -4.5
ACCAACAGCACATTCATGAT 4474 SEQ ID NO:3067 -9.3 -22.3 64.4 -13 0 -6.4
TCCATCCAGCCTTTAAATGT 4714 SEQ ID NO:3068 -9.3 -24.6 69.3 -15.3 0 -4.3
CCTCTGTCATAAAGATGTCT 4914 SEQ ID NO:3069 -9.3 -21.9 65.7 -11.9 -0.4 -4.5
CTTCAGCACAAATTCTCCAG 5180 SEQ ID NO:3070 -9.3 -22.6 66.1 -13.3 0 -3.3
AACAGATGGGTCCCCACGGT 5690 SEQ ID NO:3071 -9.3 -28.9 76.8 -18.7 -0.6 -8.8
GTACATGTTCACCACAACCA 5750 SEQ ID NO: 3072 -9.3 -24.2 68.6 -14.9 0.1 -6.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CCATCTCTCCACTCTCACAC 6054 SEQ ID NO:3073 -9.3 -27 77.3 -17.7 0 -0.5
GCATCCATCTCTCCACTCTC 6058 SEQ ID NO:3074 -9.3 -28.1 81.4 -18.8 0 -3.4
TTATAGGTAAGTCAATCCTC 6273 SEQ ID NO:3075 -9.3 -20.2 62.6 -10.4 -0.2 -3.5
TCTGGTTTTGTTACACTATC 6382 SEQ ID NO:3076 -9.3 -21.1 65.9 -11.8 0 -2.7
CCTTGTCTGGTTTTGTTACA 6387 SEQ ID NO: 3077 -9.3 -24.1 72 -14.8 0 -2.7
TTACAATTCTTTTTCTGGTT 7006 SEQ ID NO:3078 -9.3 -19.6 61.5 -10.3 0 -2.6
TGACCTAAATTAAATATAGA 7210 SEQ ID NO:3079 -9.3 -14.4 48 -5.1 0 -3.2
ATTTATTAGATTACTTTTTG 7239 SEQ ID NO:3080 -9.3 -15.6 52.3 -6.3 0 -2.4
TAGAATGGATTTATTAGATT 7247 SEQ ID NO:3081 -9.3 -15.8 52.1 -6.5 0 -2.4
ACATAGGGTATTTAATTGAC 7365 SEQ ID NO:3082 -9.3 -18 56.9 -8.7 0 -2.9
TAGCCTTTAAACTATGTTTA 7530 SEQ ID NO: 3083 -9.3 -18.8 58.3 -8.5 -0.9 -5.7
AGGCAATATTAACATGCATT 7555 SEQ ID NO:3084 -9.3 -19.3 58.4 -8 -2 -6.8
AGCAGGTTGAATTCATTCTA 7641 SEQ ID NO:3085 -9.3 -21.2 64.9 -11.2 -0.4 -8.4
TGTTGAATTAAAAGTGCAAA 7714 SEQ ID NO:3086 -9.3 -15.2 49.5 -5.9 0 -5.4
TCCAGTGTGTTTCCTTGAAA 7760 SEQ ID NO:3087 -9.3 -23.5 68.8 -13.5 -0.4 -4.5
GCAGTATCCAGTGTGTTTCC 7766 SEQ ID NO:3088 -9.3 -26.7 79.3 -17.4 0 -3.7
ATTTTAGGAAATTATCCATT 8000 SEQ ID NO:3089 -9.3 -17.4 54.9 -5.9 -2.2 -7.2
ATTATCTAACTTTTATTTTA 8014 SEQ ID NO:3090 -9.3 -15.2 51.3 -5.9 0 -1.6
AATACACTACAGTAAATAGT 8373 SEQ ID NO:3091 -9.3 -16 52.1 -6.7 0 -3.6
ATAGCAATTCCCTGCATGCA 8400 SEQ ID NO:3092 -9.3 -25.9 72.1 -14.7 -1.9 -10.8
AGCAATAGCAATTCCCTGCA 8404 SEQ ID NO:3093 -9.3 -25.2 70.3 -14.2 -1.7 -7.5
TGAAAGAAGATGAGTTTAGA 8794 SEQ ID NO:3094 -9.3 -16 52.1 -6.7 0 -2.2
GACCTCACATAAATCCAAGG 8961 SEQ ID NO:3095 -9.3 -21.6 62.1 -12.3 0 -3.7
CCTTATATAATTTATTATGG 9072 SEQ ID NO:3096 -9.3 -16.3 52.6 -6.2 -0.6 -5.3
TAAATGGAAGGTTCTTTCCA 642 SEQ ID NO:3097 -9.2 -20.5 61.4 -8.4 -2.9 -9.1
AAAAGTTTTCTTATTGATAT 722 SEQ ID NO:3098 -9.2 -14.9 50.1 -4.6 , -1 -5.7
ATAAAAGTTTTCTTATTGAT 724 SEQ ID NO:3099 -9.2 -14.9 50.1 -4.6 -1 -6.3
ATATACAAGGCAGAGGTGGC 781 SEQ ID NO: 3100 -9.2 -23.3 68.6 -14.1 0 -4
TTGGTCAAAATAGTGCACAT 874 SEQ ID NO:3101 -9.2 -19.8 59.8 -9.6 0 -9.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GATTTTTATAAGTGACTCAA 971 SEQ ID NO: 3102 -9.2 -17 54.7 -7.8 0 -4.4
CCAAGATTTTTATAAGTGAC 975 SEQ ID NO: 3103 -9.2 -17.7 55.6 -8.5 0 -4.1
ATTTATTCCTCAGATTGCCC 1281 SEQ ID NO:3104 -9.2 -24.9 71.5 -15.7 0 -3
TCCCATTTGAATCCATTGTG 1362 SEQ ID NO:3105 -9.2 -23.6 67.2 -14.4 0 -2.3
CAGATGTATCCTTCTGGACA 1507 SEQ ID NO: 3106 -9.2 -23.6 69.6 -13 -1.3 -6.6
TTTTTGTTCTGCTTCTTCCA 1775 SEQ ID NO:3107 -9.2 -24.3 73.2 -15.1 0 -3.6
TGCTTTCGCCGTCTTCAAAT 2271 SEQ ID NO:3108 -9.2 -25 69.4 -15.1 -0.5 -3.6
CTCTCCTGCTTTCGCCGTCT 2277 SEQ ID NO:3109 -9.2 -30.7 83.6 -20.8 -0.5 -3.6
GAGTCTCTCCTGCTTTCGCC 2281 SEQ ID NO:3110 -9.2 -29.6 84 -19.7 -0.5 -4.1
CATCTTCCCATTTGCTGGAA 2384 SEQ ID NO:3111 -9.2 -25.2 71 -14.9 -1 -4.4
ATCCACAGTGCTGTGCATCT 2399 SEQ ID NO:3112 -9.2 -26.9 77.8 -15.5 -1.7 -12.4
CCATTGCAATCCACAGTGCT 2407 SEQ ID NO: 3113 -9.2 -26.5 73.4 -16.3 -0.8 -9
ATTGGCAAATCTATACCAGC 2657 SEQ ID NO:3114 -9.2 -21.8 63.8 -11.9 -0.4 -4.4
CATGGCCATAAAGAGGGTAT 2789 SEQ ID NO: 3115 -9.2 -22.6 65.1 -12.2 0 -10.4
AAATCCCAGTAAAGACCAGG 2859 SEQ ID NO:3116 -9.2 -21.9 62.2 -12.7 0 -3.6
GACCTCCATACAGTCCCACA 3314 SEQ ID NO:3117 -9.2 -28.6 77.9 -19.4 0 -3.3
CAATAAGGCACATGGTTTGG 3339 SEQ ID NO:3118 -9.2 -21.4 62.8 -12.2 0 -5.2
TCCAGTATTATTGGACATGC 3614 SEQ ID NO:3119 -9.2 -22.4 66.7 -12 -1.1 -7.9
GCAGGTTTTTCGAAGATTCC 4049 SEQ ID NO:3120 -9.2 -23.5 68.6 -13.6 -0.4 -6.8
ACAATGAAAGTCTCAAACCA 4090 SEQ ID NO:3121 -9.2 -18.5 55.8 -8.7 -0.3 -3.1
TTTGTCAGCATATTCTAGCA 4187 SEQ ID NO: 3122 -9.2 -22.3 68.2 -12.1 -0.9 -4.1
GCTCCAACAAGAGCATTCAC 4444 SEQ ID NO:3123 -9.2 -23.8 68.4 -12.1 -2.5 -7.8
TTCTGTTCCTCTGTCATAAA 4921 SEQ ID NO: 3124 -9.2 -21.9 66.4 -12.7 0 -1.8
AAAGGTCTCAAAGTTGAACA 5537 SEQ ID NO: 3125 -9.2 -18.1 56.1 -8 -0.8 -6.5
AGCAGAGGTTGTAATTTGGA 5579 SEQ ID NO:3126 -9.2 -21.8 66.1 -12.6 0 -5.7
AGTTTAGAGAACTCTATAAA 5890 SEQ ID NO:3127 -9.2 -16 52.6 -5.6 -1.1 -8
GAGTGGAGTTCCCATTTAGT
6315 SEQ ID NO: 3128 -9.2 -25.1 74.4 -14.6 -1.2 -6.4 GGAGTGGAGTTCCCATTTAG
6316 SEQ ID NO:3129 -9.2 -25.1 73.5 -14.6 -1.2 -6 GTCTGGTTTTGTTACACTAT
6383 SEQ ID NO:3130 -9.2 -21.9 67.8 -12.7 0 -2.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AAACTTTTCCTTGTCTGGTT 6395 SEQ ID NO:3131 -9.2 -22.4 67 -13.2 0 -3.5
CTCTTTTCCTTTGCTTTCTT 6434 SEQ ID NO: 3132 -9.2 -24.3 73.2 -15.1 0 -3.6
GCTTCACAGAGTTGCAGTGA 6633 SEQ ID NO:3133 -9.2 -25 74.7 -14.5 -1.2 -7.2
CTGTTTCTTCAACGTAAACC 6916 SEQ ID NO: 3134 -9.2 -20.8 61.4 -10.5 -1 -6.6
TAAAAATAATCCTTTAAATA 7139 SEQ ID NO: 3135 -9.2 -11.4 42.2 -2.2 0 -4.3
GATTACTTTTTGGAAAGCAT 7231 SEQ ID NO:3136 -9.2 -18.8 57.9 -8.7 -0.7 -4.6
GCTGAGAGCAGAAGATGGCA 7329 SEQ ID NO:3137 -9.2 -24.6 71.1 -14 -1.3 -6.5
CAGCATAGGCAATATTAACA 7561 SEQ ID NO:3138 -9.2 -19.6 59 -8.8 -1.6 -6.7
GAATTCATTCTATCACCAAT 7633 SEQ ID NO:3139 -9.2 -19.5 59.2 -10.3 0 -6.7
GCAGGTTGAATTCATTCTAT 7640 SEQ ID NO:3140 -9.2 -21.2 64.6 -11.3 -0.4 -8.4
AAATTATTCTGCTTGACATA 7669 SEQ ID NO: 3141 -9.2 -17.8 55.9 -8.6 0 -3.6
GCAAAATATGAAGAATAGGT 7797 SEQ ID NO:3142 -9.2 -16 51.1 -6.8 0 -3.4
7AAACAAAAATTTATATCATG 8312 SEQ ID NO: 3143 -9.2 -11.4 42.2 -2.2 0 -5.2
GTTTAGATGCTTATAGCCAA 8781 SEQ ID NO:3144 -9.2 -21.7 64.9 -11.2 -1.2 -4.6
TATACATAGGAGTTTATATA 8884 SEQ ID NO:3145 -9.2 -16.3 53.8 -7.1 0 -3.2
GCTTGGCTTCAGTTTTCTTG 236 SEQ ID NO: 3146 -9.1 -24.8 74.9 -15.7 0 -4.4
CTCATCCCTGTCAAACCTTG 261 SEQ ID NO: 3147 -9.1 -25.4 70.9 -16.3 0 -2.5
CTCCAGGTCCCTTCTGTGAA 369 SEQ ID NO:3148 -9.1 -28.2 79.2 -18.6 -0.2 -4.2
GCTTTGGTTTGTTCTCATCA 603 SEQ ID NO: 3149 -9.1 -24.3 74 -15.2 0 -2.8
TGTCTCCATAAATAAATGGA 654 SEQ ID NO: 3150 -9.1 -18 55.3 -6.8 -2.1 -7.5
TTCATTACTATAAAAGTTTT 733 SEQ ID NO: 3151 -9.1 -14.9 50.1 -5.2 -0.3 -5.9
AAATATACAAGGCAGAGGTG 783 SEQ ID NO: 3152 -9.1 -18.9 57.7 -9.8 0 -4
ACATTGCCCAGGTCCACAAA 1087 SEQ ID NO: 3153 -9.1 -26.5 71.8 -17.4 0 -3.6
GCCACTGCAAACATTTATTC 1293 SEQ ID NO: 3154 -9.1 -22 64 -12.1 -0.6 -4.7
TTGGGGGCCACTGCAAACAT 1299 SEQ ID NO:3155 -9.1 -26.5 72 -15.9 -1.4 -6.9
CTTCCAGTTAAATGTGCTCA 1400 SEQ ID NO: 3156 -9.1 -22.7 67 -13.6 0 -5.6
AATGTCAACTGGTAAAGATT 1630 SEQ ID NO: 3157 -9.1 -17.4 54.7 -8.3 0 -3.2
CATGTCTGTGCGGCACAAAC 2304 SEQ ID NO: 3158 -9.1 -24.4 68.6 -12.7 -1.4 -13.2
GTTGTCCAGTAGGTGACGTT 2460 SEQ ID NO:3159 -9.1 -25.8 76 -15.6 -1 -5.4 kcal/ mol kcal/mol deg C kcal/mol 'kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CTTAACCTTCTCTTTCTGAC 2512 SEQ ID NO:3160 -9.1 -22.1 66.7 -13 0 -2.6
CTCCAGCATCTCCATTGAAA 2543 SEQ ID NO: 3161 -9.1 -24.2 68.6 -15.1 0 -3.3
CACTGGTGGTTCCATTCCCA 3669 SEQ ID NO:3162 -9.1 -29 80 -18.7 -1.1 -6.4
ATCATTTTCATCGATTACGT 3719 SEQ ID NO:3163 -9.1 -20.3 61.1 -10.3 -0.7 -6.3
GCCTTCTTCTGTACTTACTT 4013 SEQ ID NO:3164 -9.1 -24.5 73.4 -15.4 0 -4.8
CTCAAACCAGTTGTGCTCAA 4079 SEQ ID NO:3165 -9.1 -23.1 66.8 -13.3 -0.5 -6.4
TAGCCAGCACCAGGCATTAG 4277 SEQ ID NO:3166 -9.1 -27.1 75.8 -15.3 -2.7 -7.4
CCAACAGCACATTCATGATA 4473 SEQ ID NO: 3167 -9.1 -21.8 63.3 -12.7 0 -6.4
GACCAACAGCACATTCATGA 4475 SEQ ID NO:3168 -9.1 -22.9 65.7 -13.8 0 -6.1
ACAGACCAACAGCACATTCA 4478 SEQ ID NO:3169 -9.1 -23.2 66.4 -14.1 0 -4.1
TTTCTTGGATCCAAGTTTCT 4961 SEQ ID NO:3170 -9.1 -22.5 67.9 -9.7 -1.3 -15.5
GCTGGGCGAGGTATGGGTTT 4987 SEQ ID NO:3171 -9.1 -28.2 79.4 -19.1 0 -3.7
CAATTCCAGCTTCCTTTTTA 5511 SEQ ID NO:3172 -9.1 -23.4 68.2 -14.3 0 -4.5
GTTCTCCAGGATGACCGCGA 5771 SEQ ID NO:3173 -9.1 -28.3 76.2 -17.8 -1.3 -7.2
CTCTGCACTTTCTTCAGTAG 5801 SEQ ID NO:3174 -9.1 -23.4 71.8 -13.8 -0.1 -4.8
ATCTCAAAGTCATCCTCACT 5827 SEQ ID NO: 3175 -9.1 -22.8 68 -13.7 0 -2.6
CGGCAGACACCTCCTCTTGT 6165 SEQ ID NO:3176 -9.1 -29 79.4 -19.4 -0.1 -4
ATATTTTTTAACCTTTGCTT 6220 SEQ ID NO:3177 -9.1 -19.3 59.5 -10.2 0 -3.6
TTGCCTCTTTGTTATAGTTA 6246 SEQ ID NO: 3178 -9.1 -22 67.6 -12.9 0 -3
GTTTTTTCTGGAGTGGAGTT 6325 SEQ ID NO:3179 -9.1 -23.1 71.6 -14 0 -2.7
TTCCTTTGCTTTCTTTTTCT 6429 SEQ ID NO:3180 -9.1 -23.5 71.5 -14.4 0 -3.6
TGAGTATTTGTTAAAACAGT 6574 SEQ ID NO:3181 -9.1 -16.7 54 -7.6 0 -6.1
ATGAATAAACTATGAATTGG 6868 SEQ ID NO:3182 -9.1 -14.2 47.6 -5.1 0 -3.1
GACATAGCATTATGAATAAA 6879 SEQ ID NO:3183 -9.1 -15.7 50.8 -5.1 -1.4 -5
TGTATACTGTTTCTTCAACG 6922 SEQ ID NO: 3184 -9.1 -19.9 61 -9.7 -1 -7.3
TCATTTGAGAGACAGGGTTC 6943 SEQ ID NO:3185 -9.1 -22.1 67.8 -13 0 -3.1
TTTCAAAATTAAAGCCATCT
7056 SEQ ID NO: 3186 -9.1 -17.4 53.9 -8.3 0 -3.2 CTTTCAAAATTAAAGCCATC
7057 SEQ ID NO:3187 -9.1 -17.4 53.9 -8.3 0 -3.9 ATTGACATAGACTATCAGCT
7351 SEQ ID NO:3188 -9.1 -20.5 62.9 -11.4 0 -4.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
ATTAACATGCATTAGTGATA 7548 SEQ ID NO:3189 -9.1 -17.8 56.2 -8.7 0 -6.8
GAGCAGGTTGAATTCATTCT 7642 SEQ ID NO: 3190 -9.1 -22.1 66.9 -12.3 -0.4 -8.4
ATTTAAACAAGTTTTAGACA 7825 SEQ ID NO: 3191 -9.1 -15.4 50.8 -5.6 -0.4 -5.5
AGGAAATTATCCATTGAAAA 7995 SEQ ID NO:3192 -9.1 -15.9 50.6 -4.6 -2.2 -7.2
AGCTTTAGTGCAGCAGGAAT 8222 SEQ ID NO: 3193 -9.1 -23.9 70.7 -13.2 -1.5 -6.6
GCTCAATAATGACGTAGCTC 8436 SEQ ID NO:3194 -9.1 -21.7 64.1 -11.9 -0.5 -6.7
TCTCTTCTGCAGCACGTTTT
549 SEQ ID NO: 3195 -9 -25.5 74.9 -16 0 -8.3 TTCTCTTCTGCAGCACGTTT
550 SEQ ID NO:3196 -9 -25.5 74.9 -16 0 -8.3 TTTCTCTTCTGCAGCACGTT
551 SEQ ID NO:3197 -9 -25.5 74.9 -16 0 -8.3 TTCTCATCATCATTATCTTG
592 SEQ ID NO: 3198 -9 -19.9 62.8 -10.9 0 -1.6
CCATAAATAAATGGAAGGTT 649 SEQ ID NO:3199 -9 -16.9 52.4 -6.8 -1 -5.3
ATTACTATAAAAGTTTTCTT 730 SEQ ID NO:3200 -9 -15.1 50.7 -5.2 -0.8 -6.3
ATTCATTACTATAAAAGTTT 734 SEQ ID NO: 3201 -9 -14.8 49.8 -5.2 -0.3 -4.3
CTTGGGGGCCACTGCAAACA 1300 SEQ ID NO:3202 -9 -27.4 73.8 -16.9 -1.4 -7.6
CATGGCCACCACAGCCAGGA 1727 SEQ ID NO: 3203 -9 -30.5 80.3 -18.7 -2.8 -9.1
AGCTTCTTCCTGTTGCTTTT 1829 SEQ ID NO: 3204 -9 -25.8 76.9 -16.3 -0.2 -4.3
TCCACTGAAATCTCTTGAAG 1874 SEQ ID NO: 3205 -9 -20 60.2 -11 0 -2.7
CTAACCCACCTACTCCACTG 1887 SEQ ID NO:3206 -9 -26.9 72.5 -17.9 0 -1.4
TTCTTTTGACGCTGTCTTCA 2055 SEQ ID NO:3207 -9 -23.7 70.6 -13.8 -0.8 -7.6
GAAGCTGCTTCTTTTGACGC 2063 SEQ ID NO:3208 -9 -24.4 70.3 -13.2 -1.2 -12.4
GGAAAACAGGGAGCCACGGA 2156 SEQ ID NO:3209 -9 -24.9 67.4 -15.3 -0.3 -4.3
TCCAGCATCTCCATTGAAAT 2542 SEQ ID NO: 3210 -9 -23.3 66.7 -14.3 0 -4.1
GCAAAAATGAAGACGATGAT 3142 SEQ ID NO:3211 -9 -16.4 50.9 -7.4 0 -3.5
AGTCGTTCATGTGCCACCGT 3237 SEQ ID NO:3212 -9 -28.7 78.9 -19.7 0 -4.7
CACGCGGAACACAATCAGGA 3269 SEQ ID NO: 3213 -9 -23.4 64.2 -13.9 0 -7.9
TTATTTTTCACATAATCAAT 3514 SEQ ID NO:3214 -9 -15.6 51.4 -6.6 0 -2.1
TAAAGTCTTCTTCGGGTTCA 3942 SEQ ID NO:3215 -9 -22.3 67 -12.6 -0.5 -3.8
TGATAGTCTTTCGCTGTTCA 4161 SEQ ID NO: 3216 -9 -23.3 70.3 -14.3 0 -3.4
AAACATCAACGATCAAGAAA 4299 SEQ ID NO:3217 -9 -15.1 48.6 -6.1 0 -4.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
AAAGAAACATCAACGATCAA 4303 SEQ ID NO:3218 -9 -15.1 48.6 -6.1 0 -4.9
GGCTCTTAGAGGTCTTAAAG 4394 SEQ ID NO:3219 -9 -21.7 66.3 -12.1 -0.3 -5.3
GCACATTCATGATAGAGGGA 4467 SEQ ID NO:3220 -9 -22.5 66.8 -13.5 0 -6.4
TACTTTCACGTTTTTCCACC 4646 SEQ ID NO:3221 -9 -24 69.2 -15 0 -4.7
CCTCCAAACTTCTTTTTCTG 4891 SEQ ID NO:3222 -9 -22.8 66.5 -13.8 0 -1.8
CAGATGAGGATCATGATGCT 5062 SEQ ID NO:3223 -9 -22.1 65.6 -11 -2.1 -8.5
TTTCCACCATCATGGTGACC 5091 SEQ ID NO:3224 -9 -26.5 74 -13.8 -3.7 -11.1
TCAGCACAAATTCTCCAGTG 5178 SEQ ID NO:3225 -9 -22.8 66.9 -13.3 -0.2 -4.5
CCTTTGATCAGACGTAGGAT 5362 SEQ ID NO: 3226 -9 -23.1 67.1 -14.1 0 -6.5
GAGCAGGAGGCCGATGTTAA 5438 SEQ ID NO:3227 -9 -25.6 71.6 -15.7 -0.8 -7.7
GGACATCCCAAAGATGGCAT 5477 SEQ ID NO: 3228 -9 -24.7 68.3 -13.4 -2.3 -8
AGATCATGCTGTTGCCAAAG 5553 SEQ ID NO:3229 -9 -22.8 66.2 -12.9 -0.8 -6.6
TTAATTGCCTCTTTGTTATA 6250 SEQ ID NO:3230 -9 -20.1 61.8 -11.1 0 -3
TCCTTTGCTTTCTTTTTCTG 6428 SEQ ID NO:3231 -9 -23.4 70.9 -14.4 0 -3.6
TGGGTTTCTCCTCAGCAGTG 6699 SEQ ID NO:3232 -9 -27.2 80.3 -17.3 -0.8 -5.7
TTGGGGACCATGGAAATGCA 6852 SEQ ID NO:3233 -9 -24.1 67 -12.7 -2.4 -9.9
GAATTGGGGACCATGGAAAT 6855 SEQ ID NO:3234 -9 -21.5 61.4 -10.1 -2.4 -8.8
CAATACTTTAGATATATTTT 7269 SEQ ID NO: 3235 -9 -15 50.4 -6 0 -4.3
TGCTGAGAGCAGAAGATGGC 7330 SEQ ID NO:3236 -9 -23.9 69.8 -13 -1.9 -6.5
GTCCATGTTATATTTGTAAT 8242 SEQ ID NO:3237 -9 -19.4 60.4 -10.4 0 -4.3
TTTTTAGCAATAGCAATTCC 8409 SEQ ID NO:3238 -9 -19.9 60.5 -9.2 -1.7 -4.6
AGCTATTGTAGGTGGTTACT 8741 SEQ ID NO:3239 -9 -23.1 70.8 -13.6 -0.1 -4.4
TGACAGGTATCTCATCCCTG 271 SEQ ID NO:3240 -8.9 -25.3 73.2 -14.6 -1.8 -6.1
CACATTTAATTACGTGTAGC 440 SEQ ID NO: 3241 -8.9 -19.5 59.4 -10.6 0 -5
AGTAAAAAGGCGGAAGCTTT 506 SEQ ID NO:3242 -8.9 -19.9 58.6 -8.6 -2.4 -7.2
TCATCATCATTATCTTGTTC 589 SEQ ID NO: 3243 -8.9 -20.2 64.1 -11.3 0 -1.9
AGCTTCCAAGTCACTATTTG 623 SEQ ID NO: 3244 -8.9 -22.5 67.4 -13.6 0 -4.3
AATATACAAGGCAGAGGTGG 782 SEQ ID NO: 3245 -8.9 -20.8 62.2 -11.9 0 -4
AAATACACAGTTGGTCAAAA 884 SEQ ID NO: 3246 -8.9 -16.8 52.9 -7.9 0 -3.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
GGTTGCTCAAGGTCATAAAT 900 SEQ ID NO:3247 -8.9 -21.4 64 -12.5 0 -3.6
AGGAGGGTTGCTCAAGGTCA 905 SEQ ID NO: 3248 -8.9 -26.1 76.9 -15.2 -2 -4.7
GTCCAGTCAGGAGGGTTGCT 913 SEQ ID NO:3249 -8.9 -28.8 84.6 -18.4 -1.4 -5.9
GTGACTCAAAGGTATAGATT 960 SEQ ID NO:3250 -8.9 -19.1 59.5 -10.2 0 -3.1
AAATTGTTTTCAGTGCTCGG 1134 SEQ ID NO:3251 -8.9 -21.6 64.3 -12.7 0 -4.5
GAGCAAACACGCTCAGACAG 1239 SEQ ID NO: 3252 -8.9 -22.9 65.3 -11.5 -2.5 -7.8
ACACAGATGTATCCTTCTGG 1510 SEQ ID NO:3253 -8.9 -23.2 68.8 -12.7 -1.6 -5.3
TTGTTCTGCTTCTTCCAAGG 1772 SEQ ID NO: 3254 -8.9 -24.5 72.5 -15.1 -0.1 -3.6
GAAGCCCTGGCACCATCCTG 2367 SEQ ID NO:3255 -8.9 -30.5 80 -20.7 -0.7 -8.2
ACACATTGGCAAATCTATAC 2661 SEQ ID NO:3256 -8.9 -19.1 58.2 -10.2 0 -4.4
AACCATGCATCACAGCAGTC 2692 SEQ ID NO: 3257 -8.9 -24.8 71.3 -15 -0.7 -7.5
CACAAGATGTTTTACTTTTA 2711 SEQ ID NO:3258 -8.9 -17.8 56.5 -8.9 0 -3
AAACTCTAAGCAGTCTGAAT 3027 SEQ ID NO:3259 -8.9 -18.9 58.2 -10 0 -4.1
TCCTAGAGCCCCCACAGAAT 3101 SEQ ID NO:3260 -8.9 -28.9 76.7 -20 0 -3.8
AAGGTGAGGTTTCCTAGAGC 3112 SEQ ID NO:3261 -8.9 -24.3 72.5 -14.7 -0.5 -4.4
ACTGGTGGTTCCATTCCCAT 3668 SEQ ID NO:3262 -8.9 -28.3 79 -18.2 -1.1 -6.6
CTGGGGTTGTTTATGAATGA 3745 SEQ ID NO: 3263 -8.9 -21.4 64.2 -12.5 0 -1.8
CTTCAAAGGCCAATGCACCA 4131 SEQ ID NO:3264 -8.9 -25.1 68.5 -14.7 -1.4 -7.7
CAACGATCAAGAAATCTAGC 4293 SEQ ID NO:3265 -8.9 -18 54.9 -9.1 0 -4.9
ATGTCCGTAATGATTTGATG 4368 SEQ ID NO:3266 -8.9 -20 59.9 -11.1 0 -2.3
CAGACCAACAGCACATTCAT 4477 SEQ ID NO:3267 -8.9 -23 65.9 -14.1 0 -4.1
ACTTGCCAGCAAACAAATTC 4533 SEQ ID NO: 3268 -8.9 -20.8 60.5 -11.9 0 -7.4
GTACAGATTTTCTTCATATA 4781 SEQ ID NO:3269 -8.9 -18.6 59.6 -9.7 0 -4.6
TGTTTGCTGGGCGAGGTATG 4992 SEQ ID NO: 3270 -8.9 -25.8 73.8 -16.9 0.1 -4
GATGAGGATCATGATGCTGA 5060 SEQ ID NO:3271 -8.9 -22 65.4 -11 -2.1 -8.5
CATGGTGACCATGTTGAGGC 5081 SEQ ID NO:3272 -8.9 -25.5 73 -14 -2.6 -10.3
GCTCTGCACTTTCTTCAGTA 5802 SEQ ID NO: 3273 -8.9 -25.2 76.3 -15.8 -0.1 -4.8
AGAACTCTATAAACTGGGTC 5883 SEQ ID NO:3274 -8.9 -19.4 59.8 -10.5 0 -2.6
ATCAGAGAGTTTAGAGAACT 5897 SEQ ID NO: 3275 -8.9 -19 60.2 -8.6 -1.4 -5.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
TGGGCAGATCCATGGCAATA 5973 SEQ ID N0:3276 -8.9 -25.3 71 -15.4 -0.9 -8
AATGATAGCGGCAGACACCT 6173 SEQ ID NO:3277 -8.9 -24.5 68.2 -15.6 0 -6.6
ATAGGTAAGTCAATCCTCCC 6271 SEQ ID NO:3278 -8.9 -24.4 70.5 -15 -0.2 -3.5
TAGAATGGATGCAAGGACTG 6787 SEQ ID NO:3279 -8.9 -20.1 60.1 -11.2 0 -5.6
CCATTACAATTCTTTTTCTG 7009 SEQ ID NO:3280 -8.9 -19.8 60.5 -10.9 0 -2.5
CTGTTCAGATAGAAACAAAC
7093 SEQ ID NO:3281 -8.9 -16.5 52.7 -6.8 -0.6 -4.1 ACTGTTCAGATAGAAACAAA
7094 SEQ ID NO:3282 -8.9 -16.5 52.7 -6.8 -0.6 -5.6 AACTGTTCAGATAGAAACAA
7095 SEQ ID NO: 3283 -8.9 -16.5 52.7 -6.8 -0.6 -5.6 TTAGAGGAGACTTTACAGGC
7119 SEQ ID NO:3284 -8.9 -21.7 66.2 -11.9 -0.7 -5.4
CTTTAAATATTAGAGGAGAC 7128 SEQ ID NO:3285 -8.9 -16.1 52.6 -7.2 0 -4.3
TTTGACCTAAATTAAATATA 7212 SEQ ID NO:3286 -8.9 -14 47.3 -5.1 0 -3.2
GTTCATGGCTAAAAAGAACA 8264 SEQ ID NO:3287 -8.9 -18 55.2 -7.7 -1.3 -5.7
ATTCTTTTGGCTCAATAATG 8445 SEQ ID NO:3288 -8.9 -19 58.8 -10.1 0 -5.3
AATTATATTGAAAGAAGATG
8802 SEQ ID NO:3289 -8.9 -12.6 44.7 -3.7 0 -2.3 CAATTATATTGAAAGAAGAT
8803 SEQ ID NO:3290 -8.9 -13.3 46 -3.7 -0.4 -3.4 TTTCTCTGTGGATAAGAAAA
48 SEQ ID NO: 3291 -8.8 -17.3 54.8 -7.4 -1 -4.5
GCTCCAGGTCCCTTCTGTGA 370 SEQ ID NO:3292 -8.8 -30.7 86.5 -21.4 -0.2 -4
GATTCTCTAGTAAAAAGGCG 514 SEQ ID NO: 3293 -8.8 -18.9 57.5 -10.1 0 -4
TTGGGCTTCTTGGCTTTCTC 565 SEQ ID NO: 3294 -8.8 -26.5 78.9 -16.7 -0.9 -3.7
GCTTCCAAGTCACTATTTGG 622 SEQ ID NO: 3295 -8.8 -23.7 69.8 -13.6 -1.2 -5.2
TATACAAGGCAGAGGTGGCA 780 SEQ ID NO:3296 -8.8 -24 69.8 -14.3 -0.8 -4.1
AAATCTTGATAGCAATTTTC 825 SEQ ID NO: 3297 -8.8 -16.8 54 -7.5 -0.1 -0.3
CTCAGATTGCCCATGAACAG 1273 SEQ ID NO:3298 -8.8 -24 67.9 -15.2 0 -4.5
CCAAGGTGGCCTGATTCTGC 1758 SEQ ID NO:3299 -8.8 -28.1 77.8 -18.6 -0.4 -7.2
TTTTTTGTCACTGGTCAGTC 2105 SEQ ID NO:3300 -8.8 -23 71.8 -14.2 0 -6.6
ACTGATGAGGGGAGCAGAAT 2124 SEQ ID NO:3301 -8.8 -22.9 66.9 -13.4 -0.5 -4.1
AAATGCTTGTTTTGCTATTG 2184 SEQ ID NO:3302 -8.8 -19.4 59.6 -9.9 -0.4 -4.3
GCTATGCTCACGGCTCTTTG 2578 SEQ ID NO:3303 -8.8 -26.6 75.7 -17.1 -0.4 -4.7
TAACCATGCATCACAGCAGT 2693 SEQ ID NO:3304 -8.8 -24.1 69.1 -14 -1.2 -6.4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
ACATTTGACAGACCAAGCTC
2983 SEQ ID NO:3305 -8.8 -22.5 65.8 -13.7 0 -5 CACATTTGACAGACCAAGCT
2984 SEQ ID NO:3306 -8.8 -22.8 65.5 -14 0 -4.8 AATGATCGCAGTACAGACAA
3010 SEQ ID NO:3307 -8.8 -20.2 59.9 -10.7 -0.4 -5.7
TGAGGTTTCCTAGAGCCCCC 3108 SEQ ID NO:3308 -8.8 -30.6 83.1 -21.1 -0.5 -4.4
TAATCAATTCCCTTTTGCAT 3502 SEQ ID NO:3309 -8.8 -21.6 63.1 -12.8 0 -5.1
ATAATTAAGCTCTTTGCTTA 3641 SEQ ID NO:3310 -8.8 -18.8 58.8 -7.5 -2.5 -8
CATTTTCATCGATTACGTAT 3717 SEQ ID NO:3311 -8.8 -19.6 59.2 -9.9 -0.7 -6.3
ACAGCAATTGGCACTGTGAC 3772 SEQ ID NO:3312 -8.8 -23.6 68.4 -13.2 -1.5 -8.7
TCTTAGAGGTCTTAAAGCTC 4391 SEQ ID NO:3313 -8.8 -20.9 65.2 -12.1 0.7 -5
AACAGCACATTCATGATAGA 4471 SEQ ID NO:3314 -8.8 -19.7 59.9 -10.9 0 -6.4
AATGTCAAACATGTTACCCG 4577 SEQ ID NO:3315 -8.8 -21.1 60.4 -11.1 -1.1 -9
CAGTGCAAGATAGCCAGCGC 4682 SEQ ID NO:3316 -8.8 -26.9 74.4 -17.2 -0.7 -7.3
TCCTCTGTCATAAAGATGTC 4915 SEQ ID NO:3317 -8.8 -21.4 65.2 -11.9 -0.4 -3.1
CTGGTCATCCGTTTCCACCA 5102 SEQ ID NO:3318 -8.8 -29 79 -19 -1.1 -5.4
TGCCCTGGTCATCCGTTTCC 5106 SEQ ID NO:3319 -8.8 -31.2 83.9 -21.2 -1.1 -4.4
AGTAGTAGTGTCTGAGGGAA 5205 SEQ ID NO:3320 -8.8 -22.4 69.6 -13.6 0 -2.9
CAACAGATGGGTCCCCACGG 5691 SEQ ID NO:3321 -8.8 -28.4 74.6 -18.7 -0.6 -8.8
CCACAACCAGGAAGGATATG 5739 SEQ ID NO:3322 -8.8 -22.4 63.3 -12.8 -0.6 -4.4
GAGTTTAGAGAACTCTATAA 5891 SEQ ID NO:3323 -8.8 -17.3 55.9 -5.6 -2.9 -8.5
GCCATAAACCTGTCTTCCAT 6091 SEQ ID NO:3324 -8.8 -25.6 71.1 -16.8 0 -2
ATAGGAAGGAGGAGGGGTGG 6362 SEQ ID NO:3325 -8.8 -24.4 71.1 -15.6 0 -0.9
TCTGGTTTGTCTTTCTCAAA 6412 SEQ ID NO: 3326 -8.8 -21.6 66.6 -12.3 -0.2 -6.4
TACTAAAGGTGTTTGGTGTA 6767 SEQ ID NO:3327 -8.8 -20.2 62.5 -10.5 -0.8 -6.2
ACTGTACTAAAGGTGTTTGG 6771 SEQ ID NO: 3328 -8.8 -20.4 62.5 -11.6 0 -5.1
TATACTGTTTCTTCAACGTA 6920 SEQ ID NO:3329 -8.8 -19.6 60.5 -9.7 -1 -5.3
TAACTGTTCAGATAGAAACA 7096 SEQ ID NO:3330 -8.8 -16.9 53.9 -7.4 -0.5 -5.6
TTGACCTAAATTAAATATAG 7211 SEQ ID NO:3331 -8.8 -13.9 47.1 -5.1 0 -3.2
GCATTTGACCTAAATTAAAT 7215 SEQ ID NO:3332 -8.8 -17.1 53.1 -7.7 -0.3 -4.8
CTAGAATGGATTTATTAGAT 7248 SEQ ID NO: 3333 -8.8 -16.6 53.7 -7.8 0 -3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
ACCAATATGTGACATTCTTT 7619 SEQ ID NO:3334 -8.8 -20.2 61 -11.4 0 -3.9
ATGTTGAATTAAAAGTGCAA 7715 SEQ ID NO: 3335 -8.8 -15.9 51.1 -7.1 0 -5.4
TAGCTTTAGTGCAGCAGGAA 8223 SEQ ID NO:3336 -8.8 -23.6 70.1 -13.,2 -1.5 -6.6
TACAGTAAATAGTTTTGTAA 8366 SEQ ID NO:3337 -8.8 -15.5 51.6 -6.7 0 -4.1
TTCTTCAATACACTACAGTA 8379 SEQ ID NO:3338 -8.8 -19.1 59.9 -10.3 0 -3.4
AAACCCCAGAGCCCAATAAG 8490 SEQ ID NO:3339 -8.8 -24.9 66.1 -16.1 0 -3.2
TTATTAGCCACCAAGTAATT 8835 SEQ ID NO: 3340 -8.8 -20.6 61.1 -11.8 0 -3.2
TGGGAGAATTATGAAATACA 9055 SEQ ID NO:3341 -8.8 -16.5 52.3 -7.7 0 -3.2
TCTGTGAATTATCTCATTTA 357 SEQ ID NO:3342 -8.7 -18.5 58.9 -9.8 0.4 -3.2
TTCCGGAAAAGCTCCAGGTC 380 SEQ ID NO:3343 -8.7 -25.6 70.9 -15 -1.9 -9.8
ATAAATAAATGGAAGGTTCT 647 SEQ ID NO: 3344 -8.7 -15.5 50.5 -6.8 0 -4.2
ATCCAGGTCCTCCAGGGGCT 695 SEQ ID NO:3345 -8.7 -32.2 88.8 -22.1 -1.3 -8.4
TTATTCATTACTATAAAAGT 736 SEQ ID NO:3346 -8.7 -14.4 49 -5.2 -0.1 -2.7
TTGTCCAGTCAGGAGGGTTG 915 SEQ ID NO:3347 -8.7 -26.2 77.8 -16.1 -1.3 -5.3
TCTTCTAAGCAAAACCCTCT 997 SEQ ID NO:3348 -8.7 -22.5 64.7 -13.8 0 -4.1
GAGAGCAAACACGCTCAGAC 1241 SEQ ID NO:3349 -8.7 -22.8 65.4 -10.8 -3.3 -8.5
AGATGTATCCTTCTGGACAC 1506 SEQ ID NO:3350 -8.7 -23.1 69 -13 -1.3 -5.8
CTTCACACAGATGTATCCTT 1514 SEQ ID NO: 3351 -8.7 -22.8 67.8 -13.4 -0.5 -3.7
CTTGAGTCATGAGTCGAAAT 1599 SEQ ID NO:3352 -8.7 -20.1 60.7 -9.7 0 -11.6
TAATGTCAACTGGTAAAGAT 1631 SEQ ID NO: 3353 -8.7 -17 53.9 -8.3 0 -3.2
CTCCTTTGTTGTTTCCTTCA 2007 SEQ ID NO:3354 -8.7 -25.6 75.7 -16.9 0 -1.7
TCTCTCTCCTTTGTTGTTTC 2012 SEQ ID NO:3355 -8.7 -24.5 76.1 -15.8 0 0
CAGTCTGTTTCCATCCATGG 2090 SEQ ID NO:3356 -8.7 -26 75.3 -16.6 -0.5 -7.7
GTCAGTCTGTTTCCATCCAT 2092 SEQ ID NO:3357 -8.7 -26.4 78.2 -17.7 0 -3.6
GGTGCCCTCTGGGGGAAGTT 2477 SEQ ID NO:3358 -8.7 -30.4 83.9 -19.5 -2.2 -8.7
AGCTTAACCTTCTCTTTCTG 2514 SEQ ID NO:3359 -8.7 -23.1 69.4 -14.4 0 -4.3
TTGGCAAATCTATACCAGCA 2656 SEQ ID NO:3360 -8.7 -22.5 64.9 -13.1 -0.5 -4.6
GGGTATTTAAGACAATGCAA 2775 SEQ ID NO:3361 -8.7 -19.1 58 -9.9 -0.1 -5.6
ACCAGGTTTCCTACAGTCAA 2845 SEQ ID NO: 3362 -8.7 -25 72.4 -15.8 -0.1 -4.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
AGTAAAGACCAGGTTTCCTA 2852 SEQ ID NO:3363 -8.7 -22.6 66.6 -13.4 -0.1 -5.9
CCATCAAAGATATTCCAGCC 2938 SEQ ID N0:3364 -8.7 -23.7 66.7 -14.3 -0.4 -3.8
ACTTGAAAACTCTAAGCAGT 3033 SEQ ID NO:3365 -8.7 -18.8 57.8 -10.1 0 -4.1
CCACAGAATTGCCAATGATC 3090 SEQ ID NO:3366 -8.7 -22.4 63.7 -13.7 0 -3.9
GCTAAATGAACTCAATAATA 3416 SEQ ID NO:3367 -8.7 -15.1 49.4 -6.4 0 -3.9
ATAGTCTTTCGCTGTTCAAT 4159 SEQ ID NO:3368 -8.7 -22 66.6 -13.3 0 -3.1
CACCCTCATGCCTTCAAACC 4421 SEQ ID NO:3369 -8.7 -27.6 73.5 -18.9 0 -4.4
GGAATTGCTCCAACAAGAGC 4450 SEQ ID NO:3370 -8.7 -22.9 65.6 -12.1 -2.1 -7.7
TTTCACGTTTTTCCACCGAG 4643 SEQ ID NO:3371 -8.7 -24.6 68.9 -15.9 0 -4.7
TGATGCTGATATCAAAGACT 5049 SEQ ID NO:3372 -8.7 -19 58.2 -9.6 -0.4 -7.7
GTTTCCACCATCATGGTGAC 5092 SEQ ID NO:3373 -8.7 -25.7 73.8 -13.8 -3.2 -10.6
AGAGTTTAGAGAACTCTATA 5892 SEQ ID NO:3374 -8.7 -18 58.1 -5.6 -3.7 -9.1
TCAGAGAGTTTAGAGAACTC 5896 SEQ ID NO:3375 -8.7 -19.4 61.7 -8.6 -2.1 -7.6
GAGGATCCAGGGCAGCTGCA 5919 SEQ ID NO:3376 -8.7 -29.6 82.5 -18 -1 -14
TAATAGGCTCATAAGAGACT 6126 SEQ ID NO:3377 -8.7 -19 58.9 -8.9 -1.3 -5.2
TAGCGGCAGACACCTCCTCT 6168 SEQ ID NO:3378 -8.7 -29.2 79.8 -20 -0.1 -6.6
TCAAACTTTTCCTTGTCTGG 6397 SEQ ID NO:3379 -8.7 -22.2 66.1 -13.5 0 -2.9
TTTACTTTTGATTTTCTCTG 6456 SEQ ID NO:3380 -8.7 -18.8 60.1 -10.1 0 -2.2
GTTTCTTTTTACTTTTGATT 6463 SEQ ID NO:3381 -8.7 -18.9 60.6 -10.2 0 -2.2
CTCTTGAAGTCCAGTTGACA 6536 SEQ ID NO:3382 -8.7 -23.3 69.2 -12.8 -1.8 -5.1
TCCTCTTGAAGTCCAGTTGA 6538 SEQ ID NO:3383 -8.7 -24.8 72.9 -16.1 0 -3
TAGGCACTGACTATGAGTAT
6587 SEQ ID NO:3384 -8.7 -21.4 65 -10.5 -2.2 -7.3 ATAGGCACTGACTATGAGTA
6588 SEQ ID NO:3385 -8.7 -21.4 65 -10.5 -2.2 -7.3 TATAGGCACTGACTATGAGT
6589 SEQ ID NO:3386 -8.7 -21.4 65 -10.5 -2.2 -7.3 TGTCTTGTATAGGCACTGAC
6596 SEQ ID NO:3387 -8.7 -22.8 69.3 -13.2 -0.8 -4.7
CATTGGGTTTCTCCTCAGCA 6702 SEQ ID NO:3388 -8.7 -26.8 77.9 -17.6 -0.1 -4.1
AACTATCCCTATAGTCTAGG 6726 SEQ ID NO:3389 -8.7 -22.2 66.3 -11.5 -2 -7.6
ACATAGCATTATGAATAAAC 6878 SEQ ID NO:3390 -8.7 -15.3 50.1 -5.1 -1.4 -5
TTCAAAATTAAAGCCATCTA 7055 SEQ ID NO:3391 -8.7 -17 53.1 -8.3 0 -3.2 mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
TGTTCAGATAGAAACAAACA 7092 SEQ ID NO:3392 -8.7 -16.3 52.1 -6.9 -0.5 -4.4
TAACCAAGACTTGTGAAGAA 7600 SEQ ID NO:3393 -8.7 -18 55.1 -8.8 -0.2 -5.4
ATTTATATTTAAACAAGTTT 7831 SEQ ID NO:3394 -8.7 -13.7 47.4 -4.4 -0.3 -5.3
ATTTTCTTATGTACAAAATG 7883 SEQ ID NO:3395 -8.7 -15.1 50.2 -6.4 0 -6.8
TTTTATTTTAGGAAATTATC 8004 SEQ ID NO:3396 -8.7 -14.6 49.7 -5.1 -0.6 -4.4
TAACTTTTATTTTAGGAAAT 8008 SEQ ID NO: 3397 -8.7 -14.5 49 -5.1 -0.4 -4.6
CATTATCTAACTTTTATTTT 8015 SEQ ID NO:3398 -8.7 -16.2 53.3 -7.5 0 -1.6
CTTTAGTGCAGCAGGAATTA 8220 SEQ ID NO:3399 -8.7 -21.9 65.8 -13.2 0 -6.6
TTCTTTTGGCTCAATAATGA 8444 SEQ ID NO:3400 -8.7 -19.6 60.1 -10.3 -0.3 -5
TAGTTTGTTGTAAAATTCAT 8601 SEQ ID NO:3401 -8.7 -16.4 53.6 -7 -0.4 -4.4
AAACCTGAAAGTTGGAACAT 8709 SEQ ID NO:3402 -8.7 -18.2 54.9 -8.7 -0.6 -4.8
ATAACGTGTCTTCCTCTGGC 142 SEQ ID NO: 3403 -8.6 -25.4 73.3 -16.8 0 -5.3
TGGCTTCAGTTTTCTTGCTC 233 SEQ ID NO: 3404 -8.6 -25.1 76.4 -15.8 -0.4 -3.7
GACAGGTATCTCATCCCTGT 270 SEQ ID NO:3405 -8.6 -26.5 77 -15 -2.9 -8.3
AAAGTTTTCTTATTGATATA 721 SEQ ID NO:3406 -8.6 -15.3 51.3 -5.6 -1 -4.6
TATTCATTACTATAAAAGTT 735 SEQ ID NO:3407 -8.6 -14.4 49 -5.2 -0.3 -2.8
CCCCCACAATGGTCTTTAAA 1167 SEQ ID NO:3408 -8.6 -25.1 67.9 -15.6 -0.7 -5.2
GCCTGATTCTGCTCCTCATA 1750 SEQ ID NO:3409 -8.6 -27.5 78.3 -18.9 0 -3.6
ATAATTAAGCTCTTTGCTTA 1832 SEQ ID NO:3410 -8.6 -27 79 -17.7 -0.5 -5.2
TCAGTCTGTTTCCATCCATG 2091 SEQ ID NO:3411 -8.6 -25.2 74.3 -16.6 0 -3.9
GAATTTTTTGTCACTGGTCA 2108 SEQ ID NO:3412 -8.6 -21.3 65.2 -12.7 0 -3.3
CAGTGCTGTGCATCTTCCCA 2394 SEQ ID NO:3413 -8.6 -28.8 81.3 -19.1 -1 -5.9
TTAACCTTCTCTTTCTGACT 2511 SEQ ID NO:3414 -8.6 -22.1 66.7 -13.5 0 -2.6
GAGCTTAACCTTCTCTTTCT 2515 SEQ ID NO:3415 -8.6 -23.7 70.9 -15.1 0 -5.2
AATTCACAAGATGTTTTACT 2715 SEQ ID NO: 3416 -8.6 -17.6 55.8 -9 0 -4
TTCCATCAAAGATATTCCAG 2940 SEQ ID NO:3417 -8.6 -20.4 60.9 -11.1 -0.4 -3.9
TTGCCAATGATCTTAATTAG 3082 SEQ ID NO:3418 -8.6 -18.7 57.4 -10.1 0 -4.9
CTTATTTTTCACATAATCAA 3515 SEQ ID NO:3419 -8.6 -16.5 53.3 -7.9 0 -2.2
GTCTATCTTATTGCCTTCAT 3590 SEQ ID NO:3420 -8.6 -23.3 70.5 -14.7 0 -3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
TAAGATAATTAAGCTCTTTG 3645 SEQ ID NO:3421 -8.6 -15.9 52.1 -6.8 -0.1 -6.1
ACTACTGAGAAGGATCATGA 4112 SEQ ID NO: 3422 -8.6 -19.9 60.7 -10.4 -0.8 -7.8
TCTTTCGCTGTTCAATGTAT 4155 SEQ ID NO:3423 -8.6 -22 66.2 -13.4 0 -3.1
CTTAAAGCTCTTAATGTCCG 4381 SEQ ID NO:3424 -8.6 -20.8 61.3 -12.2 0 -5.9
CAAGAGCATTCACAACCACC 4437 SEQ ID NO:3425 -8.6 -23.6 66.2 -14.4 -0.3 -3.3
GGTAGAACTTGCCAGCAAAC 4539 SEQ ID NO:3426 -8.6 -23 65.9 -13.9 -0.1 -7.5
TGATAAAGATGACAAAGTAT 4809 SEQ ID NO:3427 -8.6 -14.5 48.4 -5.9 0 -2.8
TCTTCATTGCATTGTAATAT 4944 SEQ ID NO:3428 -8.6 -19.1 59.7 -10.5 0 -6.2
ACCATCATGGTGACCATGTT
5086 SEQ ID NO:3429 -8.6 -25.2 71.6 -14 -2.6 -10.9 CACCATCATGGTGACCATGT
5087 SEQ ID NO:3430 -8.6 -25.8 72.3 -14 -3.2 -11.5 ATCCGTTTCCACCATCATGG
5096 SEQ ID NO:3431 -8.6 -26.9 73.8 -17.4 -0.8 -5.5
GTCTCAAAGTTGAACATGTC 5533 SEQ ID NO:3432 -8.6 -19.9 61.6 -11.3 0 -7
AAGCAGATCATGCTGTTGCC 5557 SEQ ID NO: 3433 -8.6 -25.3 72.7 -13.9 -2.8 -10.6
GGGGCTCTGCACTTTCTTCA 5805 SEQ ID NO:3434 -8.6 -27.9 81.2 -19.3 ' 4.6 -4.8
ACTTTTCCCAAACCTCATAG 5850 SEQ ID NO:3435 -8.6 -23 65.6 -14.4 0 -1.7
TTGGGTTTTGCTATGAGAAG 5941 SEQ ID NO:3436 -8.6 -20.9 63.6 -12.3 0 -3.6
AGGAACTCCCATCTGTTTTT 6339 SEQ ID NO:3437 -8.6 -24.2 70.3 -14.6 -0.9 -5.1
TTGTCTGGTTTTGTTACACT 6385 SEQ ID NO:3438 -8.6 -22.3 68.7 -13.7 0 -2.9
TTCTCAAACTTTTCCTTGTC 6400 SEQ ID NO:3439 -8.6 -21.5 65.5 -12.9 0 -2.8
TCTCCTCAGCAGTGTCAGCT
6693 SEQ ID NO:3440 -8.6 -28.4 84.6 -19 -0.6 -4.6 TTCTCCTCAGCAGTGTCAGC
6694 SEQ ID NO:3441 -8.6 -27.6 82.8 -19 0 -4.2 ATTGGGTTTCTCCTCAGCAG
6701 SEQ ID NO:3442 -8.6 -26.1 77.1 -16.6 -0.8 -4.9
GCAAAACACCTTTGTCTGAT 6962 SEQ ID NO:3443 -8.6 -21.7 63.1 -11.7 -1.3 -5.9
ATTAAAGCCATCTAGAAAAT 7049 SEQ ID NO: 3444 -8.6 -16.4 51.8 -7.8 0 -6.2
TATAGAGCTCTGAAACTTAG 7196 SEQ ID NO:3445 -8.6 -18.1 57.2 -8.5 0 -10
TTCTAGAATGGATTTATTAG 7250 SEQ ID NO: 3446 -8.6 -16.5 54 -7.9 0 -7.2
GTTGAATTAAAAGTGCAAAA 7713 SEQ ID NO:3447 -8.6 -14.5 48 -5.9 0 -5.4
AACTTTTATTTTAGGAAATT 8007 SEQ ID NO:3448 -8.6 -14.9 49.8 -5.5 -0.6 -4.6
AATGAAATTTATTCTTTTGG 8455 SEQ ID NO: 3449 -8.6 -15.3 50.6 -5.6 -1 -5.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo ACATAGGAGTTTATATAATG 8881 SEQ ID NO:3450 -8.6 -16.2 53 -7.6 0 -5.5 AAGAGACCTTTCCAGAATCC 26 SEQ ID NO:3451 -8.5 -23.2 66.6 -14.7 0 -2.9
GTCCCTTCTGTGAATTATCT 363 SEQ ID NO: 3452 -8.5 -24.1 71.1 -15.1 -0.1 -3.2
CATAAATAAATGGAAGGTTC 648 SEQ ID NO:3453 -8.5 -15.3 49.9 -6.8 0 -3.3
TTACTATAAAAGTTTTCTTA 729 SEQ ID NO: 3454 -8.5 -14.8 50.1 -5.2 -1 -6.3
TGTCCAGTCAGGAGGGTTGC 914 SEQ ID NO:3455 -8.5 -27.9 82.2 -18 -1.3 -5.3
CACATATGCCATCACAATGA 1061 SEQ ID NO:3456 -8.5 -21.7 62.7 -12.5 -0.5 -8.3
TTTTCAGTGCTCGGAGAACT 1128 SEQ ID NO:3457 -8.5 -23.3 68.5 -14 -0.6 -6.4
CCATTTCCACAGAGTAAAGG 1471 SEQ ID NO: 3458 -8.5 -22.2 64.4 -13.7 0 -3.3 ATGTATCCTTCTGGACACTG
1504 SEQ ID NO:3459 -8.5 -23.4 69.2 -14.9 1.5 -5.8 GATGTATCCTTCTGGACACT
1505 SEQ ID NO:3460 -8.5 -24 70.7 -15.5 1.5 -5.9 GGTAAAGATTTTCCCAATAG
1620 SEQ ID NO: 3461 -8.5 -19.7 59.1 -11.2 0 -3.3
CATGTATGTTTTCCCAGCAG 1655 SEQ ID NO: 3462 -8.5 -24.7 71.7 -16.2 0 -4.1
TCACCAAATAAAATGAGCCC 1701 SEQ ID NO:3463 -8.5 -20.6 58.6 -12.1 0 -3.2
TCCTCCATTCTTTAGCACCT 1953 SEQ ID NO:3464 -8.5 -27.3 77.4 -18.8 0 -4.1
AATCCACAGTGCTGTGCATC 2400 SEQ ID NO:3465 -8.5 -25.3 73.2 -14.6 -1.7 -12.4
GAAGTTGTCCAGTAGGTGAC 2463 SEQ ID NO: 3466 -8.5 -23.6 71.2 -14.5 -0.3 -4.6
GCTTAACCTTCTCTTTCTGA 2513 SEQ ID NO:3467 -8.5 -23.7 70.5 -15.2 0 -2.8
GCTGGCTATGCTCACGGCTC 2582 SEQ ID NO:3468 -8.5 -29.4 82 -19.7 -1.1 -6.7
ACAATCCCTCCACATTTGAC 2994 SEQ ID NO:3469 -8.5 -24.5 68.6 -16 0 -3.2
CAGAATTGCCAATGATCTTA 3087 SEQ ID NO:3470 -8.5 -20.2 60.1 -11.7 0 -4.9
CCCACAGAATTGCCAATGAT 3091 SEQ ID NO:3471 -8.5 -24 65.8 -15.5 0 -4.3
TCTTATTTTTCACATAATCA 3516 SEQ ID NO: 3472 -8.5 -17.6 56.5 -9.1 0 -2.2
CAGTAAAACAAGCTTCCGGT 3963 SEQ ID NO: 3473 -8.5 -22.1 63 -13.6 0 -6.6
TGTACTTACTTGACAGAATG 4004 SEQ ID NO:3474 -8.5 -18.4 57.6 -9.9 0 -4.8
CTTCTTCTGTACTTACTTGA 4011 SEQ ID NO:3475 -8.5 -21.3 66.2 -12.8 0 -4.8
TATATAGGTAAAGACTTTGT 4202 SEQ ID NO: 3476 -8.5 -16.9 54.7 -7.9 -0.1 -4.8
GCATTTCCAGAATGAATATA 4218 SEQ ID NO:3477 -8.5 -19 57.8 -8.9 -1.6 -6.4
AGAGCATTGGCTACCAGGCT 4327 SEQ ID NO:3478 -8.5 -27.6 78 -17.3 -1.8 -8.4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AGCATTCACAACCACCCTCA 4433 SEQ ID NO:3479 -8.5 -27 73.6 -18.5 0 -4.1
TAACATCTCGTGAATCAACA 4749 SEQ ID NO:3480 -8.5 -18.8 57 -10.3 0 -4.6
TTCCTCTGTCATAAAGATGT 4916 SEQ ID NO: 3481 -8.5 -21.1 64.1 -11.9 -0.4 -3.1
AGTTTCTTCATTGCATTGTA 4948 SEQ ID NO:3482 -8.5 -21.5 66.9 -13 0 -6.2
AAGGTCTCAAAGTTGAACAT 5536 SEQ ID NO:3483 -8.5 -18.8 58 -9.4 -0.8 -6.5
GGCAGCTGCAAAATCAGAGA 5909 SEQ ID NO:3484 -8.5 -23.1 66.5 -11.7 -0.7 -14
TTTTTTAACCTTTGCTTTAA 6217 SEQ ID NO:3485 -8.5 -18.7 57.9 -10.2 0 -3.6
GAGGAACTCCCATCTGTTTT 6340 SEQ ID NO:3486 -8.5 -24.7 71.3 -14.6 -1.6 -5.7
GGGGTGGTAGAGGAACTCCC 6349 SEQ ID NO: 3487 -8.5 -28.1 79 -17.2 -2.4 -7.2
GTTTTGTTACACTATCATAG 6378 SEQ ID NO:3488 -8.5 -19 60.5 -10.5 0 -3.1
CTTTACCTTCATAGGCTGTA 6510 SEQ ID NO:3489 -8.5 -23.6 70.2 -14.6 -0.2 -3.7
ACTGACTATGAGTATTTGTT 6582 SEQ ID NO:3490 -8.5 -19.5 61.3 -10.5 -0.1 -3.8
TCAACGTTGATACCCTGCTT 6649 SEQ ID NO: 3491 -8.5 -24.9 69.3 -14.5 0 -12
AAAGCCATCTAGAAAATGGA 7046 SEQ ID NO: 3492 -8.5 -18.4 55.5 -8.3 -1.6 -8.3
TGATACTCATGTTGAATTAA
7723 SEQ ID NO: 3493 -8.5 -16.8 53.8 -8.3 0 -4.7 ATGATACTCATGTTGAATTA
7724 SEQ ID NO:3494 -8.5 -17.5 55.7 -8.3 -0.5 -4.7 AAAACAAAAATTTATATCAT
8313 SEQ ID NO:3495 -8.5 -10.7 40.8 -2.2 0 -5.2
GACGTAGCTCACCATTCTTT 8426 SEQ ID NO:3496 -8.5 -24.8 71.6 -16.3 0 -5.3
TATATTTTAAACTGCCAACA 8528 SEQ ID NO:3497 -8.5 -17.8 54.8 -9.3 0 -4.1
TATTAATTATATATATTTTA ι
8539 SEQ ID NO:3498 -8.5 -11.7 43.5 -3.2 0 -5.2
TCATTAATACCTTATGTATA 8900 SEQ ID NO:3499 -8.5 -17.4 55.4 -8 -0.8 -4.2
TCCCTGTCAAACCTTGATGT 257 SEQ ID NO:3500 -8.4 -25.2 70.7 -15.6 -1.1 -4.5
TACTATAAAAGTTTTCTTAT 728 SEQ ID NO: 3501 -8.4 -14.7 49.8 -5.2 -1 -6.3
AAAAGTGACTGTCATCTCCA 1428 SEQ ID NO:3502 -8.4 -21.5 63.9 -12.5 0.1 -8.6
CAGCCTTCACACAGATGTAT 1518 SEQ ID NO: 3503 -8.4 -23.9 69.7 -14.8 -0.5 -4.2
TTTTGTTCTGCTTCTTCCAA 1774 SEQ ID NO:3504 -8.4 -23.5 70.3 -15.1 0 -3.6
TTTTTGTCACTGGTCAGTCT 2104 SEQ ID NO:3505 -8.4 -23.8 73.6 -15.4 0 -6.6
ATTTTTTGTCACTGGTCAGT 2106 SEQ ID NO:3506 -8.4 -22.6 70 -14.2 0 -6.4
TGACAATAATTCCATCAAAG 2949 SEQ ID NO:3507 -8.4 -16.7 52.4 -8.3 0 -2.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
AGGTGAGGTTTCCTAGAGCC 3111 SEQ ID NO:3508 -8.4 -27 79.1 -18.1 -0.1 -3.9
GAGCTGCATGCCGACCACAG 3161 SEQ ID NO:3509 -8.4 -28.8 76.8 -19.5 -0.8 -8.4
CAGTCCCACATGGTCTCTAT 3304 SEQ ID NO:3510 -8.4 -26.6 76.7 -18.2 0 -5.2
CCAATGACCATGACCAACAT 3364 SEQ ID NO:3511 -8.4 -23.2 63.6 -14.3 -0.1 -4.5
TGGTGGTTCCATTCCCATCT 3666 SEQ ID NO:3512 -8.4 -28.5 80.1 -19 -1 -6.4
TGGGGTTGTTTATGAATGAC 3744 SEQ ID NO:3513 -8.4 -20.7 62.8 -12.3 0 -3.1
GTTTCAGCTTGTTCACCTTC 3922 SEQ ID NO: 3514 -8.4 -25.3 76.4 -16.9 0 -4.3
TCTTCAAAGGCCAATGCACC 4132 SEQ ID NO:3515 -8.4 -24.8 68.9 -14.9 -1.4 -7.7
GGTCTTAAAGCTCTTAATGT 4384 SEQ ID NO:3516 -8.4 -20.4 62.7 -12 0 -5.9
TCCAACAAGAGCATTCACAA 4442 SEQ ID NO: 3517 -8.4 -21.1 61.6 -12.1 -0.3 -4.1
GGGAATTGCTCCAACAAGAG
4451 SEQ ID NO:3518 -8.4 -22.3 64 -12.1 -1.8 -5.3 AGGGAATTGCTCCAACAAGA
4452 SEQ ID NO:3519 -8.4 -22.3 64 -12.1 -1.8 -5.2 TATCCATCCAGCCTTTAAAT
4716 SEQ ID NO:3520 -8.4 -23.1 65.8 -14.7 0 -4.3
TTCTTCATATACAGGCTGAA 4772 SEQ ID NO:3521 -8.4 -20.7 63 -12.3 0 -4.1
AAACTAGGGTCATGTATTTG 5124 SEQ ID NO:3522 -8.4 -19.2 59.6 -10.8 0 -4.7
ACACAGAATACTTTTCTATC 5298 SEQ ID NO:3523 -8.4 -18.2 57.8 -8.8 -0.9 -4.4
CAACGCAGGAAGGGACATCA 5417 SEQ ID NO:3524 -8.4 -23.6 66 -15.2 0 -3.6
GGAGGCCGATGTTAAACAAC 5433 SEQ ID NO:3525 -8.4 -22.2 62.8 -13.2 -0.2 -8.1
ATGTTCACCACAACCAGGAA 5746 SEQ ID NO:3526 -8.4 -23.5 66.3 -14.4 -0.4 -5.7
TGCACTTTCTTCAGTAGCAA 5798 SEQ ID NO:3527 -8.4 -23 69.2 -13.1 -1.4 -5.5
TGATAGCGGCAGACACCTCC 6171 SEQ ID NO: 3528 -8.4 -27.6 75.4 -19.2 0 -5.8
TTTGTCTTTCTCAAACTTTT 6407 SEQ ID NO:3529 -8.4 -19.3 60.8 -10.2 -0.4 -3.6
GTTAAAACAGTCAGTTTGGC 6565 SEQ ID NO:3530 -8.4 -20.5 62.7 -10.5 -1.6 -6.1
TCTTGTATACTGTTTCTTCA 6925 SEQ ID NO:3531 -8.4 -21 66.3 -12.6 0 -6.3
AACCAAGACTTGTGAAGAAT 7599 SEQ ID NO:3532 -8.4 -18.3 55.6 -9.4 -0.2 -5.4
TGACATTCTTTAACCAAGAC 7610 SEQ ID NO:3533 -8.4 -19.1 58.2 -9.7 -0.9 -5
CATGTTGAATTAAAAGTGCA 7716 SEQ ID NO:3534 -8.4 -17.3 54 -8.9 0 -5.2
CATATGATACTCATGTTGAA 7727 SEQ ID NO:3535 -8.4 -18.1 56.7 -8.8 -0.8 -5.2
CAGTATCCAGTGTGTTTCCT 7765 SEQ ID NO:3536 -8.4 -25.8 76.6 -17.4 0 -3.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TATATTTAAACAAGTTTTAG 7828 SEQ ID NO:3537 -8.4 -13.3 46.6 -4.9 0 -5.5
TTTTAGGAAATTATCCATTG 7999 SEQ ID NO:3538 -8.4 -17.4 54.8 -7.5 -1.4 -6.4
TTTATTTTAGGAAATTATCC 8003 SEQ ID NO:3539 -8.4 -16.5 53.4 -6.9 -1.1 -5.9
ATGAATAAAAGGTTATATTG 8140 SEQ ID NO:3540 -8.4 -13.5 46.6 -4.5 -0.3 -3
TGACGTAGCTCACCATTCTT 8427 SEQ ID NO:3541 -8.4 -24.7 71.1 -16.3 0 -5.3
AACATGTGAACTTGATCCTT 8694 SEQ ID NO:3542 -8.4 -20.5 61.1 -12.1 0 -7
ATTTATTAGCCACCAAGTAA 8837 SEQ ID NO:3543 -8.4 -20.6 61.1 -12.2 0 -3.2
TTACAACTGGAGTTTTCCAC 9002 SEQ ID NO:3544 -8.4 -21.7 64.8 -11.2 -2.1 -5.6
TTTGCTCCTTTCCCAGTAAG 310 SEQ ID NO:3545 -8.3 -25.7 73.5 -17.4 0 -3.6
TTCTGTGAATTATCTCATTT 358 SEQ ID NO:3546 -8.3 -18.9 59.9 -10.6 0.9 -3.2
TCCATAAATAAATGGAAGGT 650 SEQ ID NO:3547 -8.3 -17.2 53.2 -6.8 -2.1 -7.5
ATGTCTCCATAAATAAATGG 655 SEQ ID NO:3548 -8.3 -17.4 54.1 -7.8 -1.2 -5.7
TATAAAAGTTTTCTTATTGA 725 SEQ ID NO:3549 -8.3 -14.6 49.5 -5.6 -0.5 -6.3
ATAAATACACAGTTGGTCAA 886 SEQ ID NO:3550 -8.3 -17.9 55.9 -9.6 0 -3.6
TTCTTTACCGACTGGATCAG 1189 SEQ ID NO:3551 -8.3 -22.9 66.7 -13.7 -0.7 -5.3
CGCTTGGGGGCCACTGCAAA 1302 SEQ ID NO:3552 -8.3 -29.1 76.1 -18.9 -1.9 -6.9
ATGGCCACCACAGCCAGGAT 1726 SEQ ID NO:3553 -8.3 -29.8 79.3 -18.7 -2.8 -9.1
TTTGTTCTGCTTCTTCCAAG 1773 SEQ ID NO:3554 -8.3 -23.4 70.2 -15.1 0 -3.6
GTTTCCATCCATGGAGAAAA 2084 SEQ ID NO:3555 -8.3 -21.9 63.3 -11.4 -1.7 -12.3
AGGGGAGCAGAATTTTTTGT 2117 SEQ ID NO:3556 -8.3 -22.3 66.9 -14 0 -4.1
TGCGTCGCTCTCCATGTCTG 2316 SEQ ID NO:3557 -8.3 -28.6 79.6 -19.7 -0.3 -6.9
CTGGCCTGACTAACGTTACT 2338 SEQ ID NO:3558 -8.3 -24.6 69.1 -15.8 0 -7.9
TTTACTTTTAACCATGCATC 2701 SEQ ID NO:3559 -8.3 -20.1 60.9 -11.8 0 -6.6
CATCAAAGATATTCCAGCCT 2937 SEQ ID NO:3560 -8.3 -22.6 65 -14.3 0.1 -3.5
TGATCTTAATTAGCATATTT 3075 SEQ ID NO:3561 -8.3 -17.2 55.3 -8.9 0 -4.9
TTTCCTAGAGCCCCCACAGA 3103 SEQ ID NO:3562 -8.3 -29.8 79.9 -21.5 0 -3.8
TTTTCATCGATTACGTATTT 3715 SEQ ID NO:3563 -8.3 -19.1 58.6 -9.9 -0.7 -6.1
CTGTAGCAGGTTTTTCGAAG 4054 SEQ ID NO:3564 -8.3 -22.2 66.4 -13.9 0 -6.8
TAATGTCCGTAATGATTTGA 4370 SEQ ID NO:3565 -8.3 -19 57.6 -10.7 0 -2.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TGCTCCAACAAGAGCATTCA 4445 SEQ ID NO:3566 -8.3 -23.6 67.7 -12.1 -3.2 -9.1
GACAGACCAACAGCACATTC 4479 SEQ ID NO:3567 -8.3 -23.1 66.6 -14.8 0 -4.1
GAACTTGCCAGCAAACAAAT 4535 SEQ ID NO:3568 -8.3 -20.2 58.3 -11.9 0 -7.4
TACCCGTTGTCATGTTAACA 4563 SEQ ID NO:3569 -8.3 -23.5 67.1 -14.7 0.2 -8.4
CTTCATTGCATTGTAATATT 4943 SEQ ID NO:3570 -8.3 -18.8 58.6 -10.5 0 -6.2
GGGCGAGGTATGGGTTTCTG 4984 SEQ ID NO:3571 -8.3 -26.8 76.8 -18.5 0 -4
AGATGAGGATCATGATGCTG 5061 SEQ ID NO:3572 -8.3 -21.4 64.3 -11 -2.1 -8.5
ACATGTCATCAATTCCAGCT 5520 SEQ ID NO:3573 -8.3 -23.5 68.9 -15.2 0 -6.1
TTCTTCAGTAGCAACACTGA 5792 SEQ ID NO:3574 -8.3 -21.9 66.3 -11.6 -2 -7.8
GCTGAATGATAGCGGCAGAC 6177 SEQ ID NO:3575 -8.3 -24 68.1 -14.4 -1.2 -6.6
CCTCTTTGTTATAGTTACTT 6243 SEQ ID NO:3576 -8.3 -21.3 65.9 -13 0 -2.5
GTAGAGGAACTCCCATCTGT
6343 SEQ ID NO:3577 -8.3 -25.3 73.3 -14.6 -2.4 -6.7 GGTAGAGGAACTCCCATCTG
6344 SEQ ID NO:3578 -8.3 -25.3 72.5 -14.6 -2.4 -7.3 GTCTTTCTCAAACTTTTCCT
6404 SEQ ID NO:3579 -8.3 -22.4 67.6 -14.1 0 -1.9 TGTCTTTCTCAAACTTTTCC
6405 SEQ ID NO:3580 -8.3 -21.5 65.5 -13.2 0 -2.4 ACTTTACCTTCATAGGCTGT
6511 SEQ ID NO:3581 -8.3 -24.1 71.4 -14.6 -1.1 -4.1
CTTGAAGTCCAGTTGACACA 6534 SEQ ID NO:3582 -8.3 -22.9 67.4 -12.8 -1.8 -5.7
CATTATGAATAAACTATGAA 6872 SEQ ID NO:3583 -8.3 -13.4 46 -5.1 0 -3.5
GTAGCCATTACAATTCTTTT 7013 SEQ ID NO:3584 -8.3 -21.1 63.8 -12.3 -0.1 -3.2
TTAGATTACTTTTTGGAAAG 7234 SEQ ID NO:3585 -8.3 -16.1 52.6 -6.3 -1.4 -4.9
GAATGGATTTATTAGATTAC 7245 SEQ ID NO:3586 -8.3 -16 52.5 -7.7 0 -2.4
ATTAGTGATAGCCTTTAAAC 7538 SEQ ID NO:3587 -8.3 -18.7 58 -10.4 0 -4.2
ATGGATTGAGTAAAATAGAG 7581 SEQ ID NO:3588 -8.3 -15.6 51.1 -7.3 0 -2.3
CCAATATGTGACATTCTTTA 7618 SEQ ID NO:3589 -8.3 -19.7 59.9 -11.4 0 -3.9
TAATGGACAGAGCAGGTTGA 7651 SEQ ID NO:3590 -8.3 -21.9 65.2 -13.6 0 -4.1
AGCTTCAAATTATTCTGCTT 7675 SEQ ID NO:3591 -8.3 -20.5 62.6 -12.2 0 -4.3
TATTTATATTTAAACAAGTT
7832 SEQ ID NO:3592 -8.3 -13.3 46.6 -4.4 -0.3 -4.9 TTATTTATATTTAAACAAGT
7833 SEQ ID NO:3593 -8.3 -13.3 46.6 -4.4 -0.3 -4.9 CAAAAGTTTGGAATTGTGAT
7963 SEQ ID NO:3594 -8.3 -17 53.5 -8.7 0 -4.9 mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
TTAACATTAAACTTTTGGTT 8340 SEQ ID NO:3595 -8.3 -16.3 52.6 -7.4 -0.3 -3.9
TAGCAATTCCCTGCATGCAG 8399 SEQ ID NO:3596 -8.3 -25.9 72.4 -14.7 -1.9 -13.9
TAGCAATAGCAATTCCCTGC 8405 SEQ ID NO:3597 -8.3 -24.2 68.6 -14.2 -1.7 -6.2
ATTACAACTGGAGTTTTCCA 9003 SEQ ID NO:3598 -8.3 -21.5 64.3 -11.2 -2 -5.5
GGGAGAATTATGAAATACAT 9054 SEQ ID NO:3599 -8.3 -16.5 52.4 -7.7 -0.2 -3.8
CAATTTTTTTTCTTTCTTTC 64 SEQ ID NO: 3600 -8.2 -18.1 58.6 -9.9 0 -2.6
GATGGTTAGGGTATAACGTG 154 SEQ ID NO: 3601 -8.2 -21.3 63.6 -11.1 -2 -5.3
AAAGCTCCAGGTCCCTTCTG 373 SEQ ID NO: 3602 -8.2 -27.5 76.7 -19.3 0 -5
ACAGTGCCTGTGCCATCTTT 468 SEQ ID NO:3603 -8.2 -28 79.4 -18.7 -1 -7.8
TCTTTCCAGCTTCCAAGTCA 630 SEQ ID NO:3604 -8.2 -26.1 75.9 -17.9 0 -4.5
GTCTCCATAAATAAATGGAA 653 SEQ ID NO: 3605 -8.2 -17.3 53.7 -6.8 -2.3 -7.8
CAAAATCTTGATAGCAATTT 827 SEQ ID NO:3606 -8.2 -16.3 52 -7.5 -0.3 -0.5
TAAATACACAGTTGGTCAAA 885 SEQ ID NO:3607 -8.2 -17.2 54.1 -9 0 -3.8
AGCAAACACGCTCAGACAGA 1238 SEQ ID NO:3608 -8.2 -22.9 65.3 -14 -0.4 -4.3
CATTTATTCCTCAGATTGCC 1282 SEQ ID NO:3609 -8.2 -23.6 69 -15.4 0 -3
AAACATAAAAGTGACTGTCA 1434 SEQ ID NO: 3610 -8.2 -16.3 52 -7.5 0 -8.6
CCAGCCTTCACACAGATGTA 1519 SEQ ID NO: 3611 -8.2 -25.9 73.4 -17 -0.5 -4.2
GTGCGGCACAAACAGTGAGT
2297 SEQ ID NO:3612 -8.2 -24.9 70.3 -14.8 -1.5 -11.7 TGTGCGGCACAAACAGTGAG
2298 SEQ ID NO: 3613 -8.2 -23.7 67 -13 -1.5 -13 CTCTCCATGTCTGTGCGGCA
2309 SEQ ID NO:3614 -8.2 -29.3 81.9 -20.6 0 -7.7
CCAGATCAAGAACACATTGG
2672 SEQ ID NO:3615 -8.2 -20.7 60.7 -12.5 0 -5.4
TCACAAGATGTTTTACTTTT
2712 SEQ ID NO: 3616 -8.2 -18.5 58.5 -10.3 0 -3
ACTCTAAGCAGTCTGAATGA
3025 SEQ ID NO:3617 -8.2 -20.9 63.6 -12.7 0 -6.3 AACTCTAAGCAGTCTGAATG
3026 SEQ ID NO:3618 -8.2 -19.6 60.1 -11.4 0 -5.8 ATGATCTTAATTAGCATATT
3076 SEQ ID NO:3619 -8.2 -17.1 55 -8.9 0 -4.9
ACAATAAGGCACATGGTTTG 3340 SEQ ID NO:3620 -8.2 -20.4 60.9 -12.2 0 -5.2
ATTTTCATCGATTACGTATT 3716 SEQ ID NO:3621 -8.2 -19 58.3 -9.9 -0.7 -6.3
GATAGTCTTTCGCTGTTCAA 4160 SEQ ID NO: 3622 -8.2 -22.6 68 -14.4 0 -3.1
TCTTAAAGCTCTTAATGTCC 4382 SEQ ID NO: 3623 -8.2 -20.4 62.2 -12.2 0 -5.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo AACCACCCTCATGCCTTCAA
4424 SEQ ID NO: 3624 -8.2 -27.6 73.5 -19.4 0 -4.4 AGACCAACAGCACATTCATG
4476 SEQ ID NO: 3625 -8.2 -22.3 64.6 -14.1 0 -4.1 CTCCAAACTTCTTTTTCTGC
4890 SEQ ID NO: 3626 -8.2 -22.6 66.9 -14.4 0 -2.6 ACCTCCAAACTTCTTTTTCT
4892 SEQ ID NO: 3627 -8.2 -23 67.1 -14.8 0 -1.8 GCATTGTAATATTTTTTCTG
4936 SEQ ID NO: 3628 -8.2 -18.3 58 -10.1 0 -4.2 TTCTTGGATCCAAGTTTCTT
4960 SEQ ID NO: 3629 -8.2 -22.5 67.9 -10.6 -1.3 -15.5 GATGCTGATATCAAAGACTT
5048 SEQ ID NO:3630 -8.2 -19.1 58.5 -10.4 0 -7.5 CGAGCTTCAGCACAAATTCT
5184 SEQ ID NO: 3631 -8.2 -22.7 65.5 -13.6 -0.7 -6.6 AAGTAGTAGTGTCTGAGGGA
5206 SEQ ID NO: 3632 -8.2 -22.4 69.6 -14.2 0 -2.9 TCCTTTGATCAGACGTAGGA
5363 SEQ ID NO: 3633 -8.2 -23.5 68.7 -14.8 -0.1 -7.5 CATGTCATCAATTCCAGCTT
5519 SEQ ID NO: 3634 -8.2 -23.4 68.7 -15.2 0 -4.5 CACAACCAGGAAGGATATGA
5738 SEQ ID NO: 3635 -8.2 -21 61 -12.8 0.1 -3.7 AATCAGAGAGTTTAGAGAAC
5898 SEQ ID NO: 3636 -8.2 -17.4 56.1 -8.6 -0.3 -3.2 GCAGATCCATGGCAATAAGC
5970 SEQ ID NO: 3637 -8.2 -24 68.2 -15.1 -0.5 -8 TGGTAGAGGAACTCCCATCT
6345 SEQ ID NO: 3638 -8.2 -25.3 72.5 -14.6 -2.5 -7.9 TGTCTGGTTTTGTTACACTA
6384 SEQ ID NO: 3639 -8.2 -21.9 67.7 -13.7 0 -2.7 CACTTTGCACAACTATCCCT
6736 SEQ ID NO: 3640 -8.2 -24.8 69.6 -16.6 0 -4.7 AGAATGGATGCAAGGACTGT
6786 SEQ ID NO: 3641 -8.2 -21.6 63.7 -13.4 0 -5.6 TTCAACGTAAACCTCATTTA
6909 SEQ ID NO: 3642 -8.2 -19.1 57.4 -10.4 -0.2 -5.3 AAGTAACTGAAACTGTAGCC
7027 SEQ ID NO: 3643 -8.2 -19.6 59.1 -11.4 0 -3.3 AAATTAAATATAGAGCTCTG
7204 SEQ ID NO: 3644 -8.2 -15 49.8 -5.8 0 -10 TACCATATGATACTCATGTT
7730 SEQ ID NO: 3645 -8.2 -20.1 61.2 -11 -0.8 -6 AATTTTCTTATGTACAAAAT
7884 SEQ ID NO: 3646 -8.2 -14.4 48.6 -5.6 -0.3 -6.8 ATATCATGTTAGGTAATTGC
8300 SEQ ID NO: 3647 -8.2 -19.1 60 -10.9 0 -4.7 GAAAGAAGATGAGTTTAGAT
8793 SEQ ID NO: 3648 -8.2 -16 52.2 -7.8 0 -2.2 TTGACCTCACATAAATCCAA
8963 SEQ ID NO: 3649 -8.2 -20.5 59.8 -12.3 0 -2.9 TATTATGGGAGAATTATGAA
9060 SEQ ID NO: 3650 -8.2 -16.1 52 -7.9 0 -3.2 CTTATATAATTTATTATGGG
9071 SEQ ID NO: 3651 -8.2 -15.5 51.3 -6.7 -0.3 -5.3 GTCTTCCTCTGGCAGCTGTT
135 SEQ ID NO: 3652 -8.1 -28.9 85.1 -20.1 0 -8.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CAGCATAACAAAGCCCAGCA 179 SEQ ID NO: 3653 -8.1 -24.7 67.6 -15.7 -0.7 -5
TCCAGGTCCTCCAGGGGCTC 694 SEQ ID NO: 3654 -8.1 -32.6 91 -23.2 -1.2 -8.4
TTTATTCATTACTATAAAAG 737 SEQ ID NO:3655 -8.1 -13.3 46.6 -5.2 0 -3.2
TCTTTGTCCAGTCAGGAGGG 918 SEQ ID NO:3656 -8.1 -26.3 78.3 -16.8 -1.3 -5
CTCAACGCTGAGACATTGCC 1099 SEQ ID NO:3657 -8.1 -25 69.6 -15.4 -1.4 -5.8
CTGCAGCCCAATGAGAGCAA 1253 SEQ ID NO: 3658 -8.1 -26.2 71.6 -17.4 -0.5 -7.2
GTCATCTCCAATGTAATCCT 1418 SEQ ID NO: 3659 -8.1 -23.5 68.7 -14.8 -0.3 -3
TTGCTTTTTAAGCTGTTCGA 1817 SEQ ID NO:3660 -8.1 -22 65.6 -11.3 -2.6 -9
AGGTGCTCTCTCTGTCTTCT 1987 SEQ ID NO:3661 -8.1 -26.9 83.3 -18.8 0 -3.6
GCTTCTTTTGACGCTGTCTT 2057 SEQ ID NO:3662 -8.1 -25.3 74.2 -15.8 -1.3 -7.6
TGCTGGAAGCCCTGGCACCA 2372 SEQ ID NO:3663 -8.1 -31.1 81.5 -20.8 -2.2 -10.4
ACAGTGCTGTGCATCTTCCC 2395 SEQ ID NO: 3664 -8.1 -28.3 80.9 -19.1 -1 -8.5
TTCTGACTTCCGTTTCAGTG 2499 SEQ ID NO:3665 -8.1 -24.1 71.3 -14.8 -1.1 -5.7
ACACTACTGAATTGCTCAGT
2824 SEQ ID NO:3666 -8.1 -21.8 65.4 -11.4 -2.3 -7.5 CACACTACTGAATTGCTCAG
2825 SEQ ID NO:3667 -8.1 -21.3 63.4 -11.4 -1.8 -6.2 CTGCAGATTATTCATTTCAT
3467 SEQ ID NO:3668 -8.1 -20.3 62.5 -12.2 0.6 -7.6
AATCATTTTCATCGATTACG 3720 SEQ ID NO:3669 -8.1 -18.4 56.3 -9.6 -0.4 -6.3
CTTCAGATGAGCTGGTTGCA 3873 SEQ ID NO:3670 -8.1 -25 73.5 -15.3 -1.5 -6.8
AACTTTTTAATACACCCTTC 3982 SEQ ID NO:3671 -8.1 -20 60 -11.9 0 -2.5
AAGTCTCAAACCAGTTGTGC 4083 SEQ ID NO: 3672 -8.1 -22.7 67.2 -13.9 -0.4 -3.4
GTCTTTCGCTGTTCAATGTA 4156 SEQ ID NO:3673 -8.1 -23.2 69.6 -15.1 0 -3.1
ATCTAGCCAGCACCAGGCAT 4280 SEQ ID NO: 3674 -8.1 -28.6 79.3 -18.6 -1.9 -7.4
CCTCATGCCTTCAAACCGGG 4418 SEQ ID NO:3675 -8.1 -27.9 73.3 -19.8 0 -7.1
AACTTGCCAGCAAACAAATT 4534 SEQ ID NO:3676 -8.1 -19.7 57.5 -11.6 0 -7.4
CAGTGGTAGAACTTGCCAGC 4543 SEQ ID NO: 3677 -8.1 -25.4 73.3 -16 -1.2 -4.8
AAATTCTCCAGTGAACAGAA 5171 SEQ ID NO: 3678 -8.1 -19 57.6 -10.9 0 -4.5
AATACTTTTCTATCATCTCA 5292 SEQ ID NO:3679 -8.1 -18.9 59.9 -10.8 0 -1.4
AGGAGGCCGATGTTAAACAA 5434 SEQ ID NO:3680 -8.1 -22 62.5 -13.2 -0.5 -8.1
CTTTTCCCAAACCTCATAGA 5849 SEQ ID NO:3681 -8.1 -23.4 66.4 -15.3 0 -2.4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GTGGTAGAGGAACTCCCATC 6346 SEQ ID NO:3682 -8.1 -25.6 73.9 -14.6 -2.9 -8.2
TTGAAGTCCAGTTGACACAT 6533 SEQ ID NO:3683 -8.1 -22 65.4 -12.8 -1 -5.7
ATCATTTGAGAGACAGGGTT 6944 SEQ ID NO:3684 -8.1 -21.7 66.1 -13.6 0 -4
AGTAACTGAAACTGTAGCCA 7026 SEQ ID NO: 3685 -8.1 -21 62.2 -12.9 0 -3.3
CATAACTGTTCAGATAGAAA 7098 SEQ ID NO:3686 -8.1 -16.7 53.4 -7.9 -0.5 -5
CATTAGTGATAGCCTTTAAA 7539 SEQ ID NO:3687 -8.1 -19.2 58.8 -11.1 0 -4
ACTACAGTAAATAGTTTTGT 8368 SEQ ID NO:3688 -8.1 -17.6 56.6 -9.5 0 -3.6
CTTTTTAGCAATAGCAATTC 8410 SEQ ID NO:3689 -8.1 -18.8 58.6 -9 -1.7 -4.6
GTAGCTCACCATTCTTTTTA 8423 SEQ ID NO:3690 -8.1 -23.1 69.8 -15 0 -4.8
AAAACCCCAGAGCCCAATAA 8491 SEQ ID NO:3691 -8.1 -24.2 64.1 -16.1 0 -3.2
ATTAATTATATATATTTTAA 8538 SEQ ID NO:3692 -8.1 -11.3 42.5 -3.2 0 -6.8
ATTGTAGGTGGTTACTACTA 8737 SEQ ID NO:3693 -8.1 -21.2 65.9 -11.5 -1.6 -5.2
GCATCAATTATATTGAAAGA 8807 SEQ ID NO:3694 -8.1 -16.3 52.3 -6.2 -2 -7.9
CATTTATTAGCCACCAAGTA 8838 SEQ ID NO:3695 -8.1 -22 64.3 -13.9 0 -3.2
TGACCTCACATAAATCCAAG 8962 SEQ ID NO:3696 -8.1 -20.4 59.7 -12.3 0 -2.6
TTTTGACCTCACATAAATCC 8965 SEQ ID NO:3697 -8.1 -20.7 61.2 -12.6 0 -2.9
ACAGCATAACAAAGCCCAGC 180 SEQ ID NO: 3698 -8 -24.2 67.1 -15.7 -0.2 -4.1
TAGCTTCTTGCATACGAATT 424 SEQ ID NO: 3699 -8 -21.1 62.7 -11.5 -1.5 -5.2
GCGGAAGCTTTCAGGTCCTG 497 SEQ ID NO:3700 -8 -27.4 76.8 -17.7 -1.6 -10.7
CCAAGTCACTATTTGGCTTT 618 SEQ ID NO:3701 -8 -23.4 68.5 -13.8 -1.5 -5
CTCTTGCCAAGATTTTTATA 981 SEQ ID NO:3702 -8 -20.5 62.1 -11.7 -0.6 -6.3
CAGGGCCCCCACAATGGTCT 1172 SEQ ID NO: 3703 -8 -31.5 82.2 -21.7 -0.7 -11.8
ATTGCCCATGAACAGCTGCA 1268 SEQ ID NO:3704 -8 -26.6 72.8 -17.9 -0.2 -8.9
TGTATCCTTCTGGACACTGG 1503 SEQ ID NO:3705 -8 -24.6 71.9 -16.6 1.5 -5.9
ACTGGTAAAGATTTTCCCAA 1623 SEQ ID NO:3706 -8 -21.1 61.8 -13.1 0 -4.8
TCCATTCTTTAGCACCTTTG 1950 SEQ ID NO:3707 -8 -24.2 70.6 -16.2 0 -4.1
GGAAGCTGCTTCTTTTGACG 2064 SEQ ID NO:3708 -8 -23.8 68.7 -13.2 -1.8 -13.3
AGTCTGTTTCCATCCATGGA 2089 SEQ ID NO:3709 -8 -25.9 75.5 -16.3 -1.5 -10.1
GATCTTAATTAGCATATTTA 3074 SEQ ID NO:3710 -8 -16.9 54.8 -8.9 0 -4.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
CATCATCAGTAGCAGCAAGG
3444 SEQ ID NO: 3711 -8 -23.3 69.1 -15.3 0 -5.4 TTTCACATAATCAATTCCCT
3509 SEQ ID NO: 3712 -8 -21 62 -13 0 -2.5 AAACACTCCCGCATCTTATT
3529 SEQ ID NO: 3713 -8 -23.5 65.7 -15.5 0 -3.6 CTTTCTAAAAAAGGCTTTTT
3551 SEQ ID NO: 3714 -8 -16.9 53.5 -7.6 -1.2 -8.2 CCAGTATTATTGGACATGCA
3613 SEQ ID NO: 3715 -8 -22.7 66.4 -14.7 0 -5.2 CCATCTCTAAGATAATTAAG
3652 SEQ ID NO: 3716 -8 -17 53.9 -8.3 -0.5 -4.9 GGGTTCAGTTTCAGCTTGTT
3929 SEQ ID NO: 3717 -8 -25.4 77.7 -17.4 0 -4.5 AAAGTCTCAAACCAGTTGTG
4084 SEQ ID NO: 3718 -8 -20.2 60.9 -11.5 -0.4 -3.4 AGGCCAATGCACCACTACTG
4125 SEQ ID NO:3719 -8 -26.3 72.1 -16.8 -1.4 -7.7 GTTCAATGTATATATCTTCA
4146 SEQ ID NO: 3720 -8 -18.5 59.2 -10.5 0 -3.9 AAGAGCATTGGCTACCAGGC
4328 SEQ ID NO:3721 -8 -26 73.6 -16.2 -1.8 -8.4 TGGTAGAACTTGCCAGCAAA
4540 SEQ ID NO: 3722 -8 -22.8 65.3 -13.9 -0.8 -7.5 CAGGCTGAAGTTTAACATCT
4761 SEQ ID NO: 3723 -8 -21.1 63.4 -13.1 0 -4.6 TCCAGCCTATAGTGAAGTAG
5220 SEQ ID NO: 3724 -8 -23.2 68.7 -15.2 0 -5.1 AAGATGTTCCAGCCTATAGT
5227 SEQ ID NO: 3725 -8 -23.6 69.4 -15.6 0 -5.1 ATCATCAAAGCAAAGAGCAG
5401 SEQ ID NO: 3726 -8 -19 57.7 -9.4 -1.6 -4.4 CAGAGGTTGTAATTTGGAAC
5577 SEQ ID NO: 3727 -8 -19.5 60 -11.5 0 -3 ACCACAACCAGGAAGGATAT
5740 SEQ ID NO: 3728 -8 -22.6 63.9 -13.8 -0.6 -4.3 TTTCTTCAGTAGCAACACTG
5793 SEQ ID NO: 3729 -8 -21.4 65.3 -12.3 -1 -5.8 AGGGGCTCTGCACTTTCTTC
5806 SEQ ID NO:3730 -8 -27.2 80.5 -19.2 4.6 -4.8 CGCATCGGGATCAAACTTTT
5864 SEQ ID NO:3731 -8 -22.6 63.7 -14.6 0 -5.3 CTTGTCTGGTTTTGTTACAC
6386 SEQ ID NO: 3732 -8 -22.3 68.7 -14.3 0 -2.9 TCTTGAAGTCCAGTTGACAC
6535 SEQ ID NO: 3733 -8 -22.6 67.8 -12.8 -1.8 -5.1 ATGGATGCAAGGACTGTACT
6783 SEQ ID NO: 3734 -8 -22.5 66.2 -14.5 0 -5.1 AAAATATGGCAGATATGGAA
6815 SEQ ID NO: 3735 -8 -16.7 52.4 -7.3 -1.3 -5.2 GACCTAAATTAAATATAGAG
7209 SEQ ID NO: 3736 -8 -14.4 48.1 -6.4 0 -3.2 AGCAAAATATGAAGAATAGG
7798 SEQ ID NO: 3737 -8 -14.8 48.7 -6.8 0 -4.1 ATTGTGATGTCATCAACCTG
7909 SEQ ID NO: 3738 -8 -21.7 64.7 -12.6 -1 -7.2 ACGTAGCTCACCATTCTTTT
8425 SEQ ID NO:3739 -8 -24.3 70.7 -16.3 0 -4.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligc oligo ATTATATATATTTTAAACTG
8534 SEQ ID NO:3740 -8 -12.6 45.1 -4.6 0 -5.2 GTTTTGACCTCACATAAATC
8966 SEQ ID NO: 3741 -8 -19.9 60.5 -11.9 0 -2.9 CAGGTCCCTTCTGTGAATTA
366 SEQ ID NO: 3742 -7.9 -24.7 71.6 -16.8 0 -4.2 GCTTTCTCTTCTGCAGCACG
553 SEQ ID NO:3743 -7.9 -26.9 77.5 -18.3 -0.4 -8.3 GTTCTCATCATCATTATCTT
593 SEQ ID NO: 3744 -7.9 -21.1 66.4 -13.2 0 -0.9 CAGTCAGGAGGGTTGCTCAA
910 SEQ ID NO: 3745 -7.9 -25.6 75.3 -15.7 -2 -5 CAAAACCCTCTTGCCAAGAT
988 SEQ ID NO:3746 -7.9 -23.5 64.6 -14.8 -0.6 -6.3 GGGGCCACTGCAAACATTTA
1296 SEQ ID NO: 3747 -7.9 -25.1 69.5 -15.7 -1.4 -7.6 ATTTCCACAGAGTAAAGGGT
1469 SEQ ID NO: 3748 -7.9 -21.9 65.2 -14 0 -3.6 CTTTTTGTTCTGCTTCTTCC
1776 SEQ ID NO:3749 -7.9 -24.5 74.1 -16.6 0 -3.6 CTCTCCTAACCCACCTACTC
1892 SEQ ID NO:3750 -7.9 -27.7 76.1 -19.8 0 -0.3 GGATACTCAAGAGAGACTGA
2139 SEQ ID NO: 3751 -7.9 -20.5 62.4 -11.8 -0.6 -4.5 CGTCTTGGGGAAAACAGGGA
2164 SEQ ID NO: 3752 -7.9 -23.4 65.8 -15.5 0 -2.7 GAAAATCCCAGTAAAGACCA
2861 SEQ ID NO: 3753 -7.9 -20.6 59.1 -12.7 0 -2.1 GAATGATCGCAGTACAGACA
3011 SEQ ID NO: 3754 -7.9 -21.5 63.2 -12.9 -0.4 -5.7 CCATACAGTCCCACATGGTC
3309 SEQ ID NO:3755 -7.9 -27.3 76.3 -18.7 -0.5 -5.2 TATTTTTCACATAATCAATT
3513 SEQ ID NO: 3756 -7.9 -15.6 51.4 -7.7 0 -2.3 TGGCACTGTGACGGTGAGGC
3764 SEQ ID NO: 3757 -7.9 -27.6 77.3 -17.9 -1.8 -7.6 AGTAAAACAAGCTTCCGGTT
3962 SEQ ID NO:3758 -7.9 -21.5 62.2 -13.6 0 -6.6 TCTTCCCTTTGCCTTCTTCT
4023 SEQ ID NO:3759 -7.9 -28.4 81.3 -20.5 0 -3 ATCAAGAAATCTAGCCAGCA
4288 SEQ ID NO: 3760 -7.9 -21.6 63.3 -13.7 0 -4.6 CCAAGAGCATTGGCTACCAG
4330 SEQ ID NO: 3761 -7.9 -25.7 71.5 -16.2 -1.6 -7.2 TACAGATTTTCTTCATATAC
4780 SEQ ID NO:3762 -7.9 -17.6 57 -9.7 0 -2.6 TATTTTTTCTGTTCCTCTGT
4927 SEQ ID NO: 3763 -7.9 -22.6 69.9 -14.7 0 -0.7 AAAGACCATTCCTTGGAATT
5012 SEQ ID NO: 3764 -7.9 -20.8 60.6 -11.2 -1.7 -8.4 TGGTGACCATGTTGAGGCAG
5079 SEQ ID NO: 3765 -7.9 -25.5 73.3 -17.1 -0.2 -5.5 TG7AAGTAGTAGTGTCTGAGG
5208 SEQ ID NO:3766 -7.9 -21.2 66.5 -13.3 0 -2.9 GTGAAGTAGTAGTGTCTGAG
5209 SEQ ID NO: 3767 -7.9 -21.2 67.3 -13.3 0 -2.9 AGTGAAGTAGTAGTGTCTGA
5210 SEQ ID NO:3768 -7.9 -21.2 67.3 -13.3 0 -2.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ATGTCATCAATTCCAGCTTC 5518 SEQ ID NO:3769 -7.9 -23.1 69.1 -15.2 0 -4.5
CCAGGGTGAATTGTGTCAGG 5653 SEQ ID NO:3770 -7.9 -25 72.4 -17.1 0 -3.3
TGTACATGTTCACCACAACC 5751 SEQ ID NO:3771 -7.9 -23.5 67.4 -14.9 -0.4 -7.1
AGCAACACTGAAGTTCTCCA 5783 SEQ ID NO:3772 -7.9 -23.4 68.1 -15.5 0 -6.3
CTTTCTTCAGTAGCAACACT 5794 SEQ ID NO:3773 -7.9 -22.3 67.5 -13.7 -0.5 -0.8
GACCATGGGCAGATCCATGG 5978 SEQ ID NO:3774 -7.9 -27.3 75 -14.3 -5.1 -12.8
TTTTTAACCTTTGCTTTAAA 6216 SEQ ID NO:3775 -7.9 -17.9 55.7 -10 0 -4
TGCTTTCTTTTTCTGGTTTG 6423 SEQ ID NO:3776 -7.9 -22.5 69.3 -14.6 0 -3.6
TTAAAACAGTCAGTTTGGCA 6564 SEQ ID NO:3777 -7.9 -20 60.8 -10.5 -1.6 -7.7
TCTGATCATTTGAGAGACAG 6948 SEQ ID NO:3778 -7.9 -19.9 61.9 -11.5 -0.1 -6.2
TCTAGAAAATGGAAGTAACT 7039 SEQ ID NO:3779 -7.9 -15.9 51.4 -8 0 -5.2
AATTAAAGCCATCTAGAAAA
7050 SEQ ID NO:3780 -7.9 -15.7 50.2 -7.8 0 -6.2 AAATTAAAGCCATCTAGAAA
7051 SEQ ID NO:3781 -7.9 -15.7 50.2 -7.8 0 -6.2 CACATAACTGTTCAGATAGA
7100 SEQ ID NO:3782 -7.9 -19 59 -10.6 -0.2 -5.6
TATTAGAGGAGACTTTACAG 7121 SEQ ID NO:3783 -7.9 -18.4 58.5 -9.6 -0.7 -5.5
CATTTGACCTAAATTAAATA 7214 SEQ ID NO: 3784 -7.9 -15 49 -6.5 -0.3 -5
TTTGGAAAGCATTTGACCTA 7223 SEQ ID NO: 3785 -7.9 -20.7 61.2 -12 -0.6 -4.1
GCAATACTTTAGATATATTT 7270 SEQ ID NO:3786 -7.9 -16.7 54 -8.8 0 -4.3
AAAGCAATACTTTAGATATA 7273 SEQ ID NO:3787 -7.9 -15.1 50 -6.1 -1 -4.7
AATGGATTGAGTAAAATAGA 7582 SEQ ID NO:3788 -7.9 -14.9 49.3 -7 0 -2.1
CACCAATATGTGACATTCTT 7620 SEQ ID NO:3789 -7.9 -20.8 61.9 -12.9 0 -4
TTCATTCTATCACCAATATG 7630 SEQ ID NO:3790 -7.9 -19.3 59.3 -11.4 0 -2.7
TAGACATATTTTTAGCAAAA 7811 SEQ ID NO:3791 -7.9 -15.4 50.6 -6.8 -0.4 -5
TTTAAACAAGTTTTAGACAT 7824 SEQ ID NO:3792 -7.9 -15.4 50.8 -6.8 -0.4 -5.5
GCAATAGCAATTCCCTGCAT 8403 SEQ ID NO:3793 -7.9 -25.2 70 -15.6 -1.7 -6.8
TTTTGGCTCAATAATGACGT 8441 SEQ ID NO: 3794 -7.9 -20.4 60.6 -11.8 -0.5 -5.3
ACAAAGCTGCTTTTAATTTG 8657 SEQ ID NO:3795 -7.9 -18.4 56.8 -9 -0.5 -10.9
CTATTGTAGGTGGTTACTAC 8739 SEQ ID NO:3796 -7.9 -21.2 65.9 -12.8 -0.1 -4.3
CATAGGAGTTTATATAATGC 8880 SEQ ID NO:3797 -7.9 -17.8 56.6 -9.9 0 -5.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TTGGTTTTGACCTCACATAA 8969 SEQ ID NO:3798 -7.9 -21.5 63.9 -11.3 -2.3 -5
AGTTTGGTTTTGACCTCACA 8972 SEQ ID NO:3799 -7.9 -23.8 70.7 -13.6 -2.3 -5.7
TTTTTTTTTTTTTTTTCCAC 9091 SEQ ID NO: 3800 -7.9 -18.8 59.8 -10.9 0 0
AGCTGTTCAGCTTTTTTTTT 122 SEQ ID NO:3801 -7.8 -22.6 69.8 -13 -1.7 -10.8
GGCTTCAGTTTTCTTGCTCC 232 SEQ ID NO: 3802 -7.8 -27.1 80.5 -18.6 -0.4 -3.7
GAATCCTTGACAGGTATCTC 278 SEQ ID NO:3803 -7.8 -22.6 67.8 -13.8 -0.9 -3.6
TCTTACAATATCCCTAGAAG 336 SEQ ID NO:3804 -7.8 -19.9 60 -12.1 0 -3.8
TCTTCTGCAGCACGTTTTTC 547 SEQ ID NO:3805 -7.8 -24.7 73.3 -16.4 0 -8.3
TAAATAAATGGAAGGTTCTT 646 SEQ ID NO:3806 -7.8 -15.6 50.7 -7.8 0 -4.2
CTCCATAAATAAATGGAAGG 651 SEQ ID NO:3807 -7.8 -16.9 52.4 -6.8 -2.3 -7.8
GGAATGTCTCCATAAATAAA 658 SEQ ID NO:3808 -7.8 -17.3 53.7 -8.4 -1 -4
AGGAATGTCTCCATAAATAA 659 SEQ ID NO: 3809 -7.8 -18 55.5 -8.4 -1.8 -4.8
CATCTCTGGAGGAATGTCTC 668 SEQ ID NO:3810 -7.8 -23.1 69.8 -14.6 -0.4 -6.1
CTTGATAGCAATTTTCCTAA 821 SEQ ID NO:3811 -7.8 -19.7 59.7 -11.3 -0.3 -0.5
AGATTTTTATAAGTGACTCA 972 SEQ ID NO: 3812 -7.8 -17.7 56.9 -9.9 0 -4.7
GGTTTCGACCAGCCTTCACA 1527 SEQ ID NO:3813 -7.8 -28.1 77.5 -18.4 -1.9 -7.2
TAGCCATAGTTGGGGTTTCG 1540 SEQ ID NO: 3814 -7.8 -25.4 73.2 -16.1 -1.4 -5.1
AAAAAATATCATGTATGTTT 1664 SEQ ID NO:3815 -7.8 -13.6 46.7 -5.3 -0.1 -5.8
ATTCACCAAATAAAATGAGC 1703 SEQ ID NO: 3816 -7.8 -16.7 52.1 -8.9 0 -3
TCCTTTGTTGTTTCCTTCAA 2006 SEQ ID NO:3817 -7.8 -24 71.1 -16.2 0 -2.9
G/AAAACAGGGAGCCACGGAT 2155 SEQ ID NO:3818 -7.8 -23.7 65.1 -15.3 -0.3 -4.3
GCCCGACCTCTGAAACTGAA 2203 SEQ ID NO:3819 -7.8 -25.8 68.6 -18 0 -2.8
CAATCCACAGTGCTGTGCAT 2401 SEQ ID NO:3820 -7.8 -25.6 72.6 -15.9 -1.2 -11.9
CATGCATCACAGCAGTCCCA 2689 SEQ ID NO:3821 -7.8 -28 77.8 -18.9 -1.2 -7.5
ATTAAATTCACAAGATGTTT 2719 SEQ ID NO:3822 -7.8 -15.8 51.6 -8 0 -3.2
TCCCTCCACATTTGACAGAC 2990 SEQ ID NO:3823 -7.8 -25.8 72.4 -18 0 -2.4
CCAGCGACCTCCATACAGTC 3319 SEQ ID NO:3824 -7.8 -28.3 77.1 -20.5 0 0
CAAGGTTTCCAATGACCATG 3372 SEQ ID NO:3825 -7.8 -22.5 64.3 -13.1 -1.5 -5.8
AGGTTCAGAACCACAAGGTT 3385 SEQ ID NO:3826 -7.8 -23.1 67.6 -12.6 -2.7 -12 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CGGTTTAAAGTCTTCTTCGG 3947 SEQ ID NO:3827 -7.8 -22.1 64.9 -13.6 -0.5 -4.7
TATATCTTCAAAGGCCAATG 4136 SEQ ID NO:3828 -7.8 -19.5 58.7 -11.2 0 -7.7
CAGGCTAACCAAAGAAACAT 4313 SEQ ID NO:3829 -7.8 -19.2 56.5 -10 -1.3 -3.7
GATTTGATGGCACCGAGTTC 4357 SEQ ID NO:3830 -7.8 -24.4 69.9 -16.6 0 -4
GAGGTCTTAAAGCTCTTAAT 4386 SEQ ID NO: 3831 -7.8 -19.8 61.2 -11.5 -0.1 -5.9
GATAAGGCTCTTAGAGGTCT 4399 SEQ ID NO:3832 -7.8 -22.9 69.8 -14.5 -0.3 -6.1
CCGGGATAAGGCTCTTAGAG 4403 SEQ ID NO:3833 -7.8 -24.4 69.3 -16.1 -0.2 -6.1
TGTCAAACATGTTACCCGTT 4575 SEQ ID NO:3834 -7.8 -23.1 65.6 -14.7 0 -8.5
GTTTCTTCATTGCATTGTAA 4947 SEQ ID NO:3835 -7.8 -20.8 64.3 -13 0 -6.2
GAGGCAGATGAGGATCATGA 5066 SEQ ID NO:3836 -7.8 -23 68 -13.1 -2.1 -7.8
CCATCATGGTGACCATGTTG 5085 SEQ ID NO:3837 -7.8 -25 70.9 -14 -3.2 -11.5
GATGTTCCAGCCTATAGTGA 5225 SEQ ID NO:3838 -7.8 -24.9 72.8 -17.1 0 -5.1
GTGAATTGTGTCAGGGTCAC 5648 SEQ ID NO:3839 -7.8 -23.6 71.4 -15.2 -0.3 -5.2
GGGATCAAACTTTTCCCAAA 5858 SEQ ID NO:3840 -7.8 -21.8 62.2 -11.9 -2.1 -7.7
TAGAGAACTCTATAAACTGG 5886 SEQ ID NO:3841 -7.8 -16.9 53.9 -8.6 0 -7.5
AAGCTGGACTTTGTTGGGTT 5954 SEQ ID NO:3842 -7.8 -24.1 71.2 -16.3 0 -5.1
ATCCATCTCTCCACTCTCAC 6056 SEQ ID NO:3843 -7.8 -26.5 77.4 -18.7 0 -0.5
GAGACTTTGGAGGGGTTTGA 6112 SEQ ID NO:3844 -7.8 -23.9 70.9 -16.1 0 -2.6
TTGCTTTAAAAGATAACATC 6206 SEQ ID NO:3845 -7.8 -15.5 50.7 -7.7 0 -4.3
GTAAGTCAATCCTCCCTTTA 6267 SEQ ID NO:3846 -7.8 -24.3 70.3 -16.5 0 -2.4
GTTTGTCTTTCTCAAACTTT 6408 SEQ ID NO:3847 -7.8 -20.4 63.7 -10.2 -2.4 -7.4
AGATAATTCTTTGTTTCTTT 6475 SEQ ID NO:3848 -7.8 -18.1 58.5 -10.3 0 -2.9
ACTATGAGTATTTGTTAAAA 6578 SEQ ID NO:3849 -7.8 -15.4 51 -7.6 0 -2.8
AGGTCACTTCACTGTCTTGT 6608 SEQ ID NO:3850 -7.8 -24.7 75.7 -16.9 0 -2.6
AATAGTGACATAGCATTATG 6885 SEQ ID NO:3851 -7.8 -17.7 56 -8.8 -1 -4.7
AGTGCAAAAGTAAAGGTGTT 7702 SEQ ID NO: 3852 -7.8 -18.8 57.9 -11 0 -5.4
GATACTCATGTTGAATTAAA 7722 SEQ ID NO: 3853 -7.8 -16.1 52.1 -8.3 0 -4.7
AGTTTTAGACATATTTTTAG 7816 SEQ ID NO:3854 -7.8 -16.5 54.7 -8 -0.4 -2.9
AAAACCCATTATCTAACTTT 8021 SEQ ID NO:3855 -7.8 -18.2 55.2 -10.4 0 -1.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TAATTATATATATTTTAAAC 8536 SEQ ID NO:3856 -7.8 -10.7 41.2 -2.9 0 -5
ACATGTGAACTTGATCCTTT 8693 SEQ ID NO:3857 -7.8 -21.3 63.5 -13.5 0 -6.1
TATTGTAGGTGGTTACTACT 8738 SEQ ID NO:3858 -7.8 -21.2 65.9 -11.8 -1.6 -5.2
TGAGTTTAGATGCTTATAGC 8784 SEQ ID NO:3859 -7.8 -20.3 63.5 -11.6 -0.8 -4.2
ACCTTATGTATACATAGGAG 8892 SEQ ID NO:3860 -7.8 -19.9 61.1 -9.9 -1.1 -12.6
TGCTCCTTTCCCAGTAAGCC 308 SEQ ID NO:3861 -7.7 -29.3 80.6 -20.7 -0.8 -4.5
GGAAGCTTTCAGGTCCTGGG 495 SEQ ID NO: 3862 -7.7 -27.2 77.9 -18 -0.8 -10.8
TACCAAAATCTTGATAGCAA 830 SEQ ID NO: 3863 -7.7 -18 55 -9.7 -0.3 -4.5
GTCAAAATAGTGCACATGAT 871 SEQ ID NO:3864 -7.7 -19.1 58.3 -10.4 0 -9.9
ACATATGCCATCACAATGAC 1060 SEQ ID NO:3865 -7.7 -21.2 62 -12.8 -0.5 -8.3
ACTCTGAATGTTCTCAACGC 1111 SEQ ID NO:3866 -7.7 -22.1 65.1 -13.5 -0.8 -4.6
GCCCCCACAATGGTCTTTAA 1168 SEQ ID NO:3867 -7.7 -27.6 73.9 -19 -0.7 -4.3
CCCATGAACAGCTGCAGCCC 1264 SEQ ID NO:3868 -7.7 -30.5 79.5 -20.3 0 -13.2
GCTTGGGGGCCACTGCAAAC 1301 SEQ ID NO:3869 -7.7 -28.5 76.9 -19.3 -1.4 -7.1
CATTTCCACAGAGTAAAGGG 1470 SEQ ID NO:3870 -7.7 -21.4 63.3 -13.7 0 -3.5
CCTTTGTTGTTTCCTTCAAG 2005 SEQ ID NO:3871 -7.7 -23.6 69.7 -15.9 0 -3.1
TGCTTCTTTTGACGCTGTCT 2058 SEQ ID NO:3872 -7.7 -25.2 73.6 -15.5 -2 -7.6
GCTCTCCATGTCTGTGCGGC 2310 SEQ ID NO:3873 -7.7 -30.4 85.5 -22.7 0 -5.1
TGGTGCCCTCTGGGGGAAGT 2478 SEQ ID NO:3874 -7.7 -30.3 83.3 -21 -1.5 -8
AGAGGGTATTTAAGACAATG 2778 SEQ ID NO:3875 -7.7 -17.9 56.3 -10.2 0 -2.6
TCTGCTGTGAAAATCCCAGT 2869 SEQ ID NO:3876 -7.7 -24 68.4 -15.8 -0.1 -3.6
GGCTGACAATAATTCCATCA 2952 SEQ ID NO:3877 -7.7 -22 63.9 -14.3 0 -3.7
CTCTAAGCAGTCTGAATGAT 3024 SEQ ID NO:3878 -7.7 -20.7 63 -13 0 -6.3
CGGGTTCAGTTTCAGCTTGT 3930 SEQ ID NO:3879 -7.7 -26.1 76.9 -18.4 0 -4.5
TCAGTAAAACAAGCTTCCGG 3964 SEQ ID NO:3880 -7.7 -21.3 61.5 -13.6 0 -6.4
GAAGCATTTCCAGAATGAAT 4221 SEQ ID NO:3881 -7.7 -19.5 58.4 -10.2 -1.6 -5.7
GAAATATGTTTGAAATCCAT
4256 SEQ ID NO:3882 -7.7 -16.6 52.3 -8.9 0 -4.1 TGAAATATGTTTGAAATCCA
4257 SEQ ID NO: 3883 -7.7 -16.6 52.3 -8.9 0 -4.1 AGGTCTTAAAGCTCTTAATG
4385 SEQ ID NO:3884 -7.7 -19.2 59.8 -11.5 0 -5.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
CAGCAAACAAATTCACACCC
4527 SEQ ID NO:3885 -7.7 -21.6 61 -13.9 0 -4.1 CCAGCAAACAAATTCACACC
4528 SEQ ID NO:3886 -7.7 -21.6 61 -13.9 0 -4.1 TAATGTCAAACATGTTACCC
4578 SEQ ID NO:3887 -7.7 -20 59.4 -11.1 -1.1 -9
GGCAGATGAGGATCATGATG 5064 SEQ ID NO:3888 -7.7 -22.4 66.3 -13.1 -1.6 -8.5
GTTGAGGCAGATGAGGATCA 5069 SEQ ID NO:3889 -7.7 -23.7 70.5 -14.8 -1.1 -6
GTCATCCGTTTCCACCATCA 5099 SEQ ID NO:3890 -7.7 -28 77.5 -20.3 0 -2.6
AAAACTAGGGTCATGTATTT 5125 SEQ ID NO:3891 -7.7 -18.5 57.6 -10.8 0 -4.7
CAAATTCTCCAGTGAACAGA 5172 SEQ ID NO:3892 -7.7 -20.4 60.7 -12.7 0 -3.9
TTCTATCATCTCAGCCAGAA 5285 SEQ ID NO:3893 -7.7 -23 68.6 -15.3 0 -3.6
TTCCCAAACCTCATAGAACA 5846 SEQ ID NO:3894 -7.7 -22.5 63.5 -14.8 0 -2.7
ACATCTGAAATTACGCTGAA
6191 SEQ ID NO:3895 -7.7 -18.8 56.4 -11.1 0 -3.3 AACATCTGAAATTACGCTGA
6192 SEQ ID NO:3896 -7.7 -18.8 56.4 -11.1 0 -3.3 GGGTGGTAGAGGAACTCCCA
6348 SEQ ID NO:3897 -7.7 -27.6 77.5 -17.2 -2.7 -8.2
GTAGCCATTGGGTTTCTCCT 6707 SEQ ID NO:3898 -7.7 -27.9 80.6 -19.3 -0.8 -6.3
TCACTTTGCACAACTATCCC 6737 SEQ ID NO:3899 -7.7 -24.3 69.2 -16.6 0 -5
TTATGAATAAACTATGAATT 6870 SEQ ID NO:3900 -7.7 -12.8 45.1 -5.1 0 -3.1
TCATTTACAAAAATAGTGAC 6896 SEQ ID NO:3901 -7.7 -14.8 49.3 -6.4 -0.5 -5
CCATCTAGAAAATGGAAGTA 7042 SEQ ID NO:3902 -7.7 -18.2 55.7 -9.5 -0.9 -7.2
AAAATTAAAGCCATCTAGAA 7052 SEQ ID NO:3903 -7.7 -15.7 50.2 -8 0 -6.2
TCTAGAATGGATTTATTAGA 7249 SEQ ID NO:3904 -7.7 -17 55 -9.3 0 -5.2
TGAAGAATGGATTGAGTAAA 7587 SEQ ID NO:3905 -7.7 -15.8 51 -8.1 0 -2.1
TATGATACTCATGTTGAATT
7725 SEQ ID NO:3906 -7.7 -17.5 55.7 -8.9 -0.8 -4.9 ATATGATACTCATGTTGAAT
7726 SEQ ID NO:3907 -7.7 -17.4 55.4 -8.8 -0.8 -5.1 AGACATATTTTTAGCAAAAT
7810 SEQ ID NO:3908 -7.7 -15.7 51.1 -6.8 -1.1 -5.3
GGAAATTATCCATTGAAAAA 7994 SEQ ID NO:3909 -7.7 -15.2 49 -6 -1.4 -6.8
GTAATAGCTTTAGTGCAGCA 8227 SEQ ID NO:3910 -7.7 -22.7 68.6 -13.4 -1.5 -6.5
AGTTCTTCAATACACTACAG 8381 SEQ ID NO:3911 -7.7 -19.4 60.7 -11.7 0 -3.1
AGCAATTCCCTGCATGCAGT 8398 SEQ ID NO: 3912 -7.7 -27.4 76.3 -16.6 -1.9 -14.3
TATTCTTTTGGCTCAATAAT 8446 SEQ ID NO:3913 -7.7 -18.7 58.3 -11 0 -4.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ATCAAACCTGAAAGTTGGAA 8712 SEQ ID NO: 3914 -7.7 -18.4 55.6 -10 -0.4 -3.8
TTTGGTTTTGACCTCACATA 8970 SEQ ID NO:3915 -7.7 -22.3 66.5 -12.3 -2.3 -4.8
CCAAGATGGTTAGGGTATAA 158 SEQ ID NO: 3916 -7.6 -21.1 62.7 -13 -0.2 -3.7
AGTTTTCTTGCTCCATAATC 226 SEQ ID NO:3917 -7.6 -22.1 67.2 -14.5 0 -4.4
CTTCTGTG7AATTATCTCATT 359 SEQ ID NO:3918 -7.6 -19.7 61.6 -12.1 0.4 -3.2
TTGCATACGAATTACCTTAG 417 SEQ ID NO: 3919 -7.6 -19.9 59.2 -12.3 0 -5.1
TTCTTTCCAGCTTCCAAGTC 631 SEQ ID NO:3920 -7.6 -25.5 75.1 -17.9 0 -4.5
CCATGAACAGCTGCAGCCCA 1263 SEQ ID NO: 3921 -7.6 -29.2 77.2 -19.1 0 -13.2
ACAAATGTCCCATTTGAATC 1369 SEQ ID NO:3922 -7.6 -20.3 59.9 -8.9 -3.8 -10.4
GTCAACTGGTAAAGATTTTC 1627 SEQ ID NO: 3923 -7.6 -18.7 58.6 -11.1 0 -3.2
ACAAAAAATATCATGTATGT 1666 SEQ ID NO:3924 -7.6 -14.3 47.9 -6.7 0 -4.7
GGAGCAGAATTTTTTGTCAC 2114 SEQ ID NO: 3925 -7.6 -21.2 64.6 -13.6 0 -4.1
TTCATCATCAGCAAAGTCAT 2243 SEQ ID NO: 3926 -7.6 -20.8 63.4 -13.2 0 -4.1
ATACTGGCCTGACTAACGTT 2341 SEQ ID NO:3927 -7.6 -23.7 67.2 -15.6 0 -7.8
TTGTCCAGTAGGTGACGTTA 2459 SEQ ID NO:3928 -7.6 -24.3 71.8 -15.6 -1 -7
AAGCTCCATTAAACTGAGGC 2969 SEQ ID NO:3929 -7.6 -22.2 64.5 -14.1 -0.1 -5
ATTGCCAATGATCTTAATTA 3083 SEQ ID NO:3930 -7.6 -18.7 57.3 -11.1 0 -4.9
CACAGAATTGCCAATGATCT 3089 SEQ ID NO:3931 -7.6 -21.3 62 -13.7 0 -4.9
CAGGCATTAGTGAAATATGT 4267 SEQ ID NO:3932 -7.6 -19.5 59.6 -11.9 0 -4
TGCCAGCAAACAAATTCACA 4530 SEQ ID NO:3933 -7.6 -21.2 60.7 -13.6 0 -5.2
TTGCATTGTAATATTTTTTC 4938 SEQ ID NO:3934 -7.6 -17.5 56.4 -9.9 0 -5.1
ATGATGCTGATATCAAAGAC 5050 SEQ ID NO:3935 -7.6 -18.1 56.3 -9.6 -0.8 -7.7
AGATGTTCCAGCCTATAGTG 5226 SEQ ID NO:3936 -7.6 -24.3 71.7 -16.7 0 -5.1
AGGATTCGGCCAATCCTGGC 5347 SEQ ID NO:3937 -7.6 -28.4 76.7 -17.1 -3.3 -15.1
TCTCAAAGTTGAACATGTCA 5532 SEQ ID NO:3938 -7.6 -19.4 59.8 -11.3 -0.1 -7
CAGGGTGAATTGTGTCAGGG 5652 SEQ ID NO:3939 -7.6 -24.2 71.3 -16.6 0 -3.3
TCTTCAGTAGCAACACTGAA 5791 SEQ ID NO:3940 -7.6 -21.1 63.7 -10.6 -2.9 -9.6
CATCTCAAAGTCATCCTCAC 5828 SEQ ID NO:3941 -7.6 -22.6 67.2 -15 0 -1.9
TCCCAAACCTCATAGAACAT 5845 SEQ ID NO: 3942 -7.6 -22.4 63.2 -14.8 0 -2.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GAACTCTATAAACTGGGTCG 5882 SEQ ID NO: 3943 -7.6 -20.2 60.1 -12.6 0 -2.7
TGGGTTTTGCTATGAGAAGA 5940 SEQ ID NO: 3944 -7.6 -21.4 64.5 -13.8 0 -3.6
AGAGGAACTCCCATCTGTTT 6341 SEQ ID NO: 3945 -7.6 -24.6 71.2 -14.6 -2.4 -6.7
GTTTCTCCTCAGCAGTGTCA 6696 SEQ ID NO:3946 -7.6 -27.1 81.9 -19.5 0 -4.2
TTCACTTTGCACAACTATCC 6738 SEQ ID NO:3947 -7.6 -22.4 66 -14.8 0 -5
TGGGGACCATGGAAATGCAC 6851 SEQ ID NO:3948 -7.6 -24.2 67.2 -14.4 -2.2 -9.8
TATGAATAAACTATGAATTG 6869 SEQ ID NO:3949 -7.6 -12.7 44.8 -5.1 0 -3.1
ATTATGAATAAACTATGAAT 6871 SEQ ID NO:3950 -7.6 -12.7 44.8 -5.1 0 -3.5
GTTCAGATAGAAACAAACAT 7091 SEQ ID NO: 3951 -7.6 -16.3 52.1 -8 -0.5 -3.7
TATATATATATTTGCCCAAA 7418 SEQ ID NO: 3952 -7.6 -17.8 54.8 -10.2 0 -6.7
TTATATTTAAACAAGTTTTA 7829 SEQ ID NO:3953 -7.6 -13.4 46.8 -5.8 0 -5.5
CACAAAGCTGCTTTTAATTT 8658 SEQ ID NO: 3954 -7.6 -19.1 58.1 -10 -0.3 -10.9
TTTATATAATGCATTTAAGT 8872 SEQ ID NO: 3955 -7.6 -15.5 51.3 -7.2 0 -8.8
GAGTTTGGTTTTGACCTCAC 8973 SEQ ID NO: 3956 -7.6 -23.7 70.9 -13.8 -2.3 -6.2
TAAGAGTTTGGTTTTGACCT 8976 SEQ ID NO:3957 -7.6 -21.4 64.8 -11.5 -2.3 -6.3
TTCTCTGTGGATAAGAAAAC 47 SEQ ID NO:3958 -7.5 -17.4 55 -9.9 0 -3.5
TCTAGTAAAAAGGCGGAAGC 509 SEQ ID NO:3959 -7.5 -19.8 58.7 -10.7 -1.6 -7.2
CGTTTTTCGATAGCAGCAAG 535 SEQ ID NO:3960 -7.5 -22.2 64.4 -14.7 0 -5.4
CAGCTTCCAAGTCACTATTT 624 SEQ ID NO:3961 -7.5 -23.2 68.7 -15.7 0 -4.5
AAATAAATGGAAGGTTCTTT 645 SEQ ID NO:3962 -7.5 -16 51.6 -8.5 0 -4.2
AAGGTCATAAATACACAGTT 892 SEQ ID NO: 3963 -7.5 -17.9 56.1 -10.4 0 -2.8
TCCAGTCAGGAGGGTTGCTC 912 SEQ ID NO:3964 -7.5 -28 82.7 -19.5 -0.9 -6.2
GAAATCCAGCCAGTTCCATG 1037 SEQ ID NO:3965 -7.5 -25.2 70.3 -17.7 0 -3.9
GGGCCCCCACAATGGTCTTT 1170 SEQ ID NO:3966 -7.5 -31 81.6 -21.7 -0.7 -11.8
ACGGATACTCAAGAGAGACT 2141 SEQ ID NO:3967 -7.5 -20.9 62.2 -11.8 -1.5 -6.2
GACATACTGGCCTGACTAAC 2344 SEQ ID NO:3968 -7.5 -23.1 66.5 -15.6 0 -7.2
GCTGGAAGCCCTGGCACCAT 2371 SEQ ID NO:3969 -7.5 -31.1 81.6 -22 -1.5 -10.6
TCCACAGTGCTGTGCATCTT 2398 SEQ ID NO:3970 -7.5 -27 78.3 -17.3 -1.7 -12.4
TGTCCAGTAGGTGACGTTAG 2458 SEQ ID NO:3971 -7.5 -24.2 71.7 -15.6 -1 -7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GAGGAATCCTCCAGCATCTC 2551 SEQ ID NO:3972 -7.5 -26.3 75.4 -16.9 -1.9 -10
ACAAGATGTTTTACTTTTAA 2710 SEQ ID NO:3973 -7.5 -16.4 53.3 -8.9 0 -2.9
TCCATCAAAGATATTCCAGC 2939 SEQ ID NO:3974 -7.5 -22.1 64.6 -13.9 -0.4 -3.5
AACAATAAGGCACATGGTTT 3341 SEQ ID NO:3975 -7.5 -19.7 59 -12.2 0 -5.2
AATCAATTCCCTTTTGCATT 3501 SEQ ID NO:3976 -7.5 -22 64 -14.5 0 -5.1
TCATTTTCATCGATTACGTA 3718 SEQ ID NO:3977 -7.5 -20 60.5 -11.6 -0.7 -6.3
TATAATCATTTTCATCGATT 3723 SEQ ID NO:3978 -7.5 -17.1 54.5 -9.6 0 -6.3
CTGTGCTTCCTTCAGATGAG 3882 SEQ ID NO:3979 -7.5 -24.6 72.7 -17.1 0 -3.7
GTTCAGTTTCAGCTTGTTCA 3927 SEQ ID NO:3980 -7.5 -24.1 74.9 -16.6 0 -4.5
GTAGCAGGTTTTTCGAAGAT 4052 SEQ ID NO:3981 -7.5 -21.9 65.8 -13.7 -0.4 -6.8
CCACTACTGAGAAGGATCAT 4114 SEQ ID NO: 3982 -7.5 -22 64.5 -13.6 -0.8 -6.3
ATCTTCAAAGGCCAATGCAC 4133 SEQ ID NO:3983 -7.5 -22.8 65.4 -13.8 -1.4 -7.7
AATGATTTGATGGCACCGAG 4360 SEQ ID NO:3984 -7.5 -22 62.8 -14.5 0 -4
TAGAGGTCTTAAAGCTCTTA 4388 SEQ ID NO:3985 -7.5 -20.2 63 -11.5 -1.1 -5.2
TTGCTCCAACAAGAGCATTC 4446 SEQ ID NO:3986 -7.5 -23 66.9 -12.1 -3.4 -9.5
TTGCCAGCAAACAAATTCAC 4531 SEQ ID NO:3987 -7.5 -20.6 59.9 -13.1 0 -7.1
TGCTGGTTGAAGTTATCTAT 4873 SEQ ID NO:3988 -7.5 -21.1 64.8 -13.6 0 -3.6
ATATTTTTTCTGTTCCTCTG 4928 SEQ ID NO:3989 -7.5 -21.4 66.3 -13.9 0 -1.8
CATTGTAATATTTTTTCTGT 4935 SEQ ID NO:3990 -7.5 -17.7 56.9 -10.2 0 -4.2
TGCATTGTAATATTTTTTCT 4937 SEQ ID NO:3991 -7.5 -18.3 58 -10.8 0 -4.7
TCATTGCATTGTAATATTTT
4941 SEQ ID NO:3992 -7.5 -18 57 -10.5 0 -6.2 TTCATTGCATTGTAATATTT
4942 SEQ ID NO:3993 -7.5 -18 57 -10.5 0 -6.2 TTCTTCATTGCATTGTAATA
4945 SEQ ID NO:3994 -7.5 -19.2 60 -11.7 0 -5.6
TTGGATCCAAGTTTCTTCAT 4957 SEQ ID NO:3995 -7.5 -22.2 66.7 -13 0 -11.5
CATGATGCTGATATCAAAGA 5051 SEQ ID NO:3996 -7.5 -18.6 57 -10.2 -0.8 -7.7
TTGAGGCAGATGAGGATCAT 5068 SEQ ID NO:3997 -7.5 -22.5 67 -13.1 -1.9 -7.8
GCCCTGGTCATCCGTTTCCA 5105 SEQ ID NO:3998 -7.5 -31.9 85.1 -23.7 -0.4 -4.2
CACAAATTCTCCAGTGAACA 5174 SEQ ID NO:3999 -7.5 -20.7 61 -13.2 0 -4.2
TTTGCTTTAAAAGATAACAT 6207 SEQ ID NO:4000 -7.5 -15.2 49.9 -7.7 0 -4.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ATAGTTACTTGATATATTTT 6233 SEQ ID NO:4001 -7.5 -16.2 53.7 -8.7 0 -4.3
TCTTTTCCTTTGCTTTCTTT 6433 SEQ ID NO:4002 -7.5 -23.5 71.5 -16 0 -3.6
GGGTTTCTCCTCAGCAGTGT 6698 SEQ ID NO: 4003 -7.5 -28.4 84.6 -20 -0.8 -5.7
GTACTAAAGGTGTTTGGTGT 6768 SEQ ID NO:4004 -7.5 -21.7 66.5 -13.3 -0.8 -4.6
CTTTTTCTGGTTTTGAGCAA 6998 SEQ ID NO:4005 -7.5 -21.7 65.9 -14.2 0 -4.1
GTGAAGAATGGATTGAGTAA 7588 SEQ ID NO:4006 -7.5 -17.7 55.6 -10.2 0 -2.1
TGAATTCATTCTATCACCAA 7634 SEQ ID NO:4007 -7.5 -19.5 59.2 -11.3 -0.4 -8
CAAAATATGAAGAATAGGTT 7796 SEQ ID NO:4008 -7.5 -14.3 47.8 -6.8 0 -2.7
TTCATGGCTAAAAAGAACAA 8263 SEQ ID NO:4009 -7.5 -16.1 51 -8.6 0 -4.7
ATTAACATTAAACTTTTGGT 8341 SEQ ID NO:4010 -7.5 -16.2 52.3 -8.7 0 -3.5
TGCAATAAAAAATGAAATTT 8465 SEQ ID NO:4011 -7.5 -11.4 41.9 -2.8 -1 -6.7
AAATATGCATTACAACTGGA 9011 SEQ ID NO:4012 -7.5 -17.7 54.6 -10.2 0 -6.8
AGCATAACAAAGCCCAGCAT 178 SEQ ID NO:4013 -7.4 -24 66.5 -15.7 -0.7 -5
GAGATTCTTTGCTCCTTTCC 317 SEQ ID NO:4014 -7.4 -25.4 74.8 -18 0 -4.2
CCTTCTGTGAATTATCTCAT 360 SEQ ID NO:4015 -7.4 -21.6 65.1 -14.2 0.4 -3.2
CCGGAAAAGCTCCAGGTCCC 378 SEQ ID NO:4016 -7.4 -29.1 75.6 -20.1 -1.5 -5.6
TGGGCTTCTTGGCTTTCTCT 564 SEQ ID NO:4017 -7.4 -27.3 80.6 -18.9 -0.9 -3.7
CAAGTCACTATTTGGCTTTG 617 SEQ ID NO:4018 -7.4 -21.4 64.6 -12.4 -1.5 -5
CCATCTCTGGAGGAATGTCT 669 SEQ ID NO:4019 -7.4 -24.7 71.9 -16.5 -0.6 -6.1
AGTTTTCTTATTGATATAGT 719 SEQ ID NO:4020 -7.4 -17.9 58.6 -10.5 0 -2.7
TGAATCGGAAAATTGCCTTT 759 SEQ ID NO:4021 -7.4 -19.8 57.7 -12.4 0 -4.4
AAAATATACAAGGCAGAGGT 784 SEQ ID NO:4022 -7.4 -18.2 55.9 -10.8 0 -4
AAAATCTTGATAGCAATTTT 826 SEQ ID NO:4023 -7.4 -15.7 51 -7.5 -0.6 -1.2
AGGGCCCCCACAATGGTCTT 1171 SEQ ID NO:4024 -7.4 -30.9 81.6 -21.7 -0.7 -11.8
TCTCCAATGTAATCCTTCCA 1414 SEQ ID NO:4025 -7.4 -24.4 69.5 -17 0 -2.2
ACCAGCCTTCACACAGATGT 1520 SEQ ID NO: 4026 -7.4 -26.4 74.5 -18.4 -0.3 -3.8
TAGTTGGGGTTTCGACCAGC 1534 SEQ ID NO:4027 -7.4 -26.5 75.8 -16.4 -2.7 -7.1
CAACTTTGATGCTTCTGAAG 1925 SEQ ID NO:4028 -7.4 -19.9 60.3 -12 0 -7.8
AGCATCTCCATTGAAATCTG 2539 SEQ ID NO:4029 -7.4 -21.5 63.7 -14.1 0 -4.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AAAATGAAGACGATGATGGC 3139 SEQ ID NO:4030 -7.4 -17.6 53.5 -10.2 0 -3.5
AGAGCTGCATGCCGACCACA 3162 SEQ ID NO:4031 -7.4 -28.8 76.8 -20.4 -0.8 -9.1
TGCAGATTATTCATTTCATT 3466 SEQ ID NO:4032 -7.4 -19.5 60.8 -11.6 -0.2 -4.9
TTTCATCGATTACGTATTTT 3714 SEQ ID NO:4033 -7.4 -19.1 58.6 -10.8 -0.7 -6.3
ACATATAATCATTTTCATCG 3726 SEQ ID NO:4034 -7.4 -17.3 54.6 -9.9 0 -2.5
GGTTCAGTTTCAGCTTGTTC 3928 SEQ ID NO:4035 -7.4 -24.6 76.7 -17.2 0 -4.5
TATCTTCAAAGGCCAATGCA 4134 SEQ ID NO:4036 -7.4 -22.3 64.3 -13.4 -1.4 -7.7
GTATATATCTTCAAAGGCCA 4139 SEQ ID NO:4037 -7.4 -21.1 63.2 -13.2 0 -7.7
TCTAGCCAGCACCAGGCATT 4279 SEQ ID NO:4038 -7.4 -28.7 79.8 -18.6 -2.7 -7.4
CAACAGCACATTCATGATAG 4472 SEQ ID NO:4039 -7.4 -19.8 59.8 -12.4 0 -6.4
TGGTTGAAGTTATCTATGAT 4870 SEQ ID NO:4040 -7.4 -19 59.8 -11.6 0 -2.6
CTATAGTGAAGTAGTAGTGT 5214 SEQ ID NO: 4041 -7.4 -19.6 62.9 -12.2 0 -4.3
AGCCTATAGTGAAGTAGTAG 5217 SEQ ID NO:4042 -7.4 -21 65 -13.6 0 -5.1
TGTCATCAATTCCAGCTTCC 5517 SEQ ID NO:4043 -7.4 -25.1 72.9 -17.7 0 -4.5
TACATGTTCACCACAACCAG 5749 SEQ ID NO:4044 -7.4 -23 65.8 -14.9 -0.4 -6.5
TGACCGCGATGTACATGTTC 5760 SEQ ID NO:4045 -7.4 -24.3 68.3 -16.2 0 -8.9
GCAACACTGAAGTTCTCCAG 5782 SEQ ID NO:4046 -7.4 -23.4 68.1 -15.5 -0.2 -6.3
GGCAGATCCATGGCAATAAG 5971 SEQ ID NO:4047 -7.4 -23.4 66.7 -15.1 -0.7 -8
TGACCATGGGCAGATCCATG 5979 SEQ ID NO:4048 -7.4 -26.1 72.4 -15.8 -2.9 -8.8
TGGATCCGGTCACCACTGAC 5995 SEQ ID NO:4049 -7.4 -27.3 74.9 -16.5 -1.8 -14. S
TGAATGATAGCGGCAGACAC 6175 SEQ ID NO:4050 -7.4 -22.2 64 -14.8 0 -6.6
TAGTTACTTGATATATTTTT 6232 SEQ ID NO:4051 -7.4 -16.3 54.1 -8.9 0 -4.3
CATAGGAAGGAGGAGGGGTG 6363 SEQ ID NO: 4052 -7.4 -23.9 69.7 -16.5 0 -1.2
CTTGTATAGGCACTGACTAT 6593 SEQ ID NO:4053 -7.4 -21.8 65.8 -13.7 -0.4 -4.8
GGTTTCTCCTCAGCAGTGTC 6697 SEQ ID NO:4054 -7.4 -27.6 83.8 -20.2 0 -4.2
CAATGTTCACTTTGCACAAC 6743 SEQ ID NO: 4055 -7.4 -20.6 61.5 -13.2 0 -5
AAATAGTGACATAGCATTAT 6886 SEQ ID NO:4056 -7.4 -17 54.2 -9.6 0 -4.1
CTCATTTACAAAAATAGTGA 6897 SEQ ID NO:4057 -7.4 -15.5 50.6 -7.4 -0.5 -5
ATTTGATTTAATAGAAGTTG 7448 SEQ ID NO:4058 -7.4 -14.9 50.1 -7.5 0 -2.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
AACTATGTTTAATGAATGAT 7521 SEQ ID NO:4059 -7.4 -15 49.7 -7.6 0 -3.1
TTTTTAGCAAAATATGAAGA 7803 SEQ ID NO:4060 -7.4 -14.7 48.9 -6.8 -0.1 -5.3
TTTTCTTATGTACAAAATGC 7882 SEQ ID NO: 4061 -7.4 -16.9 54.1 -9.5 0 -6.8
TATCATGTTAGGTAATTGCA 8299 SEQ ID NO:4062 -7.4 -19.8 61.3 -12.4 0 -5.1
TAGCTCACCATTCTTTTTAG 8422 SEQ ID NO: 4063 -7.4 -21.9 66.6 -14.5 0 -4.8
TCTTTTGGCTCAATAATGAC 8443 SEQ ID NO:4064 -7.4 -19.7 60.3 -11.6 -0.5 -5.3
ACAAAAAACCCCAGAGCCCA 8495 SEQ ID NO:4065 -7.4 -25.4 66 -18 0 -3.2
TTTTAAACTGCCAACAGCAA 8524 SEQ ID NO: 4066 -7.4 -20.2 59 -11.2 -1.5 -8.9
CCTTTCCAGAATCCTCTCTG 20 SEQ ID NO: 4067 -7.3 -26 73.8 -17.8 -0.7 -4.2
GTAAAAAGGCGGAAGCTTTC 505 SEQ ID NO:4068 -7.3 -20.3 59.7 -10.6 -2.4 -7.2
CTTTCCAGCTTCCAAGTCAC 629 SEQ ID NO: 4069 -7.3 -25.9 74.7 -18.6 0 -4.5
CTTTATTCATTACTATAAAA 738 SEQ ID NO:4070 -7.3 -14.2 48.3 -6.9 0 -3.3
GTACCAAAATCTTGATAGCA 831 SEQ ID NO: 4071 -7.3 -19.9 59.6 -12 -0.3 -4.4
GATCACGAAGAAACGTAAAA 1017 SEQ ID NO:4072 -7.3 -15.6 49.2 -7.4 -0.8 -6.1
CCCAATGAGAGCAAACACGC 1247 SEQ ID NO:4073 -7.3 -24 65 -16.7 0 -4.1
CATGAACAGCTGCAGCCCAA 1262 SEQ ID NO: 4074 -7.3 -26.5 71.7 -16.7 0 -13.2
AAGCAGAATCGCTTGGGGGC 1311 SEQ ID NO:4075 -7.3 -26.3 72.8 -17.6 -1.3 -8.4
TAAAAGTGACTGTCATCTCC 1429 SEQ ID NO:4076 -7.3 -20.5 62.1 -12.5 -0.1 -8.8
CACACAGATGTATCCTTCTG
1511 SEQ ID NO: 4077 -7.3 -22.7 67.3 -14.1 -1.2 -5 TCACACAGATGTATCCTTCT
1512 SEQ ID NO: 4078 -7.3 -23.1 69.1 -15.1 -0.5 -3.7 TGCTTTTTAAGCTGTTCGAG
1816 SEQ ID NO:4079 -7.3 -21.9 65.5 -12 -2.6 -9.4
TTTGGAACTCAACTTTGATG 1934 SEQ ID NO: 4080 -7.3 -18.7 57.6 -10.8 -0.3 -5
GAGCAGAATTTTTTGTCACT 2113 SEQ ID NO: 4081 -7.3 -20.9 64 -13.6 0 -4.1
CGGATACTCAAGAGAGACTG 2140 SEQ ID NO:4082 -7.3 -20.7 61.5 -11.8 -1.5 -5.4
TATTGCGTCTTGGGGAAAAC 2169 SEQ ID NO:4083 -7.3 -21.3 62 -14 0 -5.2
AAAATGCTTGTTTTGCTATT 2185 SEQ ID NO:4084 -7.3 -18.7 57.7 -10.9 -0.2 -4.7
CACTGTGACGGTGAGGCTGG 3761 SEQ ID NO:4085 -7.3 -26.7 74.9 -18.2 -1.1 -6.5
CTCCAACAGCAATTGGCACT 3777 SEQ ID NO:4086 -7.3 -24.9 69.5 -16 -1.5 -8.1
TCTTCTTCGGGTTCAGTTTC 3937 SEQ ID NO:4087 -7.3 -24.6 75.2 -17.3 0 -3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TCAACAATACTGTAGCAGGT 4063 SEQ ID NO:4088 -7.3 -21.2 63.8 -13 -0.7 -5.3
ATATATAGGTAAAGACTTTG 4203 SEQ ID NO:4089 -7.3 -15.7 51.8 -7.9 -0.1 -4.9
ACCAAAGAAACATCAACGAT 4306 SEQ ID NO:4090 -7.3 -17.6 52.8 -10.3 0 -3.5
GTTCTGAGTAGCCAAGAGCA 4341 SEQ ID NO:4091 -7.3 -25 73.6 -16.2 -1.4 -4.7
AGAGGTCTTAAAGCTCTTAA 4387 SEQ ID NO:4092 -7.3 -19.8 61.4 -11.5 -0.9 -5.6
ACCACCCTCATGCCTTCAAA 4423 SEQ ID NO:4093 -7.3 -27.6 73.5 -20.3 0 -4.4
AAGTTTAACATCTCGTGAAT 4754 SEQ ID NO:4094 -7.3 -18.2 56.4 -10.9 0 -3.9
GGACATCATCAAAGCAAAGA 5405 SEQ ID NO:4095 -7.3 -19.2 57.7 -11.3 -0.3 -4.4
CAACACTGAAGTTCTCCAGG 5781 SEQ ID NO:4096 -7.3 -22.8 66.4 -15.5 0.3 -6.3
CAGAGAGTTTAGAGAACTCT 5895 SEQ ID NO:4097 -7.3 -19.9 62.3 -8.6 -4 -9.5
CGGTCACCACTGACCATGGG 5989 SEQ ID NO:4098 -7.3 -28.2 75.5 -16.5 -4.4 -9.6
TGCTTTAAAAGATAACATCT 6205 SEQ ID NO:4099 -7.3 -16.3 52.2 -8.2 -0.6 -6.5
TAATTGCCTCTTTGTTATAG 6249 SEQ ID NO:4100 -7.3 -20 61.6 -12.7 0 -2.9
TAAAAATAGAATGGATGCAA 6793 SEQ ID NO:4101 -7.3 -14.1 47 -6.8 0 -5.6
TCTTTTTCTGGTTTTGAGCA 6999 SEQ ID NO: 4102 -7.3 -22.8 69.9 -15.5 0 -4.1
TAAAGCCATCTAGAAAATGG 7047 SEQ ID NO: 103 -7.3 -17.5 53.8 -9.5 -0.5 -7.1
TGGATTGAGTAAAATAGAGC 7580 SEQ ID NO:4104 -7.3 -17.4 55 -10.1 0 -2.8
TATGAATAAAAGGTTATATT 8141 SEQ ID NO: 4105 -7.3 -13.2 46 -5.9 0.2 -3
ACACTACAGTAAATAGTTTT 8370 SEQ ID NO: 4106 -7.3 -17.3 55.5 -9.5 -0.1 -3.3
AAAAACCCCAGAGCCCAATA 8492 SEQ ID NO:4107 -7.3 -24.2 64.1 -16.9 0 -3.2
TTACAGCATAACAAAGCCCA 182 SEQ ID NO:4108 -7.2 -22.2 62.8 -15 ^ 0.6 -3.9
CTTGACAGGTATCTCATCCC 273 SEQ ID NO:4109 -7.2 -25.4 73.8 -18.2 0 -2.9
AAGTTTTCTTATTGATATAG 720 SEQ ID NO: 4110 -7.2 -16 53.3 -8.1 -0.5 -3.7
GGCAGAGGTGGCACTGAATC 773 SEQ ID NO:4111 -7.2 -25.8 74.4 -17.7 -0.8 -4.7
GACTCAAAGGTATAGATTCC 958 SEQ ID NO:4112 -7.2 -20.3 61.8 -13.1 0 -2.5
AAAGTGACTGTCATCTCCAA 1427 SEQ ID NO: 4113 -7.2 -21.5 63.9 -13.6 -0.1 -8.8
CAAAAAATATCATGTATGTT 1665 SEQ ID NO:4114 -7.2 -14.2 47.7 -7 0 -4.7
CTTCTTTTGACGCTGTCTTC 2056 SEQ ID NO:4115 -7.2 -23.9 71.4 -15.8 -0.8 -7.6
AGGAAGCTGCTTCTTTTGAC 2065 SEQ ID NO: 4116 -7.2 -23 68.8 -13.2 -1.8 -13.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex T of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GTCCAGTAGGTGACGTTAGA 2457 SEQ ID NO: 4117 -7.2 -24.8 73.3 -17 -0.3 -7
TGGCAAATCTATACCAGCAT 2655 SEQ ID NO:4118 -7.2 -22.4 64.6 -14.5 -0.5 -4.5
AACACATTGGCAAATCTATA 2662 SEQ ID NO: 4119 -7.2 -18.2 55.8 -11 0 -4.4
TTCACAAGATGTTTTACTTT 2713 SEQ ID NO: 4120 -7.2 -18.5 58.5 -11.3 0 -3
GAGGCTGACAATAATTCCAT
2954 SEQ ID NO:4121 -7.2 -21.5 62.8 -14.3 0 -3.7 TGAGGCTGACAATAATTCCA
2955 SEQ ID NO: 4122 -7.2 -21.5 62.8 -14.3 0 -3.7 AGCTCCATTAAACTGAGGCT
2968 SEQ ID NO: 4123 -7.2 -23.8 68.5 -16.1 -0.1 -4.6
ACAGAATTGCCAATGATCTT 3088 SEQ ID NO:4124 -7.2 -20.7 61.2 -13.5 0 -4.9
AGAAGTCGTTCATGTGCCAC 3240 SEQ ID NO: 4125 -7.2 -24.6 71.3 -16.1 -1.2 -4.8
GAACCACAAGGTTTCCAATG 3378 SEQ ID NO: 4126 -7.2 -22 62.9 -12.2 -2.6 -7.6
TGTCTATCTTATTGCCTTCA 3591 SEQ ID NO:4127 -7.2 -23.3 70.3 -16.1 0 -3
GATAATTAAGCTCTTTGCTT
3642 SEQ ID NO:4128 -7.2 -19.7 60.7 -10.3 -2.2 -8 AGATAATTAAGCTCTTTGCT
3643 SEQ ID NO: 4129 -7.2 -19.6 60.5 -10.9 -1.4 -8 ATCGATTACGTATTTTTCAA
3710 SEQ ID NO:4130 -7.2 -18.3 56.4 -10.2 -0.7 -6.1
GACATATAATCATTTTCATC 3727 SEQ ID NO:4131 -7.2 -17.1 55.1 -9.9 0 -2.5
AATTGGCACTGTGACGGTGA 3767 SEQ ID NO:4132 -7.2 -24 68.2 -15 -1.8 -7.6
GCTTTCTTCTAGTTCTGACT 3839 SEQ ID NO:4133 -7.2 -23.6 73.1 -15.9 -0.2 -4
TCAGATGAGCTGGTTGCATT
3871 SEQ ID NO:4134 -7.2 -24.1 71.5 -15.3 -1.5 -8 TTCAGATGAGCTGGTTGCAT
3872 SEQ ID NO:4135 -7.2 -24.1 71.5 -15.3 -1.5 -8 GTAAAACAAGCTTCCGGTTT
3961 SEQ ID NO:4136 -7.2 -21.6 62.3 -13.6 -0.5 -8.6
TGTATATATCTTCAAAGGCC 4140 SEQ ID NO: 4137 -7.2 -20.4 61.9 -13.2 0 -6.4
TCAAGAAATCTAGCCAGCAC 4287 SEQ ID NO:4138 -7.2 -21.8 63.8 -14.6 0 -4.6
TAATGATTTGATGGCACCGA 4361 SEQ ID NO:4139 -7.2 -21.7 62.1 -14.5 0 -4
CAGTCACTCAAATTGTTAAC 4603 SEQ ID NO:4140 -7.2 -18.4 57.5 -11.2 0 -5.8
CATTGCATTGTAATATTTTT 4940 SEQ ID NO:4141 -7.2 -17.7 56 -10.5 0 -5.6
AGGCAGATGAGGATCATGAT 5065 SEQ ID NO:4142 -7.2 -22.4 66.7 -13.1 -2.1 -8.5
TGAGGCAGATGAGGATCATG 5067 SEQ ID NO: 4143 -7.2 -22.4 66.6 -13.1 -2.1 -7.8
GAGCTTCAGCACAAATTCTC 5183 SEQ ID NO:4144 -7.2 -22.3 66.7 -14.2 -0.7 -6.6
GGATTCGGCCAATCCTGGCA 5346 SEQ ID NO:4145 -7.2 -29.1 77.4 -17.6 -4.3 -13.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CTCCTTTGATCAGACGTAGG 5364 SEQ ID NO:4146 -7.2 -23.8 69.3 -16.6 0 -6.5
TTCCTTTTTAACATAGGCAA 5501 SEQ ID NO:4147 -7.2 -20.4 61.2 -13.2 0 -4
CATGTTCACCACAACCAGGA 5747 SEQ ID NO:4148 -7.2 -24.9 69.5 -17 -0.4 -5.7
ACGCTTTGTAAAGGCAAATA 6029 SEQ ID NO:4149 -7.2 -19.4 57.6 -10.2 -2 -7.2
AGAGACTTTGGAGGGGTTTG 6113 SEQ ID NO:4150 -7.2 -23.3 69.8 -16.1 0 -2.6
TAGAGGAACTCCCATCTGTT 6342 SEQ ID NO: 4151 -7.2 -24.2 70.2 -14.6 -2.4 -6.7
TTGATCACAAAGATAATTCT 6485 SEQ ID NO:4152 -7.2 -16.3 52.5 -8.4 -0.5 -6.5
TGTCAACGTTGATACCCTGC 6651 SEQ ID NO:4153 -7.2 -25.1 70.1 -15.6 -0.1 -12.8
CTCCTCAGCAGTGTCAGCTG 6692 SEQ ID NO:4154 -7.2 -28 82.2 -19 -1.8 -8
GTAACTGAAACTGTAGCCAT 7025 SEQ ID NO:4155 -7.2 -21 62 -13.8 0 -3.3
ATCTAGAAAATGGAAGTAAC 7040 SEQ ID NO:4156 -7.2 -15 49.6 -7.8 0 -6.2
ACATAACTGTTCAGATAGAA 7099 SEQ ID NO:4157 -7.2 -17.6 55.7 -9.8 -0.3 -5.6
ATTTGACCTAAATTAAATAT 7213 SEQ ID NO:4158 -7.2 -14.3 47.8 -6.6 -0.1 -3.2
ACTATTTACATAACATAGGG 7377 SEQ ID NO:4159 -7.2 -17.6 55.5 -9.9 -0.1 -4.2
GTGCAAAAGTAAAGGTGTTT 7701 SEQ ID NO:4160 -7.2 -18.9 58.1 -11.7 0 -5.4
TAATTTTCTTATGTACAAAA 7885 SEQ ID NO:4161 -7.2 -14.1 48 -6.9 0 -6.8
AGTGTTTGACCAATGTATCT 8084 SEQ ID NO:4162 -7.2 -21.6 65.3 -14.4 0 -3.1
TTAGGTAATTGCACAACTTT 8292 SEQ ID NO:4163 -7.2 -19.3 59.2 -12.1 0 -5.1
GCTATTGTAGGTGGTTACTA 8740 SEQ ID NO:4164 -7.2 -22.8 69.9 -15.1 -0.1 -4
TTGAAAGCTATTGTAGGTGG 8746 SEQ ID NO:4165 -7.2 -20.3 62 -13.1 0 -4.6
TTATATAATTTATTATGGGA 9070 SEQ ID NO:4166 -7.2 -15.2 50.7 -7.2 -0.6 -5
TTTTTTTTTGACCACAGAGG 99 SEQ ID NO: 4167 -7.1 -21 63.4 -13.4 -0.2 -3.6
TTTTTCCGGAAAAGCTCCAG 383 SEQ ID NO:4168 -7.1 -23.1 65 -12.9 -1.5 -14.4
GCAAACACGCTCAGACAGAA 1237 SEQ ID NO:4169 -7.1 -22.2 63 -15.1 0 -3.6
CTCCTCATAGGCCATGGCCA 1739 SEQ ID NO:4170 -7.1 -30.4 82.2 -18.7 -2.5 -17.4
TTCTGCTCCTCATAGGCCAT 1744 SEQ ID NO:4171 -7.1 -27.9 79.2 -20.1 -0.5 -7.7
CTTCTGAAGAACTTTCCAAC 1914 SEQ ID NO: 4172 -7.1 -20 60.1 -12.9 0.3 -7.2
CATCCATGGAGAAAAGGAAG 2079 SEQ ID NO:4173 -7.1 -19.2 57.1 -10.8 -0.4 -10.4
GGGAGCAGAATTTTTTGTCA 2115 SEQ ID NO:4174 -7.1 -22.2 66.7 -15.1 0 -4.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TTTTACTTTTAACCATGCAT 2702 SEQ ID NO:4175 -7.1 -19.8 59.9 -12.7 0 -6.4
CCCCACAGAATTGCCAATGA 3092 SEQ ID NO: 4176 -7.1 -26 69.1 -18.9 0 -4.3
CACATAATCAATTCCCTTTT 3506 SEQ ID NO:4177 -7.1 -20.7 61 -13.6 0 -2.5
TTCATCGATTACGTATTTTT 3713 SEQ ID NO:4178 -7.1 -19.1 58.6 -11.5 -0.1 -6.3
TTGTTTATGAATGACATATA 3739 SEQ ID NO: 4179 -7.1 -16 52.3 -8 -0.7 -6
TCGGGGTAGAACAACATCAA 3902 SEQ ID NO:4180 -7.1 -21.1 61.3 -14 0 -3
AAAGTCTTCTTCGGGTTCAG 3941 SEQ ID NO:4181 -7.1 -22.6 67.9 -14.8 -0.5 -3.8
AGGCTAACCAAAGAAACATC 4312 SEQ ID NO:4182 -7.1 -18.9 56.5 -10.4 -1.3 -3.7
AGGCTCTTAGAGGTCTTAAA 4395 SEQ ID NO:4183 -7.1 -21.7 66.3 -14 -0.3 -5.3
GAGCATTCACAACCACCCTC 4434 SEQ ID NO: 4184 -7.1 -26.9 73.8 -19.8 0 -4.1
GAATTGCTCCAACAAGAGCA 4449 SEQ ID NO: 4185 -7.1 -22.4 64.3 -12.1 -3.2 -9.2
ATGATAGAGGGAATTGCTCC 4459 SEQ ID NO: 4186 -7.1 -22.4 66 -14.4 -0.7 -6.1
AGAACTTGCCAGCAAACAAA 4536 SEQ ID NO:4187 -7.1 -20.2 58.5 -13.1 0 -7.2
TTTCCACCGAGCTTGCTTGC 4634 SEQ ID NO:4188 -7.1 -28.3 77.7 -20.6 -0.3 -6.4
CCATCCAGCCTTTAAATGTG 4713 SEQ ID NO:4189 -7.1 -24.2 67.7 -17.1 0 -4.3
AACATCTCGTGAATCAACAG 4748 SEQ ID NO:4190 -7.1 -19.1 57.7 -12 0 -4.6
TTGT7ΛATATTTTTTCTGTTC 4933 SEQ ID NO:4191 -7.1 -17.5 57.3 -10.4 0 -4.2
GCCTATAGTGAAGTAGTAGT 5216 SEQ ID NO:4192 -7.1 -22.2 68.3 -15.1 0 -5.1
GTAGGATTCGGCCAATCCTG 5349 SEQ ID NO: 4193 -7.1 -26.3 72.8 -15.3 -3.5 -15.6
CTGCCAGGGTGAATTGTGTC 5656 SEQ ID NO: 4194 -7.1 -25.8 74.6 -18.7 0 -3.8
ACACTGAAGTTCTCCAGGAT 5779 SEQ ID NO: 4195 -7.1 -23.4 68.8 -15.5 -0.6 -5.6
TTTCCCAAACCTCATAGAAC 5847 SEQ ID NO: 4196 -7.1 -21.9 62.7 -14.8 0 -2.8
GACTTTGTTGGGTTTTGCTA 5948 SEQ ID NO:4197 -7.1 -23.5 70.8 -16.4 0 -3.6
CATCCATCTCTCCACTCTCA 6057 SEQ ID NO:4198 -7.1 -27 77.8 -19.9 0 -0.5
TTGCTTTCTTTTTCTGGTTT 6424 SEQ ID NO: 4199 -7.1 -22.6 69.9 -15.5 0 -3.6
CACAGAGTTGCAGTGACAGA 6629 SEQ ID NO: 4200 -7.1 -23.3 69.4 -16.2 0 -5.5
TTACAATGTTCACTTTGCAC 6746 SEQ ID NO: 4201 -7.1 -20.4 62.2 -13.3 0 -5.4
7AAAAATATGGCAGATATGGA 6816 SEQ ID NO: 4202 -7.1 -16.7 52.4 -8.2 -1.3 -5.2
TGAATTGGGGACCATGGAAA 6856 SEQ ID NO: 4203 -7.1 -21.5 61.4 -12.3 -2.1 -8.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structu: oligo oligo TGTAGCCATTACAATTCTTT
7014 SEQ ID NO: 4204 -7.1 -21 63.4 -13 -0.8 -3.7 ATAGAGCTCTGAAACTTAGA
7195 SEQ ID NO: 4205 -7.1 -19 59.1 -10.9 0 -10 AGCCTTTAAACTATGTTTAA
7529 SEQ ID NO: 4206 -7.1 -18.4 56.9 -9.7 -1.6 -7.4 AGAGCAGGTTGAATTCATTC
7643 SEQ ID NO: 4207 -7.1 -21.2 65.1 -13.5 0 -8.4 CAAATTATTCTGCTTGACAT
7670 SEQ ID NO: 4208 -7.1 -18.8 57.7 -11.7 0 -3.6 TTTTAGCAAAATATGAAGAA
7802 SEQ ID NO: 4209 -7.1 -13.9 47.1 -6.8 0 -4.8 TTTATATTTAAACAAGTTTT
7830 SEQ ID NO: 4210 -7.1 -13.8 47.7 -6.7 0 -5.5 ACCATAGTTGGTAGAAAATG
8115 SEQ ID NO: 4211 -7.1 -18.5 56.8 -9.5 -1.9 -5.4 TTTAGTGCAGCAGGAATTAA
8219 SEQ ID NO: 4212 -7.1 -20.3 61.7 -13.2 0 -6.1 CAATACACTACAGTAAATAG
8374 SEQ ID NO: 4213 -7.1 -15.5 50.6 -8.4 0 -3.6 TATCAAACCTGAAAGTTGGA
8713 SEQ ID NO: 4214 -7.1 -18.8 56.8 -11 -0.4 -4.3 ATCCAAGGGTTCTTGAAAAA
8949 SEQ ID NO: 4215 -7.1 -19.3 57.8 -10.1 -2.1 -5.7 TGGTTTTGACCTCACATAAA
8968 SEQ ID NO: 4216 -7.1 -20.7 61.5 -11.3 -2.3 -5 TGCATACGAATTACCTTAGA
416 SEQ ID NO: 4217 -7 -20.4 60.1 -13.4 0 -4.7 TCTCCATAAATAAATGGAAG
652 SEQ ID NO: 4218 -7 -16.1 51.2 -6.8 -2.3 -7.8 AGTAGGGATCCAGGTCCTCC
702 SEQ ID NO: 4219 -7 -29.1 83.4 -20.8 -1.2 -8.2 TTGCCCAGGTCCACAAACTC
1084 SEQ ID NO: 4220 -7 -27.1 74.2 -20.1 0 -3.6 TGTTCTCAACGCTGAGACAT
1103 SEQ ID NO: 4221 -7 -22.8 66.5 -13 -2.8 -8.2 ATGTTCTCAACGCTGAGACA
1104 SEQ ID NO: 222 -7 -22.8 66.5 -13 -2.8 -8.4 TTACCGACTGGATCAGGGCC
1185 SEQ ID NO: 4223 -7 -27.6 75.2 -19.7 -0.8 -7.5 CTCCAATGTAATCCTTCCAG
1413 SEQ ID NO: 4224 -7 -24 68.3 -17 0 -2.2 AGCCTTCACACAGATGTATC
1517 SEQ ID NO: 225 -7 -23.6 70.1 -15.9 -0.5 -4.2 TGGTAAAGATTTTCCCAATA
1621 SEQ ID NO: 4226 -7 -19.7 58.9 -12.7 0 -4.6 GACAAAAAATATCATGTATG
1667 SEQ ID NO: 4227 -7 -13.7 46.6 -6.7 0 -4.7 GGCCACCACAGCCAGGATCA
1724 SEQ ID NO: 4228 -7 -30.9 82.2 -22.2 -1.7 -8.7 CCTCATAGGCCATGGCCACC
1737 SEQ ID NO: 4229 -7 -31.3 82.4 -19.7 -2.5 -17.4 TTCCTTCAAGGTGCTCTCTC
1995 SEQ ID NO: 4230 -7 -26 77.6 -18.2 -0.6 -5.3 TCTCCTTTGTTGTTTCCTTC
2008 SEQ ID NO: 4231 -7 -25.3 76.4 -18.3 0 0 CATTGGCAAATCTATACCAG
2658 SEQ ID NO: 4232 -7 -20.7 61 -13 -0.4 -3.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AAGAGGGTATTTAAGACAAT 2779 SEQ ID NO:4233 -7 -17.2 54.5 -10.2 0 -2.9
CTGCTGTGAAAATCCCAGTA 2868 SEQ ID NO: 4234 -7 -23.3 66.3 -15.8 -0.1 -3.7
AGTAATAAGGATCCATGGCA 2907 SEQ ID NO:4235 -7 -21.8 64 -14.1 0 -9
AGGCTGACAATAATTCCATC 2953 SEQ ID NO: 4236 -7 -21.3 63 -14.3 0 -3.7
CAGCAAAAATGAAGACGATG 3144 SEQ ID NO:4237 -7 -16.5 51 -9.5 0 -4.1
GTGGGAGCGTACAGTCATCA 3219 SEQ ID NO:4238 -7 -26 75.7 -19 0 -4.8
ACAGCACGCGGAACACAATC 3273 SEQ ID NO:4239 -7 -23.6 65 -16.1 0 -7.9
TTTCTAAAAAAGGCTTTTTG 3550 SEQ ID NO:4240 -7 -16 51.7 -7.6 -1.3 -7.7
TAATCATTTTCATCGATTAC 3721 SEQ ID NO:4241 -7 -17.3 55 -9.6 -0.5 -6.3
CACAATGAAAGTCTCAAACC 4091 SEQ ID NO:4242 -7 -18.5 55.8 -11.5 0.2 -3.1
TAGAACTTGCCAGCAAACAA 4537 SEQ ID NO:4243 -7 -20.6 59.8 -13.6 0 -7.4
TCTGTCATAAAGATGTCTTG 4912 SEQ ID NO:4244 -7 -19.1 60 -12.1 0.2 -6.8
GTAATATTTTTTCTGTTCCT 4931 SEQ ID NO:4245 -7 -20.3 63.2 -13.3 0 -4.2
CTTCCTTTTTAACATAGGCA 5502 SEQ ID NO:4246 -7 -22 65.2 -15 0 -4
AGGTCTCAAAGTTGAACATG 5535 SEQ ID NO:4247 -7 -19.5 59.9 -11.6 -0.8 -6.5
AGGGTGAATTGTGTCAGGGT 5651 SEQ ID NO:4248 -7 -24.7 73.7 -17.7 0 -3.3
TTAACCTTTGCTTTAAAAGA 6213 SEQ ID NO: 4249 -7 -17.5 54.4 -10 -0.1 -4.8
GGAGTTCCCATTTAGTTTGT 6311 SEQ ID NO:4250 -7 -24.7 73.5 -17.2 -0.1 -3.4
ACTATCATAGGAAGGAGGAG 6368 SEQ ID NO: 4251 -7 -20.3 62.1 -13.3 0 -3.4
AAGATAATTCTTTGTTTCTT 6476 SEQ ID NO:4252 -7 -17.3 56.1 -9.4 -0.8 -3.9
GAAGTCCAGTTGACACATAT
6531 SEQ ID NO: 4253 -7 -21.6 64.6 -12.8 -1.8 -4.5 TGAAGTCCAGTTGACACATA
6532 SEQ ID NO: 4254 -7 -21.6 64.5 -12.8 -1.8 -5.6 TGTTAAAACAGTCAGTTTGG
6566 SEQ ID NO:4255 -7 -18.7 58.4 -10.5 -1.1 -6.7
GAGAGGTCACTTCACTGTCT 6611 SEQ ID NO:4256 -7 -24.6 74.9 -17.6 0 -3.4
AATTCTTTTTCTGGTTTTGA 7002 SEQ ID NO:4257 -7 -19.7 61.9 -12.7 0 -2.3
ACTGTAGCCATTACAATTCT 7016 SEQ ID NO:4258 -7 -21.9 65.2 -13.9 -0.9 -3.9
ATAACATAGGGTATTTAATT 7368 SEQ ID NO:4259 -7 -16.2 52.6 -9.2 0 -2.9
ATATATATATTTGCCCAAAC 7417 SEQ ID NO:4260 -7 -18.3 55.8 -11.3 0 -6.3
TTAACATGCATTAGTGATAG 7547 SEQ ID NO:4261 -7 -17.8 56.3 -10.8 0 -6.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GAAGAATGGATTGAGTAAAA 7586 SEQ ID NO: 4262 -7 -15.1 49.4 -8.1 0 -2.1
AGTATCCAGTGTGTTTCCTT 7764 SEQ ID NO:4263 -7 -25.2 75.9 -18.2 0 -3.7
TTTAGCAAAATATGAAGAAT 7801 SEQ ID NO:4264 -7 -13.8 46.8 -6.8 0 -4.2
AACCTGAAAGTTGGAACATG 8708 SEQ ID NO:4265 -7 -18.9 56.6 -11.1 -0.6 -4.8
TTACTACTATTATTATCAAA 8726 SEQ ID NO:4266 -7 -14.7 49.6 -7.7 0 -1.2
ATAAGAGTTTGGTTTTGACC 8977 SEQ ID NO: 4267 -7 -20.5 62.8 -11.9 -1.5 -6.3
CCTCTGGCAGCTGTTCAGCT 130 SEQ ID NO:4268 -6.9 -29.7 85 -21 -1.7 -10.8
TTCAGTTTTCTTGCTCCATA 229 SEQ ID NO:4269 -6.9 -23.6 71.3 -16.7 0 -4.4
TCCAAGTCACTATTTGGCTT 619 SEQ ID NO: 4270 -6.9 -23.7 69.8 -15.3 -1.4 -5.1
CATATGCCATCACAATGACA 1059 SEQ ID NO: 4271 -6.9 -21.7 62.7 -14.1 -0.4 -7.5
TCAG7AAAGCTTCTTTACCGA 1198 SEQ ID NO:4272 -6.9 -21.9 63.9 -14.1 -0.7 -6.5
CAATGAGAGCAAACACGCTC 1245 SEQ ID NO: 4273 -6.9 -21.3 61.3 -12.2 -2.2 -7.2
GATTGCCCATGAACAGCTGC 1269 SEQ ID NO: 4274 -6.9 -26.5 73 -18.9 -0.2 -8.9
TCAGATTGCCCATGAACAGC 1272 SEQ ID NO:4275 -6.9 -24.9 70.1 -18 0 -4.5
AGAATCGCTTGGGGGCCACT 1307 SEQ ID NO:4276 -6.9 -28.3 76.6 -20.7 -0.5 -7
TGGCCACCACAGCCAGGATC 1725 SEQ ID NO: 4277 -6.9 -30.2 81.1 -20.9 -2.4 -8.3
CCTGATTCTGCTCCTCATAG 1749 SEQ ID NO:4278 -6.9 -25.7 74.2 -18.8 0 -3.6
TCTGCTTCTTCCAAGGTGGC 1768 SEQ ID NO:4279 -6.9 -27.3 79 -19.5 -0.7 -4.9
CCACTGAAATCTCTTGAAGC 1873 SEQ ID NO: 4280 -6.9 -21.4 62.8 -14.5 0 -2.8
GACTGATGAGGGGAGCAGAA 2125 SEQ ID NO: 4281 -6.9 -23.5 68.2 -15.9 -0.5 -4.1
CAGATCAAGAACACATTGGC 2671 SEQ ID NO: 4282 -6.9 -20.5 61 -13.6 0 -5.4
TTGCCAACTTGAAAACTCTA 3039 SEQ ID NO:4283 -6.9 -19.7 58.5 -12.8 0 -3
CAATGATCTTAATTAGCATA 3078 SEQ ID NO:4284 -6.9 -17 54.1 -10.1 0 -4.9
ATTCCCTTTTGCATTCTTCC 3496 SEQ ID NO: 4285 -6.9 -26.1 74.9 -19.2 0 -5.1
AGGCTTTTTGGAAACACTCC 3540 SEQ ID NO:4286 -6.9 -23.1 66.9 -15.4 -0.6 -5.4
TCAAACCAGTTGTGCTCAAC 4078 SEQ ID NO: 4287 -6.9 -22.4 65.5 -13.3 -2.2 -5.3
ATATATCTTCAAAGGCCAAT 4137 SEQ ID NO:4288 -6.9 -19.5 58.7 -12.1 0 -7.7
CAAGAGCATTGGCTACCAGG 4329 SEQ ID NO: 4289 -6.9 -24.9 70.4 -16.2 -1.8 -7
TGATAGAGGGAATTGCTCCA 4458 SEQ ID NO:4290 -6.9 -23.1 67.2 -14.4 -1.8 -5.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
IntreInter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CACATTCATGATAGAGGGAA 4466 SEQ ID NO: 4291 -6.9 -20 60.5 -13.1 0 -6.1
GCAGATGAGGATCATGATGC 5063 SEQ ID NO:4292 -6.9 -23 67.9 -13 -3.1 -8.6
TCATGGTGACCATGTTGAGG 5082 SEQ ID NO: 293 -6.9 -24.1 70.3 -14 -3.2 -11.5
TTGCCCTGGTCATCCGTTTC 5107 SEQ ID NO: 4294 -6.9 -29.3 80.9 -21.2 -1.1 -4.4
ACTAGGTTGATCCGGGACAA 5143 SEQ ID NO: 4295 -6.9 -24.3 68.6 -16.2 -1.1 -8.5
GGCCGATGTTAAACAACGCA 5430 SEQ ID NO:4296 -6.9 -23.7 64.3 -16.8 2.1 -7.4
TAGCAACACTGAAGTTCTCC 5784 SEQ ID NO: 4297 -6.9 -22.4 66.3 -15.5 0 -6.3
GTTGGGTTTTGCTATGAGAA 5942 SEQ ID NO:4298 -6.9 -22.1 66.6 -15.2 0 -3.6
ATAAGCTGGACTTTGTTGGG 5956 SEQ ID NO:4299 -6.9 -22.5 66.8 -15 -0.3 -5.1
TCAAGACAGTGGATCCGGTC 6004 SEQ ID NO:4300 -6.9 -24.9 71.6 -17.1 0 -9.6
GAACTCCCATCTGTTTTTTC 6337 SEQ ID NO:4301 -6.9 -23.5 69.4 -16.6 0 -3.5
GAGGGGTGGTAGAGGAACTC 6351 SEQ ID NO:4302 -6.9 -24.7 73.3 -15.8 -2 -5.5
CTCAAACTTTTCCTTGTCTG 6398 SEQ ID NO:4303 -6.9 -21.9 65.5 -15 0 -2.8
GATAATTCTTTGTTTCTTTT 6474 SEQ ID NO:4304 -6.9 -18.2 58.6 -11.3 0 -2.9
TGGATGCAAGGACTGTACTA 6782 SEQ ID NO: 4305 -6.9 -22.2 65.6 -15.3 0 -5.6
GAATGGATGCAAGGACTGTA 6785 SEQ ID NO:4306 -6.9 -21.3 62.9 -14.4 0 -5.6
GACCATGGAAATGCACTAGA 6847 SEQ ID NO:4307 -6.9 -21.8 62.9 -13.5 -1.3 -8.8
GGGGACCATGGAAATGCACT 6850 SEQ ID NO: 4308 -6.9 -25.1 69.1 -16.6 -1.5 -8.5
CCTCATTTACAAAAATAGTG 6898 SEQ ID NO:4309 -6.9 -16.9 53.1 -9.3 -0.5 -4.1
GTTTCTTCAACGTAAACCTC 6914 SEQ ID NO: 4310 -6.9 -21.2 62.8 -13.7 -0.3 -5.6
GGCAAAACACCTTTGTCTGA 6963 SEQ ID NO: 4311 -6.9 -22.9 65.5 -14.4 -1.6 -6.5
TTGCACAACTTTGCCACTTT 8284 SEQ ID NO:4312 -6.9 -23.9 68.2 -16 -0.9 -5
TAACATTAAACTTTTGGTTT 8339 SEQ ID NO:4313 -6.9 -16.3 52.6 -8.2 -1.1 -4.7
GCAATTCCCTGCATGCAGTT 8397 SEQ ID NO:4314 -6.9 -27.5 76.3 -17.5 -1.1 -14.3
TTATTAATTATATATATTTT 8540 SEQ ID NO: 4315 -6.9 -12.1 44.3 -5.2 0 -5.2
GTTTGTTGTAAAATTCATGT 8599 SEQ ID NO:4316 -6.9 -17.9 56.9 -11 0.1 -6.6
TCAATTATATTGAAAGAAGA 8804 SEQ ID NO.-4317 -6.9 -13.7 47 -5.2 -1.5 -5.6
AAGAGTTTGGTTTTGACCTC 8975 SEQ ID NO:4318 -6.9 -22.1 67 -12.9 -2.3 -6.3
ATTATGGGAGAATTATGAAA 9059 SEQ ID NO:4319 -6.9 -15.7 50.9 -8.8 0 -3.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
AGATGGTTAGGGTATAACGT 155 SEQ ID NO:4320 -6.8 -21.3 63.9 -13.2 -1.2 -5
GATGTGGCTTGGCTTCAGTT 242 SEQ ID NO: 4321 -6.8 -26.2 77.5 -18.7 -0.4 -6
GGCTTCTTGGCTTTCTCTTC 562 SEQ ID NO: 4322 -6.8 -26.6 80.4 -18.8 -0.9 -3.7
AGGCAGAGGTGGCACTGAAT 774 SEQ ID NO:4323 -6.8 -25.4 73 -17.7 -0.8 -4.7
CAAGGTCATAAATACACAGT 893 SEQ ID NO: 4324 -6.8 -18.5 57.1 -11.7 0 -2.8
GCCAAGATTTTTATAAGTGA 976 SEQ ID NO:4325 -6.8 -19.3 59 -12.5 0 -4.1
ATCTTCTAAGCAAAACCCTC 998 SEQ ID NO: 4326 -6.8 -21.6 62.9 -14.8 0 -4.1
GCCCATGAACAGCTGCAGCC 1265 SEQ ID NO:4327 -6.8 -30.3 80.4 -21 0 -13.2
CACAGAGTAAAGGGTCTTTT 1464 SEQ ID NO: 4328 -6.8 -20.9 63.7 -13.4 -0.4 -4.1
ATTCTGCTCCTCATAGGCCA 1745 SEQ ID NO:4329 -6.8 -27.9 79.2 -20.4 -0.5 -7.7
ATGCTGCCGCAACTGCCTGA 1848 SEQ ID NO:4330 -6.8 -29.5 77.4 -21.1 -1.6 -8
GGAGAAAAGGAAGCTGCTTC 2072 SEQ ID NO:4331 -6.8 -21.3 62.9 -12.4 -1 -12.4
GGGGAGCAGAATTTTTTGTC 2116 SEQ ID NO:4332 -6.8 -22.7 68.2 -15.9 0 -3.3
GAGAACCATTTCTGCTGTGA 2879 SEQ ID NO:4333 -6.8 -23.4 68.3 -15.2 -1.3 -5.8
AAAACTCTAAGCAGTCTGAA 3028 SEQ ID NO:4334 -6.8 -18.2 56.3 -11.4 0 -4.1
TGACATATAATCATTTTCAT 3728 SEQ ID NO:4335 -6.8 -16.7 53.8 -9.9 0 -3.4
GTCTCAAACCAGTTGTGCTC 4081 SEQ ID NO:4336 -6.8 -24.7 72.9 -17.2 -0.4 -4.9
AGAAGCATTTCCAGAATGAA 4222 SEQ ID NO: 4337 -6.8 -19.5 58.6 -11.7 -0.9 -6
CCATTTGAGAAGCATTTCCA 4229 SEQ ID NO:4338 -6.8 -23.2 66.6 -15.6 -0.6 -4.1
AAATATGTTTGAAATCCATA 4255 SEQ ID NO:4339 -6.8 -15.7 50.6 -8.9 0 -3.3
AAATCTAGCCAGCACCAGGC 4282 SEQ ID NO:4340 -6.8 -26.5 73.4 -18.1 -1.6 -6.1
CCAGGCTAACCAAAGAAACA 4314 SEQ ID NO:4341 -6.8 -21.2 59.8 -13 -1.3 -4.2
ACCGGGATAAGGCTCTTAGA 4404 SEQ ID NO:4342 -6.8 -24.6 69.6 -17.3 -0.2 -7.4
GTTGTCATGTTAACACAGTG 4558 SEQ ID NO:4343 -6.8 -20.9 64.4 -13.3 -0.5 -8.7
TACATGTACAGATTTTCTTC 4786 SEQ ID NO:4344 -6.8 -19.1 60.7 -11.6 0 -8.7
ATGATAAAGATGACAAAGTA 4810 SEQ ID NO:4345 -6.8 -14.5 48.4 -7.7 0 -2.8
CCCAAAGATGATAAAGATGA 4817 SEQ ID NO:4346 -6.8 -18 54.2 -11.2 0 -2.1
AATATTTTTTCTGTTCCTCT 4929 SEQ ID NO:4347 -6.8 -20.7 64.1 -13.9 0 -3.8
AAGTTTCTTCATTGCATTGT 4949 SEQ ID NO:4348 -6.8 -21.1 65.1 -14.3 0 -6.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CAAAGACCATTCCTTGGAAT 5013 SEQ ID NO:4349 -6.8 -21.4 61.4 -13 -1.5 -8.1
CCTGGTCATCCGTTTCCACC 5103 SEQ ID NO: 4350 -6.8 -30.3 81.4 -22.3 -1.1 -4.5
GGACACAGAATACTTTTCTA 5300 SEQ ID NO:4351 -6.8 -19.6 60.3 -11.8 -0.9 -4.4
GAGGCCGATGTTAAACAACG 5432 SEQ ID NO:4352 -6.8 -21.8 61 -15 3.3 -8.1
CCAACAGATGGGTCCCCACG 5692 SEQ ID NO: 4353 -6.8 -29.2 75.5 -21.4 -0.9 -8.8
AAATCCCAACAGATGGGTCC 5697 SEQ ID NO: 354 -6.8 -24.5 67.9 -14.5 -3.2 -7.9
CAATAAGCTGGACTTTGTTG 5958 SEQ ID NO:4355 -6.8 -20.1 60.7 -12.7 -0.3 -4.6
ATATATTTTTTAACCTTTGC 6222 SEQ ID NO:4356 -6.8 -18 56.7 -11.2 0 -3.3
TACTTTACCTTCATAGGCTG 6512 SEQ ID NO:4357 -6.8 -22.6 67.4 -14.6 -1.1 -3.7
ACAAAAATAGTGACATAGCA 6890 SEQ ID NO:4358 -6.8 -16.7 52.6 -9.9 0 -4.1
TAGAGGAGACTTTACAGGCA 7118 SEQ ID NO:4359 -6.8 -22.3 67.1 -14.6 -0.7 -5.2
TCATTCTATCACCAATATGT 7629 SEQ ID NO:4360 -6.8 -20.4 62 -13.6 0 -2.8
TAGCTTCAAATTATTCTGCT 7676 SEQ ID NO: 4361 -6.8 -20.1 61.7 -13.3 0 -4.6
AGTCCATGTTATATTTGTAA 8243 SEQ ID NO: 4362 -6.8 -19.4 60.6 -12.6 0 -4.3
ATTGCACAACTTTGCCACTT 8285 SEQ ID NO:4363 -6.8 -23.8 67.9 -16 -0.9 -5
TTATTCTTTTGGCTCAATAA 8447 SEQ ID NO:4364 -6.8 -18.8 58.6 -12 0 -4.9
ATATATTTTAAACTGCCAAC 8529 SEQ ID NO: 4365 -6.8 -17.1 53.5 -10.3 0 -4.4
GAAAGCTATTGTAGGTGGTT 8744 SEQ ID NO: 4366 -6.8 -21.5 65.3 -14.7 0 -5.1
TTTAGATGCTTATAGCCAAG 8780 SEQ ID NO:4367 -6.8 -20.5 62 -12.4 -1.2 -4.6
AGCATCAATTATATTGAAAG 8808 SEQ ID NO:4368 -6.8 -15.7 51.2 -6.9 -2 -8.1
ATAGGAGTTTATATAATGCA 8879 SEQ ID NO:4369 -6.8 -17.8 56.6 -11 0 -5.5
TTCCAGAATCCTCTCTGCTT 17 SEQ ID NO: 4370 -6.7 -25.8 74.6 -18.1 -0.9 -4.5
GTTTTCTTGCTCCATAATCT 225 SEQ ID NO:4371 -6.7 -23 69 -16.3 0 -3.6
GGGCCACTGCAAACATTTAT 1295 SEQ ID NO:4372 -6.7 -23.9 67.1 -15.7 -1.4 -7.6
TTCCAGTTAAATGTGCTCAT 1399 SEQ ID NO:4373 -6.7 -21.8 65.1 -14.4 -0.4 -5.6
ATCTCCAATGTAATCCTTCC 1415 SEQ ID NO: 4374 -6.7 -23.7 68.4 -17 0 -1.7
CCACAGAGTAAAGGGTCTTT 1465 SEQ ID NO: 4375 -6.7 -22.8 67.2 -15.6 -0.2 -3.9
AATGACCAGGACAAAAAATA 1676 SEQ ID NO:4376 -6.7 -15.7 49.6 -9 0 -3.1
CACCAAATAAAATGAGCCCA 1700 SEQ ID NO:4377 -6.7 -20.9 58.5 -14.2 0 -3.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TTTCCTTCAAGGTGCTCTCT 1996 SEQ ID NO:4378 -6.7 -25.7 76.2 -18.2 -0.6 -5.3
GTCTTGGGGAAAACAGGGAG 2163 SEQ ID NO:4379 -6.7 -22.6 65.8 -15.9 0 -2.7
TCAGATCCAACATCCTTTGC 2221 SEQ ID NO:4380 -6.7 -24.3 69.8 -17.1 -0.1 -4.5
CAGTGGTGGTGCCCTCTGGG 2484 SEQ ID NO:4381 -6.7 -31.1 86.6 -23.4 -0.9 -5.7
GGCTATGCTCACGGCTCTTT 2579 SEQ ID NO:4382 -6.7 -27.8 78.6 -19.9 -1.1 -5.3
CTATACCAGCATGGCGGACA 2647 SEQ ID NO:4383 -6.7 -26.2 71.8 -18.3 -1.1 -7.4
TCTAAGCAGTCTGAATGATC 3023 SEQ ID NO:4384 -6.7 -20.2 62.4 -13.5 0 -6.3
CTGCATGCCGACCACAGCAA 3158 SEQ ID NO:4385 -6.7 -28.2 74 -20.3 -1.1 -9.1
CTCCCGCATCTTATTTTTCA 3524 SEQ ID NO:4386 -6.7 -25.2 71.5 -18.5 0 -3.1
ATATAATCATTTTCATCGAT 3724 SEQ ID NO:4387 -6.7 -17 54.1 -10.3 0 -6
CCTTCAGATGAGCTGGTTGC 3874 SEQ ID NO:4388 -6.7 -26.3 76.2 -18.4 -1.1 -5
TCGGGTTCAGTTTCAGCTTG 3931 SEQ ID NO:4389 -6.7 -25.3 75 -18.6 0 -4.5
CTTCAGTAAAACAAGCTTCC 3966 SEQ ID NO:4390 -6.7 -20.3 60.7 -13.6 0 -6.4
AGCATTTCCAGAATGAATAT 4219 SEQ ID NO:4391 -6.7 -19.3 58.5 -11 -1.6 -5.2
GAGCATTGGCTACCAGGCTA 4326 SEQ ID NO:4392 -6.7 -27.3 77.1 -18.6 -2 -8.4
GCCTTTAAATGTGGCCACTT 4706 SEQ ID NO:4393 -6.7 -25.3 70.6 -16.2 -1 -13
CAAAACTAGGGTCATGTATT 5126 SEQ ID NO: 4394 -6.7 -19.1 58.5 -12.4 0 -4.7
CACTAGGTTGATCCGGGACA 5144 SEQ ID NO:4395 -6.7 -25.7 72 -18.4 -0.3 -6.8
TTGCTCCTTTGATCAGACGT 5367 SEQ ID NO:4396 -6.7 -24.8 71.5 -18.1 0 -6.5
GACATCATCAAAGCAAAGAG 5404 SEQ ID NO:4397 -6.7 -18 55.5 -11.3 0 -4.1
TTGTGTCAGGGTCACAGTCG 5643 SEQ ID NO:4398 -6.7 -25.6 76.1 -17.3 -1.6 -5.8
AAATCAGAGAGTTTAGAGAA 5899 SEQ ID NO:4399 -6.7 -16.5 53.6 -9.8 0 -3.2
TGTTGGGTTTTGCTATGAGA 5943 SEQ ID NO:4400 -6.7 -22.8 68.8 -16.1 0 -3.6
GGGCAGATCCATGGCAATAA 5972 SEQ ID NO:4401 -6.7 -24.6 68.9 -16.9 -0.9 -8
ATCAAGACAGTGGATCCGGT 6005 SEQ ID NO:4402 -6.7 -24.5 69.9 -17.1 0 -8.9
CCACTCTCACACAAAACACG 6046 SEQ ID NO:4403 -6.7 -21.8 61.4 -15.1 0 -3
GCTCATAAGAGACTTTGGAG 6120 SEQ ID NO: 4404 -6.7 -21.1 64.1 -13 -1.3 -6.3
ATAGCGGCAGACACCTCCTC
6169 SEQ ID NO:4405 -6.7 -28.3 77.8 -21.6 0.4 -6.6 GATAGCGGCAGACACCTCCT
6170 SEQ ID NO:4406 -6.7 -28.5 77.4 -21.3 -0.1 -6.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TGATCACAAAGATAATTCTT 6484 SEQ ID NO:4407 -6.7 -16.3 52.5 -8.4 -1.1 -8.2
TATTTGTTAAAACAGTCAGT 6570 SEQ ID NO:4408 -6.7 -17.2 55.3 -10.5 0 -5.9
ATATTAGAGGAGACTTTACA 7122 SEQ ID NO: 4409 -6.7 -18.4 58.3 -10.8 -0.7 -5.5
GACATATTTTTAGCAAAATA 7809 SEQ ID NO:4410 -6.7 -15.4 50.5 -6.8 -1.9 -6.6
ATAATTTTCTTATGTACAAA 7886 SEQ ID NO:4411 -6.7 -14.8 49.7 -8.1 0 -6.8
AAATAAATTGTGATGTCATC 7915 SEQ ID NO:4412 -6.7 -15.5 50.9 -8.8 0 -5.1
ACAGTAAATAGTTTTGTAAA 8365 SEQ ID NO:4413 -6.7 -15.1 50.4 -8.4 0 -3.5
CGTAGCTCACCATTCTTTTT 8424 SEQ ID NO: 4414 -6.7 -24.2 70.4 -17.5 0 -4.8
TTCTCAATAACTATATCATT 8915 SEQ ID NO:4415 -6.7 -16.5 53.6 -9.8 0 -2.4
CAGCTGTTCAGCTTTTTTTT 123 SEQ ID NO: 4416 -6.6 -23.2 70.7 -14.7 -1.8 -11
TTGGCTTCAGTTTTCTTGCT 234 SEQ ID NO: 4417 -6.6 -24.8 74.9 -17.5 -0.4 -3.7
TCAAACCTTGATGTGGCTTG 251 SEQ ID NO: 4418 -6.6 -22.7 65.7 -15.3 -0.6 -4.9
CATAAATACACAGTTGGTCA 887 SEQ ID NO:4419 -6.6 -19.3 59.1 -12.7 0 -2.8
TCACATATGCCATCACAATG 1062 SEQ ID NO: 4420 -6.6 -21.5 62.8 -14.4 -0.1 -6.5
AAAAGCAGAATCGCTTGGGG 1313 SEQ ID NO: 4421 -6.6 -21.9 62.3 -13.5 -1.8 -9.3
GGACAAAAAATATCATGTAT 1668 SEQ ID NO: 4422 -6.6 -14.9 48.9 -8.3 0 -4.7
GCTCCTCATAGGCCATGGCC 1740 SEQ ID NO: 4423 -6.6 -31.5 85.6 -20.9 -1.4 -16.1
TTCTGCTTCTTCCAAGGTGG 1769 SEQ ID NO: 4424 -6.6 -25.6 74.9 -18.3 -0.5 -4.6
AATTCGGCCTCTTTTTGTTC 1786 SEQ ID NO:4425 -6.6 -23.9 69.9 -17.3 0 -6.2
CTGCCGCAACTGCCTGAGCT 1845 SEQ ID NO:4426 -6.6 -30.4 79.7 -22.6 -1.1 -7.3
TCATCATCAGCAAAGTCATT 2242 SEQ ID NO: 4427 -6.6 -20.8 63.4 -14.2 0 -4.1
AAAATCCCAGTAAAGACCAG 2860 SEQ ID NO:4428 -6.6 -20 58.1 -13.4 0 -2.1
CGTGGGAGCGTACAGTCATC 3220 SEQ ID NO: 4429 -6.6 -26.1 74.4 -19 -0.2 -4.8
TCCCACATGGTCTCTATCCA 3301 SEQ ID NO:4430 -6.6 -27.8 78.2 -20.5 -0.5 -4.9
ATAATCATTTTCATCGATTA 3722 SEQ ID NO:4431 -6.6 -17.1 54.5 -9.6 -0.8 -6.3
GCTGGTTGCATTTAATTTCT 3863 SEQ ID NO:4432 -6.6 -22.4 67.2 -14.9 -0.7 -5.1
TTCAGTAAAACAAGCTTCCG 3965 SEQ ID NO:4433 -6.6 -20.2 59.4 -13.6 0 -6.4
AAAGGCCAATGCACCACTAC 4127 SEQ ID NO: 4434 -6.6 -24 66.2 -15.9 -1.4 -7.7
AATATATAGGTAAAGACTTT 4204 SEQ ID NO: 4435 -6.6 -15 50.1 -7.9 -0.1 -4.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AGTTCTGAGTAGCCAAGAGC 4342 SEQ ID NO:4436 -6.6 -24.3 72.7 -17.1 -0.3 -3.4
GTCATGTTAACACAGTGGTA 4555 SEQ ID NO:4437 -6.6 -21.7 66.3 -14.3 -0.5 -8.7
CTAGGTTGATCCGGGACAAA 5142 SEQ ID NO:4438 -6.6 -23.4 66 -15.6 -1.1 -8.2
TTCCAGCCTATAGTGAAGTA 5221 SEQ ID NO:4439 -6.6 -23.3 68.8 -16.7 0 -5.1
GAGAGTTTAGAGAACTCTAT 5893 SEQ ID NO: 4440 -6.6 -18.9 60.1 -8.1 -4.2 -9.6
CAGATCCATGGCAATAAGCT 5969 SEQ ID NO:4441 -6.6 -23.1 66.1 -15.1 -1.3 -7.4
CACTGACCATGGGCAGATCC 5982 SEQ ID NO:4442 -6.6 -27.2 75 -18.8 -1.8 -8.8
ATATACTTTACCTTCATAGG 6515 SEQ ID NO:4443 -6.6 -19.6 60.6 -12 -0.9 -4.2
ATACTGTTTCTTCAACGTAA 6919 SEQ ID NO: 4444 -6.6 -19.2 59.1 -11.3 -1.2 -5.3
AATGGAAGTAACTGAAACTG 7032 SEQ ID NO: 4445 -6.6 -16 51.1 -9.4 0 -3
TCCTTTAAATATTAGAGGAG 7130 SEQ ID NO:4446 -6.6 -17.7 55.9 -9.3 -1.8 -7.4
TAAATTAAATATAGAGCTCT 7205 SEQ ID NO: 4447 -6.6 -14.7 49.3 -7.2 0 -9.6
AGCATTTGACCTAAATTAAA 7216 SEQ ID NO: 448 -6.6 -17.1 53.2 -9.9 -0.3 -4
GAGCAGAAGATGGCAAAGCA 7324 SEQ ID NO: 4449 -6.6 -22.4 64.7 -14.9 -0.8 -5.6
GAATGATACAGGATACATCC 7508 SEQ ID NO:4450 -6.6 -19.9 59.9 -12.6 -0.5 -6.5
GTGACATTCTTTAACCAAGA 7611 SEQ ID NO:4451 -6.6 -20.1 60.6 -12.6 -0.7 -5.9
TTAGCAAAATATGAAGAATA 7800 SEQ ID NO: 4452 -6.6 -13.4 46 -6.8 0 -4.1
AAATGAAATTTATTCTTTTG 8456 SEQ ID NO: 4453 -6.6 -13.4 46.5 -5.6 -1.1 -4.7
TTTAAACTGCCAACAGCAAA 8523 SEQ ID NO: 4454 -6.6 -19.4 57 -11.2 -1.5 -8.9
TATTAGCCACCAAGTAATTA 8834 SEQ ID NO:4455 -6.6 -20.2 60.2 -13.1 -0.1 -4.1
AATCCTCTCTGCTTATGCCT 11 SEQ ID NO: 4456 -6.5 -26.4 75.3 -19 -0.8 -4.6
TCTCTGATAAAACAGAGCCT 208 SEQ ID NO:4457 -6.5 -21 62.2 -11.5 -3 -8.7
GTGGCTTGGCTTCAGTTTTC 239 SEQ ID NO:4458 -6.5 -26.2 79.1 -19 -0.4 -6
GGTCCCTTCTGTGAATTATC 364 SEQ ID NO: 4459 -6.5 -24.4 71.8 -17.9 0 -3.2
GCTTCTTGGCTTTCTCTTCT 561 SEQ ID NO:4460 -6.5 -26.3 79.7 -19.3 -0.1 -3.7
GTAGGGATCCAGGTCCTCCA 701 SEQ ID NO:4461 -6.5 -29.8 84 -21.3 -2 -10.3
ATACAAGGCAGAGGTGGCAC 779 SEQ ID NO: 4462 -6.5 -24.5 71 -17.1 -0.8 -4.1
TACACAGTTGGTCAAAATAG 881 SEQ ID NO: 4463 -6.5 -17.9 56.1 -11.4 0 -3.8
TGACTCAAAGGTATAGATTC 959 SEQ ID NO: 4464 -6.5 -18.3 57.8 -11.8 0 -2.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TCTTGCCAAGATTTTTATAA 980 SEQ ID NO:4465 -6.5 -18.9 58.1 -11.7 -0.4 -6
GTCACATATGCCATCACAAT 1063 SEQ ID NO: 4466 -6.5 -22.7 65.9 -16.2 0 -6.5
GGCCCCCACAATGGTCTTTA 1169 SEQ ID NO:4467 -6.5 -29.5 78.6 -22.3 -0.2 -8.5
CAGAAAGCTTCTTTACCGAC 1197 SEQ ID NO:4468 -6.5 -21.7 63 -14.3 -0.7 -7
GCAGCCCAATGAGAGCAAAC 1251 SEQ ID NO: 4469 -6.5 -24.8 68.3 -17.5 -0.6 -4.8
AGCCATTTCCACAGAGTAAA 1473 SEQ ID NO: 4470 -6.5 -22.8 66 -16.3 0 -3.2
CCACCACAGCCAGGATCAAA 1722 SEQ ID NO:4471 -6.5 -26.5 71.1 -20 0 -5.3
GAAATTCGGCCTCTTTTTGT 1788 SEQ ID NO:4472 -6.5 -23.3 67.1 -16.8 0 -6.7
TTTTGTCACTGGTCAGTCTG 2103 SEQ ID NO:4473 -6.5 -23.7 73 -17.2 0 -6.6
AAAACAGGGAGCCACGGATA 2154 SEQ ID NO: 4474 -6.5 -22.8 63.4 -15.7 -0.3 -4.3
GCAATCCACAGTGCTGTGCA 2402 SEQ ID NO:4475 -6.5 -27.4 77 -18.7 -1.7 -12.4
ATGCTGGCTATGCTCACGGC 2584 SEQ ID NO:4476 -6.5 -28.1 78 -20.9 -0.4 -6.5
TGAAAATCCCAGTAAAGACC 2862 SEQ ID NO:4477 -6.5 -19.9 57.9 -13.4 0 -2.1
CTGACAATAATTCCATCAAA 2950 SEQ ID NO:4478 -6.5 -17.6 54 -11.1 0 -2.9
TTAAACTGAGGCTGACAATA 2961 SEQ ID NO:4479 -6.5 -18.5 56.6 -12 0 -3.7
TTCCTAGAGCCCCCACAGAA 3102 SEQ ID NO:4480 -6.5 -29 77.1 -22.5 0 -3.8
AGCTGCATGCCGACCACAGC 3160 SEQ ID NO:4481 -6.5 -30 79.7 -21.2 -2.3 -9.3
ACAGTCATCATTGATCTTGC 3209 SEQ ID NO:4482 -6.5 -22.2 67.8 -15 -0.5 -5.6
AGTTTCAGCTTGTTCACCTT 3923 SEQ ID NO:4483 -6.5 -24.9 74.8 -18.4 0 -4.5
CTTTCGCTGTTCAATGTATA 4154 SEQ ID NO: 4484 -6.5 -21.3 64.1 -14.8 0 -2.7
GTAGAACTTGCCAGCAAACA 4538 SEQ ID NO:4485 -6.5 -22.5 64.6 -16 0 -7.4
TTTCTTCATTGCATTGTAAT 4946 SEQ ID NO:4486 -6.5 -19.6 61 -13.1 0 -6.2
GATCATGATGCTGATATCAA 5054 SEQ ID NO:4487 -6.5 -19.7 60 -12.3 -0.6 -8.5
ACCATGTTGAGGCAGATGAG 5074 SEQ ID NO:4488 -6.5 -23.7 69.1 -17.2 0 -4.3
CATCATCAAAGCAAAGAGCA 5402 SEQ ID NO:4489 -6.5 -19.7 58.7 -11.6 -1.6 -4.4
TTCAGTAGCAACACTGAAGT 5789 SEQ ID NO:4490 -6.5 -21 63.7 -11.6 -2.9 -9.6
TTAGAGAACTCTATAAACTG 5887 SEQ ID NO:4491 -6.5 -15.8 51.8 -8.6 -0.3 -8
GTTTAGAGAACTCTATAAAC 5889 SEQ ID NO:4492 -6.5 -16.2 53 -8.1 -1.5 -8.1
GGAGGATCCAGGGCAGCTGC 5920 SEQ ID NO: 4493 -6.5 -30.1 84.2 -19.5 -1.8 -16.4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CACTCTCACACAAAACACGC 6045 SEQ ID NO:4494 -6.5 -21.6 61.7 -15.1 0 -3.3
AAGAGACTTTGGAGGGGTTT 6114 SEQ ID NO:4495 -6.5 -22.6 67.6 -16.1 0 -2.8
GAGTTCCCATTTAGTTTGTC 6310 SEQ ID NO:4496 -6.5 -23.9 72.5 -17.4 0 -1.7
AGGGGTGGTAGAGGAACTCC 6350 SEQ ID NO:4497 -6.5 -26.1 75.7 -17.2 -2.4 -6.3
TGTTTCTTTTTACTTTTGAT 6464 SEQ ID NO: 4498 -6.5 -18.8 60.2 -12.3 0 -2.2
AGAGGTCACTTCACTGTCTT 6610 SEQ ID NO:4499 -6.5 -24.1 73.9 -17.6 0 -3.4
AGAAAATGGAAGTAACTGAA 7036 SEQ ID NO:4500 -6.5 -14.8 48.6 -8.3 0 -3
AGCAATACTTTAGATATATT 7271 SEQ ID NO:4501 -6.5 -16.6 53.9 -10.1 0 -4.3
TATATATATTTGCCCAAACA 7416 SEQ ID NO:4502 -6.5 -19 57 -12.5 0 -5.4
GAAGCTTGCAAAAGACACAT 7482 SEQ ID NO:4503 -6.5 -19.5 58 -10.9 -2.1 -7
TAACATGCATTAGTGATAGC 7546 SEQ ID NO:4504 -6.5 -19.5 60.1 -13 0 -6.8
ATACTCATGTTGAATTAAAA 7721 SEQ ID NO: 4505 -6.5 -14.8 49.2 -8.3 0 -4.1
ATACCATATGATACTCATGT 7731 SEQ ID NO:4506 -6.5 -20 60.9 -12.6 -0.8 -6
TAGCAAAATATGAAGAATAG 7799 SEQ ID NO:4507 -6.5 -13.3 45.9 -6.8 0 -4.1
AAGTTTTAGACATATTTTTA 7817 SEQ ID NO:4508 -6.5 -15.8 52.6 -8.6 -0.4 -2.9
CAAAAAACCCCAGAGCCCAA 8494 SEQ ID NO:4509 -6.5 -24.5 63.8 -18 0 -3.2
TCACAAAGCTGCTTTTAATT 8659 SEQ ID NO:4510 -6.5 -19.4 59 -11.4 -0.3 -10.9
TTGGAACATGTGAACTTGAT 8698 SEQ ID NO:4511 -6.5 -19 57.9 -11.7 -0.6 -6.5
ACCTTATATAATTTATTATG 9073 SEQ ID NO: 4512 -6.5 -15.3 50.7 -8 -0.6 -5.3
AATGTCTCCATAAATAAATG 656 SEQ ID NO: 4513 -6.4 -15.5 50.1 -8.5 -0.3 -2.9
ATAGTAGGGATCCAGGTCCT 704 SEQ ID NO: 4514 -6.4 -26.4 77.1 -18 -2 -8.9
CTACATTCTTTGTCCAGTCA 924 SEQ ID NO:4515 -6.4 -23.7 71.4 -16.7 -0.3 -3.1
AAAACCCTCTTGCCAAGATT 987 SEQ ID NO:4516 -6.4 -22.9 63.8 -15.7 -0.6 -6.3
ACGAAGAAACGTAAAATCTT 1013 SEQ ID NO:4517 -6.4 -15.3 48.8 -8.1 -0.6 -5.6
TGCCCAGGTCCACAAACTCT 1083 SEQ ID NO:4518 -6.4 -27.9 75.7 -21.5 0 -3.6
AACTCTGAATGTTCTCAACG 1112 SEQ ID NO:4519 -6.4 -19.6 59.1 -12.3 -0.8 -5.3
GGAGAACTCTGAATGTTCTC 1116 SEQ ID NO:4520 -6.4 -21 64.3 -10.8 -3.8 -11.4
CCCCACAATGGTCTTTAAAC 1166 SEQ ID NO:4521 -6.4 -23.3 65.1 -16 -0.7 -5.4
AGTTGGGGTTTCGACCAGCC 1533 SEQ ID NO: 4522 -6.4 -28.8 79.9 -19.7 -2.7 -7.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TCCTCATAGGCCATGGCCAC 1738 SEQ ID NO: 4523 -6.4 -29.7 80.9 -18.7 -2.5 -17.4
TTCTTCCAAGGTGGCCTGAT 1763 SEQ ID NO: 4524 -6.4 -26.8 75.7 -19.7 -0.4 -7.2
ATTCGGCCTCTTTTTGTTCT 1785 SEQ ID NO:4525 -6.4 -25.5 74.4 -19.1 0 -6.7
GCTCTCCTAACCCACCTACT 1893 SEQ ID NO:4526 -6.4 -29.1 78.6 -22.7 0 -2.8
GCAGAATTTTTTGTCACTGG 2111 SEQ ID NO: 4527 -6.4 -21.5 64.9 -14.5 -0.3 -4.1
ATAAAGAGGGTATTTAAGAC 2782 SEQ ID NO:4528 -6.4 -16.2 52.7 -9.8 0 -3
TTGAGAACCATTTCTGCTGT 2881 SEQ ID NO: 4529 -6.4 -22.9 67.4 -15.1 -1.3 -5.8
ATCCCTCCACATTTGACAGA 2991 SEQ ID NO:4530 -6.4 -25.6 71.8 -19.2 0 -2.4
TGGAAGAAGTCGTTCATGTG 3244 SEQ ID NO: 4531 -6.4 -21 63.1 -13.9 -0.4 -4.9
TATGAATGACATATAATCAT 3734 SEQ ID NO:4532 -6.4 -14.9 49.4 -7.6 -0.7 -5.2
7AAACTTTTTAATACACCCTT 3983 SEQ ID NO: 4533 -6.4 -18.9 56.9 -12.5 0 -2.5
AAGGCCAATGCACCACTACT 4126 SEQ ID NO:4534 -6.4 -25.6 70.1 -17.7 -1.4 -7.7
TAGTCTTTCGCTGTTCAATG 4158 SEQ ID NO:4535 -6.4 -22 66.5 -15.6 0 -3.1
GTGAAATATGTTTGAAATCC 4258 SEQ ID NO:4536 -6.4 -17.1 53.8 -10.7 0 -4.1
CTTAGAGGTCTTAAAGCTCT 4390 SEQ ID NO:4537 -6.4 -21.4 65.7 -14 -0.9 -5
ACAGTCACTCAAATTGTTAA 4604 SEQ ID NO:4538 -6.4 -18.4 57.5 -12 0 -4.6
ATCCATCCAGCCTTTAAATG 4715 SEQ ID NO:4539 -6.4 -23.4 66.2 -17 0 -4.3
AGCTTCAGCACAAATTCTCC 5182 SEQ ID NO:4540 -6.4 -23.7 69.2 -16.4 -0.7 -6.6
TCCTTTTTAACATAGGCAAA 5500 SEQ ID NO:4541 -6.4 -19.6 58.9 -13.2 0 -4
AAAGTTGAACATGTCATCAA 5528 SEQ ID NO:4542 -6.4 -17.4 54.6 -9.9 -0.8 -9.7
GAGGTTGTAATTTGGAACAA 5575 SEQ ID NO:4543 -6.4 -18.8 57.8 -10.9 -1.4 -7.3
TCCATCCCAGCCAGCAGAGG 5591 SEQ ID NO:4544 -6.4 -31 83.4 -24.6 0 -4.6
AACACTGAAGTTCTCCAGGA 5780 SEQ ID NO:4545 -6.4 -22.7 66.6 -15.5 -0.6 -6.3
CTTTGCTTTAAAAGATAACA 6208 SEQ ID NO:4546 -6.4 -16.1 51.7 -9.2 -0.1 -4.3
AGTTCCCATTTAGTTTGTCA 6309 SEQ ID NO:4547 -6.4 -24 72.2 -17.6 0 -1.7
TCATAGGAAGGAGGAGGGGT 6364 SEQ ID NO:4548 -6.4 -24.3 71.5 -17.9 0 -2.4
TTTGCTTTCTTTTTCTGGTT 6425 SEQ ID NO: 4549 -6.4 -22.6 69.9 -16.2 0 -3.6
TCTTTGTTTCTTTTTACTTT 6468 SEQ ID NO: 4550 -6.4 -19.6 62.9 -13.2 0 -1.8
ATTTGTTAAAACAGTCAGTT 6569 SEQ ID NO: 4551 -6.4 -17.6 56.2 -10.5 -0.4 -5.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GAGTATTTGTTAAAACAGTC 6573 SEQ ID NO: 4552 -6.4 -17.1 55.3 -10.7 0 -6.1
TGTACTAAAGGTGTTTGGTG 6769 SEQ ID NO: 4553 -6.4 -20.5 63 -13.2 -0.8 -5.1
AATGGATGCAAGGACTGTAC 6784 SEQ ID NO: 4554 -6.4 -20.9 62.2 -14.5 0 -5.6
AGATTACTTTTTGGAAAGCA 7232 SEQ ID NO:4555 -6.4 -18.8 58.1 -10.8 -1.6 -5.5
AATGGATTTATTAGATTACT 7244 SEQ ID NO: 4556 -6.4 -16.3 53.1 -9.9 0 -2.4
AAGAATGGATTGAGTAAAAT 7585 SEQ ID NO: 4557 -6.4 -14.5 48.3 -8.1 0 -2.2
ATATTTTTACATTATTTATA
7844 SEQ ID NO:4558 -6.4 -14.1 48.8 -7.7 0 -1.8 TATATTTTTACATTATTTAT
7845 SEQ ID NO: 4559 -6.4 -14.1 48.8 -7.7 0 -2.2 CTCAATAATGACGTAGCTCA
8435 SEQ ID NO:4560 -6.4 -20.6 61.3 -13.5 -0.5 -5.6
GGCTCAATAATGACGTAGCT 8437 SEQ ID NO:4561 -6.4 -22.5 65.2 -14.8 -1.2 -6.5
TACCTTATGTATACATAGGA 8893 SEQ ID NO:4562 -6.4 -19.6 60.3 -11 -1.1 -12.6
AATCCAAGGGTTCTTGAAAA 8950 SEQ ID NO: 4563 -6.4 -19.3 57.8 -10.8 -2.1 -6.7
TCACATAAATCCAAGGGTTC 8957 SEQ ID NO:4564 -6.4 -20.8 61.9 -14.4 0 -4.3
TTTGACCTCACATAAATCCA 8964 SEQ ID NO: 4565 -6.4 -21.3 62 -14.9 0 -2.9
GGAGAATTATGAAATACATA 9053 SEQ ID NO:4566 -6.4 -15 49.4 -7.7 -0.8 -4.5
TCCAGAATCCTCTCTGCTTA 16 SEQ ID NO: 4567 -6.3 -25.4 73.6 -18.1 -0.9 -4.5
CTTGGCTTCAGTTTTCTTGC 235 SEQ ID NO:4568 -6.3 -24.8 74.9 -18.5 0 -3.7
CGGAAAAGCTCCAGGTCCCT 377 SEQ ID NO: 4569 -6.3 -28 74.2 -20.1 -1.5 -6.7
CGGAAGCTTTCAGGTCCTGG 496 SEQ ID NO: 4570 -6.3 -26.8 75 -19 -0.8 -10.8
CTCTGGAGGAATGTCTCCAT 665 SEQ ID NO: 4571 -6.3 -24.7 71.9 -15.1 -3.3 -8.5
AATTTTCCTAACAGGGTTTA 812 SEQ ID NO: 4572 -6.3 -20.3 61.5 -13.1 -0.7 -4.1
TTCCAGTGAATGTGTACTCT 942 SEQ ID NO: 4573 -6.3 -22.8 68.6 -16.5 0 -4.9
CTCTGAATGTTCTCAACGCT 1110 SEQ ID NO:4574 -6.3 -22.8 66.4 -15.6 -0.8 -5.3
TTTCAGTGCTCGGAGAACTC 1127 SEQ ID NO: 4575 -6.3 -23.6 69.8 -16.4 -0.7 -6.4
AGCCATAGTTGGGGTTTCGA 1539 SEQ ID NO: 4576 -6.3 -26.3 75.1 -18.5 -1.4 -7.6
AATTTTTTGTCACTGGTCAG 2107 SEQ ID NO:4577 -6.3 -20.7 64 -14.4 0 -5
GCCACGGATACTCAAGAGAG 2144 SEQ ID NO: 4578 -6.3 -23.7 67.3 -16.2 -1.1 -5.7
GTAATAAGGATCCATGGCAA 2906 SEQ ID NO:4579 -6.3 -21.1 61.8 -14.1 0 -9
GTGGGCCAGGATTTTGCCAA 3052 SEQ ID NO: 4580 -6.3 -28 76.8 -19.4 -2.3 -7.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AGCAAAAATGAAGACGATGA 3143 SEQ ID N0:4581 -6.3 -16.4 51 -10.1 0 -4.1
TCTGCAGATTATTCATTTCA 3468 SEQ ID N0:4582 -6.3 -20.7 64.1 -13.4 -0.2 -9.8
GGCACTGTGACGGTGAGGCT 3763 SEQ ID NO:4583 -6.3 -28.5 79.4 -20.4 -1.8 -7.6
TGCATTTAATTTCTCTTTGC 3857 SEQ ID NO:4584 -6.3 -20.5 63.2 -13.7 -0.1 -4.7
TTCAATGTATATATCTTCAA 4145 SEQ ID NO: 4585 -6.3 -16.6 54 -10.3 0 -3.9
CCAAAGAAACATCAACGATC 4305 SEQ ID NO:4586 -6.3 -17.8 53.5 -11.5 0 -3.5
TGGCACCGAGTTCTGAGTAG 4350 SEQ ID NO:4587 -6.3 -25.4 73.2 -19.1 0 -4
TCTTAATGTCCGTAATGATT 4373 SEQ ID NO:4588 -6.3 -19.7 59.5 -13.4 0 -2.6
CTAATGTCAAACATGTTACC 4579 SEQ ID NO:4589 -6.3 -18.9 57.6 -11.4 -1.1 -9
CTGGTTGAAGTTATCTATGA 4871 SEQ ID NO:4590 -6.3 -19.9 61.8 -13.6 0 -2.6
ATTGTAATATTTTTTCTGTT 4934 SEQ ID NO:4591 -6.3 -17.1 55.9 -10.8 0 -3.9
GATCCAAGTTTCTTCATTGC 4954 SEQ ID NO: 4592 -6.3 -22.8 68.4 -16.5 0 -4.3
CCTATAGTGAAGTAGTAGTG 5215 SEQ ID NO: 4593 -6.3 -20.4 63.6 -14.1 0 -5.1
CAAAGATGGCATAGATAAAC 5469 SEQ ID NO: 4594 -6.3 -16.4 51.9 -10.1 0 -4
GCTTCCTTTTTAACATAGGC 5503 SEQ ID NO:4595 -6.3 -23.1 68.3 -16.8 0 -3.6
CAAAGTTGAACATGTCATCA 5529 SEQ ID NO:4596 -6.3 -18.8 57.7 -11.9 -0.3 -7.3
AATAAGCTGGACTTTGTTGG 5957 SEQ ID NO: 4597 -6.3 -20.6 62.1 -13.7 -0.3 -5.1
CGCTTTGTAAAGGCAAATAA 6028 SEQ ID NO:4598 -6.3 -18.5 55.4 -10.2 -2 -6.4
CAGACACCTCCTCTTGTTTA
6162 SEQ ID NO:4599 -6.3 -25.1 72.9 -18.8 0 -3 GCAGACACCTCCTCTTGTTT
6163 SEQ ID NO:4600 -6.3 -27.2 77.9 -20.9 0 -3.5 CTTTTCCTTTGCTTTCTTTT
6432 SEQ ID NO: 4601 -6.3 -23.2 70.1 -16.9 0 -3.6
AAAGATAATTCTTTGTTTCT 6477 SEQ ID NO:4602 -6.3 -16.5 53.8 -8.4 -1.8 -5.2
TAAAACAGTCAGTTTGGCAT 6563 SEQ ID NO:4603 -6.3 -19.9 60.5 -12 -1.6 -7.7
TCACAGAGTTGCAGTGACAG 6630 SEQ ID NO: 4604 -6.3 -23.1 69.7 -15.6 -1.1 -7
GTCAACGTTGATACCCTGCT 6650 SEQ ID NO:4605 -6.3 -26 72.1 -17.4 -0.1 -12.8
CTGGCAAAACACCTTTGTCT 6965 SEQ ID NO: 4606 -6.3 -23.2 66.1 -14.6 -2.3 -5.8
ATGGATTTATTAGATTACTT 7243 SEQ ID NO: 4607 -6.3 -17.1 55.3 -10.8 0 -2.4
CAGAGCAGGTTGAATTCATT 7644 SEQ ID NO: 608 -6.3 -21.5 64.8 -14.6 0 -8.4
GTTGATTATATTTTTACATT 7851 SEQ ID NO:4609 -6.3 -16.5 54.2 -10.2 0 -2.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AAAATAAATTGTGATGTCAT 7916 SEQ ID NO:4610 -6.3 -14.4 48.2 -8.1 0 -5.1
TTAGTGCAGCAGGAATTAAA 8218 SEQ ID NO: 4611 -6.3 -19.5 59.3 -13.2 0 -6.6
TAGGTAATTGCACAACTTTG 8291 SEQ ID NO: 4612 -6.3 -19.2 58.8 -12.9 0 -5.1
TCAATACACTACAGTAAATA 8375 SEQ ID NO:4613 -6.3 -15.9 51.6 -9.6 0 -3.6
TATTATCAAACCTGAAAGTT 8716 SEQ ID NO: 4614 -6.3 -16.8 53.1 -10.5 0.1 -3.1
AGAAGATGAGTTTAGATGCT 8790 SEQ ID NO:4615 -6.3 -19.5 60.8 -13.2 0 -3.6
ACATTTATTAGCCACCAAGT 8839 SEQ ID NO:4616 -6.3 -22.5 65.4 -16.2 0 -3.2
TCTCAATAACTATATCATTA 8914 SEQ ID NO: 4617 -6.3 -16.1 52.8 -9.8 0 -2.4
AAATTCTCAATAACTATATC 8918 SEQ ID NO:4618 -6.3 -14.3 48.5 -8 0 -3.1
GAATCCTCTCTGCTTATGCC 12 SEQ ID NO: 4619 -6.2 -26.1 74.6 -19 -0.8 -4.6
GCCTTATGAATTACAGCATA 192 SEQ ID NO: 4620 -6.2 -21.3 63 -15.1 0 -4.1
ATCCCTGTCAAACCTTGATG 258 SEQ ID NO: 4621 -6.2 -24 67.5 -16.6 -1.1 -4.5
TGAATCCTTGACAGGTATCT 279 SEQ ID NO: 4622 -6.2 -22.2 66.1 -14.6 -1.3 -3.8
CTTTGGTTTGTTCTCATCAT 602 SEQ ID NO: 4623 -6.2 -22.5 69.3 -16.3 0 -1.9
CCTTTATTCATTACTATAAA 739 SEQ ID NO:4624 -6.2 -16.9 53.8 -10.7 0 -3.2
AAACCCTCTTGCCAAGATTT 986 SEQ ID NO: 4625 -6.2 -23.7 66.1 -16.7 -0.6 -6.3
GTCCACAAACTCTGTCACAT 1076 SEQ ID NO:4626 -6.2 -23.4 68.2 -16.7 -0.1 -4.2
TTGCCCATGAACAGCTGCAG 1267 SEQ ID NO:4627 -6.2 -26.6 73.1 -19.5 -0.3 -9.4
ACAGAGTAAAGGGTCTTTTT 1463 SEQ ID NO:4628 -6.2 -20.3 62.8 -13.4 -0.4 -4.1
TTGAGTCATGAGTCGAAATA 1598 SEQ ID NO:4629 -6.2 -18.9 58.3 -11 0 -11.6
CAACTGGTAAAGATTTTCCC 1625 SEQ ID NO:4630 -6.2 -21.1 61.8 -14.9 0 -3.3
GAGCATCTGCTGAAATTCGG 1799 SEQ ID NO:4631 -6.2 -22.8 65.6 -15.6 -0.9 -7.9
ACTGGTCAGTCTGTTTCCAT 2096 SEQ ID NO:4632 -6.2 -25.6 76.8 -18.9 -0.1 -7.3
GGGAAAACAGGGAGCCACGG 2157 SEQ ID NO: 4633 -6.2 -25.5 68.5 -18.7 -0.3 -4.3
AGTTGTCCAGTAGGTGACGT 2461 SEQ ID NO:4634 -6.2 -25.7 76 -18.4 -1 -5.8
AAATTCACAAGATGTTTTAC 2716 SEQ ID NO: 4635 -6.2 -16 52.1 -9.8 0 -4.3
TAAAGAGGGTATTTAAGACA 2781 SEQ ID NO:4636 -6.2 -16.9 53.9 -10.7 0 -2.9
CTGAATTGCTCAGTCATGGG 2818 SEQ ID NO:4637 -6.2 -23.4 68.9 -15.9 -1.2 -8.7
GCTGACAATAATTCCATCAA 2951 SEQ ID NO:4638 -6.2 -20.1 59.5 -13.9 0 -2.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CTCCATTAAACTGAGGCTGA 2966 SEQ ID NO:4639 -6.2 -22.6 65.3 -16.4 0 -3.7
TTTTTCACATAATCAATTCC 3511 SEQ ID NO:4640 -6.2 -18.3 57 -12.1 0 -2.5
CTGGTGGTTCCATTCCCATC 3667 SEQ ID NO:4641 -6.2 -28.5 80.1 -21.1 -1.1 -6.6
GGTTGCATTTAATTTCTCTT 3860 SEQ ID NO: 4642 -6.2 -21.1 64.9 -14.9 0 -5.1
AACCAGTTGTGCTCAACAAT 4075 SEQ ID NO:4643 -6.2 -22 64 -13.3 -2.5 -5.8
ATATAGGTAAAGACTTTGTC 4201 SEQ ID NO:4644 -6.2 -17.6 56.6 -10.9 -0.1 -4.1
TAAAGCTCTTAATGTCCGTA 4379 SEQ ID NO: 4645 -6.2 -20.7 61.5 -14.5 0 -5
GATAGAGGGAATTGCTCCAA 4457 SEQ ID NO:4646 -6.2 -22.4 65.1 -14.4 -1.8 -6.1
GTATAAATACATGTACAGAT 4793 SEQ ID NO:4647 -6.2 -16.2 52.6 -9.5 0 -8.2
ATCATGATGCTGATATCAAA 5053 SEQ ID NO:4648 -6.2 -18.4 56.8 -11.3 -0.8 -7.7
AGGCCGATGTTAAACAACGC 5431 SEQ ID NO: 4649 -6.2 -23 63.4 -16.8 2.6 -8.1
AGCAATCCATCCCAGCCAGC 5596 SEQ ID NO:4650 -6.2 -30.3 80.9 -24.1 0 -4.1
GTGGAGTTCCCATTTAGTTT 6313 SEQ ID NO:4651 -6.2 -24.7 73.5 -17.2 -1.2 -4.4
GATCACAAAGATAATTCTTT 6483 SEQ ID NO: 4652 -6.2 -16.4 52.8 -8.4 -1.8 -8.3
GACTGTACTAAAGGTGTTTG 6772 SEQ ID NO:4653 -6.2 -19.8 61.2 -13.6 0 -5.1
TAGCATTATGAATAAACTAT
6875 SEQ ID NO:4654 -6.2 -15 49.6 -8.8 0 -4.1 ATAGCATTATGAATAAACTA
6876 SEQ ID NO: 4655 -6.2 -15 49.6 -8.8 0 -4.1 CAGATAGAAACAAACATAAC
7088 SEQ ID NO: 4656 -6.2 -13.8 46.6 -7.6 0 -1.2
AATTGACATAGACTATCAGC 7352 SEQ ID NO:4657 -6.2 -18.9 58.8 -12.7 0 -3.3
AAACTATGTTTAATGAATGA 7522 SEQ ID NO:4658 -6.2 -14.3 48.1 -7.6 -0.2 -4.3
ATTTTTAGCAAAATATGAAG 7804 SEQ ID NO:4659 -6.2 -14.1 47.7 -6.8 -1 -5.3
TT7AAACAAGTTTTAGACATA 7823 SEQ ID NO:4660 -6.2 -15 50 -8.1 -0.4 -5.5
AGTTGATTATATTTTTACAT 7852 SEQ ID NO:4661 -6.2 -16.4 54 -10.2 0 -2.6
TTTCTTATGTACAAAATGCT 7881 SEQ ID NO:4662 -6.2 -17.7 55.6 -11.5 0 -6.8
TAAATTGTGATGTCATCAAC 7912 SEQ ID NO:4663 -6.2 -17.1 54.5 -9.8 -1 -7.2
AAAAGTTTGGAATTGTGATT 7962 SEQ ID NO:4664 -6.2 -16.4 52.6 -10.2 0 -4.6
TTAGCAATAGCAATTCCCTG 8406 SEQ ID NO:4665 -6.2 -22.5 64.9 -14.6 -1.7 -4.9
TATATATTTTAAACTGCCAA 8530 SEQ ID NO:4666 -6.2 -16.6 52.5 -10.4 0 -4.4
TATATCATTAATACCTTATG 8904 SEQ ID NO:4667 -6.2 -16.2 52.5 -10 0 -4.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AAAATATGCATTACAACTGG 9012 SEQ ID NO:4668 -6.2 -16.4 51.7 -10.2 0 -6.5
ATTACAGCATAACAAAGCCC 183 SEQ ID NO:4669 -6.1 -21.5 61.7 -14.9 -0.2 -4.1
GCTCCTTTCCCAGTAAGCCA 307 SEQ ID NO:4670 -6.1 -30 81.8 -23.4 -0.1 -3.6
GCACATTTAATTACGTGTAG 441 SEQ ID NO: 4671 -6.1 -19.5 59.4 -12.8 -0.3 -5.4
AACAGTGCCTGTGCCATCTT 469 SEQ ID NO:4672 -6.1 -27.2 76.4 -19.5 -1.5 -8.7
TCCTAACAGGGTTTAGTGGA 807 SEQ ID NO:4673 -6.1 -23.7 70 -16.7 -0.7 -4.3
AAGAAACGTAAAATCTTCTA 1010 SEQ ID NO: 4674 -6.1 -14.7 48.5 -8.1 -0.2 -6.1
TGAAATCCAGCCAGTTCCAT 1038 SEQ ID NO: 4675 -6.1 -25.2 70.3 -19.1 0 -3.2
AAATAAAATGAGCCCAAGAA 1696 SEQ ID NO: 4676 -6.1 -16.5 50.8 -10.4 0 -3.2
AAATTCGGCCTCTTTTTGTT 1787 SEQ ID NO:4677 -6.1 -22.8 66.2 -16.7 0 -6.7
TGTCTCTCTCTCCTTTGTTG 2016 SEQ ID NO:4678 -6.1 -25.2 77.2 -19.1 0 0
CAAGAGAGACTGATGAGGGG 2132 SEQ ID NO:4679 -6.1 -21.7 64.3 -15.6 0 -2.2
CCTGGATGACATACTGGCCT 2351 SEQ ID NO:4680 -6.1 -26.9 74 -20.8 0 -7.2
TTGCAATCCACAGTGCTGTG 2404 SEQ ID NO:4681 -6.1 -25 71.8 -16.8 -1.5 -12.1
GTAAAGACCAGGTTTCCTAC 2851 SEQ ID NO:4682 -6.1 -22.8 66.9 -16.2 -0.1 -5.9
GCCAACTTGAAAACTCTAAG
3037 SEQ ID NO:4683 -6.1 -18.9 56.6 -12.8 0 -2.9 TGCCAACTTGAAAACTCTAA
3038 SEQ ID NO: 4684 -6.1 -18.9 56.4 -12.8 0 -3 AAGTCGTTCATGTGCCACCG
3238 SEQ ID NO: 4685 -6.1 -26.8 73.2 -20.7 0 -4.7
GCGACCTCCATACAGTCCCA 3316 SEQ ID NO:4686 -6.1 -30.3 80.1 -23.7 -0.1 -3.4
CATATAATCATTTTCATCGA 3725 SEQ ID NO:4687 -6.1 -17.7 55.4 -11.6 0 -4.8
TGGTTGCATTTAATTTCTCT
3861 SEQ ID NO:4688 -6.1 -21 64.4 -14.9 0 -5.1 CTGGTTGCATTTAATTTCTC
3862 SEQ ID NO:4689 -6.1 -21 64.4 -14.9 0 -4.8 GGAAACTTTTTAATACACCC
3985 SEQ ID NO:4690 -6.1 -19.7 58.3 -13.6 0 -2.5
CAAACCAGTTGTGCTCAACA 4077 SEQ ID NO:4691 -6.1 -22.7 65.2 -13.3 -3.3 -6.6
TTCGCTGTTCAATGTATATA 4152 SEQ ID NO: 4692 -6.1 -20 61.2 -13.9 0 -3.6
TCTGAGTAGCCAAGAGCATT
4339 SEQ ID NO: 4693 -6.1 -23.8 70.1 -16.2 -1.4 -4.1 TTCTGAGTAGCCAAGAGCAT
4340 SEQ ID NO: 4694 -6.1 -23.8 70.1 -16.2 -1.4 -4.8 CCACCCTCATGCCTTCAAAC
4422 SEQ ID NO:4695 -6.1 -27.6 73.5 -21.5 0 -4.4
ATTGCTCCAACAAGAGCATT 4447 SEQ ID NO:4696 -6.1 -22.6 65.4 -13.1 -3.4 -9.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TATACAGGCTGAAGTTTAAC 4765 SEQ ID NO: 4697 -6.1 -18.7 58.2 -12.6 0 -4.1
CTGTCATAAAGATGTCTTGA 4911 SEQ ID NO:4698 -6.1 -19.3 60 -12.5 -0.4 -6.8
CTCTGTCATAAAGATGTCTT 4913 SEQ ID NO:4699 -6.1 -20 62.2 -13.2 -0.4 -6.5
TGTAATATTTTTTCTGTTCC 4932 SEQ ID NO: 4700 -6.1 -19.4 61.1 -13.3 0 -4.2
TCTTGGATCCAAGTTTCTTC 4959 SEQ ID NO:4701 -6.1 -22.8 69.2 -13 -1.3 -15.5
TGTTGAGGCAGATGAGGATC 5070 SEQ ID NO:4702 -6.1 -23 69.1 -16.9 0 -4.1
AGGTTGATCCGGGACAAAAC 5140 SEQ ID NO: 4703 -6.1 -22.3 63.2 -15 -1.1 -8.7
GGAAGGGACATCATCAAAGC 5410 SEQ ID NO:4704 -6.1 -21.6 63.4 -14.9 -0.3 -3.1
AATTCCAGCTTCCTTTTTAA 5510 SEQ ID NO:4705 -6.1 -22 64.9 -15.9 0 -4.5
CTTCAGTAGCAACACTGAAG 5790 SEQ ID NO:4706 -6.1 -20.7 62.5 -10.6 -4 -11.8
ACTTTCTTCAGTAGCAACAC 5795 SEQ ID NO:4707 -6.1 -21.6 66.1 -14.8 -0.5 -0.8
CTCAAAGTCATCCTCACTCA 5825 SEQ ID NO:4708 -6.1 -23.5 69.2 -17.4 0 -2.6
TAAGAGACTTTGGAGGGGTT 6115 SEQ ID NO:4709 -6.1 -22.2 66.6 -16.1 0 -2.9
CTCATAAGAGACTTTGGAGG 6119 SEQ ID NO:4710 -6.1 -20.5 62.5 -12.6 -1.8 -5.4
GAATGATAGCGGCAGACACC 6174 SEQ ID NO: 4711 -6.1 -24.2 67.6 -18.1 0 -6.6
ATTGCCTCTTTGTTATAGTT 6247 SEQ ID NO: 4712 -6.1 -22.3 68.2 -16.2 0 -3
ATTGATCACAAAGATAATTC 6486 SEQ ID NO:4713 -6.1 -15.4 50.7 -8.4 -0.8 -6.3
TTCACAGAGTTGCAGTGACA 6631 SEQ ID NO: 4714 -6.1 -23.2 69.8 -15.6 -1.4 -7.4
ACCTCATTTACAAAAATAGT 6899 SEQ ID NO: 4715 -6.1 -17.1 53.6 -10.4 -0.3 -3.9
CAAAATTAAAGCCATCTAGA 7053 SEQ ID NO: 4716 -6.1 -17.1 53 -11 0 -5.8
TTTACAGGCACATAACTGTT 7108 SEQ ID NO: 4717 -6.1 -20.8 62.7 -13.1 -1.5 -5.2
TTTAAATATTAGAGGAGACT 7127 SEQ ID NO: 4718 -6.1 -16.1 52.6 -9.3 -0.5 -5.7
AAAAGTGCAAAAGTAAAGGT 7705 SEQ ID NO:4719 -6.1 -15.4 49.7 -9.3 0 -4.9
AATAATTTTCTTATGTACAA 7887 SEQ ID NO:4720 -6.1 -14.8 49.7 -8.7 0 -6.8
TTGTGATGTCATCAACCTGA 7908 SEQ ID NO:4721 -6.1 -22.3 66 -15.1 -1 -6.9
ATAAATTGTGATGTCATCAA 7913 SEQ ID NO: 4722 -6.1 -16.9 53.9 -9.7 -1 -6.9
ATTATGAAATACATATTTAG 9048 SEQ ID NO: 4723 -6.1 -13.2 46.2 -6 -1 -5.2
TTCCAAGTCACTATTTGGCT 620 SEQ ID NO: 4724 -6 -23.7 69.8 -16.2 -1.4 -5.1
AATAAATGGAAGGTTCTTTC 644 SEQ ID NO: 4725 -6 -17.1 54.5 -11.1 0 -4.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TAGTAGGGATCCAGGTCCTC 703 SEQ ID NO:4726 -6 -26.8 79 -18.8 -2 -8.9
CTGAATCGGAAAATTGCCTT 760 SEQ ID NO:4727 -6 -20.6 59.1 -14.6 0 -4.4
TGGTCAAAATAGTGCACATG 873 SEQ ID NO:4728 -6 -19.7 59.4 -12.7 0 -9.9
TTCTCAACGCTGAGACATTG 1101 SEQ ID NO: 4729 -6 -21.7 63.8 -12.9 -2.8 -8.2
TCTTTACCGACTGGATCAGG 1188 SEQ ID NO:4730 -6 -24 68.9 -17.1 -0.7 -5.3
AAAGCAGAATCGCTTGGGGG 1312 SEQ ID NO:4731 -6 -23.8 66.7 -16 -1.8 -9.3
GCCATTTCCACAGAGTAAAG 1472 SEQ ID NO:4732 -6 -22.8 66 -16.8 0 -2.7
CCTTCAAGGTGCTCTCTCTG 1993 SEQ ID NO:4733 -6 -26.4 77.2 -20.4 0 -4.8
GAGAAAAGGAAGCTGCTTCT 2071 SEQ ID NO: 4734 -6 -21 62.3 -12.4 -1.8 -13.3
CACTGGTCAGTCTGTTTCCA 2097 SEQ ID NO:4735 -6 -26.3 78 -20.3 0 -6.6
ATCTTCCCATTTGCTGGAAG 2383 SEQ ID NO:4736 -6 -24.5 70.1 -16 -2.5 -7.5
AGAGCTTAACCTTCTCTTTC 2516 SEQ ID NO:4737 -6 -22.8 69.2 -16 -0.6 -5.2
AGGAATCCTCCAGCATCTCC 2550 SEQ ID NO:4738 -6 -27.7 77.6 -19.8 -1.9 -7.1
TGCTGGCTATGCTCACGGCT 2583 SEQ ID NO:4739 -6 -29 80 -21.8 -1.1 -7.5
GCAAATCTATACCAGCATGG 2653 SEQ ID NO: 4740 -6 -22.4 64.6 -14.6 -1.8 -7
AAGACCAGGTTTCCTACAGT 2848 SEQ ID NO:4741 -6 -24.5 71.2 -18 -0.1 -5.9
AAACTGAGGCTGACAATAAT 2959 SEQ ID NO:4742 -6 -18 55 -12 0 -3.7
AACTTGAAAACTCTAAGCAG 3034 SEQ ID NO:4743 -6 -16.9 53.2 -10.9 0 -4.1
ACCGTGGGAGCGTACAGTCA
3222 SEQ ID NO:4744 -6 -27.9 76.9 -21 -0.7 -4.8 CACCGTGGGAGCGTACAGTC
3223 SEQ ID NO:4745 -6 -27.9 76.9 -21 -0.7 -4.8 CCACCGTGGGAGCGTACAGT
3224 SEQ ID NO:4746 -6 -29.5 78.6 -22.6 -0.7 -7.8 CTACTGCAATCTGCAGATTA
3477 SEQ ID NO:4747 -6 -21.7 64.7 -11.3 -4.4 -14
AATTCCCTTTTGCATTCTTC 3497 SEQ ID NO:4748 -6 -23.4 68.8 -17.4 0 -5.1
ATGAATGACATATAATCATT 3733 SEQ ID NO:4749 -6 -15.3 50.2 -7.6 -1.7 -7.9
CAGCAATTGGCACTGTGACG 3771 SEQ ID NO:4750 -6 -24.2 68 -16.6 -1.5 -7.1
CGCTGTTCAATGTATATATC
4150 SEQ ID NO:4751 -6 -19.9 60.8 -13.9 0 -3.9 TCGCTGTTCAATGTATATAT
4151 SEQ ID NO:4752 -6 -19.9 60.8 -13.9 0 -3.8 AGAATGAATATATAGGTAAA
4210 SEQ ID NO: 4753 -6 -13.6 46.8 -7.6 0 -4.2
TTGAGAAGCATTTCCAGAAT 4225 SEQ ID NO:4754 -6 -20.3 60.9 -13.5 -0.6 -4.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AAGGCTCTTAGAGGTCTTAA 4396 SEQ ID NO:4755 -6 -21.7 66.3 -15.1 -0.3 -5.3
AAGAGCATTCACAACCACCC 4436 SEQ ID NO:4756 -6 -24.9 68.6 -18.3 -0.3 -4.1
CAGCGCCAACATTATCAAAG 4668 SEQ ID NO:4757 -6 -21.5 61.1 -15 0 -7.6
TAGGTTGATCCGGGACAAAA 5141 SEQ ID NO:4758 -6 -21.8 62.2 -14.6 -1.1 -8.7
GAAGTAGTAGTGTCTGAGGG 5207 SEQ ID NO:4759 -6 -22.4 69.6 -16.4 0 -2.9
GATCCCCTTTGCTCCTTTGA 5375 SEQ ID NO:4760 -6 -28.9 79.3 -22.9 0 -3.6
CCTTTTTAACATAGGCAAAG 5499 SEQ ID NO:4761 -6 -19.2 57.8 -13.2 0 -4
AAGTTGAACATGTCATCAAT 5527 SEQ ID NO:4762 -6 -18.1 56.5 -10.8 -1 -9.9
GGGTGGTGCACTATTAAGAA 5624 SEQ ID NO:4763 -6 -22.3 65.9 -15.1 -1.1 -8.7
TCCCTTAACTGAGCTGCCAG 5669 SEQ ID NO:4764 -6 -27.3 75.2 -20.6 -0.2 -8.8
GACCGCGATGTACATGTTCA 5759 SEQ ID NO:4765 -6 -25 69.5 -18.4 0 -8.4
AAAATCAGAGAGTTTAGAGA 5900 SEQ ID NO:4766 -6 -16.5 53.6 -10.5 0 -4.2
GTTTTGCTATGAGAAGAGGA 5937 SEQ ID NO:4767 -6 -20.8 63.6 -14.8 0 -2.9
ATAAGAGACTTTGGAGGGGT 6116 SEQ ID NO:4768 -6 -22.1 66.2 -16.1 0 -2.9
AGTCCAGTTGACACATATAC 6529 SEQ ID NO:4769 -6 -21.6 65.5 -13.8 -1.8 -5.1
CAGTTTGGCATGGACCTCCT 6554 SEQ ID NO: 4770 -6 -28 78.2 -21.5 -0.1 -5.1
GCCATTGGGTTTCTCCTCAG 6704 SEQ ID NO:4771 -6 -28.1 80.5 -21.2 -0.8 -6.3
AACCTCATTTACAAAAATAG 6900 SEQ ID NO:4772 -6 -15.2 49.4 -8.5 -0.5 -3
ATTCTTTTTCTGGTTTTGAG 7001 SEQ ID NO:4773 -6 -20.4 64.4 -14.4 0 -2.3
TAAAGCAATACTTTAGATAT 7274 SEQ ID NO: 4774 -6 -15.1 50 -7.5 -1.6 -5.7
TGTGAAGAATGGATTGAGTA 7589 SEQ ID NO:4775 -6 -18.4 57.4 -12.4 0 -2.1
AATAAAGTTGATTATATTTT 7857 SEQ ID NO: 4776 -6 -13.3 46.5 -7.3 0 -2.9
TAAAACCCATTATCTAACTT 8022 SEQ ID NO:4777 -6 -17.8 54.4 -11.8 0 -1.6
AATTGCACAACTTTGCCACT 8286 SEQ ID NO:4778 -6 -23 65.4 -16 -0.9 -5
GTTAGGTAATTGCACAACTT 8293 SEQ ID NO:4779 -6 -20.4 61.9 -14.4 0 -5.3
AAAAACAAAAATTTATATCA 8314 SEQ ID NO:4780 -6 -10 39.6 -4 0 -5.2
AAAAAACCCCAGAGCCCAAT 8493 SEQ ID NO:4781 -6 -23.8 62.8 -17.8 0 -3.2
AACAAAAAACCCCAGAGCCC 8496 SEQ ID NO: 4782 -6 -24 63.3 -18 0 -3.2
AATTATATATATTTTAAACT 8535 SEQ ID NO:4783 -6 -11.9 43.6 -5.9 0 -5.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo AGTTTGTTGTAAAATTCATG 8600 SEQ ID NO: 4784 -6 -16.7 54.1 -10 -0.4 -5.2
ATTGAAAGCTATTGTAGGTG 8747 SEQ ID NO:4785 -6 -19.1 59.3 -13.1 0 -5.1
TTATATAATGCATTTAAGTA 8871 SEQ ID NO: 4786 -6 -15.1 50.4 -8.4 0 -8.8 CTCTGCTTATGCCTCCGCTT 5 SEQ ID NO:4787 -5.9 -29.4 80.5 -22.6 -0.8 -5
CCAGAATCCTCTCTGCTTAT 15 SEQ ID NO:4788 -5.9 -25 71.9 -18.1 -0.9 -4.5
CTTACAATATCCCTAGAAGA 335 SEQ ID NO: 4789 -5.9 -20.1 60 -14.2 0 -3.8
CCCTTCTGTGAATTATCTCA 361 SEQ ID NO: 4790 -5.9 -23.6 68.9 -17.2 -0.1 -3.2
GCATACGAATTACCTTAGAT 415 SEQ ID NO: 4791 -5.9 -20.4 60.2 -14.5 0 -3.4
TAGGGATCCAGGTCCTCCAG 700 SEQ ID NO: 4792 -5.9 -28.6 80.7 -20.7 -2 -10.3
CTTTCCTTTATTCATTACTA 743 SEQ ID NO:4793 -5.9 -20.1 62.3 -14.2 0 -0.7
TACAAGGCAGAGGTGGCACT 778 SEQ ID NO: 4794 -5.9 -25.4 73 -18.6 -0.8 -4.5
ATTTTCCTAACAGGGTTTAG 811 SEQ ID NO: 795 -5.9 -21 63.8 -14.6 -0.1 -3.6
TTCTTTGTCCAGTCAGGAGG 919 SEQ ID NO:4796 -5.9 -25.2 75.8 -17.9 -1.3 -4.7
7AATGTTCTCAACGCTGAGAC 1105 SEQ ID NO: 4797 -5.9 -21.4 63.2 -13 -2.5 -7.9
ATGAACAGCTGCAGCCCAAT 1261 SEQ ID NO:4798 -5.9 -25.8 70.6 -17.4 0 -13.2
GGCCACTGCAAACATTTATT 1294 SEQ ID NO: 4799 -5.9 -22.8 65 -15.4 -1.4 -7
AAAACATAAAAGTGACTGTC 1435 SEQ ID NO:4800 -5.9 -14.9 49.1 -9 0 -6
GTTGGGGTTTCGACCAGCCT 1532 SEQ ID NO:4801 -5.9 -29.7 81.5 -21.9 -1.9 -7
CAGGACAAAAAATATCATGT 1670 SEQ ID NO:4802 -5.9 -15.9 50.7 -10 0 -4.7
GCTGCCGCAACTGCCTGAGC 1846 SEQ ID NO:4803 -5.9 -31.3 82 -24.5 -0.8 -6.4
TACTCAAGAGAGACTGATGA 2136 SEQ ID NO:4804 -5.9 -19.3 59.7 -11.8 -1.5 -5.4
GATACTCAAGAGAGACTGAT 2138 SEQ ID NO:4805 -5.9 -19.3 59.8 -11.8 -1.5 -5.4
TCTGACTTCCGTTTCAGTGG 2498 SEQ ID NO:4806 -5.9 -25.2 73.6 -18.1 -1.1 -5.7
ACAGCAAAAATGAAGACGAT 3145 SEQ ID NO:4807 -5.9 -16.7 51.5 -10.8 0 -4.1
AGAACCACAAGGTTTCCAAT 3379 SEQ ID NO:4808 -5.9 -22 63.2 -13.5 -2.6 -7.6
AGAGGTTCAGAACCACAAGG 3387 SEQ ID NO:4809 -5.9 -22.4 65.6 -13.8 -2.7 -12
GCAGATTATTCATTTCATTG 3465 SEQ ID NO:4810 -5.9 -19.5 60.8 -13.1 -0.2 -3.7
TTTTGGCTTTCTAAAAAAGG 3557 SEQ ID NO:4811 -5.9 -17.1 53.8 -9.7 -1.4 -5.5
CCACTGGTGGTTCCATTCCC 3670 SEQ ID NO:4812 -5.9 -30.3 82.5 -23.2 -1.1 -9.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TGAATGACATATAATCATTT 3732 SEQ ID NO:4813 -5.9 -15.4 50.5 -7.6 -1.9 -8.1
TTCAGTTTCAGCTTGTTCAC 3926 SEQ ID NO:4814 -5.9 -23.1 71.7 -17.2 0 -4.5
GTCTTCTTCGGGTTCAGTTT 3938 SEQ ID NO:4815 -5.9 -25.4 77.2 -19.5 0 -3
GATCAAGAAATCTAGCCAGC 4289 SEQ ID NO: 4816 -5.9 -21.5 63.4 -15.6 0 -4.7
GAGGGAATTGCTCCAACAAG 4453 SEQ ID NO: 4817 -5.9 -22.3 64 -14.6 -1.8 -5.2
TAGAGGGAATTGCTCCAACA 4455 SEQ ID NO:4818 -5.9 -22.7 65.6 -15.7 -1 -6.1
ACAGGCTGAAGTTTAACATC 4762 SEQ ID NO: 4819 -5.9 -20.4 62 -14.5 0 -4.5
ATATACAGGCTGAAGTTTAA 4766 SEQ ID NO:4820 -5.9 -18.5 57.7 -12.6 0 -3.9
GTTCCTCTGTCATAAAGATG 4917 SEQ ID NO:4821 -5.9 -21.1 64.1 -14.7 -0.1 -3.5
TCATCCGTTTCCACCATCAT 5098 SEQ ID NO:4822 -5.9 -26.8 74.1 -20.9 0 -2.1
ACAAATTCTCCAGTGAACAG 5173 SEQ ID NO:4823 -5.9 -20 60 -14.1 0 -3.9
ACAACGCAGGAAGGGACATC 5418 SEQ ID NO:4824 -5.9 -23.1 65.4 -17.2 0 -3.3
GGTCTCAAAGTTGAACATGT 5534 SEQ ID NO:4825 -5.9 -20.7 62.8 -13.9 -0.8 -6.8
ATTGTGTCAGGGTCACAGTC 5644 SEQ ID NO: 826 -5.9 -24.8 76.3 -17.3 -1.6 -5.8
GCCAGGGTGAATTGTGTCAG 5654 SEQ ID NO:4827 -5.9 -25.6 74.2 -19.7 0 -3.8
GGGCTCTGCACTTTCTTCAG 5804 SEQ ID NO:4828 -5.9 -26.7 78.8 -19.9 -0.7 -6.4
TCTATAAACTGGGTCGCATC 5878 SEQ ID NO:4829 -5.9 -22.1 65 -16.2 0 -3.6
AGATCCATGGCAATAAGCTG 5968 SEQ ID NO:4830 -5.9 -22.4 64.8 -15.1 -1.3 -8
CCGGTCACCACTGACCATGG 5990 SEQ ID NO:4831 -5.9 -29 76.4 -18.7 -4.4 -10.3
GGGTTTGATGCCATAAACCT 6100 SEQ ID NO:4832 -5.9 -24.3 68.1 -15.3 -3.1 -9.5
GCTTTAAAAGATAACATCTG 6204 SEQ ID NO:4833 -5.9 -16.3 52.2 -9.5 -0.8 -6.5
TCTTTCTCAAACTTTTCCTT 6403 SEQ ID NO:4834 -5.9 -21.3 64.7 -15.4 0 -1.7
TATACTTTACCTTCATAGGC 6514 SEQ ID NO: 4835 -5.9 -21.4 64.9 -14.3 -1.1 -3.7
TTTCTCCTCAGCAGTGTCAG 6695 SEQ ID NO:4836 -5.9 -25.9 78.3 -20 0 -4.2
AAAAATAGAATGGATGCAAG 6792 SEQ ID NO:4837 -5.9 -14.4 47.6 -8.5 0 -5.6
TTTTTCTGGTTTTGAGCAAA 6997 SEQ ID NO:4838 -5.9 -20.1 61.7 -14.2 0 -5.5
TAGCCATTACAATTCTTTTT 7012 SEQ ID NO:4839 -5.9 -20 61 -14.1 0 -3.2
AAATGGAAGTAACTGAAACT 7033 SEQ ID NO: 4840 -5.9 -15.3 49.6 -9.4 0 -3
TATTTGATTTAATAGAAGTT 7449 SEQ ID NO:4841 -5.9 -14.6 49.6 -8.7 0 -2.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GCCTTTAAACTATGTTTAAT 7528 SEQ ID NO: 4842 -5.9 -18.4 56.7 -10.4 -2.1 -8
ATTATTTATATTTAAACAAG 7834 SEQ ID NO:4843 -5.9 -12.1 44 -5.6 -0.3 -4.9
ATAAAGTTGATTATATTTTT 7856 SEQ ID NO:4844 -5.9 -14.1 48.5 -8.2 0 -2.6
AATAAATTGTGATGTCATCA 7914 SEQ ID NO:4845 -5.9 -16.9 53.9 -10.1 -0.8 -6.7
AAGTCCATGTTATATTTGTA 8244 SEQ ID NO: 4846 -5.9 -19.4 60.6 -13.5 0 -3.8
TGTTAGGTAATTGCACAACT 8294 SEQ ID NO: 4847 -5.9 -20.3 61.5 -14.4 0 -6.1
TTCAATACACTACAGTAAAT 8376 SEQ ID NO:4848 -5.9 -16.3 52.5 -10.4 0 -3.6
ATAAAAAATGAAATTTATTC 8461 SEQ ID NO:4849 -5.9 -9.8 39.3 -3 -0.7 -5.2
TTAAACTGCCAACAGCAAAA 8522 SEQ ID NO: 4850 -5.9 -18.6 55 -11.2 -1.4 -6.6
TTAATTATATATATTTTAAA 8537 SEQ ID NO:4851 -5.9 -10.6 41 -4.7 0 -6.2
TTTATTAATTATATATATTT 8541 SEQ ID NO:4852 -5.9 -12.1 44.3 -6.2 0 -5.2
ATTATCAAACCTGAAAGTTG 8715 SEQ ID NO: 4853 -5.9 -17.1 53.5 -10.5 -0.4 -3.6
TAGGAGTTTATATAATGCAT 8878 SEQ ID NO:4854 -5.9 -17.8 56.6 -11.9 0 -7
ACATAAATCCAAGGGTTCTT 8955 SEQ ID NO:4855 -5.9 -20.7 61.6 -14.8 0 -3.8
ATCCTCTCTGCTTATGCCTC 10 SEQ ID NO:4856 -5.8 -27.5 79.7 -20.8 -0.8 -4.6
TCTCTGTGGATAAGAAAACA 46 SEQ ID NO:4857 -5.8 -18 55.9 -12.2 0 -2.8
AGCATCCAAGATGGTTAGGG 163 SEQ ID NO: 4858 -5.8 -24.1 70 -16.8 -1.4 -6.2
CCTTTCCCAGTAAGCCACTC
304 SEQ ID NO:4859 -5.8 -28.4 78.1 -22.6 0 -3.4 TCCTTTCCCAGTAAGCCACT
305 SEQ ID NO:4860 -5.8 -28.4 78.1 -22.6 0 -3.4 CTCCTTTCCCAGTAAGCCAC
306 SEQ ID NO:4861 -5.8 -28.4 78.1 -22.6 0 -3.2 TACAATATCCCTAGAAGAGA
333 SEQ ID NO:4862 -5.8 -19.7 59.2 -13.9 0 -3.8
AGGTCCCTTCTGTGAATTAT 365 SEQ ID NO:4863 -5.8 -24 70.4 -18.2 0 -4
AAAAGCTCCAGGTCCCTTCT 374 SEQ ID NO: 4864 -5.8 -26.8 74.4 -21 0 -5
GAACTCTGAATGTTCTCAAC 1113 SEQ ID NO: 4865 -5.8 -19.4 59.8 -12.3 -1.2 -6.2
TACCGACTGGATCAGGGCCC 1184 SEQ ID NO: 4866 -5.8 -29.5 78.2 -22.1 -0.8 -11.1
TTTACCGACTGGATCAGGGC 1186 SEQ ID NO:4867 -5.8 -25.7 72.1 -19 -0.8 -5.3
TGTCATCTCCAATGTAATCC 1419 SEQ ID NO:4868 -5.8 -22.6 66.7 -16.2 -0.3 -3
TCTCTCCTGCTTTCGCCGTC 2278 SEQ ID NO:4869 -5.8 -30.2 83.5 -23.7 -0.5 -3.6
CATACTGGCCTGACTAACGT 2342 SEQ ID NO:4870 -5.8 -24.3 68 -18.5 0 -7.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CAAATCTATACCAGCATGGC 2652 SEQ ID NO:4871 -5.8 -22.4 64.6 -14.6 -2 -7.3
TACAGTCATCATTGATCTTG 3210 SEQ ID NO:4872 -5.8 -20.1 62.7 -14.3 0 -5.6
CCGTGGGAGCGTACAGTCAT 3221 SEQ ID NO:4873 -5.8 -27.7 76.3 -21 -0.7 -4.8
CTCCATACAGTCCCACATGG 3311 SEQ ID NO: 4874 -5.8 -27 74.8 -20.3 -0.8 -5.2
AAAAAAGGCTTTTTGGAAAC 3545 SEQ ID NO: 4875 -5.8 -15.4 49.6 -8.2 -1.3 -7.7
AGCAGGTTTTTCGAAGATTC 4050 SEQ ID NO:4876 -5.8 -21.5 65 -15 -0.4 -6.8
TGTTC7AATGTATATATCTTC 4147 SEQ ID NO:4877 -5.8 -17.8 57.7 -12 0 -3.9
AAAGCTCTTAATGTCCGTAA 4378 SEQ ID NO:4878 -5.8 -20.3 60.1 -14.5 0 -5
ATACATAATATCCATCCAGC 4724 SEQ ID NO: 4879 -5.8 -21.3 62.8 -15.5 0 -2.8
GCTGGTTGAAGTTATCTATG 4872 SEQ ID NO:4880 -5.8 -21.1 64.8 -15.3 0 -2.8
CCACCATCATGGTGACCATG 5088 SEQ ID NO:4881 -5.8 -26.6 72.6 -17.1 -3.7 -11.1
TCATCTCAGCCAGAAACATA 5280 SEQ ID NO:4882 -5.8 -21.8 64.2 -16 0 -3.6
GCAATAAGCTGGACTTTGTT 5959 SEQ ID NO: 4883 -5.8 -21.9 64.9 -15.4 -0.5 -5.1
TATAGTTACTTGATATATTT 6234 SEQ ID NO:4884 -5.8 -15.8 52.8 -10 0 -4.3
CTTTGCTTTCTTTTTCTGGT 6426 SEQ ID NO:4885 -5.8 -23.4 71.6 -17.6 0 -3.6
ATACTTTACCTTCATAGGCT 6513 SEQ ID NO:4886 -5.8 -22.6 67.5 -15.6 -1.1 -3.7
TACAAAAATAGTGACATAGC 6891 SEQ ID NO:4887 -5.8 -15.7 50.9 -9.9 0 -3.5
CATTTACAAAAATAGTGACA 6895 SEQ ID NO:4888 -5.8 -15.1 49.4 -8.6 -0.5 -4.8
ACCTAAATTAAATATAGAGC 7208 SEQ ID NO:4889 -5.8 -15.6 50.6 -9.8 0 -3
TGTGACATTCTTTAACCAAG 7612 SEQ ID NO:4890 -5.8 -19.5 59.2 -13.7 0 -2.9
CATAAAGTAAAATAAATTGT 7924 SEQ ID NO:4891 -5.8 -11.4 42.2 -5.6 0 -3.2
CACAACTTTGCCACTTTGTT 8281 SEQ ID NO: 4892 -5.8 -23.3 67.3 -17 -0.2 -3.8
CTTTTGGCTCAATAATGACG 8442 SEQ ID NO: 4893 -5.8 -20.1 59.5 -13.6 -0.5 -5.3
TTATGGGAGAATTATGAAAT 9058 SEQ ID NO:4894 -5.8 -15.7 50.9 -9.9 0 -3.2
CTATAAAAGTTTTCTTATTG 726 SEQ ID NO:4895 -5.7 -14.9 50.2 -8.1 -1 -6.3
TGTACTCTACATTCTTTGTC 930 SEQ ID NO:4896 -5.7 -21.1 66.5 -14.7 -0.4 -5.4
GGTCTTTTTGCCCATCCAAA 1452 SEQ ID NO: 4897 -5.7 -26.3 72.8 -20.1 -0.2 -3.5
AATAAAATGAGCCCAAGAAA 1695 SEQ ID NO:4898 -5.7 -16.5 50.8 -10.8 0 -3.2
ATTGCGTCTTGGGGAAAACA 2168 SEQ ID NO:4899 -5.7 -22.3 63.7 -16.6 0 -5.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AAGTTGTCCAGTAGGTGACG 2462 SEQ ID NO: 4900 -5.7 -23.8 69.9 -17.4 -0.4 -5.2
GGTATTTAAGACAATGCAAA 2774 SEQ ID NO:4901 -5.7 -17.2 53.8 -11 -0.1 -5.6
TAAACTGAGGCTGACAATAA 2960 SEQ ID NO:4902 -5.7 -17.7 54.5 -12 0 -3.7
GTCGTTCATGTGCCACCGTG 3236 SEQ ID NO:4903 -5.7 -28.7 78.4 -23 0 -4.7
ATCAATTCCCTTTTGCATTC 3500 SEQ ID NO: 4904 -5.7 -23.1 67.6 -17.4 0 -5.1
TTCAAAGGCCAATGCACCAC 4130 SEQ ID NO:4905 -5.7 -24.4 67.2 -17.2 -1.4 -7.7
CTTTGTCAGCATATTCTAGC 4188 SEQ ID NO:4906 -5.7 -22.5 69.1 -16.8 0 -4.1
CTGAGTAGCCAAGAGCATTG 4338 SEQ ID NO:4907 -5.7 -23.4 68.3 -16.2 -1.4 -4.6
CCAACAAGAGCATTCACAAC 4441 SEQ ID NO:4908 -5.7 -20.9 60.8 -14.6 -0.3 -4.1
GACAGTCACTCAAATTGTTA 4605 SEQ ID NO:4909 -5.7 -19.7 60.8 -14 0 -5.7
ACATCTCGTGAATCAACAGC 4747 SEQ ID NO: 4910 -5.7 -21.6 63.6 -15.9 0 -4.6
GGTTGAAGTTATCTATGATG 4869 SEQ ID NO:4911 -5.7 -19 59.8 -13.3 0 -3.2
ACAACCAGGAAGGATATGAT 5737 SEQ ID NO: 4912 -5.7 -20.3 59.9 -13.8 -0.6 -4.5
CTCCAGGATGACCGCGATGT 5768 SEQ ID NO:4913 -5.7 -27.8 74.1 -21.4 -0.5 -7.2
TCAGTAGCAACACTGAAGTT 5788 SEQ ID NO:4914 -5.7 -21 63.7 -13.4 -1.9 -7.6
CAAGACAGTGGATCCGGTCA 6003 SEQ ID NO:4915 -5.7 -25.2 71.1 -17.9 -1.1 -10.8
CGCTGAATGATAGCGGCAGA 6178 SEQ ID NO:4916 -5.7 -24.6 67.7 -16.2 -2.7 -9.5
TTTTAACCTTTGCTTTAAAA 6215 SEQ ID NO:4917 -5.7 -17.1 53.6 -10.5 -0.7 -4.3
TTTTTTCTGGAGTGGAGTTC 6324 SEQ ID NO: 4918 -5.7 -22.3 69.7 -16.6 0 -2.4
TTGTTTCTTTTTACTTTTGA 6465 SEQ ID NO:4919 -5.7 -18.9 60.6 -13.2 0 -2.2
TAGGCTGTAAACAATTGATC 6499 SEQ ID NO:4920 -5.7 -18.4 57.1 -12.7 0 -7.2
TTTACCTTCATAGGCTGTAA 6509 SEQ ID NO: 4921 -5.7 -22 65.8 -15.1 -1.1 -4.5
TTTGTTAAAACAGTCAGTTT 6568 SEQ ID NO:4922 -5.7 -17.7 56.6 -10.5 -1.4 -5.9
TCCTCAGCAGTGTCAGCTGG 6691 SEQ ID NO: 4923 -5.7 -28.3 82.9 -19.8 -2.8 -9.2
TTGTAAAAATATGGCAGATA 6820 SEQ ID NO: 4924 -5.7 -15.9 51.2 -10.2 0 -4
AAAATAGTGACATAGCATTA 6887 SEQ ID NO:4925 -5.7 -16.3 52.4 -10.6 0 -4.1
AAGCATTTGACCTAAATTAA 7217 SEQ ID NO:4926 -5.7 -17.1 53.2 -10.8 -0.3 -4
ATATGTGACATTCTTTAACC 7615 SEQ ID NO: 4927 -5.7 -19.2 59.2 -13.5 0 -3.9
TTGAATTAAAAGTGCAAAAG 7712 SEQ ID NO: 4928 -5.7 -13.3 45.7 -7.6 0 -5.4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo AAAATATGAAGAATAGGTTT 7795 SEQ ID NO: 4929 -5.7 -13.7 46.8 -8 0 -2.7
TAAAGTAAAATAAATTGTGA 7922 SEQ ID NO:4930 -5.7 -11.3 42.1 -5.6 0 -3.2
TCAAAAGTTTGGAATTGTGA 7964 SEQ ID NO:4931 -5.7 -17.4 54.7 -11.2 -0.1 -6.9
GAAATTATCCATTGAAAAAT 7993 SEQ ID NO:4932 -5.7 -14 46.8 -7.7 -0.3 -3.8
GTGTTTGACCAATGTATCTC 8083 SEQ ID NO:4933 -5.7 -22 66.7 -16.3 0 -3.4
AAAAACATCTATGAATAAAA
8150 SEQ ID NO:4934 -5.7 -10.6 40.6 -4.9 0 -2.9 AAAAAACATCTATGAATAAA
8151 SEQ ID NO:4935 -5.7 -10.6 40.6 -4.9 0 -3.8 GCAATAAAAAATGAAATTTA
8464 SEQ ID NO:4936 -5.7 -11.1 41.5 -4.1 -1.2 -5.7
ATTTTAAACTGCCAACAGCA 8525 SEQ ID NO:4937 -5.7 -20.9 60.9 -13.6 -1.5 -7.3
TGAAAGCTATTGTAGGTGGT 8745 SEQ ID NO:4938 -5.7 -21.4 64.8 -15.7 0 -5.1
CTCTGATAAAACAGAGCCTT 207 SEQ ID NO:4939 -5.6 -20.7 61.2 -12.7 -2.4 -7.6
ATCTCTGATAAAACAGAGCC 209 SEQ ID NO:4940 -5.6 -20.1 60.3 -11.5 -3 -8.7
TCTTGCTCCATAATCTCTGA 221 SEQ ID NO: 4941 -5.6 -23.4 69.4 -17.8 0 -3.6
CTTCAGTTTTCTTGCTCCAT 230 SEQ ID NO: 4942 -5.6 -24.8 74.1 -19.2 0 -4.4
TCCCTTCTGTGAATTATCTC 362 SEQ ID NO:4943 -5.6 -23.3 69.4 -17.2 -0.1 -3.2
GTTTTTCGATAGCAGCAAGA 534 SEQ ID NO: 4944 -5.6 -22 65.4 -16.4 0 -5.4
TGTTCTCATCATCATTATCT 594 SEQ ID NO:4945 -5.6 -21 65.8 -15.4 0 -1.7
ATGGAAGGTTCTTTCCAGCT 639 SEQ ID NO:4946 -5.6 -24.9 72.9 -16.2 -3.1 -9.4
TTCCTAACAGGGTTTAGTGG 808 SEQ ID NO:4947 -5.6 -23.2 69 -16.7 -0.7 -4.1
GTACTCTACATTCTTTGTCC 929 SEQ ID NO:4948 -5.6 -23.1 70.8 -16.9 -0.3 -4.6
CGAAGAAACGTAAAATCTTC 1012 SEQ ID NO:4949 -5.6 -15.5 49.4 -8.1 -1.8 -8
AAGCTTCTTTACCGACTGGA 1193 SEQ ID NO:4950 -5.6 -23.8 67.9 -17.3 -0.7 -7.3
TCCTTCCAGTTAAATGTGCT 1402 SEQ ID NO:4951 -5.6 -24 69.6 -18.4 0 -5.6
TCGGCCTCTTTTTGTTCTGC 1783 SEQ ID NO:4952 -5.6 -27.2 78.4 -21.6 0 -6.7
CTGAAATCTCTTGAAGCAGC 1870 SEQ ID NO:4953 -5.6 -21 62.8 -15.4 0 -4.1
AAGAGAGACTGATGAGGGGA 2131 SEQ ID NO:4954 -5.6 -21.6 64.4 -16 0 -2.2
TGCGGCACAAACAGTGAGTC 2296 SEQ ID NO:4955 -5.6 -24.1 68.6 -17.6 -0.8 -7.2
CACCATTGCAATCCACAGTG 2409 SEQ ID NO:4956 -5.6 -24.7 69.1 -18.5 0 -8.6
TCTATACCAGCATGGCGGAC 2648 SEQ ID NO:4957 -5.6 -25.9 72.3 -18.3 -2 -7.4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CCGGTTTAAAGTCTTCTTCG 3948 SEQ ID NO:4958 -5.6 -22.9 66 -16.6 -0.5 -6.2
TTTGAGAAGCATTTCCAGAA 4226 SEQ ID NO:4959 -5.6 -20.4 61.2 -14.2 -0.3 -4.1
TCAAACCGGGATAAGGCTCT 4408 SEQ ID NO:4960 -5.6 -23.9 66.6 -18.3 0 -6.2
TCCAGCCTTTAAATGTGGCC 4710 SEQ ID NO:4961 -5.6 -26.5 73.1 -19.1 -1.8 -8.6
TTTGCTCCTTTGATCAGACG 5368 SEQ ID NO:4962 -5.6 -23.7 68.6 -18.1 0 -6.5
CACCACAACCAGGAAGGATA 5741 SEQ ID NO: 4963 -5.6 -23.3 65 -16.9 -0.6 -4.3
GCATCGGGATCAAACTTTTC 5863 SEQ ID NO:4964 -5.6 -22.2 64.7 -16.6 0 -5.3
AGGCTGTAAACAATTGATCA 6498 SEQ ID NO:4965 -5.6 -19.4 58.8 -13.8 0 -7.2
CTTTGCACAACTATCCCTAT 6734 SEQ ID NO:4966 -5.6 -23.6 67.4 -18 0 -5
TGTAAAAATATGGCAGATAT 6819 SEQ ID NO:4967 -5.6 -15.8 50.9 -10.2 0 -4.4
CAATATGTGACATTCTTTAA 7617 SEQ ID NO:4968 -5.6 -17 54.2 -11.4 0 -3.9
TCAAATTATTCTGCTTGACA 7671 SEQ ID NO:4969 -5.6 -19.2 59 -13.6 0 -3.6
TGGAATTGTGATTAAAAATC 7955 SEQ ID NO:4970 -5.6 -14.4 48.2 -8.1 -0.5 -4.1
AAAGTTTGGAATTGTGATTA 7961 SEQ ID NO:4971 -5.6 -16.8 53.8 -11.2 0 -3.7
AAGAAGATGAGTTTAGATGC 8791 SEQ ID NO:4972 -5.6 -17.9 56.7 -12.3 0 -2.6
CATCAATTATATTGAAAGAA 8806 SEQ ID NO:4973 -5.6 -13.8 47 -6.2 -2 -6.6
TAGCATCAATTATATTGAAA / 8809 SEQ ID NO:4974 -5.6 -15.4 50.5 -8.2 -1.5 -8.1
TAAATTCTCAATAACTATAT
8919 SEQ ID NO:4975 -5.6 -13.6 46.9 -8 0 -3.1 ATAAATTCTCAATAACTATA
8920 SEQ ID NO:4976 -5.6 -13.6 46.9 -8 0 -3.1 TATAAATTCTCAATAACTAT
8921 SEQ ID NO:4977 -5.6 -13.6 46.9 -8 0 -3.1 ACAATTTTTTTTCTTTCTTT
65 SEQ ID NO:4978 -5.5 -17.9 57.7 -12.4 0 -2.6
CATCCCTGTCAAACCTTGAT 259 SEQ ID NO: 4979 -5.5 -24.7 68.8 -18 -1.1 -4.5
TTGATAGCAATTTTCCTAAC 820 SEQ ID NO:4980 -5.5 -19 58.3 -13 -0.1 -0.2
GTTGCTCAAGGTCATAAATA 899 SEQ ID NO:4981 -5.5 -19.9 60.9 -14.4 0 -3.6
TACATTCTTTGTCCAGTCAG 923 SEQ ID NO:4982 -5.5 -22.8 69.6 -16.7 -0.3 -3.1
TCCAGTGAATGTGTACTCTA 941 SEQ ID NO:4983 -5.5 -22.4 67.6 -16.9 0 -4.9
CTCTGTCACATATGCCATCA 1067 SEQ ID NO:4984 -5.5 -24.7 71.9 -19.2 0 -6.5
GAAATTGTTTTCAGTGCTCG 1135 SEQ ID NO:4985 -5.5 -21 63 -14 -1.4 -6.4
AACAAATGTCCCATTTGAAT 1370 SEQ ID NO:4986 -5.5 -19.2 56.9 -9.9 -3.8 -10.4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GTATCCTTCTGGACACTGGC 1502 SEQ ID NO:4987 -5.5 -26.4 76.6 -19.5 -1.3 -5.3
GCTTGTGTAGCCATAGTTGG 1547 SEQ ID NO:4988 -5.5 -25.6 75.5 -19 -1 -4.8
GTCATGAGTCGAAATAGAGA
1594 SEQ ID NO: 4989 -5.5 -19.4 59.5 -13.9 0 -6.6 AGTCATGAGTCGAAATAGAG
1595 SEQ ID NO:4990 -5.5 -18.8 58.4 -13.3 0 -6.6 CCAGGACAAAAAATATCATG
1671 SEQ ID NO:4991 -5.5 -16.7 51.7 -11.2 0 -4.1
GAAAAGGAAGCTGCTTCTTT
2069 SEQ ID NO:4992 -5.5 -20.6 61.5 -12.4 -1.8 -13.5 AGAAAAGGAAGCTGCTTCTT
2070 SEQ ID NO:4993 -5.5 -20.5 61.3 -12.4 -1.8 -13.3 AGACTGATGAGGGGAGCAGA
2126 SEQ ID NO:4994 -5.5 -24.2 70.8 -18 -0.5 -4.1
ATGTTTTACTTTTAACCATG 2705 SEQ ID NO:4995 -5.5 -18.5 57.6 -13 0 -3.9
GTATTTAAGACAATGCAAAT 2773 SEQ ID NO:4996 -5.5 -16 51.4 -10 -0.1 -5.6
CAGGTTTCCTACAGTCAACA 2843 SEQ ID NO:4997 -5.5 -23.7 69.8 -17.7 -0.2 -3.9
TGAGAACCATTTCTGCTGTG 2880 SEQ ID NO:4998 -5.5 -22.8 66.9 -15.9 -1.3 -5.8
GCAATGATCTTGAGAACCAT 2890 SEQ ID NO:4999 -5.5 -21.2 62.1 -15 -0.4 -6.2
TCCATTAAACTGAGGCTGAC 2965 SEQ ID NO:5000 -5.5 -21.9 64 -16.4 0 -3.7
GAGGTTCAGAACCACAAGGT 3386 SEQ ID NO:5001 -5.5 -23.6 68.5 -15.4 -2.7 -12
TGTCATCATCAGTAGCAGCA 3447 SEQ ID NO: 5002 -5.5 -24.4 73.7 -18.9 0 -5.4
CACTACTGAGAAGGATCATG 4113 SEQ ID NO: 5003 -5.5 -20 60.7 -13.8 -0.5 -5.9
CAGAATGAATATATAGGTAA 4211 SEQ ID NO: 5004 -5.5 -15 49.7 -9.5 0 -4.2
GAGAAGCATTTCCAGAATGA 4223 SEQ ID NO:5005 -5.5 -20.8 61.8 -13.7 -1.6 -6
GTCCGTAATGATTTGATGGC 4366 SEQ ID NO:5006 -5.5 -23 66.5 -17.5 0 -3.3
GCAGTGCAAGATAGCCAGCG 4683 SEQ ID NO:5007 -5.5 -26.9 74.4 -20.7 -0.2 -8.9
CATATACAGGCTGAAGTTTA 4767 SEQ ID NO:5008 -5.5 -19.9 61 -14.4 0 -4.1
AAAGATGTTCCAGCCTATAG 5228 SEQ ID NO:5009 -5.5 -21.7 63.9 -16.2 0 -4.7
ACCAGGAAGGATATGATGAT 5734 SEQ ID NO:5010 -5.5 -20.7 61.3 -14.4 -0.6 -4
TTTAGAGAACTCTATAAACT 5888 SEQ ID NO:5011 -5.5 -15.9 52.1 -9.7 -0.3 -8
TTGGAGGGGTTTGATGCCAT 6106 SEQ ID NO: 5012 -5.5 -26 74 -19.4 -1 -4.8
GGTGGTAGAGGAACTCCCAT 6347 SEQ ID NO:5013 -5.5 -26.4 74.8 -18 -2.9 -8.2
CACTATCATAGGAAGGAGGA 6369 SEQ ID NO: 5014 -5.5 -21 63.1 -15.5 0 -3.4
TTGTTAAAACAGTCAGTTTG 6567 SEQ ID NO:5015 -5.5 -17.6 56.2 -10.5 -1.6 -7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
GACTATGAGTATTTGTTAAA 6579 SEQ ID NO: 5016 -5.5 -16.7 54.1 -10.7 -0.1 -3
TTAAAGCCATCTAGAAAATG 7048 SEQ ID NO:5017 -5.5 -16.4 51.8 -10.9 0 -6.2
TTCAGATAGAAACAAACATA 7090 SEQ ID NO:5018 -5.5 -14.8 49 -9.3 0 -3.4
TAACATAGGGTATTTAATTG 7367 SEQ ID NO:5019 -5.5 -16.2 52.6 -10.7 0 -2.9
ACATATTTTTAGCAAAATAT 7808 SEQ ID NO:5020 -5.5 -14.8 49.2 -6.8 -2.5 -7.8
CATTATTTATATTTAAACAA 7835 SEQ ID NO:5021 -5.5 -12.8 45.2 -7.3 0.2 -4.9
AAGTTGATTATATTTTTACA 7853 SEQ ID NO: 5022 -5.5 -15.7 52.1 -10.2 0 -2.6
TAGTGCAGCAGGAATTAAAA 8217 SEQ ID NO: 5023 -5.5 -18.7 57.1 -13.2 0 -6.6
TAATAGCTTTAGTGCAGCAG 8226 SEQ ID NO: 5024 -5.5 -21.5 65.4 -15.1 -0.7 -6.6
TCCCTGCATGCAGTTCTTCA 8392 SEQ ID NO: 5025 -5.5 -28.1 80.1 -19.5 -0.2 -14.3
TTATCAAACCTGAAAGTTGG 8714 SEQ ID NO:5026 -5.5 -18.3 55.9 -12.1 -0.4 -3.6
ATTCTCAATAACTATATCAT 8916 SEQ ID NO:5027 -5.5 -16.4 53.3 -10.9 0 -2.4
TCCAAGGGTTCTTGAAAAAA 8948 SEQ ID NO: 5028 -5.5 -18.6 56 -11 -2.1 -5.7
ATATGCATTACAACTGGAGT 9009 SEQ ID NO:5029 -5.5 -20.3 61.4 -14.8 0 -6.8
CACCTTATATAATTTATTAT 9074 SEQ ID NO:5030 -5.5 -16 52 -9.8 -0.4 -5.3
TCTTCCTCTGGCAGCTGTTC 134 SEQ ID NO: 5031 -5.4 -28.1 83.2 -22 0 -8.9
GCCCAGCATCCAAGATGGTT 167 SEQ ID NO: 5032 -5.4 -28.5 77.6 -21.6 -1.4 -6.2
GCTTCAGTTTTCTTGCTCCA 231 SEQ ID NO:5033 -5.4 -26.6 78.8 -21.2 0 -4.4
CTCTTCTGCAGCACGTTTTT 548 SEQ ID NO: 5034 -5.4 -25.2 73.6 -19.3 0 -7.7
AAGGCAGAGGTGGCACTGAA 775 SEQ ID NO: 5035 -5.4 -24.7 70.6 -18.4 -0.8 -4.7
GAAGAAACGTAAAATCTTCT 1011 SEQ ID NO:5036 -5.4 -15.6 50.2 -8.1 -2.1 -8.6
AGACAGAACACAGTCAGGAT 1225 SEQ ID NO:5037 -5.4 -21.3 64.1 -14.4 -1.4 -4.6
CAGATTGCCCATGAACAGCT 1271 SEQ ID NO:5038 -5.4 -25.4 70.4 -19.5 -0.2 -4.5
AAATGACCAGGACAAAAAAT 1677 SEQ ID NO:5039 -5.4 -15.3 48.6 -9.9 0 -4
GCCACCACAGCCAGGATCAA 1723 SEQ ID NO: 5040 -5.4 -29 77.3 -23.6 0 -5.3
CTTCTTCCAAGGTGGCCTGA 1764 SEQ ID NO: 5041 -5.4 -27.7 77.7 -21.4 -0.7 -7.2
TGCTGCCGCAACTGCCTGAG 1847 SEQ ID NO: 5042 -5.4 -29.5 77.7 -22.8 -1.2 -7.1
CATCATCAGCAAAGTCATTT 2241 SEQ ID NO: 5043 -5.4 -20.5 62.2 -15.1 0 -4.1
GAATGCTGGCTATGCTCACG 2586 SEQ ID NO: 5044 -5.4 -25 70.2 -18.9 -0.4 -5.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GCATGGCGGACATTTCTGTC 2639 SEQ ID NO:5045 -5.4 -26.1 74.5 -18.8 -1.9 -8.8
ATACCAGCATGGCGGACATT 2645 SEQ ID NO:5046 -5.4 -25.7 70.8 -18.3 -2 -7.4
GATGTTTTACTTTTAACCAT 2706 SEQ ID NO:5047 -5.4 -19.1 58.9 -13.7 0 -2.8
CAATCTGCAGATTATTCATT 3471 SEQ ID NO: 5048 -5.4 -19.5 60 -11.2 -0.2 -14
TCCTACTGCAATCTGCAGAT 3479 SEQ ID NO:5049 -5.4 -24.3 70.1 -15.4 -3.5 -12.2
AAGATAATTAAGCTCTTTGC 3644 SEQ ID NO:5050 -5.4 -18 56.6 -11.9 -0.4 -5.7
TGAGAAGCATTTCCAGAATG 4224 SEQ ID NO:5051 -5.4 -20.2 60.5 -13.5 -1.2 -6
AACCAAAGAAACATCAACGA 4307 SEQ ID NO:5052 -5.4 -16.9 51.3 -11.5 0 -3.5
ATGGCACCGAGTTCTGAGTA 4351 SEQ ID NO: 5053 -5.4 -25.4 72.8 -20 0 -4
TTGATGGCACCGAGTTCTGA 4354 SEQ ID NO: 5054 -5.4 -25.2 71.3 -19.8 0 -4
CATTCATGATAGAGGGAATT 4464 SEQ ID NO: 5055 -5.4 -19.2 59 -13.3 -0.1 -6.4
GCCAGCAAACAAATTCACAC 4529 SEQ ID NO:5056 -5.4 -21.4 61.2 -16 0 -4.1
TAATATTTTTTCTGTTCCTC 4930 SEQ ID NO: 5057 -5.4 -19.5 61.4 -14.1 0 -4.2
CGTTTCCACCATCATGGTGA 5093 SEQ ID NO:5058 -5.4 -26.3 73.1 -17.2 -3.7 -11.1
CTCCAGTGAACAGAACAATG 5166 SEQ ID NO:5059 -5.4 -20.1 59.5 -14.2 -0.1 -3.9
GGGTGAATTGTGTCAGGGTC 5650 SEQ ID NO: 5060 -5.4 -25.1 75.2 -19.7 0 -3.3
AACCAGGAAGGATATGATGA 5735 SEQ ID NO:5061 -5.4 -20 59.3 -13.8 -0.6 -4
AACTCTATAAACTGGGTCGC 5881 SEQ ID NO: 5062 -5.4 -21.4 62.8 -16 0 -2.7
GCTGCAAAATCAGAGAGTTT 5905 SEQ ID NO: 5063 -5.4 -20.8 62.5 -14.7 -0.4 -4.9
TCTTTGTTATAGTTACTTGA 6241 SEQ ID NO: 5064 -5.4 -19 61 -13.6 0 -2.5
TGGAGTTCCCATTTAGTTTG 6312 SEQ ID NO: 5065 -5.4 -23.5 69.8 -17.2 -0.8 -4.4
AACTGTAGCCATTACAATTC 7017 SEQ ID NO: 5066 -5.4 -20.3 61.1 -13.9 -0.9 -3.9
AAATACTTTCAAAATTAAAG 7062 SEQ ID NO: 5067 -5.4 -11 41.5 -5.6 0.4 -4.4
CAGAAGATGGCAAAGCAATA 7321 SEQ ID NO:5068 -5.4 -19 56.9 -12.7 -0.7 -4.3
ATATATATTTGCCCAAACAT 7415 SEQ ID NO: 5069 -5.4 -19.3 57.5 -13.9 0 -5.4
CTTGCAAAAGACACATACAC 7478 SEQ ID NO: 5070 -5.4 -18.6 56.3 -11.7 -1.4 -6.9
GAATGGATTGAGTAAAATAG 7583 SEQ ID NO: 5071 -5.4 -14.9 49.3 -9.5 ' 0 -2.3
TATTTTTAGCAAAATATGAA 7805 SEQ ID NO: 5072 -5.4 -13.8 47.1 -6.8 -1.6 -6
CTATGAATAAAAGGTTATAT 8142 SEQ ID NO: 5073 -5.4 -14 47.6 -8 -0.3 -3.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AAAGAAGATGAGTTTAGATG 8792 SEQ ID NO:5074 -5.4 -15.4 50.9 -10 0 -1.9
ATGTAACATTTATTAGCCAC 8844 SEQ ID NO:5075 -5.4 -19.5 59.6 -14.1 0 -3.6
CTATATCATTAATACCTTAT 8905 SEQ ID NO:5076 -5.4 -17.1 54.5 -11.7 0 -4.2
CATAAATCCAAGGGTTCTTG 8954 SEQ ID NO:5077 -5.4 -20.5 61 -13.4 -1.7 -5.1
ATTGTCTTTAAAAATATGCA 9022 SEQ ID NO: 5078 -5.4 -15.9 51.5 -10.5 0 -5.2
AGAATCCTCTCTGCTTATGC 13 SEQ ID NO: 5079 -5.3 -24.1 71.2 -18.1 -0.4 -4.2
AAATTAGTTACAATTTTTTT 74 SEQ ID NO: 5080 -5.3 -14.2 48.5 -8.3 -0.3 -3.7
CCCAGCATCCAAGATGGTTA 166 SEQ ID NO:5081 -5.3 -26.4 72.9 -20.2 -0.8 -5.7
CTTATGAATTACAGCATAAC 190 SEQ ID NO:5082 -5.3 -17 53.9 -10.6 -1 -5.1
TTTTCGATAGCAGCAAGAGA 532 SEQ ID NO:5083 -5.3 -21.3 63.5 -16 0 -5.4
AAATGGAAGGTTCTTTCCAG 641 SEQ ID NO:5084 -5.3 -20.8 62.2 -12.4 -3.1 -9.4
CAGCTGCAGCCCAATGAGAG 1256 SEQ ID NO:5085 -5.3 -26.9 74.1 -19.1 0 -13.2
TCATCTCCAATGTAATCCTT 1417 SEQ ID NO:5086 -5.3 -22.4 65.9 -16.5 -0.3 -3
TCTGCTCCTCATAGGCCATG 1743 SEQ ID NO:5087 -5.3 -27.8 78.6 -21.8 -0.5 -8.3
TCTTCCAAGGTGGCCTGATT 1762 SEQ ID NO:5088 -5.3 -26.8 75.7 -20.6 -0.7 -7.2
AGCTGATGCTGCCGCAACTG 1853 SEQ ID NO:5089 -5.3 -27.5 74.4 -20.6 -1.6 -8
TCACTGGTCAGTCTGTTTCC 2098 SEQ ID NO:5090 -5.3 -26 78.8 -20.7 0 -6.6
ATACTCAAGAGAGACTGATG 2137 SEQ ID NO:5091 -5.3 -18.7 58.4 -11.8 -1.5 -5.4
TCAGTGGTGGTGCCCTCTGG 2485 SEQ ID NO:5092 -5.3 -30.3 85.9 -23.4 -1.5 -5.8
TTTCAGTGGTGGTGCCCTCT 2487 SEQ ID NO:5093 -5.3 -29.3 84.2 -23.4 -0.3 -5.1
ACATGGTCTCTATCCACTCT 3297 SEQ ID NO:5094 -5.3 -25.1 74.4 -18.9 -0.7 -5.2
GAAAGAGGTTCAGAACCACA 3390 SEQ ID NO:5095 -5.3 -21.1 62 -13.1 -2.7 -12
ATGACATATAATCATTTTCA 3729 SEQ ID NO:5096 -5.3 -16.7 53.8 -10.8 -0.3 -5.1
TCTCCAACAGCAATTGGCAC 3778 SEQ ID NO:5097 -5.3 -24.4 69.2 -17.5 -1.5 -8.1
GAAGGATCATGAACACAATG 4104 SEQ ID NO:5098 -5.3 -17.8 54.8 -12.5 0 -6.9
AATTGCTCCAACAAGAGCAT 4448 SEQ ID NO:5099 -5.3 -21.8 63 -13.1 -3.4 -9.5
CCAAAGATGATAAAGATGAC 4816 SEQ ID NO:5100 -5.3 -16.2 51.2 -10.9 0 -2.1
ATCCAAGTTTCTTCATTGCA 4953 SEQ ID NO: 5101 -5.3 -22.9 68.2 -17.6 0 -4.8
ATGCTGATATCAAAGACTTG 5047 SEQ ID NO:5102 -5.3 -18.5 57.2 -12.7 0 -7.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ACAAAACTAGGGTCATGTAT 5127 SEQ ID NO:5103 -5.3 -19.2 58.7 -13.4 -0.1 -4.7
GCACAAATTCTCCAGTGAAC 5175 SEQ ID NO:5104 -5.3 -21.8 63.7 -15.7 -0.6 -4.6
GTTCCAGCCTATAGTGAAGT 5222 SEQ ID NO: 5105 -5.3 -24.8 72.9 -19.5 0 -5.1
ATACTTTTCTATCATCTCAG 5291 SEQ ID NO: 5106 -5.3 -19.6 62.3 -14.3 0 -1.6
GACACAGAATACTTTTCTAT 5299 SEQ ID NO:5107 -5.3 -18.4 57.7 -12.2 -0.7 -4.4
AACGCAGGAAGGGACATCAT 5416 SEQ ID NO: 5108 -5.3 -22.9 64.9 -17.6 0 -3.6
ATCCAGGGCAGCTGCAAAAT 5915 SEQ ID NO:5109 -5.3 -25.1 69.7 -16.9 -1 -14
AGTGGAGTTCCCATTTAGTT 6314 SEQ ID NO: 5110 -5.3 -24.6 73.4 -18 -1.2 -6.4
ATAGGCTGTAAACAATTGAT 6500 SEQ ID NO: 5111 -5.3 -18 55.8 -12.7 0 -7.2
CAACTATCCCTATAGTCTAG 6727 SEQ ID NO: 5112 -5.3 -21.7 64.9 -14.4 -2 -7.4
GGATGCAAGGACTGTACTAA 6781 SEQ ID NO:5113 -5.3 -21.5 63.6 -16.2 0 -5.6
CTATGAATTGGGGACCATGG 6859 SEQ ID NO: 5114 -5.3 -22.9 65.3 -15.2 -2.4 -8.3
AAACCTCATTTACAAAAATA 6901 SEQ ID NO: 5115 -5.3 -14.5 47.8 -8.5 -0.5 -3
TGGCAAAACACCTTTGTCTG 6964 SEQ ID NO: 5116 -5.3 -22.3 64.2 -14.7 -2.3 -6.6
TTCTTTTTCTGGTTTTGAGC 7000 SEQ ID NO:5117 -5.3 -22.2 69.1 -16.9 0 -2.8
CTGAAACTGTAGCCATTACA 7021 SEQ ID NO:5118 -5.3 -21.3 62.5 -15.1 -0.8 -3.7
TTACAGGCACATAACTGTTC 7107 SEQ ID NO: 5119 -5.3 -21.1 63.8 -14.2 -1.5 -5.2
AGCAGAAGATGGCAAAGCAA 7323 SEQ ID NO: 5120 -5.3 -21.1 61.4 -14.9 -0.8 -5.6
CATAACATAGGGTATTTAAT 7369 SEQ ID NO:5121 -5.3 -16.8 53.6 -11.5 0 -2.9
TTGCAAAAGACACATACACT 7477 SEQ ID NO: 5122 -5.3 -18.6 56.3 -13.3 0 -6.6
AAATAATTTTCTTATGTACA 7888 SEQ ID NO: 5123 -5.3 -14.8 49.7 -9.5 0 -6.4
AAAGTAAAATAAATTGTGAT 7921 SEQ ID NO: 5124 -5.3 -11.6 42.6 -6.3 0 -3.2
TAATTGCACAACTTTGCCAC 8287 SEQ ID NO:5125 -5.3 -21.8 63.1 -16 -0.2 -5
TTTGGCTCAATAATGACGTA 8440 SEQ ID NO: 5126 -5.3 -20 59.7 -14 -0.5 -5.3
AATTGAAAGCTATTGTAGGT 8748 SEQ ID NO:5127 -5.3 -18.4 57.4 -13.1 0 -5.1
TCTCTGCTTATGCCTCCGCT 6 SEQ ID NO: 5128 -5.2 -29.7 81.9 -23.6 -0.8 -4.3
AATTAGTTACAATTTTTTTT 73 SEQ ID NO: 5129 -5.2 -15 50.6 -9.8 0 -2.6
CCTTATGAATTACAGCATAA 191 SEQ ID NO:5130 -5.2 -18.8 57.1 -12.7 -0.8 -4.9
CTTGCTCCATAATCTCTGAT 220 SEQ ID NO: 5131 -5.2 -23 67.7 -17.8 0 -3.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TGCACATTTAATTACGTGTA 442 SEQ ID NO: 5132 -5.2 -19.5 59.2 -13.7 -0.3 -5.4 TTCGATAGCAGCAAGAGATT
530 SEQ ID NO: 5133 -5.2 -21.2 63.1 -16 0 -5.4 TTTCGATAGCAGCAAGAGAT
531 SEQ ID NO:5134 -5.2 -21.2 63.1 -16 0 -5.4 GAGGAATGTCTCCATAAATA
660 SEQ ID NO: 5135 -5.2 -19.3 58.6 -12.3 -1.8 -4.8
TTTTCCTAACAGGGTTTAGT 810 SEQ ID NO: 5136 -5.2 -22.2 67.2 -16.1 -0.7 -4.1
ACCGACTGGATCAGGGCCCC 1183 SEQ ID NO: 5137 -5.2 -31.8 82 -24.9 -0.8 -11.5
AGAAAGCTTCTTTACCGACT 1196 SEQ ID NO:5138 -5.2 -21.9 63.7 -15.8 -0.7 -7
GTTAAATGTGCTCATTGTTA 1394 SEQ ID NO:5139 -5.2 -19.7 61.1 -12.9 -1.6 -4
CATGAGTCGAAATAGAGACA 1592 SEQ ID NO:5140 -5.2 -18.7 57 -12.7 -0.6 -5.8
TCAACTGGTAAAGATTTTCC 1626 SEQ ID NO: 5141 -5.2 -19.5 59.4 -14.3 0 -3.3
CTGCTTCTTTTGACGCTGTC 2059 SEQ ID NO:5142 -5.2 -25.2 73.6 -18 -2 -6.6
AGCAGAATTTTTTGTCACTG 2112 SEQ ID NO: 5143 -5.2 -20.3 62.5 -15.1 0 -4.1
GAACACATTGGCAAATCTAT 2663 SEQ ID NO: 5144 -5.2 -19.1 57.6 -13.9 0 -4.4
ATCAAAGATATTCCAGCCTT 2936 SEQ ID NO: 5145 -5.2 -22 64.2 -16.1 -0.4 -3.8
AATGATCTTAATTAGCATAT 3077 SEQ ID NO:5146 -5.2 -16.3 52.8 -11.1 0 -4.9
TGCATGCCGACCACAGCAAA 3157 SEQ ID NO:5147 -5.2 -26.6 70.2 -20.3 -1 -9.1
CCTACTGCAATCTGCAGATT 3478 SEQ ID NO:5148 -5.2 -24 68.9 -14.4 -4.4 -13.6
TACACCACTGGTGGTTCCAT 3674 SEQ ID NO:5149 -5.2 -26.6 75 -18.8 -2.6 -12
CCTTCAGTAAAACAAGCTTC 3967 SEQ ID NO:5150 -5.2 -20.3 60.7 -15.1 0 -6.4
GAGAAGGATCATGAACACAA 4106 SEQ ID NO: 5151 -5.2 -18.4 56.2 -12.5 -0.5 -6.9
GATGGCACCGAGTTCTGAGT 4352 SEQ ID NO:5152 -5.2 -26.3 74.8 -21.1 0 -4
AACAAGAGCATTCACAACCA 4439 SEQ ID NO:5153 -5.2 -20.9 60.8 -15.7 0.5 -4.1
AGCAAACAAATTCACACCCA 4526 SEQ ID NO: 5154 -5.2 -21.6 61 -16.4 0 -4.1
GGATCCAAGTTTCTTCATTG 4955 SEQ ID NO:5155 -5.2 -22.2 66.7 -16.5 0 -8.3
TCATGATGCTGATATCAAAG 5052 SEQ ID NO:5156 -5.2 -18.4 57 -12.3 -0.8 -7.7
CATCCGTTTCCACCATCATG 5097 SEQ ID NO: 5157 -5.2 -26.4 72.4 -21.2 0 -4.1
CCCTGGTCATCCGTTTCCAC 5104 SEQ ID NO: 5158 -5.2 -30.3 81.4 -23.9 -1.1 -4.5
GAAGGGACATCATCAAAGCA 5409 SEQ ID NO:5159 -5.2 -21.1 62.1 -15.9 0.5 -3.6
CATAGGCAAAGTTGGACATC 5490 SEQ ID NO:5160 -5.2 -21.1 63 -15.9 0 -4.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TATCAAGACAGTGGATCCGG 6006 SEQ ID NO:5161 -5.2 -23 66.2 -17.1 0 -8.9
GCTTTGTAAAGGCAAATAAA 6027 SEQ ID NO: 5162 -5.2 -17 53 -10.2 -1.6 -5.9
CATCTGAAATTACGCTGAAT 6190 SEQ ID NO:5163 -5.2 -18.6 56 -13.4 0 -3.3
TCATGTTGAATTAAAAGTGC
7717 SEQ ID NO: 5164 -5.2 -17 54 -11.8 0 -4.7
ATATTTTTAGCAAAATATGA
7806 SEQ ID NO: 5165 -5.2 -14.5 48.7 -6.8 -2.5 -7.8
CTAAAAAGAACAAAGTCCAT 8256 SEQ ID NO: 5166 -5.2 -15.5 49.5 -10.3 0 -2.8
TCATGGCTAAAAAGAACAAA 8262 SEQ ID NO: 5167 -5.2 -15.3 49.2 -10.1 0 -4.7
TGGCTCAATAATGACGTAGC 8438 SEQ ID NO:5168 -5.2 -21.6 63.2 -15.7 -0.5 -5.6
ATGCATTTAAGTAACAAAGA 8864 SEQ ID NO:5169 -5.2 -16 51.5 -10.8 0 -6.4
GGAGTTTTCCACTGAGAATA 8994 SEQ ID NO: 5170 -5.2 -21.7 65 -15.1 -1.3 -4.8
TTTTTTTTGACCACAGAGGT 98 SEQ ID NO: 5171 -5.1 -22.1 66.2 -15.6 -1.3 -4.7
TTCTTGCTCCATAATCTCTG 222 SEQ ID NO: 5172 -5.1 -22.9 68.4 -17.8 0 -2.9
ATGAATCCTTGACAGGTATC 280 SEQ ID NO: 5173 -5.1 -21.3 64.1 -15.2 -0.9 -3.5
GGAAAAGCTCCAGGTCCCTT 376 SEQ ID NO: 5174 -5.1 -27.3 74.7 -21.1 -1 -6.6
TTTCCAGCTTCCAAGTCACT 628 SEQ ID NO: 5175 -5.1 -25.9 74.7 -20.8 0 -4.3
TCTGGAGGAATGTCTCCATA 664 SEQ ID NO: 5176 -5.1 -23.5 69.3 -15.1 -3.3 -8.5
ATCTCTGGAGGAATGTCTCC 667 SEQ ID NO: 5177 -5.1 -24.4 72.5 -17.2 -2.1 -7.4
GCAGAGGTGGCACTGAATCG 772 SEQ ID NO: 5178 -5.1 -25.4 71.7 -19.4 -0.7 -4.5
CTGTCACATATGCCATCACA 1065 SEQ ID NO: 5179 -5.1 -24.3 70 -19.2 0 -6.5
TCATTGTTACATTAACAAAT 1383 SEQ ID NO: 5180 -5.1 -15.7 51.1 -7.8 -2.8 -8.5
ATCCTTCCAGTTAAATGTGC 1403 SEQ ID NO: 5181 -5.1 -23.1 67.6 -18 0 -5.6
TTCACACAGATGTATCCTTC 1513 SEQ ID NO: 5182 -5.1 -22.3 67.4 -16.5 -0.5 -3.6
TCATGAGTCGAAATAGAGAC 1593 SEQ ID NO: 5183 -5.1 -18.4 57 -12.7 -0.3 -6.9
TGCTCCTCATAGGCCATGGC 1741 SEQ ID NO: 5184 -5.1 -29.5 81.9 -22.2 -0.5 -12.5
ATCTATACCAGCATGGCGGA 2649 SEQ ID NO:5185 -5.1 -25.7 71.7 -18.6 -2 -7.4
AGAACCATTTCTGCTGTGAA 2878 SEQ ID NO:5186 -5.1 -22.1 64.8 -16.1 -0.8 -5.5
TGTTTATGAATGACATATAA 3738 SEQ ID NO:5187 -5.1 -15.2 50.2 -9 -1 -5.8
GTACTTACTTGACAGAATGG 4003 SEQ ID NO:5188 -5.1 -19.6 60.3 -13.8 -0.4 -4.5
TGTAGCAGGTTTTTCGAAGA 4053 SEQ ID NO:5189 -5.1 -21.9 65.7 -16.3 -0.2 -6.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GGTAAAGACTTTGTCAGCAT
4196 SEQ ID NO:5190 -5.1 -21.4 64.6 -15 -1.2 -5.3 AGGTAAAGACTTTGTCAGCA
4197 SEQ ID NO:5191 -5.1 -21.4 64.9 -15 -1.2 -5.3 CGATCAAGAAATCTAGCCAG
4290 SEQ ID NO:5192 -5.1 -20.5 59.9 -15.4 0 -4.9
TTAAAGCTCTTAATGTCCGT 4380 SEQ ID NO:5193 -5.1 -21.1 62.4 -16 0 -5.6
GTCTTAAAGCTCTTAATGTC 4383 SEQ ID NO:5194 -5.1 -19.6 61.5 -14.5 0 -5.9
TATAAATACATGTACAGATT 4792 SEQ ID NO:5195 -5.1 -15.1 50.1 -9.5 0 -8.2
CAGCACAAATTCTCCAGTGA 5177 SEQ ID NO: 5196 -5.1 -23 66.7 -17.1 -0.6 -4.6
GGGACACAGAATACTTTTCT 5301 SEQ ID NO: 5197 -5.1 -21.1 63.5 -15.1 -0.8 -4.2
CCCCTTTGCTCCTTTGATCA 5372 SEQ ID NO:5198 -5.1 -29 79 -23.9 0 -6.1
GGTTGTAATTTGGAACAAGC 5573 SEQ ID NO:5199 -5.1 -20 60.5 -13.3 -1.6 -7.3
AGAGGTTGTAATTTGGAACA 5576 SEQ ID NO:5200 -5.1 -19.5 60 -13.7 -0.4 -4.7
GGTCACAGTCGGGTGGTGCA 5634 SEQ ID NO:5201 -5.1 -29.3 83.7 -23 -0.7 -10.2
AAACTTTTCCCAAACCTCAT 5852 SEQ ID NO:5202 -5.1 -21.9 62 -16.8 0 -2.4
CATCGGGATCAAACTTTTCC 5862 SEQ ID NO:5203 -5.1 -22.4 64.3 -17.3 0 -5.3
CACAAAACACGCTTTGTAAA 6037 SEQ ID NO: 5204 -5.1 -17.8 53.6 -11.2 -1.4 -6.6
TGGAGGGGTTTGATGCCATA 6105 SEQ ID NO:5205 -5.1 -25.6 73 -19.4 -1 -4.6
ATAATTCTTTGTTTCTTTTT 6473 SEQ ID NO:5206 -5.1 -17.7 57.6 -12.6 0 -2.9
TTTGTAAAAATATGGCAGAT 6821 SEQ ID NO:5207 -5.1 -16.3 52 -10.2 -0.9 -4.9
TGAAACTGTAGCCATTACAA 7020 SEQ ID NO:5208 -5.1 -19.7 58.7 -13.6 -0.9 -3.9
AATATGTGACATTCTTTAAC 7616 SEQ ID NO:5209 -5.1 -16.5 53.4 -11.4 0 -3.9
TAAAAGTGCAAAAGTAAAGG 7706 SEQ ID NO:5210 -5.1 -13.9 46.8 -8.8 0 -5.4
ATAAAGTAAAATAAATTGTG 7923 SEQ ID NO: 5211 -5.1 -10.7 40.9 -5.6 0 -3.2
GCATAAAGTAAAATAAATTG 7925 SEQ ID NO:5212 -5.1 -12 43.2 -6.9 0 -3.4
AAAACATCTATGAATAAAAG 8149 SEQ ID NO:5213 -5.1 -11.3 42 -6.2 0 -3.8
AGTGCAGCAGGAATTAAAAA 8216 SEQ ID NO: 5214 -5.1 -18.3 55.8 -13.2 0 -6.6
GCTAAAAAGAACAAAGTCCA 8257 SEQ ID NO:5215 -5.1 -17.3 53 -12.2 0 -2.8
CATGTTAGGTAATTGCACAA 8296 SEQ ID NO:5216 -5.1 -19.9 60.3 -14.8 0 -5.3
TTCACAAAGCTGCTTTTAAT 8660 SEQ ID NO:5217 -5.1 -19.4 59 -12.9 -0.1 -10.7
TAGATGCTTATAGCCAAGGG 8778 SEQ ID NO: 5218 -5.1 -22.7 66.4 -16.9 -0.5 -4.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo ATACCTTATGTATACATAGG 8894 SEQ ID NO:5219 5.1 -19 59 -11.9 -0.7 -12.1
ATCCAAGATGGTTAGGGTAT 160 SEQ ID NO: 5220 -5 -22.5 66.9 -16.6 -0.8 -4.9
CATAACAAAGCCCAGCATCC 176 SEQ ID NO: 5221 -5 -24.6 67.2 -18.7 -0.7 -4.1
AGCCTTATGAATTACAGCAT 193 SEQ ID NO: 5222 -5 -21.6 63.7 -15.9 -0.4 -4.1
TCAAGGTCATAAATACACAG 894 SEQ ID NO: 5223 -5 -17.7 55.5 -12.7 0 -2
TGTGTACTCTACATTCTTTG
932 SEQ ID NO: 5224 -5 -20.7 64.7 -14.8 -0.8 -4.8 ATGTGTACTCTACATTCTTT
933 SEQ ID NO: 5225 -5 -20.7 64.8 -14.8 -0.8 -5.4 ATCACGAAGAAACGTAAAAT
1016 SEQ ID NO: 5226 -5 -15 48.1 -9.1 -0.8 -6.1
TTCAGTGCTCGGAGAACTCT 1126 SEQ ID NO: 5227 -5 -24.4 71.4 -18.5 -0.7 -6.4
TGCCCATGAACAGCTGCAGC 1266 SEQ ID NO: 5228 -5 -28.3 76.8 -21 -0.2 -12.8
ATTGTTACATTAACAAATGT 1381 SEQ ID NO:5229 -5 -15.8 51.4 -8 -2.8 -8.5
TCCAGTTAAATGTGCTCATT 1398 SEQ ID NO: 5230 -5 -21.8 65.1 -15.3 -1.4 -3.7
GGGTTTCGACCAGCCTTCAC 1528 SEQ ID NO:5231 -5 -28.6 79.1 -20.9 -2.7 -6
AGCTTGTGTAGCCATAGTTG 1548 SEQ ID NO: 5232 -5 -24.4 73.1 -17.8 -1.5 -4.6
CTGGTAAAGATTTTCCCAAT 1622 SEQ ID NO: 5233 -5 -20.9 61.2 -15.9 0 -4.8
TCTTTAGCACCTTTGGAACT 1945 SEQ ID NO: 5234 -5 -23.2 68 -18.2 0 -4.1
GAAAATGCTTGTTTTGCTAT 2186 SEQ ID NO:5235 -5 -19.2 58.6 -13.3 -0.8 -4.8
AGAATGCTGGCTATGCTCAC 2587 SEQ ID NO:5236 -5 -24.2 70.4 -18.5 -0.4 -5.2
TATACCAGCATGGCGGACAT 2646 SEQ ID NO:5237 -5 -25.3 69.9 -18.3 -2 -7.4
ACCATTTCTGCTGTGAAAAT 2875 SEQ ID NO:5238 -5 -20.8 61.3 -14.9 -0.7 -5
CAACTTGAAAACTCTAAGCA 3035 SEQ ID NO: 5239 -5 -17.6 54.2 -12.6 0 -4.1
GCACGCGGAACACAATCAGG 3270 SEQ ID NO:5240 -5 -24.6 66.7 -19.1 0 -7.9
CAGCACGCGGAACACAATCA 3272 SEQ ID NO: 5241 -5 -24.1 65.5 -19.1 0 -7
TGAACTCAATAATAAGGCCA 3410 SEQ ID NO: 5242 -5 -19.1 57 -13.6 0 -7.7
AATCTGCAGATTATTCATTT 3470 SEQ ID NO:5243 -5 -18.9 59.1 -11.2 -0.2 -13.6
AGCTGGTTGCATTTAATTTC 3864 SEQ ID NO:5244 -5 -21.5 65.5 -14.9 -1.5 -5.1
ATCAACTGTGCTTCCTTCAG 3887 SEQ ID NO:5245 -5 -24 70.8 -19 0.6 -3.6
AGTCTTTCGCTGTTCAATGT 4157 SEQ ID NO: 5246 -5 -23.5 70.5 -18.5 0 1 -3.1
CTAGCCAGCACCAGGCATTA 4278 SEQ ID NO: 5247 -5 -28 77.4 -20.3 -2.7 -7.4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AATCTAGCCAGCACCAGGCA 4281 SEQ ID NO:5248 -5 -27.9 76.8 -20.2 -2.7 -7.4
ACCAGGCTAACCAAAGAAAC 4315 SEQ ID N0:5249 -5 -20.7 59.2 -14.3 -1.3 -5
AGTAGCCAAGAGCATTGGCT 4335 SEQ ID NO:5250 -5 -25.8 74.1 -15.6 -5.2 -14.4
TCCGTAATGATTTGATGGCA 4365 SEQ ID NO:5251 -5 -22.5 64.6 -17.5 0 -4
ACAGTGGTAGAACTTGCCAG 4544 SEQ ID NO: 5252 -5 -23.8 69.5 -17.5 -1.2 -5.1
AGCCTTTAAATGTGGCCACT 4707 SEQ ID NO: 5253 -5 -25.2 70.5 -17.7 -1.8 -13
TACAGGCTGAAGTTTAACAT 4763 SEQ ID N0:5254 -5 -19.7 60 -14.7 0 -4.1
ATACATGTACAGATTTTCTT 4787 SEQ ID NO:5255 -5 -18.7 59.2 -13 0 -9.1
AAATACATGTACAGATTTTC 4789 SEQ ID NO:5256 -5 -16.3 53 -10.8 0 -8.2
AGTATAAATACATGTACAGA 4794 SEQ ID NO: 5257 -5 -16.2 52.7 -10.5 -0.5 -8.2
GTCATAAAGATGTCTTGACC
4909 SEQ ID NO: 5258 -5 -20.6 62.5 -14.1 -1.4 -7.7 TGTCATAAAGATGTCTTGAC
4910 SEQ ID NO:5259 -5 -18.6 58.5 -12.7 -0.8 -8.3 GGACAAAACTAGGGTCATGT
5129 SEQ ID NO: 5260 -5 -21.3 63.1 -15 -1.2 -5 GGGACAAAACTAGGGTCATG
5130 SEQ ID NO:5261 -5 -21.3 62.6 -15 -1.2 -5 ATGTTCCAGCCTATAGTGAA
5224 SEQ ID NO:5262 -5 -23.6 69 -18.6 0 -5.1
CGGAACAAGGTAGGGGACAC 5314 SEQ ID NO: 5263 -5 -23.5 66.3 -17.9 -0.3 -3.2
CCCTTTGCTCCTTTGATCAG 5371 SEQ ID NO:5264 -5 -27 75.9 -22 0 -6.5
AGTTGAACATGTCATCAATT 5526 SEQ ID NO: 5265 -5 -18.9 58.8 -12.6 -1 -9.9
GCACTATTAAGAATAGGTGC 5617 SEQ ID NO:5266 -5 -20.2 61.4 -12.6 -2.6 -8.1
AGAGAGTTTAGAGAACTCTA 5894 SEQ ID NO:5267 -5 -18.9 60.3 -9.7 -4.2 -9.6
CAGCTGCAAAATCAGAGAGT 5907 SEQ ID NO: 5268 -5 -21.3 63.2 -15.6 -0.4 -7.2
CCAGGGCAGCTGCAAAATCA 5913 SEQ ID NO: 5269 -5 -25.8 70.8 -18.3 -1 -13.2
GGCAGACACCTCCTCTTGTT 6164 SEQ ID NO: 5270 -5 -28.3 80.2 -23.3 0 -4
AAATTACGCTGAATGATAGC 6184 SEQ ID NO:5271 -5 -18.1 55.2 -12.3 -0.6 -4.4
GTGTCAGCTGGTAATAAAAA 6682 SEQ ID NO: 5272 -5 -18.5 57 -12.9 0 -8.6
ACCATGGAAATGCACTAGAA 6846 SEQ ID NO: 5273 -5 -20.5 59.7 -14.1 -1.3 -8.8
TCTGGTTTTGAGCAAAAATT 6993 SEQ ID NO: 5274 -5 -18.4 56.7 -12.8 -0.3 -7.6
GCAGAAGATGGCAAAGCAAT 7322 SEQ ID NO: 5275 -5 -21.1 61.2 -15.2 -0.7 -4.9
GTGTTTGTAAATAGCTTCAA 7687 SEQ ID NO:5276 -5 -19 59.3 -14 0 -4.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AACAAGTTTTAGACATATTT 7820 SEQ ID NO:5277 -5 -16.1 52.6 -11.1 0.4 -3.1
TAAACAAGTTTTAGACATAT 7822 SEQ ID NO: 5278 -5 -14.9 49.7 -9.2 -0.4 -5.5
TTGGAATTGTGATTAAAAAT 7956 SEQ ID NO:5279 -5 -14.1 47.4 -9.1 0 -3.1
ATGTTAGGTAATTGCACAAC 8295 SEQ ID NO:5280 -5 -19.4 59.6 -14.4 0 -5.6
ATCATGTTAGGTAATTGCAC 8298 SEQ ID NO:5281 -5 -20.3 62.5 -15.3 0 -5.3
TAAACTGCCAACAGCAAAAA 8521 SEQ ID NO: 5282 -5 -17.8 53.2 -11.2 -1.5 -4.5
TAACTATATCATTAATACCT 8908 SEQ ID NO:5283 -5 -16.5 52.9 -11.5 0 -4.2
CTTTCCAGAATCCTCTCTGC 19 SEQ ID NO: 5284 -4.9 -25.8 74.6 -20.2 -0.4 -4
TCCGGAAAAGCTCCAGGTCC 379 SEQ ID NO: 5285 -4.9 -27.5 73.9 -20.7 -1.9 -7.8
CAACAGTGCCTGTGCCATCT 470 SEQ ID NO:5286 -4.9 -27.8 77.1 -21.3 -1.5 -8.7
AAAGGCGGAAGCTTTCAGGT 501 SEQ ID NO:5287 -4.9 -23.9 68 -16.6 -2.4 -7.6
AATGGAAGGTTCTTTCCAGC 640 SEQ ID NO: 5288 -4.9 -23.3 68.5 -15.3 -3.1 -9.4
TAAAATATACAAGGCAGAGG 785 SEQ ID NO:5289 -4.9 -16.7 52.7 -11.8 0 -4
TCAAAATAGTGCACATGATA 870 SEQ ID NO:5290 -4.9 -17.6 54.9 -11.7 0 -9.9
ACTCTGTCACATATGCCATC 1068 SEQ ID NO:5291 -4.9 -24.2 71.3 -19.3 0 -6.5
ATCAGAAAGCTTCTTTACCG 1199 SEQ ID NO: 5292 -4.9 -21.3 62.6 -15.6 -0.6 -7
ATGTGCTCATTGTTACATTA 1389 SEQ ID NO: 5293 -4.9 -20.8 64.1 -15.4 -0.1 -1.1
AAGCTTGTGTAGCCATAGTT 1549 SEQ ID NO:5294 -4.9 -23.7 70.7 -17.2 -1.5 -7.5
AGGACAAAAAATATCATGTA 1669 SEQ ID NO:5295 -4.9 -14.9 49 -10 0 -4.7
GTCTCTCCTGCTTTCGCCGT 2279 SEQ ID NO:5296 -4.9 -31 85.3 -25.4 -0.5 -3.6
CAAGATGTTTTACTTTTAAC 2709 SEQ ID NO:5297 -4.9 -16.4 53.3 -11.5 0 -2.9
GCTCCATTAAACTGAGGCTG 2967 SEQ ID NO:5298 -4.9 -23.8 68.1 -18.4 -0.1 -4.1
CACAGCAAAAATGAAGACGA 3146 SEQ ID NO:5299 -4.9 -17.4 52.6 -12.5 0 -4.1
ATGTGCCACCGTGGGAGCGT 3229 SEQ ID NO:5300 -4.9 -30.7 81 -24.6 -1.1 -8.8
TTGTCATCATCAGTAGCAGC 3448 SEQ ID NO:5301 -4.9 -23.8 72.9 -18.9 0 -4.1
AAAAAGGCTTTTTGGAAACA 3544 SEQ ID NO:5302 -4.9 -16.8 52.3 -10.8 -1 -7.9
TTCTAAAAAAGGCTTTTTGG 3549 SEQ ID NO:5303 -4.9 -17.1 53.8 -10.7 -1.4 -7.7
AAGCTCTTAATGTCCGTAAT 4377 SEQ ID NO: 5304 -4.9 -21 62.1 -16.1 0 -5
AGTCACTCAAATTGTTAACA 4602 SEQ ID NO:5305 -4.9 -18.4 57.5 -13 0 -8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TGACCCAAAGATGATAAAGA 4820 SEQ ID NO:5306 -4.9 -18.2 54.7 -13.3 0 -1.9
TGTTCCTCTGTCATAAAGAT 4918 SEQ ID NO:5307 -4.9 -21.1 64.1 -16.2 0 -3.5
CTTGGATCCAAGTTTCTTCA 4958 SEQ ID NO:5308 -4.9 -23.1 68.7 -15.1 -0.7 -14.3
GCTCCTTTGATCAGACGTAG 5365 SEQ ID NO:5309 -4.9 -24.4 71 -19.5 0 -6.5
AGGGACATCATCAAAGCAAA 5407 SEQ ID NO:5310 -4.9 -19.8 58.9 -14.3 -0.3 -4.4
CCAAAGATGGCATAGATAAA 5470 SEQ ID NO:5311 -4.9 -18.2 54.9 -12.4 -0.8 -5
CAAAGTCATCCTCACTCAGG 5823 SEQ ID NO: 5312 -4.9 -23.4 68.5 -17.8 -0.4 -3.1
AACATCTCAAAGTCATCCTC 5830 SEQ ID NO:5313 -4.9 -21.2 63.8 -16.3 0 -2.8
TTTTCCCAAACCTCATAGAA 5848 SEQ ID NO: 5314 -4.9 -21.8 62.5 -16.9 0 -2.8
TCCACTCTCACACAAAACAC 6047 SEQ ID NO: 5315 -4.9 -21.4 62.3 -16.5 0 0
TCATAAGAGACTTTGGAGGG 6118 SEQ ID NO: 5316 -4.9 -20.8 63.1 -15.9 0 -3.4
AATTGCCTCTTTGTTATAGT 6248 SEQ ID NO: 5317 -4.9 -21.5 65.5 -16.6 0 -3
TTGTCAACGTTGATACCCTG 6652 SEQ ID NO:5318 -4.9 -23.4 66.5 -16.2 -0.1 -12.8
TTAAATATTAGAGGAGACTT 7126 SEQ ID NO:5319 -4.9 -16.1 52.6 -10.3 -0.7 -5.9
CTAAATTAAATATAGAGCTC 7206 SEQ ID NO:5320 -4.9 -14.7 49.3 -9.3 0 -8
TAAACTATGTTTAATGAATG 7523 SEQ ID NO: 5321 -4.9 -13.4 46.3 -7.6 -0.8 -5.5
ATAGCTTCAAATTATTCTGC 7677 SEQ ID NO: 5322 -4.9 -19.2 59.7 -14.3 0 -4.6
CAAGTTTTAGACATATTTTT 7818 SEQ ID NO: 5323 -4.9 -16.8 54.6 -11.2 -0.4 -2.9
AACCATAGTTGGTAGAAAAT 8116 SEQ ID NO: 5324 -4.9 -17.8 55 -10.5 -2.4 -6.3
CAGTTCTTCAATACACTACA 8382 SEQ ID NO: 5325 -4.9 -20.1 61.8 -15.2 0 -3.1
TTCCCTGCATGCAGTTCTTC 8393 SEQ ID NO: 5326 -4.9 -27.5 79.4 -19.5 -0.2 -14.3
GGTTTTGACCTCACATAAAT 8967 SEQ ID NO:5327 -4.9 -20.7 61.6 -14.-2 -1.6 -4.2
TATATAATTTATTATGGGAG 9069 SEQ ID NO:5328 -4.9 -15.1 50.5 -9.4 -0.6 -4.9
GCAGCTGTTCAGCTTTTTTT 124 SEQ ID NO: 5329 -4.8 -24.9 75 -18.2 -1.8 -11
TAACGTGTCTTCCTCTGGCA 141 SEQ ID NO: 5330 -4.8 -26.1 74.4 -21.3 0 -5.3
CAATATCCCTAGAAGAGATT 331 SEQ ID NO:5331 -4.8 -19.9 59.6 -15.1 0 -0.4
CTTTTTCCGGAAAAGCTCCA 384 SEQ ID NO: 5332 -4.8 -24 66.6 -16.1 -1.6 -14.4
TCCTTTATTCATTACTATAA 740 SEQ ID NO: 5333 -4.8 -18 57 -13.2 0 -2.3
GTGGCACTGAATCGGAAAAT 766 SEQ ID NO: 5334 -4.8 -20.8 60 -16 0 -4.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
AATCTTCTAAGCAAAACCCT 999 SEQ ID NO: 5335 -4.8 -20.5 59.7 -15.7 0 -4.1
ACAGCTGCAGCCCAATGAGA 1257 SEQ ID NO:5336 -4.8 -27.1 74.4 -19.8 0 -13.2
TAAATGTGCTCATTGTTACA 1392 SEQ ID NO:5337 -4.8 -19.3 59.5 -12.9 -1.6 -4
TTTTTGCCCATCCAAAACAT 1448 SEQ ID NO: 5338 -4.8 -22.8 63.7 -16.5 -1.4 -5.4
GATTCTGCTCCTCATAGGCC 1746 SEQ ID NO:5339 -4.8 -27.8 79.5 -22.3 -0.5 -6.4
CTTTGGAACTCAACTTTGAT 1935 SEQ ID NO:5340 -4.8 -19.6 59.6 -14.2 -0.3 -5
AGAGCCCCCACAGAATTGCC 3097 SEQ ID NO:5341 -4.8 -29.8 78 -25 0 -3.2
GCTGCATGCCGACCACAGCA 3159 SEQ ID NO: 5342 -4.8 -30.7 80.3 -23.3 -2.6 -9.7
TCGTTCATGTGCCACCGTGG 3235 SEQ ID NO: 5343 -4.8 -28.7 77.5 -23.1 -0.6 -8.4
ATGAACTCAATAATAAGGCC 3411 SEQ ID NO: 5344 -4.8 -18.4 55.8 -13.6 0 -6.4
TCATCATCAGTAGCAGCAAG 3445 SEQ ID NO:5345 -4.8 -22.5 68 -17.7 0 -5.4
AACTGTGCTTCCTTCAGATG 3884 SEQ ID NO:5346 -4.8 -23.5 69.2 -17.8 -0.7 -4
AAGGATCATGAACACAATGA 4103 SEQ ID NO: 5347 -4.8 -17.8 54.8 -12.5 -0.1 -7.4
TATATATCTTCAAAGGCCAA 4138 SEQ ID NO: 5348 -4.8 -19.2 58.2 -13.9 0 -7.7
ATTCATGATAGAGGGAATTG 4463 SEQ ID NO:5349 -4.8 -18.5 57.7 -13.7 0 -6.4
GATGACAAAGTATAAATACA
4802 SEQ ID NO:5350 -4.8 -14.5 48.3 -9 -0.5 -5.8 AGATGACAAAGTATAAATAC
4803 SEQ ID NO:5351 -4.8 -13.8 47.1 -9 0 -4.5 ATGACCCAAAGATGATAAAG
4821 SEQ ID NO:5352 -4.8 -17.6 53.5 -12.8 0 -2.1
TCAAAGACCATTCCTTGGAA 5014 SEQ ID NO: 5353 -4.8 -21.8 62.8 -15.4 -1.5 -6.9
TGAATTGTGTCAGGGTCACA 5647 SEQ ID NO: 5354 -4.8 -23.1 69.1 -17.1 -1.1 -5.6
CACTTTCTTCAGTAGCAACA 5796 SEQ ID NO:5355 -4.8 -22.1 66.7 -16.6 -0.5 -0.8
TCAAAGTCATCCTCACTCAG 5824 SEQ ID NO: 5356 -4.8 -22.6 67.5 -17.8 0 -2.6
AGAAGAGGAGGATCCAGGGC 5926 SEQ ID NO:5357 -4.8 -25.4 73.1 -18 -2.6 -9
GGAGGGGTTTGATGCCATAA 6104 SEQ ID NO:5358 -4.8 -24.9 70.8 -19.4 -0.5 -4
GACTTTGGAGGGGTTTGATG 6110 SEQ ID NO:5359 -4.8 -23.3 69.1 -18.5 0 -2.6
TCTCAAACTTTTCCTTGTCT 6399 SEQ ID NO:5360 -4.8 -22.3 67.1 -17.5 0 -2.8
CTGGTTTGTCTTTCTCAAAC 6411 SEQ ID NO:5361 -4.8 -21.4 65.6 -14.2 -2.4 -7.4
CCTCTTGAAGTCCAGTTGAC 6537 SEQ ID NO: 5362 -4.8 -24.6 71.8 -18.9 -0.7 -3.7
AGTATTTGTTAAAACAGTCA 6572 SEQ ID NO:5363 -4.8 -17.2 55.3 -12.4 0 -5.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GAGGTCACTTCACTGTCTTG 6609 SEQ ID NO: 5364 -4.8 -24.1 73.3 .-19.3 0 -3
ACTTTGCACAACTATCCCTA 6735 SEQ ID NO:5365 -4.8 -23.8 67.9 -19 0 -5
TAAAAATATGGCAGATATGG 6817 SEQ ID NO:5366 -4.8 -15.8 50.7 -9.6 -1.3 -4.7
TCAACGTAAACCTCATTTAC 6908 SEQ ID NO:5367 -4.8 -19.2 57.6 -13.2 -1.1 -5.3
ACTGAAACTGTAGCCATTAC 7022 SEQ ID NO: 5368 -4.8 -20.8 61.9 -16 0 -3.3
TAACTGAAACTGTAGCCATT 7024 SEQ ID NO:5369 -4.8 -19.9 59.4 -15.1 0 -3.3
GTATCCAGTGTGTTTCCTTG 7763 SEQ ID NO: 5370 -4.8 -25.2 75.3 -20.4 0 -3.2
GCTGACAAATAAAGTTGATT 7864 SEQ ID NO:5371 -4.8 -17.1 53.7 -12.3 0.8 -3.2
AAAAAAACATCTATGAATAA 8152 SEQ ID NO: 5372 -4.8 -10.6 40.6 -5.8 0 -3.8
TACGTAAATACTACAAAAGT 8179 SEQ ID NO:5373 -4.8 -14.7 48.4 -9.2 -0.4 -5.8
AGGTAATTGCACAACTTTGC 8290 SEQ ID NO:5374 -4.8 -21.3 63.4 -15.8 -0.5 -5.3
ATAATGACGTAGCTCACCAT 8431 SEQ ID NO:5375 -4.8 -22.2 64.2 -17.4 0 -5.3
AATTATGAAATACATATTTA 9049 SEQ ID NO:5376 -4.8 -12.5 44.6 -6.6 -1 -5.2
AAAGAGACCTTTCCAGAATC 27 SEQ ID NO:5377 -4.7 -20.5 60.9 -14.9 -0.8 -3.7
CAAACCTTGATGTGGCTTGG 250 SEQ ID NO:5378 -4.7 -23.5 66.7 -18.8 0 -3.7
AAGGCGGAAGCTTTCAGGTC 500 SEQ ID NO: 5379 -4.7 -25 71.8 -17.9 -2.4 -7.4
TTCCTTTATTCATTACTATA 741 SEQ ID NO: 5380 -4.7 -18.8 59.3 -14.1 0 -1.5
TCCACAAACTCTGTCACATA 1075 SEQ ID NO:5381 -4.7 -21.9 64.4 -16.7 -0.1 -4.2
CTGAATGTTCTCAACGCTGA 1108 SEQ ID NO:5382 -4.7 -22.1 64.3 -16.5 -0.8 -4.8
CCTGGAATGACTGAAATTGT 1147 SEQ ID NO:5383 -4.7 -20.2 59.5 -15.5 0 -3.6
AGCTGCAGCCCAATGAGAGC 1255 SEQ ID NO: 5384 -4.7 -28 77.3 -20.8 -0.7 -13.2
CAGAATCGCTTGGGGGCCAC 1308 SEQ ID NO: 5385 -4.7 -28.1 75.8 -22.7 -0.5 -7.6
TGTGCTCATTGTTACATTAA 1388 SEQ ID NO:5386 -4.7 -20.1 61.9 -15.4 0 -4.1
TTTTGCCCATCCAAAACATA 1447 SEQ ID NO:5387 -4.7 -22.4 62.8 -16.5 -1.1 -5
TCCAAGGTGGCCTGATTCTG 1759 SEQ ID NO:5388 -4.7 -26.7 75.2 -21.1 -0.7 -7.2
CTGCTTCTTCCAAGGTGGCC 1767 SEQ ID NO:5389 -4.7 -28.9 80.8 -23.3 -0.7 -6.3
TTCGGCCTCTTTTTGTTCTG 1784 SEQ ID NO:5390 -4.7 -25.5 74.2 -20.8 0 -6.7
TCTGCTGAAATTCGGCCTCT 1794 SEQ ID NO: 5391 -4.7 -25.7 71.7 -19 -2 -10.2
TTCTGAAGAACTTTCCAACA 1913 SEQ ID NO: 5392 -4.7 -19.8 59.5 -14.4 -0.4 -4.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AGTGGTGGTGCCCTCTGGGG 2483 SEQ ID NO:5393 -4.7 -31.6 88.3 -25.1 -1.8 -6.6
TCCGTTTCAGTGGTGGTGCC 2491 SEQ ID NO:5394 -4.7 -29.5 83.3 -24.8 0 -4.7
CCAGGTTTCCTACAGTCAAC 2844 SEQ ID NO: 5395 -4.7 -25 72.4 -19.8 -0.1 -3.9
AGACCAGGTTTCCTACAGTC 2847 SEQ ID NO:5396 -4.7 -25.6 75.5 -20.2 -0.5 -5.9
AACCATTTCTGCTGTGAAAA 2876 SEQ ID N0:5397 -4.7 -20.1 59.4 -14.9 -0.2 -4.5
CCACTCTCCACACAGCACGC 3284 SEQ ID NO:5398 -4.7 -29.3 78.6 -24.6 0 -4.1
CATGGTCTCTATCCACTCTC 3296 SEQ ID NO:5399 -4.7 -25.3 75.6 -19.7 -0.7 -3.9
CATACAGTCCCACATGGTCT 3308 SEQ ID NO:5400 -4.7 -26.2 74.7 -21.5 0 -5.2
TCCATACAGTCCCACATGGT 3310 SEQ ID NO:5401 -4.7 -27.3 76.3 -21.4 -1.1 -5.2
CTAAATGAACTCAATAATAA 3415 SEQ ID NO:5402 -4.7 -12.6 44.4 -7.9 0 -3.4
ACACCACTGGTGGTTCCATT 3673 SEQ ID NO:5403 -4.7 -27 76 -19.7 -2.6 -12
AAACCAGTTGTGCTCAACAA 4076 SEQ ID NO: 5404 -4.7 -21.3 62 -13.3 -3.3 -6.6
TCATGAACACAATGAAAGTC 4098 SEQ ID NO:5405 -4.7 -16.9 53.3 -11.6 -0.3 -6.9
CTGTTCAATGTATATATCTT 4148 SEQ ID N0:5406 -4.7 -18.3 58.4 -13.6 0 -3.9
CCCATTTGAGAAGCATTTCC 4230 SEQ ID NO:5407 -4.7 -24.5 69 -19 -0.6 -4.1
AGTGAAATATGTTTGAAATC 4259 SEQ ID NO:5408 -4.7 -15.1 50.1 -10.4 0 -4.1
TCATGCCTTCAAACCGGGAT 4416 SEQ ID NO:5409 -4.7 -25.6 69.4 -20.9 0 -7.1
ATACAGGCTGAAGTTTAACA 4764 SEQ ID NO: 5410 -4.7 -19.7 60 -15 0 -4.1
TCCGTTTCCACCATCATGGT 5095 SEQ ID NO:5411 -4.7 -28.1 77.1 -21.8 -1.5 -6.9
AGCACAAATTCTCCAGTGAA 5176 SEQ ID NO: 5412 -4.7 -21.6 63.4 -16.1 -0.6 -4.6
TCGGAACAAGGTAGGGGACA 5315 SEQ ID NO:5413 -4.7 -23.7 67.2 -18.4 -0.3 -3.3
CAGGGTCACAGTCGGGTGGT 5637 SEQ ID NO:5414 -4.7 -28.7 82.3 -23.2 -0.6 -5.6
AAAATCCCAACAGATGGGTC 5698 SEQ ID NO:5415 -4.7 -21.8 62.4 -14.5 -2.6 -7.5
GTTTGATGCCATAAACCTGT 6098 SEQ ID NO:5416 -4.7 -23.1 66.1 -17.9 -0.1 -4.2
AGAGAGGTCACTTCACTGTC 6612 SEQ ID NO: 5417 -4.7 -23.7 73.1 -18.5 -0.2 -4.1
TGCAAGGACTGTACTAAAGG 6778 SEQ ID NO:5418 -4.7 -20.2 60.5 -15.5 0 -4.8
ATGAATTGGGGACCATGGAA
6857 SEQ ID NO: 5419 -4.7 -22.2 63.3 -15.1 -2.4 -8.8 TATGAATTGGGGACCATGGA
6858 SEQ ID NO:5420 -4.7 -22.6 64.7 -15.5 -2.4 -8.8 TTCTGGTTTTGAGCAAAAAT
6994 SEQ ID NO:5421 -4.7 -18.4 56.7 -12.8 -0.8 -8.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TTTTCTGGTTTTGAGCAAAA 6996 SEQ ID NO: 5422 -4.7 -19.3 59.3 -14.1 -0.1 -7.9
TACAGGCACATAACTGTTCA 7106 SEQ ID NO: 5423 -4.7 -21.7 64.7 -15.4 -1.5 -5.2
TACTCATGTTGAATTAAAAG 7720 SEQ ID NO: 5424 -4.7 -14.8 49.3 -10.1 0 -4.7
GCACAACTTTGCCACTTTGT 8282 SEQ ID NO:5425 -4.7 -25 71.1 -19.8 -0.2 -3.8
AATTAACATTAAACTTTTGG 8342 SEQ ID NO:5426 -4.7 -14.3 48.1 -9.6 0 -3.5
ATGACGTAGCTCACCATTCT 8428 SEQ ID NO:5427 -4.7 -24.6 70.7 -19.9 0 -5.3
ATATAAATTCTCAATAACTA 8922 SEQ ID NO:5428 -4.7 -13.6 46.9 -8.9 0 -2.6
CTTTCCCAGTAAGCCACTCT 303 SEQ ID NO:5429 -4.6 -27.3 76.5 -22.7 0 -3.4
ACCATCTCTGGAGGAATGTC 670 SEQ ID NO:5430 -4.6 -24 70.5 -17.8 -1.5 -6
GAGAACTCTGAATGTTCTCA 1115 SEQ ID NO:5431 -4.6 -20.5 62.8 -11.8 -4.1 -12
TGAAATTGTTTTCAGTGCTC 1136 SEQ ID NO: 5432 -4.6 -20.2 62.5 -13.5 -2.1 -7.7
CAGAGTAAAGGGTCTTTTTG 1462 SEQ ID NO: 5433 -4.6 -20.1 62.1 -14.8 -0.4 -4.1
CTTGTGTAGCCATAGTTGGG 1546 SEQ ID NO:5434 -4.6 -25 73.7 -18.9 -1.4 -4.3
TGAAATTCGGCCTCTTTTTG 1789 SEQ ID NO: 5435 -4.6 -22.1 63.9 -17.5 0 -6.7
CCATTCTTTAGCACCTTTGG 1949 SEQ ID NO:5436 -4.6 -25 71.6 -20.4 0 -4.1
AGAGAGACTGATGAGGGGAG 2130 SEQ ID NO: 5437 -4.6 -22.3 66.9 -17.7 0 -2.1
GCACAAACAGTGAGTCTCTC 2292 SEQ ID NO:5438 -4.6 -22.9 68.9 -16.7 -1.5 -5.2
TTCAGTGGTGGTGCCCTCTG 2486 SEQ ID NO: 5439 -4.6 -29.2 83.5 -23.4 -1.1 -5.6
AAAGAGGGTATTTAAGACAA 2780 SEQ ID NO:5440 -4.6 -16.5 52.7 -11.9 0 -2.9
ATTTAGTGTGGGCCAGGATT 3059 SEQ ID NO: 5441 -4.6 -25.1 73.3 -20 0 -7.6
ATCTTAATTAGCATATTTAG 3073 SEQ ID NO:5442 -4.6 -16.3 53.6 -11.7 0 -4.1
CCCCCACAGAATTGCCAATG 3093 SEQ ID NO: 5443 -4.6 -27.4 71.1 -22.8 0 -4.3
AAACAATAAGGCACATGGTT 3342 SEQ ID NO:5444 -4.6 -18.9 56.8 -14.3 0 -5.2
AGAAAGAGGTTCAGAACCAC 3391 SEQ ID NO: 5445 -4.6 -20.4 61.1 -13.1 -2.7 -12
ACTGTGCTTCCTTCAGATGA 3883 SEQ ID NO:5446 -4.6 -24.8 73 -19.3 -0.7 -4.2
CTTCCGGTTTAAAGTCTTCT 3951 SEQ ID NO:5447 -4.6 -23 67.7 -18.4 0 -6.6
AGAAGGATCATGAACACAAT 4105 SEQ ID NO: 5448 -4.6 -17.8 55 -12.5 -0.5 -6.9
TCAATGTATATATCTTCAAA 4144 SEQ ID NO:5449 -4.6 -15.8 51.9 -11.2 0 -3.9
CATTTGAGAAGCATTTCCAG 4228 SEQ' ID NO: 5450 -4.6 -21.2 63.2 -15.8 -0.6 -4.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GAAATCCATAAGCAACCCAT 4245 SEQ ID NO:5451 -4.6 -22 61.5 -17.4 0 -4.1 TTGAAATCCATAAGCAACCC
4247 SEQ ID NO:5452 -4.6 -21.4 60.7 -16.8 0 -4.1 TTTGAAATCCATAAGCAACC
4248 SEQ ID NO: 5453 -4.6 -19.5 57.5 -14.9 0 -4.1 GGCACCGAGTTCTGAGTAGC
4349 SEQ ID NO:5454 -4.6 -27.2 77.8 -22.6 0 -4
CTCTTAATGTCCGTAATGAT 4374 SEQ ID NO: 5455 -4.6 -20.5 61.1 -15.9 0 -2.6
AACCGGGATAAGGCTCTTAG 4405 SEQ ID NO: 5456 -4.6 -23.3 66.2 -18.2 -0.2 -7.4
GACCCAAAGATGATAAAGAT 4819 SEQ ID NO: 5457 -4.6 -18.2 54.7 -13.6 0 -2.1
CAAGTTTCTTCATTGCATTG 4950 SEQ ID NO:5458 -4.6 -20.6 63.1 -16 0 -5.6
ACATCATCAAAGCAAAGAGC 5403 SEQ ID NO: 5459 -4.6 -19.2 58.1 -13.9 -0.5 -4.1
AAGGGACATCATCAAAGCAA 5408 SEQ ID NO: 5460 -4.6 -19.8 58.9 -14.6 -0.3 -4.4
CCAGGATGACCGCGATGTAC
5766 SEQ ID NO: 5461 -4.6 -26.4 70.8 -20.4 -1.3 -7.2 TCCAGGATGACCGCGATGTA
5767 SEQ ID NO:5462 -4.6 -26.6 71.8 -20.6 -1.3 -7.2 GCAGCTGCAAAATCAGAGAG
5908 SEQ ID NO: 5463 -4.6 -21.9 64.2 -14.7 -0.4 -13.4
TCCAGGGCAGCTGCAAAATC 5914 SEQ ID NO:5464 -4.6 -25.5 71.2 -18 -1 -14
CACGCTTTGTAAAGGCAAAT 6030 SEQ ID NO: 5465 -4.6 -20.4 59.2 -13.8 -2 -7.2
ATCTCTCCACTCTCACACAA 6052 SEQ ID NO:5466 -4.6 -24.3 71.1 -19.7 0 -0.3
CTCTTTGTTATAGTTACTTG 6242 SEQ ID NO: 5467 -4.6 -19.3 61.7 -14.7 0 -2.5
TTTTGTTACACTATCATAGG 6377 SEQ ID NO:5468 -4.6 -19 60 -14.4 0 -3.3
GGGACCATGGAAATGCACTA 6849 SEQ ID NO: 5469 -4.6 -23.6 66.2 -18.1 -0.8 -8.8
TGTTTCTTCAACGTAAACCT 6915 SEQ ID NO: 5470 -4.6 -20.8 61.4 -15.1 -1 -6.6
CATCTAGAAAATGGAAGTAA 7041 SEQ ID NO:5471 -4.6 -15.5 50.4 -10.9 0 -6.2
GTTTAATGAATGATACAGGA 7515 SEQ ID NO: 5472 -4.6 -17.3 54.7 -12.7 0 -2.5
AAAGTGCAAAAGTAAAGGTG 7704 SEQ ID NO:5473 -4.6 -16.1 51.3 -11.5 0 -5.4
AAATTGTGATGTCATCAACC 7911 SEQ ID NO: 5474 -4.6 -19.4 58.8 -13.7 -1 -7.2
CAGTAAATAGTTTTGTAAAA 8364 SEQ ID NO: 5475 -4.6 -14.2 48.2 -9.6 0 -4.1
ATGCAGTTCTTCAATACACT 8385 SEQ ID NO:5476 -4.6 -21.3 64.7 -16.7 0 -5.5
AAACTGCCAACAGCAAAAAA 8520 SEQ ID NO:5477 -4.6 -17.4 52.2 -11.2 -1.5 -4.5
TTAGATGCTTATAGCCAAGG 8779 SEQ ID NO:5478 -4.6 -21.6 64.2 -15.7 -1.2 -4.9
AATAAGAGTTTGGTTTTGAC 8978 SEQ ID NO:5479 -4.6 -17.8 56.8 -13.2 0 -2.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TACAACTGGAGTTTTCCACT 9001 SEQ ID NO:5480 -4.6 -22.5 66.4 -15.8 -2.1 -5.6
AATATGCATTACAACTGGAG 9010 SEQ ID NO: 5481 -4.6 -18.4 56.5 -13.8 0 -6.8
GAATTATGAAATACATATTT 9050 SEQ ID NO:5482 -4.6 -13.4 46.3 -7.7 -1 -5.1
AACGTGTCTTCCTCTGGCAG 140 SEQ ID NO: 5483 -4.5 -26.4 75.3 -21.9 0 -5.3
TGCTCCATAATCTCTGATAA 218 SEQ ID NO:5484 -4.5 -21 62.7 -16.5 0 -3.6
AGTCACAGCACCTTTTTCCG 395 SEQ ID NO:5485 -4.5 -26.4 74.4 -21.9 0 -4.1
TTTCAGGTCCTGGGGGTACC 489 SEQ ID NO:5486 -4.5 -28.9 82.4 -21.1 -3.3 -12.6
GGTGGCACTGAATCGGAAAA 767 SEQ ID NO: 5487 -4.5 -22 62.3 -17.5 0 -4.5
CCAGTGAATGTGTACTCTAC 940 SEQ ID NO: 5488 -4.5 -22.2 66.6 -17.7 0 -4.9
AAAATCTTCTAAGCAAAACC 1001 SEQ ID NO:5489 -4.5 -16.2 51.1 -11.7 0 -4.1
AGAAACGTAAAATCTTCTAA 1009 SEQ ID NO:5490 -4.5 -14.7 48.5 -10.2 0 -5.3
GGTCCACAAACTCTGTCACA 1077 SEQ ID NO: 5491 -4.5 -24.6 70.8 -19.4 -0.5 -3
GAGTCATGAGTCGAAATAGA 1596 SEQ ID NO: 5492 -4.5 -19.4 59.5 -13.4 0 -10.9
CACCACAGCCAGGATCAAAT 1721 SEQ ID NO: 5493 -4.5 -24.5 67.7 -20 0 -5.3
CTGTCTCTCTCTCCTTTGTT 2017 SEQ ID NO: 5494 -4.5 -26.1 79.7 -21.6 0 0
TTCAGATTCGGATTTGGGAA 2039 SEQ ID NO:5495 -4.5 -21.4 63.2 -16.9 0 -5
AAAGGAAGCTGCTTCTTTTG 2067 SEQ ID NO:5496 -4.5 -20.8 62.5 -13.1 -2 -14.4
CTGGTCAGTCTGTTTCCATC 2095 SEQ ID NO: 5497 -4.5 -25.8 78 -20.8 -0.1 -4.4
CCCTGGCACCATCCTGGATG 2363 SEQ ID NO:5498 -4.5 -30.6 80.2 -24.4 -1.2 -11.2
GAGCTGAAGGTCCACCCACC 2439 SEQ ID NO:5499 -4.5 -29.8 79.8 -24.4 -0.8 -5.8
CAATGATCTTGAGAACCATT 2889 SEQ ID NO:5500 -4.5 -19.5 58.5 -15 0 -7.1
CAATCCCTCCACATTTGACA 2993 SEQ ID NO:5501 -4.5 -25 69.2 -20.5 0 -2.4
GAGCCCCCACAGAATTGCCA 3096 SEQ ID NO: 5502 -4.5 -30.5 78.7 -26 0 -3.2
GCATGCCGACCACAGCAAAA 3156 SEQ ID NO:5503 -4.5 -25.9 68.3 -20.3 -1 -8.1
ATACAGTCCCACATGGTCTC 3307 SEQ ID NO:5504 -4.5 -25.9 75.3 -21.4 0 -5.2
TTTCGCTGTTCAATGTATAT 4153 SEQ ID NO:5505 -4.5 -20.4 62.1 -15.9 0 -3.1
AAGCATTTCCAGAATGAATA 4220 SEQ ID NO:5506 -4.5 -18.6 56.6 -12.5 -1.6 -4.9
CTTAATGTCCGTAATGATTT 4372 SEQ ID NO:5507 -4.5 -19.4 58.5 -14.9 0 -2.6
GCTCTTAATGTCCGTAATGA 4375 SEQ ID NO:5508 -4.5 -22.3 65.1 -17.8 0 -2.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ACATTCATGATAGAGGGAAT 4465 SEQ ID NO:5509 -4.5 -19.3 59.2 -14.8 0 -6.4
GTTAACATCACTAATGTCAA 4589 SEQ ID NO: 5510 -4.5 -18 56.4 -11.9 -1.5 -6.6
GCAGGAAGGGACATCATCAA 5413 SEQ ID NO: 5511 -4.5 -23 66.6 -17.9 -0.3 -3.7
TCAAAGTTGAACATGTCATC 5530 SEQ ID NO: 5512 -4.5 -18.5 57.8 -13.4 -0.3 -7
AAAAAGAAAATCCCAACAGA 5704 SEQ ID NO:5513 -4.5 -15.6 49 -11.1 0 -2
ACATGTTCACCACAACCAGG 5748 SEQ ID NO:5514 -4.5 -24.5 68.8 -19.3 -0.4 -6.1
ACACAAAACACGCTTTGTAA 6038 SEQ ID NO: 5515 -4.5 -18.7 55.7 -12.7 -1.4 -6.6
TAAGTCAATCCTCCCTTTAA 6266 SEQ ID NO:5516 -4.5 -22.4 64.9 -17.9 0 -2.4
TTTTCCTTTGCTTTCTTTTT 6431 SEQ ID NO:5517 -4.5 -22.4 68.4 -17.9 0 -3.6
CAAAGATAATTCTTTGTTTC 6478 SEQ ID NO: 5518 -4.5 -16.3 53.2 -8.4 -3.4 -8.4
TGACTATGAGTATTTGTTAA 6580 SEQ ID NO:5519 -4.5 -17.4 56 -12.4 -0.1 -3
CTTCACAGAGTTGCAGTGAC 6632 SEQ ID NO: 5520 -4.5 -23.4 70.7 -17.4 -1.4 -7.4
AAAAATAGTGACATAGCATT 6888 SEQ ID NO: 5521 -4.5 -15.9 51.2 -11.4 0 -4.1
CTAGAAAATGGAAGTAACTG 7038 SEQ ID NO:5522 -4.5 -15.5 50.3 -11 0 -3
ACAGGCACATAACTGTTCAG 7105 SEQ ID NO: 5523 -4.5 -22 65.5 -16.2 -1.2 -6.7
ATGTGACATTCTTTAACCAA 7613 SEQ ID NO:5524 -4.5 -19.5 59 -15 0 -3.5
TGAATTAAAAGTGCAAAAGT 7711 SEQ ID NO:5525 -4.5 -14.4 47.8 -9.9 0 -5.4
TGTCATCAACCTGAAAATAA 7902 SEQ ID NO:5526 -4.5 -17.3 53.5 -12.8 0.4 -3
TACTACAAAAGTTGAATAAA 8171 SEQ ID NO:5527 -4.5 -12.8 44.9 -7.7 -0.3 -4.2
GTTCACAAAGCTGCTTTTAA 8661 SEQ ID NO:5528 -4.5 -20.6 62 -14.6 -0.3 -10.9
ATTAGTTACAATTTTTTTTC 72 SEQ ID NO:5529 -4.4 -16.1 53.7 -11.7 0 -2.6
CTGATAAAACAGAGCCTTAT 205 SEQ ID NO:5530 -4.4 -19.1 57.5 -14.7 0 -4.5
GAATGTCTCCATAAATAAAT 657 SEQ ID NO:5531 -4.4 -16.1 51.3 -11.1 -0.3 -2.8
AATAGTGCACATGATAAGCA 866 SEQ ID NO: 5532 -4.4 -19.7 59.6 -14.3 -0.4 -9.9
GCCCAATGAGAGCAAACACG 1248 SEQ ID NO:5533 -4.4 -24 65 -19.6 0 -4.1
GCTCATTGTTACATTAACAA 1385 SEQ ID NO:5534 -4.4 -19.1 58.7 -12.6 -2.1 -8
CGAAATAGAGACAGGAAAGC 1585 SEQ ID NO: 5535 -4.4 -18 54.7 -13.6 0 -2.8
CTGCTGAAATTCGGCCTCTT 1793 SEQ ID NO:5536 -4.4 -25.4 70.6 -19 -2 -10.2
CTGGATGACATACTGGCCTG 2350 SEQ ID NO:5537 -4.4 -24.9 70.4 -20.5 0 -7.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TAGATTCTTCAAGTTCTTCC 2619 SEQ ID NO:5538 -4.4 -21.3 66.2 -16.4 -0.2 -3.6
TAAATTCACAAGATGTTTTA 2717 SEQ ID NO:5539 -4.4 -15.5 51 -11.1 0 -4.3
CACTACTGAATTGCTCAGTC 2823 SEQ ID NO:5540 -4.4 -22 66.4 -14.8 -2.8 -8.2
CTGAGGCTGACAATAATTCC 2956 SEQ ID NO: 5541 -4.4 -21.7 63.5 -17.3 0 -2.9
TTTTCACATAATCAATTCCC 3510 SEQ ID NO: 5542 -4.4 -20.2 60.4 -15.8 0 -2.5
CAGTATTATTGGACATGCAG 3612 SEQ ID NO:5543 -4.4 -20.7 62.8 -16.3 0 -5.5
AGGATCATGAACACAATGAA 4102 SEQ ID NO:5544 -4.4 -17.8 54.8 -12.5 -0.8 -7.4
ATGTATATATCTTCAAAGGC 4141 SEQ ID NO: 5545 -4.4 -18.4 58 -14 0 -4.2
CCAGCCTTTAAATGTGGCCA 4709 SEQ ID NO: 5546 -4.4 -26.8 72.6 -20.6 -1.8 -8.8
CCATGTTGAGGCAGATGAGG 5073 SEQ ID NO: 5547 -4.4 -24.7 71.1 -20.3 0 -4.3
CAAAGATGTTCCAGCCTATA 5229 SEQ ID NO: 5548 -4.4 -22.4 64.9 -18 0 -3.2
CCTTTGCTCCTTTGATCAGA 5370 SEQ ID NO:5549 -4.4 -25.6 73.6 -21.2 0 -6.5
GCCGATGTTAAACAACGCAG 5429 SEQ ID NO:5550 -4.4 -22.5 62.2 -18.1 2.6 -6
CTTTTTAACATAGGCAAAGT 5498 SEQ ID NO:5551 -4.4 -18.4 57 -14 0 -4
GGTGGTGCACTATTAAGAAT 5623 SEQ ID NO: 5552 -4.4 -21.1 63.3 -15.1 -1.1 -10.8
ATGTACATGTTCACCACAAC 5752 SEQ ID NO: 5553 -4.4 -21.5 63.7 -16.4 -0.4 -7.6
ATCAAACTTTTbCCAAACCT 5855 SEQ ID NO:5554 -4.4 -21.9 62 -17.5 0 -2.5
AGCTGCAAAATCAGAGAGTT 5906 SEQ ID NO:5555 -4.4 -20.7 62.3 -15.6 -0.4 -6.5
TCTCTCCACTCTCACACAAA 6051 SEQ ID NO:5556 -4.4 -23.6 68.8 -19.2 0 0
AGACTTTGGAGGGGTTTGAT 6111 SEQ ID NO: 5557 -4.4 ;-23.3 69.5 -18.9 0 -2.6
CCTTTGCTTTAAAAGATAAC 6209 SEQ ID NO:5558 -4.4 -17.4 54.1 -12.2 -0.6 -4.8
CTTGATATATTTTTTAACCT 6226 SEQ ID NO:5559 -4.4 -17.6 55.6 -13.2 0 -4.3
TGGTTTGTCTTTCTCAAACT 6410 SEQ ID NO: 5560 -4.4 -21.4 65.6 -13.8 -3.2 -8.3
CCATTGGGTTTCTCCTCAGC 6703 SEQ ID NO: 5561 -4.4 -28.1 80.5 -22.8 -0.8 -5
ACAACTATCCCTATAGTCTA 6728 SEQ ID NO: 5562 -4.4 -21.9 65.3 -15.5 -2 -5.4
TACTGTTTCTTCAACGTAAA 6918 SEQ ID NO: 5563 -4.4 -18.5 57.2 -13 -1 -5.3
AATATTAGAGGAGACTTTAC 7123 SEQ ID NO:5564 -4.4 -17 55 -11.7 -0.7 -6.7
ATATTTGATTTAATAGAAGT 7450 SEQ ID NO: 5565 -4.4 -14.5 49.3 -10.1 0 -2.6
AAACAAGTTTTAGACATATT 7821 SEQ ID NO:5566 -4.4 -15.3 50.5 -10.2 -0.4 -5.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GTGCAGCAGGAATTAAAAAA 8215 SEQ ID NO:5567 -4.4 -17.6 53.9 -13.2 0 -6.6
TTTTATTAATTATATATATT 8542 SEQ ID NO: 5568 -4.4 -12.1 44.3 -7.7 0 -5.2
TTATTATCAAACCTGAAAGT ( 8717 SEQ ID NO:5569 -4.4 -16.8 53.1 -11.7 -0.4 -2.9
ATCAATTATATTGAAAGAAG 8805 SEQ ID NO:5570 -4.4 -13.1 45.8 -6.7 -2 -6.6
AATGTAACATTTATTAGCCA 8845 SEQ ID NO:5571 -4.4 -18.6 57.2 -13.7 -0.2 -5.5
TATATAATGCATTTAAGTAA 8870 SEQ ID NO:5572 -4.4 -14.3 48.4 -9.3 0 -8.5
CTCTGTGGATAAGAAAACAA 45 SEQ ID NO: 5573 -4.3 -16.9 53 -12.6 0 -2.9
CTTCCAAGTCACTATTTGGC 621 SEQ ID NO: 5574 -4.3 -23.7 69.8 -17.9 -1.4 -5.1
GCACTGAATCGGAAAATTGC 763 SEQ ID NO: 5575 -4.3 -20.3 58.9 -16 0 -4.3
CTCTACATTCTTTGTCCAGT 926 SEQ ID NO: 5576 -4.3 -23.9 72.3 -19 -0.3 -3.5
GTGTACTCTACATTCTTTGT 931 SEQ ID NO: 5577 -4.3 -21.9 68.4 -16.7 -0.8 -5
GTTCTCAACGCTGAGACATT 1102 SEQ ID NO: 5578 -4.3 -22.9 67 -15.8 -2.8 -8.2
TTCC7AAGGTGGCCTGATTCT 1760 SEQ ID NO: 5579 -4.3 -26.8 75.7 -21.6 -0.7 -7.2
GCTGAAATTCGGCCTCTTTT 1791 SEQ ID NO: 5580 -4.3 -24.7 69.5 -19 -1.3 -9.2
CTTCAGATTCGGATTTGGGA 2040 SEQ ID NO:5581 -4.3 -23 67.3 -18.7 0 -5
CCCGACCTCTGAAACTGAAA 2202 SEQ ID NO:5582 -4.3 -23.3 63.1 -19 0 -2.8
AAGAGCTTAACCTTCTCTTT 2517 SEQ ID NO: 5583 -4.3 -21.7 65.2 -15.8 -1.5 -5.5
GCGGACATTTCTGTCTAGAT 2634 SEQ ID NO: 5584 -4.3 -23.6 69.6 -16.6 -2.7 -8
AGATGTTTTACTTTTAACCA 2707 SEQ ID NO: 5585 -4.3 -19.1 59.1 -14.8 0 -2.8
ATGATCTTGAGAACCATTTC 2887 SEQ ID NO:5586 -4.3 -20 61 -15.7 0 -5.1
GAAAACTCTAAGCAGTCTGA 3029 SEQ ID NO:5587 -4.3 -19.5 59.5 -15.2 0 -4.1
AAAGAGCTGCATGCCGACCA 3164 SEQ ID NO:5588 -4.3 -26.5 70.8 -21.5 0 -9.1
ACAGTCCCACATGGTCTCTA
3305 SEQ ID NO:5589 -4.3 -26.8 77.4 -22.5 0 -5.2 TACAGTCCCACATGGTCTCT
3306 SEQ ID NO:5590 -4.3 -26.8 77.4 -22.5 0 -5.2 CTACACCACTGGTGGTTCCA
3675 SEQ ID NO:5591 -4.3 -27.5 77 -20.6 -2.6 -12
GAAACTTTTTAATACACCCT 3984 SEQ ID NO:5592 -4.3 -19.4 57.8 -15.1 0 -2.5
TCAAAGGCCAATGCACCACT 4129 SEQ ID NO:5593 -4.3 -25.2 68.7 -19.4 -1.4 -6.9
AGCATTGGCTACCAGGCTAA 4325 SEQ ID NO:5594 -4.3 -26 73.3 -20.1 -1.5 -7.1
TTAGAGGTCTTAAAGCTCTT 4389 SEQ ID NO:5595 -4.3 -20.6 64 -15.1 -1.1 -5.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
CATGCCTTCAAACCGGGATA
4415 SEQ ID NO: 5596 -4.3 -24.9 67.5 -20.6 0 -7.1 CATCTCGTGAATCAACAGCT
4746 SEQ ID NO: 5597 -4.3 -22.3 64.9 -18 0 -4.6 TAAATACATGTACAGATTTT
4790 SEQ ID NO: 5598 -4.3 -15.6 51.2 -10.8 0 -8.2 TCCAAGTTTCTTCATTGCAT
4952 SEQ ID NO: 5599 -4.3 -22.9 68.2 -18.6 0 -5.1 ATCAAAGACCATTCCTTGGA
5015 SEQ ID NO: 5600 -4.3 -22.5 64.8 -16.6 -1.5 -4.8 GTGAACAGAACAATGAACAC
5161 SEQ ID NO: 5601 -4.3 -17.1 53.2 -12.8 0 -3.2 ATCATCTCAGCCAGAAACAT
5281 SEQ ID NO: 5602 -4.3 -22.1 64.8 -17.8 0 -3.6 AGGAAGGGACATCATCAAAG
5411 SEQ ID NO: 5603 -4.3 -19.8 59.6 -14.9 -0.3 -2.9 AACATGTCATCAATTCCAGC
5521 SEQ ID NO: 5604 -4.3 -21.9 64.7 -17.6 0 -6.9 TTGAACATGTCATCAATTCC
5524 SEQ ID NO: 5605 -4.3 -20.1 60.7 -14.9 -0.5 -9.1 GAAAATCCCAACAGATGGGT
5699 SEQ ID NO: 5606 -4.3 -22 62.3 -14.5 -3.2 -7.9 GGGTTTTGCTATGAGAAGAG
5939 SEQ ID NO: 5607 -4.3 -21.4 64.9 -17.1 0 -3.6 GGTTTGATGCCATAAACCTG
6099 SEQ ID NO: 5608 -4.3 -23.1 65.5 -16.5 -2.3 -8.6 AATTACGCTGAATGATAGCG
6183 SEQ ID NO: 5609 -4.3 -19.6 57.6 -13 -2.3 -7.6 ACTGTTTCTTCAACGTAAAC
6917 SEQ ID NO: 5610 -4.3 -19 58.2 -13.6 -1 -6.2 TGTGATGTCATCAACCTGAA
7907 SEQ ID NO: 5611 -4.3 -21.5 63.5 -16.1 -1 -6.9 AAATTATCCATTGAAAAATC
7992 SEQ ID NO: 5612 -4.3 -13.8 46.6 -8.8 -0.5 -4 GGAATGGTAGAAAATATATT
8058 SEQ ID NO: 5613 -4.3 -15.2 49.9 -10.9 0 -5.9 TTGGAATGGTAGAAAATATA
8060 SEQ ID NO: 5614 -4.3 -15.2 49.9 -10.9 0 -2.7 AAAAATAAGACTAGTCTGCA
8199 SEQ ID NO: 5615 -4.3 -16.6 52.8 -10.6 0 -11.5 TAAAAAGAACAAAGTCCATG
8255 SEQ ID NO: 5616 -4.3 -14.6 47.9 -10.3 0 -3.9 TAAAAAATGAAATTTATTCT
8460 SEQ ID NO: 5617 -4.3 -10.7 41 -5.1 -1.2 -5.2 ATAGCATCAATTATATTGAA
8810 SEQ ID NO: 5618 -4.3 -16.1 52.2 -9.8 -2 -8.1 CTCAATAACTATATCATTAA
8913 SEQ ID NO: 5619 -4.3 -15 49.8 -10.7 0 -2.6 AAAAATATGCATTACAACTG
9013 SEQ ID NO: 5620 -4.3 -14.5 47.9 -10.2 0 -6.8 TATGGGAGAATTATGAAATA
9057 SEQ ID NO: 5621 -4.3 -15.3 50.1 -11 0 -3.2 CAGAATCCTCTCTGCTTATG
14 SEQ ID NO: 5622 -4.2 -23 68 -18.1 -0.4 -3.7 TTTCCAGAATCCTCTCTGCT
18 SEQ ID NO: 5623 -4.2 -25.8 74.6 -20.6 -0.9 -4.5 GCATCCAAGATGGTTAGGGT
162 SEQ ID NO: 5624 -4.2 -25.3 73.1 -19.6 -1.4 -6.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligc oligo AGCCCAGCATCCAAGATGGT
168 SEQ ID NO: 5625 -4.2 -28.4 77.5 -22.6 -1.5 -7 TCTGATAAAACAGAGCCTTA
206 SEQ ID NO: 5626 -4.2 -19.5 58.8 -14.1 -1.1 -5.9 TAAAAAGGCGGAAGCTTTCA
504 SEQ ID NO: 5627 -4.2 -19.8 58.1 -13.2 -2.4 -7.6 ATAGTGCACATGATAAGCAT
865 SEQ ID NO: 5628 -4.2 -20.4 61.6 -14.9 -1.1 -9.4 ATTCCAGTGAATGTGTACTC
943 SEQ ID NO: 5629 -4.2 -21.9 66.5 -16.8 -0.7 -6.2 ATATGCCATCACAATGACAC
1058 SEQ ID NO: 5630 -4.2 -21.2 62 -16.3 -0.4 -4.2 TGCAGCCCAATGAGAGCAAA
1252 SEQ ID NO: 5631 -4.2 -24.6 67.6 -19.6 -0.6 -5.4 TGCTCATTGTTACATTAACA
1386 SEQ ID NO: 5632 -4.2 -19.8 60.7 -14.1 -1.4 -6.4 TTAAATGTGCTCATTGTTAC
1393 SEQ ID NO: 5633 -4.2 -18.7 58.6 -12.9 -1.6 -4 ATAAAATGAGCCCAAGAAAA
1694 SEQ ID NO: 5634 -4.2 -16.5 50.8 -12.3 0 -3.2 TTCTTTAGCACCTTTGGAAC
1946 SEQ ID NO: 5635 -4.2 -22.4 66.4 -18.2 0 -4.1 TCTTCAGATTCGGATTTGGG
2041 SEQ ID NO: 5636 -4.2 -22.8 67.5 -18.6 0 -5 AAAAGGAAGCTGCTTCTTTT
2068 SEQ ID NO: 5637 -4.2 -20.1 60.5 -12.4 -2.3 -15 GGCACCATCCTGGATGACAT
2359 SEQ ID NO: 5638 -4.2 -27.2 74.7 -21.3 -1.2 -11.3 CCACACCATTGCAATCCACA
2412 SEQ ID NO: 5639 -4.2 -26.4 70.9 -21.6 0 -8.6 AAGATGTTTTACTTTTAACC
2708 SEQ ID NO: 5640 -4.2 -17.7 55.9 -13.5 0 -2.8 TTTCTGCTGTGAAAATCCCA
2871 SEQ ID NO: 5641 -4.2 -23 65.7 -18.3 -0.2 -4 TATTTAGTGTGGGCCAGGAT
3060 SEQ ID NO: 5642 -4.2 -24.7 72.3 -20 0 -7.6 TTGCATTTAATTTCTCTTTG
3858 SEQ ID NO: 5643 -4.2 -18.8 59.3 -14.6 0 -5.1 GTAAAGACTTTGTCAGCATA
4195 SEQ ID NO: 5644 -4.2 -19.9 61.4 -15 -0.4 -4.6 TGGATCCAAGTTTCTTCATT
4956 SEQ ID NO: 5645 -4.2 -22.2 66.7 -17.1 0 -9.6 TGCTGATATCAAAGACTTGT
5046 SEQ ID NO: 5646 -4.2 -19.7 60.2 -14.9 -0.3 -7.7 TACTTTTCTATCATCTCAGC
5290 SEQ ID NO: 5647 -4.2 -21.4 66.9 -17.2 0 -2.8 ATTCCAGCTTCCTTTTTAAC
5509 SEQ ID NO: 5648 -4.2 -22.9 67.6 -18.7 0 -4.3 AGGGTCACAGTCGGGTGGTG
5636 SEQ ID NO: 5649 -4.2 -28 81 -23.8 0 -5.6 CCAAACCTCATAGAACATCT
5843 SEQ ID NO: 5650 -4.2 -21.3 61.5 -17.1 0 -2.6 CTCTATAAACTGGGTCGCAT
5879 SEQ ID NO: 5651 -4.2 -22.6 65.4 -18.4 0 -3.6 CTCCCTTTAATTGCCTCTTT
6256 SEQ ID NO: 5652 -4.2 -25.7 72.6 -21.5 0 -3 GGTTTGTCTTTCTCAAACTT
6409 SEQ ID NO: 5653 -4.2 -21.5 66.1 -14.1 -3.2 -8.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo AAGTCCAGTTGACACATATA 6530 SEQ ID NO: 5654 -4.2 -20.7 62.7 -14.7 -1.8 -4.9
ACATAACAGACTAAAATACT 7075 SEQ ID NO:5655 -4.2 -14.9 49 -10.7 0 -2
TAGATTACTTTTTGGAAAGC 7233 SEQ ID NO: 5656 -4.2 -17.8 56.3 -12 -1.6 -5.2
AGAAGATGGCAAAGCAATAC 7320 SEQ ID NO: 5657 -4.2 -18.5 56.2 -13.4 -0.7 -4.3
AAGCTTGCAAAAGACACATA 7481 SEQ ID NO:5658 -4.2 -18.6 56.3 -12.3 -2.1 -6.9
TGAATGATACAGGATACATC 7509 SEQ ID NO:5659 -4.2 -17.9 56.1 -13.7 0 -3.2
AAGTGCAAAAGTAAAGGTGT 7703 SEQ ID NO: 5660 -4.2 -18 55.7 -13.8 0 -5.4
TAAAGTTGATTATATTTTTA 7855 SEQ ID NO:5661 -4.2 -13.8 47.9 -9.6 0 -2.6
TGCTGACAAATAAAGTTGAT
7865 SEQ ID NO: 5662 -4.2 -17 53.3 -12.3 -0.1 -3.7 ATGCTGACAAATAAAGTTGA
7866 SEQ ID NO:5663 -4.2 -17 53.3 -12.3 -0.1 -3.7 TTCAAAAGTTTGGAATTGTG
7965 SEQ ID NO:5664 -4.2 -16.9 53.8 -12.2 -0.1 -6.9
TGGAATGGTAGAAAATATAT 8059 SEQ ID NO:5665 -4.2 -15.1 49.6 -10.9 0 -3.9
AAAATAAGACTAGTCTGCAT 8198 SEQ ID NO: 5666 -4.2 -17.3 54.5 -11.4 0 -11.5
ACTGGAGTTTTCCACTGAGA 8997 SEQ ID NO:5667 -4.2 -23.8 70.4 -17.5 -2.1 -6.3
CTGTCAAACCTTGATGTGGC 254 SEQ ID NO: 5668 -4.1 -23.8 68.5 -18.5 -1.1 -5
CCAACAGTGCCTGTGCCATC 471 SEQ ID NO: 5669 -4.1 -28.9 78.6 -23.2 -1.5 -8.7
TGCCAAGATTTTTATAAGTG 977 SEQ ID NO:5670 -4.1 -18.7 57.7 -14.6 0 -4.1
CTCATTGTTACATTAACAAA 1384 SEQ ID NO:5671 -4.1 -16.6 53 -9.7 -2.8 -8.5
AATTCACCAAATAAAATGAG 1704 SEQ ID NO: 5672 -4.1 -14.2 47.1 -10.1 0 -3
AGCTCTCCTAACCCACCTAC 1894 SEQ ID NO: 5673 -4.1 -28.2 77 -24.1 0 -4.3
GTTTCCTTCAAGGTGCTCTC 1997 SEQ ID NO:5674 -4.1, -26 77.8 -21.1 -0.6 -5.3
TTCAGATCCAACATCCTTTG 2222 SEQ ID NO: 5675 -4.1 -22.6 66 -18 -0.1 -4.5
TACCAGCATGGCGGACATTT 2644 SEQ ID NO: 5676 -4.1 -25.8 71.2 -19.7 -2 -7.4
AAATCTATACCAGCATGGCG 2651 SEQ ID NO:5677 -4.1 -22.5 63.8 -16.4 -2 -7.4
GTTTCCTACAGTCAACACAC 2840 SEQ ID NO:5678 -4.1 -22.9 68.1 -18.3 -0.1 -3
AGGTTTCCTACAGTCAACAC 2842 SEQ ID NO:5679 -4.1 -23.2 69.2 -18.6 -0.2 -3.6
AAAGACCAGGTTTCCTACAG 2849 SEQ ID NO:5680 -4.1 -22.6 65.7 -18 -0.1 -5.9
CCATTTCTGCTGTGAAAATC 2874 SEQ ID NO:5681 -4.1 -21 62.1 -16 -0.7 -5
CTTCTTGGAAATAGTAATAA 2919 SEQ ID NO: 5682 -4.1 -15.7 51.3 -11.6 0 -3.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CTAAGCAGTCTGAATGATCG 3022 SEQ ID NO:5683 -4.1 -20.6 61.5 -15.8 -0.4 -5.6
GGAGCGTACAGTCATCATTG 3216 SEQ ID NO:5684 -4.1 -23.7 69.9 -19.6 0 -5
TCTAAAAAAGGCTTTTTGGA 3548 SEQ ID NO: 5685 -4.1 -17.6 54.7 -11.4 -2.1 -7.7
AACATCAACTGTGCTTCCTT 3890 SEQ ID NO:5686 -4.1 -23.1 67.2 -18.3 -0.4 -4.1
GGGTAGAACAACATCAACTG 3899 SEQ ID NO:5687 -4.1 -19.8 59.4 -15.7 0 -2.9
TGGAAACTTTTTAATACACC 3986 SEQ ID NO: 5688 -4.1 -17.7 54.7 -13.6 0 -2.8
GAGTAGCCAAGAGCATTGGC 4336 SEQ ID NO:5689 -4.1 -25.5 73.4 -17.8 -3.6 -12
TGATGGCACCGAGTTCTGAG 4353 SEQ ID NO:5690 -4.1 -25.1 71.2 -21 0 -3.9
AAAGATGACAAAGTATAAAT 4805 SEQ ID NO:5691 -4.1 -12.5 44.2 -8.4 0 -2.8
CCGTTTCCACCATCATGGTG 5094 SEQ ID NO: 5692 -4.1 -27.7 75.3 -20.3 -3.3 -10.5
CAAGCAGATCATGCTGTTGC 5558 SEQ ID NO:5693 -4.1 -24 70.2 -17.1 -2.8 -10.6
TAGCAATCCATCCCAGCCAG 5597 SEQ ID NO: 5694 -4.1 -28.2 76.2 -24.1 0 -4.1
AACTTTTCCCAAACCTCATA 5851 SEQ ID NO: 5695 -4.1 -22.3 63.4 -18.2 0 -1.7
GACAGTGGATCCGGTCACCA 6000 SEQ ID NO:5696 -4.1 -28.1 77.3 -22.8 -0.7 -10.1
CTGAAATTACGCTGAATGAT 6187 • SEQ ID NO: 5697 -4.1 -18.1 54.8 -14 0 -3.3
GGACTGTACTAAAGGTGTTT 6773 SEQ ID NO: 5698 -4.1 -21 63.9 -16.9 0 -4.1
ATTTACAAAAATAGTGACAT 6894 SEQ ID NO:5699 -4.1 -14.4 48.2 -9.7 -0.3 -4.8
TAAAATAAATTGTGATGTCA 7917 SEQ ID NO:5700 -4.1 -14.1 47.6 -10 0 -4.9
CAATAATGACGTAGCTCACC 8433 SEQ ID NO:5701 -4.1 -21.5 62.2 -17.4 0 -5.3
ATAACTATATCATTAATACC 8909 SEQ ID NO:5702 -4.1 -15.6 51 -11.5 0 -4.2
TTATGAAATACATATTTAGA 9047 SEQ ID NO:5703 -4.1 -13.8 47.4 -8.6 -1 -4.6
ATAACAAAGCCCAGCATCCA 175 SEQ ID NO: 5704 -4 -24.6 67.2 -19.7 -0.7 -4.1
TTATGAATTACAGCATAACA 189 SEQ ID NO: 5705 -4 -16.8 53.3 -11.9 -0.8 -4.9
CTGGAGGAATGTCTCCATAA 663 SEQ ID NO:5706 -4 -22.4 65.5 -15.1 -3.3 -8.5
ACTGAATCGGAAAATTGCCT 761 SEQ ID NO:5707 -4 -20.7 59.3 -16.7 0 -4.4
CCGACTGGATCAGGGCCCCC 1182 SEQ ID NO:5708 -4 -33.6 84.5 -28.2 -0.7 -10.5
AGAACACAGTCAGGATCATC 1221 SEQ ID NO: 5709 -4 -21.3 65 -17.3 0 -5.3
TGTAATCCTTCCAGTTAAAT 1407 SEQ ID NO: 5710 -4 -20.3 60.9 -16.3 0 -2.8
ACTGTCATCTCCAATGTAAT 1421 SEQ ID NO:5711 -4 -21.3 63.9 -17.3 0.3 -3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TTTGCCCATCCAAAACATAA 1446 SEQ ID NO: 5712 -4 -21.6 60.7 -17.1 -0.1 -3.4
ATAGTTGGGGTTTCGACCAG 1535 SEQ ID NO:5713 -4 -24.7 71.3 -18 -2.7 -6.4
AACTGGTAAAGATTTTCCCA 1624 SEQ ID NO: 5714 -4 -21.1 61.8 -17.1 0 -4.6
TGCCGCAACTGCCTGAGCTT 1844 SEQ ID N0:5715 -4 -29.6 78.3 -24.4 -1.1 -7.1
AACTTTGATGCTTCTGAAGA 1924 SEQ ID N0:5716 -4 -19.8 60.4 -15.3 0 -8.3
GCGGCACAAACAGTGAGTCT 2295 SEQ ID NO: 5717 -4 -25 70.7 -19.4 -1.5 -7
TGGCACCATCCTGGATGACA 2360 SEQ ID NO:5718 -4 -27.2 74.6 -21.3 -1.2 -11.8
TTAAGACAATGCAAATAGTG 2769 SEQ ID NO:5719 -4 -15.9 51.2 -11.4 -0.1 -5.6
TAGTAATAAGGATCCATGGC 2908 SEQ ID N0:5720 -4 -20.8 62.3 -15.9 0 -9.5
TCTTAATTAGCATATTTAGT 3072 SEQ ID NO: 5721 -4 -17.5 56.7 -13.5 0 -4.1
AAGAGGTTCAGAACCACAAG 3388 SEQ ID NO:5722 -4 -20.5 61 -13.8 -2.7 -12
ATCTGCAGATTATTCATTTC 3469 SEQ ID NO: 5723 -4 -20 62.7 -14.3 -0.2 -11.6
TTTGCATTCTTCCTACTGCA 3489 SEQ ID NO:5724 -4 -24.8 72.4 -19.3 -1.4 -5.4
CTGTCTATCTTATTGCCTTC 3592 SEQ ID NO:5725 -4 -23.5 71.2 -19.5 0 -3
TACCTACACCACTGGTGGTT 3678 SEQ ID NO:5726 -4 -26.3 74.2 -19.7 -2.6 -12
TCATCGATTACGTATTTTTC 3712 SEQ ID NO: 5727 -4 -19.4 59.6 -14.5 -0.7 -6.3
GTTTATGAATGACATATAAT 3737 SEQ ID NO:5728 -4 -15.2 50.3 -10.1 -1 -5.1
GATGAGCTGGTTGCATTTAA 3868 SEQ ID NO: 5729 -4 -22.1 65.8 -17.2 -0.7 -5.1
CAGATGAGCTGGTTGCATTT 3870 SEQ ID NO: 5730 -4 -23.8 70.2 -18.2 -1.5 -6.1
TTCCTTCAGATGAGCTGGTT 3876 SEQ ID NO: 5731 -4 -25 74 -19.8 -1.1 -5
TCAACTGTGCTTCCTTCAGA 3886 SEQ ID NO:5732 -4 -24.6 72.2 -19.7 -0.7 -4
CATCAACTGTGCTTCCTTCA 3888 SEQ ID NO: 5733 -4 -24.7 71.7 -20.7 0 -3.6
CAACATCAACTGTGCTTCCT 3891 SEQ ID NO: 5734 -4 -23.7 68 -19 -0.4 -4.1
CGGGGTAGAACAACATCAAC 3901 SEQ ID NO: 5735 -4 -20.9 60.6 -16.9 0 -2.9
TGAACACAATGAAAGTCTCA 4095 SEQ ID NO:5736 -4 -17.8 55.1 -13.3 -0.1 -3.3
TATAGGTAAAGACTTTGTCA 4200 SEQ ID NO: 5737 -4 -18.3 58 -13 -1.2 -5.2
TCCATAAGCAACCCATTTGA 4241 SEQ ID NO: 5738 -4 -23.6 65.9 -18.9 -0.4 -4.1
GCATTGGCTACCAGGCTAAC 4324 SEQ ID NO:5739 -4 -26.2 73.6 -20.9 -1.2 -7.2
AGCTCTTAATGTCCGTAATG 4376 SEQ ID NO:5740 -4 -21.7 64 -17.7 0 -4.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TGTCATGTTAACACAGTGGT 4556 SEQ ID NO:5741 -4 -22 66.8 -17.3 -0.3 -8.2
TCATAAAGATGTCTTGACCT 4908 SEQ ID NO: 5742 -4 -20.3 61.4 -15.5 -0.6 -6.3
TGAACAGAACAATGAACACT 5160 SEQ ID NO:5743 -4 -16.8 52.3 -12.8 0 -3.1
CATCTCAGCCAGAAACATAC 5279 SEQ ID NO: 5744 -4 -21.6 63.4 -17.6 0 -3.6
TGCTCCTTTGATCAGACGTA 5366 SEQ ID NO:5745 -4 -24.4 70.6 -20.4 0 -6.5
ACATAGGCAAAGTTGGACAT 5491 SEQ ID NO:5746 -4 -20.9 62.1 -16.9 0 -4.2
CAAACTTTTCCCAAACCTCA 5853 SEQ ID NO: 5747 -4 -22.6 63.1 -18.6 0 -2.4
ATATCAAGACAGTGGATCCG 6007 SEQ ID NO:5748 -4 -21.8 63.7 -17.1 0 -8.9
TCAGTTTGGCATGGACCTCC 6555 SEQ ID NO:5749 -4 -27.5 78 -23 -0.1 -5.4
TGTCAGCTGGTAATAAAAAC 6681 SEQ ID NO:5750 -4 -17.5 54.7 -12.9 0 -8.6
AAAATAGAATGGATGCAAGG 6791 SEQ ID NO: 5751 -4 -16.3 51.4 -12.3 0 -5.6
TCTGGCAAAACACCTTTGTC 6966 SEQ ID NO: 5752 -4 -22.7 65.7 -17.1 -1.5 -6.6
TTTCTGGTTTTGAGCAAAAA 6995 SEQ ID NO: 5753 -4 -18.5 57 -13.7 -0.6 -8.1
TCAAAATTAAAGCCATCTAG 7054 SEQ ID NO:5754 -4 -16.9 52.9 -12.9 0 -3.4
AACTATTTACATAACATAGG 7378 SEQ ID NO: 5755 -4 -15.7 51.3 -11.2 -0.1 -4.2
TTAAAAGTGCAAAAGTAAAG 7707 SEQ ID NO: 5756 -4 -12.8 44.8 -8.8 0 -5.4
CATATTTTTAGCAAAATATG 7807 SEQ ID NO:5757 -4 -14.6 48.7 -6.8 -3.8 -10.4
GAAAATATATTATAACAAAG 8049 SEQ ID NO:5758 -4 -10.2 40 -6.2 0 -6.2
TGGAACATGTGAACTTGATC 8697 SEQ ID NO:5759 -4 -19.3 58.9 -14.6 -0.4 -7
TACTATTATTATCAAACCTG 8722 SEQ ID NO: 5760 -4 -16.9 53.7 -12.9 0 -1.5
TAAAAATATGCATTACAACT 9014 SEQ ID NO:5761 -4 -14.2 47.4 -10.2 0 -6.8
AATTGTCTTTAAAAATATGC 9023 SEQ ID NO: 5762 -4 -14.5 48.6 -10.5 0 -4.3
CTCTCTGCTTATGCCTCCGC 7 SEQ ID NO: 5763 -3.9 -29.7 81.9 -24.9 -0.8 -4.6
TTTTTTTGACCACAGAGGTT 97 SEQ ID NO: 5764 -3.9 -22.1 66.2 -16.6 -1.5 -4.7
ACCAACAGTGCCTGTGCCAT 472 SEQ ID NO:5765 -3.9 -28.7 77.5 -23.2 -1.5 -8.7
TTGTTCTCATCATCATTATC 595 SEQ ID NO:5766 -3.9 -20.2 64.1 -16.3 0 -1.9
TGATAGCAATTTTCCTAACA 819 SEQ ID NO:5767 -3.9 -19.6 59.2 -15.7 0 -3.3
ACTCTACATTCTTTGTCCAG 927 SEQ ID NO: 5768 -3.9 -22.9 69.3 -19 0 -2.9
ACTCAAAGGTATAGATTCCA 957 SEQ ID NO:5769 -3.9 -20.4 61.7 -15.8 -0.4 -3.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
TGTCACATATGCCATCACAA 1064 SEQ ID NO:5770 -3.9 -22.7 65.8 -18.8 0 -5.6
AGAACTCTGAATGTTCTCAA 1114 SEQ ID NO: 5771 -3.9 -19.2 59.4 -13.3 -2 -7.7
AAAGCTTCTTTACCGACTGG 1194 SEQ ID NO: 5772 -3.9 -22.5 64.6 -17.9 -0.4 -7.6
TTCCTCAGATTGCCCATGAA 1276 SEQ ID NO: 5773 -3.9 -25.6 71.3 -21.7 0 -4.5
GCCCAAGAAAATGACCAGGA 1685 SEQ ID NO: 5774 -3.9 -23.6 64.4 -19.7 0 -4
ACCACAGCCAGGATCAAATT 1720 SEQ ID NO: 5775 -3.9 -23.9 67 -20 0 -5.3
CTGAAATTCGGCCTCTTTTT 1790 SEQ ID NO: 5776 -3.9 -23 65.9 -19.1 0 -6.7
CCTTTGGAACTCAACTTTGA 1936 SEQ ID NO:5777 -3.9 -21.6 63.2 -17.1 -0.3 -4.7
CTTTGTTGTTTCCTTCAAGG 2004 SEQ ID NO:5778 -3.9 -22.8 68.6 -18.3 -0.3 -4.6
TCAAGAGAGACTGATGAGGG 2133 SEQ ID NO: 5779 -3.9 -20.9 63.2 -17 0 -2.8
ATCATCAGCAAAGTCATTTT 2240 SEQ ID NO: 5780 -3.9 -19.9 61.3 -16 0 -4.1
TCCTGGATGACATACTGGCC 2352 SEQ ID NO: 5781 -3.9 -26.4 73.8 -22.5 0 -6.2
CTTCCCATTTGCTGGAAGCC 2381 SEQ ID NO: 5782 -3.9 -27.9 76.2 -21.8 -2.2 -7.9
TTAAATTCACAAGATGTTTT 2718 SEQ ID NO:5783 -3.9 -15.9 51.9 -12 0 -4.3
AACAATTAAATTCACAAGAT 2723 SEQ ID NO: 5784 -3.9 -13.9 46.9 -10 0 -3.1
GACCAGGTTTCCTACAGTCA 2846 SEQ ID NO:5785 -3.9 -26.3 76.3 -21.5 -0.8 -5.9
TAAAGACCAGGTTTCCTACA 2850 SEQ ID NO:5786 -3.9 -22.3 64.9 -17.9 -0.1 -5.3
AATGATCTTGAGAACCATTT 2888 SEQ ID NO:5787 -3.9 -18.9 57.7 -15 0 -7.1
AATCCCTCCACATTTGACAG 2992 SEQ ID NO:5788 -3.9 -24.3 68.3 -20.4 0 -2.4
TTGAAAACTCTAAGCAGTCT 3031 SEQ ID NO:5789 -3.9 -19 58.5 -15.1 0 -4.1
CAAAAATGAAGACGATGATG 3141 SEQ ID NO:5790 -3.9 -14.6 47.5 -10.7 0 -3.5
AAGAGCTGCATGCCGACCAC 3163 SEQ ID NO: 5791 -3.9 -27.4 73.5 -22.5 -0.8 -9.1
ACACAGCACGCGGAACACAA 3275 SEQ ID NO: 5792 -3.9 -24.1 65.2 -19.7 0 -7.9
GTAGCCAAGAGCATTGGCTA 4334 SEQ ID NO: 5793 -3.9 -25.5 73.2 -15.6 -6 -16
GAGTTCTGAGTAGCCAAGAG 4343 SEQ ID NO: 5794 -3.9 -23.1 69.6 -19.2 0 -3.2
TTTGATGGCACCGAGTTCTG 4355 SEQ ID NO: 5795 -3.9 -24.7 70.4 -20.8 0 -4
AGAGGGAATTGCTCCAACAA 4454 SEQ ID NO: 5796 -3.9 -22.3 64 -16.6 -1.8 -6.1
GGAACAAGGTAGGGGACACA 5313 SEQ ID NO:5797 -3.9 -23.4 67.2 -18.9 -0.3 -3.2
CAGTAGCAACACTGAAGTTC 5787 SEQ ID NO: 5798 -3.9 -21 63.7 -16.2 -0.8 -5.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GATCCATGGCAATAAGCTGG 5967 SEQ ID NO:5799 -3.9 -23.6 67 -18.3 -1.3 -8
TTTTGTAAAAATATGGCAGA 6822 SEQ ID NO: 5800 -3.9 -16.4 52.3 -11.2 -1.2 -6.3
ACTATTCTAAAGCAATACTT 7281 SEQ ID NO: 5801 -3.9 -17.2 54.6 -12.7 -0.3 -4.1
AACATAGGGTATTTAATTGA 7366 SEQ ID NO:5802 -3.9 -17.1 54.5 -13.2 0 -2.9
GATACCATATGATACTCATG 7732 SEQ ID NO: 5803 -3.9 -19.4 59.2 -14.6 -0.8 -5.5
AAAAAAAACATCTATGAATA 8153 SEQ ID NO:5804 -3.9 -10.6 40.6 -6.7 0 -3.8
TCATGTTAGGTAATTGCACA 8297 SEQ ID NO:5805 -3.9 -21 63.8 -17.1 0 -5.3
AAAAAACAAAAATTTATATC 8315 SEQ ID NO: 5806 -3.9 -8.6 37.2 -4.7 0 -5.2
CTTCAATACACTACAGTAAA 8377 SEQ ID NO:5807 -3.9 -17.2 54.4 -13.3 0 -3.6
ATATTTTAAACTGCCAACAG 8527 SEQ ID NO:5808 -3.9 -18.1 55.4 -12.8 -1.3 -7.3
CTGGAGTTTTCCACTGAGAA 8996 SEQ ID NO:5809 -3.9 -22.9 67.5 -16.9 -2.1 -6.3
GCTCCATAATCTCTGATAAA 217 SEQ ID NO: 5810 -3.8 -20.3 60.8 -16.5 0 -3.3
CCTGTCAAACCTTGATGTGG 255 SEQ ID NO:5811 -3.8 -24 68 -19 -1.1 -4.5
GTCCTGGGGGTACCAACAGT 483 SEQ ID NO: 5812 -3.8 -28.5 79.7 -21.9 -2.8 -10.6
CAATTTTCCTAACAGGGTTT 813 SEQ ID NO: 5813 -3.8 -21.3 63.3 -16.6 -0.7 -4.1
AATGAGAGCAAACACGCTCA 1244 SEQ ID NO: 5814 -3.8 -21.3 61.3 -15 -2.5 -7.7
AGGATC--AAATTCACCAAATA 1711 SEQ ID NO: 5815 -3.8 -17.9 54.8 -13.5 -0.3 -5.3
CTGCTCCTCATAGGCCATGG 1742 SEQ ID NO: 5816 -3.8 -28.6 79.4 -23.6 -0.3 -10.3
CTGATTCTGCTCCTCATAGG 1748 SEQ ID NO: 5817 -3.8 -24.9 73.1 -20.5 -0.3 -4
ATCTGCTGAAATTCGGCCTC 1795 SEQ ID NO: 5818 -3.8 -24.8 69.9 -19 -2 -10.2
TTTGTTGTTTCCTTCAAGGT 2003 SEQ ID NO: 5819 -3.8 -23.1 70 -18.5 -0.6 -5.2
GTGAGTCTCTCCTGCTTTCG 2283 SEQ ID NO: 5820 -3.8 -27 79.2 -22.6 -0.3 -4.3
CCTGGCACCATCCTGGATGA 2362 SEQ ID NO: 5821 -3.8 -29.2 78.2 -23.5 -1.2 -11.8
CCGTTTCAGTGGTGGTGCCC 2490 SEQ ID NO:5822 -3.8 -31.1 84.8 -26.7 -0.3 -5.1
CGGACATTTCTGTCTAGATT 2633 SEQ ID NO: 5823 -3.8 -21.9 65.6 -15.4 -2.7 -8.7
GGCAAATCTATACCAGCATG 2654 SEQ ID NO: 5824 -3.8 -22.4 64.6 -17.9 -0.5 -4.3
AGCACGCGGAACACAATCAG 3271 SEQ ID NO: 5825 -3.8 -23.4 64.7 -19.1 0 -7.9
GAACTCAATAATAAGGCCAG 3409 SEQ ID NO:5826 -3.8 -19.1 57.2 -14.8 0 -7.7
CATGCAGCTGTCTATCTTAT 3599 SEQ ID NO:5827 -3.8 -23.2 70 -18.7 0 -8.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GCTTCCGGTTTAAAGTCTTC 3952 SEQ ID NO:5828 -3.8 -23.9 70.1 -20.1 0 -6.6
ATGAACACAATGAAAGTCTC 4096 SEQ ID NO:5829 -3.8 -17.1 53.9 -13.3 0 -3.1
TACCAGGCTAACCAAAGAAA 4316 , SEQ ID NO:5830 -3.8 -20.2 58.2 -15.7 -0.5 -4.3
AGCCAAGAGCATTGGCTACC 4332 SEQ ID NO: 5831 -3.8 -26.8 74.5 -17.8 -5.2 -14.3
TTCATGATAGAGGGAATTGC 4462 SEQ ID NO: 5832 -3.8 -20.3 61.8 -16.5 0 -6.4
TTGTCATGTTAACACAGTGG 4557 SEQ ID NO: 5833 -3.8 -20.9 63.8 -16.3 -0.5 -8.7
AATACATGTACAGATTTTCT 4788 SEQ ID NO: 5834 -3.8 -17.9 56.9 -13.6 0 -8.2
GATTCGGCCAATCCTGGCAA 5345 SEQ ID NO: 5835 -3.8 -27.2 72.8 -19.1 -4.3 -10.3
AACAACGCAGGAAGGGACAT 5419 SEQ ID NO:5836 -3.8 -22 62.1 -18.2 0 -3.6
AGGAAGGATATGATGATGTA 5731 SEQ ID NO: 5837 -3.8 -18.7 58.1 -14.9 0 -2.6
CACTGAAGTTCTCCAGGATG 5778 SEQ ID NO:5838 -3.8 -23.2 68.1 -18.6 -0.6 -6.3
GCAAATAAAATATCAAGACA 6016 SEQ ID NO:5839 -3.8 -14.3 47.5 -10.5 0 -3.4
ACTCTCACACAAAACACGCT 6044 SEQ ID NO: 5840 -3.8 -21.8 62.3 -18 0 -3.3
ATAACATCTGAAATTACGCT 6194 SEQ ID NO:5841 -3.8 -17.9 54.8 -14.1 0 -3.3
TTTAACCTTTGCTTTAAAAG 6214 SEQ ID NO: 5842 -3.8 -17 53.5 -12.7 -0.2 -4.3
CATAGGCTGTAAACAATTGA 6501 SEQ ID NO: 5843 -3.8 -18.7 57 -14.9 0 -7.2
CTCAGCAGTGTCAGCTGGTA 6689 SEQ ID NO: 5844 -3.8 -26.8 80.4 -20.2 -2.8 -10
GAAAATGGAAGTAACTGAAA 7035 SEQ ID NO: 5845 -3.8 -14.1 47.1 -10.3 0 -3
TTGATTATATTTTTACATTA 7850 SEQ ID NO:5846 -3.8 -15 50.7 -11.2 0 -2.2
TTCTTATGTACAAAATGCTG 7880 SEQ ID NO: 5847 -3.8 -17.6 55.3 -13.8 0 -6.8
AAAAAATGAAATTTATTCTT 8459 SEQ ID NO:5848 -3.8 -11.1 41.7 -6 -1.2 -5.2
GATAGCATCAATTATATTGA 8811 SEQ ID NO:5849 -3.8 -17.4 55.3 -11.8 -1.8 -7.5
AATTCTCAATAACTATATCA 8917 SEQ ID NO: 5850 -3.8 -15.7 51.5 -11.9 0 -2.4
TTGTCTTTAAAAATATGCAT 9021 SEQ ID NO:5851 -3.8 -15.9 51.5 -12.1 0 -6.6
GAAATACATATTTAGATCCA 9043 SEQ ID NO: 5852 -3.8 -17.1 53.9 -12.7 -0.3 -5.8
CCACAGAGGTTTACAAATTA 88 SEQ ID NO: 5853 -3.7 -19.8 59.5 -16.1 0 -3.2
GCATAACAAAGCCCAGCATC 177 SEQ ID NO: 5854 -3.7 -24.4 67.7 -19.8 -0.7 -4.9
GCCACTCTACTATGAATCCT 291 SEQ ID NO:5855 -3.7 -24.6 70.2 -20.9 0 -2.2
ATCCCTAGAAGAGATTCTTT 327 SEQ ID NO: 5856 -3.7 -21.7 65 -15.7 -2.3 -4.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structu oligo oligo
GGCACTGAATCGGAAAATTG
764 SEQ ID NO: 5857 -3 .7 -19.7 57.6 -16 0 -4.3 TGGCACTGAATCGGAAAATT
765 SEQ ID NO: 5858 -3 .7 -19.7 57.6 -16 0 -4 ACCTGGAATGACTGAAATTG
1148 SEQ ID NO:5859 -3 .7 -19.2 57.2 -15.5 0 -5.1 CCATGGAGAAAAGGAAGCTG
2076 SEQ ID NO: 5860 -3 .7 -20.8 60.2 -17.1 0 -7.3 ACTCAAGAGAGACTGATGAG
2135 SEQ ID NO: 5861 -3 .7 -19.6 60.5 -14.3 -1.5 -6.3 TTTCAGATCCAACATCCTTT
2223 SEQ ID NO: 5862 -3 .7 -22.7 66.5 -19 0.7 -3.7 TCTTCCCATTTGCTGGAAGC
2382 SEQ ID NO: 5863 -3 .7 -26.3 74.4 -19.9 -2.7 -8 ACACCATTGCAATCCACAGT
2410 SEQ ID NO: 5864 -3 .7 -24.9 69.8 -20.6 0 -8.4 ACCACACCATTGCAATCCAC
2413 SEQ ID NO: 5865 -3 .7 -25.9 70.4 -21.6 0 -8.6 GTGGTGCCCTCTGGGGGAAG
2479 SEQ ID NO: 5866 -3 .7 -30.3 83.3 -24.4 -2.2 -8.7 GTAAGAGCTTAACCTTCTCT
2519 SEQ ID NO: 5867 -3 .7 -22.4 67.2 -17.8 -0.8 -4.9 AATGCTGGCTATGCTCACGG
2585 SEQ ID NO: 5868 -3 .7 -25.6 71.4 -21.2 -0.4 -5.9 TTCTTCCATTGTGTTGGTCA
2606 SEQ ID NO: 5869 -3 .7 -24.7 74.3 -21 0.2 -3.7 ACAGACCAAGCTCCATTAAA
2976 SEQ ID NO: 5870 -3 .7 -21.9 62.8 -18.2 0 -5 TTAATTAGCATATTTAGTGT
3070 SEQ ID NO: 5871 -3. .7 -17.4 56.3 -13.7 0 -6.1 CCCACATGGTCTCTATCCAC
3300 SEQ ID NO: 5872 -3, .7 -27.6 77.1 -23 -0.7 -5.2 GTCATCATCAGTAGCAGCAA
3446 SEQ ID NO: 5873 -3 .7 -23.7 71.3 -20 0 -5.4 AGATGAGCTGGTTGCATTTA
3869 SEQ ID NO: 5874 -3 .7 -22.8 68.4 -17.5 -1.5 -5.1 AGTCTTCTTCGGGTTCAGTT
3939 SEQ ID NO: 5875 -3, .7 -25.3 77.1 -21.6 0 -3 TGTCCGTAATGATTTGATGG
4367 SEQ ID NO: 5876 -3, .7 -21.2 62.4 -17.5 0 -3.2 CAACAAGAGCATTCACAACC
4440 SEQ ID NO: 5877 -3 .7 -20.9 60.8 -16.6 -0.3 -4.1 GCAAACAAATTCACACCCAT
4525 SEQ ID NO: 5878 -3 , .7 -21.6 60.8 -17.9 0 -3.4 GTCACTCAAATTGTTAACAT
4601 SEQ ID NO: 5879 -3, .7 -18.4 57.3 -14.2 0 -8.3 ACCCAAAGATGATAAAGATG
4818 SEQ ID NO: 5880 -3, .7 -17.6 53.5 -13.9 0 -2.1 TAGGATTCGGCCAATCCTGG
5348 SEQ ID NO: 5881 -3, .7 -26.3 72.1 -18.7 -3.5 -15.6 TTCCAGCTTCCTTTTTAACA
5508 SEQ ID NO: 5882 -3, .7 -23.6 68.8 -19.9 0 -4.5 GTTGTAATTTGGAACAAGCA
5572 SEQ ID NO: 5883 -3, .7 -19.5 59.2 -14.2 -1.6 -7.3 AAAAGAAAATCCCAACAGAT
5703 SEQ ID NO: 5884 -3, .7 -16.3 50.5 -12.6 0 -2.9 GGCTCTGCACTTTCTTCAGT
5803 SEQ ID NO: 5885 -3, .7 -26.7 79.8 -22.1 -0.7 -6.4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
'Sition oligo binding formation Duplex structure oligo oligo
TCAAACTTTTCCCAAACCTC
5854 SEQ ID NO: 5886 -3 .7 -22.3 63.3 -18.6 0 -2.5 TTTGTTACACTATCATAGGA
6376 SEQ ID NO: 5887 -3 .7 -19.5 61 -15.8 0 -3.3 CTTTCTCAAACTTTTCCTTG
6402 SEQ ID NO: 5888 -3 .7 -20.9 63.1 -17.2 0 -2.5 TTTCCTTTGCTTTCTTTTTC
6430 SEQ ID NO: 5889 -3 .7 -22.7 69.7 -19 0 -3.6 CAGCAGTGTCAGCTGGTAAT
6687 SEQ ID NO: 5890 -3 .7 -24.8 73.5 -18.9 -2.2 -9.2 TCAGATAGAAACAAACATAA
7089 SEQ ID NO: 5891 -3 .7 -14 47.1 -10.3 0 -2.4 AACTATTCTAAAGCAATACT
7282 SEQ ID NO: 5892 -3 .7 -16.4 52.5 -12.7 0 -4.1 CTGCAGCAGAAAGTGGAACA
7301 SEQ ID NO: 5893 -3 .7 -22.3 64.5 -17.2 -0.9 -10.4 GGAATTGTGATTAAAAATCA
7954 SEQ ID NO: 5894 -3 .7 -15.1 49.4 -9.6 -1.8 -6.9 ATTGGAATGGTAGAAAATAT
8061 SEQ ID NO: 5895 -3 .7 -15.5 50.4 -11.8 0 -2.4 TACTACTATTATTATCAAAC
8725 SEQ ID NO: 5896 -3 .7 -14.8 49.8 -11.1 0 -1.3 AAATCCAAGGGTTCTTGAAA
8951 SEQ ID NO: 5897 -3 .7 -19.3 57.8 -14 -1.6 -6.7 ATAAATCCAAGGGTTCTTGA
8953 SEQ ID NO: 5898 -3 .7 -20.4 61.1 -14.6 -2.1 -6.7 CCTAGAAGAGATTCTTTGCT
324 SEQ ID NO: 5899 -3 .6 -22 65.8 -16.1 -2.3 -8.3 GAATTACCTTAGATAGTCAC
409 SEQ ID NO: 5900 -3 .6 -19.4 60.2 -15.8 0 -3.2 GATAGCAATTTTCCTAACAG
818 SEQ ID NO: 5901 -3 .6 -19.6 59.5 -16 0 -4.1 CTGAAATCCAGCCAGTTCCA
1039 SEQ ID NO: 5902 -3 .6 -26.1 72.1 -22 -0.2 -4.9 TCTGTCACATATGCCATCAC
1066 SEQ ID NO: 5903 -3 , .6 -24 70.5 -20.4 0 -6.5 TAATCCTTCCAGTTAAATGT
1405 SEQ ID NO: 5904 -3 .6 -20.3 60.9 -16.7 0 -5.6 AAAGCTTGTGTAGCCATAGT
1550 SEQ ID NO: 5905 -3 , .6 -22.9 67.9 -17.7 -1.5 -7.9 TCAAATTCACCAAATAAAAT
1707 SEQ ID NO: 5906 -3 , .6 -14 46.6 -10.4 0 -3.1 CAGGATCAAATTCACCAAAT
1712 SEQ ID NO: 5907 -3 , .6 -18.9 56.5 -14.7 -0.3 -5.3 TGCTGAAATTCGGCCTCTTT
1792 SEQ ID NO: 5908 -3, .6 -24.6 69.1 -19 -2 -10.2 TGTTTCCTTCAAGGTGCTCT
1998 SEQ ID NO: 5909 -3, .6 -25.6 75.7 -22 0 -5.3 GCTGTCTCTCTCTCCTTTGT
2018 SEQ ID NO: 5910 -3, .6 -27.8 84.3 -24.2 0 -2.8 CTGAAAATGCTTGTTTTGCT
2188 SEQ ID NO: 5911 -3. .6 -20.4 61 -15.9 -0.8 -4.8 TAAGAGCTTAACCTTCTCTT
2518 SEQ ID NO: 5912 -3 , .6 -21.3 64.3 -16.1 -1.6 -5.7 TAACAATTAAATTCACAAGA
2724 SEQ ID NO: 5913 -3. .6 -13.6 46.4 -10 0 -3.1 TCAACACACTACTGAATTGC
2829 SEQ ID NO: 5914 -3. ,6 -19.9 59.8 -15.8 -0.1 -3.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CCTACAGTCAACACACTACT 2836 SEQ ID NO:5915 -3.6 -22.8 66.5 -18.7 -0.1 -2.9
GAACCATTTCTGCTGTGAAA 2877 SEQ ID NO:5916 -3.6 -21.4 62.6 -17.1 -0.5 -4.6
TTCTTGGAAATAGTAATAAG 2918 SEQ ID NO:5917 -3.6 -14.8 49.6 -11.2 0 -3.1
ATTAAACTGAGGCTGACAAT 2962 SEQ ID NO:5918 -3.6 -18.8 57.1 -15.2 0 -3.7
AACTCAATAATAAGGCCAGA 3408 SEQ ID NO:5919 -3.6 -19.1 57.2 -15 0 -7.7
TCGATTACGTATTTTTCAAC 3709 SEQ ID NO:5920 -3.6 -18.5 56.9 -14 -0.7 -5.8
TTTATGAATGACATATAATC 3736 SEQ ID N0:5921 -3.6 -14.4 48.7 -9.7 -1 -4
AGCAATTGGCACTGTGACGG 3770 SEQ ID N0:5922 -3.6 -24.7 69.4 -19.5 -1.5 -7.1
CTTTCTTCTAGTTCTGACTC 3838 SEQ ID NO:5923 -3.6 -22.2 70 -17.9 -0.4 -4
GTTGCATTTAATTTCTCTTT 3859 SEQ ID NO:5924 -3.6 -20 62.6 -16.4 0 -5.1
GCCAAGAGCATTGGCTACCA 4331 SEQ ID NO:5925 -3.6 -27.5 75.3 -19.5 -4.4 -12.8
TCTTCATATACAGGCTGAAG 4771 SEQ ID NO:5926 -3.6 -20.6 62.9 -15.3 -1.7 -6.5
GTTGAAGTTATCTATGATGA 4868 SEQ ID NO:5927 -3.6 -18.4 58.4 -14.8 0 -3.2
GATGTACATGTTCACCACAA 5753 SEQ ID NO:5928 -3.6 -21.9 64.5 -17.6 -0.4 -8.4
TCTCCAGGATGACCGCGATG 5769 SEQ ID NO:5929 -3.6 -27 72.5 -22 -1.3 -7.2
AAACCTCATAGAACATCTCA 5841 SEQ ID NO: 5930 -3.6 -19.7 59.3 -16.1 0 -2.8
CAGTGGATCCGGTCACCACT 5998 SEQ ID NO:5931 -3.6 -28.4 77.9 -21.7 -3 -13.5
CATCTCTCCACTCTCACACA 6053 SEQ ID NO: 5932 -3.6 -25.7 74.8 -22.1 0 -0.5
ACTTTGGAGGGGTTTGATGC 6109 SEQ ID NO:5933 -3.6 -24.5 72.2 -20.9 0 -2.6
CCTCCCTTTAATTGCCTCTT 6257 SEQ ID NO:5934 -3.6 -27.6 75.8 -24 0 -3
CTGACTATGAGTATTTGTTA 6581 SEQ ID NO:5935 -3.6 -19 60.1 -14.9 -0.1 -3
CACAACTATCCCTATAGTCT 6729 SEQ ID NO:5936 -3.6 -22.9 67 -17.3 -2 -5.4
CCATGGAAATGCACTAGAAC 6845 SEQ ID NO:5937 -3.6 -20.5 59.7 -15.5 -1.3 -7.3
AATACTTTCAAAATTAAAGC 7061 SEQ ID NO:5938 -3.6 -13.5 46.4 -9 -0.7 -5.6
GGTGTTTGTAAATAGCTTCA 7688 SEQ ID NO:5939 -3.6 -20.9 64.1 -17.3 0 -4.9
AAATAAAGTTGATTATATTT 7858 SEQ ID NO:5940 -3.6 -12.5 44.7 -8.9 0 -3.2
TTTGGAATTGTGATTAAAAA 7957 SEQ ID NO: 5941 -3.6 -14.2 47.7 -10.6 ' 0 -3
ATACGTAAATACTACAAAAG 8180 SEQ ID NO: 5942 -3.6 -13.5 46 -9.2 -0.4 -6.6
AAAAAGAACAAAGTCCATGT 8254 SEQ ID NO:5943 -3.6 -16.1 50.8 -12.5 0 -4.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AAAAATGAAATTTATTCTTT 8458 SEQ ID NO:5944 -3.6 -11.9 43.3 -7 -1.2 -5.2
CACAGGTTTTATTAATTATA 8548 SEQ ID NO: 5945 -3.6 -16.6 53.9 -13 0 -4.2
CAAATTAGTTACAATTTTTT 75 SEQ ID NO: 5946 -3.5 -14.8 49.5 -10.6 -0.5 -4
TTGCTCCATAATCTCTGATA 219 SEQ ID NO:5947 -3.5 -21.8 65.2 -18.3 0 -3.6
TACCAACAGTGCCTGTGCCA 473 SEQ ID NO: 5948 -3.5 -28.4 77 -23.8 -1 -8.2
CACCATCTCTGGAGGAATGT 671 SEQ ID NO: 5949 -3.5 -24.3 70.1 -19.2 -1.5 -6.1
ACTATAAAAGTTTTCTTATT 727 SEQ ID NO: 5950 -3.5 -15.1 50.7 -10.5 -1 -6
CCACAAACTCTGTCACATAT 1074 SEQ ID NO: 5951 -3.5 -21.5 63 -17.5 -0.1 -4.2
CAGACAGAACACAGTCAGGA 1226 SEQ ID NO: 5952 -3.5 -22 65.4 -17 -1.4 -4.6
CAAACACGCTCAGACAGAAC 1236 SEQ ID NO: 5953 -3.5 -20.6 59.8 -17.1 0 -3.4
TCCAATGTAATCCTTCCAGT 1412 SEQ ID NO: 5954 -3.5 -24.3 69.6 -20.8 0 -2.2
ATAAAAGTGACTGTCATCTC 1430 SEQ ID NO: 5955 -3.5 -18.5 58.3 -14.3 -0.1 -8.8
AGCATCTGCTGAAATTCGGC 1798 SEQ ID NO: 5956 -3.5 -24 68.4 -18.9 -1.6 -9.8
TGAGTCTCTCCTGCTTTCGC 2282 SEQ ID NO:5957 -3.5 -27.6 80.1 -23.4 -0.4 -4.5
TCTTGAGAACCATTTCTGCT 2883 SEQ ID NO:5958 -3.5 -23 67.7 -18.6 -0.7 -5.2
TGGGCCAGGATTTTGCCAAC 3051 SEQ ID NO: 5959 -3.5 -27 74 -21.2 -2.3 -7.9
ATATTTAGTGTGGGCCAGGA 3061 SEQ ID NO:5960 -3.5 -24.7 72.3 -20.7 0 -7.6
CACTCTCCACACAGCACGCG 3283 SEQ ID NO: 5961 -3.5 -28.1 75 -24.6 0 -7.4
CAGCGACCTCCATACAGTCC 3318 SEQ ID NO: 5962 -3.5 -28.3 77.1 -24.3 -0.1 -3.5
CAGATTATTCATTTCATTGT 3464 SEQ ID NO:5963 -3.5 -18.9 59.7 -14.9 -0.2 -3
TTTTGCATTCTTCCTACTGC 3490 SEQ ID NO:5964 -3.5 -24.2 71.7 -20.1 -0.3 -5.1
AAAGGCTTTTTGGAAACACT 3542 SEQ ID NO: 5965 -3.5 -19.3 58 -15 -0.6 -7.3
TTTCTTCTAGTTCTGACTCA 3837 SEQ ID NO:5966 -3.5 -22 69.1 -17.8 -0.4 -4
CAGTTGTGCTCAACAATACT 4072 SEQ ID NO:5967 -3.5 -21.3 63.8 -14.5 -3.3 -6.6
GCATTAGTGAAATATGTTTG 4264 SEQ ID NO:5968 -3.5 -17.8 56.2 -14.3 0 -4.1
CCTTTAAATGTGGCCACTTG 4705 SEQ ID NO:5969 -3.5 -23.5 66.5 -17.6 0 -13
ATGACAAAGTATAAATACAT 4801 SEQ ID NO:5970 -3.5 -13.9 47.1 -9.7 -0.5 -5.8
AAGTTATCTATGATGACACC 4864 SEQ ID NO: 5971 -3.5 -19.6 60 -14.6 -1.4 -5.8
ATCAAAGACTTGTCTGGTTA 5039 SEQ ID NO:5972 -3.5 -20.2 62.3 -15.7 -0.9 -6.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ACGCAGGAAGGGACATCATC 5415 SEQ ID NO:5973 -3.5 -24 68.4 -20.5 0 -3.6
GGGTCACAGTCGGGTGGTGC 5635 SEQ ID NO:5974 -3.5 -29.8 85.4 -25.5 -0.6 -5.6
CCAGGAAGGATATGATGATG 5733 SEQ ID NO: 5975 -3.5 -20.5 60.6 -17 0 -3.1
ACTCTATAAACTGGGTCGCA 5880 SEQ ID NO:5976 -3.5 -22.8 66 -19.3 0 -3.6
CAAAATCAGAGAGTTTAGAG 5901 SEQ ID NO:5977 -3.5 -16.6 53.6 -12.6 -0.1 -4.4
CTGCAAAATCAGAGAGTTTA 5904 SEQ ID NO:5978 -3.5 -18.7 57.8 -14.7 -0.1 -4.9
ACAGTGGATCCGGTCACCAC 5999 SEQ ID NO:5979 -3.5 -27.7 76.5 -21.9 -2.2 -12
ATGCAAGGACTGTACTAAAG 6779 SEQ ID NO:5980 -3.5 -19 58 -15.5 0 -5.6
ACCTTTGTCTGATCATTTGA 6955 SEQ ID NO:5981 -3.5 -22.3 67 -18.8 0 -6.2
CATAAAAATAATCCTTTAAA 7141 SEQ ID NO: 5982 -3.5 -12.4 43.9 -8.9 0 -4
CAACTATTCTAAAGCAATAC 7283 SEQ ID NO:5983 -3.5 -16.2 51.9 -12.7 0 -4.1
GAATTGTGATTAAAAATCAA 7953 SEQ ID NO: 5984 -3.5 -13.2 45.6 -7.7 -2 -8.2
ACAGGTTTTATTAATTATAT 8547 SEQ ID NO:5985 -3.5 -15.9 52.5 -12.4 0 -4.2
TAGCCAAGGGAGTTAATTGA 8768 SEQ ID NO:5986 -3.5 -21.5 63.6 -18 0 -3.7
AACATTTATTAGCCACCAAG 8840 SEQ ID NO:5987 -3.5 -20.6 60.4 -17.1 0 -3.2
ACCTCACATAAATCCAAGGG 8960 SEQ ID NO:5988 -3.5 -22.2 63.3 -18.1 -0.3 -3.9
TATGAATCCTTGACAGGTAT 281 SEQ ID NO: 5989 -3.4 -20.6 62.1 -16.2 -0.9 -3.4
ACTATGAATCCTTGACAGGT 283 SEQ ID NO: 5990 -3.4 -22 65.1 -17.6 -0.9 -3.4
CTTCTTGGCTTTCTCTTCTG 560 SEQ ID NO: 5991 -3.4 -24.5 74.6 -21.1 0 -3.7
TTCCAGCTTCCAAGTCACTA 627 SEQ ID NO: 5992 -3.4 -25.5 73.8 -22.1 0 -4.5
GGAAGGTTCTTTCCAGCTTC 637 SEQ ID NO: 5993 -3.4 -25.4 75.3 -20 -2 -8.6
ACAAGGCAGAGGTGGCACTG 777 SEQ ID NO:5994 -3.4 -25.7 73.4 -21.7 -0.3 -4.5
ATGACACTGAAATCCAGCCA 1045 SEQ ID NO: 5995 -3.4 -23.4 65.7 -18.8 -1.1 -4.9
GCCCAGGTCCACAAACTCTG 1082 SEQ ID NO:5996 -3.4 -27.9 75.7 -24.5 0 -3.4
GAATGTTCTCAACGCTGAGA 1106 SEQ ID NO: 5997 -3.4 -21.8 64 -15.8 -2.6 -8
CTTTACCGACTGGATCAGGG 1187 SEQ ID NO:5998 -3.4 -24.8 69.9 -20.5 -0.7 -5.3
CAGAACACAGTCAGGATCAT 1222 SEQ ID NO: 5999 -3.4 -21.6 64.7 -18.2 0 -5.3
CTTTTTGCCCATCCAAAACA 1449 SEQ ID NO: 6000 -3.4 -23.7 65.4 -18.8 -1.4 -5.4
GAAATAGAGACAGGAAAGCC 1584 SEQ ID NO: 6001 -3.4 -19.2 57.5 -15.8 0 -3.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo CATGGAGAAAAGGAAGCTGC 2075 SEQ ID NO: 6002 -3.4 -20.6 60.4 -17.2 0 -5.2
TAAGACAATGCAAATAGTGA 2768 SEQ ID NO:6003 -3.4 -16.4 52.1 -12.1 -0.7 -5.6
CCTTCTTGGAAATAGTAATA 2920 SEQ ID NO: 6004 -3.4 -18.4 56.8 -15 0 -3.2
CCATTAAACTGAGGCTGACA 2964 SEQ ID NO:6005 -3.4 -22.2 63.8 -18.8 0 -3.7
CTTAATTAGCATATTTAGTG 3071 SEQ ID NO: 6006 -3.4 -17.1 55.3 -13.7 0 -5
TCCACACAGCACGCGGAACA 3278 SEQ ID NO:6007 -3.4 -27 71.3 -23.1 0 -7.9
ATTTTTCACATAATCAATTC 3512 SEQ ID NO: 6008 -3.4 -16.3 53.2 -12.9 0 -2.5
CATCTTATTTTTCACATAAT 3518 SEQ ID NO:6009 -3.4 -17.2 55.1 -13.8 0 -2.2
GCACTGTGACGGTGAGGCTG 3762 SEQ ID NO: 6010 -3.4 -27.3 76.6 -22.1 -1.8 -7.6
AAAACAAGCTTCCGGTTTAA
3959 SEQ ID NO:6011 -3.4 -19.7 57.7 -15.4 -0.7 -8.9 TAAAACAAGCTTCCGGTTTA
3960 SEQ ID NO: 6012 -3.4 -20.1 59 -15.8 -0.7 -8.9 TCATGATAGAGGGAATTGCT
4461 SEQ ID NO:6013 -3.4 -21.1 63.4 -17.7 0 -5.9
CACAGTGGTAGAACTTGCCA 4545 SEQ ID NO: 6014 -3.4 -24.5 70.4 -20.4 -0.5 -5.2
TGACAGTCACTCAAATTGTT 4606 SEQ ID NO:6015 -3.4 -20 61.3 -16.6 0 -7
TGAACACTAGGTTGATCCGG 5148 SEQ ID NO: 6016 -3.4 -23.1 66 -18.5 -1.1 -6.8
GGGGACACAGAATACTTTTC 5302 SEQ ID NO: 6017 -3.4 -21.4 64.1 -18 0 -3.5
AGAAAATCCCAACAGATGGG 5700 SEQ ID NO:6018 -3.4 -20.8 59.7 -14.5 -2.9 -7.4
GATCCGGTCACCACTGACCA 5993 SEQ ID NO: 6019 -3.4 -28.8 77 -21.5 -3.9 -11.8
TTTGGAGGGGTTTGATGCCA 6107 SEQ ID NO: 6020 -3.4 -26.1 74.4 -21.6 -1 -4.7
ATCTGAAATTACGCTGAATG 6189 SEQ ID NO: 6021 -3.4 -17.9 54.7 -14.5 0 -3.3
GATATATTTTTTAACCTTTG 6223 SEQ ID NO: 6022 -3.4 -16.8 54 -13.4 0 -4.3
CCTTCATAGGCTGTAAACAA 6505 SEQ ID NO: 6023 -3.4 -21.4 62.6 -17.5 -0.2 -5.7
ACAGAGTTGCAGTGACAGAG 6628 SEQ ID NO: 6024 -3.4 -22.6 68.5 -19.2 0 -4.9
CTGTAGCCATTACAATTCTT 7015 SEQ ID NO: 6025 -3.4 -21.8 65 -17.4 -0.9 -3.9
TTTGCACTTGCTGAAACAGA 7169 SEQ ID NO: 6026 -3.4 -21.3 62.8 -17.2 -0.5 -6.5
AGAGCAGAAGATGGCAAAGC 7325 SEQ ID NO:6027 -3.4 -21.7 63.7 -17.4 -0.8 -4.7
TTTAATGAATGATACAGGAT 7514 SEQ ID NO: 6028 -3.4 -16.1 51.9 -12.7 0 -2.5
CCTTTAAACTATGTTTAATG 7527 SEQ ID NO: 6029 -3.4 -16.6 52.9 -11.1 -2.1 -8
CAAATAAAGTTGATTATATT 7859 SEQ ID NO:6030 -3.4 -13.1 45.7 -9.7 0 -2.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
AATGCTGACAAATAAAGTTG 7867 SEQ ID NO:6031 -3.4 -15.7 50.5 -12.3 0 -3.6
TCTATGAATAAAAGGTTATA 8143 SEQ ID NO: 6032 -3.4 -14.4 48.6 -10.4 -0.3 -3.1
GTCTGCATACGTAAATACTA 8186 SEQ ID NO: 6033 -3.4 -19.7 59.6 -16.3 0 -6.6
AAAATGAAATTTATTCTTTT 8457 SEQ ID NO: 6034 -3.4 -12.7 45 -7.8 -1.4 -6.5
TGCATTTAAGTAACAAAGAA 8863 SEQ ID NO: 6035 -3.4 -15.3 49.9 -11.9 0 -4.7
AAGATGGTTAGGGTATAACG 156 SEQ ID NO: 6036 -3.3 -19.4 58.8 -14.1 -2 -4.6
TCCAAGATGGTTAGGGTATA 159 SEQ ID NO: 6037 -3.3 -22.2 66.4 -18 -0.8 -4.9
CATCCAAGATGGTTAGGGTA 161 SEQ ID NO:6038 -3.3 -23.2 68.2 -19 -0.8 -4.9
CCCTAGAAGAGATTCTTTGC 325 SEQ ID NO: 6039 -3.3 -23.1 67.6 -17.5 -2.3 -7.5
CCTTTTTCCGGAAAAGCTCC 385 SEQ ID NO:6040 -3.3 -25.3 68.9 -18.8 -2.1 -14.4
AAAAGGCGGAAGCTTTCAGG 502 SEQ ID NO: 6041 -3.3 -22 62.9 -16.6 -2.1 -7.6
GGCTCTGACACCATCTCTGG 679 SEQ ID NO: 6042 -3.3 -27.4 78.1 -22.9 -1.1 -5.9
AGTGCTCGGAGAACTCTGAA 1123 SEQ ID NO: 6043 -3.3 -23.1 67.2 -19 -0.6 -8
TCCTCAGATTGCCCATGAAC 1275 SEQ ID NO: 6044 -3.3 -25.7 71.5 -22.4 0 -4.5
AAAATGACCAGGACAAAAAA 1678 SEQ ID NO: 6045 -3.3 -14.6 47.2 -11.3 0 -4
TGGAGAAAAGGAAGCTGCTT 2073 SEQ ID NO: 6046 -3.3 -20.9 61.4 -16.8 0 -9.4
TGATCTTGAGAACCATTTCT 2886 SEQ ID NO:6047 -3.3 -20.9 62.9 -16.4 -1.1 -7.1
GCCAGGATTTTGCCAACTTG 3048 SEQ ID NO:6048 -3.3 -25.6 71.3 -21.7 -0.3 -3.8
TGTGGGCCAGGATTTTGCCA 3053 SEQ ID NO:6049 -3.3 -28.7 79.1 -23.1 -2.3 -7.9
AAGAAGTCGTTCATGTGCCA 3241 SEQ ID NO:6050 -3.3 -23.7 68.4 -19.1 -1.2 -4.7
GGTCTCTATCCACTCTCCAC 3293 SEQ ID NO:6051 -3.3 -27.5 80.3 -24.2 0 -2.8
CACATGGTCTCTATCCACTC 3298 SEQ ID NO:6052 -3.3 -24.9 73.5 -20.7 -0.7 -5.2
CAATGACCATGACCAACATG 3363 SEQ ID NO:6053 -3.3 -21.2 60.2 -16 -1.9 -5.4
CATTAGTGAAATATGTTTGA 4263 SEQ ID NO: 6054 -3.3 -16.6 53.5 -13.3 0 -4.1
GTTGATCCGGGACAAAACTA 5138 SEQ ID NO: 6055 -3.3 -21.7 61.9 -17.7 0 -8.7
ACACTAGGTTGATCCGGGAC 5145 SEQ ID NO:6056 -3.3 -25.2 71.4 -20.7 -1.1 -6.8
ATGAACACTAGGTTGATCCG 5149 SEQ ID NO: 6057 -3.3 -21.9 63.6 -17.4 -1.1 -6
AGGTTGTAATTTGGAACAAG 5574 SEQ ID NO:6058 -3.3 -18.2 56.7 -13.3 -1.6 -7.3
AAGAAAATCCCAACAGATGG 5701 SEQ ID NO: 6059 -3.3 -18.9 55.8 -14.5 -1 -4.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GAACATCTCAAAGTCATCCT 5831 SEQ ID NO: 6060 -3.3 -21.4 63.6 -18.1 0 -2.8
CCACTGACCATGGGCAGATC 5983 SEQ ID NO: 6061 -3.3 -27.2 75 -22.1 -1.8 -8.8
ACGCTGAATGATAGCGGCAG 6179 SEQ ID NO: 6062 -3.3 -24.2 67.1 -17.3 -3.6 -10.6
CTTTAAAAGATAACATCTGA 6203 SEQ ID NO: 6063 -3.3 -15.1 49.7 -10.9 -0.8 -6.5
ACTTGATATATTTTTTAACC 6227 SEQ ID NO: 6064 -3.3 -16.9 54.2 -13.6 0 -3.7
GGAACTCCCATCTGTTTTTT 6338 SEQ ID NO: 6065 -3.3 -24.3 70.4 -20.5 -0.1 -3.9
AAAACAGTCAGTTTGGCATG 6562 SEQ ID NO: 6066 -3.3 -20.2 60.9 -15.3 -1.6 -7.7
AAGGACTGTACTAAAGGTGT 6775 SEQ ID NO:6067 -3.3 -20.1 61.3 -16.8 0 -4.8
AAAATACTTTCAAAATTAAA 7063 SEQ ID NO: 6068 -3.3 -10.3 40.2 -7 0 -3.2
TTGCATAAAAATAATCCTTT
7144 SEQ ID NO: 6069 -3.3 -16 50.9 -12.7 0 -5.1 TTTGCATAAAAATAATCCTT
7145 SEQ ID NO:6070 -3.3 -16 50.9 -12.7 0 -5.1 ACTGCAGCAGAAAGTGGAAC
7302 SEQ ID NO: 6071 -3.3 -21.8 63.9 -17.2 -0.7 -10.4
ACATAACATAGGGTATTTAA 7370 SEQ ID NO: 6072 -3.3 -17 54.1 -13.7 0 -2.9
AGAATGGATTGAGTAAAATA 7584 SEQ ID NO: 6073 -3.3 -14.9 49.3 -11.6 0 -2.3
AAGGTGTTTGTAAATAGCTT 7690 SEQ ID NO: 6074 -3.3 -19.1 59.5 -15.8 0 -4.9
AAAATATATTATAACAAAGA 8048 SEQ ID NO:6075 -3.3 -10.2 40 -6.9 0 -6.2
AAGACTAGTCTGCATACGTA
8193 SEQ ID NO: 6076 -3.3 -21.3 64 -16.3 0 -11.5 TAAGACTAGTCTGCATACGT
8194 SEQ ID NO: 6077 -3.3 -21.3 64 -16.3 0 -11.5 TGCAGTTCTTCAATACACTA
8384 SEQ ID NO:6078 -3.3 -21 64.1 -17.7 0 -4.7
CAATAGCAATTCCCTGCATG 8402 SEQ ID NO: 6079 -3.3 -23.4 65.9 -19.1 -0.9 -4.9
AAACAAAAAACCCCAGAGCC 8497 SEQ ID NO:6080 -3.3 -21.3 58.5 -18 0 -3.2
TTTGTTGTAAAATTCATGTA 8598 SEQ ID NO:6081 -3.3 -16.4 53.4 -12.4 -0.4 -6.6
ATATAATTTATTATGGGAGA 9068 SEQ ID NO: 6082 -3.3 -16 52.3 -11.9 -0.6 -4.9
ACCACAGAGGTTTACAAATT 89 SEQ ID NO: 6083 -3.2 -20.3 60.6 -16.1 -0.9 -4.7
GCAAGAGATTCTCTAGTAAA 520 SEQ ID NO: 6084 -3.2 -18.9 59.1 -14.4 -1.2 -9.3
CCTAACAGGGTTTAGTGGAG 806 SEQ ID NO:6085 -3.2 -23.3 68.6 -19.6 -0.1 -3.6
CTCAAGGTCATAAATACACA 895 SEQ ID NO: 6086 -3.2 -18.6 57.2 -15.4 0 -2.8
ATTCTTTGTCCAGTCAGGAG 920 SEQ ID NO:6087 -3.2 -24 72.9 -19.4 -1.3 -4.4
GTAAAATCTTCTAAGCAAAA 1003 SEQ ID NO: 6088 -3.2 -14.9 49.1 -11.7 0 -4.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TATGCCATCACAATGACACT 1057 SEQ ID NO: 6089 -3.2 -22.1 63.9 -18.4 -0.1 -4.2
TAAAATGAGCCCAAGAAAAT 1693 SEQ ID NO:6090 -3.2 -16.5 50.8 -13.3 0 -3.2
ATGGAGAAAAGGAAGCTGCT 2074 SEQ ID NO:6091 -3.2 -20.8 61.1 -17.6 0 -7.2
TGGTCAGTCTGTTTCCATCC 2094 SEQ ID NO: 6092 -3.2 -26.9 79.8 -23.7 0 -4.2
GAGACTGATGAGGGGAGCAG 2127 SEQ ID NO: 6093 -3.2 -24.2 70.8 -20.5 -0.1 -4.1
CAGAATGCTGGCTATGCTCA 2588 SEQ ID NO:6094 -3.2 -24.7 71 -20.7 -0.6 -5.9
TACAGTCAACACACTACTGA 2834 SEQ ID NO: 6095 -3.2 -20.5 62 -15.6 -1.7 -5.6
TTAGTGTGGGCCAGGATTTT 3057 SEQ ID NO: 6096 -3.2 -25.2 73.8 -21.5 0 -7.6
GGGAGCGTACAGTCATCATT 3217 SEQ ID NO:6097 -3.2 -24.9 72.7 -21.7 0 -4.8
GAAGAAGTCGTTCATGTGCC 3242 SEQ ID NO:6098 -3.2 -23.6 68.5 -19.1 -1.2 -4.7
CCACACAGCACGCGGAACAC 3277 SEQ ID NO: 6099 -3.2 -26.8 70.4 -23.1 0 -7.9
AGCGACCTCCATACAGTCCC 3317 SEQ ID NO:6100 -3.2 -29.6 79.4 -25.9 -0.1 -3.5
TTCCTACTGCAATCTGCAGA 3480 SEQ ID NO:6101 -3.2 -24.4 70.5 -16.8 -4.4 -11.4
AAAAGGCTTTTTGGAAACAC 3543 SEQ ID NO: 6102 -3.2 -17.7 54.4 -13.6 -0.7 -7.2
ACCACTGGTGGTTCCATTCC 3671 SEQ ID NO:6103 -3.2 -28.5 79.6 -23.4 -1.5 -11.7
TAGCCAAGAGCATTGGCTAC 4333 SEQ ID NO: 6104 -3.2 -24.5 70.4 -15.6 -5.7 -15.4
CGAGTTCTGAGTAGCCAAGA 4344 SEQ ID NO:6105 -3.2 -23.9 69.4 -20.7 0 -3.2
ATCCAGCCTTTAAATGTGGC 4711 SEQ ID NO:6106 -3.2 -24.5 69.6 -20.5 -0.6 -7.4
AGAAACATACCTACAATGGA 5269 SEQ ID NO: 6107 -3.2 -18.6 56.1 -15.4 0.2 -4
CCGCGATGTACATGTTCACC 5757 SEQ ID NO:6108 -3.2 -26.4 71.7 -22.7 0 -7.8
AAAGTCATCCTCACTCAGGG 5822 SEQ ID NO: 6109 -3.2 -23.9 70 -19.8 -0.8 -3.4
ACTTTGTTGGGTTTTGCTAT 5947 SEQ ID NO: 6110 -3.2 -22.9 69.3 -19.7 0 -3.6
ATCCGGTCACCACTGACCAT 5992 SEQ ID NO: 6111 -3.2 -28.2 75.7 -20.6 -4.4 -9.6
AAGACAGTGGATCCGGTCAC 6002 SEQ ID NO: 6112 -3.2 -24.7 70.5 -19.9 -1.1 -10.8
CCCTTTAATTGCCTCTTTGT
6254 SEQ ID NO: 6113 -3.2 -25.6 72.3 -22.4 0 -3 TCCCTTTAATTGCCTCTTTG
6255 SEQ ID NO: 6114 -3.2 -24.8 70.6 -21.6 0 -3 TTTTTCTGGAGTGGAGTTCC
6323 SEQ ID NO: 6115 -3.2 -24.2 73.3 -20.5 -0.1 -4
TAATTCTTTGTTTCTTTTTA 6472 SEQ ID NO: 6116 -3.2 -17.4 57 -14.2 0 -2.9
TCAGCAGTGTCAGCTGGTAA 6688 SEQ ID NO: 6117 -3.2 -25.2 75.4 -19.2 -2.8 -10 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo ACTTTCAAAATTAAAGCCAT 7058 SEQ ID NO: 6118 -3.2 -17.2 53.2 -13.1 -0.7 -5.6
TGAGAGCAGAAGATGGCAAA
7327 SEQ ID NO:6119 -3.2 -20.5 60.7 -17.3 0 -4.1 CTGAGAGCAGAAGATGGCAA
7328 SEQ ID NO: 6120 -3.2 -22.1 64.6 -18 -0.8 -5.2 ATATATTTGCCCAAACATGC
7413 SEQ ID NO: 6121 -3.2 -21.4 61.7 -18.2 0 -5
AAACATCTATGAATAAAAGG 8148 SEQ ID NO: 6122 -3.2 -13.2 45.5 -10 0 -3.8
GCAGTTCTTCAATACACTAC 8383 SEQ ID NO: 6123 -3.2 -21.2 64.8 -18 0 -3.4
CATGCAGTTCTTCAATACAC 8386 SEQ ID NO:6124 -3.2 -21.1 63.9 -17.9 0 -5.5
CAATTCCCTGCATGCAGTTC 8396 SEQ ID NO: 6125 -3.2 -26.1 73.7 -19.8 -0.2 -14.3
TATTTTAAACTGCCAACAGC 8526 SEQ ID NO: 6126 -3.2 -19.9 59.2 -15.1 -1.5 -7.3
ACTACTATTATTATCAAACC 8724 SEQ ID NO: 6127 -3.2 -17.1 54.2 -13.9 0 -1.3
CAGCATCCAAGATGGTTAGG 164 SEQ ID NO: 6128 -3.1 -23.6 68.5 -19 -1.4 -6.2
TACAGCATAACAAAGCCCAG 181 SEQ ID NO: 6129 -3.1 -22.1 62.7 -18.5 -0.2 -4.1
GGAGGAATGTCTCCATAAAT 661 SEQ ID NO: 6130 -3.1 -20.8 61.7 -15.2 -2.5 -7
TTGCCAAGATTTTTATAAGT 978 SEQ ID NO: 6131 -3.1 -18.8 58.1 -15.7 0 -4.1
GAACACAGTCAGGATCATCA 1220 SEQ ID NO: 6132 -3.1 -22 66 -18.9 0 -5.3
TTGGGGTTTCGACCAGCCTT 1531 SEQ ID NO: 6133 -3.1 -28.6 78.4 -22.8 -2.7 -7.8
ATGAGCCCAAGAAAATGACC 1689 SEQ ID NO: 6134 -3.1 -21.7 61 -18.6 0 -3.2
CAGCTGATGCTGCCGCAACT 1854 SEQ ID NO: 6135 -3.1 -28.2 75.6 -22.4 -2.7 -12
CCAACAGCTCTCCTAACCCA 1899 SEQ ID NO: 6136 -3.1 -28.1 74.9 -25 0 -4.2
CCACGGATACTCAAGAGAGA 2143 SEQ ID NO: 6137 -3.1 -22.5 64.5 -17.8 -1.5 -6.2
TGACATACTGGCCTGACTAA
2345 SEQ ID NO:6138 -3.1 -22.9 65.9 -19.8 0 -7.2 ATGACATACTGGCCTGACTA
2346 SEQ ID NO: 6139 -3.1 -23.6 68 -20.5 0 -7.2 TTCTGCTGTGAAAATCCCAG
2870 SEQ ID NO:6140 -3.1 -22.9 65.6 -19.8 0 -3.6
CATTAAACTGAGGCTGACAA 2963 SEQ ID NO: 6141 -3.1 -19.5 58.3 -16.4 0 -3.7
CCAGGATTTTGCCAACTTGA 3047 SEQ ID NO: 6142 -3.1 -24.4 68.5 -20.7 -0.3 -3.5
ATTGTCATCATCAGTAGCAG 3449 SEQ ID NO:6143 -3.1 -22 68.1 -18.9 0 -4.1
TCTTCTAGTTCTGACTCACT 3835 SEQ ID NO: 6144 -3.1 -22.9 71.2 -19.1 -0.4 -4
AAACAAGCTTCCGGTTTAAA 3958 SEQ ID NO:6145 -3.1 -19.7 57.7 -16 -0.2 -8
TGAAATCCATAAGCAACCCA 4246 SEQ ID NO: 6146 -3.1 -22 61.4 -18.9 0 -4.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ATTGGCTACCAGGCTAACCA 4322 SEQ ID NO: 6147 -3.1 -26.4 72.9 -21.7 -1.5 -7.2
ATAAAGATGACAAAGTATAA 4807 SEQ ID NO: 6148 -3.1 -12.9 45.2 -9.8 0 -2.8
ATAGTGAAGTAGTAGTGTCT 5212 SEQ ID NO: 6149 -3.1 -20.3 65.2 -17.2 0 -1.9
GGAAGGATATGATGATGTAA 5730 SEQ ID NO.-6150 -3.1 -18 56 -14.9 0 -2.6
CGATGTACATGTTCACCACA 5754 SEQ ID NO:6151 -3.1 -23.4 66.9 -19.6 -0.2 -8.4
CAAACCTCATAGAACATCTC 5842 SEQ ID NO: 6152 -3.1 -19.7 59.3 -16.6 0 -2.8
AAATAAAATATCAAGACAGT 6014 SEQ ID NO:6153 -3.1 -13 45.3 -9.9 0 -2.9
GGGGTTTGATGCCATAAACC 6101 SEQ ID NO.-6154 -3.1 -24.6 68.7 -19.2 -2.3 -8.6
CTTTGTTTCTTTTTACTTTT 6467 SEQ ID NO: 6155 -3.1 -19.3 61.7 -16.2 0 -2.2
TTTACAAAAATAGTGACATA 6893 SEQ ID NO:6156 -3.1 -14.1 47.7 -11 0 -3.5
GGTTTTGAGCAAAAATTTTA 6990 SEQ ID NO: 6157 -3.1 -17 53.8 -13 -0.8 -8.1
CATAACAGACTAAAATACTT 7074 SEQ ID NO: 6158 -3.1 -14.8 48.9 -11.7 0 -2
GAAGATGGCAAAGCAATACT 7319 SEQ ID NO:6159 -3.1 -19.4 57.9 -15.4 -0.7 -4.3
ATTTAATTGACATAGACTAT 7356 SEQ ID NO: 6160 -3.1 -15.9 52.1 -12.8 0 -3.3
TAATGAATGATACAGGATAC 7512 SEQ ID NO: 6161 -3.1 -15.8 51.3 -12.7 0 -2.4
AGCATAAAGTAAAATAAATT 7926 SEQ ID NO:6162 -3.1 -12 43.3 -8.9 0 -4.1
ATTCAAAAGTTTGGAATTGT 7966 SEQ ID NO: 6163 -3.1 -16.9 53.8 -13.3 -0.2 -6.5
TTTGACCAATGTATCTCCTA 8080 SEQ ID NO:6164 -3.1 -22.2 65.5 -19.1 0 -3.4
TGTTTGACCAATGTATCTCC 8082 SEQ ID NO: 6165 -3.1 -22.8 67.2 -19.7 0 -3.4
TCTTCAATACACTACAGTAA 8378 SEQ ID NO:6166 -3.1 -18.3 57.5 -15.2 0 -3.6
AATAATGACGTAGCTCACCA 8432 SEQ ID NO:6167 -3.1 -21.5 62.2 -18.4 0 -5.3
AGCCAAGGGAGTTAATTGAA 8767 SEQ ID NO:6168 -3.1 -21.1 62.1 -18 0 -3.7
AAATACATATTTAGATCCAA 9042 SEQ ID NO:6169 -3.1 -15.8 51 -12.7 0 -5.7
TTTTTTGACCACAGAGGTTT 96 SEQ ID NO: 6170 -3 -22.1 66.2 -17.5 -1.5 -4.7
CTTCCTCTGGCAGCTGTTCA 133 SEQ ID NO: 6171 -3 -28.4 82.2 -24.7 0 -8.9
AAACCTTGATGTGGCTTGGC 249 SEQ ID NO: 6172 -3 -24.6 69.7 -21.6 0 -3.7
TCTACTATGAATCCTTGACA 286 SEQ ID NO: 6173 -3 -20.6 62 -17.6 0 -2.3
TTCAGGTCCTGGGGGTACCA 488 SEQ ID NO:6174 -3 -29.5 83 -23.2 -3.3 -12.6
GAGTTAAAATATACAAGGCA 789 SEQ ID NO: 6175 -3 -16.8 53.1 -13.8 0 -4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TAGTGCACATGATAAGCATG 864 SEQ ID NO: 6176 -3 -20.4 61.5 -15.3 -2.1 -9.9
TACTCTACATTCTTTGTCCA 928 SEQ ID NO: 6177 -3 -22.6 68.4 -19 -0.3 -2.9
AACCTGGAATGACTGAAATT 1149 SEQ ID NO:6178 -3 -18.5 55.5 -15.5 0 -5.1
TTGTTACATTAACAAATGTC 1380 SEQ ID NO: 6179 -3 -16.2 52.6 -10.9 -2.3 -7.5
AAGTGACTGTCATCTCCAAT 1426 SEQ ID NO:6180 -3 -22.2 66.1 -18.5 -0.1 -8.8
CATAGTTGGGGTTTCGACCA 1536 SEQ ID NO: 6181 -3 -25.4 72.2 -19.7 -2.7 -6.4
CACTGAAATCTCTTGAAGCA 1872 SEQ ID NO: 6182 -3 -20.1 60.3 -17.1 0 -4.1
ACTTTCCAACAGCTCTCCTA 1904 SEQ ID NO: 6183 -3 -25.6 73.5 -22.6 0 -4.4
GAGAGACTGATGAGGGGAGC 2129 SEQ ID NO: 6184 -3 -24.1 71 -21.1 0 -2.8
TAATAAGGATCCATGGCAAT 2905 SEQ ID NO: 6185 -3 -19.9 58.9 -16.2 0 -9
TGAAAACTCTAAGCAGTCTG 3030 SEQ ID NO: 6186 -3 -18.9 58.1 -15.9 0 -4.1
CTTGAAAACTCTAAGCAGTC 3032 SEQ ID NO: 6187 -3 -19 58.5 -16 0 -4.1
CCTAGAGCCCCCACAGAATT 3100 SEQ ID NO:6188 -3 -28.6 75.5 -25.6 0 -3.8
AAAACAATAAGGCACATGGT 3343 SEQ ID NO: 6189 -3 -18.1 54.8 -15.1 0 -5.2
CCTTTTGCATTCTTCCTACT 3492 SEQ ID NO:6190 -3 -25.3 73.1 -22.3 0 -4.8
CAAAGGCCAATGCACCACTA 4128 SEQ ID NO: 6191 -3 -24.5 66.8 -20.7 -0.6 -7.7
TTCAAACCGGGATAAGGCTC 4409 SEQ ID NO:6192 -3 -23.1 65.1 -20.1 0 -7.1
ACTAATGTCAAACATGTTAC 4580 SEQ ID NO: 6193 -3 -17.1 54.4 -12.9 -1.1 -9
CTTTAAATGTGGCCACTTGA 4704 SEQ ID NO: 6194 -3 -22.1 64.2 -16.7 0 -13
TAAAGATGACAAAGTATAAA 4806 SEQ ID NO: 6195 -3 -12.2 43.7 -9.2 0 -2.8
TATCAAAGACTTGTCTGGTT 5040 SEQ ID NO: 6196 -3 -20.2 62.3 -15.7 -1.4 -7
GACAAAACTAGGGTCATGTA 5128 SEQ ID NO:6197 -3 -19.8 60 -15.9 -0.7 -4.7
CGGGTGGTGCACTATTAAGA 5625 SEQ ID NO: 6198 -3 -23.8 68.3 -19.5 -1.1 -9.5
TTACCTTCATAGGCTGTAAA 6508 SEQ ID NO: 6199 -3 -21.2 63.3 -17 -1.1 -4.4
GTAAAAATATGGCAGATATG 6818 SEQ ID NO: 6200 -3 -15.8 50.9 -11.8 -0.9 -4.5
GCCATTACAATTCTTTTTCT 7010 SEQ ID NO:6201 -3 -21.6 64.8 -18.6 0 -2.5
GCATAAAAATAATCCTTTAA 7142 SEQ ID NO: 6202 -3 -14.9 48.6 -11.9 0 -3.4
TGCAAAAGACACATACACTG 7476 SEQ ID NO: 6203 -3 -18.5 56 -15.5 0 -4.7
TTAATGAATGATACAGGATA 7513 SEQ ID NO: 6204 -3 -15.7 51.1 -12.7 0 -2.4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GTACAAAATGCTGACAAATA 7873 SEQ ID NO: 6205 -3 -16.2 51.3 -13.2 0 -4.6
GTGATGTCATCAACCTGAAA 7906 SEQ ID NO: 6206 -3 -20.8 61.6 -16.7 -1 -6.9
TGACCAATGTATCTCCTATT
8078 SEQ ID NO: 6207 -3 -22.1 65.1 -19.1 0 -2.4 TTGACCAATGTATCTCCTAT
8079 SEQ ID NO: 6208 -3 -22.1 65.1 -19.1 0 -2.9 TCAATAATGACGTAGCTCAC
8434 SEQ ID NO:6209 -3 -19.9 59.9 -16.3 -0.3 -5.4
AGTTCACAAAGCTGCTTTTA 8662 SEQ ID NO: 6210 -3 -21.3 64.4 -16.8 -0.3 -10.9
GAATGTAACATTTATTAGCC 8846 SEQ ID NO:6211 -3 -18.5 57.2 -14.6 -0.8 -6.5
CAACTGGAGTTTTCCACTGA 8999 SEQ ID NO: 6212 -3 -23.2 67.6 -18.1 -2.1 -7.1
CATTACAACTGGAGTTTTCC 9004 SEQ ID NO: 6213 -3 -21.5 64.3 -17.5 -0.9 -5.2
TATGAAATACATATTTAGAT 9046 SEQ ID NO: 6214 -3 -13.7 47.2 -9.8 -0.7 -5.2
AACCTTGATGTGGCTTGGCT 248 SEQ ID NO: 6215 -2.9 -26.2 73.9 -22.6 -0.4 -3.8
AATTACCTTAGATAGTCACA 408 SEQ ID NO: 6216 -2.9 -19.5 60.1 -16.6 0 -2.7
GGCTTTCTCTTCTGCAGCAC 554 SEQ ID NO: 6217 -2.9 -27.3 80.7 -23.1 -1.2 -8.3
AGTGCACATGATAAGCATGC 863 SEQ ID NO: 6218 -2.9 -22.5 66.2 -17.3 -2.3 -9.9
AGTAAAGGGTCTTTTTGCCC 1459 SEQ ID NO: 6219 -2.9 -24.6 71.3 -20.5 -1.1 -4.8
AGAGTAAAGGGTCTTTTTGC 1461 SEQ ID NO: 6220 -2.9 -21.2 65.2 -17.8 -0.1 -3.8
CTTCCAAGGTGGCCTGATTC 1761 SEQ ID NO: 6221 -2.9 -26.8 75.7 -23 -0.7 -7.2
AAGCTGTCTCTCTCTCCTTT 2020 SEQ ID NO: 6222 -2.9 -25.9 77.9 -23 0 -5.1
ACTGAAAATGCTTGTTTTGC 2189 SEQ ID NO: 6223 -2.9 -19.7 59.6 -15.9 -0.8 -4.7
GATGACATACTGGCCTGACT 2347 SEQ ID NO: 6224 -2.9 -24.5 69.9 -21.6 0 -7.2
ACAATTAAATTCACAAGATG 2722 SEQ ID NO: 6225 -2.9 -14.6 48.5 -11.7 0 -3.1
GTCAACACACTACTGAATTG 2830 SEQ ID NO:6226 -2.9 -19.3 58.8 -16.4 0 -3.6
GTGAAAATCCCAGTAAAGAC 2863 SEQ ID NO: 6227 -2.9 -19.1 57.1 -16.2 0 -2.1
CCAACTTGAAAACTCTAAGC 3036 SEQ ID NO:6228 -2.9 -18.9 56.6 -16 0 -2.9
GCCCCCACAGAATTGCCAAT 3094 SEQ ID NO: 6229 -2.9 -29.2 75 -26.3 0 -4.2
CCACAGCAAAAATGAAGACG 3147 SEQ ID NO:6230 -2.9 -18.8 54.8 -15.9 0 -3.3
ATGACCAACATGAAAACAAT 3355 SEQ ID NO: 6231 -2.9 -16.4 50.8 -13 -0.1 -5.2
CGATTACGTATTTTTCAACA 3708 SEQ ID NO:6232 -2.9 -18.8 56.9 -15.4 -0.1 -6.1
TTATGAATGACATATAATCA " 3735 SEQ ID NO: 6233 -2.9 -15 49.7 -11 -1 -4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structu: oligo oligo
CTTCTAGTTCTGACTCACTG
3834 SEQ ID NO: 6234 -2. .9 -22.5 69.2 -19.1 -0.1 -4 TTCTTCTAGTTCTGACTCAC
3836 SEQ ID NO: 6235 -2, .9 -22.1 69.4 -18.5 -0.4 -3.4 GAATGAATATATAGGTAAAG
4209 SEQ ID NO: 6236 -2, .9 -13.6 46.8 -10.7 0 -4.2 TGTTAACATCACTAATGTCA
4590 SEQ ID NO: 6237 -2, .9 -18.7 58.3 -14.7 -1 -7.9 ACTCAAATTGTTAACATCAC
4598 SEQ ID NO: 6238 -2, .9 -17.4 54.9 -14 0 -8.3 GATAAAGATGACAAAGTATA
4808 SEQ ID NO: 6239 -2, .9 -14.2 47.9 -11.3 0 -2.8 ATATCAAAGACTTGTCTGGT
5041 SEQ ID NO: 6240 -2, .9 -20.1 61.9 -15.7 -1.4 -7 ATTAAGAATAGGTGCTAGCA
5612 SEQ ID NO: 6241 -2. .9 -20 61.1 -15.8 0 -10.6 GAGAAGAGGAGGATCCAGGG
5927 SEQ ID NO: 6242 -2, .9 -24.2 70.1 -18.7 -2.6 -9 ACACTATCATAGGAAGGAGG
6370 SEQ ID NO: 6243 -2, .9 -20.6 62.4 -17.7 0 -3.4 CAAAAATAGTGACATAGCAT
6889 SEQ ID NO: 6244 -2, .9 -16.5 52.2 -13.6 0 -4.1 ATTTGCACTTGCTGAAACAG
7170 SEQ ID NO: 6245 -2, .9 -20.7 61.5 -17.2 -0.3 -6.5 ATGAATGATACAGGATACAT
7510 SEQ ID NO: 6246 -2, .9 -17.5 54.8 -14.6 0 -3.2 AGGTGTTTGTAAATAGCTTC
7689 SEQ ID NO: 6247 -2. .9 -20.2 63 .1 -17.3 0 -4.9 GAATTAAAAGTGCAAAAGTA
7710 SEQ ID NO: 6248 -2, .9 -14.1 47.3 -11.2 0 -5.4 GTAAAATAAATTGTGATGTC
7918 SEQ ID NO: 6249 -2. .9 -14.6 49 -11.7 0 -3.2 AAATAAGACTAGTCTGCATA
8197 SEQ ID NO: 6250 -2, .9 -17.7 55.8 -13.3 0 -11 AAAAAATAAGACTAGTCTGC
8200 SEQ ID NO: 6251 -2, .9 -15.2 49.9 -10.6 0 -11.5 TAAAAAAATAAGACTAGTCT
8202 SEQ ID NO: 6252 -2 .9 -12.4 44.3 -7.9 0 -11.2 TTAAAAAAATAAGACTAGTC
8203 SEQ ID NO: 6253 -2, .9 -11.6 42.8 -7.9 0 -9.2 AATAGCTTTAGTGCAGCAGG
8225 SEQ ID NO: 6254 -2 .9 -23 68.7 -18.5 -1.5 -6.6 GGCTAAAAAGAACAAAGTCC
8258 SEQ ID NO: 6255 -2, .9 -17.8 54.1 -14.9 0 -3.7 ATAGCCAAGGGAGTTAATTG
8769 SEQ ID NO: 6256 - .9 -20.9 62.3 -18 0 -3.7 ACAACTGGAGTTTTCCACTG
9000 SEQ ID NO: 6257 - .9 -22.8 66.9 -18 -1.9 -5.9 CCAGCATCCAAGATGGTTAG
165 SEQ ID NO: 6258 -2 .8 -24.4 69.6 -20.1 -1.4 -6.2 AAAGCCCAGCATCCAAGATG
170 SEQ ID NO: 6259 -2 .8 -24.6 67.5 -20.7 -1 -5.5 GAGCCTTATGAATTACAGCA
194 SEQ ID NO: 6260 -2 .8 -22.2 65.1 -18.7 -0.4 -4.1 AGCCACTCTACTATGAATCC
292 SEQ ID NO: 6261 -2 .8 -23.7 68.6 -20.9 0 -3.2 ACAATATCCCTAGAAGAGAT
332 SEQ ID NO: 6262 -2 .8 -20 59.8 -17.2 0 -3.8 mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
GTCACAGCACCTTTTTCCGG 394 SEQ ID NO:6263 -2.8 -27.6 76.6 -24.8 0 -6
AAAAAGGCGGAAGCTTTCAG 503 SEQ ID NO: 6264 -2.8 -20.1 58.7 -14.9 -2.4 -7.6
GTGCACATGATAAGCATGCT 862 SEQ ID NO: 6265 -2.8 -23.4 67.9 -18.8 -1.7 -10.9
CAAAATAGTGCACATGATAA 869 SEQ ID NO: 6266 -2.8 -16.5 52 -12.7 0 -9.9
CAGGTCCACAAACTCTGTCA 1079 SEQ ID NO:6267 -2.8 -24.4 70.5 -21.1 -0.1 -3.6
CTGAAATTGTTTTCAGTGCT 1137 SEQ ID NO:6268 -2.8 -20.7 63 -14.5 -3.4 -11.5
CGACTGGATCAGGGCCCCCA 1181 SEQ ID NO:6269 -2.8 -32.3 82.3 -28.1 -0.7 -10.5
CCAATGTAATCCTTCCAGTT 1411 SEQ ID NO: 6270 -2.8 -24 68.4 -21.2 0 -2.2
TGACTGTCATCTCCAATGTA
1423 SEQ ID NO: 6271 -2.8 -22.6 67.4 -19.1 -0.3 -8.1 GTGACTGTCATCTCCAATGT
1424 SEQ ID NO:6272 -2.8 -24.1 71.4 -20.6 -0.3 -8.8 CAAAACATAAAAGTGACTGT
1436 SEQ ID NO:6273 -2.8 -15.2 49.3 -12.4 0 -3.2
TTGCCCATCCAAAACATAAA 1445 SEQ ID NO: 6274 -2.8 -20.8 58.7 -18 0 -3
AAGGAAGCTGCTTCTTTTGA 2066 SEQ ID NO: 6275 -2.8 -22.1 65.9 -16.7 -1.8 -13.3
TGAAAATGCTTGTTTTGCTA 2187 SEQ ID NO:6276 -2.8 -19.2 58.6 -15.5 -0.8 -4.8
TTTCCTACAGTCAACACACT 2839 SEQ ID NO:6277 -2.8 -22.6 66.7 -19.3 -0.1 -2.9
CTTGAGAACCATTTCTGCTG 2882 SEQ ID NO: 6278 -2.8 -22.6 66.1 -18.4 -1.3 -5.8
TCAAAGATATTCCAGCCTTC 2935 SEQ ID NO:6279 -2.8 -22.4 65.7 -18.9 -0.4 -3.8
ATTTTGCCAACTTGAAAACT 3042 SEQ ID NO:6280 -2.8 -18.9 56.6 -16.1 0 -4
TCTATCCACTCTCCACACAG 3289 SEQ ID NO: 6281 -2.8 -25.4 73.3 -22.6 0 -1.6
AATAAGGCCAGAAAGAGGTT 3400 SEQ ID NO:6282 -2.8 -20.3 60.1 -17.5 0 -6.9
CTCTCCAACAGCAATTGGCA 3779 SEQ ID NO: 6283 -2.8 -25.1 70.5 -20.7 -1.5 -8.1
CTTCCTTCAGATGAGCTGGT 3877 SEQ ID NO:6284 -2.8 -25.8 75.6 -21.8 -1.1 -5
TCCGGTTTAAAGTCTTCTTC 3949 SEQ ID NO: 6285 -2.8 -22.5 67.3 -19 -0.5 -7.4
TGAGAAGGATCATGAACACA 4107 SEQ ID NO:6286 -2.8 -19.1 58 -15.6 -0.5 -6.9
AAAGACTTTGTCAGCATATT 4193 SEQ ID NO: 6287 -2.8 -19.1 59.2 -15 -1.2 -5.3
ATAAATACATGTACAGATTT 4791 SEQ ID NO:6288 -2.8 -15.5 50.9 -12.2 0 -7.7
AGTTATCTATGATGACACCA 4863 SEQ ID NO:6289 -2.8 -21 63.4 -16.7 -1.4 -5.8
TTTTTAACATAGGCAAAGTT 5497 SEQ ID NO:6290 -2.8 -17.6 55.4 -14.8 0 -4
TCAGGGTCACAGTCGGGTGG 5638 SEQ ID NO: 6291 -2.8 -27.9 80.5 -24.3 -0.6 -5.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GCACTTTCTTCAGTAGCAAC 5797 SEQ ID NO: 6292 -2.8 -23.2 69.9 -19.5 -0.7 -4.2
TTTGTTGGGTTTTGCTATGA 5945 SEQ ID NO: 6293 -2.8 -22.4 67.9 -19.6 0 -3.6
GGATCCGGTCACCACTGACC 5994 SEQ ID NO: 6294 -2.8 -29.3 78.4 -23.2 -3.3 0
AATTGATCACAAAGATAATT 6487 SEQ ID NO: 6295 -2.8 -14.3 47.9 -10.6 -0.8 -6.3
TGCACAACTATCCCTATAGT 6731 SEQ ID NO: 6296 -2.8 -23.4 67.6 -18.8 -1.8 -8.3
CTTTGTCTGATCATTTGAGA 6953 SEQ ID NO: 6297 -2.8 -20.7 64.1 -17.9 0 -6.2
AGATAGAAACAAACATAACA 7087 SEQ ID NO:6298 -2.8 -13.8 46.6 -11 0 -1.2
CTTTGCATAAAAATAATCCT 7146 SEQ ID NO: 6299 -2.8 -16.8 52.4 -14 0 -5.1
AGCAGAAAGTGGAACAACTA 7297 SEQ ID NO:6300 -2.8 -19 57.6 -15.2 -0.9 -5.6
TACTGCAGCAGAAAGTGGAA 7303 SEQ ID NO: 6301 -2.8 -21.3 62.8 -17.2 -0.7 -10.4
GAATGGTAGAAAATATATTA 8057 SEQ ID NO:6302 -2.8 -13.7 47 -10.9 0 -6.2
ATCTATGAATAAAAGGTTAT 8144 SEQ ID NO: 6303 -2.8 -14.7 49.2 -11.4 -0.1 -2.9
CTAGTCTGCATACGTAAATA 8189 SEQ ID NO: 6304 -2.8 -19.5 59.3 -16.7 0 -6.6
ATAGCTTTAGTGCAGCAGGA 8224 SEQ ID NO: 6305 -2.8 -24.3 72.6 -19.9 -1.5 -6.6
CTTATAGCCAAGGGAGTTAA 8772 SEQ ID NO: 6306 -2.8 -21.5 63.8 -18.7 0 -3.7
TAAATCCAAGGGTTCTTGAA 8952 SEQ ID NO:6307 -2.8 -19.7 59.1 -14.8 -2.1 -6.7
ATGCATTACAACTGGAGTTT 9007 SEQ ID NO: 6308 -2.8 -20.8 62.7 -18 0 -6.4
AACAGAGCCTTATGAATTAC 198 SEQ ID NO:6309 -2.7 -19.2 58.4 -16.5 0 -3.2
TTCTTGGCTTTCTCTTCTGC 559 SEQ ID NO:6310 -2.7 -25.4 77.3 -22.7 0 -3.7
TCTCTGGAGGAATGTCTCCA 666 SEQ ID NO: 6311 -2.7 -25.1 73.7 -19.3 -3.1 -8.2
AGTTAAAATATACAAGGCAG 788 SEQ ID NO: 6312 -2.7 -16.2 52 -13.5 0 -4
GTGCTCGGAGAACTCTGAAT 1122 SEQ ID NO: 6313 -2.7 -23.1 66.9 -19.7 -0.4 -8.2
TTAAACCTGGAATGACTGAA 1152 SEQ ID NO: 6314 -2.7 -18.2 55 -15.5 0 -4.2
TCAGGATCATCACATCAGAA 1212 SEQ ID NO: 6315 -2.7 -21 63.6 -17.8 -0.1 -5.3
GTGCTCATTGTTACATTAAC 1387 SEQ ID NO: 6316 -2.7 -20.3 62.6 -17 -0.3 -4.2
GGGTCTTTTTGCCCATCCAA 1453 SEQ ID NO: 6317 -2.7 -28.2 77.7 -24 -1.4 -5.4
GAAAATGACCAGGACAAAAA 1679 SEQ ID NO:6318 -2.7 -15.9 49.7 -13.2 0 -4
ATCAAATTCACCAAATAAAA 1708 SEQ ID NO: 6319 -2.7 -14 46.6 -11.3 0 -3.1
AATCTATACCAGCATGGCGG 2650 SEQ ID NO:6320 -2.7 -24.4 68.2 -19.7 -2 -7.4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ACTGAATTGCTCAGTCATGG 2819 SEQ ID NO: 6321 -2.7 -22.4 66.9 -17.2 -2.5 -10.5
CACAGCACGCGGAACACAAT 3274 SEQ ID NO:6322 -2.7 -23.9 64.7 -20.7 0 -7.9
ACTGCAATCTGCAGATTATT 3475 SEQ ID NO: 6323 -2.7 -21.2 63.6 -14.1 -4.4 -13.8
AACAAGCTTCCGGTTTAAAG 3957 SEQ ID NO: 6324 -2.7 -20.4 59.7 -17.7 0 -6.6
ATTAGTGAAATATGTTTGAA 4262 SEQ ID NO:6325 -2.7 -15.2 50.4 -12.5 0 -4.1
7AAGATGACAAAGTATAAATA 4804 SEQ ID NO:6326 -2.7 -12.9 45.2 -10.2 0 -2.8
AGTGAAGAATGACCCAAAGA 4829 SEQ ID NO:6327 -2.7 -19.7 58 -17 0 -2.1
GATCCGGGACAAAACTAGGG 5135 SEQ ID NO:6328 -2.7 -22.8 63.7 -20.1 0 -6.8
GAACAGAACAATGAACACTA 5159 SEQ ID NO:6329 -2.7 -16.5 51.9 -13.8 0 -3.1
GGGACATCATCAAAGCAAAG 5406 SEQ ID NO:6330 -2.7 -19.8 58.9 -16.5 -0.3 -4.4
GAATTGTGTCAGGGTCACAG 5646 SEQ ID NO:6331 -2.7 -23.1 69.6 -18.8 -1.6 -5.8
TTTTGCTATGAGAAGAGGAG 5936 SEQ ID NO: 6332 -2.7 -19.6 60.6 -16.9 0 -3.6
AATATCAAGACAGTGGATCC 6008 SEQ ID NO:6333 -2.7 -20.3 61.2 -17.1 0 -7.5
CTTTGTAAAGGCAAATAAAA 6026 SEQ ID NO:6334 -2.7 -14.5 47.9 -10.2 -1.6 -5
CTCTCACACAAAACACGCTT 6043 SEQ ID NO:6335 -2.7 -21.7 62.1 -19 0 -3.3
CATAAGAGACTTTGGAGGGG 6117 SEQ ID NO:6336 -2.7 -21.6 64.2 -18.9 0 -2.9
AACCTTTGCTTTAAAAGATA 6211 SEQ ID NO:6337 -2.7 -17.4 54.1 -13.9 -0.6 -4.8
TTGATATATTTTTTAACCTT 6225 SEQ ID NO:6338 -2.7 -16.8 54 -14.1 0 -4.3
CTTCATAGGCTGTAAACAAT 6504 SEQ ID NO:6339 -2.7 -19.4 59 -16.7 0 -3.7
AACAGTCAGTTTGGCATGGA 6560 SEQ ID NO: 6340 -2.7 -23.4 69.3 -20 -0.5 -5.5
TTCTATCACCAATATGTGAC 7626 SEQ ID NO: 6341 -2.7 -20.1 61.2 -16.4 -0.9 -6
CTCATGTTGAATTAAAAGTG 7718 SEQ ID NO:6342 -2.7 -16.1 52 -13.4 0 -4.7
AAATGCTGACAAATAAAGTT 7868 SEQ ID NO:6343 -2.7 -15 48.9 -12.3 0 -3.6
AAAAGAACAAAGTCCATGTT 8253 SEQ ID NO:6344 -2.7 -16.9 52.7 -13.5 -0.4 -4.3
ATTCCCTGCATGCAGTTCTT 8394 SEQ ID NO: 6345 -2.7 -27.1 77.5 -21.6 0.3 -13.8
TAATGACGTAGCTCACCATT 8430 SEQ ID NO:6346 -2.7 -22.3 64.5 -19.6 0 -4.8
CAATAAAAAATGAAATTTAT 8463 SEQ ID NO:6347 -2.7 -9.3 38.3 -5.3 -1.2 -5.2
GTAACAAAGAATGTAACATT 8854 SEQ ID NO:6348 -2.7 -14.8 48.9 -11.2 -0.8 -7.2
GAGTTTTCCACTGAGAATAA 8993 SEQ ID NO:6349 -2.7 -19.8 60.3 -16.5 -0.3 -3.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CAGAGCCTTATGAATTACAG 196 SEQ ID NO:6350 -2.6 -20.4 61.2 -17.8 0 -3.2
CTACTATGAATCCTTGACAG 285 SEQ ID NO:6351 -2.6 -20.2 60.9 -17.6 0 -2.4
TCGATAGCAGCAAGAGATTC 529 SEQ ID NO:6352 -2.6 -21.5 64.2 -18.9 0 -5.4
TCACGAAGAAACGTAAAATC 1015 SEQ ID NO:6353 -2.6 -15.4 49.1 -11.9 -0.8 -5.3
TGAATGTTCTCAACGCTGAG 1107 SEQ ID NO:6354 -2.6 -21.2 62.6 -17 -1.6 -6
TGAGCCCAAGAAAATGACCA 1688 SEQ ID NO:6355 -2.6 -22.4 62 -19.8 0 -3.2
TGAAATCTCTTGAAGCAGCT 1869 SEQ ID NO:6356 -2.6 -21 62.8 -18.4 0 -6.1
AACAGCTCTCCTAACCCACC 1897 SEQ ID NO:6357 -2.6 -27.6 74.4 -25 0 -4.4
TCCAGTAGGTGACGTTAGAG 2456 SEQ ID NO:6358 -2.6 -23.6 70.1 -20.4 -0.3 -7
TCATTGATCTTGCAGACACA 3202 SEQ ID NO:6359 -2.6 -22.1 66.1 -19.5 0 -5.2
TACTGCAATCTGCAGATTAT 3476 SEQ ID NO:6360 -2.6 -20.8 62.7 -13.8 -4.4 -14
CTTTTGCATTCTTCCTACTG 3491 SEQ ID NO:6361 -2.6 -23.3 69.2 -20.7 0 -5.1
GGGGTAGAACAACATCAACT 3900 SEQ ID NO:6362 -2.6 -21 61.9 -18.4 0 -2.9
ATAGGTAAAGACTTTGTCAG 4199 SEQ ID NO:6363 -2.6 -18.6 58.7 -14.7 -1.2 -5.2
ACCCATTTGAGAAGCATTTC 4231 SEQ ID NO: 6364 -2.6 -22.7 66 -19.6 -0.2 -4.1
ACAAGAGCATTCACAACCAC 4438 SEQ ID NO:6365 -2.6 -21.8 63.2 -18.6 -0.3 -4.1
TTAACATCACTAATGTCAAA 4588 SEQ ID NO: 6366 -2.6 -16.1 51.8 -11.9 -1.5 -4.9
CTGTTCCTCTGTCATAAAGA 4919 SEQ ID NO: 6367 -2.6 -22 66.1 -19.4 0 -2.7
TGTTCCAGCCTATAGTGAAG 5223 SEQ ID NO: 6368 -2.6 -23.6 69.3 -21 0 -5.1
AAGTCATCCTCACTCAGGGG 5821 SEQ ID NO: 6369 -2.6 -25.8 75.1 -22.3 -0.8 -3.5
AACCTCATAGAACATCTCAA 5840 SEQ ID NO.-6370 -2.6 -19.7 59.3 -17.1 0 -2.8
TGCAAAATCAGAGAGTTTAG 5903 SEQ ID NO:6371 -2.6 -17.8 56.1 -14.7 -0.1 -4.7
TCCGGTCACCACTGACCATG 5991 SEQ ID NO.-6372 -2.6 -28.2 75.6 -21.2 -4.4 -9.6
AATAAAATATCAAGACAGTG 6013 SEQ ID NO: 6373 -2.6 -13.7 46.8 -11.1 0 -4.1
GAAATTACGCTGAATGATAG 6185 SEQ ID NO: 6374 -2.6 -16.9 52.7 -14.3 0 -3.3
CTCTGGCAAAACACCTTTGT 6967 SEQ ID NO: 6375 -2.6 -23.2 66.1 -19.2 -1.3 -6.6
TGGTTTTGAGCAAAAATTTT 6991 SEQ ID NO:6376 -2.6 -17.3 54.3 -13.8 -0.8 -8.1
AAACTGTAGCCATTACAATT 7018 SEQ ID NO:6377 -2.6 -19.2 57.9 -15.6 -0.9 -3.9
GAAACAAACATAACAGACTA 7082 SEQ ID NO:6378 -2.6 -14.9 48.7 -12.3 0 -2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TTGCACTTGCTGAAACAGAA 7168 SEQ ID NO:6379 -2.6 -20.5 60.5 -17.2 -0.5 -6.5
ATTCTATCACCAATATGTGA 7627 SEQ ID NO.-6380 -2.6 -19.9 60.6 -16 -1.2 -6.2
CCAGTGTGTTTCCTTGAAAT 7759 SEQ ID NO:6381 -2.6 -23.1 67.3 -19.7 -0.6 -4.7
TGTACAAAATGCTGACAAAT 7874 SEQ ID NO: 6382 -2.6 -16.5 51.8 -13.9 0 -5.9
AAAAAAAAACATCTATGAAT 8154 SEQ ID NO: 6383 -2.6 -10.2 39.9 -7.6 0 -3.8
ACGTAAATACTACAAAAGTT 8178 SEQ ID NO:6384 -2.6 -15.1 49.2 -11.8 -0.4 -4.8
CTGCATACGTAAATACTACA 8184 SEQ ID NO: 6385 -2.6 -19 57.2 -15.7 -0.4 -6.1
GGTAATTGCACAACTTTGCC 8289 SEQ ID NO: 6386 -2.6 -23.3 66 . 9 -19.7 -0.9 -5.3
GGTTTGTGCAAAAAACAAAA 8324 SEQ ID NO:6387 -2.6 -15.6 49.6 -11 -2 -10
GCTTATAGCCAAGGGAGTTA 8773 SEQ ID NO:6388 -2.6 -24 70.3 -20.7 -0.5 -4.2
AGTAACAAAGAATGTAACAT 8855 SEQ ID NO:6389 -2.6 -14.7 48.7 -11.2 -0.8 -6.1
AATTACAGCATAACAAAGCC 184 SEQ ID NO:6390 -2.5 -18.8 56.4 -15.8 -0.2 -4.1
TAGTCACAGCACCTTTTTCC 396 SEQ ID NO:6391 -2.5 -25.3 73.9 -22.8 0 -4.1
ATACGAATTACCTTAGATAG 413 SEQ ID NO:6392 -2.5 -17.6 54.8 -15.1 0 -3.5
CAAGAGATTCTCTAGTAAAA 519 SEQ ID NO: 6393 -2.5 -16.4 53.1 -12.6 -1.2 -9.3
ACAGAACACAGTCAGGATCA 1223 SEQ ID NO: 6394 -2.5 -21.8 65.3 -19.3 0 -5.3
CATCTCCAATGTAATCCTTC 1416 SEQ ID NO:6395 -2.5 -22.4 65.9 -19.9 0 -2.4
AGCTGTCTCTCTCTCCTTTG 2019 SEQ ID NO:6396 -2.5 -26.6 80.6 -24.1 0 -4.3
TCCATGGAGAAAAGGAAGCT 2077 SEQ ID NO:6397 -2.5 -21.2 61.5 -17.8 0 -9.5
ATCTTGAGAACCATTTCTGC 2884 SEQ ID NO: 6398 -2.5 -22.1 65.8 -18.2 -1.3 -5.5
CGACCTCCATACAGTCCCAC 3315 SEQ ID NO: 6399 -2.5 -28.7 76.6 -25.7 -0.1 -3.4
GCTGTTCAATGTATATATCT 4149 SEQ ID NO:6400 -2.5 -20 62.3 -17.5 0 -3.9
ATTTGATGGCACCGAGTTCT 4356 SEQ ID NO: 6401 -2.5 -24.7 70.5 -22.2 0 -4
CTGACAGTCACTCAAATTGT 4607 SEQ ID NO: 6402 -2.5 -20.8 62.9 -18.3 0 -7.1
GATGATAAAGATGACAAAGT 4811 SEQ ID NO: 6403 -2.5 -15.4 50.1 -12.9 0 -2.9
CGGGACAAAACTAGGGTCAT 5131 SEQ ID NO: 6404 -2.5 -22.1 63.1 -18.3 -1.2 -5
CGCAGGAAGGGACATCATCA 5414 SEQ ID NO: 6405 -2.5 -24.5 69 -21.4 -0.3 -3.9
AGTAGCAACACTGAAGTTCT 5786 SEQ ID NO:6406 -2.5 -21.2 64.5 -18 -0.5 -6.8
GATCAAACTTTTCCCAAACC 5856 SEQ ID NO:6407 -2.5 -21.6 61.5 -19.1 0 -4.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TTGCTATGAGAAGAGGAGGA 5934 SEQ ID NO:6408 -2.5 -21.2 63.9 -18.7 0 -3.6
TAAGCTGGACTTTGTTGGGT 5955 SEQ ID NO:6409 -2.5 -23.7 70.2 -20.6 -0.3 -5.1
ACCTTTGCTTTAAAAGATAA 6210 SEQ ID NO: 6410 -2.5 -17.4 54.1 -14.1 -0.6 -4.8
TGATATATTTTTTAACCTTT 6224 SEQ ID NO: 6411 -2.5 -16.8 54 -14.3 0 -4.3
GTTACTTGATATATTTTTTA 6230 SEQ ID NO: 6412 -2.5 -16.4 54.3 -13.9 0 -4.3
TCACAAAGATAATTCTTTGT 6481 SEQ ID NO: 6413 -2.5 -17 54.4 -9.8 -4.7 -11
TTCATAGGCTGTAAACAATT 6503 SEQ ID NO: 6414 -2.5 -18.6 57.4 -16.1 0 -3.7
AAACAGTCAGTTTGGCATGG 6561 SEQ ID NO: 6415 -2.5 -22.1 65.6 -18.4 -1.1 -7.2
CGTAAACCTCATTTACAAAA 6904 SEQ ID N0:6416 -2.5 -17.2 52.6 -12 -2.7 -6.1
TTTGTCTGATCATTTGAGAG 6952 SEQ ID NO: 6417 -2.5 -19.8 62.3 -17.3 0 -6.2
ATAAAAATAATCCTTTAAAT 7140 SEQ ID NO: 6418 -2.5 -11.7 42.7 -9.2 0 -4.3
TGCATAAAAATAATCCTTTA 7143 SEQ ID NO: 6419 -2.5 -15.6 50.2 -13.1 0 -4.7
AAAGGTGTTTGTAAATAGCT 7691 SEQ ID NO: 6420 -2.5 -18.3 57.1 -15.8 0 -4.7
ACAAGTTTTAGACATATTTT 7819 SEQ ID NO: 6421 -2.5 -16.9 54.8 -13.7 -0.4 -2.9
TGATTATATTTTTACATTAT 7849 SEQ ID NO: 6422 -2.5 -14.9 50.3 -12.4 0 -2
AAAGTTGATTATATTTTTAC 7854 SEQ ID NO: 6423 -2.5 -14.3 49 -11.8 0 -2.6
GACCAATGTATCTCCTATTG 8077 SEQ ID NO: 6424 -2.5 -22.1 65.1 -19.1 -0.1 -3.4
ATTAAAAAAATAAGACTAGT 8204 SEQ ID NO: 6425 -2.5 -11.2 41.9 -8.7 0 -6.2
TGCAGCAGGAATTAAAAAAA 8214 SEQ ID NO: 6426 -2.5 -15.7 49.8 -13.2 0 -6
AATTCCCTGCATGCAGTTCT 8395 SEQ ID NO: 6427 -2.5 -26.3 74.6 -20.7 -0.2 -14.3
CTACTATTATTATCAAACCT 8723 SEQ ID NO: 6428 -2.5 -17.8 55.6 -15.3 0 -1.3
CTTGATGTGGCTTGGCTTCA 245 SEQ ID NO:6429 -2.4 -25.9 75.3 -22.8 -0.4 -6
ACCTTGATGTGGCTTGGCTT 247 SEQ ID NO: 6430 -2.4 -27 76.7 -23.9 -0.4 -3.8
AATGTGTACTCTACATTCTT 934 SEQ ID NO:6431 -2.4 -19.9 62.2 -16.1 -1.3 -7.4
GTGAATGTGTACTCTACATT 937 SEQ ID NO:6432 -2.4 -20.3 62.8 -16.2 -1.7 -8.2
CTTGCCAAGATTTTTATAAG 979 SEQ ID NO: 6433 -2.4 -18.5 57 -16.1 0 -4.1
CATTGTTACATTAACAAATG 1382 SEQ ID NO: 6434 -2.4 -15.3 50 -10.1 -2.8 -8.5
AATGTGCTCATTGTTACATT 1390 SEQ ID NO:6435 -2.4 -20.4 62.5 -16.8 -1.1 -3.1
ATGTAATCCTTCCAGTTAAA 1408 SEQ ID NO: 6436 -2.4 -20.3 60.9 -17.9 0 -2.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AATGTAATCCTTCCAGTTAA 1409 SEQ ID NO: 6437 -2.4 -20.3 60.9 -17.9 0 -2.6
CCATAGTTGGGGTTTCGACC 1537 SEQ ID NO:6438 -2.4 -26.7 74.7 -21.4 -2.9 -7
AATCTCTTGAAGCAGCTGAT 1866 SEQ ID NO:6439 -2.4 -21.7 64.9 -18.6 0 -8.7
CTTTCCAACAGCTCTCCTAA 1903 SEQ ID NO: 6440 -2.4 -24.7 70.5 -22.3 0 -4.4
CAACACACTACTGAATTGCT 2828 SEQ ID NO:6441 -2.4 -20.4 60.4 -18 0 -3.6
GGCCAGGATTTTGCCAACTT 3049 SEQ ID NO: 6442 -2.4 -26.8 73.9 -22.8 -1.5 -7.4
CATCATTGATCTTGCAGACA 3204 SEQ ID NO: 6443 -2.4 -21.9 65.5 -19.5 0 -5.6
GCCACCGTGGGAGCGTACAG 3225 SEQ ID NO: 6444 -2.4 -30.1 79.4 -26.6 -1 -9.1
GGAAGAAGTCGTTCATGTGC 3243 SEQ ID NO:6445 -2.4 -22.8 67.4 -19.1 -1.2 -4.9
GACCAACATGAAAACAATAA 3353 SEQ ID NO: 6446 -2.4 -15.4 48.9 -13 0 -5.2
CCCTTTTGCATTCTTCCTAC 3493 SEQ ID NO:6447 -2.4 -26.4 74.8 -24 0 -5.1
AATGACATATAATCATTTTC 3730 SEQ ID NO:6448 -2.4 -15.3 50.7 -11.5 -1.3 -7.1
TCCTTCAGATGAGCTGGTTG 3875 SEQ ID NO:6449 -2.4 -24.9 73.4 -21.8 -0.5 -5
CCAGTTGTGCTCAACAATAC 4073 SEQ ID NO:6450 -2.4 -22.4 65.6 -16.7 -3.3 -6.6
ACTTTGTCAGCATATTCTAG 4189 SEQ ID NO:6451 -2.4 -20.9 65.1 -18.5 0 -4.1
TAAAGACTTTGTCAGCATAT 4194 SEQ ID NO:6452 -2.4 -18.7 58.3 -15 -1.2 -5.3
TTGGCTACCAGGCTAACCAA 4321 SEQ ID NO:6453 -2.4 -25.7 70.7 -21.7 -1.5 -7.2
CAAATTGTTAACATCACTAA
4595 SEQ ID NO:6454 -2.4 -15.8 51 -12.9 0 -8 TCAAATTGTTAACATCACTA
4596 SEQ ID NO:6455 -2.4 -16.9 53.9 -14 0 -8.3 AATGACCCAAAGATGATAAA
4822 SEQ ID NO: 6456 -2.4 -16.9 51.8 -14.5 0 -2.1
TTGATCCGGGACAAAACTAG 5137 SEQ ID NO:6457 -2.4 -20.5 59.4 -17.6 0 -7.9
CAGAAACATACCTACAATGG 5270 SEQ ID NO: 6458 -2.4 -18.7 56 -15.8 -0.1 -3.3
TCCCCTTTGCTCCTTTGATC 5373 SEQ ID NO: 6459 -2.4 -28.7 79.8 -26.3 0 -3.9
CAACCAGGAAGGATATGATG 5736 SEQ ID NO: 6460 -2.4 -20.1 59.3 -16.9 -0.6 -4
AGAACATCTCAAAGTCATCC 5832 SEQ ID NO:6461 -2.4 -20.5 61.9 -18.1 0 -2.8
GGCAATAAGCTGGACTTTGT 5960 SEQ ID NO: 6462 -2.4 -23 67.1 -19.2 -1.3 -5.9
CTCCACTCTCACACAAAACA 6048 SEQ ID NO:6463 -2.4 -22.1 63.6 -19.7 0 0
ATTACGCTGAATGATAGCGG 6182 SEQ ID NO:6464 -2.4 -21.5 61.7 -15.5 -3.6 -8.9
TAACATCTGAAATTACGCTG 6193 SEQ ID NO:6465 -2.4 -17.9 54.7 -15.5 0 -3.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo AGTTACTTGATATATTTTTT 6231 SEQ ID NO:6466 -2.4 -16.7 55 -14.3 0 -4.3
AACAATTGATCACAAAGATA 6490 SEQ ID NO:6467 -2.4 -15.1 49.4 -12 -0.5 -7.3
ACCTTCATAGGCTGTAAACA 6506 SEQ ID NO:6468 -2.4 -22.3 65.2 -18.7 -1.1 -5.4
GCACAACTATCCCTATAGTC 6730 SEQ ID NO:6469 -2.4 -23.8 69.3 -19.8 -1.5 -7.2
GATGCAAGGACTGTACTAAA 6780 SEQ ID NO:6470 -2.4 -19.6 59.1 -17.2 0 -5.6
CAGACTAAAATACTTTCAAA
7069 SEQ ID NO: 6471 -2.4 -14.7 48.7 -12.3 0 -2.5 ACAGACTAAAATACTTTCAA
7070 SEQ ID NO: 6472 -2.4 -15.6 50.7 -13.2 0 -2.5 CAGCAGAAAGTGGAACAACT
7298 SEQ ID NO: 6473 -2.4 -20 59.3 -16.6 -0.9 -5.6
TGTTTGTAAATAGCTTCAAA 7686 SEQ ID NO: 6474 -2.4 -17.1 54.4 -14 -0.5 -4.9
AAAATAATTTTCTTATGTAC 7889 SEQ ID NO:6475 -2.4 -13.4 46.7 -11 0 -4.1
CTACAAAAGTTGAATAAAAA 8169 SEQ ID NO:6476 -2.4 -11.5 42.3 -8.4 -0.4 -3.4
GTAAATACTACAAAAGTTGA 8176 SEQ ID NO: 6477 -2.4 -14.7 48.9 -11.6 -0.4 -4.2
TCTGCATACGTAAATACTAC 8185 SEQ ID NO:6478 -2.4 -18.7 57.3 -16.3 0 -6.6
ACTGCCAACAGCAAAAAACA 8518 SEQ ID NO:6479 -2.4 -19.7 56.8 -15.7 -1.5 -4.5
CTATTATTATCAAACCTGAA
8720 SEQ ID NO: 6480 -2.4 -16.9 53.2 -13.8 -0.4 -2.9 ACTATTATTATCAAACCTGA
8721 SEQ ID NO:6481 -2.4 -17.8 55.5 -14.9 -0.2 -2.7 AGGGAGTTAATTGAAATTGA
8762 SEQ ID NO: 6482 -2.4 -17.3 54.6 -14.9 0 -3.9
GCATTTAAGTAACAAAGAAT 8862 SEQ ID NO:6483 -2.4 -15.3 49.9 -12.9 0 -3.4
TGCATTACAACTGGAGTTTT 9006 SEQ ID NO:6484 -2.4 -20.9 63.1 -18.5 0 -5.2
TGTCTTTAAAAATATGCATT 9020 SEQ ID NO: 6485 -2.4 -15.9 51.5 -13.5 0 -6.8
ACAGAGCCTTATGAATTACA 197 SEQ ID NO: 6486 -2.3 -20.6 61.5 -18.3 0 -3.2
CCTTGATGTGGCTTGGCTTC 246 SEQ ID NO: 6487 -2.3 -27.2 77.9 -24.2 -0.4 -3.8
TTTCCCAGTAAGCCACTCTA 302 SEQ ID NO:6488 -2.3 -26.1 74 -23.8 0 -3.4
AGAAGAGATTCTTTGCTCCT 321 SEQ ID NO: 6489 -2.3 -22.7 68 -18.3 -2.1 -8.1
GCTCTGACACCATCTCTGGA 678 SEQ ID NO: 6490 -2.3 -26.8 76.8 -22.9 -1.5 -5.5
TTAAAATATACAAGGCAGAG 786 SEQ ID NO: 6491 -2.3 -15.6 50.6 -13.3 0 -4
GGAGTTAAAATATACAAGGC 790 SEQ ID NO: 6492 -2.3 -17.3 54.3 -15 0 -2.8
CAATGTAATCCTTCCAGTTA 1410 SEQ ID NO: 6493 -2.3 -21.7 64.2 -19.4 0 -1.9
TGATTCTGCTCCTCATAGGC 1747 SEQ ID NO: 6494 -2.3 -25.8 75.6 -22.8 -0.5 -5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AAGTCATTTTCAGATCCAAC 2230 SEQ ID NO: 6495 -2.3 -20.2 61.7 -17.9 0 -4.5
CGTTTCAGTGGTGGTGCCCT 2489 SEQ ID NO:6496 -2.3 -30 83.3 -27.1 -0.3 -5.1
CAAAGATATTCCAGCCTTCT 2934 SEQ ID NO: 6497 -2.3 -22.9 66.1 -19.9 -0.4 -3.8
GGGCCAGGATTTTGCCAACT 3050 SEQ ID NO: 6498 -2.3 -27.9 76.1 -23.3 -2.3 -7.9
CAGTCATCATTGATCTTGCA 3208 SEQ ID NO:6499 -2.3 -22.7 68.4 -19.7 -0.5 -5.8
CGTACAGTCATCATTGATCT 3212 SEQ ID NO:6500 -2.3 -22 66.1 -19 -0.5 -5.6
TGGGAGCGTACAGTCATCAT 3218 SEQ ID NO: 6501 -2.3 -24.8 72.2 -22.5 0 -4.8
CATGACCAACATGAAAACAA 3356 SEQ ID NO:6502 -2.3 -17.1 52 -13 -1.8 -5.2
ATAAGGCCAGAAAGAGGTTC 3399 SEQ ID NO:6503 -2.3 -21.4 63.5 -18.6 -0.1 -7.8
ATTTCATTGTCATCATCAGT 3454 SEQ ID NO: 6504 -2.3 -21.1 66 -18.8 0 -2.4
CTAAAAAAGGCTTTTTGGAA 3547 SEQ ID NO: 6505 -2.3 -16.5 51.9 -12.7 -1.4 -7.7
ACTCTTCAGTATTTAAGTTT 3810 SEQ ID NO: 6506 -2.3 -19.1 61.3 -16.8 0 -2.7
TTCCGGTTTAAAGTCTTCTT 3950 SEQ ID NO:6507 -2.3 -22.2 66.1 -19.3 -0.3 -7.2
ACTGAGAAGGATCATGAACA 4109 SEQ ID NO:6508 -2.3 -19.3 58.6 -16.1 -0.8 -8.2
TGAATATATAGGTAAAGACT 4206 SEQ ID NO: 6509 -2.3 -15.4 50.7 -12.6 -0.1 -4.3
CGTAATGATTTGATGGCACC 4363 SEQ ID NO: 6510 -2.3 -22.3 63.8 -20 0 -4
AGCAGTGCAAGATAGCCAGC 4684 SEQ ID NO:6511 -2.3 -26.1 74.9 -22.8 -0.7 -9.6
AATCAAAGACCATTCCTTGG 5016 SEQ ID NO: 6512 -2.3 -21.2 61.5 -17.7 -1.1 -3.9
GATATCAAAGACTTGTCTGG 5042 SEQ ID NO: 6513 -2.3 -19.5 60.1 -15.7 -1.4 -8.9
GGTTGATCCGGGACAAAACT 5139 SEQ ID NO: 6514 -2.3 -23.2 64.8 -20.2 -0.3 -8.7
TGTAACTGACAAAAAAGAAA 5715 SEQ ID NO: 6515 -2.3 -12.5 44 -9.7 -0.2 -2.9
TTGTAAAGGCAAATAAAATA 6024 SEQ ID NO: 6516 -2.3 -13.2 45.4 -10.2 -0.4 -4.8
GTATTTGTTAAAACAGTCAG 6571 SEQ ID NO: 6517 -2.3 -17.2 55.3 -14.9 0 -5.6
CAGCAACCTCTTGTCAACGT 6662 SEQ ID NO: 6518 -2.3 -24.8 69.8 -21.9 -0.3 -5.5
GTTTTGAGCAAAAATTTTAT 6989 SEQ ID NO:6519 -2.3 -15.8 51.3 -12.6 -0.8 -8.1
GAAGTAACTGAAACTGTAGC 7028 SEQ ID NO: 6520 -2.3 -18.2 56.6 -15.9 0 -3.3
AAAATGGAAGTAACTGAAAC 7034 SEQ ID NO: 6521 -2.3 -13.7 46.4 -11.4 0 -3
TAGAAAATGGAAGTAACTGA 7037 SEQ ID NO: 6522 -2.3 -15.2 49.7 -12.9 0 -3
TAAAATACTTTCAAAATTAA 7064 SEQ ID NO: 6523 -2.3 -10.7 41 -8.4 0 -3.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo ATAGAAACAAACATAACAGA 7085 SEQ ID NO: 6524 -2.3 -13.8 46.6 -11.5 0 -1
TAAAATTTGCACTTGCTGAA 7174 SEQ ID NO: 6525 -2.3 -18.1 55.4 -15.2 -0.3 -6.5
CTAAAGCAATACTTTAGATA 7275 SEQ ID NO: 6526 -2.3 -16 51.9 -10.6 -3.1 -7.9
GAGAGCAGAAGATGGCAAAG 7326 SEQ ID NO:6527 -2.3 -20.5 61 -17.3 -0.8 -4.1 GAATAAAAAAAAACATCTAT
8158 SEQ ID NO:6528 -2.3 -9.9 39.4 -7.6 0 -1.8 TGAATAAAAAAAAACATCTA
8159 SEQ ID NO: 6529 -2.3 -9.9 39.4 -7.6 0 -2.5 AAATACTACAAAAGTTGAAT
8174 SEQ ID NO: 6530 -2.3 -13.1 45.4 -10.1 -0.4 -4.2
TATAGCCAAGGGAGTTAATT 8770 SEQ ID NO: 6531 -2.3 -20.6 61.8 -18.3 0 -3.7
ACTATATCATTAATACCTTA
8906 SEQ ID NO:6532 -2.3 -17.3 55 -15 0 -4.2 AACTATATCATTAATACCTT
8907 SEQ ID NO:6533 -2.3 -16.9 53.7 -14.6 0 -4.2 GTTCTTGAAAAAAAAGTTAA
8941 SEQ ID NO: 6534 -2.3 -12.7 44.8 -10.4 0 -3.5
ATGGGAGAATTATGAAATAC 9056 SEQ ID NO: 6535 -2.3 -15.8 51.1 -13.5 0 -3.2
ACAGAGGTTTACAAATTAGT 86 SEQ ID NO: 6536 -2.2 -18.3 57.6 -16.1 0 -3.2
TATCCCTAGAAGAGATTCTT 328 SEQ ID NO:6537 -2.2 -21.3 64.1 -16.8 -2.3 -5.3
AAATCTTCTAAGCAAAACCC 1000 SEQ ID NO: 6538 -2.2 -18.9 56.2 -16.7 0 -4.1
TAAAATCTTCTAAGCAAAAC 1002 SEQ ID NO: 6539 -2.2 -13.9 47.1 -11.7 0 -4.1
AAACCTGGAATGACTGAAAT 1150 SEQ ID NO:6540 -2.2 -17.7 53.6 -15.5 0 -5.1
ACTGGATCAGGGCCCCCACA 1179 SEQ ID NO: 6541 -2.2 -31.8 83.1 -28.3 -0.7 -10.4
AATCCTTCCAGTTAAATGTG 1404 SEQ ID NO:6542 -2.2 -20.6 61.4 -18.4 0 -5.6
GTAATCCTTCCAGTTAAATG 1406 SEQ ID NO: 6543 -2.2 -20.3 60.9 -18.1 0 -5.2
GAGCCCAAGAAAATGACCAG 1687 SEQ ID NO: 6544 -2.2 -22.4 62.3 -20.2 0 -3.2
CCAGGATCAAATTCACCAAA 1713 SEQ ID NO: 6545 -2.2 -20.9 59.9 -18.1 -0.3 -5.3
GCATCTGCTGAAATTCGGCC 1797 SEQ ID NO:6546 -2.2 -26 71.6 -21.8 -2 -10.2
ATCCATGGAGAAAAGGAAGC 2078 SEQ ID NO:6547 -2.2 -20.3 59.7 -16.8 -0.4 -10.4
GGTCCACCCACCAAGGAAAC 2431 SEQ ID NO:6548 -2.2 -27.2 72 -24.3 -0.5 -5
TTCCGTTTCAGTGGTGGTGC 2492 SEQ ID NO: 6549 -2.2 -27.6 80 -25.4 0 -4.1
CATTGTGTTGGTCAGAATGC 2600 SEQ ID NO:6550 -2.2 -22.5 67.6 -20.3 2.5 -1.2
CAAGTTCTTCCATTGTGTTG 2610 SEQ ID NO: 6551 -2.2 -22.4 67.5 -20.2 0 -2.9
TTCTTCAAGTTCTTCCATTG 2615 SEQ ID NO: 6552 -2.2 -21.8 66.7 -19.6 0 -2.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
GGACATTTCTGTCTAGATTC 2632 SEQ ID NO: 6553 -2.2 -21.5 67 -16.6 -2.7 -6.8
ACAATGCAAATAGTGATGGC 2764 SEQ ID NO: 6554 -2.2 -19.8 59.2 -17 -0.3 -5.6
ACAGTCAACACACTACTGAA 2833 SEQ ID NO:6555 -2.2 -20.1 60.5 -16.2 -1.7 -5.6
TTTAGTGTGGGCCAGGATTT 3058 SEQ ID NO:6556 -2.2 -25.2 73.8 -22.5 0 -7.6
ATGCCGACCACAGCAAAAAT 3154 SEQ ID NO: 6557 -2.2 -22.7 61.9 -19.4 -1 -4.6
CATTGATCTTGCAGACACAT 3201 SEQ ID NO:6558 -2.2 -21.7 64.5 -19.5 0 -5.2
CGTTCATGTGCCACCGTGGG 3234 SEQ ID NO: 6559 -2.2 -29.5 78.3 -26.2 -1 -9.1
AAAGAGGTTCAGAACCACAA 3389 SEQ ID NO: 6560 -2.2 -19.8 58.9 -15.6 -1.9 -11.2
CTCTTCAGTATTTAAGTTTT 3809 SEQ ID NO:6561 -2.2 -19 61 -16.8 0 -2.7
GGTAGAACAACATCAACTGT 3898 SEQ ID NO:6562 -2.2 -19.8 59.8 -17.1 -0.2 -3.3
ACACAATGAAAGTCTCAAAC 4092 SEQ ID NO:6563 -2.2 -16.7 52.7 -13.9 -0.3 -3.1
ACACAGTGGTAGAACTTGCC 4546 SEQ ID NO:6564 -2.2 -24 69.8 -21.8 0 -6.2
CCAAGTTTCTTCATTGCATT 4951 SEQ ID NO: 6565 -2.2 -22.6 67 -20.4 0 -5.1
AATGAACACTAGGTTGATCC 5150 SEQ ID NO:6566 -2.2 -20.4 61.1 -17.4 -0.6 -6
TCAAAGATGTTCCAGCCTAT 5230 SEQ ID NO: 6567 -2.2 -23.1 66.9 -20.9 0 -3.2
CCAGCTTCCTTTTTAACATA 5506 SEQ ID NO: 6568 -2.2 -22.8 66.3 -20.6 0 -4.5
TTTGCTATGAGAAGAGGAGG 5935 SEQ ID NO:6569 -2.2 -20.7 62.9 -18.5 0 -3.6
TCTGAAATTACGCTGAATGA 6188 SEQ ID NO: 6570 -2.2 -18.5 55.9 -16.3 0 -3.3
CAGAGTTGCAGTGACAGAGA 6627 SEQ ID NO: 6571 -2.2 -23 69.3 -20.8 0 -5.5
AGCCATTACAATTCTTTTTC 7011 SEQ ID NO: 6572 -2.2 -20.7 63 -18.5 0 -3.2
ATGGAAGTAACTGAAACTGT 7031 SEQ ID NO: 6573 -2.2 -17.9 55.5 -15.7 0 -3
CTATTCTAAAGCAATACTTT 7280 SEQ ID NO:6574 -2.2 -17.1 54.4 -13.7 -1.1 -4.1
TTTAATTGACATAGACTATC 7355 SEQ ID NO: 6575 -2.2 -16.3 53.3 -14.1 0 -3.3
TTTTACATTATTTATATTTA 7840 SEQ ID NO: 6576 -2.2 -14.2 49.1 -12 0 -2.2
AATGGTAGAAAATATATTAT 8056 SEQ ID NO: 6577 -2.2 -13.1 45.8 -10.9 0 -6.2
ACTACAAAAGTTGAATAAAA 8170 SEQ ID NO: 6578 -2.2 -12.4 44 -9.5 -0.4 -4.1
TATTATTATCAAACCTGAAA 8719 SEQ ID NO: 6579 -2.2 -15.3 49.8 -12.4 -0.4 -2.9
AAGTAACAAAGAATGTAACA 8856 SEQ ID NO:6580 -2.2 -14 47.2 -11.2 -0.3 -5.2
TCAATAACTATATCATTAAT 8912 SEQ ID NO:6581 -2.2 -14.1 48 -11.9 0 -3.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AGGGTTCTTGAAAAAAAAGT 8944 SEQ ID NO: 6582 -2.2 -16 51.2 -13.8 0 -3.5
GGCAGCTGTTCAGCTTTTTT 125 SEQ ID NO:6583 -2.1 -26 77.4 -22 -1.8 -11
CTATGAATCCTTGACAGGTA 282 SEQ ID NO: 6584 -2.1 -21.5 64 -18.4 -0.9 -3.4
TACTATGAATCCTTGACAGG 284 SEQ ID NO:6S85 -2.1 -20.5 61.5 -17.6 -0.6 -3.1
CTCAAAGGTATAGATTCCAG 956 SEQ ID NO: 6586 -2.1 -20.2 61.4 -17.4 -0.4 -3.6
CACGAAGAAACGTAAAATCT 1014 SEQ ID NO:6587 -2.1 -15.9 49.7 -12.9 -0.8 -5.3
TGACACTGAAATCCAGCCAG 1044 SEQ ID NO:6588 -2.1 -23.4 66 -20.8 -0.2 -5.5
GATCAAATTCACCAAATAAA 1709 SEQ ID NO:6589 -2.1 -15.3 49.2 -13.2 0 -4.7
CTTTAGCACCTTTGGAACTC 1944 SEQ ID NO:6590 -2.1 -23.2 68 -21.1 0 -3.3
TTTTCAGATCCAACATCCTT 2224 SEQ ID NO: 6591 -2.1 -22.7 66.5 -20.1 -0.1 -4.5
ACGTTAGAGCTGAAGGTCCA 2445 SEQ ID NO: 6592 -2.1 -24.7 70.9 -22.6 0 -5.8
GTGACGTTAGAGCTGAAGGT 2448 SEQ ID NO:6593 -2.1 -23.4 69 -21.3 0 -6.6
GGTGGTGCCCTCTGGGGGAA 2480 SEQ ID NO: 6594 -2.1 -31.5 85.5 -27.2 -2.2 -8.7
TTCAAGTTCTTCCATTGTGT 2612 SEQ ID NO: 6595 -2.1 -22.8 69.3 -20.7 0 -3.1
TCTTCAAGTTCTTCCATTGT 2614 SEQ ID NO: 6596 -2.1 -22.9 69.8 -20.8 0 -3.1
TATTTAAGACAATGCAAATA 2772 SEQ ID NO:6597 -2.1 -14.5 48.3 -11.8 -0.3 -5.6
TAGTGTGGGCCAGGATTTTG 3056 SEQ ID NO:6598 -2.1 -25.1 73.2 -22.5 0 -7.6
AGCCCCCACAGAATTGCCAA 3095 SEQ ID NO:6599 -2.1 -29.2 75.3 -27.1 0 -3.2
TAGAGCCCCCACAGAATTGC 3098 SEQ ID NO:6600 -2.1 -27.5 74.2 -25.4 0 -3.2
TCATCATTGATCTTGCAGAC 3205 SEQ ID NO: 6601 -2.1 -21.6 65.8 -19.5 0 -5.6
TGTGCCACCGTGGGAGCGTA 3228 SEQ ID NO:6602 -2.1 -30.4 80.5 -27.1 -1.1 -9.1
CCAGAAAGAGGTTCAGAACC 3393 SEQ ID NO: 6603 -2.1 -22.2 64.2 -18.4 -1.6 -10.7
ATCTTATTTTTCACATAATC 3517 SEQ ID NO:6604 -2.1 -16.9 55.1 -14.8 0 -2.2
ATGGAAACTTTTTAATACAC 3987 SEQ ID NO:6605 -2.1 -15.7 51.1 -13.6 0 -2.5
TACTTACTTGACAGAATGGA 4002 SEQ ID NO:6606 -2.1 -19 58.5 -16.2 -0.4 -3.2
TTAGTGAAATATGTTTGAAA 4261 SEQ ID NO: 6607 -2.1 -14.5 48.8 -12.4 0 -4.1
CCAGGCATTAGTGAAATATG 4268 SEQ ID NO:6608 -2.1 -20.3 60.4 -18.2 0 -4
TGAGTAGCCAAGAGCATTGG 4337 SEQ ID NO:6609 -2.1 -23.7 68.9 -19.5 -2.1 -8.2
CTTCAAACCGGGATAAGGCT 4410 SEQ ID NO: 6610 -2.1 -23.6 65.5 -21.5 0 -7.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GTGAATCAACAGCTGCATAC 4740 SEQ ID NO:6611 -2.1 -21.5 63.8 -18.7 0 -9
AGATGATAAAGATGACAAAG 4812 SEQ ID NO:6612 -2.1 -14.2 47.7 -12.1 0 -2.5
CCAATGAATAGATTCAGAGT 4846 SEQ ID NO: 6613 -2.1 -19.2 58.6 -15.9 -1.1 -7.8
GAAGTTATCTATGATGACAC 4865 SEQ ID NO:6614 -2.1 -18.2 57.5 -14.6 -1.4 -5.8
TGATCCGGGACAAAACTAGG 5136 SEQ ID NO:6615 -2.1 -21.6 61.4 -19.5 0 -6.8
CCAGAAACATACCTACAATG 5271 SEQ ID NO:6616 -2.1 -19.5 57.2 -17.4 0 -3
GTTGAACATGTCATCAATTC 5525 SEQ ID NO:6617 -2.1 -19.3 60 -15.9 -1 -9.9
TTAAGAATAGGTGCTAGCAA 5611 SEQ ID NO:6618 -2.1 -19.3 59.1 -15.8 0 -10.8
CCCAAACCTCATAGAACATC 5844 SEQ ID NO:6619 -2.1 -22.4 63.2 -20.3 0 -2.5
AGGCAAATAAAATATCAAGA 6018 SEQ ID NO:6620 -2.1 -14.6 48.2 -12.5 0 -4
TAAAGGCAAATAAAATATCA 6021 SEQ ID NO:6621 -2.1 -13 45 -10.9 0 -3.2
GATAACATCTGAAATTACGC 6195 SEQ ID NO:6622 -2.1 -17.6 54.2 -15.5 0 -3.3
TTTGTTTCTTTTTACTTTTG 6466 SEQ ID NO: 6623 -2.1 -18.4 59.5 -16.3 0 -2.2
TTGTCTGATCATTTGAGAGA 6951 SEQ ID NO:6624 -2.1 -20.3 63.3 -18.2 0 -6
CTGGTTTTGAGCAAAAATTT 6992 SEQ ID NO:6625 -2.1 -18.1 55.8 -15.1 -0.8 -8.1
TACTTTCAAAATTAAAGCCA 7059 SEQ ID NO:6626 -2.1 -16.9 52.7 -13.9 -0.7 -5.6
ATAAAATTTGCACTTGCTGA 7175 SEQ ID NO:6627 -2.1 -18.8 57.2 -16.1 -0.3 -6.5
TATATATTTGCCCAAACATG 7414 SEQ ID NO:6628 -2.1 -19.3 57.4 -17.2 0 -5.4
ACTCATGTTGAATTAAAAGT 7719 SEQ ID NO: 6629 -2.1 -16.3 52.6 -14.2 0 -4.7
TATTGGAATGGTAGAAAATA 8062 SEQ ID NO:6630 -2.1 -15.2 49.9 -13.1 0 -2.2
TTGGCTCAATAATGACGTAG 8439 SEQ ID NO:6631 -2.1 -19.9 59.6 -17.2 _ -0.3 -5.3
GTTTTATTAATTATATATAT 8543 SEQ ID NO:6632 -2.1 -13.2 46.8 -11.1 0 -5.4
TTATAGCCAAGGGAGTTAAT 8771 SEQ ID NO:6633 -2.1 -20.6 61.8 -18.5 0 -3.7
AACTGGAGTTTTCCACTGAG 8998 SEQ ID NO:6634 -2.1 -22.5 66.7 -18.3 -2.1 -6.3
ATGAAATACATATTTAGATC 9045 SEQ ID NO:6635 -2.1 -14.4 48.8 -11.7 -0.3 -5.2
CAAGATGGTTAGGGTATAAC 157 SEQ ID NO: 6636 -2 -19.3 59.5 -16.3 -0.9 -3.8
CCAGTAAGCCACTCTACTAT 298 SEQ ID NO:6637 -2 -24.3 70 -22.3 0 -4.7
TTACAATATCCCTAGAAGAG 334 SEQ ID NO: 6638 -2 -19.2 58.3 -17.2 0 -3.8
TCCTGGGGGTACCAACAGTG 482 SEQ ID NO:6639 -2 -27.3 76 -22.5 -2.8 -10.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GCAGCAAGAGATTCTCTAGT 523 SEQ ID NO: 6640 -2 -23.1 70.1 -19.8 -1.2 -9.3
CACTGAATCGGAAAATTGCC 762 SEQ ID NO: 6641 -2 -20.5 58.7 -18.5 0 -4.3
AGTGAATGTGTACTCTACAT 938 SEQ ID NO: 6642 -2 -20.2 62.7 -17.3 -0.8 -5.5
ATAGATTCCAGTGAATGTGT 947 SEQ ID NO: 6643 -2 -21 64 -17.6 -1.3 -4.1
AGGTCCACAAACTCTGTCAC 1078 SEQ ID NO: 6644 -2 -23.9 69.9 -21.4 -0.1 -3.6
TGAGAGCAAACACGCTCAGA
1242 SEQ ID NO: 6645 -2 -22.6 64.7 -17.3 -3.3 -8.5 ATGAGAGCAAACACGCTCAG
1243 SEQ ID NO: 6646 -2 -22 63.5 -16.7 -3.3 -8.5 GTAAAGGGTCTTTTTGCCCA
1458 SEQ ID NO: 6647 -2 -25.3 72.1 -21.8 -1.4 -5.3
TGGGGTTTCGACCAGCCTTC 1530 SEQ ID NO: 6648 -2 -28.9 79.8 -24.2 -2.7 -7.8
TTGTTGTTTCCTTCAAGGTG 2002 SEQ ID NO:6649 -2 -23 69.5 -20.2 -0.6 -5.2
CCACAGTGCTGTGCATCTTC 2397 SEQ ID NO:6650 -2 -27 78.3 -22.8 -1.7 -12.4
TCTGGTAAGAGCTTAACCTT 2523 SEQ ID NO: 6651 -2 -22.3 66.2 -19.2 -1 -8
GAGCGTACAGTCATCATTGA 3215 SEQ ID NO: 6652 -2 -23.1 68.6 -20.5 -0.3 -5.5
CACACAGCACGCGGAACACA 3276 SEQ ID NO:6653 -2 -25.5 68.2 -23 0 -7.9
ATGGTCTCTATCCACTCTCC 3295 SEQ ID NO: 6654 -2 -26.6 78.3 -23.7 -0.7 -3.9
TCTTCCTACTGCAATCTGCA 3482 SEQ ID NO: 6655 -2 -25.1 72.5 -21 -2.1 -7
TCAATTCCCTTTTGCATTCT 3499 SEQ ID NO:6656 -2 -24 69.6 -22 0 -5.1
AGTATTATTGGACATGCAGC 3611 SEQ ID NO:6657 -2 -21.8 65.9 -19.8 0 -5.5
TTTCAAAGTCAGACTCTCCA 3792 SEQ ID NO: 6658 -2 -22.3 66.8 -20.3 0 -7.3
TCTAGTTCTGACTCACTGCT 3832 SEQ ID NO:6659 -2 -24.2 73.5 -21.5 -0.4 -4.4
CAACTGTGCTTCCTTCAGAT 3885 SEQ ID NO:6660 -2 -24.2 70.5 -21.3 -0.7 -4
TAGTGAAATATGTTTGAAAT 4260 SEQ ID NO:6661 -2 -14.4 48.5 -12.4 0 -3.5
CATTGGCTACCAGGCTAACC 4323 SEQ ID NO: 6662 -2 -26.4 72.9 -23.1 -1.2 -7.2
ATGCCTTCAAACCGGGATAA 4414 SEQ ID NO: 6663 -2 -23.5 64.5 -21.5 0 -7.1
AAAGTATAAATACATGTACA 4796 SEQ ID NO: 6664 -2 -14.2 47.9 -11.5 -0.5 -8.2
GCTGATATCAAAGACTTGTC 5045 SEQ ID NO: 6665 -2 -20.1 61.7 -17.4 -0.3 -8.1
AGGGGACACAGAATACTTTT 5303 SEQ ID NO: 6666 -2 -21 62.9 -19 0 -1.9
CTCGGAACAAGGTAGGGGAC 5316 SEQ ID NO:6667 -2 -23.9 67.9 -21.9 0 -3
AACATAGGCAAAGTTGGACA 5492 SEQ ID NO: 6668 -2 -20.2 60.1 -18.2 0 -4.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
ATCCATCCCAGCCAGCAGAG
5592 SEQ ID NO: 6669 -2 -29.8 80.8 -27.8 0 -4.6 TAAGAATAGGTGCTAGCAAT
5610 SEQ ID NO: 6670 -2 -19.2 58.7 -15.8 0 -10.8 AAAAAAGAAAATCCCAACAG
5705 SEQ ID NO: 6671 -2 -14.3 46.6 -12.3 0 -2.2 ACATCTCAAAGTCATCCTCA
5829 SEQ ID NO: 6672 -2 -22.6 67.2 -20.6 0 -2.5 AACACGCTTTGTAAAGGCAA
6032 SEQ ID NO: 6673 -2 -20.6 59.7 -17 -1.5 -5.9 CTTTGGAGGGGTTTGATGCC
6108 SEQ ID NO: 6674 -2 -26.3 75.3 -24.3 0 -3 CACAAAGATAATTCTTTGTT
6480 SEQ ID NO: 6675 -2 -16.7 53.5 -9.8 -4.9 -11.3 GAAACTTAGAATAAAATTTG
7185 SEQ ID NO: 6676 -2 -11.8 43 -9.8 0 -5.2 TGAAACTTAGAATAAAATTT
7186 SEQ ID NO: 6677 -2 -11.8 43 -9.8 0 -4.9 CTTTAAACTATGTTTAATGA
7526 SEQ ID NO: 6678 -2 -15.2 50.3 -11.1 -2.1 -8 ATATGAAGAATAGGTTTTGT
7792 SEQ ID NO: 6679 -2 -17.1 55 -15.1 0 -1.8 TGCACAACTTTGCCACTTTG
8283 SEQ ID NO: 6680 -2 -23.8 67.8 -20.8 -0.9 -4.7 AATGACGTAGCTCACCATTC
8429 SEQ ID NO: 6681 -2 -23 66.5 -21 0 -5.3 AACTGCCAACAGCAAAAAAC
8519 SEQ ID NO: 6682 -2 -18.3 54.1 -14.7 -1.5 -4.5 TGGAGTTTTCCACTGAGAAT
8995 SEQ ID NO: 6683 -2 -22 65.5 -18 -2 -6.2 AGAATTATGAAATACATATT
9051 SEQ ID NO: 6684 -2 -13.3 46.1 -10.4 -0.7 -4.6 CAAAGAGACCTTTCCAGAAT
28 SEQ ID NO: 6685 -1.9 -20.8 60.8 -17.8 -1 -3.9 GACCACAGAGGTTTACAAAT
90 SEQ ID NO: 6686 -1.9 -20.8 61.5 -17.3 -1.5 -7.1 TAACAAAGCCCAGCATCCAA
174 SEQ ID NO: 6687 -1.9 -23.9 65.3 -21.1 -0.7 -4.1 TTTCTTGCTCCATAATCTCT
223 SEQ ID NO: 6688 -1.9 -23 68.9 -21.1 0 -3.6 CAGCAAGAGATTCTCTAGTA 1
522 SEQ ID NO: 6689 -1.9 -21 64.9 -18.2 -0.7 -8.8 TGTACCAAAATCTTGATAGC
832 SEQ ID NO: 6690 -1.9 -19.2 58.3 -17.3 0.2 -4.8 TAAAGAATGTACCAAAATCT
839 SEQ ID NO: 6691 -1.9 -15.2 49.3 -13.3 0 -4.2 TCTACATTCTTTGTCCAGTC
925 SEQ ID NO: 6692 -1.9 -23.4 71.9 -20.9 -0.3 -3.1 TAAACCTGGAATGACTGAAA
1151 SEQ ID NO: 6693 -1.9 -17.4 53.1 -15.5 0 -5.1 GAAAGCTTCTTTACCGACTG
1195 SEQ ID NO: 6694 -1.9 -21.9 63.4 -19.1 -0.7 -7 CCACAGCCAGGATCAAATTC
1719 SEQ ID NO: 6695 -1.9 -24.1 67.9 -22.2 0 -5.3 ATCTGGTAAGAGCTTAACCT
2524 SEQ ID NO: 6696 -1.9 -22.2 65.8 -19.2 -1 -8 TCAAGTTCTTCCATTGTGTT
2611 SEQ ID NO: 6697 -1.9 -22.8 69.3 -20.9 0 -3.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ATCATTGATCTTGCAGACAC 3203 SEQ ID NO:6698 -1.9 -21.4 64.8 -19.5 0 -5.4
CCACATGGTCTCTATCCACT 3299 SEQ ID NO: 6699 -1.9 -26.5 75.5 -24.1 -0.2 -5.2
TAATAAGGCCAGAAAGAGGT 3401 SEQ ID NO: 6700 -1.9 -19.9 59.3 -17.5 0 -7.7
ACATGCAGCTGTCTATCTTA 3600 SEQ ID NO:6701 -1.9 -23.4 70.6 -20.9 0 -8.6
TCAGTATTTAAGTTTTCAAA 3805 SEQ ID NO:6702 -1.9 -16.4 53.8 -14.5 0 -2.7
ACAAGCTTCCGGTTTAAAGT 3956 SEQ ID NO:6703 -1.9 -22.3 64.5 -20.4 0 -6.6
CAGAATGGAAACTTTTTAAT 3991 SEQ ID NO:6704 -1.9 -15.5 50.3 -13.6 0 -2.5
CATGATAGAGGGAATTGCTC 4460 SEQ ID NO:6705 -1.9 -21.1 63.4 -18.7 -0.2 -5.7
CTCAAATTGTTAACATCACT 4597 SEQ ID NO:6706 -1.9 -18.1 56.3 -15.7 0 -8.3
CAAAGATGATAAAGATGACA 4815 SEQ ID NO: 6707 -1.9 -14.9 48.8 -13 0 -2.3
TGAAGTTATCTATGATGACA 4866 SEQ ID NO: 6708 -1.9 -18 56.9 -14.6 -1.4 -5.8
TATAGTGAAGTAGTAGTGTC 5213 SEQ ID NO:6709 -1.9 -19.1 62.3 -17.2 0 -1.7
TCCAGCTTCCTTTTTAACAT 5507 SEQ ID NO:6710 -1.9 -23.5 68.4 -21.6 0 -4.5
CTCAAAGTTGAACATGTCAT 5531 SEQ ID NO: 6711 -1.9 -19 58.4 -16.5 -0.3 -7
ATGTAACTGACAAAAAAGAA 5716 SEQ ID NO:6712 -1.9 -13.2 45.4 -10.5 -0.6 -3.4
GCAAAATCAGAGAGTTTAGA 5902 SEQ ID NO: 6713 -1.9 -18.4 57.5 -16 -0.1 -4.4
TTGTTGGGTTTTGCTATGAG 5944 SEQ ID NO: 6714 -1.9 -22.3 67.8 -20.4 0 -3.6
TTTGTAAAGGCAAATAAAAT 6025 SEQ ID NO: 6715 -1.9 -13.6 46.2 -10.2 -1.4 -4.8
TCTCACACAAAACACGCTTT 6042 SEQ ID NO: 6716 -1.9 -20.9 60.7 -19 0 -3.3
GAGGGGTTTGATGCCATAAA 6103 SEQ ID NO: 6717 -1.9 -23 66.1 -20 -1 -3.7
TTACTTGATATATTTTTTAA 6229 SEQ ID NO:6718 -1.9 -14.5 49.5 -12.6 0 -4.3
ACGTAAACCTCATTTACAAA 6905 SEQ ID NO:6719 -1.9 -18.1 54.7 -13.5 -2.7 -6.1
ATACTTTCAAAATTAAAGCC 7060 SEQ ID NO:6720 -1.9 -16.2 51.5 -13.4 -0.7 -5.6
GCAGAAAGTGGAACAACTAT 7296 SEQ ID NO: 6721 -1.9 -19 57.4 -16.1 -0.9 -4.9
TAACTATTTACATAACATAG 7379 SEQ ID NO: 6722 -1.9 -14.2 48.3 -12.3 0 -3.7
TTTACATTATTTATATTTAA 7839 SEQ ID NO:6723 -1.9 -13.4 47.1 -11.5 0 -2.2
AAAATGCTGACAAATAAAGT 7869 SEQ ID NO: 6724 -1.9 -14.2 47.2 -12.3 0 -2.9
AAATCCATAAAACCCATTAT 8029 SEQ ID NO: 6725 -1.9 -18 53.7 -16.1 0 -2.4
AAATATATTATAACAAAGAA 8047 SEQ ID NO: 6726 -1.9 -10.2 40 -8.3 0 -6.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GTTTGACCAATGTATCTCCT 8081 SEQ ID N0:6727 -1.9 -23.7 69.3 -21.8 0 -3.4
ACTAGTCTGCATACGTAAAT 8190 SEQ ID NO: 6728 -1.9 -20 60.4 -18.1 0 -6.6
AATAAGACTAGTCTGCATAC 8196 SEQ ID NO: 6729 -1.9 -18.6 58.3 -15 0 -11.5
CATGGCTAAAAAGAACAAAG 8261 SEQ ID NO: 6730 -1.9 -14.9 48.3 -13 0 -3.7
CCAAGGGTTCTTGAAAAAAA 8947 SEQ ID NO: 6731 -1.9 -17.5 53.3 -13.5 -2.1 -5.7
TTTAGATCCAAATTGTCTTT 9033 SEQ ID NO: 6732 -1.9 -19 59 -17.1 0 -4.5
AAACAGAGCCTTATGAATTA 199 SEQ ID NO: 6733 -1.8 -18.3 56 -16.5 0 -3.2
TGATAAAACAGAGCCTTATG 204 SEQ ID NO: 6734 -1.8 -18.2 55.7 -16.4 0 -3.2
TAGAAGAGATTCTTTGCTCC 322 SEQ ID NO: 6735 -1.8 -21.5 65.4 -17.4 -2.3 -8.3
AGCAAGAGATTCTCTAGTAA 521 SEQ ID NO: 6736 -1.8 -19.6 61.4 -16.5 -1.2 -9.3
ATGTACCAAAATCTTGATAG
833 SEQ ID NO:6737 -1.8 -17.4 54.5 -15 -0.3 -4.8 AATGTACCAAAATCTTGATA
834 SEQ ID NO: 6738 -1.8 -16.7 52.6 -14.3 -0.3 -4.8 GAATGTACCAAAATCTTGAT
835 SEQ ID NO: 6739 -1.8 -17.6 54.3 -15.2 -0.3 -4.8 GGAATGACTGAAATTGTTTT
1144 SEQ ID NO: 6740 -1.8 -17.6 55 -15.8 0 -3.2
AACTTTCCAACAGCTCTCCT 1905 SEQ ID NO: 6741 -1.8 -25.2 71.6 -23.4 0 -4.4
TCCTTCAAGGTGCTCTCTCT 1994 SEQ ID NO: 6742 -1.8 -26.8 79.3 -24.2 -0.6 -5.3
TCATCAGCAAAGTCATTTTC 2239 SEQ ID NO: 6743 -1.8 -20.3 62.8 -18.5 0 -4.1
CTGGCACCATCCTGGATGAC 2361 SEQ ID NO: 6744 -1.8 -27.4 75.4 -23.7 -1.2 -11.8
AGCTGAAGGTCCACCCACCA 2438 SEQ ID NO: 6745 -1.8 -29.9 79.5 -26.9 -1.1 -5.6
GGTGACGTTAGAGCTGAAGG 2449 SEQ ID NO:6746 -1.8 -23.4 68.3 -21.6 0 -5.4
TAATTAGCATATTTAGTGTG 3069 SEQ ID NO: 6747 -1.8 -17.3 55.9 -15.5 0 -5.4
GTACCTACACCACTGGTGGT 3679 SEQ ID NO:6748 -1.8 -27.4 77.3 -23 -2.6 -11.7
ATGAGCTGGTTGCATTTAAT 3867 SEQ ID NO: 6749 -1.8 -21.5 64.4 -18.1 -1.5 -5.1
AACCCATTTGAGAAGCATTT 4232 SEQ ID NO:6750 -1.8 -21.6 62.5 -19.8 0 -4.1
AATCCATAAGCAACCCATTT 4243 SEQ ID NO:6751 -1.8 -22.3 62.8 -20.5 0 -4.1
GCTAAAGATCAACCAGAAGA 4502 SEQ ID NO: 6752 -1.8 -19.4 58 -17.6 0 -5.4
TCCAGTGAACAGAACAATGA 5165 SEQ ID NO: 6753 -1.8 -19.8 58.9 -17.3 -0.5 -3.9
ACAAGCAGATCATGCTGTTG 5559 SEQ ID NO: 6754 -1.8 -22.4 66.5 -17.8 -2.8 -10.6
TAGAACATCTCAAAGTCATC 5833 SEQ ID NO: 6755 -1.8 -18.2 57.5 -16.4 0 -2.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CTATGAGAAGAGGAGGATCC 5931 SEQ ID NO:6756 -1.8 -21.7 64.7 -18.3 -1.5 -7.7
AAAGGCAAATAAAATATCAA 6020 SEQ ID NO:6757 -1.8 -12.6 44.1 -10.8 0 -4
GTAAAGGCAAATAAAATATC 6022 SEQ ID NO:6758 -1.8 -13.5 46.1 -11.7 0 -4
ACAAAACACGCTTTGTAAAG 6036 SEQ ID NO: 6759 -1.8 -17.1 52.6 -14 -1.2 -6.2
CTCTCCACTCTCACACAAAA 6050 SEQ ID NO:6760 -1.8 -22.5 65.1 -20.7 0 0
CCTTTAATTGCCTCTTTGTT 6253 SEQ ID NO: 6761 -1.8 -23.7 69 -21.9 0 -3
TTTCTCAAACTTTTCCTTGT 6401 SEQ ID NO: 6762 -1.8 -21.2 64.3 -19.4 0 -2.8
AAACAATTGATCACAAAGAT 6491 SEQ ID NO: 6763 -1.8 -14.7 48.3 -12 -0.8 -7.2
AGGACTGTACTAAAGGTGTT 6774 SEQ ID NO: 6764 -1.8 -20.9 63.8 -19.1 0 -4.8
TGGAAGTAACTGAAACTGTA 7030 SEQ ID NO:6765 -1.8 -17.6 55 -15.8 0 -3.3
TAAATATTAGAGGAGACTTT 7125 SEQ ID NO: 6766 -1.8 -16.1 52.6 -13.4 -0.7 -7.1
AATTTGCACTTGCTGAAACA 7171 SEQ ID NO: 6767 -1.8 -20 59.4 -18.2 0.4 -5.8
GCAGCAGAAAGTGGAACAAC 7299 SEQ ID NO: 6768 -1.8 -20.9 61.3 -18.1 -0.9 -6.2
AAATATGAAGAATAGGTTTT 7794 SEQ ID NO: 6769 -1.8 -14.5 48.7 -12.7 0 -2.7
ACAAAAGTTGAATAAAAAAA 8167 SEQ ID NO: 6770 -1.8 -9.5 38.7 -7 -0.4 -3.4
AATACTACAAAAGTTGAATA 8173 SEQ ID NO: 6771 -1.8 -13.5 46.4 -11 -0.4 -4.2
TAAATACTACAAAAGTTGAA 8175 SEQ ID NO: 6772 -1.8 -12.8 44.9 -10.3 -0.4 -4.2
TGCCAACAGCAAAAAACAAA 8516 SEQ ID NO: 6773 -1.8 -17.2 51.7 -14 -1.3 -4.1
ATTTAGATCCAAATTGTCTT 9034 SEQ ID NO: 6774 -1.8 -18.9 58.7 -17.1 0 -2
CACAGAGGTTTACAAATTAG 87 SEQ ID NO: 6775 -1.7 -17.8 55.9 -16.1 0 -3.2
AATCTCTGATAAAACAGAGC 210 SEQ ID NO: 6776 -1.7 -17.4 54.7 -12.7 -3 -8.7
TGATGTGGCTTGGCTTCAGT 243 SEQ ID NO: 6777 -1.7 -26.1 76.9 -23.7 -0.4 -6
CCCAGTAAGCCACTCTACTA 299 SEQ ID NO: 6778 -1.7 -26.3 73.6 -24.6 0 -4.7
TTCCCAGTAAGCCACTCTAC 301 SEQ ID NO:6779 -1.7 -26.2 74.2 -24.5 0 -3.2
ACGAATTACCTTAGATAGTC 411 SEQ ID NO: 6780 -1.7 -19.5 59.5 -17.8 0 -3.5
TGGAAGGTTCTTTCCAGCTT 638 SEQ ID NO:6781 -1.7 -25 73.3 -20.6 -2.7 -9.2
TTTCCTAACAGGGTTTAGTG 809 SEQ ID NO: 6782 -1.7 -22.1 66.7 -19.5 -0.7 -4.1
AAAGAATGTACCAAAATCTT 838 SEQ ID NO: 6783 -1.7 -15.6 50 -13.3 -0.3 -4.2
CAGTGAATGTGTACTCTACA 939 SEQ ID NO: 6784 -1.7 -20.9 64 -18.4 -0.6 -4.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TAGATTCCAGTGAATGTGTA 946 SEQ ID NO: 6785 -1.7 -20.7 63.4 -17.6 -1.3 -6
AGTGACTGTCATCTCCAATG 1425 SEQ ID NO: 6786 -1.7 -22.9 68.3 -20.5 -0.1 -8.8
CACCTTTGGAACTCAACTTT 1938 SEQ ID NO: 6787 -1.7 -21.9 63.8 -20.2 0 -4
TGGATGACATACTGGCCTGA 2349 SEQ ID NO:6788 -1.7 -24.6 69.8 -22.9 0 -7.2
ATTGTGTTGGTCAGAATGCT 2599 SEQ ID NO:6789 -1.7 -22.7 68.4 -21 0 0
GTACAGTCATCATTGATCTT 3211 SEQ ID NO: 6790 -1.7 -21.3 66.3 -18.9 -0.5 -5.8
TTTCATTGTCATCATCAGTA 3453 SEQ ID NO:6791 -1.7 -20.8 65.4 -19.1 0 -2.4
AGTACCTACACCACTGGTGG 3680 SEQ ID NO: 6792 -1.7 -26.2 74.2 -21.9 -2.6 -11
CAGTATTTAAGTTTTCAAAG 3804 SEQ ID NO: 6793 -1.7 -16 52.7 -14.3 0 -2.7
TTCAGTATTTAAGTTTTCAA 3806 SEQ ID NO:6794 -1.7 -17.2 56.1 -15.5 0 -2.7
TCTTCAGTATTTAAGTTTTC 3808 SEQ ID NO: 6795 -1.7 -18.5 60.4 -16.8 0 -2.7
CTACTGAGAAGGATCATGAA 4111 SEQ ID NO: 6796 -1.7 -19 58.2 -16.4 -0.8 -8.2
CATAAGCAACCCATTTGAGA 4239 SEQ ID NO:6797 -1.7 -21.8 62.5 -19.4 -0.4 -3.3
GTTATCTATGATGACACCAA 4862 SEQ ID NO: 6798 -1.7 -20.3 61.1 -17.8 -0.6 -5.1
CAAAATCAAAGACCATTCCT 5019 SEQ ID NO:6799 -1.7 -19.2 56.5 -17.5 0 -2.8
AGAACAATGAACACTAGGTT 5155 SEQ ID NO:6800 -1.7 -18.2 56.2 -15.8 -0.4 -6
TGGAACAAGCAGATCATGCT
5563 SEQ ID NO: 6801 -1.7 -22.2 64.7 -17.1 -3.4 -11.7 TTGGAACAAGCAGATCATGC
5564 SEQ ID NO: 6802 -1.7 -21.4 63.2 -16.3 -3.4 -11.9 GGTGCTAGCAATCCATCCCA
5602 SEQ ID NO:6803 -1.7 -28.8 78.6 -25.6 0 -10.9
TCGGGTGGTGCACTATTAAG 5626 SEQ ID NO: 6804 -1.7 -23.6 68.5 -20.6 -1.1 -9.5
TGTGTCAGGGTCACAGTCGG 5642 SEQ ID NO: 6805 -1.7 -26.7 78.5 -23.5 -1.4 -5.7
TTAAAAGATAACATCTGAAA 6201 SEQ ID NO:6806 -1.7 -12.7 44.7 -10.4 -0.3 -3.7
TAACCTTTGCTTTAAAAGAT 6212 SEQ ID NO: 6807 -1.7 -17.4 54.1 -14.9 -0.6 -4.8
AGCAACCTCTTGTCAACGTT 6661 SEQ ID NO: 6808 -1.7 -24.2 69.1 -21.9 -0.3 -6.9
TTGCACAACTATCCCTATAG
6732 SEQ ID NO:6809 -1.7 -22.3 64.8 -19.7 -0.8 -6.6 TTTGCACAACTATCCCTATA
6733 SEQ ID NO: 6810 -1.7 -22.4 64.9 -20.7 0 -5 ATTTTGTAAAAATATGGCAG
6823 SEQ ID NO: 6811 -1.7 -15.8 51.1 -12.4 -1.7 -7.4
GATTATATTTTTACATTATT 7848 SEQ ID NO: 6812 -1.7 -15 50.7 -13.3 0 -2.2
AATTGTGATTAAAAATCAAA 7952 SEQ ID NO: 6813 -1.7 -11.9 43.1 -8.6 -1.5 -7.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CATCTATGAATAAAAGGTTA 8145 SEQ ID NO: 6814 -1.7 -15.4 50.4 -13.7 0 -2.5
AAACTTTTGGTTTGTGCAAA 8332 SEQ ID NO: 6815 -1.7 -18.9 57.7 -16.1 -1 -8.8
GAATTAACATTAAACTTTTG 8343 SEQ ID NO: 6816 -1.7 -13.7 46.9 -12 0 -3.5
GCCAACAGCAAAAAACAAAA 8515 SEQ ID NO: 6817 -1.7 -16.5 50.2 -14 -0.6 -4.1
AAGTTCACAAAGCTGCTTTT 8663 SEQ ID NO: 6818 -1.7 -20.9 62.8 -17.7 -0.3 -10.9
GGGAGTTAATTGAAATTGAA 8761 SEQ ID NO: 6819 -1.7 -16.6 52.7 -14.9 0 -3.9
AAGAATGTACCAAAATCTTG 837 SEQ ID NO: 6820 -1.6 -16.3 51.6 -14.7 0 -4.8
TTGCTCAAGGTCATAAATAC 898 SEQ ID NO: 6821 -1.6 -18.9 58.4 -17.3 0 -3.6
ACACGCTCAGACAGAACACA 1233 SEQ ID NO: 6822 -1.6 -22.9 65.3 -21.3 0 -3.4
GGGGTTTCGACCAGCCTTCA 1529 SEQ ID NO: 6823 -1.6 -29.6 81 -25.3 -2.7 -7.7
TGAGTCATGAGTCGAAATAG 1597 SEQ ID NO: 6824 -1.6 -18.8 58.1 -15.5 0 -11.5
CAGCTCTCCTAACCCACCTA 1895 SEQ ID NO: 6825 -1.6 -28.7 77.5 -27.1 0 -4.4
AGAGACTGATGAGGGGAGCA 2128 SEQ ID NO: 6826 -1.6 -24.2 70.8 -22.6 0 -4.1
GTGGTGGTGCCCTCTGGGGG 2482 SEQ ID NO: 6827 -1.6 -32.8 90.6 -29 -2.2 -8.2
CATCTCCATTGAAATCTGGT 2537 SEQ ID NO: 6828 -1.6 -22.1 65 -20.5 0.3 -3.1
GGCGGACATTTCTGTCTAGA 2635 SEQ ID NO: 6829 -1.6 -24.8 72.3 -20.5 -2.7 -8.6
CAATTAAATTCACAAGATGT 2721 SEQ ID NO:6830 -1.6 -15.6 50.6 -14 0 -3.1
CTACAGTCAACACACTACTG 2835 SEQ ID NO: 6831 -1.6 -20.8 62.6 -17.8 -1.3 -5.1
GGCAATGATCTTGAGAACCA 2891 SEQ ID NO: 6832 -1.6 -22.4 64.6 -20.1 -0.4 -6.2
TTTTGCCAACTTGAAAACTC 3041 SEQ ID NO:6833 -1.6 -19.3 57.8 -17.7 0 -3.1
TGGTCTCTATCCACTCTCCA 3294 SEQ ID NO: 6834 -1.6 -27.3 79.4 -25.1 -0.3 -3.7
ACCAACATGAAAACAATAAG 3352 SEQ ID NO:6835 -1.6 -14.8 47.9 -13.2 0 -4.3
TAGCAGGTTTTTCGAAGATT 4051 SEQ ID NO:6836 -1.6 -20.8 62.9 -18.5 -0.4 -6.8
AGTTGTGCTCAACAATACTG 4071 SEQ ID NO:6837 -1.6 -20.6 62.4 -15.7 -3.3 -6.6
GGATCATGAACACAATGAAA 4101 SEQ ID NO:6838 -1.6 -17.1 52.9 -14.6 -0.8 -7.4
CCATAAGCAACCCATTTGAG 4240 SEQ ID NO: 6839 -1.6 -23.2 64.7 -20.9 -0.4 -4.1
GCCTTCAAACCGGGATAAGG 4412 SEQ ID NO: 6840 -1.6 -24.7 67.1 -22.2 -0.8 -8.6
ATAGAGGGAATTGCTCCAAC 4456 SEQ ID NO: 6841 -1.6 -22 64.4 -18.6 -1.8 -6.1
AAATTGTTAACATCACTAAT 4594 SEQ ID NO: 6842 -1.6 -15.1 49.7 -13 0 -8.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GAATCAACAGCTGCATACAT
4738 SEQ ID NO: 6843 -1.6 -21 62 -18.7 0 -8.9 TGAATCAACAGCTGCATACA
4739 SEQ ID NO:6844 -1.6 -21 61.9 -18.7 0 -8.9 AAAGTCAAAGATGTTCCAGC
5234 SEQ ID NO: 6845 -1.6 -20.3 61 -18.7 0 -2.9
CTTTGCTCCTTTGATCAGAC 5369 SEQ ID NO: 6846 -1.6 -23.8 70.5 -22.2 0 -6.5
TGAACATGTCATCAATTCCA 5523 SEQ ID NO:6847 -1.6 -20.7 61.6 -18.4 -0.5 -7.2
CTTTGTTGGGTTTTGCTATG 5946 SEQ ID NO: 6848 -1.6 -22.7 68.6 -21.1 0 -3.6
TACGCTGAATGATAGCGGCA 6180 SEQ ID NO: 6849 -1.6 -23.9 66.3 -18.7 -3.6 -10.6
TTTAAAAGATAACATCTGAA 6202 SEQ ID NO:6850 -1.6 -13.5 46.4 -11 -0.8 -6.5
AGCAGTGTCAGCTGGTAATA 6686 SEQ ID NO: 6851 -1.6 -23.8 71.7 -20.6 -1.6 -8.6
AGATGGCAAAGCAATACTGC 7317 SEQ ID NO: 6852 -1.6 -21.3 62.3 -18.2 -1.4 -6
TTAATTGACATAGACTATCA 7354 SEQ ID NO: 6853 -1.6 -16.9 54.3 -15.3 0 -3.3
TATATTTGCCCAAACATGCA 7412 SEQ ID NO: 6854 -1.6 -22.1 62.9 -19.8 -0.5 -5.4
TCTATCACCAATATGTGACA 7625 SEQ ID NO: 6855 -1.6 -20.7 62 -17.6 -1.4 -6.5
TGTAAATAGCTTCAAATTAT 7682 SEQ ID NO: 6856 -1.6 -15.5 50.8 -13.9 0 -4.6
TTTTTACATTATTTATATTT 7841 SEQ ID NO:6857 -1.6 -14.6 50 -13 0 -2.2
ATTGTGATTAAAAATCAAAA 7951 SEQ ID NO: 6858 -1.6 -11.9 43.1 -8.3 -2 -7
ATGGTAGAAAATATATTATA 8055 SEQ ID NO: 6859 -1.6 -13.5 46.8 -11.9 0 -6.2
TACAAAAGTTGAATAAAAAA 8168 SEQ ID NO:6860 -1.6 -9.9 39.4 -7.6 -0.4 -3.4
CAGGTTTTATTAATTATATA 8546 SEQ ID NO:6861 -1.6 -15.4 51.4 -13.8 0 -4.2
TTGTTGTAAAATTCATGTAA 8597 SEQ ID NO: 6862 -1.6 -15.6 51.3 -13.3 -0.4 -6.6
GGGTTCTTGAAAAAAAAGTT 8943 SEQ ID NO:6863 -1.6 -16.1 51.4 -14.5 0 -3.5
TTTTTCGATAGCAGCAAGAG 533 SEQ ID NO: 6864 -1.5 -20.8 62.5 -19.3 0 -5.4
CAGAGGTGGCACTGAATCGG 771 SEQ ID NO: 6865 -1.5 -24.8 70 -23.3 0 -4
GGTTTAGTGGAGTTAAAATA 798 SEQ ID NO: 6866 -1.5 -17.9 56.8 -16.4 0 -2.8
TCTGAATGTTCTCAACGCTG 1109 SEQ ID NO:6867 -1.5 -21.9 64.4 -19.5 -0.8 -5.3
GAAATCTCTTGAAGCAGCTG 1868 SEQ ID NO: 6868 -1.5 -21 62.8 -19 0 -8.2
GTTCTTCCATTGTGTTGGTC 2607 SEQ ID NO: 6869 -1.5 -25.2 76.9 -23 -0.4 -3.7
ATCCATAACAATTAAATTCA 2729 SEQ ID NO:6870 -1.5 -15.9 50.9 -14.4 0 -3.1
CATGGCAATGATCTTGAGAA 2894 SEQ ID NO: 6871 -1.5 -20.2 60.3 -18.7 0 -5.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
GCGTACAGTCATCATTGATC 3213 SEQ ID NO: 6872 -1.5 -22.9 68.5 -20.7 -0.5 -5.7
CTCTATCCACTCTCCACACA 3290 SEQ ID NO: 6873 -1.5 -26.3 75 -24.8 0 -0.9
GCTTCCTTCAGATGAGCTGG 3878 SEQ ID NO: 6874 -1.5 -26.4 76.6 -23.7 -1.1 -5.2
GAATATATAGGTAAAGACTT 4205 SEQ ID NO:6875 -1.5 -15.5 51 -13.5 -0.1 -4.3
AGATGAGACAGACCAACAGC 4485 SEQ ID NO: 6876 -1.5 -22.2 64.8 -20.7 0 -2.8
CTAAAGATCAACCAGAAGAT 4501 SEQ ID NO: 6877 -1.5 -17.6 54.2 -16.1 0 -4.6
CGTGAATCAACAGCTGCATA 4741 SEQ ID NO: 6878 -1.5 -22.1 63.6 -19.9 0 -9
GAACAATGAACACTAGGTTG 5154 SEQ ID NO: 6879 -1.5 -18.2 56 -15.9 -0.6 -6
TTGTTACACTATCATAGGAA 6375 SEQ ID NO:6880 -1.5 -18.7 58.6 -17.2 0 -3.4
ATTCTTTGTTTCTTTTTACT 6470 SEQ ID NO: 6881 -1.5 -19.5 62.5 -18 0 -2.2
TAAACAATTGATCACAAAGA 6492 SEQ ID NO:6882 -1.5 -14.4 47.8 -12 -0.8 -7.2
CTGGTAATAAAAACAGCAAC 6675 SEQ ID NO:6883 -1.5 -16.1 50.9 -14.6 0 -4.1
CAAGGACTGTACTAAAGGTG 6776 SEQ ID NO: 6884 -1.5 -19.6 59.5 -18.1 0 -4.8
TGCAGCAGAAAGTGGAACAA 7300 SEQ ID NO: 6885 -1.5 -20.7 60.7 -18.2 -0.9 -7.5
CTATCACCAATATGTGACAT 7624 SEQ ID NO: 6886 -1.5 -20.3 60.7 -17.3 -1.4 -6.5
ATGTACAAAATGCTGACAAA 7875 SEQ ID NO:6887 -1.5 -16.5 51.8 -15 0 -6.8
AAGCATAAAGTAAAATAAAT 7927 SEQ ID NO:6888 -1.5 -11.2 41.7 -9.7 0 -4.1
ACAAAAACAAAAAACCCCAG 8501 SEQ ID NO: 6889 -1.5 -16.4 49.6 -14.9 0 0
AGATAGCATCAATTATATTG 8812 SEQ ID NO:6890 -1.5 -16.8 54.2 -14.4 -0.7 -5.7
GTAACATTTATTAGCCACCA 8842 SEQ ID NO: 6891 -1.5 -22.2 64.7 -20.7 0 -3.2
TTCCACTGAGAATAAGAGTT 8988 SEQ ID NO: 6892 -1.5 -19.7 60.2 -18.2 0 -2.8
TATGCATTACAACTGGAGTT 9008 SEQ ID NO: 6893 -1.5 -20.4 61.8 -18.9 0 -6.8
TTAGATCCAAATTGTCTTTA 9032 SEQ ID NO:6894 -1.5 -18.6 58.1 -17.1 0 -4.6
AAAACAGAGCCTTATGAATT 200 SEQ ID NO: 6895 -1.4 -17.9 54.8 -16.5 0 -3.2
CTAGAAGAGATTCTTTGCTC 323 SEQ ID NO: 6896 -1.4 -20.4 63.5 -16.7 -2.3 -8.3
CATACGAATTACCTTAGATA 414 SEQ ID NO: 6897 -1.4 -18.3 55.8 -16.9 0 -3.5
GGTCCTGGGGGTACCAACAG 484 SEQ ID NO: 6898 -1.4 -28.5 78.7 -24.6 -2.5 -10.2
CGATAGCAGCAAGAGATTCT 528 SEQ ID NO: 6899 -1.4 -22 64.7 -20.6 0 -4.6
GATTCCAGTGAATGTGTACT 944 SEQ ID NO: 6900 -1.4 -22.1 66.3 -19.3 -1.3 -7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TGCTCGGAGAACTCTGAATG 1121 SEQ ID NO:6901 -1.4 -21.9 63.7 -19.8 -0.4 -8.2
CAGTGCTCGGAGAACTCTGA 1124 SEQ ID NO:6902 -1.4 -24.5 70.6 -22.2 -0.7 -7.9
CACGCTCAGACAGAACACAG 1232 SEQ ID NO:6903 -1.4 -22.7 65 -21.3 0 -3.4
CTGTCATCTCCAATGTAATC 1420 SEQ ID NO: 6904 -1.4 -21.5 64.8 -19.5 -0.3 -3
GAGTAAAGGGTCTTTTTGCC 1460 SEQ ID NO: 6905 -1.4 -23.2 68.9 -21.1 -0.4 -4.1
CAAAGCTTGTGTAGCCATAG 1551 SEQ ID NO:6906 -1.4 -22.4 65.8 -19.4 -1.5 -7.9
CCCAAGAAAATGACCAGGAC 1684 SEQ ID NO:6907 -1.4 -22 61.3 -20.6 0 -4
AGCCCAAGAAAATGACCAGG 1686 SEQ ID NO:6908 -1.4 -23 63.4 -21.6 0 -3.6
TCTCTTGAAGCAGCTGATGC 1864 SEQ ID NO:6909 -1.4 -24.2 71.5 -21.2 -1.6 -8.7 ATTCTTTAGCACCTTTGGAA
1947 SEQ ID NO:6910 -1.4 -22.2 65.8 -20.8 0 -4.1 CATTCTTTAGCACCTTTGGA
1948 SEQ ID NO: 6911 -1.4 -23.6 69.2 -22.2 0 -4.1 AGGTCCACCCACCAAGGAAA
2432 SEQ ID NO:6912 -1.4 -27 71.7 -24.4 -1.1 -5.8
TCTTCCATTGTGTTGGTCAG 2605 SEQ ID NO: 6913 -1.4 -24.6 74.2 -22.5 -0.4 -3.7
CTTCAAGTTCTTCCATTGTG 2613 SEQ ID NO:6914 -1.4 -22.5 67.9 -21.1 0 -3.1
CAGCATGGCGGACATTTCTG 2641 SEQ ID NO:6915 -1.4 -25.2 70.9 -22.9 -0.7 -5.4
GATTTTGCCAACTTGAAAAC 3043 SEQ ID NO:6916 -1.4 -18.6 56 -17.2 0 -4
CATGTGCCACCGTGGGAGCG 3230 SEQ ID NO:6917 -1.4 -30.2 78.7 -27.7 -1 -9.1
CAGAAAGAGGTTCAGAACCA 3392 SEQ ID NO:6918 -1.4 -20.9 61.7 -16.8 -2.7 -12
TTGCATTCTTCCTACTGCAA 3488 SEQ ID NO:6919 -1.4 -24 69.7 -20.5 -2.1 -6.8
TACTGAGAAGGATCATGAAC 4110 SEQ ID NO:6920 -1.4 -18.3 56.9 -16 -0.8 -8.2
CCTTCAAACCGGGATAAGGC 4411 SEQ ID NO: 6921 -1.4 -24.7 67.1 -22.7 -0.3 -7.6
ATCTCAGCCAGAAACATACC 5278 SEQ ID NO:6922 -1.4 -22.9 65.8 -21.5 0 -3.6
CAATCCATCCCAGCCAGCAG 5594 SEQ ID NO:6923 -1.4 -29.2 77.7 -27.8 0 -4.6
GTCACAGTCGGGTGGTGCAC 5633 SEQ ID NO:6924 -1.4 -28.3 81.6 -25.8 -0.6 -9.9
GCTGTAAACAATTGATCACA 6496 SEQ ID NO:6925 -1.4 -19.1 57.9 -17.7 0 -7.2
GTCTTGTATAGGCACTGACT 6595 SEQ ID NO: 6926 -1.4 -23.7 71.5 -21.3 -0.9 -4.3
TAGAAACAAACATAACAGAC 7084 SEQ ID NO:6927 -1.4 -14 47 -12.6 0 -1
ATACTGCAGCAGAAAGTGGA 7304 SEQ ID NO: 6928 -1.4 -22 64.9 -19.3 -0.7 -10.4
TGGCAAAGCAATACTGCAGC 7314 SEQ ID NO: 6929 -1.4 -23.2 66.2 -19.3 -2.5 -9.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AGATACCATATGATACTCAT 7733 SEQ ID NO:6930 -1.4 -19.4 59.4 -17.2 -0.6 -6
CAAAAGTTGAATAAAAAAAA 8166 SEQ ID NO: 6931 -1.4 -8.6 37.2 -7.2 0 -2.6
TAGTCTGCATACGTAAATAC 8188 SEQ ID NO:6932 -1.4 -18.8 57.9 -17.4 0 -6.6
AAAAAAATAAGACTAGTCTG 8201 SEQ ID NO:6933 -1.4 -12.7 44.8 -9.6 0 -11.5
CAAAAAACAAAAATTTATAT 8316 SEQ ID NO:6934 -1.4 -8.9 37.6 -7.5 0 -5.2
ATGTGAACTTGATCCTTTGC 8691 SEQ ID NO: 6935 -1.4 -22.2 65.8 -20.8 0 -4.3
TAACATTTATTAGCCACCAA 8841 SEQ ID NO:6936 -1.4 -20.3 59.7 -18.9 0 -3.2
ACAAATTAGTTACAATTTTT 76 SEQ ID NO: 6937 -1.3 -14.9 49.7 -12.9 -0.5 -4
AGAGCCTTATGAATTACAGC 195 SEQ ID NO: 6938 -1.3 -21.5 64.1 -20.2 0 -3.2
CTCCATAATCTCTGATAAAA 216 SEQ ID NO:6939 -1.3 -17.8 55.1 -16.5 0 -3.3
TCCCAGTAAGCCACTCTACT 300 SEQ ID NO:6940 -1.3 -27 75.8 -25.7 0 -4.5
TGGCTTTCTCTTCTGCAGCA 555 SEQ ID NO: 6941 -1.3 -27.1 79.8 -24.5 -1.2 -8.3
GAGACAGGAAAGCCCAGCTA 1578 SEQ ID NO: 6942 -1.3 -25.4 70.8 -23.1 -0.9 -6
AAAATGAGCCCAAGAAAATG 1692 SEQ ID NO: 6943 -1.3 -16.8 51.2 -15.5 0 -3.2
AAATCTCTTGAAGCAGCTGA 1867 SEQ ID NO:6944 -1.3 -21 62.8 -19 0 -8.7
CAACAGCTCTCCTAACCCAC 1898 SEQ ID NO: 6945 -1.3 -26.3 72.1 -25 0 -4.4
GTTGTTTCCTTCAAGGTGCT 2000 SEQ ID NO: 6946 -1.3 -25.6 75.9 -23.5 -0.6 -5.3
ATTTTCAGATCCAACATCCT 2225 SEQ ID NO: 6947 -1.3 -22.6 66.1 -20.8 -0.1 -4.5
CACACCATTGCAATCCACAG 2411 SEQ ID NO: 6948 -1.3 -24.4 67.8 -22.5 0 -8.6
GGTTTCCTACAGTCAACACA 2841 SEQ ID NO:6949 -1.3 -23.9 70.1 -22.1 -0.2 -3.6
AGATATTCCAGCCTTCTTGG 2931 SEQ ID NO:6950 -1.3 -24.9 72.4 -23.1 -0.2 -6.7
GCCGACCACAGCAAAAATGA 3152 SEQ ID NO: 6951 -1.3 -23.3 63 -22 0 -4.1
AGTCATCATTGATCTTGCAG 3207 SEQ ID NO: 6952 -1.3 -22 67.5 -20 -0.5 -6.4
TTCTTCCTACTGCAATCTGC 3483 SEQ ID NO: 6953 -1.3 -24.5 71.7 -22.1 -1 -4.9
CACCACTGGTGGTTCCATTC 3672 SEQ ID NO:6954 -1.3 -27.2 77.1 -23.8 -1.7 -12
TCAAAGTCAGACTCTCCAAC 3790 SEQ ID NO:6955 -1.3 -21.6 64.5 -20.3 0 -7.3
GTTGTGCTCAACAATACTGT 4070 SEQ ID NO:6956 -1.3 -21.8 65.4 -18 -2.5 -8.8
CATCACTAATGTCAAACATG 4584 SEQ ID NO: 6957 -1.3 -17.7 55 -15.2 -1.1 -5
CCTGACAGTCACTCAAATTG 4608 SEQ ID NO:6958 -1.3 -21.6 63.6 -20.3 0 -7.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ATCTCGTGAATCAACAGCTG 4745 SEQ ID NO: 6959 -1.3 -21.6 63.7 -19.7 0 -8.6
CCGGGACAAAACTAGGGTCA 5132 SEQ ID NO:6960 -1.3 -24.1 66.5 -21.5 -1.2 -7.1
AAGACGGATCACTCGGAACA 5327 SEQ ID NO: 6961 -1.3 -22.1 62.6 -20.1 -0.4 -5.3
AATCCATCCCAGCCAGCAGA 5593 SEQ ID NO: 6962 -1.3 -29.1 78 -27.8 0 -4.6
AAAGAAAATCCCAACAGATG 5702 SEQ ID NO:6963 -1.3 -17 52 -15.7 0 -3
CGCGATGTACATGTTCACCA 5756 SEQ ID NO: 6964 -1.3 -25.1 69.3 -23.2 0 -8.4
ATCCATGGCAATAAGCTGGA 5966 SEQ ID NO:6965 -1.3 -23.6 67 -19.8 -2.5 -8
ATAAAATATCAAGACAGTGG 6012 SEQ ID NO:6966 -1.3 -15.6 50.7 -14.3 0 -4.6
ATCACAAAGATAATTCTTTG 6482 SEQ ID NO: 6967 -1.3 -15.8 51.6 -10.5 -4 -9.6
ACAAATTTTGTAAAAATATG 6827 SEQ ID NO:6968 -1.3 -11.6 42.6 -7.7 -2.6 -7.8
GGACCATGGAAATGCACTAG 6848 SEQ ID NO:6969 -1.3 -22.4 64 -19.7 -1.3 -8.8
AAACAAACATAACAGACTAA 7081 SEQ ID NO:6970 -1.3 -13.6 46.1 -12.3 0 -2
AGAAACAAACATAACAGACT 7083 SEQ ID NO:6971 -1.3 -15.2 49.3 -13.9 0 -1.8
GATAGAAACAAACATAACAG 7086 SEQ ID NO: 6972 -1.3 -13.8 46.6 -12.5 0 -1.2
AAATATTAGAGGAGACTTTA 7124 SEQ ID NO: 6973 -1.3 -16.1 52.6 -13.9 -0.7 -7.1
AGCTCTGAAACTTAGAATAA 7191 SEQ ID NO:6974 -1.3 -17 53.9 -15.7 0 -4.3
GATGGCAAAGCAATACTGCA 7316 SEQ ID NO: 6975 -1.3 -22 63.2 -18.2 -2.5 -8.1
CTATGTTTAATGAATGATAC
7519 SEQ ID NO:6976 -1.3 -15.4 50.8 -14.1 0 -2.5 ACTATGTTTAATGAATGATA
7520 SEQ ID NO: 6977 -1.3 -15.4 50.8 -14.1 0 -2.5 GTGTGTTTCCTTGAAATCCA
7756 SEQ ID NO: 6978 -1.3 -23.5 68.5 -21.7 -0.1 -3.8
CAGTGTGTTTCCTTGAAATC 7758 SEQ ID NO:6979 -1.3 -21.5 65 -19.4 -0.6 -5.1
ACCAATGTATCTCCTATTGG 8076 SEQ ID NO:6980 -1.3 -22.7 66.3 -19.1 -2.3 -7.1
TAAACTTTTGGTTTGTGCAA 8333 SEQ ID NO:6981 -1.3 -19.3 59 -16.1 -1.3 -11.8
TCTGTGGATAAGAAAACAAA 44 SEQ ID NO: 6982 -1.2 -15.3 49.6 -14.1 0 -2.9
TGCTGAATAAAGAATGTACC 846 SEQ ID NO:6983 -1.2 -17.9 54.9 -16.7 0 -4.2
ATCATCACATCAGAAAGCTT 1207 SEQ ID NO: 6984 -1.2 -20.2 61.4 -19 0 -6.8
GTCAGGATCATCACATCAGA 1213 SEQ ID NO: 6985 -1.2 -22.9 69.3 -21.7 0.7 -4.5
ACGCTCAGACAGAACACAGT 1231 SEQ ID NO: 6986 -1.2 -23.2 67 -22 0 -3.4
GCCCATCCAAAACATAAAAG 1443 SEQ ID NO:6987 -1.2 -20 57 -18.8 0 -2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
GAGTCGAAATAGAGACAGGA
1589 SEQ ID NO: 6988 -1.2 -19.8 59.8 -17.1 -1.4 -5 AGAAAATGACCAGGACAAAA
1680 SEQ ID NO: 6989 -1.2 -16.6 51.3 -15.4 0 -4 TCTGAAGAACTTTCCAACAG
1912 SEQ ID NO: 6990 -1.2 -19.7 59.3 -17.8 -0.4 -4.1 TGGTGGTGCCCTCTGGGGGA
2481 SEQ ID NO: 6991 -1.2 -32.2 88.1 -28.8 -2.2 -8.7 AGTCAACACACTACTGAATT
2831 SEQ ID NO: 6992 -1.2 -19.3 59.1 -17.6 -0.1 -3.2 CTGTGAAAATCCCAGTAAAG
2865 SEQ ID NO: 6993 -1.2 -19.2 57.1 -18 0 -2.9 ATAGTAATAAGGATCCATGG
2909 SEQ ID NO: 6994 -1.2 -19 58.2 -16.9 0 -9.5 GTGCCACCGTGGGAGCGTAC
3227 SEQ ID NO: 6995 -1.2 -30.6 81.3 -28.2 -1.1 -9.1 TTCAAAGTCAGACTCTCCAA
3791 SEQ ID NO: 6996 -1.2 -21.5 64.2 -20.3 0 -6.8 GTATTTAAGTTTTCAAAGTC
3802 SEQ ID NO: 6997 -1.2 -16.9 55.5 -15.7 0 -2.7 CTTCAGTATTTAAGTTTTCA
3807 SEQ ID NO: 6998 -1.2 -18.8 60.3 -17.6 0 -2.6 CTGCTGAACTCTTCAGTATT
3817 SEQ ID NO: 6999 -1.2 -22.1 66.9 -18.2 -2.7 -10.1 ACTGCTGAACTCTTCAGTAT
3818 SEQ ID NO: 7000 -1.2 -22.2 67.2 -18.3 -2.7 -10.1 AATGGAAACTTTTTAATACA
3988 SEQ ID NO: 7001 -1.2 -14.8 49 -13.6 0 -2.5 GCTCAACAATACTGTAGCAG
4065 SEQ ID NO: 7002 -1.2 -21.5 64.2 -18.2 -2.1 -6.6 CTACCAGGCTAACCAAAGAA
4317 SEQ ID NO: 7003 -1.2 -21.8 61.7 -19.2 -1.3 -5 GTAATGATTTGATGGCACCG
4362 SEQ ID NO: 7004 -1.2 -22.3 63.8 -21.1 0 -4 CACCCATGATGCTAAAGATC
4512 SEQ ID NO: 7005 -1.2 -22.2 63.6 -21 0 -4.5 GGTTACAAAATCAAAGACCA
5024 SEQ ID NO: 7006 -1.2 -18.2 55.1 -16.5 -0.2 -4.1 GCAATCCATCCCAGCCAGCA
5595 SEQ ID NO: 7007 -1.2 -31 81.5 -29.8 0 -4.6 GCGATGTACATGTTCACCAC
5755 SEQ ID NO: 7008 -1.2 -24.5 69.8 -22.7 0 -8.4 ACCTCATAGAACATCTCAAA
5839 SEQ ID NO: 7009 -1.2 -19.7 59.3 -18.5 0 -2.8 CCTTTGTCTGATCATTTGAG
6954 SEQ ID NO: 7010 -1.2 -22.1 66.7 -20.9 0 -6.2 ACAAATAAAGTTGATTATAT
7860 SEQ ID NO: 7011 -1.2 -13.2 45.9 -11.5 -0.1 -3.7 AGTAAATAGTTTTGTAAAAA
8363 SEQ ID NO: 7012 -1.2 -12.8 45.3 -10.4 -1.1 -4.3 AATAAAAAATGAAATTTATT
8462 SEQ ID NO: 7013 -1.2 -8.7 37.3 -6.2 -1.2 -5.5 ATATAATGCATTTAAGTAAC
8869 SEQ ID NO: 7014 -1.2 -14.8 49.5 -12.9 0 -8.8 TTAAAAATATGCATTACAAC
9015 SEQ ID NO: 7015 -1.2 -13.4 46 -12.2 0 -6.8 AAGCCCAGCATCCAAGATGG
169 SEQ ID NO: 7016 -1.1 -26.5 72 -23.9 -1.4 -6.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TCCCTAGAAGAGATTCTTTG 326 SEQ ID NO: 7017 -1.1 -21.7 64.9 -18.6 -2 -4.7
GTACCAACAGTGCCTGTGCC 474 SEQ ID NO: 7018 -1.1 -28.9 79.4 -26.2 -1.5 -8.7
AGATTCTCTAGTAAAAAGGC 515 SEQ ID NO:7019 -1.1 -18.1 57 -17 0 -4
AAGAGATTCTCTAGTAAAAA 518 SEQ ID NO: 7020 -1.1 -15 50 -12.6 -1.2 -9.3
GATAGCAGCAAGAGATTCTC 527 SEQ ID NO: 7021 -1.1 -21.6 65.9 -20.5 0 -7
CATTCTTTGTCCAGTCAGGA 921 SEQ ID NO: 7022 -1.1 -24.7 73.8 -22.4 -1.1 -4.5
ATGCCATCACAATGACACTG 1056 SEQ ID NO: 7023 -1.1 -22.4 64.3 -20.6 -0.4 -3.8
ATCCAAAACATAAAAGTGAC 1439 SEQ ID NO: 7024 -1.1 -15.5 49.7 -14.4 0 -2.9
GACGTTAGAGCTGAAGGTCC 2446 SEQ ID NO:7025 -1.1 -24.6 71.1 -22.6 -0.7 -8.8
AAGTTCTTCCATTGTGTTGG 2609 SEQ ID NO:7026 -1.1 -22.9 69 -21.3 -0.1 -4.3
CTAGATTCTTCAAGTTCTTC 2620 SEQ ID NO: 7027 -1.1 -20.2 64.2 -18.6 -0.2 -3.6
ACATTTCTGTCTAGATTCTT 2630 SEQ ID NO:7028 -1.1 -20.7 65.2 -19.6 0 -6
CCATAACAATTAAATTCACA 2727 SEQ ID NO: 7029 -1.1 -16.4 51.5 -15.3 0 -3.1
AACACACTACTGAATTGCTC 2827 SEQ ID NO:7030 -1.1 -20.1 60.5 -19 0 -3.6
CCAAAGAGCTGCATGCCGAC 3166 SEQ ID NO:7031 -1.1 -26.5 70.8 -24.4 -0.8 -9.1
GTCATCATTGATCTTGCAGA 3206 SEQ ID NO: 7032 -1.1 -22.6 68.6 -20.8 -0.5 -6.4
CAATTCCCTTTTGCATTCTT 3498 SEQ ID NO:7033 -1.1 -23.7 68.4 -22.6 0 -5.1
TGGACATGCAGCTGTCTATC 3603 SEQ ID NO: 7034 -1.1 -24.5 72.8 -21.5 -1.9 -10.5
GTTCTGACTCACTGCTGAAC 3828 SEQ ID NO:7035 -1.1 -23.3 69.4 -22.2 0 -4.2
ACAACATCAACTGTGCTTCC 3892 SEQ ID NO: 7036 -1.1 -23 66.7 -21.2 -0.4 -4.1
GAATGGAAACTTTTTAATAC 3989 SEQ ID NO:7037 -1.1 -14.7 48.9 -13.6 0 -2.5
CCTTCTTCTGTACTTACTTG 4012 SEQ ID NO: 7038 -1.1 -22.7 68.7 -21.6 0 -4.8
AACACAATGAAAGTCTCAAA 4093 SEQ ID NO:7039 -1.1 -15.8 50.6 -14.1 -0.3 -3.1
TCAGAGTGAAGAATGACCCA 4833 SEQ ID NO:7040 -1.1 -22.2 64.3 -21.1 0 -2.7
AGCTTCCTTTTTAACATAGG 5504 SEQ ID NO: 7041 -1.1 -21.3 64.2 -20.2 0 -4.3
TATTAAGAATAGGTGCTAGC 5613 SEQ ID NO: 7042 -1.1 -19 59.3 -17.4 0 -8
GGTTTTGCTATGAGAAGAGG 5938 SEQ ID NO:7043 -1.1 -21.4 64.9 -20.3 0 -3.6
AACGTAAACCTCATTTACAA 6906 SEQ ID NO: 7044 -1.1 -18.1 54.7 -14.3 -2.7 -6.1
ATGTTTAATGAATGATACAG 7517 SEQ ID NO: 7045 -1.1 -15.5 50.9 -14.4 0 -3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TATGTTTAATGAATGATACA 7518 SEQ ID NO: 7046 1.1 -15.2 50.2 -14.1 0 -2.9
TACAAAATGCTGACAAATAA 7872 SEQ ID NO: 7047 1.1 -14.3 47.3 -13.2 0 -3.6
CATGTGAACTTGATCCTTTG 8692 SEQ ID NO: 7048 1.1 -21.1 62.9 -20 0 -4.3
AAGGGAGTTAATTGAAATTG 8763 SEQ ID NO: 7049 1.1 -16 51.6 -14.9 0 -3.9
TCTTGAAAAAAAAGTTAATA 8939 SEQ ID NO:7050 1.1 -11.1 41.7 -10 0 -2.9
TAAAACAGAGCCTTATGAAT
201 SEQ ID NO: 7051 -1 -17.5 54 -16.5 0 -3.2 ATAAAACAGAGCCTTATGAA
202 SEQ ID NO:7052 -1 -17.5 54 -16.5 0 -3.2 TTTTCTTGCTCCATAATCTC
224 SEQ ID NO: 7053 -1 -22.2 67.2 -21.2 0 -3.6
TACGAATTACCTTAGATAGT 412 SEQ ID NO: 7054 -1 -18.8 57.6 -17.8 0 -3.5
GGTACCAACAGTGCCTGTGC 475 SEQ ID NO:7055 -1 -28.1 78.5 -25.2 -1.5 -11.6
ATAGCAGCAAGAGATTCTCT 526 SEQ ID NO: 7056 -1 -21.9 66.6 -19.8 -1 -9
TGGAGGAATGTCTCCATAAA 662 SEQ ID NO: 7057 -1 -20.8 61.6 -16.6 -3.2 -8.3
GGGTTTAGTGGAGTTAAAAT 799 SEQ ID NO: 7058 -1 -19.4 60 -18.4 0 -2.8
TATAGATTCCAGTGAATGTG 948 SEQ ID NO:7059 -1 -19.5 60.2 -17.6 -0.7 -5.3
GAAACGTAAAATCTTCTAAG 1008 SEQ ID NO:7060 -1 -14.7 48.5 -13.7 0 -5.3
ACTGAAATCCAGCCAGTTCC 1040 SEQ ID NO: 7061 -1 -25.6 71.6 -23.4 -1.1 -6.2
CCCAGGTCCACAAACTCTGT 1081 SEQ ID NO:7062 -1 -27.3 74.8 -25.8 -0.2 -3.7
GTCTTTAAACCTGGAATGAC 1156 SEQ ID NO:7063 -1 -20 60 -19 0 -5.1
GGATCATCACATCAGAAAGC 1209 SEQ ID NO: 7064 -1 -21 63 -19.5 -0.1 -5.3
GACTGTCATCTCCAATGTAA 1422 SEQ ID NO: 7065 -1 -21.9 65.3 -20.3 -0.3 -6.8
TGCCCATCCAAAACATAAAA 1444 SEQ ID NO:7066 -1 -20 56.8 -19 0 -3
TTTAGCACCTTTGGAACTCA 1943 SEQ ID NO: 7067 -1 -23 67.2 -22 0 -4.1
CCAGCATGGCGGACATTTCT 2642 SEQ ID NO:7068 -1 -27.2 74.6 -25 -1.1 -7.4
TGTGAAAATCCCAGTAAAGA 2864 SEQ ID NO:7069 -1 -18.9 56.6 -17.9 0 -2.1
GATCTTGAGAACCATTTCTG 2885 SEQ ID NO:7070 -1 -20.9 62.9 -18.5 -1.3 -6.3
GCCTTCTTGGAAATAGTAAT 2921 SEQ ID NO:7071 -1 -20.5 61.3 -18.9 -0.3 -3.2
CAGGATTTTGCCAACTTGAA 3046 SEQ ID NO:7072 -1 -21.7 62.9 -20.1 -0.3 -3.5
CCAACATGAAAACAATAAGG 3351 SEQ ID NO:7073 -1 -15.8 49.6 -14.8 0 -5.2
TGACCAACATGAAAACAATA 3354 SEQ ID NO:7074 -1 -16.1 50.4 -15.1 0 -5.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GATTACGTATTTTTCAACAC 3707 SEQ ID NO: 7075 -1 -18.2 56.7 -17.2 0 -6.1
CTCAACAATACTGTAGCAGG 4064 SEQ ID NO: 7076 -1 -20.9 62.6 -19 -0.7 -5.3
CTGAGAAGGATCATGAACAC 4108 SEQ ID NO:7077 -1 -19.3 58.6 -17.6 -0.5 -6.9
AATGAATATATAGGTAAAGA 4208 SEQ ID NO: 7078 -1 -13.6 46.8 -12.6 0 -3.9
ACACCCATGATGCTAAAGAT 4513 SEQ ID NO:7079 -1 -22 62.7 -21 0 -4.4
GCCTGACAGTCACTCAAATT 4609 SEQ ID NO:7080 -1 -23.4 67.8 -22.4 0 -7.1
ACAAAATCAAAGACCATTCC 5020 SEQ ID NO:7081 -1 -18.5 55.3 -17.5 0 -2.8
TAGTGAAGTAGTAGTGTCTG 5211 SEQ ID NO: 7082 -1 -20.3 65.1 -19.3 0 -2.3
TCACTCGGAACAAGGTAGGG 5319 SEQ ID NO:7083 -1 -23.2 66.7 -22.2 0 -2.9
TTTTAACATAGGCAAAGTTG 5496 SEQ ID NO: 7084 -1 -17.5 55.1 -16.5 0 -4
GGAACAAGCAGATCATGCTG 5562 SEQ ID NO:7085 -1 -22.2 64.7 -18.4 -2.8 -10.6
AGTTCTCCAGGATGACCGCG 5772 SEQ ID NO: 7086 -1 -27.7 75.3 -25.3 -1.3 -6.6
TTATAGTTACTTGATATATT 6235 SEQ ID NO:7087 -1 -15.8 52.8 -14.8 0 -4.3
AGACTAAAATACTTTCAAAA 7068 SEQ ID NO: 7088 -1 -13.3 45.9 -12.3 0 -2.5
AACAGACTAAAATACTTTCA 7071 SEQ ID NO:7089 -1 -15.6 50.7 -14.6 0 -2.5
TCTAAAGCAATACTTTAGAT 7276 SEQ ID NO:7090 -1 -16.7 53.6 -11.5 -4. '2 -9.9
TTACATAACATAGGGTATTT
7372 SEQ ID NO:7091 -1 -17.8 56.3 -16.8 0 -3.3 TTTACATAACATAGGGTATT
7373 SEQ ID NO: 7092 -1 -17.8 56.3 -16.8 0 -3.3 GACAAATAAAGTTGATTATA
7861 SEQ ID NO: 7093 -1 -13.8 47.1 -12.3 -0.1 -3.7
TAAAAAAAAACATCTATGAA 8155 SEQ ID NO: 7094 -1 -9.9 39.4 -8.9 0 -3.8
ATGGCTAAAAAGAACAAAGT 8260 SEQ ID NO:7095 -1 -15.4 49.5 -14.4 0 -3.7
TGTGAACTTGATCCTTTGCA 8690 SEQ ID NO: 7096 -1 -22.9 67 -21.9 0 -4.8
AGAATGTAACATTTATTAGC 8847 SEQ ID NO:7097 -1 -16.5 53.5 -14.6 -0.8 -6.5
TCCACTGAGAATAAGAGTTT 8987 SEQ ID NO: 7098 -1 -19.7 60.2 -18.7 0 -2.8
ATATCCCTAGAAGAGATTCT 329 SEQ ID NO:7099 -0.9 -21.2 63.7 -18.2 -2.1 -6
TCACAGCACCTTTTTCCGGA 393 SEQ ID NO: 7100 -0.9 -27 74.6 -25.6 0 -8
GCTCAAGGTCATAAATACAC 896 SEQ ID NO: 7101 -0.9 -19.7 59.9 -18.8 0 -2.8
AGTCGAAATAGAGACAGGAA 1588 SEQ ID NO: 7102 -0.9 -18.5 56.6 -16.1 -1.4 -5
CAAATTCACCAAATAAAATG 1706 SEQ ID NO: 7103 -0.9 -13.6 45.7 -12.7 0 -3.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AGTGAGTCTCTCCTGCTTTC 2284 SEQ ID NO: 7104 -0.9 -26.2 80.1 -24.7 -0.3 -4.6
CACAGTGCTGTGCATCTTCC 2396 SEQ ID NO:7105 -0.9 -27 78.3 -24.3 -1.2 -11.5
AGTTCTTCCATTGTGTTGGT 2608 SEQ ID NO: 7106 -0.9 -24.8 75.3 -23.2 -0.4 -3.7
TGGCAATGATCTTGAGAACC 2892 SEQ ID NO: 7107 -0.9 -21.7 63.3 -20.1 -0.4 -6.2
TTACCAAAGAGCTGCATGCC 3169 SEQ ID NO:7108 -0.9 -24.9 69.4 -23 -0.8 -9.1
ATGAAAACAATAAGGCACAT 3346 SEQ ID NO:7109 -0.9 -16.3 51.1 -15.4 0 -4
GACCATGACCAACATGAAAA 3359 SEQ ID NO:7110 -0.9 -19.7 56.9 -16.5 -2.3 -5.9
TTCATTGTCATCATCAGTAG 3452 SEQ ID NO: 7111 -0.9 -20.7 65.3 -19.8 0 -2.4
CTGCAATCTGCAGATTATTC 3474 SEQ ID NO: 7112 -0.9 -21.4 64.5 -17 -3.5 -14
CACTGCTGAACTCTTCAGTA 3819 SEQ ID NO: 7113 -0.9 -22.9 68.4 -19.4 -2.6 -7.7
ACATCAACTGTGCTTCCTTC 3889 SEQ ID NO: 7114 -0.9 -24.2 71.1 -23.3 0 -3.9
GCAACCCATTTGAGAAGCAT
4234 SEQ ID NO: 7115 -0.9 -23.9 66.9 -22.3 -0.4 -4.6 AGCAACCCATTTGAGAAGCA
4235 SEQ ID NO: 7116 -0.9 -23.9 67.1 -22.3 -0.4 -4.6 CCATGATGCTAAAGATCAAC
4509 SEQ ID NO:7117 -0.9 -19.5 58.1 -17.8 -0.6 -5.4
AACAATGAACACTAGGTTGA 5153 SEQ ID NO: 7118 -0.9 -18.2 56 -16.5 -0.6 -6
GGTAGGGGACACAGAATACT 5306 SEQ ID NO:7119 -0.9 -22.8 67 -21.3 -0.3 -3.2
ACAAGGTAGGGGACACAGAA 5310 SEQ ID NO:7120 -0.9 -22.2 64.9 -21.3 0.5 -2.1
ATTCGGCCAATCCTGGCAAG 5344 SEQ ID NO: 7121 -0.9 -26.6 71.8 -22.2 -3.5 -10.3
ATCCCCTTTGCTCCTTTGAT 5374 SEQ ID NO: 7122 -0.9 -28.3 78 -27.4 0 -3.6
AACTGACAAAAAAGAAAATC 5712 SEQ ID NO: 7123 -0.9 -11.3 41.8 -10.4 0 -2.2
AATTCTTTGTTTCTTTTTAC 6471 SEQ ID NO: 7124 -0.9 -17.9 58.2 -17 0 -2.3
ACAAAGATAATTCTTTGTTT 6479 SEQ ID NO: 7125 -0.9 -16.1 52.5 -10.5 -4.7 -11
AACATAACAGACTAAAATAC 7076 SEQ ID NO: 7126 -0.9 -13.3 45.8 -12.4 0 -2
GAGATACCATATGATACTCA 7734 SEQ ID NO: 7127 -0.9 -20 60.7 -19.1 0 -6.6
AATATATTATAACAAAGAAA 8046 SEQ ID NO:7128 -0.9 -10.2 40 -9.3 0 -5.3
GACTAGTCTGCATACGTAAA 8191 SEQ ID NO: 7129 -0.9 -20.6 61.7 -18.9 0 -9.4
ATAAGACTAGTCTGCATACG 8195 SEQ ID NO: 7130 -0.9 -20.1 60.9 -17.5 0 -11.5
AATAGTTTTGTAAAAAGAAT 8359 SEQ ID NO: 7131 -0.9 -12.5 44.6 -10.3 -1.2 -4.3
AATAGCAATTCCCTGCATGC 8401 SEQ ID NO: 7132 -0.9 -24.5 68.8 -21.9 -1.7 -8.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TTTTTGACCACAGAGGTTTA 95 SEQ ID NO: 7133 -0.8 -21.7 65.3 -19.3 -1.5 -7.1
TCTGGCAGCTGTTCAGCTTT 128 SEQ ID NO: 7134 -0.8 -27 80 -24.3 -1.8 -11
TATGAATTACAGCATAACAA 188 SEQ ID NO:7135 -0.8 -16 51.3 -15.2 0 -4.1
AAGAGATTCTTTGCTCCTTT 319 SEQ ID NO: 7136 -0.8 -22.3 67.1 -20.8 -0.4 -5.3
TGGGGGTACCAACAGTGCCT 479 SEQ ID NO: 7137 -0.8 -28.7 78.5 -25.6 -2.3 -8.8
TCAGGTCCTGGGGGTACCAA 487 SEQ ID NO: 7138 -0.8 -28.7 79.9 -24.6 -3.3 -12.6
AGCAGCAAGAGATTCTCTAG 524 SEQ ID NO: 7139 -0.8 -21.9 66.8 -19.8 -1.2 -9.3
AGAATGTACCAAAATCTTGA 836 SEQ ID NO: 7140 -0.8 -17.6 54.5 -16.2 -0.3 -4
GAATGTGTACTCTACATTCT 935 SEQ ID NO: 7141 -0.8 -20.4 63.2 -16.4 -3.2 -11.2
GAATGACTGAAATTGTTTTC 1143 SEQ ID NO: 7142 -0.8 -16.8 53.8 -14.9 -1 -3.6
CTGGATCAGGGCCCCCACAA 1178 SEQ ID NO: 7143 -0.8 -30.9 80.1 -28.9 -0.3 -10.4
AAACACGCTCAGACAGAACA 1235 SEQ ID NO: 7144 -0.8 -20.6 59.8 -19.8 0 -3.1
AGACAGGAAAGCCCAGCTAA 1577 SEQ ID NO: 7145 -0.8 -24.1 67.3 -22.4 -0.8 -5
GTCGAAATAGAGACAGGAAA 1587 SEQ ID NO: 7146 -0.8 -17.8 54.7 -16.2 -0.6 -5
GCCAGGATCAAATTCACCAA 1714 SEQ ID NO: 7147 -0.8 -23.4 65.6 -22 -0.3 -4.5
ACAGCTCTCCTAACCCACCT 1896 SEQ ID NO:7148 -0.8 -29.2 78.6 -28.4 0 -4.4
TTTCCAACAGCTCTCCTAAC 1902 SEQ ID NO: 7149 -0.8 -24 69.2 -23.2 0 -4.4
AAAGCTGTCTCTCTCTCCTT 2021 SEQ ID NO: 7150 -0.8 -25.1 74.8 -24.3 0 -5.1
AAAGTCATTTTCAGATCCAA 2231 SEQ ID NO: 7151 -0.8 -19.3 59.1 -18.5 0 -4.5
ATTCTTCAAGTTCTTCCATT 2616 SEQ ID NO: 7152 -0.8 -21.8 66.8 -21 0 -2.9
TCTTGGAAATAGTAATAAGG 2917 SEQ ID NO: 7153 -0.8 -15.9 51.7 -15.1 0 -2.8
CCAGCCTTCTTGGAAATAGT 2924 SEQ ID NO: 7154 -0.8 -24.2 69 -22.8 -0.3 -4.9
TACCAAAGAGCTGCATGCCG 3168 SEQ ID NO: 7155 -0.8 -25.6 69.1 -23.8 -0.8 -9.1
TCCACTCTCCACACAGCACG 3285 SEQ ID NO:7156 -0.8 -27.9 76.1 -27.1 0 -4.1
TTCTGACTCACTGCTGAACT 3827 SEQ ID NO: 7157 -0.8 -23 68 -22.2 0 -3.6
ATGAATATATAGGTAAAGAC 4207 SEQ ID NO: 7158 -0.8 -14.5 48.9 -13.7 0 -4.2
CATGATGCTAAAGATCAACC 4508 SEQ ID NO: 7159 -0.8 -19.5 58.1 -17.9 -0.6 -5.4
AATTGTTAACATCACTAATG 4593 SEQ ID NO: 7160 -0.8 -15.8 51.4 -14.3 -0.3 -8.3
TTGCCAAGAGCCTGACAGTC 4618 SEQ ID NO: 7161 -0.8 -26.3 74.5 -24.7 -0.6 -5.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
AGCTTGCTTGCCAAGAGCCT 4625 SEQ ID NO: 7162 -0.8 -28.7 79.3 -25.9 -2 -7.4
AAGATGATAAAGATGACAAA 4813 SEQ ID NO: 7163 -0.8 -13.5 46.1 -12.7 0 -2.5
GAATGACCCAAAGATGATAA 4823 SEQ ID NO: 7164 -0.8 -18.2 54.5 -17.4 0 -2.1
TGATATCAAAGACTTGTCTG 5043 SEQ ID NO: 7165 -0.8 -18.3 57.5 -15.7 -1.4 -11.5
GAACACTAGGTTGATCCGGG 5147 SEQ ID NO: 7166 -0.8 -24.3 68.6 -22.3 -1.1 -7.4
TATCATCTCAGCCAGAAACA 5282 SEQ ID NO: 7167 -0.8 -21.8 64.2 -21 0 -3.1
CAGGAAGGGACATCATCAAA 5412 SEQ ID NO: 7168 -0.8 -20.5 60.6 -19.1 -0.3 -2.9
AGGTGCTAGCAATCCATCCC 5603 SEQ ID NO: 7169 -0.8 -28.1 77.9 -25.6 -0.2 -11.5
GTGTCAGGGTCACAGTCGGG 5641 SEQ ID NO: 7170 -0.8 -27.9 81.5 -26.2 -0.7 -4.4
TGCCAGGGTGAATTGTGTCA 5655 SEQ ID NO: 7171 -0.8 -25.6 73.7 -24.8 0 -3.8
AAGTTCTCCAGGATGACCGC 5773 SEQ ID NO: 7172 -0.8 -26.2 73.1 -24 -1.3 -5.6
AGACAGTGGATCCGGTCACC 6001 SEQ ID NO: 7173 -0.8 -27.4 76.5 -25 -1.1 -10.8
GTTATAGTTACTTGATATAT 6236 SEQ ID NO: 7174 -0.8 -16.9 55.6 -16.1 0 -4.1
ACAGTCAGTTTGGCATGGAC 6559 SEQ ID NO: 7175 -0.8 -24.3 72.4 -22.8 -0.5 -5.4
TTACAAAAATAGTGACATAG 6892 SEQ ID NO: 7176 -0.8 -14 47.5 -13.2 0 -3.5
GAAACTGTAGCCATTACAAT 7019 SEQ ID NO: 7177 -0.8 -19.7 58.8 -18 -0.7 -3.7
TAATTGACATAGACTATCAG 7353 SEQ ID NO: 7178 -0.8 -16.8 54.1 -16 0 -3.3
ATAACTATTTACATAACATA 7380 SEQ ID NO: 7179 -0.8 -14.2 48.2 -13.4 0 -1.7
AATGAATGATACAGGATACA 7511 SEQ ID NO: 7180 -0.8 -16.8 53.1 -16 0 -2.4
ATACTACAAAAGTTGAATAA 8172 SEQ ID NO: 7181 -0.8 -13.5 46.4 -12 -0.4 -4.2
CATACGTAAATACTACAAAA 8181 SEQ ID NO: 7182 -0.8 -14.2 47.1 -13.4 0.1 -6.6
TTGTGCAAAAAACAAAAATT 8321 SEQ ID NO: 7183 -0.8 -12.5 43.8 -11 -0.5 -5.4
AACAAAAACAAAAAACCCCA 8502 SEQ ID NO: 7184 -0.8 -15.7 48.3 -14.9 0 0
TAACAAAGAATGTAACATTT 8853 SEQ ID NO: 7185 -0.8 -13.7 46.6 -12 -0.8 -7.2
CACTGAGAATAAGAGTTTGG 8985 SEQ ID NO: 7186 -0.8 -18.5 57.5 -17.7 0 -2.8
CTGGCAGCTGTTCAGCTTTT 127 SEQ ID NO: 7187 -0.7 -26.7 78.5 -24.3 -1.6 -10.8
CTAACAGGGTTTAGTGGAGT 805 SEQ ID NO:7188 -0.7 -22.5 68.2 -21.8 0 -3.6
TGCTCAAGGTCATAAATACA 897 SEQ ID NO: 7189 -0.7 -19.5 59.3 -18.8 0 -3.6
AATGACACTGAAATCCAGCC 1046 SEQ ID NO: 7190 -0.7 -22 62.7 -20.1 -1.1 -4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AAACTCTGTCACATATGCCA 1070 SEQ ID NO:7191 -0.7 -22.4 65.2 -21.7 0 -6.5
GACTGGATCAGGGCCCCCAC 1180 SEQ ID NO: 7192 -0.7 -31.7 83.5 -29.6 -0.7 -10.5
CATTTTCAGATCCAACATCC * 2226 SEQ ID NO: 7193 -0.7 -22.4 65.4 -21.2 -0.1 -4.5
GCCCTGGCACCATCCTGGAT 2364 SEQ ID NO: 7194 -0.7 -32.4 84.6 -29.9 -1.8 -10.4
AACCACACCATTGCAATCCA 2414 SEQ ID NO:7195 -0.7 -25 67.8 -23.7 0 -8.6
AATCTGGTAAGAGCTTAACC 2525 SEQ ID NO: 7196 -0.7 -20.6 61.8 -19.2 -0.5 -6.3
ATTTAAGACAATGCAAATAG 2771 SEQ ID NO:7197 -0.7 -14.8 48.9 -13.5 -0.3 -5.6
AGTGTGGGCCAGGATTTTGC 3055 SEQ ID NO:7198 -0.7 -27.2 78.3 -26 0 -7.6
CTAGAGCCCCCACAGAATTG 3099 SEQ ID NO: 7199 -0.7 -26.6 72 -25.9 0 -3.1
ATGACCATGACCAACATGAA 3361 SEQ ID NO:7200 -0.7 -21.1 60.3 -18.6 -1.8 -5.4
ATTCATTTCATTGTCATCAT 3458 SEQ ID NO:7201 -0.7 -20 62.7 -19.3 0 -2.4
CTTCCTACTGCAATCTGCAG 3481 SEQ ID NO:7202 -0.7 -24.7 71.2 -20 -4 -10.9
AAATCCATAAGCAACCCATT 4244 SEQ ID NO: 7203 -0.7 -21.5 60.7 -20.8 0 -4.1
CAACCAGAAGATGAGACAGA 4493 SEQ ID NO:7204 -0.7 -20.1 59.6 -19.4 0 -2.4
TTGTTAACATCACTAATGTC
4591 SEQ ID NO:7205 -0.7 -18.1 57.3 -15.8 -1.5 -9.5 ATTGTTAACATCACTAATGT
4592 SEQ ID NO: 7206 -0.7 -17.7 56 -15.6 -1.3 -9.5 GCATACATAATATCCATCCA
4726 SEQ ID NO:7207 -0.7 -22 63.8 -21.3 0 -3.4
AAATCAAAGACCATTCCTTG 5017 SEQ ID NO: 7208 -0.7 -19.3 57.3 -18.6 0 -2.8
TCAAAGACTTGTCTGGTTAC 5038 SEQ ID NO:7209 -0.7 -20.4 62.9 -18.2 -1.4 -7
AAGAATAGGTGCTAGCAATC 5609 SEQ ID NO:7210 -0.7 -19.9 60.7 -17.8 0 -10.8
CACTATTAAGAATAGGTGCT 5616 SEQ ID NO: 7211 -0.7 -19.3 59.3 -16.9 -1.7 -6.7
AGTCGGGTGGTGCACTATTA 5628 SEQ ID NO: 7212 -0.7 -25.5 74.3 -23.5 -1.1 -9.5
GATGTAACTGACAAAAAAGA 5717 SEQ ID NO: 7213 -0.7 -14.5 47.9 -13 -0.6 -3.4
TGCTATGAGAAGAGGAGGAT 5933 SEQ ID NO: 7214 -0.7 -21.1 63.5 -20.4 0 -3.6
AAGGCAAATAAAATATCAAG 6019 SEQ ID NO: 7215 -0.7 -13.3 45.6 -12.6 0 -4
ACACGCTTTGTAAAGGCAAA 6031 SEQ ID NO:7216 -0.7 -20.6 59.7 -17.9 -2 -6.4
TCTCCACTCTCACACAAAAC 6049 SEQ ID NO: 7217 -0.7 -21.8 63.8 -21.1 0 0
TACTTGATATATTTTTTAAC 6228 SEQ ID NO: 7218 -0.7 -14.6 49.7 -13.9 0 -4.3
TTCTTTGTTTCTTTTTACTT 6469 SEQ ID NO: 7219 -0.7 -19.6 62.9 -18.9 0 -2.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo CTTGTCAACGTTGATACCCT 6653 SEQ ID NO: 7220 -0.7 -24.3 68.4 -21.3 -0.1 -12.8
AACAAATTTTGTAAAAATAT 6828 SEQ ID NO: 7221 -0.7 -10.9 41.2 -8.5 -1.7 -8.7
ATAACAGACTAAAATACTTT 7073 SEQ ID NO:7222 -0.7 -14.2 47.9 -13.5 0 -2
ATGGCAAAGCAATACTGCAG 7315 SEQ ID NO: 7223 -0.7 -21.4 62.2 -18.2 -2.5 -9.3
ATTTACATAACATAGGGTAT 7374 SEQ ID NO:7224 -0.7 -17.7 56 -17 0 -3.3
TTGTAAATAGCTTCAAATTA 7683 SEQ ID NO:7225 -0.7 -15.6 51.1 -14.9 0 -4.6 AGTTTGGAATTGTGATTAAA
7959 SEQ ID NO: 7226 -0.7 -16.8 53.8 -16.1 0 -3.2 AAGTTTGGAATTGTGATTAA
7960 SEQ ID NO: 7227 -0.7 -16.8 53.8 -16.1 0 -3.1 GTTTGTGCAAAAAACAAAAA
8323 SEQ ID NO:7228 -0.7 -13.7 46 -11 -2 -9.4
GCATTACAACTGGAGTTTTC 9005 SEQ ID NO:7229 -0.7 -21.3 64.7 -20.6 0 -5.2
TAGATCCAAATTGTCTTTAA 9031 SEQ ID NO:7230 -0.7 -17.8 55.8 -17.1 0 -4.6
TTCCTCTGGCAGCTGTTCAG 132 SEQ ID NO:7231 -0.6 -27.5 80.5 -26.3 0 -8.5
TCCATAATCTCTGATAAAAC 215 SEQ ID NO:7232 -0.6 -17.1 53.8 -16.5 0 -3.3
CCACTCTACTATGAATCCTT 290 SEQ ID NO: 7233 -0.6 -22.9 66.5 -22.3 0 -2.2
CAGTAAGCCACTCTACTATG 297 SEQ ID NO:7234 -0.6 -22.3 66.1 -21.7 0 -4.7
CGAATTACCTTAGATAGTCA 410 SEQ ID NO: 7235 -0.6 -20 60.2 -19.4 0 -3.2
ACATTCTTTGTCCAGTCAGG 922 SEQ ID NO:7236 -0.6 -24.3 73 -23.7 0 -3.8
CAAAGGTATAGATTCCAGTG 954 SEQ ID NO: 7237 -0.6 -20.1 61 -18.8 -0.4 -3.6
TCAGGGCCCCCACAATGGTC 1173 SEQ ID NO: 7238 -0.6 -31 82.1 -28.6 -0.7 -11.8
AAGGTCCACCCACCAAGGAA 2433 SEQ ID NO:7239 -0.6 -27 71.7 -25.2 -1.1 -5.8
CATGGCGGACATTTCTGTCT 2638 SEQ ID NO: 7240 -0.6 -25.2 72.2 -21.9 -2.7 -8.6
AGCATGGCGGACATTTCTGT 2640 SEQ ID NO: 7241 -0.6 -25.7 73.1 -23.9 -1.1 -6.5
TCCATAACAATTAAATTCAC 2728 SEQ ID NO: 7242 -0.6 -16.1 51.4 -15.5 0 -3.1
AAAAATGAAGACGATGATGG 3140 SEQ ID NO: 7243 -0.6 -15.1 48.5 -14.5 0 -3.5
CAAAGAGCTGCATGCCGACC 3165 SEQ ID NO: 7244 -0.6 -26.5 70.8 -24.9 -0.8 -9.1
ACCAAAGAGCTGCATGCCGA 3167 SEQ ID NO: 7245 -0.6 -26.5 70.8 -24.9 -0.8 -9.1
CATGAAAACAATAAGGCACA 3347 SEQ ID NO:7246 -0.6 -17 52.3 -16.4 0 -4
CAACCCATTTGAGAAGCATT 4233 SEQ ID NO:7247 -0.6 -22.2 63.3 -21.6 0 -4.1
GATGAGACAGACCAACAGCA 4484 SEQ ID NO:7248 -0.6 -22.9 65.8 -22.3 0 -4.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo AAGATGAGACAGACCAACAG 4486 SEQ ID NO: 7249 -0.6 -19.7 58.9 -19.1 0 -2.4
CTGCATACATAATATCCATC 4728 SEQ ID NO: 7250 -0.6 -20.2 60.7 -19.6 0 -4.9
AGAATGACCCAAAGATGATA 4824 SEQ ID NO:7251 -0.6 -18.9 56.4 -18.3 0 -2.1
CCAGTGAACAGAACAATGAA 5164 SEQ ID NO: 7252 -0.6 -18.7 55.9 -17.4 -0.5 -3.9
GAAACATACCTACAATGGAG 5268 SEQ ID NO: 7253 -0.6 -18.6 56.1 -17.5 -0.1 -4 CTATCATCTCAGCCAGAAAC
5283 SEQ ID NO:7254 -0.6 -22 65 -21.4 0 -3.6 TCTATCATCTCAGCCAGAAA
5284 SEQ ID NO: 7255 -0.6 -22.2 65.9 -21.6 0 -3.6 AATTGTGTCAGGGTCACAGT
5645 SEQ ID NO: 7256 -0.6 -23.7 71.7 -21.5 -1.6 -5.8
CAAATAAAATATCAAGACAG 6015 SEQ ID NO:7257 -0.6 -12.5 44.1 -11.9 0 -2.8
A-AACACGCTTTGTAAAGGCA 6033 SEQ ID NO:7258 -0.6 -20.6 59.7 -18 -2 -5.8
AAAAGATAACATCTGAAATT
6199 SEQ ID NO: 7259 -0.6 -13 45.2 -11.5 -0.8 -4.4 TAAAAGATAACATCTGAAAT
6200 SEQ ID NO:7260 -0.6 -12.6 44.4 -11.1 -0.8 -4.2 TCTTGTATAGGCACTGACTA
6594 SEQ ID NO:7261 -0.6 -22.2 67.4 -20.9 -0.4 -4.8
CTAAAATACTTTCAAAATTA 7065 SEQ ID NO:7262 -0.6 -12.3 44 -11.7 0 -3.2
GAATACTTTGCATAAAAATA 7151 SEQ ID NO:7263 -0.6 -14 47.2 -13.4 0 -5.1
TCTGAAACTTAGAATAAAAT 7188 SEQ ID NO: 7264 -0.6 -12.9 45.2 -12.3 0 -2.3
GCTCTGAAACTTAGAATAAA 7190 SEQ ID NO:7265 -0.6 -16.3 52 -15.7 0 -2.8
CTATTTACATAACATAGGGT 7376 SEQ ID NO:7266 -0.6 -18.6 58 -18 0 -2.8
CATATTTGATTTAATAGAAG 7451 SEQ ID NO: 7267 -0.6 -14 47.9 -13.4 0 -2.6
AATTAAAAGTGCAAAAGTAA 7709 SEQ ID NO:7268 -0.6 -12.8 44.7 -12.2 0 -5.4
TATGTACAAAATGCTGACAA 7876 SEQ ID NO: 7269 -0.6 -16.9 52.9 -16.3 0 -6.8
TGATGTCATCAACCTGAAAA 7905 SEQ ID NO: 7270 -0.6 -18.9 56.9 -17.5 -0.6 -6.2
ATTATCCATTGAAAAATCTT 7990 SEQ ID NO: 7271 -0.6 -16.2 51.7 -14.9 -0.5 -3.4
ATAAAAAAAAACATCTATGA 8156 SEQ ID NO:7272 -0.6 -10.6 40.6 -10 0 -3.8
CGTAAATACTACAAAAGTTG 8177 SEQ ID NO: 7273 -0.6 -14.9 48.7 -13.6 -0.4 -3.5
GTCAGATCAAGCACAGGTTT 8559 SEQ ID NO:7274 -0.6 -23.3 70 -22.7 0 -5.4
AAACAAAGAGACCTTTCCAG 31 SEQ ID NO:7275 -0.5 -19.7 58.2 -18.1 -1 -4.1
CTCTGGCAGCTGTTCAGCTT 129 SEQ ID NO:7276 -0.5 -27.8 81.7 -25.4 -1.8 -11
TAGCAGCAAGAGATTCTCTA 525 SEQ ID NO:7277 -0.5 -21.6 66 -19.8 -1.2 -9.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GTATAGATTCCAGTGAATGT 949 SEQ ID NO: 7278 -0.5 -20.7 63.5 -18.8 -1.3 -5.5
AAGGTATAGATTCCAGTGAA
952 SEQ ID NO: 7279 -0.5 -20 61.1 -18.8 -0.4 -3.9 AAAGGTATAGATTCCAGTGA
953 SEQ ID NO: 7280 -0.5 -20 61.1 -18.8 -0.4 -3.9 ACAATGACACTGAAATCCAG
1048 SEQ ID NO: 7281 -0.5 -19.1 57.1 -17.6 -0.9 -4.9
TCATCACATCAGAAAGCTTC 1206 SEQ ID NO: 7282 -0.5 -20.6 62.8 -20.1 0 -7
CCAAAACATAAAAGTGACTG 1437 SEQ ID NO: 7283 -0.5 -16 50.3 -15.5 0 -3.1
ATCTCTTGAAGCAGCTGATG 1865 SEQ ID NO: 7284 -0.5 -22.4 67.1 -21.2 0 -8.7
CCGACCTCTGAAACTGAAAA 2201 SEQ ID NO: 7285 -0.5 -20.6 58.2 -20.1 0 -2.8
CACAAACAGTGAGTCTCTCC 2291 SEQ ID NO: 7286 -0.5 -23.1 68.3 -21.7 -0.8 -4.8
GCATCTCCATTGAAATCTGG 2538 SEQ ID NO: 7287 -0.5 -22.7 66 -22.2 0 -3.4
ACCATGACCAACATGAAAAC 3358 SEQ ID NO: 7288 -0.5 -19.3 56.2 -16.5 -2.3 -5.9
TGACCATGACCAACATGAAA 3360 SEQ ID NO: 7289 -0.5 -20.4 58.5 -17.6 -2.3 -5.9
TAAATGAACTCAATAATAAG 3414 SEQ ID NO: 7290 -0.5 -11.7 42.8 -11.2 0 -3.9
ACCTACACCACTGGTGGTTC 3677 SEQ ID NO: 7291 -0.5 -27 76.5 -24.4 -1.7 -12
TAGGTAAAGACTTTGTCAGC 4198 SEQ ID NO: 7292 -0.5 -20.4 63.1 -18.6 -1.2 -5.2
TAACATCACTAATGTCAAAC 4587 SEQ ID NO: 7293 -0.5 -16.2 52 -14.1 -1.5 -4.3
TCACTCAAATTGTTAACATC 4600 SEQ ID NO: 7294 -0.5 -17.6 55.7 -16.6 0 -8.3
GTCGGGTGGTGCACTATTAA 5627 SEQ ID NO: 7295 -0.5 -24.8 71.5 -23.4 -0.3 -9.5
TGAGAAGAGGAGGATCCAGG 5928 SEQ ID NO: 7296 -0.5 -23 67.4 -19.9 -2.6 -9
CAATTGATCACAAAGATAAT 6488 SEQ ID NO: 7297 -0.5 -14.9 48.9 -13.5 -0.8 -6.6
TGGTAATAAAAACAGCAACC 6674 SEQ ID NO: 7298 -0.5 -17.2 52.7 -16.7 0 -4.1
CAAACATAACAGACTAAAAT 7078 SEQ ID NO: 7299 -0.5 -13.4 45.6 -12.9 0 -2
AAAATTTGCACTTGCTGAAA 7173 SEQ ID NO: 7300 -0.5 -17.7 54.2 -16.6 -0.3 -6.5
TCCAGAGAGATACCATATGA 7740 SEQ ID NO: 7301 -0.5 -21.8 64.3 -21.3 0 -6
AATATGAAGAATAGGTTTTG 7793 SEQ ID NO: 7302 -0.5 -15.2 50.3 -14.7 0 -2.7
CAAAATGCTGACAAATAAAG 7870 SEQ ID NO: 7303 -0.5 -13.7 46 -13.2 0 -3.6
GCATGCAGTTCTTCAATACA 8387 SEQ ID NO: 7304 -0.5 -22.7 67.6 -21.3 0 -9.5
CAAAAACAAAAAACCCCAGA 8500 SEQ ID NO: 7305 -0.5 -16.8 50.3 -16.3 0 0
GGTTTTATTAATTATATATA 8544 SEQ ID NO: 7306 -0.5 -14.4 49.4 -13.9 0 -5.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AGTTAATATAAATTCTCAAT 8927 SEQ ID NO: 7307 -0.5 -14.1 48.2 -13.6 0 -3.1
TTTCCACTGAGAATAAGAGT 8989 SEQ ID NO:7308 -0.5 -19.7 60.2 -19.2 0 -2.9
TCAAAGGTATAGATTCCAGT 955 SEQ ID NO:7309 -0.4 -20.5 62.5 -20.1 0.4 -2.8
GACACTGAAATCCAGCCAGT 1043 SEQ ID NO: 7310 -0.4 -24.6 69.2 -23 -1.1 -6.2
CACAATGACACTGAAATCCA 1049 SEQ ID NO: 7311 -0.4 -19.8 58.1 -19.4 0 -3.1
ATCAGGGCCCCCACAATGGT 1174 SEQ ID NO: 7312 -0.4 -30.6 80.3 -28.4 -0.7 -11. ε
CATCAGAAAGCTTCTTTACC 1200 SEQ ID NO:7313 -0.4 -21.2 63.4 -19.9 -0.7 -7
GACAGAACACAGTCAGGATC 1224 SEQ ID NO: 7314 -0.4 -21.7 65.4 -20.5 -0.6 -5.3
CATCCAAAACATAAAAGTGA 1440 SEQ ID NO: 7315 -0.4 -16 50.4 -15.6 0 -2.9
AATGAGCCCAAGAAAATGAC 1690 SEQ ID NO: 7316 -0.4 -19 55.9 -18.6 0 -2.4
TTGTTTCCTTCAAGGTGCTC 1999 SEQ ID NO: 7317 -0.4 -24.8 74.1 -23.6 -0.6 -5.3
GGTAAGAGCTTAACCTTCTC 2520 SEQ ID NO: 7318 -0.4 -22.7 67.9 -21.7 -0.3 -7.2
ATCTCCATTGAAATCTGGTA 2536 SEQ ID NO: 7319 -0.4 -21.1 63.2 -20.1 -0.3 -3.7
AATGGATCCATAACAATTAA
2734 SEQ ID NO: 7320 -0.4 -16.5 51.8 -14.1 0 -12.2 AAATGGATCCATAACAATTA
2735 SEQ ID NO: 7321 -0.4 -16.5 51.8 -14.1 0 -12.2 ATTTCTGCTGTGAAAATCCC
2872 SEQ ID NO: 7322 -0.4 -22.3 64.6 -21 -0.7 -5
GCCAGAAAGAGGTTCAGAAC 3394 SEQ ID NO: 7323 -0.4 -22 64.6 -20.3 -1.2 -7.1
AATGAACTCAATAATAAGGC 3412 SEQ ID NO: 7324 -0.4 -15.7 50.6 -15.3 0 -3.9
GATTATTCATTTCATTGTCA
3462 SEQ ID NO: 7325 -0.4 -19.3 61 -18.9 0 -2.4 AGATTATTCATTTCATTGTC
3463 SEQ ID NO: 7326 -0.4 -18.6 59.9 -17.7 -0.2 -3 GTATTATTGGACATGCAGCT
3610 SEQ ID NO: 7327 -0.4 -22.7 67.7 -22.3 0 -5.5
AGTATTTAAGTTTTCAAAGT 3803 SEQ ID NO: 7328 -0.4 -16.5 54.3 -16.1 0 -2.4
AACTCTTCAGTATTTAAGTT 3811 SEQ ID NO: 7329 -0.4 -18.3 58.7 -17.4 -0.2 -3.6
AAGTCTTCTTCGGGTTCAGT 3940 SEQ ID NO: 7330 -0.4 -24.5 73.9 -24.1 0 -4.4
GACTTTGTCAGCATATTCTA 4190 SEQ ID NO: 7331 -0.4 -21.5 66.3 -20.4 -0.4 -5.1
GTTTGAAATCCATAAGCAAC 4249 SEQ ID NO: 7332 -0.4 -18.7 56.7 -18.3 0 -4.1
ATATGTTTGAAATCCATAAG 4253 SEQ ID NO: 7333 -0.4 -16.4 52.4 -16 0 -3.5
GCTACCAGGCTAACCAAAGA 4318 SEQ ID NO:7334 -0.4 -24.3 67.5 -22.5 -1.3 -5
CAGAGTGAAGAATGACCCAA 4832 SEQ ID NO: 7335 -0.4 -21.1 60.9 -20.7 0 -2.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ACAATGAACACTAGGTTGAT 5152 SEQ ID NO: 7336 -0.4 -18.9 57.8 -17.7 -0.6 -6
AACAGAACAATGAACACTAG 5158 SEQ ID N0:7337 -0.4 -15.9 50.8 -15.5 0 -4
GCCAGAAACATACCTACAAT 5272 SEQ ID NO: 7338 -0.4 -21.3 60.9 -20.9 0 -2
TTGTAATTTGGAACAAGCAG 5571 SEQ ID NO: 7339 -0.4 -18.3 56.5 -16.3 -1.6 -7.1
TAACTGACAAAAAAGAAAAT 5713 SEQ ID NO: 7340 -0.4 -10.6 40.5 -10.2 0 -2.2
CAGGAAGGATATGATGATGT 5732 SEQ ID NO: 7341 -0.4 -19.7 59.9 -19.3 0 -2.6
ACCGCGATGTACATGTTCAC 5758 SEQ ID NO: 7342 -0.4 -24.6 68.8 -23.6 0 -8.4
TGTAAAGGCAAATAAAATAT 6023 SEQ ID NO: 7343 -0.4 -13.1 45.2 -12.7 0 -4
TGAAATTACGCTGAATGATA 6186 SEQ ID NO: 7344 -0.4 -16.9 52.5 -16.5 0 -3.3
GTCAGTTTGGCATGGACCTC 6556 SEQ ID NO:7345 -0.4 -26.7 78 -25.8 -0.1 -5.4
TCTTGTCAACGTTGATACCC 6654 SEQ ID NO: 7346 -0.4 -23.8 68.1 -21.3 0.4 -12.3
ACAGCAACCTCTTGTCAACG 6663 SEQ ID NO: 7347 -0.4 -23.8 67.3 -22.8 -0.3 -4.6
GAACAACTATTCTAAAGCAA 7286 SEQ ID NO:7348 -0.4 -16.4 52 -16 0 -4.1
GCAAAAGACACATACACTGT 7475 SEQ ID NO:7349 -0.4 -19.7 58.8 -19.3 0 -3.4
ATTTTTACATTATTTATATT 7842 SEQ ID NO: 7350 -0.4 -14.5 49.7 -14.1 0 -2.2
CTGACAAATAAAGTTGATTA 7863 SEQ ID NO: 7351 -0.4 -15 49.4 -14.1 -0.1 -3.3
TTATGTACAAAATGCTGACA 7877 SEQ ID NO: 7352 -0.4 -17.7 54.9 -17.3 0 -6.8
CTGCCAACAGCAAAAAACAA 8517 SEQ ID NO:7353 -0.4 -18.8 54.7 -16.9 -1.4 -4.2
TATAATGCATTTAAGTAACA 8868 SEQ ID NO:7354 -0.4 -15.5 50.8 -14.4 0 -8.8
CCAAATTGTCTTTAAAAATA 9026 SEQ ID NO: 7355 -0.4 -14.7 48.4 -14.3 0 -4.3
GAGAATTATGAAATACATAT 9052 SEQ ID NO: 7356 -0.4 -13.8 47.1 -12.3 -1 -4.6
AGAGATTCTTTGCTCCTTTC 318 SEQ ID NO: 7357 -0.3 -23.4 71.2 -22.4 -0.4 -4.2
AATATCCCTAGAAGAGATTC 330 SEQ ID NO: 7358 -0.3 -19.6 59.7 -17.9 -1.3 -5.2
ATTACCTTAGATAGTCACAG 407 SEQ ID NO: 7359 -0.3 -20.2 62.5 -19.9 0 -2.7
TTGGCTTTCTCTTCTGCAGC 556 SEQ ID NO: 7360 -0.3 -26.5 79.1 -25.4 -0.6 -8.3
ACACCATCTCTGGAGGAATG 672 SEQ ID NO: 7361 -0.3 -23.3 67.4 -21.4 -1.5 -6.1
CCAGGTCCTCCAGGGGCTCT 693 SEQ ID NO: 7362 -0.3 -33.1 90.9 -31.4 -1.3 -5.6
GTTAAAATATACAAGGCAGA 787 SEQ ID NO: 7363 -0.3 -16.8 53.1 -16.5 0 -4
GTTTAGTGGAGTTAAAATAT 797 SEQ ID NO: 7364 -0.3 -16.7 54.2 -16.4 0 -2.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular position oligo binding formation Duplex structure oligo oligo
ATAAAGAATGTACCAAAATC 840 SEQ ID NO:7365 -0.3 -14.3 47.6 -14 0 -4.2
TGCCATCACAATGACACTGA 1055 SEQ ID NO:7366 -0.3 -23 65.6 -22 -0.4 -3.8
AGTTAAATGTGCTCATTGTT 1395 SEQ ID NO: 7367 -0.3 -20 61.9 -18.5 -1.1 -3.5
CCATCCAAAACATAAAAGTG 1441 SEQ ID NO:7368 -0.3 -17.4 52.7 -17.1 0 -2.9
AAATAGAGACAGGAAAGCCC 1583 SEQ ID NO:7369 -0.3 -20.6 59.9 -19.6 -0.4 -3.2
CTCAAGAGAGACTGATGAGG 2134 SEQ ID NO:7370 -0.3 -20.6 62.5 -19.2 -1 -5.1
ATAACAATTAAATTCACAAG 2725 SEQ ID NO:7371 -0.3 -13 45.3 -12.7 0 -3.1
CAATGCAAATAGTGATGGCA 2763 SEQ ID NO: 7372 -0.3 -20.3 59.9 -19.2 -0.6 -5.6
GCTGTGAAAATCCCAGTAAA 2866 SEQ ID NO: 7373 -0.3 -21 60.7 -20.2 -0.1 -3.5
ATGGCAATGATCTTGAGAAC 2893 SEQ ID NO: 7374 -0.3 -19.7 59.6 -18.7 -0.4 -6.2
CCATGGCAATGATCTTGAGA 2895 SEQ ID NO:7375 -0.3 -22.9 66 -21.9 -0.5 0
AAAGATATTCCAGCCTTCTT 2933 SEQ ID NO:7376 -0.3 -22.3 65.3 -21.3 -0.4 -4
CTTGCAGACACATTCTTTGT 3194 SEQ ID NO:7377 -0.3 -22.7 68 -21.9 0 -8.2
ATTGATCTTGCAGACACATT 3200 SEQ ID NO: 7378 -0.3 -21.1 63.7 -20.8 0 -5.2
TCATTGTCATCATCAGTAGC 3451 SEQ ID NO:7379 -0.3 -22.4 69.6 -22.1 0 -2.8
ATCCATAAGCAACCCATTTG 4242 SEQ ID NO:7380 -0.3 -23 64.6 -22.7 0 -4.1
CCACTTGAAGCAGTGCAAGA 4692 SEQ ID NO: 7381 -0.3 -23.9 68.1 -21.9 -1.7 -9.6
TTCAGAGTGAAGAATGACCC 4834 SEQ ID NO:7382 -0.3 -21.6 63.4 -20.5 -0.6 -3.9
GATGTTAAACAACGCAGGAA 5426 SEQ ID NO: 7383 -0.3 -19 56.4 -18.2 -0.2 -4.7
GTAGCAACACTGAAGTTCTC 5785 SEQ ID NO:7384 -0.3 -21.6 65.8 -21.3 0 -6.3
TTACGCTGAATGATAGCGGC 6181 SEQ ID NO:7385 -0.3 -23.3 65.5 -19.4 -3.6 -9.4
TTGTTATAGTTACTTGATAT 6238 SEQ ID NO:7386 -0.3 -17.3 56.5 -17 0 -2.6
CAACGTAAACCTCATTTACA 6907 SEQ ID NO: 7387 -0.3 -19.5 57.5 -16.5 -2.7 -6.1
AAACTTAGAATAAAATTTGC 7184 SEQ ID NO:7388 -0.3 -13 45.3 -12.7 0 -5.2
TCACCAATATGTGACATTCT 7621 SEQ ID NO: 7389 -0.3 -21.1 62.9 -19.8 -0.9 -5.6
T7AAAGGTGTTTGTAAATAGC 7692 SEQ ID NO:7390 -0.3 -17.1 54.7 -16.8 0 0
AGTGTGTTTCCTTGAAATCC 7757 SEQ ID NO: 7391 -0.3 -22.8 67.6 -21.7 -0.6 -4.3
ATTATATTTTTACATTATTT 7847 SEQ ID NO:7392 -0.3 -14.5 49.7 -14.2 0 -2.2
ATAGTTTTGTAAAAAGAATT 8358 SEQ ID NO: 7393 -0.3 -13.3 46.3 -11.6 -1.3 -9.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GCACAGGTTTTATTAATTAT 8549 SEQ ID NO: 7394 -0.3 -18.7 58.6 -18.4 0 -4.2
AAAAAAAAGTTAATATAAAT 8934 SEQ ID NO: 7395 -0.3 -7.4 35.1 -7.1 0 -2.8
CACATAAATCCAAGGGTTCT 8956 SEQ ID NO:7396 -0.3 -21.3 62.4 -21 0 -4.3
ACTGAGAATAAGAGTTTGGT 8984 SEQ ID NO: 7397 -0.3 -19 59.3 -18.7 0 -2.7
AGATCCAAATTGTCTTTAAA 9030 SEQ ID NO:7398 -0.3 -17.4 54.6 -17.1 0 -4.6
TCAGTGCTCGGAGAACTCTG 1125 SEQ ID NO: 7399 -0.2 -24.3 70.8 -23.2 -0. 7 -6.4
CAGTCAGGATCATCACATCA 1215 SEQ ID NO: 7400 -0.2 -23 69.1 -22.3 -0. 1 -5.3
AAATGTGCTCATTGTTACAT 1391 SEQ ID NO: 7401 -0.2 -19.6 60 -17.8 -1. 6 -4
CAGTTAAATGTGCTCATTGT 1396 SEQ ID NO: 7402 -0.2 -20.6 62.8 -18.8 -1. 6 -4
CATCTGCTGAAATTCGGCCT 1796 SEQ ID NO: 7403 -0.2 -25.1 69.4 -23.5 -1. 3 -9.5
GATTCTTCAAGTTCTTCCAT 2617 SEQ ID NO: 7404 -0.2 -22.3 67.8 -22.1 0 -2.9
GACAATGCAAATAGTGATGG 2765 SEQ ID NO: 7405 -0.2 -18.6 56.6 -17.5 -0. 7 -5.1
TTTGCCAACTTGAAAACTCT 3040 SEQ ID NO: 7406 -0.2 -20.1 59.3 -19.9 0 -3
CTATCCACTCTCCACACAGC 3288 SEQ ID NO: 7407 -0.2 -26.8 76 -26.6 0 -2.8
CATTCTTCCTACTGCAATCT 3485 SEQ ID NO: 7408 -0.2 -23.4 68.7 -23.2 0 -4.9
TGCATTCTTCCTACTGCAAT 3487 SEQ ID NO: 7409 -0.2 -23.9 69.3 -22.2 -1. 4 -5.3
GACATGCAGCTGTCTATCTT 3601 SEQ ID NO: 7410 -0.2 -24.3 72.7 -22.8 -1. 1 -9.6
CAAAGTCAGACTCTCCAACA 3789 SEQ ID NO:7411 -0.2 -21.9 64.2 -21.7 0 -7.3
ACCAGTTGTGCTCAACAATA 4074 SEQ ID NO: 7412 -0.2 -22.4 65.6 -18.9 -3. 3 -6.6
CATGAACACAATGAAAGTCT 4097 SEQ ID NO:7413 -0.2 -17.4 54 -17.2 0 -3.7
TGCCTTCAAACCGGGATAAG 4413 SEQ ID NO: 7414 -0.2 -23.5 64.7 -23.3 0 -7.1
CATACATAATATCCATCCAG 4725 SEQ ID NO: 7415 -0.2 -20.2 60 -20 0 -2.6
TCTCAGCCAGAAACATACCT 5277 SEQ ID NO: 7416 -0.2 -23.8 67.7 -23.6 0 -2.7
GGCTGTAAACAATTGATCAC 6497 SEQ ID NO: 7417 -0.2 -19.6 59.2 -19.4 0 -7.2
AACTTAGAATAAAATTTGCA 7183 SEQ ID NO: 7418 -0.2 -14.4 48 -14.2 0 -5.2
CCTAAATTAAATATAGAGCT 7207 SEQ ID NO: 7419 -0.2 -16.3 51.9 -16.1 0 -5.3
AAGATGGCAAAGCAATACTG 7318 SEQ ID NO: 7420 -0.2 -18.8 56.6 -17.7 -0. 7 -4.3
TACATAACATAGGGTATTTA 7371 SEQ ID NO: 7421 -0.2 -17.4 55.4 -17.2 0 -3.1
TATTTACATAACATAGGGTA 7375 SEQ ID NO: 7422 -0.2 -17.4 55.4 -17.2 0 -3.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TATCACCAATATGTGACATT 7623 SEQ ID NO: 7423 -0.2 -19.5 59.1 -17.8 -1.4 -6.5
GTGTTTCCTTGAAATCCAGA 7754 SEQ ID NO: 7424 -0.2 -22.9 67 -21.9 -0.6 -4.3
AATTATCCATTGAAAAATCT 7991 SEQ ID NO: 7425 -0.2 -15.4 49.8 -14.5 -0.5 -3.4
TGCTTATAGCCAAGGGAGTT 8774 SEQ ID NO: 7426 -0.2 -24.3 70.7 -22.8 -1.2 -4.9
GAGATAGCATCAATTATATT 8813 SEQ ID NO: 7427 -0.2 -17.4 55.5 -16.3 -0.7 -5.7
AAGTTAATATAAATTCTCAA 8928 SEQ ID NO: 7428 -0.2 -13.4 46.6 -13.2 0 -3.1
TGAAATACATATTTAGATCC 9044 SEQ ID NO: 7429 -0.2 -16.4 52.6 -15.6 -0.3 -5.8
CAAAGCCCAGCATCCAAGAT 171 SEQ ID NO: 7430 -0.1 -25.3 68.6 -24.3 -0.7 -4.1
TTGATGTGGCTTGGCTTCAG 244 SEQ ID NO: 7431 -0.1 -25 73.6 -24.2 -0.4 -6
GCAATTTTCCTAACAGGGTT 814 SEQ ID NO: 7432 -0.1 -23 67 -22 -0.7 -4.6
AAATGAGCCCAAGAAAATGA 1691 SEQ ID NO: 7433 -0.1 -18.1 53.8 -18 0 -3.2
GGATCAAATTCACCAAATAA 1710 SEQ ID NO: 7434 -0.1 -17.2 53 -17.1 0 -5.3
CCTCTTTTTGTTCTGCTTCT 1779 SEQ ID NO: 7435 -0.1 -25.3 75.9 -25.2 0 -3.6
ACTGAAATCTCTTGAAGCAG 1871 SEQ ID NO: 7436 -0.1 -19.4 59.3 -18.8 -0.2 -4.1
GGAAAGCTGTCTCTCTCTCC 2023 SEQ ID NO: 7437 -0.1 -25.9 76.5 -25.8 0 -6.4
TCTGTCTAGATTCTTCAAGT 2625 SEQ ID NO: 7438 -0.1 -21.2 66.9 -20.6 -0.2 -6
AATTAAATTCACAAGATGTT 2720 SEQ ID NO: 7439 -0.1 -15 49.6 -14.9 0 -3
CATAACAATTAAATTCACAA 2726 SEQ ID NO: 7440 -0.1 -13.7 46.4 -13.6 0 -3.1
AGCGTACAGTCATCATTGAT 3214 SEQ ID NO: 7441 -0.1 -22.5 67.2 -21.7 -0.5 -5.7
CCATGACCAACATGAAAACA 3357 SEQ ID NO: 7442 -0.1 -19.8 56.9 -17.4 -2.3 -5.9
ATAATAAGGCCAGAAAGAGG 3402 SEQ ID NO: 7443 -0.1 -18.7 56.5 -18.1 0 -7.7
GCAATCTGCAGATTATTCAT 3472 SEQ ID NO: 7444 -0.1 -21.2 63.9 -18.2 -1.7 -14
GCAATTGGCACTGTGACGGT 3769 SEQ ID NO: 7445 -0.1 -25.9 72.3 -24.9 -0.7 -7
TCACTGCTGAACTCTTCAGT 3820 SEQ ID NO: 7446 -0.1 -23.6 70.7 -20.8 -2.7 -7.6
TTCTAGTTCTGACTCACTGC 3833 SEQ ID NO: 7447 -0.1 -23.4 71.8 -22.6 -0.4 -4
CAAGCTTCCGGTTTAAAGTC 3955 SEQ ID NO: 7448 -0.1 -22.5 65.4 -22.4 0 -6.6
ACAGAATGGAAACTTTTTAA 3992 SEQ ID NO: 7449 -0.1 -15.7 50.8 -14.9 -0.4 -2.7
CACCAGGCATTAGTGAAATA
4270 SEQ ID NO: 7450 -0.1 -21.2 62.2 -21.1 0 -4.2 GCACCAGGCATTAGTGAAAT
4271 SEQ ID NO: 7451 -0.1 -23.3 66.7 -22.3 -0.7 -4.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GTTACAAAATCAAAGACCAT 5023 SEQ ID NO: 7452 -0. ,1 -17 52.8 -16.9 0 -2.8
CAAGGTAGGGGACACAGAAT 5309 SEQ ID NO: 7453 -0. ,1 -22 64.3 -21.3 -0.3 -2.8
ATTTGGAACAAGCAGATCAT 5566 SEQ ID NO: 7454 -0. 1 -19.7 59.6 -18 -1.6 -8.6
TCATAGGCTGTAAACAATTG 6502 SEQ ID NO: 7455 -0. 1 -18.5 57 -18.4 0 -6.7
CCTCAGCAGTGTCAGCTGGT 6690 SEQ ID NO: 7456 -0. 1 -29.1 84.9 -26.2 -2.8 -9.2
GTAAACCTCATTTACAAAAA 6903 SEQ ID NO:7457 -0. 1 -15.7 50.2 -13.4 -2.2 -5.9
AACTGAAACTGTAGCCATTA 7023 SEQ ID NO: 7458 -0. 1 -19.9 59.4 -19.8 0 -3.3
GACTAAAATACTTTCAAAAT 7067 SEQ ID NO:7459 -0. 1 -13.3 45.9 -13.2 0 -2
TTACATTATTTATATTTAAA 7838 SEQ ID NO:7460 -0. 1 -12.6 45.2 -12 -0.1 -4.6
GATTCAAAAGTTTGGAATTG 7967 SEQ ID NO: 7461 -0. 1 -16.3 52.3 -15.3 -0.8 -7.1
AAATAGTTTTGTAAAAAGAA 8360 SEQ ID NO: 7462 -0. 1 -11.8 43.1 -10.3 -1.3 -4.2
AAAGTTCACAAAGCTGCTTT 8664 SEQ ID NO: 7463 -0. 1 -20.1 60.5 -18.7 -0.1 -10.6
AAAACAAAGAGACCTTTCCA 32 SEQ ID NO: 7464 0 -19 56.3 -18.1 -0.8 -4.4
CAGAGGTTTACAAATTAGTT 85 SEQ ID NO: 7465 0 -18.2 57.4 -18.2 0 -3.3
TGAATGTGTACTCTACATTC 936 SEQ ID NO: 7466 0 -19.5 61.1 -16.4 -3.1 -11
TGGAATGACTGAAATTGTTT
1145 SEQ ID NO: 7467 0 -17.5 54.7 -17.5 0 -3.2 CTGGAATGACTGAAATTGTT
1146 SEQ ID NO: 7468 0 -18.3 56.2 -18.3 0 -3.2 AACACGCTCAGACAGAACAC
1234 SEQ ID NO: 7469 0 -21.5 62.2 -21.5 0 -3.4
AGATTGCCCATGAACAGCTG 1270 SEQ ID NO: 7470 0 -24.7 69.2 -24.2 0.5 -8.6
GACAGGAAAGCCCAGCTAAA 1576 SEQ ID NO: 7471 0 -23.4 65.1 -22.4 -0.9 -6
AGCCAGGATCAAATTCACCA 1715 SEQ ID NO: 7472 0 -24.1 67.9 -24.1 0.5 -5.3
CATCAGCAAAGTCATTTTCA 2238 SEQ ID NO: 7473 0 -20.6 62.6 -20.6 0 -3.3
AAGCCCTGGCACCATCCTGG 2366 SEQ ID NO: 7474 0 -31.1 81.2 -30 -0.8 -9.6
AAGGAAACCACACCATTGCA 2419 SEQ ID NO: 7475 0 -23 63.8 -22.3 -0.5 -5.3
CAGTCAACACACTACTGAAT 2832 SEQ ID NO:7476 0 -19.9 60 -19 -0.8 -4.2
TTGACAGAATGGAAACTTTT 3995 SEQ ID NO:7477 0 -17.3 54.2 -16.6 -0.4 -3.2
AATATGTTTGAAATCCATAA 4254 SEQ ID NO: 7478 0 -15.7 50.6 -15.7 0 -3.5
TTAATGTCCGTAATGATTTG 4371 SEQ ID NO: 7479 0 -18.5 56.6 -18.5 0 -2.6
TTGAAGCAGTGCAAGATAGC 4688 SEQ ID NO:7480 0 -21.6 64.6 -20.9 0.1 -8.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo CACTTGAAGCAGTGCAAGAT 4691 SEQ ID NO: 7481 0 -21.9 64.5 -20.2 -1.7 -9.6
TGGAGAGAATCACCACCACA
5253 SEQ ID NO: 7482 0 -24.1 67.7 -24.1 2.5 -4.9 ATGGAGAGAATCACCACCAC
5254 SEQ ID NO: 7483 0 -23.4 66.6 -23.4 2.1 -5.3 TAGGGGACACAGAATACTTT
5304 SEQ ID NO:7484 0 -20.6 62 -20.6 0 -1.9
AGGTAGGGGACACAGAATAC 5307 SEQ ID N0:7485 0 -21.9 65.3 -21.3 -0.3 -2.8
CAAGACGGATCACTCGGAAC 5328 SEQ ID NO:7486 0 -22.1 62.6 -21.4 -0.4 -5.3
TAACATAGGCAAAGTTGGAC 5493 SEQ ID NO: 7487 0 -19.2 58.4 -19.2 0 -4.2
CAGCTTCCTTTTTAACATAG 5505 SEQ ID NO:7488 0 -20.8 62.9 -20.8 0 -4.5
TCACACAAAACACGCTTTGT 6040 SEQ ID NO:7489 0 -20.8 60.4 -19.5 -1.2 -6.2
TACACTATCATAGGAAGGAG 6371 SEQ ID NO:7490 0 -19.1 59.2 -19.1 0 -3.4
TGACAAATAAAGTTGATTAT 7862 SEQ ID NO: 7491 0 -14.1 47.6 -13.6 -0.1 -3.6
GTTTGGAATTGTGATTAAAA 7958 SEQ ID NO: 7492 0 -16.1 51.9 -16.1 0 -3.4
TGCATACGTAAATACTACAA 8183 SEQ ID NO: 7493 0 -17.4 53.7 -16.7 -0.4 -6.6
AGACTAGTCTGCATACGTAA 8192 SEQ ID NO: 7494 0 -21.3 64 -19.9 0 -10.7
GTAATTGCACAACTTTGCCA 8288 SEQ ID NO:7495 0 -22.8 65.5 -21.8 -0.9 -4.7
CCAACAGCAAAAAACAAAAA 8514 SEQ ID NO: 7496 0 -14 45.8 -14 0 -4.1
AATAACTATATCATTAATAC 8910 SEQ ID NO:7497 0 -12.9 45.6 -12.9 0 -5.1
AAAAAAGTTAATATAAATTC 8932 SEQ ID NO: 7498 0 -9.3 38.4 -9.3 0 -3.1
TTCTTGAAAAAAAAGTTAAT 8940 SEQ ID NO:7499 0 -11.5 42.5 -11.5 0 -2.9
TCCAAATTGTCTTTAAAAAT 9027 SEQ ID NO:7500 0 -15.4 49.9 -15.4 0 -4.3
AACAAAGCCCAGCATCCAAG 173 SEQ ID NO: 7501 0.1 -24.2 66 -23.4 -0.7 -4.1
ATGAATTACAGCATAACAAA 187 SEQ ID NO: 7502 0.1 -15.6 50.2 -15.7 0 -4.1
TAAGCCACTCTACTATGAAT 294 SEQ ID NO: 7503 0.1 -20.3 60.8 -20.4 0 -3.2
CCTGGGGGTACCAACAGTGC 481 SEQ ID NO: 7504 0.1 -28.7 78.5 -26 -2.8 -10.6
AGCAATTTTCCTAACAGGGT 815 SEQ ID NO: 7505 0.1 -22.9 66.9 -22.1 -0.7 -5.3
CTCAGACAGAACACAGTCAG 1228 SEQ ID NO: 7506 0.1 -21.5 64.9 -20.1 -1.4 -4.6
CCAGTTAAATGTGCTCATTG 1397 SEQ ID NO:7507 0.1 -21.4 63.5 -19.9 -1.6 -4
GTCTTTTTGCCCATCCAAAA 1451 SEQ ID NO: 7508 0.1 -24.4 68.1 -23.2 -1.2 -5.2
TGAGTCGAAATAGAGACAGG 1590 SEQ ID NO: 7509 0.1 -19.2 58.4 -17.8 -1.4 -5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AAGAAAATGACCAGGACAAA 1681 SEQ ID NO:7510 0.1 -16.6 51.3 -16.7 0 -4
CAGCCAGGATCAAATTCACC 1716 SEQ ID NO: 7511 0.1 -24.1 67.9 -24.2 0 -5.3
CTCTTTTTGTTCTGCTTCTT 1778 SEQ ID NO: 7512 0.1 -23.4 72.3 -23.5 0 -3.6
CTCTGAAACTGAAAATGCTT 2196 SEQ ID NO: 7513 0.1 -17.8 54.6 -17.9 0 -3.6
GGATGACATACTGGCCTGAC 2348 SEQ ID NO: 7514 0.1 -24.8 70.5 -24.9 0 -7.2
CTGAAGGTCCACCCACCAAG 2436 SEQ ID NO: 7515 0.1 -27.4 73.2 -26.9 -0.3 -4.1
TGACGTTAGAGCTGAAGGTC 2447 SEQ ID NO: 7516 0.1 -22.6 67.2 -21.5 -1 -9.4
TCAGAATGCTGGCTATGCTC 2589 SEQ ID NO: 7517 0.1 -24.4 71.5 -23.2 -1.2 -5.9
AAGATATTCCAGCCTTCTTG 2932 SEQ ID NO: 7518 0.1 -23 67.4 -23.1 0 -3.3
AATTAGCATATTTAGTGTGG 3068 SEQ ID NO: 7519 0.1 -18.8 59.2 -18.9 0 -3.3
GGCCAGAAAGAGGTTCAGAA 3395 SEQ ID NO: 7520 0.1 -23 66.5 -22.4 -0.4 -8
CACACCCATGATGCTAAAGA 4514 SEQ ID NO: 7521 0.1 -22.7 63.9 -22.8 0 -4.5
GGCCACTTGAAGCAGTGCAA 4694 SEQ ID NO: 7522 0.1 -26.3 73.2 -24.8 -1.5 -9.6
TTTAAATGTGGCCACTTGAA 4703 SEQ ID NO: 7523 0.1 -20.5 60.4 -18.2 0 -13
ACAAAGTATAAATACATGTA
4798 SEQ ID NO: 7524 0.1 -14.2 47.9 -13.7 -0.3 -7.9 GACAAAGTATAAATACATGT
4799 SEQ ID NO:7525 0.1 -15.1 49.7 -14.3 -0.7 -7.1 CATGTTGAGGCAGATGAGGA
5072 SEQ ID NO: 7526 0.1 -23.3 68.7 -23.4 0 -4
CTGGCAAGACGGATCACTCG 5332 SEQ ID NO:7527 0.1 -24.7 68.3 -24.1 -0.4 -5.3
ATAGAACATCTCAAAGTCAT 5834 SEQ ID NO: 7528 0.1 -17.8 56.2 -17.9 0 -2.8
GCAGTGTCAGCTGGTAATAA 6685 SEQ ID NO:7529 0.1 -23.1 68.9 -21.6 -1.6 -8.6
AATGCACTAGAACAAATTTT 6838 SEQ ID NO: 7530 0.1 -16.3 51.8 -16.4 0 -5.5
AAATTTGCACTTGCTGAAAC 7172 SEQ ID NO:7531 0.1 -18.6 56.4 -18.1 -0.3 -6.5
ATCACCAATATGTGACATTC 7622 SEQ ID NO: 7532 0.1 -20.2 61 -18.8 -1.4 -6.5
ATCCAGAGAGATACCATATG 7741 SEQ ID NO: 7533 0.1 -21.2 63 -21.3 0 -5.4
AAAGCATAAAGTAAAATAAA 7928 SEQ ID NO: 7534 0.1 -10.5 40.4 -10.6 0 -4.1
TTTGTGCAAAAAACAAAAAT 8322 SEQ ID NO: 7535 0.1 -12.5 43.8 -11 -1.5 -7.1
GTTAATATAAATTCTCAATA 8926 SEQ ID NO: 7536 0.1 -13.8 47.5 -13.9 0 -3.1
TGGCAGCTGTTCAGCTTTTT 126 SEQ ID NO:7537 0.2 -25.9 76.8 -24.2 -1.8 -11
GATAAAACAGAGCCTTATGA 203 SEQ ID NO: 7538 0.2 -18.8 56.9 -19 0 -3.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TTACCTTAGATAGTCACAGC 406 SEQ ID NO:7539 0.2 -22 66.9 -22.2 0 -2.8
TCTTTAAACCTGGAATGACT 1155 SEQ ID NO:7540 0.2 -19.7 58.9 -19.9 0 -5.1
ACAGGAAAGCCCAGCTAAAG 1575 SEQ ID NO:7541 0.2 -22.8 64.1 -22 -0.9 -6
GGCCTCTTTTTGTTCTGCTT 1781 SEQ ID NO:7542 0.2 -27 79.4 -27.2 0 -6.4
CTGAAACTGAAAATGCTTGT 2194 SEQ ID NO:7543 0.2 -17.7 54.3 -17.9 0 -3.6
TGAAATCTGGTAAGAGCTTA 2528 SEQ ID NO:7544 0.2 -19 58.7 -19.2 0 -5.2
TATTTAAGTTTTCAAAGTCA 3801 SEQ ID NO: 7545 0.2 -16.4 53.8 -16.6 0 -2.7
ACCGAGTTCTGAGTAGCCAA 4346 SEQ ID NO: 7546 0.2 -25.5 72 -25.7 0 -3.2
CCGTAATGATTTGATGGCAC 4364 SEQ ID NO:7547 0.2 -22.3 63.8 -22.5 0 -4
GCCACTTGAAGCAGTGCAAG 4693 SEQ ID NO: 7548 0.2 -25.1 71 -23.9 -1.3 -9.6
TTATCTATGATGACACCAAT 4861 SEQ ID NO: 7549 0.2 -19.1 58.1 -19.3 0 -3.2
TCACAGTCGGGTGGTGCACT 5632 SEQ ID NO:7550 0.2 -28 79.8 -26.8 -1.1 -10.3
TGTTATAGTTACTTGATATA 6237 SEQ ID NO:7551 0.2 -16.9 55.5 -17.1 0 -2.7
ATGCACTAGAACAAATTTTG 6837 SEQ ID NO:7552 0.2 -17 53.5 -17.2 0 -6.4
TTTTGAGCAAAAATTTTATC 6988 SEQ ID NO:7553 0.2 -15 49.8 -14.6 -0.3 -7.3
TTCTAAAGCAATACTTTAGA 7277 SEQ ID NO:7554 0.2 -16.8 53.9 -12.7 -4.3 -10.1
TGAAAAATCTTATGGATTCA 7981 SEQ ID NO:7555 0.2 -15.9 51.3 -15.2 -0.8 -6
TATCCATTGAAAAATCTTAT
7988 SEQ ID NO: 7556 0.2 -15.8 50.9 -15.4 -0.3 -3.4 TTATCCATTGAAAAATCTTA
7989 SEQ ID NO: 7557 0.2 -15.9 51.2 -15.4 -0.5 -3.4 GCAAAAAACAAAAATTTATA
8317 SEQ ID NO:7558 0.2 -10.7 40.7 -10.9 0 -5.2
GTGAACTTGATCCTTTGCAC 8689 SEQ ID NO:7559 0.2 -23.1 67.7 -23.3 0 -5
GGAGTTAATTGAAATTGAAA 8760 SEQ ID NO:7560 0.2 -14.7 48.7 -14.9 0 -3.9
AAGGGTTCTTGAAAAAAAAG 8945 SEQ ID NO:7561 0.2 -14.1 47.2 -14.3 0 -3.5 ACAAAGAGACCTTTCCAGAA 29 SEQ ID NO:7562 0.3 -21 61.3 -20.2 -1 -3.8
GAAAACAAAGAGACCTTTCC 33 SEQ ID NO:7563 0.3 -18.9 56.3 -18.1 -1 -4.1
TGACCACAGAGGTTTACAAA 91 SEQ ID NO:7564 0.3 -20.8 61.4 -19.5 -1.5 -7.1
GAGATTCTCTAGTAAAAAGG 516 SEQ ID NO:7565 0.3 -16.9 54.3 -17.2 0 -7
AATGACTGAAATTGTTTTCA 1142 SEQ ID NO: 7566 0.3 -16.9 53.8 -15.1 -2.1 -5.7
CCACAATGGTCTTTAAACCT 1164 SEQ ID NO: 7567 0.3 -22.2 63.5 -21.4 -1 -5.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CCCACAATGGTCTTTAAACC 1165 SEQ ID NO: 7568 0.3 -23.3 65.1 -22.7 -0.7 -5.4
GCTCAGACAGAACACAGTCA 1229 SEQ ID NO: 7569 0.3 -23.3 69 -22.8 -0.6 -4.7
TCCAAAACATAAAAGTGACT 1438 SEQ ID NO: 7570 0.3 -16.4 51.4 -16.7 0 -3
CAGGAAAGCCCAGCTAAAGG 1574 SEQ ID NO: 7571 0.3 -23.8 65.9 -23.1 -0.9 -6
CTCTTGAAGCAGCTGATGCT 1863 SEQ ID NO: 7572 0.3 -24.7 71.8 -22.4 -2.6 -8.7
ACCTTTGGAACTCAACTTTG 1937 SEQ ID NO: 7573 0.3 -21.2 62.5 -20.9 -0.3 -4
TGTTGTTTCCTTCAAGGTGC 2001 SEQ ID NO: 7574 0.3 -24.7 73.6 -24.2 -0.6 -5.2
AACTGAAAATGCTTGTTTTG 2190 SEQ ID NO: 7575 0.3 -17.2 53.9 -17 -0.2 -3.9
CGGCACAAACAGTGAGTCTC 2294 SEQ ID NO: 7576 0.3 -23.6 68 -22.3 -1.5 -6.4
GTCCACCCACCAAGGAAACC 2430 SEQ ID NO: 7577 0.3 -28 72.9 -27.6 -0.5 -4.7
ATTGAAATCTGGTAAGAGCT 2530 SEQ ID NO: 7578 0.3 -19.3 59.2 -18.9 -0.5 -5
CATTTCTGTCTAGATTCTTC 2629 SEQ ID NO: 7579 0.3 -20.9 66.3 -20.7 -0.2 -6
TGGCGGACATTTCTGTCTAG 2636 SEQ ID NO: 7580 0.3 -24.2 70.7 -22.6 -1.9 -8.6
TGCTGTGAAAATCCCAGTAA 2867 SEQ ID NO: 7581 0.3 -21.7 62.5 -21.5 -0.1 -3.7
AGGATTTTGCCAACTTGAAA 3045 SEQ ID NO: 7582 0.3 -20.3 59.9 -20 -0.3 -3.5
TGCCGACCACAGCAAAAATG 3153 SEQ ID NO: 7583 0.3 -22.7 61.8 -22.2 -0.6 -4.1
CTTACCAAAGAGCTGCATGC 3170 SEQ ID NO: 7584 0.3 -23.8 67.7 -23.3 -0.4 -8.7
CAACATGAAAACAATAAGGC 3350 SEQ ID NO: 7585 0.3 -15.6 49.6 -15.9 0 -5.2
GTCAGACTCTCCAACAGCAA 3785 SEQ ID NO: 7586 0.3 -24.4 70.6 -24.7 0 -5.1
GCTGCATACATAATATCCAT 4729 SEQ ID NO: 7587 0.3 -21.6 63.4 -21.9 0 -5.8
CAAAGTATAAATACATGTAC 4797 SEQ ID NO: 7588 0.3 -14.2 47.9 -13.8 -0.5 -8.2
TTGAAGTTATCTATGATGAC 4867 SEQ ID NO:7589 0.3 -17.4 55.9 -17.7 0 -4.2
ATGTTAAACAACGCAGGAAG 5425 SEQ ID NO: 7590 0.3 -18.4 55.4 -18.2 -0.2 -4.7
ACTATTAAGAATAGGTGCTA 5615 SEQ ID NO: 7591 0.3 -18.3 57.5 -16.9 -1.7 -6.7
CAAAACACGCTTTGTAAAGG 6035 SEQ ID NO: 7592 0.3 -18.1 54.4 -17.7 -0.4 -5.7
AAGATAACATCTGAAATTAC 6197 SEQ ID NO: 7593 0.3 -14.3 48.1 -13.7 -0.8 -4.7
TGTTACACTATCATAGGAAG 6374 SEQ ID NO: 7594 0.3 -18.6 58.4 -18.9 0 -3.4
GGAAGTAACTGAAACTGTAG 7029 SEQ ID NO: 7595 0.3 -17.6 55.2 -17.9 0 -3.3
AATACTTTGCATAAAAATAA 7150 SEQ ID NO: 7596 0.3 -12.7 44.6 -13 0 -5.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CTGAAACTTAGAATAAAATT 7187 SEQ ID NO:7597 0.3 -12.6 44.5 -12.9 0 -3.1
AAAGTGGAACAACTATTCTA 7292 SEQ ID NO:7598 0.3 -17 53.8 -16.3 -0.9 -5.1
GGCAAAGCAATACTGCAGCA 7313 SEQ ID NO: 7599 0.3 -23.9 67.4 -21.4 -2.8 -9.6
ACATATTTGATTTAATAGAA 7452 SEQ ID NO: 7600 0.3 -14.2 48.3 -14.5 0 -2.6
ATTAAAAGTGCAAAAGTAAA 7708 SEQ ID NO:7601 0.3 -12.8 44.7 -13.1 0 -5.4
GAAAATAATTTTCTTATGTA 7890 SEQ ID NO:7602 0.3 -13.8 47.5 -12.4 -1.7 -7.6
GATGTCATCAACCTGAAAAT 7904 SEQ ID NO:7603 0.3 -18.9 56.9 -18.7 -0.1 -4.9
GAATTAAAAAAATAAGACTA 8206 SEQ ID NO:7604 0.3 -9.9 39.4 -10.2 0 -3.2
AAAAAGTTAATATAAATTCT 8931 SEQ ID NO: 7605 0.3 -10.9 41.4 -11.2 0 -3.1
TTGACCACAGAGGTTTACAA 92 SEQ ID NO: 7606 0.4 -21.6 63.8 -20.4 -1.5 -7.1
TTTCCTTTATTCATTACTAT 742 SEQ ID NO: 7607 0.4 -19.2 60.3 -19.6 0 -0.7
TCATTTTCAGATCCAACATC 2227 SEQ ID NO:7608 0.4 -20.8 63.1 -21.2 0 -4.5
ATCCTGGATGACATACTGGC 2353 SEQ ID NO:7609 0.4 -24.4 70.2 -24.3 0 -7.6
ACCACAGCAAAAATGAAGAC 3148 SEQ ID NO: 7610 0.4 -18.2 54.6 -18.6 0 -4.1
GAAAACAATAAGGCACATGG 3344 SEQ ID NO: 7611 0.4 -17.5 53.4 -17.9 0 -5.2
CATTTCATTGTCATCATCAG 3455 SEQ ID NO: 7612 0.4 -20.6 63.8 -21 0 -1.9
TGCTTCCAGTACCTACACCA 3687 SEQ ID NO:7613 0.4 -27.4 76.2 -27.8 0 -4.4
TGCTCAACAATACTGTAGCA 4066 SEQ ID NO: 7614 0.4 -21.5 63.9 -19.1 -2.8 -7.7
ATAAGCAACCCATTTGAGAA 4238 SEQ ID NO: 7615 0.4 -20.4 59.5 -20.8 0.3 -4.1
CCGAGTTCTGAGTAGCCAAG 4345 SEQ ID NO: 7616 0.4 -25.3 71.7 -25.7 0 -3.2
TCATGTTAACACAGTGGTAG 4554 SEQ ID NO: 7617 0.4 -20.5 63.2 -20.1 -0.5 -8.7
AAAGATGATAAAGATGACAA 4814 SEQ ID NO:7618 0.4 -13.5 46.1 -13.9 0 -2.5
TTAAACAACGCAGGAAGGGA 5422 SEQ ID NO: 7619 0.4 -20.2 58.5 -20.6 0 -3.6
AGAATAGGTGCTAGCAATCC 5608 SEQ ID NO:7620 0.4 -22.6 66.6 -21.6 0 -10.8
CACACAAAACACGCTTTGTA 6039 SEQ ID NO:7621 0.4 -20.1 58.6 -19 -1.4 -6.6
AAAGATAACATCTGAAATTA 6198 SEQ ID NO: 7622 0.4 -13.4 46.1 -12.9 -0.8 -4.7
AATTTTGTAAAAATATGGCA 6824 SEQ ID NO: 7623 0.4 -15.1 49.4 -13.3 -2.2 -8.3
ACTTTGCATAAAAATAATCC 7147 SEQ ID NO: 7624 0.4 -16.1 51.1 -16.5 0 -5.1
GAGCTCTGAAACTTAGAATA 7192 SEQ ID NO: 7625 0.4 -18.3 57 -18.2 0 -8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TGTTTAATGAATGATACAGG 7516 SEQ ID NO: 7626 0.4 -16.7 53.4 -17.1 0 -2.6
TGGTTTGTGCAAAAAACAAA
8325 SEQ ID NO:7627 0.4 -16.3 51.1 -14.8 -1.8 -10.8 TTGGTTTGTGCAAAAAACAA
8326 SEQ ID NO: 7628 0.4 -17.1 53 -15.5 -1.7 -11.6 TTTGGTTTGTGCAAAAAACA
8327 SEQ ID NO: 7629 0.4 -17.9 54.9 -16.5 -1.7 -10.9 AGAATTAACATTAAACTTTT
8344 SEQ ID NO: 7630 0.4 -13.7 47 -14.1 0 -3.5
AAATTGAAAGCTATTGTAGG 8749 SEQ ID NO: 7631 0.4 -16.5 52.7 -16.9 0 -5.1
CAAGGGTTCTTGAAAAAAAA 8946 SEQ ID NO: 7632 0.4 -14.8 48.3 -13.6 -1.6 , -5.2
TTTAAAAATATGCATTACAA 9016 SEQ ID NO: 7633 0.4 -13.3 45.8 -13.7 0 -6.8
TCCTCTGGCAGCTGTTCAGC 131 SEQ ID NO: 7634 0.5 -29.2 84.9 -28.6 -0.9 -9.3
GAAGAGATTCTTTGCTCCTT 320 SEQ ID NO:7635 0.5 -22.8 68.1 -21.9 -1.3 -7.7
GAAAAGCTCCAGGTCCCTTC 375 SEQ ID NO:7636 0.5 -26.5 73.8 -27 0 -5
CTTAGATAGTCACAGCACCT 402 SEQ ID NO: 7637 0.5 -23.8 70.4 -24.3 0 -4.1
TCAAAGCTTGTGTAGCCATA 1552 SEQ ID NO: 7638 0.5 -22.8 67.1 -22.4 -0.7 -7.9
ACCAAATAAAATGAGCCCAA 1699 SEQ ID NO: 7639 0.5 -19.5 55.9 -20 0 -3.2
AGCCCTGGCACCATCCTGGA 2365 SEQ ID NO:7640 0.5 -32.4 85 -31 -1.9 -10.4
TTAGAGCTGAAGGTCCACCC 2442 SEQ ID NO: 7641 0.5 -26.7 74.9 -27.2 0 -5
TTGAAATCTGGTAAGAGCTT 2529 SEQ ID NO: 7642 0.5 -19.4 59.6 -19.2 -0.5 -5.2
ATGGCGGACATTTCTGTCTA 2637 SEQ ID NO: 7643 0.5 -24.2 70.4 -22 -2.7 -8.6
ACCAGCATGGCGGACATTTC 2643 SEQ ID NO: 7644 0.5 -26.5 73.3 -25 -2 -7.4
TAAGGCCAGAAAGAGGTTCA 3398 SEQ ID NO:7645 0.5 -22.1 64.7 -21.3 -1.2 -9
TGCAATCTGCAGATTATTCA 3473 SEQ ID NO: 7646 0.5 -21.2 63.8 -18.7 -2.3 -14
AGAATGGAAACTTTTTAATA 3990 SEQ ID NO:7647 0.5 -14.5 48.5 -15 0 -2.5
AAACCGGGATAAGGCTCTTA 4406 SEQ ID NO: 7648 0.5 -22.6 63.9 -23.1 0 -7.1
ATGAGACAGACCAACAGCAC 4483 SEQ ID NO: 7649 0.5 -22.5 65 -23 0 -4.1
CACTAATGTCAAACATGTTA 4581 SEQ ID NO:7650 0.5 -17.6 55.1 -17.2 -0.6 -9
ACATCACTAATGTCAAACAT 4585 SEQ ID NO: 7651 0.5 -17.9 55.5 -17.3 -1 -5
TGCATACATAATATCCATCC 4727 SEQ ID NO: 7652 0.5 -21.3 62.5 -21.8 0 -4.7
TGGTTACAAAATCAAAGACC 5025 SEQ ID NO: 7653 0.5 -17.5 53.8 -18 0 -3.7
ATCACTCGGAACAAGGTAGG 5320 SEQ ID NO: 7654 0.5 -22 64.2 -22.5 0 -3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
CCATGGCAATAAGCTGGACT
5964 SEQ ID NO: 7655 0, .5 -24 .3 68 -23.6 -1.1 -6.9 AAACATAACAGACTAAAATA
7077 SEQ ID NO: 7656 0, .5 -12 .4 44 -12.9 0 -2 AATAACTATTTACATAACAT
7381 SEQ ID NO: 7657 0, .5 -13 .8 47.1 -14.3 0 -2.3 TTTAAACTATGTTTAATGAA
7525 SEQ ID NO: 7658 0, .5 -13 .6 46.9 -12 -2.1 -8 TGGTAGAAAATATATTATAA
8054 SEQ ID NO: 7659 0, .5 -12 .8 45.2 -13.3 0 -6.2 TCAGATCAAGCACAGGTTTT
8558 SEQ ID NO: 7660 0, .5 -22 .2 66.9 -22.7 0 -5.4 AGTTAATTGAAATTGAAAGC
8758 SEQ ID NO: 7661 0, .5 -14 .7 48.9 -15.2 0 -3.9 CAATAACTATATCATTAATA
8911 SEQ ID NO: 7662 0, .5 -13 .4 46.4 -13.9 0 -5.1 AGTTTTCCACTGAGAATAAG
8992 SEQ ID NO: 7663 0 .5 -19 .2 59.2 -19.7 0 -2.9 TTTGACCACAGAGGTTTACA
93 SEQ ID NO: 7664 0 .6 -22 .4 66.3 -21.4 -1.5 -7.1 ATAATCTCTGATAAAACAGA
212 SEQ ID NO: 7665 0 .6 -15 .3 50.3 -14.7 -1.1 -5 ACCTTTTTCCGGAAAAGCTC
386 SEQ ID NO: 7666 0, .6 -23, .5 66 -20.9 -2.1 -14.4 ATAGTCACAGCACCTTTTTC
397 SEQ ID NO: 7667 0, .6 -23 .3 70.1 -23.9 0 -4.1 7AAAATAGTGCACATGATAAG
868 SEQ ID NO: 7668 0, .6 -15 .8 50.9 -15.4 0 -9.9 AGGTATAGATTCCAGTGAAT
951 SEQ ID NO: 7669 0, .6 -20 .7 63.2 -20.1 -1.1 -4.7 ACATCAGAAAGCTTCTTTAC
1201 SEQ ID NO: 7670 0, .6 -19 .4 60.1 -19.1 -0.7 -7 CGCTCAGACAGAACACAGTC
1230 SEQ ID NO: 7671 0, .6 -23 .4 67.9 -23.4 -0.3 -4.4 AGAGACAGGAAAGCCCAGCT
1579 SEQ ID NO: 7672 0 .6 -25 .7 71.6 -25.3 -0.9 -5.5 CCAAATAAAATGAGCCCAAG
1698 SEQ ID NO:7673 0 .6 -19 .3 55.6 -19.9 0 -3.2 TCTTTTTGTTCTGCTTCTTC
1777 SEQ ID NO: 7674 0 .6 -22 .9 71.9 -23.5 0 -3.6 TTCCAACAGCTCTCCTAACC
1901 SEQ ID NO: 7675 0 .6 -25 .9 72.4 -26.5 0 -4.4 AGCACCTTTGGAACTCAACT
1940 SEQ ID NO: 7676 0 .6 -23 .5 67.3 -23.5 -0.3 -4.5 AAACTGAAAATGCTTGTTTT
2191 SEQ ID NO: 7677 0, .6 -16, .5 52.3 -16.3 -0.6 -4.7 CATGCCGACCACAGCAAAAA
3155 SEQ ID NO: 7678 0, .6 -23, .4 62.9 -22.9 -1 -4.6 CTAGTTCTGACTCACTGCTG
3831 SEQ ID NO: 7679 0 .6 -23 .8 71.6 -23.7 -0.4 -4.4 TATGTTTGAAATCCATAAGC
4252 SEQ ID NO: 7680 0 .6 -18 .2 56.3 -18.8 0 -3 CCCATGATGCTAAAGATCAA
4510 SEQ ID NO: 7681 0 .6 -21 .3 61.1 -21.1 -0.6 -5.4 TGAAGCAGTGCAAGATAGCC
4687 SEQ ID NO: 7682 0 .6 -23 .5 68 -23.1 -0.7 -9.6 AAGTATAAATACATGTACAG
4795 SEQ ID NO: 7683 0 .6 -14 .9 49.7 -14.8 -0.5 -8.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ATACCTACAATGGAGAGAAT 5263 SEQ ID NO:7684 0.6 -19 57.5 -19.6 0 -3.3
CACTCGGAACAAGGTAGGGG 5318 SEQ ID NO:7685 0.6 -24 67.7 -24.6 0 -3
AATTTGGAACAAGCAGATCA 5567 SEQ ID NO:7686 0.6 -19 57.7 -18 -1.6 -8.6
GCTAGCAATCCATCCCAGCC 5599 SEQ ID NO: 7687 0.6 -30.2 80.9 -30.1 0 -8.8
GTAACTGACAAAAAAGAAAA 5714 SEQ ID NO: 7688 0.6 -11.8 42.7 -12.4 0 -2.3
GGCAAATAAAATATCAAGAC 6017 SEQ ID NO: 7689 0.6 -14.8 48.5 -15.4 0 -4
TTTGTTATAGTTACTTGATA 6239 SEQ ID NO:7690 0.6 -17.4 56.8 -18 0 -2.5
CAGTGTCAGCTGGTAATAAA 6684 SEQ ID NO: 7691 0.6 -20.6 62.4 -20.2 -0.9 -8.6
AAATGCACTAGAACAAATTT 6839 SEQ ID NO:7692 0.6 -15.5 49.9 -16.1 0 -5.5
TAAACCTCATTTACAAAAAT 6902 SEQ ID NO:7693 0.6 -14.5 47.8 -14.5 -0.3 -2.8
TGTCTGATCATTTGAGAGAC 6950 SEQ ID NO: 7694 0.6 -20.4 63.6 -20.1 -0.7 -8.3
CAAAAGTAAAGGTGTTTGTA 7698 SEQ ID NO:7695 0.6 -16.8 53.6 -17.4 0 -3.5
TGTGTTTCCTTGAAATCCAG 7755 SEQ ID NO: 7696 0.6 -22.3 65.6 -22.1 -0.6 -4.3
ATATATTATAACAAAGAAAT 8045 SEQ ID NO:7697 0.6 -10.9 41.3 -11.5 0 -3.9
AAACAAAAACAAAAAACCCC 8503 SEQ ID NO:7698 0.6 -14.3 46 -14.9 0 0
TAGGAGATAGCATCAATTAT 8816 SEQ ID NO:7699 0.6 -18.5 58 -19.1 0.1 -4.9
GAGAATAAGAGTTTGGTTTT 8981 SEQ ID NO:7700 0.6 -18.2 57.8 -18.8 0 -1.9
CAAATTGTCTTTAAAAATAT 9025 SEQ ID NO: 7701 0.6 -12.7 44.8 -13.3 0 -4.3
AACAAAGAGACCTTTCCAGA 30 SEQ ID NO: 7702 0.7 -21 61.3 -20.6 -1 -3.6
TAGATAGTCACAGCACCTTT 400 SEQ ID NO: 7703 0.7 -23 68.7 -23.7 0 -4.1
GTGGAGTTAAAATATACAAG
792 SEQ ID NO: 7704 0.7 -15.5 50.8 -16.2 0 -2.8 AGTGGAGTTAAAATATACAA
793 SEQ ID NO: 7705 0.7 -15.5 50.8 -16.2 0 -2.8 CACAATGGTCTTTAAACCTG
1163 SEQ ID NO: 7706 0.7 -20.2 59.9 -19.8 -1 -5.8
CATCACATCAGAAAGCTTCT 1205 SEQ ID NO:7707 0.7 -21.1 63.3 -21.1 -0.5 -7
AGTCAGGATCATCACATCAG 1214 SEQ ID NO:7708 0.7 -22.3 68.2 -22.5 -0.1 -5.3
AGGAAAGCCCAGCTAAAGGT 1573 SEQ ID NO: 7709 0.7 -24.3 67.8 -24 -0.9 -6
ACCAGGACAAAAAATATCAT 1672 SEQ ID NO: 7710 0.7 -16.9 52.2 -17.6 0 -4
GAAAGCTGTCTCTCTCTCCT 2022 SEQ ID NO: 7711 0.7 -25.6 75.8 -26.3 0 -5.6
TCTCCATTGAAATCTGGTAA 2535 SEQ ID NO: 7712 0.7 -20.4 61.2 -20.5 -0.3 -3.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TCTCCACACAGCACGCGGAA 3280 SEQ ID NO:7713 0.7 -27.4 73 -27.6 0 -7.9
AGTTCTGACTCACTGCTGAA 3829 SEQ ID NO: 7714 0.7 -23.1 69 -23.3 -0.2 -3.9
TGAGCTGGTTGCATTTAATT 3866 SEQ ID NO: 7715 0.7 -21.6 64.8 -20.7 -1.5 -5.1
CTTGACAGAATGGAAACTTT 3996 SEQ ID NO: 7716 0.7 -18.1 55.7 -18.8 0.5 -3.2
GAACACAATGAAAGTCTCAA 4094 SEQ ID NO:7717 0.7 -17.1 53.4 -17.2 -0.3 -3.1
ATGTTTGAAATCCATAAGCA 4251 SEQ ID NO: 7718 0.7 -19.2 58 -19.9 0 -4.1
CAGCACCAGGCATTAGTGAA 4273 SEQ ID NO:7719 0.7 -24.7 70.4 -23.8 -1.5 -5.4
AACATCACTAATGTCAAACA 4586 SEQ ID O:7720 0.7 -17.2 53.8 -16.3 -1.5 -4.6
TGGCCACTTGAAGCAGTGCA 4695 SEQ ID NO:7721 0.7 -27 75.4 -26.1 -1.5 -9.6
ATGTTGAGGCAGATGAGGAT 5071 SEQ ID NO:7722 0.7 -22.6 67.5 -23.3 0 -4
TTCGGCCAATCCTGGCAAGA 5343 SEQ ID NO: 7723 0.7 -27.2 73.1 -23.6 -4.3 -11.1
CTAGCAATCCATCCCAGCCA 5598 SEQ ID NO:7724 0.7 -29.1 77.7 -29.8 0 -4.1
ACAATTGATCACAAAGATAA 6489 SEQ ID NO: 7725 0.7 -15.1 49.4 -14.9 -0.8 -7.3
GGTAATAAAAACAGCAACCT 6673 SEQ ID NO: 7726 0.7 -18.1 54.5 -18.8 0 -4.1
GTCTGATCATTTGAGAGACA 6949 SEQ ID NO:7727 0.7 -21.1 65 -20.6 -1.1 -9.1
AATACTGCAGCAGAAAGTGG 7305 SEQ ID NO: 7728 0.7 -20.7 61.5 -20.1 -0.7 -10.4
CCAGAGAGATACCATATGAT 7739 SEQ ID NO: 7729 0.7 -21.4 62.9 -22.1 0 -6
TGAAAATAATTTTCTTATGT 7891 SEQ ID NO: 7730 0.7 -14.1 48 -12.4 -2.4 -8.4
ATAAAACCCATTATCTAACT 8023 SEQ ID NO: 7731 0.7 -17.7 54.1 -18.4 0 -2.4
GAAATCCATAAAACCCATTA 8030 SEQ ID NO: 7732 0.7 -18.6 54.8 -19.3 0 -1.9
AGCACAGGTTTTATTAATTA 8550 SEQ ID NO: 7733 0.7 -18.7 58.8 -19.4 0 -4.2
GTTAATTGAAATTGAAAGCT 8757 SEQ ID NO: 7734 0.7 -15.6 50.6 -16.3 0 -4.8
TTAATATAAATTCTCAATAA 8925 SEQ ID NO: 7735 0.7 -11.9 43.5 -12.6 0 -3.1
GAATAAGAGTTTGGTTTTGA 8979 SEQ ID NO: 7736 0.7 -18.2 57.6 -18.9 0 -1.9
TCTTTTTGCCCATCCAAAAC 1450 SEQ ID NO: 7737 0.8 -23.4 65.7 -22.7 -1.4 -5.4
GCCATAGTTGGGGTTTCGAC 1538 SEQ ID NO:7738 0.8 -26.5 75.4 -25.8 -1.4 -7.3
CCAGCTAAAGGTGTCAAAGC 1565 SEQ ID NO: 7739 0.8 -22.8 65.9 -22.9 -0.4 -4.6
ATGACCAGGACAAAAAATAT 1675 SEQ ID NO:7740 0.8 -16.4 51.1 -17.2 0 -4
CAGTGAGTCTCTCCTGCTTT 2285 SEQ ID NO: 7741 0.8 -26.5 79.2 -26.1 -1.1 -5.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GAAGGTCCACCCACCAAGGA 2434 SEQ ID NO: 7742 0.8 -28.3 75.1 -27.9 -1.1 -5.8
GACATTTCTGTCTAGATTCT 2631 SEQ ID NO: 7743 0.8 -21.2 66.3 -20.1 -1.9 -6.1
TTTAAGACAATGCAAATAGT 2770 SEQ ID NO: 7744 0.8 -16 51.5 -16.1 -0.5 -7.4
GATATTCCAGCCTTCTTGGA 2930 SEQ ID NO: 7745 0.8 -25.5 73.4 -25.3 -0.9 -6
GTGTGGGCCAGGATTTTGCC 3054 SEQ ID NO: 7746 0.8 -29.2 81.6 -29.3 -0.4 -6.8
CTCTCCACACAGCACGCGGA 3281 SEQ ID NO: 7747 0.8 -29 77 -29.3 0 -7.9
TGAAAACAATAAGGCACATG 3345 SEQ ID NO:7748 0.8 -16.3 51.1 -17.1 0 -4.7
TAAAAAAGGCTTTTTGGAAA 3546 SEQ ID NO:7749 0.8 -14.9 48.7 -14.2 -1.4 -7.7
TTGTGCTCAACAATACTGTA 4069 SEQ ID NO:7750 0.8 -20.3 61.7 -19.8 -1.2 -7.6
AGCACCAGGCATTAGTGAAA 4272 SEQ ID NO: 7751 0.8 -23.3 67 -22.5 -1.5 -5.4
TGAGACAGACCAACAGCACA 4482 SEQ ID NO: 7752 0.8 -23.2 66.2 -24 0 -4.1
AAACAACGCAGGAAGGGACA 5420 SEQ ID NO: 7753 0.8 -21.3 60.3 -22.1 0 -3.6
TGTTAAACAACGCAGGAAGG 5424 SEQ ID NO: 7754 0.8 -19.6 57.7 -19.9 -0.2 -3.8
CTGACAAAAAAGAAAATCCC 5710 SEQ ID NO: 7755 0.8 -15.8 49.4 -16.6 0 -2.2
GAAGGATATGATGATGTAAC 5729 SEQ ID NO: 7756 0.8 -17 54 -17.8 0 -2
TTACACTATCATAGGAAGGA 6372 SEQ ID NO: 7757 0.8 -19.2 59.3 -20 0 -3.2
CTGTAAACAATTGATCACAA 6495 SEQ ID NO: 7758 0.8 -16.6 52.4 -16.6 -0.6 -7.2
GCAGTGACAGAGAGGTCACT 6620 SEQ ID NO: 7759 0.8 -25 74.6 -21.9 -3.9 -10.5
AATCCAGAGAGATACCATAT 7742 SEQ ID NO: 7760 0.8 -20.5 61.1 -21.3 0 -3
TGTTGTAAAATTCATGTAAA 8596 SEQ ID NO: 7761 0.8 -14.8 49.3 -14.9 -0.4 -6.6
TTGAAATTGAAAGCTATTGT 8752 SEQ ID NO: 7762 0.8 -16.3 52.2 -17.1 0 -5.1
GGTTCTTGAAAAAAAAGTTA 8942 SEQ ID NO: 7763 0.8 -14.6 48.6 -15.4 0 -3.5
CATATTTAGATCCAAATTGT 9037 SEQ ID NO: 7764 0.8 -17.9 55.8 -18.7 0 -2.4
CGGCCTCTTTTTGTTCTGCT 1782 SEQ ID NO: 7765 0.9 -27.7 78.6 -28.6 0 -6.7
TCCAACAGCTCTCCTAACCC 1900 SEQ ID NO:7766 0.9 -27.8 75.4 -28.7 0 -4.4
GTTTCAGTGGTGGTGCCCTC 2488 SEQ ID NO:7767 0.9 -29.6 86.1 -29.9 -0.3 -5.1
AACTGAGGCTGACAATAATT 2958 SEQ ID NO:7768 0.9 -18.8 57.1 -19.7 0 -3.7
ATTCTTCCTACTGCAATCTG 3484 SEQ ID NO: 7769 0.9 -22.7 67.4 -23.6 0 -4.9
GAATGACATATAATCATTTT 3731 SEQ ID NO: 7770 0.9 -15.5 50.8 -14.5 -1.9 -8.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
AGACTCTCCAACAGCAATTG
3782 SEQ ID NO: 7771 0.9 -22.2 64.9 -23.1 0 -6.3 GAACTCTTCAGTATTTAAGT
3812 SEQ ID NO: 7772 0.9 -18.8 59.7 -19.2 -0.2 -3.1 TGTTTGAAATCCATAAGCAA
4250 SEQ ID NO: 7773 0.9 -18.5 56.2 -19.4 0 -4.1 TGCTAAAGATCAACCAGAAG
4503 SEQ ID NO: 7774 0.9 -18.8 56.7 -19.7 0 -5.4 CAGCCTTTAAATGTGGCCAC
4708 SEQ ID NO: 7775 0.9 -25 69.7 -23.8 -1.8 -12 TACCTACAATGGAGAGAATC
5262 SEQ ID NO: 7776 0.9 -19.4 58.8 -20.3 0 -3.3 AAGGTAGGGGACACAGAATA
5308 SEQ ID NO: 7777 0.9 -21 62.6 -21.3 -0.3 -2.8 GATCACTCGGAACAAGGTAG
5321 SEQ ID NO: 7778 0.9 -21.4 63 -22.3 0 -4.7 GAACATGTCATCAATTCCAG
5522 SEQ ID NO: 7779 0.9 -20.7 61.9 -21.6 0 -6.9 AACAAGCAGATCATGCTGTT
5560 SEQ ID NO: 7780 0.9 -21.7 64.4 -19.5 -3.1 -11.3 TGTCAGGGTCACAGTCGGGT
5640 SEQ ID NO: 7781 0.9 -27.9 81.5 -28.8 0 -3 TGAAGTTCTCCAGGATGACC
5775 SEQ ID NO: 7782 0.9 -24.2 70 -24.6 -0.2 -6.7 AAAATATCAAGACAGTGGAT
6010 SEQ ID NO: 7783 0.9 -16.5 52.5 -17.4 0 -4.6 TTGTGATTAAAAATCAAAAG
7950 SEQ ID NO: 7784 0.9 -11.9 43.1 -10.8 -2 -6.9 AAGCACAGGTTTTATTAATT
8551 SEQ ID NO: 7785 0.9 -18.3 57.3 -19.2 0 -4.2 ATTAGCCACCAAGTAATTAG
8833 SEQ ID NO: 7786 0.9 -20.5 61 -20.9 -0.1 -4.2 ATAATGCATTTAAGTAACAA
8867 SEQ ID NO: 7787 0.9 -15.1 49.6 -15.3 0 -8.8 GTTTACAAATTAGTTACAAT
80 SEQ ID NO: 7788 1 -15.6 51.3 -16.6 0 -3.4 AGGTCCTGGGGGTACCAACA
485 SEQ ID NO: 7789 1 -28.5 78.7 -26.7 -2.8 -8.8 ATGAGTCGAAATAGAGACAG
1591 SEQ ID NO: 7790 1 -18 55.9 -17.5 -1.4 -4.7 GACCAGGACAAAAAATATCA
1673 SEQ ID NO: 7791 1 -17.5 53.3 -18.5 0 -4 TCTGAAACTGAAAATGCTTG
2195 SEQ ID NO: 7792 1 -16.9 52.8 -17.9 0 -3.6 CGTTAGAGCTGAAGGTCCAC
2444 SEQ ID NO: 7793 1 -24.7 70.9 -25.7 0 -5 CAGTAGGTGACGTTAGAGCT
2454 SEQ ID NO: 7794 . 1 -23.9 71.1 -24.3 -0.3 -5.4 TTGTGTTGGTCAGAATGCTG
2598 SEQ ID NO: 7795 1 -22.7 68.3 -22.8 -0.8 -4.2 ATGGATCCATAACAATTAAA
2733 SEQ ID NO: 7796 1 -16.5 51.8 -15.9 0 -11.3 ACAAATGGATCCATAACAAT
2737 SEQ ID NO: 7797 1 -17.6 53.7 -16.6 0 -12.2 AATAGTAATAAGGATCCATG
2910 SEQ ID NO: 7798 1 -17.1 53.9 -17.2 0 -9.6 ACTCTCCACACAGCACGCGG
3282 SEQ ID NO: 7799 1 -28.6 76.4 -29.1 0 -7.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CTCAATAATAAGGCCAGAAA 3406 SEQ ID NO:7800 1 -18.2 55 -18.7 0 -7.7
ACCAGAAGATGAGACAGACC 4491 SEQ ID NO:7801 1 -22.3 64.5 -23.3 0 -2.4
AGATCAACCAGAAGATGAGA 4497 SEQ ID NO: 7802 1 -19.6 59.2 -20.6 0 -5.4
ACTTGAAGCAGTGCAAGATA 4690 SEQ ID NO: 7803 1 -20.9 62.7 -20.2 -1.7 -9.6
TGACAAAGTATAAATACATG 4800 SEQ ID NO: 7804 1 -13.9 47.1 -14.2 -0.5 -5.8
ACCAATGAATAGATTCAGAG 4847 SEQ ID NO:7805 1 -18.2 56.2 -18.4 -0.6 -7.3
TTAACATAGGCAAAGTTGGA 5494 SEQ ID NO: 7806 1 -19.1 58.2 -20.1 0 -4.2
GTGCTAGCAATCCATCCCAG 5601 SEQ ID NO: 7807 .1 -27.6 76.4 -27.2 0 -10.8
TGGCAATAAGCTGGACTTTG 5961 SEQ ID NO:7808 1 -21.8 63.9 -21.4 -1.3 -6.1
AATAAAATTTGCACTTGCTG 7176 SEQ ID NO:7809 1 -17.5 54.2 -17.9 -0.3 -6.5
TTAAACTATGTTTAATGAAT 7524 SEQ ID NO:7810 1 -13.5 46.6 -12.7 -1.8 -7.5
GTAAATAGCTTCAAATTATT 7681 SEQ ID NO: 7811 1 -15.6 51.2 -16.6 0 -4.6
ACATTATTTATATTTAAACA 7836 SEQ ID NO: 7812 1 -13.7 47.2 -14.1 -0.3 -4.9
TATATTATAACAAAGAAATC 8044 SEQ ID NO: 7813 1 -11.3 42.2 -12.3 0 -4.4
CTTTTGGTTTGTGCAAAAAA 8329 SEQ ID NO: 7814 1 -18 55.4 -17.3 -1.7 -7.9
TAGTTTTGTAAAAAGAATTA 8357 SEQ ID NO: 7815 1 -13 45.8 -12.6 -1.3 -9.3
CATTTAAGTAACAAAGAATG 8861 SEQ ID NO: 7816 1 -13.5 46.3 -14.5 0 -3.2
TTGAAAAAAAAGTTAATATA 8937 SEQ ID NO: 7817 1 -9.5 38.7 -10.5 0 -2.8
CTGAGAATAAGAGTTTGGTT 8983 SEQ ID NO:7818 1 -18.9 59 -19.9 0 -1.5
CTGGGGGTACCAACAGTGCC 480 SEQ ID NO: 7819 1.1 -28.7 78.5 -27.5 -2.3 -9.8
TGGAGTTAAAATATACAAGG 791 SEQ ID NO: 7820 1.1 -15.5 50.5 -16.6 0 -2.7
AGGGTTTAGTGGAGTTAAAA 800 SEQ ID NO: 7821 1.1 -19.4 60.2 -20.5 0 -2.8
TAACAGGGTTTAGTGGAGTT 804 SEQ ID NO: 7822 1.1 -21.7 66.5 -22.8 0 -3.6
ACACTGAAATCCAGCCAGTT 1042 SEQ ID NO: 7823 1.1 -24.1 68.2 -24 -1.1 -6.3
ATGGTCTTTAAACCTGGAAT 1159 SEQ ID NO: 7824 1.1 -20.4 60.6 -20.4 -1 -5.8
CCCATCCAAAACATAAAAGT 1442 SEQ ID NO:7825 1.1 -19.4 56.1 -20.5 0 -2.8
C7AAATAAAATGAGCCCAAGA 1697 SEQ ID NO: 7826 1.1 -17.9 53.4 -19 0 -3.2
CTTCCGTTTCAGTGGTGGTG 2493 SEQ ID NO: 7827 1.1 -26.7 77.4 -27.8 0 -4.1
CTACTGAATTGCTCAGTCAT 2821 SEQ ID NO: 7828 1.1 -21.8 65.8 -20.1 -2.8 -8.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TTCCTACAGTCAACACACTA 2838 SEQ ID NO:7829 1.1 -22.2 65.8 -22.8 -0.1 -2.9
TCCATGGCAATGATCTTGAG 2896 SEQ ID NO:7830 1.1 -22.7 66.2 -23 -0.5 -8.7
TCCAGCCTTCTTGGAAATAG 2925 SEQ ID NO:7831 1.1 -23.4 67.4 -23.3 -1.1 -6
ATCCACTCTCCACACAGCAC 3286 SEQ ID NO:7832 1.1 -27.1 76.3 -28.2 0 -4.1
CCAGTACCTACACCACTGGT 3682 SEQ ID NO:7833 1.1 -27.7 76.4 -26.4 -2.4 -7.3
CTTCCAGTACCTACACCACT 3685 SEQ ID NO:7834 1.1 -26.7 74.6 -27.8 0 -4.4
TGCTGAACTCTTCAGTATTT 3816 SEQ ID NO:7835 1.1 -21.3 65.3 -19.7 -2.7 -10.1
TAGTTCTGACTCACTGCTGA 3830 SEQ ID NO:7836 1.1 -23.5 70.9 -23.9 -0.4 -4.4
GACAGAATGGAAACTTTTTA 3993 SEQ ID NO:7837 1.1 -17 53.7 -17.4 -0.4 -2.5
GTGCTCAACAATACTGTAGC 4067 SEQ ID NO: 7838 1.1 -22 65.8 -21.4 -1.7 -5.8
CCAGAAGATGAGACAGACCA 4490 SEQ ID NO: 7839 1.1 -22.8 65.1 -23.9 0 -2.4
GACGGATCACTCGGAACAAG 5325 SEQ ID NO: 7840 1.1 -22.1 62.6 -22.7 -0.1 -5.3
CCTGGCAAGACGGATCACTC 5333 SEQ ID NO: 7841 1.1 -25.9 71.7 -26.3 -0.4 -5.3
GTTAAACAACGCAGGAAGGG 5423 SEQ ID NO: 7842 1.1 -20.8 60 -21.9 0 -3.6
GAAGTTCTCCAGGATGACCG 5774 SEQ ID NO: 7843 1.1 -25 70.2 -24.7 -1.3 -7.2
TCCATGGCAATAAGCTGGAC 5965 SEQ ID NO: 7844 1.1 -23.8 67.6 -22.7 -2.2 -8
TACTTTGCATAAAAATAATC 7148 SEQ ID NO: 7845 1.1 -13.8 47 -14.9 0 -4.8
AGAATACTTTGCATAAAAAT 7152 SEQ ID NO: 7846 1.1 -14.3 47.8 -15.4 0 -5.1
TTAGAATAAAATTTGCACTT 7180 SEQ ID NO:7847 1.1 -15.2 49.9 -16.3 0 -5.2
AGTCTGCATACGTAAATACT 8187 SEQ ID NO:7848 1.1 -20 60.4 -21.1 0 -6.6
GGAATTAAAAAAATAAGACT 8207 SEQ ID NO:7849 1.1 -11.4 42.1 -12.5 0 -3.2
AAAAGTTCACAAAGCTGCTT 8665 SEQ ID NO:7850 1.1 -19.3 58.2 -19.6 0 -9.2
ATTAGGAGATAGCATCAATT 8818 SEQ ID NO:7851 1.1 -18.9 58.9 -19.1 -0.7 -5.7
AATATAAATTCTCAATAACT 8923 SEQ ID NO: 7852 1.1 -13.2 45.9 -14.3 0 -3.1
TTTACAAATTAGTTACAATT 79 SEQ ID NO: 7853 1.2 -14.5 48.9 -15.7 0 -3.3
AAGCCACTCTACTATGAATC 293 SEQ ID NO: 7854 1.2 -21 62.7 -22.2 0 -3.2
AGATAGTCACAGCACCTTTT 399 SEQ ID NO:7855 1.2 -23.4 69.7 -24.6 0 -4.1
ACCTTAGATAGTCACAGCAC 404 SEQ ID NO: 7856 1.2 -23.1 68.9 -24.3 0 -4.1
AGAGATTCTCTAGTAAAAAG 517 SEQ ID NO: 7857 1.2 -15.7 51.9 -16 -0.8 -8.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AAATAGTGCACATGATAAGC 867 SEQ ID NO:7858 1.2 -18.3 56.4 -18.8 0 -9.1
ACAGTCAGGATCATCACATC 1216 SEQ ID NO:7859 1.2 -22.5 68.5 -23.7 0 -5.3
AAATTCACCAAATAAAATGA 1705 SEQ ID NO: 7860 1.2 -13.5 45.6 -14.7 0 -3.1
TGCTTCTTCCAAGGTGGCCT 1766 SEQ ID NO:7861 1.2 -28.9 80.8 -29.2 -0.7 -7.3
GCACCTTTGGAACTCAACTT 1939 SEQ ID NO: 7862 1.2 -23.6 67.4 -24.2 -0.3 -3.8
GCTGAAGGTCCACCCACCAA 2437 SEQ ID NO: 7863 1.2 -29.2 76.8 -29.2 -1.1 -4.9
CCAGTAGGTGACGTTAGAGC 2455 SEQ ID NO: 7864 1.2 -25 72.8 -25.6 -0.3 -5.4
GTCTAGATTCTTCAAGTTCT 2622 SEQ ID NO:7865 1.2 -21.3 67.4 -22.5 0.6 -6
AGGCCAGAAAGAGGTTCAGA 3396 SEQ ID NO:7866 1.2 -23.7 69 -23.6 -1.2 -9
AAGGCTTTTTGGAAACACTC 3541 SEQ ID NO: 7867 1.2 -20.4 61.2 -20.8 -0.6 -6.3
TTTTCAAAGTCAGACTCTCC 3793 SEQ ID NO:7868 1.2 -21.7 66 -22.9 0 -7.3
GAGCTGGTTGCATTTAATTT 3865 SEQ ID NO:7869 1.2 -21.7 65.3 -21.3 -1.5 -5.1
CAAACCGGGATAAGGCTCTT 4407 SEQ ID NO: 7870 1.2 -23.6 65.5 -24.8 0 -7.1
ACCCATGATGCTAAAGATCA 4511 SEQ ID NO:7871 1.2 -22.2 63.6 -23.4 0.1 -5.4
7AATTCACACCCATGATGCTA 4518 SEQ ID NO: 7872 1.2 -23.3 66.1 -24.5 0 -4.5
CAAACAAATTCACACCCATG 4524 SEQ ID NO: 7873 1.2 -19.8 57.2 -21 0 -3.9
GAGCTTGCTTGCCAAGAGCC 4626 SEQ ID NO: 7874 1.2 -28.4 78.7 -27.6 -2 -10.3
CAAAGACTTGTCTGGTTACA 5037 SEQ ID NO:7875 1.2 -20.7 62.6 -20.4 -1.4 -7
AGTGAACAGAACAATGAACA 5162 SEQ ID NO:7876 1.2 -16.9 52.9 -18.1 0 -3.1
AGTGTCAGCTGGTAATAAAA 6683 SEQ ID NO:7877 1.2 -19.2 59.1 -19.9 0 -8
ATACTTTGCATAAAAATAAT 7149 SEQ ID NO:7878 1.2 -13.4 46 -14.6 0 -5.1
TAGAATAAAATTTGCACTTG 7179 SEQ ID NO: 7879 1.2 -15.1 49.6 -16.3 0 -5.2
AGAGCTCTGAAACTTAGAAT 7193 SEQ ID NO: 7880 1.2 -18.6 57.7 -18.9 0 -9.5
GGAACAACTATTCTAAAGCA 7287 SEQ ID NO:7881 1.2 -18.3 56.1 -18.9 -0.3 -4.4
GCAAAGCAATACTGCAGCAG 7312 SEQ ID NO: 7882 1.2 -22.7 65.2 -21.9 -2 -9.9
ATATTTGCCCAAACATGCAC 7411 SEQ ID NO:7883 1.2 -22.6 63.9 -23.1 -0.4 -5.5
TACATTATTTATATTTAAAC 7837 SEQ ID NO:7884 1.2 -12.7 45.4 -13.3 -0.3 -4.9
ATATTATAACAAAGAAATCC 8043 SEQ ID NO: 7885 1.2 -13.6 46.4 -14.8 0 -4.4
AATTAAAAAAATAAGACTAG 8205 SEQ ID NO:7886 1.2 -9.3 38.4 -10.5 0 -4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
CATTAAACTTTTGGTTTGTG
8336 SEQ ID NO:7887 1.2 -18.3 57.3 -18.1 -1.3 -5.6 ACATTAAACTTTTGGTTTGT
8337 SEQ ID NO:7888 1.2 -18.5 57.9 -18.6 -1 -4.5 CAGATCAAGCACAGGTTTTA
8557 SEQ ID NO:7889 1.2 -21.5 64.8 -22.7 0 -5.4
TACATATTTAGATCCAAATT 9039 SEQ ID NO:7890 1.2 -16.6 53 -17.8 0 -2.1
CTGTGGATAAGAAAACAAAG 43 SEQ ID NO:7891 1.3 -14.9 48.7 -16.2 0 -2.9
TACCTTAGATAGTCACAGCA 405 SEQ ID NO:7892 1.3 -22.6 67.7 -23.9 0 -4.1
AGGTGGCACTGAATCGGAAA
768 SEQ ID NO:7893 1.3 -22.7 64.4 -24 0 -4.5 TCGAAATAGAGACAGGAAAG
1586 SEQ ID NO: 7894 1.3 -16.6 52.2 -17.9 0 -4.2
GCTTCTTCCAAGGTGGCCTG 1765 SEQ ID NO: 7895 1.3 -28.9 80.8 -29.3 -0.7 -7.3
GTCAGAATGCTGGCTATGCT 2590 SEQ ID NO: 7896 1.3 -25.2 73.3 -24.9 -1.5 -6.6
TCCTACAGTCAACACACTAC 2837 SEQ ID NO: 7897 1.3 -22.3 66 -23.1 -0.1 -2.9
ACTGAGGCTGACAATAATTC 2957 SEQ ID NO:7898 1.3 -19.9 60.3 -21.2 0 -3.7
TTGATCTTGCAGACACATTC 3199 SEQ ID NO:7899 1.3 -21.5 65.2 -22.8 0 -5.2
TCTCTATCCACTCTCCACAC 3291 SEQ ID NO:7900 1.3 -26 75.6 -27.3 0 -0.6
ACTCAATAATAAGGCCAGAA 3407 SEQ ID NO-.7901 1.3 -19.1 57.2 -19.9 0 -7.7
AAATGAACTCAATAATAAGG 3413 SEQ ID NO:7902 1.3 -13.2 45.5 -14.5 0 -3.9
ACTTACTTGACAGAATGGAA 4001 SEQ ID NO: 7903 1.3 -18.6 57.2 -19.2 -0.4 -3.2
AAAATCAAAGACCATTCCTT 5018 SEQ ID NO:7904 1.3 -18.6 55.7 -19.9 0 -2.8
TACAAAATCAAAGACCATTC 5021 SEQ ID NO:7905 1.3 -16.2 51.3 -17.5 0 -2.8
AACACTAGGTTGATCCGGGA 5146 SEQ ID NO:7906 1.3 -24.3 68.6 -24.4 -1.1 -6.6
TAAAATATCAAGACAGTGGA 6011 SEQ ID NO: 7907 1.3 -16.2 51.9 -17.5 0 -4.6
AGATAACATCTGAAATTACG 6196 SEQ ID NO: 7908 1.3 -15.8 50.7 -16.4 -0.4 -3.9
CAAAAGACACATACACTGTG 7474 SEQ ID NO:7909 1.3 -17.9 55 -17.1 -2.1 -6.8
TTATATTTTTACATTATTTA 7846 SEQ ID NO:7910 1.3 -14.2 49.1 -15.5 0 -2.2
TCATCAACCTGAAAATAATT 7900 SEQ ID NO:7911 1.3 -16.2 51.2 -17 -0.1 -2.9
TTGAAAAATCTTATGGATTC 7982 SEQ ID NO: 7912 1.3 -15.3 50.4 -15.2 -1.3 -5.2
TGAAAAAAAAGTTAATATAA 8936 SEQ ID NO: 7913 1.3 -8.7 37.3 -10 0 -2.8
GTTTTCCACTGAGAATAAGA 8991 SEQ ID NO:7914 1.3 -19.8 60.3 -21.1 0 -2.9
GAGGTGGCACTGAATCGGAA
769 SEQ ID NO:7915 1.4 -24 67.8 -25.4 0 -4.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TAGTGGAGTTAAAATATACA 794 SEQ ID NO: 7916 1.4 -15.9 51.9 -17.3 0 -2.8
CACATCAGAAAGCTTCTTTA 1202 SEQ ID NO: 7917 1.4 -19.9 60.8 -20.4 -0.7 -7
GTCAAAGCTTGTGTAGCCAT 1553 SEQ ID NO: 7918 1.4 -24.3 71 -24.1 -1.5 -7.9
GCCTCTTTTTGTTCTGCTTC 1780 SEQ ID NO: 7919 1.4 -26.2 78.5 -27.6 0 -3.6
GAACTTTCCAACAGCTCTCC 1906 SEQ ID NO: 7920 1.4 -24.9 71 -26.3 0 -4.4
TGAAGAACTTTCCAACAGCT 1910 SEQ ID NO: 7921 1.4 -21.1 61.9 -21.8 -0.4 -4.7
CGGATTTGGGAAAGCTGTCT 2031 SEQ ID NO: 7922 1.4 -23.6 67.4 -25 0.5 -6.4
TAGAGCTGAAGGTCCACCCA 2441 SEQ ID NO: 7923 1.4 -27.3 75.6 -27.8 -0.8 -5.8
GTTAGAGCTGAAGGTCCACC 2443 SEQ ID NO: 7924 1.4 -25.9 74.7 -27.3 0 -4.6
AGGTGACGTTAGAGCTGAAG 2450 SEQ ID NO: 7925 1.4 -22.2 65.9 -23.6 0 -5
TCATGTGCCACCGTGGGAGC 3231 SEQ ID NO: 7926 1.4 -29.8 80.8 -30.1 -1 -9.1
TCAATAATAAGGCCAGAAAG 3405 SEQ ID NO: 7927 1.4 -17.3 53.4 -18.2 0 -7.7
ATTTGAGAAGCATTTCCAGA 4227 SEQ ID NO: 7928 1.4 -21.1 63.3 -21.7 -0.6 -4.1
ATGATGCTAAAGATCAACCA 4507 SEQ ID NO: 7929 1.4 -19.5 58.1 -20.1 -0.6 -5.4
TCACTAATGTCAAACATGTT 4582 SEQ ID NO: 7930 1.4 -18.3 56.9 -18.5 -1.1 -8.7
CACTCAAATTGTTAACATCA 4599 SEQ ID NO:7931 1.4 -17.9 55.7 -18.8 0 -8.3
TGCTTGCCAAGAGCCTGACA 4621 SEQ ID NO: 7932 1.4 -27.4 75.2 -27.4 -1.3 -6.2
TCGGCCAATCCTGGCAAGAC 5342 SEQ ID NO: 7933 1.4 -27.3 73.3 -24.4 -4.3 -11
GAATAGGTGCTAGCAATCCA 5607 SEQ ID NO: 7934 1.4 -23.3 67.5 -23.4 0.4 -10.7
CTCTTGTCAACGTTGATACC 6655 SEQ ID NO: 7935 1.4 -22.7 66.3 -21.8 -0.1 -12.8
TTTGAGCAAAAATTTTATCT 6987 SEQ ID NO: 7936 1.4 -15.8 51.3 -17.2 0 -7.2
TGCACTTGCTGAAACAGAAT 7167 SEQ ID NO: 7937 1.4 -20.4 60.2 -21.1 -0.5 -6.5
TACATATTTGATTTAATAGA 7453 SEQ ID NO:7938 1.4 -14.6 49.4 -16 0 -2.6
GCAAAAGTAAAGGTGTTTGT 7699 SEQ ID NO: 7939 1.4 -18.9 58.1 -19.5 -0.6 -4.2
TATTTTTACATTATTTATAT 7843 SEQ ID NO: 7940 1.4 -14.1 48.8 -15.5 0 -2
TGCAAAAAACAAAAATTTAT 8318 SEQ ID NO:7941 1.4 -11 41.2 -12.4 0 -5.2
ACTTTTGGTTTGTGCAAAAA 8330 SEQ ID NO: 7942 1.4 -18.9 57.7 -18.6 -1.7 -7.9
TTAGGAGATAGCATCAATTA 8817 SEQ ID NO: 7943 1.4 -18.6 58.3 -19.1 -0.7 -5.7
AAGAATGTAACATTTATTAG 8848 SEQ ID NO: 7944 1.4 -14 47.9 -14.5 -0.8 -6.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo AAAAGTTAATATAAATTCTC 8930 SEQ ID NO:7945 1.4 -12 43.7 -13.4 0 -3.1
AAATTGTCTTTAAAAATATG 9024 SEQ ID NO: 7946 1.4 -12 43.5 -13.4 0 -4.3
TTTTGACCACAGAGGTTTAC 94 SEQ ID NO: 7947 1.5 -21.8 65.5 -22.3 -0.9 -7.1
CATAATCTCTGATAAAACAG
213 SEQ ID NO: 7948 1.5 -15.4 50.3 -16.4 -0.2 -3.7 ATAGCAATTTTCCTAACAGG
817 SEQ ID NO: 7949 1.5 -20.2 60.7 -21.1 -0.3 -4.7
CAGGATCATCACATCAGAAA 1211 SEQ ID NO: 7950 1.5 -19.9 60.1 -20.9 -0.1 -5.3
TCAGACAGAACACAGTCAGG 1227 SEQ ID NO: 7951 1.5 -21.8 65.5 -21.8 -1.4 -4.6
GAAGAACTTTCCAACAGCTC 1909 SEQ ID NO: 7952 1.5 -21.5 63.4 -23 0 -4.4
CTGAAGAACTTTCCAACAGC 1911 SEQ ID NO: 7953 1.5 -21.1 61.9 -21.9 -0.4 -4.1
CACGGATACTCAAGAGAGAC 2142 SEQ ID NO: 7954 1.5 -20.7 61.5 -20.6 -1.5 -6.2
TGTTGGTCAGAATGCTGGCT 2595 SEQ ID NO: 7955 1.5 -25.3 73.8 -25.2 -1.5 -5.9
GGATTTTGCCAACTTGAAAA 3044 SEQ ID NO:7956 1.5 -19.6 57.9 -21.1 0 -3.7
TCTTGCAGACACATTCTTTG 3195 SEQ ID NO: 7957 1.5 -21.9 66.2 -23.4 0 -5.2
TTTTCAACACTGCTTCCAGT 3697 SEQ ID NO:7958 1.5 -23.8 69.9 -23.7 -1.6 -4.8
ACTCTCCAACAGCAATTGGC 3780 SEQ ID NO:7959 1.5 -24.6 70 -25.1 -0.9 -7.5
AAATTCACACCCATGATGCT 4519 SEQ ID NO:7960 1.5 -22.9 64.6 -24.4 0 -4.5
CATGTTAACACAGTGGTAGA 4553 SEQ ID NO:7961 1.5 -20.7 63.1 -21.4 -0.5 -8.7
ACAGAACAATGAACACTAGG 5157 SEQ ID NO:7962 1.5 -17.8 54.8 -19.3 0 -4.5
GTCAAAGATGTTCCAGCCTA 5231 SEQ ID NO:7963 1.5 -24.3 7O.2" -25.8 0 -3.2
CTCACACAAAACACGCTTTG 6041 SEQ ID NO: 7964 1.5 -20.5 59.4 -21.3 -0.5 -4.8
CTTTGTTATAGTTACTTGAT 6240 SEQ ID NO:7965 1.5 -18.6 59.5 -20.1 0 -2.5
AAATAGCTTCAAATTATTCT 7679 SEQ ID NO:7966 1.5 -16 52 -17.5 0 -4.6
ACAAAATGCTGACAAATAAA 7871 SEQ ID NO:7967 1.5 -13.9 46.4 -15.4 0 -3.6
CATCAACCTGAAAATAATTT 7899 SEQ ID NO:7968 1.5 -15.9 50.4 -16.9 -0.1 -3.3
AAAAGCATAAAGTAAAATAA 7929 SEQ ID NO: 7969 1.5 -10.5 40.4 -12 0 -4.1
GCCAAGGGAGTTAATTGAAA 8766 SEQ ID NO: 7970 1.5 -20.4 60 -21.9 0 -3.6
AGAATAAGAGTTTGGTTTTG 8980 SEQ ID NO: 7971 1.5 -17.6 56.4 -19.1 0 -1.9
TAATCTCTGATAAAACAGAG 211 SEQ ID NO: 7972 1.6 -15.3 50.4 -14.1 -2.8 -8.4
CCATAATCTCTGATAAAACA
214 SEQ ID NO: 7973 1.6 -17.4 53.8 -19 0 -3.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GACACCATCTCTGGAGGAAT 673 SEQ ID NO: 7974 1.6 -23.9 68.8 -23.9 -1.5 -6.1
ATGCTGAATAAAGAATGTAC 847 SEQ ID NO: 7975 1.6 -15.9 51.3 -17.5 0 -3.8
AGATTCCAGTGAATGTGTAC 945 SEQ ID NO: 7976 1.6 -21.2 64.6 -21.4 -1.3 -6
AAACCACACCATTGCAATCC 2415 SEQ ID NO: 7977 1.6 -23.6 64.8 -24.6 0 -8.6
GAAATCTGGTAAGAGCTTAA 2527 SEQ ID NO:7978 1.6 -18.3 56.8 -19.2 -0.5 -5.2
CTCCATTGAAATCTGGTAAG 2534 SEQ ID NO: 7979 1.6 -20 60 -21 -0.3 -3.7
AGATTCTTCAAGTTCTTCCA 2618 SEQ ID NO:7980 1.6 -22.3 68.1 -23.4 -0.2 -3.3
AGCATATTTAGTGTGGGCCA
3064 SEQ ID NO: 7981 1.6 -25.4 73.9 -26.5 0 -7.7 TAGCATATTTAGTGTGGGCC
3065 SEQ ID NO: 7982 1.6 -24.4 72.1 -26 0 -6.4 TTGCAGACACATTCTTTGTA
3193 SEQ ID NO:7983 1.6 -21.5 65.4 -22.5 -0.2 -8.2
GTTCATGTGCCACCGTGGGA 3233 SEQ ID NO: 7984 1.6 -29.3 80 -29.8 -1 -9.1
CTCCACACAGCACGCGGAAC 3279 SEQ ID NO: 7985 1.6 -27.2 72 -28.3 0 -7.9
AATGACCATGACCAACATGA 3362 SEQ ID NO:7986 1.6 -21.1 60.3 -20.4 -2.3 -5.9
GCTTCCAGTACCTACACCAC 3686 SEQ ID NO:7987 1.6 -27.6 77 -29.2 0 -4.4
ATTTAAGTTTTCAAAGTCAG 3800 SEQ ID NO: 7988 1.6 -16.7 54.5 -18.3 0 -2.7
CTCACTGCTGAACTCTTCAG 3821 SEQ ID NO:7989 1.6 -23.3 69.3 -22.5 -2.4 -7.1
CTTACTTGACAGAATGGAAA 4000 SEQ ID NO:7990 1.6 -17.7 54.9 -18.6 -0.4 -3.2
AGACAGACCAACAGCACATT 4480 SEQ ID NO: 7991 1.6 -22.7 65.4 -24.3 0 -4.1
AAGAATGACCCAAAGATGAT 4825 SEQ ID NO: 7992 1.6 -18.5 55.2 -20.1 0 -2.1
CTGATATCAAAGACTTGTCT 5044 SEQ ID NO: 7993 1.6 -19.2 59.5 -19.4 -1.2 -10
CATACCTACAATGGAGAGAA 5264 SEQ ID NO: 7994 1.6 -19.7 58.7 -21.3 0 -3.3
TAAACAACGCAGGAAGGGAC 5421 SEQ ID NO: 7995 1.6 -20.3 58.7 -21.9 0 -3.6
TAATTTGGAACAAGCAGATC 5568 SEQ ID NO:7996 1.6 -18 55.9 -18 -1.6 -7.3
TGTAATTTGGAACAAGCAGA 5570 SEQ ID NO:7997 1.6 -18.8 57.4 -18.8 -1.6 -7.1
GTGCACTATTAAGAATAGGT 5619 SEQ ID NO: 7998 1.6 -19.6 60.4 -20.3 -0.8 -8.6
GCAAGGACTGTACTAAAGGT 6777 SEQ ID NO: 7999 1.6 -21.4 63.6 -23 0 -4.8
AACAACTATTCTAAAGCAAT 7285 SEQ ID NO: 8000 1.6 -15.8 50.8 -17.4 0 -4.1
CAGA-AAGTGGAACAACTATT 7295 SEQ ID NO: 8001 1.6 -17.3 53.9 -17.9 -0.9 -4.8
GCATACGTAAATACTACAAA 8182 SEQ ID NO: 8002 1.6 -16.7 52.1 -17.6 -0.4 -6.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GAAATTGAAAGCTATTGTAG 8750 SEQ ID NO: 8003 1.6 -15.9 51.5 -17.5 0 -5.1
ATACATATTTAGATCCAAAT 9040 SEQ ID NO: 8004 1.6 -16.5 52.7 -18.1 0 -2.2
GATCATCACATCAGAAAGCT 1208 SEQ ID NO:8005 1.7 -20.7 62.3 -22.4 0 -4.8
ACACAGTCAGGATCATCACA 1218 SEQ ID NO:8006 1.7 -23 68.7 -24.7 0 -5.3
AAAGGTGTCAAAGCTTGTGT 1559 SEQ ID NO:8007 1.7 -21.1 63.6 -22.8 0 -7.1
TGACCAGGACAAAAAATATC 1674 SEQ ID NO: 8008 1.7 -16.8 52.2 -18.5 0 -4
AAATAGTAATAAGGATCCAT 2911 SEQ ID NO: 8009 1.7 -16.4 52.2 -17.2 0 -9.6
AACATGAAAACAATAAGGCA 3349 SEQ ID NO: 8010 1.7 -15.6 49.6 -17.3 0 -5.2
CAATAATAAGGCCAGAAAGA 3404 SEQ ID NO: 8011 1.7 -17.5 53.5 -18.7 0 -7.7
GCATTCTTCCTACTGCAATC 3486 SEQ ID NO: 8012 1.7 -24.3 71 -25.1 -0.7 -4.9
TCCAGTACCTACACCACTGG 3683 SEQ ID NO: 8013 1.7 -26.9 74.7 -25.9 -2.7 -7.9
ATTACGTATTTTTCAACACT 3706 SEQ ID NO: 8014 1.7 -18.5 57.3 -20.2 0 -6.1
CAATTGGCACTGTGACGGTG 3768 SEQ ID NO:8015 1.7 -24.1 68.1 -24.3 -1.4 -7.4
GCTGAACTCTTCAGTATTTA 3815 SEQ ID NO: 8016 1.7 -21 64.8 -20 -2.7 -10.1
AGCCTGACAGTCACTCAAAT 4610 SEQ ID NO: 8017 1.7 -23.3 67.7 -25 0 -7.1
GTGAAGAATGACCCAAAGAT 4828 SEQ ID NO: 8018 1.7 -19.7 57.8 -21.4 0 -2.1
TGCACTAGAACAAATTTTGT 6836 SEQ ID NO: 8019 1.7 -18.2 56.3 -18.8 -1 -8.4
TAGAGCTCTGAAACTTAGAA 7194 SEQ ID NO: 8020 1.7 -18.3 57.2 -19 0 -10
AAGTGGAACAACTATTCTAA 7291 SEQ ID NO: 8021 1.7 -17 53.8 -17.7 -0.9 -5.1
AATAAAAAAAAACATCTATG 8157 SEQ ID NO: 8022 1.7 -9.3 38.4 -11 0 -3.3
CAAATGTCAGATCAAGCACA 8564 SEQ ID NO: 8023 1.7 -20 59.9 -21.7 0 -5.4
TTACAAATTAGTTACAATTT 78 SEQ ID NO: 8024 1.8 -14.5 48.9 -15.7 -0.3 -3.7
GTAAGCCACTCTACTATGAA 295 SEQ ID NO: 8025 1.8 -21.5 63.8 -23.3 0 -3.2
CCAGCTTCCAAGTCACTATT 625 SEQ ID NO: 8026 1.8 -25.1 72 -26.9 0 -4.5
AGAGGTGGCACTGAATCGGA 770 SEQ ID NO: 8027 1.8 -24.7 70.2 -26.5 0 -4.5
TAGCAATTTTCCTAACAGGG 816 SEQ ID NO: 8028 1.8 -21.4 63.2 -22.3 -0.7 -5.3
AATAAAGAATGTACCAAAAT 841 SEQ ID NO: 8029 1.8 -13.2 45.2 -15 0 -4.2
CAAACTCTGTCACATATGCC 1071 SEQ ID NO: 8030 1.8 -22.4 65.2 -24.2 0 -6.5
7AATGGTCTTTAAACCTGGAA 1160 SEQ ID NO: 8031 1.8 -19.7 58.8 -20.4 -1 -5.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ACAATGGTCTTTAAACCTGG 1162 SEQ ID NO: 8032 1.8 -20.7 61.1 -21.9 -0.3 -5.1
TCACATCAGAAAGCTTCTTT 1203 SEQ ID NO: 8033 1.8 -20.6 62.8 -21.6 -0.6 -7
AGGTGTCAAAGCTTGTGTAG 1557 SEQ ID NO: 8034 1.8 -22.2 67.8 -24 0 -7.1
TAGCACCTTTGGAACTCAAC 1941 SEQ ID NO: 8035 1.8 -22.3 64.9 -23.5 -0.3 -4.5
GAAACTGAAAATGCTTGTTT 2192 SEQ ID NO: 8036 1.8 -17 53.2 -18.1 -0.4 -4.5
AATGCAAATAGTGATGGCAA 2762 SEQ ID NO: 8037 1.8 -18.9 56.8 -19.8 -0.8 -5.6
AAGGCCAGAAAGAGGTTCAG 3397 SEQ ID NO: 8038 1.8 -22.4 65.5 -22.9 -1.2 -9
AATAATAAGGCCAGAAAGAG 3403 SEQ ID NO: 8039 1.8 -16.8 52.4 -18.1 0 -7.7
ACTCACTGCTGAACTCTTCA 3822 SEQ ID NO: 8040 1.8 -23.5 69.6 -24.4 -0.7 -4.3
TCTGACTCACTGCTGAACTC 3826 SEQ ID NO: 8041 1.8 -23.3 69.2 -25.1 0 -3.6
AAGCTTCCGGTTTAAAGTCT 3954 SEQ ID NO: 8042 1.8 -22.7 66.1 -24.5 0 -6.6
ATTCACACCCATGATGCTAA 4517 SEQ ID NO: 8043 1.8 -23.3 66.1 -25.1 0 -4.5
C7AAATTCACACCCATGATGC 4520 SEQ ID NO: 8044 1.8 -22.7 63.9 -24.5 0 -4.5
TCCGGGACAAAACTAGGGTC 5133 SEQ ID NO: 8045 1.8 -23.8 66.8 -25.6 0.4 -7.2
GCAAGACGGATCACTCGGAA 5329 SEQ ID NO: 8046 1.8 -23.7 65.8 -24.8 -0.4 -5.3
TTTAACATAGGCAAAGTTGG 5495 SEQ ID NO: 8047 1.8 -18.6 57.2 -20.4 0 -4.2
TGCTAGCAATCCATCCCAGC 5600 SEQ ID NO: 8048 1.8 -28.2 77.3 -28.9 0 -10.1
CTATTAAGAATAGGTGCTAG 5614 SEQ ID NO: 8049 1.8 -18.1 57.1 -19 -0.8 -5.2
GCTGGTAATAAAAACAGCAA 6676 SEQ ID NO: 8050 1.8 -17.7 54 -16.8 -2.7 -8
ATTTTATCTCTCTGGCAAAA
6976 SEQ ID NO: 8051 1.8 -19.5 59.8 -21.3 0 -4 AATTTTATCTCTCTGGCAAA
6977 SEQ ID NO: 8052 1.8 -19.5 59.8 -21.3 0 -4 AAATTTTATCTCTCTGGCAA
6978 SEQ ID NO:8053 1.8 -19.5 59.8 -21.3 0 -4.3 AAAATTTTATCTCTCTGGCA
6979 SEQ ID NO: 8054 1.8 -19.5 59.8 -21.3 0 -6.3 ACTTAGAATAAAATTTGCAC
7182 SEQ ID NO: 8055 1.8 -15.3 50.1 -17.1 0 -5.2
CAAAAGCATAAAGTAAAATA 7930 SEQ ID NO:8056 1.8 -11.9 42.9 -13.7 0 -3.3
AAAAATCAAAAGCAAAAGCA 7942 SEQ ID NO: 8057 1.8 -13.1 44.7 -14.4 -0.2 -4.1
TATTATAACAAAGAAATCCA 8042 SEQ ID NO: 8058 1.8 -14.3 47.6 -16.1 0 -4.4
AACTTTTGGTTTGTGCAAAA 8331 SEQ ID NO: 8059 1.8 -18.9 57.7 -19.1 -1.5 -7.9
TGTCAGATCAAGCACAGGTT 8560 SEQ ID NO: 8060 1.8 -23.2 69.5 -25 0 -4.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo ATGTCAGATCAAGCACAGGT 8561 SEQ ID NO:8061 1.8 -23.1 69.1 -24.9 0 -5.4
AAATGTCAGATCAAGCACAG 8563 SEQ ID NO:8062 1.8 -19.3 58.9 -21.1 0 -5.4
TGAACTTGATCCTTTGCACA 8688 SEQ ID NO:8063 1.8 -22.6 65.7 -24.4 0 -5
TGAGAATAAGAGTTTGGTTT 8982 SEQ ID NO:8064 1.8 -18.1 57.4 -19.9 0 -1.9
CCACTGAGAATAAGAGTTTG 8986 SEQ ID NO:8065 1.8 -19.3 58.8 -21.1 0 -2.8 TATTTAGATCCAAATTGTCT
9035 SEQ ID NO:8066 1.8 -18.5 57.8 -20.3 0 -2.4 ATATTTAGATCCAAATTGTC
9036 SEQ ID NO:8067 1.8 -17.6 55.8 -19.4 0 -2.4 TACAAATTAGTTACAATTTT
77 SEQ ID NO:8068 1.9 -14.5 48.9 -15.7 -0.5 -4
CACCTTTTTCCGGAAAAGCT 387 SEQ ID NO:8069 1.9 -23.8 65.7 -22.7 -2.1 -14.1
CCTTAGATAGTCACAGCACC 403 SEQ ID NO: 8070 1.9 -24.9 72.1 -26.8 0 -4.1
CACTGAAATCCAGCCAGTTC 1041 SEQ ID NO:8071 1.9 -24.3 69.2 -25 -1.1 -6.3
GAAGCAGCTGATGCTGCCGC 1858 SEQ ID NO: 8072 1.9 -28.8 77.8 -24.8 -5.9 -14.2
TTGAAGCAGCTGATGCTGCC 1860 SEQ ID NO:8073 1.9 -26.3 74 -23.1 -5.1 -12.9
TTAGCACCTTTGGAACTCAA 1942 SEQ ID NO:8074 1.9 -22.2 64.7 -23.6 -0.1 -4.3
TCGGATTTGGGAAAGCTGTC 2032 SEQ ID NO:8075 1.9 -23.1 67 -25 0.3 -5.6
GGCACAAACAGTGAGTCTCT 2293 SEQ ID NO:8076 1.9 -23.7 69.9 -24 -1.5 -5.2
CTGACTTCCGTTTCAGTGGT 2497 SEQ ID NO:8077 1.9 -26 75.4 -27.2 -0.5 -5.1
GATCCATAACAATTAAATTC 2730 SEQ ID NO:8078 1.9 -15.8 50.9 -17.7 0 -3.3
ATGCAAATAGTGATGGCAAG 2761 SEQ ID NO:8079 1.9 -19.6 58.9 -20.6 -0.8 -5.6
ATTATTCATTTCATTGTCAT 3461 SEQ ID NO:8080 1.9 -18.7 59.6 -20.6 0 -2.4
CTGCTTCCAGTACCTACACC 3688 SEQ ID NO:8081 1.9 -27.6 77.1 -28.9 -0.3 -4.4
GCACCGAGTTCTGAGTAGCC 4348 SEQ ID NO:8082 1.9 -28 78.8 -29.9 0 -3.5
AGAAGATGAGACAGACCAAC 4488 SEQ ID NO:8083 1.9 -19.6 58.9 -21.5 0 -2.4
ATCAACCAGAAGATGAGACA 4495 SEQ ID NO:8084 1.9 -19.9 59.5 -21.8 0 -3.3
TTACAAAATCAAAGACCATT 5022 SEQ ID NO:8085 1.9 -15.9 50.5 -17.8 0 -2.8
AAACATACCTACAATGGAGA 5267 SEQ ID NO:8086 1.9 -18.6 56.1 -20 -0.1 -4
CTCAGCCAGAAACATACCTA 5276 SEQ ID NO:8087 1.9 -23.1 65.7 -25 0 -3.2
ACGGATCACTCGGAACAAGG 5324 SEQ ID NO:8088 1.9 -22.7 63.7 -24.1 -0.1 -5.3
AGACGGATCACTCGGAACAA 5326 SEQ ID NO:8089 1.9 -22.1 62.6 -23.3 -0.4 -4.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
AAGGATATGATGATGTAACT 5728 SEQ ID NO: 8090 1.9 -17.3 54.6 -19.2 0 -2.6
CTCTGAAACTTAGAATAAAA 7189 SEQ ID NO:8091 1.9 -13.8 46.9 -15.7 0 -2.5
CTGAAAATAATTTTCTTATG 7892 SEQ ID NO: 8092 1.9 -13.8 47.2 -13.3 -2.4 -8.4
GTCATCAACCTGAAAATAAT 7901 SEQ ID NO: 8093 1.9 -17.3 53.5 -18.7 -0.1 -3
GTAAATAGTTTTGTAAAAAG 8362 SEQ ID NO: 8094 1.9 -12.8 45.3 -13.3 -1.3 -4.3
AGATCAAGCACAGGTTTTAT 8556 SEQ ID NO: 8095 1.9 -20.8 63.5 -22.7 0 -5.4
AATTAGGAGATAGCATCAAT 8819 SEQ ID NO: 8096 1.9 -18.1 56.6 -19.1 -0.7 -5.7
TAATATAAATTCTCAATAAC 8924 SEQ ID NO: 8097 1.9 -12 43.6 -13.9 0 -3.1
ACTGAAATTGTTTTCAGTGC 1138 SEQ ID NO: 8098 2 -20 61.6 -17.3 -4.7 -13.2
AGGGTCTTTTTGCCCATCCA 1454 SEQ ID NO: 8099 2 -28.9 80.6 -28.7 -2.2 -6.1
CCAAGAAAATGACCAGGACA 1683 SEQ ID NO: 8100 2 -20.7 59 -22.7 0 -4
CAAAGTCATTTTCAGATCCA 2232 SEQ ID NO: 8101 2 -20.7 62.3 -22.7 0 -4.5
CAAGGAAACCACACCATTGC 2420 SEQ ID NO: 8102 2 -23 63.8 -24.3 -0.5 -3.7
AAATCTGGTAAGAGCTTAAC 2526 SEQ ID NO: 8103 2 -17.9 56.1 -19.2 -0.5 -5.2
TCTAGATTCTTCAAGTTCTT 2621 SEQ ID NO: 8104 2 -20.2 64.2 -21.7 -0.2 -5.2
GACCACAGCAAAAATGAAGA 3149 SEQ ID NO:8105 2 -18.6 55.3 -20.6 0 -4.1
GTCTCTATCCACTCTCCACA 3292 SEQ ID NO: 8106 2 -27 78.6 -29 0 -1.9
CATTGTCATCATCAGTAGCA 3450 SEQ ID NO: 8107 2 -22.7 69.1 -24.7 0 -4.1
CAGTACCTACACCACTGGTG 3681 SEQ ID NO: 8108 2 -25.7 72.7 -25.5 -2.2 -10.5
TTGCTTGCCAAGAGCCTGAC 4622 SEQ ID NO: 8109 2 -26.8 74.5 -27.4 -1.3 -6.2
ATCCGGGACAAAACTAGGGT 5134 SEQ ID NO: 8110 2 -23.4 65.4 -25.4 0 -7.1
CAATGAACACTAGGTTGATC 5151 SEQ ID NO:8111 2 -19.1 58.6 -21.1 0 -5.4
CAGTGAACAGAACAATGAAC 5163 SEQ ID NO: 8112 2 -16.9 52.9 -18.9 0 -3.5
AGTCAAAGATGTTCCAGCCT 5232 SEQ ID NO: 8113 2 -24.6 71 -26.6 0 -3.2
CGGATCACTCGGAACAAGGT 5323 SEQ ID NO: 8114 2 -23.7 66.1 -25.2 -0.1 -5.3
TGATGTAACTGACAAAAAAG 5718 SEQ ID NO: 8115 2 -13.9 46.8 -15.1 -0.6 -3.4
CCTCATAGAACATCTCAAAG 5838 SEQ ID NO: 8116 2 -19.5 58.9 -21.5 0 -2.8
ATGAGAAGAGGAGGATCCAG 5929 SEQ ID NO: 8117 2 -21.8 64.7 -21.2 -2.6 -9
GTCAGCTGGTAATAAAAACA 6680 SEQ ID NO: 8118 2 -18.2 55.9 -19.6 0 -8.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GAAATGCACTAGAACAAATT 6840 SEQ ID NO: 8119 2 -16 50.8 -18 0 -5.5
CTTAGAATAAAATTTGCACT 7181 SEQ ID NO: 8120 2 -16 51.4 -18 0 -5.2
TGTTTCCTTGAAATCCAGAG 7753 SEQ ID NO: 8121 2 -21.7 64.1 -22.9 -0.6 -4.3
TGTGATTAAAAATCAAAAGC 7949 SEQ ID NO: 8122 2 -13.6 46.3 -13.6 -2 -6.9
TCCATTGAAAAATCTTATGG 7986 SEQ ID NO: 8123 2 -17.3 53.8 -18.5 -0.6 -5.2
AAAAAACAAAAACAAAAAAC 8506 SEQ ID NO: 8124 2 -6.2 33.6 -8.2 0 0
TAAAAGTTCACAAAGCTGCT 8666 SEQ ID NO: 8125 2 -18.9 57.4 -20.9 0 -7.2
ATTGAAATTGAAAGCTATTG 8753 SEQ ID NO: 8126 2 -15.1 49.6 -17.1 0 -5.1
CAAGGGAGTTAATTGAAATT 8764 SEQ ID NO: 8127 2 -16.7 52.9 -18.7 0 -3.5
AAAAAAAGTTAATATAAATT 8933 SEQ ID NO: 8128 2 -8.2 36.4 -10.2 0 -2.9
CTTGAAAAAAAAGTTAATAT 8938 SEQ ID NO:8129 2 -10.7 40.9 -12.7 0 -2.8
AGTAAGCCACTCTACTATGA 296 SEQ ID NO: 8130 2.1 -22.2 66.3 -24.3 0 -4.5
CAGGTCCTCCAGGGGCTCTG 692 SEQ ID NO: 8131 2.1 -31.1 87.1 -31.7 -1.4 -6.4
GATCAGGGCCCCCACAATGG 1175 SEQ ID NO: 8132 2.1 -30 78.3 -30.3 -0.4 -11.8
AAGGGTCTTTTTGCCCATCC 1455 SEQ ID NO: 8133 2.1 -27.5 76.9 -27.4 -2.2 -6.1
TAAAGGGTCTTTTTGCCCAT 1457 SEQ ID NO: 8134 2.1 -24.1 68.8 -24 -2.2 -6.1
TGAAGGTCCACCCACCAAGG 2435 SEQ ID NO: 8135 2.1 -27.7 73.7 -28.6 -1.1 -4.9
AGAGCTGAAGGTCCACCCAC 2440 SEQ ID NO:8136 2.1 -27.8 76.7 -29 -0.8 -5.8
TTCCATTGTGTTGGTCAGAA 2603 SEQ ID NO:8137 2.1 -23.2 69.2 -24.6 -0.4 -3.7
GATGGCAAGATCAACAAATG 2750 SEQ ID NO:8138 2.1 -18.1 55.1 -20.2 0 -5.4
TACTGAATTGCTCAGTCATG 2820 SEQ ID NO:8139 2.1 -20.9 63.6 -20.2 -2.8 -10.1
ATTAGCATATTTAGTGTGGG 3067 SEQ ID NO:8140 2.1 -20.7 64.1 -22.8 0 -4.1
ACATGAAAACAATAAGGCAC 3348 SEQ ID NO:8141 2.1 -16.5 51.6 -18.6 0 -5.2
GCTGTCTATCTTATTGCCTT 3593 SEQ ID NO: 8142 2.1 -24.9 74 -27 0 -3.1
TATTGGACATGCAGCTGTCT 3606 SEQ ID NO:8143 2.1 -24.2 71.4 -25 -1.1 -9.7
GTAGAACAACATCAACTGTG 3897 SEQ ID NO:8144 2.1 -18.6 57.3 -20 -0.4 -3.4
GAGACAGACCAACAGCACAT 4481 SEQ ID NO: 8145 2.1 -23.2 66.3 -25.3 0 -4.1
CTTGCCAAGAGCCTGACAGT 4619 SEQ ID NO: 8146 2.1 -26.8 74.8 -28.1 -0.6 -5
GAAGCAGTGCAAGATAGCCA 4686 SEQ ID NO: 8147 2.1 -24.2 69.2 -25.3 -0.7 -9.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TGAAGAATGACCCAAAGATG 4827 SEQ ID NO:8148 2.1 -18.5 55.1 -20.6 0 -2.1
AGCCAGAAACATACCTACAA 5273 SEQ ID NO: 8149 2.1 -21.3 61.1 -23.4 0 -3.2
ACAGTCGGGTGGTGCACTAT 5630 SEQ ID NO:8150 2.1 -26.6 76.3 -27.4 -1.1 -9.5
GAAACAGAATACTTTGCATA 7157 SEQ ID NO: 8151 2.1 -17.2 53.9 -19.3 0 -6
GCCCAAACATGCACCACAGG 7405 SEQ ID NO:8152 2.1 -27.5 72.4 -29.6 0 -5.5
AATAGCTTCAAATTATTCTG 7678 SEQ ID NO: 8153 2.1 -16.7 53.7 -18.8 0 -4.6
AAAAGTAAAGGTGTTTGTAA 7697 SEQ ID NO:8154 2.1 -15.4 50.6 -17.5 0 -2.3
AGTAAAATAAATTGTGATGT 7919 SEQ ID NO:8155 2.1 -14.2 48 -16.3 0 -3.2
ACAAATGTCAGATCAAGCAC 8565 SEQ ID NO: 8156 2.1 -19.5 59.2 -21.6 0 -5.4
ATTATTATCAAACCTGAAAG 8718 SEQ ID NO:8157 2.1 -15.6 50.4 -17 -0.4 -2.9
CCAAGGGAGTTAATTGAAAT 8765 SEQ ID NO: 8158 2.1 -18.6 56.2 -20.7 0 -3.1
GGAGATAGCATCAATTATAT 8814 SEQ ID NO: 8159 2.1 -18.5 57.8 -19.7 -0.7 -5.7
TTAGCCACCAAGTAATTAGG 8832 SEQ ID NO: 8160 2.1 -21.7 63.5 -22.7 -1 -5.2
TTTTCCACTGAGAATAAGAG 8990 SEQ ID NO: 8161 2.1 -18.6 57.5 -20.7 0 -2.9
ACATATTTAGATCCAAATTG 9038 SEQ ID NO: 8162 2.1 -16.9 53.5 -19 0 -2.6
TGAATTACAGCATAACAAAG 186 SEQ ID NO:8163 2.2 -15.6 50.3 -17.8 0 -4.1
TTTGGGAAAGCTGTCTCTCT
2027 SEQ ID NO: 8164 2.2 -23.6 70.4 -25.8 0 -6.5 ATTTGGGAAAGCTGTCTCTC
2028 SEQ ID NO:8165 2.2 -22.7 68.3 -24.9 0 -6.5 CGACCTCTGAAACTGAAAAT
2200 SEQ ID NO: 8166 2.2 -18.6 54.9 -20.8 0 -2.3
TCCATTGTGTTGGTCAGAAT 2602 SEQ ID NO: 8167 2.2 -23.1 68.8 -24.6 -0.4 -4.8
CAGACACATTCTTTGTAGCT
3190 SEQ ID NO: 8168 2.2 -22.3 67.4 -24.5 0 -5.7 GCAGACACATTCTTTGTAGC
3191 SEQ ID NO: 8169 2.2 -23.2 69.9 -24.9 -0.2 -3.8 TGCAGACACATTCTTTGTAG
3192 SEQ ID NO: 8170 2.2 -21.4 65.3 -23.1 -0.2 -5.1 ACCAGGCATTAGTGAAATAT
4269 SEQ ID NO: 8171 2.2 -20.5 61 -22.7 0 -3.8
TCAACCAGAAGATGAGACAG 4494 SEQ ID NO: 8172 2.2 -19.9 59.6 -22.1 0 -2.7
TTCACACCCATGATGCTAAA 4516 SEQ ID NO:8173 2.2 -22.6 64.1 -24.8 0 -4.5
CTTGAAGCAGTGCAAGATAG 4689 SEQ ID NO: 8174 2.2 -20.7 62.4 -21.8 -0.8 -9.6
TTGTCTGGTTACAAAATCAA 5030 SEQ ID NO:8175 2.2 -18 56.1 -19.5 -0.4 -5
CAGAGAGGTCACTTCACTGT 6613 SEQ ID NO:8176 2.2 -24 72.5 -25.7 -0.2 -4.1 . kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GATAAAATAACTATTTACAT 7386 SEQ ID NO: 8177 2.2 -12.8 45.1 -14.5 -0.2 -5.2
TATTTGCCCAAACATGCACC 7410 SEQ ID NO: 8178 2.2 -24.6 67.3 -25.9 -0.7 -5.5
TATGTGACATTCTTTAACCA 7614 SEQ ID NO: 8179 2.2 -19.9 60.5 -22.1 0 -3.9
TTTTGGTTTGTGCAAAAAAC 8328 SEQ ID NO: 8180 2.2 -17.3 54 -17.9 -1.5 -8
AACATTAAACTTTTGGTTTG 8338 SEQ ID NO: 8181 2.2 -16.6 53.1 -17.4 -1.3 -4.8
AAGAATTAACATTAAACTTT 8345 SEQ ID NO: 8182 2.2 -12.9 45.2 -15.1 0 -4.5
GAGTTAATTGAAATTGAAAG 8759 SEQ ID NO: 8183 2.2 -13.5 46.5 -15.7 0 -3.6
ATGCTTATAGCCAAGGGAGT 8775 SEQ ID NO: 8184 2.2 -24.2 70.3 -25.1 -1.2 -4.9
GAAAAAAAAGTTAATATAAA 8935 SEQ ID NO: 8185 2.2 -8 36.1 -10.2 0 -2.8
AGAAAACAAAGAGACCTTTC 34 SEQ ID NO: 8186 2.3 -16.9 52.9 -18.1 -1 -4.5
GGTCCTCCAGGGGCTCTGAC 690 SEQ ID NO: 8187 2.3 -31.2 87.8 -32.1 -1.3 -5.9
GCTGAATAAAGAATGTACCA 845 SEQ ID NO: 8188 2.3 -18.6 56.2 -20.9 0 -4.2
CCAGGTCCACAAACTCTGTC 1080 SEQ ID NO: 8189 2.3 -25.7 73 -27.5 -0.2 -3.7
ATGACTGAAATTGTTTTCAG 1141 SEQ ID NO: 8190 2.3 -17.6 55.8 -15.9 -4 -9.6
ATCACATCAGAAAGCTTCTT 1204 SEQ ID NO: 8191 2.3 -20.5 62.5 -22 -0.6 -7
AAAGGGTCTTTTTGCCCATC 1456 SEQ ID NO: 8192 2.3 -24.8 70.9 -24.9 -2.2 -6.1
GGTGTCAAAGCTTGTGTAGC 1556 SEQ ID NO: 8193 2.3 -24 72.1 -25.1 -1.1 -7.1
AAGGTGTCAAAGCTTGTGTA 1558 SEQ ID NO: 8194 2.3 -21.5 65.2 -23.8 0 -7.1
CTAAAGGTGTCAAAGCTTGT 1561 SEQ ID NO: 8195 2.3 -20.5 61.9 -22.8 0 -7.1
GCAGCTGATGCTGCCGCAAC 1855 SEQ ID NO: 8196 2.3 -29.1 77.8 -26.3 -5.1 -15
TCAGCAAAGTCATTTTCAGA 2236 SEQ ID NO: 8197 2.3 -20.5 62.9 -22.8 0 -4.1
CTGTCTAGATTCTTCAAGTT 2624 SEQ ID NO: 8198 2.3 -20.9 65.6 -22.7 -0.2 -6
TTACGTATTTTTCAACACTG 3705 SEQ ID NO: 8199 2.3 -18.5 57.3 -20.8 0 -6.1
GAAGATGAGACAGACCAACA 4487 SEQ ID NO: 8200 2.3 -20.3 59.9 -22.6 0 -2.4
GCTTGCTTGCCAAGAGCCTG 4624 SEQ ID NO: 8201 2.3 -28.7 78.7 -29 -2 -7.4
TGTCTGGTTACAAAATCAAA 5029 SEQ ID NO: 8202 2.3 -17.2 54 -19.5 0 -4
CAAAGTCAAAGATGTTCCAG 5235 SEQ ID NO: 8203 2.3 -19.2 58.2 -21.5 0 -2.7
GTAGGGGACACAGAATACTT 5305 SEQ ID NO: 8204 2.3 -21.7 64.8 -24 0 -2.5
CAGTCGGGTGGTGCACTATT 5629 SEQ ID NO: 8205 2.3 -26.5 76 -27.5 -1.1 -9.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo CTGAAGTTCTCCAGGATGAC 5776 SEQ ID NO: 8206 2.3 -23.1 68.3 -25.4 0 -6.3
GCTATGAGAAGAGGAGGATC 5932 SEQ ID NO: 8207 2.3 -21.5 65.1 -23.8 0 -4.1
CAACCTCTTGTCAACGTTGA 6659 SEQ ID NO: 8208 2.3 -23 65.9 -22.9 -0.3 -13
AACAAACATAACAGACTAAA 7080 SEQ ID NO: 8209 2.3 -13.6 46.1 -15.9 0 -2
ACAGAATACTTTGCATAAAA
7154 SEQ ID NO: 8210 2.3 -15.9 51 -18.2 0 -6 AACAGAATACTTTGCATAAA
7155 SEQ ID NO: 8211 2.3 -15.9 51 -18.2 0 -6 AAACAGAATACTTTGCATAA
7156 SEQ ID NO: 8212 2.3 -15.9 51 -18.2 0 -6 TAAAAATCAAAAGCAAAAGC
7943 SEQ ID NO: 8213 2.3 -12.1 43.1 -14.4 0 -4.1
GTGATTAAAAATCAAAAGCA 7948 SEQ ID NO: 8214 2.3 -14.3 47.5 -14.6 -2 -7.9
ATCCATAAAACCCATTATCT 8027 SEQ ID NO: 8215 2.3 -20.7 60 -23 0 -2.6
AGAAATCCATAAAACCCATT 8031 SEQ ID NO: 8216 2.3 -18.9 55.5 -21.2 0 -2.2
ATTAAACTTTTGGTTTGTGC 8335 SEQ ID NO: 8217 2.3 -19.4 60.1 -20.3 -1.3 -5.2
TAGCCACCAAGTAATTAGGA 8831 SEQ ID NO: 8218 2.3 -22.2 64.4 -23 -1.4 -5.7
CGTAAAATCTTCTAAGCAAA 1004 SEQ ID NO: 8219 2.4 -16.4 51.6 -18.8 0 -4.1
CAAATGGATCCATAACAATT 2736 SEQ ID NO: 8220 2.4 -17.5 53.5 -17.9 0 -12.2
TGCAAATAGTGATGGCAAGA 2760 SEQ ID NO: 8221 2.4 -20.2 60.1 -21.9 -0.4 -4.8
ATAAGGATCCATGGCAATGA 2903 SEQ ID NO: 8222 2.4 -21.5 62.5 -23 -0.5 -9
TGCCACCGTGGGAGCGTACA 3226 SEQ ID NO: 8223 2.4 -30.1 78.9 -31.3 -1.1 -9.1
TATTTTTCAACACTGCTTCC 3700 SEQ ID NO: 8224 2.4 -21.7 64.9 -24.1 0 -3.6
ATCAACAGCTGCATACATAA 4736 SEQ ID NO: 8225 2.4 -20.1 60.2 -22 0 -8
AAGTCAAAGATGTTCCAGCC 5233 SEQ ID NO: 8226 2.4 -23 66.8 -25.4 0 -3.2
ACCTACAATGGAGAGAATCA 5261 SEQ ID NO: 8227 2.4 -20.4 60.6 -21.9 -0.8 -4.1
GGATCACTCGGAACAAGGTA 5322 SEQ ID NO: 8228 2.4 -22.6 65.3 -24.5 -0.1 -5.3
AAAACACGCTTTGTAAAGGC 6034 SEQ ID NO: 8229 2.4 -19.2 56.8 -20.6 -0.9 -5.7
TTGCAGTGACAGAGAGGTCA 6622 SEQ ID NO: 8230 2.4 -24 72.1 -24.4 -1.4 -12
TATTCTAAAGCAATACTTTA 7279 SEQ ID NO: 8231 2.4 -15.9 52 -16.8 -1.4 -4.5
AAATAACTATTTACATAACA 7382 SEQ ID NO: 8232 2.4 -13.1 45.6 -15.5 0 -4.3
ATCCATTGAAAAATCTTATG 7987 SEQ ID NO: 8233 2.4 -16.1 51.4 -17.8 -0.5 -3.4
CCAATGTATCTCCTATTGGA 8075 SEQ ID NO: 8234 2.4 -23.1 67.1 -23.7 -1.8 -6.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
CCCTGCATGCAGTTCTTCAA 8391 SEQ ID NO: 8235 2.4 -27 75.7 -26.3 -0.2 -14.3
AATGTCAGATCAAGCACAGG 8562 SEQ ID NO: 8236 2.4 -21.2 63.5 -23.6 0 -5.4
CATGATAAGCATGCTGAATA 857 SEQ ID NO: 8237 2.5 -19.1 57.8 -19.9 -1.4 -11.2
GGTATAGATTCCAGTGAATG 950 SEQ ID NO: 8238 2.5 -20.7 62.9 -21.8 -1.3 -5.5
CACAGCCAGGATCAAATTCA 1718 SEQ ID NO: 8239 2.5 -22.8 65.5 -25.3 0 -5.3
AGTCATTTTCAGATCCAACA 2229 SEQ ID NO: 8240 2.5 -21.6 65.1 -24.1 0 -4.5
CTTCCATTGTGTTGGTCAGA 2604 SEQ ID NO: 8241 2.5 -24.8 73.8 -26.6 -0.4 -3.7
ACTACTGAATTGCTCAGTCA 2822 SEQ ID NO: 8242 2.5 -22 66.4 -21.7 -2.8 -8.2
ATATTCCAGCCTTCTTGGAA 2929 SEQ ID NO: 8243 2.5 -24.2 69.7 -24.3 -2.4 -7.4
TCATTTCATTGTCATCATCA 3456 SEQ ID NO: 8244 2.5 -21 65.2 -23.5 0 -2.4
AATGTATATATCTTCAAAGG 4142 SEQ ID NO: 8245 2.5 -15.9 52.1 -18.4 0 -4.2
AAACAAATTCACACCCATGA 4523 SEQ ID NO: 8246 2.5 -19.7 57.2 -22.2 0 -4.5
GTGGCCACTTGAAGCAGTGC 4696 SEQ ID NO: 8247 2.5 -27.5 77.8 -27.9 -0.7 -12.3
CAGCCAGAAACATACCTACA 5274 SEQ ID NO: 8248 2.5 -22.7 64.2 -25.2 0 -3.2
GTAATTTGGAACAAGCAGAT 5569 SEQ ID NO: 8249 2.5 -18.8 57.5 -19.9 -1.3 -6.8
CATAGAACATCTCAAAGTCA 5835 SEQ ID NO: 8250 2.5 -18.5 57.4 -21 0 -2.8
AGCTGGTAATAAAAACAGCA 6677 SEQ ID NO: 8251 2.5 -18.4 55.9 -17.4 -3.5 -8.7
CTCTCTGGCAAAACACCTTT 6969 SEQ ID NO: 8252 2.5 -23.3 66.5 -25.3 -0.1 -4
TAAATAGCTTCAAATTATTC 7680 SEQ ID NO: 8253 2.5 -14.8 49.6 -17.3 0 -4.3
TTTGTAAATAGCTTCAAATT
7684 SEQ ID NO: 8254 2.5 -16 52 -18 -0.2 -4.6 GTTTGTAAATAGCTTCAAAT
7685 SEQ ID NO: 8255 2.5 -17.1 54.5 -18.7 -0.7 -4.9 AAATCCAGAGAGATACCATA
7743 SEQ ID NO: 8256 2.5 -19.8 59.1 -22.3 0 -3
ATGTCATCAACCTGAAAATA 7903 SEQ ID NO:8257 2.5 -18 55.2 -20 -0.1 -2.9
GGATTCAAAAGTTTGGAATT 7968 SEQ ID NO: 8258 2.5 -17.5 54.8 -19.1 -0.8 -7.1
CAAGCACAGGTTTTATTAAT 8552 SEQ ID NO:8259 2.5 -18.9 58.3 -21.4 0 -4.1
GATGCTTATAGCCAAGGGAG
8776 SEQ ID NO: 8260 2.5 -23.6 68.3 -24.8 -1.2 -4.9 AGATGCTTATAGCCAAGGGA
8777 SEQ ID NO:8261 2.5 -23.6 68.3 -24.8 -1.2 -4.9 ATTTAAGTAACAAAGAATGT
8860 SEQ ID NO: 8262 2.5 -14 47.5 -15.7 -0.6 -3.8
AGAGGTTTACAAATTAGTTA 84 SEQ ID NO: 8263 2.6 -17.2 55.5 -19.8 0 -3.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GAATTACAGCATAACAAAGC 185 SEQ ID NO: 8264 2.6 -17.4 54 -20 0 -4.1
ATGATAAGCATGCTGAATAA 856 SEQ ID NO:8265 2.6 -17.7 54.8 -18.7 0 -11.2
GCAAAGTCATTTTCAGATCC 2233 SEQ ID NO:8266 2.6 -21.8 65.3 -24.4 0 -4.5
AGTAGGTGACGTTAGAGCTG 2453 SEQ ID NO: 8267 2.6 -23.2 69.7 -25.2 -0.3 -5.4
TGTCTAGATTCTTCAAGTTC 2623 SEQ ID NO:8268 2.6 -20.4 65.1 -22.5 -0.2 -6
CATTTCTGCTGTGAAAATCC 2873 SEQ ID NO:8269 2.6 -21 62.1 -22.7 -0.7 -5
AACAACATCAACTGTGCTTC 3893 SEQ ID NO: 8270 2.6 -20.3 60.9 -22.2 -0.4 -4.1
GATCATGAACACAATGAAAG 4100 SEQ ID NO: 8271 2.6 -15.9 50.8 -17.6 -0.8 -7.4
AACCAGAAGATGAGACAGAC 4492 SEQ ID NO:8272 2.6 -19.6 58.9 -22.2 0 -2.4
ATGCTAAAGATCAACCAGAA 4504 SEQ ID NO:8273 2.6 -18.8 56.5 -21.4 0 -5.4
TTAACACAGTGGTAGAACTT 4549 SEQ ID NO:8274 2.6 -19.3 59.6 -21.9 0 -6.4
TCAACAGCTGCATACATAAT 4735 SEQ ID NO: 8275 2.6 -20.1 60.2 -22 0 -8.9
GAAGAATGACCCAAAGATGA 4826 SEQ ID NO: 8276 2.6 -19.1 56.3 -21.7 0 -2.1
AGAGTGAAGAATGACCCAAA 4831 SEQ ID NO: 8277 2.6 -19.7 58 -22.3 0 -2.1
TATGATGACACCAATGAATA 4856 SEQ ID NO: 8278 2.6 -17.6 54.1 -20.2 0 -3.4
GTGGTGCACTATTAAGAATA 5622 SEQ ID NO:8279 2.6 -19.6 60.1 -20.8 -0.3 -10.8
ACTGACAAAAAAGAAAATCC 5711 SEQ ID NO:8280 2.6 -14 46.5 -16.6 0 -2.2
CAGTGACAGAGAGGTCACTT 6619 SEQ ID NO: 8281 2.6 -23.3 70.3 -21.9 -4 -10.7
GCACTTGCTGAAACAGAATA 7166 SEQ ID NO: 8282 2.6 -20.1 59.7 -22 -0.5 -5.7
ATCAACCTGAAAATAATTTT 7898 SEQ ID NO: 8283 2.6 -15.3 49.5 -17.4 -0.2 -4.6
TCCATAAAACCCATTATCTA 8026 SEQ ID NO: 8284 2.6 -20.4 59.5 -23 0 -2.6
ATTATAACAAAGAAATCCAT 8041 SEQ ID NO: 8285 2.6 -14.6 48.1 -17.2 0 -4.4
TGAAATTGAAAGCTATTGTA 8751 SEQ ID NO:8286 2.6 -15.9 51.4 -18.5 0 -5.1
TTTAGTGGAGTTAAAATATA 796 SEQ ID NO: 8287 2.7 -15.2 50.7 -17.9 0 -2.8
ACATGATAAGCATGCTGAAT 858 SEQ ID NO:8288 2.7 -19.6 58.9 -20 -2.3 -11.2
-AACAAATGGATCCATAACAA 2738 SEQ ID NO: 8289 2.7 -16.9 52.1 -17.8 0 -11.7
GCAAATAGTGATGGCAAGAT 2759 SEQ ID NO:8290 2.7 -20.2 60.2 -22.9 0 -4.3
CCGACCACAGCAAAAATGAA 3151 SEQ ID NO: 8291 2.7 -20.8 57.9 -23.5 0 -4.1
ATTGGACATGCAGCTGTCTA 3605 SEQ ID NO: 8292 2.7 -24.2 71.4 -25 -1.9 -10.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex struct :u: oligo oligo
ACGTATTTTTCAACACTGCT
3703 SEQ ID NO: 8293 2. ,7 -21.4 63.4 -24. ,1 0 -4.4 CAATGTATATATCTTCAAAG
4143 SEQ ID NO: 8294 2. ,7 -15.4 50.9 -18. ,1 0 -3.9 CATCCAGCCTTTAAATGTGG
4712 SEQ ID NO: 8295 2. ,7 -23.4 66.6 -26. .1 0 -5.6 AAATATCAAGACAGTGGATC
6009 SEQ ID NO: 8296 2. ,7 -17.6 55.5 -20. ,3 0 -4.6 AAATTTTGTAAAAATATGGC
6825 SEQ ID NO: 8297 2. .7 -13.7 46.6 -14. .2 -2.2 -7.1 CAGAATACTTTGCATAAAAA
7153 SEQ ID NO: 8298 2. ,7 -15 49 -17. ,7 0 -6 CAATACTGCAGCAGAAAGTG
7306 SEQ ID NO: 8299 2. ,7 -20.2 60.2 -22 0.2 -9.5
AAGTAAAATAAATTGTGATG
7920 SEQ ID NO: 8300 2. .7 -12.3 44 -15 0 -3.2
GTTGAATAAAAAAAAACATC
8161 SEQ ID NO: 8301 2. ,7 -10.6 40.6 -13. ,3 0 -3.2 CAGCAGGAATTAAAAAAATA
8212 SEQ ID NO: 8302 2. ,7 -13.6 46 -16. ,3 0 -4.1 TTAAACTTTTGGTTTGTGCA
8334 SEQ ID NO: 8303 2. .7 -20.1 61.4 -20. .9 -1.3 -11. ε AAAAACAAAAACAAAAAACC
8505 SEQ ID NO: 8304 2. ,7 -8.9 37.7 -11. .6 0 0 AGCCACCAAGTAATTAGGAG
8830 SEQ ID NO: 8305 2, .7 -22.5 65.2 -24, .5 -0.5 -5.7 CTTGGCTTTCTCTTCTGCAG
557 SEQ ID NO: 8306 2, .8 -25.6 76.5 -27. .6 -0.6 -8 GGGCTCTGACACCATCTCTG
680 SEQ ID NO: 8307 2. .8 -27.4 78.1 -29. .5 -0.5 -5.2 AGGTCCTCCAGGGGCTCTGA
691 SEQ ID NO: 8308 2, .8 -31 87.5 -32. .4 -1.3 -6 CATGCTGAATAAAGAATGTA
848 SEQ ID NO: 8309 2, .8 -16.4 52 -19, .2 0 -3.6 AACTCTGTCACATATGCCAT
1069 SEQ ID NO: 8310 2, .8 -23.1 67.4 -25, .9 0 -6.5 ACAGTGAGTCTCTCCTGCTT
2286 SEQ ID NO: 8311 2 .8 -26.6 79.5 -27, .4 -2 -7.6 CCACCAAGGAAACCACACCA
2424 SEQ ID NO: 8312 2, .8 -26 68 -28, .1 -0.5 -4.2 GTGTTGGTCAGAATGCTGGC
2596 SEQ ID NO: 8313 2 .8 -25.6 75.4 -26 .8 -1.5 -5.2 CAACAAATGGATCCATAACA
2739 SEQ ID NO: 8314 2 .8 -18.3 54.8 -19 .1 0 -12.2 GTGATGGCAAGATCAACAAA
2752 SEQ ID NO: 8315 2 .8 -19.3 57.8 -21 .3 -0.6 -5.5 TTCCAGCCTTCTTGGAAATA
2926 SEQ ID NO: 8316 2 .8 -23.5 67.5 -24 .2 -2.1 -7 TTCCAGTACCTACACCACTG
3684 SEQ ID NO: 8317 2 .8 -25.8 72.5 -27 .7 -0.8 -4.1 AGACTTTGTCAGCATATTCT
4191 SEQ ID NO: 8318 2 .8 -21.8 67.2 -23 .3 -1.2 -5.3 ACCGAGCTTGCTTGCCAAGA
4629 SEQ ID NO: 8319 2 .8 -27.6 74.5 -28 .4 -2 -6.8 CTATGATGACACCAATGAAT
4857 SEQ ID NO: 8320 2 .8 -18.8 56.4 -21 .6 0 -3.4 GGAGAGAATCACCACCACAA
5252 SEQ ID NO: 8321 2 .8 -23.4 65.7 -25 .6 -0.3 -4.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
IntraInter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
TTTGGAACAAGCAGATCATG 5565 SEQ ID NO:8322 2.8 -19.7 59.5 -19.8 -2.7 -10.5
AGGGGTTTGATGCCATAAAC 6102 SEQ ID NO: 8323 2.8 -22.6 65.4 -24.3 -1 -5
GTAAACAATTGATCACAAAG
6493 SEQ ID NO: 8324 2.8 -15 49.2 -16.9 -0.8 -6.3 ACAAACATAACAGACTAAAA
7079 SEQ ID NO: 8325 2.8 -13.6 46.1 -16.4 0 -2
ATTTGCCCAAACATGCACCA 7409 SEQ ID NO: 8326 2.8 -25.6 68.8 -27.5 -0.7 -5.5
TGCAAAAGTAAAGGTGTTTG 7700 SEQ ID NO: 8327 2.8 -17.7 55.1 -19.9 -0.3 -4.7
CCATTGAAAAATCTTATGGA 7985 SEQ ID NO:8328 2.8 -17.5 53.8 -19.6 -0.5 -4.8
AATCCATAAAACCCATTATC 8028 SEQ ID NO:8329 2.8 -19.1 56.5 -21.9 0 -2.4
CTGAATAAAGAATGTACCAA 844 SEQ ID NO: 8330 2.9 -16.1 50.9 -19 0 -4.2
CTTTAAACCTGGAATGACTG 1154 SEQ ID NO: 8331 2.9 -19.3 57.6 -22.2 0 -5.1
GGAAAGCCCAGCTAAAGGTG 1572 SEQ ID NO: 8332 2.9 -24.3 67.5 -26.3 -0.8 -5
TGGGAAAGCTGTCTCTCTCT 2025 SEQ ID NO: 8333 2.9 -24.7 73.4 -27.6 0 -6.5
CCATCCTGGATGACATACTG 2355 SEQ ID NO: 8334 2.9 -24.1 68.2 -25.1 -1.2 -11.8
ATCCATGGCAATGATCTTGA 2897 SEQ ID NO: 8335 2.9 -22.7 65.9 -24.8 -0.5 -8.7
TTATTGGACATGCAGCTGTC 3607 SEQ ID NO:8336 2.9 -23.4 69.8 -25 -1.1 -9.6
TGACAGAATGGAAACTTTTT 3994 SEQ ID NO:8337 2.9 -17.3 54.2 -19.5 -0.4 -2.9
ACAAATTCACACCCATGATG 4521 SEQ ID NO: 8338 2.9 -21.1 60.7 -24 0 -4.5
GTTAACACAGTGGTAGAACT 4550 SEQ ID NO: 8339 2.9 -20.4 62.3 -23.3 0 -6.6
CGAGCTTGCTTGCCAAGAGC 4627 SEQ ID NO:8340 2.9 -27.2 74.9 -28.1 -2 -10.3
AGCTGCATACATAATATCCA 4730 SEQ ID NO:8341 2.9 -21.6 63.6 -24.5 0 -6.5
TGTAAACAATTGATCACAAA
6494 SEQ ID NO: 8342 2.9 -15 49 -17 -0.8 -7.2 AACCTCTTGTCAACGTTGAT
6658 SEQ ID NO: 8343 2.9 -22.3 64.7 -22.9 -0.1 -12.8
GGAAATGCACTAGAACAAAT 6841 SEQ ID NO: 8344 2.9 -17.1 52.8 -20 0 -5
ACTAAAATACTTTCAAAATT 7066 SEQ ID NO: 8345 2.9 -12.8 45 -15.7 0 -2.9
AGTTTTGTAAAAAGAATTAA 8356 SEQ ID NO:8346 2.9 -12.6 44.8 -14.1 -1.3 -9.3
TACAAATGTCAGATCAAGCA 8566 SEQ ID NO: 8347 2.9 -19 58.1 -21.9 0 -5.4
GGGGTACCAACAGTGCCTGT 477 SEQ ID NO: 8348 3 -28.7 79.5 -28.1 -3.6 -11.9
TCCAGCTTCCAAGTCACTAT 626 SEQ ID NO: 8349 3 -25.4 73.3 -28.4 0 -4.5
TGACACCATCTCTGGAGGAA 674 SEQ ID NO: 8350 3 -23.9 68.7 -26.1 -0.6 -7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TGATGGCAAGATCAACAAAT 2751 SEQ ID NO:8351 3 -18.1 55.1 -20.6 -0.2 -5.4
TATTATTGGACATGCAGCTG 3609 SEQ ID NO:8352 3 -21.5 64.3 -24 0 -8.2
ATCACTAATGTCAAACATGT 4583 SEQ ID NO: 8353 3 -18.2 56.6 -20 -1.1 -6.7
ACAAAGTCAAAGATGTTCCA 5236 SEQ ID NO.-8354 3 -19.4 58.6 -22.4 0 -2.8
GACAGAGAGGTCACTTCACT 6615 SEQ ID NO: 8355 3 -23.6 71.1 -25.9 -0.5 -4.9
AAAGTAAAGGTGTTTGTAAA 7696 SEQ ID NO: 8356 3 -15.4 50.6 -18.4 0 -3.1
GAAATCCAGAGAGATACCAT 7744 SEQ ID NO:8357 3 -20.7 60.9 -23.7 0 -3
CAATGTATCTCCTATTGGAA 8074 SEQ ID NO: 8358 3 -20.4 61.3 -22.3 -1 -4.3
CAAGGCAGAGGTGGCACTGA 776 SEQ ID NO:8359 3.1 -26.1 74.1 -28.3 -0.8 -4.7
GAATAAAGAATGTACCAAAA 842 SEQ ID NO: 8360 3.1 -13.8 46.3 -16.9 0 -4.2
TAGAGACAGGAAAGCCCAGC 1580 SEQ ID NO:8361 3.1 -24.5 69.2 -26.6 -0.9 -4.1
CACCAAGGAAACCACACCAT 2423 SEQ ID NO:8362 3.1 -24 64.8 -26.4 -0.5 -4.2
TAGGTGACGTTAGAGCTGAA 2451 SEQ ID NO:8363 3.1 -21.9 65.1 -25 0 -5.4
ATTTCTGTCTAGATTCTTCA 2628 SEQ ID NO: 8364 3.1 -20.9 66.3 -23.5 -0.2 -6
CAGCTGTCTATCTTATTGCC 3595 SEQ ID NO: 8365 3.1 -24.6 73.1 -27.7 0 -7.4
CGTATTTTTCAACACTGCTT 3702 SEQ ID NO:8366 3.1 -21.3 63.2 -24.4 0 -3.6
TACGTATTTTTCAACACTGC 3704 SEQ ID NO:8367 3.1 -20.2 60.9 -23.3 0 -5.6
GACTCTCCAACAGCAATTGG 3781 SEQ ID NO:8368 3.1 -23.4 67.1 -25.1 -1.3 -7.8
GACTCACTGCTGAACTCTTC 3823 SEQ ID NO: 8369 3.1 -23.4 69.8 -26.5 0 -3.6
AGAACAACATCAACTGTGCT 3895 SEQ ID NO: 8370 3.1 -20.4 60.7 -22.8 -0.4 -4.1
CACCGAGTTCTGAGTAGCCA 4347 SEQ ID NO: 8371 3.1 -26.9 75.5 -30 0 -3.2
GATGCTAAAGATCAACCAGA 4505 SEQ ID NO: 8372 3.1 -20.1 59.6 -23.2 0 -5.4
CACCGAGCTTGCTTGCCAAG 4630 SEQ ID NO.-8373 3.1 -27.7 74.3 -29.2 -1.6 -6.8
ACTCGGAACAAGGTAGGGGA 5317 SEQ ID NO:8374 3.1 -23.9 67.9 -27 0 -3
TGACAAAAAAGAAAATCCCA 5709 SEQ ID NO: 8375 3.1 -15.6 48.9 -18.7 0 -2.2
ATGATGTAACTGACAAAAAA 5719 SEQ ID NO: 8376 3.1 -13.9 46.7 -16.2 -0.6 -3.9
ACTGAAGTTCTCCAGGATGA 5777 SEQ ID NO:8377 3.1 -23.1 68.3 -25.4 -0.6 -6.3
AGTCAGTTTGGCATGGACCT 6557 SEQ ID NO:8378 3.1 -26.3 76.5 -28.7 -0.5 -5.4
GCTGAAACAGAATACTTTGC 7160 SEQ ID NO: 8379 3.1 -19.5 58.9 -21.9 -0.5 -4.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TGCCCAAACATGCACCACAG 7406 SEQ ID NO: 8380 3.1 -26.3 70 -28.7 -0.5 -5.5
AAGAAATCCATAAAACCCAT 8032 SEQ ID NO:8381 3.1 -18.1 53.6 -21.2 0 -2.2
GTAGAAAATATATTATAACA 8052 SEQ ID NO: 8382 3.1 -12.5 44.6 -15.6 0 -6.2
GTGCAAAAAACAAAAATTTA 8319 SEQ ID NO: 8383 3.1 -12.2 43.3 -15.3 0 -5.9
TGTAACATTTATTAGCCACC 8843 SEQ ID NO:8384 3.1 -21.5 63.4 -24.6 0 -3.2
TTTAAGTAACAAAGAATGTA 8859 SEQ ID NO: 8385 3.1 -13.7 47 -15.9 -0.8 -4.1
AATACATATTTAGATCCAAA 9041 SEQ ID NO:8386 3.1 -15.8 51 -18.9 0 -4.5
AAGAAAACAAAGAGACCTTT
35 SEQ ID NO: 8387 3.2 -15.8 50.3 -18.1 -0.8 -3.4 TAAGAAAACAAAGAGACCTT
36 SEQ ID NO: 8388 3.2 -15.4 49.5 -18.1 -0.1 -2.7 TTAGATAGTCACAGCACCTT
401 SEQ ID NO: 8389 3.2 -23 68.7 -26.2 0 -4.1
CAGGTCCTGGGGGTACCAAC 486 SEQ ID NO: 8390 3.2 -28.5 78.7 -28.9 -2.8 -9.6
AACGTAAAATCTTCTAAGCA 1006 SEQ ID NO: 8391 3.2 -17.3 53.7 -20.5 0 -5.3
TAAAGGTGTCAAAGCTTGTG 1560 SEQ ID NO: 8392 3.2 -19.6 59.9 -22.8 0 -7.1
GCACCATCCTGGATGACATA 2358 SEQ ID NO: 8393 3.2 -25.7 71.7 -27 -1.2 -11.8
ACTTCCGTTTCAGTGGTGGT 2494 SEQ ID NO: 8394 3.2 -26.9 78.3 -30.1 0 -4.1
TAAGGATCCATGGCAATGAT 2902 SEQ ID NO: 8395 3.2 -21.5 62.5 -23.8 -0.5 -9
TAGCTCTTACCAAAGAGCTG 3175 SEQ ID NO:8396 3.2 -22.3 65.7 -.19.4 -6.1 -13.8
GGACATGCAGCTGTCTATCT 3602 SEQ ID NO: 8397 3.2 -25.4 75 -26.7 -1.9 -10.5
ATTTTTCAACACTGCTTCCA 3699 SEQ ID NO:8398 3.2 -22.7 66.7 -25.9 0 -3.6
GTATTTTTCAACACTGCTTC 3701 SEQ ID NO:8399 3.2 -20.9 64.3 -24.1 0 -3.6
TAGAACAACATCAACTGTGC 3896 SEQ ID NO: 8400 3.2 -19.2 58.3 -21.7 -0.4 -3.3
AAGACTTTGTCAGCATATTC 4192 SEQ ID NO: 8401 3.2 -20.2 62.8 -22.1 -1.2 -5.3
GGCTACCAGGCTAACCAAAG 4319 SEQ ID NO: 8402 3.2 -24.9 68.6 -26.7 -1.3 -5.5
AACAAATTCACACCCATGAT 4522 SEQ ID NO: 8403 3.2 -20.4 58.9 -23.6 0 -4.5
ATGGCAATAAGCTGGACTTT 5962 SEQ ID NO: 8404 3.2 -21.8 64 -23.6 -1.3 -6.1
GGATAAAATAACTATTTACA 7387 SEQ ID NO: 8405 3.2 -14 47.4 -17.2 0.2 -4.7
CCTG7ΛAAATAATTTTCTTAT 7893 SEQ ID NO: 8406 3.2 -15.8 51 -16.6 ' -2.4 -8.4
GCAAAAGCATAAAGTAAAAT 7931 SEQ ID NO: 8407 3.2 -14 46.7 -17.2 0 -4.2
AAAAGTTGAATAAAAAAAAA 8165 SEQ ID NO: 8408 3.2 -7.2 34.9 -10.4 0 -2.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
AGGAATTAAAAAAATAAGAC 8208 SEQ ID NO:8409 3.2 -10.5 40.5 -13.7 0 -3.2
ACAAAGCCCAGCATCCAAGA 172 SEQ ID NO.-8410 3.3 -25.5 69.2 -28.8 0.1 -4.1
ACGTAAAATCTTCTAAGCAA 1005 SEQ ID NO:8411 3.3 -17.3 53.7 -20.6 0 -4.4
ACAGCCAGGATCAAATTCAC 1717 SEQ ID NO.-8412 3.3 -22.3 64.9 -25.6 0 -5.3
TTGGGAAAGCTGTCTCTCTC 2026 SEQ ID NO:8413 3.3 -23.9 71.7 -27.2 0 -6.5
GTCATTTTCAGATCCAACAT 2228 SEQ ID NO: 8414 3.3 -21.6 64.8 -24.9 0 -4.5
GTAGCTCTTACCAAAGAGCT 3176 SEQ ID NO: 8415 3.3 -23.5 69 -20.9 -5.9 -14.4
AGCTGTCTATCTTATTGCCT 3594 SEQ ID NO:8416 3.3 -24.8 74 -28.1 0 -4.3
CCTACACCACTGGTGGTTCC 3676 SEQ ID NO:8417 3.3 -28.8 79.5 -29.5 -2.6 -11.8
CAGACTCTCCAACAGCAATT 3783 SEQ ID NO:8418 3.3 -22.9 66.1 -26.2 0 -4.1
ATCATGAACACAATGAAAGT 4099 SEQ ID NO:8419 3.3 -16.5 52.2 -18.9 -0.8 -7.4
CAACAGCTGCATACATAATA 4734 SEQ ID NO:8420 3.3 -19.4 58.3 -22 0 -8.9
AACATACCTACAATGGAGAG 5266 SEQ ID NO:8421 3.3 -19.3 58 -22.1 -0.1 -4
GAACAAGCAGATCATGCTGT 5561 SEQ ID NO: 8422 3.3 -22.2 65.3 -22.9 -2.6 -10.4
GTCAGGGTCACAGTCGGGTG 5639 SEQ ID NO: 8423 3.3 -27.9 81.5 -30.7 -0.2 -5
GTTGCAGTGACAGAGAGGTC 6623 SEQ ID NO: 8424 3.3 -24.5 74.6 -27.3 -0.1 -6.5
AAAGACACATACACTGTGGT 7472 SEQ ID NO:8425 3.3 -20.3 60.9 -22 -1.6 -7.3
CATAAAACCCATTATCTAAC 8024 SEQ ID NO:8426 3.3 -17.5 53.6 -20.8 0 -2.6
AAAACAAAAACAAAAAACCC 8504 SEQ ID NO:8427 3.3 -11.6 41.8 -14.9 0 0
AGGTTTTATTAATTATATAT 8545 SEQ ID NO:8428 3.3 -14.7 50.1 -18 0 -4.2
AGTAATTAGGAGATAGCATC 8822 SEQ ID NO:8429 3.3 -19 60 -22.3 0 -4.7
CACAGCACCTTTTTCCGGAA 392 SEQ ID NO:8430 3.4 -25.9 70.7 -28.3 0 -10
GGGGGTACCAACAGTGCCTG 478 SEQ ID NO:8431 3.4 -28.7 78.5 -29.5 -2.6 -10
TTAGTGGAGTTAAAATATAC 795 SEQ ID NO: 8432 3.4 -15.3 50.9 -18.7 0 -2.8
GGGAAAGCTGTCTCTCTCTC 2024 SEQ ID NO.-8433 3.4 -25.1 75.4 -28.5 0 -6.4
GACCTCTGAAACTGAAAATG 2199 SEQ ID NO:8434 3.4 -17.8 54.2 -21.2 0 -2.5
ACCAAGGAAACCACACCATT 2422 SEQ ID NO: 8435 3.4 -23.4 64.1 -26.8 0.3 -3.8
CCCACCAAGGAAACCACACC 2425 SEQ ID NO:8436 3.4 -27.3 70.1 -30.1 -0.3 -4
GATCAACCAGAAGATGAGAC 4496 SEQ ID NO .-8437 3.4 -19.8 59.5 -23.2 0 -4.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo ATCTATGATGACACCAATGA
4859 SEQ ID NO: 8438 3.4 -19.9 59.5 -23.3 0 -2.9 TATCTATGATGACACCAATG
4860 SEQ ID NO: 8439 3.4 -19 57.7 -22.4 0 -3.2 GATGATGTAACTGACAAAAA
5720 SEQ ID NO: 8440 3.4 -15.2 49.3 -18.1 -0.1 -3.9
ACAGAGAGGTCACTTCACTG 6614 SEQ ID NO: 8441 3.4 -23 69.5 -25.7 -0.5 -1.6
GTTGTAAAATTCATGTAAAC 8595 SEQ ID NO: 8442 3.4 -15 49.8 -17.7 -0.4 -6.6
AATTGAAATTGAAAGCTATT 8754 SEQ ID NO: 8443 3.4 -14.4 48 -17.8 0 -5.1
AAACGTAAAATCTTCTAAGC 1007 SEQ ID NO: 8444 3.5 -15.9 50.9 -19.4 0 -5.3
TGAAACTGAAAATGCTTGTT 2193 SEQ ID NO: 8445 3.5 -16.9 52.9 -20.4 0 -3.6
ATCAGCAAAGTCATTTTCAG 2237 SEQ ID NO: 8446 3.5 -19.9 61.6 -23.4 0 -4.1
TATTCCAGCCTTCTTGGAAA 2928 SEQ ID NO: 8447 3.5 -23.5 67.5 -24.4 -2.6 -7.8
TTACTTGACAGAATGGAAAC 3999 SEQ ID NO: 8448 3.5 -17 53.5 -19.8 -0.4 -3.2
TCACACCCATGATGCTAAAG 4515 SEQ ID NO: 8449 3.5 -22.5 64 -26 0 -4.5
AATAGGTGCTAGCAATCCAT 5606 SEQ ID NO: 8450 3.5 -22.7 66.2 -24.5 -0.2 -11.5
CATGGCAATAAGCTGGACTT 5963 SEQ ID NO: 8451 3.5 -22.4 64.8 -24.5 -1.3 -6.1
TGACAGAGAGGTCACTTCAC 6616 SEQ ID NO: 8452 3.5 -22.7 68.8 -24.9 -1.2 -5.5
CCTCTTGTCAACGTTGATAC 6656 SEQ ID NO: 8453 3.5 -22.7 66.3 -23.9 -0.1 -12.8
GCACTAGAACAAATTTTGTA 6835 SEQ ID NO: 8454 3.5 -17.9 55.8 -20.1 -1.2 -8.7
CTGAAACAGAATACTTTGCA 7159 SEQ ID NO: 8455 3.5 -18.4 56.2 -21.9 0 -4.8
TGGAACAACTATTCTAAAGC 7288 SEQ ID NO: 8456 3.5 -17.6 54.8 -20.4 -0.4 -3.8
AAGTAAAGGTGTTTGTAAAT 7695 SEQ ID NO: 8457 3.5 -16.1 52.3 -19.6 0 -3.3
AAAGTTGAATAAAAAAAAAC 8164 SEQ ID NO: 8458 3.5 -8.1 36.4 -11.6 0 -2.9
GCAGCAGGAATTAAAAAAAT 8213 SEQ ID NO: 8459 3.5 -15.7 49.9 -19.2 0 -4.7
GTAATTAGGAGATAGCATCA 8821 SEQ ID NO: 8460 3.5 -19.7 61.1 -22.3 -0.7 -5.7
AAAGAATGTAACATTTATTA 8849 SEQ ID NO: 8461 3.5 -13.3 46.2 -15.9 -0.8 -6.5
ACTCTACTATGAATCCTTGA 288 SEQ ID NO: 8462 3.6 -20.8 62.8 -24.4 0 -2.2
TCTTGAAGCAGCTGATGCTG 1862 SEQ ID NO: 8463 3.6 -23.8 69.7 -24.2 -3.2 -8.7
GATTTGGGAAAGCTGTCTCT 2029 SEQ ID NO: 8464 3.6 -22.9 68.1 -26.5 0 -5.8
CAGCAAAGTCATTTTCAGAT 2235 SEQ ID NO: 8465 3.6 -20.1 61.5 -23.7 0 -4.1
CACCATCCTGGATGACATAC 2357 SEQ ID NO: 8466 3.6 -24.1 68.1 -25.8 -1.2 -11.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ATGGCAAGATCAACAAATGG 2749 SEQ ID NO: 8467 3.6 -18.7 56.2 -22.3 0 -5.4
AGTGATGGCAAGATCAACAA 2753 SEQ ID NO: 8468 3.6 -20 59.8 -22.8 -0.6 -5.5
AATAAGGATCCATGGCAATG 2904 SEQ ID NO: 8469 3.6 -20.2 59.3 -23.2 -0.1 -8.2
ACTTGACAGAATGGAAACTT 3997 SEQ ID NO: 8470 3.6 -18.2 55.9 -21.1 -0.4 -3.2
CAGAAGATGAGACAGACCAA 4489 SEQ ID NO: 8471 3.6 -20.1 59.6 -23.7 0 -2.4
AAGATCAACCAGAAGATGAG 4498 SEQ ID NO: 8472 3.6 -18.3 56.1 -21.9 0 -5.4
TTAAATGTGGCCACTTGAAG 4702 SEQ ID NO: 8473 3.6 -20.4 60.2 -21.6 0 -13
GGCAAGACGGATCACTCGGA 5330 SEQ ID NO: 8474 3.6 -25.6 70.3 -28.7 -0.1 -5.3
TCCTGGCAAGACGGATCACT 5334 SEQ ID NO: 8475 3.6 -25.9 71.7 -28.8 -0.4 -5.3
CAGCTGGTAATAAAAACAGC 6678 SEQ ID NO: 8476 3.6 -18.4 55.9 -19.6 -2.4 -7.6
TCTTATGTACAAAATGCTGA 7879 SEQ ID NO: 8477 3.6 -18.1 56.2 -21.7 0 -6.3
GATCCAAATTGTCTTTAAAA 9029 SEQ ID NO: 8478 3.6 -16.7 52.7 -20.3 0 -4.3
GGTTTACAAATTAGTTACAA 81 SEQ ID NO: 8479 3.7 -16.8 53.8 -20.5 0 -4.2
GGGGCTCTGACACCATCTCT 681 SEQ ID NO: 8480 3.7 -28.6 81 -31.6 -0.5 -5.4
TGACTGAAATTGTTTTCAGT 1140 SEQ ID NO: 8481 3.7 -18.8 58.8 -17.4 -5.1 -11.8
CAATGGTCTTTAAACCTGGA 1161 SEQ ID NO: 8482 3.7 -21.1 61.8 -23.7 -1 -5.8
GGATCAGGGCCCCCACAATG 1176 SEQ ID NO: 8483 3.7 -30 78.3 -32.5 -0.3 -10.4
AACACAGTCAGGATCATCAC 1219 SEQ ID NO: 8484 3.7 -21.6 65.2 -25.3 0 -5.3
GCTAAAGGTGTCAAAGCTTG 1562 SEQ ID NO: 8485 3.7 -21.1 62.9 -24.1 -0.4 -7.1
TGAAGCAGCTGATGCTGCCG 1859 SEQ ID NO: 8486 3.7 -27 73.5 -24.8 -5.9 -14.2
ACCATCCTGGATGACATACT 2356 SEQ ID NO: 8487 3.7 -24.3 68.9 -26.1 -1.2 -11.8
AAGGATCCATGGCAATGATC 2901 SEQ ID NO: 8488 3.7 -22.2 64.4 -24.8 -1 -9
CAACACTGCTTCCAGTACCT 3693 SEQ ID NO: 8489 3.7 -25.9 72.7 -27.8 -1.8 -5.2
TTTCAACACTGCTTCCAGTA 3696 SEQ ID NO: 8490 3.7 -23.4 68.9 -25.3 -1.8 -5.2
TATCTCTCTGGCAAAACACC 6972 SEQ ID NO: 8491 3.7 -22.3 64.8 -26 0 -4
TTGAGCAAAAATTTTATCTC 6986 SEQ ID NO: 8492 3.7 -16.1 52.2 -19.1 0 -8.9
TTGTAAAAAGAATTAACATT 8352 SEQ ID NO: 8493 3.7 -12.2 43.8 -15.9 0 -3.2
TGCATGCAGTTCTTCAATAC
8388 SEQ ID NO: 8494 3.7 -22 66.3 -24.3 0 -10.8 CTGCATGCAGTTCTTCAATA
8389 SEQ ID NO: 8495 3.7 -22.7 67.7 -23.7 0 -13.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TAATGCATTTAAGTAACAAA 8866 SEQ ID NO: 8496 3.7 -14.4 48.1 -17.4 0 -8.8
TGGATAAGAAAACAAAGAGA 40 SEQ ID NO: 8497 3.8 -14 46.9 -17.8 0 -2
CACATGATAAGCATGCTGAA 859 SEQ ID NO: 8498 3.8 -20.3 60 -21.8 -2.3 -11.2
AACAGTGAGTCTCTCCTGCT 2287 SEQ ID NO: 8499 3.8 -25.8 76.2 -27.6 -2 -7.6
CATCCTGGATGACATACTGG 2354 SEQ ID NO:8500 3.8 -23.3 67.1 -25.1 -1.5 -11.8
CCAAGGAAACCACACCATTG 2421 SEQ ID NO: 8501 3.8 -23.2 63.5 -26.3 -0.5 -3.8
AGACAATGCAAATAGTGATG 2766 SEQ ID NO: 8502 3.8 -17.4 54.3 -20.3 -0.7 -5.6
AGGATCCATGGCAATGATCT 2900 SEQ ID NO: 8503 3.8 -23.8 68.5 -25.8 -1.8 -9
AACACTGCTTCCAGTACCTA 3692 SEQ ID NO: 8504 3.8 -24.9 71.1 -26.9 -1.8 -5.2
GAACAACATCAACTGTGCTT 3894 SEQ ID NO:8505 3.8 -20.5 60.8 -24.3 0.1 -3.9
TGGCTACCAGGCTAACCAAA 4320 SEQ ID NO: 8506 3.8 -24.9 68.3 -27.1 -1.5 -6.1
ATTCAGAGTGAAGAATGACC 4835 SEQ ID NO: 8507 3.8 -19.6 59.7 -22.2 -1.1 -5.2
CAAAAAAGAAAATCCCAACA 5706 SEQ ID NO: 8508 3.8 -15 47.6 -18.8 0 -2.2
TATGAGAAGAGGAGGATCCA 5930 SEQ ID NO: 8509 3.8 -21.5 63.9 -22.7 -2.6 -9
CAGTCAGTTTGGCATGGACC 6558 SEQ ID NO: 8510 3.8 -26.1 75.5 -29.2 -0.5 -5.4
AGAGTTGCAGTGACAGAGAG 6626 SEQ ID NO: 8511 3.8 -22.3 68.3 -26.1 0 -5.5
TCTCTCTGGCAAAACACCTT 6970 SEQ ID NO: 8512 3.8 -23.6 67.6 -26.9 -0.1 -4
AAAAGACACATACACTGTGG 7473 SEQ ID NO: 8513 3.8 -18.4 56.1 -19.7 -2.5 -7.3
AGCAGGAATTAAAAAAATAA 8211 SEQ ID NO: 8514 3.8 -12.2 43.4 -16 0 -4.1
CCTGCATGCAGTTCTTCAAT 8390 SEQ ID NO: 8515 3.8 -25 72.1 -25.7 -0.2 -14.3
GAACTTGATCCTTTGCACAC 8687 SEQ ID NO: 8516 3.8 -22.8 66.4 -26.6 0 -5
CAAAGAATGTAACATTTATT 8850 SEQ ID NO: 8517 3.8 -14.3 48 -17.6 -0.2 -5.9
AAAGTTAATATAAATTCTCA 8929 SEQ ID NO: 8518 3.8 -13.4 46.6 -17.2 0 -3.1
GTAGGTGACGTTAGAGCTGA 2452 SEQ ID NO: 8519 3.9 -23.8 70.8 -27.7 0 -5.4
GCATATTTAGTGTGGGCCAG 3063 SEQ ID NO: 8520 3.9 -25.4 73.9 -28.8 0 -7.7
TCTTACCAAAGAGCTGCATG 3171 SEQ ID NO: 8521 3.9 -22.4 65.1 -25.2 -1 -8.4
TTCATGTGCCACCGTGGGAG 3232 SEQ ID NO: 8522 3.9 -28.1 76.9 -30.9 -1 -9.1
ACACTGCTTCCAGTACCTAC 3691 SEQ ID NO: 8523 3.9 -25.8 74.1 -27.9 -1.8 -5.2
AGTCAGACTCTCCAACAGCA 3786 SEQ ID NO: 8524 3.9 -25.1 73.3 -29 0 -6.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TGAAACAGAATACTTTGCAT 7158 SEQ ID NO: 8525 3.9 -17.5 54.4 -21.4 0 -6
GTTTCCTTGAAATCCAGAGA 7752 SEQ ID NO: 8526 3.9 -22.3 65.5 -25.4 -0.6 -4.3
GAAAAATCTTATGGATTCAA 7980 SEQ ID NO:8527 3.9 -15.2 49.7 -17.7 -1.3 -5.6
TTAAGTAACAAAGAATGTAA 8858 SEQ ID NO:8528 3.9 -12.9 45.2 -15.9 -0.8 -4.2
ATCCAAATTGTCTTTAAAAA 9028 SEQ ID NO:8529 3.9 -15.4 49.9 -19.3 0 -4.3
TCTTGGCTTTCTCTTCTGCA 558 SEQ ID NO: 8530 4 -26 78 -30 0.2 -4.7
ACAAACTCTGTCACATATGC 1072 SEQ ID NO: 8531 4 -20.6 62.1 -24.6 0 -6.5
GGTCTTTAAACCTGGAATGA 1157 SEQ ID NO: 8532 4 -21 61.9 -24.4 -0.3 -5.1
TTCATTTCATTGTCATCATC 3457 SEQ ID NO: 8533 4 -20.4 64.3 -24.4 0 -2.4
ATGCAGCTGTCTATCTTATT 3598 SEQ ID NO: 8534 4 -22.6 69.1 -25.9 0 -8.7
TTGGACATGCAGCTGTCTAT 3604 SEQ ID NO:8535 4 -24.2 71.4 -26.3 -1.9 -10.5
ATTATTGGACATGCAGCTGT 3608 SEQ ID NO:8536 4 -23 68.1 -26.3 0 -8.7
AAAGTCAGACTCTCCAACAG 3788 SEQ ID NO:8537 4 -21.2 63.2 -25.2 0 -7.3
AACAGCTGCATACATAATAT 4733 SEQ ID NO:8538 4 -18.7 57.1 -22 0 -8.9
AATCAACAGCTGCATACATA 4737 SEQ ID NO:8539 4 -20.1 60.2 -23.4 0 -8.9
AGTTGCAGTGACAGAGAGGT 6624 SEQ ID NO: 8540 4 -24.1 73 -28.1 0 -5.5
ACCTCTTGTCAACGTTGATA 6657 SEQ ID NO: 8541 4 -22.7 66.3 -24.4 -0.1 -12.8
GTAATAAAAACAGCAACCTC 6672 SEQ ID NO: 8542 4 -17.3 53.3 -21.3 0 -4.1
TTTATCTCTCTGGCAAAACA 6974 SEQ ID NO: 8543 4 -20.3 61.3 -24.3 0 -4
AAAAATTTTATCTCTCTGGC 6980 SEQ ID NO: 8544 4 -18.1 56.7 -22.1 0 -7.2
GGTACATATTTGATTTAATA 7455 SEQ ID NO: 8545 4 -16.4 53.4 -20.4 0 -5.2
TTGAAATCCAGAGAGATACC 7746 SEQ ID NO: 8546 4 -20.1 60 -24.1 0 -3
TTAAAAATCAAAAGCAAAAG 7944 SEQ ID NO: 8547 4 -10.4 40.2 -14.4 0 -4.1
CCATAAAACCCATTATCTAA 8025 SEQ ID NO: 8548 4 -19.3 56.5 -23.3 0 -2.6
AGTTGAATAAAAAAAAACAT
8162 SEQ ID NO: 8549 4 -10.2 39.9 -13.5 -0.4 -3.9 AAGTTGAATAAAAAAAAACA
8163 SEQ ID NO: 8550 4 -9.5 38.7 -12.8 -0.4 -3.9 TAATTGAAATTGAAAGCTAT
8755 SEQ ID NO: 8551 4 -14 47.2 -18 0 -5.1
GCCACCAAGTAATTAGGAGA 8829 SEQ ID NO: 8552 4 -23.1 66.2 -25.6 -1.4 -4.9
TGTGGATAAGAAAACAAAGA 42 SEQ ID NO: 8553 4.1 -14.6 48.1 -18.7 0 -2.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo AGGGGCTCTGACACCATCTC
682 SEQ ID NO: 8554 4.1 -27.7 79.3 -31.1 -0.5 -5.4 AGGATCATCACATCAGAAAG
1210 SEQ ID NO: 8555 4.1 -19.2 59.1 -22.8 -0.1 -5.3 TGACTTCCGTTTCAGTGGTG
2496 SEQ ID NO: 8556 4.1 -25.1 73.2 -29.2 0 -4.7 AATAGTGATGGCAAGATCAA
2756 SEQ ID NO: 8557 4.1 -18.8 57.6 -22.4 -0.1 -5.5 AAGACAATGCAAATAGTGAT
2767 SEQ ID NO: 8558 4.1 -16.7 52.6 -19.9 -0.7 -5.6 GCAGCTGTCTATCTTATTGC
3596 SEQ ID NO: 8559 4.1 -24.4 73.8 -27.8 0 -8.7 AGCTTCCGGTTTAAAGTCTT
3953 SEQ ID NO: 8560 4.1 -23.5 68.7 -27.6 0 -6.3 CAATGAATAGATTCAGAGTG
4845 SEQ ID NO: 8561 4.1 -17.2 54.7 -20.1 -1.1 -7.8 CTTGTCTGGTTACAAAATCA
5031 SEQ ID NO: 8562 4.1 -19.6 59.9 -22.9 -0.6 -4.7 GAACAAGGTAGGGGACACAG
5312 SEQ ID NO: 8563 4.1 -22.2 64.9 -25.7 -0.3 -3.2 GAGTTGCAGTGACAGAGAGG
6625 SEQ ID NO: 8564 4.1 -23.5 70.8 -27.6 0 -5.5 TCTCTGGCAAAACACCTTTG
6968 SEQ ID NO: 8565 4.1 -22.4 64.5 -25.4 -1 -6.6 ATCTCTCTGGCAAAACACCT
6971 SEQ ID NO: 8566 4.1 -23.5 67.2 -27.1 -0.1 -4 TAACAGACTAAAATACTTTC
7072 SEQ ID NO: 8567 4.1 -14.6 48.9 -18.7 0 -2 AGCAAAAAACAAAAACAAAA
8509 SEQ ID NO: 8568 4.1 -9.9 39.2 -14 0 -4.1 CAGCAAAAAACAAAAACAAA
8510 SEQ ID NO: 8569 4.1 -11.3 41.5 -15.4 0 -4.1 AATGCATTTAAGTAACAAAG
8865 SEQ ID NO: 8570 4.1 -14.7 48.7 -18.2 0 -8.4 ATAAGAAAACAAAGAGACCT
37 SEQ ID NO: 8571 4.2 -15.3 49.2 -19.5 0 -1.8 GGATAAGAAAACAAAGAGAC
39 SEQ ID NO: 8572 4.2 -14.2 47.4 -18.4 0 -1.2 CAGGGGCTCTGACACCATCT
683 SEQ ID NO: 8573 4.2 -28 78.5 -31.5 -0.5 -5.6 TGGATCAGGGCCCCCACAAT
1177 SEQ ID NO: 8574 4.2 -30 78.3 -33 -0.3 -10.4 CACAGTCAGGATCATCACAT
1217 SEQ ID NO: 8575 4.2 -22.8 68.1 -27 0 -5.3 TCAACAAATGGATCCATAAC
2740 SEQ ID NO: 8576 4.2 -18 54.8 -20.2 0 -12.2 ATTCCAGCCTTCTTGGAAAT
2927 SEQ ID NO: 8577 4.2 -23.8 68 -25.4 -2.6 -7.8 CCGAGCTTGCTTGCCAAGAG
4628 SEQ ID NO: 8578 4.2 -27.4 74.2 -30.2 -1.3 -6.8 GACAAAAAAGAAAATCCCAA
5708 SEQ ID NO: 8579 4.2 -14.9 47.6 -19.1 0 -2.2 G7AATAAAATTTGCACTTGCT
7177 SEQ ID NO: 8580 4.2 -18.1 55.4 -21.7 - -0.3 -7.2 AGAAAATATATTATAACAAA
8050 SEQ ID NO: 8581 4.2 -10.2 40 -14.4 0 -6.2 TGGCTAAAAAGAACAAAGTC
8259 SEQ ID NO: 8582 4.2 -15.8 50.6 -20 0 -3.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo ACAGCAAAAAACAAAAACAA 8511 SEQ ID NO:8583 4.2 -12.2 43 -16.4 0 -4.1
AGGAGATAGCATCAATTATA 8815 SEQ ID NO: 8584 4.2 -18.5 58 -21.8 -0.7 -5.7
AAATAGTGATGGCAAGATCA 2757 SEQ ID NO:8585 4.3 -18.8 57.6 -22.4 -0.4 -5.5
AAGTCAGACTCTCCAACAGC 3787 SEQ ID NO.-8586 4.3 -23.7 69.7 -28 0 -7.3
GAGTGAAGAATGACCCAAAG 4830 SEQ ID NO: 8587 4.3 -19.7 58 -24 0 -2.1 AATGGAGAGAATCACCACCA
5255 SEQ ID NO: 8588 4.3 -22.5 64 -26.8 2.1 -5.2 CAATGGAGAGAATCACCACC
5256 SEQ ID NO: 8589 4.3 -22.5 64 -26.8 2.1 -5.8 CGGCCAATCCTGGCAAGACG
5341 SEQ ID NO: 8590 4.3 -27.7 71.7 -27.7 -4.3 -10.7
TGCACTATTAAGAATAGGTG 5618 SEQ ID NO:8591 4.3 -18.4 57.3 -21 -1.7 -7.4
TCATAGAACATCTCAAAGTC 5836 SEQ ID NO: 8592 4.3 -18.2 57.5 -22.5 0 -2.8
GTGACAGAGAGGTCACTTCA 6617 SEQ ID NO:8593 4.3 -23.7 71.8 -24.9 -3.1 -9
ACAACTATTCTAAAGCAATA 7284 SEQ ID NO:8594 4.3 -16.2 51.9 -20.5 0 -4.1
AAAAATCTTATGGATTCAAA 7979 SEQ ID NO:8595 4.3 -13.9 47 -16.8 -1.3 -4.3
TTATAACAAAGAAATCCATA 8040 SEQ ID NO:8596 4.3 -14.3 47.6 -18.6 0 -3.5
TAGAAAATATATTATAACAA 8051 SEQ ID NO: 8597 4.3 -10.6 40.8 -14.9 0 -5.7
GGTAGAAAATATATTATAAC 8053 SEQ ID NO:8598 4.3 -13 45.7 -17.3 0 -6.2
CCTATTGGAATGGTAGAAAA 8064 SEQ ID NO: 8599 4.3 -18.4 55.8 -22.7 0 -2.7
GAGGTTTACAAATTAGTTAC 83 SEQ ID NO: 8600 4.4 -17.4 55.9 -21.8 0 -3.3
GGGTACCAACAGTGCCTGTG 476 SEQ ID NO: 8601 4.4 -27.5 76.7 -28 -3.9 -12.2
TTTAAACCTGGAATGACTGA 1153 SEQ ID NO:8602 4.4 -19 57.1 -23.4 0 -5.1
CCTCTGAAACTGAAAATGCT 2197 SEQ ID NO: 8603 4.4 -19.7 57.8 -24.1 0 -3.6
AGGAAACCACACCATTGCAA 2418 SEQ ID NO: 8604 4.4 -23 63.8 -26.7 -0.5 -7.7
CCATTGTGTTGGTCAGAATG 2601 SEQ ID NO: 8605 4.4 -22.7 67.1 -27.1 2.2 -1.8
TTGGAAATAGTAATAAGGAT 2915 SEQ ID NO: 8606 4.4 -15.2 50 -19.6 0 -1.9
TTATTCATTTCATTGTCATC 3460 SEQ ID NO: 8607 4.4 -19.1 61.1 -23.5 0 -2.4
TTTTTCAACACTGCTTCCAG 3698 SEQ ID NO: 8608 4.4 -22.7 66.9 -26.1 -0.9 -3.6
TGACTCACTGCTGAACTCTT 3824 SEQ ID NO: 8609 4.4 -23 68 -26.9 -0.1 -3.6
GCTTGCCAAGAGCCTGACAG 4620 SEQ ID NO:8610 4.4 -27.4 75.6 -31 -0.6 -5.7
ATGATGACACCAATGAATAG 4855 SEQ ID NO.-8611 4.4 -17.9 54.8 -22.3 0 -3.4 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo AGGATATGATGATGTAACTG 5727 SEQ ID NO: 8612 4.4 -18 56.5 -22.4 0 -2.6
ATGGAAATGCACTAGAACAA 6843 SEQ ID NO: 8613 4.4 -17.8 54.4 -22.2 0 -5.5
AGAATAAAATTTGCACTTGC 7178 SEQ ID NO: 8614 4.4 -17.2 53.8 -21.6 0 -7.2
AGTAAAGGTGTTTGTAAATA 7694 SEQ ID NO: 8615 4.4 -16.5 53.6 -20.9 0 -3.3
TCAACCTGAAAATAATTTTC 7897 SEQ ID NO: 8616 4.4 -15.7 50.6 -18.5 -1.6 -7.4
TCCTATTGGAATGGTAGAAA
8065 SEQ ID NO: 8617 4.4 -19.5 58.9 -23 -0.8 -4 TAAATAGTTTTGTAAAAAGA
8361 SEQ ID NO: 8618 4.4 -12.2 44 -15.2 -1.3 -4.3
GTCTTTAAAAATATGCATTA 9019 SEQ ID NO: 8619 4.4 -15.6 51 -20 0 -6.8
TGAATAAAGAATGTACCAAA 843 SEQ ID NO: 8620 4.5 -14.5 47.7 -19 0 -4.2
GGATCCATAACAATTAAATT 2731 SEQ ID NO: 8621 4.5 -16.6 52.1 -20.6 0 -8.3
CTTGCTTGCCAAGAGCCTGA 4623 SEQ ID NO: 8622 4.5 -27.5 75.8 -30.6 -1.3 -6.2
AAGCAGTGCAAGATAGCCAG 4685 SEQ ID NO: 8623 4.5 -23.6 68.2 -27.1 -0.7 -9.6
TAAATGTGGCCACTTGAAGC 4701 SEQ ID NO: 8624 4.5 -22.1 63.8 -24.5 0 -12.3
ACAATGGAGAGAATCACCAC 5257 SEQ ID NO: 8625 4.5 -20.7 61 -25.2 2.1 -4.5
CTATTGGAATGGTAGAAAAT 8063 SEQ ID NO: 8626 4.5 -16.4 52.2 -20.9 0 -2.2
CTCCTATTGGAATGGTAGAA
8066 SEQ ID NO: 8627 4.5 -21.1 62.7 -24.5 -1 -4.2 TCTCCTATTGGAATGGTAGA
8067 SEQ ID NO: 8628 4.5 -22.2 66.3 -25.6 -1 -4.3 CAGGAATTAAAAAAATAAGA
8209 SEQ ID NO: 8629 4.5 -11 41.3 -15.5 0 -3.2
ATAAAAGTTCACAAAGCTGC 8667 SEQ ID NO: 8630 4.5 -18 55.5 -22.5 0 -5.2
TTAATTGAAATTGAAAGCTA 8756 SEQ ID NO: 8631 4.5 -14.1 47.5 -18.6 0 -5.1
CTTTAAAAATATGCATTACA 9017 SEQ ID NO: 8632 4.5 -14.9 49 -19.4 0 -6.8
GTGTCAAAGCTTGTGTAGCC 1555 SEQ ID NO: 8633 4.6 -24.8 73.2 -27.8 -1.5 -7.1
ACAAACAGTGAGTCTCTCCT 2290 SEQ ID NO: 8634 4.6 -23.3 69.1 -27.3 -0.3 -4.6
TTGGTCAGAATGCTGGCTAT
2593 SEQ ID NO: 8635 4.6 -23.8 69.9 -26.1 -2.3 -8.1 GTTGGTCAGAATGCTGGCTA
2594 SEQ ID NO: 8636 4.6 -25 73.4 -27.3 -2.3 -6.6 TAGTGATGGCAAGATCAACA
2754 SEQ ID NO: 8637 4.6 -20.4 61.3 -24.2 -0.6 -5.5
TGCAGCTGTCTATCTTATTG 3597 SEQ ID NO: 8638 4.6 -22.6 69 -26.5 ' 0 -8.7
TCAGACTCTCCAACAGCAAT 3784 SEQ ID NO: 8639 4.6 -23.2 67.3 -27.8 0 -4.1
TAAGCAACCCATTTGAGAAG 4237 SEQ ID NO: 8640 4.6 -20.4 59.7 -24.3 -0.4 -4.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/ ol Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
ACAAAAAAGAAAATCCCAAC
5707 SEQ ID NO: 8641 4.6 -14.5 46.9 -19.1 0 -2.2 GCAACCTCTTGTCAACGTTG
6660 SEQ ID NO: 8642 4.6 -24.2 68.7 -25.7 -0.6 -14.4 ATTCTAAAGCAATACTTTAG
7278 SEQ ID NO: 8643 4.6 -16.2 52.6 -17.5 -3.3 -8.1 TGAAATCCAGAGAGATACCA
7745 SEQ ID NO: 8644 4.6 -20.7 60.8 -25.3 0 -3 TGTGCAAAAAACAAAAATTT
8320 SEQ ID NO: 8645 4.6 -12.5 43.8 -17.1 0 -5.4 TATCCACTCTCCACACAGCA
3287 SEQ ID NO: 8646 4.7 -26.6 75.1 -31.3 0 -4.1 TAGGTGCTAGCAATCCATCC
5604 SEQ ID NO: 8647 4.7 -25.8 73.8 -28.8 -0.2 -11.5 TGCAGTGACAGAGAGGTCAC
6621 SEQ ID NO: 8648 4.7 -24.1 72.3 -25.7 -3.1 -11.1 TTTTATCTCTCTGGCAAAAC
6975 SEQ ID NO: 8649 4.7 -19.7 60.4 -24.4 0 -4 ACTGTGGTACATATTTGATT
7460 SEQ ID NO: 8650 4.7 -19.9 61.6 -23.7 -0.8 -5.2 CACTGTGGTACATATTTGAT
7461 SEQ ID NO: 8651 4.7 -20.5 62.5 -24.6 -0.3 -5.8 TGATTAAAAATCAAAAGCAA
7947 SEQ ID NO: 8652 4.7 -12.4 43.8 -15.5 -1.6 -7.2 TGGATTCAAAAGTTTGGAAT
7969 SEQ ID NO: 8653 4.7 -17.4 54.4 -21.3 -0.6 -6.9 AAAATCTTATGGATTCAAAA
7978 SEQ ID NO: 8654 4.7 -13.9 47 -17.2 -1.3 -4.3 ACATCTATGAATAAAAGGTT
8146 SEQ ID NO: 8655 4.7 -15.9 51.5 -20.6 0 -3.8 GCAGGAATTAAAAAAATAAG
8210 SEQ ID NO: 8656 4.7 -12.2 43.4 -16.9 0 -3.4 TTTGTAAAAAGAATTAACAT
8353 SEQ ID NO: 8657 4.7 -12.2 43.8 -15.9 -0.9 -5.7 TGGTCTTTAAACCTGGAATG
1158 SEQ ID NO: 8658 4.8 -20.4 60 . 6 -24.1 -1 -5.8 AGCAAAGTCATTTTCAGATC
2234 SEQ ID NO: 8659 4.8 -19.8 61.7 -24.6 0 -4.1 TCCATTGAAATCTGGTAAGA
2533 SEQ ID NO: 8660 4.8 -19.7 59.4 -23.9 -0.3 -3.9 CATATTTAGTGTGGGCCAGG
3062 SEQ ID NO: 8661 4.8 -24.8 72.1 -29.1 0 -7.6 TACTTGACAGAATGGAAACT
3998 SEQ ID NO: 8662 4.8 -17.8 55.1 -21.9 -0.4 -3.2 CACAAAGTCAAAGATGTTCC
5237 SEQ ID NO: 8663 4.8 -19.4 58.6 -24.2 0 -3 CCTACAATGGAGAGAATCAC
5260 SEQ ID NO: 8664 4.8 -20.4 60.6 -24.3 -0.8 -3.9 TACCTTCATAGGCTGTAAAC
6507 SEQ ID NO: 8665 4.8 -21.3 63.5 -24.9 -1.1 -3.9 AGTGGAACAACTATTCTAAA
7290 SEQ ID NO: 8666 4.8 -17 53.8 -20.8 -0.9 -4.7 GCAATACTGCAGCAGAAAGT
7307 SEQ ID NO: 8667 4.8 -22 64.3 -25.1 -1.7 -10.4 CTGTGGTACATATTTGATTT
7459 SEQ ID NO: 8668 4.8 -19.8 61.4 -23.7 -0.8 -4.6 AAGACACATACACTGTGGTA
7471 SEQ ID NO: 8669 4.8 -20.7 62.4 -23 -2.5 -7.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
TCAGATTCGGATTTGGGAAA 2038 SEQ ID NO: 8670 4.9 -20.6 60.9 -25.5 0 -5
CTTGGAAATAGTAATAAGGA 2916 SEQ ID NO: 8671 4.9 -16.1 51.8 -21 0 -2.2
CAGCCTTCTTGGAAATAGTA 2923 SEQ ID NO: 8672 4.9 -21.9 64.8 -26.2 -0.3 -3.3
TATTCATTTCATTGTCATCA 3459 SEQ ID NO: 8673 4.9 -19.7 62.1 -24.6 0 -2.4
GTTTTCAAAGTCAGACTCTC 3794 SEQ ID NO: 8674 4.9 -20.9 65.4 -25.8 0 -7.3
CGATGTTAAACAACGCAGGA 5427 SEQ ID NO: 8675 4.9 -20.5 58.7 -24.9 -0.2 -2.3
ATAGGTGCTAGCAATCCATC 5605 SEQ ID NO:8676 4.9 -23.8 70 -27 -0.2 -11.5
TGGTGCACTATTAAGAATAG 5621 SEQ ID NO: 8677 4.9 -18.4 57.3 -21.7 -1.3 -10.8
AACAGCAACCTCTTGTCAAC 6664 SEQ ID NO: 8678 4.9 -22.3 64.9 -26.7 -0.2 -4.9
GAAAGTGGAACAACTATTCT 7293 SEQ ID NO: 8679 4.9 -17.9 55.6 -21.6 -1.1 -5.7
GTACATATTTGATTTAATAG 7454 SEQ ID NO: 8680 4.9 -15.2 50.9 -20.1 0 -4.6
CTCTACTATGAATCCTTGAC 287 SEQ ID NO: 8681 5 -20.8 62.8 -25.8 0 -2.2
GGAAACCACACCATTGCAAT 2417 SEQ ID NO: 8682 5 -23 63.6 -27.4 0 -8.4
AGCCTTCTTGGAAATAGTAA 2922 SEQ ID NO: 8683 5 -20.5 61.5 -24.9 -0.3 -3.3
TTTGTAGCTCTTACCAAAGA 3179 SEQ ID NO:8684 5 -21 63.2 -24.9 -1 -5.3
TTATCTCTCTGGCAAAACAC 6973 SEQ ID NO: 8685 5 -20.4 61.5 -25.4 0 -4
AAGCAATACTGCAGCAGAAA
7309 SEQ ID NO: 8686 5 -20.1 59.4 -22.6 -2.5 -10.4 AAAGCAATACTGCAGCAGAA
7310 SEQ ID NO: 8687 5 -20.1 59.4 -22.6 -2.5 -10.4 AAAACAAAAAACCCCAGAGC
8498 SEQ ID NO:8688 5 -18.6 53.9 -23.6 0 -2.8
ATACAAATGTCAGATCAAGC 8567 SEQ ID NO: 8689 5 -18.3 56.9 -23.3 0 -5.4
TAAGTAACAAAGAATGTAAC 8857 SEQ ID NO:8690 5 -13 45.4 -17.1 -0.8 -4.8
GCACCTTTTTCCGGAAAAGC 388 SEQ ID NO: 8691 5.1 -24.7 67.8 -26.6 -2.1 -14.4
CTCTGACACCATCTCTGGAG 677 SEQ ID NO: 8692 5.1 -25 72.7 -28.5 -1.5 -5.5
CCATCACAATGACACTGAAA
1053 SEQ ID NO: 8693 5.1 -19.8 58.1 -24.2 -0.4 -3.3 GCCATCACAATGACACTGAA
1054 SEQ ID NO: 8694 5.1 -22.3 63.7 -26.7 -0.4 -3.3 GAAAGCCCAGCTAAAGGTGT
1571 SEQ ID NO: 8695 5.1 -24.3 68.1 -28.5 -0.8 -5.1
GGATCCATGGCAATGATCTT 2899 SEQ ID NO: 8696 5.1 -23.9 68.6 -27.2 -1.8 -8.3
TGTGCTCAACAATACTGTAG 4068 SEQ ID NO: 8697 5.1 -20.2 61.5 -24.6 -0.5 -6.5
TACAATGGAGAGAATCACCA 5258 SEQ ID NO: 8698 5.1 -20.2 59.9 -25.3 2.8 -0.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
GGTGCACTATTAAGAATAGG 5620 SEQ ID NO:8699 5.1 -19.6 59.9 -22.9 -1.7 -10.8
TGATGATGTAACTGACAAAA 5721 SEQ ID NO: 8700 5.1 -15.9 50.9 -20.2 -0.6 -3.9
CAAATTTTGTAAAAATATGG 6826 SEQ ID NO:8701 5.1 -12.6 44.4 -15.5 -2.2 -7.4
AACAAAGAAATCCATAAAAC 8036 SEQ ID NO:8702 5.1 -12.9 44.5 -18 0 -2.2
GTCCTCCAGGGGCTCTGACA 689 SEQ ID NO: 8703 5.2 -30.7 86.1 -34.8 -1 -5.4
ACCCACCAAGGAAACCACAC 2426 SEQ ID NO.-8704 5.2 -25.5 67.5 -30.1 -0.3 -4
GACTTCCGTTTCAGTGGTGG 2495 SEQ ID NO: 8705 5.2 -26.3 76 -31.5 0 -4.7
TTTCTGTCTAGATTCTTCAA 2627 SEQ ID NO:8706 5.2 -20.2 63.9 -24.9 -0.2 -6
AAATGTGGCCACTTGAAGCA 4700 SEQ ID NO: 8707 5.2 -23.1 65.5 -25.9 -0.7 -13
AATGAATAGATTCAGAGTGA 4844 SEQ ID NO:8708 5.2 -17.1 54.7 -21.1 -1.1 -7.8
CACCAATGAATAGATTCAGA 4848 SEQ ID NO:8709 5.2 -18.9 57.3 -22.9 -1.1 -7.8
AATAAAAACAGCAACCTCTT 6670 SEQ ID NO:8710 5.2 -17.4 53.2 -22.6 0 -4.1
CATGGAAATGCACTAGAACA 6844 SEQ ID NO: 8711 5.2 -19.2 57.4 -23.5 -0.8 -6.1
AAAGAAATCCATAAAACCCA 8033 SEQ ID NO:8712 5.2 -17.4 52.1 -22.6 0 -2.2
TTGAATAAAAAAAAACATCT 8160 SEQ ID NO:8713 5.2 -10.3 40.1 -15.5 0 -2.5
TGTAAAAAGAATTAACATTA 8351 SEQ ID NO:8714 5.2 -11.8 43 -17 0 -3.2
CACTCTACTATGAATCCTTG 289 SEQ ID NO: 8715 5.3 -20.9 62.7 -26.2 0 -2.2
AAACAGTGAGTCTCTCCTGC 2288 SEQ ID NO:8716 5.3 -24.2 71.6 -27.5 -2 -7.6
AAGCAACCCATTTGAGAAGC 4236 SEQ ID NO: 8717 5.3 -22.5 64 -27.1 -0.4 -4.3
AAAGATCAACCAGAAGATGA 4499 SEQ ID NO:8718 5.3 -17.6 54.1 -22.9 0 -5.4
TCTATGATGACACCAATGAA 4858 SEQ ID NO: 8719 5.3 -19.2 57.7 -24.5 0 -3.4
CTACAATGGAGAGAATCACC 5259 SEQ ID NO: 8720 5.3 -20.4 60.6 -24.8 -0.8 -3.9
TCAGCCAGAAACATACCTAC 5275 SEQ ID NO: 8721 5.3 -22.4 64.4 -27.7 0 -3.2
GGATATGATGATGTAACTGA 5726 SEQ ID NO:8722 5.3 -18.6 57.6 -23.9 0 -2.6
TGGAAATGCACTAGAACAAA 6842 SEQ ID NO: 8723 5.3 -17.1 52.8 -22.4 0 -5.5
ATCTTATGGATTCAAAAGTT 7975 SEQ ID NO: 8724 5.3 -17.3 55.1 -22.6 0.2 -2.2
CAACAGCAAAAAACAAAAAC 8513 SEQ ID NO.-8725 5.3 -12.2 43 -17.5 0 -3.3
CTGAACTCTTCAGTATTTAA 3814 SEQ ID NO:8726 5.4 -18.5 58.3 -21.9 -2 -6.3
CTGACTCACTGCTGAACTCT 3825 SEQ ID NO.-8727 5.4 -23.8 69.6 -28.7 -0.1 -3.6 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TTTGCCCAAACATGCACCAC 7408 SEQ ID NO:8728 5.4 -25.8 69.4 -30.3 -0.7 -5.5
AACATCTATGAATAAAAGGT 8147 SEQ ID NO:8729 5.4 -15.1 49.5 -20.5 0 -3.8
GCAAAAAACAAAAACAAAAA 8508 SEQ ID NO: 8730 5.4 -9.2 38.1 -14.6 0 -3.4
TCTTTAAAAATATGCATTAC 9018 SEQ ID NO:8731 5.4 -14.6 48.8 -20 0 -6.8
TGTCAAAGCTTGTGTAGCCA 1554 SEQ ID NO:8732 5.5 -24.3 70.9 -28.2 -1.5 -6.9
AGCAGCTGATGCTGCCGCAA 1856 SEQ ID NO:8733 5.5 -28.9 77.6 -28.5 -5.9 -15.4
GGATTTGGGAAAGCTGTCTC 2030 SEQ ID NO:8734 5.5 -23.2 68.8 -28.7 0.3 -6.4 ATTCGGATTTGGGAAAGCTG
2034 SEQ ID NO:8735 5.5 -21.6 62.8 -27.1 0.3 -5.1 GATTCGGATTTGGGAAAGCT
2035 SEQ ID NO: 8736 5.5 -22.2 64.2 -27.7 0.3 -4.8 TGTAGCTCTTACCAAAGAGC
3177 SEQ ID NO: 8737 5.5 -22.6 66.9 -23 -5.1 -12.5
TGCCAAGAGCCTGACAGTCA 4617 SEQ ID NO: 8738 5.5 -26.9 75.2 -31.6 -0.6 -7.8
TCTCGTGAATCAACAGCTGC 4744 SEQ ID NO: 8739 5.5 -23.4 67.8 -28.2 0 -9
CCGATGTTAAACAACGCAGG 5428 SEQ ID NO:8740 5.5 -21.9 60.9 -27.4 2.6 -3.2
GATTAAAAATCAAAAGCAAA 7946 SEQ ID NO:8741 5.5 -11.7 42.5 -16.2 -0.9 -5.9
ATGGATTCAAAAGTTTGGAA 7970 SEQ ID NO: 8742 5.5 -17.4 54.4 -22.4 -0.1 -5.9
GTTTTGTAAAAAGAATTAAC 8355 SEQ ID NO: 8743 5.5 -12.8 45.2 -16.9 -1.3 -9.3
AGCACCTTTTTCCGGAAAAG 389 SEQ ID NO: 8744 5.6 -22.9 64.2 -25.4 -1.4 -14.4
GATAGTCACAGCACCTTTTT 398 SEQ ID NO: 8745 5.6 -23.5 69.8 -29.1 0 -4.1
CTCCAGGGGCTCTGACACCA 686 SEQ ID NO:8746 5.6 -30 82.1 -34.5 -1 -5.4
CAGGGTTTAGTGGAGTTAAA 801 SEQ ID NO: 8747 5.6 -20.8 63.6 -26.4 0 -2.8
TTCGGATTTGGGAAAGCTGT 2033 SEQ ID NO:8748 5.6 -22.8 65.8 -28.4 0.3 -5.1
CAAGATCAACAAATGGATCC 2745 SEQ ID NO: 8749 5.6 -18.7 56.1 -22.8 -1.4 -7.5
GAAATAGTAATAAGGATCCA 2912 SEQ ID NO:8750 5.6 -17 53.4 -21.7 0 -9.5
TCTTTGTAGCTCTTACCAAA 3181 SEQ ID NO: 8751 5.6 -21.7 65.1 -27.3 0.1 -4.8
TGTTAACACAGTGGTAGAAC 4551 SEQ ID NO: 8752 5.6 -19.5 60.3 -24.6 -0.1 -7.9
CAACCTGAAAATAATTTTCT 7896 SEQ ID NO:8753 5.6 -16.2 51.2 -19.4 -2.4 -8.4
ATCAAAAGCAAAAGCATAAA
7938 SEQ ID NO:8754 5.6 -14.2 47 -19.3 -0.2 -4.1 AATCAAAAGCAAAAGCATAA
7939 SEQ ID NO: 8755 5.6 -14.2 47 -19.3 -0.2 -4.1 AAATCAAAAGCAAAAGCATA
7940 SEQ ID NO: 8756 5.6 -14.2 47 -19.3 -0.2 -4.1 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
ATCAAGCACAGGTTTTATTA
8554 SEQ ID NO :8757 5.6 -20 61.7 -25.6 0 -3.3 GACTGAAATTGTTTTCAGTG
1139 SEQ ID NO: 8758 5.7 -18.8 58.8 -19.2 -5.3 -11.8 TTCAACACTGCTTCCAGTAC
3695 SEQ ID NO: 8759 5.7 -23.5 69.1 -27.4 -1.8 -5.2 CTTATGTACAAAATGCTGAC
7878 SEQ ID NO: 8760 5.7 -17.9 55.5 -23.6 0 -6.8 AAAATCAAAAGCAAAAGCAT
7941 SEQ ID NO: 8761 5.7 -13.8 46.1 -19 -0.2 -4.1 GTATCTCCTATTGGAATGGT
8070 SEQ ID NO: 8762 5.7 -22.8 68 -27.6 -0.8 -4 GCACATGATAAGCATGCTGA
860 SEQ ID NO: 8763 5.8 -22.8 66.1 -26.3 -2.3 -11.2 CTGGTAAGAGCTTAACCTTC
2522 SEQ ID NO .-8764 5.8 -22.3 66.2 -27 -1 -8 TGGATCCATAACAATTAAAT
2732 SEQ ID NO: 8765 5.8 -16.5 51.8 -21.4 0 -9.6 CAAGAGCCTGACAGTCACTC
4614 SEQ ID NO: 8766 5.8 -24.6 71.6 -29.6 -0.5 -8.7 CCAAGAGCCTGACAGTCACT
4615 SEQ ID NO: 8767 5.8 -26.2 73.6 -32 0 -7.1 GTCTGGTTACAAAATCAAAG
5028 SEQ ID NO: 8768 5.8 -17.2 54.2 -23 0 -3.4 AGACTTGTCTGGTTACAAAA
5034 SEQ ID NO: 8769 5.8 -19.3 59.4 -24 -1 -6.2 AACAAGGTAGGGGACACAGA
5311 SEQ ID NO: 8770 5.8 -22.2 64.9 -27.4 -0.3 -3.2 AGTGACAGAGAGGTCACTTC
6618 SEQ ID NO: 8771 5.8 -23 70.9 -24.9 -3.9 -10.5 TCAGCTGGTAATAAAAACAG
6679 SEQ ID NO: 8772 5.8 -17 53.3 -22.1 -0.1 -8.6 AGCAAAAGCATAAAGTAAAA
7932 SEQ ID NO: 8773 5.8 -14 46.8 -19.3 -0.2 -4.1 CATTGAAAAATCTTATGGAT
7984 SEQ ID NO: 8774 5.8 -15.5 50.2 -20.6 -0.5 -3.8 AATGTATCTCCTATTGGAAT
8073 SEQ ID NO: 8775 5.8 -19.7 60 -24.4 -1 -5.1 GATCAAGCACAGGTTTTATT
8555 SEQ ID NO: 8776 5.8 -20.9 63.7 -26.7 0 -4.7 CCCAGCTAAAGGTGTCAAAG
1566 SEQ ID NO: 8777 5.9 -23 65.4 -28.9 0 -4.6 GCCCAGCTAAAGGTGTCAAA
1567 SEQ ID NO: 8778 5.9 -24.8 69.2 -30.7 0 -4.6 AAGAACTTTCCAACAGCTCT
1908 SEQ ID NO: 8779 5.9 -21.8 64 -27.7 0 -4.4 ACCTCTGAAACTGAAAATGC
2198 SEQ ID NO: 8780 5.9 -19 56.6 -24.9 0 -2.6 CTCTTACCAAAGAGCTGCAT
3172 SEQ ID NO: 8781 5.9 -23.3 67.1 -26.9 -2.3 -11.2 TTGTAGCTCTTACCAAAGAG
3178 SEQ ID NO: 8782 5.9 -20.9 63.1 -24 -2.8 -7.4 ATGTTAACACAGTGGTAGAA
4552 SEQ ID NO: 8783 5.9 -19.3 59.7 -24.4 -0.5 -8.7 CTCGTGAATCAACAGCTGCA
4743 SEQ ID NO: 8784 5.9 -23.7 67.4 -28.9 0 -9 ACACCAATGAATAGATTCAG
4849 SEQ ID NO: 8785 5.9 -18.5 56.6 -23.2 -1.1 -7.8 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo CAGAACAATGAACACTAGGT 5156 SEQ ID NO: 8786 5.9 -18.8 57.1 -24.7 0 -4.5
GAGAGAATCACCACCACAAA 5251 SEQ ID NO: 8787 5.9 -21.5 61.4 -26.5 -0.8 -3.3
AGAAAGTGGAACAACTATTC 7294 SEQ ID NO: 8788 5.9 -17 53.9 -21.7 -1.1 -5.6
ACACTGTGGTACATATTTGA 7462 SEQ ID NO: 8789 5.9 -20.7 63.1 -25.7 -0.8 -7.3
TGTAAAATTCATGTAAACTT
8593 SEQ ID NO: 8790 5.9 -14.7 49 -20.6 0 -4.7 AACTTGATCCTTTGCACACA
8686 SEQ ID NO: 8791 5.9 -22.9 66.2 -28.8 0 -5
CAAATAGTGATGGCAAGATC 2758 SEQ ID NO: 8792 6 -18.8 57.6 -24.8 0 -4.3
TGGAAATAGTAATAAGGATC 2914 SEQ ID NO: 8793 6 -15.5 50.8 -21.5 0 -4.1
AGCTCTTACCAAAGAGCTGC 3174 SEQ ID NO: 8794 6 -24.4 70.4 -24.5 -5.9 -15.4
AAGACTTGTCTGGTTACAAA
5035 SEQ ID NO: 8795 6 -19.3 59.4 -23.8 -1.4 -7 ACATACCTACAATGGAGAGA
5265 SEQ ID NO: 8796 6 -20.6 61.2 -26.1 -0.1 -4
ATAAAAACAGCAACCTCTTG 6669 SEQ ID NO: 8797 6 -18.1 54.8 -24.1 0 -4.1
TAATAAAAACAGCAACCTCT 6671 SEQ ID NO: 8798 6 -17 52.5 -23 0 -4.1
AATCTTATGGATTCAAAAGT 7976 SEQ ID NO: 8799 6 -16.5 53 -21.6 -0.8 -2.2
TATCTCCTATTGGAATGGTA 8069 SEQ ID NO: 8800 6 -21.3 64.2 -26.2 -1 -4.2
TCACAATGACACTGAAATCC 1050 SEQ ID NO: 8801 6.1 -19.5 58.1 -25.6 0 -3.1
CACAAACTCTGTCACATATG 1073 SEQ ID NO: 8802 6.1 -19.5 59.2 -25.1 -0.1 -6.3
ATAGAGACAGGAAAGCCCAG 1581 SEQ ID NO: 8803 6.1 -22.7 65.1 -27.8 -0.9 -3.4
CAAACAGTGAGTCTCTCCTG 2289 SEQ ID NO: 8804 6.1 -23.1 68.4 -27.4 -1.8 -7.3
AAGAGCCTGACAGTCACTCA 4613 SEQ ID NO: 8805 6.1 -24.6 71.6 -29.1 -1.6 -10
CTGGTTACAAAATCAAAGAC 5026 SEQ ID NO: 8806 6.1 -16.4 52 -22.5 0 -2.8
AAAGACTTGTCTGGTTACAA
5036 SEQ ID NO: 8807 6.1 -19.3 59.4 -23.9 -1.4 -7 TGAGCAAAAATTTTATCTCT
6985 SEQ ID NO: 8808 6.1 -16.9 53.7 -21.8 -0.8 -9.9
CAAAGCAATACTGCAGCAGA 7311 SEQ ID NO: 8809 6.1 -21.5 62.5 -25.1 -2.5 -10.4
TATAACAAAGAAATCCATAA 8039 SEQ ID NO:8810 6.1 -13.5 45.9 -19.6 0 -2.2
AAAAACAAAAAACCCCAGAG 8499 SEQ ID NO: 8811 6.1 -16.1 49.3 -22.2 0 0
TCAAGCACAGGTTTTATTAA 8553 SEQ ID NO: 8812 6.1 -19.3 59.6 -25.4 0 -4.1
TTGTAAAATTCATGTAAACT
8594 SEQ ID NO: 8813 6.1 -14.7 49 -20.8 0 -4.7 GTGGATAAGAAAACAAAGAG
41 SEQ ID NO: 8814 6.2 -14.6 48.2 -20.8 0 -2.3 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo
ATCAACAAATGGATCCATAA 2741 SEQ ID NO: 8815 6.2 -17.8 54.3 -22 0 -12.2
ATCTTGCAGACACATTCTTT 3196 SEQ ID NO: 8816 6.2 -21.9 66.3 -28.1 0 -5.2
TAAAGATCAACCAGAAGATG 4500 SEQ ID NO: 8817 6.2 -16.7 52.4 -22.9 0 -5.4
CAGCTGCATACATAATATCC 4731 SEQ ID NO: 8818 6.2 -21.6 63.6 -27.3 0 -7.9
ATGACACCAATGAATAGATT 4852 SEQ ID NO: 8819 6.2 -18 55.2 -24.2 0 -2.9
CAAAAATTTTATCTCTCTGG 6981 SEQ ID NO: 8820 6.2 -17 54 -23.2 0 -7.2
AAATCTTATGGATTCAAAAG 7977 SEQ ID NO: 8821 6.2 -14.6 48.6 -19.4 -1.3 -4.3
AACAGGGTTTAGTGGAGTTA 803 SEQ ID NO: 8822 6.3 -21.7 66.5 -28 0 -3.5
GAAACCACACCATTGCAATC 2416 SEQ ID NO: 8823 6.3 -22.2 62.6 -27.9 0 -8.6
GACTTGTCTGGTTACAAAAT 5033 SEQ ID NO: 8824 6.3 -19.3 59.2 -24.8 -0.6 -4.8
AGCAATACTGCAGCAGAAAG 7308 SEQ ID NO: 8825 6.3 -20.8 61.5 -24.6 -2.5 -10.4
TTGCCCAAACATGCACCACA 7407 SEQ ID NO: 8826 6.3 -26.4 70.1 -31.8 -0.7 -5.5
ACTTGATCCTTTGCACACAT 8685 SEQ ID NO: 8827 6.3 -23.6 68.4 -29.9 0 -5
CAATGACACTGAAATCCAGC 1047 SEQ ID NO: 8828 6.4 -20.7 60.3 -25.9 -1.1 -4
CATCACAATGACACTGAAAT 1052 SEQ ID NO: 8829 6.4 -17.8 54.5 -23.7 -0.1 -3.2
AAGCAGCTGATGCTGCCGCA 1857 SEQ ID NO: 8830 6.4 -28.9 77.6 -29.4 -5.9 -15.4
AGATTCGGATTTGGGAAAGC 2036 SEQ ID NO: 8831 6.4 -21.3 62.5 -27.7 0 -4.3
TGTGTTGGTCAGAATGCTGG 2597 SEQ ID NO: 8832 6.4 -23.8 70.7 -28.9 -1.2 -4.2
GGAAATAGTAATAAGGATCC 2913 SEQ ID NO: 8833 6.4 -17.5 54.6 -23.4 0 -7.7
TCAACACTGCTTCCAGTACC 3694 SEQ ID NO: 8834 6.4 -25.4 72.4 -30.2 -1.6 -5
TGAACTCTTCAGTATTTAAG 3813 SEQ ID NO: 8835 6.4 -17.6 56.5 -23.1 -0.7 -3.9
TGATGCTAAAGATCAACCAG 4506 SEQ ID NO: 8836 6.4 -19.5 58.3 -25.4 -0.2 -5.4
GCCAAGAGCCTGACAGTCAC 4616 SEQ ID NO: 8837 6.4 -27.1 76 -33.5 0 -7.1
AGATTCAGAGTGAAGAATGA 4837 SEQ ID NO: 8838 6.4 -18 56.8 -23.2 -1.1 -5.4
AGACACATACACTGTGGTAC 7470 SEQ ID NO: 8839 6.4 -21.6 65.2 -25.5 -2.5 -8.4
CCTCCAGGGGCTCTGACACC 687 SEQ ID NO: 8840 6.5 -31.3 84.5 -36.7 -1 -5.4
ACAGGGTTTAGTGGAGTTAA 802 SEQ ID NO: 8841 6.5 -21.7 66.5 -28.2 0 -2.6
TGGTCAGAATGCTGGCTATG 2592 SEQ ID NO: 8842 6.5 -23.7 69.4 -27.9 -2.3 -8.1
ATAGTGATGGCAAGATCAAC 2755 SEQ ID NO: 8843 6.5 -19.7 60 -25.4 -0.6 -5.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GATCCATGGCAATGATCTTG 2898 SEQ ID NO: 8844 6.5 -22.7 65.9 -28.1 -1 -8.7
ACATTCTTTGTAGCTCTTAC 3185 SEQ ID NO: 8845 6.5 -21.4 66.7 -27.9 0 -5.7
ACTTGTCTGGTTACAAAATC 5032 SEQ ID NO: 8846 6.5 -19.1 59.2 -24.8 -0.6 -4.7
TGGCAAGACGGATCACTCGG 5331 SEQ ID NO: 8847 6.5 -25 68.9 -30.8 -0.4 -5.3
ATCTCCTATTGGAATGGTAG 8068 SEQ ID NO: 8848 6.5 -21.6 65 -27 -1 -4.2
AAGTAATTAGGAGATAGCAT
8823 SEQ ID NO: 8849 6.5 -17.9 56.6 -24.4 0 -4.2 AGGTTTACAAATTAGTTACA
82 SEQ ID NO: 8850 6.6 -17.5 55.9 -24.1 0 -4.2
TGCACATGATAAGCATGCTG 861 SEQ ID NO: 8851 6.6 -22.2 64.7 -26.5 -2.3 -11.2
AGCCCAGCTAAAGGTGTCAA 1568 SEQ ID NO: 8852 6.6 -25.5 71.6 -31.4 -0.4 -4.7
ACAGCTGCATACATAATATC 4732 SEQ ID NO: 8853 6.6 -19.8 60.4 -25.7 0 -8.9
TGCACCACAGGATAAAATAA 7396 SEQ ID NO: 8854 6.6 -18.7 55.7 -25.3 0 -4.7
GTAAAGGTGTTTGTAAATAG 7693 SEQ ID NO: 8855 6.6 -16.5 53.6 -23.1 0 -3.3
GTAAAAAGAATTAACATTAA 8350 SEQ ID NO: 8856 6.6 -11.1 41.6 -17.7 0 -3.2
CAAAAAACAAAAACAAAAAA 8507 SEQ ID NO: 8857 6.6 -6.7 34.4 -13.3 0 0
CAAGTAATTAGGAGATAGCA
8824 SEQ ID NO: 8858 6.6 -18.6 57.9 -24.7 -0.1 -4.3 ACAGCACCTTTTTCCGGAAA
391 SEQ ID NO: 8859 6.7 -24.5 67.6 -29.3 0 -12
CTTTGTAGCTCTTACCAAAG 3180 SEQ ID NO: 8860 6.8 -21.3 63.8 -27 -1 -5.4
CCAAACATGCACCACAGGAT 7403 SEQ ID NO: 8861 6.8 -24.3 66.5 -31.1 0 -5.5
GTAAAATTCATGTAAACTTT 8592 SEQ ID NO: 8862 6.8 -14.8 49.3 -21.6 0 -4.7
TAATTAGGAGATAGCATCAA 8820 SEQ ID NO: 8863 6.8 -17.8 56 -23.7 -0.7 -5.7
AGCTAAAGGTGTCAAAGCTT 1563 SEQ ID NO: 8864 6.9 -21.1 63.3 -26.7 -1.2 -6.8
AACACAGTGGTAGAACTTGC 4547 SEQ ID NO: 8865 6.9 -21.3 63.8 -28.2 0 -6.2
CACTAGAACAAATTTTGTAA 6834 SEQ ID NO: 8866 6.9 -15.4 50.3 -21 -1.2 -8.7
CTTGAAATCCAGAGAGATAC 7747 SEQ ID NO: 8867 6.9 -19 58.2 -25.9 0 -3
TTTCCTTGAAATCCAGAGAG 7751 SEQ ID NO: 8868 6.9 -21.1 62.6 -27.5 -0.1 -3.6
TC7ΛAAAGCAAAAGCATAAAG 7937 SEQ ID NO: 8869 6.9 -14.2 47.1 -20.6 -0.2 -4.1
TCTGACACCATCTCTGGAGG 676 SEQ ID NO: 8870 7 -25.3 73.3 -30.7 -1.5 -7
CCATTGAAATCTGGTAAGAG 2532 SEQ ID NO: 8871 7 -19.3 58.3 -25.6 -0.5 -3.5
TTCTGTCTAGATTCTTCAAG 2626 SEQ ID NO: 8872 7 -20.1 63.7 -26.6 -0.2 -5.5 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular
Position oligo binding formation Duplex structure oligo oligo
CACATTCTTTGTAGCTCTTA
3186 SEQ ID NO: 8873 7 -21.9 67.4 -28.4 -0.2 -5.7 GGCCAATCCTGGCAAGACGG
5340 SEQ ID NO: 8874 7 -28.1 74.1 -30.8 -4.3 -11.1
AAACAGCAACCTCTTGTCAA 6665 SEQ ID NO: 8875 7 -21.4 62.3 -27.8 -0.3 -4.9
TTGCTGAAACAGAATACTTT 7162 SEQ ID NO: 8876 7 -17.8 55.3 -24.1 -0.5 -4.6
CACTTGCTGAAACAGAATAC 7165 SEQ ID NO: 8877 7 -18.5 56.4 -24.8 -0.5 -4.6
CCCAAACATGCACCACAGGA 7404 SEQ ID NO: 8878 7 -26.3 69.8 -33.3 0 -5.5
TGGTACATATTTGATTTAAT 7456 SEQ ID NO: 8879 7 -16.7 53.9 -23 -0.4 -5.2
ATAACAAAGAAATCCATAAA 8038 SEQ ID NO: 8880 7 -13.1 45 -20.1 0 -2.2
AACAGCAAAAAACAAAAACA 8512 SEQ ID NO: 8881 7. -12.2 43 -19.2 0 -4.1
GATCTTGCAGACACATTCTT
3197 SEQ ID NO:8882 7.1 -22.4 67.4 -29.5 0 -5.1 TCTGGTTACAAAATCAAAGA
5027 SEQ ID NO: 8883 7.1 -16.6 52.7 -23.7 0 -2.7
TGATCTTGCAGACACATTCT
3198 SEQ ID NO:8884 7.2 -22.3 66.9 -29.5 0 -5.2 GTGGAACAACTATTCTAAAG
7289 SEQ ID NO: 8885 7.2 -17 53.8 -23.3 -0.8 -4.1
ATTAAAAATCAAAAGCAAAA 7945 SEQ ID NO: 8886 7.2 -10.4 40.2 -17.6 0 -4.1
CAAAGAAATCCATAAAACCC 8034 SEQ ID NO:8887 7.2 -17.4 52.1 -24.6 0 -2.2
TGTATCTCCTATTGGAATGG 8071 SEQ ID NO: 8888 7.2 -21.6 64.6 -27.7 -1 -3.9
CCACCAAGTAATTAGGAGAT 8828 SEQ ID NO:8889 7.2 -21.3 62.2 -27 -1.4 -4.6
CCAGGGGCTCTGACACCATC 684 SEQ ID NO: 8890 7.3 -29.1 80.1 -35.3 -1 -5.4
AAGCCCAGCTAAAGGTGTCA 1569 SEQ ID NO: 8891 7.3 -25.5 71.6 -31.9 -0.8 -5
AGAACTTTCCAACAGCTCTC 1907 SEQ ID NO: 8892 7.3 -22.9 67.6 -30.2 0 -4.4
CCAAGTAATTAGGAGATAGC 8825 SEQ ID NO: 8893 7.3 -19.9 60.5 -26.5 -0.5 -3.8
ACACATTCTTTGTAGCTCTT
3187 SEQ ID NO:8894 7.4 -22.4 68.6 -29.3 -0.2 -5.7 ACTTGCTGAAACAGAATACT
7164 SEQ ID NO: 8895 7.4 -18.7 57 -26.1 0.2 -3.9
GAGAGATACCATATGATACT 7736 SEQ ID NO:8896 7.4 -19.5 59.6 -26.9 0 -6
AACCTGAAAATAATTTTCTT 7895 SEQ ID NO:8897 7.4 -15.6 50.3 -21.3 -1.7 -7.7
ACAAAGAATGTAACATTTAT 8851 SEQ ID NO: 8898 7.4 -14.4 48.2 -20.9 -0.8 -6.5
CATTGAAATCTGGTAAGAGC 2531 SEQ ID NO:8899 7.5 -19.1 58.5 -25.9 -0.5 -3.1
AATGTGGCCACTTGAAGCAG 4699 SEQ ID NO: 8900 7.5 -23.8 67.8 -28.9 -0.7 -13
TCGTGAATCAACAGCTGCAT 4742 SEQ ID NO: 8901 7.5 -22.8 65.5 -29.6 0 -9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo TCACCACCACAAAGTCAAAG
5244 SEQ ID NO: 8902 7.5 -21.3 61.2 -28.8 0 -2.5 ACAGGATAAAATAACTATTT
7390 SEQ ID NO: 8903 7.5 -14.3 48 -21.8 0 -4.9 ATCACAATGACACTGAAATC
1051 SEQ ID NO: 8904 7.6 -17.5 54.5 -24.6 -0.1 -3.2
CCACCCACCAAGGAAACCAC
2428 SEQ ID NO: 8905 7.6 -27.3 70.1 -34.3 -0.3 -4 CAAACATGCACCACAGGATA
7402 SEQ ID NO: 8906 7.6 -22 62.6 -29.6 0 -5.5
AGAGATACCATATGATACTC 7735 SEQ ID NO: 8907 7.6 -19.3 59.7 -26.9 0 -6
CACCCACCAAGGAAACCACA 2427 SEQ ID NO: 8908 7.7 -26 68 -33.1 -0.3 -4
GATCAACAAATGGATCCATA 2742 SEQ ID NO: 8909 7.7 -19.1 57.2 -24.8 -0.6 -12.2
CTTGCTGAAACAGAATACTT 7163 SEQ ID NO: 8910 7.7 -18.6 56.8 -25.6 -0.5 -4.6
CACAGGATAAAATAACTATT
7391 SEQ ID NO: 8911 7.7 -14.9 49 -22.6 0 -2.9 TAAAAAGAATTAACATTAAA
8349 SEQ ID NO: 8912 7.7 -9.2 38.2 -16.9 0 -3.5
CTGACACCATCTCTGGAGGA 675 SEQ ID NO: 8913 7.8 -25.5 73 -31.7 -1.5 -7
CAAGAAAATGACCAGGACAA 1682 SEQ ID NO: 8914 7.8 -18 54 -25.8 0 -4
CAGATTCGGATTTGGGAAAG 2037 SEQ ID NO: 8915 7.8 -20.2 59.8 -28 0 -4.4
TCCACCCACCAAGGAAACCA
2429 SEQ ID NO: 8916 7.8 -27.5 71 -34.7 -0.3 -4.5 TAACACAGTGGTAGAACTTG
4548 SEQ ID NO: 8917 7.8 -19.2 59.1 -27 0 -6.1
ATCACCACCACAAAGTCAAA
5245 SEQ ID NO: 8918 7.8 -21.3 61 -29.1 0 -2.5 CTCATAGAACATCTCAAAGT
5837 SEQ ID NO: 8919 7.8 -18.7 58.1 -26.5 0 -2.8
GCACCACAGGATAAAATAAC 7395 SEQ ID NO: 8920 7.8 -18.9 56.3 -26.7 0 -3.7
GTGGTACATATTTGATTTAA 7457 SEQ ID NO: 8921 7.8 -17.9 56.9 -24.8 -0.8 -5.2
ACCTGAAAATAATTTTCTTA 7894 SEQ ID NO: 8922 7.8 -16 51.4 -21.4 -2.4 -8.4
AAAAGAATTAACATTAAACT 8347 SEQ ID NO: 8923 7.8 -11.3 42 -19.1 0 -3.5
CTTGAAGCAGCTGATGCTGC 1861 SEQ ID NO: 8924 7.9 -25.2 72.4 -27.6 -5.5 -12.6
AAAACAGCAACCTCTTGTCA 6666 SEQ ID NO: 8925 7.9 -21.4 62.3 -28.7 -0.3 -4.9
GACACATACACTGTGGTACA 7469 SEQ ID NO: 8926 7.9 -22.3 66.1 -27.7 -2.5 -9.6
CAAAAGCAAAAGCATAAAGT 7936 SEQ ID NO: 8927 7.9 -15 48.5 -22.9 0.6 -4.1
AAAGAATTAACATTAAACTT 8346 SEQ ID NO: 8928 7.9 -12.1 43.5 -20 0 -5.1
ACCAAGTAATTAGGAGATAG 8826 SEQ ID NO: 8929 7.9 -18.3 57 -24.7 -1.4 -4.3
AACAAAGAATGTAACATTTA 8852 SEQ ID NO: 8930 7.9 -13.7 46.6 -20.7 -0.8 -7.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo CAGCTAAAGGTGTCAAAGCT 1564 SEQ ID NO:8931 8 -21.7 64.1 -28.4 -1.2 -5
AAAGCCCAGCTAAAGGTGTC 1570 SEQ ID NO: 8932 8 -24.1 68.3 -31.2 -0.8 -5.1
TGGTAAGAGCTTAACCTTCT 2521 SEQ ID NO:8933 8 -22.3 66.2 -29.2 -1 -8
TGACACCAATGAATAGATTC 4851 SEQ ID NO:8934 8 -18.4 56.4 -26.4 0 -4.9 ATATGATGATGTAACTGACA
5724 SEQ ID NO:8935 8 -17.7 55.6 -25 -0.4 -3.2 AGAGAGATACCATATGATAC
7737 SEQ ID NO:8936 8 -18.6 57.9 -26.6 0 -6 CAGAGAGATACCATATGATA
7738 SEQ ID NO:8937 8 -19.1 58.6 -27.1 0 -6 AATAGAGACAGGAAAGCCCA
1582 SEQ ID NO:8938 8.1 -22 62.9 -29.1 -0.9 -3.4
CGACCACAGCAAAAATGAAG 3150 SEQ ID NO:8939 8.1 -18.8 54.8 -26.9 0 -4.1
TTTAAGTTTTCAAAGTCAGA 3799 SEQ ID NO: 8940 8.1 -17.3 55.9 -25.4 0 -2.8
GATTCAGAGTGAAGAATGAC 4836 SEQ ID NO:8941 8.1 -18.2 57.2 -25.1 -1.1 -5.4
CCACAAAGTCAAAGATGTTC 5238 SEQ ID NO:8942 8.1 -19.4 58.6 -27.5 0 -3
AAAAAGAATTAACATTAAAC 8348 SEQ ID NO:8943 8.1 -9.7 39.1 -17.8 0 -3.5
GCCAATCCTGGCAAGACGGA 5339 SEQ ID NO: 8944 8.2 -27.5 73 -32.2 -3.5 -10.5
GATATGATGATGTAACTGAC
5725 SEQ ID NO: 8945 8.2 -17.6 55.6 -25.8 0 -2.6 AGGATAAAATAACTATTTAC
7388 SEQ ID NO: 8946 8.2 -13.3 46.2 -21 -0.2 -5.2 CAGGATAAAATAACTATTTA
7389 SEQ ID NO: 8947 8.2 -13.8 47 -21.5 -0.2 -5.2 ATGCACCACAGGATAAAATA
7397 SEQ ID NO:8948 8.2 -19.4 57.5 -27.6 0 -5.5
TACACTGTGGTACATATTTG 7463 SEQ ID NO: 8949 8.2 -19.8 61.2 -27.1 -0.8 -7.3
TTAGCATATTTAGTGTGGGC 3066 SEQ ID NO: 8950 8.3 -22.5 68.6 -30.8 0 -4.1
CATTCTTTGTAGCTCTTACC 3184 SEQ ID NO:8951 8.3 -23.2 70.1 -31 -0.1 -4.8
CACCACAGGATAAAATAACT 7394 SEQ ID NO:8952 8.3 -18 54.4 -26.3 0 -3.7
CATAAAAGTTCACAAAGCTG 8668 SEQ ID NO:8953 8.3 -16.9 53 -25.2 0 -5.1
AGATCAACAAATGGATCCAT 2743 SEQ ID NO:8954 8.4 -19.4 57.9 -25.8 -1.4 -11.9
GACACATTCTTTGTAGCTCT 3188 SEQ ID NO:8955 8.4 -22.9 69.7 -30.8 -0.2 -5.7
CCTTGAAATCCAGAGAGATA 7748 SEQ ID NO:8956 8.4 -20.8 61.3 -29.2 0 -3
ACTGCTTCCAGTACCTACAC 3689 SEQ ID NO:8957 8.5 -25.8 74.1 -32.7 -1.6 -4.8
TAGATTCAGAGTGAAGAATG 4838 SEQ ID NO:8958 8.5 -17.1 54.9 -24.4 -1.1 -5.4
CTAGAACAAATTTTGTAAAA 6832 SEQ ID NO:8959 8.5 -13.1 45.5 -20.7 -0.7 -8.2 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo ATGTATCTCCTATTGGAATG 8072 SEQ ID NO: 8960 8.5 -20.4 62 -27.8 -1 -5.1
GACACCAATGAATAGATTCA 4850 SEQ ID NO: 8961 8.6 -19.1 57.6 -26.7 -0.9 -7.5
AGAGAATCACCACCACAAAG 5250 SEQ ID NO: 8962 8.6 -20.9 60.4 -28.6 -0.8 -3.3
TTTTGTAAAAAGAATTAACA 8354 SEQ ID NO: 8963 8.6 -12.3 44 -19.6 -1.2 -9.3
ACATAAAAGTTCACAAAGCT 8669 SEQ ID NO: 8964 8.6 -17.1 53.5 -25.7 0 -4.8
CCACAGGATAAAATAACTAT 7392 SEQ ID NO: 8965 8.7 -16.8 52.3 -25.5 0 -2.3
CTTATGGATTCAAAAGTTTG 7973 SEQ ID NO: 8966 8.7 -17 54.1 -25.7 0.3 -5.3
TTTTATGTATACAAATGTCA
8575 SEQ ID NO:8967 8.7 -16.4 53.3 -24.6 0 -7.8 CACCAAGTAATTAGGAGATA
8827 SEQ ID NO: 8968 8.7 -19 58 -26.2 -1.4 -4.3
TATGATGATGTAACTGACAA 5723 SEQ ID NO: 8969 8.8 -17 53.7 -25 -0.6 -3.9
GTTACACTATCATAGGAAGG 6373 SEQ ID NO:8970 8.8 -19.8 61.1 -28.6 0 -3.4
TAAAATTCATGTAAACTTTT 8591 SEQ ID NO: 8971 8.8 -13.7 47 -22.5 0 -4.7
TGATAAGCATGCTGAATAAA 855 SEQ ID NO: 8972 8.9 -17 53.1 -24.5 0 -10.7
ATAAAATAACTATTTACATA 7385 SEQ ID NO: 8973 8.9 -11.9 43.4 -20.3 -0.2 -5.2
CTTTTATGTATACAAATGTC
8576 SEQ ID NO: 8974 8.9 -16.6 53.9 -25 0 -8.3 TCCTCCAGGGGCTCTGACAC
688 SEQ ID NO: 8975 9.1 -29.7 82.9 -38.1 -0.5 -5.3
TGCTGAAACAGAATACTTTG 7161 SEQ ID NO: 8976 9.1 -17.7 55 -26.1 -0.5 -4.6
TAACAAAGAAATCCATAAAA 8037 SEQ ID NO:8977 9.1 -12.4 43.6 -21.5 0 -2.2
CAGCACCTTTTTCCGGAAAA 390 SEQ ID NO: 8978 9.2 -23.6 65.1 -29.9 -0.3 -14
ATAAGCATGCTGAATAAAGA 853 SEQ ID NO: 8979 9.2 -17 53.2 -24.6 0 -11.2
AGACACATTCTTTGTAGCTC 3189 SEQ ID NO: 8980 9.2 -22 67.8 -30.7 -0.2 -5.7
ACTAGAACAAATTTTGTAAA 6833 SEQ ID NO:8981 9.2 -14 47.4 -21.9 -1.2 -8.7
TAAGCATGCTGAATAAAGAA 852 SEQ ID NO: 8982 9.3 -16.3 51.6 -24 0 -11.2
TAGAACAAATTTTGTAAAAA 6831 SEQ ID NO: 8983 9.3 -11.5 42.4 -19.5 -1.2 -8.7
ATGTGGCCACTTGAAGCAGT 4698 SEQ ID NO:8984 9.4 -25.7 73.4 -32.7 0.1 -13
ATAGATTCAGAGTGAAGAAT 4839 SEQ ID NO: 8985 9.4 -17.1 55 -25.7 -0.6 -5.1
CACCACCACAAAGTCAAAGA 5243 SEQ ID NO: 8986 9.4 -21.5 61.1 -30.9 0 -2.7
ACAAAGAAATCCATAAAACC 8035 SEQ ID NO: 8987 9.4 -15.6 49.2 -25 0 -1.4
CACAGTCGGGTGGTGCACTA 5631 SEQ ID NO:8988 9.5 -27.3 77.4 -35.4 -1.1 -10 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo GAACAAATTTTGTAAAAATA
6829 SEQ ID NO:8989 9.5 -11.5 42.3 -18.8 -2.2 -8.7 TCTTATGGATTCAAAAGTTT
7974 SEQ ID NO: 8990 9.5 -17.4 55.4 -26.9 2.9 -2.2
ATTGAAAAATCTTATGGATT 7983 SEQ ID NO:8991 9.5 -14.9 49.3 -23.2 -1.1 -4.6
AGTTTTCAAAGTCAGACTCT 3795 SEQ ID NO:8992 9.6 -20.5 64 -30.1 0 -7.3
ACCACAGGATAAAATAACTA 7393 SEQ ID NO:8993 9.6 -17 52.7 -26.6 0 -3.7
ACACATACACTGTGGTACAT 7468 SEQ ID NO:8994 9.6 -21.7 64.8 -28.8 -2.5 -9.6
TAAGTTTTCAAAGTCAGACT
3797 SEQ ID NO:8995 9.7 -18.2 57.8 -27.9 0 -7.1 TT7ΛAGTTTTCAAAGTCAGAC
3798 SEQ ID NO:8996 9.7 -17.4 56.1 -27.1 0 -5.1 TCCAGGGGCTCTGACACCAT
685 SEQ ID NO:8997 9.8 -29.1 80.1 -37.8 -1 -4.9
ATGAATAGATTCAGAGTGAA 4843 SEQ ID NO:8998 9.8 -17.1 54.7 -25.7 -1.1 -7.8 AGAACAAATTTTGTAAAAAT
6830 SEQ ID NO: 8999 9.8 -11.8 42.9 -19.6 -2 -8.7 AAAATAACTATTTACATAAC
7383 SEQ ID NO:9000 9.8 -11.7 42.9 -21 -0.2 -5.2 TGTGGTACATATTTGATTTA
7458 SEQ ID NO:9001 9.8 -18.6 58.8 -27.5 -0.8 -5.2 GAGCCTGACAGTCACTCAAA
4611 SEQ ID NO:9002 9.9 -23.9 69 -32.8 -0.8 -9.3 TAAAATAACTATTTACATAA
7384 SEQ ID NO:9003 9.9 -11.2 42 -20.6 -0.2 -5.2 AGAGCCTGACAGTCACTCAA
4612 SEQ ID NO:9004 10 -24.6 71.6 -33 -1.6 -10 TTCCTTGAAATCCAGAGAGA
7750 SEQ ID NO:9005 10 -21.6 63.6 -31.6 0 -2.9
TTATGGATTCAAAAGTTTGG 7972 SEQ ID NO:9006 10 -17.3 54.7 -26.8 -0.1 -5.9
AAGATCAACAAATGGATCCA 2744 SEQ ID NO: 9007 10.1 -18.7 56.1 -27.2 -1.4 -10.1
TAAAAACAGCAACCTCTTGT 6668 SEQ ID NO:9008 10.1 -19.3 57.5 -28.8 -0.3 -4.2
ACTTTTATGTATACAAATGT 8577 SEQ ID NO:9009 10.1 -16.4 53.2 -26 0 -8.3
CACATAAAAGTTCACAAAGC 8670 SEQ ID NO:9010 10.1 -16.9 53 -27 0 -2.8
GATAAGAAAACAAAGAGACC 38 SEQ ID NO:9011 10.2 -15 48.7 -25.2 0 -1.2
TTATGTATACAAATGTCAGA 8573 SEQ ID NO: 9012 10.2 -16.8 54.1 -26.5 0 -8.3
AAAATTCATGTAAACTTTTA 8590 SEQ ID NO: 9013 10.2 -13.7 47 -23.9 0 -4.7
GGTCAGAATGCTGGCTATGC 2591 SEQ ID NO:9014 10.3 -25.5 73.9 -33.5 -2.3 -8.1
TCCTTGAAATCCAGAGAGAT 7749 SEQ ID NO: 9015 10.3 -21.5 63.2 -31.8 0 -2.9
CCAATCCTGGCAAGACGGAT 5338 SEQ ID NO:9016 10.5 -25.7 69.1 -35.3 -0.8 -5.2
AAAAACAGCAACCTCTTGTC 6667 SEQ ID NO: 9017 10.5 -20 59.3 -29.9 -0.3 -4.9 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo CACATACACTGTGGTACATA 7467 SEQ ID NO: 9018 10.5 -21.2 63.6 -30.1 -1.6 -8.5
TTTATGTATACAAATGTCAG 8574 SEQ ID NO: 9019 10.5 -16.3 53.1 -26.3 0 -8.3
ATTCTTTGTAGCTCTTACCA 3183 SEQ ID NO: 9020 10.6 -23.2 70.1 -33.3 -0.1 -4.8
ACCACAAAGTCAAAGATGTT
5239 SEQ ID NO: 9021 10.6 -19.2 57.8 -29.8 0 -3 AAAAGCAAAAGCATAAAGTA
7935 SEQ ID NO: 9022 10.7 -14 46.8 -24.2 -0.2 -4.1
TGTATACAAATGTCAGATCA 8570 SEQ ID NO: 9023 10.7 -18.1 57 -28.8 0 -7.4
AATAGATTCAGAGTGAAGAA
4840 SEQ ID NO: 9024 10.8 -16.4 53.1 -26 -1.1 -4.8 CACCACAAAGTCAAAGATGT
5240 SEQ ID NO: 9025 10.8 -19.8 58.7 -30.6 0 -2.8 AGCAAAAATTTTATCTCTCT
6983 SEQ ID NO: 9026 10.8 -17.6 55.6 -28.4 0 -7.2
CACTGCTTCCAGTACCTACA 3690 SEQ ID NO: 9027 10.9 -26.3 74.6 -35.4 -1.8 -5.2
AAGTTTTCAAAGTCAGACTC 3796 SEQ ID NO: 9028 10.9 -18.9 59.8 -29.8 0 -7.3
ATGATGATGTAACTGACAAA 5722 SEQ ID NO: 9029 10.9 -16.6 52.6 -26.7 -0.6 -3.9
TATGGATTCAAAAGTTTGGA 7971 SEQ ID NO: 9030 10.9 -17.8 55.7 -28.2 -0.1 -5.9
AAATTCATGTAAACTTTTAT 8589 SEQ ID NO: 9031 11 -14.4 48.6 -25.4 0 -4.1
GATAAGCATGCTGAATAAAG 854 SEQ ID NO: 9032 11.1 -17 53.2 -26.5 0 -11.2
TGGCAAGATCAACAAATGGA 2748 SEQ ID NO: 9033 11.1 -19.3 57.4 -30.4 0 -5.4
CCACCACAAAGTCAAAGATG
5241 SEQ ID NO: 9034 11.1 -20.6 59.4 -31.7 0 -2.7 TATGTATACAAATGTCAGAT
8572 SEQ ID NO:9035 11.1 -16.7 53.8 -27.3 0 -8.3
GCTCTTACCAAAGAGCTGCA 3173 SEQ ID NO: 9036 11.2 -25.1 71.3 -31.2 -5.1 -15.4
GAATAGATTCAGAGTGAAGA
4841 SEQ ID NO: 9037 11.2 -17.7 56.3 -27.7 -1.1 -5.7 ACCACCACAAAGTCAAAGAT
5242 SEQ ID NO: 9038 11.3 -20.8 60 -32.1 0 -2.7 TTTGCACACATAAAAGTTCA
8676 SEQ ID NO: 9039 11.5 -18.5 56.9 -30 0 -5
GGCAAGATCAACAAATGGAT 2747 SEQ ID NO:9040 11.7 -19.3 57.4 -31 0 -4.6
TTCTTTGTAGCTCTTACCAA 3182 SEQ ID NO: 9041 11.7 -22.5 67.7 -33.7 -0.1 -4.8
GATGACACCAATGAATAGAT 4853 SEQ ID NO: 9042 11.7 -18.5 56.1 -30.2 0 -3
GTATACAAATGTCAGATCAA 8569 SEQ ID NO: 9043 11.7 -17.4 55.1 -29.1 0 -6.1
TGATGACACCAATGAATAGA 4854 SEQ ID NO: 9044 11.9 -18.5 56 -30.4 0 -3.4
TGAATAGATTCAGAGTGAAG
4842 SEQ ID NO: 9045 12 -17.1 54.9 -27.9 -1.1 -7 TGTGGCCACTTGAAGCAGTG
4697 SEQ ID NO: 9046 12.1 -25.7 73.2 -35.4 -0.8 -13 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo AATCCTGGCAAGACGGATCA
5336 SEQ ID NO:9047 12.1 -24.1 67.2 -35.1 -1 -5.3 CAATCCTGGCAAGACGGATC
5337 SEQ ID NO: 9048 12.1 -24.1 67.2 -35.1 -1 -4.8 AATTCATGTAAACTTTTATG
8588 SEQ ID NO:9049 12.1 -15.1 50.2 -27.2 0 -4.7 TTGATCCTTTGCACACATAA
8683 SEQ ID NO.-9050 12.1 -21.5 63.2 -33.6 0 -5 ATGTATACAAATGTCAGATC
8571 SEQ ID NO: 9051 12.3 -17.4 55.7 -29.2 0 -8.3 CTTTGCACACATAAAAGTTC
8677 SEQ ID NO: 9052 12.3 -18.7 57.5 -31 0 -5 GC7AAAAATTTTATCTCTCTG
6982 SEQ ID NO:9053 12.4 -17.6 55.4 -30 0 -7.2
TGATCCTTTGCACACATAAA 8682 SEQ ID NO: 9054 12.4 -20.7 60.9 -33.1 0 -5
AAGCAAAAGCATAAAGTAAA
7933 SEQ ID NO: 9055 12.7 -14 46.8 -26.2 -0.2 -4.1 AAAGCAAAAGCATAAAGTAA
7934 SEQ ID NO: 9056 12.7 -14 46.8 -26.2 -0.2 -4.1 ATCCTGGCAAGACGGATCAC
5335 SEQ ID NO: 9057 12.8 -25 69.8 -37.1 -0.5 -5.3 CTTGATCCTTTGCACACATA
8684 SEQ ID NO: 9058 12.8 -23.1 67.3 -35.9 0 -5 GCACACATAAAAGTTCACAA
8673 SEQ ID NO: 9059 12.9 -18.5 56.2 -31.4 0 -3.4 TCCTTTGCACACATAAAAGT
8679 SEQ ID NO: 9060 13 -20.6 60.9 -32.9 -0.4 -4.7 GAGCAAAAATTTTATCTCTC
6984 SEQ ID NO:9061 13.2 -17.3 55 -29.8 -0.1 -9.1
TATACAAATGTCAGATCAAG 8568 SEQ ID NO:9062 13.3 -16.2 52.4 -29.5 0 -5.4
AACTTTTATGTATACAAATG 8578 SEQ ID NO:9063 13.4 -14.5 48.7 -27.4 0 -8.3
CCTTTGCACACATAAAAGTT
8678 SEQ ID NO: 9064 13.5 -20.3 59.9 -33.1 -0.4 -5 GATCCTTTGCACACATAAAA
8681 SEQ ID NO: 9065 13.6 -20 59.1 -33.6 0 -5
GCATGCTGAATAAAGAATGT 849 SEQ ID NO: 9066 13.7 -18.5 56.3 -31.5 0 -8.9 TGCACACATAAAAGTTCACA
8674 SEQ ID NO: 9067 13.7 -19.2 58 -32.9 0 -4.7 GCAAGATCAACAAATGGATC
2746 SEQ ID NO:9068 14.1 -18.5 56.3 -31.5 -1 -5.4
CACACATAAAAGTTCACAAA 8672 SEQ ID NO: 9069 14.3 -16 50.9 -30.3 0 -2.6
ATTCATGTAAACTTTTATGT 8587 SEQ ID NO: 9070 14.4 -17 54.8 -31.4 0 -4.7
AATCACCACCACAAAGTCAA
5246 SEQ ID NO: 9071 14.5 -21.3 61 -35.8 0 -2.5 AAGCATGCTGAATAAAGAAT
851 SEQ ID NO: 9072 14.6 -16.6 52.1 -29.6 0 -11.2 GAATCACCACCACAAAGTCA
5247 SEQ ID NO: 9073 14.7 -22.6 64.1 -37.3 0 -2.6 ATCCTTTGCACACATAAAAG
8680 SEQ ID NO:9074 14.8 -19.4 58 -33.7 -0.1 -5 TTCATGTAAACTTTTATGTA
8586 SEQ ID NO: 9075 14.9 -16.7 54.3 -31.6 0 -4.7 kcal/ mol kcal/mol deg C kcal/mol kcal/mol kcal/mol
Intra- Inter- total duplex Tm of target molecular molecular Position oligo binding formation Duplex structure oligo oligo ATACACTGTGGTACATATTT
7464 SEQ ID NO: 9076 15 -19.8 61.3 -33.9 -0.8 -7.3 CATGTAAACTTTTATGTATA
8584 SEQ ID NO:9077 15 -15.9 52.1 -30.9 0 -3.5 AAACTTTTATGTATACAAAT
8579 SEQ ID NO:9078 15.1 -13.8 47.2 -28.4 0 -8.3 ACACATAAAAGTTCACAAAG
8671 SEQ ID NO:9079 15.1 -15.3 49.8 -30.4 0 -2.6
AAACATGCACCACAGGATAA 7401 SEQ ID NO:9080 15.2 -20.6 59.6 -35.8 0 -5
TCATGTAAACTTTTATGTAT
8585 SEQ ID NO: 9081 15.2 -16.6 53.9 -31.8 0 -4.7 ATGTAAACTTTTATGTATAC
8583 SEQ ID NO: 9082 15.3 -15.4 51.3 -30.7 0 -5.8
AGCATGCTGAATAAAGAATG 850 SEQ ID NO: 9083 15.4 -17.3 53.7 -31.5 0 -10.4 ACATGCACCACAGGATAAAA
7399 SEQ ID NO: 9084 15.8 -20.6 59.6 -36.4 0 -5.5 AACATGCACCACAGGATAAA
7400 SEQ ID NO: 9085 15.8 -20.6 59.6 -36.4 0 -5.5 CATACACTGTGGTACATATT
7465 SEQ ID NO: 9086 15.8 -20.4 62.2 -35.3 -0.8 -7.3 CATGCACCACAGGATAAAAT
7398 SEQ ID NO:9087 16 -20.4 59.1 -36.4 0 -5.5
GAGAATCACCACCACAAAGT 5249 SEQ ID NO:9088 16.3 -22.1 63.1 -38.4 0 -3.3
AGAATCACCACCACAAAGTC 5248 SEQ ID NO: 9089 16.5 -21.9 63.2 -38.4 0 -3.3
ACATACACTGTGGTACATAT
7466 SEQ ID NO: 9090 16.9 -20.5 62.4 -36.5 -0.8 -6.4 TAAACTTTTATGTATACAAA
8580 SEQ ID NO: 9091 17 -13.5 46.6 -30 0 -8.3 TGTAAACTTTTATGTATACA
8582 SEQ ID O:9092 17.6 -16.1 52.7 -32.9 -0.6 -7.9
TTGCACACATAAAAGTTCAC 8675 SEQ ID NO:9093 17.8 -18.6 57.1 -36.4 0 -5
GTAAACTTTTATGTATACAA
8581 SEQ ID NO: 9094 21.5 -15.4 50.9 -36.4 0 -8.3
Example 15
Western blot analysis of Navl.3 protein levels
[00184] Western blot analysis (immunoblot analysis) is carried out using standard methods. Cells are harvested 16-20 h after oligonucleotide treatment, washed once with PBS, suspended in Laemmli buffer (100 ul/well), boiled for 5 minutes and loaded on a 4% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and transferred to membrane for western blotting. Appropriate primary antibody directed to Navl.3 is used, with a radiolabeled or fluorescently labeled secondary antibody directed against the primary antibody species. Bands are visualized using a
PHOSPHORIMAGER™ (Molecular Dynamics, Sunnyvale CA).

Claims

WHAT IS CLAIMED IS:
1. An antisense compound targeted to a nucleic acid molecule encoding Navl.3, wherein said antisense compound specifically hybridizes with and inhibits the expression of Navl .3.
2. An antisense compound 8 to 30 nucleobases in length targeted to a nucleic acid molecule encoding Navl.3, wherein said antisense compound specifically hybridizes with and inhibits the expression of Navl.3.
3. The antisense compound of claim 2 wherein said antisense compound is an antisense oligonucleotide.
4. The antisense oligonucleotide of claim 3 comprising a nucleic acid sequence selected from the group consisting of at least eight contiguous bases of SEQ ID NO:l - SEQ ID NO:9094.
5. The antisense oligonucleotide of claim 3 comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 - SEQ ID NO:9094.
6. The antisense compound of claim 2, 3, 4, or 5 wherein the antisense oligonucleotide comprises at least one modified internucleoside linkage.
7. The antisense compound of claim 6 wherein the modified internucleoside linkage is a phosphorothioate linkage.
8. The antisense compound of claim 2, 3, 4, or 5 wherein the antisense oligonucleotide comprises at least one modified sugar moiety.
9. The antisense compound of claim 8 wherein the modified sugar moiety is a 2'-O-methoxyethyl sugar moiety.
10. The antisense compound of claim 2, 3, 4, or 5 wherein the antisense oligonucleotide comprises at least one modified nucleobase.
11. The antisense compound of claim 10 wherein the modified nucleobase is a 5-methylcytosine.
12. The antisense compound of claim 2, 3, 4, or 5 wherein the antisense oligonucleotide is a chimeric oligonucleotide.
13. A composition comprising the antisense compound of claim 2 and a pharmaceutically acceptable carrier or diluent.
14. The composition of claim 13 further comprising a colloidal dispersion system.
15. The composition of claim 13 wherein the antisense compound is an antisense oligonucleotide.
16. A method of inhibiting the expression of Navl .3 in cells or tissues comprising contacting said cells or tissues with the antisense compound of claim 2 so that expression of Navl.3 is inhibited.
17. A method of treating a human having a disease or condition associated with Navl .3 comprising administering to said animal a therapeutically or prophylactically effective amount of the antisense compound of claim 2 so that expression of Navl .3 is inhibited.
18. The method of claim 17 wherein the disease or condition is pain, including but not limited to neuropathic pain, post-herpetic neuralgia, chronic pain, lower back pain, diabetic neuropathy, trigeminal neuropathy, arthritic pain, acute pain, pain from burns, migraine headache, cluster headache, mild-to-moderate headache.
19. The method of claim 18 wherein the disease or condition is a seizure disorder.
20. The method of claim 17 wherein the disease or condition is a childhood seizure disorder, including but not limited to neonatal or infantile epilepsy.
21. The method of claim 17 wherein the disease or condition is an ataxia.
EP03749047A 2002-08-14 2003-08-14 Antisense modulation of nav1.3 expression Withdrawn EP1578927A2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US40341602P 2002-08-14 2002-08-14
US403416P 2002-08-14
PCT/US2003/025465 WO2004016754A2 (en) 2002-08-14 2003-08-14 ANTISENSE MODULATION OF Nav1.3 EXPRESSION

Publications (1)

Publication Number Publication Date
EP1578927A2 true EP1578927A2 (en) 2005-09-28

Family

ID=31888234

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03749047A Withdrawn EP1578927A2 (en) 2002-08-14 2003-08-14 Antisense modulation of nav1.3 expression

Country Status (7)

Country Link
EP (1) EP1578927A2 (en)
JP (1) JP2006507808A (en)
AU (1) AU2003268096A1 (en)
BR (1) BR0313455A (en)
CA (1) CA2495398A1 (en)
MX (1) MXPA05001836A (en)
WO (1) WO2004016754A2 (en)

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8258105B2 (en) 2003-10-07 2012-09-04 Isis Pharmaceuticals, Inc. Antisense oligonucleotides optimized for kidney targeting
US20050191653A1 (en) 2003-11-03 2005-09-01 Freier Susan M. Modulation of SGLT2 expression
GB0719367D0 (en) 2007-10-03 2007-11-14 Procarta Biosystems Ltd Transcription factor decoys, compositions and methods
US20110059895A1 (en) * 2007-11-09 2011-03-10 Isis Pharmaceuticals, Inc. Modulation of factor 9 expression
JP2011502514A (en) 2007-11-09 2011-01-27 アイシス ファーマシューティカルズ インコーポレイティッド Regulation of factor 7 expression
GB0906130D0 (en) * 2008-10-03 2009-05-20 Procrata Biosystems Ltd Transcription factor decoys
EP2515947B1 (en) * 2009-12-23 2021-10-06 CuRNA, Inc. Treatment of uncoupling protein 2 (ucp2) related diseases by inhibition of natural antisense transcript to ucp2
GB201002413D0 (en) 2010-02-12 2010-03-31 Procarta Biosystems Ltd Nucleic acid complexes
GB201005545D0 (en) 2010-04-01 2010-05-19 Procarta Biosystems Ltd Transcription factor decoys
PL2585596T3 (en) 2010-06-23 2021-06-28 Curna, Inc. Treatment of sodium channel, voltage-gated, alpha subunit (scna) related diseases by inhibition of natural antisense transcript to scna
ES2688831T3 (en) 2012-06-25 2018-11-07 Ionis Pharmaceuticals, Inc. UBE3A-ATS expression modulation
EP2931893A1 (en) * 2012-12-13 2015-10-21 Universität Leipzig T-cell modulation by exon skipping
WO2016086104A1 (en) 2014-11-25 2016-06-02 Ionis Pharmaceuticals, Inc. Modulation of ube3a-ats expression
EP3374498A1 (en) 2015-11-12 2018-09-19 H. Hoffnabb-La Roche Ag Standardized neuronal cell assays from primate species
TWI809004B (en) * 2017-11-09 2023-07-21 美商Ionis製藥公司 Compounds and methods for reducing snca expression
EA202190581A1 (en) * 2018-08-20 2021-07-13 Рогкон, Инк. ANTI-SENSE OLIGONUCLEOTIDES TARGETING SCN2A FOR THE TREATMENT OF SCN1A ENCEPHALOPATHY
JP7550165B2 (en) 2019-03-29 2024-09-12 アイオーニス ファーマシューティカルズ, インコーポレーテッド Compounds and methods for modulating UBE3A-ATS

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6610539B1 (en) * 1997-07-10 2003-08-26 Genesense Technologies, Inc. Antisense oligonucleotide sequences as inhibitors of microorganisms
US6124133A (en) * 1999-10-15 2000-09-26 Isis Pharmaceuticals Inc. Antisense inhibition of fra-1 expression
DE60230641D1 (en) * 2001-09-14 2009-02-12 Oxford Biomedica Ltd LENTIVIRAL VECTORS FOR THE TREATMENT OF PAIN

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2004016754A2 *

Also Published As

Publication number Publication date
AU2003268096A1 (en) 2004-03-03
WO2004016754A3 (en) 2005-11-10
WO2004016754A2 (en) 2004-02-26
AU2003268096A8 (en) 2004-03-03
BR0313455A (en) 2007-07-31
CA2495398A1 (en) 2004-02-26
MXPA05001836A (en) 2005-04-19
JP2006507808A (en) 2006-03-09

Similar Documents

Publication Publication Date Title
US6365354B1 (en) Antisense modulation of lysophospholipase I expression
US6033910A (en) Antisense inhibition of MAP kinase kinase 6 expression
US6046321A (en) Antisense modulation of G-alpha-i1 expression
US6107091A (en) Antisense inhibition of G-alpha-16 expression
EP1325019B1 (en) Antisense modulation of clusterin expression
AU770526B2 (en) Antisense modulation of PI3K P85 expression
AU767011B2 (en) Antisense modulation of ship-2 expression
US5951455A (en) Antisense modulation of G-alpha-11 expression
WO2004016224A2 (en) Antisense modulation of vegf co-regulated chemokine-1 expression
WO2004030750A1 (en) Antisense modulation of farnesoid x receptor expression
US6037176A (en) Antisense inhibition of integrin beta 3 expression
US5959097A (en) Antisense modulation of MEK2 expression
WO2004016754A2 (en) ANTISENSE MODULATION OF Nav1.3 EXPRESSION
US5962673A (en) Antisense modulation of inhibitor-kappa B kinase-alpha expression
US5948680A (en) Antisense inhibition of Elk-1 expression
US6159734A (en) Antisense modulation of peroxisome proliferator-activated receptor gamma expression
WO2004028458A2 (en) Antisense modulation of microsomal prostaglandin e2 synthase expression
US6008344A (en) Antisense modulation of phospholipase A2 group IV expression
AU2001229537B2 (en) Antisense modulation of macrophage migration inhibitory factor expression
US20030211610A1 (en) Antisense inhibition of adam10 expression
EP1534728A2 (en) Antisense modulation of glucocorticoid receptor expression
EP1218395B1 (en) Antisense modulation of x-linked inhibitor of apoptosis expression
EP1543159A2 (en) Antisense modulation of endothelial specific molecule 1 expression
US5985664A (en) Antisense modulation of Sentrin expression
US6165728A (en) Antisense modulation of NCK-2 expression

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

PUAK Availability of information related to the publication of the international search report

Free format text: ORIGINAL CODE: 0009015

DAX Request for extension of the european patent (deleted)
AK Designated contracting states

Kind code of ref document: A3

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

RIC1 Information provided on ipc code assigned before grant

Ipc: A61K 48/00 19900101ALI20051115BHEP

Ipc: C07H 21/04 19740701AFI20051115BHEP

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20060511

REG Reference to a national code

Ref country code: DE

Ref legal event code: 8566