JP2005065528A - New gene and protein encoded with the same - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To directly clone a new DNA containing a region encoding a protein from a cDNA library derived from a human adult amygdaloid body, a hippocampus and the human fetal whole brain, to determine the base sequence thereof and to identify functions thereof. <P>SOLUTION: The DNA comprises a base sequence encoding the following polypeptide (a) or (b): (a) a polypeptide composed of an amino acid sequence which is the same or substantially the same as a specific amino acid sequence derived from humans and (b) a polypeptide composed of an amino acid sequence in which a part of amino acids are deleted, substituted or added in the specific amino acid sequence derived from the humans and having substantially the same biological activity as the function of the polypeptide (a). A recombinant polypeptide is encoded with the DNA. The protein comprises the polypeptide. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to DNA and a gene containing the DNA, a recombinant polypeptide encoded by the DNA, and a novel recombinant protein containing the polypeptide.

Due to the large-scale sequencing in the Human Genome Project, the human genome draft sequence was published in February 2001.
The ultimate goal of the Human Genome Project will not be simply to determine the entire base sequence of a genome, but to interpret various human life phenomena from its structural information, that is, DNA base sequence information.
Only a small part of the region of the human genome sequence encodes a protein. At present, the coding region is predicted using an information science technique called a neural network or a hidden Markov model. However, their prediction accuracy is still not sufficient.

DNA Research Vol.4,53-59 (1997) Nucreic Acids Res., 29, e22 (2001) DNA Research Vol. 9, 47-57 (2002)

  In order to find a new gene, the present inventors have succeeded in directly cloning a novel DNA containing a region encoding a protein from cDNA libraries derived from human adult amygdala, hippocampus and whole human fetus brain. The present invention was completed by determining their nucleotide sequences.

That is, the present invention relates to a DNA comprising a base sequence encoding the following polypeptide (a) or (b) as a first aspect:
(A) a polypeptide comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by any one of SEQ ID NOs: 1 to 5,
(B) the amino acid sequence represented by any one of SEQ ID NOs: 1 to 5, consisting of an amino acid sequence in which some of the amino acids are deleted, substituted or added, and substantially functions and functions of the polypeptide of (a) Having the same biological activity.
The second aspect of the present invention relates to the following DNA (a) or (b):
(A) DNA comprising a nucleotide sequence encoding the amino acid sequence represented by each of the nucleotide sequences represented by any one of SEQ ID NOs: 1 to 5,
(b) a protein that hybridizes with a DNA comprising a base sequence complementary to the DNA of (a) under stringent conditions and has a biological activity substantially the same as the function of the polypeptide of (a). DNA encoding.
The DNAs according to the first and second aspects of the present invention will be collectively referred to as “the DNA of the present invention” hereinafter. The present invention also relates to genes containing these DNAs.
Furthermore, the present invention relates to a recombinant polypeptide encoded by the above DNA or gene (hereinafter also referred to as “the polypeptide of the present invention”) and a recombinant protein containing the polypeptide.

Table 1 shows the name of the clone having the DNA of the present invention, the length of the polypeptide or protein of the present invention, and its function.
The DNA of the present invention is commercially available (manufactured by Clontech), and is isolated as a cDNA fragment from a cDNA library prepared by the present inventors using human adult amygdala, hippocampus and human fetal whole brain mRNA as starting materials. The base sequence was determined and identified.
Specifically, the method of Ohara et al. (DNA Research Vol. 4, 53-59 (1997), Nucreic Acids Res., 29, e22 (2001) and DNA Research Vol. 9, 47-57 (2002)) Clones are randomly isolated from cDNA libraries derived from human adult amygdala, hippocampus and whole human fetal brain prepared according to
After analyzing these terminal nucleotide sequences, homology search was performed in a database of known genes using these sequences as queries, and as a result, the 5 'and 3' terminal sequences of cDNA were determined for clones that were found to be new. If an unknown long-chain gene is identified in the region between them, a full-length analysis of the cDNA is performed.
Assemble the 5 'and 3' end sequences of about 100,000 clones isolated from cDNA libraries and the full length sequence of about 2000 clones, group cDNA clones from the same gene, By complementing 3 ′ end-deficient clones and frameshift clones, it is possible to sort complete genes.
Thus, unknown genes that could not be obtained by a conventional cloning method depending on known genes can also be systematically cloned.
In addition, the entire region of the human-derived gene containing the DNA of the present invention can also be obtained by using a PCR method such as RACE while paying sufficient attention to prevent artificial errors in short fragments and the obtained sequence. It is also possible to prepare.
Furthermore, by combining the RACE method and the Lic (ligase independent cloning) method (Nucreic Acids Res., 25, 4165-4166 (1997), the N-terminal of a plurality of clones is fractionated by a single RACE method, and This can yield a full-length clone linked to the original clone.

  Furthermore, the present invention provides a recombinant vector containing the DNA of the present invention or a gene containing the DNA of the present invention, a transformant holding the recombinant vector, culturing the transformant, and the polypeptide of the present invention or the polypeptide of the present invention. A method for producing a polypeptide of the present invention, a recombinant protein containing the polypeptide, or a salt thereof, and a method for producing the polypeptide of the present invention thus obtained. A peptide or a recombinant protein containing the polypeptide or a salt thereof is provided.

The present invention also relates to a pharmaceutical comprising the DNA or gene of the present invention, a polynucleotide (DNA) comprising a base sequence encoding the polypeptide of the present invention or a partial polypeptide thereof or a recombinant protein containing the polypeptide, An antisense nucleotide having a nucleotide sequence substantially complementary to the nucleotide sequence, the polynucleotide or a pharmaceutical comprising the antisense nucleotide, the polypeptide of the present invention or a partial polypeptide thereof, and the polypeptide or the same The present invention relates to a medicine containing a recombinant protein.
Furthermore, the present invention relates to an antibody against the polypeptide of the present invention or a partial polypeptide thereof or a recombinant protein containing the polypeptide or a salt thereof, and a recombinant of the polypeptide of the invention, a partial polypeptide thereof or the polypeptide. A screening method for a substance that specifically interacts with a substance, a screening kit, and a substance (compound) itself identified by the screening method, characterized by using a protein or a salt thereof, or an antibody against them Etc.

  Furthermore, the present invention comprehensively prepares and accumulates the DNA of the present invention, the polypeptide of the present invention, a partial polypeptide thereof or a recombinant protein containing the polypeptide, or an antibody against the DNA or gene of the present invention. It also relates to a so-called DNA chip (array) and protein chip.

The DNA of the present invention may be any DNA as long as it comprises a base sequence encoding the above-described polypeptide of the present invention. In addition, cDNA identified and isolated from a human brain or a cDNA library derived from other tissues, for example, cells, tissues such as heart, lung, liver, spleen, kidney, testis, etc., or Any of synthetic DNA may be used.
The vector used for creating the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, a direct RNA transcriptase-polymerase chain reaction (hereinafter abbreviated as “RT-PCR method”) using a total RNA fraction or mRNA fraction prepared from the cells / tissues described above. ) Can also be amplified.

The amino acid sequence substantially the same as the amino acid sequence represented by any one of SEQ ID NOs: 1 to 5 is the degree of homology with the entire amino acid sequence represented by any one of SEQ ID NOs: 1 to 5 Means an amino acid sequence having an average of about 70% or more, preferably about 80% or more, more preferably about 90% or more, and particularly preferably about 95% or more.
Therefore, as a polypeptide consisting of an amino acid sequence substantially the same as the amino acid sequence represented by any one of SEQ ID NOs: 1 to 5 of the present invention, for example, for the amino acid sequence represented by each of the aforementioned SEQ ID NOs: And polypeptides having the above-mentioned homology and having biological activity (function) substantially the same as the function of the polypeptide comprising the amino acid sequence represented by each SEQ ID NO. Here, substantially the same quality means that their activities (functions) are qualitatively the same.
The polypeptide of the present invention includes, for example, a part of the amino acid sequence represented by any one of SEQ ID NOs: 1 to 5 (preferably about 1 to 20, more preferably about 1 to 10, A polypeptide comprising an amino acid sequence represented by any one of SEQ ID NOs: 1 to 5, consisting of an amino acid sequence in which several amino acids have been deleted, substituted or added, or a combination thereof. Polypeptides having biological activity (function) substantially the same as function are also included.

A polypeptide comprising an amino acid sequence substantially the same as the amino acid sequence represented by any one of SEQ ID NOs: 1 to 5 above, or a polypeptide comprising an amino acid sequence obtained by deleting, substituting, or adding a part of the amino acids Peptides can be easily prepared by appropriately combining methods well known to those skilled in the art, such as site-directed mutagenesis, gene homologous recombination, primer extension, and PCR.
In this case, in order to have substantially the same biological activity, among the amino acids constituting the polypeptide, homologous amino acids (polar / nonpolar amino acids, hydrophobic / hydrophilic amino acids, positive / negative) Possible substitution between charged amino acids, aromatic amino acids, etc.). In addition, in order to maintain substantially the same biological activity, it is desirable to retain amino acids in the functional domain included in each polypeptide of the present invention.

Furthermore, the DNA of the present invention comprises a DNA comprising a nucleotide sequence encoding the amino acid sequence represented by each of the nucleotide sequences represented by any one of SEQ ID NOs: 1 to 5, and a stringent sequence with the DNA. The function of a polypeptide that hybridizes under conditions, that is, more specifically, hybridizes with a DNA comprising a base sequence complementary to the DNA under stringent conditions and comprises an amino acid sequence represented by each sequence. DNA encoding a polypeptide (protein) having the same biological activity (function) as.
Under such conditions, in the base sequence represented by any one of SEQ ID NOs: 1 to 5, as a DNA that can hybridize with a DNA containing a base sequence encoding the amino acid sequence represented by each sequence, for example, the DNA Examples include DNA containing a base sequence whose degree of homology with the entire base sequence of DNA is about 80% or more, preferably about 90% or more, and more preferably about 95% or more in average as a whole. .
Hybridization is a method known in the art such as the method described in Current protocols in molecular biology (edited by Frederick M. Ausubel et al., 1987) or the like. It can be done according to the method. Moreover, when using a commercially available library, it can carry out according to the method as described in an attached instruction manual.
Here, “stringent conditions” means, for example, hybridization in 1 mM EDTA sodium at 65 ° C., 0.5 M sodium hydrogen phosphate (pH 7.2), 7% SDS aqueous solution, and 1 mM EDTA sodium at 65 ° C. The conditions are such that they hybridize to the DNA probe of the present invention by Southern blot hybridization under the condition of washing the membrane in 40 mM sodium hydrogen phosphate (pH 7.2), 1% SDS aqueous solution.

As a means for cloning the DNA of the present invention, a DNA amplified by a PCR method using a synthetic DNA primer having an appropriate base sequence, such as a portion of the polypeptide of the present invention, or a DNA incorporated into an appropriate vector is used. Can be selected by hybridization with a DNA fragment encoding a part or the entire region of the DNA or one labeled with a synthetic DNA.
The hybridization method can be performed, for example, according to the method described in Current protocols in molecular biology (edited by Frederick M. Ausubel et al., 1987). Moreover, when using a commercially available library, it can carry out according to the method as described in an attached instruction manual.
The DNA encoding the cloned polypeptide can be used as it is depending on the purpose, or digested with a restriction enzyme or added with a linker, if desired. The DNA may have ATG as a translation initiation codon on the 5 ′ end side, and may have TAA, TGA, or TAG as a translation termination codon on the 3 ′ end side. These translation initiation codon and translation termination codon can be added using an appropriate synthetic DNA adapter.

The expression vector for the protein of the present invention can be prepared according to a method known in the art. For example, it can be produced by (1) excising a DNA fragment containing the DNA of the present invention or a gene containing the DNA of the present invention and (2) ligating the DNA fragment downstream of a promoter in an appropriate expression vector.
Examples of the vector include plasmids derived from E. coli (eg, pBR322, pBR325, pUC18, pUC118), plasmids derived from Bacillus subtilis (eg, pUB110, pTP5, pC194), plasmids derived from yeast (eg, pSH19, pSH15), λ phage and the like. Animal viruses such as bacteriophage, retrovirus, vaccinia virus, and baculovirus can be used.
The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. For example, when the host is Escherichia coli, trp promoter, lac promoter, recA promoter, λPL promoter, lpp promoter, etc. are used, and when the host is Bacillus subtilis, the host is yeast such as SPO1, SPO2 promoter, penP promoter, etc. In some cases, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter and the like are preferable. When animal cells are used as a host, examples include SRα promoter, SV40 promoter, LTR promoter, CMV promoter, HSV-TK promoter, and the like.

  In addition to the above, an enhancer, a splicing signal, a poly A addition signal, a selection marker, an SV40 origin of replication (origin) and the like known in the art can be added to the expression vector as desired. If necessary, the protein encoded by the DNA of the present invention can be expressed as a fusion protein with other proteins (for example, glutathione S-transferase and protein A). Such a fusion protein can be cleaved using an appropriate protease and separated into each protein.

Examples of host cells that can be used include Escherichia bacteria, Bacillus bacteria, yeasts, insect cells, and animal cells.
Specific examples of the genus Escherichia include Escherichia coli K12 / DH1 (Proc. Natl. Acad. Sci. USA, 60, 160 (1968)), JM103 (Nucleic Acids Research, 9, 309 ( 1981)), JA221 (Journal of Molecular Biology, 120, 517 (1978)), and HB101 (Journal of Molecular Biology, 41, 459 (1969)).
Examples of the Bacillus bacterium include Bacillus subtilis MI114 (Gene, 24, 255 (1983)), 207-21 [Journal of Biochemistry, 95, 87 (1984)].
Examples of the yeast include Saccaromyces cerevisiae AH22, AH22R-, NA87-11A, DKD-5D, 20B-12, Schizosaccaromyces pombe NCYC1913, NCYC2036, Pichia pastoris It is done.
Examples of animal cells include monkey cell COS-7, Vero, Chinese hamster cell CHO (hereinafter abbreviated as CHO cell), dhfr gene-deficient CHO cell, mouse L cell, mouse AtT-20, mouse myeloma cell, rat GH3. Human FL cells and the like are used.

Transformation of these host cells can be performed according to methods known in the art. For example, the following documents can be referred to.
Proc. Natl. Acad. Sci. USA, 69, 2110 (1972); Gene, 17, 107 (1982); Molecular & General Genetics, 168, 111 (1979); Methods in Enzymology, 194, 182- 187 (1991); Proc. Natl. Acad. Sci. USA), 75, 1929 (1978); 263-267 (1995) (published by Shujunsha); and Virology, 52, 456 (1973).

The thus obtained transformant transformed with the DNA of the present invention or the expression vector containing the gene containing the DNA of the present invention can be cultured according to a method known in the art.
For example, when the host is an Escherichia bacterium, the culture is usually performed at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration or agitation can be added. When the host is a genus Bacillus, the culture is usually performed at about 30 to 40 ° C. for about 6 to 24 hours, and if necessary, aeration or agitation can be added.
When cultivating a transformant whose host is yeast, the culture is usually performed at about 20 ° C. to 35 ° C. for about 24 to 72 hours using a medium adjusted to a pH of about 5 to 8, and if necessary, aeration or Stirring can also be added.
When cultivating a transformant whose host is an animal cell, it is usually performed at about 30 ° C. to 40 ° C. for about 15 to 60 hours using a medium whose pH is adjusted to about 6 to 8, and if necessary, aeration or Stirring can also be added.

In order to separate and purify the polypeptide or protein of the present invention from the above culture, for example, after culturing, cells or cells are collected by a known method, suspended in an appropriate buffer, and subjected to ultrasound, lysozyme and / or After destroying cells or cells by freezing and thawing, a crude protein extract is obtained by centrifugation or filtration. The buffer solution may contain a protein denaturant such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 ^™ (trademark). When the protein is secreted into the culture solution, the cells or cells are separated from the supernatant by a known method after completion of the culture, and the supernatant is collected. Purification of the protein contained in the thus obtained culture supernatant or extract can be performed by appropriately combining known separation / purification methods.
The polypeptide (protein) of the present invention thus obtained can be converted into a salt by a known method or a method analogous thereto, and conversely, when obtained as a salt, the free form can be obtained by a known method or a method analogous thereto. Or it can be converted to other salts. Furthermore, the protein produced by the recombinant may be modified arbitrarily or partially removed by allowing an appropriate protein modifying enzyme such as trypsin and chymotrypsin to act before or after purification. You can also.
The presence of the polypeptide (protein) of the present invention or a salt thereof can be measured by various binding assays and enzyme immunoassays using specific antibodies.

In the polypeptide (protein) of the present invention, the C-terminus is usually a carboxyl group (—COOH) or a carboxylate (—COO—), but the C-terminus may be an amide (—CONH ₂ ) or an ester (—COOR). Good. Here, R in the ester is, for example, a C1-6 alkyl group such as methyl, ethyl, n-propyl, isopropyl or n-butyl, for example, a C3-8 cycloalkyl group such as cyclopentyl, cyclohexyl, for example, phenyl, α -C6-12 aryl groups such as naphthyl, for example, C7-14 aralkyl groups such as phenyl-C1-2 alkyl groups such as benzyl and phenethyl or α-naphthyl-C1-2 alkyl groups such as α-naphthylmethyl, Pivaloyloxymethyl ester, which is widely used as an oral ester, is used.

When the polypeptide (protein) of the present invention has a carboxyl group (or carboxylate) in addition to the C-terminus, those in which the carboxyl group is amidated or esterified are also included in the protein of the present invention. As the ester in this case, for example, the above-mentioned C-terminal ester or the like is used. Furthermore, the protein of the present invention includes those in which the amino group of the N-terminal methionine residue is protected with a protecting group (for example, a C1-6 acyl group such as formyl group, acetyl group, etc.), which is cleaved in vivo. An N-terminal glutamic acid residue produced in this manner is pyroglutamated, or is present on the side chain of an amino acid in the molecule, for example, OH, COOH, NH ₂ , SH, etc. are suitable protecting groups (for example, formyl group, acetyl group) And those protected by a C1-6 acyl group, etc.) or complex proteins such as so-called glycoproteins to which sugar chains are bound.

The partial polypeptide of the protein of the present invention may be any partial peptide of the above-described polypeptide (protein) of the present invention as long as it has substantially the same activity. For example, at least 10 or more, preferably 50 or more, more preferably 70 or more, more preferably 100 or more, and most preferably 200 or more amino acid sequences of the constituent amino acid sequences of the polypeptide (protein) of the present invention. For example, a peptide having substantially the same biological activity as the function of the polypeptide of the present invention is used. As the partial polypeptide of the present invention, for example, those containing each functional domain are preferable. In the partial peptide of the present invention, the C-terminus is usually a carboxyl group (—COOH) or a carboxylate (—COO—), but the C-terminus is an amide (—CONH ₂ ) or ester as in the protein of the present invention described above. (-COOR) may be sufficient. Furthermore, in the partial peptide of the present invention, as in the above-described protein of the present invention, the amino group of the N-terminal methionine residue is protected with a protecting group, and glutamyl produced by cleaving the N-terminal side in vivo. Examples include those in which the group is pyroglutamine oxidized, those in which substituents on the side chains of amino acids in the molecule are protected with an appropriate protecting group, and complex peptides such as so-called glycopeptides to which sugar chains are bonded. The partial peptide of the present invention can be used as, for example, a reagent, a standard substance for experiments, or an immunogen or a part thereof.

  The salt of the polypeptide (protein) of the present invention or a partial peptide thereof is particularly preferably a physiologically acceptable acid addition salt. Such salts include, for example, salts with inorganic acids (eg hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid). Acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like.

The polypeptide (protein) of the present invention, a partial peptide thereof, a salt thereof, or an amide thereof can also be prepared using a chemical synthesis method known in the art.
For example, a commercially available resin for protein synthesis is used, and an amino acid with an α-amino group and a side chain functional group appropriately protected is subjected to various condensation methods known in the art according to the sequence of the target protein. Condensation on the resin. At the end of the reaction, the protein is cut out from the resin, and at the same time, various protecting groups are removed, and an intramolecular disulfide bond forming reaction is performed in a highly diluted solution to obtain the target protein, its partial peptide, or their amides. Regarding the condensation of the above-mentioned protected amino acids, for example, for protein synthesis represented by carbodiimides such as DCC, N, N′-diisopropylcarbodiimide, and N-ethyl-N ′-(3-dimethylaminoprolyl) carbodiimide. Various activating reagents that can be used can be used. For activation by these, a protected amino acid is added directly to the resin together with a racemization inhibitor (for example, HOBt, HOOBt), or the protected amino acid is activated in advance as a control anhydride, HOBt ester or HOOBt ester. Once done, it can be added to the resin.

Solvents used for the activation of protected amino acids and condensation with resins include acid amides, halogenated hydrocarbons, alcohols, sulfoxides, ethers and the like that can be used for protein condensation reactions in the industry. It may be appropriately selected from known solvents. The reaction temperature is appropriately selected from a range known to be usable for protein bond forming reactions. The activated amino acid derivative is usually used in an excess of 1.5 to 4 times. As a result of a test using the ninhydrin reaction, if the condensation is insufficient, sufficient condensation can be performed by repeating the condensation reaction without removing the protecting group. When sufficient condensation is not obtained even after repeating the reaction, the unreacted amino acid can be acetylated with acetic anhydride or acetylimidazole so as not to affect the subsequent reaction.
As a protective group such as each amino group, carboxyl group, and serine hydroxyl group of the raw material, groups usually used in this technical field can be used.
The protection of the functional group that should not be involved in the reaction of the raw material, the protection group, the removal of the protective group, the activation of the functional group involved in the reaction, etc. can be appropriately selected from known groups or known means.

The partial peptide of the present invention or a salt thereof can be produced according to a peptide synthesis method known per se in the art or by cleaving the protein of the present invention with an appropriate peptidase. As a peptide synthesis method, for example, either a solid phase synthesis method or a liquid phase synthesis method may be used. Examples of known condensation methods and protecting group elimination include the methods described in the following (1) to (3).
(1) Nobuo Izumiya et al., Basics and Experiments of Peptide Synthesis, Maruzen Co., Ltd. (1975)
(2) Haruaki Yajima and Shunpei Sugawara, Biochemistry Experiment Course 1, Protein Chemistry IV, 205, (1977)
(3) Supervised by Yajima Haruaki, continued drug development Vol. 14 Peptide synthesis Hirokawa Shoten Purification after reaction is also known per se, eg, solvent extraction, distillation, column chromatography, liquid chromatography, recrystallization, etc. The partial peptide of the present invention can be purified and isolated. When the partial peptide obtained by the above method is a free form, it can be converted into an appropriate salt by a known method. Conversely, when it is obtained as a salt, it can be converted into a free form by a known method. Can do.

The antibody against the polypeptide (protein) of the present invention, a partial peptide thereof or a salt thereof may be a polyclonal antibody or a monoclonal antibody as long as they can recognize them. An antibody against the polypeptide (protein) of the present invention, a partial peptide thereof or a salt thereof can be produced according to a known antibody or antiserum production method using the polypeptide (protein) of the present invention or a partial peptide thereof as an antigen. .
The antibody of the present invention can be used to detect the polypeptide (protein) of the present invention present in a subject such as a body fluid or tissue. In addition, production of antibody columns used to purify them, detection of the polypeptide (protein) of the present invention in each fraction during purification, analysis of the behavior of the polypeptide (protein) of the present invention in test cells, etc. Can be used for.

Furthermore, the antibody of the present invention can be used for quantification of the polypeptide (protein) of the present invention in a test solution by a known method, in particular, quantification by sandwich immunoassay using a monoclonal antibody, detection by tissue staining, etc. Can be used. Thereby, for example, a disease associated with the polypeptide (protein) of the present invention can be diagnosed.
For these purposes, the antibody molecule itself may be used, or F (ab ′) 2, Fab ′, or Fab fraction of the antibody molecule may be used. The method for quantifying the protein of the present invention using the antibody of the present invention is not particularly limited, and an antibody, antigen or antibody-antigen complex corresponding to the amount of antigen (for example, protein mass) in the solution to be measured. Any measurement method may be used as long as it is a measurement method in which the amount is detected by a chemical or physical means and calculated from a standard curve prepared using a standard solution containing a known amount of antigen. For example, nephrometry, competition method, immunometric method and sandwich method are preferably used, but the sandwich method described later is preferably used in terms of sensitivity and specificity. As a labeling agent used in a measurement method using a labeling substance, for example, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance, or the like known in the technical field can be used.

  For the details of general technical means relating to these measurement / detection methods, review articles, books, etc. can be referred to. For example, Hiroshi Irie “Continuing radioimmunoassay” (Kodansha, published in 1979), “Enzyme immunoassay” edited by Eiji Ishikawa et al. (3rd edition) (Medical Shoin, published in 1987), “Methods in ENZYMOLOGY” Vol 70 (Immunochemical Techniques (Part A)), ibid Vol.73 (Immunochemical Techniques (Part B)), ibid Vol.74 (Immunochemical Techniques (Part C)), ibid Vol.84 (Immunochemical Techniques (Part D: Selected Immunoassays) )), Vol. 92 (Immunochemical Techniques (Part E: Monoclonal Antibodies and General Immunoassay Methods)), ibid. Vol. 121 (Immunochemical Techniques (Part I: Hybridoma Technology and Monoclonal Antibodies))) (published by Academic Press) Can be referred to.

  The antisense oligonucleotide (DNA) having a base sequence substantially complementary to the DNA encoding the polypeptide (protein) of the present invention or a partial polypeptide thereof is a base substantially complementary to the base sequence of the DNA. Any antisense DNA may be used as long as it has a sequence and has an action capable of suppressing the expression of the DNA. The substantially complementary base sequence is preferably, for example, about 90% or more, more preferably about 95% or more, and most preferably 100% or more of the whole or partial base sequence of the base sequence complementary to the DNA of the present invention. % Of base sequences having homology of%. Further, nucleic acid sequences (RNA or modified DNA) having the same action as these antisense DNAs are also included in the antisense DNA referred to in the present invention. These antisense DNAs can be produced using a known DNA synthesizer.

Furthermore, the polypeptide (protein) of the present invention is useful as a reagent for screening for compounds that specifically interact with these substances. That is, the present invention uses the polypeptide of the present invention (protein), a partial peptide thereof or a salt thereof, or an antibody against them, screening for a compound that specifically interacts with the substance or a salt thereof. Methods and screening kits therefor are provided.
The compound or salt thereof identified using the screening method or screening kit of the present invention is a compound selected from the test compounds described above, interacts with the polypeptide (protein) of the present invention, and the biological A compound that modulates, inhibits, promotes, or antagonizes activity. The compound or a salt thereof may directly act on the activity of the protein of the present invention, or indirectly by acting on the expression of the polypeptide (protein) of the present invention. ) And the like. Examples of the salt of the compound include pharmaceutically acceptable salts. Examples include salts with inorganic bases, salts with organic bases, salts with inorganic acids, salts with organic acids, salts with basic or acidic amino acids, and the like. There is a possibility that a compound that inhibits biological activity such as the polypeptide (protein) of the present invention can also be used as a medicine such as a therapeutic / prophylactic agent for the above-mentioned various diseases.

By using the DNA of the present invention and a gene containing the DNA as a probe, an abnormality (gene abnormality) of DNA or mRNA encoding the polypeptide of the present invention or a partial peptide thereof can be detected. It is useful as a gene diagnostic agent for mRNA damage, mutation or decreased expression, or increased or excessive expression of the DNA or mRNA. The gene diagnosis using the DNA of the present invention includes, for example, the known Northern hybridization and PCR-SSCP method (Genomics, Vol. 5, pp. 874-879 (1989), Proceedings of the National Academy of Sciences of the United States). States of America, 86, 2766-2770 (1989)).
Furthermore, when the DNA or gene of the present invention is abnormal or deficient, or the expression level is decreased, for patients who cannot exhibit normal functions in vivo, follow (1) retro The DNA or gene of the present invention is introduced into the patient and expressed by gene therapy using an appropriate vector such as a viral vector, adenoviral vector, adenoviral associated viral vector as a vehicle, or (2) the present invention. It is considered that the function of the protein or the like of the present invention can be exhibited in the patient by injecting the protein or the like into the patient.
It is also possible to administer the DNA or gene of the present invention alone or together with an auxiliary agent for promoting uptake by a catheter such as a gene gun or a hydrogel catheter.

  In this specification and on the surface, when bases, amino acids, etc. are indicated by abbreviations, they are based on abbreviations by IUPAC-IUB Commission on Biochemical Nomenclature or conventional abbreviations in the field, and there may be optical isomers for amino acids. Unless otherwise specified, the L form is indicated.

  The present invention will be described more specifically with reference to the following examples, but the present invention is not limited thereto. Various gene manipulations in the examples were performed according to the method described in Current protocols in molecular biology (edited by Frederick M. Ausubel et al., 1987).

(1) Construction of cDNA library derived from human adult amygdala, hippocampus and human fetal whole brain (Part 1)
SuperScriptII reverse transcriptase kit (manufactured by Invitrogen) using oligonucleotide (GACTAGTTCTAGATCGCGAGCGGCCCGCCC (T) ₁₅ ) (Invitrogen) as a primer and mRNA derived from human adult amygdala and hippocampal and human fetal whole brain (Clontech) as a template ) To synthesize a double-stranded cDNA. An adapter having a SalI site (Invitrogen) was ligated with cDNA. Thereafter, NotI digestion was performed, and a DNA fragment of 3 kb or more was purified by low-melting agarose electrophoresis at 1% concentration.
The purified cDNA fragment was ligated with pBluescript IISK + plasmid treated with SalI-NotI restriction enzyme. This recombinant plasmid was introduced into E. coli ElectroMax DH10B strain (Invitrogen) by electroporation.

(2) Screening The terminal base sequence of a randomly isolated clone was determined, and the homologous search program BLASTN 2.2.3 (Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui, using the obtained sequence as a query. Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25: 3389-3402) A homology search was performed on the database (All GenBank + EMBL + DDBJ + PDB sequences (but no EST, STS, GSS, or phase 0, 1 or 2 HTGS sequences)). As a result, the 5 ′ and 3 ′ terminal sequences of those in which a homologous gene did not exist, that is, a novel gene, were converted into the human genome sequence (ftp: /) using the homologous search program BLASTN2.2.3. /ncbi.nlm.nih.gov/genomes/H_sapiens/).
Next, from the genomic region between them, the Genscan program (Burge, C. and Karlin, S. 1997, Prediction of complete gene structures in human genomic DNA, J Mol. Biol., 268, 78-94, The encoded gene was extracted using computer software for prediction. Using this as a query, using homology search program BLASTN2.2.3, mergedb (human cDNA sequence determined by Kazusa DNA Research Institute and GenBank homo sapiens database excluding EST and genome were mixed without duplication, When a new long chain gene (Genscan predicted cds of 1200 bp or more) was confirmed by matching with a DNA sequence database originally created by Kazusa DNA Research Institute, a full-length cDNA was analyzed.
For sequencing, a DNA sequencer (ABI PRISM377) manufactured by PE Applied Biosystems and a reaction kit manufactured by the same company were used. Most sequences were determined by shotgun clones using the dye terminator method. For some base sequences, oligonucleotides were synthesized based on the determined base sequences and determined by the primer walking method.
Thus, screening of new DNA or gene was performed. As a result, a novel DNA or gene shown in any one of SEQ ID NOS: 1 to 5 in the sequence listing was detected.
The base sequences of these novel DNAs or genes were determined by the above sequencing method. The names of the clones having the DNA or gene of the present invention are shown in Table 1.

(3) Homology search of the DNA of the present invention Next, based on the whole nucleotide sequence thus obtained, the amino acid sequence of the clone is analyzed against the known sequence library nr by the analysis program BLASTP 2.2.3 (Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25 : 3389-3402) revealed that the homologous genes shown in Table 2 were homologous. In Table 2, information on these homologous genes, that is, their names, database IDs, biological species, protein lengths, and descriptions are listed. In addition, the meanings of the abbreviations of “species species” in these tables are explained in Table 3.

Further, various data relating to the homology between the DNA or gene of the present invention contained in each clone and each homologous gene shown in Table 2 are summarized in Table 4. The meaning of each item in these tables is as follows.
“Homologous region clone” Origin and end point of homologous region of clone “Homologous region homologous gene” Origin and end point of homologous region of homologous gene “Score” The higher this value, the higher the reliability “E-value” This value becomes 0 Percentage of amino acid residue matches in the homology region that is more reliable as it is closer The percentage of homology in the homologous gene

(4) Search of various domains Next, the search tool Pfam HMM ver 2.1 Search (HMMPFAM) (Sonnhammer ELL, Eddy SR, Birney E, Bateman A included in Pfam 9.0 is searched from the amino acid sequence encoded by the DNA contained in the clone. , Durbin R (1998) Pfam: multiple sequence alignments and HMM-profiles of protein domains, Nucleic Acids Research 26: 320-322).
Furthermore, SOSUI system (ver. 1.0 / 10, Mar., 1996) (Takatsugu Hirokawa, Seah Boon-Chieng and Shigeki Mitaku, SOSUI: Classification and Secondary Structure Prediction System for Membrane Proteins, Bioinformatics (formerly CABIOS ) 1998 May; 14 (4): 378-379.) Was used to search for transmembrane domains.
These detected functional domains and transmembrane domains are shown in Table 5, Table 6 and Table 7 for each clone.
The meaning of each item in these tables is as follows.
“Functional domain” Domain detected by Pfam SOSUI “Clone from” Origin of clone functional domain “Clone to” End of clone functional domain “Homologous gene from” Origin of homologous gene functional domain “Homologous gene to” End point “Score (Pfam only)” The higher the value, the higher the reliability “Exp (Pfam only)” The higher the value is, the higher the reliability is. Also, Table 8 shows the complete description of each functional domain.

(5) Use the homologous search program BLASTN 2.2.3 to match the DNA sequence of the chromosome position clone to the clone library (ftp://ncbi.nlm.nih.gov/genomes/H_sapiens/) that encodes the human genome. It was. The number of the chromosome from which this clone was derived was extracted from the corresponding clone description (Definition), and this is shown in Table 9.

  Based on the above information on homology, homologous genes, various domains, expression sites, chromosome positions, etc., those skilled in the art will predict each function of the DNA or gene of the present invention with sufficient scientific probability. I can do it.

A novel DNA or gene obtained in the present invention is accumulated on a so-called DNA chip or the like, and, for example, a probe prepared from blood or tissue of a normal person as a control and a patient with a disease involving a brain such as psychosis Can be used for diagnosis, treatment, etc. of these diseases.
In addition, using synthetic DNA primers prepared based on the DNA or gene of the present invention or a partial base sequence thereof, PCR is performed using chromosomal DNA extracted from human blood or tissue, and the base sequence of the product is determined. By determining, it is possible to find single-base mutations, i.e., cSNPs, which vary depending on the individual in the DNA or gene of the present invention. Thereby, the constitution and the like of the individual are predicted, and it becomes possible to develop a medicine suitable for each individual.

Further, by isolating an ortholog (homolog, counterpart) gene for the DNA or gene of the present invention in a model organism such as a mouse by cross hybridization, for example, a human disease model animal is created by knocking out these genes, It is also possible to search and identify genes that cause human pathogenesis.
Furthermore, the polypeptide of the present invention, a partial polypeptide thereof or a recombinant protein containing the polypeptide, or an antibody against the DNA or gene of the present invention is comprehensively prepared, and these are accumulated to produce a so-called protein chip, Proteome analysis, such as detecting differences in protein expression levels between patients and normal individuals, can be useful for disease diagnosis and treatment.

Claims (5)

DNA comprising a base sequence encoding the following polypeptide (a) or (b):
(A) a polypeptide comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by any one of SEQ ID NOs: 1 to 5,
(B) the amino acid sequence represented by any one of SEQ ID NOs: 1 to 5, consisting of an amino acid sequence in which some of the amino acids are deleted, substituted or added, and substantially functions and functions of the polypeptide of (a) Having the same biological activity. The following DNA (a) or (b):
(A) DNA comprising a nucleotide sequence encoding the amino acid sequence represented by each of the nucleotide sequences represented by any one of SEQ ID NOs: 1 to 5,
(b) a protein that hybridizes with a DNA comprising a base sequence complementary to the DNA of (a) under stringent conditions and has a biological activity substantially the same as the function of the polypeptide of (a). DNA encoding. A gene comprising the human DNA according to claim 1 or 2. The following recombinant polypeptide (a) or (b):
(A) a polypeptide comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by any one of SEQ ID NOs: 1 to 5,
(b) the amino acid sequence represented by any one of SEQ ID NOs: 1 to 5, consisting of an amino acid sequence in which a part of the amino acids is deleted, substituted or added, and substantially functions and functions of the polypeptide of (a) Having the same biological activity. A recombinant protein encoded by the gene according to claim 3.