JP2003514531A - BT toxin receptor from lepidopteran insects and methods of use - Google Patents

Abstract

(57) Summary The present invention relates to the management of Bt toxin resistance. The invention particularly relates to the isolation and characterization of nucleic acids and polypeptides for the novel Bt toxin receptor. Nucleic acids and polypeptides are useful in identifying and designing novel Bt toxin receptor ligands, including novel insect toxins. The present invention also provides an isolated nucleic acid molecule having a nucleotide sequence encoding a Bt toxin receptor. The invention also provides an isolated polypeptide having an amino acid sequence.

Description

Detailed Description of the Invention

FIELD OF THE INVENTION The field of the invention is to manipulate Bt toxin sensitivity in plant pests.
The field of the invention relates to the isolation and characterization of nucleic acids and polypeptides for novel Bt toxin receptors. Nucleic acids and polypeptides are useful in developing new insecticides.

BACKGROUND OF THE INVENTION Traditionally, growers have used chemical pesticides as a means to control agronomically important pests. Bacillus thuringiensis (
The introduction of transgenic plants carrying δ-endotoxin from Bt) provided a non-chemical control strategy. Bt toxins have traditionally been classified by their specific toxicity to specific insect categories. For example,
The Cryl group of the toxin is toxic to Lepidoptera. Cryl groups include, but are not limited to, CrylA (a), CrylA (b), and CrylA (c). Hofte et al. (1989) Microbiol
See Rev 53: 242-255.

Lepidopteran insects cause considerable damage to maize plants throughout North America and around the world. One of the main pests is Ostri
nia nubilalis, which is the European corn borer (ECB
) Is commonly called. CryA (b, a crystal protein derived from Bt
) And CrylA (c) encoding genes have been introduced into maize as a means of ECB regulation. These transgenic maize hybrids are effective in controlling ECB. However, the developed resistance to Bt toxin presents a challenge in controlling pests. McGaughey et al. (19
98) Nature Biotechnology 16: 144-146; E.
struch et al. (1997) Nature Biotechnology 15
137-141; Roush et al. (1997) Nature Biotechn.
15: 816-817; and Hofte et al. (1989) Micr.
See ovio Rev 53: 242-255.

The main site of action of the Cryl toxin is in the brush border membrane of the midgut epithelium of the larvae of sensitive insects such as lepidopteran insects. CrylA toxin-binding polypeptides are available in various Li
It is characterized from the species Pidopteran. Manduca sexta
, A Lymantria dispar, Helicoverpa zea, and Heliothis virescens-derived homology to aminopeptidase N have been reported for CrylA (c) -binding polypeptides.
Knight et al. (1994) Mol Micro 11: 429-436: Le.
e et al. (1996) Appl Environ Micro 63: 2845-2.
849; Gill et al. (1995) J. Am. Biol. Chem. 270: 27277
-27282; and Garczynski et al. (1991) Appl Envi.
See Ron Microbiol 10: 2816-1820.

M. Another Bt toxin binding polypeptide (BTR cloned from sexta
1) has homology to the cadherin polypeptide superfamily and binds to Cty1A (a), CrylA (b), and CrylA (c). Vadlamudi et al. (1995) J. Am. Biol. Chem. 270 (
10): 5490-4, Keeton et al. (1998) Appl Environ.
Microbiol 64 (6): 2158-2165; Keeton et al. (1).
997) Appl Environ Microbiol 63 (9): 341.
See 9-3425, and U.S. Patent No. 5,693,491.

[0006] Subsequent cloned homologs for BTR1 have been reported by Ihara et al.
8) Comparative Biochemistry and Physi
biology, Part B 120: 197-204 and Nagamatsu et al. (1998) Biosci. Biotechnol. Biochem. 62 (4
): 727-734, showed binding to CrylA (a) from Bombyx mori.

Identification of plant pest binding polypeptides for Bt toxins develops new insecticides to select and design improved toxins to distinguish Bt toxin-Bt toxin receptor interactions. For, as well as for a novel Bt toxin resistance management strategy.

SUMMARY OF THE INVENTION Compositions and methods for modulating the sensitivity of cells to Bt toxins are provided. The composition is a Lepidopteran insect, European corn borer (ECB, Ost
linia nubialis), corn leafworm (CEW, He)
liothis Zea), and the American procession caterpillar Spodoptera frugiperda (FAW, Sp)
Bt toxin receptor polypeptide from O. optera frugiperda), and fragments and variants thereof. These polypeptides bind to CrylA toxin, and more specifically to CrylA (b). Nucleic acids encoding the polypeptides, antibodies specific for the polypeptides, as well as nucleic acid constructs for expressing the polypeptides in cells of interest are also provided.

These methods identify the structure-function relationship of the Bt toxin receptor; distinguish the toxin-receptor interaction; elucidate the mode of action of Bt toxin; novel Bt toxin receptor ligands It is useful for screening and identifying (including novel insecticide toxins); and for designing and developing novel Bt toxin receptor ligands.

These methods are useful for controlling Bt toxin resistance in plants and protecting plants against damage by plant pests.

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to a novel receptor polypeptide that binds to Bt toxin, which is a receptor from the order Lepidoptera. As a receptor of the present invention, it binds to Bt toxin and binds to the lepidopteran superfamily Py
raloidea and, in particular, Ostrinia species (especially Ostrinia
Nubilalis); and Heliothus Zea (H
． Those receptor polypeptides derived from Zea). These polypeptides have homology to members of the cadherin superfamily of proteins.

Accordingly, the composition of the present invention comprises an isolated polypeptide involved in the binding of Bt toxin. In particular, the invention relates to an isolated nucleic acid molecule containing a nucleotide sequence encoding the amino acid sequences set forth in SEQ ID NOs: 2, 4 and 6; or Patent Deposit No. PTA-278, PTA-1760, and PT
A-2222 provides the nucleotide sequence having the DNA sequence deposited in a plasmid in a bacterial host. Further, a polypeptide having an amino acid sequence encoded by a nucleic acid molecule described herein (eg, those set forth in SEQ ID NOs: 1, 3, and 5); Patent Deposit No. PTA- 278, PT
A-1760, and PTA-2222 deposited in a plasmid in a bacterial host; and fragments and variants thereof are provided.

Plasmids containing the nucleotide sequences of the present invention have been identified in the American Type Culture Collection (ATCC), Manassas, Virginia patent deposit period, June 25, 1999; April 25, 2000; and 2000.
Deposited on July 11, 2010; and patent deposit numbers PTA-278, PTA-176
0, and PTA-2222. These deposits are maintained under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the purposes of patent proceedings. It is not obvious that these deposits are merely made as a matter of convenience to those skilled in the art, and that deposits are required under 35 USC 112.

The term “nucleic acid” refers to all forms of DNA, such as cDNA or genomic DNA and RNA (eg, mRNA), and analogs of DNA or RNA made using nucleotide analogs. The nucleic acid molecule can be single-stranded or double-stranded. The chains may include coding or non-coding chains.

The present invention includes isolated or substantially purified nucleic acid or polypeptide compositions. An "isolated" or "purified" nucleic acid molecule or polypeptide, or biologically active portion thereof, is another cellular material or culture medium if produced by recombinant techniques. Or substantially no chemical precursors or other chemicals when chemically synthesized. Preferably, the "isolated" nucleic acid is the genomic DNA of the organism from which the nucleic acid is derived.
A nucleic acid that does not include a sequence (preferably a sequence encoding a polypeptide) that is a naturally adjacent nucleic acid therein (ie, sequences located at the 5'and 3'ends of the nucleic acid). For example, in various embodiments, the isolated nucleic acid molecule is a naturally flanking nucleic acid in the genomic DNA of the cell from which the nucleic acid is derived, about 5 kb.
It may comprise less than 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence. Polypeptides that are substantially free of cellular material include preparations of polypeptides that have less than about 30%, 20%, 10%, 5% (by dry weight) contaminating polypeptide. When the polypeptide of the invention or biologically active portion thereof is recombinantly produced, preferably the culture medium is less than about 30%, 20%, 10%, or 5% (dry weight). Chemical precursors or non-polypeptide compounds of interest.

However, it is understood that there are embodiments in which preparations that are substantially free of pure polypeptide may also be useful. Thus, impure preparations may be useful if the contaminating materials do not interfere with the specific desired use of the peptide. The compositions of the present invention also include fragments and variants of the disclosed nucleotide sequences, and polypeptides encoded thereby.

The compositions of the present invention are, inter alia, for distinguishing structure-function relationships of Bt toxin receptors; for distinguishing toxin-receptor interactions; for elucidating the mode of action of Bt toxins; In order to screen and identify Bt toxin receptor ligands, including novel insecticide toxins; and to design and develop new Bt toxin receptor ligands, including novel insecticide toxins, It is useful for expressing the receptor polypeptide in cells of interest so as to produce a preparation or an isolated preparation.

The isolated nucleotide sequence encoding the receptor polypeptide of the present invention is expressed in the cell of interest. The Bt toxin receptor polypeptide produced by expression is then utilized in receptor binding assays in intact cells or in vivo, and / or in intact cell toxicity assays. Methods and conditions for Bt toxin binding and toxicity assays are known in the art and include, but are not limited to, those described below: US Pat. No. 5,693,491; P. Keeton et al. (1998) A
ppl. Environ. Microbiol. 64 (6): 2158-216.
5; B. R. Francis et al. (1997) Insect Biochem. M
ol. Biol. 27 (6): 541-550; P. Keeton et al. (19
97) Appl. Environ. Microbiol. 63 (9): 3419
-3425; K. Vadlamudi et al. (1995) J. Am. Biol. Che
m. 270 (10): 5490-5494; Ihara et al. (1998) Comp.
Arative Biochem. Physiol. B 120: 197-20
4; Nagamatsu et al. (1998) Biosci. Biotechnol.
Biochem. 62 (4): 727-734 (incorporated herein by reference). Such methods can be modified by those of skill in the art to develop assays that utilize the polypeptides of the invention.

By “cell of interest” is intended any cell in which expression of a polypeptide of the invention is desired. Cells of interest include, but are not limited to, mammalian, avian, insect, plant, bacterial, fungal, and yeast cells. As the target cells,
Included, but not limited to, cultured cell lines, primary cell cultures, cells in vivo, and cells of transgenic organisms.

The method of the invention encodes with the nucleotide sequences of the invention in a receptor binding and / or toxicity assay to screen candidate ligands and to identify novel Bt toxin receptor ligands, including receptor agonists and antagonists. Using a polypeptide as described above. Candidate ligands include molecules available from various libraries of small molecules produced by combinatorial synthetic methods. Candidate ligands also include, but are not limited to, antibodies, peptides, and other small molecules that are designed or putatively designed to interact with the receptor polypeptides of the invention. As candidate ligands, peptide fragments of receptors, anti-receptor antibodies, anti-idiotypic antibodies that mimic one or more receptor binding domains of toxins, fusion proteins produced by combining two or more toxins or fragments thereof, etc. But is not limited to these. Ligands identified by the screening methods of the present invention include potent novel insecticidal toxins, the insecticidal activity of which can be determined by known methods; eg, US Pat. No. 5,407,454; US No. 09 / 218,942; U.S. patent application Ser. No. 09 / 003,217.

The present invention provides methods for screening ligands that bind to the polypeptides described herein. Both the polypeptide and its related fragments (eg, toxin binding domains) can be used to screen by assays for compounds that bind to the receptor and exhibit the desired binding properties. Desired binding properties include, but are not limited to, binding affinity, binding site specificity, association, and dissociation rate.
The screening assay can be a whole cell or in vitro assay that involves exposing the ligand binding domain to a sample ligand and detecting the formation of a ligand binding polypeptide complex. The assay can be a direct ligand-receptor binding assay or a ligand competition assay.

In one embodiment, the method comprises providing at least one Bt toxin receptor polypeptide of the present invention, contacting the polypeptide with a sample and a control ligand under conditions that promote binding; and , Determining the binding properties of the sample ligand relative to the control ligand. This method includes any method known to those of skill in the art that can be used to provide a polypeptide of the invention in a binding assay. For in vitro binding assays, the polypeptides can be provided as isolated, lysed, or homogenized cellular preparations. The isolated polypeptide is
It can be provided in solution or fixed to the matrix. Methods for immobilizing polypeptides are well known in the art and include, but are not limited to, commercially available constructions with high affinity ligands and the use of fusion polypeptides therewith. For example, GST fusion proteins can be adsorbed on glutathione sepharose beads (Sigma Chemical, St. Louis, MO) or microtiter plates induced by glutathione.
Polypeptides can also be immobilized utilizing techniques well known in the art which utilize the binding of biotin and streptavidin. Polypeptides can also be immobilized using techniques well known in the art, utilizing chemical coupling (ligation) of the polypeptide to the matrix. Alternatively, the polypeptide can be provided in a complete cell binding assay in which the polypeptide is commonly expressed as a cell surface Bt toxin receptor.

The present invention utilizes a complete cytotoxicity assay to screen for ligands that bind to the receptor polypeptides described herein and toxic to cells of interest expressing the polypeptide. Provide a way to do. The ligand selected by this screen expresses the receptor polypeptide (
In particular, it is a powerful insecticidal toxin against insects (in the intestine). This speculation is that the insect specificity of a particular Bt toxin is determined by the presence of the receptor in a specific insect species, or that the toxin binding is specific for receptors of some insect species and other mutations. Body receptors are predicated on insignificant or non-specific binding. For example, Hofte et al. (1989) M
See icrobiol Rev 53: 242-255. Toxicity assay determines exposure of a toxin binding domain of a polypeptide to a sample ligand in intact cells expressing a polypeptide of the invention and the toxicity affected in cells expressing the polypeptide. Including that. By "toxicity" is intended reduced cell viability. By "viability" is intended the ability of a cell to proliferate and / or differentiate and / or maintain its biological characteristics in a manner that is characteristic of that cell in the absence of certain cytotoxic agents.

In one embodiment, the method of the present invention provides at least one cell surface Bt toxin receptor polypeptide of the present invention containing an extracellular toxin binding domain, under conditions that promote binding. Contacting the polypeptide with a sample and a control ligand at, and comparing with the control ligand,
Determining the viability of cells expressing the cell surface Bt toxin receptor polypeptide.

By “contacting” it is intended that the sample and control reagents are presented to the intended ligand binding site of the polypeptide of the invention.

“Binding facilitating conditions” allow the ligands of a polypeptide of the invention to physically and biochemically bind ligands of the intended polypeptide above background levels in a determinable manner. Any combination of conditions is contemplated. Such conditions for the binding of Cryl toxin to the Bt toxin receptor,
As well as examples of methods for assessing binding are known in the art, and Ke
eton et al. (1998) Appl Environ Microbiol 64.
(6): 2158-2165; Francis et al. (1997) Insect B.
iochem. Mol. Biol. 27 (6): 541-550; Keeton.
(1997) Appl. Environ. Microbiol. 63 (9):
3419-3425; Vadlamudi et al. (1995) J. Am. Biol. Che
m. 270 (10): 5490-5494; Ihara et al. (1998) Comp.
Arative Biochemistry and Physiology
Part B 120: 197-204; and Nagamatsu et al. (199).
8) Biosci. Biotechnol. Biochem. 62 (4): 72
7-734, the contents of which are incorporated herein by reference, but are not limited thereto. In this aspect of the invention, known and commercially available methods for studying protein-protein interactions (eg, yeast and / or bacterial two-hybrid systems) can also be used. The two-hybrid system is, for example, CLONTECH (P
alo Alto, Ca) or Display Systems Biote
ch Inc. (Vista, Ca).

The compositions and screening methods of the present invention are useful for designing and developing novel Bt toxin receptor ligands, including novel insecticidal toxins. A variety of candidate ligands; ligands screened and characterized for binding, toxicity, and species specificity; and / or ligands with known characteristics and specificities have specific desired characteristics and specificities. Can be linked or modified to produce a novel ligand having The methods described herein for assessing binding, toxicity, and insecticidal activity can be used to screen and characterize novel ligands.

In one embodiment of the invention, a sequence encoding a receptor of the invention,
And variants and fragments thereof for the Bt toxin of interest (eg,
Used with yeast and bacterial two-hybrid systems to screen for insect molecules that bind to more specific and / or more potent toxins) or receptors, and can be used in developing new insecticides .

By “linked” is intended a covalent bond produced between two or more molecules. Known methods that can be used for the modification and / or ligation of polypeptide ligands such as toxins include mutagenesis and recombination approaches, including but not limited to site-directed mutagenesis, construction of chimeric polypeptides. , And D
Examples include, but are not limited to, NA shuffling. Such methods are described in further detail below. Known methods of modifying polypeptides also include methods for covalent modification of polypeptides. "Operably linked" means that the linked molecules perform the function intended by the linkage.

The compositions and screening methods of the present invention are useful for targeting ligands to cells expressing the receptor polypeptides of the present invention. For targeting, a secondary polypeptide and / or small molecule that does not bind to the receptor polypeptide of the invention is one or more major ligands that bind to the receptor polypeptide, including but not limited to: Linked to: CrylA toxin; more specifically, CrylA (b) toxin or a fragment thereof. This linking allows any polypeptide and / or small molecule linked to the main ligand to be targeted to the receptor polypeptide, thereby targeting cells expressing the receptor polypeptide. Where the ligand binding site is
It is available on the extracellular surface of cells.

In one embodiment of the invention, at least one secondary polypeptide toxin targets an insect expressing a receptor for the major toxin and produces a combined toxin that is toxic thereto. Thus, it is linked to a major CrylA toxin that can bind the receptor polypeptides of the present invention. Such insects include the orders Lepidoptera, the superfamily Pyraloidea, and especially the species Ostrinia (especially Ostrinia nubialis).
) Insects. Such insects include Lepidoptera, S. frugipe
rda and H .; Zea can be used. Such combination toxins are particularly useful for eliminating or reducing grain damage by insects that have become resistant to the major toxins.

For expression of the Bt toxin receptor polypeptide of the present invention in cells of interest,
A Bt toxin receptor sequence is provided in the expression cassette. The cassette contains 5'and 3'regulatory sequences operably linked to the Bt toxin receptor sequence of the invention. In this aspect of the invention, by "operably linked",
A functional linkage between the promoter and the second sequence is contemplated. Here, the promoter sequence initiates and mediates the transcription of the DNA sequence corresponding to the second sequence. For nucleic acids, operably linked generally means that the nucleic acid sequences being linked are contiguous, and, where it is necessary to join the two polypeptide coding regions. And it means within the same reading frame. The cassette further comprises at least one cotransformed into the organism.
It may include one additional gene. Alternatively, the additional gene may be provided on multiple expression cassettes.

Such an expression cassette is provided with multiple restriction sites for insertion of the Bt toxin receptor sequence under the transcriptional regulation of the regulatory region. The expression cassette is further
A selectable marker may be included.

The expression cassette contains the transcription and translation initiation region, the Bt toxin receptor nucleotide sequence of the present invention, and the transcription and translation termination region functions in the host cell 5 ′ to 3 ′ of transcription. The promoter, which is the transcription initiation region, can be native or analog, or foreign or heterologous to the plant host. Furthermore, the promoter can be a native sequence or a synthetic sequence. By "foreign" is intended that the transcription initiation region is not found in the native host cell into which it is introduced. As used herein, a chimeric gene comprises a coding sequence operably linked to a transcription initiation region that is heterologous to the coding sequence.

Although it may be preferred to express the sequence using a heterologous promoter, the native promoter sequence may be used. Such a construct is suitable for Bt in cells of interest.
Alter the expression level of the toxin receptor. Therefore, the phenotype of the cell is changed.

The termination region may be native with a transcription initiation region, native with an operably linked DNA sequence of interest, or may be derived from another source.

Where appropriate, the gene may be optimized for increased expression in the particular transformed cell of interest. That is, the gene may be synthesized using host cell-preferred codons for improved expression.

Further sequence modifications are known to enhance expression of genes in cellular hosts. These include exclusion of sequences encoding pseudo-polyadenylation signals, exon-intron splicing site signals, transposon-like repeats, and other such well-characterized sequences that can be deleterious to gene expression. included. The G-C content of a sequence can be adjusted to average levels for a given cellular host, calculated with reference to known genes expressed in the host cell. If possible, the sequences are modified to avoid putative hairpin secondary mRNA structures.

The expression cassette may further include a 5'leader sequence in the expression cassette construct. Such leader sequences may act to enhance translation. Translation leaders are known in the art and include: a picornavirus leader (eg, EMCV leader (Encephalomyocarditis 5'noncoding region) (Elroy-Stein et al., (1989) PNAS USA 86).
: 6126-6130); potyvirus leader (eg, TEV leader (tobacco etch disease virus) (Allison et al. (198
6)); MDMV leader (maize atrophy mosaic virus (maize)
Dwarf Mosaic Virus); Virology 154: 9-2.
0), and human immunoglobulin heavy chain binding polypeptide (BiP) (Macej).
ak et al. (1991) Nature 353: 90-94); an untranslated leader derived from alfalfa mosaic virus coat polypeptide mRNA (AMV RNA4) (Jobling et al. (1987) Nature 325: 622-).
625); Tobacco mosaic virus leader (TMV) (Gallie et al. (19
89), Molecular Biology of RNA, edited by Cech (L
iss, New York), 237-256); and maize chlorotic mottle virus.
Leader (MCMV) (Lommel et al. (1991) Virology 81:
382-385). Della-Cioppa et al. (1987) Plant Ph
ysiol. See also 84: 965-968. Other methods known to enhance translation, such as introns, may also be utilized.

In preparing the expression cassette, various DNA fragments can be engineered to provide DNA sequences in the proper orientation and, if appropriate, in the proper reading frame. To this end, adapters or linkers can be used to ligate the DNA fragments, or to provide other convenient manipulation restriction sites, removal of unnecessary DNA, restriction site removal, etc. May be included. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitution (eg translocation and transversion) may be included.

Using the nucleic acids of the present invention, the polypeptides of the present invention can be used to select any cell of interest (a particular selection of cells depending on factors such as the desired level of expression and / or receptor activity). A). Cells of interest include, but are not limited to, mammalian, plant, insect, bacterial, and yeast host cells that are conveniently available. The choice of promoter, terminator, and other components of the expression vector will also depend on the cell selected. Cells have been genetically modified to do so through human intervention, so that they may be used in non-natural conditions (eg,
Quantity, composition, location, and / or time).

One of skill in the art will be familiar with the numerous expression systems available for expression of nucleic acids that encode the proteins of the present invention. No attempt has been made to detail the various known methods for the expression of proteins in prokaryotes or eukaryotes.

In summary, expression of an isolated nucleic acid encoding a protein of the invention is typically accomplished by operably linking, eg, DNA or cDNA to a promoter, followed by expression in an expression vector. Is achieved by The vector may be suitable for replication and integration in either prokaryotes or eukaryotes. A typical expression vector contains transcription and translation terminators, initiation sequences, and a promoter that are useful for controlling expression of the DNA encoding the proteins of the present invention. In order to obtain high level expression of cloned genes, it is possible to construct an expression vector containing at least a strong promoter directing transcription, a ribosome binding site for translation initiation, and a transcription / translation terminator. Desired. The person skilled in the art is aware that modifications can be made to the proteins of the invention without diminishing the biological activity. Some modifications may be made to facilitate cloning, expression, or uptake of the targeting molecule into the fusion protein. Such modifications are well known to those of skill in the art and make, for example, a methionine added to the amino terminus to provide an initiation site, or a conveniently placed restriction site or stop codon, or the sequence is purified. To include additional amino acids (eg, poly-His) placed at either end.

Prokaryotic cells can be used as hosts for expression. Prokaryotes are E. c
Most often represented by various strains of oli; however, other microbial strains may also be used. Defined herein to include a promoter for transcription initiation and optionally an operator (along with a ribosome binding site sequence),
Commonly used prokaryotic control sequences include such commonly used promoters as the β-lactamase (penicillinase) and lactose (lac) promoter systems (Chang et al. (1977) Nature 198: 105.
6), tryptophan (trp) promoter system (Goeddel et al. (1
980) Nucleic Acid Res. 8: 4057), and the PL promoter and N-gene ribosome binding site (Shi that are induced by λ.
Matake et al. (1981) Nature 292: 128). E.
It is also useful to include a selectable marker in the DNA vector that is transfected into E. coli. Examples of such markers include genes that direct resistance to ampicillin, tetracycline, or chloramphenicol.

The vector is chosen to allow introduction into a suitable host cell. Bacterial vectors are typically of plasmid or phage origin. Appropriate bacterial cells are infected with phage vector particles or transfected with naked phage vector DNA. If a plasmid vector is used, bacterial cells are transfected with the plasmid vector DNA.
An expression system for expressing the protein of the present invention is Bacillus sp
． And Salmonella (Palva et al. (1983) Gene 22: 2.
29-235; Mosbach et al. (1983) Nature 302: 543.
545).

Various eukaryotic expression systems, such as yeast, insect cell lines, plants, and mammalian cells are known to those of skill in the art. The sequences of the invention can be expressed in these eukaryotic systems. In some embodiments, transformed / transfected plant cells are used as an expression system for the production of the proteins of the invention.

The synthesis of heterologous proteins in yeast is well known. Sherman, F .; , (
1982) Methods in Yeast Genetics, Cold.
The Spring Harbor Laboratory is a well-recognized task that describes the various methods available for producing proteins in yeast. Two widely used yeasts for the production of eukaryotic proteins are:
Saccharomyces cerevisia and Pichia Pas
toris. Vectors, strains, and protocols for expression in Saccharomyces and Pichia are known in the art and are available from commercial suppliers (eg, Invitrogen). Suitable vectors usually include expression control sequences, such as the desired promoter (including 3-phosphoglycerate kinase or alcohol oxidase), an origin of replication,
Termination sequence, etc.).

The proteins of the invention, once expressed, can be isolated from yeast by lysing the cells and subjecting the lysate to standard protein isolation techniques. Monitoring the purification process can be accomplished by using Western blot techniques, or radioimmunoassays, or other standard immunoassay techniques.

Sequences encoding the proteins of the invention can also be linked to a variety of expression vectors for use in transfecting cell culture (eg, of mammalian, insect, or plant origin). Examples of cell cultures that are useful for producing peptides are mammalian cells. Mammalian cell systems are often in the form of monolayers of cells, although suspensions of mammalian cells can also be used. Many suitable host cell lines capable of expressing the complete protein have been developed in the art, and CO
Includes S, HEK293, BHK21, and CHO cell lines. Expression vectors for these cells may include expression control sequences such as: origin of replication, promoters (eg CMV promoter, HSV tk promoter or pgk (phosphoglycerate kinase promoter)), enhancer (Q
ueen et al., (1986) Immunol. Rev. 89:49), and an essential processing information site (eg, ribosome binding site, RNA splicing site, polyadenylation site (eg, SV40 large T Ag poly A addition site).
, And a transcription terminator sequence. Other animal cells useful for the production of the proteins of the invention are, for example, the American Type Culture Co.
reflection Catalog of Cell Lines and
It is available from Hybridomas (7th edition, 1992). A specific example of mammalian cells for assessing Bt toxin receptor expression and receptor-mediated cytotoxicity of Bt toxin includes embryonic 293 cells. See US Pat. No. 5,693,491, which is incorporated herein by reference.

Suitable vectors for expressing the promoters of the invention in insect cells are usually derived from SF9 baculovirus. As a suitable insect cell line, bow hula,
Silkworm, weevil, moth, and Drosophila cell lines (eg, Sc
hneider cell line) (Schneider et al. (1987), J.
． Embryol. Exp. Morphol. 27: 353-365).

As with yeast, when higher animal or plant host cells are used, a polyadenylation sequence or transcription terminator sequence is typically incorporated into the vector. An example of a terminator sequence is the polyadenylation sequence derived from the bovine growth hormone gene. Sequences for correct splicing of transcripts may also be included. An example of a splicing sequence is the VP1 intron derived from SV40 (Sprague et al. (1983) J. Virol. 45: 773.
781). In addition, genetic sequences for controlling replication in host cells can be incorporated into the vector, such as those found in bovine papillomavirus-type vectors. Saveria-Campo, M .; , Bovine Papillo
ma Virus DNA a Eukaryotic Cloning Ve
Ctor in DNA Cloning, Volume II a Practical
Approach, D.M. M. Glover, IRL Press, Arli
ngton, Virginia, pp. 213-238 (1985).

In certain embodiments of the invention, receptor binding is negatively regulated, especially when toxicity to cells is no longer desired, or where it is desired to reduce toxicity to lower levels. It may be desired. In this case, a ligand-receptor polypeptide binding assay can be used to screen for compounds that bind to the receptor but do not confer toxicity to cells expressing the receptor. Examples of molecules that can be used to block ligand binding include antibodies that specifically recognize the ligand binding domain of the receptor so that binding of the ligand is reduced or prevented as desired.

In another embodiment, the expression of the receptor polypeptide is the receptor RN
It can be blocked by the use of antisense molecules directed against A, or ribozymes specifically targeted to the receptor RNA. Using the nucleic acid sequence provided, the messenger RNA (mRNA of the Bt toxin receptor sequence
It is recognized that antisense constructs can be constructed that are complementary to at least a portion of Antisense nucleotides are constructed to hybridize to the corresponding mRNA. The modification of the antisense sequence is performed by modifying the corresponding mR
It can be done so long as it hybridizes to NA and interferes with its expression. In this manner, antisense constructs having 70%, preferably 80%, more preferably 85% sequence similarity to the corresponding antisense sequence can be used. In addition, some of the antisense nucleotides can be used to disrupt expression of the target gene. Generally, sequences of at least 50 nucleotides, 100 nucleotides, 200 nucleotides or larger can be used.

Fragments and variants of the disclosed nucleotide sequences and the polypeptides encoded thereby are included in the present invention. By "fragment"
Part of the nucleotide sequence, or part of the amino acid sequence, and thus part of the polypeptide encoded by it is intended. Fragments of the nucleotide sequence retain the biological activity of the native polypeptide and may, for example, encode a polypeptide fragment that binds Bt toxin. Alternatively, fragments of nucleotide sequences useful as hybridization probes generally do not encode fragment polypeptides that retain biological activity. Thus, fragments of a nucleotide sequence can range from at least about 20 nucleotides, about 50 nucleotides, about 100 nucleotides, and more up to the full length nucleotide sequence encoding a polypeptide of the invention.

A fragment of the nucleotide sequence of the Bt toxin receptor encoding the biologically active portion of the Bt toxin receptor polypeptide of the invention comprises at least 15,
Encodes 25, 30, 50, 100, 150, 200, or 250 contiguous amino acids, or more, to all numbers of amino acids present in the full-length Bt toxin receptor polypeptides of the invention ( (For example, 1717, 1730, and 1734 amino acids of SEQ ID NOs: 2, 4, and 6, respectively). Fragments of the nucleotide sequence of the Bt toxin receptor that are useful as hybridization probes for PCR primers generally do not necessarily need to encode the biologically active portion of the Bt toxin receptor polypeptide.

Thus, a fragment of the Bt toxin receptor nucleotide sequence can encode a biologically active portion of a Bt toxin receptor polypeptide, or it can be a hybridization probe using the methods disclosed below. Or P
It can be a fragment that can be used as a CR primer. The biologically active portion of the Bt toxin receptor polypeptide is isolated from a portion of one of the Bt toxin receptor nucleotide sequences of the invention, expressing the encoded portion of the Bt toxin receptor polypeptide (eg, , By recombinant expression in vitro),
And can be prepared by assessing the activity of the encoded portion of the Bt toxin receptor polypeptide. A nucleic acid molecule that is a fragment of the Bt toxin receptor nucleotide sequence has at least 16, 20, 50, 75, 100, 150, 2
00, 250, 300, 350, 400, 450, 500, 550, 600, 6
50, 700, 800, 900, 1,000, 1,100, 1,200, 1,3
The number of nucleotides present in the full length Bt toxin receptor nucleotide sequence disclosed herein from 00, or 1400 nucleotides, or more (eg, 5498 for SEQ ID NOS: 1, 3, and 5, respectively, 54, 552
7 and up to 5614 nucleotides).

By “variant” is intended a substantially similar sequence. For nucleotide sequences, conservative variants include sequences that encode one amino acid sequence of a Bt toxin receptor polypeptide of the invention due to the degeneracy of the genetic code. Naturally occurring allelic variants such as these are identified using well-known molecular biology techniques, for example using the polymerase chain reaction (PCR) and hybridization techniques as outlined below. Can be done. Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those made by using site-directed mutagenesis, but still encoding the Bt toxin receptor proteins of the invention. In general, variants of a particular nucleotide sequence of the invention, as determined by the sequence alignment program described elsewhere herein using default parameters,
At least about 40%, 50%, 60% for that particular nucleotide sequence,
65%, 70%, generally at least about 75%, 80%, 85%, preferably at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97.
%, And more preferably at least about 98%, 99%, or higher sequence identity.

A “variant” protein allows for the N-terminus and / or C of the native protein.
One or more amino acid deletions (so-called truncations) or additions to the termini; one or more amino acid deletions or additions at one or more sites in the native protein; or one or more in the native protein Proteins derived from the native protein by substitution of one or more amino acids at the site of are contemplated. The variant proteins encompassed by the present invention are biologically active, ie, they have the desired biological activity of the native protein (ie, the activity described herein (eg, Bt toxin). Binding activity)). Such variants are
For example, it may occur due to genetic polymorphism or by human manipulation. Biologically active variants of the native Bt toxin receptor protein of the present invention may be derived from naturally occurring variants as determined by the sequence alignment program described elsewhere herein using default parameters. At least about 40%, 50%, 60%, 65%, 70%, generally at least about 75%, 80%, 85%, preferably at least about 90%, 9 relative to the amino acid sequence of the protein of
Have 1%, 92%, 93%, 94%, 95%, 96%, 97%, and more preferably at least about 98%, 99%, or more sequence identity. The biologically active variants of the protein of the present invention include 1 to 15 amino acid residues, 1 to 10 amino acids, for example, 6 to 10 amino acids, 5 amino acids, 4 amino acids and 3 amino acids. It may differ from the protein by one, two, or even one amino acid residue.

The polypeptides of the present invention may be altered in various ways, including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art. For example, amino acid sequence variants of Bt toxin receptor polypeptide can be prepared by mutations in DNA. Methods for mutagenesis and alteration of nucleotide sequences are well known in the art. For example, Kunkel (19
85) Proc. Natl. Acad. Sci. USA 82: 488-492.
Kunkel et al. (1987) Methods in Enzymol. 154
: 367-382; U.S. Pat. No. 4,873,192; Walker and Ga.
astra ed. (1983) Technologies in Molecular
Biology (MacMillan Publishing Company)
, New York), as well as the references cited therein. Guidance for appropriate amino acid substitutions that do not affect the biological activity of the protein of interest are incorporated by reference herein, such as Dayhoff et al. (1978) Atlas of Protein Sequence and.
Structure (Natl. Biomed. Res. Found., Was
Hington, D.H. C. ) Model. Conservative substitutions, such as exchanging one amino acid with another having similar properties, may be preferred.

Thus, the gene and nucleotide sequences of the present invention include both naturally occurring sequences as well as variant forms. Similarly, the proteins of the present invention include both naturally occurring proteins, as well as variants and modified forms thereof. Such variants continue to possess the desired toxin binding activity. Apparently, the mutations made in the DNA encoding the variant should not place the sequence outside the open reading frame, and preferably the secondary mR
It does not create complementary regions that could give rise to NA structures. European Patent Application Publication No. 75,
See No. 444.

Deletions, insertions, and substitutions of the protein sequences included herein are not expected to result in fundamental changes in protein characteristics.

For example, from the N-terminus of the polypeptide having the amino acid sequence shown in SEQ ID NO: 2, at least about 10, 20, 50, 100, 150, 200, 250, 300
, 350, 400, 450, 500, 550, 600, 650, 700, 750
It is recognized that up to 800, 850, 900, 950, and 960 amino acids can be deleted and still retain the binding function. Further, at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110.
, And up to 119 amino acids can be deleted from the C-terminus of the polypeptide having the amino acid sequence shown in SEQ ID NO: 2, and it is recognized that it still retains binding function. Deletion variants of the invention include polypeptides that have these deletions. Deletion variants of the invention which retain the binding function may have deletions at their N- or C-termini or may have any combination of deletions at both C- and N-termini. It is understood to include the polypeptide.

However, if it is difficult to predict the exact effect of the substitutions, deletions, or insertions so made, one skilled in the art will appreciate that the effect is assessed by routine screening assays. recognize. That is, activity can be assessed by receptor binding and / or toxicity assays. See, for example, US Pat. No. 5,693,491; T. et al., Incorporated herein by reference. P. Keeton et al.
1998) Appl. Environ. Microbiol. 64 (6): 21
58-2165; B. R. Francis et al. (1997) Insect Bio
chem. Mol. Biol. 27 (6): 541-550; P. Keet
on et al. (1997) Appl. Environ. Microbiol. 63 (9
): 3419-3425; K. Vadlamudi et al. (1995) J. Am. Bi
ol. Chem. 270 (10): 5490-5494; Ihara et al. (199).
8) Comparative Biochem. Physiol. B 120:
197-204; Nagamatsu et al. (1998) Biosci. Biote
chnol. Biochem. 62 (4): 727-734.

Variant nucleotide sequences and polypeptides also include sequences and polypeptides derived by mutagenesis and recombination procedures such as DNA shuffling. Using such a procedure, novel toxin receptors are created, including, but not limited to, novel Bt toxin receptors in which the sequences encoding one or more different toxin receptors possess the desired properties. Can be manipulated for. In this manner, a library of recombinant polynucleotides has a substantial sequence identity and a population of polynucleotides of related sequence containing sequence regions capable of homologous recombination in vitro or in vivo. Made from. For example, using this approach, a sequence motif encoding the domain of interest may be present between the Bt toxin receptor gene of the present invention and other known Bt toxin receptor genes,
It can be shuffled to obtain novel genes that encode polypeptides having improved properties of interest (eg, increased ligand affinity in the case of receptors). The strategy for such DNA shuffling is
Known in the art. For example, Stemmer (1994) Proc. Nat
l. Acad. Sci. USA 91: 10747-10751; Stemme.
r (1994) Nature 370: 389-391; Crameri et al. (1).
997) Nature Biotech. 15: 436-438; Moore et al. (1997) J. Am. Mol. Biol. 272: 336-347; Zhang et al.
1997) Proc. Natl. Acad. Sci. USA 94: 4504-
4509; Crameri et al. (1998) Nature 391: 288-29.
1; and U.S. Patent Nos. 5,605,793 and 5,837,448.

When a receptor polypeptide of the invention is expressed in cells and associates with the cell membrane (eg, by a transmembrane segment), the receptor of the invention binds the desired ligand (eg, CrylA toxin). In order to do so, the ligand binding domain of the receptor must be made available to the ligand. In this aspect, it is recognized that the native Bt toxin receptor of the present invention is oriented so that the toxin binding site is available extracellularly.

Thus, in methods involving the use of intact cells, the invention provides cell surface Bt toxin receptors. By "cell surface Bt toxin receptor" is intended a membrane-bound receptor polypeptide containing at least one extracellular Bt toxin binding site. The cell surface receptors of the present invention include a suitable combination of signal sequences and transmembrane segments to direct and retain the receptor at the cell membrane such that the toxin binding site is available extracellularly. Natural Bt
When the toxin receptor is used for expression, the estimation of the composition and conformation of the signal sequence and transmembrane segment ensures the topology of the polypeptide suitable for presenting the toxin binding site extracellularly. That is not necessary. As an alternative to the native signal and transmembrane sequences, heterologous signal and transmembrane sequences can be utilized to generate the cell surface receptor polypeptides of the invention.

Making a Bt toxin receptor capable of interacting with a ligand for a receptor that is available intracellularly in the cytoplasm, nucleus, or other organelle, other subcellular spaces; or in the extracellular space. It is recognized that can be an objective. Accordingly, the invention includes variants of the receptor of the invention in which one or more segments of the receptor polypeptide are modified to target the polypeptide to a desired intracellular or extracellular location.

Also included by the invention are receptor fragments and variants that are useful as binding antagonists that compete with the cell surface receptors of the invention, among other things. Such fragments or variants can, for example, bind toxins but are not toxic to specific cells. In this aspect, the invention provides secreted receptors, and more particularly secreted Bt toxin receptors; or receptors that are not membrane bound. The secreted receptor of the present invention may include a heterologous or cognate signal sequence that facilitates its secretion from cells expressing the receptor; and further includes variations in secretion in the region corresponding to the transmembrane segment. By "secretion variation," one or more deletions of the amino acid corresponding to the transmembrane segment of the membrane-bound receptor,
It is intended to include substitutions, insertions, or any combination thereof; as a result,
This region no longer retains the requisite hydrophobicity to act as a transmembrane segment. Alteration of sequences to create a secretion variation can be tested by confirming secretion of the polypeptide containing the variation by cells expressing the polypeptide.

The polypeptide of the present invention may be purified from cells which naturally express it, purified from cells which have been modified to express it (ie recombinant), or in the art. Can be synthesized using well-known polypeptide synthesis techniques in.
In one embodiment, the polypeptide is produced by recombinant DNA methods. In such a method, the nucleic acid molecule encoding the polypeptide is cloned into an expression vector as described more fully herein and in a suitable host cell according to methods known in the art. Is expressed in. The polypeptide is then isolated from the cells using polypeptide purification techniques well known to those of skill in the art. Alternatively, the polypeptide or fragment can be synthesized using peptide synthesis methods well known to those skilled in the art.

The invention also includes fusion polypeptides in which one or more polypeptides of the invention are fused to at least one polypeptide of interest. In one embodiment, the invention comprises a fusion polypeptide in which the heterologous polypeptide of interest has an amino acid sequence that is not substantially homologous to the polypeptide of the invention. In this embodiment, the polypeptide of the invention and the polypeptide of interest may or may not be operably linked. An example of an operable linkage is an in-frame fusion such that a single polypeptide is produced upon translation. Such fusion polypeptides may, for example, facilitate purification of recombinant polypeptides.

In another embodiment, the fused polypeptide of interest may include a heterologous signal sequence at the N-terminus that facilitates its secretion from a specific host cell. Thereby expression and secretion of the polypeptide can be increased by the use of heterologous signal sequences.

The invention also relates to a polypeptide in which one or more domains in the polypeptides described herein are operably linked to a heterologous domain having a homologous function. It also concerns. Thus, toxin binding domains can be replaced with toxin binding domains for other toxins. Thereby, the toxin specificity of the receptor is
Although based on a toxin binding domain other than the domain encoded by the Bt toxin receptor, other characteristics of the polypeptide (eg, membrane localization and topology) are:
Based on the toxin receptor.

Alternatively, the native Bt toxin binding domain may be retained, while additional heterologous ligand binding domains, including but not limited to heterologous toxin binding domains, are included by the receptor. Accordingly, the invention also includes fusion polypeptides in which the polypeptide of interest is a heterologous polypeptide containing a heterologous toxin binding domain. Examples of heterologous polypeptides containing a Cryl toxin binding domain include:
Knight et al. (1994) Mol Micro 11: 429-236; Le.
e et al. (1996) Appl Environ Micro 63: 2845-2.
849; Gill et al. (1995) J. Am. Biol. Chem. 270: 27277
-27282; Garczynski et al. (1991) Appl. Environ
． Microbiol. 10: 2816-2820; Vadlamudi et al. (1
995) J. Biol. Chem. 270 (10): 5490-4, U.S. Pat. No. 5,693,491, but is not limited thereto.

The Bt toxin receptor peptides of the invention can also be fused to other members of the cadherin superfamily. Such fusion polypeptides may provide an important reflection of the binding properties of superfamily members. Such combinations further extend the range of adaptive capacities of these molecules in a wide range of systems or species, which may otherwise not be sensitive to native or relatively homologous polypeptides. Can be used. The fusion construct may be replaced with a system in which the natural construct is not functional due to species-specific constraints. Hybrid constructs further cannot be obtained using combinations of naturally occurring polypeptides,
It may exhibit desirable or unusual characteristics.

Polypeptide variants encompassed by the present invention include polypeptide variants that contain a mutation that either enhances or reduces one or more domain functions. For example, mutations can be introduced into the toxin binding domain that increase or decrease the sensitivity of the domain to specific toxins.

As an alternative to introducing mutations, an increase in function can be provided by increasing the copy number of the ligand binding domain. Thus, the invention also includes receptor polypeptides in which the toxin binding domain is provided in one or more copies.

The present invention further includes cells containing a Bt toxin receptor sequence, and receptor expression vectors containing fragments and variants thereof. Expression vectors can contain one or more expression cassettes used to transform cells of interest. Transcription of these genes can be placed under the control of a constitutive or inducible (eg, tissue- or cell cycle-preferred) promoter.

If more than one expression cassette is utilized, the cassette added to the cassette containing at least one receptor sequence of the invention may be a receptor sequence of the invention or any other Any of the desired sequences of

The nucleotide sequences of the present invention may be used in insect species other than ostrinia, especially in other
It can be used to isolate homologous sequences in Lepidoptera species, and more particularly in other Pyraloidea species.

The following terms are used to describe the sequence relationships between two or more nucleic acids or polynucleotides: (a) “reference sequence”, (b) “comparison window”, (c
) "Sequence identity", (d) "Percentage of sequence identity", and (e) "Substantial identity".

(A) As used herein, a "reference sequence" is a defined sequence used as a basis for sequence comparisons. The reference sequence may be a subset or the entire identified sequence; eg, a segment of a full-length cDNA or gene sequence, or a complete cDNA or gene sequence.

(B) As used herein, a “comparison window” creates a reference to a contiguous and specialized segment of a polynucleotide sequence. Here, the polynucleotide sequences in the comparison window have additions or deletions (ie, gaps) compared to the reference sequence (which does not include additions or deletions) for optimal alignment of the two sequences. May be included. In general, the comparison window is
It is at least 20 contiguous nucleotides in length, and can be 30, 40, 50, 100, or more in length, as desired. Those skilled in the art
It is understood that gap penalties are typically introduced and subtracted from the number of matches in order to avoid high similarities to the reference sequence due to inclusion of gaps in the polynucleotide sequence.

Methods of aligning sequences for comparison are well known in the art. Therefore,
The determination of percent identity between any two sequences can be accomplished using a mathematical algorithm. A non-limiting example of such a mathematical algorithm is
Myers and Miller (1988) CABIOS 4: 11-17 algorithm; Smith et al. (1981) Adv. Appl. Math. 2:48
2 local homology algorithms; Needleman and Wunsch (1
970) J. Mol. Biol. 48: 443-453 homology alignment algorithm; Pearson and Lipman (1988) Proc. Na
tl. Acad. Sci. 85: 2444-2448 similarity search method; Karlin and Altschul (1993) Proc. Natl. A
cad. Sci. USA 90: 5873-5877, modified as in Karlin and Altschul (1990) Proc. Natl. Ac
ad. Sci. This is the algorithm of USA 87264.

Computer execution of these mathematical algorithms can be utilized for sequence comparisons to determine sequence identity. As such execution, PC
/ CLUSTAL (Intelligenetics, in the Gene program,
Available from Mountain View, California); ALIG
N program (version 2.0); ALI PLUS program (version 3.0, copyright 1997); and Wisconsin Gen
etics Software Package, GAP, B in version 8
ESTFIT, BLAST, FASTA, and TFASTA (Genetic
s Computer Group (GCG), 575 Science Dr
available from Ive, Madison, Wisconsin, USA), but is not limited thereto. Alignments using these programs can be performed using the default parameters. The CLUSTAL program is reviewed by Higgins et al. (1988) Gene 73: 237-244 (198).
8); Higgins et al. (1989) CABIOS 5: 151-153; Co.
rpet et al. (1988) Nucleic Acids Res. 16: 1088
1-90; Huang et al. (1992) CABIOS 8: 155-65; and Pearson et al. (1994) Meth. Mol. Biol. 24: 307-3
31 is fully described. The ALIGN and ALIGN PLUS programs are based on the algorithm of Myers and Miller (1988) supra. A PAM120 mass residue table, a gap length penalty of 12, and a gap penalty of 4 can be used with the ALIGN program when comparing amino acid sequences. Altschul (1990) J. Mol. B
iol. 215: 403 BLAST program by Karlin and Alt
Schul (1990) Based on the algorithm described above. BLAST nucleotide searches can be performed using the BLASTN program, score = 100, wordlength = 12 to obtain nucleotide sequence homology to nucleotide sequences encoding the proteins of the invention. BLAST protein search is BLASTX
The program, score = 50, wordlength = 3 can be used to obtain amino acid sequence homology to a protein or polypeptide of the invention. To obtain a gapped alignment for comparison purposes, use Gapp
ed BLAST (in BLAST 2.0) was reported by Altschul et al.
997) Nucleic Acids Res. 25: 3389 can be used. Alternatively, PSI-BLAST (in BLAST 2.0) can be used to perform an iterated search which detects different relationships between molecules. See Altschul et al. (1997) supra. When using BLAST, Gapped BLAST, PSI-BLAST, default parameters of each program (for example, BL for nucleotide sequences
ASTN, for proteins BLASTX) may be used. http: /
/ Www. ncbi. hlm. nih. gov. checking ... Alignment can also be done manually by visual inspection.

Unless otherwise stated, the sequence identity / similarity values provided herein refer to values obtained using GAP Version 10 using the following parameters: 50 GAP Weight and 3 Length Weig
% identity using ht; 12 GAP Weight and 4 Length
% Similarity using Weight, or any equivalent program. An "equivalent program", for any two sequences of interest, matches the same nucleotide or amino acid residue and the same percent sequence identity when compared to the corresponding alignments produced by the preferred program. Any sequence comparison program that produces an alignment having

GAP searched Needleman and Wunsch (to find an alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps.
1970) J. Mol. Biol. 48: 443-453 algorithm is used. GAP considers all possible alignments and gap positions and creates an algorithm with the largest number of matching bases and the fewest gaps. This allows for the provision of gap creation and gap extension penalties in units of matched bases. GAP is
The number of matching gap creation penalties for each gap it inserts must be utilized. If a gap extension penalty of greater than 0 is selected, then GAP also utilizes, for each gap, the length of the inserted gap times the gap extension penalty. Wisconsin Genetics Software Package for protein sequences
The default gap creation penalty values and gap extension penalty values in version 10 are 8 and 2, respectively. For nucleotide sequences, the default gap creation penalty is 50, while the default gap extension penalty is 3. Gap creation and gap extension penalties may be indicated as an integer selected from the group of integers consisting of 0 to 200. Thus, for example, the gap creation and gap extension penalties are 0
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35
, 40, 45, 50, 55, 60, 65 or more.

GAP represents one member of the family of best alignments. Many members of this family may exist, but others do not have good quality. GAP exhibits the advantages of four values for alignment; quality, ratio, identity, and similarity. Quality is a metric that is maximized to align sequences. Ratio is the quality divided by the number of bases in the shorter segment. Percent identity is the percentage of symbols that actually match. Percent similarity is the percentage of symbols that are similar. Symbols that cross the gap are ignored. Similarity is scored as a similarity threshold if the value of the scoring matrix for the pair of symbols is greater than or equal to 0.50. Wisco
The scoring matrix used in version 10 of the Nsin Genetics Software Package is BLOSUM62 (Henikoff and Henikoff (1989) Proc. Natl.
Acad. Sci. USA 89: 1010915).

(C) As used herein, “sequence identity” or “identity”, in the context of two nucleic acid or polypeptide sequences, refers to maximal match over the specified comparison window. To refer to residues in the two sequences that are the same when aligned. When percent sequence identity is used with respect to proteins, non-identical residue positions often differ by conservative amino acid substitutions, where amino acid residues have similar chemical properties (eg, charge or hydrophobicity). sex)
It is intended that it be substituted with another amino acid residue having, and thus does not alter the functional properties of the molecule. If the sequences differ in conservative substitutions, percent sequence identity may be adjusted upward to correct the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity." Means for making this adjustment are well known to those of skill in the art. This typically involves scoring conservative substitutions for parts other than complete mismatches, thereby increasing the percent sequence identity. Thus, for example, if the same amino acid is given a score of 1 and the non-conservative substitution is given a score of 0, a conservative substitution is given a score between 0 and 1. Scoring of conservative substitutions can be performed, for example, by the program PC / GENE (Intelligene).
Tics, Mountain View, Calif.).

(D) As used herein, “percentage of sequence identity” means a value determined by comparing two optimally aligned sequences over a comparison window. Here, a portion of a polynucleotide sequence in a comparison window is added when compared to a reference sequence (which does not include additions or deletions) for optimal alignment of the two sequences. Or deletion (ie,
Gap) may be included. The ratio determines the number of positions where the same nucleobase or amino acid residue occurs in both sequences to obtain the number of matched positions, the number of matched positions in the total number of positions in the comparison window. Calculated by dividing and multiplying the result by 100 to get the percentage sequence identity.

(E) (i) The term "substantial identity" of polynucleotide sequences refers to using one of the alignment programs described using standard parameters,
Polynucleotides have at least 70% sequence identity, preferably at least 80% sequence identity, more preferably at least 90% sequence identity, and most preferably at least 70%, when compared to a reference sequence. It is meant to include sequences with 95% sequence identity. Those of skill in the art will appreciate that these values determine the corresponding identities of the proteins encoded by the two nucleotide sequences by considering codon degeneracy, amino acid similarity, reading frame localization, and the like. Recognize that it can be adjusted appropriately. Substantial identity of amino acid sequences for these purposes usually means at least 60%, more preferably at least 70%, 80%, 90%, and most preferably at least 95% sequence identity. .

Another indication that the nucleotide sequences are substantially identical is when the two molecules hybridize to each other under stringent conditions. Generally, stringent conditions are selected to be about 5 ° C. below the thermal melting point (T _m ) for a particular sequence at a defined ionic strength and pH. However, stringent conditions include temperatures in the range of about 1 ° C. to about 20 ° C. below T _m , depending on the desired degree of stringency, as provided elsewhere herein. . Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides they encode are substantially identical. This can occur, for example, if a copy of the nucleic acid is made using the maximum codon degeneracy permitted by the genetic code. One indication that two nucleic acid sequences are substantially identical is that the polypeptide encoded by the first nucleic acid sequence is the second
Immunologically cross-reacting with the polypeptide encoded by the nucleic acid sequence of

(E) (ii) In the context of peptides, the term “substantially identical” means that the peptides have at least 70% sequence identity with the reference sequence, preferably 80%, more preferably 85%. Most preferably, applications are indicated that contain at least 90% or 95% sequence identity to the reference sequence over the specified window. Preferably, the optimal alignment is Needleman and Wunsch (19
70) J. Mol. Biol. 48: 443-453 homology alignment algorithm. An indication that the two peptide sequences are substantially identical is that one peptide is immunologically reactive with the antibody raised against the second peptide. Thus, a peptide is substantially identical to a second peptide, for example, where the two peptides differ only by a conservative substitution. "
Peptides that are "substantially similar" share sequences such as those described above, except that non-identical residue positions may differ by conservative amino acid changes.

The nucleotide sequences of the invention can be used in other organisms, especially other insects, and more particularly
Can be used to isolate the corresponding sequences from other Lepidoptera species). In this manner, methods such as PCR, hybridization, etc. can be used to identify such sequences based on their sequence homology to the sequences set forth herein. Included in the present invention are sequences isolated based on their sequence identity to the entire Bt toxin receptor sequences shown herein or fragments thereof. Such sequences include sequences that are orthologs of the disclosed sequences. By "ortholog" is intended a gene that is derived from a gene of a common ancestor and is found in different species as a result of speciation. Genes found in different species are such that their nucleotide sequences and / or their encoded protein sequences share substantial identity as defined elsewhere herein. , Considered an ortholog. The functions of orthologs are often highly conserved among species.

In the PCR approach, oligonucleotide primers can be designed for use in a PCR reaction to amplify the corresponding DNA sequence from cDNA or genomic DNA extracted from any organism of interest. Methods for designing PCR primers and methods for PCR cloning are generally known in the art, and Sambrook et al. (1989) Molecular Cl.
oning: A Laboratory Manual (2nd edition, Cold S)
pring Harbor Laboratory Press, Plainv
(New, New York). Innis et al. (1990) P
CR Protocols: A Guide to Methods and
Applications (Academic Press, New York)
); Innis and Gelfand (1995) PCR Strategi.
es (Academic Press, New York); and Infini
s and Gelfand ed. (1999) PCR Methods Manual
See also (Academic Press, New York). Known PCR methods include methods using paired primers, nested primers, single-strand-specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially incompatible primers, etc. It is not limited to these.

In hybridization techniques, all or part of a known nucleotide sequence is in a population of cloned genomic DNA or cDNA fragments (ie, a genomic or cDNA library) derived from the selected organism. Used as a probe that selectively hybridizes to other corresponding nucleotide sequences present in Hybridization probes include genomic DNA fragments, cDNA fragments, RNA fragments,
Or it can be another oligonucleotide and can be labeled with a detectable group, such as ³² P, or any other detectable marker. Thus, for example, probes for hybridization can be made by labeling synthetic oligonucleotides based on the Bt toxin receptor sequences of the invention. Methods for the hybridization of cDNA and genomic libraries and for the preparation of probes for construction are generally known in the art, and Samb
look et al. (1989) Molecular Cloning: A Labor.
atory Manual (2nd edition, Cold Spring Harbor)
(Laboratory Press, Plainview, New York)
Is disclosed in.

For example, probes in which the entire Bt toxin receptor sequence disclosed herein, or one or more portions thereof, can specifically hybridize to the corresponding Bt toxin receptor sequence and messenger RNA. Can be used as. In order to achieve specific hybridization under various conditions, such a probe is unique between the Bt toxin receptor sequences, and, preferably,
At least about 10 nucleotides in length, and most preferably at least about 20 nucleotides.
Contains sequences that are the length of the nucleotides. Such probes can be used to amplify the corresponding Bt toxin receptor sequence from selected plants by PCR. This technique can be used as a diagnostic assay to isolate additional coding sequences from the desired organism or to determine the presence of coding sequences in the organism. Hybridization techniques include hybridization screening of plated DNA libraries (either plaques or colonies; eg Sambrook et al. (1989) Molcu.
la Cloning: A Laboratory Manual (2nd edition,
Cold Spring Harbor Laboratory Press,
Plainview, New York)).

Hybridization of such sequences can be performed under stringent conditions. A "stringent condition" or "stringent hybridization condition" allows a probe to hybridize to its target sequence to a detectably greater extent than other sequences (eg, at least twice background). Conditions are intended. Stringent conditions are sequence-dependent and will be different in different circumstances. 1 for the probe by controlling the stringency of hybridization and / or wash conditions
Target sequences that are 00% complementary can be identified (homology probing). Alternatively, stringency conditions can be adjusted to allow for some mismatches in the sequence so that a lower degree of similarity is detected (heterologous probing).
Generally, the probe is less than about 1000 nucleotides in length, preferably less than 500 nucleotides in length.

Typically, stringent conditions are those in which the salt concentration is less than about 1.5 M Na ions at pH 7.0 to 8.3, typically about 0.01 to 1.0 M Na. Ion concentration (or other salt) and temperature is short (eg 10
To 50 nucleotides) and at least about 60 ° C. for long probes (eg, longer than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. An exemplary low stringency condition is 3
Hybridization at 0C to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulfate) buffer at 37 ° C, and IX.
To 2 × SSC (20 × SSC = 3.0 M NaCl / 0.3 M trisodium citrate) at 50-55 ° C. Exemplary moderate stringency conditions are 40 to 45% formamide, 1.0 M NaCl, 1%
Hybridization in SDS at 37 ° C. and 0.5 × to 1 × SS
Including a wash in C at 55-60 ° C. Exemplary high stringency conditions include 50% formamide, 1M NaCl, 1% SDS at 37 ° C. for hybridization, and 0.1 × SSC at 60-65 ° C. for washing. Hybridization times are generally less than about 24 hours, usually about 4 hours to about 12 hours.

Specificity is typically a function of post-hybridization washes, and the critical factors are the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the T _m is determined by Meinkoth and Wahl (1984).
Anal. Biochem. 138: 267-284: T _m = 81.5 ° C. + 16.6 (log M) +0.41 (% GC) -0.6.
1 (% form) -500 / L; where M is the molar concentration of monovalent cations,% GC is the percentage of guanosine and cytosine nucleotides in the DNA, and% form is the hybridization solution. Is the proportion of formamide in and L is the length of the base pair hybrid. The _Tm is the temperature (under defined ionic strength and pH) at which 50% of the complementary target sequence hybridizes to a perfectly matched probe. The T _m is reduced by about 1 ° C. for each 1% mismatch; therefore, the T _m , hybridization, and / or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, the T _m can be reduced by 10 ° C. if sequences with 90% or greater identity are envisioned. In general, stringent conditions are
The specific sequence and its complement are selected to be about 5 ° C. below the thermal melting point (T _m ) at a defined ionic strength and pH. However, strong stringent conditions may use hybridization and / or washing 1, 2, 3, or 4 ° C. below the thermal melting point (T _m ); moderate stringent conditions may Hybridization and / or washing at 6, 7, 8, 9, or 10 ° C below the point (T _m ) may be used; conditions of low stringency are 11, 12 _{above the} thermal melting point (T _m ). Hybridization and / or washing at 13, 14, 15, or 20 ° C. lower may be utilized. Using the equation, hybridization and wash composition, and the desired T _m , one of skill in the art would
It is understood that variations in hybridization and / or wash solution stringency are inherently described. The desired degree of nonconformity is 45
If it results in a T _m lower than 0 ° C (aqueous solution) or 32 ° C (formamide solution), it is preferred to increase the SSC concentration so that higher temperatures can be used.
Expanded guidelines for nucleic acid hybridization can be found in Tijssen (
1993) Laboratory Technologies in Bioche
mystery and Molecular Biology-Hybri
dization with Nucleic Acid Probes, 1st
Part, Chapter 2 (Elsevier, New York); and Ausubel et al. (1995) Current Protocols in Molecular.
r Biology, Chapter 2 (Green Publishing and
Wiley-Interscience, New York).
Sambrook et al. (1989) Molecular Cloning: AL
Laboratory Manual (2nd edition, Cold Spring Har)
bor Laboratory Press, Plaonview, New Y
ork).

Accordingly, an isolated sequence encoding a Bt toxin receptor protein and hybridizing under stringent conditions to the Bt toxin receptor sequence disclosed herein or a fragment thereof is provided by the present invention. include. Such sequences are at least about 40% to 50% homologous, about 60%, 65%, or 70% homologous to the disclosed sequences, and still at least about 75%.
%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96
%, 97%, 98%, 99% or more homologous. That is, the sequence identity of the sequences is at least about 40% to 50%, about 60%, 65%, or 7%.
0%, and still at least about 75%, 80%, 85%, 90%, 91%
, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more.

The compositions and screening methods of the present invention include the BT toxin receptor of the present invention,
And useful for identifying cells expressing variants and homologues thereof. Such identification may use detection methods at the protein level (eg, ligand-receptor binding); or detection methods at the nucleotide level. The detection of the polypeptide can be in situ by means of in situ hybridization of tissue sections, but can also be analyzed by purification of the bulk polypeptide and subsequent analysis of the bulk preparation by Western blot or immunoassay. Alternatively, expression of the receptor gene can be detected at the nucleic acid level by techniques well known to those of skill in the art using complementary strand polynucleotides to assess levels of genomic DNA, mRNA, etc. As an example, PCR primers that are complementary to the nucleic acid of interest can be used to identify the level of expression. Tissues and cells identified to express the receptor sequences of the invention are determined to be sensitive to toxins that bind the receptor polypeptide.

If the source of cells identified to express the receptor polypeptide of the present invention is an organism (eg, a pest of a plant that is an insect), the organism may bind to the polypeptide. Determined to be sensitive to toxins. In one particular embodiment, the identification is in a pest of a Lepidopteran plant that expresses the Bt toxin receptor of the present invention.

The present invention includes antibody preparations having specificity for the polypeptides of the present invention.
In a further embodiment of the invention, the antibody is used to detect expression of the receptor in the cell.

In one aspect, the present invention details compositions and methods for modulating the susceptibility of plant pests to Bt toxins. However, it is recognized that the methods and compositions can be used to regulate the sensitivity of any cell or organism to toxins. By "modulating" is intended to increase or decrease the sensitivity of a cell or organism to the cytotoxic effects of a toxin. By "sensitivity" is intended reduced viability of cells contacted with the toxin. Accordingly, the invention includes expressing the cell surface receptor polypeptides of the invention to increase the sensitivity of target cells or organs to Bt toxin. Such an increase in toxin susceptibility is useful for medical and veterinary purposes in which eradication or reduction of cell group viability is desired. Such an increase in susceptibility is also useful for agronomic applications where it is desired to eradicate or reduce the pest population of a particular plant.

The pests of the target plant include, but are not limited to, insects and nematodes. Nematodes include parasitic nematodes such as root-knot nematodes, cyst nematodes, lesion nematodes, and renniform nematodes.

The following examples are provided for purposes of illustration and not limitation.

Experiments Example 1: Isolation of EC Bt Toxin Receptor Standard recombinant methods well known to those skilled in the art were performed. For the construction of the library, total RNA was isolated from the European corn borer (ECB), Ostrinia nu.
It was isolated from the midgut of Bilalis. Larvae of Anoumega (eg Stage 2)
Equal mixtures of 3, and 4) could be triturated in liquid nitrogen, homogenized, and total RNA extracted by standard procedures. Poly A RNA was isolated using standard poly A isolation procedures (eg, Promega Corporation Madi).
(Poly A Tact system by Son, WI) can be used to isolate from total RNA. CDNA synthesis may then be performed, and, for example, the unidirectional cDNA
The library was prepared using known commercial procedures (eg Stratagene, La.
ZAP Express cDNA Synthesis Kit by Jolla, CA). The cDNA can be amplified by PCR, sized, and appropriately digested with the restriction fragments ligated into the vector. Subcloned c
The DNA can be sequenced, the sequence identified using the appropriate peptide, and identified against the corresponding published sequence. These fragments could be used to probe a genomic or cDNA library corresponding to a particular host (eg Ostrinia nubialis) to obtain the full length coding sequence. Probes can also be made based on Applicants' disclosed sequences. Then
The coding sequence may be ligated into the desired expression cassette and used to transform host cells according to standard transformation procedures. Such expression cassettes may be part of commercially available vectors and expression systems; eg Nova.
gen Inc. (Madison, WI) pET system. Additional vectors that can be used for expression include pBKCMV, pBKRSV, pPb
ac, and pMbac (Stratagene Inc.), pFASTBa
c1 (Gibco BRL), as well as other common bacteria, baculovirus,
Included are mammalian and yeast expression vectors.

All vectors are described, for example, in Sambrook et al. (1989) Molecular.
ar Cloning: A Laboratory Manual (2nd edition, C)
old Spring Harbor Laboratory: Cold Sp
ring Harbor, N.M. Y. ) Was constructed using standard molecular biology techniques as described in (1).

Expression is tested by ligand blotting and testing for Bt toxin binding. Ligand blotting, binding, and toxicity are tested by known methods; eg, Martinez-Ramirez (1994) Bioch.
em. Biophys. Res. Comm. 201: 782-787; Vadl.
amudi et al. (1995) J. Am. Biol. Chem. 270 (10): 5490
-4, Keeton et al. (1998) Appl Environ Microbi.
ol 64 (6): 2158-2165; Keeton et al. (1997) Appl.
Environ Microbiol 63 (9): 3419-3425, I.
Hara et al. (1998) Comparative Biochemistry.
and Physiology, Part B 120: 197-204 and N.
agamatsu et al. (1998) Biosci. Biotechnol. Bio
chem. 62 (4): 727-734.

Identification of CrylA (b) binding polypeptides in the ECB was performed by ligand blotting brush border membrane vesicle polypeptides and probing those polypeptides that bind with CrylA (b) toxin. went. Two polypeptides (about 210 and 205 kDa) were found to bind CrylA (b). Blotting and ligation were performed essentially as described in the paragraph above.

Degenerate primers for RT-PCR were designed based on the known Cryl toxin binding polypeptide sequence from Manducca sexta and Bombyx mori. The primers are shown below. cDNA was constructed from total midgut RNA (cDNA synthesis kit GibcoBrL). Degenerate primers were used to amplify the expected size product. The annealing temperature used was 53 ° C. in the generation of the 280 bp fragment and 1.6 kb
It was 55 ° C. when the fragment was prepared.

A 280 bp fragment was obtained from the midgut RNA of the ECB. Upon cloning and sequencing, the fragment was cloned into Vadlamudi et al. (1995) J
． Biol. Chem. 270 (10): 5490-4 and was identified as having homology to the Bt toxin receptor 1 polypeptide (BTR1).

A similar approach was used to generate a 1.6 kilobase pair clone. The sequence of the primers used to generate the 280 base pair fragment was: Primer BTRD1S: 5'GTTAMYGTGAGAGAGGCAGAYC.
C3 '(SEQ ID NO: 8), and primer BTRD5A: 5'GGATRTTAAGMGTCAGYACWCC
G3 '(SEQ ID NO: 9). The sequence of the primers used to generate the 1.6 kb fragment was: Primer BTRD6S: 5'TCCGAATTCTTCTTYAAACCTCA.
TCGAYAACTT 3 '(SEQ ID NO: 10), and primer BTRD7A: 5'CGCAAGCTTAACTTGGTCGATGT
TRCASGTCAT3 '(SEQ ID NO: 11).

A clone of the 1.6 kb fragment was cloned into E. coli expression vector pET-
28a-c (+) and the pET system (Novagen Inc.
． , Madison, WI). The purified polypeptide encoded by this 1.6 kb fragment was labeled with Cr in the ligand blot.
The binding to ylA (b) was shown. An ECB midgut cDNA library was generated and screened using this 1.6 kb clone yielding 120 positive plaques. 30 of these plaques were selected for secondary screening, and 15 of these plaques were purified,
Then sent for DNA sequencing.

The resulting nucleotide sequence of a selected Bt toxin receptor clone derived from ECB is shown in SEQ ID NO: 1. The total length of the clone is 5498 base pairs. The coding sequence is residues 162-5312. The CrylA binding site is at residue 4038.
Coded by ~ 4547. The putative transmembrane domain is at residue 4872.
Coded by ~ 4928. The corresponding deduced amino acid sequence for this Bt toxin receptor clone from ECB is shown in SEQ ID NO: 2.

A purified polypeptide made from the 1.6 kb fragment shown in SEQ ID NO: 7 was used to inoculate rabbits for the production of polyclonal antibodies. On Western blots of animals prepared from brush border membrane vesicles from various insect species, this set of antibodies showed that the ECB Bt toxin receptor compared to Bt toxin receptor homologous polypeptides from other insect species. It specifically recognized the polypeptide. The rabbit polyclonal antibody also has amino acids 1293-14 of SEQ ID NO: 2.
Raised from a purified polypeptide corresponding to 62.

Example 2: Isolation of CEW and FAW Bt Toxin Receptor Orthologs: Full length Bt from larvae of the tobacco budworm (CEW, Heliothis Zea).
DNA encoding the toxin receptor was isolated. The nucleotide sequence for this cDNA is shown in SEQ ID NO: 3. Nucleotides 171-5360 correspond to the open reading frame. Nucleotides 4917-4973 correspond to the transmembrane region. Nucleotides 4083-4589 correspond to the CrylA binding site. The deduced corresponding amino acid sequence for the CEW Bt toxin receptor is shown in SEQ ID NO: 4.

American Procession Caterpillar Yomoga (FAW, Spodoptera frugip)
The cDNA encoding the full-length Bt toxin receptor from erda) was isolated. The nucleotide sequence of this cDNA is shown in SEQ ID NO: 5. Nucleotide 16
2 to 5363 are nucleotides 41 corresponding to the open reading frame
10-4616 correspond to the CrylA binding site, nucleotides 4941-4
997 corresponds to the transmembrane region. Nucleotides 162-227 corresponded to the signal peptide. The deduced corresponding amino acid sequence for the FAW Bt toxin receptor is shown in SEQ ID NO: 6.

Example 3 lepidoptera expressing the Bt toxin receptor of the present invention
Binding and cell death in insect cells An in vitro system was developed to demonstrate the functionality of the Bt toxin receptor of the present invention. The results disclosed in this example show that the ECB Bt toxin receptors of the present invention (SEQ ID NOS: 1 and 2) are particularly involved in the binding and killing effects of CrylAb toxin.

Well-known molecular biology methods are used to clone and express the ECB Bt toxin receptor in Sf9 cells. Baculovirus expression system (Gibco BRL Catalog No. 10359-016)
Used according to the protocol provided by the manufacturer and as described below. S. cerevisiae obtained from ATCC. frugiperda (Sf9) cells (AT
CC-CRL 1711) was added to Sf-900II serum-free medium (Gibco
BRL Catalog No. 10902-088) at 27 ° C. Expression constructs containing these cells, which are not sensitive to CrylAb toxin, containing the Bt toxin receptor of the present invention (SEQ ID NO: 1) operably linked downstream of the polyhedrin promoter ( pFastBac1 bacmid, Gibco BRL Catalog No. 10360-014)
Transfected with. Transfected Sf9 cells express the ECB Bt toxin receptor and were lysed in the presence of CrylAb toxin.
Toxin specificity, binding parameters (eg Kd values), and half maximal dose for cell death and / or toxicity are also determined.

To make the expression construct, the ECB Bt toxin receptor cDNA (SEQ ID NO: 1) was subjected to appropriate restriction digests and the resulting cDNA containing the full length coding region was cloned into the donor plasmid pFastBac1. Ligate into the multiple cloning site. After transformation and subsequent transfer, recombinant bacmid DNA containing the ECB _Bt toxin receptor (RBECB1) is isolated. As a control, recombinant bacmid DNA containing the reporter gene β-glucuronidase (RBGUS) is similarly constructed and isolated.

For transfection, 2 μg RBECB1 or RBGUS D
Each NA was treated with 6 μl of CellFectin (Gibco BRL Ca
talogue No. 10362-010) with 100 μl of Sf90
Mix in 0 medium and incubate for 30 minutes at room temperature. The mixture is then diluted with 0.8 ml Sf-900 medium. Sf9 cells (106 / ml per 35 mm well) were washed once with Sf-900 medium to give DNA / CellFe.
Mix with ctin mix, add to wells and incubate for 5 hours at room temperature. The medium is removed and 2 ml of SF-900 medium containing penicillin and streptomycin is added to the wells. 3 of transfection
After 5 days, Western blotting is used to test for protein expression.

For Western blotting, 100 μl of cell lysis buffer (50 mM
Tris, pH 7.8, 150 mM NaCl, 1% Nonidet P-
40) is added to the wells. Cells are scraped and subjected to centrifugation at 16,000 xg. The pellet and supernatant are separated and subjected to Western blotting. An antibody preparation against the ECB Bt toxin receptor (Example 1) was added to 1
Used as the secondary antibody. 2 anti-rabbit IgG labeled with alkaline phosphatase
Used as the secondary antibody. The Western blot results show that the full-length ECB of the invention is
It is shown that the Bt toxin receptor (SEQ ID NOS: 1 and 2) is expressed in the cell membrane of these cells.

To determine GUS activity, collect the medium of RBGUS-transfected cells. Cells and medium are separately mixed with GUS substrate and assayed for well-known enzyme activity. The GUS activity assay shows that this reporter gene is actively expressed in transfected cells.

To determine toxin sensitivity, Cry toxins (CrylA, CrylB, Cry
IC, CrylD, CrylE, CrylF, CrylI, Cry2, Cry3
, And Cry9 toxin (Schnepf E et al. (1998) Microbiol.
ody and Molecular Biology Reviews 62
(3): 775-806) are prepared by methods known in the art. The crystals are dissolved in 50 mM carbonate buffer pH 10.0 and treated with trypsin. Active fragments of the Cry protein are purified by chromatography. Three to five days after transfection, cells are washed with phosphate buffered saline (PBS). Various concentrations of Cry
The active fragment of toxin is applied to the cells. At various time intervals, cells are examined under the microscope to easily determine their sensitivity to toxins. Alternatively, cell death, viability, and / or toxicity are quantified by methods well known in the art. For example, In Situ by Roche Biochemicals
Cell Death Detection Kit (Catalogue
Nos. 2156792, 1684809, and 1648817), and M
Olecular Probes (available from LIVE / DEAD® Viability / Cytotoxicity Kitcatalogu
e No. L-3224).

It is readily observed that the dose-dependent response of RBECB1-transfected cells to CrylAb is well within the reach of many receptors with the Kd values determined. Control cells (eg pFast without insert)
Bac1 bacmid-transfected, or RBGus-transfected) are not significantly affected by CrylAb. Other Cry
The interaction with the toxin is similarly characterized.

This in vitro system is not only used to confirm the functionality of the putative Bt toxin receptor, but also to determine the active site and other functional domains of the toxin and receptor. Also used as a tool. Furthermore, this system is used as a cell-based high throughput screen. For example, methods are known in the art for distinguishing living versus dead cells with different dyes. This allows aliquots of transfected cells treated with various toxin samples and serves as a means for screening toxin samples for desired specificity or binding properties. This is a useful tool in controlling insect resistance, as this system is used to identify the specificity of the Cry protein receptor.

Example 4 ECB Bt Toxin Receptor Expression at Toxin-Sensitive Stages of the Insect Life Cycle Total RNA was expressed in eggs, pupae, adults, and TRI from the 5th to 5th instar development stages.
Isolated using zol Reagent (Gibco BRL) essentially as directed by the manufacturer (Gibco BRL). RNA was quantified and 20 μg of each sample was loaded on a formaldehyde agarose gel and electrophoresed at constant voltage. RNA was then transferred to a nylon membrane through neutral capillary migration and cross-linked to the membrane using UV light. For hybridization, a 460 base pair ECB Bt toxin receptor DNA probe (bases 3682 to 4141 of SEQ ID NO: 1) was added to Amer.
Constructed from a 460 base pair fragment prepared according to the manufacturer's protocol for the sham Rediprime II random prime labeling system. The denatured probe was added to the prehybridized membranes at 65 ° C for at least 3 hours and allowed to incubate at 65 ° C for at least 12 hours with gentle agitation. After hybridization, the membrane was incubated at 65 ° C. for 1 hour with 1/4 × 0.5M NaCl, 0.1M NaPO ₄ (ph7.0),
It was washed with 6 mM EDTA, and 1% SDS solution, followed by 2 washes for 1 hour in the above solution without SDS. Briefly air dry the membrane, Saran
Wrapped in Wrap and exposed to X-ray film.

The 5.5 kilobase ECB Bt toxin receptor transcript was strongly expressed at larval age and had a much reduced expression at the pupal stage. The level of expression appeared to be fairly constant from age 1 to age 5, but was significantly reduced at the pupal stage. There were no detectable transcripts at either the egg or adult stage. These results indicate that the ECBBt toxin transcript is produced at a sensitive stage of the insect life cycle, but not at a stage that is resistant to the toxic effects of CrylAb.

Example 5 Tissue and Subcellular Expression of ECB Bt Toxin Receptor: Fifth instar ECB were dissected to isolate the following tissues: fat pad (FB),
Malpighian canal (MT), posterior stomach (HG), anterior midgut (AM), and posterior midgut (PM). The midgut derived from the 5th instar larvae was also transformed into Wolfersber
ger et al. (1987) Comp. Biochem. Physiol. 86A: 3
It was isolated for the preparation of brush border membrane vesicles (BBMV) using the well known protocol according to 01-308. Tissues are Tris buffered saline, 0.1% twe.
Homogenized in en-20, centrifuged to pellet insoluble material and transferred to a new tube. 50 μg of protein from each preparation was added to SDS sample buffer and B-mercaptoethanol at 100 ° C.
Heated for 10 minutes and loaded on a 4-12% Bis-Tris gel (Novex). After electrophoresis, the proteins were transferred to nitrocellulose membrane using a semi-drying device. Membranes were blocked in 5% nonfat dry milk buffer for 1 hour at room temperature with gentle agitation. Primary antibody (Example 1) was added to a final dilution of 1: 5000 and hybridized for 1 hour. The blot was then washed 3 times for 20 minutes in each non-fat milk buffer. The blot was then incubated with a secondary antibody (goat anti-rabbit with alkaline phosphatase conjugate) at 1: 100.
Hybridization was performed with a dilution of 00 for 1 hour at room temperature. Washing was done as previously described. Bands were visualized using standard chemiluminescence protocols (Tr
opix western photoprotein detection kit).

The ECB Bt toxin receptor protein was only visible in the BBMV-enriched lane and was not detected in any of the other ECB tissue types. The results show that the expression of ECBBt toxin receptor protein is at very low levels. Because, the BBMV preparation has 20-30 midgut brush borders.
This is because it is a fraction containing a large amount. This result supports the claim that the ECBBt toxin receptor is an integral membrane protein that is highly related to the brush border. This also demonstrates that the ECB Bt toxin receptor is expressed in putative target tissues for the CrylAb toxin. However, the results do not necessarily prevent expression in other tissue types, nevertheless, expression of this protein in these tissues is greater than expression in BBMV-rich fractions. It can be low.

All publications and patent applications mentioned in the specification are indicative of the level of ordinary skill in the art to which this invention belongs. All publications and patent applications, as if each individual publication or patent application were individually incorporated by reference, in detail and by way of reference,
To the same extent, it is incorporated herein by reference.

While the above invention has been described in some detail by way of illustration and illustration for purposes of clarity of understanding, it will be apparent that certain changes and modifications may be made within the scope of the appended claims. Is.

[0134]

[Table 1]

[0135]

[Table 2]

[0136]

[Table 3]

[Sequence list]

[Brief description of drawings]

FIG. 1 schematically depicts the location of the signal sequence of the Bt toxin receptor from Ostrinia nubilalis, putative glycosylation site, cadherin-like domain, transmembrane segment, CrylA binding region, and protein kinase C phosphorylation site. SEQ ID NO: 1 shows the nucleotide sequence of this receptor; and SEQ ID NO: 2 shows the corresponding deduced amino acid sequence.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) C12N 1/19 C12N 1/21 1/21 C12Q 1/02 5/10 G01N 33/15 Z C12Q 1/02 33/50 Z G01N 33/15 33/53 D 33/50 G 33/53 33/566 C12N 15/00 ZNAA 33/566 5/00 AC (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE, TR), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY) , KG, KZ, MD, R , TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA, CH, CN, CR, CU, CZ, DE, DK, DM. , DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ , TM, TR, TT, TZ, UA, UG, UZ, VN, YU, ZA, ZW (72) Inventor Mathis, John P. United States Iowa 50313, Demoyne, 6T Street 3808, Apartment 15 (72) Inventor Mayer, Terry Euclair United States Iowa 50322, Urbandale, 101 Estee Street-4338 F-term (reference) 2G045 AA34 AA35 BB14 BB51 DA13 DA36 FB02 FB03 FB13 4B024 AA07 AA08 BA63 CA04 DA01 DA02 DA05 DA12 EA02 EA04 GA11 GA18 GA19 HA03 4B063 QA01 QA18 QQ20 QR48 QR77 QR80 QS15 QX01 4B065 AA01X AA72X AA90X AA90Y AA91X AB01 AC14 BA01 CA24 CA48 CA53 4H045 AA10 AA30 BA10 BA41 CA51 DA50 DA76 DA86 EA06 FA72 FA74

Claims (25)

[Claims] 1. An isolated nucleic acid molecule having a nucleotide sequence encoding a Bt toxin receptor, said sequence being selected from the group consisting of:
Nucleic acid molecule: a) a nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5; b) a nucleotide sequence having at least about 70% identity to the nucleotide sequence of a); c) a D) a nucleotide sequence having at least about 75% identity to the nucleotide sequence; d) a nucleotide sequence having at least about 85% identity to the nucleotide sequence of a); e) a A) a nucleotide sequence having at least about 95% identity to the nucleotide sequence of); f) a nucleotide sequence consisting of at least 22 contiguous nucleotides of the nucleotide sequence set forth in SEQ ID NO: 1; and g). Is at least about 50 consecutive nucleotides of the nucleotide sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 5 A nucleotide sequence consisting of 2. The nucleic acid molecule according to claim 1, wherein the toxin is a CrylA toxin. 3. The nucleic acid according to claim 2, wherein the CrylA toxin is a CrylA (b) toxin. 4. An isolated polypeptide having an amino acid sequence selected from the group consisting of: a) the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6; b) a A) an amino acid sequence having at least about 70% identity to the amino acid sequence of c); c) an amino acid sequence having at least about 75% identity to the amino acid sequence of a); d) a A) an amino acid sequence having at least about 85% identity to the amino acid sequence of e); e) an amino acid sequence having at least about 95% identity to the amino acid sequence of a); f) a sequence An amino acid sequence containing at least about 30 consecutive residues of the amino acid sequence set forth in SEQ ID NO: 2; g) at least about 25 consecutive amino acids of the amino acid sequence set forth in SEQ ID NO: 4. An amino acid sequence containing an acid; h) an amino acid sequence containing at least about 15 consecutive residues of the amino acid sequence set forth in SEQ ID NO: 6; i) a nucleotide sequence according to claim 1. Encoded amino acid sequence; j) a fragment of the amino acid sequence set forth in SEQ ID NO: 2 that binds Bt toxin, wherein the fragment is at least about 30 contiguous sequences of the amino acid sequence set forth in SEQ ID NO: 2. K) a fragment of the amino acid sequence set forth in SEQ ID NO: 4 that binds a Bt toxin, wherein the fragment comprises at least about the amino acid sequence set forth in SEQ ID NO: 4. A fragment comprising 25 consecutive residues; and l) a Bt toxin binding amino acid sequence of SEQ ID NO: 6 A Ragumento, wherein the fragment comprises at least about 15 contiguous to have residues of the amino acid sequence shown in SEQ ID NO: 6, fragments. 5. A fusion polypeptide containing the polypeptide of claim 4 and at least one polypeptide of interest. 6. The polypeptide of interest is a toxin receptor.
The fusion polypeptide according to. 7. An expression cassette containing a nucleotide sequence encoding the fusion polypeptide of claim 5, wherein the nucleotide sequence is
An expression cassette operably linked to a promoter that drives expression in a cell of interest. 8. The expression cassette according to claim 7, wherein the polypeptide of interest is a toxin receptor. 9. An antibody preparation which is specific for the polypeptide of claim 4. 10. An expression cassette containing at least one nucleotide sequence according to claim 1, wherein the nucleotide sequence is operably linked to a promoter driving expression in a cell of interest. Expression cassette. 11. The expression cassette according to claim 10, wherein the cell of interest is an insect or mammalian cell. 12. The expression cassette according to claim 10, wherein the target cell is a microorganism. 13. The expression cassette according to claim 12, wherein the microorganism is yeast or bacterium. 14. A vector for delivering a nucleotide sequence to a cell of interest, which contains at least one nucleotide sequence according to claim 1. 15. A cell containing the vector according to claim 14. 16. A transformed cell of interest, which has stably incorporated into its genome a nucleotide sequence selected from the group consisting of: a) set forth in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5. A nucleotide sequence having at least about 70% identity to the nucleotide sequence of b) a); and c) having at least about 75% identity to the nucleotide sequence of a). D) having at least about 85% identity to the nucleotide sequence of a); e) having at least about 95% identity to the nucleotide sequence of a) F) a nucleotide sequence consisting of at least 22 contiguous nucleotides of the nucleotide sequence shown in SEQ ID NO: 1 And g) a nucleotide sequence consisting of at least about 50 contiguous nucleotides of the nucleotide sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 5. 17. The transformed cell according to claim 16, wherein the plant cell is a plant cell. 18. The transformed cell of claim 17, wherein the cell is a monocot. 19. A method for screening a ligand that binds a Bt toxin receptor, the method comprising: i) providing at least one Bt toxin receptor polypeptide according to claim 4; ii. A.) Contacting the polypeptide with a sample and a control ligand under conditions that promote binding; and iii) determining the binding properties of the sample ligand relative to the control ligand. 20. A method for screening a ligand that binds to a Bt toxin receptor, the method comprising: i) in cells expressing the polypeptide, wherein a, b, c.
, D, e, f, g, h, i, j, k, and l, wherein at least one Bt toxin receptor polypeptide having an amino acid sequence selected from the group consisting of: And wherein the polypeptide comprises a toxin binding domain; ii) contacting the cells with a sample and a control ligand under conditions that promote binding; and iii) comparing the sample ligand with the control ligand. Determining the binding characteristics of the. 21. The method of claim 20, wherein the toxin is a CrylA toxin. 22. A method for screening a toxin that binds a Bt toxin receptor, the method comprising the step of claim 20 and further comprising comparing the cell to a control ligand. , Determining the viability of said cells contacted with a sample ligand. 23. The method of claim 20, wherein the sample ligand is: a) the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6); An amino acid sequence having at least about 70% identity to the amino acid sequence; c) an amino acid sequence having at least about 75% identity to the amino acid sequence of a); d) of a) An amino acid sequence having at least about 85% identity to the amino acid sequence; e) an amino acid sequence having at least about 95% identity to the amino acid sequence of a); f) SEQ ID NO: 2 An amino acid sequence containing at least about 30 contiguous residues of the amino acid sequence set forth in: g) at least about 25 contiguous amino acids of the amino acid sequence set forth in SEQ ID NO: 4 An amino acid sequence having: h) an amino acid sequence containing at least about 15 contiguous residues of the amino acid sequence set forth in SEQ ID NO: 6; i) encoded by the nucleotide sequence of claim 1. J) a fragment of the amino acid sequence set forth in SEQ ID NO: 2 that binds a Bt toxin, wherein the fragment comprises at least about 30 consecutive amino acid sequences set forth in SEQ ID NO: 2. A fragment of the amino acid sequence set forth in SEQ ID NO: 4 that binds a Bt toxin, wherein the fragment comprises at least about 25 amino acid sequences set forth in SEQ ID NO: 4. A fragment comprising a contiguous residue of; and 1) a flag of the amino acid sequence set forth in SEQ ID NO: 6 that binds the Bt toxin. Wherein the fragment comprises an amino acid sequence selected from the group consisting of: a fragment comprising at least about 15 contiguous residues of the amino acid sequence set forth in SEQ ID NO: 6. The method is a chimeric polypeptide containing at least one major polypeptide that binds the existing polypeptide. 24. The method of claim 21, wherein the sample ligand is: a) the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6; An amino acid sequence having at least about 70% identity to the amino acid sequence; c) an amino acid sequence having at least about 75% identity to the amino acid sequence of a); d) of a) An amino acid sequence having at least about 85% identity to the amino acid sequence; e) an amino acid sequence having at least about 95% identity to the amino acid sequence of a); f) SEQ ID NO: 2 An amino acid sequence containing at least about 30 contiguous residues of the amino acid sequence set forth in: g) at least about 25 contiguous amino acids of the amino acid sequence set forth in SEQ ID NO: 4 An amino acid sequence having: h) an amino acid sequence containing at least about 15 contiguous residues of the amino acid sequence set forth in SEQ ID NO: 6; i) encoded by the nucleotide sequence of claim 1. J) a fragment of the amino acid sequence shown in SEQ ID NO: 2 that binds Bt toxin, comprising at least about 30 consecutive residues of the amino acid sequence shown in SEQ ID NO: 2. K) a fragment of the amino acid sequence set forth in SEQ ID NO: 4 that binds Bt toxin comprising at least about 25 consecutive residues of the amino acid sequence set forth in SEQ ID NO: 4; and l ) A fragment of the amino acid sequence set forth in SEQ ID NO: 6 that binds Bt toxin, wherein a fragment of the amino acid sequence set forth in SEQ ID NO: 6. A chimeric polypeptide containing at least one major polypeptide that binds a polypeptide having an amino acid sequence selected from the group consisting of a fragment comprising at least about 15 consecutive residues. A method that is a peptide. 25. The method of claim 22, wherein the sample ligand is: a) the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6; An amino acid sequence having at least about 70% identity to the amino acid sequence; c) an amino acid sequence having at least about 75% identity to the amino acid sequence of a); d) of a) An amino acid sequence having at least about 85% identity to the amino acid sequence; e) an amino acid sequence having at least about 95% identity to the amino acid sequence of a); f) SEQ ID NO: 2 An amino acid sequence containing at least about 30 contiguous residues of the amino acid sequence set forth in: g) at least about 25 contiguous amino acids of the amino acid sequence set forth in SEQ ID NO: 4 An amino acid sequence having: h) an amino acid sequence containing at least about 15 contiguous residues of the amino acid sequence set forth in SEQ ID NO: 6; i) encoded by the nucleotide sequence of claim 1. J) a fragment of the amino acid sequence set forth in SEQ ID NO: 2 that binds Bt toxin, wherein the fragment is at least about 30 contiguous of the amino acid sequence set forth in SEQ ID NO: 2. A fragment of the amino acid sequence set forth in SEQ ID NO: 4 that binds a Bt toxin, wherein the fragment comprises at least about 25 contiguous sequences of the amino acid sequence set forth in SEQ ID NO: 4. Fragment containing an amino acid residue; and l) a fragment of the amino acid sequence shown in SEQ ID NO: 6 that binds a Bt toxin. Wherein the fragment comprises an amino acid sequence selected from the group consisting of a fragment comprising at least about 15 consecutive residues of the amino acid sequence set forth in SEQ ID NO: 6. A method, which is a chimeric polypeptide containing at least one major polypeptide that binds the peptide.