JP2002153290A - New unc5h4 gene and protein encoded thereby - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a new gene from a human brain-derived cDNA library as a result of the study for searching new genes in the hope of elucidating in more detail the mechanism of an axon induction in developing the brain and establishing the diagnosis and therapy of diseases including nervous system development abnormalities. SOLUTION: This new unc5H4 gene is such as to encode the following protein (a) or (b): (a) a protein consisting of the identical or substantially identical amino acid sequence with a human-derived specific amino acid sequence; or (b) a protein consisting of an amino acid sequence where part of the amino acids are deleted, substituted or added in the amino acid sequence mentioned above and having substantially the same biological activity as that of a protein encoded by the mammal's unc gene family.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a novel human-derived protein involved in the induction of axons in nerve cells, and a novel unc5H4 gene encoding the same.

[0002]

2. Description of the Related Art Nerve cells existing in the nervous system exchange information through complex (but extremely ordered) connections between cells (neural circuits). During development, nerve cells form a neural circuit through a series of processes including axonal outgrowth, pathway selection, target selection, and synapse formation. In this process, the growth cone at the tip of the axon plays an important role. Also, the neural network once created is not fixed, but is finally completed by obtaining a subsequent correction process.

The axons of developing neurons are guided to target cells by cues from the extracellular environment to form synapses. Netrin, one of the cues from the extracellular environment, is a family of phylogenetically conserved inducers.
Acts as a diffusive attractant or repellent for various types of cells and axons (Cell Engineering Vol.15, No.2 p.1
72-180).

[0004] The DCC gene is known as a receptor involved in the attraction of netrin, and the unc gene is known as a receptor involved in the repellent action. Until now, the unc gene family is known to be the unc-5 gene in nematodes, the unc5H1 and unc5H2 genes in rats, the unc5H3 (rcm) gene in mice, and the unc5C gene in humans. By the way, human unc5C
The homology at the amino acid level of the gene and the mouse unc5H3 gene is 97%.

Hitherto, loss of the function of the unc5 gene in C. elegans causes abnormal movement of the C. elegans, and ectopic expression of the unc5 gene in neurons causes the axons to move away from the netrin source. Has been found to be induced.

[0006] Furthermore, when the unc5H3 gene is disrupted in mice, cerebellar rostral malformations and abnormal formation of the midbrain occur due to abnormal movement of nerve cells. This mutant mouse is also known to show ataxia.

The human unc5C gene has a chromosome 4q21-q2
This region contains the α-synuclein gene, which is the causative gene of Parkinson's disease.

[0008]

SUMMARY OF THE INVENTION The present inventors have now elucidated the mechanism of axon guidance in the development of the brain in more detail and established a method for diagnosing and treating diseases such as abnormal development of the nervous system. As a result, the present inventors succeeded in identifying a new unc5H4 gene from a human brain-derived cDNA library, and completed the present invention.

[0009]

In a first aspect, the present invention relates to a gene encoding the following protein (a) or (b): (a) an amino acid sequence represented by SEQ ID NO: 2 A protein consisting of the same or substantially the same amino acid sequence as that of (b) an amino acid sequence represented by SEQ ID NO: 2 wherein a part of the amino acid is deleted, substituted or added; A protein having substantially the same biological activity as the protein encoded by the family. The present invention provides, as a second aspect, the following (a) or (b):
According to the gene consisting of NA: (a) a DNA consisting of the nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 2 in the nucleotide sequence represented by SEQ ID NO: 1, (b) the DNA of (a) and the stringent DNA that hybridizes under mild conditions and has a biological activity substantially equivalent to that of the protein encoded by the mammalian unc gene family. Collectively the genes of the first and second aspects of the present invention,
Hereinafter, it is also referred to as "the gene of the present invention". Furthermore, the present invention relates to a recombinant protein encoded by the above gene (hereinafter, also referred to as “the protein of the present invention”).

[0010] The gene of the present invention is obtained from a cDNA library prepared by the present inventors using a commercially available (Clontech) mRNA derived from human brain as a starting material.
After isolation as a fragment, the nucleotide sequence was determined and identified. That is, specifically, Ohara et al.'S method (DNA Rese
Approximately 40,000 recombinants were selected from a human brain-derived cDNA library prepared according to arch Vol. 4, 53-59 (1997), and the base sequences at both ends of these DNAs were determined.
From these, cDN of 1,835 clones containing the novel gene
The entire nucleotide sequence for A was determined.

Next, a DNA analysis program (GCG, BLAST & Fast) was used based on the entire amino acid sequence encoded by the nucleotide sequence of the 1,835 clones thus obtained.
As a result of performing a homology search using A), a known mammalian unc gene family, ie, the unc5H1 gene, unc5
Un of the present invention having a nucleotide sequence showing significant homology to the amino acid sequences of the H2 gene, unc5H3 gene and unc5C gene.
A clone containing the c5H4 gene could be found. That is, the gene of the present invention relates to a novel human unc5H4 gene belonging to the unc gene family of mammals.

Further, the present invention provides a recombinant vector containing the unc5H4 gene of the present invention, a transformant carrying the recombinant vector, and culturing the transformant to produce and accumulate the protein of the present invention. And a method for producing the protein of the present invention or a salt thereof, and the protein of the present invention or a salt thereof obtained as described above.

The present invention also relates to a medicament comprising the gene of the present invention, an antisense nucleotide having a base sequence substantially complementary to a DNA encoding the protein of the present invention or a partial polypeptide thereof, or an antisense nucleotide comprising the same. Medicine
The present invention relates to a medicine comprising the protein of the present invention or a partial polypeptide thereof. Furthermore, the present invention uses an antibody against the protein of the present invention or a partial polypeptide thereof or a salt thereof, and specifically binds (interacts with) the substance characterized by using the protein of the present invention or a partial polypeptide thereof or a salt thereof. The present invention also relates to a method for screening a substance, a kit for screening, and a substance (compound) identified by the screening method.

[0014]

BEST MODE FOR CARRYING OUT THE INVENTION The gene of the present invention may be any DNA as long as it is a DNA comprising a base sequence encoding the protein of the present invention described above. Also, human brain, or other tissues, such as heart, lung, liver, spleen,
CDNA identified and isolated from a cDNA library derived from cells or tissues such as kidney, testis, etc., or synthetic D
Any of NA may be used. The vector used for the library construction may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, total RNA fraction or mRNA from the above-mentioned cells / tissues
Using the prepared fraction, perform the Reverse Transcrip
It can also be amplified by tion Coupled Polymerase Chain Reaction.

An amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 2 means that the degree of homology with the entire amino acid sequence represented by SEQ ID NO: 2 is about 80% or more on average, Preferably, the amino acid sequence is about 90% or more. Therefore, the protein of the present invention having an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 2 has, for example, the above-mentioned homology to the amino acid sequence represented by SEQ ID NO: 2. However, there may be mentioned proteins having substantially the same biological activity as the protein encoded by the mammalian unc gene family. Here, “substantially the same quality” means that their activities are the same in nature. Further, the protein of the present invention includes, for example, a part (preferably about 1 to 20, more preferably 1 to 1) in the amino acid sequence represented by SEQ ID NO: 2.
About 0, more preferably several) amino acids are deleted,
A polypeptide consisting of a substituted or added amino acid sequence, or a combination thereof, and having a biological activity substantially the same as the protein encoded by the mammalian unc gene family is also included. A protein consisting of an amino acid sequence in which a part of amino acids in the amino acid sequence represented by SEQ ID NO: 2 is deleted, substituted or added, or an amino acid sequence obtained by combining them; Polypeptides having the same biological activity can be easily prepared by appropriately combining methods well known to those skilled in the art, for example, site-directed mutagenesis, homologous recombination, primer extension, and PCR. You can do it. At this time, in order to have substantially the same biological activity, among the amino acids constituting the polypeptide, homologous amino acids (polar and
The substitution between non-polar amino acids, hydrophobic amino acids / hydrophilic amino acids, positive / negative charged amino acids, aromatic amino acids, etc.) is considered as a possibility. In addition, in order to maintain substantially the same biological activity, it is preferable that amino acids in the functional domain contained in each polypeptide of the present invention be retained.

Further, the gene of the present invention is, for example, a DN consisting of the nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 2 in the nucleotide sequence represented by SEQ ID NO: 1.
A or any DNA that hybridizes with the DNA under stringent conditions and encodes a protein having the same biological activity as the protein encoded by the mammalian unc gene family. Under these conditions, a DNA capable of hybridizing with the DNA consisting of the nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 2 in the nucleotide sequence represented by SEQ ID NO: 1
For example, the degree of homology with the entire base sequence of the DNA is about 80% or more on average, preferably about 90% or more.
% Or more containing a base sequence. Hybridization was performed using Current Protocols in Molecular Cloning (Current pr
otocols in molecular biology (edited by Frederick
The method described in M. Ausubel et al., 1987)) can be carried out according to a method known to those skilled in the art or a method analogous thereto. When using a commercially available library,
It can be performed according to the method described in the attached. Here, “stringent conditions” means, for example, 1 mM ED at 65 ° C.
TA sodium, 0.5M sodium hydrogen phosphate (pH 7.2), 7%
Hybridized in SDS solution and hybridized to the gene probe of the present invention by Southern blot hybridization under conditions where the membrane was washed in 1 mM sodium EDTA, 40 mM sodium hydrogen phosphate (pH 7.2), 1% SDS at 65 ° C. It is a condition of the degree to do.

PCR using a synthetic DNA primer having an appropriate nucleotide sequence in the nucleotide sequence shown in SEQ ID NO: 1
Or a human brain-derived cDNA library prepared by the above-mentioned Obara et al. Method by colony hybridization using a synthetic DNA having an appropriate nucleotide sequence in the nucleotide sequence shown in SEQ ID NO: 1 as a probe, or the like. A part or the whole of the gene of the present invention can be isolated.
It should be noted that those skilled in the art
Molecular cloning (Current protocols in mo
lecular biology (edited by Frederick M. Ausubel et
al., 1987)), a mutation can be introduced at an arbitrary position of the present gene isolated by using the PCR method described in, for example). As shown in the Examples, the entire gene of the present invention can be obtained by sequentially cloning a plurality of DNAs (including overlapping portions) corresponding to partial regions of the gene of the present invention. The DNA encoding the cloned polypeptide can be used as it is depending on the purpose, or can be used after digesting with a restriction enzyme or adding a linker, if desired. The DNA may have ATG as a translation initiation codon at the 5 'end and TAA, TGA or TAG as a translation stop codon at the 3' end. These translation initiation codon and translation termination codon can also be added using a suitable synthetic DNA adapter.

The expression vector for the protein of the present invention can be prepared according to a method known in the art. For example, it can be produced by (1) cutting out a DNA fragment containing the gene of the present invention, and (2) ligating the DNA fragment downstream of a promoter in an appropriate expression vector. As the vector, a plasmid derived from E. coli (eg, pBR322, pBR325, pUC18, pU
C118), a plasmid derived from Bacillus subtilis (eg, pUB11)
0, pTP5, pC194), yeast-derived plasmids (eg, pSH19, pSH15), bacteriophages such as λ phage, and animal viruses such as retrovirus, vaccinia virus, and baculovirus. The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. For example, when the host is Escherichia coli, the trp promoter, lac promoter, recA promoter, λPL promoter, lpp promoter and the like are used. When the host is Bacillus subtilis, the SPO1 promoter, SPO2 promoter,
When the host is yeast, such as the penP promoter,
PHO5 promoter, PGK promoter, GAP promoter, ADH promoter and the like are preferable. When animal cells are used as a host, SRα promoter,
SV40 promoter, LTR promoter, CMV promoter, HSV-TK promoter and the like.

In addition to the above, the expression vector may further include an enhancer, a splicing signal, a polyA addition signal, a selection marker, SV
Forty replication origins and the like can be added. Further, if necessary, the protein encoded by the gene of the present invention can be expressed as a fusion protein with another protein (for example, glutathione S-transferase and protein A). Such a fusion protein can be cleaved using an appropriate protease and separated into respective proteins.

Examples of the host cell include Escherichia, Bacillus, yeast, insect cells, insects, animal cells, and the like. Specific examples of Escherichia bacteria include Escherichia coli K12.
DH1 (Proc. Natl. Acad. Sci. USA, 60, 1
60 (1968)), JM103 (Nucleic Acids Resear)
ch, 9, 309 (1981)), JA221 (Journal
of Molecular Biology, 120, 517 (197
8)), and HB101 (Journal of Molecular Biolog
y, Vol. 41, 459 (1969)). Examples of Bacillus bacteria include, for example, Bacillus subtilis (Baci
llus subtilis) MI114 (Gene, 24, 255 (1
983)), 207-21 [Journal of Biochemistry,
95, 87 (1984)]. Examples of yeast include Saccharomyces cerevisiae (Saccaromy)
ces cerevisiae) AH22, AH22R-, NA87-
11A, DKD-5D, 20B-12, Schizosaccaromyces pombe NCYC
1913, NCYC2036, Saccharomyces pichia pastoris and the like. As animal cells, for example, monkey cells COS
-7, Vero, Chinese hamster cells CHO (hereinafter abbreviated as CHO cells), dhfr gene-deficient CHO cells, mouse L cells, mouse AtT-20, mouse myeloma cells, rat GH3, human FL cells, and the like.

Transformation of these host cells can be performed according to methods known in the art. For example, the following documents can be referred to. Proc. Natl.
Acad. Sci. USA, 69, 2110 (1972); Ge
ne, 17, 107 (1982); Molecular & General
Genetics, 168, 111 (1979); Methods in
Enzymology, 194, 182-187 (1991);
Proc. Natl. Acad. Sci. USA), 75, 1929.
(1978); Cell Engineering Separate Volume 8, New Cell Engineering Experiment Protocol. 263-267 (1995) (published by Shujunsha); and Virology, 52, 456 (1973).

The thus obtained transformant transformed with the gene of the present invention or the expression vector containing the gene of the present invention can be cultured according to a method known in the art. For example, the following documents can be referred to. For example, when the host is a bacterium belonging to the genus Escherichia, the cultivation is usually carried out at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring can be added. When the host is a bacterium belonging to the genus Bacillus, culturing is usually performed at about 30 to 40 ° C.
For about 6 to 24 hours, and if necessary, aeration and / or stirring may be added. When culturing a transformant in which the host is yeast, culturing is usually performed at about 20 ° C. to 35 ° C. for about 24 to 72 hours using a medium adjusted to a pH of about 5 to 8, if necessary, by aeration or the like. Stirring can also be added. When culturing a transformant in which the host is an animal cell, the medium is adjusted to a pH of about 6 to 8, usually at about 30 ° C. to 40 ° C. for about 1 hour.
It is performed for 5 to 60 hours, and aeration and stirring can be added as necessary.

In order to separate and purify the protein of the present invention from the above-mentioned culture, for example, after culturing, cells or cells are collected by a known method, suspended in an appropriate buffer, and subjected to ultrasound, lysozyme and / or lysozyme. After disrupting the cells or cells by freezing and thawing, a crude extract of the protein is obtained by centrifugation or filtration. The buffer may contain a protein denaturant such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 ^™ . When the protein is secreted into the culture solution, after the culture is completed, the supernatant is separated from the cells or cells by a known method, and the supernatant is collected. The protein contained in the thus obtained culture supernatant or extract can be purified by appropriately combining known separation and purification methods. The protein of the present invention thus obtained can be converted to a salt by a known method or a method analogous thereto. Conversely, when the protein of the present invention is obtained as a salt, the free form or another salt is obtained by a known method or a method analogous thereto. Can be converted to Furthermore, before or after purification of the protein produced by the recombinant, an appropriate protein modification enzyme such as trypsin and chymotrypsin is allowed to act on the protein to optionally modify it or partially remove the polypeptide. Can also. The presence of the protein of the present invention or a salt thereof can be measured by various binding assays, enzyme immunoassays using specific antibodies, and the like.

The protein of the present invention has a carboxyl group (-COOH) or a carboxylate (-COO)
-), but it is, C-terminal, may be an amide (-CONH ₂₎ or ester (-COOR). Here, R in the ester is, for example, C1-6 such as methyl, ethyl, n-propyl, isopropyl or n-butyl.
Alkyl groups, for example, C3-8 cycloalkyl groups such as cyclopentyl and cyclohexyl, for example, phenyl, α
C6-12 aryl groups such as -naphthyl, for example, C7-14 aralkyl groups such as phenyl-C1-2 alkyl groups such as benzyl and phenethyl or α-naphthyl-C1-2 alkyl groups such as α-naphthylmethyl; Pivaloyloxymethyl ester, which is widely used as an ester for oral use, is used.

When the protein of the present invention has a carboxyl group (or carboxylate) other than the C-terminus, the protein of the present invention includes those in which the carboxyl group is amidated or esterified. As the ester in this case, for example, the above-mentioned C-terminal ester and the like are used. Furthermore, the protein of the present invention may be one in which the amino group of the N-terminal methionine residue is protected with a protecting group (for example, a C1-6 acyl group such as a formyl group or an acetyl group), or that is cleaved in vivo. The glutamic acid residue at the N-terminus produced by pyroglutamination, or on the side chain of an amino acid in the molecule, for example, OH, COOH, NH ₂ , SH, etc. are suitable protecting groups (eg, formyl group, acetyl group) And a complex protein such as a so-called glycoprotein having a sugar chain bonded thereto.

The partial polypeptide of the protein of the present invention may be any of the above-mentioned partial polypeptides of the protein of the present invention as long as they have substantially the same activity. For example, at least 20 or more, preferably 50 or more, more preferably 70 or more, more preferably 10 or more of the constituent amino acid sequences of the protein of the present invention.
Peptides having an amino acid sequence of 0 or more, most preferably 200 or more, and having, for example, a biological activity substantially the same as the protein encoded by the unc gene family of mammals, and the like are used. In the partial polypeptide of the present invention, the C-terminus usually has a carboxyl group (—COO).
H) or carboxylate (-COO-),
As in the protein of the present invention described above, the C-terminus has an amide (-
CONH ₂ ) or an ester (—COOR). Further, the partial polypeptide of the present invention has the same structure as the above-described protein of the present invention, in which the amino group of the N-terminal methionine residue is protected with a protecting group, and the N-terminal is cleaved in vivo. Also included are those in which the glutamyl group is pyroglutamine-oxidized, those in which the substituent on the side chain of the amino acid in the molecule is protected with an appropriate protecting group, and those in which a sugar chain is bonded, such as a so-called glycopeptide.

The salt of the protein of the present invention or its partial polypeptide is preferably a physiologically acceptable acid addition salt. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) Acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used.

The protein of the present invention, a partial polypeptide thereof, a salt thereof, or an amide thereof can also be prepared by a chemical synthesis method known in the art. For example, using a commercially available resin for protein synthesis, an amino acid appropriately protected with an α-amino group and a side chain functional group may be subjected to various condensation methods known per se in the art according to the sequence of the target protein. , On a resin.
At the end of the reaction, the protein is cleaved from the resin, and at the same time, various protecting groups are removed.In addition, an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution to obtain the target protein, its partial polypeptide, or an amide thereof. . Regarding the condensation of the above protected amino acids, for example, protein synthesis represented by carbodiimides such as DCC, N, N′-diisopropylcarbodiimide, and N-ethyl-N ′-(3-dimethylaminoprolyl) carbodiimide Various activating reagents that can be used can be used. For activation by these, the protected amino acid was added directly to the resin together with a racemization inhibitor additive (eg, HOBt, HOOBt), or the protected amino acid was previously activated as a symmetric acid anhydride or HOBt ester or HOOBt ester. It can be added later to the resin.

Solvents used for activation of protected amino acids and condensation with resins include acid amides, halogenated hydrocarbons, alcohols, sulfoxides, and ethers, which are used in the art for protein condensation reactions. It can be appropriately selected from known solvents. The reaction temperature is appropriately selected from the range that can be used for the protein bond formation reaction. The activated amino acid derivative is usually used in a 1.5 to 4-fold excess. As a result of the test using the ninhydrin reaction, if the condensation is insufficient, sufficient condensation can be performed by repeating the condensation reaction without removing the protecting group. When sufficient condensation cannot be obtained even by repeating the reaction, the unreacted amino acid can be acetylated using acetic anhydride or acetylimidazole so as not to affect the subsequent reaction. As a protecting group such as each amino group, carboxyl group and serine hydroxyl group of the raw material, a group usually used in the technical field can be used. The protection of the functional group which should not be involved in the reaction of the raw materials, the protecting group, the elimination of the protective group, the activation of the functional group involved in the reaction, and the like can be appropriately selected from known groups or known means.

The partial polypeptide of the present invention or a salt thereof can be produced according to a peptide synthesis method known per se in the art, or by cleaving the protein of the present invention with an appropriate peptidase. As a method for synthesizing a peptide, for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. Examples of the known condensation method and elimination of the protecting group include the methods described in the following (1) to (3). (1) Nobuo Izumiya et al., Basics and experiments on peptide synthesis, Maruzen
Co., Ltd. (1975) (2) Haruaki Yajima and Shunpei Sakakibara, Laboratory of Biochemistry 1,
Protein Chemistry IV, 205, (1977) (3) Supervised by Haruaki Yajima, Development of Continuing Drugs Volume 14 Peptide Synthesis Hirokawa Shoten Purification after the reaction is also a method known per se, for example, solvent extraction, distillation, and column chromatography. -The partial polypeptide of the present invention can be purified and isolated by a combination of liquid chromatography, recrystallization and the like. When the partial polypeptide obtained by the above method is a free form, it can be converted to an appropriate salt by a known method, and conversely, when obtained as a salt, it is converted to a free form by a known method. be able to.

Antibodies against the protein of the present invention, its partial polypeptides or salts thereof may be any of polyclonal antibodies and monoclonal antibodies as long as they can recognize them. Antibodies against the protein of the present invention, its partial polypeptides or salts thereof can be produced using the protein of the present invention as an antigen according to a known method for producing an antibody or antiserum. The antibody of the present invention can be used for detecting the protein of the present invention or the like present in a subject such as a body fluid or a tissue. Further, it can be used for preparation of an antibody column used for purifying them, detection of the protein of the present invention in each fraction at the time of purification, analysis of the behavior of the protein of the present invention in test cells, and the like. .

Further, the antibody of the present invention can be used for quantification of the protein of the present invention in a test solution by a known method, particularly for quantification by a sandwich immunoassay using a monoclonal antibody.
And can be used for detection by tissue staining and the like. Thereby, for example, a disease associated with the protein of the present invention or the like can be diagnosed. For these purposes,
The antibody molecule itself may be used.
(ab ') 2, Fab' or Fab fraction may be used. Furthermore, a recombinant antibody molecule containing an antigenic determinant of the protein of the present invention (for example, a humanized antibody, a chimeric antibody, etc.) may be used.
The method for quantifying the protein or the like of the present invention using the antibody of the present invention is not particularly limited, and may be an antibody, an antigen, or an antibody-antigen complex corresponding to the amount of antigen (eg, the amount of protein) in the liquid to be measured. Any method may be used as long as it is a method for detecting the amount of by chemical or physical means and calculating the amount from a standard curve prepared using a standard solution containing a known amount of antigen. For example, nephrometry, competitive methods,
Although an immunometric method and a sandwich method are suitably used, it is preferable to use a sandwich method described later in terms of sensitivity and specificity. As a labeling agent used in a measurement method using a labeling substance, for example, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance, and the like known in the art can be used.

For details of general technical means relating to these measurement / detection methods, a review, a textbook, and the like can be referred to. For example, edited by Hiro Irie “Radio Immunoassay” (Kodansha, published in 1979), Eiji Ishikawa et al. “Enzyme immunoassay” (3rd edition) (Medical Publishing, published in 1987), “Methods in ENZYMOLOGY” Vol. .70 (Immunoche
mical Techniques (Part A)), ibid.Vol. 73 (Immunoche
mical Techniques (Part B)), Ibid.Vol. 74 (Immunochem
ical Techniques (Part C)), ibid.Vol. 84 (Immunochem
ical Techniques (Part D: Selected Immunoassays)),
Ibid.Vol. 92 (Immunochemical Techniques (Part E: Mono
clonal Antibodies and General Immunoassay Method
s)), ibid.Vol. 121 (Immunochemical Techniques (Part
I: HybridomaTechnology and Monoclonal Antibodies))
(Above, published by Academic Press).

The antisense DNA having a base sequence substantially complementary to the DNA encoding the protein of the present invention or a partial polypeptide thereof has a base sequence substantially complementary to the base sequence of the DNA. Any antisense DNA may be used as long as it has an effect of suppressing the expression of the DNA. The substantially complementary nucleotide sequence is, for example, a nucleotide sequence having about 95% or more, most preferably 100% homology with the entire nucleotide sequence or a partial nucleotide sequence of the nucleotide sequence complementary to the gene of the present invention. No. Nucleic acid sequences (modified RNA or DNA) having the same action as these antisense DNAs are also included in the antisense DNA referred to in the present invention. These antisense DNAs can be produced using a known DNA synthesizer or the like.

Further, the protein of the present invention may be a substance that specifically binds (interacts with), for example, a substance that reacts with these substances (for example, netrin), a compound that inhibits the activity of those substances, or a salt thereof (hereinafter, referred to as a salt thereof). Also called "inhibitor")
Is useful as a reagent for screening. That is, the present invention is characterized by using the protein of the present invention, a partial polypeptide thereof or a salt thereof, a method for screening the substance (compound), a screening kit therefor, and a method for screening the substance identified by the screening method. The substance (compound) is provided. The compound or a salt thereof obtained by using the screening method or the screening kit of the present invention is a compound selected from the test compounds described above, interacts with the protein of the present invention and the like, modulates or inhibits its biological activity. Is a compound that promotes, antagonizes, etc. The compound or a salt thereof may directly act on the activity of the protein or the like of the present invention, or may act indirectly by inhibiting the activity of the protein or the like of the present invention. As the salt of the compound, for example, a pharmaceutically acceptable salt or the like is used. For example,
Examples thereof include salts with inorganic bases, salts with organic bases, salts with inorganic acids, salts with organic acids, and salts with basic or acidic amino acids. Compounds that inhibit biological activity such as the protein of the present invention may also be used as medicaments such as therapeutic / prophylactic agents for the above various diseases.

By using the gene of the present invention as a probe, abnormalities in unc5H4 gene DNA or mRNA (gene abnormalities) in humans can be detected. For example, damage, mutation or reduced expression of the DNA or mRNA can be detected. It is useful as a diagnostic agent for a gene, such as an increase or an overexpression of the DNA or mRNA. The above-described genetic diagnosis using the DNA of the present invention can be performed, for example, by known Northern hybridization or PCR-
The SSCP method (Genomics, Vol. 5, pp. 874-879 (1
989), Proceedings of the National Academy of
Sciences of the United States of America, 86
Vol., Pages 2766-2770 (1989)). Furthermore, when the unc5H4 gene is abnormal or defective or its expression level is reduced, for patients who cannot exert normal functions in vivo, (1) retroviral vectors, The gene of the present invention is introduced and expressed in the patient by gene therapy using an appropriate vector such as an adenovirus vector or an adenovirus associated virus vector as a vehicle, or (2) the protein or the like of the present invention is expressed in the patient. It is considered that the function of the protein of the present invention or the like can be exhibited in the patient by injecting the protein into the patient. The gene of the present invention,
It is also possible to administer the DNA alone or together with an auxiliary for promoting uptake by a gene gun or a catheter such as a hydrogel catheter.

In the present specification and drawings, when bases and amino acids are indicated by abbreviations, IUPAC-IUB C
abbreviation by ommision on Biochemical Nomenclature or common abbreviation in the field,
When an amino acid can have an optical isomer, the L-form is indicated unless otherwise specified.

The sequence numbers in the sequence listing in the present specification indicate the following sequences. [SEQ ID NO: 1] comprising a nucleotide sequence encoding the protein of the present invention having the amino acid sequence represented by SEQ ID NO: 2,
1 shows the entire nucleotide sequence (7002 base pairs) of the nc5H4 gene. [SEQ ID NO: 2] This shows the amino acid sequence (amino acid number: 948) of the protein encoded by unc5H4 gene.

[0039]

EXAMPLES The present invention will be described in more detail with reference to the following Examples, but it should not be construed that the invention is limited thereto. Note that various genetic manipulations in the Examples are performed by Molecula
r cloning 2nd.ed. (Cold Spring Harbor Lab. Press, 1
The method described in 989 was followed.

[0040]

Example 1 (1) Construction of cDNA library derived from human brain Oligonucleotide having NotI site (GACTA
GTTCTAGATCGCGAGCGGCGCCCCC
(T) ₁₅ ) (Gibco BRL) as a primer
Supe using mRNA from human brain (Clontech) as a template
Double-stranded cDNA was synthesized using rScriptII reverse transcriptase kit (Gibco BRL). An adapter (Gibco BRL) having a SalI site was ligated with the cDNA. Thereafter, NotI digestion was performed, and a DNA fragment of 3 kb or more was purified by 1% concentration low-melting agarose electrophoresis. The purified cDNA fragment was ligated with pBluescript IISK + plasmid treated with SalI-NotI restriction enzyme. E. coli ElectroMax DH10B strain (Gibco BRL
Was introduced into the recombinant plasmid by electroporation. Then, the thus constructed cDNA
Approximately 40,000 recombinants were selected from the library and the DNA sequences at both ends of these clones were determined. From these, the entire nucleotide sequence of the cDNA of 1,835 clones containing the novel gene was determined. For sequencing, use PE
A DNA sequencer (ABI PRISM377) manufactured by Applied Biosystems and a reaction kit manufactured by the company were used. Most sequences were determined from shotgun clones using the dye terminator method. For some base sequences, oligonucleotides are synthesized based on the determined base sequence,
It was determined by the primer walking method.

(2) Determination of a clone containing the gene of the present invention by homology search Using a homology search program (Blast and FastA), (1)
The homology search of the amino acid sequence encoded by the full-length sequence of all the clones determined in the above was performed, and the database (Swiss P, an international amino acid sequence database) was searched.
rot, PIR and GenPept integrated)
A candidate clone fh19201 showing high homology with the amino acid sequence encoded by the nc gene family was found.
That is, as a result of comparing the amino acids between the clone fh19201 and the unc5H1 gene, the unc5H2 gene, the unc5H3 gene, and the unc5C gene, they showed about 41%, about 48%, about 47% and about 47% homology, respectively. . The N-terminal region of clone fh19201 is OR
F was open, suggesting that a protein translation region exists on the N-terminal side. So, Genscan program (Burge C,
Karlin S J. Mol. Biol. 1997 Apr 25; 268 (1): 78-94)
Clone fh19201 from human genome sequence using
N-terminal region (corresponding to base pair 611-1860 of SEQ ID NO: 1), and using human cDNA library as a template, Pri
mer 1 (5′-GTGGAATGGCTGAAAAATG-3 ′ (corresponding to base pair 611-629 of SEQ ID NO: 1)) and Primer-2 (5′-GGACCACAGGT
PCR was performed with GACTTCAGG-3 ′ (corresponding to base pair 1841-1860 of SEQ ID NO: 1) to isolate a PCR product fh19201GST1 corresponding to the predicted region. ORF in the N terminal area
Was open, so primer 3 (5′-GGTCAGCCCTGGTGTCAATG-3 ′ (corresponding to the base pair 661-680th in SEQ ID NO: 1)) was prepared on the 5 ′ side of the PCR product fh19201GST1, and the 5 ′ RACE method was performed. Further, a clone fh19201N2-1 containing the upstream (corresponding to the base pair Nos. 143-680 of SEQ ID NO: 1) was isolated. Nevertheless, the ORF is open in the N-terminal region, and it is considered that the protein translation region exists on the N-terminal side, and the clone fh19201N
Prepare primer 4 (5'-ATAAGCATCATCTGGCTC-3 '(corresponding to 215-232 base pairs of SEQ ID NO: 1) on the 5' side of 2-1;
Perform the 5 'RACE method and proceed further upstream (base pair 1-232 of SEQ ID NO: 1).
The clone fh19201NT1-2 containing the second corresponding) was isolated. As a result, a 7002 bp DNA encoding the unc5H4 gene consisting of four cDNAs was obtained. The four cDNAs are clone fh19201NT1-2 (corresponding to the 1st to 2nd base pairs of SEQ ID NO: 1) and clone fh19201N2-1 (the 14th base pair of SEQ ID NO: 1).
A PCR product (corresponding to base pair 611-1860 of SEQ ID NO: 1), and a clone fh19201 (corresponding to base pair 1802-7002 of SEQ ID NO: 1).

(3) Homology of the Gene of the Present Invention Next, a homology search program (Genetic Computer Group, BES
Using TFIT), the thus obtained novel unc5H4 gene, unc5H1 gene, unc5H2 gene, unc5H3 gene,
Comparison with the unc5C gene at the amino acid level showed about 49%, about 54%, about 53% and about 53% homology, respectively. The unc5H1 and unc5H2 genes, the unc5H1 and unc5H3 genes, the unc5H1 gene and unc5
The homology at the amino acid level among the C gene, the unc5H2 gene and the unc5H3 gene, the unc5H2 gene and the unc5C gene, and the unc5H3 gene and the unc5C gene was about 58 amino acids, respectively.
%, About 58%, about 57%, about 66%, about 65% and about 97%. Furthermore, in the same manner, a comparison at the nucleotide sequence level of the region encoding the amino acid in each gene was performed. As a result, the unc5H4 gene of the present invention was compared with the unc5H1, unc5H2, unc5H3, and unc5C genes, respectively. ,
It showed about 60%, about 63%, about 63% and about 62% homology. The unc5H1 and unc5H2 genes, unc5H1 and unc5H3 genes, unc5H1 and unc5C genes, unc5H2
Gene and unc5H3 gene, unc5H2 gene and unc5C gene,
And the homology at the nucleotide sequence level between the unc5H3 gene and the unc5C gene is about 65%, about 66%, about 66%, respectively.
%, About 69%, about 68% and about 90%.

(4) Domain (motif) search Known genes belonging to the unc gene family include a signal peptide, two IG domains, two TSP domains, one transmembrane domain, one ZO- It is known that it consists of one domain and one death domain. Therefore, in order to further examine the domain structure of the gene of the present invention, a protein analysis program hmmer 2.1 (Sonnhamme
r, ELL, Eddy, SR, Birney, E., Bateman, A.,
and Durbin, R., Nucleic Acid Res 1998; 26, 320-32
A domain search was performed using (2) (Suyama et. Al. 199
9 Nucleic Acids Res. 27: 338-339). This result and un
From the alignment with the unc5H1 gene, unc5H2 gene, unc5H3 gene and unc5C gene belonging to the c gene family, the unc5H4 gene of the present invention also from the N-terminal side of the protein,
A signal peptide, two IG domains, two TSP domains, one transmembrane domain, one ZO-1 domain, and one death domain were identified. Specifically, the signal peptide is 1-14 in SEQ ID NO: 2, the first IG domain in 48-138, the second IG domain in 168-233, 247
-302 found the first TSP domain, 303-355 the second TSP domain, 375-398 the transmembrane domain, 535-618 the ZO-1 domain, and 854-934 the death domain did. From the above results, it was confirmed that the domain structure of the gene of the present invention was the same as that of the previously known unc gene family.

The IG domain is thought to be involved in the interaction between proteins and between proteins and ligands.
IG superfamilies with IG-like domains include:
There are hundreds of proteins with different functions. For example, antibody molecules, titin which is a giant protein having kinase activity,
And receptors having tyrosine kinase activity. TS
Three P domains were initially found in thrombospondin. In addition, proteins in the complement pathway such as properdin, C6, C7, C8A and C9, and mindin, F-spondin, SCO-spondi
n, circumsporozoite surface protein 2, and Plasmod
One or more have been identified in extracellular matrices, such as ium TRAP. These domains are known to be involved in cell-cell interactions and inhibit angiogenesis and apoptosis. The ZO-1 domain contains the ZO-1 protein and unc5
Confirmed by the family. The function of this domain is unknown. This domain is also present in ankyrin, which acts to fix the network structure of spectrin, a protein that backs the membrane of actin, a cytoskeletal protein, to the membrane. Furthermore,
The death domain is the C of the intracellular domain of the TNF receptor that is initially involved in the signal transduction system of TNF-mediated cell death.
Found in the terminal region. It was also found in the C-terminal region of the intracellular domain of FAS / APO involved in apoptosis. These receptors signal cell death by self-associating via the death domain.

Based on the homology between the gene of the present invention and the mammalian unc gene family and the domain structure of the gene of the present invention, the protein encoded by the gene of the present invention is a protein encoded by the mammalian unc gene family. It is considered that the compound has the same function and action as described above, that is, it has utility as a receptor involved in the repellent effect of netrin.

The reason that the protein of the present invention is full-length is as follows.
There are the following two. 1. A stop codon (corresponding to base pairs 35 to 37 in SEQ ID NO: 1) appeared in the same open reading frame upstream of the methionine residue as the start codon of the protein. 2. The Unc5 family is a secreted protein but the N of unc5H4
A signal peptide necessary for secretion at the terminal (1 of SEQ ID NO: 2)
-14).

As a result of analysis by the RT-PCR ELISA method, it was revealed that the gene of the present invention was expressed in brain and kidney in tissues. It was also found that in the brain region, it is highly expressed in the nucleus of the hypothalamus (Nagase
T, Ishikawa K, Suyama M, Kikuno R, Miyajima N, Tan
aka A, Kotani H, Nomura N, Ohara O, DNA Res 1998
5; 277-286). Furthermore, GeneBridge 4 radiation hybrid p
RH mapping (Radiation Hybrid) using anel (Research Genetics, Inc.) (1.D. Cox. Burmeister, et al.
(1990) .Science 250: 245-250; 2.M. James, C. Richa.
rd III, et al. (1994)., Nature Genetics 8 70-75 .;
3. M. Boehnke, K. Lange, and D. Cox (1991). Am. J.
Hum. Genet. 49: 1174-1188) showed that the gene of the present invention is on chromosome 8.

[0048]

The present invention has provided useful information for research on the induction of axons in nerve cells by elucidating the nucleotide sequence of the novel unc5H4 gene, which is a novel human-derived protein, and its locus. It is. Furthermore, it is expected that the use of candidate gene analysis to identify diseases in which the gene of the present invention is the responsible gene will be greatly simplified. Thus, the gene of the present invention, the polypeptide or protein encoded by them,
Antibodies against the protein, antisense DNA and the like may be used as medicines in various treatment / prevention methods for treating diseases related to nerve cells.

[0049]

[Sequence List] SEQUENCE LISTING <110> Kazusa DNA Research Institute <120> Novel unc5H4 Gene and Protein encoded thereby <130> AB00025 <150> JP P2000-271068 <151> 2000-09-07 <160> 2 <170> PatentIn Ver. 2.1 <210> 1 <211> 7002 <212> DNA <213> Homo sapiens <220><221> CDS <222> (56) .. (2899) <400> 1 ttaaataagt agggattgtt taaaaaaaaa gctgtaatat gttatctggg ggtgg atg 58 Met 1 atc ctg gtg tta gtt aaa gct ctc agt gat gtc tgt gct ggg act tcc 106 Ile Leu Val Leu Val Lys Ala Leu Ser Asp Val Cys Ala Gly Thr Ser 5 10 15 ggg ttc ctg ttg gac ttt tcc tcc caa act tca cca gga act gac aat 154 Gly Phe Leu Leu Asp Phe Ser Ser Gln Thr Ser Pro Gly Thr Asp Asn 20 25 30 ggc gaa gcc ctt ccc gaa tcc atc cca tca gct cct ggg aca ctg cct 202 Gly Glu Ala Leu Pro Glu Ser Ile Pro Ser Ala Pro Gly Thr Leu Pro 35 40 45 cat ttc ata gag gag cca gat gat gct tat att atc aag agc aac cct 250 His Phe Ile Glu Glu Pro Asp Asp Ala Tyr Ile Ile Lys Ser Asn Pro 50 55 60 65 att gca ctc agg tgc aaa gcg agg cca gcc atg cag ata ttc ttc aaa 298 Ile Ala Leu Arg Cys Lys Ala Arg Pro Ala Met Gln Ile Phe Phe Lys 70 75 80 tgc aac ggc gag tgg gtc cat cag aac gag cac gtc tct gaa gag act 346 Cys Asn Gly Glu Trp Val His Gln Asn Glu His Val Ser Glu Glu Thr 85 90 95 ctg gac gag agc tca ggt ttg aag gtc cgc gaa gtg ttc atc aat gtt 394 Leu Asp Glu Ser Ser Gly Leu Lys Val Arg Glu Val Phe Ile Asn Val 100 105 110 act agg caa cag gtg gag gac ttc cat ggg ccc gag gac tat tgg tgc 442 Thr Arg Gln Gln Val Glu Asp Phe His Gly Pro Glu Asp Tyr Trp Cys 115 120 125 cag tgt gtg gcg tgg agc cac ctg ggt acc tcc aag agc agg aag gcc 490 Gln Cys Val Ala Trp Ser His Leu Gly Thr Ser Lys Ser Arg Lys Ala 130 135 140 145 tct gtg cgc ata gcc tat tta cgg aaa aac ttt gaa caa gac cca caa 538 Ser Val Arg Ile Ala Tyr Leu Arg Lys Asn Phe Glu Gln Asp Pro Gln 150 155 160 gga agg gaa gtt ccc att gaa ggc atg att gta ctg cac tgc cgc cca 586 Gly Arg Glu Val Pro Ile Glu Gly Met Ile Val Leu His Cys Arg Pro 165 170 175 cca gag gga gtc cct gct gcc gag gtg gaaa t aat g aa gag 634 Pro Glu Gly Val Pro Ala Ala Glu Val Glu Trp Leu Lys Asn Glu Glu 180 185 190 ccc att gac tct gaa caa gac gag aac att gac acc agg gct gac cat 682 Pro Ile Asp Ser Glu Gln Asp Glu Asn Ile Asp Thr Arg Ala Asp His 195 200 205 aac ctg atc atc agg cag gca cgg ctc tcg gac tca gga aat tac acc 730 Asn Leu Ile Ile Arg Gln Ala Arg Leu Ser Asp Ser Gly Asn Tyr Thr 210 215 220 225 tgc atg gca gcc aac atc gtg gct aag agg aga agc ctg tcg gcc act 778 Cys Met Ala Ala Asn Ile Val Ala Lys Arg Arg Ser Leu Ser Ala Thr 230 235 240 gtt gtg gtc tac gtg aat gga ggc tgg tct tcc tgg aca gag tgg tca 826 Val Tyr Val Asn Gly Gly Trp Ser Ser Trp Thr Glu Trp Ser 245 250 255 gcc tgc aat gtt cgc tgt ggt aga gga tgg cag aaa cgt tcc cgg acc 874 Ala Cys Asn Val Arg Cys Gly Arg Gly Trp Gln Lys Arg Ser Arg Thr 260 265 270 tgc acc aac cca gct cct ctc aat ggt ggg gcc ttt tgt gag gga atg 922 Cys Thr Asn Pro Ala Pro Leu Asn Gly Gly Ala Phe Cys Glu Gly Met 275 280 285 tca gtg cag aaa ata acc tgc act tct cttt c ct gtg gat ggg agc 970 Ser Val Gln Lys Ile Thr Cys Thr Ser Leu Cys Pro Val Asp Gly Ser 290 295 300 305 tgg gaa gtg tgg agc gaa tgg tcc gtc tgc agt cca gag tgt gaa cat 1018 Trp Glu Val Trp Ser Glu Trp Ser Val Cys Ser Pro Glu Cys Glu His 310 315 320 ttg cgg atc cgg gag tgc aca gca cca ccc ccg aga aat ggg ggc aaa 1066 Leu Arg Ile Arg Glu Cys Thr Ala Pro Pro Pro Arg Asn Gly Gly Lys 325 330 335 ttc tgt gaa ggt cta agc cag gaa tct gaa aac tgc aca gat ggt ctt 1114 Phe Cys Glu Gly Leu Ser Gln Glu Ser Glu Asn Cys Thr Asp Gly Leu 340 345 350 tgc atc cta gat aaa aaa cct ctt cat gaa ata aaa ccc ca 1162 Cys Ile Leu Asp Lys Lys Pro Leu His Glu Ile Lys Pro Gln Ser Ile 355 360 365 gag aat gcc agc gac att gct ttg tac tcg ggc ttg ggt gct gcc gtc 1210 Glu Asn Ala Ser Asp Ile Ala Leu Tyr Ser Gly Leu Gly Ala Ala Val 370 375 380 385 gtg gcc gtt gca gtc ctg gtc att ggt gtc acc ctt tac aga cgg agc 1258 Val Ala Val Ala Val Leu Val Ile Gly Val Thr Leu Tyr Arg Arg Ser 390 395 400 cag agt gac tat ggc gtg gac gtc att gac tct tct gca ttg aca ggt 1306 Gln Ser Asp Tyr Gly Val Asp Val Ile Asp Ser Ser Ala Leu Thr Gly 405 410 415 ggc ttc cag acc ttc aac ttc aaa aca gtc cgt caa ggt aac tcc ctg 1354 Gly Ply Thr Phe Asn Phe Lys Thr Val Arg Gln Gly Asn Ser Leu 420 425 430 ctc ctg aat tct gcc atg cag cca gat ctg aca gtg agc cgg aca tac 1402 Leu Leu Asn Ser Ala Met Gln Pro Asp Leu Thr Val Ser Arg Thr Tyr 435 440 445 agc gga ccc atc tgt ctg cag gac cct ctg gac aag gag ctc atg aca 1450 Ser Gly Pro Ile Cys Leu Gln Asp Pro Leu Asp Lys Glu Leu Met Thr 450 455 460 465 gag tcc tca ctc ttt aac cct ttg tc aaa gtg aaa gtc cag 1498 Glu Ser Ser Leu Phe Asn Pro Leu Ser Asp Ile Lys Val Lys Val Gln 470 475 480 agc tcg ttc atg gtt tcc ctg gga gtg tct gag aga gct gag tac cac 1546 Ser Ser Phe Met Val Ser Leu Gly Val Ser Glu Arg Ala Glu Tyr His 485 490 495 ggc aag aat cat tcc agg act ttt ccc cat gga aac aac cac agc ttt 1594 Gly Lys Asn His Ser Arg Thr Phe Pro His Gly Asn Asn His Ser Phe 500 505 510 agt aca atg cat ccc aga aat aaa atg ccc tac atc caa aat ctg tca 1642 Ser Thr Met His Pro Arg Asn Lys Met Pro Tyr Ile Gln Asn Leu Ser 515 520 525 tca ctc ccc aca agg aca gaa ctg agg aca act ggt gtc tttgg cat 1690 Ser Leu Pro Thr Arg Thr Glu Leu Arg Thr Thr Gly Val Phe Gly His 530 535 540 545 tta ggg ggg cgc tta gta atg cca aat aca ggg gtg agc tta ctc ata 1738 Leu Gly Gly Arg Leu Val Met Pro Asn Thr Gly Val Ser Leu Leu Ile 550 555 560 cca cac ggt gcc atc cca gag gag aat tct tgg gag att tat atg tcc 1786 Pro His Gly Ala Ile Pro Glu Glu Asn Ser Trp Glu Ile Tyr Met Ser 565 570 575 atc aac caa ggt gaa ccc agc ctc cag tca gat ggc tct gag gtg ctc 1834 Ile Asn Gln Gly Glu Pro Ser Leu Gln Ser Asp Gly Ser Glu Val Leu 580 585 590 ctg agt cct gaa gtc acc tgt ggt cct cca gac atg atc gtc acc act 1882 Le Glu Val Thr Cys Gly Pro Pro Asp Met Ile Val Thr Thr 595 600 605 ccc ttt gca ttg acc atc ccg cac tgt gca gat gtc agt tct gag cat 1930 Pro Phe Ala Leu Thr Ile Pro His Cys Ala Asp Val Ser Ser Glu H is 610 615 620 625 tgg aat atc cat tta aag aag agg aca cag cag ggc aaa tgg gag gaa 1978 Trp Asn Ile His Leu Lys Lys Arg Thr Gln Gln Gly Lys Trp Glu Glu 630 635 640 gtg atg tca gtg gaa gata gaa gata tcc tgt tac tgc ctt ttg gac 2026 Val Met Ser Val Glu Asp Glu Ser Thr Ser Cys Tyr Cys Leu Leu Asp 645 650 655 ccc ttt gcg tgt cat gtg ctc ctg gac agc ttt ggg acc tat gcg ctc 2074 Pro Phe Ala Cys Val Leu Leu Asp Ser Phe Gly Thr Tyr Ala Leu 660 665 670 act gga gag cca atc aca gac tgt gcc gtg aag caa ctg aag gtg gcg 2122 Thr Gly Glu Pro Ile Thr Asp Cys Ala Val Lys Gln Leu Lys Val Ala 675 680 685 gtt ttt ggc tgc atg tcc tgt aac tcc ctg gat tac aac ttg aga gtt 2170 Val Phe Gly Cys Met Ser Cys Asn Ser Leu Asp Tyr Asn Leu Arg Val 690 695 700 705 tac tgt gtg gac aat acc cct tgt gca tt cag gaa gt tca gat 2218 Tyr Cys Val Asp Asn Thr Pro Cys Ala Phe Gln Glu Val Val Ser Asp 710 715 720 gaa agg cat caa ggt gga cag ctc ctg gaa gaa cca aaa ttg ctg cat 2266 Glu Arg His Gln Gly Gly Gln Leu Leu Gl u Glu Pro Lys Leu Leu His 725 730 735 ttc aaa ggg aat acc ttt agt ctt cag att tct gtc ctt gat att ccc 2314 Phe Lys Gly Asn Thr Phe Ser Leu Gln Ile Ser Val Leu Asp Ile Pro 740 745 750 750 cca ttc ctc tgg aga att aaa cca ttc act gcc tgc cag gaa gtc ccg 2362 Pro Phe Leu Trp Arg Ile Lys Pro Phe Thr Ala Cys Gln Glu Val Pro 755 760 765 ttc tcc cgc gtg tgg tgc agt aac cgg cag ccc ctg cac tgt Ser Arg Val Trp Cys Ser Asn Arg Gln Pro Leu His Cys Ala Phe 770 775 780 785 tcc ctg gag cgt tat acg ccc act acc acc cag ctg tcc tgc aaa atc 2458 Ser Leu Glu Arg Tyr Thr Pro Thr Thr Thr Gln Leu Ser Cys Lys Ile 790 795 800 tgc att cgg cag ctc aaa ggc cat gaa cag atc ctc caa gtg cag aca 2506 Cys Ile Arg Gln Leu Lys Gly His Glu Gln Ile Leu Gln Val Gln Thr 805 810 815 tca atc cta gag agt gacac atc act ttc ttc gca caa gag 2554 Ser Ile Leu Glu Ser Glu Arg Glu Thr Ile Thr Phe Phe Ala Gln Glu 820 825 830 gac agc act ttc cct gca cag act ggc ccc aaa gcc ttc aaa att ccc 2602 Asp Ser Thr Phe Pro Ala Gln Thr Gly Pro Lys Ala Phe Lys Ile Pro 835 840 845 tac tcc atc aga cag cgg att tgt gct aca ttt gat acc ccc aat gcc 2650 Tyr Ser Ile Arg Gln Arg Ile Cys Ala Thr Phe Asp Thr Pro Asn Ala 850 855 855 860 865 aaa ggc aag gac tgg cag atg tta gca cag aaa aac agc atc aac agg 2698 Lys Gly Lys Asp Trp Gln Met Leu Ala Gln Lys Asn Ser Ile Asn Arg 870 875 880 aat tta tct tat ttc gct aca cagt ag cc gtc att ttg 2746 Asn Leu Ser Tyr Phe Ala Thr Gln Ser Ser Pro Ser Ala Val Ile Leu 885 890 895 aac ctg tgg gaa gct cgt cat cag cat gat ggt gat ctt gac tcc ctg 2794 Asn Leu Trp Glu Ala Arg His Gln His Asp Gly Asp Leu Asp Ser Leu 900 905 910 gcc tgt gcc ctt gaa gag att ggg agg aca cac acg aaa ctc tca aac 2842 Ala Cys Ala Leu Glu Glu Ile Gly Arg Thr His Thr Lys Leu Ser Asn 915 920 925 att tca gaa tcc cag ctt gat gaa gcc gac ttc aac tac agc agg caa 2890 Ile Ser Glu Ser Gln Leu Asp Glu Ala Asp Phe Asn Tyr Ser Arg Gln 930 935 940 945 aat gga ctc tagtccactt cctcccatga gacagagtga tggccagctt 2939 Asn Gly Leu ggggacattt gctttaaatg ggaaagaggc cgctttctgc ccagtggcgt tgggggaatt 2999 cagccttcat ttataatcag tgagattccc ctgttgaaga aactaaattt tatataggta 3059 aaacatgtta atagggaaga gtacaagctc tcttacatat aagagggctc tactatctcc 3119 ttggaatcca catttgggtt aactcctcag atttggagtg gcaaggataa aagtgagggc 3179 agaagtagct gtgggaaaag atgagctatg ataatgctgg gaaggcagag attgattaag 3239 tgcatgcttt gaaataggtt tttaatgatg tgccccaaag ggccagctga ttctggtact 3299 agattgtcag agttttctac caactggcat ctgtgatgtc agagatcatt gtaaaaatgg 3359 cttttagacg tgaaacaggg ttgccaaccc atttgtatga cttcaacaac gtcaaggagg 3419 gcatttagaa tttagaatct gagcacatca caccagcacc agctccctgt ctcttctagc 3479 cacttaatgg agacacaatg gagaggtaag acagaccaca aactagttct tatagtgtac 3539 tccacctttt acttttttcc tgagacaaat ctacccttat tctttcttcc tcttccttac 3599 cccttgcagt agggaggtat caaggagcat aattaaactt gtcaatacgg aaagttgttt 3659 tttctaacac aacaaagtgg gaccatctct attcccatct aagccactca aattgctgag 3719 tgctattaga acacagctta ttacatggat atggggacag gagagattaa agcaggttca 377 9 aaaacacatg aactgcagat gccataggcc tcaaatcagc tgtaattcta ggagacacgt 3839 gttgatctag ttatctaaca ttgttgttat aagaaaatga gtttactgca tttttcaatc 3899 cagattcttg aaattgtcta acatgtgggt actgtgtcat cacaaaatct ctcagtaagg 3959 ctatatgtga tcctcatttt gcctcttggg aaattagcag atagtctttg ctctaaatga 4019 tatctgagta aatagacttg aggaatcctc taccacagtg tccctgaaac cacatgcatc 4079 attcaggaag ccttcaccct gtgactattc agcctccctg aatatgcttt ctctatagaa 4139 ccactaacat atggctattg ctctatgatt tttttttttt acattaggag gcagtgatat 4199 tgtggaagat tgaaatccac agataattca tgaccctcat cttatcactt tactccatct 4259 ttttatccta ttaaattatt tttgacaaga tgtcctggta gactaaaggt gaacagattt 4319 gctcttgctc atcttctggt ggatatttta acttgctatt cacaatcagg acaaccaaag 4379 tcaaggaccc agatgaacca caaggcagct agtcagctac ttagaggttg gttacattcg 4439 aataaaaagt agtcagggaa tgggggaggt ggggagttgg ggagtacttg gcagttggga 4499 tatgatccat ttttttaaac aagttttttg tagatccctt gtaaaataat aataataatg 4559 ttgtgaatct ccatgccaag tgaaaaaggc ctaaagatga gttgaatttg tgataccatg 4619 ggta aggcat ggaagaactc ttgaatgtgt tggccatttt ctctaactaa catgtggtat 4679 gtatggtccc ctatattaga tagaagtctt tgctacatgt aattcaaaag catctcgctt 4739 ttctcaggaa ccaaaggctt atgatgtagg acaaagaaat catcttagaa ctgtcaagca 4799 tattttcaca ataccatgtc aagatcagga aaacaccctt ttgctagtgt gcttaactta 4859 tttatttctt ctaggaaaca atagataaac agcatgaaaa tgtaaatcat ctggcatcac 4919 tgatagaatt tctgaaagag aaagagaagt agatggtcaa ccagtcacta gttggttggc 4979 atgaggtggt gtgcagagga aagctgcatt cactattgag taaaaacttg tagaaagcac 5039 attatagagc ttatgttgga atccatcttg gaggattttt gttttaaact gtctttagca 5099 ttttccctct tcccttctaa tgggcattat aattgtttca tctactctgt gaatctacat 5159 aggtcttttt ttttagatgt ttgatacatt ttaagtattt ttaaatagat gaaaattcta 5219 aatgattttc cctcaaatct atctagatta ttttaagatg agacaagatt attgtcaatc 5279 cctgaatgtc tggagttacc tcccatggat ttttttttcc tttggcctgg gttttataaa 5339 caacttgaac atcatatcat ataggataac aaaggaggaa gttaacttaa ttcacctcag 5399 acttcagcct aagattcaat caaattcatc cttcagcctg tcttgtttct tctttatgtt 5459 tcttttactt attgctgcta ggatcctaca taggatttct atagaaatgt atgaaattct 5519 gtggtcactg catgtcagga ttgcacagta tgttacaata caatttcaaa gagaacccac 5579 atttgtgaga tttacagacc aaggtgtggt ggaggaggta gaattgcaga tcagataaaa 5639 agtgagctta cacttgaact tagttattca ctgtgaccta aatttagtcc tattgtaata 5699 tgtgcctgtc acaacacaaa tacccctctt gaaagagatt tactcatcta tccaagcact 5759 taatttggaa attttattgt cctattgcaa aatgaaacaa aattaaaagt ggcctcgagt 5819 acttggtaag ttacttaaaa tttttacaaa aatatcccac tcaatgccaa atctttcagt 5879 cctcaaaggc atttaagtcc aatagtcatg ctttaaatat ggctttaaat tatgccacca 5939 aaatggtgca cttcacagat tcaccagact gtagcatcat aaagttaatt tacagttttt 5999 acaacattgc ttctacattc ttactggttt acattaaaat cctttaagcc aaaaggaagc 6059 ttgctctatg gatttaaatg caaacttcat ttaccagtgc aggaagtctc ataaaactca 6119 gatgtactcc cacaaaaatt ttattggcct ttttgtaaga gatgaaaaag aattgacaca 6179 gttctcttta aagagaagaa cttttttatt attattttta tctccaactg caggtggtgt 6239 cttttgccaa ggtctctgta tttttctttc agttgtcttt gggaggggat gttaagtcaa 6299 atcactaaaa caggg ttctc tttggattaa aagttctgga tttattgcaa ctattttcct 6359 tgagaaacat tctcagcatc aggattgata aacaaatgta gatgattaaa ataggataat 6419 tggttttaga taatatcttc tactgccaaa cttctggcaa atttacctgt gaatttcaaa 6479 atgttataaa atctcttgat atgcttttgt ttttcctttt agccattttc tcttcaattt 6539 cttagtccct ctgccctctg taaatgtgtt gagtgatata gctatcagat gtattgaagg 6599 caaagttctc gcagaggtct ctgttccagc tctgtaaagg tcacaggaat cgtgaaggag 6659 ctgagaaatc ttcctctccg gcccactgtc tgtggcccat tgtcattgtt tcctcatgaa 6719 acattgcaga gtttgaatcc tcagtaactc tcattgactg gattagaggt gatggccaca 6779 gcaaatggga gagcaaaatg ttggcctaca gagaatgaca caattttatt cgcctttggt 6839 gttagttgcc atagtgctgt atttgaaaat cgatgcttta gccaaaagct gaatgaccac 6899 cgtttccgta gtttccactg ttttgtctgc atagaatttt cctgaactac aagcaaaaat 6959 gtattttgtc caatgtcaca aaagtgaaaa tgttactaat ctt 7002 <210> 2 <211> 948 <212> PRT <213> Homo sapiens <400> 2 Met Ile Leu Val Leu Val Lys Ala Leu Ser Asp Val Cys Ala Gly Thr 1 5 10 15 Ser Gly Phe Leu Leu Asp Phe Ser Ser Gln Thr Ser Pro G ly Thr Asp 20 25 30 Asn Gly Glu Ala Leu Pro Glu Ser Ile Pro Ser Ala Pro Gly Thr Leu 35 40 45 Pro His Phe Ile Glu Glu Pro Asp Asp Ala Tyr Ile Ile Lys Ser Asn 50 55 60 Pro Ile Ala Leu Arg Cys Lys Ala Arg Pro Ala Met Gln Ile Phe Phe 65 70 75 80 Lys Cys Asn Gly Glu Trp Val His Gln Asn Glu His Val Ser Glu Glu 85 90 95 Thr Leu Asp Glu Ser Ser Gly Leu Lys Val Arg Glu Val Phe Ile Asn 100 105 110 Val Thr Arg Gln Gln Val Glu Asp Phe His Gly Pro Glu Asp Tyr Trp 115 120 125 Cys Gln Cys Val Ala Trp Ser His Leu Gly Thr Ser Lys Ser Arg Lys 130 135 140 Ala Ser Val Arg Ile Ala Tyr Leu Arg Lys Asn Phe Glu Gln Asp Pro 145 150 155 160 Gln Gly Arg Glu Val Pro Ile Glu Gly Met Ile Val Leu His Cys Arg 165 170 175 Pro Pro Glu Gly Val Pro Ala Ala Gla Val Glu Trp Leu Lys Asn Glu 180 185 190 Glu Pro Ile Asp Ser Glu Gln Asp Glu Asn Ile Asp Thr Arg Ala Asp 195 200 205 His Asn Leu Ile Ile Arg Gln Ala Arg Leu Ser Asp Ser Gly Asn Tyr 210 215 220 Thr Cys Met Ala Ala Asn Ile Val Ala Lys Arg Arg Ser Leu Ser Ala 225 230 2 35 240 Thr Val Val Val Tyr Val Asn Gly Gly Trp Ser Ser Trp Thr Glu Trp 245 250 255 Ser Ala Cys Asn Val Arg Cys Gly Arg Gly Trp Gln Lys Arg Ser Arg 260 265 270 270 Thr Cys Thr Asn Pro Ala Pro Leu Asn Gly Gly Ala Phe Cys Glu Gly 275 280 285 285 Met Ser Val Gln Lys Ile Thr Cys Thr Ser Leu Cys Pro Val Asp Gly 290 295 300 Ser Trp Glu Val Trp Ser Glu Trp Ser Val Cys Ser Pro Glu Cys Glu 305 310 315 320 His Leu Arg Ile Arg Glu Cys Thr Ala Pro Pro Pro Arg Asn Gly Gly 325 330 335 Lys Phe Cys Glu Gly Leu Ser Gln Glu Ser Glu Asn Cys Thr Asp Gly 340 345 350 Leu Cys Ile Leu Asp Lys Lys Pro Leu His Glu Ile Lys Pro Gln Ser 355 360 365 Ile Glu Asn Ala Ser Asp Ile Ala Leu Tyr Ser Gly Leu Gly Ala Ala 370 375 380 Val Val Ala Val Ala Val Leu Val Ile Gly Val Thr Leu Tyr Arg Arg 385 390 395 400 400 Ser Gln Ser Asp Tyr Gly Val Asp Val Ile Asp Ser Ser Ala Leu Thr 405 410 415 Gly Gly Phe Gln Thr Phe Asn Phe Lys Thr Val Arg Gln Gly Asn Ser 420 425 430 Leu Leu Leu Asn Ser Ala Met Gln Pro Asp Leu Thr Val Ser Arg Thr 435 440 Four 45 Tyr Ser Gly Pro Ile Cys Leu Gln Asp Pro Leu Asp Lys Glu Leu Met 450 455 460 Thr Glu Ser Ser Leu Phe Asn Pro Leu Ser Asp Ile Lys Val Lys Val 465 470 475 480 480 Gln Ser Ser Phe Met Val Ser Leu Gly Val Ser Glu Arg Ala Glu Tyr 485 490 495 His Gly Lys Asn His Ser Arg Thr Phe Pro His Gly Asn Asn His Ser 500 505 510 Phe Ser Thr Met His Pro Arg Asn Lys Met Pro Tyr Ile Gln Asn Leu 515 520 525 Ser Ser Leu Pro Thr Arg Thr Glu Leu Arg Thr Thr Gly Val Phe Gly 530 535 540 His Leu Gly Gly Arg Leu Val Met Pro Asn Thr Gly Val Ser Leu Leu 545 550 555 560 Ile Pro His Gly Ala Ile Pro Glu Glu Asn Ser Trp Glu Ile Tyr Met 565 570 575 Ser Ile Asn Gln Gly Glu Pro Ser Leu Gln Ser Asp Gly Ser Glu Val 580 585 590 Leu Leu Ser Pro Glu Val Thr Cys Gly Pro Pro Asp Met Ile Val Thr 595 600 605 Thr Pro Phe Ala Leu Thr Ile Pro His Cys Ala Asp Val Ser Ser Glu 610 615 620 620 His Trp Asn Ile His Leu Lys Lys Arg Thr Gln Gln Gly Lys Trp Glu 625 630 635 640 Glu Val Met Ser Val Glu Asp Glu Ser Thr Ser Cys Tyr Cys Leu Leu 645 650 6 55 Asp Pro Phe Ala Cys His Val Leu Leu Asp Ser Phe Gly Thr Tyr Ala 660 665 670 Leu Thr Gly Glu Pro Ile Thr Asp Cys Ala Val Lys Gln Leu Lys Val 675 680 685 Ala Val Phe Gly Cys Met Ser Cys Asn Ser Leu Asp Tyr Asn Leu Arg 690 695 700 Val Tyr Cys Val Asp Asn Thr Pro Cys Ala Phe Gln Glu Val Val Ser 705 710 715 720 720 Asp Glu Arg His Gln Gly Gly Gln Leu Leu Glu Glu Pro Lys Leu Leu 725 730 735 His Phe Lys Gly Asn Thr Phe Ser Leu Gln Ile Ser Val Leu Asp Ile 740 745 750 Pro Pro Phe Leu Trp Arg Ile Lys Pro Phe Thr Ala Cys Gln Glu Val 755 760 765 Pro Phe Ser Arg Val Trp Cys Ser Asn Arg Gln Pro Leu His Cys Ala 770 775 780 Phe Ser Leu Glu Arg Tyr Thr Pro Thr Thr Thr Gln Leu Ser Cys Lys 785 790 795 800 Ile Cys Ile Arg Gln Leu Lys Gly His Glu Gln Ile Leu Gln Val Gln 805 810 815 Thr Ser Ile Leu Glu Ser Glu Arg Glu Thr Ile Thr Phe Phe Ala Gln 820 825 830 Glu Asp Ser Thr Phe Pro Ala Gln Thr Gly Pro Lys Ala Phe Lys Ile 835 840 845 Pro Tyr Ser Ile Arg Gln Arg Ile Cys Ala Thr Phe Asp Thr Pro Asn 850 855 860 A la Lys Gly Lys Asp Trp Gln Met Leu Ala Gln Lys Asn Ser Ile Asn 865 870 875 880 Arg Asn Leu Ser Tyr Phe Ala Thr Gln Ser Ser Pro Ser Ala Val Ile 885 890 895 895 Leu Asn Leu Trp Glu Ala Arg His Gln His Asp Gly Asp Leu Asp Ser 900 905 910 Leu Ala Cys Ala Leu Glu Glu Ile Gly Arg Thr His Thr Lys Leu Ser 915 920 925 Asn Ile Ser Glu Ser Gln Leu Asp Glu Ala Asp Phe Asn Tyr Ser Arg 930 935 940 Gln Asn Gly L
945

 ──────────────────────────────────────────────────続 き Continuing from the front page (72) Inventor: Manabu Nakayama 1532-3 Yana, Kisarazu-shi, Chiba Prefecture Inside Kazusa DeNA Institute (72) Inventor: Daisuke Nakajima 1532-3, Yana, Kisarazu-shi, Chiba Foundation F-term (reference) in Kazusa DeNA Research Laboratories 4B024 AA01 AA11 BA63 CA04 CA20 DA06 EA04 4H045 AA10 BA10 CA40 DA50 EA20 EA50 FA74

Claims (3)

[Claims] 1. A gene encoding the following protein (a) or (b): (a) a protein consisting of an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 2, (b) In the amino acid sequence represented by SEQ ID NO: 2,
A protein comprising an amino acid sequence in which some amino acids have been deleted, substituted or added, and having substantially the same biological activity as the protein encoded by the mammalian unc gene family. 2. A gene consisting of the following DNA (a) or (b): (a) consisting of a nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 2 in the nucleotide sequence represented by SEQ ID NO: 1 DNA, (b) a DNA that hybridizes with the DNA of (a) under stringent conditions and encodes a protein having substantially the same biological activity as the protein encoded by the mammalian unc gene. 3. A recombinant protein of the following (a) or (b): (a) a protein consisting of an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 2, (b) SEQ ID NO: : In the amino acid sequence represented by 2,
A protein comprising an amino acid sequence in which some amino acids have been deleted, substituted or added, and having substantially the same biological activity as the protein encoded by the mammalian unc gene family.