CA2391384C

CA2391384C - Bt toxin receptors from lepidopteran insects and methods of use

Info

Publication number: CA2391384C
Application number: CA002391384A
Authority: CA
Inventors: Ronald D. Flannagan; John P. Mathis; Terry Euclaire Meyer
Original assignee: Pioneer Hi Bred International Inc
Current assignee: Pioneer Hi Bred International Inc
Priority date: 1999-11-18
Filing date: 2000-11-17
Publication date: 2007-05-01
Anticipated expiration: 2020-11-17
Also published as: JP2003514531A; AU783296B2; CA2391384A1; AU1660301A; WO2001036639A3; WO2001036639A2; EP1230365A2; AU783296C

Abstract

The invention relates to Bt toxin resistance management. The invention particularly relates to the isolation and characterization of nucleic acid a nd polypeptides for a novel Bt toxin receptor. The nucleic acid and polypeptide s are useful in identifying and designing novel Bt toxin receptor ligands including novel insecticidal toxins.

Description

NOVEL BT TOXIN RECEPTORS FROM LEPIDOPTERAN INSECTS AND
METHODS OF USE
FIELD OF THE INVENTION
The field of the invention is manipulating Bt toxin susceptibility in plant pests.
The field of the invention relates to the isolation and characterization of nucleic acid and polypeptides for a novel Bt toxin receptor. The nucleic acid and polypeptides are useful in developing new insecticides.
BACKGROUND OF THE INVENTION
Traditionally, growers used chemical pesticides as a means to control agronomically important pests. The introduction of transgenic plants carrying the delta-endotoxin from Bacillus thuringiensis (Bt) afforded a non-chemical method of control. Bt toxins have traditionally been categorized by their specific toxicity towards specific insect categories. For example, the Cryl group of toxins are toxic to Lepidoptera The Cryl group includes, but is not limited to, CryIA(a), CryIA(b) and CrylA(c). See Hofte et al (1989) Microbiol Rev 53: 242-255.
Lepidopteran insects cause considerable damage to maize crops throughout North America and the world. One of the leading pests is Ostrinia nubilalis, commonly called the European Corn Borer (ECB). Genes encoding the crystal proteins CryIA(b) and CryIA(c) from Bt have been introduced into maize as a means of ECB control. These transgenic maize hybrids have been effective in control of ECB. However, developed resistance to Bt toxins presents a challenge in pest control. See McGaughey et al. (1998) Nature Biotechnology 16: 144-146; Estruch et al. (1997) Nature Biotechnology 15:137-141; Roush et al. (1997) Nature Biotechnology 15 816-817; and Hofte et al (1989) Microbiol Rev 53: 242-255.
The primary site of action of Cryl toxins is in the brush border membranes of the midgut epithelia of susceptible insect larvae such as lepidopteran insects. CryIA
toxin binding polypeptides have been characterized from a variety of Lepidopteran species. A CryIA(c) binding polypeptide with homology to an aminopeptidase N
has been reported from Manduca sexta, Lymantria dispar, Helicoverpa zea and Heliothis virescens . See Knight et al (1994) Mol Micro 11: 429-436; Lee et al. (1996) Appl Environ Micro 63: 2845-2849; Gill et al. (1995) JBiol. Chem 270: 27277-27282;
and Garczynski et al. (1991) Appl Environ Microbiol 10: 2816-2820.
Another Bt toxin binding polypeptide (BTR1) cloned from M. sexta has homology to the cadherin polypeptide superfamily and binds CrylA(a), CryIA(b) and CrylA(c). See Vadlamudi et al. (1995) JBiol Chem 270(10):5490-4, Keeton et al.
(1998) Appl Environ Microbiol 64(6):2158-2165; Keeton et al. (1997) Appl Environ Microbiol 63(9):3419-3425 and U.S. Patent Patent No: 5,693,491.
A subsequently cloned homologue to BTR1 demonstrated binding to CrylA(a) from Bombyx mori as described in Ihara et al. (1998) Comparative Biochemistry and Physiology, Part B 120:197-204 and Nagamatsu et al. (1998) Biosci. Biotechnol.
Biochem. 62(4):727-734.
Identification of the plant pest binding polypeptides for Bt toxins are useful for investigating Bt toxin-Bt toxin receptor interactions, selecting and designing improved toxins, developing novel insecticides, and new Bt toxin resistance management strategies.
SUMMARY OF THE INVENTION
Compositions and methods for modulating susceptibility of a cell to Bt toxins are provided. The compositions include Bt toxin receptor polypeptides, and fragments and variants thereof, from the lepidopteran insects European corn borer(ECB, Ostrinia nubilalis), corn earworm (CEW, Heliothis Zea), and fall armyworm (FAW, Spodoptera frugiperda). The polypeptides bind Cry 1 A toxins, more particularly CrylA(b). Nucleic acids encoding the polypeptides, antibodies specific to the polypeptides, as well as nucleic acid constructs for expressing the polypeptides in cells of interest are also provided.
The methods are useful for investigating the structure-function relationships of Bt toxin receptors; investigating the toxin-receptor interactions; elucidating the mode of action of Bt toxins; screening and identifying novel Bt toxin receptor ligands including novel insecticidal toxins; and designing and developing novel Bt toxin receptor ligands.
The methods are useful for managing Bt toxin resistance in plant pests, and protecting plants against damage by plant pests.

In one aspect, there is described an isolated nucleic acid molecule having a nucleotide sequence encoding a Bt toxin receptor polypeptide having Bt toxin binding activity, said sequence selected from the group consisting of: a) a nucleotide sequence set forth in SEQ ID NO:1, SEQ
ID N0:3 or SEQ ID N0:5; b) a nucleotide sequence having at least 85% identity to the nucleotide sequence of a); and c) a nucleotide sequence having at least 95% identity to the nucleotide sequence of a).
In another aspect, there is described an isolated nucleic acid consisting of at least 22 contiguous nucleotides of the nucleotide sequence set forth in SEQ ID NO: l, for use as a probe or primer.
In another aspect, there is described an isolated polypeptide which is capable of binding a Bt toxin and having an amino acid sequence selected from the group consisting of: a) an amino acid sequence set forth in SEQ ID
N0:2, SEQ ID N0:4, or SEQ ID N0:6; b) an amino acid sequence having at least 85% identity to the amino acid sequence of a); c) an amino acid sequence having at least 95% identity to the amino acid sequence of a); and d) an amino acid sequence encoded by the nucleotide sequence as described herein.
In another aspect, there is described a transformed cell of interest having stably incorporated within its genome a nucleotide sequence encoding a Bt toxin receptor polypeptide having Bt toxin binding activity, said sequence selected from the group consisting of: a) a nucleotide sequence set forth in SEQ ID NO:1, SEQ ID N0:3 or SEQ ID N0:5; b) a nucleotide sequence having at least 85%
identity to the nucleotide sequence of a); and c) a 2a nucleotide sequence having at least 95% identity to the nucleotide sequence of a).
In another aspect, there is described a method for screening for ligands that bind Bt toxin receptor, said method comprising: i) providing at least one Bt toxin receptor polypeptide as described herein; ii) contacting said polypeptide with a sample and a control ligand under conditions promoting binding; and iii) determining binding characteristics of said sample ligand, relative to said control ligand.
In another aspect, there is described a method for screening for ligands that bind Bt toxin receptor, said method comprising: i) providing at least one Bt toxin receptor polypeptide having the amino acid sequence as described herein in cells expressing said polypeptide wherein said polypeptide comprises a toxin binding domain;
ii) contacting said cells with a sample and a control ligand under conditions promoting binding; and iii) determining binding characteristics of said sample ligand, relative to said control ligand.
2b BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 schematically depicts the location of the signal sequence, putative glycosilation sites, cadherin-like domains, transmembrane segment, CryIA binding region and protein kinase C phosphorylation site of the Bt toxin receptor from Ostrinia nubilalis; the nucleotide sequence of the receptor set forth in SEQ ID NO:1 and the corresponding deduced amino acid sequence in SEQ ID N0:2.
DETAILED DESCRIPTION OF THE INVENTION
The invention is directed to novel receptor polypeptides that bind Bt toxin, the receptor being derived from the order lepidoptera. The receptors of the invention include those receptor polypeptides that bind Bt toxin and are derived from the lepidopteran superfamily Pyraloidea and particularly from the species Ostrinia, specifically Ostrinia nubilalis; those derived from Spodoptera frugiperda (S.
frugiperda); and those derived from Heliothus Zea (H Zea). The polypeptides have homology to members of the cadherin superfamily of proteins.
Accordingly, compositions of the invention include isolated polypeptides that are involved in Bt toxin binding. In particular, the present invention provides for isolated nucleic acid molecules comprising nucleotide sequences encoding the amino acid sequences shown in SEQ ID NOs: 2, 4, and 6; or the nucleotide sequences having the DNA sequences deposited in a plasmid in a bacterial host as Patent Deposit No. PTA-278, PTA-1760, and PTA-2222. Further provided are polypeptides having an amino acid sequence encoded by a nucleic acid molecule described herein, for example those set forth in SEQ ID NOs: 1, 3, and 5; those deposited in a plasmid in a bacterial host as Patent Deposit Nos. PTA-278, PTA-1760, and PTA-2222;
and fragments and variants thereof.
Plasmids containing the nucleotide sequences of the invention were deposited with the Patent Depository of the American Type Culture Collection (ATCC), Manassas, Virginia on June 25, 1999; April 25, 2000; and July 11, 2000; and assigned Patent Deposit Nos. PTA-278, PTA-1760, and PTA-2222. These deposits will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. These deposits 62451-879 (S) were made merely as a convenience for those of skill in the art and are not an admission that a deposit is required .
The temp "nucleic acid" refers to all forms of DNA such as cDNA or genomic DNA and RNA such as mRNA, as well as~analogs of the DNA or RNA generated using nucleotide analogs. The nucleic acid molecules can be single stranded or double stranded. Strands can include the coding or non-coding strand.
The invention encompasses isolated or substantially purified nucleic acid or polypeptide compositions. An "isolated" or "purified" nucleic acid molecule or polypeptide, or biologically active portion thereof, is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially fi~ee of chemical precursors or other chemicals when chemically synthesizxd. Preferably, an "isolated" nucleic acid is free of sequences (preferably polypeptide encoding sequences) that naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequences that naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived. A
polypeptide that is substantially free of cellular material includes preparations of polypeptide having less than about 30%, 20%, 10%, S%, (by dry weight) of contaminating polypeptide. When the polypeptide of the invention or biologically active portion thereof is recombinantly produced, preferably culture medium represents less than about 30%, 20%, 10%, or 5% (by dry weight) of chemical precursors or non-polypeptide-of interest chemicals.
It is understood, however, that there are embodiments in which preparations that do not contain the substantially pure polypeptide may also be useful. Thus, less pure preparations can be useful where the contaminating material does not interfere with the specific desired use of the peptide. The compositions of the invention also encompass fragments and variants of the disclosed nucleotide sequences and the polypeptides encoded thereby.
The compositions of the invention are useful for, among other uses, expressing the receptor polypeptides in cells of interest to produce cellular or isolated preparations of the polpeptides for investigating the structure-function relationships of 62451-879(S) Bt toxin receptors; investigating the toxin-receptor interactions; elucidating the mode of action of Bt toxins; screening and identifying novel Bt toxin receptor ligands including novel inseeticidal toxins; and designing and developing novel Bt toxin receptor ligands including novel insecticidal toxins.
The isolated nucleotide sequences encoding the receptor polypeptides of the invention are expressed in a cell of interest; and the Bt toxin receptor polypeptides produced by the expression is utilized in intact cell or in-vitro receptor binding assays, and/or intact cell toxicity assays. Methods and conditions for Bt toxin binding and toxicity assays are known in the art and include but are not limited to those described in United States Patent NO: 5,693,491; T.P. Keeton et al. (1998) Appl.
Ermiron.
Microbiol. 64(6):2158-2165; B.R Francis et al. (1997) Insect Biochem. Mol, Biol.
27(6):541-550; T.P. Keeton et al. (1997) Appl. Ertviron. Microbiol. 63(9):3419-3425;
R.K. Vadlamudi et al. (1995) .l. Biol. Chem. 270(10):5490-5494; Ihara et al.
(1998) Comparative Biochem. Physiol. B 120:197-204; Nagamatsu et al. (1998) Biosci.
Biotechnol. Biochem. 62(4):727-734. Such methods could be modified by one of ordinary skill in the art to develop assays utilizing the polypeptides of the invention.
By "cell of interest" is intended any cell in which expression of the polypeptides of the invention is desired. Cells of interest include, but are not limited to munmalian, avian, insect, plant, bacteria, fungi and yeast cells. Cells of interest include but are not limited to cultured cell lines, primary cell cultures, cells in vivo, and cells of transgenic organisms.
The methods of the invention encompass using the polypeptides encoded by the nucleotide sequences of the invention in receptor binding and/or toxicity assays to screen candidate ligands and identify novel Bt toxin receptor ligands, including receptor agonists and antagonists. Candidate ligands include molecules available from diverse libraries of small molecules created by combinatorial synthetic methods.
Candidate ligands also include, but are not limited to antibodies, peptides, and other small molecules designed or deduced to interact with the receptor polypeptides of the invention. Candidate ligands include but are not limited to peptide fragments of the receptor, anti-receptor antibodies, antiidiotypic antibodies mimicking one or more receptor binding domains of a toxin, fusion proteins produced by combining two or more toxins or fragments thereof, and the like. Ligands identified by the screening 62451-879(S) methods of the invention include potential novel insecticidal toxins, the insecticidal activity of which can be determined by known methods; for example, as described in U.S. Patent No. 5,407,454; U.S. Patent No. 6,232,439; U.S. Patent No. 5,986,1 i'7.
The invention provides methods for screerung for ligands that bind to the polypeptides described herein. Both the polypeptides and relevant fragments thereof (for example, the toxin binding domain) can be used to screen by assay for compounds that bind to the receptor and exhibit desired binding characteristics. Desired binding characteristics include, but are not limited to binding affinity, binding site specificity, association and dissociation rates, and the like. The screening assays could be intact cell or in vitro assays which include exposing a ligand binding domain to a sample ligand and detecting the :formation of a ligand-binding polypeptide complex. The assays could be direct ligand-receptor binding assays or ligand competition assays.
In one embodiment, th.e methods comprise providing at least one Bt toxin receptor polypeptide of the invention, contacting the polypeptide with a sample and a control ligand under conditions promoting binding; and determining binding characteristics of sample ligazrds, relative to control ligands. The methods encompass any method knov~m to the skilled artisan which can be used to provide the polypeptides of the invention in a binding assay. F'or in vitro binding assays, the polypeptide may be provided as isolated, lysed, or homogenized cellular preparations.
Isolated polypeptides may be provided in solution, or immobilized to a matrix.
Methods for immobilizing polypeptides are well known in the art, and include but are not limited to construction and use of fusion polypeptides with commercially available high affinity ligands. For example, GST fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, MO) or glutathione derivatized microtitre plates. 'The polypeptides can also be immobilized utilizing well techniques in the art utilizing conjugation of biotin and streptavidin. The polypeptides can also be immobilized utilizing well known techniques in the art utilizing chemical conjugation (linking) of polypeptides to a matrix.
Alternatively, the polypeptides may be provided in intact cell binding assays in which the polypeptides are generally expressed as cell surface Bt toxin receptors.
The invention provides methods utilizing intact cell toxicity assays to screen for ligands that bind to the receptor polypeptides described herein and confer toxicity upon a 62451-879(S) cell of interest expressing the polypeptide. A ligand selected by this screening is a potential insecticidal toxin to insects expressing the receptor polypeptides, particularly enterally. This deduction is premised on theories that insect specificity of a particular Bt toxin is determined by the presence of the receptor in specific insect species, or that binding of the toxins is specific for the receptor of some insect species and is bind is insignificant or nonspecific for other variant receptors. See, for example Hofte et al (1989) Microbiol Rev S3: 242-255. The toxicity assays include exposing, in intact cells expressing a polypeptide of the invention, the toxin binding domain of the polypeptide to a sample ligand and detecting the toxicity effected in the cell expressing the polypeptide.
By "toxicity" is intended the dviability of a cell. By 'liability" is intended the ability of a cell to proliferate and/or differentiate and/or maintain its biological characteristics in a manner characteristic of that cell in the absence of a particular cytotoxic agent.
In one embodiment, the methods of the present invention comprise providing at least one cell surface Bt toxin receptor polypeptide of the invention comprising an extracellular toxin binding domain, contacting the polypeptide with a sample and a control ligand under conditions promoting binding, and determining the viability of the cell expressing the cell surface Bt toxin receptor polypeptide, relative to the control ligand.
By "contacting" is intended that the sample and control agents are presented to the intended ligand binding site of the polypeptides of the invention.
By "conditions promoting binding" is intended any combination of physical and biochemical conditions that enables a ligand of the polypeptides of the invention to determinably bind the intended polypeptide over background levels. Examples of such conditions for binding of Cry 1 toxins to Bt toxin receptors, as well as methods for assessing the binding, are known in the art and include but are not limited to those described in Keeton et al. (1998) Appl Environ Micrabiol 64(6): 2158-2165;
Francis et al. (1997) Insect Biochem Mol Biol 27(6):541-550; Keeton et aL (1997) Appl Environ Microbiol 63(9):3419-3425; Vadlamudi et al. (1995) .T Biol Chem 270(10):5490-5494; Ihara et al. (1998) Comparative Biochemistry and Physiology, Part B 120:197-204; and Nagamatsu et al. (1998) Biosci. Biotechnol. Biochem.
6Z(4):727-734. In this aspect of the present invention, known and commercially available methods for studying protein-protein interactions, such as yeast and/or bacterial two-hybrid systems could also be used. Two-hybrid systems are available from, for example, CLONTECH (Palo Alto, Ca) or Display Systems Biotech Inc. (Vista, Ca).
The compositions and screening methods of the invention are useful for designing and developing novel Bt toxin receptor ligands including novel insecticidal toxins. Various candidate ligands; ligands screened and characterized for binding, toxicity, and species specificity; and/or ligands having known characteristics and specificities, could be linked or modified to produce novel ligands having particularly desired characteristics and specificities. The methods described herein for assessing binding, toxicity and insecticidal activity could be used to screen and characterize the novel ligands.
In one embodiment of the present invention, the sequences encoding the receptors of the invention, and variants and fragments thereof, are used with yeast and bacterial two-hybrid systems to screen for Bt toxins of interest (for example, more specific and/or more potent toxins), or for insect molecules that bind the receptor and can be used in developing novel insecticides.
By "linked" is intended that a covalent bond is produced between two or more molecules. Known methods that can be used for modification and/or linking of polypeptide ligands such as toxins, include but are not limited to mutagenic and recombinogenic approaches including but not limited to site-directed mutagenesis, chimeric polypeptide construction and DNA shuffling. Such methods are described in further detail below. Known polypeptide modification methods also include methods for covalent modification of polypeptides. "Operably linked" means that the linked molecules carry out the function intended by the linkage.
The compositions and screening methods of the present invention are useful for targeting ligands to cells expressing the receptor polypeptides of the invention.
For targeting, secondary polyeptides, and/or small molecules which do not bind the receptor polypeptides of the invention are linked with one or more primary ligands which bind the receptor polypeptides; including but not limited to CryIA
toxin; more particularly Cryl A(b) toxin or a fragment thereof. By this linkage, any polypeptide and/or small molecule linked to a primary ligand could be targeted to the receptor polypeptide, and thereby to a cell expressing the receptor polypeptide;
wherein the ligand binding site is available at the extracellular surface of the cell.

In one embodiment of the invention, at least one secondary polypeptide toxin is linked with a primary Cryl A toxin capable of binding the receptor polypeptides of the invention to produce a combination toxin which is targeted and toxic to insects expressing the receptor for the primary toxin. Such insects include those of the order lepidoptera, superfamily Pyraloidea and particularly from the species Ostrinia, specifically Ostrinia nubilalis. Such insects include the lepidopterans S.
frugiperda and H. Zea. Such a combination toxin is particularly useful for eradicating or reducing crop damage by insects which have developed resistance to the primary toxin.
For expression of the Bt toxin receptor polypeptides of the invention in a cell of interest, the Bt toxin receptor sequences are provided in expression cassettes. The cassette will include 5' and 3' regulatory sequences operably linked to a Bt toxin receptor sequence of the invention. In this aspect of the present invention, by "operably linked" is intended a functional linkage between a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence. In reference to nucleic acids, generally, operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary to join two polypeptide coding regions, contiguous and in the same reading frame. The cassette may additionally contain at least one additional gene to be cotransformed into the organism. Alternatively, the additional genes) can be provided on multiple expression cassettes.
Such an expression cassette is provided with a plurality of restriction sites for insertion of the Bt toxin receptor sequence to be under the transcriptional regulation of the regulatory regions. The expression cassette may additionally contain selectable marker genes.
The expression cassette will include in the 5'-3' direction of transcription, a transcriptional and translational initiation region, a Bt toxin receptor nucleotide sequence of the invention, and a transcriptional and translational termination region functional in host cells. The transcriptional initiation region, the promoter, may be native or analogous, or foreign or heterologous to the plant host.
Additionally, the promoter may be the natural sequence or alternatively a synthetic sequence. By "foreign" is intended that the transcriptional initiation region is not found in the native host cells into which the transcriptional initiation region is introduced. As used herein, a chimeric gene comprises a coding sequence operably linked to a transcription initiation region that is heterologous to the coding sequence.
While it may be preferable to express the sequences using heterologous promoters, the native promoter sequences may be used. Such constructs would change expression levels of Bt toxin receptor in the cell of interest. Thus, the phenotype of the cell is altered.
The termination region may be native with the transcriptional initiation region, may be native with the operably linked DNA sequence of interest, or may be derived from another source.
Where appropriate, the genes) may be optimized for increased expression in a particular transformed cell of interest. That is, the genes can be synthesized using host cell-preferred codons for improved expression.
Additional sequence modifications are known to enhance gene expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon-intron splice site signals, transposon-like repeats, and other such well-characterized sequences that may be deleterious to gene expression.
The G-C content of the sequence may be adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell.
When possible, the sequence is modified to avoid predicted hairpin secondary mRNA
structures.
The expression cassettes may additionally contain 5' leader sequences in the expression cassette construct. Such leader sequences can act to enhance translation.
Translation leaders are known in the art and include: picornavirus leaders, for example, EMCV leader (Encephalomyocarditis 5' noncoding region) (Elroy-Stein et al. (1989) PNAS USA 86:6126-6130); potyvirus leaders, for example, TEV leader (Tobacco Etch Virus) (Allison et al. (1986); MDMV leader (Maize Dwarf Mosaic Virus); Virology 154:9-20), and human immunoglobulin heavy-chain binding polypeptide (BiP), (Macejak et al. ( 1991 ) Nature 353:90-94); untranslated leader from the coat polypeptide mRNA of alfalfa mosaic virus (AMV RNA 4) (Jobling et al.
(1987) Nature 325:622-625); tobacco mosaic virus leader (TMV) (Gallie et al.
(1989) in Molecular Biology ofRNA, ed. Cech (Liss, New York), pp. 237-256); and maize chlorotic mottle virus leader (MCMV) (Lommel et al. (1991) Virology 81:382-385).

See also, Della-Cioppa et al. (1987) Plant Physiol. 84:965-968. Other methods known to enhance translation can also be utilized, for example, introns, and the like.
In preparing the expression cassette, the various DNA fragments may be manipulated, so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame. Toward this end, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g., transitions and transversions, may be involved.
Using the nucleic acids of the present invention, the polypeptides of the invention could be expressed in any cell of interest, the particular choice of the cell depending on factors such as the level of expression and/or receptor activity desired.
Cells of interest include, but are not limited to conveniently available mammalian, plant, insect, bacteria, and yeast host cells. The choice of promoter, terminator, and other expression vector components will also depend on the cell chosen. The cells produce the protein in a non-natural condition (e.g., in quantity, composition, location, and/or time), because they have been genetically altered through human intervention to do so.
It is expected that those of skill in the art are knowledgeable in the numerous expression systems available for expression of a nucleic acid encoding a protein of the present invention. No attempt to describe in detail the various methods known for the expression of proteins in prokaryotes or eukaryotes will be made.
In brief summary, the expression of isolated nucleic acids encoding a protein of the present invention will typically be achieved by operably linking, for example, the DNA or cDNA to a promoter, followed by incorporation into an expression vector. The vectors can be suitable for replication and integration in either prokaryotes or eukaryotes. Typical expression vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the DNA encoding a protein of the present invention. To obtain high level expression of a cloned gene, it is desirable to construct expression vectors which contain, at the minimum, a strong promoter to direct transcription, a ribosome binding site for translational initiation, and a transcription/translation terminator. One of skill would recognize that modifications can be made to a protein of the present invention without diminishing its biological activity. Some modifications may be made to facilitate the cloning, expression, or incorporation of the targeting molecule into a fusion protein. Such modifications are well known to those of skill in the art and include, for example, a methionine added at the amino terminus to provide an initiation site, or additional amino acids (e.g., poly His) placed on either terminus to create conveniently located restriction sites or termination codons or purification sequences.
Prokaryotic cells may be used as hosts for expression. Prokaryotes most frequently are represented by various strains of E. coli; however, other microbial strains may also be used. Commonly used prokaryotic control sequences which are defined herein to include promoters for transcription initiation, optionally with an operator, along with ribosome binding site sequences, include such commonly used promoters as the beta lactamase (penicillinase) and lactose (lac) promoter systems 1 S (Chang et al. ( 1977) Nature 198:1056), the tryptophan (trp) promoter system (Goeddel et al. (1980) Nucleic Acids Res. 8:4057) and the lambda-derived P L
promoter and N-gene ribosome binding site (Shimatake et al. (1981) Nature 292:128).
The inclusion of selection markers in DNA vectors transfected in E. coli is also useful. Examples of such markers include genes specifying resistance to ampicillin, tetracycline, or chloramphenicol.
The vector is selected to allow introduction into the appropriate host cell.
Bacterial vectors are typically of plasmid or phage origin. Appropriate bacterial cells are infected with phage vector particles or transfected with naked phage vector DNA.
If a plasmid vector is used, the bacterial cells are transfected with the plasmid vector DNA. Expression systems for expressing a protein of the present invention are available using Bacillus sp. and Salmonella (Palva et al. (1983) Gene 22:229-235;
Mosbach et al. (1983) Nature 302:543-545).
A variety of eukaryotic expression systems such as yeast, insect cell lines, plant and mammalian cells, are known to those of skill in the art. The sequences of the present invention can be expressed in these eukaryotic systems. In some embodiments, transformed/transfected plant cells are employed as expression systems for production of the proteins of the instant invention.

62451-879 (S) Synthesis of heterologous proteins in yeast is well known. Sherman, F. et al.
( 1982) Methods in Yeast Genetics, Cold Spring Harbor Laboratory is a well recognized work describing the various methods available to produce the protein in yeast. Two widely utilized yeast for production of eukaryotic proteins are Saccharomyces cerevisia and Pichia pastoris. Vectors, strains, and protocols for expression in Saccharomyces and Pichia are known in the art and available from commercial suppliers (e.g., Invitrogen). Suitable vectors usually have expression control sequences, such as promoters, iacludiag 3-phosphoglycerate ldnase or alcohol oxidase, and an origin of replication, termination sequences and the like as desired.
14 A protein of the present invention, once expressed, can be isolated from yeast by lysing the cells and applying standard protein isolation techniques to the lysates.
The monitoring of the purification process can be accomplished by using Western blot techniques or radioimmunoassay or other standard immunoassay techniques.
The sequences encoding proteins of the present invention can also be Iigated to various expression vectors for use in transfecting cell cultures of, for instance, mammalian, insect, or plant origin. Illustrative of cell cultures useful for the production of the peptides are mammalian cells. Mammalian cell systems often will be in the form of monolayers of cells although mammalian cell suspensions may also be used. A number of suitable host cell lines capable of expressing intact proteins have been developed in the art, and include the COS, HEK293, BHK21, and CHO
cell lines. Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter (e.g., the CMV
promoter, a HSV tk promoter or pgk (phosphoglycerate kinase promoter)), an enhancer (Queen et al. (1986) Immunol. Rev. 89:49), and necessary processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites (e.g., an SV40 large T
Ag poly H addition site), and transcriptional terminator sequences. Other animal cells useful for production of proteins of the present invention are available, for instance, from the American Type Culture Collection Catalogue of Cell Lines and Hybridomas (7th edition, 1992). A particular example of mammalian cells for expression of a Bt toxin receptor and assessing Bt toxin cytotoxicity mediated by the receptor, includes embryonic 293 cells. See U.S. Patent NO. 5,693,491.

Appropriate vectors for expressing proteins of the present invention in insect cells are usually derived from the SF9 baculovirus. Suitable insect cell lines include mosquito larvae, silkworm, armyworm, moth and Drosophila cell lines such as a Schneider cell line (See Schneider et al. (1987) J. Embryol. Exp. Morphol. 27:
353-365).
As with yeast, when higher animal or plant host cells are employed, polyadenylation or transcription terminator sequences are typically incorporated into the vector. An example of a terminator sequence is the polyadenylation sequence from the bovine growth hormone gene. Sequences for accurate splicing of the transcript may also be included. An example of a splicing sequence is the VP1 intron from SV40 (Sprague et al. (1983) J. Virol. 45:773-781). Additionally, gene sequences to control replication in the host cell may be incorporated into the vector such as those found in bovine papilloma virus-type vectors. Saveria-Campo, M., Bovine Papilloma Virus DNA a Eukaryotic Cloning Vector in DNA Cloning Vol. II
a Practical Approach, D.M. Glover, ed., IRL Pres, Arlington, Virginia pp. 213-(1985).
In a particular embodiment of the invention, it may be desirable to negatively control receptor binding; particularly, when toxicity to a cell is no longer desired or if it is desired to reduce toxicity to a lower level. In this case, ligand-receptor polypeptide binding assays can be used to screen for compounds which bind to the receptor but do not confer toxicity to a cell expressing the receptor. The examples of a molecule that can be used to block ligand binding include an antibody that specifically recognizes the ligand binding domain of the receptor such that ligand binding is decreased or prevented as desired.
In another embodiment, receptor polypeptide expression could be blocked by the use of antisense molecules directed against receptor RNA or ribozymes specifically targeted to this receptor RNA. It is recognized that with the provided nucleotide sequences, antisense constructions, complementary to at least a portion of the messenger RNA (mRNA) for the Bt toxin receptor sequences can be constructed.
Antisense nucleotides are constructed to hybridize with the corresponding mRNA.
Modifications of the antisense sequences may be made as long as the sequences hybridize to and interfere with expression of the corresponding mRNA. In this manner, antisense constructions having 70%, preferably 80%, more preferably 85%

sequence similarity to the corresponding antisensed sequences may be used.
Furthermore, portions of the antisense nucleotides may be used to disrupt the expression of the target gene. Generally, sequences of at least 50 nucleotides, 100 nucleotides, 200 nucleotides, or greater may be used.
Fragments and variants of the disclosed nucleotide sequences and polypeptides encoded thereby are encompassed by the present invention. By "fragment" is intended a portion of the nucleotide sequence, or a portion of the amino acid sequence, and hence a portion of the polypeptide encoded thereby.
Fragments of a nucleotide sequence may encode polypeptide fragments that retain the biological activity of the native polypeptide and, for example, bind Bt toxins.
Alternatively, fragments of a nucleotide sequence that are useful as hybridization probes generally do not encode fragment polypeptides retaining biological activity. Thus, fragments of a nucleotide sequence may range from at least about 20 nucleotides, about 50 nucleotides, about 100 nucleotides, and up to the full-length nucleotide sequence encoding the polypeptides of the invention.
A fragment of a Bt toxin receptor nucleotide sequence that encodes a biologically active portion of a Bt toxin receptor polypeptide of the invention will encode at least 15, 25, 30, S0, 100, 150, 200 or 250 contiguous amino acids, or up to the total number of amino acids present in a full-length Bt toxin receptor polypeptide of the invention (for example, 1717, 1730, and 1734 amino acids for SEQ ID
NOs:2, 4, and 6, respectively. Fragments of a Bt toxin receptor nucleotide sequence that are useful as hybridization probes for PCR primers generally need not encode a biologically active portion of a Bt toxin receptor polypeptide.
Thus, a fragment of a Bt toxin receptor nucleotide sequence may encode a biologically active portion of a Bt toxin receptor polypeptide, or it may be a fragment that can be used as a hybridization probe or PCR primer using methods disclosed below. A biologically active portion of a Bt toxin receptor polypeptide can be prepared by isolating a portion of one of the Bt toxin receptor nucleotide sequences of the invention, expressing the encoded portion of the Bt toxin receptor polypeptide (e.g., by recombinant expression in vitro), and assessing the activity of the encoded portion of the Bt toxin receptor polypeptide. Nucleic acid molecules that are fragments of a Bt toxin receptor nucleotide sequence comprise at least 16, 20, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, or 1,400 nucleotides, or up to the number of nucleotides present in a full-length Bt toxin receptor nucleotide sequence disclosed herein (for example, 5498, 5527, and 5614 nucleotides for SEQ ID NOs: 1, 3, and 5, respectively).
By "variants" is intended substantially similar sequences. For nucleotide sequences, conservative variants include those sequences that, because of the degeneracy of the genetic code, encode the amino acid sequence of one of the Bt toxin receptor polypeptides of the invention. Naturally occurring allelic variants such as these can be identified with the use of well-known molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques as outlined below. Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis, but which still encode a Bt toxin receptor protein of the invention.
Generally, variants of a particular nucleotide sequence of the invention will have at least about 40%, 50%, 60%, 65%, 70%, generally at least about 75%, 80%, 85%, preferably at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, and more preferably at least about 98%, 99% or more sequence identity to that particular nucleotide sequence as determined by sequence alignment programs described elsewhere herein using default parameters.
By "variant" protein is intended a protein derived from the native protein by deletion (so-called truncation) or addition of one or more amino acids to the N-terminal and/or C-terminal end of the native protein; deletion or addition of one or more amino acids at one or more sites in the native protein; or substitution of one or more amino acids at one or more sites in the native protein. Variant proteins encompassed by the present invention are biologically active, that is they continue to possess the desired biological activity of the native protein, that is, activity as described herein (for example, Bt toxin binding activity). Such variants may result from, for example, genetic polymorphism or from human manipulation.
Biologically active variants of a native Bt toxin receptor protein of the invention will have at least about 40%, SO%, 60%, 65%, 70%, generally at least about 75%, 80%, 85%, preferably at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, and more preferably at least about 98%, 99% or more sequence identity to the amino acid sequence for the native protein as determined by sequence alignment programs described elsewhere herein using default parameters. A biologically active variant of a 62451-879 (S) protein of the invention may differ from that protein by as few as 1-15 amino acid residues, as few as 1-10, such as 6-10, as few as 5, as few as 4, 3, 2, or even 1 amino acid residue.
The polypeptides of the invention may be altered in various ways including amino acid substitufions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art. For example, amino acid sequence variants of the Bt toxin receptor polypeptides can be prepared by mutations in the DNA. Methods for mutagenesis and nucleotide sequence alterations are well known in the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488-492;
Kunkel et al. (1987) Methods in Enzymol. 154:367-382; US Patent No. 4,873,192;
Walker and Gaastra, acts. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and the references cited therein. Guidance as to appropriate amino acid substitutions that do not affect biological activity of the protein of interest may be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washiagton, D.C.).
Conservative substitutions, such as exchanging one amino acid with another having similar properties, may be preferable.
Thus, the genes and nucleotide sequences of the invention include both the naturally occurring sequences as well as mutant forms. Likewise, the proteins of the invention encompass both naturally occurring proteins as well as variations and modified forms thereof. Such variants will continue to possess the desired toxin binding activity. Obviously, the mutations that will be made in the DNA
encoding the variant must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure. See, EP Patent Application Publication No. 75;444.
The deletions, insertions, and substitutions of the protein sequences encompassed herein are not expected to produce radical changes in the characteristics of the protein.
For example, it is recothat at least about 10, 20, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, and up to 960 amino acids may be deleted from the N-terminus of a polypeptide that has the amino acid sequence set forth in SEQ 117 N0:2, and still retain binding function. It is further recognized that at least about 10, 20, 30, 40, S0, 60, 70, 80, 90, 100, 110, and up to 62451-879(5) 119 amino acids may be deleted from the C-terminus of a polypeptide that has the amino acid sequence set forth in SEQ ID N0:2, and still retain binding function.
Deletion variants of the invention that encompass polypeptides having these deletions.
It is recognized that deletion variants of the invention that retain binding function encompass polypeptides having these N-terminal or C-terminal deletions, or having any deletion combination thereof at both the C- and the N-termini.
However, when it is difficult to predict the exact effect of the sututitution, deletion, or insertion in advance of doing so, one skilled in the art will appreciate that the effect will be evaluated by routine screening assays. That is, the activity can be evaluated by receptor binding and/or toxicity assays. See, for example, United States Patent NO: 5,693,491; T.P. Keeton et al. (1998) Appl. Environ. Microbiol.
64(6):2158-2165; B.R. Francis et al. (1997) Insect Biochem. Mol. Biol.
27(6):541-550; T.P. Keeton et al. (1997) Appl. Environ. Microbiol. 63(9):3419-3425; R.K.
Vadlamudi et al. (1995) J. Biol. Chem. 270(10):5490-5494; Ihara et al. (1998) Comparative Biochem. Physiol. B 120:197-204; Nagamatsu et al. (1998) Biosci.
Biotechnol. Biochem. 62(4):727-734.
Variant nucleotide sequences and polypeptides also encompass sequences and polypeptides derive from a mutagenic and recombinogenic procedure such as DNA
shuffling. With such a procedure, one or more different toxin receptor coding sequences can be manipulated to create a new toxin receptor, including but not limited to a new Bt toxin receptor, possessing the desired properties. In this manner, libraries of recombinant polynucleotides are generated from a population of related sequence polynucleotides comprising sequence regions that have substantial sequence identity and can be homologously recombined in vitro or in vivo. For example, using this approach, sequence motifs encoding a domain of interest may be shui~led between the Bt toxin receptor gene of the invention and other known Bt toxin receptor genes to obtain a new gene coding for a polypeptide with an improved property of interest, such as an increased ligand affinity in the case of a receptor. Strategies for such DNA
shuffling are known in the art. See, for example, Stemmer (1994) Proc. Natl.
Acaci Sci. USA 91:10747-10751; Stemmer (1994) Nature 370:389-391; Crameri et al.
(1997) Nature Biotech. 15:436-438; Moore et al. (1997) J. Mol. Biol. 272:336-347;
Zhang et al. (1997) Proc. Natl. Acacl Sci. USA 94:4504-4509; Crameri et al.
(1998) Nature 391:288-291; and U.S. Patent Nos. 5,605,793 and 5,837,448.

Where the receptor polypeptides of the invention are expressed in a cell and associated with the cell membrane (for example, by a transmembrane segment), in order for the receptor of the invention to bind a desired ligand, for example a Cry 1 A toxin, the receptor's ligand binding domain must be available to the ligand. In this aspect, it is recognized that the native Bt toxin receptor of the invention is oriented such that the toxin binding site is available extracellularly.
Accordingly, in methods comprising use of intact cells, the invention provides cell surface Bt-toxin receptors. By a "cell surface Bt toxin receptor" is intended a membrane-bound receptor polypeptide comprising at least one extracellular Bt toxin binding site. A cell surface receptor of the invention comprises an appropriate combination of signal sequences and transmembrane segments for guiding and retaining the receptor at the cell membrane such that that toxin binding site is available extracellularly. Where native Bt toxin receptors are used for expression, deduction of the composition and configuration of the signal sequences and transmembrane segments is not necessary to ensure the appropriate topology of the polypeptide for displaying the toxin binding site extracellularly. As an alternative to native signal and transmembrane sequences, heterologous signal and transmembrane sequences could be utilized to produce a cell surface receptor polypeptide of the invention.
It is recognized that it may be of interest to generate Bt toxin receptors that are capable of interacting with the receptor's ligands intracellularly in the cytoplasm, in the nucleus or other organelles, in other subcellular spaces; or in the extracellular space.
Accordingly, the invention encompasses variants of the receptors of the invention, wherein one or more of the segments of the receptor polypeptide is modified to target the polypeptide to a desired intra- or extracellular location.
Also encompassed by the invention are receptor fragments and variants that are useful, among other things, as binding antagonists that will compete with a cell surface receptor of the invention. Such a fragment or variant can, for example, bind a toxin but not be able to confer toxicity to a particular cell. In this aspect, the invention provides secreted receptors, more particularly secreted Bt toxin receptors; or receptors that are not membrane bound. The secreted receptors of the invention can contain a heterologous or homologous signal sequence facilitating its secretion from the cell expressing the receptors; and further comprise a secretion variation in the region corresponding to transmembrane segments. By "secretion variation" is intended that amino acids corresponding to a tranmembrne segment of a membrane bound receptor comprise one or more deletions, substitutions, insertions, or any combination thereof; such that the region no longer retains the requisite hydrophobicity to serve as a transmembrane segment. Sequence alterations to create a secretion variation can be tested by confirming secretion of the polypeptide comprising the variation from the cell expressing the polypeptide.
The polypeptides of the invention can be purified from cells that naturally express it, purified from cells that have been altered to express it (i. e.
recombinant) or synthesized using polypeptide synthesis techniques that are well known in the art. In one embodiment, the polypeptide is produced by recombinant DNA methods. In such methods a nucleic acid molecule encoding the polypeptide is cloned into an expression vector as described more fully herein and expressed in an appropriate host cell according to known methods in the art. The polypeptide is then isolated from cells using polypeptide purification techniques well known to those of ordinary skill in the art.
Alternatively, the polypeptide or fragment can be synthesized using peptide synthesis methods well known to those of ordinary skill in the art.
The invention also encompasses fusion polypeptides in which one or more polypeptides of the invention are fused with at least one polypeptide of interest. In one embodiment, the invention encompasses fusion polypeptides in which a heterologous polypeptide of interest has an amino acid sequence that is not substantially homologous to the polypeptide of the invention. In this embodiment, the polypeptide of the invention and the polypeptide of interest may or may not be operatively linked. An example of operative linkage is fusion in-frame so that a single polypeptide is produced upon translation. Such fusion polypeptides can, for example, facilitate the purification of a recombinant polypeptide.
In another embodiment, the fused polypeptide of interest may contain a heterologous signal sequence at the N-terminus facilitating its secretion from specific host cells. The expression and secretion of the polypeptide can thereby be increased by use of the heterologous signal sequence.
The invention is also directed to polypeptides in which one or more domains in the polypeptide described herein are operatively linked to heterologous domains having homologous functions. Thus, the toxin binding domain can be replaced with a toxin binding domain for other toxins. Thereby, the toxin specificity of the receptor is based on a toxin binding domain other than the domain encoded by Bt toxin receptor but other characteristics of the polypeptide, for example, membrane localization and topology is based on Bt toxin receptor.
Alternatively, the native Bt toxin binding domain may be retained while additional heterologous ligand binding domains, including but not limited to heterologous toxin binding domains are comprised by the receptor. Thus, the invention also encompasses fusion polypeptides in which a polypeptide of interest is a heterologous polypeptide comprising a heterologous toxin binding domains.
Examples of heterologous polypeptides comprising Cry 1 toxin binding domains include, but are not limited to Knight et al (1994) Mol Micro 1l: 429-436; Lee et al. (1996) Appl Environ Micro 63: 2845-2849; Gill et al. (1995) JBiol Chem 270: 27277-27282;
Garczynski et al. (1991) Appl Environ Microbiol 10: 2816-2820; Vadlamudi et al.
(1995) JBiol Chem 270(10):5490-4, U.S. Patent No5,693,491.
The Bt toxin receptor peptide of the invention may also be fused with other members of the cadherin superfamily. Such fusion polypeptides could provide an important reflection of the binding properties of the members of the superfamily. Such combinations could be further used to extend the range of applicability of these molecules in a wide range of systems or species that might not otherwise be amenable to native or relatively homologous polypeptides. The fusion constructs could be substituted into systems in which a native construct would not be functional because of species specific constraints. Hybrid constructs may further exhibit desirable or unusual characteristics otherwise unavailable with the combinations of native polypeptides.
Polypeptide variants encompassed by the present invention include those that contain mutations that either enhance or decrease one or more domain functions. For example, in the toxin binding domain, a mutation may be introduced that increases or decreases the sensitivity of the domain to a specific toxin.
As an alternative to the introduction of mutations, increase in function may be provided by increasing the copy number of ligand binding domains. Thus, the invention also encompasses receptor polypeptides in which the toxin binding domain is provided in more than one copy.
The invention further encompasses cells containing receptor expression vectors comprising the Bt toxin receptor sequences, and fragments and variants thereof. The expression vector can contain one or more expression cassettes used to transform a cell of interest. Transcription of these genes can be placed under the control of a constitutive or inducible promoter (for example, tissue - or cell cycle-preferred).
Where more than one expression cassette utilized, the cassette that is additional to the cassette comprising at least one receptor sequence of the invention, can comprise either a receptor sequence of the invention or any other desired sequences.
The nucleotide sequences of the invention can be used to isolate homologous sequences in insect species other than ostrinia, particularly other lepidopteran species, more particularly other Pyraloidea species.
The following terms are used to describe the sequence relationships between two or more nucleic acids or polynucleotides: (a) "reference sequence", (b) "comparison window", (c) "sequence identity", (d) "percentage of sequence identity", and (e) "substantial identity".
(a) As used herein, "reference sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence.
(b) As used herein, "comparison window" makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Generally, the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100, or longer. Those of skill in the art understand that to avoid a high similarity to a reference sequence due to inclusion of gaps in the polynucleotide sequence a gap penalty is typically introduced and is subtracted from the number of matches.
Methods of alignment of sequences for comparison are well known in the art.
Thus, the determination of percent identity between any two sequences can be accomplished using a mathematical algorithm. Non-limiting examples of such mathematical algorithms are the algorithm of Myers and Miller (1988) CABIOS
4:11-17; the local homology algorithm of Smith et al. (1981) Adv. Appl. Math.
2:482; the homology alignment algorithm of Needleman and Wunsch ( 1970) J. Mol. Biol.
48:443-453; the search-for-similarity-method of Pearson and Lipman (1988) Proc.
Natl. Acad. Sci. 85:2444-2448; the algorithm of Karlin and Altschul ( 1990) Proc.

62451-879(S) Natl. Acad. Sci. LISA 872264, modified as in Karlin and Altschul (1993) Proc.
Natl.
Acad Sci. USA 917:5873-5877..
Computer implementations of these mathematical algorithms can be utilized for comparison o:f sequences ro determine sequence identity. Such implementations include, but are not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, California); the ALIGN program (Version 2.0);
the ALIGN PLUS program (vers:ion 3.0, copyright 1997); and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Version 8 (available from Genetics Computer Group (GCG), 575 Science Drive, Madison, Wisconsin, USA I. Alignments using these programs can be performed using the default parameters. The CLUSTAL program is well described by Higgins et al.
(1988) Gene 73:237-244 (1988); Higgins et al. (1989) CABIOS 5:151-153; Corpet et al. (1988) Nucleic Acids Res. l 1i:10881-90; Huang et al. (1992) CABIOS 8:155-65;
and Pearson et al. (1994) Meth. Mol. Biol. 24:307-331. The ALIGN and the ALIGN
PLUS programs are based on th.e algorithm of Myers and Miller (1988) supra. A
PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used with the ALIGN program when comparing amino acid sequences. The BLAST programs of Altschul. et al (1990) J. Mol. Biol. 215:403 are based on the algorithm of Karlin and Altschul (1990) supra. BLAST nucleotide searches can be performed with t:he BLAST'N program, score = 1 U0, wordlength = I 2, to obtain nucleotide sequences homologous to a nucleotide sequence encoding a protein of the invention. BLAST protein searches can be performed with the BLASTX program, score = 50, wordlength = 3, to obtain amino acid sequences homologous to a protein or polypeptide of the inventi<7n. To obtain gapped alignments for comparison purposes, Gapped BLAST (ire BLAST 2.0) can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 2.5:3389. Alternatively, PSI-BLAST (in BLAST
2.0) can be used to perform an iterated search that detects distant relationships between molecules. See Altschul et al. ( 1997) supra. When utilizing BLAST, Gapped BLAST, PSI-BLAST, the default parameters of the respective programs (e.g., BLASTN for nucleotide sequences, BLASTX for proteins) can be used.
A web site which describes the BLAST algorithm is made available from the National Center for Biotechnology Information, National Library of Medicine, Building 38A, Bethesda, MD 20894 USA. Alignment may also be performed manually by inspection.

Unless otherwise stated, sequence identity/similarity values provided herein refer to the value obtained using GAP Version 10 using the following parameters:
identity using GAP Weight of 50 and Length Weight of 3; % similarity using Gap Weight of 12 and Length Weight of 4, or any equivalent program. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by the preferred program.
GAP uses the algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:
443-453, to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. GAP considers all possible alignments and gap positions and creates the alignment with the largest number of matched bases and the fewest gaps. It allows for the provision of a gap creation penalty and a gap extension penalty in units of matched bases. GAP
must make a profit of gap creation penalty number of matches for each gap it inserts. If a gap extension penalty greater than zero is chosen, GAP must, in addition, make a profit for each gap inserted of the length of the gap times the gap extension penalty.
Default gap creation penalty values and gap extension penalty values in Version 10 of the Wisconsin Genetics Software Package for protein sequences are 8 and 2, respectively. For nucleotide sequences the default gap creation penalty is 50 while the default gap extension penalty is 3. The gap creation and gap extension penalties can be expressed as an integer selected from the group of integers consisting of from 0 to 200. Thus, for example, the gap creation and gap extension penalties can be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or greater.
GAP presents one member of the family of best alignments. There may be many members of this family, but no other member has a better quality. GAP
displays four figures of merit for alignments: Quality, Ratio, Identity, and Similarity.
The Quality is the metric maximized in order to align the sequences. Ratio is the quality divided by the number of bases in the shorter segment. Percent Identity is the percent of the symbols that actually match. Percent Similarity is the percent of the symbols that are similar. Symbols that are across from gaps are ignored. A
similarity is scored when the scoring matrix value for a pair of symbols is greater than or equal to 0.50, the similarity threshold. The scoring matrix used in Version 10 of the Wisconsin Genetics Software Package is BLOSUM62 (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915).
(c) As used herein, "sequence identity" or "identity" in the context of two nucleic acid or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity". Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE
(Intelligenetics, Mountain View, California).
(d) As used herein, "percentage of sequence identity" means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
(e)(i) The term "substantial identity" of polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 70% sequence identity, preferably at least 80%, more preferably at least 90%, and most preferably at least 95%, compared to a reference sequence using one of the alignment programs described using standard parameters. One of skill in the art will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning, and the like. Substantial identity of amino acid sequences for these purposes normally means sequence identity of at least 60%, more preferably at least 70%, 80%, 90%, and most preferably at least 95%.
Another indication that nucleotide sequences are substantially identical is if two molecules hybridize to each other under stringent conditions. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. However, stringent conditions encompass temperatures in the range of about 1 °C to about 20°C lower than the Tm, depending upon the desired degree of stringency as otherwise qualified herein. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides they encode are substantially identical. This may occur, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. One indication that two nucleic acid sequences are substantially identical is when the polypeptide encoded by the first nucleic acid sequence is immunologically cross reactive with the polypeptide encoded by the second nucleic acid sequence.
(e)(ii) The term "substantial identity" in the context of a peptide indicates that a peptide comprises a sequence with at least 70% sequence identity to a reference sequence, preferably 80%, more preferably 85%, most preferably at least 90% or 95%
sequence identity to the reference sequence over a specified comparison window.
Preferably, optimal alignment is conducted using the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443-453. An indication that two peptide sequences are substantially identical is that one peptide is immunologically reactive with antibodies raised against the second peptide. Thus, a peptide is substantially identical to a second peptide, for example, where the two peptides differ only by a conservative substitution. Peptides that are "substantially similar"
share sequences as noted above except that residue positions that are not identical may differ by conservative amino acid changes.

The nucleotide sequences of the invention can be used to isolate corresponding sequences from other organisms, particularly other insects, more particularly other lepidopteran species. In this manner, methods such as PCR, hybridization, and the like can be used to identify such sequences based on their sequence homology to the sequences set forth herein. Sequences isolated based on their sequence identity to the entire Bt toxin receptor sequences set forth herein or to fragments thereof are encompassed by the present invention. Such sequences include sequences that are orthologs of the disclosed sequences. By "orthologs" is intended genes derived from a common ancestral gene and which are found in different species as a result of speciation. Genes found in different species are considered orthologs when their nucleotide sequences and/or their encoded protein sequences share substantial identity as defined elsewhere herein. Functions of orthologs are often highly conserved among species.
In a PCR approach, oligonucleotide primers can be designed for use in PCR
reactions to amplify corresponding DNA sequences from cDNA or genomic DNA
extracted from any organism of interest. Methods for designing PCR primers and PCR cloning are generally known in the art and are disclosed in Sambrook et al.
(1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York). See also Innis et al., eds. (1990) PCR
Protocols: A Guide to Methods and Applications (Academic Press, New York);
Innis and Gelfand, eds. (1995) PCR Strategies (Academic Press, New York); and Innis and Gelfand, eds. ( 1999) PCR Methods Manual (Academic Press, New York). Known methods of PCR include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially-mismatched primers, and the like.
In hybridization techniques, all or part of a known nucleotide sequence is used as a probe that selectively hybridizes to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., genomic or cDNA libraries) from a chosen organism. The hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labeled with a detectable group such as 32P, or any other detectable marker. Thus, for example, probes for hybridization can be made by labeling synthetic oligonucleotides based on the Bt toxin receptor sequences of the invention. Methods for preparation of probes for hybridization and for construction of cDNA and genomic libraries are generally known in the art and are disclosed in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York).
For example, the entire Bt toxin receptor sequence disclosed herein, or one or more portions thereof, may be used as a probe capable of specifically hybridizing to corresponding Bt toxin receptor sequences and messenger RNAs. To achieve specific hybridization under a variety of conditions, such probes include sequences that are unique among Bt toxin receptor sequences and are preferably at least about 10 nucleotides in length, and most preferably at least about 20 nucleotides in length.
Such probes may be used to amplify corresponding Bt toxin receptor sequences from a chosen plant organism by PCR. This technique may be used to isolate additional coding sequences from a desired organism or as a diagnostic assay to determine the presence of coding sequences in an organism. Hybridization techniques include hybridization screening of plated DNA libraries (either plaques or colonies;
see, for example, Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York).
Hybridization of such sequences may be carried out under stringent conditions. By "stringent conditions" or "stringent hybridization conditions"
is intended conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences that are 100% complementary to the probe can be identified (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about nucleotides in length, preferably less than 500 nucleotides in length.
Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCI, 1%
SDS (sodium dodecyl sulphate) at 37°C, and a wash in 1X to 2X SSC (20X
SSC = 3.0 M NaCI/0.3 M trisodium citrate) at 50 to 55°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCI, 1% SDS at 37°C, and a wash in O.SX to 1X SSC at 55 to 60°C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCI, 1% SDS at 37°C, and a wash in O.1X SSC at 60 to 65°C. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours.
Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution.
For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284: Tm = 81.5°C + 16.6 (log M) + 0.41 (%GC) -0.61 (% form) - 500/L; where M is the molarity of monovalent canons, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1 °C for each 1 % of mismatching; thus, Tm, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the Tm can be decreased 10°C. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4°C lower than the thermal melting point (Tm);
moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10°C lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20°C lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than 45°C (aqueous solution) or 32°C (formamide solution), it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Technigues in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, Part I, Chapter 2 (Elsevier, New York); and Ausubel et al., eds. (1995) Current Protocols in Molecular Biology, Chapter 2 (Greene Publishing and Wiley-Interscience, New York). See Sambrook et al.
(1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York).
Thus, isolated sequences that encode for a Bt toxin receptor protein and which hybridize under stringent conditions to the Bt toxin receptor sequences disclosed herein, or to fragments thereof, are encompassed by the present invention.
Such sequences will be at least about 40% to 50% homologous, about 60%, 65%, or 70%
homologous, and even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous with the disclosed sequences. That is, the sequence identity of sequences may range, sharing at least about 40%
to 50%, about 60%, 65%, or 70%, and even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity.
The compositions and screening methods of the invention are useful for identifying cells expressing the BT toxin receptors of the invention, and variants and homologues thereof. Such identification could utilize detection methods at the protein level, such as ligand-receptor binding; or at the nucleotide level. Detection of the polypeptide could be in situ by means of in situ hybridization of tissue sections but may also be analyzed by bulk polypeptide purification and subsequent analysis by Western blot or immunological assay of a bulk preparation. Alternatively, receptor gene expression can be detected at the nucleic acid level by techniques well known to those of ordinary skill in any art using complimentary polynucleotides to assess the levels of genomic DNA, mRNA, and the like. As an example, PCR primers complimentary to the nucleic acid of interest can be used to identify the level of expression.
Tissues and cells identified as expressing the receptor sequences of the invention are determined to be susceptible to toxins which bind the receptor polypeptides.
Where the source of the cells identified to express the receptor polypeptides of the invention is an organism, for example an insect plant pest, the organism is determined to be susceptible to toxins capable of binding the polypeptides. In a 62451-879(S) particular embodiment, identification is in a lepidopteran plant pesr expressing the Bt toxin receptor of the invention.
The invention encompasses antibody preparations with specificity against the polypeptides of the invention. In further embodiments of the invention, the antibodies are users to detect receptor eacptession in a cell.
In one aspect, the invention is particularly drawn to compositions and methods for modulating susceptibility of plant pests to Bt toxins. However, it is recognized that the methods and compositions could be used for modulating susceptibility of any cell or organism to the toxins. By "modulating" is intended that the susceptibility of a cell or organism to the cytotoxic effects of the toxin is increased or decreased. By "suceptibility" is intended that the viability of a cell contacted with the toxin is decreased. Thus the invention encompasses expressing the cell surface receptor ~lypeptides of the invention to increase susceptibility of a target cell or organ to Bt toxins. Such increases in toxin susceptibility are useful for medical and veterinary purposes in which eradication or reduction of viability of a group of cells is desired. Such increases in susceptibility are also useful for agricultural applications in which eradication or reduction of population of particular plant pests is desired.
Plant pests of interest include, but are not limited to insects, nematodes, and the like. Nematodes include parasitic nematodes such as root-knot, cyst, lesion, and renniform nematodes, etc.
The following examples are offered by way of illustration and not by way of limitation.
EXPERIMENTAL
EXAMPLE 1: Isolation of EC Bt toxin receptor Standard recombinant methods well known to those of ordinary skill in the art were carried out For library construction, total RNA was isolated from the midgut of European corn borer (ECB), Ostrinia nubilalis. Corn borer larvae (for example, a mix of stage 2, 3, and 4, equal weight) can be pulverized in liquid nitrogen, homogenized, and total RNA extracted by standard procedures. PolyA RNA can be isolated from the total RNA with standard PolyA isolation procedures, such as the PolyATact system from Promega Corporation, Madison; WI. cDNA synthesis can then be performed and, for example, unidirectional cDNA libraries can be constructed according to known and *Trade-mark 31 62451-879 (S) commercial procedures, such as the ZAP Express cDNA synthesis kit fiom Stratagene, La Jolla, CA. cDNA can be amplified by PCR, sized and properly digested with restriction fr~nents to be ligated into a vector. Subcloned cDNA can be sequenced to identify sequences with the pmper peptide to identity corresponding to published sequences. These fiag~nents can be used to probe genomic or cDNA libraries corresponding to a specific host, such as Ostrinia nubilalis, to obtain a full length coding sequence. Probes can also be made based on A,pplican~s disclosed sequ~ces. The coding sequence can then be ligated into a desired expression cassette and used to transform a host cell according to standard transformation procedures. Such an expression cassette can be pant of a commercially available vector and expression system; for example, the pET system from Novagen Inc. (Ntadison, VVI).
Additional vectors that can be used for expression include pBKCMV, pBKRSV, pPbac*and pMbac*
(Stratagene Inc.), pFASTBacl (Cn'bco BRL) and other common ba~cte~rial, baculovirvs, mammalian, and yeast expression vectors.
All vectors were constructed using standard molecular biology techniques as described for example in Sambrook et al., (1989) Molecular Cloning: A
Laboratory Manual (2"a ed., Cold Spring Harbor Laboratory: Cold Spring Harbor, N.Y.).
Expression is tested by ligand blotting and testing for Bt toxin binding.
Ligand blotting, binding, and toxicity are tested by known methods; for example, as described in Martinez-Ramirez (1994) Biochem. Biophys. Res. Comm. 201: 782-787;Vadlamudi et al. (1995) JBiol Chem 270(10):5490-4, Keeton et al. (1998) Appl Environ Microbiol 64(6):2158-2165; Keeton et al. (1997) Appl Environ Microbiol 63(9):3419-3425;
Ihara et al. (1998) Comparative Biochemistry and Physiology, Part B 120:197-204;
Nagamatsu et al. (1998) Biosci. Biotechnol. Biochem. 62(4):718-726 and Nagamatsu et al. (1998) Biosci. Biotechnol. Biochem. 62(4):727-734.
Identifying the CryIA(b) binding polypeptid~ in ECB was done by ligand blotting brush border membrane vesicle polypeptides and probing those polypeptides for binding with CryIA.(b) toxin. 'Iwo polypeptides, approximately 210 and 205 kDa, were found to bind to CryIA(b). Blotting and binding were done essentially as described in the preceding paragraph.
Degenerate primers for RT-PCR were designed based on known Cryl toxin binding polypeptide sequences from Manducca sexta and Bombyx mori. The primers are shown below. cDNA was constructed finm total midget RNA (cDNA synthesis *Trade-mark 32 kit GibcoBrL). Degenerate primers were used to amplify products of the expected size. The annealing temperature used was 53°C in generation of the 280 by fragment and 55°C when generating the 1.6 kb fragment.
A 280bp fragment was obtained from ECB midgut RNA. Upon cloning and sequencing, the fragment was identified as having homology with the Bt toxin receptor 1 polypeptide (BTR 1 ) described in Vadlamudi et al. ( 1995) J Biol Chem 270(10):5490-4.
A similar approach was used to generate a 1.6 kilobase pair clone. The sequence of primers used to generate the 280 base pair fragment were:
Primer BTRD1S: 5'GTTAMYGTGAGAGAGGCAGAYCC3' (SEQ ID N0:8), and Primer BTRDSA: 5'GGATRTTAAGMGTCAGYACWCCG3' (SEQ ID N0:9).
The sequence of primers used to generate the 1.6 kb fragment were:
Primer BTRD6S: 5'TCCGAATTCTTCTTYAACCTCATCGAYAACTT3' (SEQ ID
NO:10), and Primer BTRD7A: 5'CGCAAGCTTACTTGGTCGATGTTRCASGTCAT3' (SEQ ID
NO:11) The 1.6 kb fragment clone was ligated in an E. coli expression vector, pET-28a-c(+), and expressed using the pET system (Novagen Inc., Madison, WI).
Purified polypeptide encoded by this l.6kb fragment demonstrated binding to CrylA(b) in ligand blots. An ECB midgut cDNA library was generated and screened using this 1.6kb clone, generating 120 positive plaques. Thirty of these plaques were chosen for secondary screening and fifteen of those plaques were purified and sent for DNA
sequencing.
The obtained nucleotide sequence of the selected Bt toxin receptor clone from ECB is set forth in SEQ ID NO: 1. The total length of the clone is 5498 base pairs.
The coding sequences are residues 162-5312. The CrylA binding site is encoded by residues 4038-4547. The predicted transmembrane domain is encoded by residues 4872-4928. The corresponding deduced amino acid sequence for this Bt toxin receptor clone from ECB is set forth in SEQ ID NO: 2.
The purified polypeptide generated from the l.6kb fragment set forth in SEQ
ID N0:7 was used to inoculate rabbits for the production of polyclonal antibodies. On zoo western blots prepared from brush border membrane vesicles from various insect species, this set of antibodies specifically recognized ECB Bt toxin receptor polypeptides, in comparison to Bt toxin receptor homologues polypeptides from other insect species. Rabbit polyclonal antibodies were also raised from a purified polypeptide corresponding to amino acids 1293-1462 of SEQ ID N0:2.
Example 2: Isolation of CEW and FAW Bt toxin receptor orthologues:
cDNA encoding a full-length Bt toxin receptor from corn earworm (CEW, Heliothis Zea) was isolated. The nucleotide sequence for this cDNA is set forth in SEQ
ID NO: 3. Nucleotides 171-5360 correspond to the open reading frame.
Nucleotides 4917-4973 correspond to the transmembrane region. Nucleotides 4083-4589 correspond to the CryIA binding site. The deduced corresponding amino acid sequence for the CEW Bt toxin receptor is set forth in SEQ ID NO: 4.
cDNA encoding a full-length Bt toxin receptor from fall armyworm (FAW, Spodoptera frugiperda) was isolated. The nucleotide sequence for this cDNA is set forth in SEQ ID NO: 5. Nucleotides 162-5363 correspond to the open reading frame.
Nucleotides 4110-4616 correspond to the CryIA binding site. Nucleotides 4941-correspond to the transmembrane region. Nucleotides 162-227 correspond to a signal peptide. The deduced corresponding amino acid sequence for the FAW Bt toxin receptor is set forth in SEQ ID NO: 6.
Example 3: Binding and cell death in lepidopteran insect cells expressing the Bt toxin receptors of the invention:
An in vitro system is developed to demonstrate the functionality of a Bt toxin receptor of the invention. The results disclosed in this example demonstrate that the ECB Bt toxin receptor of the invention (SEQ ID NOs: l and 2) is specifically involved in the binding and killing action of CrylAb toxin.
Well known molecular biological methods are used in cloning and expressing the ECB Bt toxin receptor in Sf9 cells. A baculovirus expression system (Gibco BRL
Catalogue No. 10359-016) is used according to the manufacturer's provided protocols and as described below. S. frugiperda (Sf~) cells obtained from ATCC (ATCC-CRL
1711) are grown at 27°C in Sf 900 II serum free medium (Gibco BRL, Catalogue No.
10902-088). These cells, which are not susceptible to Cry 1 Ab toxin, are transfected with an expression construct (pFastBacl bacmid, Gibco BRL catalogue NO. 10360-014) comprising an operably linked Bt toxin receptor of the invention (SEQ ID
NO:l ) 62451-879(S) downstream of a polyhedrin promoter. Transfected Sf9 cells express the ECB Bt toxin receptor and are lysed in the presence of CrylAb toxin. Toxin specificities, binding parameters, such as Kd values, and half maximal doses for cellular death and/or toxicity are also determined.
For generating expression constructs, the ECB Bt toxin receptor cDNA (SEQ
ID NO:1) is subjected to appropriate restriction digestion, and the resulting cDNA
comprising the full-length coding region is ligated into the donor plasmid pFastBacl multiple cloning site. Following transformation and subsequent transposition, recombinant bacmid DNA cotriprising the ECB gt toxin receptor (RBECB 1 ) is isolated. As a control, ~mbinant bacmid DNA comprising the reporter gene ~-glucuronidase (RBGUS) is similarly conshucted and isolated.
For transfection, 2~g each RBECB 1 or RBGUS DNA is mixed with 6 p,1 of CellFectin*(GibcoBRL catalogue NO. 10362-010) in I00 ~1 of Sf300 medium, and incubated at room temperature for 30 minutes. The mixture is then diluted with 0.8 ml IS Sf 900 medium. Sf9 cells (106/m1 per 35 mm well) are washed once with Sf medium, mixed with the DNA/CellFectin mixture, added to the well, and incubated at room temperature for S hours. The medium is removed and 2 ml of Sf 900 medium containing penicillin and streptomycin is added to the well. 3-5 days after transfection, Western blotting is used to examine protein expression.
For Western biotting,100 p1 of cell lysis buffer (50 mM Tris, pH7.8, 150mM
NaCI, l% Nonidet P-40) is added to the well. The cells are scraped and subjected to 16,OOOxg centrifugation. Pellet and supernatant are separated and subjected to Western blotting. An antibody preparation against ECB Bt toxin receptor (Example 1 ) is used as first antibody. Alkaline phbsphatase-labelled anti-rabbit IgG
is used as s~n~Y ~tibody. Western blot results indicate that the full length ECB Bt toxin receptor of the invention (SEQ DJ NOs: l and 2) is expressed in the cell membrane of these cells.
For determining GUS activity, the medium of the cells transfected with RBGUS is removed. The cells and the medium are separately mixed with GUS
substrate and assayed for the well known enzymatic activity. GUS activity assays indicate that this reporter gene is actively expressed in the transfected cells.
For determining toxin susceptibility, Cry toxins including but not limited to CryIA, CryIB, CryIC, CrylD, CryIE, CryIF, CryII, Cry2, Cry3, and Cry9 toxins *Trade-mark 62451-879(S) (Schnepf E. et al. (1998) Microbiology and Molecular Biology Reviews 623): 775-80~ are prepared by methods known in the art. Crystals are dissolved in pH
10.0, 50 mM carbonate buffer and treated with trypsin. Active fragments of Cry proteins are purified by chromatography. Three to five days after transfection, cells are washed with phosphate buttered saline (PBS). Different concentrations of active fragments of Cry toxins are applied to the cells. At different time intervals, the cells ate examined under the microscope to readily determine susceptibility to the toxins.
Alternatively, cell death, viability and/or toxicity is quantified by methods well known in the art.
See, for example, In Situ Cell Death Detection Kits available from Roche Biochemicals (Catalogue Nos. 2 156 792, 1 684 809, and 1 684 817), and LIVE/DEAD~ Viability/Cytotoxicity Kit available from Molecular Probes (catalogue No. L-3224).
A dose-dependent response of RBECB1-transfected cells to CrylAb is readily observed, with determined Kd values well within the range for many receptors.
Control cells, e.g. those transfected with pFastBacl bacmid without an insert or those ' transfected with RBGus are not significantly affected by Cry 1 Ab. Interaction with other Cry toxins are similarly characterized.
This in vitro system is not only be used to verify the functionality of putative Bt-toxin receptors, but also used as a tool to determine the active sites) and other functional domains of the toxin and the receptor. Furthermore, the system is used as a cell-based high throughput screen. For example, methods for distinguishing live versus dead cells by differential dyes are known in the art. This allows for aliquots of transfected cells to be treated with various toxin samples and to serve as a means for screening the toxin samples for desired specificity or binding characteristics. Since the system is used to identify the specificity of Cry protein receptors, it is a useful tool in insect resistance management.
Example 4: Expression of the ECB Bt toxin receptor in toxin susceptible stages of the insect's life cycle:
. Total RNA was isolated from the eggs, pupae, adults, and the 1 st through the 5th instar developmental stages, using TRIzoI Reagent (Gibco BRL) essentially as instructed by the manufacturer.(Gibco BRL). The RNA was quantitated and 20 ug of each sample was loaded onto a formaldehyde agarose gel and electrophoresed at *Trade-mark 36 62451-879 (S) constant voltage. The RNA was then transferred to a nylon membrane via.neutral capillary transfer and cross-linked to the membrane using ultraviolet Light.
For hybridization, a 460 base pair ECB Bt toxin receptor DNA probe (bases 3682 to in SEQ ID NO: I ) was constructed from a 460 base pair fragment prepared according to the manufacturef s protocol for Amersham Rediprime II random prime labeling system. The denatured probe was added to the membrane that had been prehybridized for at least 3 hours at 65°C and allowed to incubate with gentle agitation for at least 12 hours at 65°C. Following hybridization, the membranes were washed at 65°C for 1 hour with 1/4X O.SM NaCI, O.1M NaP04 (ph 7.0), 6mM EDTA and 1% SDS
solution followed by two 1 hour washes in the above solution without SDS. The membrane was air dried briefly, wrapped is Saran Wrap and exposed to X-ray film.
An ECB Bt toxin receptor transcript of 5.5 kilobase was expressed strongly in the larval instars with much reduced expression in the pupas stage. The expression levels appeared to be fairly consistent from first to fifth instar, while decreasing markedly in the pupal stage. There were no detectable transcripts in either the egg or adult stages. These results indicate that the ECB Bt toxin transcript is being produced in the susceptible stages of the insects life cycle, while not being produced in stages resistant to the toxic effects of CrylAb.
Example 5: Tissue and subcellular expression of the ECB Bt toxin receptor:
Fifth instar ECB were dissected to isolate the following tissues: fat body (FB), malpighian tubules (MTV, hind gut (IiG), anterior midgut (AM) and posterior midgut (PM). Midgets from fifth instar larvae were also isolated for brush border membrane vesicle (BBMV} preparation using the well known protocol by Wolfersberger et a1.(1987) Comp. Biochem. Physiol. 86A:301-308. Tissues were homogenized in Tris buffered saline, 0.1 % tweeri 20, centrifuged to pellet insoluble material, and transferred to a fresh tube. SO ug of protein from each preparation was added to SDS
sample buffer and B-mercaptoethanol, heated to I00°C for IO minutes and loaded onto a 4-12% Bis-Tris gel (Novex). After electrophoresis, the proteins were transferred to a nitrocellulose membrane using a semi-dry apparatus. The membrane was blocked in 5% nonfat dry milk buffer for 1 hour at room temperature with gentle agitation. The primary antibody (Example I) was added to a final dilution of 1:5000 and allowed to hybridize for 1 hour. The blot was then washed three times for *Trade-mark 37 62451-879(S) minutes each in nonfat milk buffer. The blot was then hybridized with the secondary antibody (goat anti-rabbit with alkaline phosphatase conjugate) at a dilution of 1:10000 for l hour at room temperature. Washes were performed as before. The bands were visualized by using the standard chemiluminescent protocol (Tropix'' western light protein detection kit).
The ECB Bt toxin receptor protein was only visible in the BBMV enriched lane, and not detected in any of the other EGB tissues types. 'This result indicates that the expression of the .ECB Bt toxin receptor protein is at very low levels, since the BBMV preparation is a 20-30 fold enriched fraction of the midget brush border.
The result supports propositions that the ECB Bt toxin receptor is an integral membrane protein uniquely associated with the brush border. It also demonstrates that the ECB
Bt toxin receptor is expressed in the envisioned target tissue for CryLPrb toxins.
However, the result does not necessarily rule out expression in other tissue types, albeit the expression of this protein in those tissues may be lower than in the BBMV
enriched fraction.
All publications and patent applications mentioned in the specification are indicative of the level of those skilled in the art to which this invention pertains.
Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.
*Trade-mark SEQUENCE LISTING
<110> Flannagan, Ronald D.
Mathis, John P.
Meyer, Terry E.
<120> Novel Bt Toxin Receptors From Lepidopteran Insects and Methods of Use <130> 35718/204291 <150> 60/166,285 <151> 1999-11-18 <160> 11 <170> FastSEQ
for Windows Version 4.0 <210> 1 <211> 5498 <212> DNA

<213> Ostrinia nubilalis <220>

<221> CDS

<222> (162)...(5312) <400> 1 cataataaca ataaagagga aaaaacgaag aagttaataa acctggataa agtgtgtgtg ttaaacctga aaaaaaccgg gaattt ttgctgaaggacaa ccgtgggata 120 tgtttaagtg gctcaaatat taaaattcta gatcatgcaa a tt 176 cataactaag atg gag ggg agg g Met Gly Val Glu Arg ttc ttc cca ctactggtc tctttagcctctgccgcactagcc 224 gca gtg Phe Phe Pro LeuLeuVal SerLeuAlaSerAlaAlaLeuAla Ala Val aac caa cga tacattatc gcaataccaagaccggagactccg 272 tgt tcg Asn Gln Arg TyrIleIle AlaIleProArgProGluThrPro Cys Ser gaa ctg ccg gattacgaa ggaaaatcatggagtgaacagcct 320 cct att Glu Leu Pro AspTyrGlu GlyLysSerTrpSerGluGlnPro Pro Ile cta ata ccc acccgagag gaagtatgtatggagaacttctta 368 ggc ccg Leu Ile Pro ThrArgGlu GluValCysMetGluAsnPheLeu Gly Pro ccg gat caa caggtcata tacatggaggaagaaatcgaagga 416 atg att Pro Asp Gln GlnValIle TyrMetGluGluGluIleGluGly Met Ile gac gtc atc aagcttaac tatcaagggtccaacacgccggtg 464 att gcg Asp Val Ile LysLeuAsn TyrGlnGlySerAsnThrProVal Ile Ala ctg tcg att ggccagccc agagcccagctgggccctgagttt 512 atg tca Leu Ser Ile Met Ser Gly Gln Pro Arg Ala Gln Leu Gly Pro Glu Phe cgacagaatgaagcagacggccaatggagccttgttattacgcaaaga 560 ArgGlnAsnGluAlaAspGlyGlnTrpSerLeuValIleThrGlnArg caagactacgagacagcaaccatgcagagctatgtgttctcaatccaa 608 GlnAspTyrGluThrAlaThrMetGlnSerTyrValPheSerIleGln gtggagggtgaatcacaggccgtactggtggcgctggagatagtcaac 656 ValGluGlyGluSerGlnAlaValLeuValAlaLeuGluIleValAsn atcgacgacaatccgcccatcctgcaagtggtcagcgcctgcgtaatt 704 IleAspAspAsnProProIleLeuGlnValValSerAlaCysValIle ccagaacatggcgaggetagactgaccgactgcgtgtaccaagtgtca 752 ProGluHisGlyGluAlaArgLeuThrAspCysValTyrGlnValSer gaccgcgacggtgaaatcagcacccgcttcatgacgttccgtgtcgac 800 AspArgAspGlyGluIleSerThrArgPheMetThrPheArgValAsp agcagcagggetgcagatgaaagcatcttctacatggttggagaatac 898 SerSerArgAlaAlaAspGluSerIlePheTyrMetValGlyGluTyr gaccccagcgactggttcaatatgaagatgactgtggggatcaattcg 896 AspProSerAspTrpPheAsnMetLysMetThrValGlyIleAsnSer cccttgaacttcgagacaactcagcttcatatatttagcgtcacaget 944 ProLeuAsnPheGluThrThrGlnLeuHisIlePheSerValThrAla tctgactcgctaccgaacaaccacacggtcaccatgatggtgcaagtg 992 SerAspSerLeuProAsnAsnHisThrValThrMetMetValGlnVal gagaacgtagagtctcggccccctcgctgggtggagatcttctcagtg 1040 GluAsnValGluSerArgProProArgTrpValGluIlePheSerVal cagcagtttgacgagaagactaatcagagcttctccctccgcgcgata 1088 GlnGlnPheAspGluLysThrAsnGlnSerPheSerLeuArgAlaIle gacggggacacgggaatcaatagggccatcaactataccctcatcagg 1136 AspGlyAspThrGlyIleAsnArgAlaIleAsnTyrThrLeuIleArg gatgacgetgacgacttcttttccctggaggtgattgaagacggaget 1184 __ AspAspAlaAspAspPhePheSerLeuGluValIleGluAspGlyAla attctgcacgtgactgagatcgaccgcgacaagcttgaaagagagctt 1232 IleLeuHisValThrGluIleAspArgAspLysLeuGluArgGluLeu ttcaacctcaccatcgttgettacaaatctactgacgetagctttgca 1280 PheAsnLeuThrIleValAlaTyrLysSerThrAspAlaSerPheAla acagaggcccacattttcatcatcgtcaacgacgtcaatgatcagcga 1328 ThrGluAlaHisIlePheIleIleValAsnAspValAsnAspGlnArg cccgagccgctgcataaagaatacagtattgatatcatggaggaaact 1376 ProGluProLeuHisLysGluTyrSerIleAspIleMetGluGluThr ccaatgactctaaacttcaatgaagaatttggattccatgatcgagat 1424 ProMetThrLeuAsnPheAsnGluGluPheGlyPheHisAspArgAsp ttgggtgaaaacgetcaatacacagtggaacttgaggacgtgttcccg 1472 LeuGlyGluAsnAlaGlnTyrThrValGluLeuGluAspValPhePro ccaggggcggcgtccgcattctacatcgcgccggggagcggctaccag 1520 ProGlyAlaAlaSerAlaPheTyrIleAlaProGlySerGlyTyrGln aggcagaccttcatcatgggcaccataaaccacaccatgctggattac 1568 ArgGlnThrPheIleMetGlyThrIleAsnHisThrMetLeuAspTyr gaagatgtcatttttcagaacatcatcattaaggtcaaagcagtggac 1616 GluAspValIlePheGlnAsnIleIleIleLysValLysAlaValAsp atgaacaacgetagccacgtgggcgaggcgctggtgtacgtgaacctg 1664 MetAsnAsnAlaSerHisValGlyGluAlaLeuValTyrValAsnLeu atcaactggaacgacgaacttcccatcttcgaggagagcagctactcc 1712 IleAsnTrpAsnAspGluLeuProIlePheGluGluSerSerTyrSer gcgtcgtttaaggagaccgtcggcgccggcttcccggtggccacggtg 1760 AlaSerPheLysGluThrValGlyAlaGlyPheProValAlaThrVal ctcgccctcgacagagacatcgacgacgtagtagtgcattcattgatg 1808 LeuAlaLeuAspArgAspIleAspAspValValValHisSerLeuMet ggcaacgetgttgactacctgttcatagatgaatcaacgggagagatc 1856 GlyAsnAlaValAspTyrLeuPheIleAspGluSerThrGlyGluIle ttcgtgagcatggacgatgccttcgactaccaccgacagaacactcta 1904 PheValSerMetAspAspAlaPheAspTyrHisArgGlnAsnThrLeu tttgttcaggtgcgcgetgacgatactttgggcgacggcccacacaac 1952 PheValGlnValArgAlaAspAspThrLeuGlyAspGlyProHisAsn acagtgaccacccagctggtgatagaactggaggatgtcaacaacact 2000 Thr Val Thr Thr Gln Leu Val Ile Glu Leu Glu Asp Val Asn Asn Thr cctcccaccctacgcttgccccgttcgactccaagcgtcgaggagaac 2048 ProProThrLeuArgLeuProArgSerThrProSerValGluGluAsn gttcccgaaggatacgagatatcccgggaaatcactgetaccgacccg 2096 ValProGluGlyTyrGluIleSerArgGluIleThrAlaThrAspPro gacaccagcgcctacctgtggttcgagatcgactgggactccacctgg 2144 AspThrSerAlaTyrLeuTrpPheGluIleAspTrpAspSerThrTrp gccaccaagcagggcagagagaccaaccctactgaatacgtcgggtgt 2192 AlaThrLysGlnGlyArgGluThrAsnProThrGluTyrValGlyCys atagttatcgaaacgatataccccaccgagggcaaccggggttccgcc 2240 IleValIleGluThrIleTyrProThrGluGlyAsnArgGlySerAla atcgggcgcctcgtggtgcaagagatccgggacaacgtcaccatcgac 2288 IleGlyArgLeuValValGlnGluIleArgAspAsnValThrIleAsp ttcgaggaattcgagatgctttacctcaccgtccgcgtgagggacctc 2336 PheGluGluPheGluMetLeuTyrLeuThrValArgValArgAspLeu aacactgtcatcggagatgactacgatgaggcgacgttcacgatcaca 2389 AsnThrValIleGlyAspAspTyrAspGluAlaThrPheThrIleThr ataatcgacatgaacgacaacgcgccgatcttcgcgaacggcacgctg 2932 IleIleAspMetAsnAspAsnAlaProIlePheAlaAsnGlyThrLeu acgcagacgatgcgcgtgcgcgagctggcggccagcggcacgctcatc 2480 ThrGlnThrMetArgValArgGluLeuAlaAlaSerGlyThrLeuIle ggctccgtgctcgccaccgacatcgacggcccgctctacaaccaagtg 2528 GlySerValLeuAlaThrAspIleAspGlyProLeuTyrAsnGlnVal cgctacactatacaacctagaaacaacactcccgagggattagtgaag 2576 ArgTyrThrIleGlnProArgAsnAsnThrProGluGlyLeuValLys attgacttcacaactggtcaaattgaggtggatgcgaacgaggcgatc 2624 IleAspPheThrThrGlyGlnIleGluValAspAlaAsnGluAlaIle gatgcagacgaaccctggcgcttctacttgtactacaccgtcatcget 2672 __ AspAlaAspGluProTrpArgPheTyrLeuTyrTyrThrValIleAla agcgacgagtgctccctggaaaaccgcacggaatgtcctccagattcc 2720 SerAspGluCysSerLeuGluAsnArgThrGluCysProProAspSer aactacttcgaagttccaggcgatatcgaaatagaaatcatcgacaca 2768 AsnTyrPheGluValProGlyAspIleGluIleGluIleIleAspThr aacaacaaagtgcctgagccgctcactgagaagttcaacacgacggtg 2816 AsnAsnLysValProGluProLeuThrGluLysPheAsnThrThrVal tacgtctgggagaatgccacgagcggcgacgaggtggtccagctgtac 2864 TyrValTrpGluAsnAlaThrSerGlyAspGluValValGlnLeuTyr tcccacgaccgtgacagagacgagttgtaccacacggtacgatacacg 2912 SerHisAspArgAspArgAspGluLeuTyrHisThrValArgTyrThr atgaactttgcggtgaacccccgactgcgggatttcttcgaggtggac 2960 MetAsnPheAlaValAsnProArgLeuArgAspPhePheGluValAsp ctggacactggtcgccttgaggtgcattacccgggggacgaaaaattg 3008 LeuAspThrGlyArgLeuGluValHisTyrProGlyAspGluLysLeu gaccgcgatggggatgagcctacacatactatctttgtaaatttcatc 3056 AspArgAspGlyAspGluProThrHisThrIlePheValAsnPheIle gataacttcttttctgatggtgacggtaggagaaaccaggacgaagtt 3104 AspAsnPhePheSerAspGlyAspGlyArgArgAsnGlnAspGluVal gaaatatttgtcgttctattggatgtgaacgacaacgetcctgagatg 3152 GluIlePheValValLeuLeuAspValAsnAspAsnAlaProGluMet ccattgcctgatgaactccggtttgatgtttccgaaggagcagttget 3200 ProLeuProAspGluLeuArgPheAspValSerGluGlyAlaValAla ggtgtccgtgtactcccagaaatctacgcaccggacagggatgaacca 3248 GlyValArgValLeuProGluIleTyrAlaProAspArgAspGluPro gacacggacaactcgcgtgtcggttacggaatcctggacctcacgatc 3296 AspThrAspAsnSerArgValGlyTyrGlyIleLeuAspLeuThrIle accgaccgagacatcgaggtgccggatctcttcaccatgatctcgatt 3344 ThrAspArgAspIleGluValProAspLeuPheThrMetIleSerIle gaaaacaaaactggggaacttgagaccgetatggacttgagggggtat 3392 GluAsnLysThrGlyGluLeuGluThrAlaMetAspLeuArgGlyTyr tggggcacttacgaaatattcattgaggccttcgaccacggctacccg 3440 TrpGlyThrTyrGluIlePheIleGluAlaPheAspHisGlyTyrPro cagcagaggtccaacgagacgtacaccctggtcatccgcccctacaac 3988 Gln Gln Arg Ser Asn Glu Thr Tyr Thr Leu Val Ile Arg Pro Tyr Asn ttccaccaccctgtgttcgtgttcccgcaacccgactcc gtcattcgg 3536 PheHisHisProValPheValPheProGlnProAspSer ValIleArg ctttctagggagcgcgcaacagaaggcggcgttctggcg acggetgcc 3589 LeuSerArgGluArgAlaThrGluGlyGlyValLeuAla ThrAlaAla aacgagttcctggagccgatctacgccaccgacgaggac ggcctccac 3632 AsnGluPheLeuGluProIleTyrAlaThrAspGluAsp GlyLeuHis gcgggcagcgtcacgttccacgtccagggaaatgaggag gccgttcag 3680 AlaGlySerValThrPheHisValGlnGlyAsnGluGlu AlaValGln tactttgatataactgaagtgggagcaggagaaaatagc gggcagctt 3728 TyrPheAspIleThrGluValGlyAlaGlyGluAsnSer GlyGlnLeu atattacgccagcttttcccagagcaaatcagacaattc aggatcacg 3776 IleLeuArgGlnLeuPheProGluGlnIleArgGlnPhe ArgIleThr atccgggccacggacggcggcacggagcccggcccgctt tggaccgac 3824 IleArgAlaThrAspGlyGlyThrGluProGlyProLeu TrpThrAsp gtcacgttttcggtggtcttcgtacccacacagggcgac ccagtgttc 3872 ValThrPheSerValValPheValProThrGlnGlyAsp ProValPhe agcgaaaatgcagetactgtcgccttcttcgagggtgaa gaaggcctc 3920 SerGluAsnAlaAlaThrValAlaPhePheGluGlyGlu GluGlyLeu cgtgagagttttgagctgccgcaagcagaagaccttaaa aaccacctc 3968 ArgGluSerPheGluLeuProGlnAlaGluAspLeuLys AsnHisLeu tgcgaagatgactgccaagatatctactacaggtttatt gacggcaac 4016 CysGluAspAspCysGlnAspIleTyrTyrArgPheIle AspGlyAsn aacgagggtcttttcgtactggaccagtcaagcaacgtc atctccctt 9069 AsnGluGlyLeuPheValLeuAspGlnSerSerAsnVal IleSerLeu gcgcaggagttggaccgcgaggtggccacgtcttacacg ctgcacatc 4112 AlaGlnGluLeuAspArgGluValAlaThrSerTyrThr LeuHisIle gcggcgagcaactcgcccgacgccactgggatccctctg cagacttcc 4160 AlaAlaSerAsnSerProAspAlaThrGlyIleProLeu GlnThrSer atcctcgttgtcacggtcaatgtaagagaagcgaacccg cgcccaatt 4208 IleLeuValValThrValAsnValArgGluAlaAsnPro ArgProIle ttcgagcaggacctttacacagcgggcatttcgacgttggacagcatt 4256 PheGluGlnAspLeuTyrThrAlaGlyIleSerThrLeuAspSerIle ggccgggaattgcttactgtcagggcgagccacacagaagacgacacc 9304 GlyArgGluLeuLeuThrValArgAlaSerHisThrGluAspAspThr atcacgtacaccatagaccgtgcgagcatgcagctggacagcagccta 4352 IleThrTyrThrIleAspArgAlaSerMetGlnLeuAspSerSerLeu gaagccgtgcgcgactcggccttcgcgctgcatgcgaccaccggcgtg 4900 GluAlaValArgAspSerAlaPheAlaLeuHisAlaThrThrGlyVal ctttcgctcaatatgcagcccaccgettccatgcacggcatgttcgag 4448 LeuSerLeuAsnMetGlnProThrAlaSerMetHisGlyMetPheGlu ttcgacgtcatcgetacggatacagettctgcaatcgacacagcccgt 9496 PheAspValIleAlaThrAspThrAlaSerAlaIleAspThrAlaArg gtgaaagtctacctcatctcatcgcaaaaccgcgtgaccttcattttc 4544 ValLysValTyrLeuIleSerSerGlnAsnArgValThrPheIlePhe gataaccaacttgagaccgttgagcagaacagaaatttcatagcggcc 4592 AspAsnGlnLeuGluThrValGluGlnAsnArgAsnPheIleAlaAla acgttcagcaccgggttcaacatgacgtgcaacatcgaccaggtggtg 4640 ThrPheSerThrGlyPheAsnMetThrCysAsnIleAspGlnValVal ccgttcagcgacagcagcggcgtggcgcaagacgacaccaccgaggtg 9688 ProPheSerAspSerSerGlyValAlaGlnAspAspThrThrGluVal cgcgcgcacttcatccgggacaacgtgcccgtgcaggcacaagaggtc 4736 ArgAlaHisPheIleArgAspAsnValProValGlnAlaGlnGluVal gaggccgtccgcagcgacacggtgctgctgcgcaccatccagctgatg 4784 GluAlaValArgSerAspThrValLeuLeuArgThrIleGlnLeuMet ctgagcaccaacagcctggtgctgcaagacctggtgacgggtgacact 4832 LeuSerThrAsnSerLeuValLeuGlnAspLeuValThrGlyAspThr ccgacgctaggcgaggagtcaatgcagatcgccgtctacgcactagcc 4880 ProThrLeuGlyGlu.GluSerMetGlnIleAlaValTyrAlaLeuAla gcgctctccgetgtgctaggcttcctctgcctcgtactgcttctcgca 4928 AlaLeuSerAlaValLeuGlyPheLeuCysLeuValLeuLeuLeuAla ttgttctgtaggacaagagcactgaaccggcagctgcaagcactctcc 9976 LeuPheCysArgThrArgAlaLeu AsnArgGlnLeuGlnAlaLeuSer atgacgaagtacggctcggtggac tccgggctgaaccgcgccgggctg 5029 MetThrLysTyrGlySerValAsp SerGlyLeuAsnArgAlaGlyLeu gcgccgggcaccaacaagcacgcc gtcgagggctccaaccccatgtgg 5072 AlaProGlyThrAsnLysHisAla ValGluGlySerAsnProMetTrp aacgaggccatccgcgcgcccgac ttcgacgccatcagtgacgcgagt 5120 AsnGluAlaIleArgAlaProAsp PheAspAlaIleSerAspAlaSer ggcgactccgacctgatcggcatc gaggacatgccgcaattccgcgac 5168 GlyAspSerAspLeuIleGlyIle GluAspMetProGlnPheArgAsp gactacttcccgcccggcgacaca gactcaagcagcggcatcgtcttg 5216 AspTyrPheProProGlyAspThr AspSerSerSerGlyIleValLeu cacatgggcgaagccacggacaac aagcccgtgaccacgcatggcaac 5264 HisMetGlyGluAlaThrAspAsn LysProValThrThrHisGlyAsn aacttcgggttcaagtccaccccg tacctgccacagccgcacccaaag 5312 AsnPheGlyPheLysSerThrPro TyrLeuProGlnProHisProLys taactgccag cctacgccgc gcgaagtgcg 5372 ggtataacct cacacgcgtt gtccagggtg tatcatcggg ctatgtacat attgtaaatt 5932 aaacattagc gtaacatatc atgaagatac tatttttata ttgctaaaaa aaaaaaaaaa 5992 caaatatatt aaaaaaaaaa ttatttatat ctcgag 5498 <210>

<211> 717 <212>
PRT

<213> nia Ostri nubilalis <400>

MetGlyValGluArgPhePhePro AlaValLeuLeuValSerLeuAla SerAlaAlaLeuAlaAsnGlnArg CysSerTyrIleIleAlaIlePro ArgProGluThrProGluLeuPro ProIle.AspTyrGluGlyLysSer TrpSerGluGlnProLeuIlePro GlyProThrArgGluGluValCys MetGluAsnPheLeuProAspGln MetIleGlnValIleTyrMetGlu GluGluIleGluGlyAspValIle IleAlaLysLeuAsnTyrGlnGly SerAsnThrProValLeuSerIle MetSerGlyGlnProArgAlaGln LeuGlyProGluPheArgGlnAsn GluAlaAspGlyGlnTrpSerLeu ValIleThrGlnArgGlnAspTyr GluThrAlaThrMetGlnSerTyr ValPheSerIleGlnValGluGly GluSerGlnAlaValLeuValAla g Leu Glu Ile Val Asn Ile Asp Asp Asn Pro Pro Ile Leu Gln Val Val Ser Ala Cys Val Ile Pro Glu His Gly Glu Ala Arg Leu Thr Asp Cys Val Tyr Gln Val Ser Asp Arg Asp Gly Glu Ile Ser Thr Arg Phe Met Thr Phe Arg Val Asp Ser Ser Arg Ala Ala Asp Glu Ser Ile Phe Tyr Met Val Gly Glu Tyr Asp Pro Ser Asp Trp Phe Asn Met Lys Met Thr Val Gly Ile Asn Ser Pro Leu Asn Phe Glu Thr Thr Gln Leu His Ile Phe Ser Val Thr Ala Ser Asp Ser Leu Pro Asn Asn His Thr Val Thr Met Met Val Gln Val Glu Asn Val Glu Ser Arg Pro Pro Arg Trp Val Glu Ile Phe Ser Val Gln Gln Phe Asp Glu Lys Thr Asn Gln Ser Phe Ser Leu Arg Ala Ile Asp Gly Asp Thr Gly Ile Asn Arg Ala Ile Asn Tyr Thr Leu Ile Arg Asp Asp Ala Asp Asp Phe Phe Ser Leu Glu Val Ile Glu Asp Gly Ala Ile Leu His Val Thr Glu Ile Asp Arg Asp Lys Leu Glu Arg Glu Leu Phe Asn Leu Thr Ile Val Ala Tyr Lys Ser Thr Asp Ala Ser Phe Ala Thr Glu Ala His Ile Phe Ile Ile Val Asn Asp Val Asn Asp Gln Arg Pro Glu Pro Leu His Lys Glu Tyr Ser Ile Asp Ile Met Glu Glu Thr Pro Met Thr Leu Asn Phe Asn Glu Glu Phe Gly Phe His Asp Arg Asp Leu Gly Glu Asn Ala Gln Tyr Thr Val Glu Leu Glu Asp Val Phe Pro Pro Gly Ala Ala Ser Ala Phe Tyr Ile Ala Pro Gly Ser Gly Tyr Gln Arg Gln Thr Phe Ile Met Gly Thr Ile Asn His Thr Met Leu Asp Tyr Glu Asp Val Ile Phe Gln Asn Ile Ile Ile Lys Val Lys Ala Val Asp Met Asn Asn Ala Ser His Val Gly Glu Ala Leu Val Tyr Val Asn Leu Ile Asn Trp Asn Asp Glu Leu Pro Ile Phe Glu Glu Ser Ser Tyr Ser Ala Ser Phe Lys Glu Thr Val Gly Ala Gly Phe Pro Val Ala Thr Val Leu Ala Leu Asp Arg Asp Ile Asp Asp Val Val Val His Ser Leu Met Gly Asn Ala Val Asp Tyr Leu Phe Ile Asp Glu Ser Thr Gly Glu Ile Phe Val Ser Met Asp Asp Ala Phe Asp Tyr His Arg Gln Asn Thr Leu Phe Val Gln Val Arg Ala Asp Asp Thr Leu Gly Asp Gly Pro His Asn Thr Val Thr Thr Gln Leu Val Ile Glu Leu Glu Asp Val Asn Asn Thr Pro Pro Thr Leu Arg Leu Pro Arg Ser Thr Pro Ser Val Glu Glu Asn Val Pro Glu Gly Tyr Glu Ile Ser Arg Glu Ile Thr Ala Thr Asp Pro Asp Thr Ser Ala Tyr Leu Trp Phe Glu Ile Asp Trp Asp Ser Thr Trp Ala Thr Lys Gln Gly Arg Glu Thr Asn Pro Thr Glu Tyr Val Gly Cys Ile Val Ile Glu Thr Ile Tyr Pro Thr Glu Gly Asn Arg Gly Ser Ala Ile Gly Arg Leu Val Val Gln Glu Ile Arg Asp Asn Val Thr Ile Asp Phe Glu Glu Phe Glu Met Leu Tyr Leu Thr Val Arg Val Arg Asp Leu Asn Thr Val Ile Gly Asp Asp Tyr Asp Glu Ala Thr Phe Thr Ile Thr Ile Ile Asp Met Asn Asp Asn Ala Pro Ile Phe Ala Asn Gly Thr Leu Thr Gln Thr Met Arg Val Arg Glu Leu Ala Ala Ser Gly Thr Leu Ile Gly Ser Val Leu Ala Thr Asp Ile Asp Gly Pro Leu Tyr Asn Gln Val Arg Tyr Thr Ile Gln Pro Arg Asn Asn Thr Pro Glu Gly Leu Val Lys Ile Asp Phe Thr Thr Gly Gln Ile Glu Val Asp Ala Asn Glu Ala Ile Asp Ala Asp Glu Pro Trp Arg Phe Tyr Leu Tyr Tyr Thr Val Ile Ala Ser Asp Glu Cys Ser Leu Glu Asn Arg Thr Glu Cys Pro Pro Asp Ser Asn Tyr Phe Glu Val Pro Gly Asp Ile Glu Ile Glu Ile Ile Asp Thr Asn Asn Lys Val Pro Glu Pro Leu Thr Glu Lys Phe Asn Thr Thr Val Tyr Val Trp Glu Asn Ala Thr Ser Gly Asp Glu Val Val Gln Leu Tyr Ser His Asp Arg Asp Arg Asp Glu Leu Tyr His Thr Val Arg Tyr Thr Met Asn Phe Ala Val Asn Pro Arg Leu Arg Asp Phe Phe Glu Val Asp Leu Asp Thr Gly Arg Leu Glu Val His Tyr Pro Gly Asp Glu Lys Leu Asp Arg Asp Gly Asp Glu Pro Thr His Thr Ile Phe Val Asn Phe Ile Asp Asn Phe Phe Ser Asp Gly Asp Gly Arg Arg Asn Gln Asp Glu Val Glu Ile Phe Val Val Leu Leu Asp Val Asn Asp Asn Ala Pro Glu Met Pro Leu Pro Asp Glu Leu Arg Phe Asp Val Ser Glu Gly Ala Val Ala Gly Val Arg Val Leu Pro Glu Ile Tyr Ala Pro Asp Arg Asp Glu Pro Asp Thr Asp Asn Ser Arg Val Gly Tyr Gly Ile Leu Asp Leu Thr Ile Thr Asp Arg Asp Ile Glu Val Pro Asp Leu Phe Thr Met Ile Ser Ile Glu Asn Lys Thr Gly Glu Leu Glu Thr Ala Met Asp Leu Arg Gly Tyr Trp Gly Thr Tyr Glu Ile Phe Ile Glu Ala Phe Asp His Gly Tyr Pro Gln Gln Arg Ser Asn Glu Thr Tyr Thr Leu Val Ile Arg Pro Tyr Asn Phe His His Pro Val Phe Val Phe Pro Gln Pro Asp Ser Val Ile Arg Leu Ser Arg Glu Arg Ala Thr Glu Gly Gly Val .Leu Ala Thr Ala Ala Asn Glu Phe Leu Glu Pro Ile Tyr Ala Thr Asp Glu Asp Gly Leu His Ala Gly Ser Val Thr Phe His Val Gln Gly Asn Glu Glu Ala Val Gln Tyr Phe Asp Ile Thr Glu Val Gly Ala Gly Glu Asn Ser Gly Gln Leu Ile Leu Arg Gln Leu Phe Pro Glu Gln Ile Arg Gln Phe Arg Ile Thr Ile Arg Ala Thr Asp Gly Gly Thr Glu Pro Gly Pro Leu Trp Thr Asp Val Thr Phe Ser Val Val Phe Val Pro Thr Gln Gly Asp Pro Val Phe Ser Glu Asn Ala Ala Thr Val Ala Phe Phe Glu Gly Glu Glu Gly Leu Arg Glu Ser Phe Glu Leu Pro Gln Ala Glu Asp Leu Lys Asn His Leu Cys Glu Asp Asp Cys Gln Asp Ile Tyr Tyr Arg Phe Ile Asp Gly Asn Asn Glu Gly Leu Phe Val Leu Asp Gln Ser Ser Asn Val Ile Ser Leu Ala Gln Glu Leu Asp Arg Glu Val Ala Thr Ser Tyr Thr Leu His Ile Ala Ala Ser Asn Ser Pro Asp Ala Thr Gly Ile Pro Leu Gln Thr Ser Ile Leu Val Val Thr Val Asn Val Arg Glu Ala Asn Pro Arg Pro Ile Phe Glu Gln Asp Leu Tyr Thr Ala Gly Ile Ser Thr Leu Asp Ser Ile Gly Arg Glu Leu Leu Thr Val Arg Ala Ser His Thr Glu Asp Asp Thr Ile Thr Tyr Thr Ile Asp Arg Ala Ser Met Gln Leu Asp Ser Ser Leu Glu Ala Val Arg Asp Ser Ala Phe Ala Leu His Ala Thr Thr Gly Val Leu Ser Leu Asn Met Gln Pro Thr Ala Ser Met His Gly Met Phe Glu Phe Asp Val Ile Ala Thr Asp Thr Ala Ser Ala Ile Asp Thr Ala Arg Val Lys Val Tyr Leu Ile Ser Ser Gln Asn Arg Val Thr Phe Ile Phe Asp Asn Gln Leu Glu Thr Val Glu Gln Asn Arg Asn Phe Ile Ala Ala Thr Phe Ser Thr Gly Phe Asn Met Thr Cys Asn Ile Asp Gln Val Val Pro Phe Ser Asp Ser Ser Gly Val Ala Gln Asp Asp Thr Thr Glu Val Arg Ala His Phe Ile Arg Asp Asn Val Pro Val Gln Ala Gln Glu Val Glu Ala Val Arg Ser Asp Thr Val Leu Leu Arg Thr Ile Gln Leu Met Leu Ser Thr Asn Ser Leu Val Leu Gln Asp Leu Val Thr Gly Asp Thr Pro Thr Leu Gly Glu Glu Ser Met Gln Ile Ala Val Tyr Ala Leu Ala Ala Leu Ser Ala Val Leu Gly Phe Leu Cys Leu Val Leu Leu Leu Ala Leu Phe Cys Arg Thr Arg Ala Leu Asn Arg Gln Leu Gln Ala Leu Ser Met Thr Lys Tyr Gly Ser Val Asp Ser Gly Leu Asn Arg Ala Gly Leu Ala Pro Gly Thr Asn Lys His Ala Val Glu Gly Ser Asn Pro Met Trp Asn Glu Ala Ile Arg Ala Pro Asp Phe Asp Ala Ile AspAlaSerGlyAspSerAspLeuIleGlyIleGluAspMet Ser Pro PheArgAspAspTyrPheProProGlyAspThrAspSerSer Gln Ser IleValLeuHisMetGlyGluAlaThrAspAsnLysProVal Gly Thr HisGlyAsnAsnPheGlyPheLysSerThrProTyrLeuPro Thr Gln HisProLys Pro <210>

<211>

<212>
DNA

<213> thiszea Helio <220>

<221>
CDS

<222> ...(5360) (171) <900>

gtggattgtt gttctaaaaa aaaaaagtta tttttgtgat 60 cagaaaaaaa acgcagtttg atttgtgtaa agtgtagtgt taaaggatta aagagtgttc taaataattt ggcattgctg caattgatca cccagaggtg gaactatgag atg 176 gatcgaccag gca actagacaca MetAla gtc gtgagaatattgacggcagcggttttcattatcgetgetcac 224 gac Val ValArgIleLeuThrAlaAlaValPheIleIleAlaAlaHis Asp ttg ttcgcgcaagattgtagctacatggtagcaatacccagacca 272 act Leu PheAlaGlnAspCysSerTyrMetValAlaIleProArgPro Thr gag ccagattttccaagtctaaatttcgatggaataccatggagt 320 cga Glu ProAspPheProSerLeuAsnPheAspGlyIleProTrpSer Arg cgg cccctgataccagtggagggtagagaagatgtgtgcatgaac 368 tat Arg ProLeuIleProValGluGlyArgGluAspValCysMetAsn Tyr gaa cagccagatgccttgaacccagttaccgtcatcttcatggag 916 ttc Glu GlnProAspAlaLeuAsnProValThrValIlePheMetGlu Phe gag atagaaggggatgtggetatcgcgaggcttaactaccgaggt 464 gag Glu IleGluGlyAspValAlaIleAlaArgLeuAsnTyrArgGly Glu acc actccgaccattgtatctccatttagctttggtacttttaac 512 aat Thr ThrProThrIleValSerProPheSerPheGlyThrPheAsn Asn atg gggccggtcatacgtagaatacctgagaatggtggcgactgg 560 ttg Met GlyProValIleArgArgIleProGluAsnGlyGlyAspTrp Leu cat gtcattacacagagacaggactacgagacgccaggtatgcag 608 ctc His ValIleThrGlnArgGlnAspTyrGluThrProGlyMetGln Leu cagtacatcttcgacgtgagggtagacgatgaaccgctagtggccacg 656 GlnTyrIlePheAspValArgValAspAspGluProLeuValAlaThr gtgatgctgctcattgtcaacatcgatgacaacgatcctatcatacag 709 ValMetLeuLeuIleValAsnIleAspAspAsnAspProIleIleGln atgtttgagccttgtgatattcctgaacgcggtgaaacaggcatcaca 752 MetPheGluProCysAspIleProGluArgGlyGluThrGlyIleThr tcatgcaagtacaccgtgagcgatgetgacggcgagatcagtacacgt 800 SerCysLysTyrThrValSerAspAlaAspGlyGluIleSerThrArg ttcatgaggttcgaaatcagcagcgatcgagacgatgacgaatatttc 848 PheMetArgPheGluIleSerSerAspArgAspAspAspGluTyrPhe gaactcgtcagagaaaatatacaaggacaatggatgtatgttcatatg 896 GluLeuValArgGluAsnIleGlnGlyGlnTrpMetTyrValHisMet agagttcacgtcaaaaaacctcttgattatgaggaaaacccgctacat 949 ArgValHisValLysLysProLeuAspTyrGluGluAsnProLeuHis ttgtttagagttacagettatgattccctaccaaacacacatacagtg 992 LeuPheArgValThrAlaTyrAspSerLeuProAsnThrHisThrVal acgatgatggtgcaagtagagaacgttgagaacagaccgccgcgatgg 1040 ThrMetMetValGlnValGluAsnValGluAsnArgProProArgTrp atggagatatttgetgtccagcagttcgatgagaagacggaacaatcc 1088 MetGluIlePheAlaValGlnGlnPheAspGluLysThrGluGlnSer tttagggttcgagccatcgatggagatacgggaatcgataaacctatt 1136 PheArgValArgAlaIleAspGlyAspThrGlyIleAspLysProIle ttctataggatcgaaactgaaaaaggagaggaagacttgttcagcatt 1184 PheTyrArgIleGluThrGluLysGlyGluGluAspLeuPheSerIle caaacgatagaaggtggtcgagaaggcgettggtttaacgtcgetcca 1232 GlnThrIleGluGlyGlyArgGluGlyAlaTrpPheAsnValAlaPro atagacagggacactctagagaaggaagttttccacgtgtccataata 1280 IleAspArgAspThrLeuGluLysGluValPheHisValSerIleIle gcgtacaaatatggcgataatgacgtggaaggcagttcgtcattccag 1328 AlaTyrLysTyrGlyAspAsnAspValGluGlySerSerSerPheGln tcgaaaaccgatgtggtcatcatcgtgaacgatgtcaatgatcaggcg 1376 Ser Lys Thr Asp Val Val Ile Ile Val Asn Asp Val Asn Asp Gln Ala ccgcttcctttccgggaagagtactccattgaaattatggaggaaact 1429 ProLeuProPheArgGluGluTyrSerIleGluIleMetGluGluThr gcgatgaccctgaatttagaagactttgggttccatgatagagatctc 1472 AlaMetThrLeuAsnLeuGluAspPheGlyPheHisAspArgAspLeu ggtcctcacgcacaatacacagtacacttagagagcatccatcctccc 1520 GlyProHisAlaGlnTyrThrValHisLeuGluSerIleHisProPro cgagetcacgaggcgttctacatagcaccggaggttggctaccagcgc 1568 ArgAlaHisGluAlaPheTyrIleAlaProGluValGlyTyrGlnArg cagtccttcattatgggcacgcagaaccatcacatgctggacttcgaa 1616 GlnSerPheIleMetGlyThrGlnAsnHisHisMetLeuAspPheGlu gtgccagagttccagaatatacaactgagggccgtagcgatagacatg 1664 ValProGluPheGlnAsnIleGlnLeuArgAlaValAlaIleAspMet gacgatcccaaatgggtgggtatcgcgataatcaacattaaactgatc 1712 AspAspProLysTrpValGlyIleAlaIleIleAsnIleLysLeuIle aactggaacgatgagctgccgatgttcgagagtgacgtgcaaactgtc 1760 AsnTrpAsnAspGluLeuProMetPheGluSerAspValGlnThrVal agcttcgatgagacagagggcgcaggcttctatgtggccactgttgtg 1808 SerPheAspGluThrGluGlyAlaGlyPheTyrValAlaThrValVal gcgaaggaccgggatgttggtgataaagtcgaacactctctaatgggt 1856 AlaLysAspArgAspValGlyAspLysValGluHisSerLeuMetGly aacgcagtaagctacctgaggatcgacaaggaaaccggcgagatattc 1909 AsnAlaValSerTyrLeuArgIleAspLysGluThrGlyGluIlePhe gtcacagaaaacgaagcattcaactatcacaggcagaacgaactcttt 1952 ValThrGluAsnGluAlaPheAsnTyrHisArgGlnAsnGluLeuPhe gtgcagataccagetgacgacacgctgggcgagccttacaacaccaac 2000 ValGlnIleProAlaAspAspThrLeuGlyGluProTyrAsnThrAsn actactcagttggtgatcaagctgcgggacattaacaacacccctcct 2048 ThrThrGlnLeuValIleLysLeuArgAspIleAsnAsnThrProPro acgctcaggctgcctcgcgccactccatcagtggaagagaacgtgccc 2096 ThrLeuArgLeuProArgAlaThrProSerValGluGluAsnValPro gacgggtttgtgatccccacgcagctgcacgccacggaccccgacact 2149 AspGlyPheValIleProThrGlnLeuHisAlaThrAspProAspThr acagetgagctgcgcttcgagatcgactggcagaactcgtatgetacc 2192 ThrAlaGluLeuArgPheGluIleAspTrpGlnAsnSerTyrAlaThr aagcagggacggaatactgactctaaggagtatatcggttgtatagaa 2240 LysGlnGlyArgAsnThrAspSerLysGluTyrIleGlyCysIleGlu atcgagacgatatacccgaatataaaccagcgaggcaacgccatcggc 2288 IleGluThrIleTyrProAsnIleAsnGlnArgGlyAsnAlaIleGly cgcgtggtagtgcgagagatccgggacggcgtcaccatagactatgag 2336 ArgValValValArgGluIleArgAspGlyValThrIleAspTyrGlu atgtttgaagttctatacctcaccgtcattgtgagggatctcaacacc 2384 MetPheGluValLeuTyrLeuThrValIleValArgAspLeuAsnThr gttattggagaagaccatgatatatccacattcacgatcacgataata 2432 ValIleGlyGluAspHisAspIleSerThrPheThrIleThrIleIle gacatgaacgacaaccctcccctgtgggtggaaggcaccctgacgcaa 2480 AspMetAsnAspAsnProProLeuTrpValGluGlyThrLeuThrGln gagttccgtgtgcgagaggtggcagcctcaggagttgttataggatcc 2528 GluPheArgValArgGluValAlaAlaSerGlyValValIleGlySer gtactggccactgatatcgacggaccgctgtataatcaagtgcggtat 2576 ValLeuAlaThrAspIleAspGlyProLeuTyrAsnGlnValArgTyr actattactcccagactagacactccagaagacctagtggacatagac 2629 ThrIleThrProArgLeuAspThrProGluAspLeuValAspIleAsp ttcaacacgggtcagatctccgtaaagttacaccaggetatagacgcg 2672 PheAsnThrGlyGlnIleSerValLysLeuHisGlnAlaIleAspAla gacgagccgccgcgtcagaacctctactacaccgtcatagetagtgac 2720 AspGluProProArgGlnAsnLeuTyrTyrThrValIleAlaSerAsp aagtgtgacctccttactgtcactgagtgtccgcctgaccctacttac 2768 LysCysAspLeuLeuThrValThrGluCysProProAspProThrTyr tttgagacaccgggagagattaccatccacataacggacacgaacaac 2816 PheGluThrProGlyGluIleThrIleHisIleThrAspThrAsnAsn aaggtgcctcaagtggaagacgacaagttcgaggcgacggtgtacatc 2869 1$

Lys Val Pro Gln Val Glu Asp Asp Lys Phe Glu Ala Thr Val Tyr Ile tacgagggc gcggacgatggacaacat gtcgtgcagatctacgccagc 2912 TyrGluGly AlaAspAspGlyGlnHis ValValGlnIleTyrAlaSer gatctggat agagatgaaatctaccac aaagtgagctaccagatcaac 2960 AspLeuAsp ArgAspGluIleTyrHis LysValSerTyrGlnIleAsn tacgcgatc aactctcgtctccgcgac ttcttcgagatggacctggag 3008 TyrAlaIle AsnSerArgLeuArgAsp PhePheGluMetAspLeuGlu tccggcctc gtgtacgtcaacaacacc gccggcgagctgctggacagg 3056 SerGlyLeu ValTyrValAsnAsnThr AlaGlyGluLeuLeuAspArg gacggcgac gagcccacacatcgcatc ttcttcaatgtcatcgataac 3109 AspGlyAsp GluProThrHisArgIle PhePheAsnValIleAspAsn ttctatgga gaaggagatggcaaccgc aatcagaacgagacacaagtg 3152 PheTyrGly GluGlyAspGlyAsnArg AsnGlnAsnGluThrGlnVal ttagtagta ttgctggacatcaatgac aactatccggaactgcctgaa 3200 LeuValVal LeuLeuAspIleAsnAsp AsnTyrProGluLeuProGlu actatccca tgggetatctctgagagc ttagagctgggtgagcgtgta 3248 ThrIlePro TrpAlaIleSerGluSer LeuGluLeuGlyGluArgVal cagccagaa atctttgcccgggaccgc gacgaacccggaacagacaac 3296 GlnProGlu IlePheAlaArgAspArg AspGluProGlyThrAspAsn tcccgcgtc gcctatgccatcacaggc ctcgccagcactgaccgggac 3344 SerArgVal AlaTyrAlaIleThrGly LeuAlaSerThrAspArgAsp atacaagtg cctaatctcttcaacatg atcactatagagagggacagg 3392 IleGlnVal ProAsnLeuPheAsnMet IleThrIleGluArgAspArg ggaattgat cagacaggaatacttgag gcagetatggatttgagaggc 3440 GlyIleAsp GlnThrGlyIleLeuGlu AlaAlaMetAspLeuArgGly tattggggc acctatcaaatagatatt caggcgtatgaccatggaata 3488 TyrTrpGly ThrTyrGlnIleAspIle GlnAlaTyrAspHisGlyIle cctcaaagg atttcaaatcagaagtac ccgctggtg_attagaccttac 3536 ProGlnArg IleSerAsnGlnLysTyr ProLeuValIleArgProTyr aacttccac gacccagtgttcgtgttc cctcaacctggatccactatc 3584 AsnPheHis AspProValPheValPhe ProGlnProGlySerThrIle agactggcaaaggagcgagcagtagtcaacggtatactggetacagta 3632 ArgLeuAlaLysGluArgAlaValValAsnGlyIleLeuAlaThrVal gacggcgaatttctggacagaatcgttgccaccgacgaggatggttta 3680 AspGlyGluPheLeuAspArgIleValAlaThrAspGluAspGlyLeu gaagetggacttgtcacattctctatcgccggagatgatgaagatget 3728 GluAlaGlyLeuValThrPheSerIleAlaGlyAspAspGluAspAla cagttcttcgacgtgttgaacgacggagtgaactcgggtgetctcacc 3776 GlnPhePheAspValLeuAsnAspGlyValAsnSerGlyAlaLeuThr ctcacgcggctcttccctgaagagttccgagagttccaggtgacgatt 3824 LeuThrArgLeuPheProGluGluPheArgGluPheGlnValThrIle cgtgetacggacggtggaactgagcctggtccaaggagtacggactgc 3872 ArgAlaThrAspGlyGlyThrGluProGlyProArgSerThrAspCys ttggtgaccgtagtgtttgtacccacgcagggagagcccgtgttcgag 3920 LeuValThrValValPheValProThrGlnGlyGluProValPheGlu gataggacttacacggttgettttgttgaaaaagatgagggtatgtta 3968 AspArgThrTyrThrValAlaPheValGluLysAspGluGlyMetLeu gaggaggcggaactacctcgcgcctcagacccaaggaacatcatgtgt 4016 GluGluAlaGluLeuProArgAlaSerAspProArgAsnIleMetCys gaagatgattgtcacgacacctattacagcattgttggaggcaattcg 9064 GluAspAspCysHisAspThrTyrTyrSerIleValGlyGlyAsnSer ggtgaacacttcacagtagaccctcgtaccaacgtgctatccctggtg 4112 GlyGluHisPheThrValAspProArgThrAsnValLeuSerLeuVal aagccgctggaccgctccgaacaggagacacacaccctcatcattgga 4160 LysProLeuAspArgSerGluGlnGluThrHisThrLeuIleIleGly gccagcgacactcccaacccggccgccgtcctgcaggettctacactc 9208 AlaSerAspThrProAsnProAlaAlaValLeuGlnAlaSerThrLeu actgtcactgttaatgttcgagaagcgaacccgcgaccagtgttccaa 4256 ThrValThrValAsnValArgGluAlaAsnProArgProValPheGln agagcactctacacagetggcatctctgetggcgatttcatcgaaaga 4304 ArgAlaLeuTyrThrAlaGlyIleSerAlaGlyAspPheIleGluArg aatctgctgactttagtagcgacacattcagaagatctgcccatcact 4352 Asn Leu Leu Thr Leu Val Ala Thr His Ser Glu Asp Leu Pro Ile Thr tacactctgatacaagagtccatggaagcagaccccacactcgaaget 4900 TyrThrLeuIleGlnGluSerMetGluAlaAspProThrLeuGluAla gttcag.gagtcagccttcatcctcaaccctgagactggagtcctgtcc 4948 ValGlnGluSerAlaPheIleLeuAsnProGluThrGlyValLeuSer ctcaacttccagccaaccgcctccatgcacggcatgttcgagttcgaa 4496 LeuAsnPheGlnProThrAlaSerMetHisGlyMetPheGluPheGlu gtcaaagccactgattcaaggacagaaactgcccgcacggaagtgaag 4544 ValLysAlaThrAspSerArgThrGluThrAlaArgThrGluValLys gtgtacctgatatcagaccgcaaccgagtgttcttcacgttcaataac 4592 ValTyrLeuIleSerAspArgAsnArgValPhePheThrPheAsnAsn ccactgcctgaagtcacaccc-caggaagatttcatagcggagacgttc 4640 ProLeuProGluValThrProGlnGluAspPheIleAlaGluThrPhe acggcattcttcggcatgacgtgcaacatcgaccagtcgtggtgggcc 4688 ThrAlaPhePheGlyMetThrCysAsnIleAspGlnSerTrpTrpAla agcgatcccgtcaccggcgccaccaaggacgaccagactgaagtcagg 4736 SerAspProValThrGlyAlaThrLysAspAspGlnThrGluValArg getcatttcatcagggacgaccttcccgtgcctgetgaggagattgaa 4784 AlaHisPheIleArgAspAspLeuProValProAlaGluGluIleGlu cagttacgcggtaacccaactctagtaaatagcatccaacgagccctg 4832 GlnLeuArgGlyAsnProThrLeuValAsnSerIleGlnArgAlaLeu gaggaacagaacctgcagctagccgacctgttcacgggcgagacgccc 4880 GluGluGlnAsnLeuGlnLeuAlaAspLeuPheThrGlyGluThrPro atcctcggcggcgacgcgcaggetcgagccctgtacgcgctggcggcg 4928 IleLeuGlyGlyAspAlaGlnAlaArgAlaLeuTyrAlaLeuAlaAla gtggcggcggcactcgcgctgattgttgttgtgctgctgattgtgttc 4976 ValAlaAlaAlaLeuAlaLeuIleValValValLeuLeuIleValPhe tttgttaggactaggactctgaaccggcgcttgcaagetctgtccatg 5024 PheValArgThrArgThrLeuAsnArgArgLeuGlnAlaLeuSerMet accaagtacagttcgcaagactctgggttgaaccgcgtgggtttggcg 5072 ThrLysTyrSerSerGlnAspSerGlyLeuAsnArgValGlyLeuAla Ig gcg ccg acc aataagcacget gtcgag ggctccaaccccatc tgg 5120 ggc Ala Pro Thr AsnLysHisAla ValGlu GlySerAsnProIle Trp Gly aat gaa ttg aaggetccggac tttgac getcttagcgagcag tcg 5168 acg Asn Glu Leu LysAlaProAsp PheAsp AlaLeuSerGluGln Ser Thr tac gac gac ctaatcggcatc gaagac ttgccgcagttcagg aac 5216 tca Tyr Asp Asp LeuIleGlyIle GluAsp LeuProGlnPheArg Asn Ser gac tac cca cctgaggagggc agctcc atgcgaggagtcgtc aat 5264 ttc Asp Tyr Pro ProGluGluGly SerSer MetArgGlyValVal Asn Phe gaa cac cct gaatcaatagca aaccat aacaacaacttcggg ttt 5312 gtg Glu His Pro GluSerIleAla AsnHis AsnAsnAsnPheGly Phe Val aac tct ccc ttcagcccagag ttcgcg aacacgcagttcaga aga 5360 act Asn Ser Pro PheSerProGlu PheAla AsnThrGlnPheArg Arg Thr taaaatattaaagcatttta ttataata ttatgtaccg gtgaaatacc atacttatat5420 aa ttacctaagtatatattaaa gagattaa gtaagat actcgtattaatt aagagcattt5480 gt atttttttaaatacaaaaca taaactaa aaaaaaa aaaaaaaaaa 5527 at <210>

<211>

<212>
PRT

<213> thiszea Helio <400> 4 Met Ala Val Asp Val Arg Ile Leu Thr Ala Ala Val Phe Ile Ile Ala Ala His Leu Thr Phe Ala Gln Asp Cys Ser Tyr Met Val Ala Ile Pro Arg Pro Glu Arg Pro Asp Phe Pro Ser Leu Asn Phe Asp Gly Ile Pro Trp Ser Arg Tyr Pro Leu Ile Pro Val Glu Gly Arg Glu Asp Val Cys Met Asn Glu Phe Gln Pro Asp Ala Leu Asn Pro Val Thr Val Ile Phe Met Glu Glu Glu Ile Glu Gly Asp Val Ala Ile Ala Arg Leu Asn Tyr Arg Gly Thr Asn Thr Pro Thr Ile Val Ser Pro Phe Ser Phe Gly Thr Phe Asn Met Leu Gly Pro Val Ile Arg Arg Ile Pro Glu Asn Gly Gly Asp Trp His Leu Val Ile Thr Gln Arg Gln Asp Tyr Glu Thr Pro Gly Met Gln Gln Tyr Ile Phe Asp Val Arg Val Asp Asp Glu Pro Leu Val Ala Thr Val Met Leu Leu Ile Val Asn Ile Asp Asp Asn Asp Pro Ile Ile Gln Met Phe Glu Pro Cys Asp Ile Pro Glu Arg Gly Glu Thr Gly Ile Thr Ser Cys Lys Tyr Thr Val Ser Asp Ala Asp Gly Glu Ile Ser Thr Arg Phe Met Arg Phe Glu Ile Ser Ser Asp Arg Asp Asp Asp Glu Tyr Phe Glu Leu Val Arg Glu Asn Ile Gln Gly Gln Trp Met Tyr Val His Met Arg Val His Val Lys Lys Pro Leu Asp Tyr Glu Glu Asn Pro Leu His Leu Phe Arg Val Thr Ala Tyr Asp Ser Leu Pro Asn Thr His Thr Val Thr Met Met Val Gln Val Glu Asn Val Glu Asn Arg Pro Pro Arg Trp Met Glu Ile Phe Ala Val Gln Gln Phe Asp Glu Lys Thr Glu Gln Ser Phe Arg Val Arg Ala Ile Asp Gly Asp Thr Gly Ile Asp Lys Pro Ile Phe Tyr Arg Ile Glu Thr Glu Lys Gly Glu Glu Asp Leu Phe Ser Ile Gln Thr Ile Glu Gly Gly Arg Glu Gly Ala Trp Phe Asn Val Ala Pro Ile Asp Arg Asp Thr Leu Glu Lys Glu Val Phe His Val Ser Ile Ile Ala Tyr Lys Tyr Gly Asp Asn Asp Val Glu Gly Ser Ser Ser Phe Gln Ser Lys Thr Asp Val Val Ile Ile Val Asn Asp Val Asn Asp Gln Ala Pro Leu Pro Phe Arg Glu Glu Tyr Ser Ile Glu Ile Met Glu Glu Thr Ala Met Thr Leu Asn Leu Glu Asp Phe Gly Phe His Asp Arg Asp Leu Gly Pro His Ala Gln Tyr Thr Val His Leu Glu Ser Ile His Pro Pro Arg Ala His Glu Ala Phe Tyr Ile Ala Pro Glu Val Gly Tyr Gln Arg Gln Ser Phe Ile Met Gly Thr Gln Asn His His Met Leu Asp Phe Glu Val Pro Glu Phe Gln Asn Ile Gln Leu Arg Ala Val Ala Ile Asp Met Asp Asp Pro Lys Trp Val Gly Ile Ala Ile Ile Asn Ile Lys Leu Ile Asn Trp Asn Asp Glu Leu Pro Met Phe Glu Ser Asp Val Gln Thr Val Ser Phe Asp Glu Thr Glu Gly Ala Gly Phe Tyr Val Ala Thr Val Val Ala Lys Asp Arg Asp Val Gly Asp Lys Val Glu His Ser Leu Met Gly Asn Ala Val Ser Tyr Leu Arg Ile Asp Lys Glu Thr Gly Glu Ile Phe Val Thr Glu Asn Glu Ala Phe Asn Tyr His Arg Gln Asn Glu Leu Phe Val Gln Ile Pro Ala Asp Asp Thr Leu Gly Glu Pro Tyr Asn Thr Asn Thr Thr Gln Leu Val Ile Lys Leu Arg Asp Ile Asn Asn Thr Pro Pro Thr Leu Arg Leu Pro Arg Ala Thr Pro Ser Val Glu Glu Asn Val Pro Asp Gly Phe Val Ile Pro Thr Gln Leu His Ala Thr Asp Pro Asp Thr Thr Ala Glu Leu Arg Phe Glu Ile Asp Trp Gln Asn Ser Tyr 660 665 ' 670 Ala Thr Lys Gln Gly Arg Asn Thr Asp Ser Lys Glu Tyr Ile Gly Cys Ile Glu Ile Glu Thr Ile Tyr Pro Asn Ile Asn Gln Arg Gly Asn Ala Ile Gly Arg Val Val Val Arg Glu Ile Arg Asp Gly Val Thr Ile Asp Tyr Glu Met Phe Glu Val Leu Tyr Leu Thr Val Ile Val Arg Asp Leu Asn Thr Val Ile Gly Glu Asp His Asp Ile Ser Thr Phe Thr Ile Thr Ile Ile Asp Met Asn Asp Asn Pro Pro Leu Trp Val Glu Gly Thr Leu Thr Gln Glu Phe Arg Val Arg Glu Val Ala Ala Ser Gly Val Val Ile Gly Ser Val Leu Ala Thr Asp Ile Asp Gly Pro Leu Tyr Asn Gln Val Arg Tyr Thr Ile Thr Pro Arg Leu Asp Thr Pro Glu Asp Leu Val Asp Ile Asp Phe Asn Thr Gly Gln Ile Ser Val Lys Leu His Gln Ala Ile Asp Ala Asp Glu Pro Pro Arg Gln Asn Leu Tyr Tyr Thr Val Ile Ala Ser Asp Lys Cys Asp Leu Leu Thr Val Thr Glu Cys Pro Pro Asp Pro Thr Tyr Phe Glu Thr Pro Gly Glu Ile Thr Ile His Ile Thr Asp Thr Asn Asn Lys Val Pro Gln Val Glu Asp Asp Lys Phe Glu Ala Thr Val Tyr Ile Tyr Glu Gly Ala Asp Asp Gly Gln His Val Val Gln Ile Tyr Ala Ser Asp Leu Asp Arg Asp Glu Ile Tyr His Lys Val Ser Tyr Gln Ile Asn Tyr Ala Ile Asn Ser Arg Leu Arg Asp Phe Phe Glu Met Asp Leu Glu Ser Gly Leu Val Tyr Val Asn Asn Thr Ala Gly Glu Leu Leu Asp Arg Asp Gly Asp Glu Pro Thr His Arg Ile Phe Phe Asn Val Ile Asp Asn Phe Tyr Gly Glu Gly Asp Gly Asn Arg Asn Gln Asn Glu Thr Gln Val Leu Val Val Leu Leu Asp Ile Asn Asp Asn Tyr Pro Glu Leu Pro Glu Thr Ile Pro Trp Ala Ile Ser Glu Ser Leu Glu Leu Gly Glu Arg Val Gln Pro Glu Ile Phe Ala Arg Asp Arg Asp Glu Pro Gly Thr Asp Asn Ser Arg Val Ala Tyr Ala Ile Thr Gly Leu Ala Ser Thr Asp Arg Asp Ile Gln Val Pro Asn Leu Phe Asn Met Ile Thr Ile Glu Arg Asp Arg Gly Ile Asp Gln Thr Gly Ile Leu Glu Ala Ala Met Asp Leu Arg Gly Tyr Trp Gly Thr Tyr Gln Ile Asp Ile Gln Ala Tyr Asp His Gly Ile Pro Gln Arg Ile Ser Asn Gln Lys Tyr Pro Leu Val Ile Arg Pro Tyr Asn Phe His Asp Pro Val Phe Val Phe Pro Gln Pro Gly Ser Thr Ile Arg Leu Ala Lys Glu Arg Ala Val Val Asn Gly Ile Leu Ala Thr Val Asp Gly Glu Phe Leu Asp Arg Ile Val Ala Thr Asp Glu Asp Gly Leu Glu Ala Gly Leu Val Thr Phe Ser Ile Ala Gly Asp Asp Glu Asp Ala Gln Phe Phe Asp Val Leu Asn Asp Gly Val Asn Ser Gly Ala Leu Thr Leu Thr Arg Leu Phe Pro Glu Glu Phe Arg Glu Phe Gln Val Thr Ile Arg Ala Thr Asp Gly Gly Thr Glu Pro Gly Pro Arg Ser Thr Asp Cys Leu Val Thr Val Val Phe Val Pro Thr Gln Gly Glu Pro Val Phe Glu Asp Arg Thr Tyr Thr Val Ala Phe Val Glu Lys Asp Glu Gly Met Leu Glu Glu Ala Glu Leu Pro Arg Ala Ser Asp Pro Arg Asn Ile Met Cys Glu Asp Asp Cys His Asp Thr Tyr Tyr Ser Ile Val Gly Gly Asn Ser Gly Glu His Phe Thr Val Asp Pro Arg Thr Asn Val Leu Ser Leu Val Lys Pro Leu Asp Arg Ser Glu Gln Glu Thr His Thr Leu Ile Ile Gly Ala Ser Asp Thr Pro Asn Pro Ala Ala Val Leu Gln Ala Ser Thr Leu Thr Val Thr Val Asn Val Arg Glu Ala Asn Pro Arg Pro Val Phe Gln Arg Ala Leu Tyr Thr Ala Gly Ile Ser Ala Gly Asp Phe Ile Glu Arg Asn Leu Leu Thr Leu Val Ala Thr His Ser Glu Asp Leu Pro Ile Thr Tyr Thr Leu Ile Gln Glu Ser Met Glu Ala Asp Pro Thr Leu Glu Ala Val Gln Glu Ser Ala Phe Ile Leu Asn Pro Glu Thr Gly Val Leu Ser Leu Asn Phe Gln Pro Thr Ala Ser Met His Gly Met Phe Glu Phe Glu Val Lys Ala Thr Asp Ser Arg Thr Glu Thr Ala Arg Thr Glu Val Lys Val Tyr Leu Ile Ser Asp Arg Asn Arg Val Phe Phe Thr Phe Asn Asn Pro Leu Pro Glu Val Thr Pro Gln Glu Asp Phe Ile Ala Glu Thr Phe Thr Ala Phe Phe Gly Met Thr Cys Asn Ile Asp Gln Ser Trp Trp Ala Ser Asp Pro Val Thr Gly Ala Thr Lys Asp Asp Gln Thr Glu Val Arg Ala His Phe Ile Arg Asp Asp Leu Pro Val Pro Ala Glu Glu Ile Glu Gln Leu Arg Gly Asn Pro Thr Leu Val Asn Ser Ile Gln Arg Ala Leu Glu Glu Gln Asn Leu Gln Leu Ala Asp Leu Phe Thr Gly Glu Thr Pro Ile Leu Gly Gly Asp Ala Gln Ala Arg Ala Leu Tyr Ala Leu Ala Ala Val Ala Ala Ala Leu Ala Leu Ile Val Val Val Leu Leu Ile Val Phe Phe Val Arg Thr Arg Thr Leu Asn Arg Arg Leu Gln Ala Leu Ser Met Thr Lys Tyr Ser Ser Gln Asp Ser Gly Leu Asn Arg Val Gly Leu Ala Ala Pro Gly Thr Asn Lys His Ala Val Glu Gly Ser Asn Pro Ile Trp Asn Glu Thr Leu Lys Ala Pro Asp Phe Asp Ala Leu Ser Glu 1650 1655 ' 1660 Gln Ser Tyr Asp Ser Asp Leu Ile Gly Ile Glu Asp Leu Pro Gln Phe Arg Asn Asp Tyr Phe Pro Pro Glu Glu Gly Ser Ser Met Arg Gly Val Val Asn Glu His Val Pro Glu Ser Ile Ala Asn His Asn Asn Asn Phe Gly Phe Asn Ser Thr Pro Phe Ser Pro Glu Phe Ala Asn Thr Gln Phe Arg Arg <210>

<211>

<212>
DNA

<213> ptera Spodo frugiperda <220>

<221>
CDS

<222> ...(5363) (162) <400>

gacattctgt ggtgaaaaca agtggtttgt gggtacagtg 60 ttttttattt atttttttct taaacatttt ggaatattgt taaagtattg acagataaag 120 taaagatttc ggaatattgt ctgtaacatc actagagaag g tg tc 176 tgagaactgc a gcg gat aagatcatga g gtg M et Ala Val Asp Val cga ctgacagcaacattgctggtactcaccactgetacagcacag 224 ata Arg LeuThrAlaThrLeuLeuValLeuThrThrAlaThrAlaGln Ile cga cgatgtggctacatggtagaaatacccagaccagacaggcct 272 gat Arg ArgCysGlyTyrMetValGluIleProArgProAspArgPro Asp gac ccacctcaaaattttgacggtttaacatgggetcagcagcca 320 ttc Asp ProProGlnAsnPheAspGlyLeuThrTrpAlaGlnGlnPro Phe cta ccagetgaggatcgagaagaggtctgcctcaatgactatgaa 368 tta Leu ProAlaGluAspArgGluGluValCysLeuAsnAspTyrGlu Leu cct ccctggagcaacaaccatggtgaccagagaatttacatggag 416 gat Pro ProTrpSerAsnAsnHisGlyAspGlnArgIleTyrMetGlu Asp gag atcgaaggtcccgtagtcattgcgaaaattaactaccaagga 464 gag Glu IleGluGlyProValValIleAlaLysIleAsnTyrGlnGly Glu aac cctcctcaaataagattaccttttcgtgttggtgcagcccac 512 acc Asn ProProGlnIleArgLeuProPheArgValGlyAlaAlaHis Thr atg ggagcagaaattcgtgaatatcctgacgcaactggagactgg 560 ctt Met GlyAlaGluIleArgGluTyrProAspAlaThrGlyAspTrp Leu tat gtaattactcaaaggcaggactatgaaactcctgatatgcag 608 ctt Tyr ValIleThrGlnArgGlnAsp_TyrGluThrProAspMetGln Leu aga acgttcgatgtgagtgtggaaggccagtcgctggttgtaacg 656 tac Arg ThrPheAspValSerValGluGlyGlnSerLeuValValThr Tyr gtgaggctggatattgtgaacatcgacgacaatgcgcccatcattgag 709 ValArgLeuAspIleValAsnIleAspAspAsnAlaProIleIleGlu atgttagagccttgcaacttaccggaacttgttgaaccccatgttaca 752 MetLeuGluProCysAsnLeuProGluLeuValGluProHisValThr gaatgtaaatatatcgtgtccgacgcagacggtctgatcagtacaagt 800 GluCysLysTyrIleVal.SerAspAlaAspGlyLeuIleSerThrSer gttatgagttatcatatagacagcgagagaggagacgaaaaagtattc 848 ValMetSerTyrHisIleAspSerGluArgGlyAspGluLysValPhe gaactgatcagaaaagattatccgggcgattggacgaaggtgtatatg 896 GluLeuIleArgLysAspTyrProGlyAspTrpThrLysValTyrMet gttcttgaattgaaaaaatctcttgattacgaagagaatcctctacac 949 ValLeuGluLeuLysLysSerLeuAspTyrGluGluAsnProLeuHis atattcagagtcacggettctgattccttaccaaacaataggaccgtg 992 IlePheArgValThrAlaSerAspSerLeuProAsnAsnArgThrVal gtcatgatggttgaagtagagaacgtggaacatagaaatcctcggtgg 1040 ValMetMetValGluValGluAsnValGluHisArgAsnProArgTrp atggagatctttgetgtgcaacagtttgatgaaaaacaggcgaaatcg 1088 MetGluIlePheAlaValGlnGlnPheAspGluLysGlnAlaLysSer ttcacagtgcgagetattgatggcgacacgggaatcaataaacctata 1136 PheThrValArgAlaIleAspGlyAspThrGlyIleAsnLysProIle ttctatcgtatagaaactgaagatgaagacaaagagttcttcagcatt 1184 PheTyrArgIleGluThrGluAspGluAspLysGluPhePheSerIle gagaacataggggaaggcagagacggtgccagattccacgtggetcct 1232 GluAsnIleGlyGluGlyArgAspGlyAlaArgPheHisValAlaPro atagacagagactacctgaaaagggatatgtttcatataagaataatt 1280 IleAspArgAspTyrLeuLysArgAspMetPheHisIleArgIleIle gcatataaacaaggtgataatgacaaagaaggtgaatcatcgttcgag 1328 AlaTyrLysGlnGlyAspAsnAspLysGluGlyGluSerSerPheGlu acctcagcaaatgtgacgattataattaacgatataaatgatcagagg 1376 ThrSerAlaAsnValThrIleIleIleAsnAspIleAsnAspGlnArg ccagaacccttccataaagaatacacgatctccataatggaagaaact 1424 ProGluProPheHisLysGluTyrThrIleSerIleMetGluGluThr gcgatgaccttagatttgcaagagtttggtttccatgaccgtgacatt 1972 AlaMetThrLeuAspLeuGlnGluPheGlyPheHisAspArgAspIle ggtccccacgetcagtacgacgttcacttagagagtatacagccagag 1520 GlyProHisAlaGlnTyrAspValHisLeuGluSerIleGlnProGlu ggggcccataccgetttctacatcgcccctgaagaaggttaccaggcc 1568 GlyAlaHisThrAlaPheTyrIleAlaProGluGluGlyTyrGlnAla cagtctttcaccataggtactagaatccataacatgttggattatgaa 1616 GlnSerPheThrIleGlyThrArgIleHisAsnMetLeuAspTyrGlu gatgacgactacagaccaggaataaagctaaaggcagtagcaattgac 1669 AspAspAspTyrArgProGlyIleLysLeuLysAlaValAlaIleAsp agacacgataacaatcacattggggaagcaattattaacattaacctt 1712 ArgHisAspAsnAsnHisIleGlyGluAlaIleIleAsnIleAsnLeu atcaattggaatgatgagctacctatattcgacgaggacgcctacaac 1760 IleAsnTrpAsnAspGluLeuProIlePheAspGluAspAlaTyrAsn gtgacatttgaggagacggtcggtgatggcttccacattggtaaatac 1808 ValThrPheGluGluThrValGlyAspGlyPheHisIleGlyLysTyr cgggetaaagacagagacatcggtgacatagtcgagcactcgatattg 1856 ArgAlaLysAspArgAspIleGlyAspIleValGluHisSerIleLeu ggcaacgetgcaaacttcctgagaattgacatagatactggagatgtg 1904 GlyAsnAlaAlaAsnPheLeuArgIleAspIleAspThrGlyAspVal tacgtgtcacgggacgattactttgattatcaaagacagaacgaaatc 1952 TyrValSerArgAspAspTyrPheAspTyrGlnArgGlnAsnGluIle atagttcagattctggetgttgatacactaggtttacctcagaacagg 2000 IleValGlnIleLeuAlaValAspThrLeuGlyLeuProGlnAsnArg getaccacacagctcacgatatttttggaagacatcaacaacacgcca 2048 AlaThrThrGlnLeuThrIlePheLeuGluAspIleAsnAsnThrPro cctatactgcgactgccacgttccagtccaagtgtagaagagaacgtt 2096 ProIleLeuArgLeuProArgSerSerProSerValGluGluAsnVal gaagtcgggcacccgattaccgaggggctaacggcgacagacccagac 2194 GluValGlyHisProIleThrGluGlyLeuThrAlaThrAspProAsp accacagccgatttacacttcgagatcgattgggacaattcttacget 2192 ThrThrAlaAspLeuHisPheGluIleAspTrpAspAsnSerTyrAla acgaagcagggcaccaatggacccaacactgcagactaccacggatgc 2240 ThrLysGlnGlyThrAsnGlyProAsnThrAlaAspTyrHisGlyCys gtagaaatcctgacggtatacccagatcctgacaatcacgggagaget 2288 ValGluIleLeuThrVal.TyrProAspProAspAsnHisGlyArgAla gagggtcacttggtggcacgtgaggtcagtgatggcgtgaccatcgat 2336 GluGlyHisLeuValAlaArgGluValSerAspGlyValThrIleAsp tacgagaagtttgaggtgctgtacctcgtcgtcagggtgatagatcgc 2384 TyrGluLysPheGluValLeuTyrLeuValValArgValIleAspArg aacactgtcattggccctgattatgacgaagcaatgctgacggtgacg 2432 AsnThrValIleGlyProAspTyrAspGluAlaMetLeuThrValThr ataatcgatatgaacgacaactggccgatatgggccgacaacacgctg 2480 IleIleAspMetAsnAspAsnTrpProIleTrpAlaAspAsnThrLeu cagcagacactgcgcgtgcgcgagatggccgacgaaggagtcatcgtc 2528 GlnGlnThrLeuArgValArgGluMetAlaAspGluGlyValIleVal ggtacactgctcgccaccgacttggatggccctctctacaaccgagtc 2576 GlyThrLeuLeuAlaThrAspLeuAspGlyProLeuTyrAsnArgVal cgctacaccatggtccccatcaaggacactcctgatgacctaatagcg 2624 ArgTyrThrMetValProIleLysAspThrProAspAspLeuIleAla atcaactacgtcaccggtcagctgactgtgaacaaggggcaagcaatt 2672 IleAsnTyrValThrGlyGlnLeuThrValAsnLysGlyGlnAlaIle gacgcagatgatccacctcgcttctacctgtattacaaggtcactgcc 2720 AspAlaAspAspProProArgPheTyrLeuTyrTyrLysValThrAla agcgataagtgctctcttgacgagttcttccctgtgtgcccacctgac 2768 SerAspLysCysSerLeuAspGluPhePheProValCysProProAsp cccacttactggaataccgagggagagatagcgatcgcgataaccgat 2816 ProThrTyrTrpAsnThrGluGlyGluIleAlaIleAlaIleThrAsp acgaacaacaaaattccacgcgcggaaacagatatgttccctagtgaa 2869 ThrAsnAsnLysIleProArgAlaGluThrAspMetPheProSerGlu aagcgcatctatgagaacacacccaatggtaccaagatcacgacgatc 2912 LysArgIleTyrGluAsnThrProAsnGlyThrLysIleThrThrIle atcgetagtgaccaggacagagatcgaccaaataacgcgctgacgtac 2960 IleAlaSerAspGlnAspArgAspArgProAsnAsnAlaLeuThrTyr agaatcaactacgcattcaaccacaggctggagaacttcttcgcagtg 3008 ArgIleAsnTyrAlaPheAsnHisArgLeuGluAsnPhePheAlaVal gaccctgatactggtgaactgtttgtccacttcaccactagcgaagtg 3056 AspProAspThrGlyGluLeuPheValHisPheThrThrSerGluVal ttggacagagacggagaggaaccggagcataggatcatcttcaccatc 3104 LeuAspArgAspGlyGluGluProGluHisArgIleIlePheThrIle gtcgataacttggaaggcgetggagatggcaatcagaacacaatctcc 3152 ValAspAsnLeuGluGlyAlaGlyAspGlyAsnGlnAsnThrIleSer acggaggtgcgtgttatactgcttgatataaacgacaataagccggaa 3200 ThrGluValArgValIleLeuLeuAspIleAsnAspAsnLysProGlu ctaccaattcctgatggcgaattttggaccgtttccgaaggtgaagtg 3248 LeuProIleProAspGlyGluPheTrpThrValSerGluGlyGluVal gagggaaaacgcattccaccagagattcacgcacacgacagagatgaa 3296 GluGlyLysArgIleProProGluIleHisAlaHisAspArgAspGlu ccattcaacgacaactctcgcgtgggatatgaaattcgatcgatcaaa 3344 ProPheAsnAspAsnSerArgValGlyTyrGluIleArgSerIleLys ttgatcaatagagacatcgagcttcctcaagatccattcaaaataata 3392 LeuIleAsnArgAspIleGluLeuProGlnAspProPheLysIleIle acgattgatgatctcgatacctggaaattcgttggagagttggagact 3440 ThrIleAspAspLeuAspThrTrpLysPheValGlyGluLeuGluThr accatggaccttagaggatactggggaacctatgatgtcgagatacgt 3488 ThrMetAspLeuArgGlyTyrTrpGlyThrTyrAspValGluIleArg gcgtttgaccacggtttcccgatgctggattcattcgagacctaccaa 3536 AlaPheAspHisGlyPheProMetLeuAspSerPheGluThrTyrGln ctaaccgtcaggccatacaacttccattcaccggtgtttgtgttccca 3584 LeuThrValArgProTyrAsn_PheHisSerProValPheValPhePro actcctggctcaaccatcaggctttctagggagcgtgetatagtcaat 3632 ThrProGlySerThrIleArgLeuSerArgGluArgAlaIleValAsn ggtatgctggetctggetaatatcgcgagcggagagttcctcgacaga 3680 GlyMetLeuAlaLeuAlaAsnIleAlaSerGlyGluPheLeuAspArg ctctctgccactgatgaagatgggctacacgcaggcagagtaactttc 3728 LeuSerAlaThrAspGluAspGlyLeuHisAlaGlyArgValThrPhe tccatagetggaaacgatgaagetgcggaatatttcaatgtgttgaac 3776 SerIleAlaGlyAsnAspGluAlaAlaGluTyrPheAsnValLeuAsn gacggtgacaactcagcaatgctcacgctgaagcaagcattgcccget 3824 AspGlyAspAsnSerAlaMetLeuThrLeuLysGlnAlaLeuProAla ggcgtccagcagtttgagttggttattcgggccacggacggcgggacg 3872 GlyValGlnGlnPheGluLeuValIleArgAlaThrAspGlyGlyThr gagccgggacctaggagtaccgactgctccgtcactgtggtgtttgtg 3920 GluProGlyProArgSerThrAspCysSerValThrValValPheVal atgacgcagggagaccccgtgttcgacgacaacgcagettctgtccgc 3968 MetThrGlnGlyAspProValPheAspAspAsnAlaAlaSerValArg ttcgttgaaaaggaagetggtatgtcggaaaagtttcagctgcctcag 4016 PheValGluLysGluAlaGlyMetSerGluLysPheGlnLeuProGln gccgatgaccccaaaaactacaggtgtatggacgactgccataccatc 4064 AlaAspAspProLysAsnTyrArgCysMetAspAspCysHisThrIle tactactctatcgttgatggcaacgatggtgaccacttcgccgtggag 4112 TyrTyrSerIleValAspGlyAsnAspGlyAspHisPheAlaValGlu ccggagactaacgtgatctatttgctgaagccgctggaccgcagccaa 4160 ProGluThrAsnValIleTyrLeuLeuLysProLeuAspArgSerGln caggagcagtacagggtcgtggtggcggettccaacacgcctggcggc 4208 GlnGluGlnTyrArgValValValAlaAlaSerAsnThrProGlyGly acctccaccttgtcctcctcactcctcaccgtcaccatcggcgttcga 4256 ThrSerThrLeuSerSerSerLeuLeuThrValThrIleGlyValArg gaagcaaaccctagaccgatcttcgaaagtgaattttacacagetggc 4304 GluAlaAsnProArgProIlePheGluSerGluPheTyrThrAlaGly gtcttacacaccgatagcatacacaaggagctcgtttacctggcggca 4352 ValLeuHisThrAspSerIleHisLysGluLeuValTyrLeuAlaAla aaacattcagaagggcttcctatcgtctactcgatagatcaagaaacc 4400 LysHisSerGluGlyLeuProIleValTyrSerIleAspGlnGluThr atgaaaatagacgagtcgttgcaaacagttgtggaggacgccttcgac 4948 MetLysIleAspGluSerLeuGlnThrValValGluAspAlaPheAsp attaactctgcaaccggagtcatatcgctgaacttccagccaacatct 4496 IleAsnSerAlaThrGlyValIleSerLeuAsnPheGlnProThrSer gtcatgcacggcagtttcgacttcgaggtggtggetagtgacacgcgt 4544 ValMetHisGlySerPheAspPheGluValValAlaSerAspThrArg ggagcgagtgatcgagcaaaagtgtcaatttacatgatatcgactcgc 4592 GlyAlaSerAspArgAlaLysValSerIleTyrMetIleSerThrArg gttagagtagccttcctgttctacaacacggaagetgaagttaacgag 4640 ValArgValAlaPheLeuPheTyrAsnThrGluAlaGluValAsnGlu agaagaaatttcattgcacaaacgttcgccaacgcgtttggtatgaca 4688 ArgArgAsnPheIleAlaGlnThrPheAlaAsnAlaPheGlyMetThr tgtaacatagacagcgtgctgccggetaccgacgccaacggcgtgatt 4736 CysAsnIleAspSerValLeuProAlaThrAspAlaAsnGlyValIle cgcgaggggtacacagaactccaggetcacttcatacgagacgaccag 4784 ArgGluGlyTyrThrGluLeuGlnAlaHisPheIleArgAspAspGln ccggtgccagccgactatattgagggattatttacggaactcaataca 4832 ProValProAla.AspTyrIleGluGlyLeuPheThrGluLeuAsnThr ttgcgtgacatcagagaggtactgagtactcagcaattgacgctactg 9880 LeuArgAspIleArgGluValLeuSerThrGlnGlnLeuThrLeuLeu gactttgcggcgggagggtcggcagtgctgcccggcggagagtacgcg 4928 AspPheAlaAlaGlyGlySerAlaValLeuProGlyGlyGluTyrAla ctagcggtgtacatcctcgccggcatcgcagcgttactcgccgtcatc 4976 LeuAlaValTyrIleLeuAlaGlyIleAlaAlaLeuLeuAlaValIle tgtctcgetctcctcatcgetttcttcattaggaaccgaacactgaac 5024 CysLeuAlaLeuLeuIleAlaPhePheIleArgAsnArgThrLeuAsn cggcgcatcgaagccctcacaatcaaagatgttcctacggacatcgag 5072 ArgArgIleGluAlaLeuT__hrIleLysAspValProThrAspIleGlu ccaaaccacgcgtcagtagcagtgctaaacattaacaagcacacagaa 5120 ProAsnHisAlaSerValAlaValLeuAsnIleAsnLysHisThrGlu cctggttccaatcccttctataac ccggatgttaagaca cctaacttc 5168 ProGlySerAsnProPheTyrAsn ProAspValLysThr ProAsnPhe gacactataagcgaagtatccgat gacctgcttgatgtc gaagacttg 5216 AspThrIleSerGluValSerAsp AspLeuLeuAspVal GluAspLeu gaacagtttggaaaggattacttc ccacccgaaaacgaa attgagagc 5264 GluGlnPheGlyLysAspTyrPhe ProProGluAsnGlu IleGluSer ctgaattttgcacgtaaccccata gcgacacacgggaac aactttggc 5312 LeuAsnPheAlaArgAsnProIle AlaThrHisGlyAsn AsnPheGly gtaaactcaagcccctccaaccca gagttctccaactcc cagtttaga 5360 ValAsnSerSerProSerAsnPro GluPheSerAsnSer GlnPheArg agttaaactaaat cacttttat catagacttatgtatttaataatt 5413 a cacttg Ser ttacattttt tacattaaat ataaatgttt tatatgtaat aatagtgtga taaaatgtac 5973 gtaacaatca acatagctgt tgtaggttcg taaataacat actcgtaatg tataagtgtt 5533 atgtttatat atagaaataa aaatattaaa tattaaaaaa aaaaaaaaaa aaaaaaaaa 5592 <210> 6 <211> 1734 <212> PRT
<213> Spodoptera frugiperda <400> 6 Met Ala Val Asp Val Arg Ile Leu Thr Ala Thr Leu Leu Val Leu Thr Thr Ala Thr Ala Gln Arg Asp Arg Cys Gly Tyr Met Val Glu Ile Pro Arg Pro Asp Arg Pro Asp Phe Pro Pro Gln Asn Phe Asp Gly Leu Thr Trp Ala Gln Gln Pro Leu Leu Pro Ala Glu Asp Arg Glu Glu Val Cys Leu Asn Asp Tyr Glu Pro Asp Pro Trp Ser Asn Asn His Gly Asp Gln Arg Ile Tyr Met Glu Glu Glu Ile Glu Gly Pro Val Val Ile Ala Lys Ile Asn Tyr Gln Gly Asn Thr Pro Pro Gln Ile Arg Leu Pro Phe Arg Val Gly Ala Ala His Met Leu Gly Ala Glu Ile Arg Glu Tyr Pro Asp Ala Thr Gly Asp Trp Tyr Leu Val Ile Thr Gln Arg Gln Asp Tyr Glu Thr Pro Asp Met Gln Arg Tyr Thr Phe Asp Val Ser Val Glu Gly Gln Ser Leu Val Val Thr Val Arg Leu Asp Ile Val Asn Ile Asp Asp Asn Ala Pro Ile Ile Glu Met Leu Glu Pro Cys Asn Leu Pro Glu Leu Val Glu Pro His Val Thr Glu Cys Lys Tyr Ile Val Ser Asp Ala Asp Gly Leu Ile Ser Thr Ser Val Met Ser Tyr His Ile Asp Ser Glu Arg Gly Asp Glu Lys Val Phe Glu Leu Ile Arg Lys Asp Tyr Pro Gly Asp Trp Thr Lys Val Tyr Met Val Leu Glu Leu Lys Lys Ser Leu Asp Tyr Glu Glu Asn Pro Leu His Ile Phe Arg Val Thr Ala Ser Asp Ser Leu Pro Asn Asn Arg Thr Val Val Met Met Val Glu Val Glu Asn Val Glu His Arg Asn Pro Arg Trp Met Glu Ile Phe Ala Val Gln Gln Phe Asp Glu Lys Gln Ala Lys Ser Phe Thr Val Arg Ala Ile Asp Gly Asp Thr Gly Ile Asn Lys Pro Ile Phe Tyr Arg Ile Glu Thr Glu Asp Glu Asp Lys Glu Phe Phe Ser Ile Glu Asn Ile Gly Glu Gly Arg Asp Gly Ala Arg Phe His Val Ala Pro Ile Asp Arg Asp Tyr Leu Lys Arg Asp Met Phe His Ile Arg Ile Ile Ala Tyr Lys Gln Gly Asp Asn Asp Lys Glu Gly Glu Ser Ser Phe Glu Thr Ser Ala Asn Val Thr Ile Ile Ile Asn Asp Ile Asn Asp Gln Arg Pro Glu Pro Phe His Lys Glu Tyr Thr Ile Ser Ile Met Glu Glu Thr Ala Met Thr Leu Asp Leu Gln Glu Phe Gly Phe His Asp Arg Asp Ile Gly Pro His Ala Gln Tyr Asp Val His Leu Glu Ser Ile Gln Pro Glu Gly Ala His Thr Ala Phe Tyr Ile Ala Pro Glu Glu Gly Tyr Gln Ala Gln Ser Phe Thr Ile Gly Thr Arg Ile His Asn Met Leu Asp Tyr Glu Asp Asp Asp Tyr Arg Pro Gly Ile Lys Leu Lys Ala Val Ala Ile Asp Arg His Asp Asn Asn His Ile Gly Glu Ala Ile Ile Asn Ile Asn Leu Ile Asn Trp Asn Asp Glu Leu Pro Ile Phe Asp Glu Asp Ala Tyr Asn Val Thr Phe Glu Glu Thr Val Gly Asp Gly Phe His Ile Gly Lys Tyr Arg Ala Lys Asp Arg Asp Ile Gly Asp Ile Val Glu His Ser Ile Leu Gly Asn Ala Ala Asn Phe Leu Arg Ile Asp Ile Asp Thr Gly Asp Val Tyr Val Ser Arg Asp Asp Tyr Phe Asp Tyr Gln Arg Gln Asn Glu Ile Ile Val Gln Ile Leu Ala Val Asp Thr Leu Gly Leu Pro Gln Asn Arg Ala Thr Thr Gln Leu Thr Ile Phe Leu Glu Asp Ile Asn Asn Thr Pro Pro Ile Leu Arg Leu Pro Arg Ser Ser Pro Ser Val Glu Glu Asn Val Glu Val Gly His Pro Ile Thr Glu Gly Leu Thr Ala Thr Asp Pro Asp Thr Thr Ala Asp Leu His Phe Glu Ile Asp Trp Asp Asn Ser Tyr Ala Thr Lys Gln Gly Thr Asn Gly Pro Asn Thr Ala Asp Tyr His Gly Cys Val Glu Ile Leu Thr Val Tyr Pro Asp Pro Asp Asn His Gly Arg Ala Glu Gly His Leu Val Ala Arg Glu Val Ser Asp Gly Val Thr Ile Asp Tyr Glu Lys Phe Glu Val Leu Tyr Leu Val Val Arg Val Ile Asp Arg Asn Thr Val Ile Gly Pro Asp Tyr Asp Glu Ala Met Leu Thr Val Thr Ile Ile Asp Met Asn Asp Asn Trp Pro Ile Trp Ala Asp Asn Thr Leu Gln Gln Thr Leu Arg Val Arg Glu Met Ala Asp Glu Gly Val Ile Val Gly Thr Leu Leu Ala Thr Asp Leu Asp Gly Pro Leu Tyr Asn Arg Val Arg Tyr Thr Met Val Pro Ile Lys Asp Thr Pro Asp Asp Leu Ile Ala Ile Asn Tyr Val Thr Gly Gln Leu Thr Val Asn Lys Gly Gln Ala Ile Asp Ala Asp Asp Pro Pro Arg Phe Tyr Leu Tyr Tyr Lys Val Thr Ala Ser Asp Lys Cys Ser Leu Asp Glu Phe Phe Pro Val Cys Pro Pro Asp Pro Thr Tyr Trp Asn Thr Glu Gly Glu Ile Ala Ile Ala Ile Thr Asp Thr Asn Asn Lys Ile Pro Arg Ala Glu Thr Asp Met Phe Pro Ser Glu Lys Arg Ile Tyr Glu Asn Thr Pro Asn Gly Thr Lys Ile Thr Thr Ile Ile Ala Ser Asp Gln Asp Arg Asp Arg Pro Asn Asn Ala Leu Thr Tyr Arg Ile Asn Tyr Ala Phe Asn His Arg Leu Glu Asn Phe Phe Ala Val Asp Pro Asp Thr Gly Glu Leu Phe Val His Phe Thr Thr Ser Glu Val Leu Asp Arg Asp Gly Glu Glu Pro Glu His Arg Ile Ile Phe Thr Ile Val Asp Asn Leu Glu Gly Ala Gly Asp Gly Asn Gln Asn Thr Ile Ser Thr Glu Val Arg Val Ile Leu Leu Asp Ile Asn Asp Asn Lys Pro Glu Leu Pro Ile Pro Asp Gly Glu Phe Trp Thr Val Ser Glu Gly Glu Val Glu Gly Lys Arg Ile Pro Pro Glu Ile His Ala His Asp Arg Asp Glu Pro Phe Asn Asp Asn Ser Arg Val Gly Tyr Glu Ile Arg Ser Ile Lys Leu Ile Asn Arg Asp Ile Glu Leu Pro Gln Asp Pro Phe Lys Ile Ile Thr Ile Asp Asp Leu Asp Thr Trp Lys Phe Val Gly Glu Leu Glu Thr Thr Met Asp Leu Arg Gly Tyr Trp Gly Thr Tyr Asp Val Glu Ile Arg Ala Phe Asp His Gly Phe Pro Met Leu Asp Ser Phe Glu Thr Tyr Gln Leu Thr Val Arg Pro Tyr Asn Phe His Ser Pro Val Phe Val Phe Pro Thr Pro Gly Ser Thr Ile Arg Leu Ser Arg Glu Arg Ala Ile Val Asn Gly Met Leu Ala Leu Ala Asn Ile Ala Ser Gly Glu Phe Leu Asp Arg Leu Ser Ala Thr Asp Glu Asp Gly Leu His Ala Gly Arg Val Thr Phe Ser Ile Ala Gly Asn Asp Glu Ala Ala Glu Tyr Phe Asn Val Leu Asn Asp Gly Asp Asn Ser Ala Met Leu Thr Leu Lys Gln Ala Leu Pro Ala Gly Val Gln Gln Phe Glu Leu Val Ile Arg Ala Thr Asp Gly Gly Thr Glu Pro Gly Pro Arg Ser Thr Asp Cys Ser Val Thr Val Val Phe Val Met Thr Gln Gly Asp Pro Val Phe Asp Asp Asn Ala Ala Ser Val Arg Phe Val Glu Lys Glu Ala Gly Met Ser Glu Lys Phe Gln Leu Pro Gln Ala Asp Asp Pro Lys Asn Tyr Arg Cys Met Asp Asp Cys His Thr Ile Tyr Tyr Ser Ile Val Asp Gly Asn Asp Gly Asp His Phe Ala Val Glu Pro Glu Thr Asn Val Ile Tyr Leu Leu Lys Pro Leu Asp Arg Ser Gln Gln Glu Gln Tyr Arg Val Val Val Ala Ala Ser Asn Thr Pro Gly Gly Thr Ser Thr Leu Ser Ser Ser Leu Leu Thr Val Thr Ile Gly Val Arg Glu Ala Asn Pro Arg Pro Ile Phe Glu Ser Glu Phe Tyr Thr Ala Gly Val Leu His Thr Asp Ser Ile His Lys Glu Leu Val Tyr Leu Ala Ala Lys His Ser Glu Gly Leu Pro Ile Val Tyr Ser Ile Asp Gln Glu Thr Met Lys Ile Asp Glu Ser Leu Gln Thr Val Val Glu Asp Ala Phe Asp Ile Asn Ser Ala Thr Gly Val Ile Ser Leu Asn Phe Gln Pro Thr Ser Val Met His Gly Ser Phe Asp Phe Glu Val Val Ala Ser Asp Thr Arg Gly Ala Ser Asp Arg Ala Lys Val Ser Ile Tyr Met Ile Ser Thr Arg Val Arg Val Ala Phe Leu Phe Tyr Asn Thr Glu Ala Glu Val Asn Glu Arg Arg Asn Phe Ile Ala Gln Thr Phe Ala Asn Ala Phe Gly Met Thr Cys Asn Ile Asp Ser Val Leu Pro Ala Thr Asp Ala Asn Gly Val Ile Arg Glu Gly Tyr Thr Glu Leu Gln Ala His Phe Ile Arg Asp Asp Gln Pro Val Pro Ala Asp Tyr Ile Glu Gly Leu Phe Thr Glu Leu Asn Thr Leu Arg Asp Ile Arg Glu Val Leu Ser Thr Gln Gln Leu Thr Leu Leu Asp Phe Ala Ala Gly Gly Ser Ala Val Leu Pro Gly Gly Glu Tyr Ala Leu Ala Val Tyr Ile Leu Ala Gly Ile Ala Ala Leu Leu Ala Val Ile Cys Leu Ala Leu Leu Ile Ala Phe Phe Ile Arg Asn Arg Thr Leu Asn Arg Arg Ile Glu Ala Leu Thr Ile Lys Asp Val Pro Thr Asp Ile Glu Pro Asn His Ala Ser Val Ala Val Leu Asn Ile Asn Lys His Thr Glu Pro Gly Ser Asn Pro Phe Tyr Asn Pro Asp Val Lys Thr Pro Asn Phe Asp Thr Ile Ser Glu Val Ser Asp Asp Leu Leu Asp Val Glu Asp Leu Glu Gln Phe Gly Lys Asp Tyr Phe Pro Pro Glu Asn Glu Ile Glu Ser Leu Asn Phe Ala Arg Asn Pro Ile Ala Thr His Gly Asn Asn Phe Gly Val Asn Ser Ser Pro Ser Asn Pro Glu Phe Ser Asn Ser Gln Phe Arg Ser <210> 7 <211> 1604 <212> DNA
<213> Ostrinia nubilalis <400>

tccgaattcttcttcaacctcatcgacaacttcttttctg acggtgacgg taggagaaac60 caggacgaagttgaaatatttgtcgttctattggatgtga acgacaacgc tcctgagatg120 ccatcgcctgatgaactccggtttgatgtttccgaaggag cagttgctgg tgtccgtgta180 ctcccagaaatctacgcacctgacagggatgaaccagaca cggacaactc gcgtgtcggt240 tacggaatcctggacctcacgatcaccgaccgagacatcg aggtgccgga tctcttcacc300 atgatctcgattgaaaacaaaactggggaacttgagaccg ctatggactt gagggggtat360 tggggcacttacgaaatattcattgaggccttcgaccacg gctacccgca gcagaggtcc420 aacgggacgtacacactggtcattcgcccctacaacttcc accaccctgt gttcgtgttc480 ccgcaacccgactccgtcattcggctctctagggagcgcg caacagaagg cggggtcctg540 gcgacggctgccaacgagttcctggagccgatctacgcca ccgacgagga cggcctccac600 gcgggcagcgtcacgttccacgtccagggaaatgaggagg ccgttcagta ctttgatata660 actgaagtgggagcaggagaaaatagcgggcagcttatat tacgccagct tttcccagag720 caaatcagacaattcaggatcacgatccgggccacagacg gcggcacgga gcccggcccg780 ctttggaccgacgtcacgttttcggtggtcttcgtaccca cgcagggcga cccagtgttc840 agcgaaaatgcagctactgttgccttcttcgagggtgaag aaggcctcca tgagagtttt900 gagctgccgcaagcagaagaccttaaaaaccacctctgcg aagatgactg ccaagatatc960 tactacaggtttattgacggcaacaacgagggtctgttcg tgctggacca gtcgagcaac1020 gtcatctcccttgcgcaggagttggaccgcgaggttgcca cgtcttacac gctgcacatc1080 gcggcgagcaactcgcccgacgccactgggatccctctgc agacttccat cctcgttgtc1140 acggtcaatgtaagagaagcgaacccgcgcccaattttcg agcaggacct ttacacagcg1200 ggcatttcgacgttggacagcattggccgggaattgctta ccgtcagggc gagccacaca1260 gaagacgacaccatcacgtacatcatagaccgtgcgagca tgcagctgga cagcagccta1320 gaagccgtgcgcgactcggccttcacgctgcatgcgacca ccggcgtgct ttcgctcaat1380 atgcagcccaccgcttccatgcacggcatgttcgagttcg acgtcatcgc tacggataca1440 gcatctgcaatcgacacagctcgtgtgaaagtctacctca tctcatcgca aaaccgcgtg1500 tccttcattttcgataaccaacttgagaccgttgagcaga acagaaattt catagcggcc1560 acgttcagcaccgggttcaacatgacgtgtaacatcgacc aagt 1604 <210>

<211>

<212>
DNA

<213>
Artificial Sequence <220>

<223> etic oligonucleotide Synth <400>

gttamygtgagagaggcagaycc 23 <210>

<211>

<212>
DNA

<213>
Artificial Sequence <220>

<223>
Synthetic oligonucleotide <400>

ggatrttaagmgtcagyacwccg 23 <210> 10 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <900> 10 tccgaattct tcttyaacct catcgayaac tt 32 <210> 11 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 11 cgcaagctta cttggtcgat gttrcasgtc at 32

Claims

CLAIMS:

1. An isolated nucleic acid molecule having a nucleotide sequence encoding a Bt toxin receptor polypeptide having Bt toxin binding activity, said sequence selected from the group consisting of:
a) a nucleotide sequence set forth in SEQ ID NO:1, SEQ ID NO:3 or SEQ ID NO:5;
b) a nucleotide sequence having at least 85%
identity to the nucleotide sequence of a); and c) a nucleotide sequence having at least 95%
identity to the nucleotide sequence of a).

2. The isolated nucleic acid of claim 1 wherein the sequence encoding a Bt toxin receptor polypeptide has at least 85% identity to SEQ ID NO:1, SEQ ID NO:3 or SEQ ID NO:5.

3. The isolated nucleic acid of claim 1 wherein the sequence encoding a Bt toxin receptor polypeptide has at least 95% identity to SEQ ID NO:1, SEQ ID NO:3 or SEQ ID NO:5.

4. The nucleic acid molecule of any one of claims 1-3, wherein said toxin is a Cry1A toxin.

5. The nucleic acid of claim 4, wherein said Cry1A
toxin is a Cry1A(b) toxin.

6. An isolated nucleic acid consisting of at least 22 contiguous nucleotides of the nucleotide sequence set forth in SEQ ID NO:1, for use as a probe or primer.

7. An isolated polypeptide which is capable of binding a Bt toxin and having an amino acid sequence selected from the group consisting of:
a) an amino acid sequence set forth in SEQ ID
NO:2, SEQ ID NO:4, or SEQ ID NO:6;
b) an amino acid sequence having at least 85%
identity to the amino acid sequence of a);
c) an amino acid sequence having at least 95%
identity to the amino acid sequence of a); and d) an amino acid sequence encoded by the nucleotide sequence according to any one of claims 1-5.

8. The isolated polypeptide of claim 7 wherein the amino acid sequence has at least 85% identity to SEQ ID
NO:2, SEQ ID NO:4, or SEQ ID NO:6.

9. The isolated polypeptide of claim 7 wherein the amino acid sequence has at least 95% identity to SEQ ID
NO:2, SEQ ID NO:4, or SEQ ID NO:6.

10. The isolated polypeptide of claim 7 wherein the amino acid sequence is encoded by the nucleotide sequence defined in any one of claims 1 to 5.

11. A fusion polypeptide comprising the polypeptide of any one of claims 7 to 10, and at least one other polypeptide.

12. The fusion polypeptide of claim 11, wherein said other polypeptide is a receptor which binds to a toxin other than Bt toxin.

13. An antibody preparation specific for the polypeptide of any one of claims 7 to 10.

14. An isolated nucleic acid molecule encoding the polypeptide of any one of claims 7 to 12.

15. An expression cassette comprising a nucleotide sequence encoding the fusion polypeptide of claim 11, wherein said nucleotide sequence is operably linked to a promoter that drives expression in a cell.

16. The expression cassette of claim 15 wherein said other polypeptide is a receptor which binds to a toxin other than Bt toxin.

17. An expression cassette comprising at least one nucleic acid molecule according to any one of claims 1 to 5, wherein said nucleic acid molecule is operably linked to a promoter that drives expression in a cell of interest.

18. The expression cassette of claim 17, wherein said cell of interest is an insect or mammalian cell.

19. The expression cassette of claim 17 wherein said cell of interest is a microorganism.

20. The expression cassette of claim 19 wherein said microorganism is yeast or bacterium.

21. A vector for delivery of a nucleic acid molecule to a cell of interest, the vector comprising at least one nucleic acid molecule according to any one of claims 1 to 5.

22. A cell containing the vector of claim 21.

23. A transformed cell of interest having stably incorporated within its genome a nucleotide sequence encoding a Bt toxin receptor polypeptide having Bt toxin binding activity, said sequence selected from the group consisting of:

a) a nucleotide sequence set forth in SEQ ID
NO:1, SEQ ID NO:3 or SEQ ID NO:5;
b) a nucleotide sequence having at least 85%
identity to the nucleotide sequence of a); and c) a nucleotide sequence having at least 95%
identity to the nucleotide sequence of a).

24. The transformed cell of claim 23 wherein the nucleotide sequence stably incorporated into the genome has at least 85% identity to SEQ ID NO:1, SEQ ID NO:3 or SEQ ID
NO:5.

25. The transformed cell of claim 23 wherein the nucleotide sequence stably incorporated into the genome has at least 95% identity to SEQ ID NO:1, SEQ ID NO:3 or SEQ ID
NO:5.

26. A transformed cell having stably incorporated within its genome the nucleic acid molecule of claim 14.

27. A transformed cell having stably incorporated within its genome the expression cassette of any one of claims 15 to 20.

28. The transformed cell of any one of claims 23 to 27, wherein said cell is a plant cell.

29. The transformed cell of claim 28, wherein said plant cell is monocotyledonous.

30. A method for screening for ligands that bind Bt toxin receptor, said method comprising:
i) providing at least one Bt toxin receptor polypeptide according to any one of claims 7 to 10;

ii) contacting said polypeptide with a sample and a control ligand under conditions promoting binding; and iii) determining binding characteristics of said sample ligand, relative to said control ligand.

31. A method for screening for ligands that bind Bt toxin receptor, said method comprising:
i) providing at least one Bt toxin receptor polypeptide having the amino acid sequence according to any one of claims 7 to 10 in cells expressing said polypeptide wherein said polypeptide comprises a toxin binding domain;
ii) contacting said cells with a sample and a control ligand under conditions promoting binding; and iii) determining binding characteristics of said sample ligand, relative to said control ligand.

32. The method of claim 31 wherein said toxin is a Cry1A toxin.

33. A method for screening for toxins that bind Bt toxin receptor, said method comprising the steps of claim 31; further comprising determining viability of said cells contacted with a sample ligand relative to said cells contacted with a control ligand.

34. The method of claim 31, wherein said sample ligand is a chimeric polypeptide comprising at least one primary polypeptide that binds the polypeptide having the amino acid sequence according to any one of claims 7 to 10.

35. The method of claim 32, wherein said sample ligand is a chimeric polypeptide comprising at least one primary polypeptide that binds a polypeptide having the amino acid sequence according to any one of claims 7 to 10.

36. The method of claim 33, wherein said sample ligand is a chimeric polypeptide comprising at least one primary polypeptide that binds a polypeptide having the amino acid sequence according to any one of claims 7 to 10.