JP2004313194A - Composition and method for genetic analysis of polycystic kidney disease - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for testing a gene for identifying a gene alteration relating to autosomal dominant polycystic kidney (ADPKD) or for identifying the absence of such gene alteration. <P>SOLUTION: This invention relates to nucleic acid sequences for detection of mutation in a PKD-1 or PKD-2 gene, as well as biomarkers for ADPKD. The invention further relates to methods for diagnosing ADPKD in an individual, and kits for performing the method of the invention. The invention also provides a method for determining the presence or absence of a mutant PKD gene in an individual. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

[Related application]
The present invention claims the benefit of US Provisional Patent Application No. 60 / 328,739, filed October 12, 2001, and US patent application Ser. No. 10 / 083,246, filed February 26, 2002. (The entire disclosure of which is incorporated herein by reference).

[Field of the Invention]
The present invention relates to genetic testing methods for identifying changes in genes associated with autosomal dominant polycystic kidney disease or the absence of such changes.

  Autosomal dominant polycystic kidney disease (ADPKD) is a very common hereditary kidney disease that affects approximately 1 in 800 live births. The disease is progressive, characterized by bilateral spread of polycystic kidney disease and typically results in end-stage renal disease (ESRD) at age 65. More common complications include hypertension, gross hematuria, ureteral infection, heart valve abnormalities, and anterior abdominal wall hernia. Cyst formation is also commonly found in the liver, but its onset is not related to organ dysfunction. Less commonly reported extrarenal manifestations include cystic pancreatic disease, connective tissue abnormalities, and cerebral aneurysms.

  The typical age of onset is middle age, but the age range is from neonates to 80 years. The clinical manifestations of ADPKD vary between and within families and are partially explained by the genetically distinct nature of the disorder. Mutations in the two genes PKD-1 and PKD-2 are observed in almost all ADPKD cases (eg, for review, see Arnaout, 2001, Annu Rev. Med., 52, 93-123; Koptides and Deltas, 2000). , Hum.Genet., 107, 115-126). PKD-1 and PKD-2 encode integral membrane proteins whose function has not been fully elucidated. The major gene responsible for ADPKD, PKD-1, has been fully characterized and has been shown to encode an integral membrane protein, polycystin 1, which is thought to be involved in cell-cell and cell-substrate interactions. The PKD-2 gene encodes polycystin 2, an integral membrane protein that is predicted to have nonselective cation channel activity. Based on sequence homology to the α1 subunit component of voltage-activated calcium channels, it has been postulated that polycystin 2 may play a role in ion channeling. Using in vitro binding assays and directed two hybrid interactions, the C-terminal cytoplasmic tails of polycystin 1 and polycystin 2 have been found to interact. Interactions occur through the coiled-coil domain in PKD-1 and the region near R872 in PKD-2. Although the biological relevance of the interaction between polycystins is not yet understood, it has been suggested that PKD-1 and PKD-2 probably function along a common pathway.

  ADPKD types 1 and 2 share the entire renal and extrarenal range of onset, while type 2 appears to be delayed in onset compared to type 1. Common phenotypic complications observed with ADPKD, including hypertension, hematuria, and urinary tract infection, appear to be clinically mild in type 2 patients. The median age of death or onset of ESRD is reported to be 53 years for individuals with PKD-1 and 69 years for individuals with PKD-2. Women are reported to have a significantly longer median survival (71 years) than men (67 years). The effect of gender is not clear in PKD-1. Mutations in the PKD-1 gene are responsible for the pathogenesis of ADPKD in about 85% of the cases tested and 15% in PKD-2. Although a small subset of the ADPKD family could not demonstrate a genetic association with either PKD-1 or PKD-2, the potential for a third gene of ADPKD arose, leading to a third disease-associated The presence of the locus has been closely investigated.

  Despite the discovery of a strong association between alterations in the PKD gene and the development of ADPKD, the development of routine clinical genetic testing for ADPKD predisposition has been hampered by several technical obstacles. Hindered.

  One serious obstacle in the development of DNA-based assays for ADPKD is that sequences associated with PKD transcripts (eg, PKD-1) have been identified at least three times on chromosome 16 adjacent to the PKD-1 locus. Overlapping to form a PKD-1 homolog. Another obstacle is that the PKD-1 genomic section also contains repeating elements that are present in other genomic regions. In addition, the sequence of the PKD gene is very GC rich, requiring analysis of a large number of nucleotides (15,816 bp) for complete evolution.

  There is a need to identify segments of these sequences that are unique to the expressed PKD gene and are not present in overlapping homologous sequences. There is also a need to develop sensitive and specific genetic tests for mutation analysis of the PKD gene. The development of such a test facilitates the diagnosis and management of ADPKD.

In one aspect, the present invention relates to a method for analyzing mutations of a target nucleic acid, wherein the method comprises:
Incubating a sample containing said target nucleic acid in a reaction mixture in the presence of at least one first nucleic acid and at least one second nucleic acid, wherein said first nucleic acid has the sequence of SEQ ID NO: 1 or 2 A primer sequence that anneals to a unique site of the second nucleic acid, wherein the second nucleic acid is in the opposite direction to the first nucleic acid, and the incubation produces an amplification product;
Creating a duplex in the amplification product;
Detecting the presence or absence of a heteroduplex from the duplex, wherein the presence of the heteroduplex indicates the presence of a potential mutation in the target nucleic acid, The presence provides a method of indicating the absence of a mutation in the target nucleic acid.

  In one embodiment, the method further comprises determining the sequence of the heteroduplex region, and comparing the sequence of the heteroduplex region to SEQ ID NO: 1 or 2, wherein the target nucleic acid A difference in the sequence of the heteroduplex region as compared with SEQ ID NO: 1 or 2 in which a functional change of the protein encoded by SEQ ID NO: 1 is expected is an indicator of the mutation of the target nucleic acid.

  Preferably, the first or second nucleic acid comprises a sequence selected from the group consisting of SEQ ID NOs: 3-49.

  In another embodiment, the method comprises performing a nested amplification reaction using the amplification product produced by the first and second nucleic acids as a template; and amplifying from the nested amplification. Creating a duplex in the product.

  Preferably, the nested amplification reaction is performed using at least one primer selected from the group consisting of SEQ ID NOs: 3-49 and the complement thereof.

  In a preferred embodiment, the presence or absence of a heteroduplex from the duplex is identified by DHPLC.

In a preferred embodiment, the sequence of the heteroduplex region is determined by DNA sequencing.
Preferably, the second nucleic acid of the method of the invention comprises a primer sequence that anneals to a unique site within the sequence of SEQ ID NO: 1 or 2.

  Preferably, the sample containing the target template is selected from the group consisting of genomic DNA, cDNA, total RNA, mRNA, and a cell sample.

  In one embodiment, the incubation step comprises an amplification reaction selected from the group consisting of polymerase chain reaction, ligase chain reaction (LCR), and nucleic acid specificity based amplification.

  The method of the present invention may further comprise the step of using one or more restriction enzymes to confirm whether the amplification product is a PKD-specific product.

  Preferably, the restriction enzyme cleaves the PKD-specific product to obtain a digestion pattern that is distinguishable from the PKD homolog product.

  More preferably, the restriction enzyme is selected from the group consisting of PstI, StuI, XmaI, MluI, PvuII, BssHII, FspI, MscI, and BlnI.

In another aspect, the present invention is a diagnostic method for identifying a patient with PKD, said method comprising:
(A) obtaining a sample from an individual;
(B) incubating said sample in a reaction mixture in the presence of at least one first nucleic acid and at least one second nucleic acid, wherein said first nucleic acid is a unique nucleic acid in SEQ ID NO: 1 or 2 Wherein the second nucleic acid is in the opposite direction to the first nucleic acid, and the incubation produces an amplification product;
(C) creating a duplex in the amplification product;
(D) detecting the presence or absence of the heteroduplex derived from the duplex;
(E) determining the sequence of the heteroduplex region, wherein the presence of the heteroduplex region as compared to SEQ ID NO: 1 or 2 indicates that the individual has PKD. I will provide a.

  Preferably, the detection of the heteroduplex is performed by DHPLC.

  Preferably, the sequence is determined by DNA sequencing.

  In one embodiment, the second nucleic acid comprises a primer sequence that anneals to a unique site in the sequence of SEQ ID NO: 1 or 2.

  In another embodiment, the first or second nucleic acid comprises a primer sequence selected from the group consisting of SEQ ID NOs: 3-49.

  The diagnostic method of the present invention comprises the steps of: performing a nested amplification reaction using the amplification products produced by the first and second nucleic acids as a template; and producing a double strand derived from the nested amplification. And may further include

  In one embodiment, the nested amplification reaction is performed using at least one primer selected from the group consisting of SEQ ID NOs: 3-49 and the complement thereof.

  Preferably, the sample in the diagnostic method is selected from the group consisting of genomic DNA, cDNA, total RNA, mRNA, and cells.

  Preferably, the amplification reaction comprises an amplification reaction selected from the group consisting of polymerase chain reaction, ligase chain reaction (LCR), and nucleic acid specificity based amplification.

  The diagnostic method may further comprise the step of demonstrating the specifically amplified product using one or more restriction enzymes.

  Preferably, the restriction enzyme cleaves the PKD-specific product to obtain a digestion pattern that is distinguishable from the PKD homolog product.

  More preferably, the restriction enzyme is selected from the group consisting of PstI, StuI, XmaI, MluI, PvuII, BssHII, FspI, MscI, and BlnI.

  In a further aspect, the present invention provides one or more nucleic acid primers, wherein each primer is an isolated nucleic acid selected from the group consisting of SEQ ID NOs: 3-49 or the complement thereof.

  The invention also provides a nucleic acid pair, wherein at least one nucleic acid of the pair is selected from the group consisting of SEQ ID NOs: 3-49.

  Preferably, the nucleic acid pairs are in the reverse orientation and amplify a fragment of the template nucleic acid comprising the sequence of SEQ ID NO: 1 or 2.

  In another aspect, the invention provides that the first nucleic acid is selected from the group consisting of SEQ ID NOs: 3-49 and the complementary sequence thereof, wherein the second strand is in the opposite direction to the first nucleic acid, The two nucleic acids provide a composition comprising at least one isolated first nucleic acid and at least one isolated second nucleic acid that amplifies a fragment of a template nucleic acid comprising the sequence of SEQ ID NO: 1 or 2.

  In one embodiment, the component of the invention comprises at least one selected from the group consisting of a DNA polymerase, a template nucleic acid, a restriction enzyme, one or more control oligonucleotide primers, a ddNTP, a PCR reaction buffer, and combinations thereof. It further contains one component.

  Preferably, the template nucleic acid in the composition is genomic DNA or cDNA.

  In a further aspect, the invention provides that the first nucleic acid is selected from the group consisting of SEQ ID NOs: 1-49 and its complementary sequence, wherein the second strand is in the opposite direction to the first nucleic acid, PKD comprising at least one isolated first nucleic acid and at least one isolated second nucleic acid, and an encapsulating material thereof, which amplifies a fragment of the template nucleic acid comprising the sequence of SEQ ID NO: 1 or 2. A kit for identifying a patient is provided.

  In one embodiment, the kit of the present invention further comprises at least one component selected from the group consisting of DNA polymerase, template nucleic acid, restriction enzyme, control oligonucleotide primer, ddNTP, PCR reaction buffer, and a combination thereof. .

  Preferably, the template nucleic acid in the kit is a genomic DNA or cDNA molecule.

  The present invention provides an isolated nucleic acid comprising a sequence selected from the group consisting of SEQ ID NOs: 3-49 and its complementary sequence.

  The present invention provides nucleic acid biomarkers for ADPKD comprising a PKD-1 or PKD-2 nucleic acid sequence comprising one or more of the nucleotide changes disclosed in FIG.

  In one embodiment, at least one of the one or more nucleotide changes consists of a novel nucleotide change disclosed in FIG.

  The present invention also provides nucleic acid biomarkers for ADPKD, comprising a PKD-1 or PKD-2 nucleic acid sequence comprising one or more of the novel nucleotide changes disclosed in FIG.

  The present invention provides a polypeptide biomarker for ADPKD comprising a PKD-1 or PKD-2 polypeptide sequence comprising one or more amino acid changes disclosed in FIG.

  In one embodiment, at least one of the one or more amino acid changes consists of a novel amino acid change disclosed in FIG.

  The present invention provides a polypeptide biomarker for ADPKD comprising a PKD-1 or PKD-2 polypeptide sequence comprising one or more of the novel amino acid changes disclosed in FIG.

  The invention further comprises the step of identifying the nucleotide sequence of the individual's PKD-1 or PKD-2 gene, wherein one or more of the nucleotide sequences of the PKD-1 or PKD-2 gene disclosed in FIG. A method of diagnosing ADPKD in an individual is provided, wherein the presence of a nucleotide sequence change indicates ADPKD in said individual.

The present invention further provides a method for determining the presence or absence of a mutant PKD gene in an individual,
a) identifying the nucleotide sequence of the PKD-1 or PKD-2 gene of said individual;
b) comparing the nucleotide sequence of step a) with a nucleotide sequence change in the nucleotide sequence of the PKD-1 or PKD-2 gene disclosed in FIG.
c) detecting the presence of one or more nucleotide sequence changes disclosed in FIG.
A method is provided wherein the presence of at least one nucleotide sequence change is indicative of ADPKD in the individual and the absence of any nucleotide sequence change is indicative of the absence of said mutated PKD-1 and / or PKD-2 gene.

  In one embodiment, the method of diagnosing ADPKD and / or determining the presence or absence of a mutated PKD gene further comprises obtaining a DNA sample from the individual for identification of the nucleotide sequence of the PKD-1 or PKD-2 gene.

  Preferably, the obtained DNA sample is a genomic DNA sample or a cDNA sample.

  In another embodiment, the method of diagnosing ADPKD and / or determining the presence or absence of a mutated PKD gene further comprises amplifying a portion of the PKD-1 or PKD-2 gene from the DNA sample prior to identification.

  Preferably, a part of the PKD-1 or PKD-2 gene is amplified by the polymerase chain reaction.

  Also preferably, the nucleic acid sequence is identified by DNA sequencing.

  More preferably, DNA sequencing is performed using an isolated nucleic acid comprising a sequence selected from the group consisting of SEQ ID NOs: 3-49 and the complement thereof.

  In one embodiment, at least one or more of the at least one or more nucleotide changes consists of the novel nucleotide changes disclosed in FIG.

  The objects and features of the present invention may be better understood with reference to the following detailed description and accompanying drawings.

  The present invention is based on the identification of unique sites within the PKD gene, the design of PKD-specific primers, and the DHPLC analysis of PCR products amplified by the use of these PKD-specific primers.

I. Definitions As used herein, "ADPKD" refers to autosomal dominant polycystic kidney disease. ADPKD is a very common hereditary kidney disease that is characterized by the development of renal cysts, ultimately renal failure, or in addition to cysts in other organs including the liver and kidneys and the gastrointestinal tract. , Cardiovascular, and skeletal muscle abnormalities.

  The term “PKD gene” refers to a genomic DNA sequence that maps to chromosomal site 16p13.3 (ie, PKD-1) or chromosomal site 4q21-23 (ie, PKD-2) and is a messenger RNA molecule that encodes a PKD protein. Is obtained. The PKD-1 and PKD-2 genes include the sequences of SEQ ID NO: 1 and SEQ ID NO: 2, respectively, including introns and putative regulatory sequences. Like many other genes, PKD-1 and PKD-2 gene sequences show sequence variability when compared between individuals. Those genes that have a polymorphism that are silent (ie, with respect to gene expression or function of the gene product) are defined herein as "normal."

  A “normal” PKD gene (eg, PKD-1 or PKD-2) is defined herein as a PKD gene (such as that set forth in SEQ ID NO: 1 or 2) and any gene having a silent polymorphism. Is included.

  A "mutated" PKD gene is defined herein as having one or more substitutions (transitions, transversions), deletions (including loci deletions), insertions (including duplications), translocations, And / or a PKD gene that has been modified with a mutation that includes other modifications compared to a normal PKD gene (eg, PKD-1 or PKD-2). The mutation causes a detectable change in the expression or function of the PKD gene product, which is responsible for ADPKD. Mutations can include from one to thousands of nucleotides, resulting in altered (eg, decreased or increased) expression of one or more of the various PKDs or expression of a defective RNA transcript or protein product. Can be Mutant PKD genes include genes in which the presence of one or more copies in the genome of a human individual is associated with ADPKD.

  As used herein, a “biomarker” is a biomolecule capable of detecting its presence or concentration and correlating it with a known condition such as a condition (eg, polycystic kidney disease, especially ADPKD). (Eg, nucleic acids or polypeptides or peptides).

  A “nucleotide sequence change” or “nucleotide change” refers to one or more substitutions (transitions or transversions), deletions (including loss of loci), insertions (including duplications), translocations, and / or normal Alteration of the nucleotide sequence including other alterations related to the PKD gene.

  "Amino acid change" refers to amino acid alterations, including substitutions, frameshifts, deletions, truncations, and insertions, and / or other alterations related to the normal PKD amino acid sequence.

  The term "base pair mismatch" refers to any nucleic acid sequence that is not complementary to the sequence of SEQ ID NO: 1 or 2. Thus, base pair mismatches of the invention can be caused by alterations in the normal PKD gene or any alterations present in the polymorphism or mutant PKD gene. A “base pair mismatch” includes a nucleic acid sequence of one nucleotide base pair mismatch or two or more nucleotides (ie, 3, 4, 5, 10, 20, 100, or more than 500, or up to 1000 nucleotides). obtain. The presence or absence of a mismatch as defined herein indicates the presence or absence of a potential mutation in the target nucleic acid.

  As used herein, the term “true” refers to the genomic sequence of SEQ ID NO: 1 or 2 and sequences derived therefrom, and these true sequences are used to distinguish “PKD homologs” ( See below).

  A “PKD-1 homolog” is a sequence that is closely related to PKD-1, but does not encode an expressed PKD-1 gene product. Several examples of this homolog that map to chromosomal site 16p13.1 or 4q21-23 have been identified and sequenced. PKD-1 homologs can share more than 95% identical sequence with the true PKD gene.

  As used herein, the term “specifically amplified product” is a product that is amplified from a fragment within the true PKD gene (eg, SEQ ID NO: 1 or 2) but not from the PKD homolog. . A "non-specifically amplified product" is a product amplified from a PKD homolog or other sequence by annealing a nucleic acid primer to a template sequence that is not completely complementary in an amplification reaction.

  As used herein, "unique site" refers to a stretch of 10-50 base pairs in the PKD gene that contains at least one nucleotide that differs from the stretch in the PKD homolog sequence or other sequence. One example of a unique site includes 5'AGGTCCAGGGCGACTCGCTGG3 'or 5'CAGGGGCCACACGCGCTGGGCG3' or its complementary sequence.

  As used herein, "PKD-specific primer" refers to a nucleic acid sequence that anneals to a sequence in the PKD gene (including introns and exons) under specific stringency conditions. The PKD-specific primers of the present invention anneal to specific sites present in the true expressed PKD-1 or PKD-2 gene under specific stringency conditions, but anneal to PKD homologs or other sequences. do not do. A PKD-specific primer is more than 95% (e.g., more than 96%, 96%, 97%, 98%, 99% or 100%) identical in sequence to a unique site in the PKD gene. "PKD-specific primers" can be 10 to 60 nucleotides in length (eg, 18 to 52 nucleotides in length).

  As used herein, the term "specific stringency conditions" refers to amplification conditions under which a PKD-specific primer specifically anneals to a sequence in the PKD gene. Under "specific stringency conditions", PKD-specific primers do not anneal to PKD homologs or other sequences. For example, one specific stringency condition useful in the present invention is Taq Precision buffer (TaqPlus Precision buffer, Stratagene, La Jolla, catalog number 600210), dNTP concentrations greater than 50 nM (eg, 100 nM, 200 nM, or 300 nM). )including. Annealing temperatures under specific stringency conditions may be above, below or below 5 ° C., the lowest primer annealing temperature (Tm) (eg, 1 ° C., 2 ° C., 4 ° C., 5 ° C. below Tm). ° C, or 10 ° C higher or 4 ° C, 3 ° C, 2 ° C, or 1 ° C below the Tm).

  As used herein, "amplification" of DNA refers to a reaction used to increase the concentration of a particular DNA sequence within a DNA sequence. Amplification can be performed using the polymerase chain reaction (PCR), ligase chain reaction (LCR), nucleic acid specificity based amplification (NSBA), or any other method known in the art.

  As used herein, "RT-PCR" refers to a combination of reverse transcription and polymerase chain reaction. This amplification method uses an initial step of inducing reverse transcription of RNA into single-stranded cDNA using a mixture of specific oligonucleotides, oligo dT or random primers, and using this cDNA with standard amplification techniques ( Amplification is performed using, for example, PCR).

  A “template nucleic acid” or “target nucleic acid” (eg, genomic DNA or cDNA) is a normal (eg, wild-type) or variant that is or comprises a particular sequence (eg, a PKD-1 or PKD-2 gene sequence). It is a nucleic acid. It is understood that additional nucleotides can be added to the 5 'and / or 3' end of the disclosed sequences as part of routine recombinant DNA manipulation. In addition, conservative DNA substitutions (ie, sequence changes in the protein coding region that do not change the encoded amino acid sequence) may also be appropriate.

  As used herein, "nucleic acid primer" refers to DNA or RNA that can anneal a nucleic acid template to obtain a 3 'end for producing an extension product complementary to the nucleic acid template. The nucleic acid template catalyzes the production of a primer extension product that is complementary to the target nucleic acid template. Initiation and elongation conditions include four different deoxyribonucleosides and a polymerization inducing agent (such as DNA polymerase or reverse transcriptase), an appropriate buffer ("buffer" includes cofactors that affect pH, ionic strength, etc.). Included), and appropriate temperatures. The primer of the present invention may be single-stranded or double-stranded. Primers are single-stranded for maximum amplification efficiency and the primers and their complements form double-stranded nucleic acids. But it can be double-stranded. "Primers" useful in the present invention are no more than 100 nucleotides in length (eg, no more than 90, 80, 70, 60, 50, 40, 30, 20, or 15 nucleotides in length, or 10 nucleotides in length).

  As used herein, when the term "reverse" refers to a primer, one primer comprises the nucleotide sequence complementary to the sense strand of the target nucleic acid template, and the other primer comprises the nucleotide sequence of the same target nucleic acid template. It is meant to include a nucleotide sequence complementary to the antisense strand. Reverse primers can create a PCR amplification product from a complementary compatible nucleic acid template. The two primers having different directions can be referred to as a reverse primer and a forward primer.

  As used herein, the term "identical orientation" means that the primers contain a nucleotide sequence that is complementary to the same strand of the target nucleic acid template. Primers in the same direction will not produce a PCR amplification product from a complementary compatible nucleic acid template.

  Alternatively, the primers of the invention can be labeled with a detectable label, such as a radioactive moiety or a fluorescent label, or the labeled nucleotide can be incorporated into the reaction product by an amplification reaction. Thus, the amplification reaction product can be "detected" by "detection" with a fluorescent or radioactive label.

  As used herein, the term "nucleic acid" generally refers to a polyribonucleotide or polydeoxyribonucleotide, which can be unmodified RNA or DNA or modified RNA or DNA. "Nucleic acid" includes, but is not limited to, single-stranded and double-stranded nucleic acids. As used herein, the term "nucleic acid" also includes the above DNAs or RNAs containing one or more modified bases. Thus, DNA or RNA having a backbone that has been modified for stability or for other reasons is a "nucleic acid." As used herein, the term "nucleic acid" refers to such chemically, enzymatically, or metabolically modified forms of nucleic acids as well as viruses and cells, including, for example, simple and complex cells. And various chemical DNA and RNA forms.

  As used herein, "isolated" or "purified", when used in reference to nucleic acids, refers to conditions in which the naturally occurring sequences have been removed from the normal cellular (eg, chromosomal) environment, or under non-natural conditions. It means being synthesized under (for example, artificially synthesized). Thus, an “isolated” or “purified” sequence can be in a cell-free solution or under a different cellular environment. The term "purified" is not intended to be a sequence in which only nucleotides are present and is essentially free of non-nucleotide or nucleic acid material naturally associated with this sequence (about 90-95%, up to 99-100%). ), Intended to be distinguished from isolated chromosomes.

  As used herein, "genomic DNA" refers to chromosomal DNA as against complementary DNA copied from an RNA transcript. As used herein, "genomic DNA" can be all DNA present in one cell or a portion of DNA in one cell.

  As used herein, “complementary” refers to a single-stranded antiparallel nucleic acid of a nucleic acid (or a portion thereof) between nucleotides of a single-stranded (ie, not interrupted by any unpaired nucleotide). The ability to hybridize to a reverse nucleic acid strand (or a portion thereof) by successive base pairing to form a double-stranded nucleic acid between complementary strands. A first nucleic acid is said to be "complementary" to a second nucleic acid if each first nucleic acid forms a base pair with a nucleotide in a complementary region of the second nucleic acid. A first nucleic acid is not completely complementary to a second nucleic acid if one nucleotide of the first nucleic acid does not base pair with the corresponding nucleotide in the second nucleic acid.

  As used herein, a “sample” refers to a biological material that is isolated from a natural environment and contains a target nucleic acid and can be purified or consist of an isolated nucleic acid, or a tissue sample containing a target nucleic acid, a biological fluid. It can include a biological sample, such as an animal sample or a cell sample.

  As used herein, “double-stranded DNA” is also referred to as “duplex”. If the base sequence of one strand is completely complementary to the base sequence of the other strand, the duplex is called a “homoduplex”. If the duplex contains at least one base pair that is not complementary, the duplex is called a "heteroduplex." In the present invention, when the amplification product from a sample taken from an individual is denatured and re-annealed, formation of a heteroduplex indicates the presence of a potential mutant PKD gene in this individual.

  As used herein, "DHPLC" is used to detect sequence mutations by separating heteroduplexes (due to the presence of mutations) and homoduplexes having the same bp length. Refers to a separation process called "denaturing high performance liquid chromatography". This separation is based on the fact that heteroduplexes have a lower melting temperature (Tm) than homoduplexes. DHPLC can separate heteroduplexes that differ by only one base pair under certain conditions. DHPLC can also be used to separate duplexes of different bp lengths.

  “Heteroduplex site separation temperature,” “temperature center point,” or “Tm” is used herein to refer to one or more base pairs denatured at a base pair mismatch site in a heteroduplex DNA fragment. Defined (ie, separated).

II. General Description of PKD Gene The PKD-1 gene (eg, genBank Accession No. L3988891, SEQ ID NO: 1) is an approximately 54 kb genomic DNA present on chromosome 16 (16p13.3), into which 14 kb mRNA is transcribed. (Mochizuki et al., 1996, Science, 272, 1339-1342; Hughes et al., 1995, Nature Genet., 10, 151-160). The protein product polycystin 1 of PKD-1 is a protein consisting of 4303 amino acids with an estimated molecular weight of 460 kDa. Until recently, the analysis of the PKD-1 gene was unaffected by the presence of at least three highly homologous gene copies mapped adjacent to PKD-1 along chromosome 16 (16p13.1). Approximately 75% of the PKD-1 gene is overlapping and approximately 97% identical to its homologous copy. The reduction region includes the 50 kb (5 ') portion of the gene including the first 33 exons. Most 3 '(5.7 kb) of the gene, including exons 34-46, is unique to PKD-1. Another striking feature of the PKD-1 gene is the polypyrimidine region in intron 21, which is 2.5 kb long (longest in the human genome). The PKD-2 gene (eg, genbank accession number AF004859-004873, SEQ ID NO: 2) is a 68 kb genomic DNA and is present on chromosome 4 (4q21-23) (Mochizuki et al., 1996, supra). PKD-2 contains 15 exons and encodes a 5.4 kb transcript that produces a 968 amino acid protein product of approximately 110 kDa. Since PKD-2 is a one-copy gene, mutation analysis of PKD-2 is much easier than mutation analysis of PKD-1. See Table 1 for a summary of PKD genes and their protein products.

  Based on the evidence supporting the development of somatic mutations on the normal allele, a two-hit model similar to the pathogenesis of a number of familial cancer predisposition syndromes has described the clinical focus of disease (Qian). Watnick et al., 1998, Mol. Cell., 2, 247-251). Briefly, this model indicates that ADPKD is recessive at the cellular level and that a second somatic mutation or “hit” in a heterozygous PKD-deficient background homozygously alters PKD function in diseased tubular epithelial cells. It is suggested to be lost. Loss of PKD function is hypothesized to disrupt the signaling mechanisms required for intrinsic cell division (ie, induce abnormal growth of diseased cells in cystic structures).

  Direct sequencing of the PKD-1 gene revealed the presence of the polymorphism in normal individuals and a number of different sequence changes in ADPKD affected individuals. Table 2 shows a summary of PKD-1 sequence changes described in the literature to date.

III. Identification of Unique Sites in the PKD Gene Due to the fact that 70% of the PKD-1 gene replicates over 95% of the sequence with PKD-1 as the same non-functional homolog, the identification of the PKD-1 unique site is Important for test method development. With the successful decoding of the human genome sequence, unique sites in the PKD gene can be identified by comparing the genomic DNA sequence containing the PKD gene with the genomic DNA sequence containing the PKD homolog. Useful databases and computer programs are known in the art (eg, the databases available at the NCBI at www.ncbi.nlm.nih.gov and http://www.ncbi.nlm.nih.gov/BLAST and DNAStar). , A computer program available at www.dnastar.com). A unique site refers to a sequence in the PKD gene that is 80% or less (eg, 70%, 60%, 50%, 40%, 30%, 20%, or 10% or less) identical to a PKD homolog or other sequence. .

  Some unique sites (eg, one copy site) are described in Rossetti et al., 2000, A. et al. J. Hum. Genet. , 68, 46-63, which are incorporated herein by reference in their entirety. Applicants have identified a novel unique site for PKD-1 (5'AGGTCCAGGGCGACTCGCTGG3 'or 5'CAGGGCCAACGCGCTGGGCG3' or its complementary sequence). Other unique sites can be found, for example, in U.S. Patent Nos. 6,228,591 and 6,031,088, each of which is incorporated herein by reference in its entirety. it can.

  The identified unique sites can be used in designing PKD-specific primers for true PKD gene amplification. The length of a unique site can vary from a few nucleotides to thousands of nucleotides. Most unique sites identified contain no more than 100 nucleotides (eg, no more than 50 nucleotides or no more than 30 nucleotides). Amplification using PKD-specific primers increases the specificity of the amplification reaction and reduces by-products amplified from PKD homologs. A true PKD gene product that has been specifically amplified for cloning and / or expression for sequencing or other analysis to identify an allelic variation (eg, a mutated PKD gene) in the individual can be used.

IV. A sample for analyzing the presence or absence of a PKD-specific primer mutation useful in the present invention may contain an undetectably small amount of a substance. Thus, the first mutation detection assay step is sample amplification. The preferred amplification reaction of the present invention is PCR. PCR amplification involves steps such as primer design, DNA polymerase enzyme selection, number of amplification cycles, and reagent concentration. Each of these steps and other steps associated with the PCR process affects the purity of the amplification product. Although PCR processes and factors affecting replication fidelity and product purity are well known in the PCR art, these have previously been used to detect mutations in the PKD gene using the separation methods of the invention (eg, DHPLC). Did not address the factors.

  Any primer that anneals to the true PKD gene under specific stringency conditions but does not anneal to the PKD homolog or other sequences is a useful PKD-specific primer of the invention. The identified unique site sequence is used as a basis for designing a PKD-specific primer useful in the present invention. The primers of the present invention can be incorporated into conventional kits for identifying PKD patients.

A. Primer Selection Criteria The PKD species-specific primer preferably contains a sequence complementary to a sequence present in a unique site of the PKD gene. A PKD-specific primer can be complementary to a unique site of a normal or mutant PKD gene, as long as it is preferred to anneal to a true PKD gene other than a PKD homolog.

  PKD species-specific primers can be manually selected by analysis of the unique site sequences identified for the PKD gene. If the DNA fragment sequence to be amplified by PCR is known, commercially available software can be used to generate primers that produce the entire fragment or any sequence within the fragment. Fragment maps of the fragments can be obtained using MacMelt® (BioRad Laboratories, Hercules, Calif.), MELT (Lerman et al., Meth. Enzymol., 155, 482, 1987), or WinMelt® (BioRad Laboratories, BioRad Laboratories). Can be built using

It is known in the art that primers of about 18-25 bases in length and 50% GC content will work well at annealing temperatures of about 52-58 ° C. These properties are preferred when designing the primers of the present invention. Longer primers or primers with a higher GC content are optimally annealed at higher temperatures, as well as shorter primers or primers with a lower GC content are optimally annealed at a lower temperature. A convenient and simplified formula for obtaining an estimate of the melting temperature of primers 17-25 bases long is:
Melting temperature (Tm (° C.)) = 4 × (G number + C number) + 2 × (A number + T number).

  The entire design process consists of extensive (ie, first round PCR) and narrow range primer (ie, nested PCR) designs. In a wide range of primer designs, the goal is to design primers that produce high quality PCR products. "Good quality" PCR product is defined herein to mean that the PCR product is produced in high yield and that the amount of impurities such as primer dimers and PCR-induced mutations is low. Good PCR can also be influenced by other reaction parameters, such as the enzyme used, the number of PCR cycles, the concentration and type of buffer used, the temperature of thermal cycling, and the quality of the genomic template. Methods for producing good quality PCR products are discussed in Eckert et al. ("PCR: A Practical Approach", edited by McPherson, Quirke, and Taylor, IRL Press, Oxford, Vol. 1, 225-244, 1991). This reference and the references therein are incorporated herein by reference in their entirety.

  Narrow range primer design should meet two requirements. First, good quality PCR products should be obtained, meeting all broad primer design requirements. In addition, the DHPLC method must produce a fragment capable of detecting the mutation or polymorphism regardless of the location of the mutation or polymorphism in the amplified fragment. For example, large DNA fragments having up to several thousand base pairs can be amplified by PCR. If the purpose of amplification is only to amplify the desired fragment, the tolerance of the primer design that can be used for this purpose is great. However, when the purpose of the PCR amplification is to prepare a DNA fragment for mutation detection analysis by DHPLC, the primer is used so that the fragment prepared by the PCR method is detectable and generates a signal when analyzed by DHPL. You have to design. In a preferred embodiment of the invention, the length of the amplification product is between 150 and 600 bp. In a more preferred embodiment, the fragment length for DHPLC mutation detection analysis is 150-400 bp.

  There are two purposes in designing a narrow range of primers. One purpose of primer design is when used as a "mutation analysis" test. Another purpose is analysis for research or diagnostic purposes (identification of PKD patients). As used herein, "mutation analysis" is defined as the study or analysis of DNA fragments to identify whether a fragment contains a variation (ie, mutation or polymorphism) in a population and to link this variation to disease. I do. Within the context of the present invention, it is understood that the term “mutation” does not include polymorphisms that are silent for the disease (eg, normal). When DHPLC is used as a mutation analysis technique, an important aspect of the present invention is a method of designing primers to produce fragments that can detect putative mutations regardless of the presence of the mutation site within the fragment. . In contrast, if the mutation is known, the primer design can be further refined so that the analysis is optimized (ie, the homoduplex and heteroduplex peaks in DHPLC are maximized). The analysis can be refined by improving the analytical resolution of known mutations. Improvement of the resolution is required for application to mutation diagnosis. In addition, using the improved resolution, automated identification of the positive presence of mutations can be more easily performed by appropriate software and algorithms that superimpose and compare peaks of normal and mutant DNA samples.

  Another primer design method for application to mutation analysis is to design primers so that the region of interest is at a lower melting domain within the fragment. In this case, since the analysis is performed so as to move toward the exon, it is preferable to design the primer so that the fragment to be measured overlaps the target region. In these cases, the temperature difference between the high and low melting domains is preferably greater than 5 ° C, most preferably greater than 10 ° C.

  Once the mutation of interest is identified, diagnostic or clinical primers can be redesigned. In these cases, it is preferred that the mutation be within 25% or 25 bases of any end closer to the end. The other end of the fragment contains a high temperature melting domain, preferably 5 ° C, more preferably 10 ° C, most preferably 15 ° C above the low temperature domain in which the mutation is present. If primer selection does not yield a hot melting domain at the opposite end of the fragment, a GC clamp can be applied to increase the melting temperature at the desired end (eg, AT rich end). (Myers et al., 1985, Nucleic Acids Res., 13, 3111). GC clamping is a technique that involves the addition of a GC base on one or both 5 'ends of a primer. The polymerase enzyme extends beyond these additional bases to incorporate into the amplified fragment, raising the melting temperature at the end of the fragment as compared to the melting temperature around the mutation. For example, if the mutation is in the middle of the amplified fragment and is less than 100 bp in length and there is no change in the melting profile, or the mutation is in the hot melting region of the fragment and the hot melting region becomes a GC rich region If present, a GC clamp may be required. In these cases, appropriate primer selection results in a fragment whose mutation can be detected. The size of the GC clamp may be up to 40 bp or as small as 4 or 5 bp. The most preferred GC clamp for mutation detection by DHPLC is 10-20 bp.

  If it is not possible to design a primer that produces a domain with a certain melting point range or domain in fragments within the Tm during PCR amplification, the Tm of the domain of interest for successful mutation detection by DHPLC May need to be lowered. This can be done, for example, by substitution of the analog 7-deaza-2'-dGTP, which is known to effectively lower the melting temperature of the GC base pair of dGTP (Dierick et al., 1993, Nucl. Acids Res. , 21, 4427). If it is necessary to increase the Tm of the domain, 2,6-aminopurine can be used instead of dGTP in PCR amplification.

  In a most preferred embodiment, the primers are selected such that there is a mutation in the "cold melting" domain of the fragment. However, if the high melting domain does not have a very different melting point from the other domains in the fragment, or if a higher column temperature is used to optimize the high melting domain of the fragment, mutations in the high melting domain of the fragment may be detected by DHPLC. Can also be detected.

  The above broad primer design can be further refined by a local primer design that takes into account several other factors. For example, it may be necessary to avoid primers with non-template tails, such as universal sequencing primers or the T7 promoter. The preferred primer has a Tm of about 56 ° C. The Tm difference between the forward primer and the reverse primer is preferably about 1 ° C. The Tm difference between the primer and the template is preferably 25 ° C. The 3 'pentamer of each primer is preferably more stable than [Delta] G [deg.] = 6 kcal / mol (i.e., more negative). Any possible primer dimer is preferably not at least 5 kcal / mol more stable than the 3 'pentamer (i.e., more positive than 5 kcal). Preferably, the Tm of the self-annealing group of any primer is less than 12 ° C. Primers are preferably of high purity without undesirable sequences. In order to avoid decomposition, it is preferable to store in a Tris-HCl (pH 8.0) buffer using pure water.

  In some embodiments, it is more convenient to directly separate long fragments (eg, exons) of up to 5 kb (eg, up to 4 kb, up to 3 kb, up to 2 kb, or up to 1 kb) for mutation. Such long fragments generally contain multiple melting temperature domains. The double-stranded DNA fragment dissolved in a series of discrete steps as different regions of different temperature stability that denatured in response to elevated temperatures. These regions with different temperature stability are called "domains", and each domain is about 50 to 300 bp in length. Each domain has its own Tm and exhibits the thermodynamic behavior associated with that respective Tm. The presence of base mismatches in the domain destabilizes the domain and reduces the Tm of the domain in the heteroduplex compared to the complete hydrogen bonding compartment found in the homoduplex. In general, the presence of a base mismatch reduces Tm by about 1-2 ° C.

  According to a preferred embodiment, optimal results were obtained using DNA sequences for primers of 18-51 bases in length and primers of SEQ ID NOs: 3-49 (Tables 3 and 4). However, those skilled in the art will recognize that the length of the primers used can be varied. For example, it is envisioned that shorter primers containing at least 15, preferably 17 bases (consecutive bases of the nucleotide sequence of these primers (SEQ ID NOs: 3-49)) may be suitable. The exact upper limit of primer length is not important. Typically, however, the primer will be about 60 bases or less, preferably 50 bases or less. Furthermore, the bases contained in the primers can be modified as usual in the art, including but not limited to the incorporation of a detectable label such as biotin or a fluorescent label.

B. Primer combinations useful for PKD-specific amplification.
Specific amplification products can be made by using one or more PKD-specific primers. Preferably, both primers used to generate one amplification product are PKD-specific primers. However, one PKD-specific primer can be used in combination with another non-PKD-specific primer that is not complementary to a unique site in the PKD gene. Non-PKD-specific primers are preferably designed according to the same criteria described above for PKD-specific primers, and are preferably completely complementary to sequences other than the unique sequence in the PKD gene. Non-PKD specific primers can also be used as control primers included in amplification reactions to produce control products.

  Optimum results can be obtained by using one forward and one reverse primer listed in Tables 4 and 5, but other combinations can also be used. In a preferred embodiment, the primer pairs are selected such that the length of the amplification product is 150-600 bp. In a preferred embodiment, the primer pairs are selected such that the amplified fragment length for DHPLC mutation detection analysis is 150-400 bp.

C. Primer Synthesis Primer synthesis methods are available in the art. The oligonucleotide primers of the present invention can be used as a phosphate triester according to any conventional DNA synthesis method (Nang et al. (1979, Meth. Enzymolo., 68, 90) or Itakura (US Pat. No. 4,356,270)). Using the phosphodiester method described in Brown et al. (1979, Meth. Enzymol., 68, 109) or an automated embodiment thereof described in Mullis et al. (US Pat. No. 4,683,202). Can be prepared. In particular, see Sambrook et al., 1989, "Molecular Cloning: An Experimental Manual", Second Edition, Cold Spring Harbor Laboratory, Plainview, N.M. Y. (Also incorporated herein by reference).

V. Preparation of Template for Amplification Reaction Any sample containing a nucleic acid containing all or a part of SEQ ID NO: 1 or 2 or a variant thereof (eg, a polymorphic or mutant form) is used as a template for the amplification reaction of the present invention can do. Useful templates of the invention include, but are not limited to, genomic DNA preparations, total RNA preparations, crude cell lysates, and tissue samples.

  It is preferable to use genomic DNA as a template for PKD-specific amplification of the present invention. It is envisioned that a crude cell lysate or tissue sample can be used, however, those skilled in the art will recognize that any non-DNA material present in the sample may interfere with the polymerase reaction or subsequent analysis.

  Genomic DNA can be isolated from tissue samples or cells. Preferably, the genomic DNA used as a template in the present invention is isolated under conditions that avoid degradation and contamination. Tissue samples or cells can be digested with proteases with little or no DNase activity. The digest is extracted with a DNA solvent. Extracted genomic DNA can be purified, for example, by dialysis or chromatography. Suitable genomic DNA isolation techniques are described, for example, in "Modern Molecular Biology Protocols", edited by Ausugel, John Weley & Sons, Inc. , 1997 as known in the art.

  Preferably, genomic DNA or cDNA is extracted from a cell lysate of a tissue sample collected from an individual and used as a template for PKD amplification. Tissue sample collection also includes in vitro collection of cultured human cells from individual tissues or means of direct in vivo sampling from a subject, for example, by blood sampling, spinal tap, tissue smear, or tissue biopsy. Optionally, the tissue sample is stored in a well-known storage means (quick freezing, controlled freezing regime), cryoprotectant (eg, dimethyl sulfoxide) prior to analysis, storing the nucleic acid of the sample under analyzable conditions. (DMSO), glycerol, propanediol-sucrose). Tissue samples can also be pooled before and after storage of the amplification for analysis. In some embodiments, the sample comprises DNA, tissue, or cells from two or more individuals.

  For the practice of the method of the present invention, any human tissue containing nucleic acids can be sampled and collected. The most preferred and convenient tissue for collection is blood. Patients do not need to be prepared before blood collection. Dosing is not known to interfere with sample collection or testing. Useful aseptic techniques and avoidance of contamination are needed.

  Preferably, DNA is extracted from the blood on the day of blood collection. Preferably, the blood is stored at room temperature (72 ° F or 25 ° C) before use. However, whole blood can be stored at 4 ° C. for short periods, but room temperature is recommended. Whole blood samples can be stable for 48 hours. Subsequent hemolysis compromises DNA recovery and integrity. Preferably, the optimal blood volume for DNA extraction for PCR assays is greater than 5 ml (eg, greater than 10.0 ml).

VI. PCR amplification using PKD-specific primers The present invention relates to a method for amplifying DNA from a sample containing a target nucleic acid in a polymerase chain reaction and detecting the presence or absence of a mutation in the target nucleic acid in a specific amplification product. A method for analyzing mutation of a target nucleic acid comprising No. 1 or 2 or a variant thereof is provided.

  Amplification can be performed by means well known in the art (eg, polymerase chain reaction (PCR), transcription-based amplification (reverse transcription), strand displacement amplification) (see "Modern Molecular Biology Protocols"). . Preferably, amplification is performed by PCR as described in Mullis (US Pat. No. 4,683,202), the contents of which are incorporated herein by reference.

  PCR allows the use of a highly selective enzyme called a DNA polymerase to extend a small DNA strand, called a "primer", along a "template" to reduce the length (size) of a small DNA sample or any base pair. Amplification (replication) of other nucleic acids is possible. A small DNA sample is used as a template. PCR regenerates the complementary sequence of deoxynucleotide triphosphate (dNTP) present in the template or any selected part thereof. PCR is generally used in conjunction with diagnostic techniques, for example, to amplify a DNA sample at a concentration below the detection limit by PCR, and then analyze the large sample thus obtained.

  PCR amplifiers (eg, Air Thermo Cycler (Idaho Technologies)) and reagents are commercially available from a number of vendors (eg, the Perkin-Elmer catalog “PCR Systems, Reagents, and Consumables”, Perkin-Elmer Applied Biosystems, Foster City, Calif.).

Typically, PCR is performed in a buffer of pH 5-8. Buffers include the double-stranded DNA sample to be amplified, the forward primer, the reverse primer, magnesium (eg, MgCl ₂ ), and four deoxynucleotide triphosphates (dATP, dTTP, dCTP, commonly referred to as “dNTPs”). And dGTP) (the building blocks of DNA). The reaction mixture is heated to a temperature sufficient to denature the DNA sample (eg,> 90 ° C.), thereby separating the two complementary nucleic acid strands. Alternatively, the DNA can be enzymatically denatured using a helicase enzyme at ambient temperature. If denaturation is affected by heat and a thermostable DNA polymerase is used, the DNA polymerase is added before the start of the reaction. Other denaturing conditions are well known to those skilled in the art and are described in US Pat. No. 5,698,400. DNA polymerases are commercially available from various sources (eg, Perkin-Elmer Applied Biosystems, Foster City, Calif. And Stratagene (La Jolla, Calif.)).

The primer sequence is designed to be complementary to the identified portion of the denatured DNA strand to be replicated by PCR. Upon cooling the reaction to the appropriate annealing temperature, each primer is annealed to the complementary base sequence in each strand of the denatured DNA sample to be replicated. Heat to about 70 ° C. in the presence of DNA polymerase, four dNTPs, and Mg ²⁺ , and the primer is extended along its length from its 3 ′ end by addition of complementary dNTPs by replication. dNTPs are commercially available from various vendors (eg, Pharmacia (Piscataway, NJ)). Multiple iterations of this process will increase the desired number of DNA strands in the early stages of the process, either synergistically or as long as there is a sufficient excess of reagent in the reaction. Therefore, the amount of the original DNA sample increases.

  The amount of polymerase must be sufficient to promote DNA synthesis over a given number of amplification cycles. Guidelines for the actual amount of polymerase are generally provided by the supplier of the PCR reagent, or can be readily determined by one skilled in the art. Preferably, a DNA polymerase having proofreading activity is used.

  The amount of each primer must be a substantial excess of the amount of target DNA to be amplified. One skilled in the art can evaluate the amount of primer required for the reaction mixture with respect to the final desired number of amplified fragments after completion of the reaction.

  To avoid false positive results, those skilled in the art will recognize that assays should include a negative control, as is conventional in the art. For example, a suitable negative control does not contain primers and DNA (ie, a "water control"). To avoid false negative results, a positive control is obtained with the control primer (see below).

A. Optimization of PCR conditions Successful specific amplification (eg, amplification that produces the largest amount of specific amplification product and the least amount of non-specific amplification product according to the present invention) is performed on the corresponding compatible template. Highly dependent on PKD-specific primers. If the primers non-specifically anneal to many different sequences in the reaction mixture, the amplification process is not specific. Despite the low likelihood that non-specific annealing or non-specific amplification will be avoided in most embodiments, the PCR amplification reaction conditions will be such that non-specific amplification is reduced while specific amplification is increased. It is desirable to optimize.

  In addition, PCR-induced mutations that add non-complementary bases to the template may be formed during sample amplification. Such PCR-induced mutations obscure the mutation detection results, as it is not clear whether the detected mutation was present in the sample or produced during the PCR process. Applicants have recognized the importance of PCR sample amplification optimization to minimize the formation of PCR-induced mutations and ensure accurate and unambiguous analysis of putative mutation-containing samples.

B. Controlling the Specificity of PKD-Specific Annealing of PKD-Specific Primers The fidelity of DNA fragment replication by PCR depends on a number of long recognized factors in the art. Some of these factors are correlated in the sense that changes in the PCR product profile caused by increasing or decreasing the amount or concentration of one factor can be offset or reversed by changes in different factors. For example, increasing the enzyme concentration may decrease replication fidelity, while decreasing the reaction temperature may increase replication fidelity. Increasing the magnesium ion concentration or dNTP concentration can increase the rate of the reaction, which can affect the decrease in PCR fidelity. For a detailed discussion of the factors that contribute to PCR fidelity, see Eckert et al. ("PCR: A Practical Approach", 1991, edited by McPherson, Quirke, and Taylor, IRL Press, Oxford, Vol. 1, 225-244), Andre et al. 1977, "Genome Research", Cold Spring Harbor Laboratory Press, 843-852). These references and the references therein are incorporated herein by reference in their entirety. Thus, the availability of the product profile of the PCR process allows the PCR conditions to be improved to obtain a very effective format.

For PCR amplification, the specificity of the annealing is most important in the first few cycles. The remaining cycles are used only to expand the pool of amplified templates in the first few cycles. The specificity of primer annealing to the template is determined by the ionic strength of the buffer (mainly the K ⁺ concentration), the Mg ²⁺ concentration (affected by the amount of dNTP as it binds to dNTP), and the annealing temperature of each replication cycle Control. In a preferred embodiment, the dNTP concentration is 50 nM, preferably 100 nM, more preferably 200 nM.

  The specific annealing conditions of a primer to a particular template target must usually be determined empirically by changing some increase in annealing temperature and comparing the specificity and sensitivity of the amplification process by agarose gel electrophoresis ( See Modern Molecular Biology Protocol, supra).

  Since the unique region complementary to the PKD-specific primer may differ from the homolog sequence by only a few nucleotides (in some cases, only one nucleotide), the specificity of the amplification reaction is determined for each PKD-specific primer used in the reaction. You need to test.

  The above formula for primer annealing temperature is a rough guide, and subsequent testing at different annealing temperatures is a useful way to optimize this important parameter in PKD-specific amplification reactions. The instrument can be used for the simultaneous testing of different annealing temperatures for a particular primer-temperature pair, which can quickly and reliably determine the optimal annealing temperature (e.g., Robocycler Gradient Temperature Cycler). Cat. No. 400864, Stratagene; Eppendorf Master Cycler Gradient, Cat. No. 5331 000.045, Brinkmann Instruments, Inc., Westbury, NY).

  In some embodiments, the target sequence is amplified at an annealing and extension temperature 1C to 10C above the Tm of the primer pair. Despite insufficient amplification at this temperature, any primer extension obtained is target specific. Thus, during the high temperature cycle, the sample is enriched for a particular target sequence, and at any number of cycles (i.e., 1 to 15 cycles), the product specificity increases. Then, the annealing temperature is lowered to increase the amplification efficiency, and a detectable amount of PCR product can be obtained. A nested amplification reaction can also be performed using the amplification product from the first PCR reaction as a template (see below).

Alternatively, to define optimal conditions for obtaining high yields of specific product with a minimum amount of non-specific product, a constant temperature but different KCl or MgCl ₂ concentration, or different amounts of The reaction of adding a denaturing agent such as formamide (for example, 0, 2, 4, 6%) and DMSO (1 to 10%) can be performed simultaneously.

  In one embodiment, a primer pair comprising at least one selected from the group consisting of SEQ ID NOs: 3-49 is used in the amplification reaction mixture. The two primers are reversed so that one or more specifically amplified products are created.

In some embodiments, when the primers used in the PKD-specific amplification is selected from SEQ ID NO: from 3 to 49, AmpliTaq Gold DNA polymerase comprising a GeneAmp PCR buffer II and MgCl ₂ solution, Perkin Elmer of rTth DNA polymerase XL & XL A Buffer II pack and a Stratagene TaqPlus precision PCR system were used. PFU Turbo ™ is another high fidelity DNA polymerase with higher proofreading provided by Stratagene.

  In other embodiments, an annealing temperature above 65 ° C. (eg, 68-72 ° C.) is used for PKD-specific amplification using primers selected from SEQ ID NOs: 3-49.

  Generally, it is preferred, but not essential, to add the DNA polymerase to the amplification reaction mixture after adding the primers and the template. Alternatively, for example, the enzyme and primer are added last, or the reaction buffer or template + buffer is added last. In general, it is desirable that at least one component essential for polymerization is absent until both the primer and the template are present, and that the enzyme be able to bind and extend the desired primer / template substrate. This method, called "hot start", minimizes "primer-dimer" formation and improves amplification specificity.

The degree of specificity of the DNA polymerase varies with the reaction conditions used and the type of enzyme used. No enzyme gives completely error free primer extension. Therefore, non-complementary bases can be transferred at any time. Such enzyme-related errors result in a double-stranded DNA product that is not an exact copy of the original DNA sample, but contains a PCR-induced mutation. Other features of the PCR process (such as reaction temperature, primer annealing temperature, enzyme concentration, dNTP concentration, Mg2 ⁺ concentration, and combinations thereof) are all related to the accuracy or fidelity of DNA replication by the PCR process described herein. May decrease.

C. PKD-Specific Amplification Sensitivity The PKD-specific amplification sensitivity of the present invention depends on the template and primer used in the amplification reaction, and the ionic strength and annealing temperature of each cycle of amplification.

  When genomic DNA is used as a template, one or about two template copies (about 3-5 pg) can be used for successful PCR amplification when the reaction conditions are optimized. However, it is known in the art that higher template concentrations can increase the specificity and efficiency of amplification.

  Shorter fragments have higher amplification efficiency than longer fragments. Preferably, primers that generate amplification products of less than 1 kb, more preferably less than 600 bp, or less than 450 bp are used to increase the sensitivity of the amplification assay.

  Preferably, the sensitivity of the amplification assay is less than 100 ng genomic DNA template. More preferably, the assay sensitivity is less than 10 ng genomic DNA template. More preferably, the assay sensitivity is less than 1 ng genomic DNA template. More preferably, the assay sensitivity is less than 0.1 ng genomic DNA template. Even more preferably, the assay sensitivity is less than 0.01 ng genomic DNA template.

D. Nested Amplification In some embodiments of the present invention, nested amplification is performed using the amplification product of an initial amplification reaction as a template. Preferably, the nested amplification reaction is a nested PCR using the PCR amplification product from the initial PCR reaction as a template. In addition to optimizing the annealing temperature of the primers, "nested" amplification can be used to increase the specificity and sensitivity of a PKD-specific amplification assay.

  For example, a method involving nested PCR involves two consecutive PCR reactions. After multiple cycles of PCR using a first primer pair comprising at least one PKD-specific primer (eg, a PKD-specific primer and a control primer or two PKD-specific primers) (eg, 10-40, 10-30) , Or 10-20 cycles), anneal a small aliquot of the first reaction (e.g., 1 [mu] l of a 50 [mu] l reaction) to sequences present within or between the first pair. A second multi-cycle (eg, 10-40, 10-30, using a new primer set comprising at least one PKD-specific primer (eg, a PKD-specific primer and a control primer or two PKD-specific primers) Or 10-20 cycles) used as template for PCR reaction I do.

  The design of nested primers and nested PCR methods are known in the art (see modern molecular biology protocols, supra). The general selection criteria for primers described above also apply to the design of nested primers. Both nested primers need to anneal to sequences within the first primer pair (eg, within the primers) and to at least one nested primer, but according to the invention, need to be PKD-specific. is there.

  A nested PCR method is used to select a successfully amplified template with twice the PKD specificity. If only one primer pair fails, the use of nested PCR also greatly increases the yield of species-specific products and can increase assay sensitivity.

  Using a sample containing genomic DNA or cDNA, a DNA template for the amplification reaction can be obtained. Preferably, genomic DNA is used as a template. When a sample containing genomic DNA is used in the reaction mixture, at least two specific amplification products (each PKD allele in the genomic DNA template) are generated by a primer pair including at least one selected from the group consisting of SEQ ID NOs: 49. Products of origin).

E. FIG. Amplification control A control primer can be used as a positive control for PKD-specific amplification. Control primers can be added to the same reaction mixture for PKD-specific amplification or to a control reaction running on the same PCR device under the same parameters. The control primer may include a sequence that is complementary to any identical sequence between the PKD gene and the PKD homolog. Preferably, the control primer produces one amplification product whose size can be distinguished from the size amplified by a primer pair comprising at least one PKD-specific primer. The size of the amplification product by the control primer may be larger or smaller than the size of the amplification product generated by the primer pair including at least one PKD-specific primer. Preferably, a control product is created that differs by at least 100 bp, more preferably at least 500 bp, more preferably at least 1000 bp in size compared to an amplification product made in the same amplification reaction by a primer pair comprising at least one PKD-specific primer. Control primers as described above.

  Control amplification is particularly important when analyzing PKD alleles deleted at the location where the PKD-specific primer anneals. Loss of specific amplification in the presence of the amplification control product may indicate a deletion at a particular position in the PKD gene. In some embodiments, more than one pair of control primers is used in the reaction mixture.

  See Example 2 for the various controls that can be used in the genetic test method of the present invention.

  The amplification product can be purified to remove free primers used for amplification by methods known in the art (eg, “Modern Molecular Biology Protocol”, supra). In a preferred embodiment, the PCR products are purified using the Quickstep ™ 96-well PCR purification kit from Edge Biosystems.

VII. Detection of the Presence of PCR Amplification Products The cycle of DNA denaturation, primer annealing, and synthesis of the DNA segment defined by the 5 'end of the primer is made available with a sufficient amount of either species-specific or universal products for detection. Repeat as many times as necessary to amplify template target until complete. After completion of the amplification reaction, the presence of the amplification product can be detected using techniques conventional in the art.

To facilitate detection, the primer can be labeled. The primer is directly linked to a detectable tag (eg, a radiolabel such as ³² P, ³⁵ S, ¹⁴ C, or ¹²⁵ I, a fluorescent compound such as fluorescein or rhodamine, an enzyme such as peroxidase or alkaline phosphatase, or avidin or biotin). Can be labeled. The PKD-specific primer used to generate the PKD-specific product and the control primer used only to generate the control product can have the same or different labels.

  In a preferred embodiment, the amplification products are conveniently analyzed by gel electrophoresis.

  Perform electrophoresis under conditions that result in the desired resolution of the fragments. Usually, a resolution of as small as about 500 pb to separate fragments of different sizes is sufficient. Preferably, the resolution is about 100 bp. More preferably, the resolution is about 10 bp. Size markers can also be electrophoresed on a gel to assess the size of the fragment. Preliminary size analysis of specific amplification products can indicate insertions or deletions in the PKD gene and can interpret the information obtained in conjunction with the results obtained from subsequent DHPLC and sequence analysis.

  Amplification product patterns can be visualized. If the amplification primer is labeled, this label can be revealed. The substrate containing the separated labeled DNA fragment is contacted with a reagent that detects the presence of the label. For example, amplification products made from radiolabeled primers can be detected by autoradiography. If no amplification primers are detected, the substrate with the PCR product can be contacted with ethidium bromide to visualize the DNA fragments under ultraviolet light.

VIII. Under the most stringent conditions, only perfectly complementary sequences will anneal and sequences containing one or more non-complementary nucleotides will not anneal, the PKD-specific primer will contain only the true PKD gene template. And not with the PKD homolog. Thus, under the most stringent conditions, a PKD-specific primer, in combination with a PKD-specific or specific reverse primer, produces only amplification products from a true PKD template rather than a PKD homolog. However, during a typical PCR amplification reaction, PKD-specific primers can anneal to a template containing the true PKD gene and PKD homolog, especially by the temperature cycling required for the PCR reaction. Thus, while both specific and non-specific amplification products can be produced, the amount of non-specific amplification products can be reduced by using at least one PKD-specific primer.

A. Formation of homoduplexes and heteroduplexes In one embodiment of the invention, a mixture of homoduplexes and heteroduplexes is formed prior to DHPLC analysis. A standard nucleic acid homoduplex (eg, an amplification product from a normal PKD allele) can be added to the sample and the mixture denatured by heating the mixture to about 90 ° C or about 95 ° C. The denatured single-stranded nucleic acid formed in the denaturation process is annealed by gentle cooling of the mixture to ambient temperature. If the sample contains a mutation, a new mixture of homoduplex and heteroduplex is formed. If the sample contains no mutations, only homoduplexes of standard nucleic acids are formed. In a preferred embodiment, the standard nucleic acid is a "normal" nucleic acid.

  In most cases, PKD patients are heterozygous at the locus containing the PKD gene. That is, the carrier has only one PKD allele and a mutated form, and another normal form (eg, wild type) allele. Since most PKD mutations result in a dominant phenotype, one mutant allele is sufficient to confer a risk of developing ADPKD. Another heterozygous situation exists when both alleles are mutated, but each have one or more different mutations. For heterozygous PKD patients, PCR amplification (including nested PCR amplification) using a primer pair comprising at least one PKD-specific primer resulted in at least two specific amplified PKD products (products from each allele). can get. The two specific amplified PKD products may or may not be the same length (eg, different lengths if a mutation on one allele includes a deletion or insertion) and at least one One nucleotide.

  The amplification products can be denatured and reannealed to each other to form a duplex. When a specific amplification product from a normal allele or a mutant allele anneals to another specific amplification product from the same allele, they form a homoduplex. However, when specific amplification products from the normal allele anneal to specific amplification products from the mutant allele, they form a heteroduplex.

  In rare cases, the mutation is in a homozygous form (ie, both alleles in an individual (eg, a PKD patient) contain the same mutation). When samples are taken from homozygous PKD patients, PCR amplification does not yield specific amplification products that can form heteroduplexes upon denaturation and reannealing. In some embodiments of the present invention, amplification with a primer pair that includes at least one PKD-specific primer produces a specific amplification product from a normal PKD gene to provide a post-PCR amplification denaturation and re-annealing process. A sample containing a normal (eg, wild-type) PKD gene is added to the PCR reaction mixture to ensure the formation of a heteroduplex.

  Homoduplexes formed in the denaturation and reannealing process may also include those formed by non-specific amplification products. In very rare cases where sequences in the template allele from which non-specific amplification products are obtained (eg, PKD homolog sequences) also contain one or more mutations, heteroduplexes may also be formed. The heteroduplex formed between the non-specific amplification products is also subjected to a further identification process separation.

B. Heteroduplex Separation and Identification The presence of the heteroduplex formed by the PKD-specific amplification product indicates the presence of a mutation in the PKD gene. Heteroduplex separation can identify if a mutant allele is present in a sample taken (eg, from an individual). This separation process removes non-specific amplification products, whereby specific amplification products from normal alleles improve the identification efficiency and specificity of mutant alleles and PKD patients.

  Heteroduplexes selectively denature at base-pair mismatch sites, creating "bubbles" at the low temperatures required for denaturation of the heteroduplex remnants (ie, portions of the heteroduplex containing complementary base pairs). Forming is well known in the DNA art. This phenomenon, commonly called partial denaturation, occurs because the hydrogen bonds between the mismatched bases are weaker than the hydrogen bonds between the complementary bases. Therefore, less energy is needed to denature the heteroduplex at the mutation site, so lower temperatures are needed to partially denature the heteroduplex at the base pair mismatch site than in the residue of the strand. I do.

  If at least one base pair in the heteroduplex is not complementary, less energy is used to separate the base at that site compared to the fully complementary base pair analog in the homoduplex. This lowers the melting temperature of the heteroduplex compared to the homoduplex. Local denaturation results in the formation of "bubbles" (common names) at base-pair mismatch sites. Bubbles are distorted in DNA fragment structure as compared to perfectly complementary homoduplexes of the same base pair length. This structural distortion under partially denaturing conditions is used as the basis for DHPLC for separating heteroduplexes and homoduplexes.

  A separation process called "denaturing HPLC" (DHPLC) separated the heteroduplex (obtained from the presence of the mutation) and detected the mutant by a homoduplex with the same bp length. Apply to detection via DHPLC (see, eg, Underhill et al., 1997, Genome Research, 7, 996; Liu et al., 1998, Nucleic Acid Res., 26, 1396). This separation is based on the fact that the heteroduplex has a lower melting temperature (Tm) than the homoduplex. When DHPLC is performed at a partial denaturation temperature (ie, a temperature sufficient to denature the heteroduplex at the base mismatch site), separating the homoduplex from the heteroduplex that fluctuates the same base pair length (Hayward-Lester et al., 1995, Cenome Research, 5, 494; Underhill et al., 1996, Proc. Natl. Acad. Sci. USA, 93, 193; Doris et al., 1997, DHPLC Workshop, Stanford Univ.). These references and the references therein are hereby incorporated by reference in their entirety. Therefore, the use of DHPLC was applied to mutation detection (Underhill et al., 1997, Genome Research, 7, 996; Liu et al., 1998, Nucleic Acid Res., 26, 1396). DHPLC can separate heteroduplexes that differ by as little as one base pair under certain conditions. The above-cited references and references therein are incorporated by reference in their entirety.

  A change in the DNA structure from an ordered duplex to a disordered, non-overlapping structure that does not contain base pairs is referred to as a duplex-random chain transition (ie, melting). A statistical mechanical analysis of the equilibrium showing this change as a function of temperature for the native sequence double stranded molecule is shown in Wartell and Montroll (1972, Adv. Chem. Phys., 22, 129). . This theory assumes that each base pair can exist in only two possible states (stack, helix, and hydrogen bond or disorder): Given only the base sequence and a very small number of empirically calibrated parameters, it is possible to calculate the probability that each base pair will spiral or melt at any temperature. Statistical-mechanical theory describes the differences in the intrinsic stability of each base pair or cluster near a base, the effect of adjacent helical structures on the possibility that adjacent base pairs are helix or melting (cooperativity), and both ends Consideration is given to the restriction on the degree of freedom of higher-order structure in a disordered region when the region is partitioned by a spiral structure.

  By repeating the calculations and interpolations of the possibilities in a strictly delimited series of temperature steps, the temperature center point where each base pair balances 50/50 between the helix and the molten state is identified. The MELT program gives the temperature midpoint and some other functions. A plot of the temperature center point as a function of position along the molecule is called a melting map. This clearly shows that melting of adjacent base pairs binds tightly beyond the substantial length of the molecule despite differences in stability between individuals. The presence of a slightly longer region (30-300 bp), called the domain where all bases melt at almost the same temperature, is typical. The melting map directly represents the lowest melting domain of the molecule.

  At the partial denaturation temperature, heteroduplexes with base pair mismatches in the sample sequence will denature at the site of the mismatch and the remaining sample sequence will remain intact. Partially denatured heteroduplexes can be separated and detected using DHPLC.

  When using HPLC under partially denaturing conditions (eg, DHPLC) to separate a mixture of homoduplex and heteroduplex, the heteroduplex is usually eluted before the homoduplex. You.

  In certain embodiments of the invention, heteroduplexes are separated and identified from homoduplexes by DHPLC, wherein the presence of the heteroduplex is such that at least one mutation in the PKD gene (eg, in a mutant allele) Indicates the presence of one or more nucleotide substitutions (or one or more nucleotide insertions or deletions).

  In another specific embodiment, the DHPLC gradient is provided by Transfenomic, Inc. Determined by Wavemaker ™ 4.0 software (San Jose, CA).

  Segregation applications require the ability to detect mutations regardless of where they are on the fragment. In this situation, the mutation may be in the middle or high melting domain of the fragment, but both are difficult to detect. Variations in the melting temperature range of the fragments are preferably less than 10 ° C, most preferably less than 5 ° C.

  In some mutation analyses, there are only two peaks or partially analyzed peaks in the DHPLC analysis. Two homoduplex peaks may be seen as one peak or partially analyzed peak, and two heteroduplex peaks may be seen as one peak or partially analyzed peak. In some cases, under partial denaturing conditions, only the first broad peak is observed.

  If the sample contains a homozygous DNA fragment of sample length, only one peak is obtained at any temperature by hybridization and analysis by DHPLC, since no heteroduplex is formed. In the operation of the method, mutations can be identified by hybridization with a homozygous sample with a known wild-type fragment and performing DHPLC analysis at a partial denaturation temperature. If the sample contains a normal allele, a single peak is observed in the DHPLC analysis since no heteroduplex is formed. If the sample contains a heterozygous mutant allele, analysis by DHPLC shows a separation of homoduplex and heteroduplex.

  The temperature at which 50% of a given melting domain denatures can also be experimentally presented by plotting the UV (UV) absorbance of a DNA sample against temperature. Absorbance increases with temperature and the resulting plot is referred to as the melting profile (Breslauer et al., 1986, Proc. Natl. Acad. USA, 83, 3746; Breslauer, 1987, "For any number of reacting molecule number shifts. Calculation of Thermodynamic Data ", 221, Marky et al. Eds., J. Wiley and Sons). The center point of the absorbance axis for the melting profile indicates the melting temperature (Tm) (ie, the temperature at which 50% of the DNA strands in the duplex denature). In one embodiment of the invention, the observed Tm is used as the starting temperature for DHPLC for mutation detection. The temperature is then adjusted according to the pattern observed using the different controls (see below). In one embodiment, a constant Tm is used to analyze the same amplicon (ie, produced by the same primer pair) from different samples.

  In another embodiment of the invention, DHPLC for mutation detection is performed using software such as MELT (Lerman et al., 1987, Meth. Enzymol., 155, 482) or WinMelt ™ version 2.0. The calculated Tm to be used as the starting temperature for is obtained. These software programs show that despite different base pair stability, the melting temperatures of adjacent base sites are closely cooperating (ie, there is a cooperative effect). Thus, there is a 30-300 base pair long region called a "domain" where the melting temperature is appropriately constant. In a similar manner, the software MELTSCAN (Brossette et al., 1994, Nucleic Acid Res., 22, 4321) calculates the melting domains in DNA fragments and their corresponding melting temperatures. The concept of a constant temperature melting domain is important because it allows the detection of mutations in any domain portion at the selected temperature of one heterozygous mutation site.

  Another specific heteroduplex separation and identification method is Matched Ion Nucleic Acid Chromatography (MIPC). In order to effectively separate a mixture of double-stranded nucleic acid and generally DNA, MIPC was introduced where separation is based on base pair length (US Pat. Nos. 5,585,236 and 6,287,822). Huber et al., 1993, Chromatographia, 37, 653; Huber et al., 1993, Anal. Biochem., 212, 351). These references and the references therein are incorporated herein by reference in their entirety. MIPC separation is completed within 10 minutes, often within 5 minutes. The MIPC system (WAVE ™ DNA Fragment Analysis System, Transgenomic, Inc., San Jose, Calif.) Includes a computer controlled oven that includes a column and a column inlet.

  It is understood that although DHPLC and MICP are methods described for heteroduplex separation and identification, other methods known in the art can be used for heteroduplex identification. For example, heteroduplex analysis on high resolution gel substrates can also detect even single nucleotide polymorphisms. (Hauser et al., 1998, Plant. J., 16, 117-25). The PCR / OLA method can be used for the analysis of amplification products to detect SNPs in the 3 'end of the human PKD gene (Glick and Pasternak, 1994, "Molecular Biotechnology: Principles of Recombinant DNA and Applications, ASM Press, Washington, DC, 197-200). One skilled in the art can also use conformation-sensitive gel electrophoresis of the amplification product as an analytical tool in the practice of the method of the present invention. (Markoff et al., 1998, Eur. J. Genet., 6, 145-50). This can be accomplished by techniques such as PCR-restriction fragment-SSCP that can detect single base substitutions, deletions, or insertions (Tawata et al., 1996, Genet. Anal., 12 (3-4 Lee, et al., 1992, Anal. Biochem., 205, 289-93). The use of any of the various conventional slab or capillary electrophoresis techniques allows for rapid and sensitive electrophoresis for the analysis of amplification products, providing the practitioner with any means of detecting nucleic acid fragments (radionuclides, UV absorption, Or laser-induced fluorescence (Keparnik et al., 1998, Electrophoresis, 19, 249-55; Inoue et al., 1998, J. Chromatogr. A., 802, 179-84; Dovichi, 1997, 18, 2393-99; Baba, 1996, J. Chromatgr. B. Biomed. Appl., 687, 271-302; Chan et al., 1997, J. Chromatogr B. B., J. Pharm. omed.Sci.Appl., 695,13~15) but are able to choose to use a not limited to) optionally. Optionally, any of a variety of fluorescent dyes can be used to label the primers or amplification products of the invention to facilitate analysis, including SYBR Green I, TIO-PRO-1 Thiazole orange, Hex (ie, 6-carboxy-2 ′, 4 ′, 7 ′, 4,7-hexachlorofluorescein), picrogreen, edans, fluorescein, FAM (ie, 6-carboxyfluorescein), or TET. (I.e., 4,7,2 ', 7'-tetrachloro-6-carboxyfluoroscein) (e.g., Skeidsvoll and Ueland, 1995, Anal. Biochem., 231, 359-65; Iwahana et al., 1996, Biotechniques, 21). , 510-14, 516-19) But are not limited to these.

  In a preferred practice of the invention to perform homoduplex and heteroduplex separations for the purpose of mutation detection, the DNA sample is hybridized to a normal DNA fragment by denaturation and annealing of the above mixture. A DNA sample can hybridize directly with normal DNA. DNA samples can also be amplified by PCR and then hybridized to normal DNA. Alternatively, normal fragments can be added to the sample before PCR amplification. The amplification mixture can then be hybridized after amplification. In each of these three hybridization scenarios, a mixture of homoduplexes and heteroduplexes is obtained if the mutation is present in the sample. The samples thus prepared are analyzed by DHPLC under partially denaturing conditions (preferably 56-58 ° C.) for the presence of mutations using the method of the invention.

  When the method of the present invention is used for the separation of large numbers of samples for the presence of mutations, significantly increasing the sample throughput by speeding up the analysis of each sample using a broad gradient for the fragment enrichment range. it can.

  In all embodiments and aspects of the invention, nucleic acid fragments are detected when separated and eluted on a DHPLC column. Any detector that can detect nucleic acids can be used in a DHPLC mutation detection method. The preferred detector is an online UV detector. If the DNA fragment is tagged with a fluorescent or radioactive label, a fluorescence detector or a radioactivity detector can be used, respectively. After detection, the separated fragments are individually displayed on a video display or printed by a printer. The fragments displayed in this way are recognized as peaks or bands in lanes.

C. Quality Control Beneficial for DHPLC Evaluation of PKD-2 and PKD-1 Unique Regions The chemical principle that distinguishes heteroduplex-homoduplex mixtures from homoduplexes only by DHPLC, (1) buffer , (2) oven temperature during analysis, (3) column conditions, and (4) system conditions during sample injection. Fluctuations in the elution pattern are normal and vary depending on the size and sequence of the amplicon and the specific DHPLC conditions at the time of analysis. The person skilled in the art is knowledgeable, for example, in interpreting the elution patterns obtained according to the protocol provided by the manufacturer of the DHPLC device. However, the limits of the fluctuation range are appropriate to help ensure that the conditions are within the range expected to effectively isolate DNA variants. The following quality control control solutions are useful examples that have been established for each analytical condition to ensure consistent assay performance.

1. DNA-free control This control indicates that the reagents and materials do not generate a particular signal that can interfere with the analysis of the patient. In some embodiments, the control must show minimal signal (less than 10% of the height of a normal control peak) in a DNA-free sample that has been treated identically to a sample containing, for example, DNA extracted from tissue. . All of the analytical system hardware is reused in each sample analysis, and peak heights of up to 10% of normal controls are acceptable, as DHPLC analysis is a separation of components. The actual contamination with the different sequences gives a false positive DHPLC pattern difference, which is caused by reflection in the sequencing that is not expected to detect 10% contaminants. In the event that a sequence difference is detected, the fragments will be repeated from the PCR point to confirm the result. Similarly, a virtually positive contamination of 10% of the normal sequence would not be expected to significantly alter the pattern, as 50% of the DNA present is already normal. In the rare case where very slight pattern changes are perturbed by a 10% excess, normal DNA during injection has an estimated sensitivity of 78-96%. However, the absence of a DNA signal each time the amplicon is analyzed requires that the analysis conditions be changed to minimize or eliminate global and persistent DNA signal loss.

2. Normal Control In one embodiment, the pattern of a normal control must match a historical pattern. A match with the established pattern indicates acceptable amplification, retention time, peak height, and peak shape. Therefore, PCR and DHPLC conditions (such as machines and buffers) are performed in the examples. There are no homologs or other non-specific amplification signals when compared to the established normal control pattern.

3. Positive control A positive control is a "control of DHPLC analysis conditions" used to show that the established DHPLC analysis conditions (detecting heteroduplexes of the positive control) are effective at the time of analysis. Positive control patterns, distinguished from normal controls and consistent with historical patterns, indicate acceptable retention times, peak heights, peak shapes, and patterns. Heteroduplex detection indicates that the optimal specific DHPLC analysis conditions for each fragment are valid during patient analysis. It is important to note that controls are not necessarily PKD positive signals. No specific PKD positive sample for each 83PKD fragment is available. If not, use another heteroduplex (positive and normal control) as a positive indicator of appropriate analytical conditions at the time of analysis.

4. Additional Positive Controls Additional positive controls provide patterns that are consistent with the historical pattern for this specific mutation and can be used to isolate very common polymorphisms. In general, specific DNA variants result in heteroduplex patterns of unique properties that are highly reproducible from sample to sample. A pattern that matches the established pattern indicates an acceptable retention time, peak height, peak shape, and pattern. The specific heteroduplex pattern will be considered as having a common polymorphism because the optimal DHPLC analysis conditions for this DNA variant will be effective in analyzing the patient, and the matching patient pattern will be common Show that you can do it. This optional separation method for common polymorphisms is very specific for unique amplicons and variants and relies on proper confirmation studies unique to the variants.

D. Analysis of DHPLC results Since DHPLC is a separation process, any analyte (eg, DNA, cell lysate, or tissue sample) that has a different signal than the normal control is considered potential positive and is used depending on the environment It should handle one of several possible options. For some embodiments, a signal that is too weak to be interpreted (less than 25% of the peak height of a normal control) is a failure in PCR, a failure in wave injection, or some other sample-specific. Can be caused by sporadic equipment problems. Options include repeating PCR points, repeating wave radiation (using all controls), or reporting non-critical waves and sequencing. Signals that differ in pattern from normal controls should be considered positive, scored as "P", and sequenced. Signals that differ only slightly from the normal control pattern should be recorded as "B" and sequenced. Signals that are much stronger than normal control signals should be recorded as "P" and sequenced. Note that patient samples were not obtained based on these results alone. The specific options used will vary depending on the amplicon and its DHPLC operating history and the specific environment for the analyte.

  In some embodiments, only the results emitted from the DHPLC are the results recorded as "normal" by wave analysis. To be scored as normal, the DHPLC pattern of the sample must match the normal control according to the following QC criteria. (A) Number of peaks, (b) Peak height, (c) Peak pattern, (d) Retention time, (e) Baseline shape. In other words, the pattern of the individual's specimen must look like a normal control within a reasonable range of estimated variation. If necessary, consider the verification data reference pattern. DHPLC separation sensitivity was evaluated by counting patterns that differed substantially from normal controls. If the pattern is deemed to be truly different from the normal control, there is no doubt that it will be scored positive and proceed to sequencing. Sequences that meet the specific amplicon requirements and have a pattern that matches the normal control are recorded and considered normal.

  The specific numerical criteria used to determine "match" include (a) the number of peaks at which the peak indicates a local maximum in signal intensity, (b) peak height or maximum signal intensity (usually normal (C) between 0.5 and 2.0 times the height of the control), (c) peak retention time (must be +/- 60 seconds compared to the corresponding normal control), It is not limited to these. The peak pattern is determined by the relative correspondence of each slope change within the peak and the relative intensity and retention time of each peak within the complex pattern. Baseline patterns are usually smooth and consistent in all samples. A relatively low baseline change may indicate a heteroduplex eluting and possibly melting at a retention time significantly different from the homoduplex peak. The retention time and peak height criteria for each amplicon are specified in the table accompanying the examples.

  In one embodiment, the peak pattern evaluation comprises: (1) a sample signal that meets the same running control criteria as the normal control; and (2) a sample signal pattern that matches the normal control based on a relative comparison to the running control. It is a combination of Since the normal control pattern is acceptable even though it is expected to change slightly with each run, each sample recorded as normal is (1) the same run control criteria as the normal control, (2) Combinations that meet the unique relative control criteria in comparing normal controls to each patient sample. It appears that slight changes in the patient sample pattern are consistent with the absolute driving norms of normal controls, and are evident using the relative comparison of normal and patient within driving. Relative comparisons within driving are always interchangeable with historical patterns, normal controls pass control criteria and driving is expected to be acceptable.

IX. Verification of the heteroduplex Optionally, the identified heteroduplex can be verified by digestion of the amplification product with one or more restriction enzymes. Restriction enzymes useful for this purpose are selected by comparing the true PKD gene sequence with a PKD homolog sequence or by comparing PKD polymorphisms. Useful restriction enzymes of the invention create distinct fragment profiles for the true PKD gene and PKD homolog. Examples of such restriction enzymes include, but are not limited to, PstI, StuI, XmaI, MluI, PvuII, BssHII, FspI, MscI, and BlnI. Useful restriction enzymes can also generate distinguishable fragment profiles for normal and mutant PKD genes. It is understood that a greater number of restriction enzymes can be identified by a simple comparison of the PKD gene to a PKD homolog gene or a normal PKD allele to a mutant PKD allele. Restriction enzymes that have a recognition or cleavage site in one sequence rather than in the other sequence to destroy or create a cleavage site can be considered useful restriction enzymes of the invention. Following restriction of the nucleic acids, separation of the resulting fragments in denaturing high performance liquid chromatography (DHPLC) or electrophoresis as described above (including restriction-capillary electrophoresis) and analysis of fragment length or mobility of different fragments is performed.

X. Sequencing of heteroduplexes identified by DHPLC Heteroduplexes that indicate the presence of one or more mutations identified by DHPLC can be cloned, amplified, and / or sequenced. The heteroduplex can be sequenced using any sequencing method known in the art. In some embodiments, the identified heteroduplex is used as a template for PCR amplification, and the amplification products are sequenced by Sequetech Corporation (Mountain View, CA). In a preferred embodiment, sequencing is performed using one of the primers comprising SEQ ID NOs: 3-49.

  In some embodiments, the identified heteroduplex is amplified, cloned into a plasmid (eg, ZeroBlunt TOPO PCR Cloning Kit, Invitrogen, Carlsbad, CA, Cat. No. 4560-01) and sequenced. The plasmid containing the PCR fragment is propagated and sequenced by methods well known in the art.

XI. DNA Changes Identified by the Methods of the Invention A number of nucleotide and amino acid changes have been identified in individuals diagnosed with ADPKD. FIG. 14 summarizes a non-limiting list of changes identified in PKD-1 and PKD-2 nucleotide and amino acid sequences from ADPKD patients according to one embodiment of the present invention. The sequence positions shown in FIG. 14 correspond to the nucleotide or amino acid positions disclosed in FIGS. 15 and 16 for PKD-1 and PKD-2 (without introns), respectively.

  The nucleotide and amino acid changes listed in FIG. 14 include both changes known in the art and novel changes first identified by the present applicant. The present invention identifies known and novel changes in association with individuals diagnosed with ADPKD, so that both the known and novel changes disclosed in FIG. 14 can be used to diagnose ADPKD due to PKD or as described below. Can be used as markers for other clinical uses. Primers that can be used to identify each nucleotide sequence change are also shown in FIG. 14 (eg, PKD1X1, PKD1X36, etc.). The sequences of the primers are disclosed in Table 3 above.

  In one embodiment, the present invention provides a primer selected from the group consisting of SEQ ID NOs: 3-49.

  In one embodiment, the present invention provides an isolated PKD-1 or PKD-2 polynucleotide comprising one or more nucleotide sequence changes disclosed in FIG.

  In another embodiment, the invention provides an isolated PKD-1 or PKD-2 polynucleotide comprising one or more of the novel nucleotide sequence changes disclosed in FIG. 14 (shown in bold).

  In another embodiment, the present invention provides a purified PKD-1 or PKD-2 polynucleotide comprising one or more amino acid sequence changes disclosed in FIG.

  In another embodiment, the invention provides a purified PKD-1 or PKD-2 polynucleotide comprising one or more of the novel amino acid sequence changes (shown in bold) disclosed in FIG.

  Preferably, a PKD-1 or PKD-2 polynucleotide or polypeptide containing one or more sequence changes is used as a marker for ADPKD.

XII. Identification of Clinical Uses and Alterations of the Methods of the Invention Genetic assays described in this application file a PKD-1 or PKD-2 containing a splice-linked acceptor / donor sequence that has been reported to be pathogenic for ADPKD. The purpose is to identify changes in the DNA of the coding region. Perform this method for the physician to evaluate:

A. Diagnosis of ADPKD due to PKD in a symptomatic individual.
B. Tracking of ultrasound results indicating the presence of one or two cysts in an individual at or near the age of onset.
C. Diagnosis of different variants of ADPKD (types 1 and 2) for which determination from family history, ultrasound, and other clinical data is not preferred.
In one embodiment, the present invention comprises the step of identifying the nucleotide sequence of the individual's PKD-1 or PKD-2 gene, wherein one of the nucleotide sequences of the PKD-1 or PKD-2 gene disclosed in FIG. A method for diagnosing ADPKD in an individual is provided, wherein the presence of one or more nucleotide sequence changes is indicative of ADPKD in said individual.
D. Determination and provision of genetic counseling of other at-risk family members once an ADPKD proband has been identified in the family.
E. FIG. Determining the suitability of survival-related donors in the case of transplantation.

The present invention provides a method for detecting the presence or absence of a mutant PKD gene and the presence or absence of ADPKD.
In one embodiment, the invention provides a method of determining the presence or absence of a mutated PKD gene in an individual, the method comprising: a) identifying the nucleotide sequence of the PKD-1 or PKD-2 gene of the individual; a) comparing the nucleotide sequence of the PKD-1 or PKD-2 gene disclosed in FIG. 14 with a nucleotide sequence change of the nucleotide sequence disclosed in FIG. 14; and c) comparing one or more nucleotide sequences disclosed in FIG. Detecting the presence of a change, wherein the presence of said at least one nucleotide sequence change is indicative of ADPKD of said individual, and the absence of any of said nucleotide sequence changes is indicative of said mutant PKD-1 and / or PKD-2 gene. Provide a way to indicate the absence of

XIII. Kits The present invention also provides kits for performing the mutation analysis method and the PKD patient identification method of the present invention. The present invention provides a kit for detecting the presence or absence of a mutant PKD gene and the presence or absence of ADPKD.

An embodiment of the kit of the present invention according to the method of the present invention includes at least one isolated first nucleic acid selected from the group consisting of SEQ ID NOs: 3-49 and / or its complementary sequence. The kit may further comprise at least one single nucleic acid that is opposite to the first nucleic acid, wherein the first and second nucleic acids amplify a fragment of the template nucleic acid comprising the sequence of SEQ ID NO: 1 or 2. A separated second nucleic acid and a packaging material may be included. The kit of the present invention may further include at least one component selected from the group consisting of a DNA polymerase, a template nucleic acid, a restriction enzyme, a control oligonucleotide primer, ddNTP, a PCR reaction buffer, and a combination thereof. In addition to the reagents, the kit of the present invention preferably includes instructions for performing the method of the present invention. The kit may preferably contain pre-measured quantities of reagents packaged in a unit container and designed to operate together to obtain the desired result.
[Example]

  The present invention is illustrated by the following non-limiting examples using the following materials and methods.

[Reagents, specific equipment and equipment]
A. The following is a list of chemicals used in PKD-1 amplification and DHPLC (WAVE) analysis.
54-well gel containing 1% agarose, 1 × TBE, ethidium bromide (Embitec, catalog number GE4580)
54-well gel containing 2% agarose, 1 × TBE, ethidium bromide (Embitec, catalog number GE4582)
96-well gel filtration block (Edge Biosystems, catalog no. 91751)
Quickstep ™ 96-well PCR Purification Kit (Edge Biosystems, Cat. No. 99605)
AmpliTaq Gold with GeneAmp PCR Buffer II and MgCl ₂ solution (Perkin Elmer, catalog number N808-0241)
rTth DNA polymerase, XL & XL buffer II pack (Perkin Elmer, catalog number N808-0193)
TapPlus precision PCR system (Stratagene, catalog number 600211)
Dimethyl sulfoxide (DMSO) (Sigma, catalog number D-2650)
Ready-Load 100 bp DNA ladder or equivalent (Gibco BRL, catalog number 10380-012)
Ready-Load 1 kb DNA ladder or equivalent (Gibco BRL, 1800-828-6686, catalog number 10380-010)
BigDye Terminator Ready Reaction Kit (Perkin Elmer, Catalog No. 4303150)
Gel filtration cartridge (Edge Biosystems, catalog number 42453)
Long Ranger Singel ™ (FMC BioProducts, catalog number 50691 or 50693)
Oligonucleotides (Operon Technologies, Inc.)
WAVE Mutation Standard (209 bp) (Cat. No. 560077) (180 μl)
Acetonitrile-HPLC grade (VWR, catalog number BJ015-1)
HPLC grade water (VWR, catalog number BJ365-4)
Triethylammonium acetate (TEAA) (Transgenomic, catalog number SP5890)

B. Reagents and solutions 10 μM oligonucleotide primers: A 10 μM working aliquot of the PCR primers dissolved in TE buffer should be stored at 4 ° C. in a Pre-PCR refrigerator and the sequencing primer working aliquot should be stored in a Post-PCR refrigerator. Should be stored at 4 ° C.

Solution X-127: 50 mM EDTA (pH = 8.0) solution of upgrade blue dextran 0.5 ml of 50 mM EDTA (pH = 8.0) (solution X-35) in a 15 ml sterile centrifuge conical tube, 500 mg Combined with 9.5 ml of AND, 9.5 ml of autoclaved and filter sterilized DiH ₂ O. Vortex thoroughly to mix the solution.

  Solution X-126: Upgrade Gel Loading Buffer: Combine 200 μl of deionized formamide and 40 μl of Upgrade Blue Dextran in 50 mM EDTA (Solution X-127) in a 1.5 ml sterile microcentrifuge tube. Vortex completely.

WAVE solution A: solution A (0.025% ACN)
2 L preparation: 100 ml ion-pairing agent (TEAA)
500 μl acetonitrile (ACN)
Make up to 2 L with HPLC Great Water.
WAVE solution B: solution B (25% ACN)
2 L preparation: 100 ml ion-pairing agent (TEAA)
500 ml acetonitrile (ACN)
Make up to 2 L with HPLC Great Water.
WAVE Syringe Wash Solution: Syringe Wash Solution (8% ACN)
2 L preparation: 160 ml acetonitrile (ACN)
Make up to 2 L with HPLC Great Water.
WAVE solution D: solution D (75% ACN)
2L preparation: Make up to 2L with 500ml HPLC Great Water Acetonitrile (ACN).

C. Equipment and supplies

[procedure]
Step I: Preparation of DNA and / or RNA from Patient Specimens DNA was extracted from whole blood or lymphocytes using the Puregene (trade name) DNA extraction kit. DNA extracted using these reagents should be successfully PCR amplified under assay specific conditions. This is tested by running the assay specified in the protocol and comparing it to the results obtained with the validated positive DNA control.
The extracted DNA is quantified, and a 260/280 ratio of 1.4 or more is obtained. A lower ratio sample indicates poor DNA quality and does not meet the PCR standard. If the final result of the assay is not interpreted, the sample should be re-extracted.

Step II: Amplification of DNA by PCR The PCR reaction mixture and cycling parameters (eg, exon 1 of the PKD-1 gene) are adjusted as exemplified in Table 5. The PCR conditions are similarly adjusted, but optimized for specific and likely amplification of other exons.

  One wax bead is added to each well and incubated in a thermal cycler at 80 ° C. for 5 minutes to dissolve the wax, incubated at 25 ° C. for a further 5 minutes and placed on ice for further manipulations.

  PCR amplified fragments can be compared to a confirmed positive control DNA control for size, signal strength, and migration pattern. The size of the PCR amplified fragment is determined by comparison with a molecular weight marker on the gel (DNA MASS ™ Ladder-Gibco BRL). With a narrow range of DNA molecular weight ladder, staining of the gel with ethidium bromide yields six bands of double-stranded (100-2000 bp) DNA.

Step III: DHPLC analysis of PCR products The heteroduplex formed by the PCR amplification products was analyzed by Transgenomic, Inc. (Omaha, NE 68164).

Step IV: Cycle Sequencing Tables 9 and 10 provide examples of the sequencing conditions used in one embodiment of the present invention.

[Summary of results]
In one experiment, the detection of mutations in exons 1-34 of the PKD-1 gene was determined by using eight sets of oligonucleotide primers in eight different first round PCR reactions to amplify DNA fragments of the following sizes: Performed by use. a) LR1 is 2.2 kb and contains exon 1, b) LR2 is 4.6 kb and contains exons 2-7, c) LR3 is 4.2 kb and contains exons 8-12, d A) LR4 is 4.4 kb and includes exons 13-15; e) LR5 is 3.4 kb and includes exons 15 (3 'end) -21; f) LR6 is 0.3 kb and exon 22 G) LR7 is 4.2 kb and includes exons 23-28; h) LR8 is 5.8 kb and includes exons 29-34. Amplification products from the first round of amplification were serially diluted 1:10 ⁴ or 1:10 ⁵ to remove genomic contaminants and then used as a template in a second round of nested PCR. Nested PCR products were heteroduplexed and screened by DHPLC for sequence changes. Each fragment was analyzed against normal and positive controls using amplicon specific temperatures and acetonitrile gradients. Any test samples that were positive by DHPLC analysis were purified and sequenced. The cycle sequencing products were separated on an ABI377 automated sequencer and the results were analyzed using sequencing software classification. Tables 11-12 and Figures 1-13 show the results and procedures for some embodiments of the present invention.

Other Embodiments The above examples show experiments performed and considered by the inventors who have constructed and performed the present invention. It is believed that these examples include notifications of techniques for practicing the invention and disclosure of techniques used to prove its usefulness. Those skilled in the art will recognize that the techniques and embodiments disclosed herein are only preferred embodiments, and that generally the same results can be achieved using a number of equivalent methods and techniques. All application and patent documents, including drawings and tables, and references cited in the specification are hereby incorporated by reference in their entirety.

FIG. 3 shows the PKD1 cDNA sequence (GenBank Accession No. L33243) used in one embodiment of the present invention. Exon and PCR product junctions are indicated above the nucleotide sequence. Amino acids are shown below the center of each codon. FIG. 4 shows a comparison between an exon sequence of a PKD gene and two homologous sequences according to one embodiment. Indicates a restriction enzyme site that cleaves only either the PKD or homolog sequence. FIG. 4 is a graph showing the PKD1 exon 40D HPLC pattern of four normal samples and a 19 bp insertion (duplication) at nucleotide 11606 (codon 3799) according to one embodiment. FIG. 4 is a graph showing the PKD1 exon 40 sequence of a normal control and a 19 bp insertion (duplicate) sequence at nucleotide 11606 (codon 3799) according to one embodiment. FIG. 4 is a graph showing the PKD1 exon 6D HPLC pattern of intron 5 putative polymorphism (IVS5-9-> A) and frameshift at nucleotide 1502 (insert G) according to one embodiment. FIG. 4 is a graph showing the PKD1 exon 6 sequence of the intron 5 putative polymorphism (IVS5-9-> A) according to one embodiment. FIG. 4 is a graph showing the PKD1 exon 18D HPLC pattern of the frameshift at nucleotide 7518, codon 2436 (insert C) and the common polymorphism C7652T according to one embodiment. FIG. 4 is a graph showing the PKD1 exon 18 sequence of a normal control and a sequence having a frameshift at nucleotide 7518 (codon 2436 (insert C)) according to one embodiment. FIG. 6 is a graph illustrating an example of a software estimated melting profile and multiple temperatures required to establish partial melting near exon ends according to one embodiment. FIG. 4 is a chart showing the DNA mutation phenotype of a patient identified in one embodiment of the present invention. FIG. 4 is a table showing the DNA mutation phenotype of a patient identified in one embodiment of the present invention. 5 is a table summarizing DHPLC (WAVE) used in some embodiments of the present invention. 5 is a table summarizing PCR conditions used in some embodiments of the present invention. 1 is a schematic diagram illustrating a patient sample processing step in one embodiment of the present invention. 1 is a table showing non-limiting examples of new and known nucleotide and amino acid changes identified in PKD-1 and PKD-2 nucleotide and amino acid sequences from ADPKD patients according to one embodiment of the present invention. As used herein, "new" includes unknown predicted disease (UPD) that results in the change described in bold. X is an exon, IVS is an intervening sequence, KP is a known polymorphism, UP is an unknown polymorphism, and UAA is an unknown amino acid change. FIG. 3 shows the cDNA sequence of wild-type PKD-1 according to one embodiment of the present invention. FIG. 3 shows the cDNA sequence of wild-type PKD-2 according to one embodiment of the present invention.

Claims (23)

  An isolated nucleic acid comprising a sequence selected from the group consisting of SEQ ID NOs: 3-49 and its complementary sequence.   15. A nucleic acid biomarker for ADPKD comprising a PKD-1 or PKD-2 nucleic acid sequence comprising one or more nucleotide changes disclosed in FIG.   13. The nucleic acid biomarker of claim 2, wherein at least one of said one or more nucleotide changes consists of a novel nucleotide change disclosed in FIG.   A nucleic acid biomarker for ADPKD comprising a PKD-1 or PKD-2 nucleic acid sequence comprising one or more of the novel nucleotide changes disclosed in FIG.   A polypeptide biomarker for ADPKD comprising a PKD-1 or PKD-2 polypeptide sequence comprising one or more amino acid changes disclosed in FIG.   16. The polypeptide biomarker of claim 5, wherein at least one of said one or more amino acid changes comprises a novel amino acid change disclosed in FIG.   A polypeptide biomarker for ADPKD comprising a PKD-1 or PKD-2 polypeptide sequence comprising one or more of the novel amino acid changes disclosed in FIG.   Identifying the nucleotide sequence of the PKD-1 or PKD-2 gene of the individual, wherein the presence of one or more nucleotide sequence alterations in the nucleotide sequence of the PKD-1 or PKD-2 gene disclosed in FIG. A method for diagnosing ADPKD of an individual, wherein the method indicates ADPKD of the individual.   9. The method of claim 8, further comprising obtaining a DNA sample from said individual for identification of a nucleotide sequence of a PKD-1 or PKD-2 gene.   The method according to claim 9, wherein the obtained DNA sample is a genomic DNA sample or a cDNA sample.   10. The method of claim 9, further comprising amplifying a portion of a PKD-1 or PKD-2 gene from said DNA sample prior to said identification.   12. The method of claim 11, wherein said portion of said PKD-1 or PKD-2 gene is amplified by a polymerase chain reaction.   10. The method of claim 9, wherein said identifying is by DNA sequencing.   14. The method of claim 13, wherein said DNA sequencing is performed using an isolated nucleic acid comprising a sequence selected from the group consisting of SEQ ID NOs: 3-49 and the complement thereof.   14. The method of claim 8, wherein at least one of said one or more nucleotide changes comprises a novel nucleotide change disclosed in FIG. A method for determining the presence or absence of a mutant PKD gene in an individual,
a) identifying the nucleotide sequence of the PKD-1 or PKD-2 gene of said individual;
b) comparing the nucleotide sequence of step a) with a nucleotide sequence change in the nucleotide sequence of the PKD-1 or PKD-2 gene disclosed in FIG. 14;
c) detecting the presence of one or more of the nucleotide sequence changes disclosed in FIG.
The method wherein the presence of the at least one nucleotide sequence change is indicative of ADPKD of the individual, and the absence of any of the nucleotide sequence changes is indicative of the absence of the mutant PKD gene.   17. The method of claim 16, further comprising obtaining a DNA sample from said individual for identification of a nucleotide sequence of a PKD-1 or PKD-2 gene.   The method according to claim 17, wherein the obtained DNA sample is a genomic DNA sample or a cDNA sample.   18. The method of claim 17, further comprising amplifying a portion of a PKD-1 or PKD-2 gene from said DNA sample prior to said identification.   20. The method of claim 19, wherein said portion of said PKD-1 or PKD-2 gene is amplified by a polymerase chain reaction.   18. The method of claim 17, wherein said identifying is by DNA sequencing.   22. The method of claim 21, wherein said DNA sequencing is performed using an isolated nucleic acid comprising a sequence selected from the group consisting of SEQ ID NOs: 3-49 and the complement thereof.   17. The method of claim 16, wherein at least one of said one or more nucleotide changes comprises a novel nucleotide change disclosed in FIG.

Images