EP1543159A2 - Antisense modulation of endothelial specific molecule 1 expression - Google Patents
Antisense modulation of endothelial specific molecule 1 expressionInfo
- Publication number
- EP1543159A2 EP1543159A2 EP03781285A EP03781285A EP1543159A2 EP 1543159 A2 EP1543159 A2 EP 1543159A2 EP 03781285 A EP03781285 A EP 03781285A EP 03781285 A EP03781285 A EP 03781285A EP 1543159 A2 EP1543159 A2 EP 1543159A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- seq
- kcal
- mol
- esm
- antisense
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
- C12N2310/334—Modified C
- C12N2310/3341—5-Methylcytosine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/341—Gapmers, i.e. of the type ===---===
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/582—Recycling of unreacted starting or intermediate materials
Definitions
- the present invention provides compositions and methods for modulating the expression of Endothelial Specific Molecule-1 (ESM-1).
- this invention relates to antisense compounds, particularly oligonucleotides, specifically hybridizable with nucleic acids encoding Endothelial Specific Molecule-1.
- Such oligonucleotides have been shown to modulate the expression of Endothelial Specific Molecule-1.
- Angiogenesis is the growth of new capillary blood vessels from preexisting vessels and capillaries and is crucial in a large number of processes, such as wound repair, embryonic development, and the growth of solid tumors.
- endothelial cells will undergo migration, elongation, proliferation, and orientation leading to lumen formation, re-establishment of a basement membrane and eventual anastomosis with other vessels (Patan S. et al., (2000), J. Neurooncol. 50: 1-15).
- Endothelial cell-specific molecule 1 (ESM-1) was originally isolated in an immunoscreening of a HUNEC cD ⁇ A library in order to identify the gene encoding a 55-kDa autoantigen that may have a role in asthma (Lassalle, P., et al., ).
- the full length ESM-1 cD ⁇ A was cloned in a library constructed in pCDM8 but was found to be inserted in the reverse orientation (Lassalle, P., et al., ).
- Northern blots have shown ESM-1 to probes to hybridize to RNA from HUNEC cells, SN40-transfected HUNECs, human lung, and human kidney.
- ESM-1 ESM-1 antigen-specific semiconductor-1
- human lung colon, and kidney
- ESM-1 is expressed in venules, arterioles, and alveolar capillaries as well as by epithelial cells of the bronchi and submucosal glands.
- expression is predominantly in renal tubular epithelial cells.
- Capillaries and venules of the lamina intestinal of the colon also display ESM-1 expression.
- a splice variant of ESM-1 has been identified which lacks 150 base pairs but maintains the open reading frame (Aitkenhead, M., et al, (2002) Microvasc. Res. 63, 159-171).
- ESM-1 expression appears to be both constitutive and under the control of a variety of cytokines.
- HUNEC cells treated with T ⁇ F ⁇ or IL- l ⁇ display an up-regulation of the gene. No change in ESM-1 levels was seen upon treatment with IL-4 or IFN ⁇ . While coadministration of TNF ⁇ and IFN ⁇ lead to a synergistic induction of proinflammatory factors such as IL-6, IL-8, RANTES and ICAM-1 , the combination of these two cytokines inhibit the TNF ⁇ induced ESM-1 up-regulation (Lassale et al., 1996).
- ESM-1 has been found to be differentially expressed in endothelial cells forming tubes in a 3-dimensional collagen gel when compared to cells growing in two dimensions (Aitkenhead et al., 2002). Microarray analysis indicates a higher level of ESM-1 expression in HMNEC cells growing on collagen relative to those growing on osteopontin. We followed up on this observation by investigating the expression level of ESM-1 in colon tumor samples compared to a pool of normal colon tissue. Nine often tumors showed expression at levels of tlireefold or higher at the RNA level, as determined by real-time quantitative reverse transcription polymerase chain reaction experiments. [007] We have amplified ESM-1 from HDMECs and cloned it into an expression vector.
- a pool of transfected NIH3T3 cells were then selected and assayed for ESM-1 expression. After confirming significant gene over- expression at the RNA level, cells were injected subcutaneously into a nu/nu female mouse. While vector transfected NIH3T3 fibroblasts failed to grow in these mice, those cells transfected with ESM-1 formed solid tumors within three weeks. This data shows that ESM-1 contains the potential to augment growth in vivo to a cell line that is usually not capable of fonriing tumors.
- ESM- 1 Previous work on ESM- 1 has found that levels of expression of this gene change in cells under varying conditions. We have extended those findings to show that ESM-1 is up regulated in colon carcinomas when compared to normal colon tissue. Additionally, we have shown that forced over-expression of ESM-1 leads to an escalation of growth of NIH3T3 fibroblasts in vivo.
- Antisense technology is emerging as an effective means for reducing the expression of specific gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of ESM-1 expression.
- the present invention is directed to antisense compounds, particularly oligonucleotides, which are targeted to a nucleic acid encoding ESM-1, and which modulate the expression of ESM-1.
- Pharmaceutical and other compositions comprising the antisense compounds of the invention are also provided.
- methods of modulating the expression of ESM-1 in cells or tissues comprising contacting said cells or tissues with one or more of the antisense compounds or compositions of the invention.
- methods of treating an animal, particularly a human, suspected of having or being prone to a disease or condition associated with expression of ESM-1 by administering a therapeutically or prophylactically effective amount of one or more of the antisense compounds or compositions of the invention.
- Figure 1 shows the cDNA sequence and the ESM-1 protein sequence encoded therefrom.
- Figure 2 shows the ESM-1 expression levels in ten tumors as determined by Real-Time Quantitative PCR.
- the present invention employs oligomeric antisense compounds, particularly oligonucleotides, for use in modulating the function of nucleic acid molecules encoding ESM-1, ultimately modulating the amount of ESM-1 produced. This is accomplished by providing antisense compounds, which specifically hybridize with one or more nucleic acids encoding ESM-1.
- target nucleic acid and “nucleic acid encoding ESM-1” encompass DNA encoding ESM-1, RNA (including pre-mRNA and mRNA) transcribed from such DNA, and also cDNA derived from such RNA. The specific hybridization of an oligomeric compound with its target nucleic acid interferes with the normal function of the nucleic acid.
- RNA to be interfered with This modulation of function of a target nucleic acid by compounds, which specifically hybridize to it, is generally referred to as "antisense".
- the functions of DNA to be interfered with include replication and transcription.
- the functions of RNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA.
- the overall effect of such interference with target nucleic acid function is modulation of the expression of ESM-1.
- modulation means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene.
- inhibition is the preferred form of modulation, of gene expression and mRNA is a preferred target.
- Targeting an antisense compound to a particular nucleic acid is a multistep process. The process usually begins with the identification of a nucleic acid sequence whose function is to be modulated. This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In the present invention, the target is a nucleic acid molecule encoding ESM-1.
- the targeting process also includes determination of a site or sites within this gene for the antisense interaction to occur such that the desired effect, e.g., detection or modulation of expression of the protein, will result.
- a preferred intragenic site is the region encompassing the translation initiation or termination codon of the open reading frame (ORF) of the gene. Since, as is known in the art, the translation initiation codon is typically 5' -AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon,” the "start codon” or the "AUG start codon”.
- translation initiation codon having the RNA sequence 5'-GUG, 5'-UUG or 5'- CUG, and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo.
- the terms "translation initiation codon” and "start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions.
- start codon and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding ESM- 1 , regardless of the sequence(s) of such codons.
- a translation termination codon (or "stop codon”) of a gene may have one of three sequences, i.e. 5'- UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences are 5'- TAA, 5 '-TAG and 5'-TGA, respectively).
- start codon region and “translation initiation codon region” “refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation initiation codon.
- stop codon region and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation tennination codon.
- Other target regions include the 5' untranslated region (5'UTR), known in the art to refer to the portion of an mRNA in the 5 ' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene, and the 3 ' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3 ' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA or corresponding nucleotides on the gene.
- 5'UTR 5' untranslated region
- 3'UTR known in the art to refer to the portion of an mRNA in the 3 ' direction from the translation termination codon, and
- the 5 ' cap of an mRNA comprises an N7-methylated guanosine residue joined to the 5'-most residue of the mRNA via a 5'-5' triphosphate linkage.
- the 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap.
- the 5 ' cap region may also be a preferred target region.
- some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as "introns,” which are excised from a transcript before it is translated. The remaining (and therefore translated) regions are known as "exons" and are spliced together to form a continuous mRNA sequence.
- mRNA splice sites i.e., intron-exon junctions
- intron-exon junctions may also be preferred target regions, and are particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular mRNA splice product is implicated in disease. Aberrant fusion junctions due to rearcangements or deletions are also preferred targets. It has also been found that introns can also be effective, and therefore preferred, target regions for antisense compounds targeted, for example, to DNA or pre- mRNA.
- oligonucleotides are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
- hybridization means hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases.
- adenine and thymine are complementary nucleobases, which pair through the formation of hydrogen bonds.
- oligonucleotide and the DNA or RNA are considered to be complementary to each other at that position.
- the oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other.
- “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target.
- an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable.
- An antisense compound is specifically hybridizable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid nonspecific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are perforated.
- Antisense compounds are commonly used as research reagents and diagnostics. For example, antisense oligonucleotides, which are able to inhibit gene expression with seventeen specificity, are often used by those of ordinary skill to elucidate the function of particular genes. Antisense compounds are also used, for example, to distinguish between functions of various members of a biological pathway. Antisense modulation has, therefore, been harnessed for research use. [0021] The specificity and sensitivity of antisense is also harnessed by those of skill in the art for therapeutic uses. Antisense oligonucleotides have been employed as therapeutic moieties in the treatment of disease states in animals and man.
- oligonucleotide refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly.
- ESM-1 antisense oligonucleotides that have activity in the cardiovascular, angiogenic, and endothelial assays described herein, and/or whose gene product has been found to be localized to the cardiovascular system, is likely to have therapeutic uses in a variety of cardiovascular, endothelial, and angiogenic disorders, including systemic disorders that affect vessels, such as diabetes mellitus. Its therapeutic utility could include diseases of the arteries, capillaries, veins, and/or lymphatics.
- Examples of treatments hereunder include treating muscle wasting disease, treating osteoporosis, aiding in implant fixation to stimulate the growth of cells around the implant and therefore facilitate its attachment to its intended site, increasing IGF stability in tissues or in serum, if applicable, and increasing binding to the IGF receptor (since IGF has been shown in vitro to enhance human marrow erythroid and granulocytic progenitor cell growth).
- ESM-1 antisense oligonucleotides can be used to inhibit the production of excess connective tissue during wound healing or pulmonary fibrosis if ESM-1 promotes such production. This would include treatment of acute myocardial infarction and heart failure.
- the present invention provides the treatment of cardiac hypertrophy, regardless of the underlying cause, by administering a therapeutically effective dose of ESM-1 antisense oligonucleotides.
- the treatment for cardiac hypertrophy can be performed at any of its various stages, which may result from a variety of diverse pathologic conditions, including myocardial infarction, hypertension, hypertrophic cardiomyopathy, and valvular regurgitation. The treatment extends to all stages of the progression of cardiac hypertrophy, with or without structural damage of the heart muscle, regardless of the underlying cardiac disorder.
- ESM-1 antisense oligonucleotides would be useful for treatment of disorders where it is desired to limit or prevent angiogenesis.
- vascular tumors such as hemangioma, tumor angiogenesis, neovascularization in the retina, choroid, or cornea, associated with diabetic retinopathy or premature infant retinopathy or macular degeneration and proliferative vitreoretinopathy, rheumatoid arthritis, Crohn's disease, atherosclerosis, ovarian hyperstimulation, psoriasis, endometriosis associated with neovascularization, restenosis subsequent to balloon angioplasty, sear tissue overproduction, for example, that seen in a keloid that forms after surgery, fibrosis after myocardial infarction, or fibrotic lesions associated with pulmonary fibrosis.
- ESM-1 antisense oligonucleotides may serve as useful for vascular- related drug targeting or as therapeutic targets for the treatment or prevention of the disorders.
- Atherosclerosis is a disease characterized by accumulation of plaques of intimal thickening in arteries, due to accumulation of lipids, proliferation of smooth muscle cells, and formation of fibrous tissue within the arterial wall.
- the disease can affect large, medium, and small arteries in any organ. Changes in endothelial and vascular smooth muscle cell function are known to play an important role in modulating the accumulation and regression of these plaques.
- Hypertension is characterized by raised vascular pressure in the systemic arterial, pulmonary arterial, or portal venous systems. Elevated pressure may result from or result in impaired endothelial function and/or vascular disease.
- Inflammatory vasculitides include giant cell arteritis, Takayasu's arteritis, polyarteritis nodosa (including the microangiopathic form), Kawasaki's disease, microscopic polyarightis, Wegener's granulomatosis, and a variety 101 of infectious-related vascular disorders (including Henoch-Schonlein Prupura). Altered endothelial cell function has been shown to be important in these diseases. Reynaud's disease and Reynaud's phenomenon are characterized by intermittent abnormal impairment of the circulation through the extremities on exposure to cold. Altered endothelial cell function has been shown to be important in this disease. [0031] Aneurysms are saccular or fusiform dilatations of the arterial or venous tree that are associated with altered endothelial cell and/or vascular smooth muscle cells.
- Arterial restenosis (restenosis of the arterial wall) may occur following angioplasty as a result of alteration in the function and proliferation of endothelial and vascular smooth muscle cells.
- Thrombophlebitis and lymphangitis are inflammatory disorders of veins and lymphatics, respectively, that may result from, and/or in, altered endothelial cell function.
- lymphedema is a condition involving impaired lymphatic vessels resulting from endothelial cell function.
- the family of benign and malignant vascular tumors is characterized by abnormal proliferation and growth of cellular elements of the vascular system.
- lymphangiomas are benign tumors of the lymphatic system that are congenital, often cystic, malformations of the lymphatics that usually occur in newborns.
- Cystic tumors tend to grow into the adjacent tissue. Cystic tumors usually occur in the cervical and axillary region.
- Lymphangiomas are assumed to be caused by improperly com ected embryonic lymphatics or their deficiency. The result is impaired local lymph drainage.
- ESM-1 antisense antagonists are in the prevention of tumor angiogenesis, which involves vascularization of a tumor to enable it to growth and/or metastasize. This process is dependent on the growth of new blood vessels.
- neoplasms and related conditions that involve tumor angiogenesis include breast carcinomas, lung carcinomas, gastric carcinomas, esophageal carcinomas, colorectal carcinomas, liver carcinomas, ovarian carcinomas, thecomas, arrhenoblastomas, cervical carcinomas, endometrial carcinoma, endometrial hyperplasia, endometriosis, fibrosarcomas, choriocarcinoma, head and neck cancer, nasopharyngeal carcinoma, laryngeal carcinomas, hepatoblastoma, Kaposi's sarcoma, melanoma, skin carcinomas, hemangioma, cavernous hemangioma, hemangioblastoma, pancreas carcinoma
- ESM-1 antisense oligonucleotides that induce cartilage and/or bone growth in circumstances where bone is not normally formed have application in the healing of bone fractures and cartilage damage or defects in humans and other animals.
- Such a preparation employing ESM-1 antisense oligonucleotides may have prophylactic use in closed as well as open fracture reduction and also in the improved fixation of artificial joints. De novo bone formation induced by an osteogenic agent contributes to the repair of congenital, trauma induced, or oncologic, resection-induced craniofacial defects, and also is useful in cosmetic plastic surgery.
- ESM-1 antisense oligonucleotides may also exhibit activity for generation or regeneration of other tissues, such as organs (including, for example, pancreas, liver, intestine, kidney, skin, or endothelium), muscle (smooth, skeletal, or cardiac), and vascular (including vascular endothelium) tissue, or for promoting the growth of cells comprising such tissues. Part of the desired effects may be by inhibition or modulation of fibrotic scarring to allow normal tissue to regenerate. [0041] ESM-1 antisense oligonucleotides may also be useful for gut protection or regeneration and treatment of lung or liver fibrosis, reperfusion injury in various tissues, and conditions resulting from systemic cytokine damage.
- ESM-1 antisense oligonucleotides may be useful for promoting or inhibiting differentiation of tissues described above from precursor tissues or cells, or for inhibiting the growth of tissues described above. [0042] ESM-1 antisense oligonucleotides may also be used in the treatment of periodontal diseases and in other tooth-repair processes.
- Such agents may provide an environment to attract bone-forming cells, stimulate growth of bone- forming cells, or induce differentiation of progenitors of bone-forming cells
- ESM-1 antisense oligonucleotides may also be useful in the treatment of osteoporosis or osteoarthritis, such as through stimulation of bone and/or cartilage repair or by blocking inflammation or processes of tissue destruction (collagenase activity, osteoclast activity, etc.) mediated by inflammatory processes, since blood vessels play an important role in the regulation of bone turnover and growth.
- tissue regeneration activity that may be attributable to ESM-1 antisense oligonucleotides is tendon/ligament formation.
- a protein that induces tendon ligament-like tissue or other tissue fonnation in circumstances where such tissue is not normally formed has application in the healing of tendon or ligament tears, deformities, and other tendon or ligament defects in humans and other animals.
- Such a preparation may have prophylactic use in preventing damage to tendon or ligament tissue, as well as use in the improved fixation of tendon or ligament to bone or other tissues, and in repairing defects to tendon or ligament tissue.
- compositions herein may provide an environment to attract tendon- or ligament-forming cells, stimulate growth of tendon- or ligament-forming cells, induce differentiation of progenitors of tendon- or ligament forming cells, or induce growth of tendon/ligament cells or progenitors ex vivo for return in vivo to effect tissue repair.
- the compositions herein may also be useful in the treatment of tendinitis, carpal tunnel syndrome, and other tendon or ligament defects.
- compositions may also include an appropriate matrix and/or sequestering agent as a carrier as is well known in the art.
- ESM-1 antisense oligonucleotides may also be administered prophylactically to patients with cardiac hypertrophy, to prevent the progression of the condition, and avoid sudden death, including death of asymptomatic patients. Such preventative therapy is particularly warranted in the case of patients diagnosed with massive left ventricular cardiac hypertrophy (a maximal wall thickness of 35 mm. or more in adults, or a comparable value in children), or in instances when the hemodynamic burden on the heart is particularly strong.
- ESM-1 antisense oligonucleotides may also be useful in the management of atrial fibrillation, which develops in a substantial portion of patients diagnosed with hypertrophic cardiomyopathy. Further indications include angina, myocardial infarctions such as acute myocardial infarctions, and heart failure such as congestive heart failure.
- Additional non-neoplastic conditions include psoriasis, diabetic and other proliferative retinopathies including retinopathy of prematurity, retrolental fibroplasia, neovascular glaucoma, thyroid hyperplasias (including Grave's disease), corneal and other tissue transplantation, chronic inflammation, lung inflammation, nephrotic syndrome, preeclampsia, ascites, pericardial effusion (such as that associated with pericarditis), and pleural effusion.
- ESM-1 antisense oligonucleotides which are shown to alter or impact endothelial cell function, proliferation, and/or form, are likely to play an important role in the etiology and pathogenesis of many or all of the disorders noted above, and as such can serve as therapeutic targets to augment or inhibit these processes or for vascular-related drug targeting in these disorders.
- ESM-1 antisense oligonucleotides in preventing or treating the disorder in question may be improved by administering the active agent serially or in combination with another agent that is effective for those purposes, either in the same composition or as separate compositions.
- ESM-1 antisense therapy can be combined with the administration of inhibitors of known cardiac myocyte hypertrophy factors, e.g., inhibitors of cc-adrenergic agonists such as phenylephrine; endothelin-1 inhibitors such as BOSENTANTM and MOXONODINTM; inhibitors to CT- 1 (US Pat. No. 5,679,545); inhibitors to LIF; ACE inhibitors; des- aspartate-angiotensin I inhibitors (U.S. Pat. No. 5,773,415), and angiotensin II inhibitors.
- inhibitors of known cardiac myocyte hypertrophy factors e.g., inhibitors of cc-adrenergic agonists such as phenylephrine; endo
- ESM-1 antisense oligonucleotides can be administered in combination with P- adrenergic receptor blocking agents, e.g., propranolol, timolol, tertalolol, carteolol, nadolol, betaxolol, penbutolol, acetobutolol, atenolol, metoprolol, or carvedilol; ACE inhibitors, e.g., quinapril, captopril, enalapril, ramipril, benazepril, fosinopril, or lisinopril; diuretics, e.g., chlorothiazide, hydrochlorothiazide, hydroflumethiazide, methylchlothiazide, benzthiazide, dichlorphenamide, acetazolamide, or ind
- P- adrenergic receptor blocking agents e
- compositions comprising the therapeutic agents identified herein by their generic names are commercially available, and are to be administered following the manufacturers' instructions for dosage, administration, adverse effects, contraindications, etc. 119 See, e.z., Physicians' 'Desk Reference (Medical Economics Data Production Co.: Montvale, N.J., 1997), 51 st Edition.
- P-adrenergic-blocking drugs e.g., propranolol, timolol, tertalolol, carteolol, nadolol, betaxolol, penbutolol, acetobutolol, atenolol, metoprolol, or carvedilol
- verapamil difedipine, or diltiazem.
- Treatment of hypertrophy associated with high blood pressure may require the use of antihypertensive drug therapy, using calcium channel blockers, e.g., diltiazem, nifedipine, verapamil, or nicardipine; P-adrenergic blocking agents; diuretics, e.g., chlorothiazide, hydrochlorothiazide, hydroflumethiazide, methylchlothiazide, benzthiazide, dichlorphenamide, acetazolamide, or indapamide; and/or ACE-inhibitors, e. g., quinapril, captopril, enalapril, ramipril, benazepril, fosinopril, or lisinopril.
- calcium channel blockers e.g., diltiazem, nifedipine, verapamil, or nicardipine
- ESM-1 antisense oligonucleotides may be combined with other agents beneficial to the treatment of the bone and/or cartilage defect, wound, or tissue in question. These agents include various growth factors such as EGF, PDGF, TGF- or TGF-, IGF, FGF, and CTGF.
- ESM-1 antisense oligonucleotides used to treat cancer may be combined with cytotoxic, chemotherapeutic, or growth-inhibitory agents as identified above.
- ESM-1 antisense oligonucleotides are suitably administered serially or in combination with radiological treatments, whether involving irradiation or administration of radioactive substances.
- ESM-1 antisense oligonucleotides for treatment of breast carcinoma, ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, Trastuzumab
- Herceptin with chemotherapy, paclitaxel, docetaxel, epirubicin, mitoxantrone, topotecan, capecitabine, vinorelbine, thiotepa, vincristine, vinblastine, carboplatin or cisplatin, plicamycin, anastrozole, letrozole, exemestane, toremifine, or progestins.
- ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, doxorubicin, cytarabine, cyclophosphamide, etoposide, teniposide, allopurinol, or autologous bone marrow transplantation.
- antisense oligonucleotides can be administered in combination with, but not limited to, gemtuzumab ozogamicin (Mylotarg), mitoxantrone, idarubicin, etoposide, mercaptopurine, thioguanine, azacitidine, amsacrine, methotrexate, doxorubicin, tretinoin, allopurinol, leukapheresis, prednisone, or arsenic trioxide for acute promyelocytic leukemia.
- Mylotarg gemtuzumab ozogamicin
- mitoxantrone idarubicin
- etoposide mercaptopurine
- thioguanine thioguanine
- azacitidine amsacrine
- methotrexate methotrexate
- doxorubicin tretinoin
- allopurinol leukapheresis
- ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, busulfan, mercaptopurine, thioguanine, cytarabine, plicamycin, melphalan, autologous bone ma ⁇ ow transplantation, or allopurinol.
- ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, vincristine, cyclophosphamide, doxorubicin, cladribine (2- chlorodeoxyadenosine; CdA), allogeneic bone marrow transplant, androgens, or allopurinol.
- ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, etoposide, cytarabine, alpha interferon, dexamethasone, or autologous bone marrow transplantation.
- ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, cyclophosphamide, doxorubicin, vincristine, etoposide, mitomycin, ifosfamide, paclitaxel, irinotecan, or radiation therapy.
- ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, capecitabine, methotrexate, mitomycin, carmustine, cisplatin, irinotecan, or floxuridine.
- ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, alpha interferon, progestins, infusional FUDR, or fluorouracil.
- ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, ketoconazole, doxorubicin, aminoglutethimide, progestins, cyclophosphamide, cisplatin, vinblastine, etoposide, suramin, PC-SPES, or estramustine phosphate.
- ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, cannustine, lomustine, melphalan, thiotepa, cisplatin, paclitaxel, tamoxifen, or vincristine.
- ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, docetaxel, doxorubicin, topotecan, cyclophosphamide, doxorubicin, etoposide, or liposomal doxorubicin.
- antisense oligonucleotides are a preferred form of antisense compound
- the present invention comprehends other oligomeric antisense compounds, including but not limited to oligonucleotide mimetics such as are described below.
- the antisense compounds in accordance with this invention preferably comprise from about 8 to about 30 nucleobases (i.e. from about 8 to about 30 linked nucleo sides).
- Particularly preferred antisense compounds are antisense oligonucleotides, even more preferably those comprising from about 12 to about 25 nucleobases.
- a nucleoside is a base- sugar combination. The base portion of the nucleoside is normally a heterocyclic base.
- Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside.
- the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar.
- the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn the respective ends of this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred.
- the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide.
- the nonnal I linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.
- Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
- modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
- Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3 'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'- amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3 '-5' linkages, 2 '-5' linked analogs of these, and those having inverted polarity
- Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S.: 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of which is herein incorporated by reference.
- Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
- morpholino linkages formed in part from the sugar portion of a nucleoside
- siloxane backbones siloxane backbones
- sulfide, sulfoxide and sulfone backbones fonnacetyl and thioformacetyl backbones
- methylene formacetyl and thioformacetyl backbones alkene containing backbones
- sulfamate backbones methyleneimino and methylenehydrazino backbones
- sulfonate and sulfonamide backbones amide backbones; and others having mixed N, O, S and CH 2 component parts.
- Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference.
- both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups.
- the base units are maintained for hybridization with an appropriate nucleic acid target compound.
- an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA).
- PNA peptide nucleic acid
- the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
- nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
- Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.
- Most preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular -CH 2 -NH-O-CH 2 -, -CH 2 -N (CH 3 ) -O-CH 2 - [known as a methylene (methylimino) or MMI backbone], - CH 2 -O-N (CH 3 ) -CH 2 -, -CH 2 N(CH 3 )-N(CH 3 )-CH 2 - and -O- N(CH 3 )-CH 2 -CH 2 - [wherein the native phosphodiester backbone is represented as -O-P-O-CH2-] of the above referenced U.S.
- Modified oligonucleotides may also contain one or more substituted sugar moieties.
- Preferred oligonucleotides comprise one of the following at the 2' position: OH; F; O-, S-, orN-alkyl; O-, S-, or N- alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Ci to C 10 alkyl or C 2 to C 10 alkenyl and alkynyl.
- oligonucleotides comprise one of the following at the 2' position: Ci to C 10 , ( lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ON0 2 , NO 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
- a preferred modification includes 2' -methoxyethoxy (2' -O-CH 2 CH 2 OCH 3 , also known as 2'-O- (2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group.
- a further preferred modification includes 2'-dimethylaminooxyethoxy, i.e., a O(CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2'-DMAOE, as described in examples herein below, and 2 '-dimethylaminoethoxy ethoxy (also known in the art as 2'-O- dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH 2 -O-CH 2 -N (CH 2 )2, also described in examples herein below.
- Oligonucleotides may also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
- nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
- Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6- methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2- thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8- hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5 -trifluoromethyl and
- nucleobases include those disclosed in United States Patent No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S.T. and Lebleu, B. ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention.
- 5-substituted pyrimidines 6- azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2- aminopropyladenine, 5-propynyluracil and 5-propynylcytosine, 5- methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds, Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.
- oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates, which enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide.
- moieties include but are not limited to Hpid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al, Bioorg. Med. Chem.
- a thioether e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. NY. Acad. Sci., 1992, 660, 306-309; Manoharan et al, Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl.
- Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Mancharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 365 '-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Ada, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp.
- antisense compounds which are chimeric compounds.
- Chimeric antisense compounds or “chimeras,” in the context of this invention are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound.
- oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid.
- An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
- RNase H is a cellular endonuclease, which cleaves the RNA strand of RNA:DNA duplex.
- RNA target Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxy oligonucleotides hybridizing to the same target region.
- Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
- Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S.
- the antisense compounds used in accordance with this invention may be conveniently, and routinely made through the well- known technique of solid phase synthesis.
- Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA). Any other means for such synthesis known in the art may additionally or alternatively be employed.
- the antisense compounds of the invention are synthesized in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules.
- the compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption.
- the antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. [0083]
- prodrug indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.
- prodrug versions of the oligonucleotides of the invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al., published December 9, 1993 or in WO 94/26764 to Imbach et al.
- pharmaceutically acceptable salts refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
- Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines.
- metals used as cations are sodium, potassium, magnesium, calcium, and the like.
- suitable amines are N, N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N- methylglucamine, and procaine (see, for example, Berge et al.,
- the base addition salts of said acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional manner.
- the free acid form may be regenerated by contacting the salt form with an acid and isolating the free acid in the conventional manner.
- the free acid forms differ from their respective salt forms somewhat in certain physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acid for purposes of the present invention.
- a “pharmaceutical addition salt” includes a pharmaceutically acceptable salt of an acid form of one of the components of the compositions of the invention.
- acid salts are the hydrochlorides, acetates, salicylates, nitrates, and phosphates.
- suitable pharmaceutically acceptable salts are well known to those skilled in the art and include basic salts of a variety of inorganic and organic acids, such as, for example, with inorganic acids, such as for example hydrochloric acid, hydrobromic acid, sulfuric acid or phosphoric acid; with organic carboxylic, sulfonic, sulfo or phospho acids or N-substituted sulfamic acids, for example acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mande
- Pharmaceutically acceptable salts of compounds may also be prepared with a pharmaceutically acceptable cation.
- Suitable pharmaceutically acceptable cations are well known to those skilled in the art and include alkaline, alkaline earth, ammonium, and quaternary ammonium cations. Carbonates or hydrogen carbonates are also possible.
- salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spemiidine, etc.
- acid addition salts formed with inorganic acids for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like
- salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygal
- the antisense compounds of the present invention can be utilized for diagnostics, therapeutics, prophylaxis, as research reagents, and kits.
- an animal preferably a human, suspected of having a disease or disorder, which can be treated by modulating the expression of ESM-1, is treated by administering antisense compounds in accordance with this invention.
- the compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of an antisense compound to a suitable pharmaceutically acceptable diluent or carrier.
- Use of the antisense compounds and methods of the invention may also be useful prophylactically, e.g., to prevent or delay infection, inflammation, or tumor formation, for example.
- the antisense compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding ESM-1, enabling sandwich and other assays to easily be constructed to exploit this fact.
- Hybridization of the antisense oligonucleotides of the invention with a nucleic acid encoding ESM-1 can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide or any other suitable detection means. Kits using such detection means for detecting the level of ESM-1 in a sample may also be prepared.
- the present invention also includes pharmaceutical compositions and formulations, which include the antisense compounds of the invention.
- compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration.
- compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders.
- Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
- Coated condoms, gloves, and the like may also be useful.
- compositions and formulations for oral administration include powders or granules, suspensions, or solutions in water or non- aqueous media, capsules, sachets, or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids, or binders may be desirable.
- compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions, which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
- Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome- containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.
- the pharmaceutical formulations of the present invention may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the phannaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
- compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas.
- the compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media.
- Aqueous suspensions may further contain substances, which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol, and/or dextran.
- the suspension may also contain stabilizers.
- the pharmaceutical compositions may be formulated and used as foams.
- Pharmaceutical foams include formulations such as, but not limited to, emulsions, microemulsions, creams, jellies, and liposomes. While basically similar in nature these formulations vary in the components and the consistency of the final product.
- the preparation of such compositions and formulations is generally known to those skilled in the pharmaceutical and formulation arts and may be applied to the formulation of the compositions of the present invention.
- Emulsions [0097]
- the compositions of the present invention may be prepared and formulated as emulsions. Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 ⁇ m in diameter.
- Emulsions are often biphasic systems comprising of two immiscible liquid phases intimately mixed and dispersed with each other.
- emulsions may be either water-in- oil (w/o) or of the oil-in- water (o/w) variety.
- w/o water-in-oil
- o/w oil-in-water
- Emulsions may contain additional components in addition to the dispersed phases and the active drug, which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase.
- Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants may also be present in emulsions as needed.
- Phannaceutical emulsions may also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in- water-in-oil (o/w/o) and water-in-oil-in- water (w/o/w) emulsions.
- Such complex formulations often provide certain advantages that simple binary emulsions do not.
- Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion may be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that may be incorporated into either phase of the emulsion.
- Emulsifiers may broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (Idson, in Pharmaceutical Dosaqe Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
- Synthetic surfactants also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Liebemian, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199).
- Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion.
- HLB hydrophile/lipophile balance
- surfactants may be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic, and amphoteric (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume l, p. 285).
- Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin, and acacia.
- Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations.
- polar inorganic solids such as heavy metal hydroxides, non- swelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.
- non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions.
- Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed phase droplets and by increasing the viscosity of the external phase.
- polysaccharides for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth
- cellulose derivatives for example, carboxymethylcellulose and carboxypropylcellulose
- synthetic polymers for example, carbomers, cellulose ethers, and carb
- emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols, and phosphatides that may readily support the growth of microbes, these formulations often incorporate preservatives.
- preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid.
- Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation.
- Antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.
- free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite
- antioxidant synergists such as citric acid, tartaric acid, and lecithin.
- Emulsion formulations for oral delivery have been very widely used because of reasons of ease of formulation, efficacy from an absorption and bioavailability standpoint.
- Rosoff in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
- Mineral-oil base laxatives, oil-soluble vitamins, and high fat nutritive preparations are among the materials that have commonly been administered orally as o/w emulsions.
- the compositions of oligonucleotides and nucleic acids are formulated as microemulsions.
- a microemulsion may be defined as a system of water, oil, and amphiphile, which is a single optically isotropic, and thermodynamically stable liquid solution (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245).
- microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system.
- microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface- active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 1852-5).
- Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant, and electrolyte.
- microemulsion is of the water-in-oil (w/o) or an oil-in- water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington 's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985, p. 271).
- microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.
- Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (S0750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants.
- the cosurfactant usually a short-chain alcohol such as ethanol, 1-propanol, and 1 -butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules.
- Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art.
- the aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drag, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol.
- the oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and triglycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
- materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and triglycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
- Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs.
- Lipid based microemulsions both o/w and w/o have been proposed to enhance the oral bioavailability of drugs, including peptides (Constantinides et al., P ⁇ r ⁇ ce--ttc /Re5 , e ⁇ re/7, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol, 1993, 13, 205).
- Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form spontaneously when their components are brought together at ambient temperature. This may be particularly advantageous when formulating thermolabile drugs, peptides, or oligonucleotides. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications.
- microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of oligonucleotides and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of oligonucleotides and nucleic acids within the gastrointestinal tract, vagina, buccal cavity and other areas of administration.
- Microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the oligonucleotides and nucleic acids of the present invention.
- Penetration enhancers used in the microemulsions of the present invention may be classified as belonging to one of five broad categories - surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al.,
- Liposomes There are many organized surfactant structures besides microemulsions that have been studied and used for the formulation of drugs. These include monolayers, micelles, bilayers, and vesicles.
- Liposome means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers.
- Liposomes are unilamellar or multilamellar vesicles which have a membrane fornied from a lipophilic material and an aqueous interior.
- the aqueous portion contains the composition to be delivered.
- Cationic liposomes possess the advantage of being able to fuse to the cell wall.
- Noncationic liposomes although not able to fuse as efficiently with the cell wall, are taken up by macrophages in vivo.
- lipid vesicles In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome, which is highly deformable and able to pass through such fine pores.
- liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drags; liposomes can protect encapsulated drugs in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage
- Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes. As the merging of the liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act.
- Liposomal formulations have been the focus of extensive investigation as the mode of delivery for many drags. There is growing evidence that for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side-effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of drags, both hydrophilic and hydrophobic, into the skin.
- Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes, which interact with the negatively charged DNA molecules to form a stable complex. The positively charged DNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome.
- Liposomes Due to the acidic pH within the endosome, the liposomes are raptured, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980 - 985) [00119] Liposomes, which are pH-sensitive or negatively charged, entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some DNA is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture.
- liposomal composition includes phospholipids other than naturally derived phosphatidylcholine.
- Neutral liposome compositions can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC).
- Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE).
- DOPE dioleoyl phosphatidylethanolamine
- liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC.
- PC phosphatidylcholine
- Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.
- Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drags to the skin, in particular systems comprising non-ionic surfactant and cholesterol.
- Non-ionic liposomal formulations comprising Novasome TM I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and NovasomeTM II (glyceryl distearate/ cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporin-A into different layers of the skin (Hu et al. S.T.P.Pharma. Sci., 1994, 4, 6, 466).
- Liposomes also include "sterically stabilized" liposomes, a term, which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such, specialized lipids.
- sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside G MI , or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety.
- PEG polyethylene glycol
- Liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al.). [00125] Many liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of preparation thereof, are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2C 12 15G, which contains a PEG moiety. Ilium et al.
- Patent No. 5,213,804 and European Patent No. EP 0 496 813 Bl Liposomes comprising a number of other lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Patent No. 5,225,212 (both to Martin et al.) and in WO 94/20073 (Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids are described in WO 96/10391 (Choi et al.). U.S. Patent Nos.
- 5,540,935 (Miyazaki et al.) and 5,556,948 (Tagawa et al.) describe PEG-containing liposomes that can be further derivatized with functional moieties on their surfaces.
- a limited number of liposomes comprising nucleic acids are known in the art.
- WO 96/40062 to Thierry et al. discloses methods for encapsulating high molecular weight nucleic acids in liposomes.
- U.S. Patent No. 5,264,221 to Tagawa et al. discloses protein-bonded liposomes and asserts that the contents of such liposomes may include an antisense RNA.
- WO 97/04787 to Love et al. discloses liposomes comprising antisense oligonucleotides targeted to the raf gene.
- Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drag delivery vehicles. Transfersomes may be described as lipid droplets, which are so highly deformable that they are easily able to penetrate through pores that are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g. they are self-optimizing (adaptive to the shape of pores in the skin), self- repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge- activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.
- HLB hydrophile/lipophile balance
- Nonionic surfactants find wide application in pham aceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure.
- Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters.
- Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class.
- the polyoxyethylene surfactants are the most popular members of the nonionic surfactant class. [00130] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic.
- Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates.
- the most important members of the anionic surfactant class are the alkyl sulfates and the soaps.
- Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.
- the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric.
- Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines, and phosphatides.
- the use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).
- Penetration Enhancers include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines, and phosphatides.
- the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids particularly oligonucleotides, to the skin of animals.
- Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drags readily cross cell membranes. It has been discovered that even non-lipophilic drugs may cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non- lipophilic drags across cell membranes, penetration enhancers also enhance the permeability of lipophilic drags.
- Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating nonsurfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.
- Surfactants In connection with the present invention, surfactants (or "surface-active agents") are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of oligonucleotides through the mucosa is enhanced.
- these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol, 1988, 40, 252).
- Fatty acids Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1- monooleoyl-.rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1 -monocaprate, l-dodecylazacycloheptan-2-one, acylcamitines, acylcholines, C rl o alkyl esters thereof (e.g., methyl, isopropyl and t- butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linole
- Bile salts The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds. McGraw-Hill, New York, 1996, pp. 934-935).
- the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives.
- the bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxy cholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro- 24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate'and polyoxyethylene-9-lauryl ether (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington 's
- Chelating agents as used in connection with the present invention, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of oligonucleotides through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Chelating agents of the invention include but are not limited to disodium.
- ethylenediaminetetraacetate citric acid
- salicylates e.g., sodium salicylate, 5 -methoxy salicylate and homovanilate
- N-acyl derivatives of collagen laureth-9
- N-amino acyl derivatives of beta- diketones enamines
- Non-chelating non-surfactants As used herein, nonchelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of oligonucleotides through the alimentary mucosa (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33).
- This class of penetration enhancers includes, for example, unsaturated cyclic ureas, 1 -alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non- steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin, and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol, 1987, 39, 621-626).
- Agents that enhance uptake of oligonucleotides at the cellular level may also be added to the phannaceutical and other compositions of the present invention.
- cationic lipids such as lipofectin (Junichi et al, U.S. Patent No. 5,705,188), cationic glycerol derivatives, and poly cationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of oligonucleotides.
- nucleic acids include glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.
- glycols such as ethylene glycol and propylene glycol
- pyrrols such as 2-pyrrol
- azones such as 2-pyrrol
- terpenes such as limonene and menthone.
- compositions of the present invention also incorporate carrier compounds in the formulation.
- carrier compound or “carrier” can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation.
- a nucleic acid and a carrier compound can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor.
- the recovery of a partially phosphorothioate oligonucleotide in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4 ⁇ sothiocyano-stilbene-2,2'disulfonic acid (Miyao et al., Antisense Res. Dev., 1995, 5, 115-121; Takakura et al., Antisense & Nucl. Acid Drug Dev., 1996, 6, 177-183).
- a “pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal.
- the excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition.
- Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, com starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc.).
- binding agents e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxy
- compositions of the present invention can also be used to formulate the compositions of the present invention.
- Suitable phannaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
- Formulations for topical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases.
- the solutions may also contain buffers, diluents, and other suitable additives.
- Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration, which do not deleteriously react with nucleic acids, can be used.
- Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
- Other Components include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
- compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels.
- the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipraritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forn s of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
- additional materials useful in physically formulating various dosage forn s of the compositions of the present invention such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
- such materials when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention.
- the formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
- auxiliary agents e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
- Aqueous suspensions may contain substances, which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol, and/or dextran.
- the suspension may also contain stabilizers.
- Certain embodiments of the invention provide pharmaceutical compositions containing (a) one or more antisense compounds and (b) one or more other chemotherapeutic agents which function by a non-antisense mechanism.
- chemotherapeutic agents include, but are not limited to, anticancer drugs such as daunorabicin, dactinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard, chlorambucil, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine (CA), 5-fluorouracil (5-FU), floxuridine (5-FUdR), methotrexate (MTX), colchicine, vincristine, vinblastine, etoposide, teniposide, cisplatin and diethylstilbestrol (DES).
- anticancer drugs such as daunorabicin, dactinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard, chlorambucil, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine (CA), 5-fluorour
- Anti-inflammatory drugs including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention.
- compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target.
- antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially.
- the formulation of therapeutic compositions and their subsequent administration is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drag accumulation in the body of the patient.
- Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC 0 s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 ⁇ g to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues.
- oligonucleotide is administered in maintenance doses, ranging from 0.01 ⁇ g to 100 g per kg of body weight, once or more daily, to once every 20 years.
- Nucleoside Phosphoramidites for Oligonucleotide Synthesis Deoxy and 2 '-alkoxy amidites [00154] 2 '-Deoxy and 2 '-methoxy beta-cyanoethyldiisopropyl phosphoramidites are available from commercial sources (e.g. Chemgenes, Needham MA or Glen Research, Inc. Sterling VA). Other 2'-O-alkoxy substituted nucleoside amidites are prepared as described in U.S. Patent 5,506,351 , herein incorporated by reference.
- Oligonucleotides synthesized using 2 '-alkoxy amidites the standard cycle for unmodified oligonucleotides is utilized, except the wait step after pulse delivery of tetrazole and base is increased to 360 seconds.
- Oligonucleotides containing 5-methyl-2'-deoxycytidine (5- Me-C) nucleotides are synthesized according to published methods [Sanghvi, et. al., Nucleic Acids Research, 1993, 21, 3197-3203] using commercially available phosphoramidites (Glen Research, Sterling VA or ChemGenes, Needham MA). 2 '-Fluoro amidites 2'-Fluorodeoxyadenosine amidites
- 2'-fluoro oligonucleotides are synthesized as described previously [Kawasaki, et. al., J. Med. Chem., 1993, 36, 831-841] and United States patent 5,670,633, herein incorporated by reference. Briefly, the protected nucleoside N6-benzoyl-2'-deoxy-2'- fluoroadenosine is synthesized utilizing commercially available 9-beta- D-arabinofuranosyladenine as starting material and by modifying literature procedures whereby the 2'-alpha- fluoro atom is introduced by a S ⁇ -displacement of a 2'-beta-trityl group.
- N6-benzoyl-9-beta- D-arabinofuranosyladenine is selectively protected in moderate yield as the 3',5'-ditetrahydropyranyl (THP) intermediate.
- THP 3',5'-ditetrahydropyranyl
- Deprotection of the THP and N6-benzoyl groups is accomplished using standard methodologies and standard methods are used to obtain the 5'- dimethoxytrityl-(DMT) and 5'-DMT-3'-phosphoramidite intermediates.
- 2'-FIuorodeoxyguanosine [00157] The synthesis of 2'-deoxy-2'-fluoroguanosine is accomplished using tetraisopropyldisiloxanyl (TPDS) protected 9-beta- D-arabinofuranosylguanine as starting material, and conversion to the intermediate diisobutyrylarabinofuranosylguanosine. Deprotection of the TPDS group is followed by protection of the hydroxyl group with THP to give diisobutyryl di-THP protected arabinofuranosylguanine.
- TPDS tetraisopropyldisiloxanyl
- 2'-deoxy-2'-fluorocytidine is synthesized via amination of 2'-deoxy-2'-fluorouridine, followed by selective protection to give N4- benzoyl-2'-deoxy-2'-fluorocytidine. Standard procedures are used to obtain the 5'-DMT and 5 '-DMT-3 'phosphoramidites.
- the residue is dissolved in CHC1 3 (800 mL) and extracted with 2x200 mL of saturated sodium bicarbonate and 2x200 mL of saturated NaCl.
- the water layers are back extracted with 200 mL of CHC1 3 .
- the combined organics are dried with sodium sulfate and evaporated to a residue.
- the residue is purified on a 3.5 kg silica gel column and eluted using EtOAc/hexane(4:l). Pure product fractions are evaporated to yield the title compounds.
- a first solution is prepared by dissolving 3'-O-acetyl-2'-O- methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in CH 3 CN (700 mL) and set aside. Triethylamine (189 mL, 1.44 M) is added to a solution of triazole (90 g, 1.3 M) in CH 3 CN (1 L), cooled to - 5°C and stirred for 0.5 h using an overhead stirrer.
- POCl 3 is added dropwise, over a 30 minute period, to the stirred solution maintained at 0-10°C, and the resulting mixture stirred for an additional 2 hours.
- the first solution is added dropwise, over a 45 minute period, to the latter solution.
- the resulting reaction mixture is stored overnight in a cold room. Salts are filtered from the reaction mixture and the solution is evaporated. The residue is dissolved in EtOAc (1 L) and the insoluble solids are removed by filtration. The filtrate is washed with 1x300 mL of NaHCO 3 and 2x300 mL of saturated NaCl, dried over sodium sulfate and evaporated. The residue is triturated with EtOAc to give the title compound.
- N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5- methylcytidine-3'-amidite N4-Benzoyl-2'-O-methoxyethyl-5 '-O-dimethoxytrityl-5- methylcytidine (74 g, 0.10 M) is dissolved in CH 2 C1 2 (1 L) Tetrazole diisopropylamine (7.1 g) and 2-cyanoethoxy-tetra(isopropyl)phosphite (40.5 mL, 0.123 M) are added with stirring, under a nitrogen atmosphere.
- the resulting mixture is stirred for 20 hours at room temperature (TLC showed the reaction to be 95% complete).
- the reaction mixture is extracted with saturated NaHCU 3 (1x300 mL) and saturated NaCl (3x300 mL).
- the aqueous washes are back-extracted with CH2CI 2 (300 mL), and the extracts are combined, dried over MgSO > and concentrated.
- the residue obtained is chromatographed on a 1.5 kg silica column using EtOAc/hexane (3:1) as the eluting solvent. The pure fractions were combined to give the title compound.
- 2'-(Dimethylaminooxyethoxy) nucleoside amidites [also known in the art as 2'-O-(dimethylaminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs.
- Adenosine, cytidine and guanosine nucleoside amidites are prepared similarly to the thymidine (5-methyluridine) except the exocyclic amines are protected with a benzoyl moiety in the case of adenosine and cytidine and with isobutyryl in the case of guanosine.
- reaction vessel is cooled to ambient and opened.
- TLC Rf 0.67 for desired product and Rf 0.82 for ara-T side product, ethyl acetate
- the reaction is stopped, concentrated under reduced pressure (10 to 1mm, Hg) in a warm water bath (40- 100 °C) with the more extreme conditions used to remove the ethylene glycol.
- the remaining solution can be partitioned between ethyl acetate and water.
- the product will be in the organic phase.
- the residue is purified by column cliromatography (2kg silica gel, ethyl acetate-hexanes gradient 1 : 1 to 4: 1). The appropriate fractions are combined, stripped, and dried to product as a white crisp foam, contaminated starting material, and pure reusable starting material.
- Aqueous NaHCO 3 solution (5%, lOmL) is added and extracted with ethyl acetate (2x2 OmL). Ethyl acetate phase is dried over anhydrous Na 2 SO 4 , evaporated to dryness.
- Residue is dissolved in a solution of IM PPTS in MeOH (30.6mL).
- Formaldehyde (20% w/w, 30mL, 3.37mmol) is added and the reaction mixture is stirred at room temperature for 10 minutes.
- reaction mixture is removed from the ice bath and stirred at room temperature for 2 hrs.
- 5% NaHCO 3 (25mL) solution is added and extracted with ethyl acetate (2x25mL).
- Ethyl acetate layer is dried over anhydrous Na 2 SO and evaporated to dryness.
- the residue obtained is purified by flash column chromatography and eluted with 5% MeOH in CH 2 C1 2 to get 5'-O-tertbutyldiphenylsilyl-2'-O-[N,N- dimethylaminooxyethyl]-5- methyluridine as a white foam.
- Triethylamine trihydrofluoride (3.91mL, 24.0mmol) is dissolved in dry THF and triethylamine (1.67mL, 12mmol, dry, kept over KOH). This mixture of triethylamine-2HF is then added to 5'-O- tert-butyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5- methyluridine (1.40g, 2.4mmol) and stirred at room temperature for 24 hrs. Reaction is monitored by TLC (5% MeOH in CH 2 C1 2 ).
- reaction mixture is dissolved in anhydrous acetonitrile (8.4mL) and 2- cyanoethyl-NjNjN ⁇ N'-tetraisopropylphosphoramidite (2.12mL, 6.08mmol) is added.
- the reaction mixture is stirred at ambient temperature for 4 hrs under inert atmosphere.
- the progress of the reaction is monitored by TLC (hexane: ethyl acetate 1 :1).
- the solvent is evaporated, then the residue is dissolved in ethyl acetate (70mL) and washed with 5% aqueous NaHCO 3 (40mL). Ethyl acetate layer is dried over anhydrous Na 2 SO and concentrated.
- Residue obtained is chromatographed (ethyl acetate as eluent) to get 5'-O-DMT-2'-O-(2- N,N-dimethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoethyl)-N,N- diisopropylphosphoramidite] as a foam.
- 2 '-(Aminooxy ethoxy) nucleoside amidites [also known in the art as 2'-O-(aminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs. Adenosine, cytidine and thymidine nucleoside amidites are prepared similarly. N2-isobutyryl-6-O-diphenylcarbamoyI-2'-O-(2-ethylacetyl)-5'-O- (4,4'-dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N- diisopropylphosphoramidite]
- the 2'-O-aminooxyethyl guanosine analog may be obtained by selective 2'-O-alkylation of diaminopurine riboside.
- Multigram quantities of diaminopurine riboside may be purchased from Schering AG (Berlin) to provide 2'-O-(2-ethylacetyl) diaminopurine riboside along with a minor amount of the 3'-O-isomer.
- 2'-O-(2-ethylacetyl) diaminopurine riboside may be resolved and converted to 2' ⁇ O- (2ethylacetyl)guanosine by treatment with adenosine deaminase.
- Standard protection procedures should afford 2'-O-(2- ethylacetyl)-5 '-O-(4,4'-dimethoxytrityl)guanosine and 2-N-isobutyryl-6- O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'- dimethoxytrityl)guanosine which may be reduced to provide 2-N- isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'- dimethoxytrityl)guanosine.
- the hydroxyl group may be displaced by N-hydroxyphthalimide via a Mitsunobu reaction, and the protected nucleoside may phosphitylated as usual to yield 2-N- isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'- dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N- diisopropylphosphoramiditel.
- 2'-dimethylaminoethoxyethoxy (2'-DMAEOE) nucleoside amidites 2'-dimethylaminoethoxyethoxy nucleoside amidites (also known in the art as 2'-O-dimethylaminoethoxyethyl, i.e., 2'O-CH 2 -O- CH2-N(CH 2 )2, or 2'-DMAEOE nucleoside amidites) are prepared as follows. Other nucleoside amidites are prepared similarly.
- the bomb is cooled to room temperature and opened.
- the crude solution is concentrated and the residue partitioned between water (200 mL) and hexanes (200 mL).
- the excess phenol is extracted into the hexane layer.
- the aqueous layer is extracted with ethyl acetate (3x200 mL) and the combined organic layers are washed once with water, dried over anhydrous sodium sulfate, and concentrated.
- the residue is columned on silica gel using methanol/methylene chloride 1 :20 (which has 2% triethylamine) as the eluent. As the column fractions are concentrated a colorless solid forms which is collected to give the title compound as a white solid.
- the thiation wait step is increased to 68 sec and is followed by the capping step.
- the oligonucleotides are purified by precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCl solution.
- Phosphinate oligonucleotides are prepared as described in U.S. Patent 5,508,270, herein incorporated by reference.
- Alkyl phosphonate oligonucleotides are prepared as described in U.S. Patent 4,469,863, herein incorporated by reference.
- 3 '-Deoxy-3 '-methylene phosphonate oligonucleotides are prepared as described in U.S. Patents 5,610,289 or 5,625,050, herein incorporated by reference.
- Phosphoramidite oligonucleotides are prepared as described in U.S. Patent, 5,256,775 or U.S. Patent 5,366,878, herein incorporated by reference.
- Alkylphosphonothioate oligonucleotides are prepared as described in WO 94/17093 and WO 94/02499 herein incorporated by reference.
- 3 '-Deoxy-3 '-amino phosphoramidate oligonucleotides are prepared as described in U.S. Patent 5,476,925, herein incorporated by reference.
- Phosphotriester oligonucleotides are prepared as described in U.S. Patent 5,023,243, herein incorporated by reference.
- Borano phosphate oligonucleotides are prepared as described in U.S. Patents 5,130,302 and 5,177,198, both herein incorporated by reference.
- PNAs Peptide nucleic acids
- PNA Peptide nucleic acids
- Chimeric oligonucleotides, oligonucleosides, or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the "gap" segment of linked nucleosides is positioned between 5' and 3' "wing" segments of linked nucleosides and a second "open end” type wherein the "gap” segment is located at either the 3' or the 5' terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as “gapmers” or gapped oligonucleotides.
- Oligonucleotides of the second type are also known in the art as “hemimers” or “wingmers”. 2'-O-Me]-[2'-deoxy]-[2'-O-Me] Chimeric Phosphorothioate Oligonucleotides
- Chimeric oligonucleotides having 2'-O-alkyl phosphorothioate and 2 '-deoxy phosphorothioate oligonucleotide segments are synthesized using an Applied Biosystems automated DNA ' synthesizer Model 380B, as above. Oligonucleotides are synthesized using the automated synthesizer and 2'-deoxy-5'-dimethoxytrityl-3'-O- phosphoramidite for the DNA portion and 5'-dimethoxytrityl-2'-O- methyl-3'-O-phosphoramidite for 5' and 3' wings.
- the standard synthesis cycle is modified by increasing the wait step after the delivery of tetrazole and base to 600 s repeated four times for RNA and twice for 2'-O-methyl.
- the fully protected oligonucleotide is cleaved from the support and the phosphate group is deprotected in 3:1 ammonia/ethanol at room temperature overnight then lyophilized to dryness.
- Treatment in methanolic ammonia for 24 hrs at room temperature is then done to deprotect all bases and sample is again lyophilized to dryness.
- the pellet is resuspended in IM TBAF in THF for 24 hrs at room temperature to deprotect the 2' positions.
- the reaction is then quenched with IM TEAA and the sample is then reduced to 1/2 volume by rotovac before being desalted on a G25 size exclusion column.
- the oligo recovered is then analyzed spectrophotometrically for yield and for purity by capillary electrophoresis and by mass spectrometry.
- [2'-O-(2-methoxyethyl phosphodiester] -[2 '-deoxy phosphorothioate]— [2'-O-(methcixyethyl) phosphodiester] chimeric oligonucleotides are prepared as per the above procedure for the 2'-O- methyl chimeric oligonucleotide with the substitution of 2'-O- (methoxyethyl) amidites for the 2'-O-methyl amidites, oxidization with iodine to generate the phosphodiester intemucleotide linkages within the wing portions of the chimeric structures and sulfurization utilizing 3,H- 1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate intemucleotide linkages for the center gap.
- oligonucleotides or oligonucleosides are purified by precipitation twice out of 0.5 M NaCl with 2.5 volumes ethanol. Synthesized oligonucleotides are analyzed by polyacrylamide gel electrophoresis on denaturing gels and judged to be at least 85% full- length material.
- Oligonucleotides are synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a standard 96 well format.
- Phosphodiester intemucleotide linkages are afforded by oxidation with aqueous iodine.
- Phosphorothioate intemucleotide linkages are generated by sulfurization utilizing 3, H- 1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile.
- Standard base-protected beta-cyanoethyldiisopropyl phosphoramidites can be purchased from commercial vendors (e.g.
- Non-standard nucleosides are synthesized as per known literature or patented methods. They are utilized as base protected betacyanoethyldiisopropyl phosphoramidites.
- Oligonucleotides are cleaved from support and deprotected with concentrated NH OH at elevated temperature (55-60°C) for 12-16 hours and the released product then dried in vacuo. The dried product is then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.
- the concentration of oligonucleotide in each well is assessed by dilution of samples and UV abso ⁇ tion spectroscopy.
- the full-length integrity of the individual products is evaluated by capillary electrophoresis (CE) in either the 96 well format (Beckman P/ACETM MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACETM 5000, ABI 270).
- Base and backbone composition is confirmed by mass analysis of the compounds utilizing electrospray-mass spectroscopy. All assay test plates are diluted from the master plate using single and multi-channel robotic pipettors. Plates are judged to be acceptable if at least 85% of the compounds on the plate are at least 85% full length.
- the effect of antisense compounds on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. The following 6 cell types are provided for illustrative purposes, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, Ribonuclease protection assays, or RT-PCR. T-24 cells:
- the human transitional cell bladder carcinoma cell line T-24 is obtained from the American Type Culture Collection (ATCC) (Manassas, VA). T-24 cells are routinely cultured in complete McCoy's 5 A basal media (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf seram (Gibco/Life Technologies, Gaithersburg, MD), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells are seeded into 96-well plates (Falcon- Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis.
- cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
- A549 cells A549 cells:
- the human lung carcinoma cell line A549 can be obtained from the American Type Culture Collection (ATCC) (Manassas, VA).
- A549 cells are routinely cultured in DMEM basal media (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence.
- NHDF cells are routinely passaged by trypsinization and dilution when they reached 90% confluence.
- Human neonatal dermal fibroblast can be obtained from the Clonetics Co ⁇ oration (WalkersviUe MD). NHDFs are routinely maintained in Fibroblast Growth Medium (Clonetics Co ⁇ oration, WalkersviUe MD) supplemented as recommended by the supplier. Cells are maintained for up to 10 passages as recommended by the supplier.
- HEK cells [00212] Human embryonic keratinocytes (HEK) can be obtained from the Clonetics Co ⁇ oration (WalkersviUe MD). HEKs are routinely maintained in Keratinocyte Growth Medium (Clonetics Co ⁇ oration, WalkersviUe MD) formulated as recommended by the supplier. Cells are routinely maintained for up to 10 passages as recommended by the supplier.
- MCF-7 cells are routinely maintained for up to 10 passages as recommended by the supplier.
- the human breast carcinoma cell line MCF-7 is obtained from the American Type Colure Collection (Manassas, VA). MCF-7 cells are routinely cultured in DMEM low glucose (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis. [00214] For Northern blotting or other analyses, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
- LA4 cells [00215] The mouse lung epithelial cell line LA4 is obtained from the American Type Colure Collection (Manassas, VA). LA4 cells are routinely cultured in F12K medium (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 15% fetal calf seram (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #3872) at a density of 3000- 6000 cells/ well for use in RT-PCR analysis. [00216] For Northern blotting or other analyses, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide. Treatment with antisense compounds:
- the concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations.
- ESM-1 mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Realtime quantitative PCR is presently preferred.
- RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.1.1-4.2.9 and 4.5.1- 4.5.3, John Wiley & Sons, Inc., 1993.
- mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer- probe sets specific for GAPDH only, target gene only ("single-plexing"), or both (multiplexing). Following PCR amplification, standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples. If both the slope and correlation coefficient of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the primer-probe set specific for that target is deemed as multiplexable. Other methods of PCR are also known in the art.
- Protein levels of ESM-1 can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), ELISA or fluorescence-activated cell sorting (FACS).
- Antibodies directed to ESM-1 can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Co ⁇ oration, Birmingham, MI), or can be prepared via conventional antibody generation methods. Methods for preparation of polyclonal antisera are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John Wiley & Sons, Inc., 1997.
- Enzyme-linked immunosorbent assays are standard in the art and can be found at, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1 - 11.2.22, John Wiley & Sons, Inc., 1991.
- Poly(A)+ mRNA is isolated according to Miura et al., Clin.
- Total mRNA is isolated using an RNEASY 96TM kit and buffers purchased from Qiagen Inc. (Valencia CA) following the manufacturer's recommended procedures. Briefly, for cells grown on 96- well plates, growth medium is removed from the cells and each well is washed with 200 ⁇ L cold PBS. 100 ⁇ L Buffer RLT is added to each well and the plate vigorously agitated for 20 seconds. 100 ⁇ L of 70% ethanol is then added to each well and the contents mixed by pipetting three times up and down. The samples are then transferred to the
- PRISM 7700 Sequence Detection System PE-Applied Biosystems, Foster City, CA
- This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time.
- PCR polymerase chain reaction
- amplification products are quantitated after the PCR is completed
- products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes.
- a reporter dye e.g., JOE, FAMTM, or VIC, obtained from either Operon Technologies Inc., Alameda, CA or PE-Applied Biosystems, Foster City, CA
- a quencher dye e.g., TAMRA, obtained from either Operon Technologies Inc., Alameda, CA or PE- Applied Biosystems, Foster City, CA
- reporter dye emission is quenched by the proximity of the 3' quencher dye.
- annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5'-exonuclease activity of Taq polymerase.
- cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated.
- additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISM 7700 Sequence Detection System.
- a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.
- PCR reagents were obtained from PE-Applied Biosystems, Foster City, CA.
- RT-PCR reactions were carried out by adding 25 ⁇ L PCR cocktail (lx TAQMANTM buffer A, 5.5 MM MgCl 2 , 300 ⁇ M each of dATP, dCTP and dGTP, 600 ⁇ M of dUTP, 100 nM each of forward primer, reverse primer, and probe, 20 Units RNAse inhibitor, 1.25 Units AMPLITAQ GOLDTM, and 12.5 Units MuLV reverse transcriptase) to 96 well plates containing 25 ⁇ L poly(A) mRNA solution.
- the RT reaction was carried out by incubation for 30 minutes at 48°C.
- PCR primers were: forward primer: CTGCTTCCCACCAGCAAAG SEQ ID NO : 2001 reverse primer: GCAAGACGCTCTTCATGTTTCC SEQ ID NO : 2002 and the PCR probe is: FAMTM- CGACTGGAGAGCCGAGCCGGA SEQ ID NO;2003 -TAMRA where FAMTM (PE-Applied Biosystems, Foster City, CA) is the fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quencher dye.
- FAMTM PE-Applied Biosystems, Foster City, CA
- TAMRA PE-Applied Biosystems, Foster City, CA
- PCR primers were: forward primer: CCCACCGTGTTCTTCGACAT SEQ ID NO : 2004 reverse primer: TTTCTGCTGTCTTTGGGACCTT SEQ ID NO : 2005 and the PCR probe is: 5' JOE- CGCGTCTCCTTTGAGCTGTTTGCA SEQ ID NO : 2006 - TAMRA 3 ' where JOE (PE-Applied Biosystems, Foster City, CA) is the fluorescent reporter dye) and TAMRA (PE- Applied Biosystems, Foster City, CA) is the quencher dye.
- JOE PE-Applied Biosystems, Foster City, CA
- TAMRA PE- Applied Biosystems, Foster City, CA
- Example 14 Antisense inhibition of human ESM-1 expression by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap
- oligonucleotides are designed to target different regions of the human ESM-1 RNA, using published sequences (NM_007036, inco ⁇ orated herein as Figure 1.
- the oligonucleotides are shown in Table 1. "Position" indicates the first (5 '-most) nucleotide number on the particular target sequence to which the oligonucleotide binds.
- the indicated parameters for each oligo were predicted using RNAstracture 3.7 by David H. Mathews, Michael Zuker, and Douglas H. Turner. The parameters are described either as free energy (The energy that is released when a reaction occurs. The more negative the number, the more likely the reaction will occur.
- All free energy units are in kcal/mol.) or melting temperature (temperature at which two anneal strands of polynucleic acid separate). The higher the temperature, the greater the affinity between the two strands.
- All compounds in Table 1 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting often 2'deoxynucleotides, which is flanked on both sides (5' and 3' directions) by four-nucleotide "wings".
- the wings are composed of 2 '-methoxyethyl (2'-MOE) nucleotides.
- Cytidine residues in the 2'-MOE wings are 5-methylcytidines. All cytidine residues are 5-methylcytidines.
- SEQ ID NO: 150 CAGCAGCCACAGTCGTCGAG 210 -15.4 -28 77.3 -12.6 0 -4.9
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- General Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Diabetes (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Obesity (AREA)
- Heart & Thoracic Surgery (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Cardiology (AREA)
- Vascular Medicine (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Endocrinology (AREA)
- Emergency Medicine (AREA)
- Biochemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Antisense compounds, compositions, and methods are provided for modulating the expression of Endothelial Specific Molecule-1 (ESM-1). The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding ESM-1. Methods of using these compounds for modulation of ESM-1 expression and for treatment of diseases associated with expression of ESM-1 are provided.
Description
ANTISENSE MODULATION OF ENDOTHELIAL SPECIFIC MOLECULE 1 EXPRESSION
The present application claims priority under Title 35, United States Code, §119 to United States Provisional application Serial No.
60/404,495, filed August 19, 2002, which is incorporated by reference in its entirety as if written herein.
FIELD OF THE INVENTION
[001] The present invention provides compositions and methods for modulating the expression of Endothelial Specific Molecule-1 (ESM-1). In particular, this invention relates to antisense compounds, particularly oligonucleotides, specifically hybridizable with nucleic acids encoding Endothelial Specific Molecule-1. Such oligonucleotides have been shown to modulate the expression of Endothelial Specific Molecule-1.
BACKGROUND OF THE INVENTION
[002] Angiogenesis is the growth of new capillary blood vessels from preexisting vessels and capillaries and is crucial in a large number of processes, such as wound repair, embryonic development, and the growth of solid tumors. In neovascularization, endothelial cells will undergo migration, elongation, proliferation, and orientation leading to lumen formation, re-establishment of a basement membrane and eventual anastomosis with other vessels (Patan S. et al., (2000), J. Neurooncol. 50: 1-15).
[003] Endothelial cell-specific molecule 1 (ESM-1) was originally isolated in an immunoscreening of a HUNEC cDΝA library in order to identify the gene encoding a 55-kDa autoantigen that may have a role in asthma (Lassalle, P., et al., ). The full length ESM-1 cDΝA was cloned in a library constructed in pCDM8 but was found to be inserted in the reverse orientation (Lassalle, P., et al., ).
[004] Northern blots have shown ESM-1 to probes to hybridize to RNA from HUNEC cells, SN40-transfected HUNECs, human lung, and human kidney. Little or none was detected in human heart, pancreas, placenta, muscle, brain or liver (Lassalle et al., 1996). Antibodies raised to ESM-1 show protein expression in human lung, colon, and kidney (Bechard, D., et al.,. (2000). J. Vase. Res. 37, 417-425; WO9945028). In the lung, ESM-1 is expressed in venules, arterioles, and alveolar capillaries as well as by epithelial cells of the bronchi and submucosal glands. In the kidney, expression is predominantly in renal tubular epithelial cells. Capillaries and venules of the lamina propria of the colon also display ESM-1 expression. A splice variant of ESM-1 has been identified which lacks 150 base pairs but maintains the open reading frame (Aitkenhead, M., et al, (2002) Microvasc. Res. 63, 159-171).
[005] ESM-1 expression appears to be both constitutive and under the control of a variety of cytokines. HUNEC cells treated with TΝFα or IL- lβdisplay an up-regulation of the gene. No change in ESM-1 levels was seen upon treatment with IL-4 or IFNγ. While coadministration of TNFα and IFNγ lead to a synergistic induction of proinflammatory factors such as IL-6, IL-8, RANTES and ICAM-1 , the combination of these two cytokines inhibit the TNFα induced ESM-1 up-regulation (Lassale et al., 1996).
[006] ESM-1 has been found to be differentially expressed in endothelial cells forming tubes in a 3-dimensional collagen gel when compared to cells growing in two dimensions (Aitkenhead et al., 2002). Microarray analysis indicates a higher level of ESM-1 expression in HMNEC cells growing on collagen relative to those growing on osteopontin. We followed up on this observation by investigating the expression level of ESM-1 in colon tumor samples compared to a pool of normal colon tissue. Nine often tumors showed expression at levels of tlireefold or higher at the RNA level, as determined by real-time quantitative reverse transcription polymerase chain reaction experiments.
[007] We have amplified ESM-1 from HDMECs and cloned it into an expression vector. A pool of transfected NIH3T3 cells were then selected and assayed for ESM-1 expression. After confirming significant gene over- expression at the RNA level, cells were injected subcutaneously into a nu/nu female mouse. While vector transfected NIH3T3 fibroblasts failed to grow in these mice, those cells transfected with ESM-1 formed solid tumors within three weeks. This data shows that ESM-1 contains the potential to augment growth in vivo to a cell line that is usually not capable of fonriing tumors.
[008] Previous work on ESM- 1 has found that levels of expression of this gene change in cells under varying conditions. We have extended those findings to show that ESM-1 is up regulated in colon carcinomas when compared to normal colon tissue. Additionally, we have shown that forced over-expression of ESM-1 leads to an escalation of growth of NIH3T3 fibroblasts in vivo.
[009] Antisense technology is emerging as an effective means for reducing the expression of specific gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of ESM-1 expression.
SUMMARY OF THE INVENTION
[0010] The present invention is directed to antisense compounds, particularly oligonucleotides, which are targeted to a nucleic acid encoding ESM-1, and which modulate the expression of ESM-1. Pharmaceutical and other compositions comprising the antisense compounds of the invention are also provided. Further provided are methods of modulating the expression of ESM-1 in cells or tissues comprising contacting said cells or tissues with one or more of the antisense compounds or compositions of the invention. Further provided are methods of treating an animal, particularly a human, suspected of having or being prone to a disease or condition associated with
expression of ESM-1 by administering a therapeutically or prophylactically effective amount of one or more of the antisense compounds or compositions of the invention.
BRIEF DESCRIPTION OF THE FIGURES
[0011] Figure 1 shows the cDNA sequence and the ESM-1 protein sequence encoded therefrom.
[0012] Figure 2 shows the ESM-1 expression levels in ten tumors as determined by Real-Time Quantitative PCR.
DETAILED DESCRIPTION OF THE INVENTION
[0013] The present invention employs oligomeric antisense compounds, particularly oligonucleotides, for use in modulating the function of nucleic acid molecules encoding ESM-1, ultimately modulating the amount of ESM-1 produced. This is accomplished by providing antisense compounds, which specifically hybridize with one or more nucleic acids encoding ESM-1. As used herein, the terms "target nucleic acid" and "nucleic acid encoding ESM-1" encompass DNA encoding ESM-1, RNA (including pre-mRNA and mRNA) transcribed from such DNA, and also cDNA derived from such RNA. The specific hybridization of an oligomeric compound with its target nucleic acid interferes with the normal function of the nucleic acid. This modulation of function of a target nucleic acid by compounds, which specifically hybridize to it, is generally referred to as "antisense". The functions of DNA to be interfered with include replication and transcription. The functions of RNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA. The overall effect of such
interference with target nucleic acid function is modulation of the expression of ESM-1. In the context of the present invention, "modulation" means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene. In the context of the present invention, inhibition is the preferred form of modulation, of gene expression and mRNA is a preferred target.
[0014] It is preferred to target specific nucleic acids for antisense. "Targeting" an antisense compound to a particular nucleic acid, in the context of this invention, is a multistep process. The process usually begins with the identification of a nucleic acid sequence whose function is to be modulated. This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In the present invention, the target is a nucleic acid molecule encoding ESM-1. The targeting process also includes determination of a site or sites within this gene for the antisense interaction to occur such that the desired effect, e.g., detection or modulation of expression of the protein, will result. Within the context of the present invention, a preferred intragenic site is the region encompassing the translation initiation or termination codon of the open reading frame (ORF) of the gene. Since, as is known in the art, the translation initiation codon is typically 5' -AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon," the "start codon" or the "AUG start codon". A minority of genes have a translation initiation codon having the RNA sequence 5'-GUG, 5'-UUG or 5'- CUG, and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo. Thus, the terms "translation initiation codon" and "start codon" can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation
initiation in a particular cell type or tissue, or under a particular set of conditions. In the context of the invention, "start codon" and "translation initiation codon" refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding ESM- 1 , regardless of the sequence(s) of such codons.
[0015] It is also known in the art that a translation termination codon (or "stop codon") of a gene may have one of three sequences, i.e. 5'- UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences are 5'- TAA, 5 '-TAG and 5'-TGA, respectively). The terms "start codon region" and "translation initiation codon region "refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation initiation codon. Similarly, the terms "stop codon region" and "translation termination codon region "refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation tennination codon.
[0016] The open reading frame (ORF) or "coding region," which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is also a region which may be targeted effectively. Other target regions include the 5' untranslated region (5'UTR), known in the art to refer to the portion of an mRNA in the 5 ' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene, and the 3 ' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3 ' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA or corresponding nucleotides on the gene. The 5 ' cap of an mRNA comprises an N7-methylated guanosine residue joined to the 5'-most residue of the mRNA via a 5'-5' triphosphate linkage. The 5' cap region of an mRNA is considered to include the 5'
cap structure itself as well as the first 50 nucleotides adjacent to the cap. The 5 ' cap region may also be a preferred target region. [0017] Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as "introns," which are excised from a transcript before it is translated. The remaining (and therefore translated) regions are known as "exons" and are spliced together to form a continuous mRNA sequence. mRNA splice sites, i.e., intron-exon junctions, may also be preferred target regions, and are particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular mRNA splice product is implicated in disease. Aberrant fusion junctions due to rearcangements or deletions are also preferred targets. It has also been found that introns can also be effective, and therefore preferred, target regions for antisense compounds targeted, for example, to DNA or pre- mRNA.
[0018] Once one or more target sites have been identified, oligonucleotides are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect. [0019] In the context of this invention, "hybridization" means hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases. For example, adenine and thymine are complementary nucleobases, which pair through the formation of hydrogen bonds. "Complementary," as used herein, refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a DNA or RNA molecule, then the oligonucleotide and the DNA or RNA are considered to be complementary to each other at that position. The oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other. Thus,
"specifically hybridizable" and "complementary" are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target. It is understood in the art that the sequence of an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. An antisense compound is specifically hybridizable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid nonspecific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are perforated.
[0020] Antisense compounds are commonly used as research reagents and diagnostics. For example, antisense oligonucleotides, which are able to inhibit gene expression with exquisite specificity, are often used by those of ordinary skill to elucidate the function of particular genes. Antisense compounds are also used, for example, to distinguish between functions of various members of a biological pathway. Antisense modulation has, therefore, been harnessed for research use. [0021] The specificity and sensitivity of antisense is also harnessed by those of skill in the art for therapeutic uses. Antisense oligonucleotides have been employed as therapeutic moieties in the treatment of disease states in animals and man. Antisense oligonucleotides have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that oligonucleotides can be useful therapeutic modalities that can be configured to be useful in treatment regimes for treatment of cells, tissues and animals, especially humans. In the context of this invention, the term "oligonucleotide" refers to an oligomer or polymer
of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases. [0022] ESM-1 antisense oligonucleotides that have activity in the cardiovascular, angiogenic, and endothelial assays described herein, and/or whose gene product has been found to be localized to the cardiovascular system, is likely to have therapeutic uses in a variety of cardiovascular, endothelial, and angiogenic disorders, including systemic disorders that affect vessels, such as diabetes mellitus. Its therapeutic utility could include diseases of the arteries, capillaries, veins, and/or lymphatics. Examples of treatments hereunder include treating muscle wasting disease, treating osteoporosis, aiding in implant fixation to stimulate the growth of cells around the implant and therefore facilitate its attachment to its intended site, increasing IGF stability in tissues or in serum, if applicable, and increasing binding to the IGF receptor (since IGF has been shown in vitro to enhance human marrow erythroid and granulocytic progenitor cell growth).
[0023] ESM-1 antisense oligonucleotides can be used to inhibit the production of excess connective tissue during wound healing or pulmonary fibrosis if ESM-1 promotes such production. This would include treatment of acute myocardial infarction and heart failure.
[0024] Moreover, the present invention provides the treatment of cardiac hypertrophy, regardless of the underlying cause, by administering a therapeutically effective dose of ESM-1 antisense oligonucleotides. [0025] The treatment for cardiac hypertrophy can be performed at any of its various stages, which may result from a variety of diverse pathologic conditions, including myocardial infarction, hypertension, hypertrophic cardiomyopathy, and valvular regurgitation. The treatment extends to all stages
of the progression of cardiac hypertrophy, with or without structural damage of the heart muscle, regardless of the underlying cardiac disorder. [0026] ESM-1 antisense oligonucleotides would be useful for treatment of disorders where it is desired to limit or prevent angiogenesis. Examples of such disorders include vascular tumors such as hemangioma, tumor angiogenesis, neovascularization in the retina, choroid, or cornea, associated with diabetic retinopathy or premature infant retinopathy or macular degeneration and proliferative vitreoretinopathy, rheumatoid arthritis, Crohn's disease, atherosclerosis, ovarian hyperstimulation, psoriasis, endometriosis associated with neovascularization, restenosis subsequent to balloon angioplasty, sear tissue overproduction, for example, that seen in a keloid that forms after surgery, fibrosis after myocardial infarction, or fibrotic lesions associated with pulmonary fibrosis. [0027] Specific types of diseases are described below, where ESM-1 antisense oligonucleotides may serve as useful for vascular- related drug targeting or as therapeutic targets for the treatment or prevention of the disorders.
[0028] Atherosclerosis is a disease characterized by accumulation of plaques of intimal thickening in arteries, due to accumulation of lipids, proliferation of smooth muscle cells, and formation of fibrous tissue within the arterial wall. The disease can affect large, medium, and small arteries in any organ. Changes in endothelial and vascular smooth muscle cell function are known to play an important role in modulating the accumulation and regression of these plaques. [0029] Hypertension is characterized by raised vascular pressure in the systemic arterial, pulmonary arterial, or portal venous systems. Elevated pressure may result from or result in impaired endothelial function and/or vascular disease. [0030] Inflammatory vasculitides include giant cell arteritis, Takayasu's arteritis, polyarteritis nodosa (including the microangiopathic form), Kawasaki's disease, microscopic polyarightis, Wegener's granulomatosis, and a variety 101 of infectious-related vascular disorders (including Henoch-Schonlein Prupura). Altered endothelial cell function has been shown to be important in these
diseases. Reynaud's disease and Reynaud's phenomenon are characterized by intermittent abnormal impairment of the circulation through the extremities on exposure to cold. Altered endothelial cell function has been shown to be important in this disease. [0031] Aneurysms are saccular or fusiform dilatations of the arterial or venous tree that are associated with altered endothelial cell and/or vascular smooth muscle cells.
[0032] Arterial restenosis (restenosis of the arterial wall) may occur following angioplasty as a result of alteration in the function and proliferation of endothelial and vascular smooth muscle cells.
[0033] Thrombophlebitis and lymphangitis are inflammatory disorders of veins and lymphatics, respectively, that may result from, and/or in, altered endothelial cell function. Similarly, lymphedema is a condition involving impaired lymphatic vessels resulting from endothelial cell function. [0034] The family of benign and malignant vascular tumors is characterized by abnormal proliferation and growth of cellular elements of the vascular system. For example, lymphangiomas are benign tumors of the lymphatic system that are congenital, often cystic, malformations of the lymphatics that usually occur in newborns. [0035] Cystic tumors tend to grow into the adjacent tissue. Cystic tumors usually occur in the cervical and axillary region. They can also occur in the soft tissue of the extremities. The main symptoms are dilated, sometimes reticular, structured lymphatics and lymphocysts surrounded by connective tissue. [0036] Lymphangiomas are assumed to be caused by improperly com ected embryonic lymphatics or their deficiency. The result is impaired local lymph drainage.
[0037] Another use for ESM-1 antisense antagonists is in the prevention of tumor angiogenesis, which involves vascularization of a tumor to enable it to growth and/or metastasize. This process is dependent on the growth of new blood vessels. Examples of neoplasms and related conditions that involve tumor angiogenesis include breast carcinomas, lung carcinomas, gastric carcinomas, esophageal carcinomas, colorectal carcinomas, liver carcinomas, ovarian carcinomas, thecomas, arrhenoblastomas, cervical carcinomas, endometrial
carcinoma, endometrial hyperplasia, endometriosis, fibrosarcomas, choriocarcinoma, head and neck cancer, nasopharyngeal carcinoma, laryngeal carcinomas, hepatoblastoma, Kaposi's sarcoma, melanoma, skin carcinomas, hemangioma, cavernous hemangioma, hemangioblastoma, pancreas carcinomas, retinoblastoma, astrocytoma, glioblastoma, Schwannoma, oligodendrogliorna, medulloblastoma, neuroblastomas, rhabdomyosarcoma, osteogenic sarcoma, leiomyosarcomas, urinary tract carcinomas, thyroid carcinomas, Wilm's tumor, renal cell carcinoma, prostate carcinoma, abnormal vascular proliferation associated with phakomatoses, edema (such as that associated with brain tumors), and Meigs ' syndrome.
[0038] Healing of trauma such as wound healing and tissue repair is also a targeted use for ESM-1 antisense oligonucleotides. Formation and regression of new blood vessels is essential for tissue healing and repair. This category includes bone, cartilage, tendon, ligament, and/or nerve tissue growth or regeneration, as well as wound healing and tissue repair and replacement, and in the treatment of bums, incisions, and ulcers.
[0039] ESM-1 antisense oligonucleotides that induce cartilage and/or bone growth in circumstances where bone is not normally formed have application in the healing of bone fractures and cartilage damage or defects in humans and other animals. Such a preparation employing ESM-1 antisense oligonucleotides may have prophylactic use in closed as well as open fracture reduction and also in the improved fixation of artificial joints. De novo bone formation induced by an osteogenic agent contributes to the repair of congenital, trauma induced, or oncologic, resection-induced craniofacial defects, and also is useful in cosmetic plastic surgery.
[0040] It is expected that ESM-1 antisense oligonucleotides may also exhibit activity for generation or regeneration of other tissues, such as organs (including, for example, pancreas, liver, intestine, kidney, skin, or endothelium), muscle (smooth, skeletal, or cardiac), and vascular (including vascular endothelium) tissue, or for promoting the growth of cells comprising such tissues. Part of the desired effects may be by inhibition or modulation of fibrotic scarring to allow normal tissue to regenerate.
[0041] ESM-1 antisense oligonucleotides may also be useful for gut protection or regeneration and treatment of lung or liver fibrosis, reperfusion injury in various tissues, and conditions resulting from systemic cytokine damage. Also, ESM-1 antisense oligonucleotides may be useful for promoting or inhibiting differentiation of tissues described above from precursor tissues or cells, or for inhibiting the growth of tissues described above. [0042] ESM-1 antisense oligonucleotides may also be used in the treatment of periodontal diseases and in other tooth-repair processes. Such agents may provide an environment to attract bone-forming cells, stimulate growth of bone- forming cells, or induce differentiation of progenitors of bone-forming cells ESM-1 antisense oligonucleotides may also be useful in the treatment of osteoporosis or osteoarthritis, such as through stimulation of bone and/or cartilage repair or by blocking inflammation or processes of tissue destruction (collagenase activity, osteoclast activity, etc.) mediated by inflammatory processes, since blood vessels play an important role in the regulation of bone turnover and growth.
[0043] Another category of tissue regeneration activity that may be attributable to ESM-1 antisense oligonucleotides is tendon/ligament formation. A protein that induces tendon ligament-like tissue or other tissue fonnation in circumstances where such tissue is not normally formed has application in the healing of tendon or ligament tears, deformities, and other tendon or ligament defects in humans and other animals. Such a preparation may have prophylactic use in preventing damage to tendon or ligament tissue, as well as use in the improved fixation of tendon or ligament to bone or other tissues, and in repairing defects to tendon or ligament tissue. De novo tendon/ligament-like tissue formation induced by a composition of ESM-1 antisense oligonucleotides contributes to the repair of congenital, trauma-induced, or other tendon or ligament defects of other origin, and is also useful in cosmetic plastic surgery for attachment or repair of tendons or ligaments. The compositions herein may provide an environment to attract tendon- or ligament-forming cells, stimulate growth of tendon- or ligament-forming cells, induce differentiation of progenitors of tendon- or ligament forming cells, or induce growth of tendon/ligament cells or progenitors ex vivo for return in vivo to effect tissue
repair. The compositions herein may also be useful in the treatment of tendinitis, carpal tunnel syndrome, and other tendon or ligament defects. The compositions may also include an appropriate matrix and/or sequestering agent as a carrier as is well known in the art. [0044] ESM-1 antisense oligonucleotides may also be administered prophylactically to patients with cardiac hypertrophy, to prevent the progression of the condition, and avoid sudden death, including death of asymptomatic patients. Such preventative therapy is particularly warranted in the case of patients diagnosed with massive left ventricular cardiac hypertrophy (a maximal wall thickness of 35 mm. or more in adults, or a comparable value in children), or in instances when the hemodynamic burden on the heart is particularly strong.
[0045] ESM-1 antisense oligonucleotides may also be useful in the management of atrial fibrillation, which develops in a substantial portion of patients diagnosed with hypertrophic cardiomyopathy. Further indications include angina, myocardial infarctions such as acute myocardial infarctions, and heart failure such as congestive heart failure. Additional non-neoplastic conditions include psoriasis, diabetic and other proliferative retinopathies including retinopathy of prematurity, retrolental fibroplasia, neovascular glaucoma, thyroid hyperplasias (including Grave's disease), corneal and other tissue transplantation, chronic inflammation, lung inflammation, nephrotic syndrome, preeclampsia, ascites, pericardial effusion (such as that associated with pericarditis), and pleural effusion. [0046] In view of the above, ESM-1 antisense oligonucleotides, which are shown to alter or impact endothelial cell function, proliferation, and/or form, are likely to play an important role in the etiology and pathogenesis of many or all of the disorders noted above, and as such can serve as therapeutic targets to augment or inhibit these processes or for vascular-related drug targeting in these disorders.
Combination Therapies
[0047] The effectiveness of ESM-1 antisense oligonucleotides in preventing or treating the disorder in question may be improved by administering the active agent serially or in combination with another agent that is effective for those purposes, either in the same composition or as separate compositions. For example, for treatment of cardiac hypertrophy, ESM-1 antisense therapy can be combined with the administration of inhibitors of known cardiac myocyte hypertrophy factors, e.g., inhibitors of cc-adrenergic agonists such as phenylephrine; endothelin-1 inhibitors such as BOSENTAN™ and MOXONODIN™; inhibitors to CT- 1 (US Pat. No. 5,679,545); inhibitors to LIF; ACE inhibitors; des- aspartate-angiotensin I inhibitors (U.S. Pat. No. 5,773,415), and angiotensin II inhibitors.
[0048] For treatment of cardiac hypertrophy associated with hypertension, ESM-1 antisense oligonucleotides can be administered in combination with P- adrenergic receptor blocking agents, e.g., propranolol, timolol, tertalolol, carteolol, nadolol, betaxolol, penbutolol, acetobutolol, atenolol, metoprolol, or carvedilol; ACE inhibitors, e.g., quinapril, captopril, enalapril, ramipril, benazepril, fosinopril, or lisinopril; diuretics, e.g., chlorothiazide, hydrochlorothiazide, hydroflumethiazide, methylchlothiazide, benzthiazide, dichlorphenamide, acetazolamide, or indapamide; and/or calcium channel blockers, e.g., diltiazem, nifedipine, verapamil, or nicardipine. Pharmaceutical compositions comprising the therapeutic agents identified herein by their generic names are commercially available, and are to be administered following the manufacturers' instructions for dosage, administration, adverse effects, contraindications, etc. 119 See, e.z., Physicians' 'Desk Reference (Medical Economics Data Production Co.: Montvale, N.J., 1997), 51 st Edition. Preferred candidates for combination therapy in the treatment of hypertrophic cardiormyopathy are P-adrenergic-blocking drugs (e.g., propranolol, timolol, tertalolol, carteolol, nadolol, betaxolol, penbutolol, acetobutolol, atenolol, metoprolol, or carvedilol), verapamil, difedipine, or diltiazem. Treatment of hypertrophy associated with high blood pressure may require the use of antihypertensive drug therapy, using calcium channel blockers, e.g., diltiazem, nifedipine, verapamil, or nicardipine; P-adrenergic blocking agents; diuretics, e.g., chlorothiazide, hydrochlorothiazide, hydroflumethiazide,
methylchlothiazide, benzthiazide, dichlorphenamide, acetazolamide, or indapamide; and/or ACE-inhibitors, e. g., quinapril, captopril, enalapril, ramipril, benazepril, fosinopril, or lisinopril.
[0049] For other indications, ESM-1 antisense oligonucleotides may be combined with other agents beneficial to the treatment of the bone and/or cartilage defect, wound, or tissue in question. These agents include various growth factors such as EGF, PDGF, TGF- or TGF-, IGF, FGF, and CTGF. [0050] In addition, ESM-1 antisense oligonucleotides used to treat cancer may be combined with cytotoxic, chemotherapeutic, or growth-inhibitory agents as identified above. Also, for cancer treatment, ESM-1 antisense oligonucleotides are suitably administered serially or in combination with radiological treatments, whether involving irradiation or administration of radioactive substances. [0051] The effective amounts of the therapeutic agents administered in combination with ESM-1 antisense oligonucleotides thereof will be at the physician's, or veterinarian's discretion. Dosage administration and adjustment is done to achieve maximal management of the conditions to be treated. For example, for treating hypertension, these amounts ideally take into account use of diuretics or digitalis, and conditions such as hyper- or hypotension, renal impairment, etc. The dose will additionally depend on such factors as the type of the therapeutic agent to be used and the specific patient being treated. Typically, the amount employed will be the same dose as that used, if the given therapeutic agent is administered without ESM-1 antisense oligonucleotides. [0052] For treatment of breast carcinoma, ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, Trastuzumab
(Herceptin) with chemotherapy, paclitaxel, docetaxel, epirubicin, mitoxantrone, topotecan, capecitabine, vinorelbine, thiotepa, vincristine, vinblastine, carboplatin or cisplatin, plicamycin, anastrozole, letrozole, exemestane, toremifine, or progestins. [0053] For treatment of acute lymphocytic leukemia, ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, doxorubicin, cytarabine, cyclophosphamide, etoposide, teniposide, allopurinol, or autologous bone marrow transplantation.
[0054] For treatment of acute myelocytic and myelomonocytic leukemia, ESM-1, antisense oligonucleotides can be administered in combination with, but not limited to, gemtuzumab ozogamicin (Mylotarg), mitoxantrone, idarubicin, etoposide, mercaptopurine, thioguanine, azacitidine, amsacrine, methotrexate, doxorubicin, tretinoin, allopurinol, leukapheresis, prednisone, or arsenic trioxide for acute promyelocytic leukemia.
[0055] For treatment of chronic myelocytic leukemia, ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, busulfan, mercaptopurine, thioguanine, cytarabine, plicamycin, melphalan, autologous bone maιτow transplantation, or allopurinol. [0056] For treatment of chronic lymphocytic leukemia, ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, vincristine, cyclophosphamide, doxorubicin, cladribine (2- chlorodeoxyadenosine; CdA), allogeneic bone marrow transplant, androgens, or allopurinol.
[0057] For treatment of multiple myeloma, ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, etoposide, cytarabine, alpha interferon, dexamethasone, or autologous bone marrow transplantation.
[0058] For treatment of carcinoma of the lung (small cell and non-small cell), ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, cyclophosphamide, doxorubicin, vincristine, etoposide, mitomycin, ifosfamide, paclitaxel, irinotecan, or radiation therapy. [0059] For treatment of carcinoma of the colon and rectum, ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, capecitabine, methotrexate, mitomycin, carmustine, cisplatin, irinotecan, or floxuridine. [0060] For treatment of carcinoma of the kidney, ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, alpha interferon, progestins, infusional FUDR, or fluorouracil. [0061] For treatment of carcinoma of the prostate, ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to,
ketoconazole, doxorubicin, aminoglutethimide, progestins, cyclophosphamide, cisplatin, vinblastine, etoposide, suramin, PC-SPES, or estramustine phosphate. [0062] For treatment of melanoma, ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, cannustine, lomustine, melphalan, thiotepa, cisplatin, paclitaxel, tamoxifen, or vincristine. [0063] For treatment of carcinoma of the ovary, ESM-1 antisense oligonucleotides can be administered in combination with, but not limited to, docetaxel, doxorubicin, topotecan, cyclophosphamide, doxorubicin, etoposide, or liposomal doxorubicin. [0064] While antisense oligonucleotides are a preferred form of antisense compound, the present invention comprehends other oligomeric antisense compounds, including but not limited to oligonucleotide mimetics such as are described below. The antisense compounds in accordance with this invention preferably comprise from about 8 to about 30 nucleobases (i.e. from about 8 to about 30 linked nucleo sides). Particularly preferred antisense compounds are antisense oligonucleotides, even more preferably those comprising from about 12 to about 25 nucleobases. As is known in the art, a nucleoside is a base- sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn the respective ends of this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The nonnal I linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.
[0065] Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. [0066] Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3 'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'- amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3 '-5' linkages, 2 '-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3 '-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included.
[0067] Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S.: 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of which is herein incorporated by reference. [0068] Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or
more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; fonnacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. [0069] Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference.
[0070] In other preferred oligonucleotide mimetics, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.
[0071] Most preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular -CH2-NH-O-CH2-, -CH2-N (CH3) -O-CH2- [known as a methylene (methylimino) or MMI backbone], - CH2-O-N (CH3) -CH2-, -CH2N(CH3)-N(CH3)-CH2- and -O- N(CH3)-CH2-CH2- [wherein the native phosphodiester backbone is represented as -O-P-O-CH2-] of the above referenced U.S. patent 5,489,677, and the amide backbones of the above referenced U.S. patent 5,602,240. Also preferred are oligonucleotides having morpholino backbone structures of the above-referenced U.S. patent 5,034,506. [0072] Modified oligonucleotides may also contain one or more substituted sugar moieties. Preferred oligonucleotides comprise one of the following at the 2' position: OH; F; O-, S-, orN-alkyl; O-, S-, or N- alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Ci to C10 alkyl or C2 to C10 alkenyl and alkynyl. Particularly preferred are O[(CH2)nO]mCH3, O(CH2)n,OCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2nON[(CH2)nCH3)]2 where n and m are from 1 to about 10. Other preferred oligonucleotides comprise one of the following at the 2' position: Ci to C10, ( lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ON02, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A preferred modification includes 2' -methoxyethoxy (2' -O-CH2CH2OCH3, also known as 2'-O- (2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred modification includes 2'-dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in examples herein below, and
2 '-dimethylaminoethoxy ethoxy (also known in the art as 2'-O- dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N (CH2)2, also described in examples herein below. [0073] Other preferred modifications include 2'-methoxy (2'-O CH3), 2 '-aminopropoxy (2 '-O CH2 CH2 CH2NH2) and 2 '-fluoro (2 '-F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2 '-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, each of which is herein incorporated by reference in its entirety.
[0074] Oligonucleotides may also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6- methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2- thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8- hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5 -trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylquanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine
and 3-deazaadenine. Further nucleobases include those disclosed in United States Patent No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S.T. and Lebleu, B. ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2- aminopropyladenine, 5-propynyluracil and 5-propynylcytosine, 5- methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds, Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications. [0075] Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. 3,687,808, as well as U.S.: 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,750,692, and 5,681,941, each of which is herein incorporated by reference.
[0076] Another modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates, which enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Such moieties include but are not limited to Hpid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al, Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a
thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. NY. Acad. Sci., 1992, 660, 306-309; Manoharan et al, Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111- 1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al, Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac- glycerol or triethylammonium l,2-di-O-hexadecyl-rac-glycero-3-H- phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Mancharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 365 '-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Ada, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937). [0077] Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584: 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, each of which is herein incorporated by reference. [0078] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligonucleotide. The present invention also
includes antisense compounds, which are chimeric compounds. "Chimeric" antisense compounds or "chimeras," in the context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound. These oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease, which cleaves the RNA strand of RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxy oligonucleotides hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
[0079] Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
[0080] The antisense compounds used in accordance with this invention may be conveniently, and routinely made through the well- known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives. [0081] The antisense compounds of the invention are synthesized in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules. The compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. Representative United States patents that teach the preparation of such uptake, distribution and/or absorption assisting formulations include, but are not limited to, U.S. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756, each of which is herein incorporated by reference.
[0082] The antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
[0083] The term "prodrug" indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions. In particular, prodrug versions of the oligonucleotides of the invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al., published December 9, 1993 or in WO 94/26764 to Imbach et al. [0084] The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. [0085] Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines. Examples of metals used as cations are sodium, potassium, magnesium, calcium, and the like. Examples of suitable amines are N, N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N- methylglucamine, and procaine (see, for example, Berge et al.,
"Pharmaceutical Salts," J. ofPharma Sci., 1977, 66, 119). The base addition salts of said acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional manner. The free acid form may be regenerated by contacting the salt form with an acid and isolating the free acid in the conventional manner. The free acid forms differ from their respective salt forms somewhat in certain physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acid for purposes of the present invention. As used herein, a "pharmaceutical addition salt" includes a pharmaceutically acceptable salt of an acid form of one of the components of the compositions of the invention. These include organic or inorganic acid salts of the amines. Preferred acid salts are the hydrochlorides, acetates,
salicylates, nitrates, and phosphates. Other suitable pharmaceutically acceptable salts are well known to those skilled in the art and include basic salts of a variety of inorganic and organic acids, such as, for example, with inorganic acids, such as for example hydrochloric acid, hydrobromic acid, sulfuric acid or phosphoric acid; with organic carboxylic, sulfonic, sulfo or phospho acids or N-substituted sulfamic acids, for example acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic acid, 2-phenoxybenzoic acid, 2- acetoxybenzoic acid, embonic acid, nicotinic acid or isonicotinic acid; and with amino acids, such as the 20 alpha-amino acids involved in the synthesis of proteins in nature, for example glutamic acid or aspartic acid, and also with phenylacetic acid, methanesulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, ethane- 1 ,2-disulfonic acid, benzenesulfonic acid, 4-methylbenzenesulfoic acid, naphthalene-2- sulfonic acid, naphthalene- 1, 5 -disulfonic acid, 2- or 3-phosphoglycerate, glucose-6-phosphate, N-cyclohexylsulfamic acid (with the formation of cyclamates), or with other acid organic compounds, such as ascorbic acid. Pharmaceutically acceptable salts of compounds may also be prepared with a pharmaceutically acceptable cation. Suitable pharmaceutically acceptable cations are well known to those skilled in the art and include alkaline, alkaline earth, ammonium, and quaternary ammonium cations. Carbonates or hydrogen carbonates are also possible.
[0086] For oligonucleotides, preferred examples of pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spemiidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid,
oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine.
[0087] The antisense compounds of the present invention can be utilized for diagnostics, therapeutics, prophylaxis, as research reagents, and kits. For therapeutics, an animal, preferably a human, suspected of having a disease or disorder, which can be treated by modulating the expression of ESM-1, is treated by administering antisense compounds in accordance with this invention. The compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of an antisense compound to a suitable pharmaceutically acceptable diluent or carrier. Use of the antisense compounds and methods of the invention may also be useful prophylactically, e.g., to prevent or delay infection, inflammation, or tumor formation, for example. [0088] The antisense compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding ESM-1, enabling sandwich and other assays to easily be constructed to exploit this fact. Hybridization of the antisense oligonucleotides of the invention with a nucleic acid encoding ESM-1 can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide or any other suitable detection means. Kits using such detection means for detecting the level of ESM-1 in a sample may also be prepared. [0089] The present invention also includes pharmaceutical compositions and formulations, which include the antisense compounds of the invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon
whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration.
[0090] Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves, and the like may also be useful.
[0091] Compositions and formulations for oral administration include powders or granules, suspensions, or solutions in water or non- aqueous media, capsules, sachets, or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids, or binders may be desirable.
[0092] Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions, which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients. [0093] Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome- containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids. [0094] The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be
prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the phannaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
[0095] The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances, which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol, and/or dextran. The suspension may also contain stabilizers.
[0096] In one embodiment of the present invention the pharmaceutical compositions may be formulated and used as foams. Pharmaceutical foams include formulations such as, but not limited to, emulsions, microemulsions, creams, jellies, and liposomes. While basically similar in nature these formulations vary in the components and the consistency of the final product. The preparation of such compositions and formulations is generally known to those skilled in the pharmaceutical and formulation arts and may be applied to the formulation of the compositions of the present invention. Emulsions [0097] The compositions of the present invention may be prepared and formulated as emulsions. Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 μm in diameter. (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., in Remington 's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985, p. 301). Emulsions are often biphasic systems comprising of two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions may be either water-in- oil (w/o) or of the oil-in- water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions may contain additional components in addition to the dispersed phases and the active drug, which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants may also be present in emulsions as needed. Phannaceutical emulsions may also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in- water-in-oil (o/w/o) and water-in-oil-in- water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous provides an o/w/o emulsion.
[0098] Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion may be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that may be incorporated into either phase of the emulsion. Emulsifiers may
broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (Idson, in Pharmaceutical Dosaqe Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
[0099] Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Liebemian, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants may be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic, and amphoteric (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume l, p. 285).
[00100] Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin, and acacia. Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, non- swelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.
[00101] A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives, and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume l, p. 199). [00102] Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed phase droplets and by increasing the viscosity of the external phase. [00103] Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols, and phosphatides that may readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. Antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin. [00104] The application of emulsion formulations via dermatological, oral, and parenteral routes and methods for their manufacture have been
reviewed in the literature (Idson, in Pharmaceutical Dosage Forms, Liebemian, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for oral delivery have been very widely used because of reasons of ease of formulation, efficacy from an absorption and bioavailability standpoint. (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral-oil base laxatives, oil-soluble vitamins, and high fat nutritive preparations are among the materials that have commonly been administered orally as o/w emulsions. [00105] In one embodiment of the present invention, the compositions of oligonucleotides and nucleic acids are formulated as microemulsions. A microemulsion may be defined as a system of water, oil, and amphiphile, which is a single optically isotropic, and thermodynamically stable liquid solution (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface- active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 1852-5). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant, and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in- water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails
of the surfactant molecules (Schott, in Remington 's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985, p. 271). [00106] The phenomenological approach utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (Rosoff, in Pharmaceutical Dosage Forms, Liebemian, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously. [00107] Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (S0750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1 -butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drag, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and triglycerides, polyoxyethylated glyceryl fatty
acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil. [00108] Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (Constantinides et al., PΛαr αce--ttc /Re5,eαre/7, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol, 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form spontaneously when their components are brought together at ambient temperature. This may be particularly advantageous when formulating thermolabile drugs, peptides, or oligonucleotides. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of oligonucleotides and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of oligonucleotides and nucleic acids within the gastrointestinal tract, vagina, buccal cavity and other areas of administration. [00109] Microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the oligonucleotides and nucleic acids of the present invention. Penetration enhancers used in the microemulsions of the present invention may be classified as belonging to one of five broad categories - surfactants, fatty acids, bile
salts, chelating agents, and non-chelating non-surfactants (Lee et al.,
Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92).
Each of these classes has been discussed above.
[00110] Liposomes [00111] There are many organized surfactant structures besides microemulsions that have been studied and used for the formulation of drugs. These include monolayers, micelles, bilayers, and vesicles.
Vesicles, such as liposomes, have attracted great interest because of their specificity and the duration of action they offer from the standpoint of drag delivery. As used in the present invention, the term "liposome" means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers.
[00112] Liposomes are unilamellar or multilamellar vesicles which have a membrane fornied from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered.
Cationic liposomes possess the advantage of being able to fuse to the cell wall. Noncationic liposomes, although not able to fuse as efficiently with the cell wall, are taken up by macrophages in vivo.
[00113] In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome, which is highly deformable and able to pass through such fine pores.
[00114] Further advantages of liposomes include; liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drags; liposomes can protect encapsulated drugs in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, P. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size, and the aqueous volume of the liposomes.
[00115] Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes. As the merging of the liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act.
[00116] Liposomal formulations have been the focus of extensive investigation as the mode of delivery for many drags. There is growing evidence that for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side-effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of drags, both hydrophilic and hydrophobic, into the skin.
[00117] Several reports have detailed the ability of liposomes to deliver agents including high-molecular weight DNA into the skin. Compounds including analgesics, antibodies, hormones, and high- molecular weight DNAs have been administered to the skin. The majority of applications resulted in the targeting of the upper epidermis. [00118] Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes, which interact with the negatively charged DNA molecules to form a stable complex. The positively charged DNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are raptured, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980 - 985) [00119] Liposomes, which are pH-sensitive or negatively charged, entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some DNA is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to
deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al, Journal of Controlled Release, 1992, 19, 269-274). [00120] One major type of liposomal composition includes phospholipids other than naturally derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol. [00121] Several studies have assessed the topical delivery of liposomal drag formulations to the skin. Application of liposomes containing interferon to guinea pig skin resulted in a reduction of skin herpes sores while delivery of interferon via other means (e.g. as a solution or as an emulsion) was ineffective (Weiner et al., Journal of Drug Targeting, 1992, 2, 405-410). Further, an additional study tested the efficacy of interferon administered as part of a liposomal formulation to the administration of interferon using an aqueous system, and concluded that the liposomal formulation was superior to aqueous administration (du Plessis et al., Antiviral Research, 1992, 18, 259-265). [00122] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drags to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasome ™ I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome™ II (glyceryl distearate/ cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective
in facilitating the deposition of cyclosporin-A into different layers of the skin (Hu et al. S.T.P.Pharma. Sci., 1994, 4, 6, 466). [00123] Liposomes also include "sterically stabilized" liposomes, a term, which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such, specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside GMI, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG- derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al, Cancer Research, 1993, 53, 3765). [00124] Various liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. NY. Acad. Sci., 1987, 507, 64) reported the ability of monosialoganglioside GM1, galactocerebroside sulfate, and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., 1988, 85, 6949). U.S. Patent No. 4,837,028 and WO 88/04924, both to Allen et al., disclose liposomes comprising (1) sphingomyelin and (2) the ganglioside Gjor a galactocerebroside sulfate ester. U.S. Patent No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al.). [00125] Many liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of preparation thereof, are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2C1215G,
which contains a PEG moiety. Ilium et al. (FEBS Lett., 1984, 167, 79) noted that hydrophilic coating of polystyrene particles with polymeric glycols results in significantly enhanced blood half-lives. Synthetic phospholipids modified by the attachment of carboxylic groups of polyalkylene glycols (e.g., PEG) are described by Sears (U.S. Patent Nos. 4,426,330 and 4,534,899). Klibanov et al. (FEBS Lett., 1990, 268, 235) described experiments demonstrating that liposomes comprising phosphatidylethanolamine (PE) derivatized with PEG or PEG stearate have significant increases in blood circulation half-lives. Blume et al. (Biochimica et Biophysica Acta, 1990, 1029, 91) extended such observations to other PEG derivatized phospholipids, e.g., DSPE-PEG, formed from the combination of distearoylphosphatidylethanolamine (DSPE) and PEG. Liposomes having covalently bound PEG moieties on their external surface are described in European Patent No. EP 0 445 131 Bl and WO 90/04384 to Fisher. Liposome compositions containing 1-20 mole percent of PE derivatized with PEG, and methods of use thereof, are described by Woodle et al. (U.S. Patent Nos. 5,013,556 and 5,356,633) and Martin et al. (U.S. Patent No. 5,213,804 and European Patent No. EP 0 496 813 Bl). Liposomes comprising a number of other lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Patent No. 5,225,212 (both to Martin et al.) and in WO 94/20073 (Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids are described in WO 96/10391 (Choi et al.). U.S. Patent Nos. 5,540,935 (Miyazaki et al.) and 5,556,948 (Tagawa et al.) describe PEG-containing liposomes that can be further derivatized with functional moieties on their surfaces. [00126] A limited number of liposomes comprising nucleic acids are known in the art. WO 96/40062 to Thierry et al. discloses methods for encapsulating high molecular weight nucleic acids in liposomes. U.S. Patent No. 5,264,221 to Tagawa et al. discloses protein-bonded liposomes and asserts that the contents of such liposomes may include an antisense RNA. U.S. Patent No. 5,665,710 to Rahman et al. describes certain methods of encapsulating oligodeoxynucleotides in liposomes.
WO 97/04787 to Love et al. discloses liposomes comprising antisense oligonucleotides targeted to the raf gene.
[00127] Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drag delivery vehicles. Transfersomes may be described as lipid droplets, which are so highly deformable that they are easily able to penetrate through pores that are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g. they are self-optimizing (adaptive to the shape of pores in the skin), self- repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge- activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.
[00128] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285)
[00129] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pham aceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty
alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class. [00130] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.
[00131] If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.
[00132] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines, and phosphatides. [00133] The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285). Penetration Enhancers
[00134] In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids particularly oligonucleotides, to the skin of animals. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drags readily cross cell membranes. It has been discovered that even non-lipophilic drugs may cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-
lipophilic drags across cell membranes, penetration enhancers also enhance the permeability of lipophilic drags.
[00135] Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating nonsurfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each of the above mentioned classes of penetration enhancers are described below in greater detail. [00136] Surfactants: In connection with the present invention, surfactants (or "surface-active agents") are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of oligonucleotides through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol, 1988, 40, 252). [00137] Fatty acids: Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1- monooleoyl-.rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1 -monocaprate, l-dodecylazacycloheptan-2-one, acylcamitines, acylcholines, Crlo alkyl esters thereof (e.g., methyl, isopropyl and t- butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al, J. Pharm. Pharmacol, 1992, 44, 651-654). [00138] Bile salts: The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat-soluble
vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds. McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. The bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxy cholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro- 24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate'and polyoxyethylene-9-lauryl ether (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington 's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).
[00139] Chelating Agents: Chelating agents, as used in connection with the present invention, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of oligonucleotides through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Chelating agents of the invention include but are not limited to disodium. ethylenediaminetetraacetate (EDTA), citric acid, salicylates
(e.g., sodium salicylate, 5 -methoxy salicylate and homovanilate), N-acyl derivatives of collagen, laureth-9, and N-amino acyl derivatives of beta- diketones (enamines)(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel, 1990, 14, 43-51).
[00140] Non-chelating non-surfactants: As used herein, nonchelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of oligonucleotides through the alimentary mucosa (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers includes, for example, unsaturated cyclic ureas, 1 -alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non- steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin, and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol, 1987, 39, 621-626). [00141] Agents that enhance uptake of oligonucleotides at the cellular level may also be added to the phannaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Patent No. 5,705,188), cationic glycerol derivatives, and poly cationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of oligonucleotides.
[00142] Other agents may be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone. Carriers
[00143] Certain compositions of the present invention also incorporate carrier compounds in the formulation. As used herein, "carrier compound" or "carrier" can refer to a nucleic acid, or analog
thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate oligonucleotide in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4ϊsothiocyano-stilbene-2,2'disulfonic acid (Miyao et al., Antisense Res. Dev., 1995, 5, 115-121; Takakura et al., Antisense & Nucl. Acid Drug Dev., 1996, 6, 177-183). Excipients
[00144] In contrast to a carrier compound, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, com starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc.).
[00145] Pharmaceutically acceptable organic or inorganic excipient suitable for non-parenteral administration, which does not deleteriously react with nucleic acids, can also be used to formulate the compositions of the present invention. Suitable phannaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like. [00146] Formulations for topical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions may also contain buffers, diluents, and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration, which do not deleteriously react with nucleic acids, can be used.
[00147] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like. Other Components
[00148] The compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipraritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forn s of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized
and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
[00149] Aqueous suspensions may contain substances, which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol, and/or dextran. The suspension may also contain stabilizers. [00150] Certain embodiments of the invention provide pharmaceutical compositions containing (a) one or more antisense compounds and (b) one or more other chemotherapeutic agents which function by a non-antisense mechanism. Examples of such chemotherapeutic agents include, but are not limited to, anticancer drugs such as daunorabicin, dactinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard, chlorambucil, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine (CA), 5-fluorouracil (5-FU), floxuridine (5-FUdR), methotrexate (MTX), colchicine, vincristine, vinblastine, etoposide, teniposide, cisplatin and diethylstilbestrol (DES). See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al., eds., 1987, Rahway, N.J., pages 1206-1228). Anti-inflammatory drugs, including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al., eds., 1987, Rahway, NJ., pages 2499-2506 and 46-49, respectively), other non-antisense chemotherapeutic agents are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.
[00151] In another related embodiment, compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more
additional antisense compounds targeted to a second nucleic acid target. Numerous examples of antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially. [00152] The formulation of therapeutic compositions and their subsequent administration is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drag accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC 0s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 μg to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 μg to 100 g per kg of body weight, once or more daily, to once every 20 years. [00153] While the present invention has been described with specificity in accordance with certain of its preferred embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same.
EXAMPLES
Example 1
Nucleoside Phosphoramidites for Oligonucleotide Synthesis Deoxy and 2 '-alkoxy amidites
[00154] 2 '-Deoxy and 2 '-methoxy beta-cyanoethyldiisopropyl phosphoramidites are available from commercial sources (e.g. Chemgenes, Needham MA or Glen Research, Inc. Sterling VA). Other 2'-O-alkoxy substituted nucleoside amidites are prepared as described in U.S. Patent 5,506,351 , herein incorporated by reference. For oligonucleotides synthesized using 2 '-alkoxy amidites, the standard cycle for unmodified oligonucleotides is utilized, except the wait step after pulse delivery of tetrazole and base is increased to 360 seconds. [00155] Oligonucleotides containing 5-methyl-2'-deoxycytidine (5- Me-C) nucleotides are synthesized according to published methods [Sanghvi, et. al., Nucleic Acids Research, 1993, 21, 3197-3203] using commercially available phosphoramidites (Glen Research, Sterling VA or ChemGenes, Needham MA). 2 '-Fluoro amidites 2'-Fluorodeoxyadenosine amidites
[00156] 2'-fluoro oligonucleotides are synthesized as described previously [Kawasaki, et. al., J. Med. Chem., 1993, 36, 831-841] and United States patent 5,670,633, herein incorporated by reference. Briefly, the protected nucleoside N6-benzoyl-2'-deoxy-2'- fluoroadenosine is synthesized utilizing commercially available 9-beta- D-arabinofuranosyladenine as starting material and by modifying literature procedures whereby the 2'-alpha- fluoro atom is introduced by a S^-displacement of a 2'-beta-trityl group. Thus N6-benzoyl-9-beta- D-arabinofuranosyladenine is selectively protected in moderate yield as the 3',5'-ditetrahydropyranyl (THP) intermediate. Deprotection of the THP and N6-benzoyl groups is accomplished using standard methodologies and standard methods are used to obtain the 5'- dimethoxytrityl-(DMT) and 5'-DMT-3'-phosphoramidite intermediates. 2'-FIuorodeoxyguanosine [00157] The synthesis of 2'-deoxy-2'-fluoroguanosine is accomplished using tetraisopropyldisiloxanyl (TPDS) protected 9-beta- D-arabinofuranosylguanine as starting material, and conversion to the intermediate diisobutyrylarabinofuranosylguanosine. Deprotection of the
TPDS group is followed by protection of the hydroxyl group with THP to give diisobutyryl di-THP protected arabinofuranosylguanine.
Selective O-deacylation and triflation is followed by treatment of the crude product with fluoride, then deprotection of the THP groups. Standard methodologies are used to obtain the 5 '-DMT- and 5 '-DMT-
3 '-phosphoramidites.
2'-Fluorouridine
[00158] Synthesis of 2'-deoxy-2'-fluorouridine is accomplished by the modification of a literature procedure in which 2,2'anhydro-l-beta- D-arabinofuranosyluracil is treated with 70% hydrogen fluoride- pyridine. Standard procedures are used to obtain the 5'-DMT and 5'-
DMT-3'-phosphoramidites.
2'-Fluorodeoxycytidine
[00159] 2'-deoxy-2'-fluorocytidine is synthesized via amination of 2'-deoxy-2'-fluorouridine, followed by selective protection to give N4- benzoyl-2'-deoxy-2'-fluorocytidine. Standard procedures are used to obtain the 5'-DMT and 5 '-DMT-3 'phosphoramidites.
2'-O-(2-Methoxyethyl) modified amidites
[00160] 2'-O-Methoxyethyl-substituted nucleoside amidites are prepared as follows, or alternatively, as per the methods of Martin, P.,
Helvetica Chimica Acta, 1995, 78, 486-504.
2,2 '- Anhydro [l-(beta-D-arabinofuranosyl)-5-methyluridinel
[00161] 5-Methyluridine (ribosylthymine, commercially available through Yamasa, Choshi, Japan) (72.0 g, 0.279 M), diphenylcarbonate (90.0 g, 0.420 M) and sodium bicarbonate (2.0 g, 0.024 M) are added to
DMF (300 mL). The mixture is heated to reflux, with stirring, allowing the evolved carbon dioxide gas to be released in a controlled manner.
After 1 hour, the slightly darkened solution is concentrated under reduced pressure. The resulting syrup is poured into diethylether (2.5 L), with stirring. The product formed a gum. The ether is decanted and the residue is dissolved in a minimum amount of methanol (ca. 400 mL).
The solution is poured into fresh ether (2.5 L) to yield a stiff gum. The ether is decanted and the gum is dried in a vacuum oven (60°C at 1 mm
Hg for 24 h) to give a solid that is crushed to a light tan powder. The material is used as is for further reactions (or it can be purified further by column chromatography using a gradient of methanol in ethyl acetate (10-25%) to give a white solid. 2 '-O-MethoxyethyI-5-methyluridine
[00162] 2,2'-Anliydro-5-methyluridine (195 g, 0.81 M), tris(2- methoxyethyl)borate (231 g, 0.98 M) and 2-methoxyethanol (1.2 L) are added to a 2 L stainless steel pressure vessel and placed in a pre-heated oil bath at 160°C. After heating for 48 hours at 155-160°C, the vessel is opened and the solution evaporated to dryness and triturated with MeOH (200 mL). The residue is suspended in hot acetone (1 L). The insoluble salts are filtered, washed with acetone (150 mL) and the filtrate evaporated. The residue (280 g) is dissolved in CH3CN (600 mL) and evaporated. A silica gel column (3 kg) is packed in CH2C12 /acetone /MeOH (20:5 :3) containing 0.5% Et3NH. The residue is dissolved in CH C12 (250 mL) and adsorbed onto silica (150 g) prior to loading onto the column. The product is eluted with the packing solvent to give the title product. Additional material can be obtained by reworking impure fractions. 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-mefhyIuridine
[00163] 2'-O-Methoxyethyl-5-methyluridine (160 g, 0.506 M) is co- evaporated with pyridine (250 mL) and the dried residue dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) is added and the mixture stirred at room temperature for one hour. A second aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) is added and the reaction stirred for an additional one hour. Methanol (170 mL) is then added to stop the reaction. The solvent is evaporated and triturated with CH3CN (200 mL) The residue is dissolved in CHC1 (1.5 L) and extracted with 2x500 mL of saturated NaHCO3 and 2x500 mL of saturated NaCl. The organic phase is dried over Na2SO4, filtered, and evaporated. The residue is purified on a 3.5 kg silica gel column, packed and eluted with EtOAc/hexane/ acetone (5:5:1) containing 0-5% Et3NH. The pure fractions are evaporated to give the title product.
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5- methyluridine
[00164] 2'-O-Methoxyethyl-5 '-O-dimethoxytrityl-5-methyluridine (106 g, 0.167 M), DMF/pyridine (750 mL of a 3:1 mixture prepared from 562 mL of DMF and 188 mL of pyridine) and acetic anhydride (24.38 mL, 0.258 M) are combined and stirred at room temperature for 24 hours. The reaction is monitored by TLC by first quenching the TLC sample with the addition of MeOH. Upon completion of the reaction, as judged by TLC, MeOH (50 mL) is added and the mixture evaporated at 35°C. The residue is dissolved in CHC13 (800 mL) and extracted with 2x200 mL of saturated sodium bicarbonate and 2x200 mL of saturated NaCl. The water layers are back extracted with 200 mL of CHC13. The combined organics are dried with sodium sulfate and evaporated to a residue. The residue is purified on a 3.5 kg silica gel column and eluted using EtOAc/hexane(4:l). Pure product fractions are evaporated to yield the title compounds.
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4- triazoleuridine [00165] A first solution is prepared by dissolving 3'-O-acetyl-2'-O- methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in CH3CN (700 mL) and set aside. Triethylamine (189 mL, 1.44 M) is added to a solution of triazole (90 g, 1.3 M) in CH3CN (1 L), cooled to - 5°C and stirred for 0.5 h using an overhead stirrer. POCl3 is added dropwise, over a 30 minute period, to the stirred solution maintained at 0-10°C, and the resulting mixture stirred for an additional 2 hours. The first solution is added dropwise, over a 45 minute period, to the latter solution. The resulting reaction mixture is stored overnight in a cold room. Salts are filtered from the reaction mixture and the solution is evaporated. The residue is dissolved in EtOAc (1 L) and the insoluble solids are removed by filtration. The filtrate is washed with 1x300 mL of NaHCO3 and 2x300 mL of saturated NaCl, dried over sodium sulfate and evaporated. The residue is triturated with EtOAc to give the title compound.
2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine [00166] A solution of 3'-O-acetyl-2'-O-methoxyethyl-5'-O- dimethoxytrityl-5-methyl-4-triazoleuridine (103 g, 0.141 M) in dioxane (500 mL) and NH OH (30 mL) is stirred at room temperature for 2 hours. The dioxane solution is evaporated and the residue azeotroped with MeOH (2x200 mL). The residue is dissolved in MeOH (300 mL) and transferred to a 2-liter stainless steel pressure vessel. MeOH (400 mL) saturated with NH3 gas is added and the vessel heated to 100°C for 2 hours (TLC showed complete conversion). The vessel contents are evaporated to dryness and the residue is dissolved in EtOAc (500 mL) and washed once with saturated NaCl (200 mL). The organics are dried over sodium sulfate and the solvent is evaporated to give the title compound. N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5- methylcytidine
[00167] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (85 g, 0.134 M) is dissolved in DMF (800 mL) and benzoic anhydride (37.2 g, 0.165 M) is added with stirring. After stirring for 3 hours, TLC showed the reaction to be approximately 95% complete. The solvent is evaporated and the residue azeotroped with MeOH (200 mL). The residue is dissolved in CHCI3 (700 mL) and extracted with saturated NaHCO, (2x300 mL) and saturated NaCl (2x300 mL) , dried over MgSO and evaporated to give a residue. The residue is chromatographed on a 1.5 kg silica column using EtOAc/hexane (1 :1) containing 0-5% E13NH as the eluting solvent. The pure product fractions are evaporated to give the title compound. N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5- methylcytidine-3'-amidite [00168] N4-Benzoyl-2'-O-methoxyethyl-5 '-O-dimethoxytrityl-5- methylcytidine (74 g, 0.10 M) is dissolved in CH2C12 (1 L) Tetrazole diisopropylamine (7.1 g) and 2-cyanoethoxy-tetra(isopropyl)phosphite (40.5 mL, 0.123 M) are added with stirring, under a nitrogen atmosphere. The resulting mixture is stirred for 20 hours at room
temperature (TLC showed the reaction to be 95% complete). The reaction mixture is extracted with saturated NaHCU3 (1x300 mL) and saturated NaCl (3x300 mL). The aqueous washes are back-extracted with CH2CI2 (300 mL), and the extracts are combined, dried over MgSO > and concentrated. The residue obtained is chromatographed on a 1.5 kg silica column using EtOAc/hexane (3:1) as the eluting solvent. The pure fractions were combined to give the title compound. 2'-O-(Aminooxyethyl) nucleoside amidites and 2'-O- (dimethylaminooxyethyl) nucleoside amidites 2'-(Dimethylaminooxyethoxy) nucleoside amidites
[00169] 2'-(Dimethylaminooxyethoxy) nucleoside amidites [also known in the art as 2'-O-(dimethylaminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs. Adenosine, cytidine and guanosine nucleoside amidites are prepared similarly to the thymidine (5-methyluridine) except the exocyclic amines are protected with a benzoyl moiety in the case of adenosine and cytidine and with isobutyryl in the case of guanosine.
5'-O-tert-Butyldiphenylsilyl -O2 -2'-anhydro-5-mefhyluridine [00170] O2 -2'-anhydro-5-methyluridine (Pro. Bio. Sint., Varese, Italy, lOO.Og, 0.4'6 mmol), dimethylaminopyridine (0.66g, 0.013eq, 0.0054mmol) are dissolved in dry pyridine (500 ml) at ambient temperature under an argon atmosphere and with mechanical stirring. tert-Butyldiphenylchlorosilane (125.8g, 119.0mL, l.leq, 0.458mmol) is added in one portion. The reaction is stirred for 16 h at ambient temperature. TLC (Rf 0.22, ethyl acetate) indicated a complete reaction. The solution is concentrated under reduced pressure to a thick oil. This is partitioned between dichloromethane (1 L) and saturated sodium bicarbonate (2x1 L) and brine (1 L). The organic layer is dried over sodium sulfate and concentrated under reduced pressure to a thick oil. The oil is dissolved in a 1 : 1 mixture of ethyl acetate and ethyl ether (600mL) and the solution is cooled to -10°C. The resulting crystalline product is collected by filtration, washed with ethyl ether (3x200 mL), and dried (40°C, 1mm Hg, 24 h) to a white solid
5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-methyluridine
[00171] In a 2 L stainless steel, unstirred pressure reactor is added borane in tetrahydrofuran (1.0 M, 2.0 eq, 622 mL). In the fume hood and with manual stirring, ethylene glycol (350 mL, excess) is added cautiously at first until the evolution of hydrogen gas subsides. 5 '-O- tert-Butyldiphenylsilyl-O2-2'anhydro-5-methyluridine (149 g, 0.3'1 mol) and sodium bicarbonate (0.074 g, 0.003 eq) are added with manual stirring. The reactor is sealed and heated in an oil bath until an internal temperature of 160°C is reached and then maintained for 16 h (pressure < 100 psig). The reaction vessel is cooled to ambient and opened. TLC (Rf 0.67 for desired product and Rf 0.82 for ara-T side product, ethyl acetate) indicated about 70% conversion to the product. In order to avoid additional side product formation, the reaction is stopped, concentrated under reduced pressure (10 to 1mm, Hg) in a warm water bath (40- 100 °C) with the more extreme conditions used to remove the ethylene glycol. [Alternatively, once the low boiling solvent is gone, the remaining solution can be partitioned between ethyl acetate and water. The product will be in the organic phase.] The residue is purified by column cliromatography (2kg silica gel, ethyl acetate-hexanes gradient 1 : 1 to 4: 1). The appropriate fractions are combined, stripped, and dried to product as a white crisp foam, contaminated starting material, and pure reusable starting material.
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyIdiphenylsilyl-5- methyluridine [00172] 5 '-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)'-5- methyluridine (20g, 36.98mmol) is mixed with triphenylphosphine (11.63g, 44.36mmol) and N-hydroxyphthalimide (7.24g, 44.36mmol). It is then dried over P2O5 under high vacuum for two days at 40°C. The reaction mixture is flushed with argon and dry THF (369.8mL, Aldrich, sure seal bottle) is added to get a clear solution. Diethyl- azodicarboxylate (6.98mL, 44.36mmol) is added dropwise to the reaction mixture. The rate of addition is maintained such that resulting deep red coloration is just discharged before adding the next drop. After
the addition is complete, the reaction is stirred for 4 hrs. By that time TLC showed the completion of the reaction (ethylacetate:hexane, 60:40). The solvent is evaporated in vacuum. Residue obtained is placed on a flash column and eluted with ethyl acetate:hexane (60:40), to get 2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridine as white foam.
5'-O-tert-butyldiphenylsilyI-2'-O-[(2-formadoximinooxy)ethyl]-5- methyluridine [00173] 2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5- methyluridine (3.1g, 4.5mmol) is dissolved in dry CH2CI2 (4.5mL) and methylhydrazine (300mL, 4.64mmol) is added dropwise at-10°C to 0°C. After 1 h the mixture is filtered, the filtrate is washed with ice cold CH2CI2 and the combined organic phase is washed with water, brine and dried over anhydrous a2SO4. The solution is concentrated to get 2'- O(aminooxyethyl) thymidine, which is then dissolved in MeOH
(67.5mL). To this formaldehyde (20% aqueous solution, w/w, 1.1 eq.) is added and the resulting mixture is stirred for 1 h. Solvent is removed under vacuum; residue chromatographed to get 5'-O-tert- butyldiphenylsilyl-2'-O-[(2-formadoximinooxy) ethyl]-5-methyluridine as white foam.
5'-O-tert-Butyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5- methyluridine
[00174] 5 '-O-tert-butyldiphenylsilyl-2'-O-[(2- formadoximinooxy)ethyl]-5-methyluridine (1.77g, 3.12mmol) is dissolved in a solution of IM pyridinium p-toluenesulfonate (PPTS) in dry MeOH (30.6mL). Sodium cyanoborohydride (0.39g, 6.13mmol) is added to this solution at 10°C under inert atmosphere. The reaction mixture is stirred for 10 minutes at 10°C. After that the reaction vessel is removed from the ice bath and stirred at room temperature for 2 h, the reaction monitored by TLC (5% MeOH in CH2C12). Aqueous NaHCO3 solution (5%, lOmL) is added and extracted with ethyl acetate (2x2 OmL). Ethyl acetate phase is dried over anhydrous Na2SO4, evaporated to dryness. Residue is dissolved in a solution of IM PPTS in
MeOH (30.6mL). Formaldehyde (20% w/w, 30mL, 3.37mmol) is added and the reaction mixture is stirred at room temperature for 10 minutes. Reaction mixture cooled to 10°C in an ice bath, sodium cyanoborohydride (0.39g, 6.13mmol) is added, and reaction mixture stirred at 10°C for 10 minutes. After 10 minutes, the reaction mixture is removed from the ice bath and stirred at room temperature for 2 hrs. To the reaction mixture 5% NaHCO3 (25mL) solution is added and extracted with ethyl acetate (2x25mL). Ethyl acetate layer is dried over anhydrous Na2SO and evaporated to dryness. The residue obtained is purified by flash column chromatography and eluted with 5% MeOH in CH2C12 to get 5'-O-tertbutyldiphenylsilyl-2'-O-[N,N- dimethylaminooxyethyl]-5- methyluridine as a white foam. 2'-O-(dimethylaminooxyethyl)-5-methyluridine [00175] Triethylamine trihydrofluoride (3.91mL, 24.0mmol) is dissolved in dry THF and triethylamine (1.67mL, 12mmol, dry, kept over KOH). This mixture of triethylamine-2HF is then added to 5'-O- tert-butyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5- methyluridine (1.40g, 2.4mmol) and stirred at room temperature for 24 hrs. Reaction is monitored by TLC (5% MeOH in CH2C12). Solvent is removed under vacuum and the residue placed on a flash column and eluted with 10% MeOH in CH2C12 to get 2'-O- (dimethylaminooxyethyl)-5-methyluridine. 5 '-O-DMT-2 '-O-(dimethylaminooxyethyl)-5-methyluridine [00176] 2'-O-(dimethylaminooxyethyl)-5-methyluridine (750mg, 2.17mmol) is dried over P2O under high vacuum overnight at 40°C. It is then co-evaporated with anhydrous pyridine (20mL). The residue obtained is dissolved in pyridine (1 lmL) under argon atmosphere. 4- dimethylaminopyridine (26.5mg, 2.60mmol), 4,4 '-dimethoxytrityl chloride (880mg, 2.60mmol) is added to the mixture and the reaction mixture is stirred at room temperature until all of the starting material disappeared. Pyridine is removed under vacuum and the residue chromatographed and eluted with 10% MeOH in CH2C12 (containing a
few drops of pyridine) to get 5'-O-DMT-2'-0(dimethylammo-oxyethyi)- 5 -methyluridine.
5'-O-DMT-2'-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine- 3 '-[(2-cyanoethyI)-N,N- diisopropylphosphoramidite] [00177] 5 '-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine (1.08g, 1.67mmol) is co-evaporated with toluene (20mL). To the residue N,N-diisopropylamine tetrazonide (0.29g, 1.67mmol) is added and dried over P20, under high vacuum overnight at 40°C. Then the reaction mixture is dissolved in anhydrous acetonitrile (8.4mL) and 2- cyanoethyl-NjNjN^N'-tetraisopropylphosphoramidite (2.12mL, 6.08mmol) is added. The reaction mixture is stirred at ambient temperature for 4 hrs under inert atmosphere. The progress of the reaction is monitored by TLC (hexane: ethyl acetate 1 :1). The solvent is evaporated, then the residue is dissolved in ethyl acetate (70mL) and washed with 5% aqueous NaHCO3 (40mL). Ethyl acetate layer is dried over anhydrous Na2SO and concentrated. Residue obtained is chromatographed (ethyl acetate as eluent) to get 5'-O-DMT-2'-O-(2- N,N-dimethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoethyl)-N,N- diisopropylphosphoramidite] as a foam. 2'-(Aminooxyethoxy) nucleoside amidites
[00178] 2 '-(Aminooxy ethoxy) nucleoside amidites [also known in the art as 2'-O-(aminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs. Adenosine, cytidine and thymidine nucleoside amidites are prepared similarly. N2-isobutyryl-6-O-diphenylcarbamoyI-2'-O-(2-ethylacetyl)-5'-O- (4,4'-dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N- diisopropylphosphoramidite]
[00179] The 2'-O-aminooxyethyl guanosine analog may be obtained by selective 2'-O-alkylation of diaminopurine riboside. Multigram quantities of diaminopurine riboside may be purchased from Schering AG (Berlin) to provide 2'-O-(2-ethylacetyl) diaminopurine riboside along with a minor amount of the 3'-O-isomer. 2'-O-(2-ethylacetyl) diaminopurine riboside may be resolved and converted to 2'~O-
(2ethylacetyl)guanosine by treatment with adenosine deaminase. (McGee, D. P. C, Cook, P. D., Guinosso, C. J., WO 94/02501 Al 940203.) Standard protection procedures should afford 2'-O-(2- ethylacetyl)-5 '-O-(4,4'-dimethoxytrityl)guanosine and 2-N-isobutyryl-6- O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'- dimethoxytrityl)guanosine which may be reduced to provide 2-N- isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'- dimethoxytrityl)guanosine. As before the hydroxyl group may be displaced by N-hydroxyphthalimide via a Mitsunobu reaction, and the protected nucleoside may phosphitylated as usual to yield 2-N- isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'- dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N- diisopropylphosphoramiditel.
2'-dimethylaminoethoxyethoxy (2'-DMAEOE) nucleoside amidites [00180] 2'-dimethylaminoethoxyethoxy nucleoside amidites (also known in the art as 2'-O-dimethylaminoethoxyethyl, i.e., 2'O-CH2-O- CH2-N(CH2)2, or 2'-DMAEOE nucleoside amidites) are prepared as follows. Other nucleoside amidites are prepared similarly. 2 '-O- [2(2-N,N-dimethylaminoethoxy)ethyl] -5-methyl uridine [00181] 2[2-(Dimethylamino)ethoxylethanol (Aldrich, 6.66 g, 50 mmol) is slowly added to a solution of borane in tetrahydrofuran (1 M, 10 mL, 10 mmol) with stirring in a 100 mL bomb. Hydrogen gas evolves as the solid dissolves. O2-, 2' - anhydro-5-methyluridine (1.2 g, 5 mmol), and sodium bicarbonate (2.5 mg) are added and the bomb is sealed, placed in an oil bath, and heated to 155°C for 26 hours. The bomb is cooled to room temperature and opened. The crude solution is concentrated and the residue partitioned between water (200 mL) and hexanes (200 mL). The excess phenol is extracted into the hexane layer. The aqueous layer is extracted with ethyl acetate (3x200 mL) and the combined organic layers are washed once with water, dried over anhydrous sodium sulfate, and concentrated. The residue is columned on silica gel using methanol/methylene chloride 1 :20 (which has 2% triethylamine) as the eluent. As the column fractions are concentrated a
colorless solid forms which is collected to give the title compound as a white solid.
5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethyIaminoethoxy) ethyl)]- 5-methyl uridine [00182] To 0.5 g (1.3 mmol) of 2'-O-[2(2-N,N- dimethylaminoethoxy)ethyl)l-5-methyl uridine in anhydrous pyridine (8 mL), triethylamine (0.36 mL) and dimethoxytrityl chloride (DMT-C1, 0.87 g, 2 eq.) are added and stirred for 1 hour. The reaction mixture is poured into water (200 mL) and extracted with CH2C12 (2x200 mL). The combined CH2CI2 layers are washed with saturated NaHCO solution, followed by saturated NaCl solution, and dried over anhydrous sodium sulfate. Evaporation of the solvent followed by silica gel chromatography using MeOH: CH2Cl2:Et3N (20:1, v/v, with 1% triethylamine) gives the title compound. 5'-O-Dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)ethyI)]- 5-m ethyl uridine-3 '-O-(cyanoethyl-N,N- diisopropyl)phosphoramidite
[00183] Diisopropylaminotetrazolide (0.6 g) and 2-cyanoethoxyN,N- diisopropyl phosphoramidite (1.1 mL, 2 eq.) are added to a solution of 5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl)]-5- methyluridine (2.17 g, 3 mmol) dissolved in CH2C12 (20 mL) under an atmosphere of argon. The reaction mixture is stirred overnight and the solvent evaporated. The resulting residue is purified by silica gel flash column chromatography with ethyl acetate as the eluent to give the title compound.
Example 2
Oligonucleotide synthesis
[00184] Unsubstituted and substituted phosphodiester (P=O) oligonucleotides are synthesized on an automated DNA synthesizer (Applied Biosystems model 380B) using standard phosphoramidite chemistry with oxidation by iodine.
[00185] Phosphorothioates (P=S) are synthesized as for the phosphodiester oligonucleotides except the standard oxidation bottle is replaced by 0.2 M solution of 3H-l,2-benzodithiole-3-one 1,1 -dioxide in acetonitrile for the stepwise thiation of the phosphite linkages. The thiation wait step is increased to 68 sec and is followed by the capping step. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55°C (18 h), the oligonucleotides are purified by precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCl solution. Phosphinate oligonucleotides are prepared as described in U.S. Patent 5,508,270, herein incorporated by reference. [00186] Alkyl phosphonate oligonucleotides are prepared as described in U.S. Patent 4,469,863, herein incorporated by reference. [00187] 3 '-Deoxy-3 '-methylene phosphonate oligonucleotides are prepared as described in U.S. Patents 5,610,289 or 5,625,050, herein incorporated by reference.
[00188] Phosphoramidite oligonucleotides are prepared as described in U.S. Patent, 5,256,775 or U.S. Patent 5,366,878, herein incorporated by reference. [00189] Alkylphosphonothioate oligonucleotides are prepared as described in WO 94/17093 and WO 94/02499 herein incorporated by reference.
[00190] 3 '-Deoxy-3 '-amino phosphoramidate oligonucleotides are prepared as described in U.S. Patent 5,476,925, herein incorporated by reference. [00191] Phosphotriester oligonucleotides are prepared as described in U.S. Patent 5,023,243, herein incorporated by reference. [00192] Borano phosphate oligonucleotides are prepared as described in U.S. Patents 5,130,302 and 5,177,198, both herein incorporated by reference.
Example 3 Oligonucleoside Synthesis
[00193] Methylenemethylimino linked oligonucleosides, also identified as MMI linked oligonucleosides, methylenedimethylhydrazo linked oligonucleosides, also identified as MDH linked oligonucleosides, and methylenecarbonylamino linked oligonucleosides, also identified as amide-3 linked oligonucleosides, and methyleneaminocarbonyl linked oligonucleosides, also identified as amide-4 linked oligonucleosides, as well as mixed backbone compounds having, for instance, alternating MMI and P^O or P=S linkages are prepared as described in U.S. Patents 5,378,825; 5,386,023; 5,489,677; 5,602,240; and 5,610,289, all of which are herein incoiporated by reference.
[00194] Formacetal and thioformacetal linked oligonucleosides are prepared as described in U.S. Patents 5,264,562 and 5,264,564, herein incorporated by reference. [00195] Ethylene oxide linked oligonucleosides are prepared as described in U.S. Patent 5,223,618, herein incorporated by reference.
Example 4 PNA Synthesis [00196] Peptide nucleic acids (PNAs) are prepared in accordance with any of the various procedures referred to in Peptide Nucleic Acids (PNA): Synthesis, Properties and Potential Applications, Bioorganic & Medicinal Chemistry, 1996, 4, 523. They may also be prepared in accordance with U.S. Patents 5,539,082; 5,700,922; and 5,719,262, herein incorporated by reference.
Example 5
Synthesis of Chimeric Oligonucleotides [00197] Chimeric oligonucleotides, oligonucleosides, or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the "gap" segment of linked nucleosides is positioned between 5' and 3' "wing" segments of linked nucleosides and a second "open end" type wherein the "gap"
segment is located at either the 3' or the 5' terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as "gapmers" or gapped oligonucleotides. Oligonucleotides of the second type are also known in the art as "hemimers" or "wingmers". 2'-O-Me]-[2'-deoxy]-[2'-O-Me] Chimeric Phosphorothioate Oligonucleotides
[00198] Chimeric oligonucleotides having 2'-O-alkyl phosphorothioate and 2 '-deoxy phosphorothioate oligonucleotide segments are synthesized using an Applied Biosystems automated DNA ' synthesizer Model 380B, as above. Oligonucleotides are synthesized using the automated synthesizer and 2'-deoxy-5'-dimethoxytrityl-3'-O- phosphoramidite for the DNA portion and 5'-dimethoxytrityl-2'-O- methyl-3'-O-phosphoramidite for 5' and 3' wings. The standard synthesis cycle is modified by increasing the wait step after the delivery of tetrazole and base to 600 s repeated four times for RNA and twice for 2'-O-methyl. The fully protected oligonucleotide is cleaved from the support and the phosphate group is deprotected in 3:1 ammonia/ethanol at room temperature overnight then lyophilized to dryness. Treatment in methanolic ammonia for 24 hrs at room temperature is then done to deprotect all bases and sample is again lyophilized to dryness. The pellet is resuspended in IM TBAF in THF for 24 hrs at room temperature to deprotect the 2' positions. The reaction is then quenched with IM TEAA and the sample is then reduced to 1/2 volume by rotovac before being desalted on a G25 size exclusion column. The oligo recovered is then analyzed spectrophotometrically for yield and for purity by capillary electrophoresis and by mass spectrometry. [00199] [2'-O-(2-Methoxyethyl)]--[2'-deoxy]-[2'-O- (Methoxy ethyl)] Chimeric Phosphorothioate Oligonucleotides [00200] [2'-O-(2-methoxyethyl)]~[2'-deoxy]— [-2'-O- (methoxy ethyl)] chimeric phosphorothioate oligonucleotides are prepared as per the procedure above for the 2'-O-methyl chimeric oligonucleotide, with the substitution of phorothioate oligonucleotides
are prepared as per the procedure above for 2'-O-(methoxyethyl) amidites for the 2'-O-methyl amidites. [2'-O-(2-Methoxyefhyl)Phosphodiester]"[2'-deoxy Phosphorothioate]-[2'-O-(2-Methoxyethyl)] Phosphodiester] Chimeric Oligonucleotides
[00201] [2'-O-(2-methoxyethyl phosphodiester] -[2 '-deoxy phosphorothioate]— [2'-O-(methcixyethyl) phosphodiester] chimeric oligonucleotides are prepared as per the above procedure for the 2'-O- methyl chimeric oligonucleotide with the substitution of 2'-O- (methoxyethyl) amidites for the 2'-O-methyl amidites, oxidization with iodine to generate the phosphodiester intemucleotide linkages within the wing portions of the chimeric structures and sulfurization utilizing 3,H- 1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate intemucleotide linkages for the center gap. [00202] Other chimeric oligonucleotides, chimeric oligonucleosides, and mixed chimeric oligonucleotides/oligonucleosides are synthesized according to United States patent 5,623,065, herein incorporated by reference.
Example 6
Oligonucleotide Isolation
[00203] After cleavage from the controlled pore glass column (Applied Biosystems) and deblocking in concentrated ammonium hydroxide at 55°C for 18 hours, the oligonucleotides or oligonucleosides are purified by precipitation twice out of 0.5 M NaCl with 2.5 volumes ethanol. Synthesized oligonucleotides are analyzed by polyacrylamide gel electrophoresis on denaturing gels and judged to be at least 85% full- length material. The relative amounts of phosphorothioate and phosphodiester linkages obtained in synthesis are periodically checked by "P nuclear magnetic resonance spectroscopy, and for some studies oligonucleotides are purified by HPLC, as described by Chiang et al., J. Biol. Chem. 1991, 266, 18162-18171.
Example 7
Oligonucleotide Synthesis - 96 Well Plate Format
[00204] Oligonucleotides are synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a standard 96 well format. Phosphodiester intemucleotide linkages are afforded by oxidation with aqueous iodine. Phosphorothioate intemucleotide linkages are generated by sulfurization utilizing 3, H- 1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard base-protected beta-cyanoethyldiisopropyl phosphoramidites can be purchased from commercial vendors (e.g. PE- Applied Biosystems, Foster City, CA, or Pharmacia, Piscataway, NJ). Non-standard nucleosides are synthesized as per known literature or patented methods. They are utilized as base protected betacyanoethyldiisopropyl phosphoramidites. [00205] Oligonucleotides are cleaved from support and deprotected with concentrated NH OH at elevated temperature (55-60°C) for 12-16 hours and the released product then dried in vacuo. The dried product is then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.
Example 8
Oligonucleotide Analysis - 96 Well Plate Format
[00206] The concentration of oligonucleotide in each well is assessed by dilution of samples and UV absoφtion spectroscopy. The full-length integrity of the individual products is evaluated by capillary electrophoresis (CE) in either the 96 well format (Beckman P/ACE™ MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACE™ 5000, ABI 270). Base and backbone composition is confirmed by mass analysis of the compounds utilizing electrospray-mass spectroscopy. All assay test plates are diluted from the master plate using single and multi-channel robotic pipettors. Plates
are judged to be acceptable if at least 85% of the compounds on the plate are at least 85% full length.
Example 9 Cell culture and oligonucleotide treatment
[00207] The effect of antisense compounds on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. The following 6 cell types are provided for illustrative purposes, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, Ribonuclease protection assays, or RT-PCR. T-24 cells:
[00208] The human transitional cell bladder carcinoma cell line T-24 is obtained from the American Type Culture Collection (ATCC) (Manassas, VA). T-24 cells are routinely cultured in complete McCoy's 5 A basal media (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf seram (Gibco/Life Technologies, Gaithersburg, MD), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells are seeded into 96-well plates (Falcon- Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis.
[00209] For Northern blotting or other analysis, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide. A549 cells:
[00210] The human lung carcinoma cell line A549 can be obtained from the American Type Culture Collection (ATCC) (Manassas, VA). A549 cells are routinely cultured in DMEM basal media (Gibco/Life
Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. NHDF cells:
[00211] Human neonatal dermal fibroblast (NHDF) can be obtained from the Clonetics Coφoration (WalkersviUe MD). NHDFs are routinely maintained in Fibroblast Growth Medium (Clonetics Coφoration, WalkersviUe MD) supplemented as recommended by the supplier. Cells are maintained for up to 10 passages as recommended by the supplier. HEK cells: [00212] Human embryonic keratinocytes (HEK) can be obtained from the Clonetics Coφoration (WalkersviUe MD). HEKs are routinely maintained in Keratinocyte Growth Medium (Clonetics Coφoration, WalkersviUe MD) formulated as recommended by the supplier. Cells are routinely maintained for up to 10 passages as recommended by the supplier. MCF-7 cells:
[00213] The human breast carcinoma cell line MCF-7 is obtained from the American Type Colure Collection (Manassas, VA). MCF-7 cells are routinely cultured in DMEM low glucose (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis. [00214] For Northern blotting or other analyses, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
LA4 cells:
[00215] The mouse lung epithelial cell line LA4 is obtained from the American Type Colure Collection (Manassas, VA). LA4 cells are routinely cultured in F12K medium (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 15% fetal calf seram (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #3872) at a density of 3000- 6000 cells/ well for use in RT-PCR analysis. [00216] For Northern blotting or other analyses, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide. Treatment with antisense compounds:
[00217] When cells reached 80% confluence, they are treated with oligonucleotide. For cells grown in 96-well plates, wells are washed once with 200 μL OPTI-MEM™- 1 reduced-seram medium (Gibco
BRL) and then treated with 130 μL of OPTI-MEM™-l containing 3.75 μg/mL LIPOFECTLN™ (Gibco BRL) and the desired concentration of oligonucleotide. After 4-7 hours of treatment, the medium is replaced with fresh medium. Cells are harvested 16-24 hours after oligonucleotide treatment.
[00218] The concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations.
Example 10
Analysis of oligonucleotide inhibition of ESM-1 expression
[00219] Antisense modulation of ESM-1 expression can be assayed in a variety of ways known in the art. For example, ESM-1 mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Realtime quantitative PCR is presently preferred. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA
isolation are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.1.1-4.2.9 and 4.5.1- 4.5.3, John Wiley & Sons, Inc., 1993. Northern blot analysis is routine in the art and is taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.2.1-4.2.9, John Wiley & Sons, Inc., 1996. Real-time quantitative (PCR) can be conveniently accomplished using the commercially available ABI PRISM™ 7700 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer's instructions. Prior to quantitative PCR analysis, primer-probe sets specific to the target gene being measured are evaluated for their ability to be "multiplexed" with a GAPDH amplification reaction. In multiplexing, both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer- probe sets specific for GAPDH only, target gene only ("single-plexing"), or both (multiplexing). Following PCR amplification, standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples. If both the slope and correlation coefficient of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the primer-probe set specific for that target is deemed as multiplexable. Other methods of PCR are also known in the art. [00220] Protein levels of ESM-1 can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), ELISA or fluorescence-activated cell sorting (FACS). Antibodies directed to ESM-1 can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Coφoration, Birmingham, MI), or can be prepared via conventional antibody generation methods. Methods for preparation of polyclonal antisera are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John
Wiley & Sons, Inc., 1997. Preparation of monoclonal antibodies is taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.4.1 -11.11.5, John Wiley Sons, Inc., 1997. [00221] Immunoprecipitation methods are standard in the art and can be found at, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.110.16.11, John Wiley & Sons, Inc., 1998. Western blot (immunoblot) analysis is standard in the art and can be found at, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1-10.8.21, John Wiley Sons,
Inc., 1997. Enzyme-linked immunosorbent assays (ELISA) are standard in the art and can be found at, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1 - 11.2.22, John Wiley & Sons, Inc., 1991.
Example 11
Poly(A)+ mRNA isolation
[00222] Poly(A)+ mRNA is isolated according to Miura et al., Clin.
Chem., 1996, 42, 1758-1764. Other methods for poly(A)+ mRNA isolation are taught in, for example, Ausubel, F.M. et al., Current
Protocols in Molecular Biology, Volume 1, pp. 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Briefly, for cells grown on 96-well plates, growth medium is removed from the cells and each well is washed with 200 μL cold PBS. 60μL lysis buffer (10 mM Tris-HCI, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) is added to each well, the plate is gently agitated and then incubated at room temperature for five minutes. 55 μL of lysate is transferred to Oligo d(T) coated 96-well plates (AGCT Inc., Irvine CA). Plates are incubated for 60 minutes at room temperature, washed 3 times with 200 μL of wash buffer (10 mM Tris-HCI pH 7.6, 1 mM EDTA, 0.3 M NaCl). After the final wash, the plate is blotted on paper towels to remove excess wash buffer and then air-dried for 5 minutes. 60 pL of elution buffer (5 mM Tris-HCI pH 7.6), preheated to 70°C is added to
each well, the plate is incubated on a 90°C hot plate for 5 minutes, and the eluate is then transferred to a fresh 96-well plate. [00223] Cells grown on 100 mm or other standard plates may be treated similarly, using appropriate volumes of all solutions.
Example 12
Total RNA Isolation
[00224] Total mRNA is isolated using an RNEASY 96™ kit and buffers purchased from Qiagen Inc. (Valencia CA) following the manufacturer's recommended procedures. Briefly, for cells grown on 96- well plates, growth medium is removed from the cells and each well is washed with 200 μL cold PBS. 100 μL Buffer RLT is added to each well and the plate vigorously agitated for 20 seconds. 100 μL of 70% ethanol is then added to each well and the contents mixed by pipetting three times up and down. The samples are then transferred to the
RNEASY 96™ well plate attached to a QIAVAC™ manifold fitted with a waste collection tray and attached to a vacuum source. Vacuum is applied for 15 seconds. 1 mL of Buffer RW1 is added to each well of the
RNEASY 96 plate and the vacuum again applied for 15 seconds. 1 mL of Buffer RPE is then added to each well of the RNEASY 96™ plate and the vacuum applied for a period of 15 seconds. The Buffer RPE wash is then repeated and the vacuum is applied for an additional 10 minutes. The plate is then removed from the QIAVAC™ manifold and blotted dry on paper towels. The plate is then re-attached to the QIAVAC™ manifold fitted with a collection tube rack containing 1.2 mL collection tubes. RNA is then eluted by pipetting 60μL water into each well, incubating one minute, and then applying the vacuum for 30 seconds. The elution step is repeated with an additional 60 μL water. [00225] The repetitive pipetting and elution steps may be automated using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia CA).
Essentially, after lysing of the cells on the culture plate, the plate is transferred to the robot deck where the pipetting, DNase treatment and elution steps are carried out.
Example 13
Real-time Quantitative PCR Analysis of ESM-1 mRNA Levels
[00226] Real-time quantitative reverse transcription polymerase chain reaction experiments show ESM-1 mRNA expression at levels of threefold or higher at the mRNA level in nine out often tumors when compared to the normal tissue (Figure 2). Quantitation of ESM-1 mRNA levels were determined by real-time quantitative PCR using the ABI
PRISM 7700 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time. As opposed to standard PCR, in which amplification products are quantitated after the PCR is completed, products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes. A reporter dye (e.g., JOE, FAM™, or VIC, obtained from either Operon Technologies Inc., Alameda, CA or PE-Applied Biosystems, Foster City, CA) is attached to the 5' end of the probe and a quencher dye (e.g., TAMRA, obtained from either Operon Technologies Inc., Alameda, CA or PE- Applied Biosystems, Foster City, CA) is attached to the 3' end of the probe. When the probe and dyes are intact, reporter dye emission is quenched by the proximity of the 3' quencher dye. During amplification, annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5'-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated. With each cycle, additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the
ABI PRISM 7700 Sequence Detection System. In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.
[00227] PCR reagents were obtained from PE-Applied Biosystems, Foster City, CA. RT-PCR reactions were carried out by adding 25 μL PCR cocktail (lx TAQMAN™ buffer A, 5.5 MM MgCl2, 300 μM each of dATP, dCTP and dGTP, 600 μM of dUTP, 100 nM each of forward primer, reverse primer, and probe, 20 Units RNAse inhibitor, 1.25 Units AMPLITAQ GOLD™, and 12.5 Units MuLV reverse transcriptase) to 96 well plates containing 25 μL poly(A) mRNA solution. The RT reaction was carried out by incubation for 30 minutes at 48°C. Following a 10 minute incubation at 95°C to activate the AMPLITAQ GOLD™, 40 cycles of a two-step PCR protocol were carried out: 95 °C for 15 seconds (denaturation) followed by 60°C for 1.5 minutes (annealing/extension). [00228] Probes and primers to human ESM-1 were designed to hybridize to a human ESM-1 sequence, using published sequence, information (GenBank accession number NM_007036, incoφorated herein as Figure 1. For human ESM-1 the PCR primers were: forward primer: CTGCTTCCCACCAGCAAAG SEQ ID NO : 2001 reverse primer: GCAAGACGCTCTTCATGTTTCC SEQ ID NO : 2002 and the PCR probe is: FAM™- CGACTGGAGAGCCGAGCCGGA SEQ ID NO;2003 -TAMRA where FAM™ (PE-Applied Biosystems, Foster City, CA) is the fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quencher dye. For human cyclophilin the PCR primers were: forward primer: CCCACCGTGTTCTTCGACAT SEQ ID NO : 2004 reverse primer: TTTCTGCTGTCTTTGGGACCTT SEQ ID NO : 2005 and the PCR probe is: 5' JOE- CGCGTCTCCTTTGAGCTGTTTGCA SEQ ID NO : 2006 - TAMRA 3 ' where JOE (PE-Applied Biosystems,
Foster City, CA) is the fluorescent reporter dye) and TAMRA (PE- Applied Biosystems, Foster City, CA) is the quencher dye.
Example 14 Antisense inhibition of human ESM-1 expression by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap
[00229] In accordance with the present invention, a series of oligonucleotides are designed to target different regions of the human ESM-1 RNA, using published sequences (NM_007036, incoφorated herein as Figure 1. The oligonucleotides are shown in Table 1. "Position" indicates the first (5 '-most) nucleotide number on the particular target sequence to which the oligonucleotide binds. The indicated parameters for each oligo were predicted using RNAstracture 3.7 by David H. Mathews, Michael Zuker, and Douglas H. Turner. The parameters are described either as free energy (The energy that is released when a reaction occurs. The more negative the number, the more likely the reaction will occur. All free energy units are in kcal/mol.) or melting temperature (temperature at which two anneal strands of polynucleic acid separate). The higher the temperature, the greater the affinity between the two strands. When designing an antisense oligonucleotide that will bind with high affinity, it is desirable to consider the structure of the target RNA strand and the antisense oligomer. Specifically, for an oligomer to bind tightly (in the table described as 'duplex formation'), it should be complementary to a stretch of target RNA that has little self-structure (in the table the free energy of which is described as 'target structure'). Also, the oligomer should have little self-structure, either intramolecular (in the table the free energy of which is described as 'intramolecular oligo') or bimolecular (in the table the free energy of which is described as
'intermolecular oligo'). Breaking up any self-structure amounts to a binding penalty. All compounds in Table 1 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a
central "gap" region consisting often 2'deoxynucleotides, which is flanked on both sides (5' and 3' directions) by four-nucleotide "wings". The wings are composed of 2 '-methoxyethyl (2'-MOE) nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P=S) 5 throughout the oligonucleotide. Cytidine residues in the 2'-MOE wings are 5-methylcytidines. All cytidine residues are 5-methylcytidines.
TABLE 1
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position .. binding ation Duplex ture oligo oligo
31 GCTCGGCTCTCCAGTCGTGG
SEQ ID Nθ;l -25.9 -31 85.7 -3.4 -1.7 -7.1
32 GGCTCGGCTCTCCAGTCGTG -25.9
SEQ ID NO; 2 -31 85.7 -3.4 -1.7 -9.6
28 CGGCTCTCCAGTCGTGGTCT
SEQ ID NO; 3 -25.7 -30.4 84.9 -3.4 -1.2 -6.1
30 CTCGGCTCTCCAGTCGTGGT
SEQ ID NO; 4 -25.3 -30.4 84.9 -3.4 -1.7 -6.1 923 GCCTAGCTCCCTCTTTGGTT
SEQ ID NO; 5 -25.3 -30.4 85.5 -5.1 0 -6.2
33 CGGCTCGGCTCTCCAGTCGT
SEQ ID NO; 6 -25.1 -31.8 85.2 -4.7 -2 -9.6
27 GGCTCTCCAGTCGTGGTCTT
SEQ ID NO; 7 -25 . -29.7 86.1 -3.4 -1.2 -6.1 928 GCTTTGCCTAGCTCCCTCTT
SEQ ID NO; 8 -24.9 -30.7 85.6 -5.1 -0.4 -6.2
29 TCGGCTCTCCAGTCGTGGTC
SEQ ID NO; 9 -24.8 -29.9 84.8 -3.4 -1.7 -6.1 924 TGCCTAGCTCCCTCTTTGGT
SEQ ID NO; 10 -24.6 -30.3 84.8 -5.1 -0.3 -4.6
26 GCTCTCCAGTCGTGGTCTTT
SEQ ID NO; 11 -24.4 -28.6 83.7 -3.4 -0.6 -5.2 929 AGCTTTGCCTAGCTCCCTCT
SEQ ID NO; 12 -24.2 -30.6 85.6 -5.1 -1.2 -7.7 930 CAGCTTTGCCTAGCTCCCTC
SEQ ID NO; 13 -23.9 -30.4 84.6 -5.1 -1.3 -7.8 931 TCAGCTTTGCCTAGCTCCCT
SEQ ID NO; 14 -23.9 -30.4 84.6 -5.1 -1.3 -7.8 ACCGTCCTTCAGATACAGGT 1265 SEQ ID NO; 15 -23.9 -26.3 74.5 -1.9 -0.1 -4.5 240 GTTTCTCCCCGCCCTGCAGC
SEQ ID NO; 16 -23.6 -34.9 90.4 -10.6 -0.4 -8.1
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex oligo ture oligo oligo 925 TTGCCTAGCTCCCTCTTTGG
SEQ ID NO; 17 -23.5 -29.2 81.5 -5.1 -0.3 -4.8 1264 CCGTCCTTCAGATACAGGTA
-23.4
SEQ ID NO; 18 -25.8 73.4 -1.9 -0.1 -3.9 927 CTTTGCCTAGCTCCCTCTTT
SEQ ID NO; 19 -23.3 -29 81.5 -5.1 -0.3 -4.8 932 TTCAGCTTTGCCTAGCTCCC
-23.1 -29.6 83
SEQ ID NO; 20 -5.1 -1.3 -7.8 241 AGTTTCTCCCCGCCCTGCAG -23
SEQ ID NO; 21 -33.1 86.5 -9.4 -0.4 -7.8 243 CAAGTTTCTCCCCGCCCTGC
-23 -32.4 83.6
SEQ ID NO; 22 -9.4 0 -2.8 244 GCAAGTTTCTCCCCGCCTG -23
SEQ ID NO; 23 -32.4 83.6 -9.4 0 -3.4 245 AGCAAGTTTCTCCCCGCCCT
-23 -32.4 84.1
SEQ ID NO; 24 -9.4 0 -4.1 926 TTTGCCTAGCTCCCTCTTTG
SEQ ID NO; 25 -22.4 -28.1 79.3 -5.1 -0.3 -4.8 242 AAGTTTCTCCCCGCCCTGCA -22.3 -32.4 83.6
SEQ ID NO; 26 -9.4 -0.4 -4.7
20 CAGTCGTGGTCTTTGCTGGT -22
SEQ ID NO; 27 -27.3 80 -5.3 0 -3.6 246 TAGCAAGTTTCTCCCCGCCC -21.8 -31.2 81.8
SEQ ID NO; 28 -9.4 0 -4.1
21 CCAGTCGTGGTCTTTGCTGG
SEQ ID NO; 29 -21.7 -28.1 80 -5.3 -1 -5.3
23 CTCCAGTCGTGGTCTTTGCT
-21.6 -28.2 81.4 -5.3 -1.2
SEQ ID NO; 30 -6
34 CCGGCTCGGCTCTCCAGTCG
SEQ ID NO; 31 -21.5 -32.6 84.9 -8.9 -2.2 -8.5
19 AGTCGTGGTCTTTGCTGGTG -21.3
SEQ ID NO; 32 -26.6 78.7 -5.3 0 -3.6 199 GTCGTCGAGCACTGTCCTCT -21.2
SEQ ID NO; 33 -28.8 81.5 -7 -0.3 -4.9
24 TCTCCAGTCGTGGTCTTTGC -21.1 -27.7 81.3 -5.3
SEQ ID NO; 34 -1.2 -5 247 GTAGCAAGTTTCTCCCCGCC -21 -30.4 81.9 -9.4
SEQ ID NO; 35 0 -4.1 1024 CCTCCCCATCTTCTCCTGCT -21 -32.7 87.6 -11.7
SEQ ID NO; 36 0 -3.6 AGTCGTCGAGCACTGTCCTC 200 SEQ ID NO; 37 -20.9 -27.9 79.9 -7 0 -5.3 191 GCACTGTCCTCTTGCAGCGC
-20.8 -30.4 84.4 -8.7
SEQ ID NO; 38 -0.8 -8
22 TCCAGTCGTGGTCTTTGCTG
SEQ ID NO; 39 -20.7 -27.3 79.1 -5.3 -1.2 -6 GTCGAGCACTGTCCTCTTGC 196 -20.7
SEQ ID NO; 40 -28.3 81.2 -7 -0.3 -5.7 TCGTCGAGCACTGTCCTCTT 198
SEQ ID NO; 1 -20.7 -27.7 78.3 -7 0.2 -4.9 CCTAGCTCCCTCTTTGGTTG 922
SEQ ID NO; 42 -20.7 -28.6 80.6 -7.9 0 -6.2 CGTCCTTCAGATACAGGTAA 1263 -20.7
SEQ ID NO; 43 -23.1 67.4 -1.9 -0.1 -3.9 TCCGGCTCGGCTCTCCAGTC
35 -20.6
SEQ ID NO; 4 -32.2 87.6 -10.1 -1.4 -8.5 CTCCCCATCTTCTCCTGCTC 1023 -20.5
SEQ ID NO; 45 -31.1 86.1 -10.6 0 -3.6 CAGTCGTCGAGCACTGTCCT 201 -20.4
SEQ ID NO; 46 -28.2 79.1 -7 -0.5 -8.4
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
36 CTCCGGCTCGGCTCTCCAGT
-20.1
SEQ ID NO; 47 -32.7 87.6 -11.1 -1.4 -8.5
327 CCAAAAGGATCCTCCCCATT
-20 -26.9
SEQ ID NO; 48 70.9 -5.8 -0.9 -9.4
328 ACCAAAAGGATCCTCCCCAT
SEQ ID NO; 49 -20 -27 71 -5.8 -0.9 -9.9
190 CACTGTCCTCTTGCAGCGCG
-19.8
SEQ ID NO; 50 -29.4 79.5 -8.7 -0.6 -9
919 AGCTCCCTCTTTGGTTGACC
SEQ ID NO; 51 -19.8 -28.8 81.2 -9 0 -5.7
197 CGTCGAGCACTGTCCTCTTG
SEQ ID NO; 52 -19.7 -27.3 76.3 -7 -0.3 -4.9
1022 TCCCCATCTTCTCCTGCTCT
SEQ ID NO; 53 -19.6 -31.1 86.1 -11.5 0 -3.6
239 TTTCTCCCCGCCCTGCAGCG
-19.2
SEQ ID NO; 54 -34.5 86.2 -13.7 -1.5 -9.4
18 GTCGTGGTCTTTGCTGGTGG -19.1
SEQ ID NO; 55 -27.8 81.1 -8.7 0 -3.6
248 GGTAGCAAGTTTCTCCCCGC -19
SEQ ID NO; 56 -29.6 81 -10.6 0 -4.1
1266 AACCGTCCTTCAGATACAGG
SEQ ID NO; 57 -18.8 -24.4 68.9 -5.6 0 -4
1025 CCCTCCCCATCTTCTCCTGC
-18.7
SEQ ID NO; 58 -33.8 88.9 -15.1 0 -2.6
202 ACAGTCGTCGAGCACTGTCC
SEQ ID NO; 59 -18.6 -27.5 77.7 -7 -1.8 -11
442 TTTCAGGCATTTTCCCGTCC -18.5
SEQ ID NO; 60 -28.1 78 -9.6 0.7 -4
1538 TTATCATGCCTCAGATGTTT
SEQ ID NO; 61 -18.5 -22.7 68 -4.2 0 -4.4
1539 TTTATCATGCCTCAGATGTT
-18.5
SEQ ID NO; 62 -22.7 68 -4.2 0 -3.8
1021 CCCCATCTTCTCCTGCTCTT
-18.4
SEQ ID NO; 63 -30.8 84.6 -12.4 0 -3.6
1531 GCCTCAGATGTTTGAAAACC -18.4
SEQ ID NO; 64 -22.5 64.6 -3.6 -0.1 -5.7
1537 TATCATGCCTCAGATGTTTG -18.4
SEQ ID NO; 65 -22.6 67.5 -4.2 0 -4.4
192 AGCACTGTCCTCTTGCAGCG -18.3
SEQ ID NO; 66 -28.6 80.3 -8.7 -1.6 -6.5
585 TTCCTCATTACGGGAGACCC -18.3
SEQ ID NO; 67 -27.1 74.2 -7.4 -1.3 -5.5
936 GGTCTTCAGCTTTGCCTAGC -18.3
SEQ ID NO; 68 -28 82.3 -9 • -0.4 -6.2
1352 AGTGGGTAAAATACTTCTTA
-18.2
SEQ ID NO; 69 -18.4 57.7 0 0.6 -3.7
37 CCTCCGGCTCGGCTCTCCAG
-18.1
SEQ ID NO; 70 -33.5 87.2 -13.9 -1.4 -8.5
193 GAGCACTGTCCTCTTGCAGC -18.1
SEQ ID NO; 71 -28.4 82.2 -8.7 -1.6 -5.5
915 CCCTCTTTGGTTGACCTGTC -18.1
SEQ ID NO; 72 -28.2 79.8 -10.1 0 -6.7 GTGGGTAAAATACTTCTTAG
1351 -17.9
SEQ ID NO; 73 -18.4 57.7 0 -0.2 -3.3 CAAAAGGATCCTCCCCATTA
326 -17.8
SEQ ID NO; 74 -24.6 67.1 -5.8 -0.1 -9.9 GGCATTTTCCCGTCCCCCTG
437 -17.7
SEQ ID NO; 75 -33.7 85.7 -16 0 -4 ATTTCAGGCATTTTCCCGTC
443 -17.7
SEQ ID NO; 6 -26.1 74.4 -7.9 -o.i -4
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo
CAATATTGCCATCTCCAGAT
533 -17.7 -23.3 66.8 -5.6 0 -6.8
921 CTAGCTCCCTCTTTGGTTGA _χη _-, _27_2 ηQΛ _g 5 Q _g_2 1597 GCTCATTT TTGACATTTTT _χη _ -. _2Q_2 62 5 _2 1 _Q_1 _2 _ g
„,Q TTCTCCCCGCCCTGCAGCGC . , βQ R - „ 1 7 „ 7
238 SEQ ID NO;80 "17 "5 ~36-2 89 " 8 ~17 _1-7 ~9-7
1027 CCCCCTCCCCATCTTCTCCT _17 5 _36 91 2 -18.5 0 -0.5
-,.-_ TGCTCATTTTTTGACATTTT . „ -. „n 1 ,„ - 0 1 n 1 , .,
1598 SEQ ID NO;82 -17"5 -20"1 62Λ "2 Λ ~°Λ ~3 "3
329 CACCAAAAGGA^G ) CgCCCCA -17.4 -27.7 72.1 -9.1 -0.9 -9.9
1599 TTGCTCATTTTTTGACATTT _17 _ 4 -2o.l 62.1 -2.1 -0.2 -3.3
SEQ ID NO?o4
534 ACAATATTGCCATCTCCAGA _17_3 -23.5 67.4 -5.6 0 -8.5 SEQ ID NO; 85
1349 GGGT^AC™ GAT -17.3 -17.8 56.1 0 -0.2 -4.3
1350 TG∞^ilΑ^^I!ΑSΑ -17.3 -17.8 56.1 0 -0.2 -4.3
438 AGGCA™GCG^GCCCC -17.2 -33.7 86.3 -16 -0.1 -4
194 CGAGG SEGQ G I^D OC;oyGCAG -IV.1 "27.4 77.2 -8.7 -1.6 -6.5
469 GGTTAgG^TA™GGAAGA -17.1 -18.7 57.9 -1.6 0 -4.6
678
-17-1 -19-1 57'8 ~2 ° -3-1 g37 CGGTCTTCAGCTTTGCCTAG _1?>1 _2η ηη χ _g#9 Q _4 5
1032 TCCCACCCCCTCCCCATCTT _17 1 -36.7 90.2 -19.6 0 -0.5
SEQ ID NO; 93 gl4 CCTCTTTGGTTGACCTGTCT _χη _,-, χ 7g_2 _1Q 1 Q _g_7
364 GCCGTAGGGAC GTCTTTGC _lf__8 _27_g 7g_2 _g 5 _1>5 _8_4
586 TT CG GA™AGGGG GACC -16.8 -25.2 71.1 -7.4 -0.9 -5.1 SEQ ID NO ; 96
1028 ACCCGG^C GCA^C Q7 C CC -16.8 -35.3 90 -18.5 0 -0.5
„c CTCTCCAGTCGTGGTCTTTG - - ,, , 0 „„ , Q Q 1 c
25 SEQ ID NO:98 -16"7 "26-8 78-° _8-8 _1-2 ~5
235 -16.7 -36.4 88.2 -18 -1.7 -10
1421 -16.7 -20.3 60.8 -3.6 0 -5
444 T™A™™CCGT -16.6 -25 70.4 -7.9 -0.1 -4 SEQ ID NO: 101
237 ^^^Q^^Q?^^1'' -16.5 -36.8 90.3 -18.6 -1.7 -10.5
441 ΥΥCΑ^ ™^C^CCC -16.5 -30 81.1 -13 -0.1 -3.3 SEQ ID NO: 103
1354 CCAG ∞T^A<TACVTCT g3 _6_7
SEQ ID NO: 104
1262 ^^^^^ -16.4 -22.5 67.8 -5.6 -0.1 -3.9
1708 CTGC1G4^T G 4TCTTC -16.4 -18.7 57.7 -2.3 0.4 -3.6
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo
CTCTCACAATATTGCCATCT
539 -16.3
SEQ ID NO: 107 -23.1 67.5 -6.2 0 -8.5 GGATGTTATGGATTGTAAGT 778 -16.3
SEQ ID NO: 108 -20.1 62.2 -3.8 0 -2.2 GCGGTCTTCAGCTTTGCCTA 938 -16.3
SEQ ID NO: 109 -28.8 81.3 -12.5 0 -4.5 GACTTGCACTAACACATTTA 1419 SEQ ID NO: 110 -16.3 -20.1 60.7 -3.8 0 -5 TGACTTGCACTAACACATTT 1420 SEQ ID NO: 111 -16.3 -20.4 61.1 -4.1 0 -4.7 CCCCAGAACCGTCCTTCAGA 1272 SEQ ID NO: 112 -16.2 -29.9 77.8 -13.7 0.6 -2.7 GGTAAAATACTTCTTAGATT 1348 -16.2 53.9
SEQ ID NO: 113 -16.7 0 -0.2 -4.3 ACTGTCCTCTTGCAGCGCGG 189 -16.1
SEQ ID NO: 114 -29.9 81 -12.9 -0.6 -9 CAGGTCTCTCTGCAATCCAT 393 -16.1
SEQ ID NO: 115 -25.9 75.1 -9.8 0 -4.9 AAGTTCCTAAAATGTTGGCT 677 -16.1
SEQ ID NO: 116 -20.7 61.5 -4.6 0 -3.9 GGATTGTAAGTATCCTACTT 769 SEQ ID NO: 117 -16.1 -21.2 64.5 -3.8 -1.2 -5.5 774 GTTATGGATTGTAAGTATCC -16.1 -20.4 63.1 -3.8 -0.1 -4.4
SEQ ID NO: 118 TGCGGTCTTCAGCTTTGCCT 939 SEQ ID NO: 119 -16.1 -29.1 81.7 -12.3 -0.5 -4.5 CTGCGGTCTTCAGCTTTGCC 940 -16.1
SEQ ID NO: 120 -29.1 81.7 -12.3 -0.5 -4.5 CAGTGGGTAAAATACTTCTT 1353 SEQ ID NO: 121 -16.1 -19.4 59.6 -2.8 -0.2 -4.8 934 TCTTCAGCTTTGCCTAGCTC -26.9 -9.7 -1.
SEQ ID NO: 122 -16 79.6 1 -7.6 CCTCTGTTGCTCATTTTTTG 1605 SEQ ID NO: 123 -16 -23.8 70.9 -7.8 0 -3.6 17 TCGTGGTCTTTGCTGGTGGG
SEQ ID NO: 124 -15.9 -27.8 80.1 -11.9 0 -3.6 GCATTTTCCCGTCCCCCTGT 436 SEQ ID NO: 125 -15.9 -33.7 86.7 -17.8 0 -3.4 679 GAAAGTTCCTAAAATGTTGG -15.9 -17.9 55.2 -2 0 -2.9
SEQ ID NO: 126 1267 GAACCGTCCTTCAGATACAG
SEQ ID NO: 127 -15.9 -23.8 67.7 -7.9 0 -3.1 CTCATTTTTTGACATTTTTT 1596 -15.9 -18.5 58.6 -2.1 . -0.1 -2.6
SEQ ID NO: 128 1706 GCTGAAAATTGATTCTTCTT -15.9 -18.8 58.1 -4.9
SEQ ID NO: 129 -2.3 -0.3 1903 ATTCACAACTCTGTTGGCCA -15.9 -24.8
SEQ ID NO: 130 71.3 -7.8 -0.9 -9.5 CACAGTCGTCGAGCACTGTC 203 SEQ ID NO: 131 -15.8 -26.2 75.2 -8.3 -2 -11.2 1280 TTCCTATGCCCCAGAACCGT
SEQ ID NO: 132 -15.8 -29.7 77 -13.9 0 -3 1707 TGCTGAAAATTGATTCTTCT
SEQ ID NO: 133 -15.8 -18.7 57.7 -2.3 -0.3 -4.9 TCTGCTGAAAATTGATTCTT 1709 SEQ ID NO: 134 -15.8 -18.7 57.7 -2.3 -0.3 -4.7 1710 TTCTGCTGAAAATTGATTCT
SEQ ID NO: 135 -15.8 -18.7 57.7 -2.3 -0.3 -6.6 TGGATTGTAAGTATCCTACT 770 SEQ ID NO: 136 -15.7 -21.1 64.1 -3.8 -1.6 -5.2
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo
TCTTTGGTTGACCTGTCTCC
912 SEQ ID NO: 137 -15.7 -26.6 78 -10.9 0 -6 CTCCCTCTTTGGTTGACCTG 917 -15.7 -27.9 78.2 -12.2 0 -6.7
SEQ ID NO: 138 CCACCCCCTCCCCATCTTCT 1030 -15.7 -35.6 89 -19.9 0 -0.5
SEQ ID NO: 139 TGCCTCAGATGTTTGAAAAC 1532 -15.7 -20.5 60.9 -4.8 0 -5.3
SEQ ID NO: 140 CCCCTCCCCATCTTCTCCTG 1026 -15.6 -34 87.8 -18.4 0 -1.4
SEQ ID NO: 141 CTCCCACCCCCTCCCCATCT 1033 -15.6 -37.5 91.6 -21.9 0 -0.5
SEQ ID NO: 142 CCCTCTGTTGCTCATTTTTT 1606 -15.6 -25.8 74.8 -10.2 0 -3.6
SEQ ID NO: 143 CGTGGTCTTTGCTGGTGGGA 16 -15.5 -28 79.6 -12.5 0 -3.6
SEQ ID NO: 144 GTAAGTATCCTACTTTTTGT 764 -15.5 -20.8 64.5 -3.8 -1.4 -5.1
SEQ ID NO: 145 TATGGATGTTATGGATTGTA 781 -15.5 -19.3 60.2 -3.8 0 -1.3
SEQ ID NO: 146 CACCCCCTCCCCATCTTCTC 1029 -15.5 -34 87.7 -18.5 0 -0.5
SEQ ID NO: 147 CCACTCCCACCCCCTCCCCA 1036 -15.5 -39.1 92.4 -23.6 0 0
SEQ ID NO: 148 CCTTCAGATACAGGTAACCC 1260 -15.5 -24.9 70.3 -9.4 0 -4
SEQ ID NO: 149 ACAGTCCTGTTTGTGCTAAG 1781 -15.5 -23.7 70.7 -8.2 0 -6.1
SEQ ID NO: 150 CAGCAGCCACAGTCGTCGAG 210 -15.4 -28 77.3 -12.6 0 -4.9
SEQ ID NO: 151 CTCTTTGGTTGACCTGTCTC 913 -15.4 -25.5 76.2 -10.1 0 -6.7
SEQ ID NO: 152 TCCCTCTTTGGTTGACCTGT 916 -15.4
SEQ ID NO: 153 -28.2 79.8 -12.8 0 -6.7 CCTCAGATGTTTGAAAACCT 1530 -15.4
SEQ ID NO: 154 -21.6 62.5 -5.7 -0.1 -5.7 GCTCCCTCTTTGGTTGACCT 918 -6.7
SEQ ID NO: 155 -15.3 -29.7 82.9 -14.4 0 TCACCAAAAGGATCCTCCCC 330 -15.2
SEQ ID NO: 156 -27.4 72.5 -11 -0.9 -9.9 TCTCACAATATTGCCATCTC 538 -15.2
SEQ ID NO: 157 -22.6 67.1 -6.9 0 -7.6 ATTTCCTCATTACGGGAGAC 587 -15.2
SEQ ID NO: 158 -23.2 67.5 -7.4 -0.3 -4.2 CTAGAAAGTTCCTAAAATGT 682 -15.2
SEQ ID NO: 159 -17.2 54 -2 0 -3.7 GTAAAATACTTCTTAGATTT 1347 -15.2
SEQ ID NO: 160 -15.6 51.7 0 0 -3.7 GTTGCTCATTTTTTGACATT 1600 SEQ ID NO: 161 -15.2 -21.2 65 -5.5 -0.2 -3.3 TCGAGCACTGTCCTCTTGCA 195 SEQ ID NO: 162 -15.1 -27.8 78.6 -11.1 -1.6 -6.3 ATCCTCCCCATTAGAAGGCT 319 SEQ ID NO: 163 -15.1 -28 76.5 -12.9 0 -3.7 GCAGGTCTCTCTGCAATCCA 394 SEQ ID NO: 164 -15.1 -27.7 79.7 -9.8 . -2.8 -8.2 TCAGGCATTTTCCCGTCCCC 440 SEQ ID NO: 165 -15.1 -31.9 84 -16.3 -0.1 -4 TGGATGTTATGGATTGTAAG 779 SEQ ID NO: 166 -15.1 -18.9 58.9 -3.8 0 -2.2
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
780 ATGGATGTTATGGATTGTAA
-15.1
SEQ ID NO: 167 -18.9 58.7 -3.8 0 -2.2
1037 CCCACTCCCACCCCCTCCCC -15.1
SEQ ID NO: 168 -40.4 94.4 -25.3 0 0
1780 CAGTCCTGTTTGTGCTAAGA
SEQ ID NO: 169 -15.1 -24.1 71.5 -9 0 -3.6
320 GATCCTCCCCATTAGAAGGC -15
SEQ ID NO: 170 -27.7 75.9 -12.7 0 -3.5
365 TGCCGTAGGGACAGTCTTTG
SEQ ID NO: 171 -15 -26.1 74.5 -9.5 -1.5 -8.4
782 ATATGGATGTTATGGATTGT -15
SEQ ID NO: 172 -19.6 60.8 -4.6 0 -1.8
249 CGGTAGCAAGTTTCTCCCCG -14.9
SEQ ID NO: 173 -28.6 76.5 -13.7 0 -3.8
321 GGATCCTCCCCATTAGAAGG
SEQ ID NO: 174 -14.9 -27.1 74.2 -11.7 -0.1 -7.7
537 CTCACAATATTGCCATCTCC -14.9
SEQ ID NO: 175 -24.2 69.2 -8.7 0 -8.5
1020 CCCATCTTCTCCTGCTCTTA -14.9
SEQ ID NO: 176 -28.5 80.5 -13.6 0 -3.6
1261 TCCTTCAGATACAGGTAACC -14.9
SEQ ID NO: 177 -23.3 68.2 -7.9 -0.1 -3.8
1279 TCCTATGCCCCAGAACCGTC -14.9
SEQ ID NO -.178 -30 78.3 -15.1 0 -3
125 CCGCATAATTATTGCTCCAG
SEQ ID NO: 179 -14.8 -24 67 -7.9 -1.2 -8.4
768 GATTGTAAGTATCCTACTTT
-14.8 -20.1
SEQ ID NO: 180 62.2 -3.8 -1.4 -5.1
771 ATGGATTGTAAGTATCCTAC -14.8
SEQ ID NO: 181 -20.2 62.1 -3.8 -1.6 -5.2
777 GATGTTATGGATTGTAAGTA -14.8
SEQ ID NO: 182 -18.6 58.9 -3.8 0 -2.2
1649 TTGAAAATTCACCGAAGTCA
-14.8
SEQ ID NO: 183 -19 56.6 -4.2 0 -5.7
468 GTTACTGAATATTGGAAGAA
SEQ ID NO: 184 -14.7 -16.8 53.5 -2.1 0 -4.6
680 AGAAAGTTCCTAAAATGTTG
SEQ ID NO: 185 -14.7 -16.7 53 -2 0 -3.7
773 TTATGGATTGTAAGTATCCT
SEQ ID NO: 186 -14.7 -20.1 61.8 -3.8 -1.6 -5.2
920 TAGCTCCCTCTTTGGTTGAC
SEQ ID NO: 187 -14.7 -26.5 77 -11.8 0 -6.2
1271 CCCAGAACCGTCCTTCAGAT
SEQ ID NO: 188 -14.7 -27.9 74.6 -12.7 ■ -0.2 -3.4
1281 TTTCCTATGCCCCAGAACCG
SEQ ID NO: 189 -14.7 -28.6 74.3 -13.9 0 -3
1418 ACTTGCACTAACACATTTAT
SEQ ID NO: 190 -14.7 -19.5 59.4 -4.8 0 -5
1609 GGTCCCTCTGTTGCTCATTT
SEQ ID NO: 191 -14.7 -28.3 81.9 -13.6 0 -3.6
481 GTTGGAAGACTTGGTTACTG
SEQ ID NO: 192 -14.6 -21.5 65.1 -6.9 0 -3.1
767 ATTGTAAGTATCCTACTTTT
SEQ ID NO: 193 -14.6 -19.6 61.2 -3.8 -1.1 -4.8
775 TGTTATGGATTGTAAGTATC
SEQ ID NO: 194 -14.6 -18.4 58.9 -3.8 0 -2.5
997 CTTCATTCCATATCCCAACA
SEQ ID NO: 195 -14.6 -24.3 68.4 -9.7 0 -2 CTCTGTTGCTCATTTTTTGA
1604 SEQ ID NO: 196 -14.6 -22.4 68.4 -7.8 0 -3.2
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
AGGTCCCTCTGTTGCTCATT
1610
SEQ ID NO: 197 -14.6 -28.2 81.8 -13.6 0 -4 TTCACCGAAGTCACAGCACT
1642
SEQ ID NO: 198 -14.6 -24.9 70.3 -10.3 0 -4.1 CATTCACAACTCTGTTGGCC
1904 SEQ ID NO: 199 -14.6 -24.8 71.3 -8.4 -1.8 -7 GTATCTTGTTCTTTTTTATT
2000
SEQ ID NO:200 -14.6 -19.2 62.2 -4.6 0 -0.9 CTTCAGCTTTGCCTAGCTCC
933
SEQ ID NO: 201 -14.5 -28.5 81.4 -12.6 -1.3 -7.8
1534 CATGCCTCAGATGTTTGAAA
SEQ ID NO: 202 -14.5 -21.7 63.6 -7.2 0 -3.3
1711 TTTCTGCTGAAAATTGATTC
SEQ ID NO: 203 -14.5 -17.9 56.2 -2.3 -1 -8.6
1791 ATCTAGTACAACAGTCCTGT
-14.5
SEQ ID NO: 204 -22.7 68.6 -8.2 0 -6.7
681 TAGAAAGTTCCTAAAATGTT -14.4
SEQ ID NO: 205 -16.4 52.5 -2 0 -3.7
683 TCTAGAAAGTTCCTAAAATG
-14.4
SEQ ID NO: 206 -16.4 52.4 -2 0 -5.2
684 ATCTAGAAAGTTCCTAAAAT
-14.4
SEQ ID NO: 207 -16.4 52.5 -2 0 -6.2
766 TTGTAAGTATCCTACTTTTT
-14.4
SEQ ID NO: 208 -19.7 61.6 -3.8 -1.4 -5.1
911 CTTTGGTTGACCTGTCTCCA
SEQ ID NO: 209 -14.4 -26.9 77.2 -12 -0.2 -7.3
1034 ACTCCCACCCCCTCCCCATC
SEQ ID NO: 210 -14.4 -36.8 90.4 -22.4 0 -0.5
1533 ATGCCTCAGATGTTTGAAAA
SEQ ID NO: 211 -14.4 -20.3 60.4 -5.9 0 -3.6 TCATGCCTCAGATGTTTGAA
1535
SEQ ID NO: 212 -14.4 -22.8 67.2 -8.4 0 -4.4 ATTGATTCTTCTTTTACAAA
1699 SEQ ID NO: 213 -14.4 -17 54.8 -2.6 0 -3.5
209 AGCAGCCACAGTCGTCGAGC
SEQ ID NO: 214 -14.3 -29.1 80.6 -14.8 0 -4.9 GAATTTCAGGCATTTTCCCG
445 SEQ ID NO: 215 -14.3 -24.4 68.5 -9.6 -0.1 -4.6
470 TGGTTACTGAATATTGGAAG
SEQ ID NO: 216 -14.3 -18.1 56.5 -3.8 0 -4.6 AATCTGTTGGAAGACTTGGT
486 SEQ ID NO: 217 -14.3 -21.2 64 -6.9 0 -3.6 ATTGCCATCTCCAGATGCCA
529 SEQ ID NO: 218 -14.3 -28.1 77.2 -12.9 -0.7 -7.5 AATATTGCCATCTCCAGATG
532 SEQ ID NO: 219 -14.3 -22.6 65.5 -7.4 -0.8 -7.5 TCTCTCACAATATTGCCATC
540 SEQ ID NO: 220 -14.3 -22.6 67.1 -7.7 0 -8.5 TGTAAGTATCCTACTTTTTG
765 SEQ ID NO: 221 -14.3 -19.6 61.1 -3.8 -1.4 -5.1 TATGGATTGTAAGTATCCTA
772 SEQ ID NO: 222 -14.3 -19.7 60.9 -3.8 -1.6 -5.2 ACTGCGGTCTTCAGCTTTGC
941 SEQ ID NO: 223 -14.3 -27.3 78.7 -12.3 -0.5 -6 CCCACCCCCTCCCCATCTTC
1031 SEQ ID NO: 224 -14.3 -36.7 90.2 -22.4 0 -0.5 GATGACTTGCACTAACACAT
1422 SEQ ID NO: 225 -14.3 -20.8 61.7 -6.5 0 -5 ATTTTTTGACATTTTTTGAA
1593 SEQ ID NO: 226 -14.3 -16.4 53.3 -2.1 0 -2.4
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
1607 TCCCTCTGTTGCTCATTTTT
-14.3
SEQ ID NO: 227 -26.1 76.2 -11.8 0 -3.6
211 GCAGCAGCCACAGTCGTCGA
-14.2 -29.8
SEQ ID NO: 228 81.3 -14.6 -0.9 -5.2
392 AGGTCTCTCTGCAATCCATC -14.2
SEQ ID NO:229 -25.6 75.8 -11.4 0 -4.9
485 ATCTGTTGGAAGACTTGGTT
-14.2
SEQ ID NO: 230 -22 66.6 -6.9 -0.7 -3.6
776 ATGTTATGGATTGTAAGTAT
SEQ ID NO: 231 -14.2 -18 57.5 -3.8 0 -1.8
1705 CTGAAAATTGATTCTTCTTT -14.2
SEQ ID NO: 232 -17.1 54.5 -2.3 -0.3 -4.9
1785 TACAACAGTCCTGTTTGTGC
SEQ ID NO: 233 -14.2 -23.7 70.2 -8.4 -1 -8.7
113 TGCTCCAGGCGGCCACCAGG -14.1
SEQ ID NO: 234 -33.4 86.2 -17.7 -1.5 -10.2
234 CCCCGCCCTGCAGCGCACAC -14.1
SEQ ID NO: 235 -36.2 87.1 -20.4 -1.7 -10.5
472 CTTGGTTACTGAATATTGGA -14.1
SEQ ID NO: 236 -19.8 60.5 -5.7 0 -4.6
528 TTGCCATCTCCAGATGCCAT -14.1
SEQ ID NO: 237 -28.1 77.2 -12.9 -1 -7.8
685 TATCTAGAAAGTTCCTAAAA -14.1
SEQ ID NO: 238 -16.1 51.9 -2 0 -6.2
1650 ATTGAAAATTCACCGAAGTC -14.1
SEQ ID NO: 239 -18.3 55.4 -4.2 0 -5.7
124 CGCATAATTATTGCTCCAGG -14
SEQ ID NO: 240 -23.2 65.9 -7.9 -1.2 -8.4
480 TTGGAAGACTTGGTTACTGA -14
SEQ ID NO: 241 -20.9 63.2 -6.9 0 -3.3
690 TGCTATATCTAGAAAGTTCC -14
SEQ ID NO: 242 -20 61.5 -6 0 -6.2
871 ATTTTTAGTTCTTCAGTGTT
-14
SEQ ID NO: 243 -20.4 65.7 -6.4 0 -4.1
1641 TCACCGAAGTCACAGCACTT -14
SEQ ID NO: 244 -24.9 70.3 -10.3 -0.3 -4.7
1648 TGAAAATTCACCGAAGTCAC -14
SEQ ID NO: 245 -19.1 56.8 -5.1 0 -5.4
378 TCCATCCCGAAGGTGCCGTA -13.9 -30.1
SEQ ID NO: 246 77.9 -14.9 -1.2 -6.2
484 TCTGTTGGAAGACTTGGTTA -13.9
SEQ ID NO: 247 -21.7 66.1 -6.9 -0.7 -3.4
1268 AGAACCGTCCTTCAGATACA -13.9
SEQ ID NO: 248 -23.8 67.7 -9.4 ■ -0.2 -3.6
1345 AAAATACTTCTTAGATTTAT -13.9
SEQ ID NO: 249 -14.4 48.9 0 -0.2 -3.8
1640 CACCGAAGTCACAGCACTTA -13.9
SEQ ID NO: 250 -24.2 68.3 -10.3 0.1 -4.6 16g8 TTGATTCTTCTTTTACAAAC -13.9
SEQ ID NO: 251 -17.2 55.3 -3.3 0 -3 1713 GTTTTCTGCTGAAAATTGAT -13.9
SEQ ID NO: 252 -18.7 57.8 -2.3 -2.5 -11.4 lη . TGTTTTCTGCTGAAAATTGA -13.9
SEQ ID NO: 253 -18.7 57.7 -2.3 -2.5 -11.4 η o 2 AACAGTCCTGTTTGTGCTAA -13.9
SEQ ID NO: 254 -23 68.1 -8.2 -0.7 -8.1 676 AGTTCCTAAAATGTTGGCTG -13.8
SEQ ID NO: 255 -21.4 63.5 -7.6 0 -3.9 ηgg TTCAGTCATATGGATGTTAT -13.8
SEQ ID NO: 256 -20 62.7 -5.5 -0.4 -6.7
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position - . binding ation Duplex ture oligo oligo oligo loio _13_8 _23 8 71 _1Q Q _6
1273 G CCGA ξCG^CAG -13.8 -31.1 80.6 -16.8 -0.2 -3.4 c, ACCAGTGGGTAAAATACTTC - , p on c κι £ R n c, R o
1355 SEQ ID NO: 259 ~13 " 8 "20"6 61-6 "5 • 8 "0'9 ~8'2
-c-.c ATCATGCCTCAGATGTTTGA -, „ CQ -. . „ _ . .
1536 SEQ ID NO: 260 ~13 " 8 ~23'5 69-5 ~9-7 ° "4 " 1611 -13-8 ~27-4 78.6 -13-6 ° "5-3 154
-13-7 -24-1 72-7 -9-1 -1-2 ~6-4
204 ^^^Sf^ -13-7 -27.8 77 -12.2 -1.8 -11
„_, CTCCCCGCCCTGCAGCGCAC - no i ' 01 -l 1 in ς
236 SEQ ID NO: 264 _13-7 _36-6 89-1 ~21 _1'2 _1°-5
,c, GTGCCGTAGGGACAGTCTTT - , „ „„ , „Q , - „ 1 P. Q .
366 SEQ ID NO: 265 _13-7 "27-3 78"3 ~12 _1-5 "8"4
,Qς TGCAGGTCTCTCTGCAATCC _q „ , R _q -.
395 SEQ ID NO:266 ~13-7 ~27 78"4 9"8 3"5 9"5
._„ TGTTGGAAGACTTGGTTACT _ _ , „
482 SEQ ID NO:267 ~13-7 ~21-5 "^ ~6"9 "°-7 "3 " 8
483 CTGT s T B G Q G^GA N CoTT 2?8TTAC "13-7 -21-5 "-1 -°-9 -°-7 -3-3 o , ATTGCATTTTTAGTTCTTCA - , .- on c ci ■« C Q n c 1 876 SEQ ID NO:269 ~13-7 ~2° 'S 64"3 _6-8 ° ~5 qqc TCATTCCATATCCCAACATT _ι3 _o3 4 fiβ fi -9 7 0 -2 y9b SEQ ID NO: 270 1J ' ' ^^ b -° y> U ^
996 TTC^^^A^.C27] ACA'r ~13-7 -23.4 66.6 -9.7 0 -2
1-117 CTTGCACTAACACATTTATT - -. _ -q . __ _ _ „ _ __
141 ' SEQ ID NO: 272 ^ ' ' "LS-4 Sy^ 3 "
--Qn TCTAGTACAACAGTCCTGTT - , _ „ -
1790 SEQ ID NO: 273 "13"7 "22"8 69 ~8"2 "°-7 ^^
1913 ΥΥCCAG CAGA^CAG^A T "13-7 -22.4 64.9 -8.7 0 -1
188 CTGTGξ^G^GGGGG∞ -13.6 -30.9 82.9 -16.4 -0.6 -9
325 AA^ SE^QT IT C„DCT N^OC :C,C^ 76TTAG -13.6 -23.9 66.3 -9.1 -0.9 -9.9
,„c GTTCCTAAAATGTTGGCTGT - -, , oo ,- ec / c n -D Q
675 SEQ ID NO: 277 ~13-6 ~22'6 66'A "9 ° ~3 " 9
„co ATCCTACTTTTTGTTTTCTG - , c 1 , cc „ „ „ „ „
758 SEQ ID NO:278 "13 ' 6 _21-3 65"7 ~7-7 ° "2'2
788 TCAG^ATA^GGA^ATG -13.6 -19.9 62.2 -6.3 0.2 -6.7
1275 AT∞ s C E C Q C^o C.^8 C 0 C TC -13.6 -30.4 79.1 -16.8 0 -3
1346 TAAAA? C^AGA™A -13.6 -14.1 48.4 0 -0.2 -3.8
1647 GAA ^CAG G^GACA -13.6 -19.8 58 -6.2 0 -4.1
1786 GT C^GAG^G^GTG -13.6 -23.1 69.2 -8.4 -1 -8.7
123
-1 -5 -24.2 69.9 -9.8 -0.7 -8.1
379 ∞ ∞∞ ∞^∞^ -13.5 -30.4 78.4 -15.6 -1.2 -6.2
783 ^^^^^ -13.5 -19.1 58.9 -5.6 0 -5.2
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position άnding ation Duplex ture oligo oligo oligo 1041 ATTTCCCACTCCCACCCCCT -13.5
SEQ ID NO: 287 -34.6 86.4 -21.1 0 -0.3 TAAGGTCCCTCTGTTGCTCA 1612 -13.5 -27.1 78.1 -13.6 0 -4.7
SEQ ID NO: 288 ACAATAATAAACATGTCCTT 1978 -13.5
SEQ ID NO: 289 -17 53.1 -3.5 0 -6.9
471 TTGGTTACTGAATATTGGAA -13.4
SEQ ID NO: 290 -18.2 56.7 -4.8 0 -4.6
542 CTTCTCTCACAATATTGCCA -13.4
SEQ ID NO: 291 -23.2 67.9 -9.2 0 -8.5 ATATCTAGAAAGTTCCTAAA
686 -13.4
SEQ ID NO: 292 -16.8 53.7 -3.4 0 -6.2
873 GCATTTTTAGTTCTTCAGTG -13.4
SEQ ID NO: 293 -21.6 67.7 -8.2 0 -3.5 GGTTGACCTGTCTCCATGTA
907 -13.4
SEQ ID NO: 294 -26.7 77.4 -13.3 0 -5.9 AGATGACTTGCACTAACACA 1423 -13.4
SEQ ID NO: 295 -20.8 62 -7.4 0 -5 GGGAAGATGACTTGCACTAA 1427 -13.4
SEQ ID NO: 296 -21.3 62.7 -7 -0.7 -5.3 TGTTGCTCATTTTTTGACAT 1601 -13.4 -21.1 64.5
SEQ ID NO: 297 -7.2 -0.2 -3.6 TGAAAATTGATTCTTCTTTT 1704 -13.4 -16.3 52.9 -2.3 -0.3 -4.9
SEQ ID NO: 298 ACAACAGTCCTGTTTGTGCT 1784 -13.4 -24.9 72.8
SEQ ID NO: 299 -10.5 -0.9 -8.4 TTCACAACTCTGTTGGCCAA 1902 -13.4 -24.1 69 -8.8 -1.8 -10.8
SEQ ID NO: 300 CAATAATAAACATGTCCTTT 1977 -13.4
SEQ ID NO: 301 -16.9 52.9 -3.5 0 -6.9
792 GTGTTCAGTCATATGGATGT -13.3 -22.6 69.8 -8.6 -0.4 -6.1
SEQ ID NO: 302 TTTTTAGTTCTTCAGTGTTA
870 -13.3 -20.1 65.1
SEQ ID NO: 303 -6.8 0 -4.1 GTCTTCAGCTTTGCCTAGCT
935 -13.3 -27.7 81.6
SEQ ID NO: 304 -13.1 -1.2 -7.7 TCCCACTCCCACCCCCTCCC 1038 -13.3 -38.8 93.4
SEQ ID NO: 305 -25.5 0 0 1712 TTTTCTGCTGAAAATTGATT -13.3 -17.6 55.2
SEQ ID NO: 306 -2.3 -2 -10.6 ATGTTTTCTGCTGAAAATTG 1715 -13.3 -18.1 56.5
SEQ ID NO: 307 -2.3 -2.5 -11.4 CTAGTACAACAGTCCTGTTT 1789 -13.3 -22.5 67.8 -8.2 ■ -0.9 -8.4
SEQ ID NO: 308 GGAAGACTTGGTTACTGAAT
478 -13.2 -20.1 60.9 0 -3.1
SEQ ID NO:309 -6.9 TGGAAGACTTGGTTACTGAA
479 -13.2 -20.1 60.8
SEQ ID NO: 310 -6.9 0 -3.1
531 ATATTGCCATCTCCAGATGC -13.2 -25.1 72
SEQ ID NO: 311 -10.8 -1 -7.8 TGGTTGACCTGTCTCCATGT
908 -13.2 -27
SEQ ID NO: 312 77.8 -13.3 -0.2 -7.2 CATCTAGTACAACAGTCCTG 1792 SEQ ID NO: 313 -13.2 -22.2 66.5 -9 0 -5.3 ACCGCATAATTATTGCTCCA
126 -13.1 -24.2 67.3
SEQ ID NO: 314 -9.8 -1.2 -8.4 TATATCTAGAAAGTTCCTAA
687 SEQ ID NO: 315 -13.1 -17.2 54.9 -4.1 0 -6.2 GTTTTTATTCTAACCATTTT 1497 SEQ ID NO: 316 -13.1 -18.9 59.2 -5.8 0 -2.3
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position - . binding ation Duplex ture oligo oligo
1542 AAATTTATCATGCCTCAGAT
SEQ ID NO: 317 -13.1 -20 60.2 -6.9 0 -4.6
1592 TTTTTTGACATTTTTTGAAA
-13.1 -15.7 51.6
SEQ ID NO: 318 -2.1 -0.1 -2.5
1779 AGTCCTGTTTGTGCTAAGAT
SEQ ID NO: 319 -13.1 -23.4 70.3 -10.3 0 -3.6
114 TTGCTCCAGGCGGCCACCAG
SEQ ID NO:320 -13 -32.3 84.2 -17.7 -1.4 -10.2
115 ATTGCTCCAGGCGGCCACCA
SEQ ID NO: 321 -13 -32.3 83.8 -17.7 -1.4 -10.2
324 AAAGGATCCTCCCCATTAGA
SEQ ID NO: 322 -13 -25.2 69.6 -11 -0.9 -9.9
541 TTCTCTCACAATATTGCCAT
SEQ ID NO: 323 -13 -22.3 65.9 -8.7 0 -8.5
1019 CCATCTTCTCCTGCTCTTAA
SEQ ID NO: 324 -13 -25.8 74.3 -12.8 0 -3.6
1342 ATACTTCTTAGATTTATCTC
SEQ ID NO:325 -13 -18.2 59.3 -4.3 -0.7 -5.1
1358 ACCACCAGTGGGTAAAATAC
SEQ ID NO: 326 -13 -22.1 63.4 -7.8 -1.2 -9
111 CTCCAGGCGGCCACCAGGTG
SEQ ID NO: 327 -12.9 -32.8 85.5 -19 -0.4 -9.4
155 CACTGCTGTCACAGTGTTGA
-12.9
SEQ ID NO: 328 -24.8 73.6 -9.1 -2.8 -8.5
391 GGTCTCTCTGCAATCCATCC
SEQ ID NO: 329 -12.9 -27.6 79.2 -14.7 0 -4.9
688 CTATATCTAGAAAGTTCCTA
-12.9
SEQ ID NO: 330 -18.8 58.8 -5.9 0 -5.7
872 CATTTTTAGTTCTTCAGTGT
SEQ ID NO: 331 -12.9 -21 66.6 -8.1 0 -4.1
1186 CTCAAATTTCCATAAGCTTC
SEQ ID NO: 332 -12.9 -20.1 60.7 -7.2 0 -6.8
1276 TATGCCCCAGAACCGTCCTT
SEQ ID NO: 333 -12.9 -29.7 77 -16.8 0 -3
1282 GTTTCCTATGCCCCAGAACC -12.9 -29
SEQ ID NO:334 77.7 -16.1 0 -3
- .... ATTTATCATGCCTCAGATGT
SEQ ID NO: 335 -12.9 -22.6 67.6 -9.7 0 -4.4 - - , GCTCCAGGCGGCCACCAGGT
SEQ ID NO: 336 -12.8 -34.6 90 -20.4 -1.1 -10.2 „- „ GGCAGCAGCCACAGTCGTCG
SEQ ID NO:337 -12.8 -30.4 82.5 -14.9 -2.7 -9.6 . -, q CAGGCATTTTCCCGTCCCCC
SEQ ID NO: 338 -12.8 -33.5 85.4 -20.2 -0.1 -4 „qn GTTCAGTCATATGGATGTTA
SEQ ID NO:339 -12.8 -21.2 66.1 -7.7 -0.4 -6.7 „qι- CAAGTGTTCAGTCATATGGA
SEQ ID NO: 340 -12.8 -21.4 65.6 -8.6 0 -6.2 ... CATTCCATATCCCAACATTA
SEQ ID NO: 341 -12.8 -22.7 64.6 -9.9 0 -2
- . , - GGTAGGGAAGATGACTTGCA
SEQ ID NO:342 -12.8 -23.3 68.4 -9.6 -0.7 -5.9 -,-.-. TAAATTTATCATGCCTCAGA SEQ ID NO: 343 -12.8 -19.7 59.7 -6.9 0 -5.5
- Rqn TTTTGACATTTTTTGAAATC
SEQ ID NO:344 -12.8 -15.9 52.1 -2.1 -0.9 -3.8
- q7 , AATAATAAACATGTCCTTTT
SEQ ID NO: 345 -12.8 -16.3 52 -3.5 0 -6.9 -.„„ AGGATCCTCCCCATTAGAAG Λl SEQ ID NO: 346 -12.7 -25.9 72 -12.1 -0.9 -9.2
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation oligo Duplex ture oligo oligo
GATCCACCATGCATCACAAT
738 -12.7 -24.4
SEQ ID NO: 347 68.2 -11.7 0 -6.6
785 GTCATATGGATGTTATGGAT
-12.7 -20.6
SEQ ID NO: 348 63.3 -7.2 -0.4 -6.2
942 CACTGCGGTCTTCAGCTTTG
-12.7
SEQ ID NO: 349 -26.2 75.3 -12.8 -0.5 -6.2
1187 ACTCAAATTTCCATAAGCTT
-12.7 -19.9
SEQ ID NO: 350 59.8 -7.2 0 -6.4
1278 CCTATGCCCCAGAACCGTCC
SEQ ID NO: 351 -12.7 -31.6 79.8 -18.9 0 -2.6 AGGGAAGATGACTTGCACTA
1428 -12.7 -22
SEQ ID NO: 352 65.1 -8.4 -0.7 -5.3
1979 AACAATAATAAACATGTCCT
-12.7
SEQ ID NO: 353 -16.2 51.2 -3.5 0 -6.9
735 CCACCATGCATCACAATTTG
-12.6 -23.6
SEQ ID NO: 354 66.1 -11 0 -6.4
761 AGTATCCTACTTTTTGTTTT
-12.6 -20.9
SEQ ID NO: 355 65.2 -7.8 -0.2 -2.9
992 TTCCATATCCCAACATTAAT
-12.6
SEQ ID NO: 356 -21.3 61.5 -8.7 0 -3.8
993 ATTCCATATCCCAACATTAA
SEQ ID NO: 357 -12.6 -21.3 61.5 -8.7 0 -2.6
1127 TTTTGACTTTTCCCAAAGCC
-12.6
SEQ ID NO: 358 -23.8 67.4 -9.8 -1.3 -6.3
1277 CTATGCCCCAGAACCGTCCT
SEQ ID NO: 359 -12.6 -30.5 78.4 -17.9 0 -3
1591 TTTTTGACATTTTTTGAAAT
SEQ ID NO: 360 -12.6 -15.6 51.3 -2.1 -0.7 -3.1
1594 CATTTTTTGACATTTTTTGA
-12.6
SEQ ID NO: 361 -17.8 56.5 -5.2 0 -2.4
1778 GTCCTGTTTGTGCTAAGATT
SEQ ID NO: 362 -12.6 -23.5 70.4 -10.9 0 -3.6
1975 ATAATAAACATGTCCTTTTA
SEQ ID NO: 363 -12.6 -16.7 53.2 -4.1 0 -6.9
15 GTGGTCTTTGCTGGTGGGAA
SEQ ID NO: 364 -12.5 -26.5 77.3 -14 0 -3.6
331 TTCACCAAAAGGATCCTCCC
SEQ ID NO: 365 -12.5 -25.5 69.6 -11.8 -0.9 -9.9
473 ACTTGGTTACTGAATATTGG
SEQ ID NO: 366 -12.5 -19.4 59.8 -6.9 0 -4.6 TCACAATATTGCCATCTCCA
536 SEQ ID NO: 367 -12.5 -24 68.5 -10.9 0 -8.5 TTACGGGAGACCCGGCAGCA
578 SEQ ID NO: 368 -12.5 -29.6 77.1 -13.4 • -3.7 -12.1 TACTTCTTAGATTTATCTCT
1341 SEQ ID NO: 369 -12.5 -19.1 61.4 -5.7 -0.7 -5.1 TCAGATGTTTGAAAACCTTA
1528 SEQ ID NO: 370 -12.5 -18.5 56.9 -5.5 -0.1 -5.7 GATTCTTCTTTTACAAACCT
1696 SEQ ID NO: 371 -12.5 -20 60.8 -7.5 0 -1.9 TGATTCTTCTTTTACAAACC
1697 SEQ ID NO: 372 -12.5 -19.1 58.8 -6.6 0 -2.6 CCATCCCGAAGGTGCCGTAG
377 SEQ ID NO: 373 -12.4 -29.7 76.7 -16.4 -0.7 -6.2 CATTTCCTCATTACGGGAGA
588 SEQ ID NO: 374 -12.4 -23.7 68 -10.7 -0.3 -4.2 ACAAGTGTTCAGTCATATGG
796 SEQ ID NO: 375 -12.4 -21 64.7 -8.6 0 -6.2 TTGCATTTTTAGTTCTTCAG
875 SEQ ID NO: 376 -12.4 -20.5 64.6 -8.1 0 -5.1
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo GGAAGATGACTTGCACTAAC
1426 SEQ ID NO: 377 -12.4 -20.3 60.8 -7 -0.7 -5.3 TCATTTTTTGACATTTTTTG
1595 SEQ ID NO:378 -12.4 -17.6 56.5 -5.2 0 -2.5
1905 ACATTCACAACTCTGTTGGC
SEQ ID NO:379 -12.4 -23 68.2 -8.8 -1.8 -7
1980 GAACAATAATAAACATGTCC
SEQ ID NO: 380 -12.4 -15.9 50.6 -3.5 0 -6.9 GTATCCTACTTTTTGTTTTC
760 SEQ ID NO: 381 -12.3 -21.3 66.6 -9 0 -2.2 TAAGTATCCTACTTTTTGTT
763 SEQ ID NO: 382 -12.3 -19.7 61.6 -5.9 -1.4 -5.1 AGTGTTCAGTCATATGGATG
793 SEQ ID NO: 383 -12.3 -21.4 66.5 -8.6 -0.1 -6.4 TCCTGCTCTTAAGTCTTCAT
1011
SEQ ID NO: 384 -12.3 -24.1 72.3 -11.8 0 -6
1042 TATTTCCCACTCCCACCCCC
SEQ ID NO: 385 -12.3 -33.4 84.2 -21.1 0 -0.7 GGGGTTTTCTGGTTGTTTTA
1147
SEQ ID NO: 386 -12.3 -24.1 73.6 -11.8 0 -1.9 TACTCAAATTTCCATAAGCT
1188
SEQ ID NO:387 -12.3 -19.5 59 -7.2 0 -4.8 CAGAACCGTCCTTCAGATAC
1269
SEQ ID NO:388 -12.3 -23.8 67.7 -11 -0.2 -3.4 TTTTTATTCTAACCATTTTC
1496 SEQ ID NO: 389 -12.3 -18.1 57.5 -5.8 0 -1.4
1783 CAACAGTCCTGTTTGTGCTA
SEQ ID NO: 390 -12.3 -24.4 71.6 -11.1 -0.9 -8.4
229 CCCTGCAGCGCACACTCGGC
-12.2
SEQ ID NO: 391 -32.7 83.8 -19.6 -0.7 -8.5 AAGGATCCTCCCCATTAGAA
323
SEQ ID NO: 392 -12.2 -25.2 69.6 -11.8 -0.9 -9.9 GAGCCTTCTCTCAGAAATCA
633
SEQ ID NO:393 -12.2 -23.4 69 -10.3 -0.7 -5.1 CACATACAAGTGTTCAGTCA
801 SEQ ID NO: 394 -12.2 -21.4 65.3 -8.6 -0.3 -4.1
864 GTTCTTCAGTGTTACTATAC
SEQ ID NO: 395 -12.2 -20.7 66 -8.5 0 -4.1 TTTTAGTTCTTCAGTGTTAC
869
SEQ ID NO: 396 -12.2 -20.2 65.3 -8 0 -4.1 CCATATCCCAACATTAATGT
990 SEQ ID NO: 397 -12.2 -22 62.7 -8.7 0 -10.2 CTGCTCTTAAGTCTTCATTC
1009
SEQ ID NO: 398 -12.2 -22.2 68.8 -10 0 -5.4 TTTTGAAATTGCTCTCAGTT
1221
SEQ ID NO: 399 -12.2 -20 61.8 -7.8 0 -3.6 ATAAATTTATCATGCCTCAG
1544 SEQ ID NO: 400 -12.2 -19.1 58.4 -6.9 0 -7.3 GAAAATTGATTCTTCTTTTA
1703 SEQ ID NO: 401 -12.2 -16 52.4 -3.8 0 -4.1 CACATTCACAACTCTGTTGG
1906
SEQ ID NO: 402 -12.2 -21.9 65.1 -7.9 -1.8 -7 TCACTGCTGTCACAGTGTTG
156 SEQ ID NO: 403 -12.1 -24.6 74 -9.1 -3.4 -9.7 GCTATATCTAGAAAGTTCCT
689 SEQ ID NO: 404 -12.1 -20.9 63.6 -8.8 0 -6.2 AAGTGTTCAGTCATATGGAT
794 SEQ ID NO: 405 -12.1 -20.7 64.3 -8.6 0 -6.2 TTTAGTTCTTCAGTGTTACT
-12.1
SEQ ID NO: 406 -21 67.1 -8.9 0 -4.1
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding oligo ation Duplex ture oligo oligo
CCCAACATTAATGTACATCA
-12.1 -20.9 60.8 -7.5 -0.2 -10.5 SEQ ID NO: 407
985 TCCC S^QCA ID™G4TOA 8 CATC -12-1 -20-6 61 -7-5 0.3 -10
11-, GTTTTATTTTGACTTTTCCC 19 1 I Q KR O Q G n
1133 SEQ ID NO: 409 ~12 ~21' 9 66'2 ~9' 8 ° ~
1344 AAAT S ACTTG™AGA^ -12.1 -15.5 51.8 -3.4 0 -3.1
-.,_-. CCACCAGTGGGTAAAATACT -„ - on o c i c Q R , 1 O
1357 SEQ ID NO: 411 ~12 22 Λ 64"6 _9' 5 -1'1 "8 "2
AACCACCAGTGGGTAAAATA _q
1359 SEQ ID NO: 412 ~12-1 ~21"2 6C 9 ~7'8 _1-2 9
-,-... GAGTCATAGGTTTTTATTCT . ,
1506 SEQ ID NO: 413 -12 "1 ~20-5 65"2 ~8 "4 ° ~4-1
-,-„. AGATGTTTGAAAACCTTATA
1526 SEQ ID NO: 414 -1 "1 -17"1 53 "9 _4"5 -0 "1 ~5-7
-crιQ GTCCCTCTGTTGCTCATTTT 1 1 .„ „ D C n c - „ -, .
1608 SEQ ID NO: 415 -12 "1 " 7 "2 79 "5 -15-1 ° ~3 ' 6 Ct. AATTGAAAATTCACCGAAGT 1 1 -_, „ -.„ „ . „ . -
1651 SEQ ID NO:416 ~12 "17-2 52 "7 ~ "2 -°-7 "5 "7
17g3 ACATOTAG^TAC CAGTCCT _12 -22.4 67.2 -10.3 0 -5.3
116 A ΥG^CGAGGGGGGGACC -12 -31.3 82.3 -17.7 -1.4 -10.2
301 CTGAG GC^AGG^GGGGC -12 -33.4 85.2 -18.8 -1.4 -13.3 c,_. CACAATATTGCCATCTCCAG -_ O-D -: c- o 11 n o r,
535 SEQ ID NO: 420 "12 "23 ' 6 67 "2 _11 ° ~8-5
,-.- ATGCTATATCTAGAAAGTTC - _ 1 Q Cτ e C n c o
691 SEQ ID NO:421 ~12 ~18 57"6 "6 ° ~6-2
„_„ AAGTATCCTACTTTTTGTTT 1 „n l „ ,. C Q - - . „
762 SEQ ID NO: 422 ~12 "2°-1 52 '5 ~6-9 -1' 1 "4"7
865 AGT^C^?^3TATA - 2 -20.5 65.6 -8.5 0 -4.1
866
" - 0.5 65.6 -8.5 0 -4.1
991 SEQ ID NO:425 ~12 ~21'2 61Λ ~S "7 ° ~8 "2
1035 -12 -37.1 89.5 -25.1 0 -0.3
1146 _χ2 _22 g 7Q- 6 _1Q_g Q _1>5
1218 GA ™G^GAG^CAA -12 -20.1 61.3 -7.4 ■ -0.4 -4.9
1846 TCT A^T ^C^G C -12 -17.6 56.4 -5.6 0 -4.9
SE U NO : 4 y
153 _χχ g _2ζ Λ ?4 g _12 - _Q 4 _6
367 -11.9 -28.4 80.6 -14.9 -1.5 -8.4
475 AG ^GG^AG^2 TATT -11.9 -18.8 58.8 -6.9 0 -4.6
632 AGCCI4C4GTC4GAAATCAC -11.9 -23 68.2 -10.3 -0.6 -5.1
909 TGG TGACCTCTCTC TG _^ g
SEQ ID NO: 434 1193 TTTGTTACTC^TTTCC T _lχ _ g _lg 3 ^ _g >2 ^ _4 5
SEQ ID NO : t--iD 1425 GAAG TGACTTGCACTAACA _χχ _ g _lg _ g 5g_5 _η _Q^ _5_3
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total formTm of struc- molecular molecular position binding ation Duplex ture oligo oligo oligo AATTTATCATGCCTCAGATG 1541 SEQ ID NO: 437 -11.9 -20.7 62.2 0 -4.4 TCCACACACATTCACAACTC 1912 -11.9 -22.7 66 -10.8 0 -1
SEQ ID NO: 438 GTCTCTCTGCAATCCATCCC 390 SEQ ID NO: 439 -11.8 -28.4 80.1 -16.6 0 -4.9 TTACTGAATATTGGAAGAAG 467 -11.8 -15.6 50.9 -3.8 0 -4.6
SEQ ID NO: 440 ATTACGGGAGACCCGGCAGC 579 SEQ ID NO: 441 -11.8 -28.9 76.1 -13.4 -3.7 -11 TCATATGGATGTTATGGATT 784 -11.8 -19.5 60.4 -7 -0.4 -6.2
SEQ ID NO: 442 TTTGGTTGACCTGTCTCCAT 910 SEQ ID NO: 443 -11.8 -26 75.2 -13.5 -0.4 -7.6 TTTGAAATTGCTCTCAGTTC 1220 -11.8 -20.3 62.9 -8.5 0 -3.9
SEQ ID NO: 444 GTAGGGAAGATGACTTGCAC 1430 SEQ ID NO: 445 -11.8 -22.3 66.3 -9.6 -0.7 -5.3 TTTTATTCTAACCATTTTCA 1495 -11.8 -18.7 58.4 -6.9 0 -1.4
SEQ ID NO: 446 ATAGGTTTTTATTCTAACCA 1501 SEQ ID NO: 447 -11.8 -19.5 60.4 -5.5 -2.2 -5.9 GCTGACACCTCAGCCCCGGG 302 -11.7 -33.4 85.2 -16.7 -3.5 -18.2
SEQ ID NO: 448 AGTTGCAGGTCTCTCTGCAA 398 -11.7 -25.9 77.3 -9.5 -4.7 -12
.,.. CATTTTCCCGTCCCCCTGTC , _
435 SEQ ID NO: 450 _11-7 _32-3 84"3 _2°-6 ° "2 " 6
.-.-. GAAGACTTGGTTACTGAATA _- „ I Q C CT Q <Γ Q n -3 1
477 SEQ ID NO: 451 _11-7 ~18-6 57 • 8 ~6 '9 ° _3 " 1
R,7 TGCCATCTCCAGATGCCATG , , ,- -, - _„ _
527 SEQ ID NO: 452 _11-7 ~28 76-7 15"2 _1 7 " 8
-.., TCTTCTCTCACAATATTGCC 11 7 _„ Q ,Q , 1 n c- . Q r-
543 SEQ ID NO: 453 _11-7 ~22-9 68 "3 _1°-6 ° _8-5
943 TCACTGCGGTCTOC^AGCTTT _χ _η _26_g _,7_3 _14 2 _Q 4 _6 2
, „..Q TTGAAATTGCTCTCAGTTCA 11 OΠ O C-D Q Q C n c
1219 SEQ ID NO:455 _11-7 _2°-9 " " 8 ~8-5 "°-4 ~5
1259 C TCAGATAξAGG^GCCG -1 - -23.7 66.9 -11 -0.9 -4.5
1274 TGCCGGAGAACGGTG™CA -11.7 -31.1 80.1 -18.9 -0.2 -3.4
SEQ NO : 4o /
1356 CACC E GTGG D G^T 8 AC T -11.7 -20.9 61.4 -8 -1.1 -8.2
..,,--. AAACCACCAGTGGGTAAAAT 11 OΠ Q CQ C 7 Q 1 O Q
1360 SEQ ID NO: 459 _11 '7 ~20-8 59 " 6 ~7-8 -1-2 "9
1639 ^^^^^ -11.7 -23.5 67.1 -11.1 -0.5 -4.6
1787 AGTACAACAGTCCTGTTTGT _23 6g_g _Q_8 _8 3 SEQ ID NO: 461
110 TCCAGGGGGGCAGCAGGTGT -11.6 -33.1 87.1 -19.9 -1.4 -10.2 SEQ ID NO : 4b
1β_ GCACTCACTGCTGTCACAGT 11 (- OC O TQ O -, / -, O C -D
160 SEQ ID NO: 463 _11-6 _26-9 78"8 ~14 _1-2 "6-3
187 TGTCCTCTTCCAGCGCGGGC _χχ _ 6 _3χ_8 85 4 _lg>3 _Q 6 _g l
250 -11.6 -29.6 81 -17 -0.9 -4.5
799 CA AGA?G?GT*GAGXATA -11.6 -20.2 62.8 -8.6 0 -3.7
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo ACATACAAGTGTTCAGTCAT
800 -11.6
SEQ ID NO: 467 -20.7 64 -8.6 -0.1 -3.7 GACCTGTCTCCATGTAAGAT
903 -11.6 -24.1 70.1 -12.5 0 -5.5
SEQ ID NO: 68
904 TGACCTGTCTCCATGTAAGA -11.6 -24.1
SEQ ID NO: 469 70 -12.5 0 -5.3 1012 CTCCTGCTCTTAAGTCTTCA -11.6 -25 74.5 -13.4 0 -6
SEQ ID NO: 470 1132 TTTTATTTTGACTTTTCCCA
-11.6 -21.4 64.2 -9.8
SEQ ID NO: 471 0 -1.7 1204 GTTCAAAGCTGTTTGTTACT -11.6 -21.2 65.1
SEQ ID NO: 472 -8.1 -1.4 -6 1500 TAGGTTTTTATTCTAACCAT
SEQ ID NO: 473 -11.6 -19.5 60.4 -5.7 -2.2 -5.9 CCACACACATTCACAACTCT 1911 -11.6 -23.2 66.4 -11.6
SEQ ID NO: 474 0 -1
127 CACCGCATAATTATTGCTCC -11.5
SEQ ID NO: 475 -24.2 67.3 -11.4 -1.2 -8.4 GCCACAGTCGTCGAGCACTG
205 -11.5 -28.4 77.9 -15.6 -1.1 -9.6
SEQ ID NO: 76 GTCTTTGCAGATACCAAACT
352 -11.5 -22.1 64.9 -10
SEQ ID NO: 477 -0.3 -4.9
397 GTTGCAGGTCTCTCTGCAAT -11.5
SEQ ID NO: 478 -25.9 76.9 -9.5 -4.9 -12.2
487 AAATCTGTTGGAAGACTTGG -11.5 -19.3 58.9 -6.9 -0.7 -3.6
SEQ ID NO: 479 GGTTTTCTGGTTGTTTTATT 1145 -11.5 -21.8 68.2 -10.3 0 -1.5
SEQ ID NO: 480 TTGCACTAACACATTTATTT 1416 -11.5 -18.6 57.6 -7.1 0 -5
SEQ ID NO: 481 1429 TAGGGAAGATGACTTGCACT -11.5 -22 65.1 -10
SEQ ID NO: 482 -0.1 -5 1529 CTCAGATGTTTGAAAACCTT -11.5 -19.7 59.3 -7.7
SEQ ID NO: 483 -0.1 -5.7 CCTGCAGCGCACACTCGGCA
228 -11.4 -31.4 81.5
SEQ ID NO: 484 -19.1 -0.7 -8.8 CCCGCCCTGCAGCGCACACT
233 -11.4 -35.1 85.8 -22 -1.7 -10.5
SEQ ID NO: 485 CCCGGCAGCATTCTCTTTCA
568 -11.4 -29 79.5 -17.6 0 -6.3
SEQ ID NO: 486
577 TACGGGAGACCCGGCAGCAT -11.4 -29.5 76.7 -14.4
SEQ ID NO: 487 -3.7 -12.1 AATTGCATTTTTAGTTCTTC
877 -11.4 -19.1 60.7 -7.7 0 -5.1
SEQ ID NO: 488 1039 TTCCCACTCCCACCCCCTCC -11.4 -36.9 90.9 -25.5
SEQ ID NO: 489 0 0 1202 TCAAAGCTGTTTGTTACTCA -11.4 -21 64.2
SEQ ID NO: 490 -8.1 -1.4 -6 1515 AACCTTATAGAGTCATAGGT -11.4 -20.9 64
SEQ ID NO: 491 -8.6 -0.8 -6.3 1602 CTGTTGCTCATTTTTTGACA -11.4 -22
SEQ ID NO: 492 66.5 -10.1 -0.1 -3.6
266 CCATGCCTGAGACTGTGCGG
SEQ ID NO: 493 -11.3 -28.7 77 -16.8 -0.3 -4.2
317 CCTCCCCATTAGAAGGCTGA
SEQ ID NO: 494 -11.3 -28.2 76 -16.9 0 -3.7
530 TATTGCCATCTCCAGATGCC
SEQ ID NO: 495 -11.3 -27.1 75.6 -14.7 -1 -7.8 TATGCTATATCTAGAAAGTT
692 SEQ ID NO: 496 -11.3 -17.3 55.6 -6 0 -6.2
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo
TTATGCTATATCTAGAAAGT
693 -11.3 -17.3 55.6
SEQ ID NO: 97 -6 0 -6.2 TATCCTACTTTTTGTTTTCT 759 -11.3 -21 65.2 -9.7 0 -2.2
SEQ ID NO: 498 CAGTCATATGGATGTTATGG 787 -11.3 -20.7 63.4 -8.7 -0.4 -6.2
SEQ ID NO: 499 TGCATTTTTAGTTCTTCAGT 874 -11.3 -21.6 67.7 -10.3 0 -4.7
SEQ ID NO: 500 CACTAACACATTTATTTATA 1413 -11.3 -16.1 52.3 -4.8 0 -1.7
SEQ ID NO: 501 CAGATGTTTGAAAACCTTAT 1527 -11.3 -18.1 55.6 -6.8 0.6 -5
SEQ ID NO: 502 TTTGACATTTTTTGAAATCC 1589 -11.3 -17.8
SEQ ID NO: 503 55.6 -5.5 -0.9 -3.8 ACACATTCACAACTCTGTTG 1907 -11.3 -20.9 63.1 -8.1 -1.4 -6.5
SEQ ID NO: 504 ATTATTGCTCCAGGCGGCCA 118 -11.2 -29.2
SEQ ID NO: 505 78.7 -16.4 -1.4 -10.2 CTTCACCAAAAGGATCCTCC 332 -11.2 -24.4 68 -12.1 -0.5
SEQ ID NO: 506 -9.9 ACAAATCTGTTGGAAGACTT 489 -11.2 -19 58.2 -6.9 -0.8 -4.4
SEQ ID NO: 507 GCCTTCTCTCAGAAATCACA 631 -11.2 -23.7 69.1 -11.7 -0.6 -4.6
SEQ ID NO: 508 1192 TTGTTACTCAAATTTCCATA -11.2 -18.9
SEQ ID NO: 509 58.4 -7.2 -0.1 -4.5 GTTTGTTACTCAAATTTCCA 1194 -11.2 -20.5
SEQ ID NO: 510 62.4 -7.7 -1.6 -4.6 AATACTTCTTAGATTTATCT 1343 -11.2 -17.1 55.8 -5.2 -0.5 -4.7
SEQ ID NO: 511 1644 AATTCACCGAAGTCACAGCA -11.2 -23.1 65.7 -11.9 0 -4.1
SEQ ID NO: 512 TTCTTAAATAAGTTCTTCAC 1847 -11.2 -16.8
SEQ ID NO: 513 54.8 -5.6 0 -4.9 1908 CACACATTCACAACTCTGTT -11.2 -21.6 64.4 -9.9 -0.2 -3.1
SEQ ID NO: 514 TCCATGCCTGAGACTGTGCG 267 -11.1 -27.9 76.2 -16.8 0.4 -4.2
SEQ ID NO: 515 TCCTCCCCATTAGAAGGCTG 318 -11.1 -28 76.3 -16.9 0 -3.7
SEQ ID NO: 516 GGAATTTCAGGCATTTTCCC 446 SEQ ID NO: 517 -11.1 -24.8 71 -13 -0.4 -5 AAGACTTGGTTACTGAATAT 476 -11.1 -18 56.5 -6.9 0 -3.1
SEQ ID NO: 518 CCATTTCCTCATTACGGGAG 589 SEQ ID NO: 519 -11.1 -25.1 70.3 -14 0 -4.2 GTTGACCTGTCTCCATGTAA 906 -11.1 -24.8 72.1 -13.7 0 -5.1
SEQ ID NO: 520 1008 TGCTCTTAAGTCTTCATTCC
SEQ ID NO: 521 -11.1 -23.3 70.6 -12.2 0 -6 AACTACATCAGCAGCCTTTT 1237 SEQ ID NO: 522 -11.1 -23.6 68.7 -12.5 0 -4.5 CAGATACAGGTAACCCGGGA 1256 SEQ ID NO: 523 -11.1 -25.3 69.3 -12.7 -0.9 -10.7 1257 TCAGATACAGGTAACCCGGG
SEQ ID NO: 524 -11.1 -25.1 69.6 -12.7 -0.9 -10.2 AGGTTTTTATTCTAACCATT 1499 SEQ ID NO: 525 -11.1 -19.9 61.3 -6.6 -2.2 -5.9 CTTATAGAGTCATAGGTTTT 1512 SEQ ID NO: 526 -11.1 -19.7 62.7 -8.6 0 -4.8
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo AATAAGTTCTTCACTTCAAA 1841 -11.1 -17 54.4 -4.8 -1 -3.7
SEQ ID NO: 527 CAAATCTGTTGGAAGACTTG 488 -11 -18.8 57.6 -6.9 -0.7 -3.6
SEQ ID NO: 528 CTTATGCTATATCTAGAAAG 694 -11 -17 54.6 -6 0 -6.2
SEQ ID NO: 529 GGTTTTTATTCTAACCATTT 1498 -11 -20 61.5 -7.5 -1.4 -5.2
SEQ ID NO: 530 AATAAATTTATCATGCCTCA 1545 -11 -18.4 56.4 -6.9 0 -8.1
SEQ ID NO: 531 TCTTCTTTTACAAACCTCCT 1693 -11 -22.6 66.2 -11.6 0 -1.9
SEQ ID NO: 532 1694 TTCTTCTTTTACAAACCTCC -11 -21.8 64.7 -10.8 0 -1.9
SEQ ID NO: 533 ATTCTTAAATAAGTTCTTCA 1848 -11 -16.6 54.2 -5.6 0 -4.9
SEQ ID NO: 534 CCGCCCTGCAGCGCACACTC 232 -10.9 -33.5 84.5 -20.9 -1.7 -10.5
SEQ ID NO: 535 CAGTTGCAGGTCTCTCTGCA 399 -10.9 -27.3 81.3 -12.9 -3.5 -9.9
SEQ ID NO: 536 TTCACAACTTCTTCTCTCAC 552 -10.9 -21.9 67.2 -11 0 -0.6
SEQ ID NO: 537 CACCATGCATCACAATTTGG 734 -10.9 -22.8 65.1 -11 -0.7 -6.6
SEQ ID NO: 538 TCCACCATGCATCACAATTT 736 -10.9 -24 67.7 -13.1 0 -6.6
SEQ ID NO: 539 TGTTCAGTCATATGGATGTT 791 -10.9 -21.5 66.6 -9.9 -0.4 -6.7
SEQ ID NO: 540 TACAAGTGTTCAGTCATATG 797 -10.9 -19.5 61.4 -8.6 0 -5.6
SEQ ID NO: 541 ATACAAGTGTTCAGTCATAT 798 -10.9 -19.5 61.5 -8.6 0 -3.7
SEQ ID NO: 542 AGTCTTCATTCCATATCCCA 1000 -10.9 -25.7 74.2 -14.8 0 -2
SEQ ID NO: 543 GACTTTTCCCAAAGCCAAAA 1123 -10.9 -22.1 61.7 -9.8 -1.3 -4.1
SEQ ID NO: 544 TCAAATTTCCATAAGCTTCA 1185 -10.9 -19.9 60 -9 0 -6.8
SEQ ID NO: 545 CAAAGCTGTTTGTTACTCAA 1201 -10.9 -19.9 60.6 -8.1 -0.8 -5.5
SEQ ID NO: 546 AAAATTCACCGAAGTCACAG 1646 -10.9 -19.2 57 -8.3 0 -3.5
SEQ ID NO: 547 CAGCAGCAAGACGCTCTTCA 70 -10.8 -25.8 72.9 -13.7 ■ -1.2 -6
SEQ ID NO: 548 CAGGCGGCCACCAGGTGTGC 108 -10.8
SEQ ID NO: 549 -32.5 86.1 -19.9 -1.4 -11.3 AATCCATCCCGAAGGTGCCG 380 -10.8
SEQ ID NO: 550 -28.5 73.2 -16.4 -1.2 -6.2 TCATTACGGGAGACCCGGCA 581 SEQ ID NO: 551 -10.8 -28.2 74.4 -13.7 -3.7 -11 GTTTTCTGGATCCACCATGC 746 -1.2 -9.7
SEQ ID NO: 552 -10.8 -26.4 75.4 -14.2 TTGACCTGTCTCCATGTAAG 905 -10.8
SEQ ID NO: 553 -23.6 69.1 -12.8 0 -5.1 TTTATTTTGACTTTTCCCAA 1131 -10.8 61.7 -9.8 0 -2.7
SEQ ID NO: 554 -20.6 AGGGGTTTTCTGGTTGTTTT 1148 -10.8
SEQ ID NO: 555 -24.4 74.5 -13.6 0 -2 TTCAAAGCTGTTTGTTACTC 1203 -10.8 -20.4 63.3 -8.1 -1.4 -6
SEQ ID NO: 556
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation oligo Duplex ture oligo oligo
1270 CCAGAACCGTCCTTCAGATA
SEQ ID NO: 557 -10.8 -25.6 70.7 -14.3 -0.2 -3.4
1643 ATTCACCGAAGTCACAGCAC
SEQ ID NO: 558 -10.8 -24 68.4 -13.2 0 -4.1
1645 AAATTCACCGAAGTCACAGC
SEQ ID NO: 559 -10.8 -21.7 62.6 -10.9 0 -3.5
1656 CCTTAAATTGAAAATTCACC
SEQ ID NO: 560 -10.8 -17.3 53 -5.6 -0.7 -5.7
1716 CATGTTTTCTGCTGAAAATT
SEQ ID NO: 561 -10.8 -18.8 57.8 -5.5 -2.5 -11.4
1915 CCTTCCACACACATTCACAA
SEQ ID NO: 562 -10.8 -24.2 67.9 -13.4 0 -0.9
71 TCAGCAGCAAGACGCTCTTC
SEQ ID NO: 563 -10.7 -25.5 73.5 -13.7 -1 -6
148 GTCACAGTGTTGAGGGCAGT
-10.7 -26.4 79.2
SEQ ID NO: 564 -15.7 0 -6
334 CTCTTCACCAAAAGGATCCT
SEQ ID NO: 565 -10.7 -23.3 66.3 -11.7 0 -9.7
526 GCCATCTCCAGATGCCATGT
-10.7 -29.2
SEQ ID NO: 566 80.3 -17.4 -1 -7.8
739 GGATCCACCATGCATCACAA
SEQ ID NO: 567 -10.7 -25.6 70.7 -14.2 -0.4 -8.3
1205 AGTTCAAAGCTGTTTGTTAC -10.7 -20.3 63.2
SEQ ID NO: 568 -8.1 -1.4 -6
1513 CCTTATAGAGTCATAGGTTT
SEQ ID NO: 569 -10.7 -21.6 66.5 -10.9 0 -4.8
1836 GTTCTTCACTTCAAATAAAA -10.7
SEQ ID NO: 570 -16.3 52.5 -5.6 0 -1.6
139 TTGAGGGCAGTCCACCGCAT
SEQ ID NO: 571 -10.6 -29.4 79.4 -17.7 -1 -5.6
353 AGTCTTTGCAGATACCAAAC
-10.6 -21.2
SEQ ID NO: 572 63.2 -10 -0.3 -5.2
989 CATATCCCAACATTAATGTA
SEQ ID NO: 573 -10.6 -19.7 58.6 -7.8 -0.2 -10.5
1001 AAGTCTTCATTCCATATCCC
SEQ ID NO: 574 -10.6 -24.3 70.6 -13.7 0 -2.4
1015 CTTCTCCTGCTCTTAAGTCT
SEQ ID NO: 575 -10.6 -25.2 75.4 -14.6 0 -6
1046 ATTTTATTTCCCACTCCCAC
SEQ ID NO: 576 -10.6 -25.7 72.1 -15.1 0 -0.5
1128 ATTTTGACTTTTCCCAAAGC
SEQ ID NO: 577 -10.6 -21.8 63.8 -9.8 -1.3 -6.3 CTTCCACACACATTCACAAC
1914
SEQ ID NO: 578 -10.6 -22.4 64.9 -11.8 0 -1 GTCCTCTTGCAGCGCGGGCT
186 SEQ ID NO: 579 -10.5 -32.7 87.5 -20.7 -1.3 -10 CATGCCTGAGACTGTGCGGT
265
SEQ ID NO: 580 -10.5 -27.9 76.9 -16.8 -0.3 -5.3 TTTTCTGGATCCACCATGCA
745 SEQ ID NO: 581 -10.5 -25.9 73.1 -14.2 -1 -9.5 TTCTTCAGTGTTACTATACA
863 SEQ ID NO: 582 -10.5 -20.2 63.8 -9.7 0 -3.5 ATCCCAACATTAATGTACAT
986 SEQ ID NO: 583 -10.5 -20.2 59.7 -8.4 -0.2 -10.5 GAAATTGCTCTCAGTTCAAA
1217 SEQ ID NO: 584 -10.5 -19.4 59.4 -8.9 0 -4.2 TCTTAGATTTATCTCTGAGG
1337 SEQ ID NO: 585 -10.5 -20 63.3 -8.6 -0.7 -6.2 GGGTAGGGAAGATGACTTGC
1432 SEQ ID NO: 586 -10.5 -23.8 69.8 -12.4 -0.7 -4
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding oligo ation Duplex ture oligo oligo
1717 ACATGTTTTCTGCTGAAAAT
SEQ ID NO: 587 -10.5 -18.9 58 -6.4 -2 -10.9
1974 TAATAAACATGTCCTTTTAA
SEQ ID NO: 588 -10.5 -16 51.5 -5.5 0 -6.9
44 CCAGCTGCCTCCGGCTCGGC
SEQ ID NO: 589 -10.4 -35.4 89.9 -22.9 -2.1 -10.8
66 AGCAAGACGCTCTTCATGTT
-10.4
SEQ ID NO: 590 -23.9 69.6 -12.3 -1.1 -6.8
107 AGGCGGCCACCAGGTGTGCA
SEQ ID NO: 591 -10.4 -32.5 86.1 -19.9 -2 -11.8
128 CCACCGCATAATTATTGCTC
SEQ ID NO: 592 -10.4 -24.2 67.3 -12.9 -0.7 -7.9
335 ACTCTTCACCAAAAGGATCC
SEQ ID NO: 593 -10.4 -22.6 65 -11.7 0 -7.7
1043 TTATTTCCCACTCCCACCCC
SEQ ID NO: 594 -10.4 -31.5 81.4 -21.1 0 -0.7
1290 GTGTATGTGTTTCCTATGCC
SEQ ID NO: 595 -10.4 -25.5 75.4 -15.1 0 -3
1516 AAACCTTATAGAGTCATAGG
-10.4
SEQ ID NO: 596 -19 58.7 -8.6 0 -5
1652 AAATTGAAAATTCACCGAAG
SEQ ID NO: 597 -10.4 -15.3 48.8 -3.6 -1.2 -5.7
1695 ATTCTTCTTTTACAAACCTC
SEQ ID NO: 598 -10.4 -19.8 60.9 -9.4 0 -1.9
1981 TGAACAATAATAAACATGTC
SEQ ID NO: 599 -10.4 -13.9 47 -3.5 0 -6.9
122 CATAATTATTGCTCCAGGCG
SEQ ID NO: 600 -10.3 -23.2 65.9 -11.4 -1.4 -9.3
867 TTAGTTCTTCAGTGTTACTA
SEQ ID NO: 601 -10.3 -20.6 66.1 -10.3 0 -4.1 CTCACTGCGGTCTTCAGCTT
944
SEQ ID NO: 602 -10.3 -27.4 78.9 -16.4 -0.5 -6.2 TTATAGAGTCATAGGTTTTT
1511
SEQ ID NO: 603 -10.3 -18.9 61 -8.6 0 -4 TTGACATTTTTTGAAATCCA
1588
SEQ ID NO: 604 -10.3 -18.4 56.6 -7.2 -0.7 -5 CTTAAATTGAAAATTCACCG
1655
SEQ ID NO: 605 -10.3 -16.1 50.4 -4.5 -1.2 -5.7 TGAGGGCAGTCCACCGCATA
138 -10.2
SEQ ID NO: 606 -29 78.5 -17.7 -1 -5.6 AGGTGCCGTAGGGACAGTCT
368 SEQ ID NO: 607 -10.2 -28.3 80.5 -17 -1 -7.9 ACCATTTCCTCATTACGGGA
590 -10.2
SEQ ID NO: 608 -25.3 70.6 -14.6 ■ -0.1 -4 TTCTCTCAGAAATCACAGCC
628 -10.2
SEQ ID NO: 609 -22.8 67.4 -11.9 -0.4 -4 AGAGCCTTCTCTCAGAAATC
634 -10.2
SEQ ID NO: 610 -22.7 68.1 -10.9 -1.5 -5.1 TAGAGCCTTCTCTCAGAAAT
635 SEQ ID NO: 611 -10.2 -22 65.9 -10.1 -1.7 -6.4 TTTCTGGATCCACCATGCAT
744 -10.2
SEQ ID NO: 612 -25.8 72.7 -14.2 -1.2 -9.7 TGTTTGTTACTCAAATTTCC
1195 -10.2
SEQ ID NO: 613 -19.8 61 -8 -1.6 -4.6 GAACTACATCAGCAGCCTTT
1238 -10.2
SEQ ID NO: 614 -24.1 69.6 -13.9 0 -4.5 ATACAGGTAACCCGGGAACT
1253 -10.2
SEQ ID NO: 615 -24.4 67.1 -12.7 -0.2 -11 CAAACCACCAGTGGGTAAAA
1361 -10.2
SEQ ID NO: 616 -21.5 60.7 -10 -1.2 -9
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo TATTCTAACCATTTTCAACA 1492 -10.2 -18.6
SEQ ID NO: 617 57.3 -8.4 0 -1.2 213 CGGCAGCAGCCACAGTCGTC -10.1 -30.4 82.5 -17.1 -3.2 -9.8
SEQ ID NO: 618 CCGTAGGGACAGTCTTTGCA 363 -10.1 -26.8 75.8 -15.8 -0.8 -7.9
SEQ ID NO: 619 434 ATTTTCCCGTCCCCCTGTCA -10.1 -32.3 84.3 -22.2 0 -2.6
SEQ ID NO: 620 ACGGGAGACCCGGCAGCATT 576 -10.1 -29.9 77.6 -16.1 -3.7 -12.1
SEQ ID NO: 621 ATCCACCATGCATCACAATT 737 -10.1 -23.9 67.3 -13.8
SEQ ID NO: 622 0 -6.6 TCTTCTCCTGCTCTTAAGTC 1016 -10.1
SEQ ID NO: 623 -24.7 75.1 -14.6 0 -6 1134 TGTTTTATTTTGACTTTTCC -10.1 -19.9 62.2 -9.8 0 -2.5
SEQ ID NO: 624 TCCTTCAGGGGTTTTCTGGT 1154 -10.1 -27.3 80.7 -16.7 -0.2 -5.7
SEQ ID NO: 625 ACCCGGGAACTACATCAGCA 1244 -10.1 -26.6 71.7 -15.2 0.3 -10.7
SEQ ID NO: 626 TAAATTGAAAATTCACCGAA 1653 -10.1 -15 48.2 -3.6 -1.2 -5.4
SEQ ID NO: 627 TCACAACTCTGTTGGCCAAC 1901 -10.1 -24.2 69.2 -11.1 -1.8 -14
SEQ ID NO: 628 1982 TTGAACAATAATAAACATGT -10.1 -13.6 46.3 -3.5
SEQ ID NO: 629 0 -6.7 TCCACCGCATAATTATTGCT 129 -10 -24.2 67.3 -12.9 -1.2 -8.4
SEQ ID NO: 630 CTCACTGCTGTCACAGTGTT 157 -10 -25.5 76.3 -12.1 -3.4 -9.7
SEQ ID NO: 631 TTGCAGGTCTCTCTGCAATC 396 -10 -25.1 75 -10.7 -4.4 -11.4
SEQ ID NO: 632 643 CACGAAAATAGAGCCTTCTC -10 -21 61.2 -10.1 -0.7 -4.9
SEQ ID NO: 633 TCTTAAGTCTTCATTCCATA 1005 -10 -21 64.8
SEQ ID NO: 634 -11 0 -6 1040 TTTCCCACTCCCACCCCCTC -10 -35 88.2 -25 0 0
SEQ ID NO: 635 1546 TAATAAATTTATCATGCCTC -10 -17.4 54.6 -6.9 0 -8.1
SEQ ID NO: 636 1999 TATCTTGTTCTTTTTTATTG -10
SEQ ID NO: 637 -18 58.7 -8 0 -0.9 109 CCAGGCGGCCACCAGGTGTG -9.9 -32.7 85.1 -21.6
SEQ ID NO: 638 -0.6 -10.2 119 AATTATTGCTCCAGGCGGCC -9.9 -27.8 75.3 -16.4
SEQ ID NO: 639 -1.4 -8.9 162 TTGCACTCACTGCTGTCACA -9.9 -25.8 75 -14
SEQ ID NO: 640 -1.9 -5.9 755 CTACTTTTTGTTTTCTGGAT -9.9 -20.7 64.3 -10.8
SEQ ID NO: 641 0 -2.6 1245 AACCCGGGAACTACATCAGC -9.9 -25.2 68.6 -13.9
SEQ ID NO: 642 -0.2 -10.7 1254 GATACAGGTAACCCGGGAAC -9.9
SEQ ID NO: 643 -24.1 66.5 -12.7 -0.9 -10.7 ACTAACACATTTATTTATAA 1412 -9.9 -14.7 49.3 -4.8
SEQ ID NO: 644 0 -3.7 1415 TGCACTAACACATTTATTTA -9.9 -18.2 56.7 -8.3
SEQ ID NO: 645 0 -4.7 AACATCTAGTACAACAGTCC 1794 -9.9
SEQ ID NO: 646 -20.8 62.9 -10.9 0 -5.3
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position binding ation Duplex ture oligo oligo oligo
ACTCTGTTGGCCAACTTCAA
1896 -9.9 -24.3 69.8
SEQ ID NO: 647 -11.3 0.2 -14.3 GCCTCCGGCTCGGCTCTCCA
38 -9.8 -35.3 91.1 -23.4 -2.1 -9.2
SEQ ID NO: 648 TGCACTCACTGCTGTCACAG
161 -9.8 -25.7 74.9 -14 -1.9 -6.2
SEQ ID NO: 649 TTTCACAACTTCTTCTCTCA
553 -9.8 -21.8 67 -12 0 -0.7
SEQ ID NO: 650 TCTCTCAGAAATCACAGCCG
627 -9.8 -23.5 67.3 -13.7 0 -3.2
SEQ ID NO: 651 GAAAATAGAGCCTTCTCTCA
640 -9.8 -21.3 63.5 -9.8 -1.7 -5.1
SEQ ID NO: 652 TCACGAAAATAGAGCCTTCT
644
SEQ ID NO: 653 -9.8 -21 61.2 -11.2 0 -3.5 ACTTATGCTATATCTAGAAA
695 -9.8 -17.2 55 -7.4 0 -6.2
SEQ ID NO: 654 TATTTTATTTCCCACTCCCA
1047
SEQ ID NO: 655 -9.8 -25.2 71 -15.4 0 -0.7 ATTCTAACCATTTTCAACAA
1491 -9.8 -18.2 56 -8.4 0 -1.2
SEQ ID NO: 656
1502 CATAGGTTTTTATTCTAACC
SEQ ID NO: 657 -9.8 -19.5 60.4 -8.5 -1.1 -4.6 ATAAGTTCTTCACTTCAAAT
1840 -9.8 -17.7 56.3 -6.8 -1 -3.6
SEQ ID NO: 658 GCCTTCCACACACATTCACA
1916 -9.8 -26.7 74.2
SEQ ID NO: 659 -16.9 0 -2
333 TCTTCACCAAAAGGATCCTC
-9.7 -22.8 65.9 -12.1 0 -9.9
SEQ ID NO: 660 GCAGTTGCAGGTCTCTCTGC
400 -9.7 -28.4 85.2 -16.3 -2.4 -8.2
SEQ ID NO: 661
490 AACAAATCTGTTGGAAGACT -9.7 -18.2 56 -6.9 -1.6 -5
SEQ ID NO: 662
641 CGAAAATAGAGCCTTCTCTC -9.7 -21.4 62.7 -10 -1.7 -5.4
SEQ ID NO: 663 AGATACAGGTAACCCGGGAA
1255 -9.7 -23.9 66.2 -12.7 -0.9 -10.7
SEQ ID NO: 664
1424 AAGATGACTTGCACTAACAC -9.7 -19.4 58.8 -9.2
SEQ ID NO: 665 -0.1 -5
1654 TTAAATTGAAAATTCACCGA -9.7 -15.8 49.9 -4.8 -1.2 -5.7
SEQ ID NO: 666
1701 AAATTGATTCTTCTTTTACA -9.7 -17 54.8
SEQ ID NO: 667 -7.3 0 -3.2
164 TTTTGCACTCACTGCTGTCA -9.6 -25.1 74 -13.6
SEQ ID NO: 668 ■ -1.9 -5
389 TCTCTCTGCAATCCATCCCG -9.6 -28 76.3 -18.4
SEQ ID NO: 669 0 -4.9
466 TACTGAATATTGGAAGAAGG -9.6 -16.7 53 -7.1
SEQ ID NO: 670 0 -4
1004 CTTAAGTCTTCATTCCATAT -9.6 -20.6 63.2 -11
SEQ ID NO: 671 0 -4.8
1048 ATATTTTATTTCCCACTCCC -9.6 -24.5 69.8 -14.9
SEQ ID NO: 672 0 -1.8
1122 ACTTTTCCCAAAGCCAAAAA -9.6 -20.8 58.9 -9.8
SEQ ID NO: 673 -1.3 -4.2
1222 CTTTTGAAATTGCTCTCAGT -9.6 -20.8 63.4 -11.2
SEQ ID NO: 674 0 -3.6
1340 ACTTCTTAGATTTATCTCTG -9.6 -19.4 61.9
SEQ ID NO: 675 -8.9 -0.7 -5.1
1547 ATAATAAATTTATCATGCCT -9.6 -17 53.4 -6.9
SEQ ID NO: 676 0 -8.1
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total formTm of struc- molecular molecular position binding ation Duplex ture oligo oligo oligo
ATCTTGTTCTTTTTTATTGA
1998 -9.6 -18.9 60.7 -9.3 0 -2.3
-,-, GAGGGCAGTCCACCGCATAA - - ,. , ,, , 17 „ 1 c ,
137 SEQ ID O:678 _9-5 ~28-3 76-3 ~17-7 _1 ~5-6
149 "9-5 -25.2 75.2 -15.7 0 -6
,-_ ATTAGAAGGCTGACACCTCA _ -. „, , C7 7 -, n , . ..
310 SEQ ID NO:680 _9-5 ~23-3 67"7 "13 ~0-6 ~4-3
316 ^^"^^^ "9-5 -26.4 73.1 -16.9 0 -3.7
474 GAC^GGT^GAfXAΥ,VG -9.5 -18.8 58.5 -9.3 0 -4.6 SEQ ID NO: 682
TGCATCACAATTTGGATCTT 2 63 5 -11 7 0 -5 4
11 SEQ ID NO: 683 ^ * S ^^ ^^ ll ' ' U S ' 4
740 TGGATCCACCATGCATCACA _g g _26.3 72.8 -15.5 -1.1 -9.6 SEQ ID NO: 684
1236 ACT GA CAGCAG G™TG -9.5 -24.3 70.9 -14.8 0 -4.5
14g4 TATTCT^^TOO^A _g-5 _17 9 56_2 _8 4 Q _1 4
1520 ^^∞™^^ -9.5 -18.1 56.2 -8.6 0 -4.8
1585
"9.5 -18.3 56.6 -7.8 -0.9 -4.3
1788 ΨAGT^GAG^G™° -9.5 -21.6 65.6 -11.1 -0.9 -8.4
151 ∞T(gA^N^0^ -9-4 -27.2 80.6 -17.1 -0.4 -7.4
636 ATAGAGGC^G,VGAGAAA -9.4 -22 65.9 -10.9 -1.7 -6.4 SEQ ID NO. by I
730 ATGC SAE?QGA IGDA^ NO™: 693?TCT - . -21.1 63.1 -11.7 0 -6.4
1130 A s™G^^Q g C 9 C 4 CAAA -9.4 -19.8 59.5 -9.8 -0.3 -3.7
1153 CCTTCAGGGGTTTTCTGGCT _g_4 _27 7g_2 _lg_7 _Q_7 _4_2 SEQ ID NOifoy
1191 TGTTAG^CAAA™GG TAA -9.4 -18.1 56.2 -8.7 0 -4.5
1519 TGAA AGC™AG G^CAT -9.4 -18 55.9 -8.6 0 -4.8 SEQ ID NO .
TCTGTTGCTCATTTTTTGAC Q 1 7 ,, Q ln n 1 ., ,
1603 SEQ ID NO: 698 ~9-4 ~21-7 66"9 _11 " 8 "°-1 "3 " 3
-„„c CTGTTTGTGCTAAGATTCTT Q . i n ec c n o n c ι
1775 SEQ ID NO:699 "9" ",21-3 65-5 -11-9 ° ~5
1895 CTC~C™™ -9.4 -24.1 69.5 -11.3 -0.5 -15
GCTGCCTCCGGCTCGGCTCT _34 g - _2 χ _χQ
41 SEQ ID NO:701 9 " ^^ 9i-1 "-b A ' l XU
ATAATTATTGCTCCAGGCGG Q -. , 7 ,-, „ 1 . - . Q ,
121 SEQ ID NO:702 "9-3 ~23-7 °7-2 ~12-9 _1-4 "9-3
TTTGCACTCACTGCTGTCAC . , R 9 7/I - 1 I q R
163 SEQ ID NO: 703 -"9-3 _25'2 74"3 ~1 _1-9 "5 572 ~9-3 -29'1 79'5 -19-1 -°-5 ~5-8
580 CAΥTA^GGGAGAGCGGGCAG -9.3 -27.8 73.2 -15.7 -2.8 -10.1
SEQ Λ.U NO I /U
9 Q5C6, GAAC „T„A„AT _T.-T,G „A„C.T„C„A,C.TGC -9 Q.3 - - 11 q9. q9 c 6n0.4 /ι - i1n0. c6 n 0 - <2D.77
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo GTCTTCATTCCATATCCCAA
999 -9.3 -25 71.5 -15.7
SEQ ID NO: 707 0 -2 1045 TTTTATTTCCCACTCCCACC -9.3 -27.7 75.6 -18.4 0 -0.7
SEQ ID NO:708 CCGAAGTCACAGCACTTATG 1638 -9.3 -23.3 66.5 -13.3 -0.5 -4.6
SEQ ID NO: 709 TTATTGCTCCAGGCGGCCAC
117 -9.2 -29.4 79.4 -19 -0.7 -10.2
SEQ ID NO: 710 CTCGGCAGCAGCCACAGTCG
215 -9.2
SEQ ID NO: 711 -30.1 80.9 -17.7 -3.2 -9.8 GGCTGACACCTCAGCCCCGG
303 -9.2 -33.4 85.2 -18.8 -5.3 -18.2
SEQ ID NO: 712 CCTTCTCTCAGAAATCACAG
630 -9.2 -21.9 65.2 -11.9 -0.6 -4.3
SEQ ID NO: 713 CATGCATCACAATTTGGATC
731 -9.2 -20.9 62.4 -11.7
SEQ ID NO: 714 0 -6.6 TACTTTTTGTTTTCTGGATC
754 -9.2 -20.2 63.8 -11 -4.1
SEQ ID NO: 715 0 CCTACTTTTTGTTTTCTGGA
756 -9.2 -22.7 68.2 -13.5
SEQ ID NO:716 0 -2.7 CTACCAAGGAAGGGCTAAAT 1066 -9.2 -21.3 61.3 -12.1
SEQ ID NO: 717 0 -3.8 CAGGGGTTTTCTGGTTGTTT 1149 -9.2 -25 75.3 -15.3 -0.1 -3.6
SEQ ID NO: 718 CACACAAACCACCAGTGGGT 1365 -9.2 -25.7 70.3 -15.2 -1.2 -9
SEQ ID NO: 719 ACACACATTCACAACTCTGT 1909 -9.2 -21.7 64.6 -12.5 0 -2.5
SEQ ID NO: 720 TGCCTCCGGCTCGGCTCTCC
39 -9.1
SEQ ID NO: 721 -34.6 90 -23.4 -2.1 -10
582 CTCATTACGGGAGACCCGGC -9.1
SEQ ID NO: 722 -28.4 75.2 -15.6 -3.7 -11
584 TCCTCATTACGGGAGACCCG -9.1
SEQ ID NO: 723 -27.8 73.7 -15.4 -3.3 -10.5 TCCTAAAATGTTGGCTGTGT
673 -9.1 -22.5 65.9 -13.4 0 -3.9
SEQ ID NO: 724 TATCCCAACATTAATGTACA
987 SEQ ID NO:725 -9.1 -19.9 59.1 -9.5 -0.2 -10.5 CAAATTTCCATAAGCTTCAA 1184 -9.1 -18.8 56.8 -9.7 0 -6.8
SEQ ID NO:726 TGCTCTCAGTTCAAAGCTGT 1212 SEQ ID NO: 727 -9.1 -24 71.8 -13.5 -1.3 -6.2 TTCTAACCATTTTCAACAAA 1490 SEQ ID NO: 728 -9.1 -17.5 54.2 -8.4 0 -1.9 GAAAACCTTATAGAGTCATA 1518 SEQ ID NO: 729 -9.1 -17.7 55.4 -8.6 0 -4.8 CATTTTTTGAAATCCAGAGT 1584 SEQ ID NO:730 -9.1 -19.3 59 -9.2 -0.9 -4.3 1842 AAATAAGTTCTTCACTTCAA
SEQ ID NO:731 -9.1 -17 54.4 -6.8 -1 -4.2 1894 TCTGTTGGCCAACTTCAAGA
SEQ ID NO: 732 -9.1 -23.8 68.9 -11.3 -0.5 -15 CAGCTGCCTCCGGCTCGGCT
43 SEQ ID NO: 733 -9 -34.3 88.6 -22.9 -2.4 -9.9 GGGCAGTCCACCGCATAATT
135 SEQ ID NO: 734 -9 -27.8 75 -17.7 -1 -4.9 GTTGAGGGCAGTCCACCGCA
140 SEQ ID NO: 735 -9 -30.6 83 -20.5 -1 -4.8 CTGTCACAGTGTTGAGGGCA
150 SEQ ID NO: 736 -9 -26.1 76.9 -17.1 0 -6
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position inding ation Du lex ture oligo oligo oligo 629 CTTCTCTCAGAAATCACAGC -9 -21.7 65.6 -11.9
SEQ ID NO: 737 -0.6 -3.9 747 TGTTTTCTGGATCCACCATG -9 -24.6 70.9 -14.2 -1.2 -9.7
SEQ ID NO: 738 757 TCCTACTTTTTGTTTTCTGG -9 -22.5 68.5 -13.5 0 -2.9
SEQ ID NO: 739 949 TTTGACTCACTGCGGTCTTC -9 -24.9 73.1 -14.9 -0.9 -6.2
SEQ ID NO: 740 1225 AGCCTTTTGAAATTGCTCTC -9 -22.7 67 -13.7 0 -5.4
SEQ ID NO: 741 1252 TACAGGTAACCCGGGAACTA
-9 -24.1 66.6 -13.7 -1.1 -10.2
SEQ ID NO: 742 1366 ACACACAAACCACCAGTGGG -9 -24.7 67.8 -14.4 -1.2 -9
SEQ ID NO: 743 TCTAACCATTTTCAACAAAT 1489 -9 -17.4 53.9 -8.4 0 -2.5
SEQ ID NO: 744 1507 AGAGTCATAGGTTTTTATTC -9 -19.6 63.2 -10.6 0 -4.8
SEQ ID NO: 745 1623 TTATGTTTAAATAAGGTCCC -9 -19.3 58.8 -10.3 0 -4.3
SEQ ID NO: 746 AGGGCAGTCCACCGCATAAT 136 -8.9 -27.7 75 -17.7 -1 -5.6
SEQ ID NO: 747 TGCAGATACCAAACTCTTCA 347 -8.9 -21.9 64.1 -13 0 -4.7
SEQ ID NO: 748 CCAACATTAATGTACATCAA 983 -8.9 -18.2 55.4 -8 -0.2 -10.5
SEQ ID NO: 749 ATCTTCTCCTGCTCTTAAGT 1017 -8.9 -24.3 73.2 -15.4 0 -6
SEQ ID NO: 750 TTGCTCTCAGTTCAAAGCTG 1213 -8.9 -22.9 68.7 -12.8 -1.1 -5.6
SEQ ID NO: 751 1525 GATGTTTGAAAACCTTATAG -8.9 -17.1 53.9 -7.7 -0.1 -5.7
SEQ ID NO: 752 1702 AAAATTGATTCTTCTTTTAC -8.9 -15.6 51.6 -6.7 0 -3.2
SEQ ID NO: 753 AATAAACATGTCCTTTTAAA 1973 -8.9 -15.6 50.4 -6.7 0 -6.4
SEQ ID NO: 754 ATTGAACAATAATAAACATG 1983 -8.9 -12.4 43.9 -3.5 0 -5.3
SEQ ID NO: 755 GGCGGCCACCAGGTGTGCAG 106 -8.8 -32.5 86.1 -21.1 -2.5 -12.5
SEQ ID NO: 756 CCATCCATGCCTGAGACTGT 270 SEQ ID NO: 757 -8.8 -28 76.9 -19.2 0 -3.8 TTCTTCTCTCACAATATTGC 544 -8.8 -21 64.8 -11.6 0 -8.5
SEQ ID NO: 758 TTTGTTTTCTGGATCCACCA 749 SEQ ID NO: 759 -8.8 -24.8 71.8 -14.7 -1.1 -9.7 TCTCCTGCTCTTAAGTCTTC 1013 -8.8 -24.7 75.1 -15.9 0 -6
SEQ ID NO: 760 CATCTTCTCCTGCTCTTAAG 1018 SEQ ID NO:761 -8.8 -23.8 70.9 -15 0 -5.4 TTTTCTGGTTGTTTTATTTT 1143 -8.8 -19.6 62.6 -10.8 0 -1.5
SEQ ID NO: 762 GCTCTCAGTTCAAAGCTGTT 1211 SEQ ID NO: 763 -8.8 -24.1 72.4 -14.4 -0.7 -5.4 CAGCCTTTTGAAATTGCTCT 1226 SEQ ID NO: 764 -8.8 -23 66.7 -13.7 -0.1 -5.5 CCCGGGAACTACATCAGCAG 1243 SEQ ID NO: 765 -8.8 -26.4 71.5 -16.8 -0.2 -9.2 TGTTTCCTATGCCCCAGAAC 1283 SEQ ID NO: 766 -8.8 -27 74.1 -18.2 0 -3
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position inding ation Duplex ture oligo oligo oligo
1755 TCAAATATACTCCTAATTCC
-8.8
SEQ ID NO: 767 -19 57.8 -10.2 0 -2.9
72 GTCAGCAGCAAGACGCTCTT
-8.7 -26.3 75.2 -16.3
SEQ ID NO: 768 -1.2 -7.9
666 ATGTTGGCTGTGTGTTGAAC
-8.7 -23 69.1 -14.3
SEQ ID NO:769 0 -4
696 TACTTATGCTATATCTAGAA
-8.7 -17.6 56.3
SEQ ID NO: 770 -8.9 0 -6.2
886 GATTACCTAAATTGCATTTT
-8.7 -18.7 57.2
SEQ ID NO: 771 -10 0 -6 1129 TATTTTGACTTTTCCCAAAG -8.7 -19.7 59.3
SEQ ID NO: 772 -9.8 -1.1 -5 1258 TTCAGATACAGGTAACCCGG
-8.7 -24
SEQ ID NO: 773 67.5 -14.3 -0.9 -5.8 1777 TCCTGTTTGTGCTAAGATTC -8.7 -22.7
SEQ ID NO: 74 68.6 -14 0 -3.6 1965 TGTCCTTTTAAAACAAAACC -8.7 -17.4
SEQ ID NO: 775 53.3 -8.2 -0.1 -6
158 ACTCACTGCTGTCACAGTGT
-8.6 -25.6 76.5
SEQ ID NO: 776 -13.6 -3.4 -9.7
750 TTTTGTTTTCTGGATCCACC -8.6 -24.2
SEQ ID NO: 777 71 -14.7 0 -9.7
878 AAATTGCATTTTTAGTTCTT -8.6 -18 57.2
SEQ ID NO: 778 -9.4 0 -5.8
887 AGATTACCTAAATTGCATTT
-8.6 -18.6
SEQ ID NO: 779 57.1 -10 0 -5.3
900 CTGTCTCCATGTAAGATTAC -8.6 -21.3 64.8
SEQ ID NO: 780 -12.7 0 -5.5
950 ATTTGACTCACTGCGGTCTT -8.6 -24.5 71.4
SEQ ID NO: 81 -14.9 -0.9 -6.2 1144 GTTTTCTGGTTGTTTTATTT -8.6 -20.7
SEQ ID NO: 782 65.7 -12.1 0 -1.5 1289 TGTATGTGTTTCCTATGCCC -8.6
SEQ ID NO:783 -26.3 75.5 -17.7 0 -3 1414 GCACTAACACATTTATTTAT
-8.6 -18.2
SEQ ID NO: 784 56.8 -9.6 0 -3.4 1774 TGTTTGTGCTAAGATTCTTT -8.6
SEQ ID NO: 785 -20.5 63.8 -11.9 0 -5.6 1984 TATTGAACAATAATAAACAT
-8.6 -12.1 43.4 -3.5
SEQ ID NO:786 0 -6.5
268 ATCCATGCCTGAGACTGTGC -8.5 -27.1
SEQ ID NO: 787 76.4 -18.6 0 -4.2
492 GAAACAAATCTGTTGGAAGA
-8.5 -17 53.2 -6.9
SEQ ID NO:788 • -1.5 -5
494 GAGAAACAAATCTGTTGGAA
-8.5
SEQ ID NO:789 -17 53.2 -6.9 -1.5 -5
571 AGACCCGGCAGCATTCTCTT
-8.5 -28.6 78.6 -20.1
SEQ ID NO:790 0 -6.3 ATTTAACCATTTCCTCATTA
595 -8.5 -20.5
SEQ ID NO: 91 61.5 -12 0 -2.4
882 ACCTAAATTGCATTTTTAGT
-8.5 -19.3
SEQ ID NO: 792 59 -9.6 -0.9 -9.6 TTCCTTCAGGGGTTTTCTGG 1155 -8.5 -26.2
SEQ ID NO: 793 77.3 -16.8 -0.7 -5.7 CTGTTTGTTACTCAAATTTC 1196 -8.5
SEQ ID NO: 794 -18.7 59.1 -8.6 -1.6 -4.6 1339 CTTCTTAGATTTATCTCTGA -8.5 -19.8
SEQ ID NO: 795 62.8 -10.4 -0.7 -5.1 AAAACCTTATAGAGTCATAG 1517 -8.5 -17.1
SEQ ID NO: 796 54.3 -8.6 0 -4.8
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position binding ation Duplex ture oligo oligo oligo
1615 AAATAAGGTCCCTCTGTTGC
-8.5 -23.7 68.4 -15.2 0 -4.2
SEQ ID NO: 797 1843 TAAATAAGTTCTTCACTTCA
-8.5 -17.4 55.8 -8 -0.7 -4.2
SEQ ID NO: 798 269 CATCCATGCCTGAGACTGTG -8.4 -26 73.2 -17.6 0 -4.2
SEQ ID NO: 799 361 GTAGGGACAGTCTTTGCAGA -8.4 -24.6 74 -16.2 0 -5.9
SEQ ID NO: 800 402 TGGCAGTTGCAGGTCTCTCT -8.4 -27.8 83.1 -18.5 -0.7
SEQ ID NO: 801 -6.6 667 AATGTTGGCTGTGTGTTGAA
SEQ ID NO: 802 -8.4 -22.1 66.1 -13.7 0 -3.7 733 ACCATGCATCACAATTTGGA
-8.4 -22.7 65.2 -13.1 -1.1 -6.6
SEQ ID NO: 803 786 AGTCATATGGATGTTATGGA
-8.4 -20.6 63.5 -11.5 -0.4 -6.2
SEQ ID NO: 804 1064 ACCAAGGAAGGGCTAAATAT
-8.4 -20.4 59.5 -12 0 -3.8
SEQ ID NO: 805 1209 TCTCAGTTCAAAGCTGTTTG
-8.4 -21.5 66 -11.7 -1.3 -6.8
SEQ ID NO: 806 227 CTGCAGCGCACACTCGGCAG -8.3 -29.4 78.6 -19.6 -1.4 -8.1
SEQ ID NO: 807 264 ATGCCTGAGACTGTGCGGTA
-8.3 -26.9 75.3 -18 -0.3 -5.4
SEQ ID NO: 808 348 TTGCAGATACCAAACTCTTC
SEQ ID NO: 809 -8.3 -21.3 63.3 -13 0 -5.2 575 CGGGAGACCCGGCAGCATTC -8.3 -30.1 78.7 -19 -2.8 -11
SEQ ID NO: 810 884 ' TTACCTAAATTGCATTTTTA -8.3 -17.9 55.7 -9.6 0 -6.2
SEQ ID NO: 811 951 AATTTGACTCACTGCGGTCT -8.3 -23.7 68.7 -14.9 -0.2 -6.2
SEQ ID NO: 812 998 TCTTCATTCCATATCCCAAC -8.3 -24 68.8 -15.7 0 -2
SEQ ID NO: 813 1063 CCAAGGAAGGGCTAAATATT -8.3 -20.3 59.4 -12 0 -4.4
SEQ ID NO: 814 1206 CAGTTCAAAGCTGTTTGTTA -8.3 -20.8 63.9 -11.6 -0.8 -6.2
SEQ ID NO: 815 1505 AGTCATAGGTTTTTATTCTA -8.3 -19.6 63 -11.3 0 -2.4
SEQ ID NO: 816 1700 AATTGATTCTTCTTTTACAA -8.3 -17 54.8 -8.7 0 -3.3
SEQ ID NO: 817 1839 TAAGTTCTTCACTTCAAATA -8.3 -17.4 55.8 -8 -1 -3.6
SEQ ID NO: 818 272 TGCCATCCATGCCTGAGACT -8.2 -28.6 77.7 -20.4 0 -4.2
SEQ ID NO: 819 295 CCTCAGCCCCGGGCCACACT -8.2 -35.5 88.1 -25.9 -1 -10.4
SEQ ID NO: 820 433 TTTTCCCGTCCCCCTGTCAC -8.2 -32.5 85 -24.3 0 -2.6
SEQ ID NO: 821 732 CCATGCATCACAATTTGGAT -8.2 -22.5 64.6 -13.8 -0.2 -6.6
SEQ ID NO: 822 741 CTGGATCCACCATGCATCAC -8.2 -26.5 73.6 -16.9 -1.2 -9.7
SEQ ID NO: 823 945 ACTCACTGCGGTCTTCAGCT -8.2 -27.5 79.1 -18.6 -0.5 -6.2
SEQ ID NO: 824 1126 TTTGACTTTTCCCAAAGCCA -8.2 -24.4 68.1 -15.5 -0.4 -6
SEQ ID NO: 825 1135 TTGTTTTATTTTGACTTTTC -8.2 -18 58.5 -9.8 0 -2.5
SEQ ID NO: 826
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo
ATAAACATGTCCTTTTAAAA
1972 -8.2 -15.6 50.4 -7.4 0 -6.9
SEQ ID NO: 827 ATGTTTCCCAGCTGCCTCCG 51 -8.1 -31.1 82.6 -22.5 0 -8.1
SEQ ID NO: 828 GCCATCCATGCCTGAGACTG 271 -8.1 -28.6 77.7 -20.5 0 -4.2
SEQ ID NO: 829 AAACAAATCTGTTGGAAGAC 491 -8.1 -16.6 52.5 -6.9 -1.5 -5
SEQ ID NO: 830 GGGAGACCCGGCAGCATTCT 574 -8.1
SEQ ID NO: 831 -30.2 80.9 -20.7 -1.3 -8.1 TCCATGTAAGATTACCTAAA 895 -8.1
SEQ ID NO: 832 -19.1 57.6 -11 0 -4.3 TACCAAGGAAGGGCTAAATA 1065 -8.1 -20.1 59 -12 0 -3.8
SEQ ID NO: 833 CTAACACATTTATTTATAAA 1411 -8.1 -13.8 47.2 -4.8 -0.7 -6.1
SEQ ID NO: 834 ATTTTCATACCTTAAATTGA 1665 -8.1 -17.3 54.6 -9.2 0 -3.2
SEQ ID NO: 835 CACAACTCTGTTGGCCAACT 1900 -8.1 -24.7 69.6 -13.2 -1.8 -15
SEQ ID NO: 836 TTTTTTATTGAACAATAATA 1989 -8.1 -13.1 45.9 -4.1 -0.6 -9
SEQ ID NO: 837 CTTTTTTATTGAACAATAAT 1990 -8.1 -14.3 48.3 -5.5 -0.3 -8.7
SEQ ID NO: 838 1992 TTCTTTTTTATTGAACAATA -8.1
SEQ ID NO: 839 -15.5 51.4 -7.4 0 -6.7 52 CATGTTTCCCAGCTGCCTCC -8 -31 84.2 -22.5 0 -8.1
SEQ ID NO: 840 TCCCCATTAGAAGGCTGACA 315 -8 -26.2 72.3 -18.2 0 -3.7
SEQ ID NO: 841 CGTAGGGACAGTCTTTGCAG 362 -8 -24.8 72.4 -16.3 -0.1 -6
SEQ ID NO: 842 546 ACTTCTTCTCTCACAATATT -8 -20.3 63.1 -12.3 0 -3.8
SEQ ID NO: 843 AACCATTTCCTCATTACGGG 591 -8 -24 67.2 -16 0 -3.6
SEQ ID NO: 844 596 GATTTAACCATTTCCTCATT -8 -21.4 63.4 -13.4 0 -2.4
SEQ ID NO: 845 1548 GATAATAAATTTATCATGCC -8 -16.7 52.8 -6.9 -1.8 -8.1
SEQ ID NO: 846 1718 GACATGTTTTCTGCTGAAAA -8 -19.5
SEQ ID NO: 847 59.2 -9.2 -2.3 -11.2 1985 TTATTGAACAATAATAAACA -8 -12.2 43.7 -3.5 • -0.3 -8.5
SEQ ID NO: 848 14 TGGTCTTTGCTGGTGGGAAG -7.9 -25.3 74 -17.4 0 -3.6
SEQ ID NO: 849 58 GCTCTTCATGTTTCCCAGCT -7.9 -28.4 81.7 -20.5 0 -4.7
SEQ ID NO: 850 61 GACGCTCTTCATGTTTCCCA -7.9 -27.3 76.4 -19.4 0 -4.7
SEQ ID NO: 851 165 CTTTTGCACTCACTGCTGTC -7.9 -25.3 74.9 -16.1 -1.2 -5
SEQ ID NO: 852 216 ACTCGGCAGCAGCCACAGTC -7.9 -29.5 82 -18.4 -3.2 -9.8
SEQ ID NO: 853 351 TCTTTGCAGATACCAAACTC -7.9 -21.3 63.3 -12.8 -0.3 -5.2
SEQ ID NO: 854 493 AGAAACAAATCTGTTGGAAG -7.9 -16.4 52.1
SEQ ID NO: 855 -6.9 -1.5 -5 495 AGAGAAACAAATCTGTTGGA -7.9 -17.7 55.1 -8.7 -1 -4.4
SEQ ID NO: 856
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo CAACTTCTTCTCTCACAATA
548 -7.9 -20.2 61.9 -12.3 0 -1.2
SEQ ID NO: 857 CTTTCACAACTTCTTCTCTC
554 -7.9 -22 67.8 -14.1 0 -0.7
SEQ ID NO: 858 TTATTCTAACCATTTTCAAC 1493 -7.9 -18 56.4 -10.1 0 -1.2
SEQ ID NO: 859 ACCTTATAGAGTCATAGGTT 1514 -7.9 -21.7 66.7 -13.1 -0.5 -5.7
SEQ ID NO: 860 TTTTTATTGAACAATAATAA 1988 SEQ ID NO: 861 -7.9 -12.3 44.2 -3.5 -0.6 -9 AGACGCTCTTCATGTTTCCC
62 SEQ ID NO: 862 -7.8 -26.6 75.7 -18.8 0 -6 AAATGTTGGCTGTGTGTTGA
668 SEQ ID NO: 863 -7.8 -22.1 66.1 -14.3 0 -3.7 TTGTTTTCTGGATCCACCAT
748 SEQ ID NO: 864 -7.8 -24.7 71.4 -15.5 -1.2 -9.7 ATTACCTAAATTGCATTTTT
885 -7.8 -18.2 56.3 -10.4 0 -6.2
SEQ ID NO: 865 AAGATTACCTAAATTGCATT
888 -7.8 -17.8 54.9 -10 0 -5.3
SEQ ID NO: 866 TTTATTTCCCACTCCCACCC 1044 -7.8 -29.6 78.6 -21.8 0 -0.7
SEQ ID NO: 867 TAACCCGGGAACTACATCAG 1246 -7.8 -23.1 64.3 -13.9 -0.2 -10.7
SEQ ID NO: 868 TACACACACAAACCACCAGT 1369 SEQ ID NO: 869 -7.8 -22.9 64.3 -15.1 0 -2.6 GTCATAGGTTTTTATTCTAA 1504 -7.8 -18.9 60.5 -11.1 0 -2.6
SEQ ID NO: 870 ATACTTCTGAGATATTTCCT 1817 -7.8 -20.6 63.4 -12.8 0 -3.8
SEQ ID NO: 871 GGCAGTCCACCGCATAATTA
134 -7.7 -26.3 72.1 -17.7 -0.7 -5
SEQ ID NO: 872 ACTGAATATTGGAAGAAGGG
465 -7.7 -18.2 56 -10.5 0 -4.6
SEQ ID NO: 873 TTGGCTGTGTGTTGAACAAT
663 -7.7 -21.8 64.8 -13.2 -0.7 -7.8
SEQ ID NO: 874 TAAATTGCATTTTTAGTTCT
879 -7.7 -17.6 56.3 -9.9 0 -6.2
SEQ ID NO: 875 CCATGTAAGATTACCTAAAT
894 -7.7 -18.7 56.4 -11 0 -4.9
SEQ ID NO: 876 ' TGACTTTTCCCAAAGCCAA 1125 SEQ ID NO: 877 -7.7 -23.6 65.8 -14.5 -1.3 -6.1 1227 GCAGCCTTTTGAAATTGCTC -7.7 -23.9 68.9 -15.5 -0.4 -5.5
SEQ ID NO: 878 CAGCAGCCTTTTGAAATTGC 1229 SEQ ID NO: 879 -7.7 -23.3 66.9 -14.9 -0.4 -4.9 ACAGCACTTATGTTTAAATA 1630 SEQ ID NO: 880 -7.7 -17.7 55.8 -10 0 -5.4 AAGTTCTTCACTTCAAATAA 1838 SEQ ID NO: 881 -7.7 -17 54.4 -8.4 -0.7 -3.3 ACAGCTTATGCAGCTTTACA 1943 SEQ ID NO: 882 -7.7 -23.4 69.3 -13.7 -2 -6.9
120 TAATTATTGCTCCAGGCGGC
SEQ ID NO: 883 -7.6 -25.5 71.3 -16.4 -1.4 -7.2
152 TGCTGTCACAGTGTTGAGGG
SEQ ID NO: 884 -7.6 -25.4 75.6 -17.1 -0.4 -5.7
214 TCGGCAGCAGCCACAGTCGT
SEQ ID NO: 885 -7.6 -30.4 82.5 -19.6 -3.2 -9.8
344 AGATACCAAACTCTTCACCA
SEQ ID NO: 886 -7.6 -22.3 64.4 -14.7 0 -2.6
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo CAGATACCAAACTCTTCACC
345 -7.6 -22.3 64.4 -14.7 0 -2.6
SEQ ID NO: 887 ATCACGAAAATAGAGCCTTC
645 -7.6 -20.1 59.4 -12.5 0 -3.5
SEQ ID NO: 888 TCTACATGCATTCGAATATT
828 -7.6 -19.4 58.8 -11.2 0 -8.4
SEQ ID NO: 889 CAAATATACTCCTAATTCCA 1754 -7.6 -19.3 57.7 -11.7 0 -2.9
SEQ ID NO: 890 1849 AATTCTTAAATAAGTTCTTC -7.6 -15.2 51.1 -7.6 0 -4.9
SEQ ID NO: 891 GACACCTCAGCCCCGGGCCA
299 -7.5 -35.2 87.6 -25.8 -1.8 -11.2
SEQ ID NO: 892 ACAACTTCTTCTCTCACAAT
549 -7.5 -20.7 63 -13.2 0 -0.9
SEQ ID NO: 893 TGTTGGCTGTGTGTTGAACA
665 -7.5 -23.7 70.3 -15.5 -0.5 -5.8
SEQ ID NO: 894 TTACATGTACTTATGCTATA
703 -7.5 -18.6 58.7 -10.6 0 -7.7
SEQ ID NO: 895 ATCTACATGCATTCGAATAT
829 -7.5 -19.3 58.5 -11.2 0 -8.4
SEQ ID NO: 896 GTGTTTCCTATGCCCCAGAA 1284 -7.5 -28 76.8 -20.5 0 -3
SEQ ID NO: 897 ATGTTTGAAAACCTTATAGA 1524 -7.5 -17.1 53.9 -9.1 -0.1 -5.7
SEQ ID NO: 898 TTCTTCACTTCAAATAAAAT 1835 -7.5 -7.6
SEQ ID NO: 899 -15.1 49.8 0 -1.2 CAGCTTATGCAGCTTTACAT 1942 -7.5 -23.2 68.6 -13.7 -2 -6.9
SEQ ID NO: 900 CTGCCTCCGGCTCGGCTCTC
40 -7.4 -33.5 88.7 -24 -2.1 -10
SEQ ID NO: 901 GTCCACCGCATAATTATTGC
130 -7.4 -24.5 68.5 -16.4 -0.4 -7.5
SEQ ID NO: 902 TGCGGTAGCAAGTTTCTCCC
251 -7.4 -27.6 77.3 -18.6 -1.6 -5.1
SEQ ID NO: 903 CTTTGCAGATACCAAACTCT
350 -7.4 -21.8 63.7 -13.8 -0.3 -5.2
SEQ ID NO: 904 CTCTCTGCAATCCATCCCGA
388 -7.4 -28.2 75.9 -20.8 0 -4.7
SEQ ID NO: 905 TTTCCCGTCCCCCTGTCACA
432 -7.4 -33.1 85.5 -25.7 0 -2.5
SEQ ID NO-.906 ACGAAAATAGAGCCTTCTCT
642 -7.4 -21.2 61.9 -12.2 -1.5 -6.5
SEQ ID NO: 907 GCATCACAATTTGGATCTTC
728 -7.4 -21.6 65.1 -14.2 0 -5.4
SEQ ID NO: 908 CTTTTTGTTTTCTGGATCCA
752 -7.4 -23 69 -14.7 0 -9.6
SEQ ID NO -.909 CCTAAATTGCATTTTTAGTT
881 -7.4 -19.2 58.8 -10.6 -0.9 -9.6
SEQ ID NO: 910 TAAGATTACCTAAATTGCAT
889 -7.4 -17.4 54.1 -10 0 -5.3
SEQ ID NO: 911 TGTCTCCATGTAAGATTACC
899 -7.4 -22.4 66.6 -15 0 -5.5
SEQ ID NO: 912 TAAGTCTTCATTCCATATCC 1002 -22 66.3 -14.6
SEQ ID NO: 913 -7.4 0 -2.7 CTTTTCCCAAAGCCAAAAAA 1121 SEQ ID NO: 914 -7.4 -19.9 56.8 -11.8 -0.4 -3.4 CTACATCAGCAGCCTTTTGA 1235 SEQ ID NO: 915 -7.4 -24.7 71.6 -17.3 0 -4.5 ACACAAACCACCAGTGGGTA 1364 SEQ ID NO: 916 -7.4 -24.7 68.7 -16 -1.2 -9
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo
CACACACAAACCACCAGTGG
1367 -7.4 -24.2 66.6 -15.8 -0.9 -8.5
SEQ ID NO: 917 AATAAGGTCCCTCTGTTGCT 1614 -7.4 -25.3 72.6 -17.9 0 -4.7
SEQ ID NO: 918 1622 TATGTTTAAATAAGGTCCCT -7.4 -20.1 60.3 -12.7 0 -5.1
SEQ ID NO: 919 GAAGTCACAGCACTTATGTT 1636 -7.4 -21.8 66.1 -13.7 -0.5 -4.6
SEQ ID NO: 920 1723 AAGTTGACATGTTTTCTGCT -7.4 -21.6 65.9 -14.2 0 -7.1
SEQ ID NO: 921 TTTTAAAACAAAACCTAACA 1960 -7.4 -13.7 46.1 -5.8 -0.1 -6
SEQ ID NO: 922 42 AGCTGCCTCCGGCTCGGCTC -7.3 -34 89.6 -24.3 -2.4 -10
SEQ ID NO: 923 GGGACAGTCTTTGCAGATAC 358 -7.3 -23.6 70.6 -15.8 -0.2 -6
SEQ ID NO: 924 CACAACTTCTTCTCTCACAA 550 -7.3 -21.4 64.3 -14.1 0 -0.6
SEQ ID NO: 925 GACCCGGCAGCATTCTCTTT 570 -7.3 -28.7 78.6 -21.4 0 -6.3
SEQ ID NO: 926 CTCTCAGAAATCACAGCCGG 626 -7.3 -24.3 68.2 -17 0 -6.2
SEQ ID NO: 927 TACCTAAATTGCATTTTTAG 883 -7.3 -17.8 55.6 -9.6 -0.6 -9.2
SEQ ID NO: 928 901 CCTGTCTCCATGTAAGATTA -7.3 -23.1 68 -15.8 0 -5.5
SEQ ID NO: 929 AGCAGCCTTTTGAAATTGCT 1228 -7.3 -23.5 67.6 -14.9 -1.2 -6.2
SEQ ID NO: 930 CTTAGATTTATCTCTGAGGT 1336 -7.3 -20.8 65.2 -12.6 -0.7 -6.2
SEQ ID NO: 931 TCATAGGTTTTTATTCTAAC 1503 -7.3 -17.9 57.8 -10.6 0 -2.7
SEQ ID NO: 932 1761 ATTCTTTCAAATATACTCCT -7.3 -19.1 59.1 -11.8 0 -2.7
SEQ ID NO: 933 CCTGTTTGTGCTAAGATTCT 1776 -7.3 -23.2 69 -15.9 0 -3.8
SEQ ID NO: 934 TACTTCTGAGATATTTCCTA 1816 SEQ ID NO: 935 -7.3 -20.3 62.8 -13 0 -3.8 TTAAATAAGTTCTTCACTTC 1844 SEQ ID NO: 936 -7.3 -16.8 54.8 -8.4 -1 -4.2 CACACACATTCACAACTCTG 1910 SEQ ID NO: 937 -7.3 -21.2 62.7 -13.9 0 -1.8 AACTCTTCACCAAAAGGATC 336 -7.2 -19.9 59.5 -12.7 0 -4.1
SEQ ID NO: 938 AACTTCTTCTCTCACAATAT 547 SEQ ID NO: 939 -7.2 -19.5 60.6 -12.3 0 -2.4 CCTCATTACGGGAGACCCGG 583 -7.2 -28.6 74.5 -17.7 -3.7 -11
SEQ ID NO: 940 TCTGGATCCACCATGCATCA 742 SEQ ID NO: 941 -7.2 -26.7 74.7 -18.1 -1.2 -9.7 CTAAATTGCATTTTTAGTTC 880 SEQ ID NO: 942 -7.2 -17.6 56.3 -9.6 -0.4 -8.8 ACCTGTCTCCATGTAAGATT 902 SEQ ID NO: 943 -7.2 -23.6 69.2 -16.4 0 -5 TCTAGAGAAGCTACCTACCA 1080 SEQ ID NO: 944 -7.2 -23.6 68.5 -16.4 0 -5.2 TCTCTGAGGTGGCATACGTT 1326 SEQ ID NO: 945 -7.2 -25.3 73.8 -17.5 -0.3 -6.5 TGACATTTTTTGAAATCCAG 1587 56.4 -10.1
SEQ ID NO: 946 -7.2 -18.3 -0.9 -4.9
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position binding ation Duplex ture oligo oligo oligo
1991 TCTTTTTTATTGAACAATAA
-7.2 -14.7 49.4
SEQ ID NO: 947 -6.7 -0.4 -8.7
283 GCCACACTTCATGCCATCCA
-7.1 -29.3
SEQ ID NO: 948 79.1 -22.2 0 -4.4
314 CCCCATTAGAAGGCTGACAC -7.1
SEQ ID NO: 949 -26 71.3 -18.9 0 -3.7
359 AGGGACAGTCTTTGCAGATA -7.1 -23.4 70.3
SEQ ID NO: 950 -15.8 -0.2 -6
360 TAGGGACAGTCTTTGCAGAT
-7.1 -23.4
SEQ ID NO: 951 70.3 -15.8 -0.2 -6 AAGGTGCCGTAGGGACAGTC
369 -7.1 -26.7
SEQ ID NO: 952 75.9 -18 -1.5 -7.9
524 CATCTCCAGATGCCATGTCA
-7.1 -26.5
SEQ ID NO: 953 75.2 -18.7 -0.5 -6.9
753 ACTTTTTGTTTTCTGGATCC -7.1 -22.5
SEQ ID NO: 954 68.4 -14.9 0 -7.5
862 TCTTCAGTGTTACTATACAC -7.1
SEQ ID NO: 955 -20.3 64 -11.9 -1.2 -5.2
952 TAATTTGACTCACTGCGGTC -7.1 -22.5
SEQ ID NO: 956 66.2 -14.9 -0.1 -6.2
1014 TTCTCCTGCTCTTAAGTCTT -7.1 -24.4
SEQ ID NO: 957 73.7 -17.3 0 -6
1327 ATCTCTGAGGTGGCATACGT
-7.1 -25.2
SEQ ID NO: 958 73.4 -17.5 -0.3 -6.5
1721 GTTGACATGTTTTCTGCTGA -7.1
SEQ ID NO: 959 -22.9 69.3 -15.8 0 -7.1
1837 AGTTCTTCACTTCAAATAAA -7.1 -17
SEQ ID NO: 960 54.4 -9.9 0 -2.3
59 CGCTCTTCATGTTTCCCAGC -7
SEQ ID NO: 961 -28.3 79.2 -21.3 0 -4.7
132 CAGTCCACCGCATAATTATT -7
SEQ ID NO:962 -23.4 66 -16.4 0 -5.6
231 CGCCCTGCAGCGCACACTCG -7
SEQ ID NO:963 -32.3 80.9 -23.9 -1.2 -10.1
702 TACATGTACTTATGCTATAT -7
SEQ ID NO: 964 -18.5 58.3 -11.5 0 -7.3
810 TTTAACAAACACATACAAGT
SEQ ID NO: 965 -7 -15.6 50.4 -8.6 0 -2.8
1197 GCTGTTTGTTACTCAAATTT
SEQ ID NO: 966 -7 -20.1 61.9 -11.5 -1.6 -6.5
1223 CCTTTTGAAATTGCTCTCAG
SEQ ID NO: 967 -7 -21.6 64 -14.6 0 -3.6
1408 ACACATTTATTTATAAAAAT
SEQ ID NO: 968 -7 -12.5 44.4 -4.8 -0.4 -6.5 TAGAGTCATAGGTTTTTATT
1508 SEQ ID NO: 969 -7 -18.9 61 -11.9 0 -4.8
1613 ATAAGGTCCCTCTGTTGCTC
-7
SEQ ID NO: 970 -26.4 76.9 -19.4 0 -4.7
1624 CTTATGTTTAAATAAGGTCC
SEQ ID NO: 971 -7 -18.2 56.9 -10.4 -0.6 -5.6 GATTCTTTCAAATATACTCC
1762 -7
SEQ ID NO: 972 -18.8 58.4 -11.8 0 -2.7 TTTGTGCTAAGATTCTTTCA
1772
SEQ ID NO: 973 -7 -20.4 63.4 -12.9 -0.1 -5.6 AGCTTATGCAGCTTTACATT
1941 SEQ ID NO: 974 -7 -22.6 67.8 -13.7 -1.9 -6.9 ATGCCATCCATGCCTGAGAC
273 SEQ ID NO: 975 -6.9 -27.7 75.8 -20.8 0 -4.2 CAGTCTTTGCAGATACCAAA
354 SEQ ID NO: 976 -6.9 -21.7 63.9 -14.3 -0.2 -5.2
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position binding ation Duplex ture oligo oligo oligo
355 ACAGTCTTTGCAGATACCAA -6.9
SEQ ID NO: 977 -22.6 66.6 -15.2 -0.2 -5.2 TCACAACTTCTTCTCTCACA 551
SEQ ID NO: 978 -6.9 -22.5 68.1 -15.6 0 -0.6 639 AAAATAGAGCCTTCTCTCAG -6.9 -20.7 62.4 -12.3 -1.4 -5.1
SEQ ID NO: 979 662 TGGCTGTGTGTTGAACAATC -6.9 -22.1 66 -14.3 -0.7
SEQ ID NO: 980 -7.8 704 ATTACATGTACTTATGCTAT -6.9 -18.9 59.3 -11.5 0 -7.7
SEQ ID NO: 981 1616 TAAATAAGGTCCCTCTGTTG -6.9 -21.6 63.7 -14.7
SEQ ID NO:982 0 -4.7 1632 TCACAGCACTTATGTTTAAA -6.9
SEQ ID NO: 983 -19.1 58.9 -12.2 0 -5.2 1664 TTTTCATACCTTAAATTGAA
-6.9 -16.6 52.8 -9.2 -0.1 -3.6
SEQ ID NO: 984 1800 CCTAAGAACATCTAGTACAA -6.9 -18.8 57.5 -11.9 0 -5.7
SEQ ID NO: 985 447 GGGAATTTCAGGCATTTTCC
-6.8 -24 69.9 -16.3 -0.8 -5
SEQ ID NO: 986 AGGGGAATTTCAGGCATTTT 449 -6.8 67.5 -16
SEQ ID NO: 987 -22.8 0 -5 525 CCATCTCCAGATGCCATGTC
-6.8 -27.8 77.7 -19.9 -1 -7.8
SEQ ID NO: 988 830 AATCTACATGCATTCGAATA
SEQ ID NO: 989 -6.8 -18.6 56.7 -11.2 0 -8.4 835 TAACAAATCTACATGCATTC
SEQ ID NO: 990 -6.8 -17.4 54.6 -10.6 0 -6.7 988 ATATCCCAACATTAATGTAC
SEQ ID NO: 991 -6.8 -19.2 57.9 -11.1 -0.2 -10.5 1629 CAGCACTTATGTTTAAATAA
-6.8 -16.8 53.5 -10 0 -5.4
SEQ ID NO: 992 AGTTGACATGTTTTCTGCTG 1722 SEQ ID NO: 993 -6.8 -22.3 68.1 -15.5 0 -6.5 263 TGCCTGAGACTGTGCGGTAG
-6.7 -26.9 75.7 -19.6 -0.3 -5.4
SEQ ID NO: 994 298 ACACCTCAGCCCCGGGCCAC
SEQ ID NO: 995 -6.7 -34.8 87 -26.2 -1.8 -11.2 300 TGACACCTCAGCCCCGGGCC
SEQ ID NO: 996 -6.7 -34.5 86.5 -25.9 -1.8 -11.3 401 GGCAGTTGCAGGTCTCTCTG
SEQ ID NO: 997 -6.7 -27.8 83.1 -20.2 -0.7 -6.6 TTTTTGTTTTCTGGATCCAC 751
SEQ ID NO: 998 -6.7 -22.3 67.6 -14.7 0 -9.7 TCGAATATTTAACAAACACA 817
SEQ ID NO: 999 -6.7 -15.3 49.3 -8.6 0 -4.8 TATTTTCATACCTTAAATTG 1666 SEQ ID NO-.1000 -6.7 -16.4 52.8 -9.7 0 -3.2 TTCAAATATACTCCTAATTC 1756 SEQ ID NO: 1001 -6.7 -17.1 54.4 -10.4 0 -2.9 TTTATTGAACAATAATAAAC 1986 -6.7 -11.6 42.7 -3.5 -1.3
SEQ ID NO: 1002 -9 CTCTTGCAGCGCGGGCTGCT 183 -6.6 -19.7 -5.5 -15.6
SEQ ID NO: 1003 -31.8 84.7 CTCAGCCCCGGGCCACACTT 294 -6.6
SEQ ID NO: 1004 -33.6 85.4 -25.1 -1.8 -11.2 ATCTCCAGATGCCATGTCAT 523 -6.6 -25.8 74 -18.7 -0.1 -4.3
SEQ ID NO: 1005
TCAGGGGTTTTCTGGTTGTT 1150 -6.6 -25.3
SEQ ID NO: 1006 76.8 -17.8 -0.7 -4.2
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo
1233 ACATCAGCAGCCTTTTGAAA -6.6 -22.7 65.7 -16.1
SEQ ID NO: 1007 0 -4.5
1291 AGTGTATGTGTTTCCTATGC -6.6 -23.5 71.8 -16.9 0 -2.6
SEQ ID NO: 1008
1318 GTGGCATACGTTAAAGCTAT -6.6 -21.6 63.4
SEQ ID NO: 1009 -14.3 -0.4 -5.1
1370 ATACACACACAAACCACCAG -6.6 -21.7 61.5 -15.1
SEQ ID NO: 1010 0 -0.9
1488 CTAACCATTTTCAACAAATA -6.6 -16.7 52.3
SEQ ID NO: 1011 -9.6 -0.1 -2.7
1726 TTAAAGTTGACATGTTTTCT -6.6
SEQ ID NO: 1012 -18 57.3 -11.4 0 -7.1
1966 ATGTCCTTTTAAAACAAAAC -6.6 -15.4 49.8
SEQ ID NO: 1013 -8.2 -0.3 -6.2
217 CACTCGGCAGCAGCCACAGT -6.5
SEQ ID NO: 1014 -29.8 81.2 -20.6 -2.7 -9.3
451 GAAGGGGAATTTCAGGCATT -6.5 -22.5 65.8
SEQ ID NO: 1015 -16 0 -5
638 AAATAGAGCCTTCTCTCAGA
-6.5 -22 65.9
SEQ ID NO: 1016 -13.8 -1.7 -5.1
827 CTACATGCATTCGAATATTT -6.5 -19.1 57.9 -12 0 -8.4
SEQ ID NO: 1017
836 TTAACAAATCTACATGCATT -6.5 -17.1 53.7 -10.6 0 -6.7
SEQ ID NO: 1018
837 TTTAACAAATCTACATGCAT -6.5 -17.1 53.7 -10.6 0 -6.4
SEQ ID NO: 1019
1216 AAATTGCTCTCAGTTCAAAG -6.5 -18.8 58.3
SEQ ID NO: 1020 -12.3 0 -3.2
1325 CTCTGAGGTGGCATACGTTA -6.5 -24.6 71.5
SEQ ID NO: 1021 -17.5 -0.3 -5.2 CACAAACCACCAGTGGGTAA
1363 -6.5 -23.8 66.1 -16 -1.2 -9
SEQ ID NO: 1022
1757 TTTCAAATATACTCCTAATT
-6.5 -16.8 53.5 -10.3 0
SEQ ID NO: 1023 -2.7
1845 CTTAAATAAGTTCTTCACTT -6.5 -17.3 55.4 -9.9
SEQ ID NO: 1024 -0.8 -4.2
1899 ACAACTCTGTTGGCCAACTT -6.5
SEQ ID NO: 1025 -24.1 68.8 -14.2 -1.8 -15
1987 TTTTATTGAACAATAATAAA -6.5 -11.5 42.5 -3.5 -1.4 -9
SEQ ID NO: 1026
73 GGTCAGCAGCAAGACGCTCT -6.4 -27.4
SEQ ID NO-.1027 77.5 -19.5 -1.4 -8.5
430 TCCCGTCCCCCTGTCACAGA -6.4 -33.5 86.4 -26.5
SEQ ID NO: 1028 ■ -0.3 -5.2
459 TATTGGAAGAAGGGGAATTT -6.4 -18.5 56.7 -12.1 0 -3.3
SEQ ID NO: 1029 TAACAAACACATACAAGTGT
808 -6.4 -16.6 52.4 -8.6
SEQ ID NO: 1030 -1.6 -6 GTAAGATTACCTAAATTGCA
890 -6.4 -18.6
SEQ ID NO: 1031 56.9 -12.2 0 -5.3 AGGGCTAAATATTTTATTTC
1056 -6.4
SEQ ID NO: 1032 -17.7 56.3 -10.5 -0.6 -8.2 CAAGGAAGGGCTAAATATTT
1062 -6.4
SEQ ID NO: 1033 -18.4 56.1 -12 0 -6.4 TTTCTGGTTGTTTTATTTTG
1142 -6.4
SEQ ID NO: 1034 -19.5 62.1 -13.1 0 -1.5 TAACACATTTATTTATAAAA
1410 -6.4
SEQ ID NO: 1035 -12.2 43.9 -4.8 -0.9 -6.5 GGATAATAAATTTATCATGC
1549 -6.4
SEQ ID NO: 1036 -15.9 51.5 -6.9 -2.6 -7.6
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position nding ation Duplex ture oligo oligo oligo
1634 AGTCACAGCACTTATGTTTA
-6.4 -21.7 66.8 -15.3
SEQ ID NO: 1037 0 -4.1 TTTTACAAACCTCCTAAAAA 1688 -6.4 -16.8 52 -10.4
SEQ ID NO: 1038 0 -3.2 1917 GGCCTTCCACACACATTCAC
-6.4 -27.2 75.7 -20.3 -0.2 -6.4
SEQ ID NO: 1039 AGTCCACCGCATAATTATTG 131 -6.3 -22.7 64.8 -16.4
SEQ ID NO: 1040 0 -5.6 ATATTGGAAGAAGGGGAATT 460
SEQ ID NO: 1041 -6.3 -18.4 56.4 -12.1 0 -3.1 AATAGAGCCTTCTCTCAGAA 637 -6.3 -22 65.9 -14 -1.7 -6.3
SEQ ID NO: 1042 CGAATATTTAACAAACACAT 816 SEQ ID NO: 1043 -6.3 -14.9 48.3 -8.6 0 -4.8 TTCTAGAGAAGCTACCTACC 1081 SEQ ID NO: 1044 -6.3 -23 67.7 -16.7 0 -5.8 AGCTGTTTGTTACTCAAATT 1198 -6.3 -20 61.8 -12.5 -1.1 -9.3
SEQ ID NO: 1045 TTTACCTTCATACACACACA 1379 -6.3 -21.5 63.6 -15.2 0 -0.9
SEQ ID NO: 1046 1434 ATGGGTAGGGAAGATGACTT
SEQ ID NO: 1047 -6.3 -22 65.5 -15 -0.5 -3.2 TATGGGTAGGGAAGATGACT 1435 -6.3 -21.6 64.6 -15.3 0 -2.1
SEQ ID NO: 1048 AAGTCACAGCACTTATGTTT 1635 SEQ ID NO: 1049 -6.3 -21.3 65 -15 0 -4.3 1637 CGAAGTCACAGCACTTATGT -6.3 -22.5 66 -15.5 -0.5 -4.6
SEQ ID NO: 1050 CTTTTACAAACCTCCTAAAA 1689 -6.3 -18.4 55.3 -12.1 0 -3.2
SEQ ID NO: 1051 1944 AACAGCTTATGCAGCTTTAC
-6.3 -22 65.7 -13.7 -2 -6.9
SEQ ID NO: 1052 ACGCTCTTCATGTTTCCCAG 60 -6.2 -26.7 75.4 -20.5 0 -4.7
SEQ ID NO: 1053 CAGGTGTGCAGGCACGAGGA 97 -6.2 -27.9 77.9 -19.2 -2.5 -10
SEQ ID NO: 1054 384 CTGCAATCCATCCCGAAGGT -6.2 -27.3 72.8 -19.8 -1.2 -7.1
SEQ ID NO: 1055 CGGCAGCATTCTCTTTCACA 566 -6.2 -25.9 74.1 -19.7 0 -5.3
SEQ ID NO: 1056 813 ATATTTAACAAACACATACA -6.2 -14.8 48.8 -8.6 0 -2.4
SEQ ID NO: 1057 1208 CTCAGTTCAAAGCTGTTTGT -6.2 -22.3 67.8 -14.6 -1.4 -6.8
SEQ ID NO: 1058 1251 ACAGGTAACCCGGGAACTAC -6.2 -24.6 67.6 -16.8 -1.1 -11
SEQ ID NO: 1059 45 CCCAGCTGCCTCCGGCTCGG
-6.1 -35.6 88.8 -27.1 -2.4 -10.5
SEQ ID NO: 1060 46 TCCCAGCTGCCTCCGGCTCG -6.1 -34.8 88.3 -26.6 -2.1 -8.2
SEQ ID NO: 1061 69 AGCAGCAAGACGCTCTTCAT
-6.1 -25.1 71.8 -17.7 -1.2 -6
SEQ ID NO: 1062 GCAGTCCACCGCATAATTAT 133 -6.1 -25.1
SEQ ID NO: 1063 69.6 -19 0 -5.6 284 GGCCACACTTCATGCCATCC -6.1 -29.8
SEQ ID NO: 1064 80.6 -22.2 -1.4 -7.6 403 CTGGCAGTTGCAGGTCTCTC -6.1 -27.8
SEQ ID NO: 1065 83.1 -20.8 -0.7 -6.6 462 GAATATTGGAAGAAGGGGAA -6.1 -18.2
SEQ ID NO: 1066 55.6 -12.1 0 -4.6
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position dnding ation Duplex ture oligo oligo oligo GGCAGCATTCTCTTTCACAA
565 -6.1
SEQ ID NO: 1067 -24.4 71.7 -18.3 0 -5.3
809 TTAACAAACACATACAAGTG -6.1 -15.5 50.1 -8.6 -0.6 -4.7
SEQ ID NO: 1068
818 TTCGAATATTTAACAAACAC -6.1 -8.6 0 -6.2
SEQ ID NO: 1069 -14.7 48.4 1055 GGGCTAAATATTTTATTTCC -6.1 -19.7 60 -12.9 -0.4 -8.2
SEQ ID NO: 1070 1285 TGTGTTTCCTATGCCCCAGA -6.1
SEQ ID NO: 1071 -28.7 79.2 -22.6 0 -3 1332 GATTTATCTCTGAGGTGGCA -6.1 -23.8 71.5 -17.7 0 -6.2
SEQ ID NO: 1072 1362 ACAAACCACCAGTGGGTAAA -6.1 -22.4 63.1 -15.1 -1.1 -8.2
SEQ ID NO: 1073 1407 CACATTTATTTATAAAAATA -6.1 -12 43.5 -4.8 -1 -6.5
SEQ ID NO: 1074 GACATTTTTTGAAATCCAGA 1586 -6.1 -18.9 57.7 -11.8 -0.9 -4.3
SEQ ID NO: 1075 1773 GTTTGTGCTAAGATTCTTTC -6.1 -20.9 65.5 -14.8 0 -5.6
SEQ ID NO: 1076 1922 TCAAAGGCCTTCCACACACA -6.1 -25.5 70.4 -18.1 -0.2 -10.6
SEQ ID NO: 1077
13 GGTCTTTGCTGGTGGGAAGC -6 -27.1 78.8 -20.3 -0.6 -5.1
SEQ ID NO: 1078
63 AAGACGCTCTTCATGTTTCC -6 -23.9 69.6 -17.2 -0.4 -6.8
SEQ ID NO: 1079
429 CCCGTCCCCCTGTCACAGAT -6 -33.1 84.5 -26.5 -0.3 -5.2
SEQ ID NO: 1080
450 AAGGGGAATTTCAGGCATTT -6 -22 64.9
SEQ ID NO: 1081 -16 0 -4.2
569 ACCCGGCAGCATTCTCTTTC -6 -28.5 79.1 -22.5 0 -6.3
SEQ ID NO: 1082
648 ACAATCACGAAAATAGAGCC -6 -18.9 56 -12.9 0 -3.5
SEQ ID NO: 1083 1049 AATATTTTATTTCCCACTCC -6 -21.8 64 -15.8 0 -3.8
SEQ ID NO: 1084 1190 GTTACTCAAATTTCCATAAG -6 -18.1 56.4 -12.1 0 -4.5
SEQ ID NO: 1085 1249 AGGTAACCCGGGAACTACAT
-6 -24.4 67.1 -16.8 -1.1 -11
SEQ ID NO: 1086 1409 AACACATTTATTTATAAAAA -6 -11.8 43 -4.8 -0.9 -6.5
SEQ ID NO: 1087 1657 ACCTTAAATTGAAAATTCAC -6 -15.5 50 -8.2 ■ -1.2 -5.7
SEQ ID NO: 1088 1758 CTTTCAAATATACTCCTAAT -6 -17.6 55 -11.6 0 -2.7
SEQ ID NO: 1089
337 AAACTCTTCACCAAAAGGAT -5.9 -18.8 56.4 -12.9 0 -3.7
SEQ ID NO: 1090
342 ATACCAAACTCTTCACCAAA -5.9 -20.3 59.1 -14.4 0 -0.9
SEQ ID NO: 1091
545 CTTCTTCTCTCACAATATTG -5.9 -20.1 62.5 -13.7 0 -8.2
SEQ ID NO: 1092
972 GTACATCAAAGTCAAAGAAC -5.9 -16.5 52.8 -10.6 0 -4.6
SEQ ID NO: 1093
974 ATGTACATCAAAGTCAAAGA -5.9 -17 54 -10.6 0 -7.6
SEQ ID NO: 1094 1120 TTTTCCCAAAGCCAAAAAAA -5.9 -18.3 53.6 -12.4 0 -3.2
SEQ ID NO: 1095 1124 TGACTTTTCCCAAAGCCAAA -5.9 -22.8 63.5 -15.5 -1.3 -5.3
SEQ ID NO: 1096
11
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- T of struc- molecular molecular position binding ation Duplex ture oligo oligo oligo
GCCTTTTGAAATTGCTCTCA
1224 -5.9 -23.4 67.9 -17.5 0 -3.9
SEQ ID NO: 1097 CATACACACACAAACCACCA 1371 -5.9 -22.4 62.4 -16.5 0 -0.9
SEQ ID NO: 1098 TTAAATAAGGTCCCTCTGTT 1617 -5.9 -21.7 64.2 -15.8 0 -4.7
SEQ ID NO: 1099 GAGATATTTCCTAAGAACAT 1809 -5.9 -18.2 56.5 -11.8 -0.2 -4
SEQ ID NO: 1100 TGAGATATTTCCTAAGAACA 1810 SEQ ID NO: 1101 -5.9 -18.2 56.5 -11.8 -0.2 -4.6 TGGCCAACTTCAAGAATAAA 1889 -5.9 -18.8 56.1 -12.4 0 -8.3
SEQ ID NO: 1102 TCAGCCCCGGGCCACACTTC 293 -5.8 -33.1 85.4 -25.4 -1.8 -11.2
SEQ ID NO: 1103 CACCTCAGCCCCGGGCCACA 297 -5.8 -35.3 87.2 -27.6 -1.8 -11.2
SEQ ID NO: 1104 ATTTAACAAACACATACAAG 811 -5.8 -14.4 47.9 -8.6 0 -2.4
SEQ ID NO: 1105 CATGTAAGATTACCTAAATT 893 -5.8 -16.8 53.1 -11 0 -4.9
SEQ ID NO: 1106 AAGGAAGGGCTAAATATTTT 1061 -5.8 -17.8 55.2 -12 0 -6.6
SEQ ID NO: 1107 TCAGTTCAAAGCTGTTTGTT 1207 -5.8 -21.5 66.1 -14.2 -1.4 -6.8
SEQ ID NO: 1108 TCAGCAGCCTTTTGAAATTG 1230 -5.8 -21.9 64.3 -16.1 0 -4.5
SEQ ID NO: 1109 AGATTTCTTTCCTCAAGAGG 1463 -5.8 -21.8 66.2 -15.2 -0.6 -7.9
SEQ ID NO: 1110 TTCATACCTTAAATTGAAAA 1662 -5.8 -15 49 -9.2 0 -3.5
SEQ ID NO: 1111 CTCCTAATTCCACCTATATT 1746 -5.8 -23 66.2 -17.2 0 -2.6
SEQ ID NO: 1112 ACTTCAAATAAAATACTTCT 1829 -5.8 -14.7 49 -8.9 0 -1.2
SEQ ID NO: 1113 TAACAGCTTATGCAGCTTTA 1945 -5.8 -21.5 64.6 -13.7 -2 -6.9
SEQ ID NO: 1114 CCTTTTAAAACAAAACCTAA 1962 -5.8 -15.7 49.5 -9.3 -0.3 -6.2
SEQ ID NO: 1115 TCCTTTTAAAACAAAACCTA 1963 -5.8 -16.8 52 -10.4 -0.3 -6.2
SEQ ID NO: 1116 TGGGAAGCAGCCGTGACCCA
1 -5.7 -30.1 78.4 -22.5 -1.9 -6.9
SEQ ID NO: 1117 TCTGCAATCCATCCCGAAGG 385 -5.7 -26.5 71.2 -19.8 -0.9 -6.7
SEQ ID NO: 1118 AGAAGGGGAATTTCAGGCAT 452 -5.7 -22.4 65.7 -16 -0.5 -5
SEQ ID NO: 1119 AATCACGAAAATAGAGCCTT 646 -5.7 -19 56.4 -13.3 0 -3.2
SEQ ID NO: 1120 GTTGGCTGTGTGTTGAACAA 664 SEQ ID NO: 1121 -5.7 -23 68.1 -16.4 -0.7 -7.8 TTCTGGATCCACCATGCATC 743 -5.7 -26.1 73.9 -19 -1.2 -9.7
SEQ ID NO: 1122 TGTACATCAAAGTCAAAGAA 973 -5.7 -16.3 52.2 -10.6 0 -5.9
SEQ ID NO: 1123 GTTGTTTTATTTTGACTTTT 1136 -5.7 -18.8 60.3 -13.1 0 -2.5
SEQ ID NO: 1124 CTCTCAGTTCAAAGCTGTTT 1210 -5.7 -22.4 68.2 -15.3 -1.3 -5.1
SEQ ID NO: 1125 1317 TGGCATACGTTAAAGCTATT -5.7 -20.5 60.8 -14.1 -0.4 -5.1
SEQ ID NO: 1126
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position >inding ation Duplex ture oligo oligo oligo
ATAGAGTCATAGGTTTTTAT
1509 -5.7 -18.8 60.6 -13.1 0 -4.8
SEQ ID NO: 1127 1621 ATGTTTAAATAAGGTCCCTC -5.7 -20.8 62.2 -15.1 0 -5.1
SEQ ID NO: 1128 GTCACAGCACTTATGTTTAA 1633 -5.7 -21 64.2 -15.3 0 -5.8
SEQ ID NO: 1129 1661 TCATACCTTAAATTGAAAAT -5.7 -14.9 48.8 -9.2 0 -3.2
SEQ ID NO: 1130 TTTCATACCTTAAATTGAAA 1663 -5.7 -15.8 50.9 -9.2 -0.8 -4.3
SEQ ID NO: 1131 1767 GCTAAGATTCTTTCAAATAT -5.7 -17.3 55 -11.6 0.6 -5.6
SEQ ID NO: 1132 CAGCAAGACGCTCTTCATGT 67 -5.6 -24.5 70.4 -17.6 -1.2 -6.9
SEQ ID NO: 1133 AGCCACAGTCGTCGAGCACT 206 -5.6 -28.4 78.4 -22.2 -0.3 -5.3
SEQ ID NO: 1134 275 TCATGCCATCCATGCCTGAG -5.6 -28 76.7 -20.6 -1.8 -5
SEQ ID NO: 1135 292 CAGCCCCGGGCCACACTTCA -5.6 -33.4 84.6 -25.9 -1.8 -11.2
SEQ ID NO: 1136 AAAATGTTGGCTGTGTGTTG 669 -5.6 -20.8 62.6 -15.2 0 -3.7
SEQ ID NO: 1137 970 ACATCAAAGTCAAAGAACTA -5.6 -16.2 51.9 -10.6 0 -3
SEQ ID NO: 1138 971 TACATCAAAGTCAAAGAACT -5.6 -16.2 51.9 -10.6 0 -2.9
SEQ ID NO: 1139 1006 CTCTTAAGTCTTCATTCCAT -5.6 -22.2 67.5 -16.6 0 -6
SEQ ID NO: 1140 1007 GCTCTTAAGTCTTCATTCCA -5.6 -24 72 -18.4 0 -6
SEQ ID NO: 1141 1328 TATCTCTGAGGTGGCATACG -5.6 -23.7 69.4 -17.5 -0.3 -6.5
SEQ ID NO: 1142 1690 TCTTTTACAAACCTCCTAAA -5.6 -19.5 58.2 -13.9 0 -2.3
SEQ ID NO: 1143 1806 ATATTTCCTAAGAACATCTA -5.6 -18 56.4 -11.9 -0.2 -3.1
SEQ ID NO: 1144 1830 CACTTCAAATAAAATACTTC -5.6 -14.5 48.4 -8.9 0 -1.2
SEQ ID NO: 1145 1971 TAAACATGTCCTTTTAAAAC -5.6 -15.8 50.8 -10.2 0 -6.9
SEQ ID NO: 1146 TGTTTCCCAGCTGCCTCCGG 50 -5.5 -32.3 85.2 -26.3 0 -8.1
SEQ ID NO: 1147 147 TCACAGTGTTGAGGGCAGTC -5.5 -25.6 77.3 -20.1 0 -6.5
SEQ ID NO: 1148 ATTGGAAGAAGGGGAATTTC 458 -5.5 -19.2 58.6 -13.7 0 -3.8
SEQ ID NO: 1149 AATATTGGAAGAAGGGGAAT 461 -5.5 -17.6 54.4 -12.1 0 -3.8
SEQ ID NO: 1150 619 AAATCACAGCCGGGATCAGC -5.5 -25.1 69.5 -19.6 0 -6.9
SEQ ID NO: 1151 TATTTAACAAACACATACAA 812 SEQ ID NO: 1152 -5.5 -14.1 47.3 -8.6 0 -2.4 AATTGCTCTCAGTTCAAAGC 1215 SEQ ID NO: 1153 -5.5 -21.3 64.5 -15.2 -0.3 -3.9 TTATCTCTGAGGTGGCATAC 1329 -5.5 -23 69.7 -17.5 0 -6.2
SEQ ID NO: 1154 TTACCTTCATACACACACAA iJ/S SEQ ID NO: 1155 -5.5 -20.7 61.2 -15.2 0 -0.9
ACATTTATTTATAAAAATAT
1406 SEQ ID NO: 1156 -5.5 -11.3 42.2 -4.8 -0.9 -6.5
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo ATATGGGTAGGGAAGATGAC 1436 -5.5 -20.7 62.6 -15.2 0 -2
SEQ ID NO: 1157 1744 CCTAATTCCACCTATATTTT -5.5 -21.9 63.6 -16.4 0 -2.9
SEQ ID NO: 1158 TCTTCACTTCAAATAAAATA 1834 SEQ ID NO: 1159 -5.5 -14.7 49 -9.2 0 -1.2 TTGGCCAACTTCAAGAATAA 1890 -5.5 -19.6 58.1 -13 0 -10.2
SEQ ID NO: 1160 CAAAGGCCTTCCACACACAT 1921 SEQ ID NO: 1161 -5.5 -25.1 68.9 -18.1 -1 -10.6 TTCCCAGCTGCCTCCGGCTC
47 -5.4 -34.1 89.5 -26.6 -2.1 -8.3
SEQ ID NO: 1162 TGCAGCGCACACTCGGCAGC
226 SEQ ID NO: 1163 -5.4 -30.3 80.9 -23.6 -1.2 -8.5 CAGAAATCACAGCCGGGATC
622 SEQ ID NO: 1164 -5.4 -23.9 66.8 -18.5 0 -6.9 ACTAATTTGACTCACTGCGG
954 SEQ ID NO: 1165 -5.4 -22 64.1 -16.6 0 -4.7 AACTAATTTGACTCACTGCG
955 -5.4 -20.1 59.7 -14.7 0 -4
SEQ ID NO: 1166 TTCTGGTTGTTTTATTTTGA 1141 -14.6 0 -2.1
SEQ ID NO: 1167 -5.4 -20 63.2 ATTTCCATAAGCTTCAAACA 1181 -5.4 -19.7 59.2 -14.3 0 -6.8
SEQ ID NO: 1168 TACATCAGCAGCCTTTTGAA 1234 SEQ ID NO: 1169 -5.4 -23.1 67.4 -17.7 0 -4.5 TTTATCTCTGAGGTGGCATA 1330 -5.4 -22.9 69.5 -17.5 0 -5.6
SEQ ID NO: 1170 TTATGGATAATAAATTTATC 1553 SEQ ID NO: 1171 -5.4 -13.2 46.2 -6.9 -0.7 -8.1 1554 ATTATGGATAATAAATTTAT -5.4 -12.8 45.2 -6.8 -0.3 -7.9
SEQ ID NO: 1172 GAACATCTAGTACAACAGTC 1795 -5.4 -19.4 60.4 -14 0 -5.3
SEQ ID NO: 1173 CAACTCTGTTGGCCAACTTC 1898 -5.4 -24.3 69.8 -15.5 -0.9 -15
SEQ ID NO: 1174 CTGTGCGGTAGCAAGTTTCT
254 SEQ ID NO: 1175 -5.3 -25.3 73.6 -18 -2 -5.6 CCACACTTCATGCCATCCAT
282 -5.3 -27.5 74.9 -22.2 0 -4.4
SEQ ID NO: 1176 CTCCAGATGCCATGTCATGC
521 SEQ ID NO: 1177 -5.3 -27.2 76.6 -21.9 0.3 -4.5 GGATTTAACCATTTCCTCAT
597 SEQ ID NO: 1178 -5.3 -22.5 65.6 -17.2 0 -3.4 GCTGTGTGTTGAACAATCAC
660 SEQ ID NO: 1179 -5.3 -21.8 65.2 -15.6 -0.8 -6.6 AATTACATGTACTTATGCTA
705 SEQ ID NO: 1180 -5.3 -18.2 57.2 -12.4 0 -7.7 AAATCTACATGCATTCGAAT
831 SEQ ID NO: 1181 -5.3 -18.2 55.4 -12.4 0 -8 TGGGTAGGGAAGATGACTTG 1433 -3.1
SEQ ID NO: 1182 -5.3 -22 65.4 -15.8 -0.7 1582 TTTTTTGAAATCCAGAGTGA
SEQ ID NO: 1183 -5.3 -19.2 59 -13.9 0 -3.3 1583 ATTTTTTGAAATCCAGAGTG
SEQ ID NO: 1184 -5.3 -18.6 57.7 -12.4 -0.7 -4.3 1667 TTATTTTCATACCTTAAATT
SEQ ID NO: 1185 -5.3 -16.5 53.1 -11.2 0 -2.9 AAATATACTCCTAATTCCAC 1753 SEQ ID NO: 1186 -5.3 -18.8 57.1 -13.5 0 -2.9
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo
TTGTGCTAAGATTCTTTCAA
1771 -5.3 -19.6 60.8 -13.8 -0.1 -5.6
SEQ ID NO: 1187 ATTTCCTAAGAACATCTAGT
1804 -5.3 -19.5 60.2 -13.7 -0.2 -4.2
SEQ ID NO: 1188 TAATTCTTAAATAAGTTCTT
1850 -5.3 -14.5 49.3 -9.2 0 -4.3
SEQ ID NO: 1189 CTTTTAAAACAAAACCTAAC
1961 -5.3 -13.9 46.6 -8 -0.3 -6.2
SEQ ID NO: 1190 GTTCTTTTTTATTGAACAAT
1993 -5.3 -17 54.8 -10.2 -1.4 -5.5
SEQ ID NO: 1191 AGGCTGACACCTCAGCCCCG
304 -5.2 -32.2 83.1 -20.9 -6.1 -14
SEQ ID NO: 1192 CAATCCATCCCGAAGGTGCC
381 -5.2 -28.4 74.3 -21.9 -1.2 -6
SEQ ID NO: 1193 ATCACAGCCGGGATCAGCGT
617 -5.2 -28.5 77.2 -22.4 -0.7 -6.9
SEQ ID NO: 1194 GAATATTTAACAAACACATA
815 -5.2 -13.8 46.8 -8.6 0 -4.8
SEQ ID NO: 1195 ATTTAACAAATCTACATGCA
838 -5.2 -17.1 53.7 -11.9 0 -5.2
SEQ ID NO: 1196 TTCAGGGGTTTTCTGGTTGT
1151 -5.2 -25.3 76.8 -19.2 -0.7 -4.2
SEQ ID NO: 1197 AACTTATTTTCATACCTTAA
1670 -5.2 -17.5 55.2 -12.3 0 -2
SEQ ID NO: 1198 AAGAACATCTAGTACAACAG
1797 -5.2 -17.1 54.3 -11.9 0 -5.7
SEQ ID NO: 1199 TTTACATTCAAAGGCCTTCC
1929 -5.2 -23 66.5 -16.5 0 -10.6
SEQ ID NO: 1200 TTTCCCAGCTGCCTCCGGCT
48 -5.1 -33.8 88 -26.6 -2.1 -8.3
SEQ ID NO: 1201 TCTTGCAGCGCGGGCTGCTT
182 -5.1 -31 83.2 -19.7 -6.2 -16.3
SEQ ID NO: 1202 GGAGACCCGGCAGCATTCTC
573 SEQ ID NO: 1203 -5.1 -29.4 80.1 -23.6 -0.5 -6.3 GGCTGTGTGTTGAACAATCA
661 -5.1 -22.8 67.3 -17 -0.4 -4.9
SEQ ID NO: 1204 ATTGCTCTCAGTTCAAAGCT
1214
SEQ ID NO: 1205 -5.1 -22.9 68.8 -16.6 -1.1 -4.8 TTAGATTTATCTCTGAGGTG
1335 -5.1 -19.9 62.9 -13.9 -0.7 -6.2
SEQ ID NO: 1206 CACTCACTGCTGTCACAGTG
159 -5 -25.1 74 -17 -3.1 -9.1
SEQ ID NO: 1207 GCAGCCACAGTCGTCGAGCA
208 -5 -29.8 81.3 -24.2 ■ -0.3 -4.9
SEQ ID NO: 1208
230 GCCCTGCAGCGCACACTCGG -5 -32.7 83.8 -26.8 -0.7 -9.2
SEQ ID NO: 1209
349 TTTGCAGATACCAAACTCTT -5 -21 62.2 -15.5 -0.1 -5.2
SEQ ID NO: 1210
425 TCCCCCTGTCACAGATGCCT -5 -31.8 84.3 -26.8 0.2 -4.7
SEQ ID NO: 1211
453 AAGAAGGGGAATTTCAGGCA -5 -21.7 63.6 -16 -0.5 -5
SEQ ID NO: 1212
727 CATCACAATTTGGATCTTCA -5 -20.5 62.1 -15.5 0 -5.4
SEQ ID NO: 1213
958 AAGAACTAATTTGACTCACT -5 -17.4 54.8 -12.4 0 -2.7
SEQ ID NO: 1214
1333 AGATTTATCTCTGAGGTGGC -5 -23.1 70.6 -17.4 -0.5 -6.2
SEQ ID NO: 1215
1692 CTTCTTTTACAAACCTCCTA -5 -21.9 64.2 -16.9 0 -1.7
SEQ ID NO: 1216
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position binding ation Duplex ture oligo oligo oligo
1818 AATACTTCTGAGATATTTCC -5
SEQ ID NO: 1217 -19 59.3 -14 0 -3.8
54 TTCATGTTTCCCAGCTGCCT -4.9 -29.1 81.2 -23.7 0 -8.1
SEQ ID NO: 1218
142 GTGTTGAGGGCAGTCCACCG -4.9 -29.3 80.9 -23.3 -1
SEQ ID NO: 1219 -5.6
146 CACAGTGTTGAGGGCAGTCC -4.9 -27.2 79.2 -22.3 0 -5.8
SEQ ID NO: 1220
370 GAAGGTGCCGTAGGGACAGT -4.9
SEQ ID NO: 1221 -26.9 75.5 -20.4 -1.5 -6.7
454 GAAGAAGGGGAATTTCAGGC
-4.9 -21.6 63.7 -16 -0.5
SEQ ID NO: 1222 -5
647 CAATCACGAAAATAGAGCCT
-4.9 -19.6 57.2 -14.7 0 -3.5
SEQ ID NO: 1223
805 CAAACACATACAAGTGTTCA
-4.9 -18.6 57 -10.9 -2.8 -8.2
SEQ ID NO: 1224
959 AAAGAACTAATTTGACTCAC -4.9
SEQ ID NO: 1225 -15.8 51.2 -10.9 0 -2.7
1631 CACAGCACTTATGTTTAAAT -4.9 -18.7 57.6 -13.8 0 -5.4
SEQ ID NO: 1226
1798 TAAGAACATCTAGTACAACA
SEQ ID NO: 1227 -4.9 -16.8 53.6 -11.9 0 -5.7
1920 AAAGGCCTTCCACACACATT -4.9 -24.5 68.2 -18.1 -1 -10.6
SEQ ID NO: 1228
1928 TTACATTCAAAGGCCTTCCA -4.9
SEQ ID NO: 1229 -23.6 67.3 -17.2 -1 -10.6
1933 CAGCTTTACATTCAAAGGCC -4.9 -23 66.5 -17.3 -0.6 -6.4
SEQ ID NO: 1230
55 CTTCATGTTTCCCAGCTGCC -4.8 -29.1 81.2
SEQ ID NO: 1231 -23.8 0 -8.1
166 GCTTTTGCACTCACTGCTGT -4.8 -26.7 77.7 -20 -1.9 -7.4
SEQ ID NO: 1232
181 CTTGCAGCGCGGGCTGCTTT -4.8 -30.7 81.8 -19.7 -6.2
SEQ ID NO: 1233 -16.3
253 TGTGCGGTAGCAAGTTTCTC -4.8 -24.8 73.3 -18 -2 -5.6
SEQ ID NO: 1234
464 CTGAATATTGGAAGAAGGGG -4.8 -19.2 57.9 -14.4 0 -4.6
SEQ ID NO: 1235
522 TCTCCAGATGCCATGTCATG -4.8 -25.8 73.9 -20.5 -0.1 -4.3
SEQ ID NO: 1236
802 ACACATACAAGTGTTCAGTC -4.8 -20.9 64.6 -14.7 -1.3 -5.4
SEQ ID NO: 1237
814 AATATTTAACAAACACATAC -4.8 -13.4 46.1 -8.6 0 -3.8
SEQ ID NO: 1238
960 CAAAGAACTAATTTGACTCA -4.8 -16.3 52 -10.9 -0.3 -3.6
SEQ ID NO: 1239
1003 TTAAGTCTTCATTCCATATC -4.8 -20.1 62.7 -15.3 0 -2.7
SEQ ID NO: 1240
1231 ATCAGCAGCCTTTTGAAATT -4.8 -21.9 64.4 -17.1 0 -4.5
SEQ ID NO: 1241
1316 GGCATACGTTAAAGCTATTT -4.8 -20.6 61.2 -15.1 -0.4
SEQ ID NO: 1242 -5.1
1319 GGTGGCATACGTTAAAGCTA -4.8 -22.8 66 -17.3 -0.4 -5.4
SEQ ID NO: 1243
1720 TTGACATGTTTTCTGCTGAA -4.8 -21
SEQ ID NO: 1244 63.6 -14.6 -0.1 -11.4
1727 TTTAAAGTTGACATGTTTTC -4.8 -17.2
SEQ ID NO: 1245 55.6 -12.4 0 -7.1
1803 TTTCCTAAGAACATCTAGTA -4.8 -19.2
SEQ ID NO: 1246 59.6 -13.9 -0.2 -4.2
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position binding ation Duplex ture oligo oligo oligo
GGCCAACTTCAAGAATAAAA
1888 -4.8 -18.1 54.5 -13.3 0 -7
SEQ ID NO: 1247 AGGTGTGCAGGCACGAGGAG 96 -4.7 -27.2 77.1 -20 -2.5 -10.7
SEQ ID NO: 1248 TTAGAAGGCTGACACCTCAG 309 -4.7 -23.3 67.9 -17 -1.6 -5.1
SEQ ID NO: 1249 CAAATCTACATGCATTCGAA 832 -4.7 -18.9 56.6 -14.2 0 -6.8
SEQ ID NO: 1250 CTAATTTGACTCACTGCGGT 953 -4.7 -23 66.6 -18.3 0 -6
SEQ ID NO: 1251 CAACATTAATGTACATCAAA 982 -4.7 -15.5 50.2 -9.5 -0.2 -10.5
SEQ ID NO: 1252 CTAGAGAAGCTACCTACCAA 1079 -4.7 -22.5 64.8 -17.8 0 -5.1
SEQ ID NO: 1253 ATTTACCTTCATACACACAC 1380 -4.7 -20.8 62.4 -16.1 0 -0.9
SEQ ID NO: 1254 GATTTCTTTCCTCAAGAGGA 1462 -4.7 -22.4 67.3 -16.2 -1.3 -9.9
SEQ ID NO: 1255 TAACCATTTTCAACAAATAA 1487 -4.7 -15.1 49 -10.4 0.1 -2.7
SEQ ID NO: 1256 ATCCAGAGTGACTCCTATAA 1573 -4.7 -22.6 66.7 -17.9 0.4 -4.7
SEQ ID NO: 1257 CTAATTCCACCTATATTTTA 1743 -4.7 -19.6 59.4 -14.9 0 -2.9
SEQ ID NO: 1258 AAACATGTCCTTTTAAAACA 1970 -4.7 -16.8 52.6 -12.1 0 -6.9
SEQ ID NO: 1259 GGGCCACACTTCATGCCATC 285 -4.6 -29 79.7 -22.2 -2.2 -7.6
SEQ ID NO-.1260 CATCCCGAAGGTGCCGTAGG 376 -4.6 -28.9 75.8 -22 -2.3 -6.7
SEQ ID NO: 1261 GAGAGAAACAAATCTGTTGG 496 -4.6 -17.7 55.1 -11.5 -1.5 -4.5
SEQ ID NO: 1262 CAGGTAACCCGGGAACTACA 1250 -4.6 -25.1 68.1 -18.9 -1.1 -11
SEQ ID NO: 1263 ACACACACAAACCACCAGTG 1368 -4.6 -23.2 64.7 -18 -0.3 -5L2
SEQ ID NO: 1264 AATATGGGTAGGGAAGATGA 1437 -4.6 -19.8 60 -15.2 0 -2.7
SEQ ID NO: 1265 TGGATAATAAATTTATCATG 1550 -4.6 -14.1 47.8 -6.9 -2.6 -8.1
SEQ ID NO: 1266 ATGGATAATAAATTTATCAT 1551 -4.6 -14.1 47.8 -6.9 -2.6 -8.1
SEQ ID NO: 1267 TGACTCCTATAATTATGGAT 1565 -4.6 -19.3 59 -14 ■ -0.1 -9
SEQ ID NO: 1268 TGACATGTTTTCTGCTGAAA 1719 -4.6 -20.2 61.1 -14.1 -1.1 -10.4
SEQ ID NO: 1269 CTTTACATTCAAAGGCCTTC 1930 -4.6 -21.9 64.7 -16 0 -10.6
SEQ ID NO: 1270 GTCCTTTTAAAACAAAACCT 1964 -4.6 -18.3 55 -13.1 -0.3 -6.2
SEQ ID NO: 1271 AATGTACATCAAAGTCAAAG 975 -4.5 -15.7 51 -10.6 0 -8.4
SEQ ID NO: 1272 GGTAACCCGGGAACTACATC 1248 -4.5 -24.8 68.2 -18.8 -0.2 -11
SEQ ID NO: 1273 TTCTTAGATTTATCTCTGAG 1338 -4.5 -18.9 60.9 -13.7 -0.4 -5.6
SEQ ID NO: 1274 TGTTTGAAAACCTTATAGAG 1523 -4.5 -17.1 54 -12.1 -0.1 -5.7
SEQ ID NO: 1275 TGTTTAAATAAGGTCCCTCT 1620 -4.5 -21.7 64.2 -17.2 0 -5.2
SEQ ID NO: 1276
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo 1668 CTTATTTTCATACCTTAAAT
SEQ ID NO: 1277 -4.5 -17.3 54.7 -12.8 0 -2.7
262 GCCTGAGACTGTGCGGTAGC
-4.4
SEQ ID NO: 1278 -28.7 80.3 -23.6 -0.5 -5.4
823 ATGCATTCGAATATTTAACA
SEQ ID NO: 1279 -4.4 -17.5 54.2 -12.5 0 -8.4 1247 GTAACCCGGGAACTACATCA
SEQ ID NO: 1280 -4.4 -24.3 67 -18.5 -0.2 -10.7 1464 TAGATTTCTTTCCTCAAGAG
SEQ ID NO: 1281 -4.4 -20.3 62.9 -14.9 -0.9 -6.8 1522 GTTTGAAAACCTTATAGAGT -4.4
SEQ ID NO: 1282 -18.3 56.9 -13.9 0 -4.7 1566 GTGACTCCTATAATTATGGA
SEQ ID NO: 1283 -4.4 -20.5 62 -15.5 0 -8.5 1618 TTTAAATAAGGTCCCTCTGT
SEQ ID NO: 1284 -4.4 -21.7 64.2 -17.3 0 -4.7 1658 TACCTTAAATTGAAAATTCA
SEQ ID NO: 1285 -4.4 -15 49 -9.3 -1.2 -5.5 1684 ACAAACCTCCTAAAAACTTA
SEQ ID NO: 1286 -4.4 -17.7 53.6 -13.3 0 -1.2 1685 TACAAACCTCCTAAAAACTT
SEQ ID NO: 1287 -4.4 -17.7 53.6 -13.3 0 -0.9 1724 AAAGTTGACATGTTTTCTGC
SEQ ID NO: 1288 -4.4 -20 61.6 -15.6 0 -7.1 1969 AACATGTCCTTTTAAAACAA
SEQ ID NO: 1289 -4.4 -16.8 52.6 -12.4 0 -6.9
95 GGTGTGCAGGCACGAGGAGC
SEQ ID NO: 1290 -4.3 -29 81.3 -22.2 -2.5 -10.7
255 ACTGTGCGGTAGCAAGTTTC
SEQ ID NO: 1291 -4.3 -24.6 72.2 -18 -2.3 -6.4
274 CATGCCATCCATGCCTGAGA
SEQ ID NO: 1292 -4.3 -28.2 76.3 -22.6 -1.2 -5.7
343 GATACCAAACTCTTCACCAA
SEQ ID NO: 1293 -4.3 -21.6 62.2 -17.3 0 -1.9
387 TCTCTGCAATCCATCCCGAA
SEQ ID NO: 1294 -4.3 -26.6 71.9 -22.3 0 -4.9
426 GTCCCCCTGTCACAGATGCC
SEQ ID NO: 1295 -4.3 -32.1 86 -27.2 -0.3 -5.2
455 GGAAGAAGGGGAATTTCAGG
SEQ ID NO: 1296 -4.3 -21 62.2 -16 -0.5 -5
826 TACATGCATTCGAATATTTA
SEQ ID NO: 1297 -4.3 -17.9 55.5 -13 0 -8.4 1331 ATTTATCTCTGAGGTGGCAT
SEQ ID NO: 1298 -4.3 -23.2 70 -18.9 0 -6.2 1552 TATGGATAATAAATTTATCA
SEQ ID NO: 1299 -4.3 -13.8 47.3 -6.9 -2.6 -8.1 CATACCTTAAATTGAAAATT 1660 SEQ ID NO: 1300 -4.3 -14.6 48 -9.2 -1 -3.5 1671 AAACTTATTTTCATACCTTA
SEQ ID NO: 1301 -4.3 -17.5 55.2 -13.2 0 -1.9 1745 TCCTAATTCCACCTATATTT
SEQ ID NO: 1302 -4.3 -22.2 64.7 -17.9 0 -2.9 1801 TCCTAAGAACATCTAGTACA 60.7
SEQ ID NO: 1303 -4.3 -19.9 -15.6 0 -5.7 1897 AACTCTGTTGGCCAACTTCA
SEQ ID NO: 1304 -4.3 -24.3 69.8 -16.6 -0.5 -15
431 TTCCCGTCCCCCTGTCACAG
SEQ ID NO: 1305 -4.2 -33 85.5 -28.8 0 -4.6
615 CACAGCCGGGATCAGCGTGG
SEQ ID NO: 1306 -4.2 -29.3 77.8 -23.6 -1.4 -7.7
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total formTm of struc- molecular molecular position binding ation oligo oligo oligo
804 AAACACATACAAGTGTTCAG -4.2 -17.9 55.9 -10.9
SEQ ID NO: 1307 -2.8 -8.2 821 GCATTCGAATATTTAACAAA
-4.2 -16.1 51 -11.2 0
SEQ ID NO: 1308 -8.7 976 TAATGTACATCAAAGTCAAA -4.2 -15.4 50.3
SEQ ID NO: 1309 -10.6 0 -8.4 1051 TAAATATTTTATTTCCCACT
-4.2 -18.4 56.6 -13.4
SEQ ID NO: 1310 -0.6 -6.2 1199 AAGCTGTTTGTTACTCAAAT -4.2 -19.2 59.3
SEQ ID NO: 1311 -13.4 -1.6 -9.4 1807 GATATTTCCTAAGAACATCT -4.2 -18.9 58.3 -14 -0.5 -4
SEQ ID NO: 1312 1858 TACTGAAATAATTCTTAAAT
-4.2 -12.8 45.1 -7.4
SEQ ID NO: 1313 -1.1 -4.2 185 TCCTCTTGCAGCGCGGGCTG -4.1 -31.5 83.7 -24.2 -3.2 -10.9
SEQ ID NO: 1314 567 CCGGCAGCATTCTCTTTCAC -4.1 -27.2 76.6 -23.1 0
SEQ ID NO: 1315 -5.3 593 TTAACCATTTCCTCATTACG -4.1 -21.4 62.2 -17.3 0 -3
SEQ ID NO: 1316 854 GTTACTATACACACACATTT -4.1 -19.3
SEQ ID NO: 1317 59.7 -15.2 0 -2 1377 TACCTTCATACACACACAAA -4.1 -19.9 59 -15.8 0 -0.9
SEQ ID NO: 1318 1389 TATATAAATATTTACCTTCA -4.1 -15.6 51.1
SEQ ID NO: 1319 -11 0 -7.9 1578 TTGAAATCCAGAGTGACTCC -4.1 -22.3 65.2 -17.5
SEQ ID NO: 1320 -0.4 -5.5 1833 CTTCACTTCAAATAAAATAC
SEQ ID NO: 1321 -4.1 -14.5 48.4 -10.4 0 -1.2 180 TTGCAGCGCGGGCTGCTTTT -4 -29.9 80.4 -19.7 -6.2 -16.3
SEQ ID NO: 1322 312 CCATTAGAAGGCTGACACCT -4 -24.9 69.7 -20.2 -0.4 -4
SEQ ID NO: 1323 TTGGAAGAAGGGGAATTTCA 457 -4 -19.9 59.8 -15.2 -0.5 -5
SEQ ID NO: 1324 621 AGAAATCACAGCCGGGATCA
-4 -23.9 66.8 -19.9
SEQ ID NO: 1325 0 -6.9 AACACATACAAGTGTTCAGT 803 -4 -19.8 60.9 -13.5
SEQ ID NO: 1326 -2.3 -7.4 1137 GGTTGTTTTATTTTGACTTT
SEQ ID NO: 1327 -4 -19.9 62.7 -15.9 0 -2.8 TATAGAGTCATAGGTTTTTA 1510 -4 -18.5 60 -14.5
SEQ ID NO: 1328 0 -4.8 TCCAGAGTGACTCCTATAAT 1572 -4 -22.6 66.7 -17.9
SEQ ID NO: 1329 -0.4 -5.5 TCTTTCAAATATACTCCTAA 1759 -4 -18 56.3 -14
SEQ ID NO: 1330 0 -2.7 ATAATTCTTAAATAAGTTCT 1851 SEQ ID NO: 1331 -4 -14.4 49 -10.4 0 -4.9 GCAGCAAGACGCTCTTCATG 68 SEQ ID NO: 1332 -3.9 -25.1 71.3 -19.9 -1.2 -6.4 TGGTCAGCAGCAAGACGCTC 74 SEQ ID NO: 1333 -3.9 -26.5 75.3 -21.1 -1.4 -8.5 TACCAAACTCTTCACCAAAA 341 SEQ ID NO: 1334 -3.9 -19.6 57.4 -15.7 0 -1 TCCAGATGCCATGTCATGCT 520 76.6
SEQ ID NO: 1335 -3.9 -27.2 -22.8 -0.2 -4.6 TAAAATGTTGGCTGTGTGTT 670 SEQ ID NO: 1336 -3.9 -20.5 62.2 -16.6 0 -3.9
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo 1054 GGCTAAATATTTTATTTCCC -3.9 -20.5 61.2
SEQ ID NO: 1337 -15.8 -0.6 -8.2 1334 TAGATTTATCTCTGAGGTGG
-3.9 -21 65.4 -16.2
SEQ ID NO: 1338 -0.7 -6.2 1390 ATATATAAATATTTACCTTC -3.9
SEQ ID NO: 1339 -14.9 49.8 -11 0 -7.4 1687 TTTACAAACCTCCTAAAAAC -3.9 -16.9 52.2 -13
SEQ ID NO: 1340 0 -2.2 TGTTGAGGGCAGTCCACCGC
141 -3.8
SEQ ID NO: 1341 -29.9 81.8 -25 -1 -5.6
143 AGTGTTGAGGGCAGTCCACC -3.8
SEQ ID NO: 1342 -28.5 81.8 -23.6 -1 -5.6
278 ACTTCATGCCATCCATGCCT -3.8
SEQ ID NO: 1343 -28.6 78.1 -23 -1.8 -5 CCCGAAGGTGCCGTAGGGAC
373 -3.8 -29.8 77.4 -23.3 -2.7
SEQ ID NO: 1344 -7.9 AATCACAGCCGGGATCAGCG
618 -3.8 -26.6 71.7 -21.9 -0.7
SEQ ID NO: 1345 -6.9 TGCATTCGAATATTTAACAA
822 -3.8 -16.8 52.6 -12.4 0
SEQ ID NO: 1346 -8.4 TCAAAGTCAAAGAACTAATT
967 -3.8 -14.7 48.8 -10.9 0
SEQ ID NO: 1347 -3 TTTCCATAAGCTTCAAACAT 1180 -3.8 -19.7 59.2 -15.9 0
SEQ ID NO: 1348 -6.8 TTCTTTCAAATATACTCCTA 1760 -3.8
SEQ ID NO: 1349 -18.8 58.5 -15 0 -2.7 CTGAGATATTTCCTAAGAAC 1811 -3.8 -18.4 57.1 -14.1 -0.2 -4.6
SEQ ID NO: 1350 ATACTGAAATAATTCTTAAA 1859 -3.8 -12.8 45.1 -8.3 -0.4
SEQ ID NO: 1351 -3.5 GTTGGCCAACTTCAAGAATA 1891 -3.8 -21.5 62.9 -14.7 0 -14.2
SEQ ID NO: 1352 GAGGAGCGTGGTCAGCAGCA
82 -3.7 -28.7 81.5 -24.1 -0.7 -5.9
SEQ ID NO: 1353 TTTCCCAAAGCCAAAAAAAA 1119 -3.7 -17.5 51.9 -13.8 0 -3.2
SEQ ID NO: 1354 TTACTCAAATTTCCATAAGC 1189 -3.7
SEQ ID NO: 1355 -18.7 57.4 -15 0 -4.5 CATACGTTAAAGCTATTTAT 1314 -3.7
SEQ ID NO: 1356 -17.3 54.3 -13 -0.3 -5.7 ATTTTCAACAAATAATACTA 1482 -3.7
SEQ ID NO: 1357 -13.7 46.9 -10 0 -2.5 CCAGAGTGACTCCTATAATT 1571 -3.7
SEQ ID NO: 1358 -22.3 65.5 -17.9 -0.4 -5.5 TTCCTAAGAACATCTAGTAC 1802 -3.7 -19.3 59.8 -15.6 0 -4
SEQ ID NO: 1359 TACATTCAAAGGCCTTCCAC 1927 -3.7 -23.7 67.5 -18.5 -1 -10.6
SEQ ID NO: 1360 CTTCATGCCATCCATGCCTG
277 -3.6
SEQ ID NO: 1361 -28.4 77.3 -23 -1.8 -5 ACTGGCAGTTGCAGGTCTCT
404 -3.6
SEQ ID NO: 1362 -27.6 81.7 -23 -0.9 -6.6 TCAAAGAACTAATTTGACTC
961 -3.6
SEQ ID NO: 1363 -16 51.9 -10.9 -1.4 -5.4 AAGGGCTAAATATTTTATTT 1057 -3.6
SEQ ID NO: 1364 -16.6 53.2 -12.3 -0.4 -8.2 AATAATACTAGATTTCTTTC 1472 -3.6
SEQ ID NO: 1365 -15.5 51.8 -11.9 0 -4.5 CTATAATTATGGATAATAAA 1559 -3.6 -12.5 44.5 -8.3
SEQ ID NO: 1366 -0.3 -5.9
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo TGAAATCCAGAGTGACTCCT 1577 -3.6 -23.1 66.8 -18.8 -0.4 -5.5
SEQ ID NO: 1367 TTTTAAAGTTGACATGTTTT 1728 -3.6 -16.9 54.6 -13.3 0 -7.1
SEQ ID NO: 1368 AGATTCTTTCAAATATACTC 1763 -3.6 -16.8 54.7 -12.7 -0.1 -3.3
SEQ ID NO: 1369 1832 TTCACTTCAAATAAAATACT -3.6 -14.5 48.4 -10.9 0 -1.2
SEQ ID NO: 1370 ACATTCAAAGGCCTTCCACA 1926 -3.6 -24.7 69.1 -19.6 -1 -10.6
SEQ ID NO: 1371 1959 TTTAAAACAAAACCTAACAG -3.6 -13.6 45.9 -10 0 -4
SEQ ID NO: 1372 GCGGCCACCAGGTGTGCAGG
105 -3.5 -32.5 86.1 -26.4 -2.5 -12.5
SEQ ID NO: 1373 CGGGCCACACTTCATGCCAT
286 -3.5 -29.4 77.6 -23.7 -2.2 -7.6
SEQ ID NO: 1374 AGCCCCGGGCCACACTTCAT
291 -32.7 83.6 -27.3 -1.8 -11.2
SEQ ID NO: 1375 -3.5 GCAGATACCAAACTCTTCAC
346 -3.5 -22.1 64.8 -18.6 0 -3.4
SEQ ID NO: 1376 CAAAGTCAAAGAACTAATTT
966 -3.5 -14.4 48.1 -10.9 0 -3
SEQ ID NO: 1377 AGGCCTTCCACACACATTCA 1918 -3.5 -27 75.4 -22.4 -1 -7.9
SEQ ID NO: 1378 CAGCCACAGTCGTCGAGCAC
207 -3.4 -28.2 77.5 -24.2 -0.3 -4.9
SEQ ID NO: 1379 GTGCGGTAGCAAGTTTCTCC
252 -3.4 -26.8 77.3 -21.4 -2 -5.5
SEQ ID NO: 1380 GACAGTCTTTGCAGATACCA
356 -3.4 -23.9 70.3 -20.5 0.3 -5.2
SEQ ID NO: 1381 ATTCTAGAGAAGCTACCTAC 1082 -3.4 -21 63.8 -17.6 0 -5.8
SEQ ID NO: 1382 AATTTCCATAAGCTTCAAAC 1182 -3.4 -18.3 56.1 -14.9 0 -6.8
SEQ ID NO: 1383 AACCATTTTCAACAAATAAT 1486 -3.4 -15.4 49.5 -11.5 -0.1 -2.7
SEQ ID NO: 1384 AATTATGGATAATAAATTTA 1555 -3.4 -12.1 43.7 -8.1 -0.3 -6.1
SEQ ID NO: 1385 12 GTCTTTGCTGGTGGGAAGCA -3.3 -26.6 77.2 -21.8 -1.4 -5.7
SEQ ID NO: 1386
175 GCGCGGGCTGCTTTTGCACT -3.3 -30.9 82.1 -25.1 -2.5 -11.8
SEQ ID NO: 1387
290 GCCCCGGGCCACACTTCATG -3.3 -32.7 83.1 -28.1 -1 -10
SEQ ID NO: 1388
308 TAGAAGGCTGACACCTCAGC -3.3 -25 71.8 -17.8 -3.9 -9.4
SEQ ID NO: 1389
383 TGCAATCCATCCCGAAGGTG -3.3 -26.4 70.9 -21.8 -1.2 -6.9
SEQ ID NO: 1390
649 AACAATCACGAAAATAGAGC -3.3 -16.2 50.9 -12.9 0 -3.5
SEQ ID NO: 1391
833 ACAAATCTACATGCATTCGA -3.3 -19.8 58.9 -16.5 0 -6.7
SEQ ID NO: 1392 1160 CTTACTTCCTTCAGGGGTTT
-3.3 -25.4 75 -21.6 -0.2 -4.7
SEQ ID NO: 1393 1183 AAATTTCCATAAGCTTCAAA -17.4
SEQ ID NO: 1394 -3.3 53.9 -14.1 0 -6.8 1438 AAATATGGGTAGGGAAGATG
SEQ ID NO: 1395 -3.3 -18.5 56.8 -15.2 0 -2.7 1473 AAATAATACTAGATTTCTTT
SEQ ID NO: 1396 -3.3 -14.4 48.9 -11.1 0 -4.5
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo
TATAATTATGGATAATAAAT
1558 -3.3
SEQ ID NO: 1397 -11.6 42.7 -8.3 0.2 -5.9 ACTTATGTTTAAATAAGGTC 1625 -3.3 -16.4 53.5 -11.5 -1.5 -7.1
SEQ ID NO: 1398 TTGTTCTTTTTTATTGAACA 1995 -3.3
SEQ ID NO: 1399 -17.8 57 -12.4 -2.1 -6.7 CGCGGGCTGCTTTTGCACTC 174 -3.2
SEQ ID NO: 1400 -29.5 79.6 -24.2 -2.1 -11.3 TCAGAAATCACAGCCGGGAT 623 SEQ ID NO: 1401 -3.2 -23.9 66.8 -20.7 0 -6.9 TCTCCATGTAAGATTACCTA 897 SEQ ID NO: 1402 -3.2 -21.8 64.9 -18.6 0 -4.9 CTTCAGGGGTTTTCTGGTTG 1152 SEQ ID NO: 1403 -3.2 -25 75.1 -20.9 -0.7 -4.2 CATCAGCAGCCTTTTGAAAT 1232 -3.2 -22.5 65.2 -19.3 0 -4.1
SEQ ID NO: 1404 TCATACACACACAAACCACC 1372 -3.2 -22.1 62.6 -18.9 0 -0.9
SEQ ID NO: 1405 TTTATTTATAAAAATATATA 1403 -3.2 -5.3 -1.2 -6.5
SEQ ID NO: 1406 -9.8 39.4 CCTATAATTATGGATAATAA 1560 SEQ ID NO: 1407 -3.2 -15.2 49.6 -11.5 -0.1 -6.5 TGAATATTGGAAGAAGGGGA 463 -3.1
SEQ ID NO: 1408 -18.9 57.3 -15.8 0 -4.6 GTGTTACTATACACACACAT 856 -3.1 -20.3 62 -15.6 -1.5 -6.3
SEQ ID NO: 1409 TTGACTCACTGCGGTCTTCA 948 SEQ ID NO: 1410 -3.1 -25.5 73.9 -21.4 -0.9 -6.2 CTAAGATTCTTTCAAATATA 1766 SEQ ID NO: 1411 -3.1 -15.2 50.6 -11.6 -0.1 -5.6 AGAACATCTAGTACAACAGT 1796 -3.1 -19 59.2 -15.9 0 -5.7
SEQ ID NO: 1412 TCTTCATGTTTCCCAGCTGC 56 SEQ ID NO: 1413 -3 -27.5 79.4 -24 0 -8.1 CGAGGAGCGTGGTCAGCAGC 83 -3 -28.8 80 -24.8 -0.9 -5.9
SEQ ID NO: 1414 GCAGCGCACACTCGGCAGCA 225 SEQ ID NO: 1415 -3 -31 82.1 -25.7 -2.3 -8.5 CGAAGGTGCCGTAGGGACAG 371
SEQ ID NO: 1416 -3 -26.5 72.1 -21.9 -1.5 -6.7 GGGGAATTTCAGGCATTTTC 448
SEQ ID NO: 1417 -3 -23.2 68.8 -20.2 0 -5 TGTCATGCTCCGTGAGAGAA 509
SEQ ID NO: 1418 -3 -24.5 70.3 -20.4 -1 -6.1 CTCCATGTAAGATTACCTAA 896
SEQ ID NO: 1419 -3 -20.7 61.4 -17.7 0 -4.9 TCTGGTTGTTTTATTTTGAC 1140
SEQ ID NO: 1420 -3 -20.1 63.4 -17.1 0 -2 AGGTGGCATACGTTAAAGCT 1320
SEQ ID NO: 1421 -3 -23.1 66.7 -19.5 -0.3 -5.1 1376 ACCTTCATACACACACAAAC
SEQ ID NO: 1422 -3 -20.4 60 -17.4 0 -0.9 1388 ATATAAATATTTACCTTCAT
SEQ ID NO: 1423 -3 -15.9 51.7 -12.4 0 -7.9 TCACTTCAAATAAAATACTT 1831 SEQ ID NO: 1424 -3 -14.5 48.4 -11.5 0 -1.2 1857 ACTGAAATAATTCTTAAATA
SEQ ID NO: 1425 -3 -12.8 45.1 -8.6 -1.1 -4.2 1925 CATTCAAAGGCCTTCCACAC
SEQ ID NO: 1426 -3 -24.7 69.1 -20.2 -1 -10.6
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo
TAAAACAAAACCTAACAGCT
1957 -3 -16.1 50.3 -13.1 0 -4.3
SEQ ID NO: 1427 TTAAAACAAAACCTAACAGC
1958 -3 -15.3 49 -12.3 0 -2.8
SEQ ID NO: 1428 TTTAACCATTTCCTCATTAC
594 -2.9 -20.7 62.1 -17.8 0 -2.4
SEQ ID NO: 1429 AGAACTAATTTGACTCACTG
957 -2.9 -18.1 56.6 -15.2 0 -2.7
SEQ ID NO: 1430 ATTTCTTTCCTCAAGAGGAT
1461 -2.9 -21.8 65.9 -17.3 -1.5 -10.2
SEQ ID NO: 1431 AGTGACTCCTATAATTATGG
1567 -2.9 -19.9 60.9 -17 0 -6.9
SEQ ID NO: 1432 TTTGAAATCCAGAGTGACTC
1579 -2.9 -20.4 61.9 -17.5 0 -5.1
SEQ ID NO: 1433 TTCTTTTACAAACCTCCTAA
1691 -2.9 -20.3 60.4 -17.4 0 -1.9
SEQ ID NO: 1434 AGATATTTCCTAAGAACATC
1808 -2.9 -18 56.5 -14.4 -0.5 -4
SEQ ID NO: 1435 ACATGTCCTTTTAAAACAAA
1968 -2.9 -16.8 52.6 -13.9 0 -6.2
SEQ ID NO: 1436 CTCTTCATGTTTCCCAGCTG
57 -2.8 -26.6 76.9 -23.3 0 -7.8
SEQ ID NO: 1437 GTGTGCAGGCACGAGGAGCG
94 -2.8 -28.6 78.3 -24 -1.7 -10.7
SEQ ID NO: 1438 GCCACCAGGTGTGCAGGCAC
102 -2.8 -31.4 85.9 -25.8 -2.1 -13.5
SEQ ID NO: 1439 ACACTCGGCAGCAGCCACAG
218 -2.8 -28.8 78.4 -22.8 -3.2 -9.8
SEQ ID NO: 1440 GCGCACACTCGGCAGCAGCC
222 -2.8 -32.3 84.4 -27.2 -2.1 -12
SEQ ID NO: 1441 AAGGCTGACACCTCAGCCCC
305 -2.8 -30.7 81.2 -21.8 -6.1 -13.4
SEQ ID NO: 1442 CCGAAGGTGCCGTAGGGACA
372 -2.8 -28.5 75.1 -23.5 -2.2 -8.6
SEQ ID NO: 1443 CTCAGAAATCACAGCCGGGA
624 -2.8 -24.8 68.6 -22 0 -6.9
SEQ ID NO: 1444 GTCTCCATGTAAGATTACCT
898 -2.8 -23.3 68.7 -20.5 0 -5.5
SEQ ID NO: 1445 AAAGTCAAAGAACTAATTTG
965 -2.8 -13.7 46.8 -10.9 0.1 -3.8
SEQ ID NO: 1446 CACAATTAAATTCTAGAGAA
1091 SEQ ID NO: 1447 -2.8 -14.9 49.3 -12.1 0 -5.8 GGAACTACATCAGCAGCCTT
1239 -2.8 -25.2 71.8 -22.4 0 -4.5
SEQ ID NO: 1448 TATTTACCTTCATACACACA
1381 -2.8 -20.3 61.3 -17.5 0 -1.1
SEQ ID NO: 1449 TGTTCTTTTTTATTGAACAA
1994 -2.8 -17 54.8 -12.1 -2.1 -6.6
SEQ ID NO: 1450 AGGAGCGTGGTCAGCAGCAA
81 -2.7 -27.4 77.4 -23.1 -1.5 -5.9
SEQ ID NO: 1451 ACGAGGAGCGTGGTCAGCAG
84 -2.7 -27.2 76.2 -23.3 -1.1 -6.3
SEQ ID NO: 1452 ACCTCAGCCCCGGGCCACAC
296 -2.7 -34.8 87 -30.2 -1.8 -11.2
SEQ ID NO: 1453 GTACTTATGCTATATCTAGA
697 -2.7 -19.5 61.6 -16.8 0 -5.8
SEQ ID NO: 1454 TCCTATAATTATGGATAATA
1561 -2.7 -16.3 52.4 -12.9 0 -8.7
SEQ ID NO: 1455 GTTTAAATAAGGTCCCTCTG
1619 -2.7 -21.7 64.2 -19 0 -4.8
SEQ ID NO: 1456
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position - , binding ation Duplex ture oligo oligo
1679 CCTgEQAιD AN0™457':l:''rC ~2-7 "18-7 56"8 ~15 ~°'9 "3 ' 3
1815 ACTTCTGAGATATTTCCTAA _2 η _19.9 61.2 -17.2 0 -3.8
SEQ ID NO: 1458
CCAGGTGTGCAGGCACGAGG
-2.6 -29.3 80.1 -24.2 -2.5 -10.7
SEQ ID NO: 1459
1 „ CGGGCTGCTTTTGCACTCAC _ c ,
172 SEQ ID O:1460 ~2 ' 6 ~27-8 77 "3 ~23 "2 ~2 ~8-4 -.,„ CAAACTCTTCACCAAAAGGA „ c I Q C CT C C O n -D T 338 SEQ ID NO: 1461 ~2 ' 6 "19-5 57 ' 6 ~16-9 ° ~3-7 , 1 CTAAAATGTTGGCTGTGTGT ., „ 10 -7 n -D O 671 SEQ ID NO:1462 _2-6 -21"3 63 " 8 "18-7 ° "3 • 9
700 CATG E AC™A^GC^4g A C -2.6 -19.9 61.8 -17.3 0 -4.8
-., GACTCACTGCGGTCTTCAGC _ 0 „ Q -.
946 SEQ ID NO:1464 ~2 ' 6 ~27-2 78 "5 ~23-9 ~0-4 "6
-,-.- TTTTTGAAATCCAGAGTGAC „ , ια 1 to 9 ιe 7 n -5
1581 SEQ ID NO: 1465 "2 ' 6 ~19-3 59 "2 _16-7 ° ~3
1659 ATAG EgTAAA™GAAAATTC -2.6 -14.3 47.8 -10.4 -1.2 -3.7 lg80 ACCTCCTAAAAACTTATTTT _2 > g _χQ 5 5f. _χ-. _Q 7 _3 2
1686 ~2-6 -17-7 53-6 -15-1 ° -1-2
-_.-. TATTTCCTAAGAACATCTAG „ c 1 Q -.c , - . . n . c
1805 SEQ ID NO: 1469 ~2-6 _18 56-6 ~14-9 "°-2 "3 " 6 GAAATAATTCTTAAATAAGT SEQ ID NO:1470
1 QK CAAAACCTAACAGCTTATGC . . 1 Q Q -. - 1 C , . _, . -.
1952 SEQ ID NO: 1471 _2-6 _19 "9 58 "5 ~16-6 "°-5 _4-5
,. CAAGACGCTCTTCATGTTTC „ . .„ . , 1 Q , . - c 1
64 SEQ ID NO: 1472 "2 "5 ~22 ' 6 67 ~19-3 "°-6 -6" 1
.-,. TTCATGCCATCCATGCCTGA „c
276 SEQ ID NO: 1473 ~2-5 "28 >1 76"7 ~23-8 -1"8 ~5
... TGACTGGCAGTTGCAGGTCT „ _. .. . Q Q .. . 1 , -
406 SEQ ID NO: 1474 ~2-5 "26 "9 78 " 8 "24 "4 1 "7 "^
R1. ATGTCATGCTCCGTGAGAGA
510 SEQ ID NO: 1475 ~2-5 ~2S '2 72'7 "21-6 _1 -6-1
,q„ TAACCATTTCCTCATTACGG ,, ,. ... .- n K ς
592 SEQ ID NO: 1476 ~2 ' 5 "22 "5 64"3 ~2° ° "3 ' 5
ATGTACTTATGCTATATCTA lo q cq q 1 fi n Δ o
699 SEQ ID NO: 1477 ~2'5 ~18'9 59-9 ~16 ° ~4-8
-... AAAGCTGTTTGTTACTCAAA - _. -. ,, -.-, . - . - . Q
1200 SEQ ID O:1478 ~2 " 5 ~18-5 57 "4 _14-5 _1-4 "7 • 8
ATAATACTAGATTTCTTTCC „ -. „ . -.
1471 SEQ ID NO: 1479 "2 • 5 ~18-2 57 ' 8 "15 '7 ° ~4-5
1931
"23-3 67.4 -19.5 -0.6 -10.4 173 GCG ?S™?4 A CA "2-4 -9-4 81.1 -24.9 -2.1 -8.4 279 CACTTCATGCCATCCATGCC _2_4 ^ ηη 2 _^η _ _^
GCAATCCATCCCGAAGGTGC
382 SEQ ID NO:1483 "2"4 ~28'2 74"9 ~24-5 ~X'2 ~5 ' 6
. , TGGAAGAAGGGGAATTTCAG . . ιQ Q CQ c 1 C 0 n -5 c
456 SEQ ID NO:1484 "2"4 "19 ' 8 59-6 "l6"8 ~0-3 "5
„.. CATGCATTCGAATATTTAAC . . π c c„ ^ A c n 0 9
8 4 SEQ ID NO: 1485 _2 '4 _17'5 54"2 _14-6 ° ~8-2
AGTGTTACTATACACACACA ,„ , „ , ι ς κ , , 7 ,
857 SEQ ID NO:1486 ~2"4 " 0-3 62"3 ~15-6 ~2 ,3 "7 ' 1
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position nding ation Duplex ture oligo oligo oligo
964 AAGTCAAAGAACTAATTTGA
-2.4 -15 49.6 -10.9 -1.7 -6
SEQ ID NO: 1487 1052 CTAAATATTTTATTTCCCAC -2.4 -18.4 56.6 -15.2 -0.6 -6.2
SEQ ID NO: 1488 TTATTTATAAAAATATATAA 1402 -2.4 -9 37.9 -5.3 -1.2 -6.5
SEQ ID NO: 1489 TAAATATGGGTAGGGAAGAT 1439 -2.4 -18.2 56.3 -15.8 0 -2.7
SEQ ID NO: 1490 1444 GATGATAAATATGGGTAGGG -2.4 -18.9 57.9 -16.5 0 -2.7
SEQ ID NO: 1491 GCCAACTTCAAGAATAAAAT 1887 -2.4 -16.9 52.2 -14.5 0 -3.5
SEQ ID NO: 1492 TCATGTTTCCCAGCTGCCTC 53 -2.3 -29.4 82.6 -26.6 0 -8.1
SEQ ID NO: 1493 ACCAGGTGTGCAGGCACGAG 99 -2.3 -28.3 78.1 -24.2 -1.7 -10.7
SEQ ID NO: 1494 CACCAGGTGTGCAGGCACGA 100 -2.3 -29 78.8 -24.2 -2.5 -10.7
SEQ ID NO: 1495 ACCAAACTCTTCACCAAAAG 340 -2.3 -19.9 58 -17.6 0 -2.6
SEQ ID NO: 1496 386 CTCTGCAATCCATCCCGAAG -2.3 -26.2 70.7 -23.9 0 -4.9
SEQ ID NO: 1497 GTCATGCTCCGTGAGAGAAA 508 -2.3 -23.8 68.2 -20.4 -1 -6.1
SEQ ID NO: 1498 TGGATTTAACCATTTCCTCA 598 -22.5 65.5
SEQ ID NO: 1499 -2.3 -19.4 -0.6 -4.3 820 CATTCGAATATTTAACAAAC -2.3 -14.5 47.9 -11.4 0 -9.3
SEQ ID NO: 1500 853 TTACTATACACACACATTTA -2.3 -17.8 56.1 -15.5 0 -1.7
SEQ ID NO: 1501 947 TGACTCACTGCGGTCTTCAG -2.3 -25.4 73.8 -22.1 -0.9 -6.2
SEQ ID NO: 1502 1118 TTCCCAAAGCCAAAAAAAAA -2.3 -16.7 50.3 -14.4 0 -3.2
SEQ ID NO: 1503 1242 CCGGGAACTACATCAGCAGC
-2.3 -26.2 72.1 -23.4 -0.2 -5.6
SEQ ID NO: 1504 TTATAAAAATATATAAATAT 1398 -2.3 -8.1 36.2 -5.3 -0.1 -4.2
SEQ ID NO: 1505 ACTTATTTTCATACCTTAAA 1669 -2.3 -17.5 55.2 -15.2 0 -2.3
SEQ ID NO: 1506 1672 AAAACTTATTTTCATACCTT
SEQ ID NO: 1507 -2.3 -17.1 53.9 -14.1 -0.4 -2.9 1729 ATTTTAAAGTTGACATGTTT -2.3 -16.8 54.3 -14.5 0 -7.1
SEQ ID NO: 1508 1860 AATACTGAAATAATTCTTAA
SEQ ID NO: 1509 -2.3 -12.8 45.1 -9.3 -1.1 -4.2 1939 CTTATGCAGCTTTACATTCA -2.3 -21.9 66 -19.6 0 -5.5
SEQ ID NO: 1510 GTTTCCCAGCTGCCTCCGGC 49 SEQ ID NO: 1511 -2.2 -34.1 89.7 -30.5 -1.3 -8.1 CCGGGCCACACTTCATGCCA 287 SEQ ID NO: 1512 -2.2 -31.4 80.9 -27 -2.2 -7.6 TCCGTGAGAGAAACAAATCT 501 SEQ ID NO: 1513 -2.2 -19.6 58 -17.4 0 -2.9 GTGGATTTAACCATTTCCTC 599 SEQ ID NO: 1514 -2.2 -23 67.5 -19.9 -0.8 -4.8 ATCACAATTTGGATCTTCAA 726 -2.2 58.8 -16.9
SEQ ID NO: 1515 -19.1 0 -5.2 TGTTACTATACACACACATT 855 SEQ ID NO: 1516 -2.2 -19.2 59.3 -17 0 -2.6
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total formTm of struc- molecular molecular position binding ation oligo oligo oligo
968 ATCAAAGTCAAAGAACTAAT -2.2 -14.6 48.5 -12.4
SEQ ID NO: 1517 0 -3 GTTAAAGCTATTTATGGAAG
1309 -2.2 -17 54.3 -14.2 -0.3 -4.6
SEQ ID NO: 1518
1315 GCATACGTTAAAGCTATTTA -2.2 -19.1 58.2 -16.4 -0.1
SEQ ID NO: 1519 -5.7
1445 GGATGATAAATATGGGTAGG -2.2 -18.9
SEQ ID NO: 1520 57.9 -16.7 0 -2.7
1556 TAATTATGGATAATAAATTT -2.2 -12.1
SEQ ID NO: 1521 43.7 -9.3 -0.3 -5.2
1799 CTAAGAACATCTAGTACAAC -2.2 -17 54.2 -14.8 0 -5.7
SEQ ID NO: 1522
80 GGAGCGTGGTCAGCAGCAAG
-2.1 -27.4
SEQ ID NO: 1523 77.4 -23.7 -1.5 -5.9
104 CGGCCACCAGGTGTGCAGGC -2.1 -32.5 86.1 -27.8 -2.5
SEQ ID NO: 1524 -12.5
650 GAACAATCACGAAAATAGAG -2.1 -15
SEQ ID NO: 1525 48.6 -12.9 0 -3.5
1078 TAGAGAAGCTACCTACCAAG -2.1 -21.6 63.2 -19.5 0
SEQ ID NO: 1526 -5.1
1924 ATTCAAAGGCCTTCCACACA -2.1 -24.7 69.1 -21.3 -1
SEQ ID NO: 1527 -10.1
145 ACAGTGTTGAGGGCAGTCCA -2 -27.2 79.2 -24.1 -1 -6.6
SEQ ID NO: 1528
171 GGGCTGCTTTTGCACTCACT -2
SEQ ID NO: 1529 -27.9 79.7 -23.8 -2.1 -8.4 GAGACTGTGCGGTAGCAAGT
258 -2 -25.2
SEQ ID NO: 1530 72.8 -20.5 -2.7 -7 TGCCATGTCATGCTCCGTGA
514 -2
SEQ ID NO: 1531 -28.5 78.2 -25.6 -0.7 -5.7
625 TCTCAGAAATCACAGCCGGG
-2 -24.6 68.8 -22.6 0
SEQ ID NO: 1532 -6.9
1311 ACGTTAAAGCTATTTATGGA
-2 -18.7 57.3 -16.1 -0.3 -5.7
SEQ ID NO: 1533
1382 ATATTTACCTTCATACACAC -2 -19.6 60 -17.6 0 -1.8
SEQ ID NO: 1534 TTTATAAAAATATATAAATA
1399 SEQ ID NO: 1535 -2 -8.2 36.4 -5.3 -0.8 -5.5 ATTTATTTATAAAAATATAT
1404 -2
SEQ ID NO: 1536 -10.1 39.9 -6.8 -1.2 -6 TTTCAACAAATAATACTAGA
1480 -2
SEQ ID NO: 1537 -14.2 47.9 -12.2 0 -4.5
1956 AAAACAAAACCTAACAGCTT -2
SEQ ID NO: 1538 -16.5 51.1 -14.5 0 -4.5 TGAGAGAAACAAATCTGTTG
497 SEQ ID NO: 1539 -1.9 -16.5 52.6 -13 -1.5 -4.5 GCCATGTCATGCTCCGTGAG
513 78.7
SEQ ID NO: 1540 -1.9 -28.5 -25.6 -0.9 -6.6 ACAGCCGGGATCAGCGTGGA
614 SEQ ID NO: 1541 -1.9 -29.2 78.1 -26.4 -0.7 -6.9 CCTAAAATGTTGGCTGTGTG
672 SEQ ID NO: 1542 -1.9 -22.1 64.3 -20.2 0 -3.9
981 AACATTAATGTACATCAAAG
SEQ ID NO: 1543 -1.9 -14.8 49 -11.6 -0.2 -10.5 AATAATTCTTAAATAAGTTC
1852 SEQ ID NO: 1544 -1.9 -12.8 45.5 -10.9 0 -4.9
1893 CTGTTGGCCAACTTCAAGAA
SEQ ID NO: 1545 -1.9 -22.7 65.2 -17.4 -0.5 -15
1951 AAAACCTAACAGCTTATGCA 58.5
SEQ ID NO: 1546 -1.9 -19.9 -16.4 -1.6 -5.7
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo CACACTCGGCAGCAGCCACA
219 SEQ ID NO: 1547 -1.8 -29.5 79 -24.5 -3.2 -9.8 CCGTCCCCCTGTCACAGATG
428 -1.8 -31.1 81.2 -28.7 -0.3 -5.2
SEQ ID NO: 1548 TCACAGCCGGGATCAGCGTG
616 SEQ ID NO: 1549 -1.8 -28.5 77 -25.1 -1.6 -8.1 ACAAACACATACAAGTGTTC
806 -1.8 -18.1 56.3 -13.5 -2.8 -8.2
SEQ ID NO: 1550 ATTCGAATATTTAACAAACA
819 -1.8 -14.5 47.9 -12 0 -9.1
SEQ ID NO: 1551 AAATATTTTATTTCCCACTC 1050 -1.8 -19.1 58.4 -16.7 -0.3 -5.8
SEQ ID NO: 1552 CGTTAAAGCTATTTATGGAA 1310 54.9 -15.4 -0.3 -5.1
SEQ ID NO: 1553 -1.8 -17.8 1953 ACAAAACCTAACAGCTTATG -1.8 -18.3 55.4 -16.5 0 -4.5
SEQ ID NO: 1554 CACGAGGAGCGTGGTCAGCA
85 SEQ ID NO: 1555 -1.7 -27.9 76.9 -23.4 -2.8 -9.7
101 CCACCAGGTGTGCAGGCACG -1.7 -30.4 80.9 -26.2 -2.5 -11.6
SEQ ID NO: 1556 CATTAGAAGGCTGACACCTC
311 SEQ ID NO: 1557 -1.7 -23.3 67.7 -20.8 -0.6 -4.3
375 ATCCCGAAGGTGCCGTAGGG -1.7 -29.4 77.2 -25 -2.7 -7.9
SEQ ID NO: 1558 1156 CTTCCTTCAGGGGTTTTCTG -1.7 -25.9 76.6 -23.6 -0.3 -5.7
SEQ ID NO: 1559 TTACTTCCTTCAGGGGTTTT 1159 -1.7 -24.6 73.3 -22.4 -0.2 -4.7
SEQ ID NO: 1560 TATGTGTTTCCTATGCCCCA 1287 SEQ ID NO: 1561 -1.7 -27.8 76.9 -26.1 0 -3 TATTTATAAAAATATATAAA 1401 SEQ ID NO: 1562 -1.7 -8.2 36.4 -5.3 -1.1 -6.5 1474 CAAATAATACTAGATTTCTT
SEQ ID NO: 1563 -1.7 -15 49.9 -13.3 0 -4.5 GAGTGACTCCTATAATTATG 1568 -1.7 -19.3 59.6 -17.6 0 -5.9
SEQ ID NO: 1564 ATAAAATACAGGTAAATACT 1874 -1.7 -13.7 46.7 -12 0 -3.8
SEQ ID NO: 1565
427 CGTCCCCCTGTCACAGATGC
SEQ ID NO: 1566 -1.6 -30.9 82.1 -28.7 -0.3 -5.2 AGCTACCTACCAAGGAAGGG 1072 SEQ ID NO: 1567 -1.6 -24.9 69.6 -22.4 -0.7 -8.8 AATTCTAGAGAAGCTACCTA 1083 SEQ ID NO: 1568 -1.6 -20.1 61.2 -18.5 0 -5.8 TTTATGGAAGTGTATGTGTT 1299 SEQ ID NO: 1569 -1.6 -19.6 61.6 -18 0 -1.3 AATATTTACCTTCATACACA 1383 -18.7 57.5
SEQ ID NO: 1570 -1.6 -17.1 0 -3.8 TATAAAAATATATAAATATT 1397 SEQ ID NO: 1571 -1.6 -8.1 36.2 -5.3 -1.1 -4.4 TTTTGAAATCCAGAGTGACT 1580 SEQ ID NO: 1572 -1.6 -20.1 60.8 -18.5 0 -4.2 1742 TAATTCCACCTATATTTTAA
SEQ ID NO: 1573 -1.6 -18 55.7 -16.4 0 -2.9 GACTGTGCGGTAGCAAGTTT
256 SEQ ID NO: 1574 -1.5 -24.8 71.9 -20.4 -2.9 -7.2 TGAGACTGTGCGGTAGCAAG
259 SEQ ID NO: 1575 -1.5 -24 69.3 -20.5 -2 -7 CTGACTGGCAGTTGCAGGTC
407 SEQ ID NO: 1576 -1.5 -26.9 78.8 -24.4 -0.9 -7.6
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo
519 CCAGATGCCATGTCATGCTC
SEQ ID NO: 1577 -1.5 -27.2 76.6 -25.2 -0.2 -4.6 620 GAAATCACAGCCGGGATCAG
SEQ ID NO: 1578 -1.5 -23.9 66.8 -22.4 0 -6.9 659 CTGTGTGTTGAACAATCACG
SEQ ID NO: 1579 -1.5 -20.8 61.5 -17.4 -1.9 -8.7 GAAGGGCTAAATATTTTATT 1058 -1.5
SEQ ID NO: 1580 -17.1 54.2 -15.6 0 -6.2 1158 TACTTCCTTCAGGGGTTTTC
SEQ ID NO: 1581 -1.5 -24.9 74.8 -23.4 0.4 -4.1 1295 TGGAAGTGTATGTGTTTCCT
-1.5
SEQ ID NO: 1582 -23.1 69.5 -19.9 -1.7 -5.4 1300 ATTTATGGAAGTGTATGTGT
SEQ ID NO: 1583 -1.5 -19.5 61.2 -18 0 -1.8 1313 ATACGTTAAAGCTATTTATG
SEQ ID NO: 1584 -1.5 -16.6 53 -14.5 -0.3 -5.7 1681 AACCTCCTAAAAACTTATTT
SEQ ID NO: 1585 -1.5 -17.7 54.1 -16.2 0 -2.2 1814 CTTCTGAGATATTTCCTAAG
-1.5 -19.7
SEQ ID NO: 1586 60.9 -18.2 0 -3.3 1947 CCTAACAGCTTATGCAGCTT
SEQ ID NO: 1587 -1.5 -24.6 70.5 -21.1 -2 -6.9 1948 ACCTAACAGCTTATGCAGCT
SEQ ID NO: 1588 -1.5 -24.7 70.7 -21.3 -1.9 -6.9 698 TGTACTTATGCTATATCTAG
SEQ ID NO: 1589 -1.4 -18.9 60.1 -17.5 0 -4.8 978 ATTAATGTACATCAAAGTCA -1.4
SEQ ID NO: 1590 -16.9 54.1 -14.9 0 -8.4 1073 AAGCTACCTACCAAGGAAGG -1.4
SEQ ID NO: 1591 -23 65.1 -20 -1.6 -9.2 1288 GTATGTGTTTCCTATGCCCC
SEQ ID NO: 1592 -1.4 -28.3 79.3 -26.9 0 -3 1384 AAATATTTACCTTCATACAC
SEQ ID NO: 1593 -1.4 -17.3 54.5 -15.9 0 -5.8 1570 CAGAGTGACTCCTATAATTA
SEQ ID NO: 1594 -1.4 -20 61.2 -17.9 -0.4 -5.5 ATACTCCTAATTCCACCTAT 1749 SEQ ID NO: 1595 -1.4 -23.1 66.4 -21.7 0 -2.9 ATATACTCCTAATTCCACCT 1751
SEQ ID NO: 1596 -1.4 -23.1 66.4 -21.7 0 -2.9 1825 CAAATAAAATACTTCTGAGA
SEQ ID NO: 1597 -1.4 -14.3 47.9 -12.9 0 -2.8 AAATACTGAAATAATTCTTA 1861 SEQ ID NO: 1598 -1.4 -12.8 45.1 -10.2 -1.1 -4.2 TGTTGGCCAACTTCAAGAAT 1892 SEQ ID NO: 1599 -1.4 -21.8 63.4 -17 -0.5 -15 TTATGCAGCTTTACATTCAA 1938 SEQ ID NO: 1600 -1.4 -20.3 61.8 -18.9 0 -5.5 GCACGAGGAGCGTGGTCAGC 86 SEQ ID NO: 1601 -1.3 -29 80.2 -24.2 -3.5 -9.7 TGCTTTTGCACTCACTGCTG 167 SEQ ID NO: 1602 -1.3 -25.5 73.9 -22.2 -2 -7.5 TTTCCTCAAGAGGATGATAA 1456 SEQ ID NO: 1603 -1.3 -19.9 60.3 -17 -1.5 -10.2 1460 TTTCTTTCCTCAAGAGGATG
SEQ ID NO: 1604 -1.3 -21.8 65.8 -18.9 -1.5 -10.2 TAATACTAGATTTCTTTCCT 1470 SEQ ID NO: 1605 -1.3 -19.1 59.8 -17.8 0 -4 TAAAGTTGACATGTTTTCTG 1725
SEQ ID NO: 1606 -1.3 -17.9 56.9 -16.6 0 -7.1
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position linding ation Duplex ture oligo oligo oligo CGTGAGAGAAACAAATCTGT
499 SEQ ID NO: 1607 -1.2 -18.4 55.9 -16.6 -0.3 -3.3 AACAAATCTACATGCATTCG
834 -1.2 -18.5 55.9 -17.3 0 -6.7
SEQ ID NO: 1608 CCTACCAAGGAAGGGCTAAA 1067
SEQ ID NO: 1609 -1.2 -23.3 64.7 -21.2 -0.7 -5.1 GCTACCTACCAAGGAAGGGC 1071 -26.7
SEQ ID NO: 1610 -1.2 73.4 -23.9 -1.6 -6.1 TAAATTCTAGAGAAGCTACC 1085 SEQ ID NO: 1611 -1.2 -18.5 57.3 -17.3 0 -5.6 ACTTCCTTCAGGGGTTTTCT 1157 -1.2 -26.1 77.5 -24.4 -0.2
SEQ ID NO: 1612 -5.7 TCTTACTTCCTTCAGGGGTT 1161 SEQ ID NO: 1613 -1.2 -25.7 76.5 -24 -0.2 -4.7 TCCATAAGCTTCAAACATCT 1178 -1.2 -20.8 61.7 -19.6 0 -6.5
SEQ ID NO: 1614 TTCCATAAGCTTCAAACATC 1179 -1.2 -20 60.2 -18.8 0 -6.8
SEQ ID NO -.1615 TTAAAGCTATTTATGGAAGT 1308 -1.2 -17 54.3 -15.2 -0.3 -5.1
SEQ ID NO: 1616 1312 TACGTTAAAGCTATTTATGG
SEQ ID NO: 1617 -1.2 -17.8 55.5 -16.6 0 -5.7 1387 TATAAATATTTACCTTCATA
SEQ ID NO: 1618 -1.2 -15.6 51.1 -13.9 0 -7.9 CTGAAATAATTCTTAAATAA 1856 SEQ ID NO: 1619 -1.2 -11.9 43.3 -9.5 -1.1 -4.2 1940 GCTTATGCAGCTTTACATTC -1.2 -23 69.2 -20.6 -1.1 -6.1
SEQ ID NO: 1620 GTGAGAGAAACAAATCTGTT
498 -1.1 -17.7 55.5 -15.2
SEQ ID NO: 1621 -1.3 -4.3
654 TGTTGAACAATCACGAAAAT -1.1 -16 50.4 -14.1 -0.6 -4.4
SEQ ID NO: 1622 CGGGAACTACATCAGCAGCC 1241 SEQ ID NO: 1623 -1.1 -26.2 72.1 -24.6 -0.2 -4.7 ATAAAAATATATAAATATTT 1396 -8.5
SEQ ID NO: 1624 -1.1 36.9 -5.3 -2.1 -6 TAAAAACTTATTTTCATACC 1674 -15.
SEQ ID NO: 1625 -1.1 1 49.6 -13 -0.9 -3.3 TATGCAGCTTTACATTCAAA 1937
SEQ ID NO:1626 -1.1 -19.5 59.4 -18.4 0 -5.5 GGCCACCAGGTGTGCAGGCA
103 -1 -32.4 87.9 -28.5 -2.9 -12.5
SEQ ID NO: 1627 TGCAGCGCGGGCTGCTTTTG
179 -1 -29.8 79.8 -22.6 ■ -6.2 -16.3
SEQ ID NO: 1628 CCAAACTCTTCACCAAAAGG
339 SEQ ID NO: 1629 -1 -20.9 59.8 -19.9 0 -3.6 CATGTCATGCTCCGTGAGAG
511 -1 -25.3 72.4 -23.3 -0.9 -6.5
SEQ ID NO: 1630 TTCAAAAATTACATGTACTT
711 SEQ ID NO:1631 -1 -15.2 50 -13.7 0 -7.7 TACTATACACACACATTTAA
852 -1 -17
SEQ ID NO: 1632 53.9 -16 0 -2.2 AATATACTCCTAATTCCACC 1752 -2.9
SEQ ID NO: 1633 -1 -21.5 62.5 -20.5 0 CCCATTAGAAGGCTGACACC
313 -0.9 -26 71.3 -25.1 0 -3.7
SEQ ID NO: 1634 GTTGAACAATCACGAAAATA
653 -0.9
SEQ ID NO: 1635 -15.7 49.9 -14 -0.6 -4.4 CATTAATGTACATCAAAGTC
979 -0.9 -16.9 54.1 -15.5 0 -7.9
SEQ ID NO: 1636
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position linding ation Duplex ture oligo oligo oligo 1096 AAAAGCACAATTAAATTCTA -0.9 -14.1 47.3 -13.2 0 -4.1
SEQ ID NO: 1637 1286 ATGTGTTTCCTATGCCCCAG
-0.9 -28.1 77.8 -27.2 0 -3
SEQ ID NO: 1638 1293 GAAGTGTATGTGTTTCCTAT -0.9 -21.6 66.3 -20.7 0 -2.2
SEQ ID NO: 1639 TACTCCTAATTCCACCTATA 1748 -0.9 -22.8 65.9 -21.9 0 -2.9
SEQ ID NO: 1640 1750 TATACTCCTAATTCCACCTA -0.9 -22.8 65.9 -21.9 0 -2.9
SEQ ID NO: 1641 AAGGCCTTCCACACACATTC 1919 -0.9 -25.6 71.9 -23.4 -1 -9.8
SEQ ID NO: 1642 TCCCGAAGGTGCCGTAGGGA
374 -0.8 -30 78.4 -26.5 -2.7 -9.3
SEQ ID NO: 1643 GACTGGCAGTTGCAGGTCTC
405 -0.8 -27.3 81 -25.5 -0.9 -7.7
SEQ ID NO: 1644 TTTGAAAACCTTATAGAGTC 1521 -0.8 -17.5 55.3 -16.7 0 -3.5
SEQ ID NO: 1645 TCTTGTTCTTTTTTATTGAA 1997 -0.8 -18.2 58.6 -17.4 0 -3.3
SEQ ID NO: 1646 GGACAGTCTTTGCAGATACC
357 -0.7 -24.4 71.8 -23.2 -0.2 -6
SEQ ID NO: 1647 GGAAGTGTATGTGTTTCCTA 1294 -0.7 -22.8 69.1 -21 -1 -4.6
SEQ ID NO: 1648 CTTTCCTCAAGAGGATGATA 1457 -0.7 -21.5 64.3 -19.2 -1.5 -10.2
SEQ ID NO: 1649 1557 ATAATTATGGATAATAAATT -0.7 -12 43.5 -10.7 -0.3 -5.3
SEQ ID NO: 1650 AGAGTGACTCCTATAATTAT 1569 -0.7 -19.3 59.9 -17.9 -0.4 -5.9
SEQ ID NO: 1651
288 CCCGGGCCACACTTCATGCC -0.6 -32.7 83.1 -30.9 -1.1 -9.2
SEQ ID NO: 1652 ATTCTCTTTCACAACTTCTT
559 -0.6 -20.8 64.5 -20.2 0 -1
SEQ ID NO: 1653 TCAAAAATTACATGTACTTA
710 -0.6 -14.8 49.2 -13.7 0 -7.7
SEQ ID NO: 1654 1097 AAAAAGCACAATTAAATTCT -0.6 -13.7 46.4 -13.1 0 -3.3
SEQ ID NO: 1655 1323 CTGAGGTGGCATACGTTAAA -0.6 -21.9 63.6 -21.3 0.5 -4.8
SEQ ID NO: 1656 1385 TAAATATTTACCTTCATACA -0.6 -16.8 53.4 -16.2 0 -7
SEQ ID NO: 1657 1730 TATTTTAAAGTTGACATGTT -0.6 -16.4 53.4 -15.8 0 -7.1
SEQ ID NO: 1658 1747 ACTCCTAATTCCACCTATAT -0.6 -23.1 66.4 -22.5 0 -2.9
SEQ ID NO: 1659 1770 TGTGCTAAGATTCTTTCAAA -0.6 -18.8 58.4 -17.7 -0.1 -5.6
SEQ ID NO: 1660 1819 AAATACTTCTGAGATATTTC -0.6 -16.3 53.4 -14.8 -0.7 -4.6
SEQ ID NO: 1661 1826 TCAAATAAAATACTTCTGAG -0.6 -14.1 47.7 -13.5 0 -2.8
SEQ ID NO: 1662 1828 CTTCAAATAAAATACTTCTG -0.6 -14.5 48.5 -13.9 0 -1.5
SEQ ID NO: 1663 1936 ATGCAGCTTTACATTCAAAG -0.6 -19.8 60.2 -18.7 -0.2 -5.8
SEQ ID NO: 1664
168 CTGCTTTTGCACTCACTGCT -0.5 -26.4 76.1 -23.8 -2.1 -7.6
SEQ ID NO:1665
184 CCT ΓCCTTTTGGCCAAGGCCGGCCGGGGGGCCT.GC _0 5 _32 g 6 χ _27 _5 Λ _15_3
SEQ ID NO:1666
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo
AGAAGGCTGACACCTCAGCC
307 -0.5 -27.3 76 -21.1 -5.7 -13
SEQ ID NO: 1667 CCTGACTGGCAGTTGCAGGT 408 -0.5 -28.5 80.6 -26.1 -1.9 -9
SEQ ID NO: 1668 CAGCCGGGATCAGCGTGGAT 613 -0.5
SEQ ID NO: 1669 -29 77.5 -27.6 -0.7 -6.9 ACATTAATGTACATCAAAGT 980 -0.5 -16.7 53.4 -15.3 0 -9.6
SEQ ID NO: 1670 CTACCTACCAAGGAAGGGCT 1070 -0.5 -25.8 71.2 -23.7 -1.6 -6.6
SEQ ID NO: 1671 ACAATTAAATTCTAGAGAAG 1090 -0.5 -14.2 48.1 -13.7 0 -5.8
SEQ ID NO: 1672 GGGAACTACATCAGCAGCCT 1240 -0.5 -26.3 74 -25.3 -0.2 -4.7
SEQ ID NO: 1673 ATGGAAGTGTATGTGTTTCC 1296 -0.5 -22.2 67.4 -20.7 -0.9 -4.4
SEQ ID NO: 1674 GAATAAAATACAGGTAAATA 1876 -0.5 -12.5 44.3 -12 0 -3.6
SEQ ID NO: 1675 TGTGCAGGCACGAGGAGCGT 93 -0.4 -28.6 78.3 -26.6 -1.3 -10.7
SEQ ID NO: 1676 ACACACACATTTAACAAATC 846 -0.4 -16.7 52.7 -16.3 0 -2.7
SEQ ID NO: 1677 TGCTAAGATTCTTTCAAATA 1768 -0.4 -17.3 55 -16.4 -0.1 -5.6
SEQ ID NO: 1678 AGCTTTACATTCAAAGGCCT 1932 -0.4 -23.2 67.3 -22 -0.6 -8.4
SEQ ID NO: 1679 CTAACAGCTTATGCAGCTTT 1946 -0.4 -22.7 67.1 -20.5 -1.8 -6.9
SEQ ID NO: 1680 AACCTAACAGCTTATGCAGC 1949 -0.4 -23.1 66.5 -21.1 -1.6 -5.7
SEQ ID NO: 1681 GCAAGACGCTCTTCATGTTT 65 -0.3 -24 69.7 -22.9 -0.6 -6.1
SEQ ID NO: 1682 TTCTCTTTCACAACTTCTTC 558 -0.3 -21.2 66.1 -20.9 0 -0.7
SEQ ID NO: 1683 CCGGGATCAGCGTGGATTTA 610 -0.3 -26.4 72.3 -26.1 0 -7
SEQ ID NO: 1684 CTTCAAAAATTACATGTACT 712 -0.3 -16 51.6 -15.2 0 -7.7
SEQ ID NO: 1685 ACAATTTGGATCTTCAAAAA 723 -0.3 -15.9 51 -14.2 -1.3 -6.3
SEQ ID NO: 1686 CATGCTCCGTGAGAGAAACA 506 -0.2 -23.1 65.3 -21.8 -1 -6.1
SEQ ID NO: 1687 ACATGTACTTATGCTATATC 701 -0.2 -19.2 60.3 -19 0 -6.1
SEQ ID NO: 1688 ACATGCATTCGAATATTTAA 825 -0.2 -17.5 54.2 -16.7 0 -8.4
SEQ ID NO: 1689 845 CACACACATTTAACAAATCT -0.2 -17.4 54 -17.2 0 -2.7
SEQ ID NO: 1690 1459 TTCTTTCCTCAAGAGGATGA -0.2 -22.3 66.8 -20.7 -1.2 -9.9
SEQ ID NO: 1691 1467 TACTAGATTTCTTTCCTCAA -0.2 -20.5 63.1 -20.3 0 -4.5
SEQ ID NO: 1692 1673 AAAAACTTATTTTCATACCT -0.2 -16.3 52 -15.1 -0.9 -3.3
SEQ ID NO: 1693 1769 GTGCTAAGATTCTTTCAAAT -0.2 -18.8 58.5 -18.1 -0.1 -5.5
SEQ ID NO: 1694 1853 AAATAATTCTTAAATAAGTT -0.2 -11.7 43.1
SEQ ID NO: 1695 -11.5 0 -4.9 655 GTGTTGAACAATCACGAAAA -0.1 -17.2 52.9 -16.3 -0.6 -8.1
SEQ ID NO: 1696
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo CAATTTGGATCTTCAAAAAT
722 -0.1 -15.7 50.6 -14.2 -1.3 -6.3
SEQ ID NO: 1697 GTCAAAGAACTAATTTGACT
962 -0.1 -16.8 53.4 -13.3 -3.4 -9.4
SEQ ID NO: 1698 CATCAAAGTCAAAGAACTAA
969 -0.1 -15.3 49.8 -15.2 0 -3
SEQ ID NO: 1699 TCCCAAAGCCAAAAAAAAAA 1117 -0.1 -15.9 48.7 -15.8 0 -3.2
SEQ ID NO: 1700 1324 TCTGAGGTGGCATACGTTAA -0.1 -23 67.2 -22.3 -0.3 -4.8
SEQ ID NO: 1701 1875 AATAAAATACAGGTAAATAC -0.1 -12.1 43.5 -12 0 -3.6
SEQ ID NO: 1702 TGCAGCTTTACATTCAAAGG 1935 -0.1 -21 62.7 -20.9 0.1 -7.6
SEQ ID NO: 1703 1292 AAGTGTATGTGTTTCCTATG
0 -21 64.7 -21 0 -1.7
SEQ ID NO: 1704 AAACCTCCTAAAAACTTATT 1682 0 -16.9 52.2 -16.9 0 -1.3
SEQ ID NO: 1705 TTCAAATAAAATACTTCTGA 1827 0 -14.2 47.9 -14.2 0 -2.5
SEQ ID NO: 1706 CCATGTCATGCTCCGTGAGA
512 0.1 -27.3 75.7 -26.7 -0.4 -6.6
SEQ ID NO: 1707 AAGCACAATTAAATTCTAGA 1094 0.1 -16.1 51.8 -16.2 0 -5.4
SEQ ID NO: 1708 1162 ATCTTACTTCCTTCAGGGGT 0.1 -25.6 76 -25.2 -0.2 -4.7
SEQ ID NO: 1709 1307 TAAAGCTATTTATGGAAGTG 0.1 -16.9 54 -17" 0 -5.1
SEQ ID NO: 1710 TTTTCAACAAATAATACTAG 1481 0.1 -13.7 47 -13.8 0 -4
SEQ ID NO: 1711 1923 TTCAAAGGCCTTCCACACAC 0.1 -24.9 69.7 -23.5 -1 -10.6
SEQ ID NO: 1712 CATGTCCTTTTAAAACAAAA 1967 0.1 -15.9 50.5 -15.5 -0.1 -6.2
SEQ ID NO: 1713 CAGGCACGAGGAGCGTGGTC
89 0.2 -28.4 78.4 -25.1 -3.5 -9
SEQ ID NO: 1714 AGACTGTGCGGTAGCAAGTT
257 0.2 -24.7 71.8 -22 -2.9 -7.2
SEQ ID NO: 1715 TTGAACAATCACGAAAATAG
652 0.2 -14.5 47.6 -13.9 -0.6 -4.4
SEQ ID NO: 1716 ACCTACCAAGGAAGGGCTAA 1068 0.2 -24.2 67.3 -22.8 -1.6 -6.6
SEQ ID NO: 1717 1084 AAATTCTAGAGAAGCTACCT 0.2 -19.7 59.7 -19.9 0 -5.8
SEQ ID NO: 1718 TTCAAACATCTTACTTCCTT 1169 0.2
SEQ ID NO: 1719 -20.4 61.8 -20.6 0 -1 CCATAAGCTTCAAACATCTT 1177 0.2
SEQ ID NO: 1720 -20.5 60.7 -20.7 0 -6.8 1392 AAATATATAAATATTTACCT 0.2
SEQ ID NO: 1721 -13 45.4 -11.4 -1.8 -7.9 AACAAATAATACTAGATTTC 1476 0.2
SEQ ID NO: 1722 -13.5 46.7 -13.7 0 -4.5 AATTCCACCTATATTTTAAA 1741 SEQ ID NO: 1723 0.2 -17.6 54.5 -17.8 0 -4.2 1877 AGAATAAAATACAGGTAAAT
SEQ ID NO: 1724 0.2 -12.8 44.8 -13 0 -3.6 AACAAACACATACAAGTGTT
807 SEQ ID NO: 1725 0.3 -17 53.3 -14.7 -2.6 -8 GCTAAATATTTTATTTCCCA 1053 SEQ ID NO: 1726 0.3 -20 59.9 -19.5 -0.6 -6.2
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position binding ation Duplex ture oligo oligo oligo
GGAAGGGCTAAATATTTTAT
1059 0.3 -18.2 56.3 -18.5 0 -6.6
SEQ ID NO: 1727 1074 GAAGCTACCTACCAAGGAAG 0.3 -22.4 63.9 -21.1 -1.6 -9.2
SEQ ID NO: 1728 AATATATAAATATTTACCTT 1391 0.3 -13.8 47.1 -13.2 -0.8 -7.9
SEQ ID NO: 1729 TTCCTCAAGAGGATGATAAA 1455 0.3 -19.1 58.1 -17.8 -1.5 -10.2
SEQ ID NO: 1730 ATACTAGATTTCTTTCCTCA 1468 0.3 -21.2 65.3 -21.5 0 -4.5
SEQ ID NO: 1731 AGGCACGAGGAGCGTGGTCA
88 0.4 -28.4 78.4 -25.3 -3.5 -9.2
SEQ ID NO: 1732 CGCACACTCGGCAGCAGCCA 221 0.4 -31.2 81.2 -28.4 -3.2 -9.8
SEQ ID NO: 1733 CAGCGCACACTCGGCAGCAG 224 0.4 -29.2 78.2 -27.3 -2.3 -8.5
SEQ ID NO: 1734 CTTCAGTGTTACTATACACA 861 0.4
SEQ ID NO: 1735 -20.6 63.8 -19.4 -1.5 -5.7 TTAATGTACATCAAAGTCAA 977 0.4 -16.2 52.3 -16 0 -8.4
SEQ ID NO: 1736 1069 TACCTACCAAGGAAGGGCTA 0.4
SEQ ID NO: 1737 -24.6 68.8 -23.4 -1.6 -6.6 AAGCTTCAAACATCTTACTT 1173 0.4 -19.4 0 -6.2
SEQ ID NO: 1738 -19 58.5 1322 TGAGGTGGCATACGTTAAAG 0.4 -21 62 -20.8 -0.3 -4.8
SEQ ID NO: 1739 ACAAATAATACTAGATTTCT 1475 0.4 -15.1 50.1 -15.5 0 -4.5
SEQ ID NO: 1740 TTCTGAGATATTTCCTAAGA 1813 0.4 -19.4 60.3 -19.8 0 -4.6
SEQ ID NO: 1741 176 AGCGCGGGCTGCTTTTGCAC 0.5 -30 80.6 -27.2 -3.3 -12.5
SEQ ID NO: 1742 178 GCAGCGCGGGCTGCTTTTGC 0.5 -31.6 84.2 -26.6 -5.5 -15.5
SEQ ID NO: 1743 418 GTCACAGATGCCTGACTGGC 0.5 -27.2 77.4 -25.6 -2.1 -8.7
SEQ ID NO: 1744 505 ATGCTCCGTGAGAGAAACAA 0.5 -21.7 62.2 -21.1 -1 -6.1
SEQ ID NO: 1745 507 TCATGCTCCGTGAGAGAAAC 0.5 -22.8 65.6 -22.6 -0.4 -5.9
SEQ ID NO: 1746 TGTAAGATTACCTAAATTGC 891 0.5 -17.9 55.6 -18.4 0 -4.9
SEQ ID NO: 1747 892 ATGTAAGATTACCTAAATTG 0.5 -16.1 51.8 -16.6 0 -4.9
SEQ ID NO: 1748 CATTTATTTATAAAAATATA 1405 SEQ ID NO: 1749 0.5 -10.8 41.3 -10 -1.2 -6.5 GAGGATGATAAATATGGGTA 1447 0.5 -18.3
SEQ ID NO: 1750 56.7 -18.8 0 -2.7 1469 AATACTAGATTTCTTTCCTC
SEQ ID NO: 1751 0.5 -19.8 61.8 -20.3 0 -4.5 AAATAAAATACTTCTGAGAT 1824 SEQ ID NO: 1752 0.5 -13.6 46.6 -14.1 0 -2.8 TGCTGGTGGGAAGCAGCCGT
7 -29.7 -2.9 -8.4
SEQ ID NO: 1753 0.6 80.5 -27.4 GCACACTCGGCAGCAGCCAC 220 SEQ ID NO: 1754 0.6 -30.6 82.3 -28 -3.2 -9.8 CACACTTCATGCCATCCATG 281 SEQ ID NO: 1755 0.6 -25.5 71.3 -24.5 -1.6 -4.7 CCGTGAGAGAAACAAATCTG 500 SEQ ID NO: 1756 0.6 -19.2 56.7 -19.8 0 -3.1
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo 1092 GCACAATTAAATTCTAGAGA
0.6 -17.4 54.8 -18
SEQ ID NO: 1757 0 -5.8 AAAGCACAATTAAATTCTAG 1095 0.6 -14.8 49 -15.4 0 -4.1
SEQ ID NO: 1758 TATTTATGGAAGTGTATGTG 1301 0.6 -18 57.4 -18.6
SEQ ID NO: 1759 0 -1.8 1466 ACTAGATTTCTTTCCTCAAG
0.6 -20.8 63.9 -21.4
SEQ ID NO: 1760 0 -4.5 1764 AAGATTCTTTCAAATATACT
0.6 -15.7 51.6 -15.8 -0.1 -5.2
SEQ ID NO: 1761 CAATTAAATTCTAGAGAAGC 1089 0.7 -15.8 51.4 -16.5
SEQ ID NO: 1762 0 -5.8 1934 GCAGCTTTACATTCAAAGGC
SEQ ID NO: 1763 0.7 -22.8 67 -22.7 -0.6 -4.5 1950 AAACCTAACAGCTTATGCAG 0.7 -20.6 60.6 -19.7 -1.6 -5.7
SEQ ID NO: 1764
504 TGCTCCGTGAGAGAAACAAA
0.8 -21 60.4 -20.7 -1 -6.1
SEQ ID NO: 1765
963 AGTCAAAGAACTAATTTGAC
0.8 -15.9 51.7 -13.3 -3.4 -9.4
SEQ ID NO: 1766 TCAAACATCTTACTTCCTTC 1168 0.8 -20.7 62.9 -21.5
SEQ ID NO: 1767 0 -1 1298 TTATGGAAGTGTATGTGTTT
0.8 -19.6 61.6 -20.4 0 -1.3
SEQ ID NO: 1768 1306 AAAGCTATTTATGGAAGTGT 57.4
SEQ ID NO: 1769 0.8 -18.4 -19.2 0 -5.1 GAGCGTGGTCAGCAGCAAGA 79 0.9 -26.8 76.2 -26.1 -1.5
SEQ ID NO: 1770 -5.4 GCAGGCACGAGGAGCGTGGT 90 0.9 -29.8
SEQ ID NO: 1771 81 -27.9 -2.8 -10.3 TGAACAATCACGAAAATAGA
651 0.9 -15 48.5 -15.2 -0.4 -4.4
SEQ ID NO: 1772 TCACAATTTGGATCTTCAAA
725 SEQ ID NO: 1773 0.9 -18.4 56.9 -18.1 -1.1 -5.9
847 TACACACACATTTAACAAAT
SEQ ID NO: 1774 0.9 -16 51 -16.9 0 -2.5 1395 TAAAAATATATAAATATTTA
SEQ ID NO: 1775 0.9 -8.2 36.4 -6.8 -2.3 -7.6
409 GCCTGACTGGCAGTTGCAGG
SEQ ID NO: 1776 1 -29.1 81.5 -27.6 -2.5 -10.2
612 AGCCGGGATCAGCGTGGATT
SEQ ID NO: 1777 1 -28.4 76.8 -28.5 -0.7 -7.6 CAAAAATTACATGTACTTAT
709 SEQ ID NO: 1778 1 -14.4 48.2 -14.9 0 -7.7 1458 TCTTTCCTCAAGAGGATGAT
SEQ ID NO: 1779 1 -22.2 66.4 -21.6 -1.5 -10.2 CTAGATTTCTTTCCTCAAGA 1465 SEQ ID NO: 1780 1 -21.2 64.7 -21.3 -0.7 -6.8 ATATTTTAAAGTTGACATGT 1731 SEQ ID NO: 1781 1 -16.3 53.1 -17.3 0 -6.9 TCTTTCACAACTTCTTCTCT
555 SEQ ID NO: 1782 1.1 -22 67.8 -23.1 0 -0.7 ACTATACACACACATTTAAC
851 SEQ ID NO: 1783 1.1 -17.5 55 -18.6 0 -2.4 TCTGAGATATTTCCTAAGAA 1812 SEQ ID NO: 1784 1.1 -18.6 57.9 -19.7 0 -4.6 TGTGTGTTGAACAATCACGA
658 SEQ ID NO: 1785 1.2 -20.5 60.9 -19.8 -1.9 -8.7 AGCACAATTAAATTCTAGAG 1093 SEQ ID NO: 1786 1.2 -16.8 53.7 -18 0 -5.8
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo 1394 AAAAATATATAAATATTTAC 1.2 -8.7
SEQ ID NO: 1787 37.3 -7.6 -2.3 -7.9 CAACAAATAATACTAGATTT 1477 1.2 -13.8 46.9 -15 0 -4.5
SEQ ID NO: 1788 1478 TCAACAAATAATACTAGATT 1.2 -14.1
SEQ ID NO: 1789 47.7 -15.3 0 -4.5 1479 TTCAACAAATAATACTAGAT 1.2 -14.1 47.7 -15.3 0 -4.5
SEQ ID NO: 1790 1740 ATTCCACCTATATTTTAAAG 1.2 -18.3 56.4
SEQ ID NO: 1791 -19.5 0 -4.6
306 GAAGGCTGACACCTCAGCCC
SEQ ID NO: 1792 1.3 -29.3 79.1 -24.5 -6.1 -13.4 TCAGCGTGGATTTAACCATT
604 1.3 -22.9
SEQ ID NO: 1793 65.8 -23.3 -0.8 -5.5 ATCAGCGTGGATTTAACCAT
605 1.3 -22.8
SEQ ID NO: 1794 65.5 -23.2 -0.8 -5.5 1454 TCCTCAAGAGGATGATAAAT
SEQ ID NO: 1795 1.3 -19 57.7 -18.9 -1.2 -9.7 GCCGGGATCAGCGTGGATTT
611 1.4 -28.5
SEQ ID NO: 1796 76.9 -29.4 0 -7.6 1393 AAAATATATAAATATTTACC 1.4 -11.4 42.2
SEQ ID NO: 1797 -10.5 -2.3 -7.9 AATAAAATACTTCTGAGATA 1823
SEQ ID NO: 1798 1.4 -14 47.7 -15.4 0 -2.8 1873 TAAAATACAGGTAAATACTG 1.4 -13.7 46.7 -14.4 -0.5 -4
SEQ ID NO: 1799
170 GGCTGCTTTTGCACTCACTG 1.5 -26.7 76.8 -26.1 -2.1 -8.4
SEQ ID NO: 1800
177 CAGCGCGGGCTGCTTTTGCA
SEQ ID NO: 1801 1.5 -30.5 81 -28.7 -3.3 -12.4 1077 AGAGAAGCTACCTACCAAGG
SEQ ID NO: 1802 1.5 -23.1 66.2 -23.3 -1.2 -6.9 TAAGATTCTTTCAAATATAC 1765 SEQ ID NO: 1803 1.5 -14.5 49.2 -15.5 -0.1 -5.6
144 CAGTGTTGAGGGCAGTCCAC 1.6 -27.2 79.2 -27.7 -1
SEQ ID NO: 1804 -5.6 CCTGAGACTGTGCGGTAGCA
261 1.6 -27.6 76.9
SEQ ID NO: 1805 -27.4 -1.8 -6.3
560 CATTCTCTTTCACAACTTCT 1.6 -21.4 65.4 -23 0 -1
SEQ ID NO: 1806 CAGCGTGGATTTAACCATTT
603 SEQ ID NO: 1807 1.6 -22.6 64.7 -23.6 -0.3 -5.5 1060 AGGAAGGGCTAAATATTTTA 1.6 -18.2 56.5
SEQ ID NO: 1808 -19.8 0 -6.6 AATTAAATTCTAGAGAAGCT 1088 SEQ ID NO: 1809 1.6 -16 52 -17.6 0 -5.8 AAAAAAGCACAATTAAATTC 1098 SEQ ID NO: 1810 1.6 -12.1 43.3 -13.7 0 -4.1 1446 AGGATGATAAATATGGGTAG
SEQ ID NO: 1811 1.6 -17.7 55.6 -19.3 0 -2.7 2 GTGGGAAGCAGCCGTGACCC
SEQ ID NO: 1812 1.7 -30.6 80.7 -31.4 -0.8 -5.4 TTGCTGGTGGGAAGCAGCCG 8 SEQ ID NO: 1813 1.7 -28.6 77.5 -27.4 -2.9 -8.4 TCTTTGCTGGTGGGAAGCAG
11 -25.4 73.9
SEQ ID NO: 1814 1.7 -25.2 -1.9 -6.4 ATAAATATTTACCTTCATAC 1386 SEQ ID NO: 1815 1.7 -16.1 52.2 -17.3 0 -7.9 ACCATTTTCAACAAATAATA 1485 SEQ ID NO: 1816 1.7 -15.8 50.6 -17 -0.1 -2.7
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position binding ation Duplex ture oligo oligo oligo
AGCACTTATGTTTAAATAAG
1628 SEQ ID NO: 1817 1.7 -16.1 52.3 -16.6 -1.1 -6.6 CAAACCTCCTAAAAACTTAT 1683 1.7 -17.5 53.1 -19.2 0 -1.3
SEQ ID NO: 1818 AAAATACTTCTGAGATATTT 1820
SEQ ID NO: 1819 1.7 -15.2 50.4 -15.8 -1 -4.6 GTAAATACTGAAATAATTCT 1863
SEQ ID NO: 1820 1.7 -13.9 47.4 -14.4 -1.1 -4.8 CCTGTCACAGATGCCTGACT 421 -27.2 -1.7 -6.3
SEQ ID NO: 1821 1.8 -27.1 75.9 AAGCTATTTATGGAAGTGTA 1305 1.8 -18.8 58.8 -20.6 0 -5.1
SEQ ID NO: 1822 CCTTCATACACACACAAACC 1375 SEQ ID NO: 1823 1.8 -22.2 63 -24 0 -0.9 CCCAAAGCCAAAAAAAAAAA 1116 -16.7 0 -3.2
SEQ ID NO: 1824 1.9 -14.8 46.6 CAAACATCTTACTTCCTTCA 1167 1.9 -21 62.6 -22.9 0 -1
SEQ ID NO: 1825 CTTCAAACATCTTACTTCCT 1170
SEQ ID NO: 1826 1.9 -21.2 63.4 -23.1 0 -1 TAAGCTTCAAACATCTTACT 1174 SEQ ID NO: 1827 1.9 -18.6 57.7 -20.5 0 -6.8 CACTTATGTTTAAATAAGGT 1626 SEQ ID NO: 1828 1.9 -16.7 53.6 -17 -1.5 -7.1 1822 ATAAAATACTTCTGAGATAT
SEQ ID NO: 1829 1.9 -14.7 49.3 -16.6 0 -2.8 1855 TGAAATAATTCTTAAATAAG 1.9 -11 41.6 -11.7 -1.1 -4.3
SEQ ID NO: 1830 AAGAATAAAATACAGGTAAA 1878
SEQ ID NO: 1831 1.9 -12.1 43.4 -14 0 -3.6 CTTGTTCTTTTTTATTGAAC 1996 -4.9
SEQ ID NO: 1832 1.9 -18 57.7 -18.8 -1 503 GCTCCGTGAGAGAAACAAAT -21.9 -1 -6.1
SEQ ID NO: 1833 2 -21 60.4 1172 AGCTTCAAACATCTTACTTC
SEQ ID NO: 1834 2 -20.1 62 -22.1 0 -4.3 TAAATACTGAAATAATTCTT 1862 SEQ ID NO: 1835 2 -12.8 45.1 -13.6 -1.1 -4.2 GGCACGAGGAGCGTGGTCAG 87 2.1 -28.4 78.4 -27 -3.5 -9.3
SEQ ID NO: 1836 GCTGCTTTTGCACTCACTGC 169 2.1 -27.3 78.7 -27.3 -2.1 -7.4
SEQ ID NO: 1837 CCCCCTGTCACAGATGCCTG 424 2.1 -31.4 82.3 -32.4 -1 -5.3
SEQ ID NO: 1838 ACACACATTTAACAAATCTA 844 SEQ ID NO: 1839 2.1 -16.4 52.2 -18.5 0 -2.7 CTGGTTGTTTTATTTTGACT 1139 2.1 -20.6 63.9 -22.7 0 -2.8
SEQ ID NO: 1840 420 CTGTCACAGATGCCTGACTG
SEQ ID NO: 1841 2.2 -25.1 72.2 -25.6 -1.7 -7 TGGTTGTTTTATTTTGACTT 1138 SEQ ID NO: 1842 2.2 -19.8 62.2 -22 0 -2.8 ATGATAAATATGGGTAGGGA 1443 SEQ ID NO: 1843 2.2 -18.9 57.9 -21.1 0 -2.7 TTCCACCTATATTTTAAAGT 1739 SEQ ID NO: 1844 2.2 -19.5 59.3 -21.7 0 -4.6 ACACTTCATGCCATCCATGC 280 SEQ ID NO: 1845 2.3 -26.6 74.3 -27.1 -1.8 -5 TCACAGATGCCTGACTGGCA 417 SEQ ID NO: 1846 2.3 -26.7 75 -25.6 -3.4 -9.2
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total for - Tm of struc- molecular molecular position binding ation Duplex ture oligo oligo oligo
ATACACACACATTTAACAAA
848 2.3 -16 51 -18.3 0 -2.4
SEQ ID NO: 1847 CTATACACACACATTTAACA
850 2.3 -18 55.7 -20.3 0 -2.4
SEQ ID NO: 1848 CATCTTACTTCCTTCAGGGG
1163 2.3 -25.1 73.5 -26.9 -0.2 -4.7
SEQ ID NO: 1849 CTCCTAAAAACTTATTTTCA
1678 2.3 -17.4 54.4 -18.7 -0.9 -3.3
SEQ ID NO: 1850 TTCATACACACACAAACCAC
1373 2.4 -20.2 59.4 -22.6 0 -0.9
SEQ ID NO: 1851 CATTTTCAACAAATAATACT
1483 2.4 -14.7 48.7 -16.6 -0.1 -2.7
SEQ ID NO: 1852 AAATCCAGAGTGACTCCTAT
1575 2.4 -22.2 65 -23.9 -0.4 -5.5
SEQ ID NO: 1853 AGCGTGGTCAGCAGCAAGAC
78 2.5 -26.4 75.4 -27.3 -1.5 -7.3
SEQ ID NO: 1854 CTGAGACTGTGCGGTAGCAA
260 2.5 -24.9 70.9 -25.4 -2 -7
SEQ ID NO: 1855 GCTTCAAACATCTTACTTCC
1171 2.5 -22.1 65.6 -24.6 0 -2.8
SEQ ID NO: 1856 GAGGTGGCATACGTTAAAGC
1321 2.5 -22.8 66.1 -24.7 -0.3 -4.8
SEQ ID NO: 1857 CCTCAAGAGGATGATAAATA
1453 2.5 -18.3 56 -20.3 -0.1 -7.5
SEQ ID NO: 1858 CTCCTATAATTATGGATAAT
1562 2.5 -17.5 54.8 -19.3 -0.1 -9
SEQ ID NO: 1859 AATCCAGAGTGACTCCTATA
1574 2.5 -22.6 66.7 -24.4 -0.4 -5.5
SEQ ID NO: 1860 CCCTGTCACAGATGCCTGAC
422 2.6 -28.2 77.5 -29.3 -1.4 -5.9
SEQ ID NO: 1861 GCATTCTCTTTCACAACTTC
561 2.6 -22.3 67.8 -24.9 0 -3.4
SEQ ID NO: 1862 AATTTGGATCTTCAAAAATT
721 2.6 -15.1 49.6 -16.3 -1.3 -6.3
SEQ ID NO: 1863 CACAATTTGGATCTTCAAAA
724 2.6 -17.3 53.9 -19 -0.8 -5.8
SEQ ID NO: 1864 AAATTACATGTACTTATGCT
706 2.7 -17.8 55.9 -20 0 -7.7
SEQ ID NO: 1865 TCTTCAAAAATTACATGTAC
713 2.7 -15.5 50.9 -17.7 0 -7.7
SEQ ID NO: 1866 TCCTAAAAACTTATTTTCAT
1677 2.7 -16.5 52.6 -18.3 -0.7 -3.2
SEQ ID NO: 1867 TAAAATACTTCTGAGATATT
1821 2.7 -14.8 49.6 -17.5 0 -3.9
SEQ ID NO: 1868 AGCGCACACTCGGCAGCAGC
223 2.8 -30.3 81.5 -30.8 -2.3 -9.7
SEQ ID NO: 1869
1297 TATGGAAGTGTATGTGTTTC 2.8 -19.9 62.8 -22.7 0 -2.6
SEQ ID NO: 1870 GCACTTATGTTTAAATAAGG
1627 2.8 -17.3 54.7 -18.5 -1.5 -7.1
SEQ ID NO: 1871 GTGCAGGCACGAGGAGCGTG
92 2.9 -28.6 78.3 -28.4 -3.1 -11.5
SEQ ID NO: 1872 CCCCGGGCCACACTTCATGC
289 2.9 -32.7 83.1 -34.7 0 -9.7
SEQ ID NO: 1873
410 TGCCTGACTGGCAGTTGCAG 2.9 -27.9 78.6 -27.6 -3.2 -11.5
SEQ ID NO: 1874 CTCTTTCACAACTTCTTCTC
556 SEQ ID NO: 1875 2.9 -22 67.8 -24.9 0 -0.7 CATTTAACAAATCTACATGC
839 2.9 -17.1 53.7 -20 0 -5
SEQ ID NO: 1876
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo AGAAGCTACCTACCAAGGAA 1075 2.9 -22.4 63.9 -23.7 -1.6 -9.2
SEQ ID NO: 1877 ATAAATATGGGTAGGGAAGA 1440 SEQ ID NO: 1878 2.9 -18.2 56.3 -21.1 0 -2.7 ATTTGGATCTTCAAAAATTA
720 3 -15.5 50.7 -17.1 -1.3 -6.3
SEQ ID NO: 1879 TATACACACACATTTAACAA
849 3 -16.4 52.2 -19.4 0 -2.4
SEQ ID NO: 1880 ATTAAATTCTAGAGAAGCTA 1087 3.1
SEQ ID NO:1881 -16.4 53.2 -19.5 0 -5.8 CTTCATACACACACAAACCA 1374 3.1
SEQ ID NO: 1882 -20.9 60.7 -24 0 -0.9 AGAGGATGATAAATATGGGT 1448 -21.7 0 -2.7
SEQ ID NO: 1883 3.1 -18.6 57.5 GACTCCTATAATTATGGATA 1564 3.1
SEQ ID NO: 1884 -19 58.5 -21.4 -0.1 -9 GAAATCCAGAGTGACTCCTA 1576 SEQ ID NO: 1885 3.1 -22.8 66.4 -25.2 -0.4 -5.5 TCTCTTTCACAACTTCTTCT
557 3.2 -22 67.8 -25.2 0 -0.7
SEQ ID NO:1886 CCATTTTCAACAAATAATAC 1484 SEQ ID NO: 1887 3.2 -15.8 50.6 -18.5 -0.1 -2.7 CAGCATTCTCTTTCACAACT
563 3.3 -22.5 67.3 -25.8 0 -4.1
SEQ ID NO: 1888 TTCAGTGTTACTATACACAC
860 SEQ ID NO: 1889 3.3 -19.9 62.3 -20.9 -2.3 -6.5 GGTAAATACTGAAATAATTC 1864 SEQ ID NO: 1890 3.3 -14.2 47.9 -16.9 -0.3 -7.3 AAATACAGGTAAATACTGAA 1871 48.4 -17.9 0 -4.1
SEQ ID NO: 1891 3.3 -14.6 AAAATACAGGTAAATACTGA 1872 3.3 -14.6 48.4 -16.9 -0.9 -4.1
SEQ ID NO: 1892 GATGCCATGTCATGCTCCGT
516 3.4 -28.5 78.3 -31.4 -0.2 -4.6
SEQ ID NO: 1893 AGCATTCTCTTTCACAACTT
562 3.4 -21.9 66.4 -25.3 0 -4.1
SEQ ID NO: 1894 CACATTTAACAAATCTACAT
841 3.4 -16.2 51.7 -19.6 0 -2.7
SEQ ID NO: 1895 ATTTATAAAAATATATAAAT 1400 3.4 -8.5 36.9 -10.3 -1.5 -6.5
SEQ ID NO: 1896 TGATAAATATGGGTAGGGAA 1442 3.5 -18.2 56.1 -21.7 0 -2.7
SEQ ID NO: 1897 1732 TATATTTTAAAGTTGACATG
3.5 -14.8 49.7 -18.3 0 -4.7
SEQ ID NO: 1898 TGTCACAGATGCCTGACTGG
419 3.6 -25.4 72.8 -27.3 -1.7 -7.1
SEQ ID NO: 1899 TCAGTGTTACTATACACACA
859 3.6 -20.5 63.2 -21.8 -2.3 -6.5
SEQ ID NO: 1900 TCCACCTATATTTTAAAGTT 1738 3.6 -19.5 59.3 -23.1 0 -4.6
SEQ ID NO: 1901
502 CTCCGTGAGAGAAACAAATC 3.7 -19.6 58 -22.7 -0.3 -5
SEQ ID NO: 1902 CTGGTGGGAAGCAGCCGTGA 5 3.8 -28.5 77.6 -31.1 -1.1 -5.4
SEQ ID NO: 1903 TTTGCTGGTGGGAAGCAGCC 9 3.8 -27.9 78.2 -28.8 -2.9 -7.8
SEQ ID NO :1904
10 CTTTGCTGGTGGGAAGCAGC 3.8 -26.8 76.6 -28.1 -2.5 -7.4
SEQ ID NO: 1905
515 ATGCCATGTCATGCTCCGTG 3.8 -27.9 76.8 -31.2 -0.2 -4.6
SEQ ID NO: 1906
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex ture oligo oligo oligo
606 GATCAGCGTGGATTTAACCA 3.9 -23.4 66.7 -26.5 -0.6 -5.9
SEQ ID NO: 1907 1303 GCTATTTATGGAAGTGTATG 3.9 -19.5 60.6 -23.4 0 -2.8
SEQ ID NO: 1908 1563 ACTCCTATAATTATGGATAA 3.9 -17.7 55.3 -20.9 -0.1 -9
SEQ ID NO: 1909
714 ATCTTCAAAAATTACATGTA 4 -15.3 50.4 -18.8 0 -7.5
SEQ ID NO: 1910
1449 AAGAGGATGATAAATATGGG 4 -16.7 52.8 -20.7 0 -2.7
SEQ ID NO: 1911
1866 CAGGTAAATACTGAAATAAT 4 -14.4 48 -18.4 0 -3.8
SEQ ID NO: 1912 GCTGGTGGGAAGCAGCCGTG
6 4.1 -29.7 80.5 -31.6 -2.2 -8.4
SEQ ID NO: 1913 CAGATGCCATGTCATGCTCC
518 4.1 -27.2 76.6 -30.8 -0.1 -4.4
SEQ ID NO: 1914 AAAAAAAGCACAATTAAATT 1099 4.1 -11 41.2 -15.1 0 -4.1
SEQ ID NO: 1915 AGGTAAATACTGAAATAATT 1865 4.1 -13.8 47 -17.9 0 -3.8
SEQ ID NO: 1916 CGTGGATTTAACCATTTCCT
600 4.2 -23.4 66.2 -26.7 -0.8 -4.8
SEQ ID NO: 1917 CGGGATCAGCGTGGATTTAA
609 4.2 -23.7 66.7 -27.9 0 -5.7
SEQ ID NO: 1918 CTATATTTTAAAGTTGACAT 1733 4.2 -15.7 51.6 -19.9 0 -4.6
SEQ ID NO: 1919 TTTGGATCTTCAAAAATTAC
719 4.3 -15.7 51.2 -19.1 -0.8 -5.6
SEQ ID NO: 1920 AGCTATTTATGGAAGTGTAT 1304 4.3 -19.5 60.9 -23.8 0 -4.3
SEQ ID NO: 1921 GATAAATATGGGTAGGGAAG 1441 4.3 -18.2 56.3 -22.5 0 -2.2
SEQ ID NO: 1922 CACACATTTAACAAATCTAC
843 4.4 -16.4 52.2 -20.8 0 -2.5
SEQ ID NO: 1923 3 GGTGGGAAGCAGCCGTGACC 4.5 -29.8 79.9 -33.6 -0.4 -5.4
SEQ ID NO: 1924
517 AGATGCCATGTCATGCTCCG 4.5 -27.3 75.3 -31.3 -0.2 -4.6
SEQ ID NO: 1925
707 AAAATTACATGTACTTATGC 4.6 -16.2 52.2 -20.3 0 -7.5
SEQ ID NO: 1926
840 ACATTTAACAAATCTACATG 4.6 -15.5 50.5 -20.1 0 -4.7
SEQ ID NO: 1927 1103 AAAAAAAAAAAGCACAATTA 4.6 -9.5 38.6 -14.1 0 -4.1
SEQ ID NO: 1928 1176 CATAAGCTTCAAACATCTTA 4.6 -18.2 56.5 -22.8 0 -6.8
SEQ ID NO: 1929 1302 CTATTTATGGAAGTGTATGT 4.6 -18.9 59.5 -23.5 0 -1.8
SEQ ID NO: 1930 1676 CCTAAAAACTTATTTTCATA 4.7 -15.8 51 -19.5 -0.9 -3.3
SEQ ID NO: 1931
564 GCAGCATTCTCTTTCACAAC 4.8 -23.4 69.6 -28.2 0 -4.7
SEQ ID NO: 1932
842 ACACATTTAACAAATCTACA 4.8 -16.4 52.2 -21.2 0 -2.7
SEQ ID NO: 1933
718 TTGGATCTTCAAAAATTACA 4.9 -16.3 52.1 -21.2 0 -5
SEQ ID NO: 1934 1104 AAAAAAAAAAAAGCACAATT 4.9 -9.1 38 -14 0 -4.1
SEQ ID NO: 1935 1450 CAAGAGGATGATAAATATGG 4.9 -16.2 51.7 -21.1 0 -2.7
SEQ ID NO: 1936
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total formTm of struc- molecular molecular position binding ation oligo oligo oligo
75 GTGGTCAGCAGCAAGACGCT
SEQ ID NO: 1937 5 -27.3 77.1 -30.8 -1.4 -8.5
91 TGCAGGCACGAGGAGCGTGG
5 -28.6 77.4
SEQ ID NO: 1938 -30.1 -3.5 -11.6
1954 AACAAAACCTAACAGCTTAT
SEQ ID NO: 1939 5 -17.6 53.7 -22.6 0 -4.5
1115 CCAAAGCCAAAAAAAAAAAA
SEQ ID NO: 1940 5.2 -12.1 42.5 -17.3 0 -2.4
1870 AATACAGGTAAATACTGAAA
SEQ ID NO: 1941 5.2 -14.6 48.4 -18.8 -0.9 -4.1
77 GCGTGGTCAGCAGCAAGACG
SEQ ID NO: 1942 5.3 -27.2 74.9 -31.6 -0.7 -7.7
414 CAGATGCCTGACTGGCAGTT
5.4
SEQ ID NO: 1943 -26.7 75.7 -28.5 -3.6 -8.6
423 CCCCTGTCACAGATGCCTGA
5.4
SEQ ID NO: 1944 -30 80.3 -33.9 -1.4 -5.7
602 AGCGTGGATTTAACCATTTC
SEQ ID NO: 1945 5.5 -22.3 65 -26.9 -0.8 -5.5
708 AAAAATTACATGTACTTATG
SEQ ID NO: 1946 5.5 -13.7 46.9 -18.7 0 -7.7
1100 AAAAAAAAGCACAATTAAAT
SEQ ID NO: 1947 5.5 -10.2 39.8 -15.7 0 -4.1
1955 AAACAAAACCTAACAGCTTA
5.5 52.1
SEQ ID NO: 1948 -16.9 -22.4 0 -4.5
413 AGATGCCTGACTGGCAGTTG
5.6
SEQ ID NO: 1949 -26 74.4 -28 -3.6 -8.6
76 CGTGGTCAGCAGCAAGACGC
5.7 -27.2 74.9
SEQ ID NO: 1950 -31.4 -1.4 -8.5
858 CAGTGTTACTATACACACAC
SEQ ID NO: 1951 5.7 -20.3 62.3 -23.7 -2.3 -6.5
1105 AAAAAAAAAAAAAGCACAAT
5.8
SEQ ID NO: 1952 -8.3 36.7 -14.1 0 -4.1
601 GCGTGGATTTAACCATTTCC 5.9
SEQ ID NO: 1953 -24.3 68.3 -29.3 -0.8 -6.2
1867 ACAGGTAAATACTGAAATAA
SEQ ID NO: 1954 5.9 -14.6 48.4 -19.5 -0.9 -4.1
411 ATGCCTGACTGGCAGTTGCA
SEQ ID NO: 1955 6 -27.9 78.3 -30.3 -3.6 -11.9
607 GGATCAGCGTGGATTTAACC 6
SEQ ID NO: 1956 -23.9 68.1 -29.9 0 -5.7 ACAGATGCCTGACTGGCAGT
415 6.1
SEQ ID NO: 1957 -26.8 75.9 -29.8 -3.1 -9.8
1102 AAAAAAAAAAGCACAATTAA
6.1
SEQ ID NO: 1958 -9.5 38.6 -15.6 0 -4.1 CCTATATTTTAAAGTTGACA
1734 6.1
SEQ ID NO: 1959 -17.7 55.5 -23.8 0 -4.6 TTAAATTCTAGAGAAGCTAC
1086 6.2
SEQ ID NO: 1960 -16.6 53.8 -22.8 0 -5.8 AAACATCTTACTTCCTTCAG
1166 6.3
SEQ ID NO: 1961 -20.3 61.6 -26.6 0 -1.6 GATGCCTGACTGGCAGTTGC
412 6.4 78.6 -30.6
SEQ ID NO: 1962 -27.8 -3.6 -9.7 TGGATCTTCAAAAATTACAT
717 6.6
SEQ ID NO: 1963 -16.2 51.9 -22.8 0 -5 CTAAAAACTTATTTTCATAC
1675 6.7
SEQ ID NO: 1964 -14 47.7 -19.7 -0.9 -3.3 GAGAAGCTACCTACCAAGGA
1076 6.8
SEQ ID NO: 1965 -23.7 67.2 -28.9 -1.6 -9.2 GTGTGTTGAACAATCACGAA
657 6.9
SEQ ID NO: 1966 -19.8 59.1 -25.3 -1.3 -8.7
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex oligo ture oligo oligo GATCTTCAAAAATTACATGT
715
SEQ ID NO: 1967 6.9 -16.2 52.1 -23.1 0 -6.3 TACAGGTAAATACTGAAATA 1868
SEQ ID NO: 1968 6.9 -15 49.5 -20.9 -0.9 -4.1 TCAAGAATAAAATACAGGTA 1880
SEQ ID NO: 1969 7.1 -14.6 48.6 -21.7 0 -3.4 TGTGTTGAACAATCACGAAA
656 7.3
SEQ ID NO: 1970 -17.9 54.5 -23.8 -1.3 -8.7 ACATCTTACTTCCTTCAGGG 1164 7.4
SEQ ID NO: 1971 -24.1 71.4 -31.5 0 -4.7 1886 CCAACTTCAAGAATAAAATA
SEQ ID NO: 1972 7.4 -14.8 48.3 -22.2 0 -3.5 AAAAAAAAAAAAAAGCACAA 1106 7.5
SEQ ID NO: 1973 -7.6 35.7 -15.1 0 -4.1 AAAAAAAAAGCACAATTAAA 1101 7.6
SEQ ID NO: 1974 -9.5 38.6 -17.1 0 -4.1 1881 TTCAAGAATAAAATACAGGT
7.6
SEQ ID NO: 1975 -15 49.4 -22.6 0 -2.9 1884 AACTTCAAGAATAAAATACA
7.6 -13 45.2
SEQ ID NO: 1976 -20.6 0 -3.5
416 CACAGATGCCTGACTGGCAG 7.7
SEQ ID NO: 1977 -26.3 73.6 -30.4 -3.6 -9.8
608 GGGATCAGCGTGGATTTAAC
8.2
SEQ ID NO: 1978 -23.1 67 -31.3 0 -5.3 1107 AAAAAAAAAAAAAAAGCACA
8.3
SEQ ID NO: 1979 -7.6 35.7 -15.9 0 -4.1 1885 CAACTTCAAGAATAAAATAC
8.4 -13
SEQ ID NO: 1980 45.2 -21.4 0 -3.5
716 GGATCTTCAAAAATTACATG
8.5 -16.2
SEQ ID NO: 1981 51.9 -24.7 0 -5 1451 TCAAGAGGATGATAAATATG
SEQ ID NO: 1982 8.6 -15.4 50.4 -24 0 -2.7 1879 CAAGAATAAAATACAGGTAA
SEQ ID NO: 1983 8.6 -13.5 46.1 -22.1 0 -3.6 1735 ACCTATATTTTAAAGTTGAC
SEQ ID NO: 1984 8.8 -17.2 54.7 -26 0 -4.6 1883 ACTTCAAGAATAAAATACAG
SEQ ID NO: 1985 8.8 -13.7 46.7 -22.5 0 -3.5 1452 CTCAAGAGGATGATAAATAT
8.9 -16.3
SEQ ID NO: 1986 52.3 -25.2 0 -3.9
4 TGGTGGGAAGCAGCCGTGAC 9.2
SEQ ID NO: 1987 -27.8 76.3 -35.8 -1.1 -4.6 1114 CAAAGCCAAAAAAAAAAAAA
9.3 -9.4 38.4 -18.7
SEQ ID NO: 1988 0 -3.2 1165 AACATCTTACTTCCTTCAGG
9.3 -22.2
SEQ ID NO: 1989 66.4 -31.5 0 -4.1 1882 CTTCAAGAATAAAATACAGG
9.8
SEQ ID NO: 1990 -14.7 48.6 -24.5 0 -3.5 1109 CCAAAAAAAAAAAAAAAGCA
SEQ ID NO: 1991 10.3 -9.4 38.4 -19.7 0 -4.1 CAAAAAAAAAAAAAAAGCAC 1108
SEQ ID NO: 1992 10.5 -7.6 35.7 -18.1 0 -4.1 ATACAGGTAAATACTGAAAT 1869 10.9
SEQ ID NO: 1993 -15.3 50 -25.2 -0.9 -4.1 AAAGCCAAAAAAAAAAAAAA 1113 SEQ ID NO: 1994 11.6 -8 36.3 -19.6 0 -3.2 GCCAAAAAAAAAAAAAAAGC 1110 SEQ ID NO: 1995 11.7 -10.5 40.1 -22.2 0 -2.8 ATAAGCTTCAAACATCTTAC 1175 12.4
SEQ ID NO: 1996 -17.7 55.8 -30.1 0 -6.8
kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInter- total formTm of strucmolecular molecular position binding ation Duplex oligo ture oligo oligo CCACCTATATTTTAAAGTTG 1737 13 -19.1 57.9
SEQ ID NO: 1997 -32.1 0 -4.6 CACCTATATTTTAAAGTTGA 1736 14.9
SEQ ID NO: 1998 -17.7 55.5 -32.6 0 -4.6 1112 AAGCCAAAAAAAAAAAAAAA 16.6
SEQ ID NO: 1999 -8 36.3 -24.6 0 -3.2 1111 AGCCAAAAAAAAAAAAAAAG 17.1 -8.7 37.4
SEQ ID NO : 2000 -25.8 0 -3.2
Example 15
Western blot analysis of ESM-1 protein levels [00230] Western blot analysis (immunoblot analysis) is carried out using standard methods. Cells are harvested 16-20 h after oligonucleotide treatment, washed once with PBS, suspended in Laemmli buffer (100 ul/well), boiled for 5 minutes and loaded on a 16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and transferred to membrane for western blotting. Appropriate primary antibody directed
10 to ESM-1 is used, with a radiolabeled or fluorescently labeled secondary antibody directed against the primary antibody species. Bands are visualized using a PHOSPHORIMAGER™ (Molecular Dynamics, Sunnyvale CA).
15
Claims
1. An antisense compound 8 to 30 nucleobases in length targeted to a nucleic acid molecule encoding ESM-1, wherein said antisense compound specifically hybridizes with and inhibits the expression of ESM-1.
2. The antisense compound of claim 1 which is an antisense oligonucleotide.
3. The antisense oligonucleotide of claim 2 comprising a nucleic acid sequence selected from the group consisting of at least eight contiguous bases of SEQ ID NO:l - SEQ ID NO:2000.
4. The antisense oligonucleotide of claim 2 comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO:l - SEQ ID NO:2000.
5. The antisense compound of claim 2, 3, or 4 wherein the antisense oligonucleotide comprises at least one modified internucleoside linkage.
6. The antisense compound of claim 5 wherein the modified internucleoside linkage is a phosphorothioate linkage.
7. The antisense compound of claim 2, 3, or 4 wherein the antisense oligonucleotide comprises at least one modified sugar moiety.
8. The antisense compound of claim 7 wherein the modified sugar moiety is a 2'-O-methoxyethyl sugar moiety.
9. The antisense compound of claim 2, 3, or 4 wherein the antisense oligonucleotide comprises at least one modified nucleobase.
10. The antisense compound of claim 9 wherein the modified nucleobase is a 5-methylcytosine.
11. The antisense compound of claim 2, 3 , or 4 wherein the antisense oligonucleotide is a chimeric oligonucleotide.
12. A composition comprising the antisense compound of claim 1 and a pharmaceutically acceptable carrier or diluent.
13. The composition of claim 12 further comprising a colloidal dispersion system.
14. The composition of claim 13 wherein the antisense compound is an antisense oligonucleotide,
15. A method of inhibiting the expression of ESM- 1 in cells or tissues comprising contacting said cells or tissues with the antisense compound of claim 1 so that expression of ESM-1 is inhibited.
16. A method of treating a human having a disease or condition associated with ESM-1 comprising administering to said animal a therapeutically or prophylactically effective amount of the antisense compound of claim 1 so that expression of ESM-1 is inhibited.
17. The method of claim 16 wherein the disease or condition is diabetes.
18. The method of claim 16 wherein the disease or condition is an immunological disorder.
19. The method of claim 16 wherein the disease or condition is a cardiovascular disorder.
20. The method of claim 16 wherein the disease or condition is a neurologic disorder.
21. The method of claim 16 wherein the disease or condition is ischemia/reperfusion injury.
22. The method of claim 16 wherein the disease or condition is any form of cancer.
23. The method of claim 16 wherein the disease or condition is an angiogenic disorder.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US40449502P | 2002-08-19 | 2002-08-19 | |
US404495P | 2002-08-19 | ||
PCT/US2003/025833 WO2004021978A2 (en) | 2002-08-19 | 2003-08-19 | Antisense modulation of endothelial specific molecule 1 expression |
Publications (1)
Publication Number | Publication Date |
---|---|
EP1543159A2 true EP1543159A2 (en) | 2005-06-22 |
Family
ID=31978255
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP03781285A Withdrawn EP1543159A2 (en) | 2002-08-19 | 2003-08-19 | Antisense modulation of endothelial specific molecule 1 expression |
Country Status (4)
Country | Link |
---|---|
EP (1) | EP1543159A2 (en) |
JP (1) | JP2006511207A (en) |
AU (1) | AU2003288898A1 (en) |
WO (1) | WO2004021978A2 (en) |
Families Citing this family (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7795419B2 (en) * | 2004-05-26 | 2010-09-14 | Rosetta Genomics Ltd. | Viral and viral associated miRNAs and uses thereof |
WO2006091841A2 (en) * | 2005-02-25 | 2006-08-31 | Isis Pharmaceuticals, Inc. | Compositions and their uses directed to il-4r alpha |
WO2008049078A1 (en) * | 2006-10-18 | 2008-04-24 | Nastech Pharmaceutical Company Inc. | Nicked or gapped nucleic acid molecules and uses thereof |
KR101058753B1 (en) | 2007-11-22 | 2011-08-24 | 한국생명공학연구원 | Characterization of ESM-1 as a tumor associated marker of colorectal cancer |
WO2014112144A1 (en) * | 2013-01-15 | 2014-07-24 | 国立大学法人熊本大学 | Nucleic acid anticancer agent targeting satellite noncoding rna derived from chromosome centromere, and method using anticancer agent |
US20160025738A1 (en) * | 2013-03-04 | 2016-01-28 | Iq Products B.V. | Prognostic marker to determine the risk for early-onset preeclampsia |
NL2016967B1 (en) * | 2016-06-15 | 2017-12-21 | Iq Products B V | Markers and their ratio to determine the risk for early-onset preeclampsia. |
KR102612990B1 (en) * | 2020-12-02 | 2023-12-13 | 주식회사 에이치피바이오 | Rna aptamer specifically binding to esm-1 protein and using the same |
CN115154605A (en) * | 2022-05-31 | 2022-10-11 | 首都医科大学附属北京安贞医院 | Use of products for reducing the level of endothelial cell specific molecule-1 in the preparation of products for treating vascular inflammation or atherosclerosis |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6670328B1 (en) * | 1997-06-24 | 2003-12-30 | Institut Pasteur De Lille | Proteins and peptides derived from protein ESM-1 and their uses in the treatment and diagnosis of diseases linked to leukocyte migration |
US5968826A (en) * | 1998-10-05 | 1999-10-19 | Isis Pharmaceuticals Inc. | Antisense inhibition of integrin α4 expression |
CA2381006A1 (en) * | 1999-09-17 | 2001-03-22 | Nicholas M. Dean | Antisense modulation of transforming growth factor-.beta. expression |
US6475797B1 (en) * | 2000-11-03 | 2002-11-05 | Isis Pharmaceuticals, Inc. | Antisense modulation of SR-CYP expression |
-
2003
- 2003-08-19 AU AU2003288898A patent/AU2003288898A1/en not_active Abandoned
- 2003-08-19 JP JP2004534294A patent/JP2006511207A/en not_active Ceased
- 2003-08-19 WO PCT/US2003/025833 patent/WO2004021978A2/en not_active Application Discontinuation
- 2003-08-19 EP EP03781285A patent/EP1543159A2/en not_active Withdrawn
Non-Patent Citations (1)
Title |
---|
See references of WO2004021978A2 * |
Also Published As
Publication number | Publication date |
---|---|
JP2006511207A (en) | 2006-04-06 |
WO2004021978A3 (en) | 2005-04-21 |
WO2004021978A2 (en) | 2004-03-18 |
AU2003288898A1 (en) | 2004-03-29 |
AU2003288898A8 (en) | 2004-03-29 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2008213712B2 (en) | Antisense modulation of apolipoprotein (A) expression | |
US20060122133A1 (en) | Antisense modulation of vegf co-regulated chemokine-1 expression | |
EP2336145A1 (en) | Antisense modulation of apolipoprotein B expression | |
EP1549387A1 (en) | Antisense modulation of farnesoid x receptor expression | |
WO2002028878A1 (en) | Antisense modulation of smad6 expression | |
WO2003066805A2 (en) | Antisense modulation of complement component c3 expression | |
WO2003014306A2 (en) | Antisense modulation of cholesteryl ester transfer protein expression | |
US6379960B1 (en) | Antisense modulation of damage-specific DNA binding protein 2, p48 expression | |
WO2004028458A2 (en) | Antisense modulation of microsomal prostaglandin e2 synthase expression | |
EP1534728A2 (en) | Antisense modulation of glucocorticoid receptor expression | |
EP1543159A2 (en) | Antisense modulation of endothelial specific molecule 1 expression | |
US6395544B1 (en) | Antisense modulation of BCAS1 expression | |
EP2270230A2 (en) | Antisense modulation of insulin-like growth factor binding protein 5 expression | |
US6277636B1 (en) | Antisense inhibition of MADH6 expression | |
EP1572713A2 (en) | Antisense modulation of acyl-coa synthetase 1 expression | |
WO2004003201A2 (en) | Antisense modulation of lrh1 expression | |
US6884787B2 (en) | Antisense modulation of transforming growth factor-beta 3 expression | |
US6410325B1 (en) | Antisense modulation of phospholipase A2, group VI (Ca2+-independent) expression | |
US20050182015A1 (en) | Antisense modulation of EIF2C1 expression | |
WO2002048314A2 (en) | Antisense modulation of raidd expression | |
WO2003038050A2 (en) | Antisense modulation of phospholipase a2 group v expression | |
EP1461461A2 (en) | Antisense modulation of cd81 expression | |
WO2002055659A2 (en) | Antisense modulation of integrin beta 4 binding protein expression | |
EP1539689A2 (en) | Antisense modulation of endothelial lipase expression | |
WO2004053060A2 (en) | ANTISENSE MODULATION OF mitoNEET EXPRESSION |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20050214 |
|
AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR |
|
AX | Request for extension of the european patent |
Extension state: AL LT LV MK |
|
DAX | Request for extension of the european patent (deleted) | ||
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN |
|
18W | Application withdrawn |
Effective date: 20060517 |