JP2003512291A - Galectin 11 - Google Patents

Abstract

  (57) [Summary] The present invention relates to novel galectin-11 proteins that are members of the galectin superfamily. In particular, an isolated nucleic acid molecule encoding a human galectin 11 protein is provided. Galectin-11 polypeptides are also provided, as well as vectors, host cells and recombinant methods for producing the same. The present invention further relates to screening methods for identifying agonists and antagonists of galectin 11 activity. Diagnostic and therapeutic methods are also provided.

Description

Detailed Description of the Invention

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to novel galectins. More specifically, an isolated nucleic acid molecule encoding human galectin-11 is provided. Galectin 1
1 polypeptides are also provided, as are vectors, host cells, recombinant methods of producing them, and antibodies to galectin 11 polypeptides. The invention further relates to screening methods for identifying agonists and antagonists of galectin-11 activity. Also provided are diagnostic and therapeutic methods for detecting cell proliferative disorders, including autoimmune diseases, cancers and inflammatory disorders.

RELATED ART Lectins are proteins that bind to specific carbohydrate structures and thus are able to recognize specific sugar conjugates. Barondes et al. Biol. Chem. 269
(33): 20807-20810 (1994). Galectins are members of a family of β-galactoside-binding lectins with related amino acid sequences (for a review, Barondes et al., Cell 76: 597-598 (1).
994); Barondes et al. Biol. Chem. 269 (33) 20
807-20810 (1994)). Many glycoproteins, including β-galactoside sugars, are produced by cells, but only some bind known galectins in vitro. Such apparent binding specificity suggests a highly specific functional role for galectins.

About galectin 1 (lectin, galactoside-bound soluble-1)
Called ALS1, it is also L-14-1, L-14, RL-14.5.
, Galaptin, MGBP, GBP, BHL, CHA, HBP, HPL, HLBP
14, also known as rIML-1) is a homodimer with a subunit of molecular weight 14,500 daltons. Galectin-1 is abundantly expressed in smooth and skeletal muscle and to a lesser extent in many other cell types (Couraud et al., J. Biol. Chem. 264: 131.
0-1316 (1989)). Galectin-1 is believed to specifically bind to laminin, a highly polylactosamined cellular glycoprotein, and a highly polylactosamined lysosomal binding membrane protein (LAMP).
Galectin 1 also lactosamine containing glycolipids found on neurons olfactory, and that specifically binds to integrin a ₇ b ₁ on skeletal muscle cells are shown.

Other members of the galectin family have also been reported. Galectin 2
Is a homodimer originally found in hepatocellular carcinoma and having a subunit of molecular weight 14,650 daltons (Gitt et al., J. Biol. Chem. 26).
7: 10601-10606 (1992)). Galectin 3 (ak, Ma
c-2, EPB, CBP-35, CBP-30 and L-29) are abundant in activated macrophages and epithelial cells, and 26,320-30,300.
A monomer with an apparent molecular weight between Daltons (Cherayil et al.,
Proc. Natl. Acad. Sci. USA 87: 7324-7326 (
1990)). Galectin-3 has been observed to bind specifically to laminin, immunoglobulin E and its receptor, and bacterial lipopolysaccharide. Galectin 4 has a molecular weight of 36,300 daltons and contains two carbohydrate binding domains within a single polypeptide chain (Oda et al., J. Biol.
Chem. 268: 5929-5939 (1993)). Galectins 5 and 6
Are discussed in Barondes et al., Cell 76: 597-598 (1994). Human galectin 7 has a molecular weight of 15,073 daltons and is found primarily in stratified squamous epithelium (Madsen et al., J. Biol. C).
hem. 270 (11): 5823-5829 (1995)).

Animal lectins generally function in the regulation of often cell-cell and cell-matrix interactions. Galectin-1 has been shown to either promote or inhibit cell adhesion depending on the cell type in which it is present. Galectin 1, probably laminin - by decay galectin 1 mediated integrin a ₇ b ₁ interaction, cells in skeletal muscle - inhibiting matrix interaction (Cooper et al., J.Cell.Biol.115: 1437~1448 (
1991)). In some non-skeletal muscle cell types, galectin-1 promotes cell-matrix adhesion, presumably by cross-linking the cell surface with substrate glycoconjugates (
Zhou et al., Arch. Bioch. Biophys. 300: 6-17 (19
93); Skrincosky et al., Cancer Res. 53: 2667-2
675 (1993)).

Galectin-1 also induces cell proliferation (Wells et al., Cell 64: 91-97).
(1991)) and some immune functions (Offner et al., J. Neuroi.
mmunol. 28: 177-184 (1990)). Galectin-1 induces tumor necrosis factor release from macrophages (Kajika)
wa et al., Life Sci. 39: 1177-1181 (1986)). Galectin 1 has also been demonstrated to have therapeutic activity against experimental myasthenia gravis and autoimmune disease in animal models of experimental autoimmune encephalomyelitis (Levi et al., Eur. J, respectively). Immunol. 13: 500-
507 (1983); and Offner et al., J. Am. Neuroimmunol.
28: 177-185 (1990)). Furthermore, galectin-1 has been shown to regulate the immune response by mediating T cell apoptosis (Pe.
rillo et al., Nature 378: 736-739 (1995)).

Galectin-3 promotes the growth of cells cultured under restricted culture conditions (Ya
ng et al., Proc. Natl. Acad. Sci. USA 93: 6737-6.
742 (June 1996)). Expression of galectin-3 in cells confers resistance to apoptosis, indicating that galectin-3 may be a cell death suppressor that interferes with the common pathway of apoptosis. Ibid. Galectin-3 has also been observed to function in the regulation of cell adhesion and in the activation of specific immune cells by cross-linking IgE and IgE receptors.

In recent years, a galectin-like antigen called HOM-HD-21 has been identified as a Hodgkin's disease cDNA.
Another galectin, found to be highly expressed in the library and designated PCTA-1, was identified as a specific cell surface marker on human prostate cancer cell lines and patient-derived carcinomas.

It has therefore been observed that galectins are involved in the regulation of immune cell activity and in diverse processes such as cell adhesion, proliferation, inflammation, autoimmunity, and tumor cell metastasis. Therefore, there is a need in the art for the identification of novel galectins that can act as useful tools in the development of therapeutics and diagnostics to regulate immune responses, inflammatory diseases and cancer.

SUMMARY OF THE INVENTION The present invention has the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2), ATCC Deposit No. 209053, deposited in a bacterial host on May 16, 1997. c
Provided is an isolated nucleic acid molecule comprising a polynucleotide encoding a galectin-11 polypeptide having an amino acid sequence encoded by a DNA clone, and fragments, variants and analogs thereof.

The present invention also relates to a recombinant vector containing the isolated nucleic acid molecule of the present invention, and a host cell containing this recombinant vector, as well as methods for making such vectors and host cells, and recombinant techniques. It relates to their use for the production of galectin 11 polypeptides.

The invention further provides isolated galectin-11 polypeptides having an amino acid sequence encoded by the polynucleotides described herein, and antibodies that bind these polypeptides.

The present invention also provides screening methods for identifying compounds that can enhance or inhibit the galectin-11-induced cellular response (eg, apoptosis). Generally, these methods involve contacting cells expressing the candidate compound, galectin-11, and galectin-11 ligand, assaying the cellular response produced by the binding of that ligand to galectin-11, and a standard (galectin-11 and A standard assayed when the contact with the galectin-11 ligand is made in the absence of the candidate compound), which results in an increased cellular response to the standard. The compound is shown to be an agonist, and a reduced cellular response to the standard indicates that the compound is an antagonist.

In another aspect, screening assays for agonists and antagonists are provided. This assay involves determining the effect a candidate compound has on galectin 11 binding to β-galactoside sugars. In detail,
This method involves contacting a β-galactoside sugar with a galectin-11 polypeptide and a candidate compound, and whether galectin-11 binding to the β-galactoside sugar is increased or decreased due to the presence of the candidate compound. The step of determining

The present invention also provides diagnostic methods useful during the diagnosis of disorders associated with elevated, diminished or otherwise abnormal expression of galectin-11.

The invention further provides a method for treating an individual in need of increasing the level of galectin-11 activity in the body, the method comprising a therapeutically effective amount of the isolated galectin of the invention. Administering to such an individual a composition comprising 11 polypeptides, fragments, variants, derivatives or analogs, or agonists thereof.

In another embodiment, the invention provides a method for treating an individual in need of reducing the level of galectin-11 activity in the body, the method comprising a therapeutically effective amount of the invention. Administering a composition comprising a galectin-11 fragment, variant, derivative, analog or antibody, or galectin-11 antagonist to such an individual.

(Detailed Description) The present invention is directed to galectin-1 having the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2).
An isolated nucleic acid molecule comprising a polynucleotide encoding one polypeptide is provided, the amino acid sequence of which was determined by sequencing the cloned cDNA. The nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1) is HJA
Obtained by sequencing the CE54 plasmid. This plasmid is 1
May 16, 997, American Type Culture Col
section, 12301 Park Lawn Drive, Rockvi
lle, deposited with Maryland 20852 and received accession number 209053. Galectin 11 polypeptides of the present invention share sequence homology with rat galectin 5, chicken trigger lectin 3, and human galectin 8 gene products (see, eg, Figure 2; SEQ ID NOs: 3-4).

The invention further provides fragments, variants, of Galectin-11 polynucleotides,
Derivatives and analogs, and polypeptides encoded thereby, and antibodies that bind to these polypeptides are provided.

Definitions The following definitions are provided to facilitate understanding of certain terms frequently used herein.

“Functional activity” or “biological activity” refers to polypeptides, fragments, derivatives, variants and analogs of galectin-11, which are functionally active. That is, they may display one or more functional activities associated with the intact galectin 11 polypeptide or the mature galectin 11 polypeptide. Such functional activities include, but are not limited to, biological activities such as the ability to bind β-galactoside sugars, the ability to aggregate trypsinized rabbit red blood cells and / or apoptosis. Ability to induce), antigenicity (ability to bind galectin 11 polypeptide, or ability to compete with galectin 11 polypeptide for binding to anti-galectin 11 antibody), immunogenicity (produce antibody that binds galectin 11 polypeptide) The ability to form dimers with the galectin-11 polypeptides of the present invention, and the ability to bind to other galectins and / or galectin-11 receptors or galectin-11 ligands. Polynucleotides encoding polypeptides having a functional or biological activity of galectin 11 as well as the complementary strands of these polynucleotides are also encompassed by the present invention.

“Polynucleotide” generally refers to any polynucleotide or polydeoxyribonucleotide, whether unmodified RNA or DNA or modified RNA or DNA. Good. "Polynucleotides" include, but are not limited to, single-stranded DNA and double-stranded DNA, DNA that is a mixture of single-stranded and double-stranded regions, single-stranded RNA and double-stranded. RNA, as well as RNA, a mixture of single-stranded and double-stranded regions, a hybrid molecule comprising DNA and RNA, which may be single-stranded or, more typically, double-stranded. Or it may be a mixture of single-stranded and double-stranded regions). Furthermore, "polynucleotide" means RNA or DNA.
Alternatively, it refers to a triple-stranded region containing both RNA and DNA. The term polynucleotide also refers to DNA or RNA containing one or more modified bases, as well as DNA or RNA having a backbone modified for stability or for other reasons.
including. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. Various modifications have been made to DNA and RNA; thus, "polynucleotide" refers to chemically, enzymatically, or metabolically modified forms of a polynucleotide typically found in nature. , And the chemical forms of DNA and RNA that are characteristic of viruses and cells. "Polynucleotide" also embraces relatively short polynucleotides, often referred to as oligonucleotides.

“Polypeptide” refers to any peptide or protein comprising two or more amino acids linked together by a peptide bond or a modified peptide bond (ie, a peptide isostere). "Polypeptide" refers to both short chains (commonly referred to as peptides, oligopeptides or oligomers) and longer chains (commonly referred to as proteins). Polypeptides may contain amino acids other than the 20 gene-encoded amino acids. A "polypeptide" is a natural process (
For example, post-translational processing) or an amino acid sequence modified by any of the chemical modification techniques well known in the art. Such modifications are well documented in basic textbooks and more detailed research articles, as well as in the vast body of research literature. Modifications can occur anywhere in the polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxy termini. It is understood that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Polypeptides can be branched as a result of ubiquitination and can be cyclic with or without branching. The cyclic branched polypeptide and the branched cyclic polypeptide are
It may result from a post-translational natural process or it may be made by synthetic means.
Modifications include: acetylation, acylation, ADP-ribosylation, amidation, flavin covalent bond, heme moiety covalent bond, nucleotide or nucleotide derivative covalent bond, lipid or lipid derivative covalent bond, Covalent bond, cross-linking, cyclization, disulfide bond formation, demethylation, covalent cross-link formation of phosphatidyl inositol, cysteine formation, pyroglutamate formation, formylation, γ-carboxylation, glycosylation, GP
I anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, seronylation, sulfation, transfer RNA-mediated amino acid addition to proteins (eg, Arginylation),
And ubiquitination (for example, PROTEINS-STRUCTURE AND
MOLECULAR PROPERIES, 2nd Edition, T.M. E. Creight
ton, W.W. H. Freeman and Company, New York
1993, and Wold, F .; , Posttranslational
Protein Modifications: Perspectives a
nd Prospects, pages 1-12, POSTTRANSLATIONAL
COVALENT MODIFICATION OF PROTEINS, B
． C. Edited by Johnson, Academic Press, New York,
1983; Seifter et al., "Analysis for protein".
modifications and nonprotein cofacto
rs ", Meth Enzymol (1990) 182: 626-646 and Rattan et al.," Protein Synthesis: Posttrans.
"national modifications and aging", An
n NY Acad Sci (1992) 663: 48-62).

A “variant”, as the term is used herein, is a polynucleotide that differs from a reference polynucleotide or polypeptide, respectively, but retains the functional or biological activity of galectin-11. Or it is a polypeptide. A typical variant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide. Changes in the nucleotide sequence of the variant may or may not change the amino acid sequence of the polypeptide encoded by the reference polynucleotide. Nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as described below. A typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide. Generally, the difference is that the sequences of the reference polypeptide and its variants are
Closely similar throughout and restricted to be identical in many areas.
Variant and reference polypeptides may differ in amino acid sequence by one or more substitutions, additions, deletions in any combination. A substituted or inserted amino acid residue may or may not be one encoded by the genetic code. A variant of a polynucleotide or variant of a polypeptide may be naturally occurring, such as an allelic variant, or may be a variant not known to occur naturally. Non-naturally occurring variants of polynucleotides and polypeptides can be made by mutagenesis techniques or direct synthesis.

As used herein, “antibody” includes polyclonal and monoclonal antibodies, chimeric antibodies, single chain antibodies, and humanized antibodies, and Fab fragments. Fab fragments include products of the Fab expression library or other immunoglobulin expression libraries.

Nucleic Acid Molecules Unless otherwise indicated, all nucleotide sequences determined by sequencing a DNA molecule herein may be labeled with an automated DNA sequencer (eg, Ap.
plied Biosystems, Inc. 373), and all amino acid sequences of the polypeptides encoded by the DNA molecules determined herein are deduced by translation of the DNA sequences determined as described above. It was Thus, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. The nucleotide sequence determined by automation is typically at least about 90% identical, more typically at least about 95% identical to the actual nucleotide sequence of the DNA molecule being sequenced.
To at least about 99.9% identical. The actual sequence can be more accurately determined by other approaches, including manual DNA sequencing methods well known in the art. As is also known in the art, a single insertion or deletion in the determined nucleotide sequence, as compared to the actual sequence, causes a frameshift in the translation of the nucleotide sequence, so that the determined nucleotide sequence The deduced amino acid sequence encoded is completely different from the amino acid sequence actually encoded by the DNA molecule being sequenced. Such differences begin at such insertions or deletions.

Using the information provided herein, eg, the nucleotide sequences in FIG. 1, nucleic acid molecules of the present invention that encode galectin-11 polypeptides may be labeled using standard cloning and screening procedures (eg, starting materials). Procedure for cloning cDNA using mRNA as a). As an illustration of the present invention, the nucleic acid molecule depicted in Figure 1 (SEQ ID NO: 1) is a G1 phase Jurkat T
Found in a cell-derived cDNA library. This gene is also identified in a cDNA library generated from human neutrophils and human fetal adrenal glands.
The polynucleotides of the invention can also be obtained from natural sources such as mRNA or genomic DNA using techniques known in the art, or can be chemically synthesized using techniques known in the art. .

The human galectin 11 gene is located on chromosome 11 and contains 5 exons (see, eg, FIG. 4). The nucleotide sequence of the Galectin 11 cDNA in FIG. 1 (SEQ ID NO: 1) is 865 nucleotides long (830 nucleotides minus the poly A tail of the cDNA) and has an open reading frame encoding a protein of 133 amino acid residues. There is a putative initiation codon (located in the second exon of this gene) at nucleotides 49-51 of the nucleotide sequence shown in Figure 1 (SEQ ID NO: 1). Galectin 11 shown in FIG.
The protein (SEQ ID NO: 2) shares homology with the translation products of rat galectin 5, chicken trigger lectin 3, and human galectin 8 (see, eg, FIG. 2). Furthermore, as discussed further below, galectin-11 induces apoptosis of transfected T cells (eg, Example 5 and FIG. 5).
See A and 5B). These findings indicate that galectin-11 functions in a similar manner to other previously characterized galectins, and thus galectin-11 is important in the regulation of cell proliferative disorders, autoimmune diseases, cancer and inflammatory diseases. Is shown.

As will be appreciated by those in the art, the putative galectin 11 polypeptide encoded by the deposited cDNA is about Contains 133 amino acid residues,
It can range anywhere from 125 to 150 amino acids.

As shown, the nucleic acid molecule of the invention is in the form of RNA (eg, mRNA),
Or it may be in the form of DNA, including, for example, cDNA and genomic DNA, obtained by cloning or produced synthetically. This DNA can be double-stranded or single-stranded. Single-stranded DNA or RNA can be the coding strand, also known as the sense strand, or it can be the non-coding strand, also referred to as the complementary or antisense strand.

By “isolated” nucleic acid molecule is intended a nucleic acid molecule, DNA or RNA, that has been removed from its native environment. For example, recombinant DN contained in a vector
The A molecule is considered isolated for the purposes of this invention. Further examples of isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or purified (partially or substantially) DNA molecules in solution. The isolated RNA molecule can be used as an in vivo or in vitro R
Includes NA transcripts. Isolated nucleic acid molecules according to the present invention further include such molecules as produced synthetically. In a particular embodiment, an "isolated" nucleic acid molecule of the present invention comprises all or part of the coding region of galectin 11 shown in Figure 1 (SEQ ID NO: 1). In a further embodiment, the isolated nucleic acid molecule of the invention is a polynucleotide encoding the entire coding region of a gene flanking galectin 11 on chromosome 11, or a portion thereof, or flanking chromosome 11. Any part of the gene or 1, 2, 3, 4, 5, 10, 20, 25 or 50
Not related to individuals (eg, not linked).

The isolated nucleic acid molecules of the present invention include: a DNA molecule comprising an open reading frame (ORF) (SEQ ID NO: 1) or portion of the ORF shown in FIG. 1; and a reduction in the genetic code. Due to their weight, further mention is made of DNA molecules which code for galectin 11 protein, but which contain sequences which are substantially different from those mentioned above. Of course, the genetic code is well known in the art. Therefore, it is routine for those skilled in the art to generate such degenerate variants.

In a particular embodiment, the invention provides an isolated nucleic acid molecule encoding the full-length galectin 11 polypeptide (SEQ ID NO: 2) shown in FIG. 1, and 1997.
Provided is a galectin 11 nucleic acid molecule encoding a galectin 11 polypeptide sequence encoded by the cDNA clone contained in the plasmid deposited on May 16, 2013 under ATCC Deposit No. 209053. In a further embodiment, a nucleic acid molecule encoding a full-length galectin 11 polypeptide lacking the N-terminal methionine is provided. The present invention further comprises an isolated nucleic acid molecule having the nucleotide sequence shown in Figure 1 (SEQ ID NO: 1), or an isolated nucleic acid molecule having the nucleotide sequence of galectin 11 cDNA contained in the above deposited clone, or A nucleic acid molecule having a sequence complementary to one of the sequences of Such an isolated molecule (particularly a DNA molecule) is a probe for gene mapping by in situ hybridization with a chromosome, and a probe for detecting expression of galectin 11 gene in human tissue by, for example, Northern blot analysis. Have uses including but not limited to.

The invention further relates to fragments of the isolated nucleic acid molecules described herein. A fragment of an isolated nucleic acid molecule having the nucleotide sequence of the deposited cDNA clone, the nucleotide sequence shown in Figure 1 (SEQ ID NO: 1), or the complementary strand thereto, is at least about 15 nt long, and more preferably Is intended to be at least about 20 nt long, even more preferably at least about 30 nt long, and even more preferably at least about 40 nt long. A fragment of at least 20 nt is intended to mean, for example, a fragment containing 20 or more consecutive bases from the deposited cDNA or the nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1) or the nucleotide sequence of a strand complementary thereto. To do. Sequence shown in Figure 1 (SEQ ID NO: 1) strand complementary to it, or 50, 100, 150, 200, 250, 300 of the sequence contained in the deposited clone
, 350, 365, 370, 375, 380, 400, 450, 500, 550
, 600, 650, 700, 750, 800, 850 contiguous nucleotide fragments are also encompassed by the present invention. The invention also includes fragments of the nucleotide sequence of the deposited cDNA or the nucleotide sequence shown in Figure 1 (SEQ ID NO: 1), or most (if not all) of the complementary strands thereof. In a further embodiment, the polynucleotide fragment of the invention comprises amino acids 1-1 of the amino acid sequence shown in Figure 1 (SEQ ID NO: 2).
4, 1-20, 1-40, 1-66, 2-67, 3-8, 3-67, 5-108
, 5 to 128, 10 to 17, 10 to 20, 12 to 16, 13 to 20, 13 to 68
, 14-67, 23-40, 20-50, 40-108, 41-60, 47-6.
1, 47 to 108, 47 to 128, 50 to 100, 61 to 80, 65 to 108,
65-128, 66-108, 76-88, 81-100, 88-108, 88
~ 128, 95-101, 101-133, 108-120, 114-128 and / or 114-128. In a preferred embodiment, the polynucleotide fragment of the present invention encodes a polypeptide exhibiting the functional activity of galectin-11. The fragments of the present invention have numerous uses, including but not limited to the diagnostic probes and primers discussed herein.

Preferred nucleic acid fragments of the invention include nucleic acid molecules that encode the epitope-bearing portion of the galectin 11 protein. In particular, such nucleic acid fragments of the invention include nucleic acid molecules that encode: a polypeptide comprising about 65-70 and 118-124 amino acid residues in Figure 1 (SEQ ID NO: 2). The inventors have determined that the above polypeptide fragment is the antigenic region of the galectin 11 protein. Methods for determining other such epitope-bearing portions of the Galectin 11 protein are described in detail below.

In another embodiment, the invention provides for all or a portion (including fragments) of a polynucleotide described herein under stringent hybridization conditions, eg, FIG. 1 (SEQ ID NO: 1). ), The complementary strand of the DNA sequence shown in
Provided is an isolated nucleic acid molecule comprising a polynucleotide that hybridizes to the cDNA clone contained in ATCC Accession No. 209053 of May 16, 1997, or a fragment thereof. “Stringent hybridization conditions” are 50% formamide, 5 × SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 × De.
nhardt's solution, 10% dextran sulfate, and 20 μg / ml denatured sheared salmon sperm DNA in a solution at 42 ° C. overnight incubation, followed by 0
． This means washing the filter in 1 × SSC at 65 ° C.

A polynucleotide that hybridizes to a portion of a polynucleotide is at least about 15 nucleotides (nt) of the reference polynucleotide, and more preferably at least about 20, even more preferably at least about 30, 50, 60, 7
5, 100, 150, 175, 200, 250, 300, 350 nt, preferably about 30-70 nt or 80-150 nucleotides, or a full-length hybridizing polynucleotide (either DNA or RNA).
For example, a portion of a polynucleotide that is at least "20 nt long" means 20 or more contiguous nucleotides from the nucleotide sequence of the reference polynucleotide (eg, the deposited cDNA or the nucleotide sequence shown in Figure 1 (SEQ ID NO: 1). In certain embodiments, the polynucleotide is nucleotides 0-20, 0-25, 0-30, 0 of the nucleotide sequence disclosed in Figure 1 (SEQ ID NO: 1).
-50, 51-100, 80-100, 101-200, 201-300, 30
1-400, 401-450, 451-500, 501-550, 551-60
0, 601-700, 701-750, 751-780, and / or 780
Hybridizes to ~ 820. In another particular embodiment, the polynucleotide comprises amino acid residues 1-14 of the amino acid sequence shown in Figure 1 (SEQ ID NO: 2).
, 10-20, 20-50, 50-100, 100-133. These polynucleotides have uses including, but not limited to, the diagnostic probes and primers described above and in more detail below.

Of course, the poly A sequence (eg Galectin 11 shown in FIG. 1 (SEQ ID NO: 1)
Polynucleotides that hybridize only to the 3'terminal poly (A) tract of the cDNA) or to a complementary stretch of T (or U) residues are used to hybridize to a portion of the nucleic acids of the invention. Not included in the polynucleotide.
Because such a polynucleotide hybridizes to any nucleic acid molecule that comprises the poly (A) stretch or its complementary strand (eg, virtually any double-stranded cDNA clone generated using an oligo dT primer). Because it soybeans.

As shown, the nucleic acid molecule of the present invention encoding a galectin-11 polypeptide is that which itself encodes the amino acid sequence of the polypeptide; the coding sequence of the polypeptide and additional sequences (eg, amino acid leader). Or that encodes a secretory sequence (eg, pre-, or pro, or pre-pro protein sequence); additional non-coding sequences (eg, introns and non-coding 5 ′ and 3 ′ sequences (eg, includes transcription, mRNA processing (splicing)) )
And a polyadenylation signal, such as, but not limited to, transcribed non-translated sequences that play a role in ribosome binding and mRNA stability), with or without the additional coding sequences described above. Coding sequences for; additional amino acids (eg, those that provide additional functionality)
Can include, but is not limited to, additional coding sequences that encode Thus, the polypeptide coding sequence can be fused to a marker sequence (eg, a peptide coding sequence that facilitates purification of the fused polypeptide). In certain preferred embodiments of this aspect of the invention, the marker amino acid sequence is a hexahistidine peptide (eg, among others, pQE vector (Qage).
n, Inc. A) tag provided in), and most of them are commercially available. For example, Gentz et al., Proc. Natl. Acad. Sci. U
Hexahistidine provides convenient purification of fusion proteins, as described in SA 86: 821-824 (1989). The "HA" tag is Wilson
Et al., Cell 37: 767-778 (1984), another peptide useful for purification corresponding to an epitope derived from the influenza hemagglutinin protein. As discussed below, other such fusion proteins include Galectin 11 fused to Fc at the N or C terminus.

The present invention further relates to variants of the nucleic acid molecules of the present invention that encode a portion (ie, fragment), analog, or derivative of the galectin-11 protein.
Variants can occur naturally (eg, naturally occurring allelic variants). By "allelic variant" is intended one of several alternative forms of a gene that occupy a given locus on the chromosome of an organism. Genes II, Lewin, B.M. Edited by Joh
n Wiley & Sons, New York (1985). Non-naturally occurring variants can be produced using mutagenesis techniques known in the art.

Such variants include variants produced by nucleotide substitutions, deletions, or additions that can include one or more nucleotides. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 1 of the polypeptide of the present invention
5, 20, 25, 30, 35, 40, 50, or 20-15, 15-10, 1
A modified form in which nucleotide sequences encoding 0 to 5, 1 to 5, 1 to 3, or 1 to 2 amino acids are substituted, deleted or added in any combination is particularly preferable. Variants can be altered in coding regions, non-coding regions, or both. Changes in the coding region may produce conservative or non-conservative amino acid substitutions, deletions, additions. Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activity of the galectin 11 protein or part thereof. Conservative substitutions are also particularly preferred in this regard.

A further embodiment of the present invention comprises at least 75%, 8
0%, 85%, or 90% identical, and more preferably at least 95%,
Included is an isolated nucleic acid molecule, including a polynucleotide having a nucleotide sequence that is 96%, 97%, 98%, or 99%, or 98-99% identical: (a) amino acids 1 to 2 of SEQ ID NO: 2. Nucleotides encoding 133; (b) nucleotides encoding amino acids 2-133 of SEQ ID NO: 2; (c) nucleotide sequence of galectin 11 polypeptide encoded by the cDNA contained in ATCC Deposit No. 209053; or (d) Fragments and other polynucleotide sequences of the invention, as described herein.

A polynucleotide having a nucleotide sequence that is at least, for example, 95% “identical” to a reference nucleotide sequence that encodes a galectin-11 polypeptide, causes the nucleotide sequence of that polynucleotide to 100 of each of the reference nucleotide sequences encoding the Galectin 11 polypeptide.
It is intended to be identical to the reference sequence, except that it may contain up to 5 nucleotide mismatches per nucleotide. That is, to obtain a polynucleotide having a nucleotide sequence that is at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides of the reference sequence may be deleted or replaced with another nucleotide, or the entire reference sequence may be replaced. Up to 5% of the nucleotides can be inserted in the reference sequence. These variations in the reference sequence may occur at the 5'or 3'terminal positions of the reference nucleotide sequence, or anywhere between those terminal positions (either individually between the nucleotides of the reference sequence or within the reference sequence). In any of one or more consecutive groups).

In practice, any particular nucleic acid molecule may be present in at least 75% of the nucleotide sequence, eg, in the nucleotide sequence shown in FIG. 1 or in the deposited cDNA clone.
, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity is determined by the Bestfit program (Wisconsin Seque).
ence Analysis Package, version 8, compatible with Unix,
Genetics Computer Group, University R
esarch Park, 575 Science Drive, Madis
on, WI 53711) and can be conventionally determined using known computer programs. Bestfit has found that in finding the best homology segment between two sequences, Smith and Waterman (Advan
ces in Applied Mathematics 2: 482-489.
(1981)) local homology algorithm. The specific sequence is
To determine whether it is, for example, 95% identical to a reference sequence according to the invention,
When using Bestfit or any other sequence alignment program,
The parameters are of course set such that the percentage of identity is calculated over the entire length of the reference nucleotide sequence and a homology gap of up to 5% of the total number of nucleotides of the reference sequence is allowed.

In a particular embodiment, the identity between the reference (query) sequence (the sequence of the invention) and the subject sequence is also referred to as the overall sequence alignment, which is B
rutlag et al. (Comp. App. Biosci. 6: 237-245 (19.
90)) algorithm based on the FASTDB computer program. FASTDB of DNA sequences to calculate percent identity
The preferred parameters used for the alignment are: Matrix =
Unity, k-tuple = 4, Mismatch Penalty = 1
, Joining Penalty = 30, Randomization Gr
up Length = 0, Cutoff Score = 1, Gap Pena
lty = 5, Gap Size Penalty 0.05, Windows S
size = 500 or the length of the nucleotide sequence of interest (whichever is shorter). According to this embodiment, if the subject sequence is shorter than the query sequence due to a 5'or 3'deletion rather than an internal deletion, the FASTDB program will calculate the percent identity of 5 of the subject sequence when calculating percent identity. Taking into account that the'and 3'shortenings are not accounted for, the results are manually corrected. For sequences of interest that are truncated at the 5'or 3'end (as compared to the query sequence), the percent identity is 5'and 3'of the sequence of interest.
And is corrected by calculating the number of bases in the query sequence that do not match / align as a percentage of the total bases in the query sequence. The determination of whether nucleotides are matched / aligned is determined by the results of the FASTDB sequence alignment.
This percentage is then taken as the FAST above using the specified parameters.
Subtract from the percent identity calculated by the DB program to arrive at the final percent identity score. This corrected score is what is used for the purposes of this embodiment. As indicated by the FASTDB alignment, only bases outside the 5'and 3'bases of the subject sequence that do not match / align with the query sequence are calculated for the purpose of manually adjusting the percent identity score. For example, a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity. The deletion occurs at the 5'end of the subject sequence, so the FASTDB alignment does not show a match / alignment of the first 10 residues at the 5'end. The 10 unpaired bases represent 10% of the sequence (number of unmatched 5'and 3'terminal bases per total number of bases in the query sequence), so the percent identity score calculated by the FASTDB program. Subtract 10% from 90 remaining
If the bases were an exact match, the final percent identity would be 90%. In another example, a 90 base subject sequence is compared to a 100 base query sequence. This time the deletion is an internal deletion in which there are no bases on the 5'or 3'of the subject sequence that are not matched / aligned with the query. In this case, the percent identity calculated by FASTDB is not manually corrected. Again, only the 5'or 3'of the subject sequence that are not matched / aligned with the query sequence are manually corrected. No other manual corrections are made for this embodiment.

The present application is based on the nucleic acid sequence shown in FIG. 1 (SEQ ID NO: 1), the nucleic acid sequence of the deposited cDNA clone and fragments thereof, at least 75%, 8
0%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical nucleic acid molecules, whether they encode polypeptides having a galectin-11 functional activity I don't care. This is because, even if a particular nucleic acid molecule does not encode a polypeptide having a galectin-11 functional activity, one skilled in the art would
This is because we understand how to use nucleic acid molecules as, for example, hybridization probes or polymerase chain reaction (PCR) primers.
The use of the nucleic acid molecule of the present invention that does not encode a polypeptide having a functional activity of galectin-11 includes, inter alia: (1) a single copy of the galectin-11 gene or its allelic variants in a cDNA library. Separation; (2) In situ hybridization (eg FISH) to metaphase chromosome spreads to provide the correct chromosomal location of the galectin 11 gene (Verma).
Et al., Human Chromosomes: A Manual of Basi.
c Technologies, Pergamon Press, New York
(1988)); (3) used as a marker for chromosome 11 in linkage analysis; and (4) Northern blot analysis to detect galectin 11 mRNA expression in specific tissues.

However, the nucleic acid sequence shown in FIG. 1 (SEQ ID NO: 1), the nucleic acid sequence of the deposited cDNA clone, the nucleic acid encoding the polypeptide shown in FIG. 1 (SEQ ID NO: 2),
And their fragments, at least 75%, 80%, 85%, 9
Nucleic acid molecules having sequences that are 0%, 95%, 96%, 97%, 98%, or 99% identical are preferred, which in fact encode polypeptides having a galectin-11 functional activity. A galectin-11 functionally active polypeptide is a polypeptide that exhibits an activity (not necessarily the same) as that of the galectin-11 protein of the present invention when measured in a particular assay. Intended for petite. For example, galectin 11 protein activity is determined by β-galactosidase sugar (eg, thiodigalactoside or lactose) binding assays, assays for apoptosis, and / or agglutination of trypsinized rabbit red blood cells, as described further below. Can be measured using an assay for

Of course, due to the degeneracy of the genetic code, those skilled in the art will appreciate that the nucleic acid sequence of the deposited cDNA, the nucleic acid sequence shown in FIG. 1 (SEQ ID NO: 1), the polypeptide shown in FIG. Many having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleic acid encoding number 2), or fragments thereof. Immediately recognizes that the nucleic acid molecule of "encodes a polypeptide having a functional activity of galectin-11". In fact, many degenerate variants of these nucleotide sequences encode the same polypeptide, and this will be apparent to those skilled in the art, even without the comparison assay described above. For nucleic acid molecules that are not degenerate variants, a considerable number of them are also galectin-1.
It is further recognized in the art to encode a polypeptide having one activity. This is because one of ordinary skill in the art would appreciate that amino acid substitutions that are either less likely to significantly affect protein function or less likely to significantly affect protein function (e.g. Substitution with an aliphatic amino acid) is fully recognized.

For example, for guidance on how to make phenotypically silent amino acid substitutions, see Bowie et al., Deciphering the Message in.
Protein Sequence: Tolerance to Amino
Acid Substitutions, Science 247: 1306-
1310 (1990), where the authors show that the protein is surprisingly tolerant of amino acid substitutions.

Vectors and Host Cells The present invention also relates to vectors containing the isolated DNA molecules of the present invention, host cells genetically engineered with the polynucleotides and / or recombinant vectors of the present invention, and Galectin 11 poly. Peptides and their fragments, variants, derivatives,
And its analogs by recombinant techniques.

The polynucleotide may be linked to a vector containing a selectable marker for growth in the host. Generally, the plasmid vector is introduced into a precipitate, such as a calcium phosphate precipitate, or in complex with a charged lipid. If the vector is a virus, the vector can be packaged in vitro using a suitable packaging cell line and then transduced into host cells.

In one embodiment, the DNA of the invention comprises a suitable heterologous regulatory element (eg, promoter or enhancer) (eg, the phage λPL promoter, E. coli lac promoter, trp promoter, and to name a few). The tac promoter, SV40 early and late promoters, and the promoter of the retroviral LTR). Other suitable promoters and enhancers are known to those of skill in the art.

In embodiments in which the vector comprises expression constructs, these constructs further comprise:
It contains a site for transcription initiation and termination, and a ribosome binding site for translation in the transcribed region. The coding portion of the transcript expressed by the construct preferably contains a translation start at the beginning of the polypeptide to be translated and a stop codon (UAA, UGA, or UAG) appropriately located at the end.

As indicated, the expression vector preferably contains at least one selectable marker. Such markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, and E. coli. For culture in E. coli and other bacteria, the tetracycline resistance gene or the ampicillin resistance gene may be mentioned. Representative examples of suitable hosts include bacterial cells (eg E. c.
oli cells, Streptococcus staphylococci cells,
Bacillus subtilis cells, Streptomyces cells, and Salmonella typhimurium cells); fungal cells (eg yeast cells); insect cells (eg Drosophila S2 cells and Spo
doptera Sf9 cells); animal cells (eg, CHO cells, COS cells,
HeLa cells, C127 cells, 3T3 cells, BHK cells, HEK293 cells, and Bowes melanoma cells); and plant cells, but are not limited thereto. Appropriate culture media and culture conditions for the above-described host cells are known in the art.

Selection of the appropriate vector and promoter for expression in the host cell is as follows:
Techniques well known and necessary for the construction of expression vectors, introduction of vectors into host cells, expression in host cells are conventional in the art.
A great variety of expression vectors can be used to express the galectin-11 polypeptides and fragments, variants, derivatives, and analogs of the invention. Examples of such a vector include a chromosomal vector, an episomal vector, and a virus-derived vector (for example, a bacterial plasmid-derived vector, a bacteriophage-derived vector, a yeast episome-derived vector, a yeast chromosomal element vector, a virus-derived vector (for example, baculovirus, papovavirus). (Eg, SV40), vaccinia virus, adenovirus, fowlpox virus, pseudorabies virus, and retrovirus), and vectors derived from combinations thereof (eg, plasmids and bacteriophage genetic elements (
For example, vectors derived from cosmids and phagemids), all of which can be used for expression according to this aspect of the invention. In general, any vector suitable to maintain, propagate or express polynucleotides to express the polypeptide in a host may be used. Suitable nucleotide sequences can be found in any of a variety of known techniques (eg Ausubel et al. Eds., 1989, Cu.
current Protocols in Molecular Biology
, Green Publishing Associates, Inc. And John Wiley & Sons, Inc. , New York), and can be inserted into an expression vector system.

Among the preferred vectors for use in bacteria are pQE70, pQE60, and pQE-9 (available from Qiagen); pBS vector, Phases
script vector, Bluescript vector, pNH8A, pNH16
a, pNH18A, pNH46A (available from Stratagene); and ptrc99a, pKK223-3, pKK233-3, pDR540, p.
RIT5 (available from Pharmacia) is included. Among the preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG (available from Stratagene); and pSVK3, pBP.
V, pMSG, and pSVL (available from Pharmacia).
Other suitable vectors will be readily apparent to those of skill in the art.

The present invention also relates to host cells containing the vector constructs discussed herein, and further, using techniques known in the art, one or more heterologous regulatory regions (eg, promoter and / or Or an enhancer) and a host cell comprising the nucleotide sequence of the invention operably linked thereto. As discussed above, the host cell can be a higher eukaryotic cell (eg, a mammalian cell (eg, a human-derived cell)), or a lower eukaryotic cell (eg, a yeast cell), or the host The cell can be a prokaryotic cell (eg, a bacterial cell). A host strain may be chosen which modulates the expression of the inserted gene sequences, or modifies and processes the gene product in the specific fashion desired. Expression from a particular promoter can be increased in the presence of a particular inducer; thus, expression of a genetically engineered polypeptide can be controlled. Moreover, different host cells have characteristic and specific mechanisms for the translational and post-translational processing and modification of proteins (eg, glycosylation, phosphorylation, cleavage). Appropriate cell lines can be chosen to ensure the desired modification and processing of the foreign protein expressed.

For secretion of the translated protein into the lumen of the endoplasmic reticulum, the periplasmic space, or the extracellular environment, appropriate secretion signals are provided within the desired polypeptide using techniques known in the art. Can be incorporated into. These signals can be endogenous to the polypeptide or they can be heterologous signals.

Introduction of the construct into the host cell may be carried out by calcium phosphate transfection, DE
It can be provided by AE-dextran mediated transfection, cationic lipid mediated transfection, electroporation, transduction, infection or other methods. Such methods are described by Davis et al., Basic Method.
s In Molecular Biology (1986) and in many standard laboratory manuals.

Polypeptides can be expressed in modified forms, such as fusion proteins, including polypeptides linked via peptide bonds to heterologous protein sequences (of different proteins), and not only secretion signals , May also include additional heterologous functional regions. For example, a region of additional amino acids, particularly charged amino acids, may be added to the N-terminus of a polypeptide to improve stability and persistence in host cells during purification or during subsequent manipulation and storage. Can be added to. Also, peptide moieties can be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide. In particular, the addition of peptide moieties to polypeptides to produce secretion or excretion, to improve stability, and to facilitate purification is well known in the art and is conventional in the art. is there. Alternatively, such fusion proteins can be made by protein synthesis techniques, such as by using a peptide synthesizer.

A preferred fusion protein comprises a heterologous region from immunoglobulin that is useful for protein solubilization. For example, EP-A-O 464 533 (Canada application 2
045869) discloses fusion proteins comprising various parts of the constant region of immunoglobulin molecules together with another human protein or part thereof. In many cases, the Fc part in the fusion protein is sufficiently advantageous for use in therapy and diagnosis, thus resulting, for example, in improved pharmacokinetic properties (EP-A 0232).
262). On the other hand, for some uses it is desirable that the Fc portion can be deleted after the fusion protein has been expressed, detected and purified in the advantageous manner described. This is where the Fc part proves to be a hindrance to use in therapy and diagnosis (eg when the fusion protein should be used as an antigen for immunization). In drug discovery, for example, human proteins such as hIL5- are fused to the Fc portion for the purpose of high throughput screening assays to identify antagonists of hIL-5. Bennett et al. M
d. Recog. 8: 52-58 (1995), and Johnson et al., J.
． Biol. Chem. 270 (16): 9459-9471 (1995).

Galectin-11 protein can be precipitated by ammonium sulfate or ethanol, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, and lectin chromatography. Recombinant cell cultures can be harvested and purified by well known methods including chromatography. Most preferably, high performance liquid chromatography ("HPLC") is used for purification.

Polypeptides of the invention include naturally occurring purified products, products of chemical synthetic procedures, and prokaryotic or eukaryotic hosts (eg, bacterial cells, yeast cells, plant cells, insect cells, teleost cells, (Including avian cells and mammalian cells) by recombinant techniques. Depending on the host used in the recombinant production procedure,
The polypeptides of the present invention may be glycosylated or non-glycosylated. In addition, the polypeptides of the present invention may also, in some cases, contain modified starting methionine residues or lose starting methionine residues as a result of host-mediated processes.

Galectin 11 Polypeptides and Fragments The present invention further provides an isolated galectin 11 polypeptide having: the amino acid sequence encoded by the deposited cDNA sequence, the amino acid sequence shown in FIG. (Amino acid residues 1 to 133 of SEQ ID NO: 2), the amino acid sequence shown in FIG. 1 below the amino terminal methionine (amino acid residues 2 to 13 of SEQ ID NO: 2)
3) hybridizes under stringent hybridization conditions to a polynucleotide sequence encoding a polypeptide having the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2) and / or the amino acid sequence contained in the deposited clone. Polypeptides encoded by the polynucleotides, and fragments, variants, derivatives and analogs of these polypeptides.

The polypeptides of the present invention are preferably provided in isolated form. By "isolated polypeptide" is intended a polypeptide removed from its native environment. Thus, a polypeptide produced and / or contained in a recombinant host cell is considered isolated for the purposes of this invention. Polypeptides that have been partially or substantially purified from recombinant host cells are also contemplated as "isolated polypeptides." For example, recombinantly produced versions of Galectin 11 polypeptides are described by Smith and Johnson, Gene.
67: 31-40 (1988).

It is recognized in the art that some amino acid sequences of galectin-11 polypeptides can be altered without significant effect on the structure or function of this protein. When such differences in sequence are intended, it should be remembered that there are important regions on the protein that determine activity.

Accordingly, the present invention further provides variations of galectin-11 polypeptides that exhibit substantial galectin-11 polypeptide functional activity or include regions of the galectin-11 protein (eg, protein moieties discussed below). including.
Such variants include deletions, insertions, interventions, repeats, and type substitutions.

As noted above, guidance on which amino acid changes appear to be phenotypically silent is given by Bowie et al., Deciphering the Message.
in Protein Sequences: Tolerance to A
mino Acid Substitutions, Science 247:
1306-1310 (1990). Therefore, the fragment, variant, derivative or analog of the polypeptide of FIG. 1 (SEQ ID NO: 2) or the fragment, variant, derivative or analog of the polypeptide encoded by the deposited cDNA is (i) at least one or more. Of amino acid residues are replaced by conservative or non-conservative amino acid residues, preferably conservative amino acid residues, and more preferably at least one but less than 10 conservative amino acid residues, and Such a substituted amino acid residue may or may not be an amino acid residue encoded by the genetic code, or (ii)
One or more amino acid residues containing a substituent, or (iii) a mature polypeptide fused to another compound, such as a compound that increases the half-life of this polypeptide (eg, polyethylene glycol), Alternatively (iv) an additional amino acid is fused to a mature polypeptide (eg, an IgG Fc fusion region peptide or leader or secretory sequence or a sequence or proprotein sequence used to purify the mature polypeptide). Such fragments, variants, derivatives and analogs are considered to be within the skill of those in the art given the teachings herein.

Substitution of one or more charged amino acids with other charged amino acids and neutral or negatively charged amino acids is of particular interest. The latter results in proteins with a reduced positive charge, improving the characteristics of galectin 11 protein. Prevention of agglomeration is highly desirable. Protein aggregation not only results in loss of activity, but can also be a problem when preparing pharmaceutical formulations. Because they are
Because it may be immunogenic (Pinckard et al., Clin. Exp. Im.
munol. 2: 331-340 (1967); Robbins et al., Diabe.
tes 36: 838-845 (1987); Cleland et al., Crit. R
ev. Therapeutic Drug Carrier Systems
10: 307-377 (1993)).

As indicated, changes of insignificant properties are preferred (eg, conservative amino acid substitutions that do not significantly affect protein folding or activity) (see Table 1).

[0071]

[Table 1] In certain embodiments, the number of addition, substitution and / or deletion in the amino acid sequence of Figure 1 (SEQ ID NO: 2) and / or any of the polypeptide fragments described herein is 50, 40, 35, 30, 25, 20, 15, 1
4, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1, or 15 to 20, 15 to 10, 5 to 10, 1 to 5, 1 to 3, Or 1-2.

A galectin-11 polypeptide, fragment of the invention, which is essential for function,
Amino acid residues in variants, derivatives, or analogs can be prepared by methods known in the art (eg, site-directed mutagenesis or alanine scan mutagenesis (alani).
ne-scanning mutagenesis) (Cunningham and Wells, Science 244: 1081-1085 (1989)). The latter procedure introduces one alanine mutation at each residue in the molecule. The resulting mutant molecule is then subjected to a biological or functional activity (eg, receptor binding, β-galactosidase (eg, thiodigalactoside or lactose) binding, the ability to aggregate trypsinized rabbit red blood cells, or in vitro or Ability to induce apoptosis in vivo). Sites that are important for ligand-receptor binding also have structural analyzes such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al., J. Mol. Biol. 22).
4: 899-904 (1992) and de Vos et al., Science 25.
5: 306-312 (1992)).

The present invention also includes at least 75%, 80%, 85%, 9 of the above polypeptides.
0%, 95%, 96%, 97%, 98%, or 99%, or 97-99%
Includes polypeptides that are identical. An amino acid sequence of this polypeptide is a polypeptide having an amino acid sequence that is at least 95% “identical” to the reference amino acid sequence of the galectin-11 polypeptide, such that the polypeptide sequence is each of the reference amino acids of the galectin-11 polypeptide. It is intended to be identical to the reference sequence, except that it may contain up to 5 amino acid changes per 100 amino acids. In other words, up to 5% of the amino acid residues in the reference sequence can be deleted or replaced by another amino acid in order to obtain a polypeptide having an amino acid sequence at least 95% identical to the reference amino acid sequence. Alternatively, up to 5% of all amino acid residues in the reference sequence may be inserted in the reference sequence. These changes in the reference sequence may be made either individually among the residues in the reference sequence or in one or more contiguous groups within the reference sequence, either at the amino-terminal position or the carboxy-terminal position of the reference amino acid sequence. Locations, or anywhere between their terminal locations can occur.

As a practical matter, for example, any particular polypeptide may be added to the amino acid sequence shown in Figure 1 (SEQ ID NO: 2), the amino acid sequence encoded by the deposited cDNA clone, or a fragment thereof, At least 75%, 80%, 8
Whether it is 5%, 90%, 95%, 96%, 97%, 98% or 99% identical is determined by known computer programs (such as the Bestfit program) (W
isconsin Sequence Analysis Package, V
version 8 for Unix, Genetics Computer
Group, University Research Park, 575 S
Science Drive, Madison, WI 53711). For example, when using Bestfit or any other sequence alignment program to determine whether a particular sequence is 95% identical to a reference sequence according to the invention, the parameters are, of course, the percentage of identity. Calculated for the total length of the reference amino acid sequence and set to allow for gaps in homology up to 5% of the total number of amino acid residues in the reference sequence.

In another embodiment, the identity between the reference (query) sequence (the sequence of the invention) and the subject sequence, also referred to as the overall sequence alignment, is determined by Brutlag et al.
omp. App. Biosci. 6: 237-245 (1990)) based on the FASTDB computer program. FA
The preferred parameters used in the STDB amino acid alignment are: Matrix = PAM 0, k-tuple = 2, Mismatch.
Penalty = 1, Joining Penalty = 20, Randomi
zation Group Length = 0, Cutoff Score = 1
, Window Size = length of array, Gap Penalty = 5, Gap
Size Penalty = 0.05, Window Size = 500 or the length of the target amino acid sequence (whichever is shorter). According to this embodiment, when the sequence of interest is shorter than the query sequence due to N- or C-terminal deletions, rather than due to internal deletions, when calculating overall percent identity, FAST
Manual corrections are made to the results, taking into account the fact that the DB program does not account for N-terminal and C-terminal truncations of the subject sequence. For a subject sequence that is truncated at the N- and C-termini to the query sequence, the percent identity is the number of residues in the query sequence that are N- and C-termini of the subject sequence that do not match / align with the corresponding subject residues. Is corrected as the percent of total bases in the query sequence. The determination of whether residues are matched / aligned is determined by the results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity calculated by the FASTDB program above using the specified parameters, leading to the final percent identity score. This final percent identity score is what is used for the purposes of this embodiment. Only residues at the N- and C-termini of the subject sequence that are not matched / aligned with the query sequence are considered for the purpose of manually adjusting the percent identity score. That is, only query residue positions outside the furthest N-terminal and C-terminal residues of the subject sequence. For example, a 90 amino acid residue subject sequence may be labeled with 10 to determine percent identity.
Aligned with the 0 residue query sequence. This deletion occurs at the N-terminus of the subject sequence, so the FASTDB alignment does not show a match / alignment to the first 10 residues at the N-terminus. The 10 unpaired residues represent 10% of the sequence (number of unmatched N- and C-terminal residues / total number of residues in the query sequence). As a result, 10%
Subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched, the final percent identity would be 90%. In another example, a 90 residue subject sequence is compared to a 100 residue query sequence. This time this deletion is an internal deletion and there are no residues at the N-terminus or C-terminus of the subject sequence that are not compatible / aligned with this query. In this case, FA
The percent identity calculated by STDB is not manually corrected. Once again, only residue positions outside the N- and C-termini of the subject sequence that do not match / align with the query sequence, as shown in the FASTDB alignment, are manually corrected. No other manual correction is made for the purposes of this embodiment.

The polypeptides of the present invention have uses including, but not limited to, molecular weight markers on SDS-PAGE gels or on molecular sieve gel filtration columns using methods well known to those of skill in the art.

The present invention also includes fragments of the above-described polypeptides of the present invention. In a particular embodiment, these fragments are at least 20, 25, 30,
It is 40, 50, 75, 90, 100, 110, 120, 125 or 130 amino acid residues long.

For many proteins, including the mature form of secreted proteins, it is possible that one or more amino acids may be deleted from the N-terminus or C-terminus without substantial loss of biological function. , Are known in the art. However, even if the deletion of one or more amino acids from the N-terminus or C-terminus of the protein results in modification or loss of one or more biological functions of this protein, the functional activity of other galectins 11 Can still be retained. For example, in many instances, induce an antibody that recognizes galectin 11 (eg, does not cross-react with other previously characterized galectins), preferably an antibody that specifically binds galectin 11; and The ability of the truncated protein to bind to / or bind to it is retained regardless of the size or location of the deletion. Whether a particular polypeptide lacking the N-terminal and / or C-terminal residues of the complete protein retains such immunological activity can be readily determined by conventional methods described herein. , Otherwise known in the art.

In one embodiment, the invention further comprises from the amino terminus of the amino acid sequence of the galectin 11 polypeptide shown in FIG. 1 (SEQ ID NO: 2) or encoded by the cDNA of the deposited clone. Provided is a polypeptide in which one or more residues have been deleted. In particular, in one embodiment, the N-terminal deletion of galectin-11 polypeptide may be described by the general formula m-133. Where m is
An integer from 1 to 132 corresponding to the position of the amino acid sequence identified in SEQ ID NO: 2, and preferably one of the N-terminal amino acid residues identified in the N-terminal deletion identified herein. Corresponding to. In a particular embodiment, the N-terminal deletion of the galectin-11 polypeptide of the invention comprises or consists of the following amino acid residues of SEQ ID NO: 2:

[0080]

[Chemical 1] Polynucleotides encoding these polypeptides are also included in the invention.

Furthermore, an embodiment of the present invention is the galectin-1 described by the general formulas 1-n.
One polypeptide C-terminal deletion. Where n is an integer from 2 to 132 corresponding to the position of the amino acid residue identified in SEQ ID NO: 2, and preferably the C identified in the C-terminal deletion specified herein. Corresponds to one of the terminal amino acid residues. In a particular embodiment, the C-terminal deletion of the galectin-11 polypeptide of the invention comprises or consists of the following amino acid residues of SEQ ID NO: 2:

[0082]

[Chemical 2] Polynucleotides encoding these polypeptides are also included in the invention.

Further embodiments of the invention relate to polypeptide fragments comprising or consisting of the amino acids described by the general formulas m-n. Here, m and n each correspond to any one of the amino acid residues specified above for these symbols. Polynucleotides encoding these polypeptides are also encompassed by the present invention.

In a preferred embodiment, the polypeptide of the invention comprises or consists of the following amino acid residues of SEQ ID NO: 2:

[0085]

[Chemical 3] Polynucleotides encoding these polypeptides are also included in the invention.

Particularly preferred fragments of the invention are those characterized by the structural or functional properties of galectin-11. Such a fragment is
Galectin 11 α-helix and α-helix forming region (“α region”), β
Sheet and β sheet forming area (“β area”), turns and turn forming area (
“Turn region”), coil and coil forming region (“coil region”), hydrophilic region, hydrophobic region, α amphipathic region, β amphipathic region, surface forming region, and high antigenic index region (ie, , Having an antigenic region of 3 or more consecutive amino acid residues, each having an antigenicity index of 1.5 or more). A particular preferred region is the region shown in Figure 3 and of the type described above identified by analysis of the amino acid sequence shown in Figure 1 (SEQ ID NO: 2) using the default parameters of the identified computer program. Including, but not limited to. Such preferred areas include: Garnier-Robs.
on predicted α region, β region, turn region, and coil region; Chou-Fasm
an predicted α region, β region, turn region, and coil region; Kyte-Dool
Title Predicted hydrophilic and hydrophobic regions; Eisenberg α and β
Amphiphilic area; Emini surface forming area; and Jameson-Wolf
High antigenic index area. Polynucleotides encoding these polypeptides are also included in the invention.

FIG. 2 provides a comparison of galectin 11 polypeptides with other galectins. Identical amino acids shared between galectins are shaded, while conservative amino acid changes are boxed. By examining the shaded and / or enclosed regions of amino acids, one of skill in the art can readily identify conserved domains between two polypeptides. Amino acid sequences present within these conserved, shaded and / or enclosed domains are included in preferred polypeptide fragments of the invention.

Representative examples of polypeptide residue fragments of the present invention include, for example, approximately amino acid numbers 1-2 of the galectin-11 polypeptide shown in FIG. 1 (SEQ ID NO: 2).
0, 1-66, 5-108, 5-128, 21-40, 40-108, 41-6
0, 47-108, 47-128, 61-80, 65-108, 65-128,
81-100, 88-108, 88-128, 108-120; 114-128
; And 101 to the fragments derived from the ends. In this situation,
"Approximately" includes larger or smaller specifically recited ranges of the order of a few, 5, 4, 3, 2, or 1 amino acid at either or both ends.

In another embodiment, the invention provides a peptide or polypeptide that comprises an epitope-bearing portion of a polypeptide of the invention. The epitope of this polypeptide portion is an immunogenic or antigenic epitope described herein. An "immunogenic epitope" is defined as the part of a protein that elicits an antibody response when the whole protein is the immunogen. On the other hand, the region of a protein molecule to which an antibody can bind can be defined as an antigenic epitope. The number of immunogenic epitopes of a protein is generally less than the number of antigenic epitopes. For example,
Geysen et al., Proc. Natl. Acad. Sci. USA 81:39.
98-4002 (1983). With respect to the selection of peptides or polypeptides bearing antigenic epitopes (ie, including the regions of the protein molecule to which an antibody can bind), relatively short synthetic peptides that mimic a portion of the protein sequence were partially mimicked. It is well known in the art that antisera that react with proteins can be routinely elicited. For example, Sutcliffe et al., Science 2
19: 660-666 (1993). Peptides capable of eliciting protein-reactive sera are often represented by the primary sequence of the protein, can be characterized by a simple set of chemical rules, and are found in the immunodominant region of intact proteins (ie, immunogenic epitopes). Nor is it limited to the amino or carboxyl termini.

Therefore, the antigenic epitope-bearing peptides and polypeptides of the present invention are useful for raising antibodies (including monoclonal antibodies) that specifically bind to the polypeptides of the present invention. For example, Wilson et al., Cell 37: 767-77.
8 (1984).

The antigenic epitope-bearing peptides and polypeptides of the invention are preferably at least 7, 9, 15, 20, 2 of the amino acid sequence shown in Figure 1 (SEQ ID NO: 2).
It comprises 5, 30, 35, 40, 45, 50, 75, 100, 110 or 120 consecutive amino acid residues.

Non-limiting examples of antigenic polypeptides or peptides that can be used to produce galectin-11-specific antibodies include: about 65-70 and 118 in Figure 1 (SEQ ID NO: 2). A polypeptide comprising amino acid residues from ˜124. As indicated above, the inventors have determined that the polypeptide fragment is the antigenic region of galectin 11 protein.

Epitope-bearing peptides and epitope-bearing polypeptides of the invention also include
It can be produced by any conventional means. Generally, Houghten, R .; A. ,
Proc. Natl. Acad. Sci. USA 82: 5131-5135 (
1985). This simultaneous replication peptide synthesis (Simultaneou
s Multiple Peptide Synthesis (SMPS) process is further described in US Pat. No. 4,631,2 of Houghten et al. (1986).
No. 11.

As will be appreciated by one of skill in the art, galectin 11 polypeptides of the present invention (eg, an epitope-bearing fragment of galectin 11 etc.) can be labeled with immunoglobulin (IgG).
) May be combined with a portion of the constant domain of to produce a chimeric polypeptide. These fusion proteins facilitate purification and exhibit increased half-life in vivo. This has been shown, for example, for a fusion protein consisting of the first two domains of the human CD4-polypeptide and various domains of the constant region of the heavy or light chain of a mammalian immunoglobulin (EPA 394,827; Traunec).
ker et al., Nature 331: 84-86 (1988)). Fusion proteins having a disulfide-linked dimer structure with an IgG moiety may also be more efficient in binding and neutralizing other molecules than the monomeric galectin-11 protein or protein fragment alone (Funtoulakis et al., J. Chem.
Biochem. 270: 3958-3964 (1995)).

The polypeptide of the present invention includes the polynucleotide sequence shown in FIG. 1 (SEQ ID NO: 1), the complementary strand to the sequence, and / or the nucleotide sequence contained in the deposited clone (for example, stringent Polypeptides encoded by hybridizing polynucleotides (under hybridizing conditions) are included. In a particular embodiment, the polypeptide of the invention has a functional and / or biological activity of galectin-11.

Assays for Galectin-11 Functional Activity The functional and / or biological activity of the galectin-11 polypeptides, fragments, variants, derivatives and analogs of the invention can be assayed by a variety of methods. .

For example, binding to galectin 11 polypeptide or anti-galectin 11
In one embodiment, assaying for the ability to compete for binding to an antibody, various immunoassays known in the art may be used, including radioimmunoassays, ELISAs, "sandwich" immunoassays, Immunoradiometric and diffusion precipitation reactions, immunodiffusion assays, in situ immunoassays (eg using colloidal gold, enzyme or radioisotope labeling)
, Western blots, precipitation reactions, agglutination assays (eg gel agglutination assays,
Hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, immunoelectrophoretic assays, and the like, and competitive and non-competitive assay systems are used. Many means for detecting binding in immunoassays are known in the art and are within the scope of the invention.

In another embodiment, the ability of the galectin-11 polypeptides, fragments, variants, derivatives and analogs of the invention to bind β-galactoside sugars is determined using or using assays known in the art. It can be determined by routine modification. For example, the expressed galectin-11 polypeptide and fragments thereof,
The lactose binding activity of the variant, derivative or analog is
Asialofetuin immobilized on Amersham)
uin) (Sigma) can be assayed by immunodetection of in situ binding activity (Madsen et al., J. Biol. Chem. 270 (11): 5823.
-5829 (1995)). For example, in one assay, 30 μg asialofetuin dissolved in 3 μl water is spotted on a 1 cm ² nitrocellulose strip. The nitrocellulose pieces were then placed in 24-well tissue culture plates and buffer B (58 mM NA ₂ HPO ₄ , 18 mM KH ₂ PO ₄ , 75 mM NaCl, 2 mM EDTA, and 3%).
Incubate overnight at 22 ° C. in BSA, pH 7.2) with constant agitation. After the incubation, the blocking medium was aspirated and the nitrocellulose pieces were added to buffer A (58 mM NaHPO ₄ , 18 mM KH ₂ PO ₄ , 7).
Wash 3 times in 5 mM NaCl, 2 mM EDTA, 4 mM β-mercaptoethanol and 0.2% BSA, pH 7.2). Containing 1% BSA,
And cell (preferably COS cell) extract with or without 150 mM lactose (105 μl primary extract, 15 μ in buffer A)
Prepare 1 μl of 10% BSA and 30 μl of 0.75 M lactose in buffer A or 30 μl of buffer A). The immobilized asialofetuin is incubated with the extract for 2 hours and washed 5 times in buffer A. The piece of nitrocellulose was then treated with PBS (58 mM Na ₂ HPO ₄ , 18 m
_{2 in} M KH ₂ PO ₄ , 75 mM NaCl, 2 mM EDTA pH 7.2)
Fix in% formalin for 1 hour to prevent loss of bound galectin-11.
After extensive washing in PBS, the pieces are incubated for 2 hours at 22 ° C. with rabbit anti-galectin 11 polyclonal serum (produced using techniques known in the art) diluted 1: 100 in PBS. To do. This piece is then
Goat anti-rabbit antibody (DAKO) washed in water and labeled with peroxidase
Incubate with. After 2 hours incubation at 22 ° C., the strips are washed in PBS and the substrate is added. The nitrocellulose strips are incubated until color develops, and the reaction is stopped by washing in distilled water.

The ability of the galectin-11 polypeptides, fragments, variants, derivatives and analogs of the invention to agglutinate trypsinized rabbit red blood cells can be routinely assayed using techniques known in the art.

The ability of the galectin-11 polypeptides, fragments, variants, derivatives and analogs of the invention to induce T cell apoptosis is described herein (see, eg, Example 5). Otherwise, it may be determined using techniques known in the art or routine modification of the techniques. See, eg, Perillo et al., Nature 378: 736-739 (1995); Chinanaiyan.
Et al., Cell 81: 505-512 (1995); Boldin et al., J. Am. Bi
ol. Chem. 270: 7795-7798 (1995); Kischkel.
EMBO J. et al. 14: 5579-5585 (1995); Chinanai.
an et al. Biol. Chem. 271: 4961-4965 (1996) (
The content of each of these is incorporated herein by reference in its entirety).

Galectin-11 polynucleotides and polypeptides, and fragments, variants, derivatives and analogs thereof; and antibodies, agonists and antagonists thereto, can be tested in vivo for the desired therapeutic or prophylactic activity. For example, such compounds may be tested in a suitable animal model system before testing in humans. Such animal models include, but are not limited to, rat, mouse, chicken, cow, monkey, rabbit and the like. Such tests can also be used to routinely determine dosages for delivery to human patients. For in vivo testing prior to administration to humans, any animal model system known in the art can be used (eg, Levi et al., Eur. J.
． Imun. 13: 500-507 (1983); and Offner et al.
Neuroimmunol 28: 177-184 (1990)).
. For example, a useful animal model for studying the treatment of human MS is experimental allergic encephalomyelitis (EAE). EAE is an experimentally induced disease that shares many of the same clinical and pathological symptoms of MS (Martin et al., Ann.
Rev. Immunol. 10: 153-187 (1992); Hafler et al., Immunology Today 10: 104-107 (1989)).
Some studies in rodents have shown that CD4 ⁺ T cells, like MS, show EA
It has been shown to be involved in the pathophysiology of E (Traugott et al., Cellu.
lar Immunology 91: 240-254 (1985); Ben-.
Nun, Eur. J. Immunol. 11: 195-199 (1981); P.
ettinel et al. Immunol. 127: 1420-1423 (198)
1)). EAE can be induced in certain strains of mice by immunization with myelin in adjuvant. This immunity is due to myelin basic protein (MBP
) And proteolipid (PLP) specific CD4 ⁺ T cells are activated (
Bernard et al. Immunol. 114: 1537-1540 (197)
5); Chou et al. Immunol. 130: 2183-2186 (198).
3); Kurchloo et al. Immunol. 148: 3776-3782
(1992)). The activated T cells enter the central nervous system, and their local effects cause both the anatomical pathology and clinical signs of the disease, such as paralytic ascending hindlimb paresis. . As discussed above, galectin-1 was demonstrated to suppress clinical and histological manifestations of experimental autoimmune encephalomyelitis in rats (Offner et al., J. Neuroimmuno.
l. 28: 177-184 (1990)).

Another that can be utilized both to study the role of the polypeptides, variants, derivatives and analogs of the invention as suppressors of the immune response and to determine the effective dosage to do so. Is a model system for experimental autoimmune myasthenia gravis (EAMG) in rabbits. EAMG is an autoimmune disease induced by immunization with purified acetylcholine receptor protein (AChR) and is considered a good model for the human disease myasthenia gravis. As discussed further above, galectin-1 has been demonstrated to have prophylactic and therapeutic effects on experimental autoimmune myasthenia gravis in rabbits (Levi et al., Eur. J. Immunol. 13). : 500-507 (1
983)).

Other model assays known in the art that can be used to determine the desired therapeutic or prophylactic activity of a compound of the invention (eg, as a suppressor of an immune response) include mixed lymphocyte reactions. Examples include, but are not limited to, T cell proliferation in the assay (the art-accepted model for allograft rejection) and the mouse allograft model known in the art.

Assays described herein or otherwise known in the art show that any of the galectin-11 polypeptides, fragments, variants, derivatives and analogs of the invention exhibit a functional activity of galectin-11. Or, and can be applied to routinely determine the optimal concentration at which these compounds exhibit this activity. These assays can be further utilized to identify molecules that enhance galectin 11 functional activity (agonists) or suppressors (antagonists).

The exact formulation, route of administration and dosage of the compounds to be administered can be selected by the individual physician in view of the patient's condition (eg Fingl et al.,
1975, "The Pharmacologic Basis of T
herapeutics. See Chapter 1, page 1).

[0106]   Other methods are known to those of skill in the art and are within the scope of this invention.

Antibodies The polypeptides of the invention and their fragments, variants, derivatives or analogs, or cells expressing them are also used to produce antibodies immunospecific for the galectin-11 polypeptides of the invention. It can be used as an immunogen. the term"
By "immunospecific" is meant that the antibody has an affinity for a polypeptide of the invention that is substantially higher than the affinity for other related polypeptides in the prior art.

The term “antibody” (Ab) or “monoclonal antibody” as used herein
(MAb) is meant to include intact molecules and fragments thereof, such as Fab and F (ab ′) ₂ fragments, which are capable of specifically binding to an antigen. Fab, Fab ′ and F (ab ′) ₂ fragments lack the Fc fragment of the intact antibody, are more rapidly cleared from the circulation, and may have less non-specific tissue binding of the intact antibody ( Wahl et al., J. Nu.
cl. Med. 24: 316-325 (1983)).

Antibodies according to the present invention may be prepared by any of a variety of standard methods using the galectin-11 immunogens of the present invention. For example, an antibody raised against full-length galectin 11 polypeptide can be a polypeptide or epitope-bearing fragment, variant, derivative, analog, or cell of an animal (preferably non-human).
, And can be obtained by administration using conventional protocols. For the preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include hybridoma technology (Kohl
er et al., Nature 256: 495-497 (1975)), trioma (
trioma) technology, human B cell hybridoma technology (Kozbor et al., Imm
unology Today 4:72 (1983)), and EBV-hybridoma technology (Cole et al., MONOCLONAL ANTIBODIES A).
ND CANCER THERAPY, pp. 77-96, Alan R. et al. Liss
, Inc. , 1985). In addition, techniques for the production of single chain antibodies (
US Pat. No. 4,946,778) can also be adapted to produce single chain antibodies to the polypeptides of the invention. Also, transgenic mice, or other organisms including other mammals, can be used to express humanized antibodies.

The antibodies of the invention are associated with the localization and activity of these polypeptide sequences, for example for imaging the polypeptides of the invention, measuring their levels in a suitable physiological sample, and the like. It can be used in methods known in the art. The antibody also has uses in immunoassays and therapeutics as agonists and antagonists of galectin-11. Furthermore, the antibodies of the invention can be used to isolate or identify clones expressing the polypeptide, or to purify the polypeptide by affinity chromatography.

Diagnosis and Prognosis Certain diseases, such as, but not limited to, autoimmune diseases: lupus erythematosus (SLE), rheumatoid arthritis (RA), insulin-dependent diabetes mellitus, multiple sclerosis (MS). , Giant cell arteritis, polyarteritis nodosa, myasthenia gravis, scleroderma, and graft-versus-host disease; transplant rejection; mammalian cancers including but not limited to: melanoma, kidney Specific tissues in mammals with astrocytoma, Hodgkin's disease, breast cancer, ovarian cancer, prostate cancer, bone cancer, liver cancer, lung cancer, pancreatic cancer, and spleen cancer; inflammatory diseases; asthma; and allergic diseases) Is a significantly altered (eg, increased or decreased) level of galectin when compared to a corresponding “standard” mammal (ie, a mammal of the same species without the disease). It believed to express the mRNA encoding the emissions 11 polypeptide and galectin 11 polypeptides. Furthermore, altered levels of galectin-11 polypeptide when compared to serum from a mammal of the same species without this disorder results in specific body fluids (eg, serum, plasma, Urine, and cerebrospinal fluid). Accordingly, the present invention provides a diagnostic method useful during diagnosis. This involves assaying the expression level of a gene encoding a galectin-11 polypeptide in mammalian cells or body fluids and comparing the gene expression level to a standard galectin-11 gene expression level, Thereby, an increase or decrease in gene expression level above the standard is indicative of the disease.

The present invention is useful as a prognostic indicator if the diagnosis has already been made according to the usual methods, whereby patients exhibiting altered galectin-11 gene expression express this gene at normal levels. Experience worse clinical results compared to patients who do.

By “assaying the expression level of the gene encoding the galectin-11 polypeptide”, the level of the galectin-11 polypeptide or the mRNA encoding the galectin-11 polypeptide in the first biological sample is directly (eg, , By measuring or also estimating absolute polypeptide levels or absolute mRNA levels) or relative (eg, by comparing to galectin 11 polypeptide levels or mRNA levels in a second biological sample). It is intended to be qualitatively or quantitatively measured and evaluated.

Nucleic acids for diagnosis are used in a biological sample of a subject (eg blood, urine, saliva,
Tissue biopsy, or autopsy material), using techniques known in the art. Genomic DNA can be used directly for detection or can be enzymatically amplified prior to analysis by using PCR or other amplification techniques. RNA or cDNA can also be used in a similar fashion. Deletions and insertions can be detected by the size of the amplified product that is altered compared to the normal genotype. The point mutation is
It can be identified by hybridizing amplified DNA to a labeled galectin 11 nucleotide sequence. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase digestion or by differences in melting temperatures. D
NA sequence differences also by changes in electrophoretic mobility of DNA fragments in gels (with or without denaturing agents) or by direct DNA sequencing (see, eg, Myers et al., Science 230; 1242 (1985)). Can be detected. Sequence changes at specific positions may also be revealed by nuclease protection assays (eg RNase and S1 protection) or chemical cleavage methods (Cotton et al., Proc. Natl. Acad. Sci. US).
A 85: 4397-4401 (1985)). In another embodiment, an array of oligonucleotide probes containing the galectin-11 polynucleotide sequence or fragments thereof can be constructed, eg, to perform efficient screening for genetic mutations. Array technology methods are well known and have general applicability and can be used to address a variety of questions in molecular genetics including gene expression, gene linkage, and gene variability (eg, Chee).
Et al., Science 274: 610-613 (1996)) Diagnostic assays provide a process for diagnosing or determining susceptibility to a particular disease through detection of mutations in the galectin-11 gene according to the methods described. To do.

In addition, certain diseases can be diagnosed by methods that include determining from a sample obtained from a subject, aberrantly reduced or increased levels of galectin 11 polypeptide or mRNA. Reduced or increased expression is
It can be measured at the RNA level using any of the methods well known in the art. These methods include, but are not limited to, Northern blot analysis (Harada et al., Cell 63: 303-312 (1990), S.
1 Nuclease mapping (Figita et al., Cell 49: 357-367).
(1987)), RNAse protection, polymerase chain reaction (PCR), reverse transcription (RT-PCR) in combination with polymerase chain reaction (Makino et al., Te.
chnique 2: 295-301 (1990)), reverse transcription RT-LCR in combination with ligase chain reaction), and other hybridization methods.

The step of assaying galectin 11 polypeptide levels in the biological sample can be done by any of the techniques known in the art. These techniques include, but are not limited to, radioimmunoassays, competitive-binding assays, Western blot analysis, and enzyme-linked immunosorbent assay (EL).
ISA), as well as other antibody-based technologies. For example, galectin-11 polypeptide expression in tissues can be studied by classical immunohistological methods (Jalka.
nen et al. Cell. Biol. 101: 976-985 (1985).
Jalkanen, M .; Et al., J. Cell. Biol. 105: 308
7-3096 (1987)).

[0117]   Suitable labels are known in the art and may be enzymatic labels (eg glucose
Xydase) and radioisotopes (eg iodine (¹²⁵I,¹²¹I), carbon ( ¹⁴ C), sulfur (³⁵S), tritium (³H), indium (¹¹²In) and
Cnetium (^99mTc)), and a fluorescent label (eg, fluorescein and
-Damine), as well as biotin.

Accordingly, in another aspect, the invention relates to a diagnostic kit for a disease or susceptibility to a disease, which kit comprises: (a) a galectin-11 polynucleotide, preferably the nucleotide of SEQ ID NO: 1. (B) a nucleotide sequence complementary to the nucleotide sequence of (a); (c) the galectin-11 polypeptide of the present invention, preferably the polypeptide of SEQ ID NO: 2 or a fragment thereof; or (d) the present invention. An antibody against the Galectin11 polypeptide of, preferably an antibody against the polypeptide of SEQ ID NO: 2.

In any such kit, (a), (b), (c) or (d) is
It is understood that it may include substantial components.

Screening Assays for Galectin-11 Agonists or Antagonists Abnormalities in galectin-11 expression are responsible for many biological functions, including many pathologies. Therefore, it is desirable to find compounds and drugs that enhance the activity of galectin-11 or suppress the activity of galectin-11. The invention also provides methods of screening compounds to identify those that enhance or suppress Galectin 11 activity. Agonists are compounds that increase the natural biological function of galectin-11 or that function in a manner similar to galectin-11, while antagonists reduce or eliminate such function.

Accordingly, embodiments of the invention identify compounds that interact with (eg, bind to) the galectin-11 polypeptides of the invention, compounds that interfere with or enhance the interaction of galectin-11 with its cognate ligand. Assays designed to as well as compounds that modulate the galectin 11 gene (ie, regulate the level of galectin 11 gene expression) or regulate the level of galectin 11 functional or biological activity. The assay also includes a compound that binds a galectin-11 gene regulatory sequence (eg, a promoter sequence), and galectin-11.
Can be used to identify compounds that can regulate gene expression in. For example, Pl
att, J.M. Biol. Chem. 269: 28558-28562 (1994)
), Which is incorporated herein by reference in its entirety.

Thus, the polypeptides of the present invention can be used to assess the binding of small molecule substrates and ligands in, for example, cells, cell-free preparations, chemical libraries, and mixtures of natural products. These substrates and ligands can be natural substrates and ligands, or can be structural or functional mimetics. Coliga
n et al., Current Protocols in Immunology 1
(2): See Chapter 5 (1991). Examples of additional compounds that may be screened include peptides (eg, random peptide libraries (eg, L
Am et al., Nature 354: 84-86 (1991)), and molecular libraries of D- and L-amino acids from combinatorial chemistry; phosphopeptides (random-directed phosphopeptide libraries or moieties). A member of a dynamically degenerate peptide library (eg,
Songyang et al., Cell 72: 767-778 (1993)); antibodies (monoclonal antibodies, humanized antibodies, anti-idiotype antibodies, chimeric antibodies or single chain antibodies, and Fabs). , F (
ab ') 2, and FAB expression library fragments, as well as, but not limited to, epitope binding fragments thereof); and soluble peptides, including but not limited to peptides found in small organic or inorganic molecules). However, it is not limited to these.

Many experimental methods can be used to select and detect compounds that bind the galectin-11 polypeptides of the invention and thereby modulate galectin-11 expression or activity. These include protein affinity chromatography, affinity blotting, immunoprecipitation, crosslinking, and library-based methods (eg, protein probing, phage display, two-hybrid systems (Fields and Song, Nature 340: 24.
5-246 (1989)), as well as a modified version of the two-hybrid system (Gyuris et al., Cell 75: 791-803 (1993); Zerv.
os et al., Cell 72: 223-232 (1993))), but is not limited thereto. In general, Phizicky et al., Microbiol. Re
v. 59: 94-123 (1995).

The rationale behind the assay to identify compounds that bind to the galectin-11 polypeptide of the present invention is that under conditions that allow the two components to interact and bind, thus forming a complex. , A reaction mixture of galectin 11 polypeptide and a test compound. This complex can be detected and purified in the reaction mixture using techniques known in the art. Therefore, the assay can simply test the binding of the candidate compound to galectin-11.

In addition, the assay involves combining a candidate compound with a solution containing a galectin-11 polypeptide to form a mixture, and galectin-11 contained in the mixture, a galectin-11 cognate ligand (eg, a surface of a T cell). Determining the ability to bind a β-galactoside sugar and / or a compound containing a molecule expressed in E. coli to aggregate trypsinized rabbit erythrocytes or induce T cell apoptosis. Comparing to the observed capacity for galectin 11 polypeptide in the same or similar solution under the same or similar conditions but without the compound may be simply included. Of this candidate molecule,
The ability to interfere with binding of galectin-11 to the cognate ligand is reflected in a decrease in binding of labeled galectin11 to the cognate ligand compared to its ability in the absence of the candidate molecule. Molecules that interfere with the ability of galectin-11 to trigger a cellular response (eg, apoptosis) that results from binding of galectin-11 to its cognate ligand are antagonists. Molecules that enhance the cellular response induced by galectin-11 are agonists when mixed with galectin-11 or when they are capable of inducing a similar cellular response in the absence of galectin.

The galectin-11 polynucleotides, galectin-11 polypeptides, and galectin-11 antibodies of the present invention also comprise an assay for detecting the effect of added compounds on the production of galectin-11 mRNA and protein in cells. Can be used. For example, ELIZA uses monoclonal and polyclonal antibodies by standard methods known in the art to measure secreted levels of galectin-11 protein or levels of galectin-11 protein associated with cells. It can be constructed and used to discover factors (also called antagonists or agonists, respectively) that can inhibit or enhance galectin-11 production from appropriately engineered cells or tissues. Standard methods for conducting screening assays are well understood in the art.

Examples of potent galectin-11 antagonists include antibodies or, in some cases, oligonucleotides closely related to galectin-11 or its cognate ligands (eg, a fragment of galectin-11 or a ligand of galectin-11). Alternatively, a small molecule is included that binds to a protein, or a cognate ligand, but does not elicit a response and thus interferes with galectin-11 activity.

Accordingly, in another aspect, the present invention provides a screen to identify agonists, antagonists, ligands, receptors, substrates, enzymes, etc. for galectin-11 polypeptides; or compounds that reduce or enhance galectin-11 production. Regarding the kit, the kit comprises: (a) Galectin 11 of the invention, eg, the polypeptide of SEQ ID NO: 2.
A polypeptide; (b) a cell that expresses a galectin-11 ligand, such as a T cell; (c) a cell membrane that expresses a galectin-11 ligand, which is preferably a T cell membrane; (d) contains a β-galactoside sugar Or (e) Galectin 11 of the present invention, which is preferably the polypeptide of SEQ ID NO: 2.
Antibodies to the polypeptides.

It will be appreciated that in any such kit, (a), (b), (c), (d) or (e) may comprise a substantial component.

Compounds identified through assays as disclosed herein may be used, for example, in producing the biological function of the galectin-11 gene product and in cell proliferation (
cell growth, cell proliferation
) And differentiation, and may be useful for regulating apoptosis. For example, antibodies against galectin-11 and galectin-11 polypeptides, fragments, derivatives, variants, or analogs of the invention may be utilized to suppress galectin-11 activity and treat abnormalities resulting from elevated galectin-11. Combinations of these identified compounds with pharmaceutically acceptable carriers, such as carriers as described herein, as well as growth dysregulation and immune dysregulation (autoimmune diseases, cancer, and Their administration to treat or prevent inflammatory diseases, including but not limited to inflammatory diseases, is also encompassed by the present invention.

Prophylactic and Therapeutic Methods Although the following discussion specifically relates to human patients, it should be understood that these teachings are also applicable to any animal that expresses galectin-11. is there.

As mentioned above, galectin 11 shares significant homology with other galectins. Furthermore, as disclosed herein, galectin-11, like galectin-1, induces apoptosis of T cell lines. Furthermore, as discussed above, galectin-1 is directed against cell proliferation and several immune functions (eg, against autoimmune diseases in experimental myasthenia gravis animal model systems and experimental autoimmune encephalomyelitis animal model systems). Therapeutic activity) has been demonstrated.
Thus, galectin-11, like galectin-1, is active in growth-regulating activity (eg, cell differentiation and / or cell proliferation), immunomodulatory activity, cell-cell and cell-matrix interactions, and apoptosis. It seems

Apoptosis, or programmed cell death, is a physiological mechanism involved in the deficiency of peripheral T lymphocytes in the immune system, and its dysregulation can lead to many different pathogenic processes. Diseases associated with increased cell survival or inhibition of apoptosis include cancer (eg, follicular lymphoma, cancers with p53 mutations, and hormone-dependent tumors (eg, breast cancer, prostate cancer, Kaposi's sarcoma, and ovarian cancer). ))
Autoimmune disorders (eg systemic lupus erythematosus, myasthenia gravis and immune-related glomerulonephritis rheumatoid arthritis), and viral infections (eg herpesvirus, poxvirus, and adenovirus), inflammation; host-versus transplantation Includes schizophrenia, acute graft rejection, and chronic graft rejection. Diseases associated with increased apoptosis include AIDS; neurodegenerative diseases (eg Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, retinitis pigmentosa, cerebellar degeneration); myelodysplastic syndromes (eg poor regeneration). Anemia), ischemic injury (eg, injury caused by myocardial infarction, stroke, and reperfusion injury), toxin-induced liver disease (eg, alcohol-induced disease), septic shock, cachexia, and appetite. Includes poor performance.

Any method of neutralizing or enhancing galectin-11 activity can be used to modulate growth regulatory activity (eg, cell proliferation), immunomodulatory activity, cell-cell and cell-matrix interactions, and apoptosis. Can be used to

Galectin 11 polypeptides or polynucleotides, including galectin 11 fragments, variants, derivatives, and analogs, as well as galectin 11 agonists and antagonists, as described herein, increase the proliferation of immune cells, It may be useful in treating defects or disorders of the immune system by activating or inhibiting differentiation, or migration (chemotactic). Immune cells develop through a process called hematopoiesis that produces myeloid cells (platelets, red blood cells, neutrophils, and macrophages) and lymphoid cells (B and T lymphocytes) from pluripotent stem cells. The etiology of these immune deficiencies or disorders may be genetic, physical, eg cancer or some autoimmune disorder, acquired (eg chemotherapy or toxins). By),
Or it can be infectious. In addition, galectin 11 polynucleotides or polypeptides can be used as markers or detectors of certain immune system diseases or disorders.

Galectin-11 polynucleotides or polypeptides, including fragments, variants, derivatives and analogs of Galectin-11 as described herein, as well as agonists and antagonists of Galectin-11, are defective in hematopoietic cells. Or it may be useful in treating or detecting disorders. As discussed further below, galectin-11 polypeptides or polynucleotides are used in an effort to treat disorders associated with the reduction of certain (or many) types of hematopoietic cells (hematopoietic cells (pluripotent stem cells). , Including) and proliferation. Examples of immunological deficiency syndromes include, but are not limited to: blood protein disorders (eg, agammaglobulinemia, hypogammaglobulinemia), ataxia-telangiectasia, unclassified immunity. Deficiency, Di George Syndrome, H
IV infection, HTLV-BLV infection, leukocyte adhesion deficiency syndrome, lymphopenia, phagocytic bactericidal dysfunction, severe combined immunodeficiency (SCID), Viscott-Aldrich disorder, anemia, thrombocytopenia, or hemoglobinuria.

In addition, galectin-11 polypeptides or polynucleotides, including galectin-11 fragments, variants, derivatives and analogs as described herein, as well as galectin-11 agonists and antagonists, are also hemostatic. It can be used to regulate activity (stop bleeding) or thrombolytic activity (clot formation). For example, by increasing hemostasis or thrombolytic activity, galectin-11 polynucleotides or polypeptides are associated with blood coagulation disorders (eg, afibrinogenemia, factor deficiency), blood platelet disorders (eg,
Thrombocytopenia), or wounds resulting from trauma, surgery or other causes. Alternatively, it may reduce hemostatic or thrombolytic activity,
Galectin-11 polynucleotides or polypeptides may be used to inhibit or lyse coagulation, which is important in the treatment of heart attack (infarction), stroke, or scarring.

Galectin-11 polynucleotides or polypeptides, including galectin-11 fragments, variants, derivatives and analogs as described herein, and agonists of galectin-11, also treat autoimmune disorders. Or it may be useful for detecting. Galectin 11 as disclosed herein
Induces apoptosis of T cell lines (see Example 5, FIGS. 5A and 5B). Many autoimmune disorders result from the inappropriate recognition of self as a foreign substance by immune cells. This inadequate recognition produces an immune response that leads to the destruction of host tissues. Therefore, administration of galectin-11 polypeptides or polynucleotides that can inhibit the immune response, particularly T cell proliferation, differentiation, or chemotaxis, may be an effective treatment for preventing autoimmune disorders.

Examples of autoimmune disorders that can be treated or detected by Galectin-11 include:
Non-exclusive examples include: Addison's disease, hemolytic anemia, antiphospholipid syndrome, rheumatoid arthritis, dermatitis, allergic encephalomyelitis, glomerulonephritis, Goodpasture's syndrome, Graves' disease, multiple sclerosis. , Myasthenia gravis, neuritis, ocular conjunctivitis, bullous pemphigoid, pemphigus, multiple endocrine glands, purpura, Reiter's disease, Stiffman syndrome, autoimmune thyroiditis, systemic lupus erythematosus, autoimmune Pulmonary inflammation, Guyan-Barre syndrome, insulin-dependent diabetes mellitus, and autoimmune inflammatory eye disease.

Similarly, allergic reactions and conditions such as, for example, asthma (particularly allergic asthma) or other respiratory problems can also be treated with galectin-11 polypeptides or polynucleotides. In addition, galectin 11 may be used to treat anaphylaxis, hypersensitivity to antigenic molecules, or blood group incompatibility.

Galectin-11 polynucleotides or polypeptides, including fragments, variants, derivatives and analogs of Galectin-11 as described herein, as well as agonists of Galectin-11, may also be used in organ rejection or anti-host. It can be used to treat and / or prevent sex graft disease (GVHD). Organ rejection is caused by host immune cells destroying the transplanted tissue via an immune response. Similarly, an immune response is also involved in GVHD, where the foreign transplanted immune cells destroy host tissue. Administration of galectin-11 polypeptides or polynucleotides that inhibit the immune response, particularly T cell proliferation, differentiation, or chemotaxis, may be an effective treatment for preventing organ rejection or GVHD.

Similarly, galectin-11 polypeptides or polynucleotides, including fragments, variants, derivatives and analogs of galectin-11 as described herein, and agonists of galectin-11, also induce inflammation. It can be used to adjust. For example, galectin-11 polypeptides or polynucleotides may inhibit proliferation and differentiation of cells involved in the inflammatory response. These molecules are associated with infections (eg, septic shock, sepsis, or systemic inflammatory response syndrome (SIRS)), ischemic reperfusion injury, endotoxin death, arthritis, complement-mediated hyperacute rejection, nephritis, cytokines or Inflammatory conditions (both chronic and acute), including chemokine-induced lung injury, inflammatory bowel disease, inflammation associated with Crohn's disease, or inflammation resulting from overproduction of cytokines (eg, TNF or IL-1)
Can be used to treat

Galectin-11 polypeptides or polynucleotides, including galectin-11 fragments, variants, derivatives and analogs as described herein, as well as galectin-11 agonists and antagonists, include neoplasms. It can be used to treat or detect hyperproliferative disorders. Galectin 11
Polypeptide or polynucleotide may inhibit the growth of the disorder through direct or indirect interactions. Alternatively, the galectin-11 polypeptide or polynucleotide may proliferate other cells that may inhibit hyperproliferative disorders.

For example, by increasing the immune response, in particular by increasing the antigenic quality of hyperproliferative disorders, or by T cell proliferation, differentiation, or recruitment.
Hyperproliferative disorders can be treated. This immune response may be elevated by either enhancing an existing immune response or initiating a new immune response. Alternatively, diminished immune response may also be a method of treating hyperproliferative disorders such as chemotherapeutic agents.

Examples of hyperproliferative disorders that may be treated or detected by a galectin-11 polynucleotide or polypeptide include, but are not limited to, neoplasms present in: abdomen, bone, breast, digestive system. , Liver, pancreas, prostate, peritoneum,
Endocrine glands (adrenal gland, parathyroid gland, pituitary gland, testis, ovary, thymus, thyroid), eyes, head and neck, nerves (central and peripheral), lymphatic system, pelvis, skin, soft tissue, spleen, chest, and Urogenital organs.

Similarly, other hyperproliferative disorders can also be treated or detected with galectin-11 polynucleotides or polypeptides. Examples of such hyperproliferative disorders include, but are not limited to, hypergammaglobulinemia, lymphoproliferative disorders, paraproteinemia, purpura, sarcoidosis, Sézary syndrome, Waldenström. Macroglobulinemia, Gaucher disease, histiocytosis, and any other hyperproliferative disease, as well as neoplasms found in the organ systems listed above.

Galectin-11 polypeptides or polynucleotides, including fragments, variants, derivatives and analogs of Galectin-11 as described herein, and Galectin-11 agonists and antagonists, treat infectious agents. Or it can be used to detect. For example, infectious diseases can be treated by increasing the immune response, particularly by increasing the proliferation and differentiation of B and / or T cells. The immune response can be elevated by either enhancing an existing immune response or initiating a new immune response. Alternatively, the galectin-11 polypeptide or polynucleotide may also directly inhibit the infectious agent without necessarily eliciting an immune response.

A virus is an example of an infectious agent that can cause a disease or condition that can be treated or detected by a galectin-11 polynucleotide or polypeptide.
Examples of viruses include, but are not limited to, the following families of DNA viruses and RNA viruses: arbovirus, adenovirus, arenavirus, arterivirus, birnavirus, bunyavirus, calici. Viridae, Sarcoviridae, Coronaviridae, Flaviviridae, Hepadnaviridae (hepatitis), Herpesviridae (
For example, cytomegalovirus, herpes simplex, herpes zoster, mononegavirus (M
oneonevirus (eg, Paramyxoviridae, Morbillivirus, Rhabdoviridae), Orthomyxoviridae (eg, influenza)
, Papovaviridae, Parvoviridae, Picornaviridae, Poxviridae (eg, smallpox or vaccinia), Reoviridae (eg, rotavirus), Retroviridae (HTLV-I, HTLV-II, lentivirus),
And Togaviridae (eg, Rubivirus). Viruses that fall within these families can cause a variety of diseases or conditions, including but not limited to: arthritis, bronchiolitis, encephalitis, ocular infections (
For example, conjunctivitis, keratitis, chronic fatigue syndrome, hepatitis (A type, B type, C type, E type,
Chronic activity, Delta), meningitis, opportunistic infections (eg AIDS), pneumonia, Burkitt lymphoma, chickenpox, hemorrhagic fever, measles, mumps, parainfluenza, rabies, common cold, polio, leukemia , Rubella, sexually transmitted diseases, skin diseases (eg, capouge, warts), and viremia. Galectin-11 polypeptides or polynucleotides can be used to treat or detect any of these conditions or diseases.

Similarly, bacterial or fungal agents that can cause a disease or condition and that can be treated or detected by Galectin 11 polynucleotides or Galectin II polypeptides include the following Gram-negative and Gram-positive bacteria and fungi Include, but are not limited to:

[0150]

[Table 2] These Bacterial or Fungal families can cause the following diseases or conditions, including, but not limited to, the following:
Bacteremia, endocarditis, ocular infections (conjunctivitis, tuberculosis, uveitis), gingivitis, opportunistic infections (eg AIDS related infections), periungual inflammation, prosthesis related infections, Reiter's disease, respiratory tract. Infectious diseases (eg, whooping cough or pyometra), sepsis, Lyme disease, cat scratch disease, dysentery, paratyphoid fever, food poisoning, typhoid, pneumonia, gonorrhea, meningitis, chlamydiosis, syphilis, diphtheria, leprosy, paratuberculosis, tuberculosis. , Lupus, botulism, tetanus, impetigo, rheumatic fever, scarlet fever, sexually transmitted diseases, skin diseases (eg cellulitis,
Dermatomycosis, toxemia, urinary tract infection, wound infection. Galectin-11 polypeptides or polynucleotides may be used to treat or detect any of these conditions or diseases.

In addition, parasitic agents that cause diseases or conditions that can be treated or detected by a galectin-11 polynucleotide or polypeptide include, but are not limited to, the following families: Amebiasis, Babes.
iosis, Coccidiosis, Cryptosporidiosis,
Dientamoebiasis, Dourine, Ectoparasiti
c, Giardiasis, Helminthiasis, Leishmani
assis, Theileriasis, Toxoplasmosis, Tryp
anosomias, and Trichomonas. These parasites can cause a variety of diseases or conditions including, but not limited to, scabies, worm disease, eye infections, intestinal infections (eg, Dysentery, giardiasis, liver disease, lung disease, opportunistic infections (eg, AIDS related), malaria, pregnancy complications (pregnancy c)
), and toxoplasmosis. Galectin-11 polypeptides or polynucleotides may be used to treat or detect any of these conditions or diseases.

Galectin-11 polynucleotides or polypeptides, including galectin-11 fragments, variants, derivatives, and analogs described herein, and galectin-11 agonists and antagonists, are used for tissue regeneration. The leading cells can be differentiated, proliferated and attracted. (Science 276
: 59-87 (1997). ) Using tissue regeneration, congenital defects,
Trauma (wound, burn, incision or ulcer), age-related disease (eg osteoporosis, osteoarthritis, periodontal disease, liver failure), surgery (including cosmetic surgery), fibrosis, Tissues damaged by reperfusion injury or systemic cytokine damage can be repaired, replaced, or protected.

Tissues that can be regenerated using the present invention include: organs (eg, pancreas, liver, intestine, kidney, skin, endothelium), muscle tissue (smooth muscle, skeletal muscle or myocardium).
, Vascular tissue (including vascular endothelium), neural tissue, hematopoietic tissue, and skeletal (eg, bone, cartilage, tendon, and ligament) tissue. Preferably, the regeneration produces scarring or reduced scarring. Regeneration can also include angiogenesis.

Further, galectin-11 polynucleotides or polypeptides, including galectin-11 fragments, variants, derivatives, and analogs described herein, as well as agonists and antagonists of galectin-11, are associated with difficult-to-heal tissues. Can increase the regeneration of. For example, increased tendon / ligament regeneration has faster recovery time after injury. The galectin-11 polynucleotides or polypeptides of the present invention may also be used in an effort to avoid injury. Specific diseases that can be treated include tendinitis, carpal tunnel syndrome, and other tendon defects or ligament injuries. Further examples of tissue healing of unhealed wounds include pressure ulcers, ulcers associated with valvular insufficiency, surgical wounds, and traumatic wounds.

Similarly, neural and brain tissue can also be regenerated by using galectin-11 polynucleotides or polypeptides to proliferate and differentiate neural cells. Diseases that can be treated using this method include those of the central and peripheral nervous system, neuropathy, or mechanical and traumatic disorders such as spinal cord injury, head trauma, cerebrovascular disease, and stroke. )). In particular, diseases associated with peripheral nerve injury, peripheral neuropathy (eg resulting from chemotherapy or other medical therapies), localized neuropathy, and central nervous system diseases (eg Alzheimer's disease, Parkinson's disease, Huntington chorea). disease,
Amyotrophic lateral sclerosis, and Shy-Drager syndrome) are all galectin-1
It can be treated with one polynucleotide or polypeptide.

Accordingly, in one aspect, the invention relates to a method for enhancing galectin-11-regulated apoptosis, cell proliferation, cell differentiation, or other cell proliferative activity, the method comprising increasing levels of increased levels. Administration of a Galectin-11 Polypeptide, Fragment, Variant, or Analog, or Agonist to a Individual In Need of Galectin-11 Functional or Biological Activity in a Therapeutic Effective Amount That Can Augment a Galectin-11-Mediated Cellular Response The step of performing is included. In certain embodiments, galectin-11-mediated signaling is increased to treat diseases that exhibit reduced apoptosis.

Given activity regulated by galectin-11, it is at normal or “normal” levels.
It is readily apparent that a substantially altered (increased or decreased) expression level of galectin 11 in an individual as compared to a "normal" level results in a pathological condition as described above. It will also be apparent to those skilled in the art that the galectin-11 polypeptides of the present invention exert a modulation of their activity on any of their target cells. Therefore, it is clear that conditions caused by a decrease in normal or normal levels of galectin 11 activity in an individual can be treated by administration of galectin 11 protein or an agonist thereof.

In addition to treating diseases associated with increased or decreased levels of galectin-11 activity, the present invention provides galectin-11 polypeptides or polynucleotides (fragments, variants, as described herein). Derivatives and analogs, as well as agonists and antagonists) to increase the biological activity associated with galectin-11.

[0159] For example, any method of increasing galectin concentration and / or activity can be used to stimulate hematopoiesis. Using these methods, the galectin-11 polypeptide and nucleotide sequences described herein can be used to stimulate hematopoiesis. In certain embodiments, galectin-11 polypeptides and polynucleotides are used in erythropoietin therapy, which is directed to assisting the oxygen carrying capacity of blood. Galectin-11 treatments within the scope of the present invention include, but are not limited to: patients generally in need of blood transfusion (eg, trauma victims, surgery patients, dialysis patients, and blood composition related disorders). (For example, hemophilia,
Cystic fibrosis, pregnancy, menstrual disorders, premature early anemia, spinal cord injury, space flight, aging,
Various non-neoplastic disease states, etc.)). Examples of patient conditions that are needed to support the oxygen carrying capacity of blood and are within the scope of the invention include, but are not limited to: blood characterized by hypoerythropoiesis or erythropoiesis deficiency. Treatment of disorders, anemia associated with chronic renal failure, stimulation of reticulocytes, development of iron kinetic effects (eg plasma ion turnover effects and bone marrow transit time effects), changes in red blood cell mass,
Stimulation of hemoglobin C synthesis and increased levels of hematocrit in vertebrates. The invention also provides treatments (eg, exposing an individual to hypoxia) to enhance an individual's oxygen carrying capacity.

The present invention also includes combinations of the galectin-11 polypeptides and polynucleotides described herein with other recommended or conventional hematopoietic therapies. Therefore, for example, galectin 11 is a compound that independently exhibits an erythropoiesis stimulating effect (eg, erythropoietin, testosterone, precursor cell stimulating factor, insulin-like growth factor, prostaglandin, serotonin, cyclic AMP,
Prolactin, and triiodothyzonin
e)). Also, compounds commonly used to treat aplastic anemia (eg, methenolene, stanozolol, and nandrolen); compounds commonly used to treat iron deficiency anemia (eg, iron preparations). ); Compounds commonly used to treat pernicious anemia (eg, vitamin B12 and / or folic acid); and compounds commonly used to treat hemolytic anemia (eg, adrenocortisol steroid (
For example, it can be combined with corticoids)). For example, Resegotti et al., 1981, Panminer Medica, 23: 243-248; K.
urtz, 1982, FEBS Letters, 14a: 105-108; M.
cGonigle et al., 1984, Kidney Int. , 25: 437-44.
4; and Pavlovic-Kantera, 1980, Expt. Hem
atol. 8 (Supplement 8) 283-291.

Compounds that enhance or synergize with the effects of erythropoietin are also useful as adjuvants herein, and these compounds are
Includes but is not limited to adrenergic agonists, thyroid hormones, androgens, hepatic erythropoietic factors, erythrotropins (erythr).
and erythrogenin (eg Dunn, “Current Concepts in Erythrop”).
Oasis, John Wiley and Sons (Chichester)
er, England, 1983); Weiland et al., 1982, Blut,
44: 173-175; Kalmani, 1982, Kidney Int. ,
22: 383-391; Shahidi, 1973, New Eng. J. Me
d. 289: 72-80; Urabe et al., 1979, J. Am. Exp. Med. ,
149: 1314-1325; Billat et al., 1982, Expt. Hema
tol. 10: 133-140; Naughton et al., 1983, Acta.
Haemat, 69: 171-179; Cognote et al., Abstract 364, Pro.
ceedings 7th Intl. Cong. of Endocrinol
ody (Quebec City, Quebec, July 1-7, 1984);
And Rothman et al., 1982, J. Am. Surg. Oncol. , 20:10
5-108).

The method of stimulating hematopoiesis includes administering to a patient a hematopoietic effective amount of a pharmaceutical composition containing galectin-11 (ie, an amount that results in the formation of blood cells). Galectin-11 is administered to a patient by any suitable technique including, but not limited to, parenteral, sublingual, topical, intrapulmonary, and intranasal, and these techniques are further described herein. To be done. The pharmaceutical composition optionally comprises one or more members of the group consisting of: erythropoietin, testosterone, precursor cell stimulator, insulin-like growth factor, prostaglandin, serotonin, cyclic AMP. , Prolactin, triiodothyronine (t
riodothyzoneine), methenolene,
Stanozolol, and nandrolone, iron preparations, vitamin B12, folic acid and / or corticosteroids. Galectin 11 and cotreatment
nt) The drug is suitably delivered by separate or the same route of administration and at the same time or at different times, eg depending on the medication, the clinical condition of the patient, etc.

Several approaches are available for treatment of abnormal conditions associated with underexpression of galectin-11 and its activity, or for treatments where elevated or decreased levels of galectin-11 are desired. One approach is to provide an isolated galectin-11 polypeptide, fragment, variant, derivative or analog of the invention, or a compound that activates galectin-11 to an individual in need of increased levels of galectin-11 in the body. Administering a therapeutically effective amount of (ie, an agonist as described above), optionally in combination with a pharmaceutically acceptable carrier. Alternatively, gene therapy can be used to effect the endogenous production of galectin-11 by the relevant cells in the subject. For example,
The polynucleotides of the present invention can be engineered for expression in replication defective retroviral vectors using techniques known in the art. The retroviral expression construct can then be isolated and RNA encoding the polypeptide of the invention.
Can be introduced into a packaging cell that has been transduced with a retroviral plasmid vector containing H. These producer cells can be engineered into cells in vivo and administered to a subject for expression of the polypeptide in vivo. For a review of gene therapy, see Gene Therapy and
other Molecular Genetic-based Thera
pecular Approaches, Chapter 20 (and references therein), Human Molecular Genetics, T Stracha.
n and A P Read, BIOS Scientific Publish
See ers Ltd (1996).

Further, the treatment can be administered, for example, in the form of gene replacement therapy. In particular, one or more copies of the galectin-11 nucleotide sequence of the present invention, which directs the production of a normal functioning galectin-11 product, is transferred to other particles (eg, liposomes, and genes) that introduce DNA into cells. In addition to the activation matrix), vectors can be inserted into appropriate cells in a patient or animal subject using vectors including, but not limited to: adenovirus, adeno-associated virus, retrovirus and herpes virus. vector. Since the gene for galectin-11 is expressed in neutrophils, such gene replacement techniques should be able to deliver the galectin-11 gene sequence to these cells in the patient, or the sequence of the galectin-11 gene expressed. Direct administration of such galectin 11 polynucleotide sequences to the site of cells to be administered should be included. Alternatively, targeted homologous recombination may be utilized to correct the defective endogenous galectin 11 gene and / or its regulatory sequences (eg, promoter and enhancer sequences), or to other genes in appropriate tissues or cell types. It stimulates the activity of galectin 11 in the resting state.
rn on) ”.

Additional methods that can be utilized to increase the overall level of galectin-11 expression and / or galectin-11 activity are provided to patients in a location and number sufficient to ameliorate abnormal conditions in cell growth regulation. Introducing appropriate galectin-11 expressing cells, preferably autologous cells of Such cells can be either recombinant or non-recombinant. Among the cells that can be administered to increase the overall level of galectin 11 gene expression in a patient are normal cells that express the galectin 11 gene. Cell-based gene therapy techniques are well known to those of skill in the art. See, eg, Anderson et al., US Pat. No. 5,399,349; and Mulligan and Wilson, US Pat. No. 5,460,959.

If the activity of galectin-11 is in excess, several approaches are utilized to reduce or inhibit the activity of galectin-11 with molecules derived from the above-described polypeptide and polynucleotide sequences. Accordingly, a further aspect of the present invention relates to a method of treating an individual in need of reduced levels of galectin-11 activity in the body, which comprises the galectin-11 of the present invention acting on such an individual as an antagonist of galectin-11. Administering a composition comprising a therapeutically effective amount of a polypeptide, fragment, variant, derivative or analog, optionally in combination with a pharmaceutically acceptable carrier. Preferably,
Galectin-11 activity is reduced to treat diseases in which increased apoptosis or other cell proliferative activity regulated by galectin-11 is demonstrated. The polypeptides, derivatives, variants and analogs of the present invention that function as galectin-11 antagonists can generally be identified using the assays described below and other techniques known in the art. A preferred antagonist for use in the present invention is a galectin-11 specific antibody.

Accordingly, one embodiment of the invention provides, for example, an antibody or fragment of the invention, with an amount of a pharmaceutically acceptable carrier effective to suppress (ie reduce) galectin-11 activity, Administering to the subject an inhibitor compound (antagonist), such as a variant, derivative or analog.

In another approach, galectin-11 activity can be reduced or inhibited by decreasing the expression level of the galectin11 gene. In one embodiment, this is accomplished through the use of antisense sequences, either internally generated or administered separately (eg, O'Connor, J. Neuro.
chem. (1991) 56: 560, Oligodeoxynucleoti.
des as Antisense Inhibitors of Gene
Expression, CRC Press, Boca Raton, FL (1
988)). Antisense technology can be used to regulate gene expression through antisense DNA or RNA, or through triple helix formation. Antisense technology is described, for example, in Okano, J. et al. Neurochem. 5
6: 560 (1991); Oligodeoxynucleotides as
Antisense Inhibitors of Gene Express
Sion, CRC Press, Boca Raton, FL (1988). Triple helix formation is described, for example, in Lee et al., Nucleic A.
cids Research 6: 3070 (1979); Cooney et al., S.
science 241: 456 (1988); and Dervan et al., Scie.
nce 254: 1360 (1991). These methods are
It is based on the binding of polynucleotides to complementary DNA or RNA. For example, the 5 ′ coding portion of the polynucleotide encoding the galectin-11 polypeptide of the invention can be used to design an antisense RNA oligonucleotide of about 10-40 base pairs in length. DNA oligonucleotides are designed to be complementary to regions of the gene involved in transcription, thereby inhibiting the transcription and production of galectin-11 polypeptide. Antisense RNA oligonucleotides are
It hybridizes to RNA and blocks the translation of mRNA molecules into polypeptides.

In one embodiment, the galectin-11 antisense nucleic acids of the invention are produced intracellularly by transcription from an exogenous sequence. For example, the vector or a portion thereof is transcribed to produce the antisense nucleic acid (RNA) of the invention. Such a vector contains a sequence encoding a galectin-11 antisense nucleic acid. Such a vector may remain episomal or become chromosomally integrated, as long as it is transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art. The vector is
It may be a plasmid, virus, or other vector known in the art used for replication and expression in vertebrate cells. Expression of the galectin-11 coding sequence or fragments thereof may be by any promoter known in the art to act in vertebrate, preferably human cells. Such promoters can be inducible or constitutive. Such promoters include, but are not limited to, the SV40 early promoter region (B
ernoist and Chamber, Nature 29: 304-310 (
1981)), the 3'long terminal repeat of Rous sarcoma virus (Yamamoto et al., C).
ell 22: 787-797 (1980)), herpes thymidine promoter (Wagner et al., Proc. Natl. Acad. Sci. USA 78).
1441-1445 (1981)), the regulatory sequence of the metallothionein gene (B
promoters included in Linster et al., Nature 296: 39-42 (1982)).

The antisense nucleic acid of the present invention contains a sequence complementary to at least a part of the RNA transcript of galectin-11 gene. However, absolute complementarity is preferred but not required. A sequence “complementary to at least a portion of RNA” as referred to herein means a sequence that has sufficient complementarity to hybridize with RNA to form a stable duplex. Thus, in the situation where the galectin 11 antisense nucleic acid is double stranded, a single strand of double stranded DNA can be tested or triplex formation can be assayed. The ability to hybridize depends on both the degree of complementarity and the length of the antisense nucleic acid. In general, the larger the hybridizing nucleic acid, the more base mismatches with the galectin 11 RNA, which can include stable duplexes (or triplexes in some cases) and can still form. One of ordinary skill in the art can ascertain a considerable degree of mismatch by using standard means to determine the melting point of the hybridized complex.

Potential galectin antagonists according to the present invention also include catalytic RNA, ie ribozymes (eg PCT International Publication WO 90/11364 (1990).
October 4, published); Sarver et al., Science 247: 1222-1.
225 (1990)). Ribozymes that cleave mRNAs at site-specific recognition sequences can be used to disrupt galectin 11 mRNA, although the use of hammerhead ribozymes is preferred. Hammerhead-type ribozymes produce mRNAs at positions dictated by flanking regions that form complementary base pairs with the target mRNA.
Disconnect NA. The only requirement is that the target mRNA has the following two base sequence:
5'-UG-3 '. Construction and production of hammerhead ribozymes are well known in the art, and Haseloff and Gerlach
, Nature 334: 585-591 (1988). Many potential hammerhead ribozyme cleavage sites are present within the galectin 11 nucleotide sequence (FIG. 1; SEQ ID NO: 1). Preferably, the ribozyme is engineered so that its cleavage recognition site is located near the 5'end of galectin-11 mRNA; ie, it increases efficiency and minimizes intracellular accumulation of non-functional mRNA transcripts. To do. The DNA construct encoding the ribozyme can be introduced intracellularly in the same manner as described above for the introduction of antisense-encoding DNA. Ribozymes, unlike antisense molecules, are catalytic, so lower intracellular concentrations are required for efficiency.

Endogenous galectin-11 gene expression is also associated with targeted homologous recombination (eg, Sm
ities et al., Nature 317: 330-234 (1985); Tho
Mas et al., Cell 51: 503-512 (1987); Thompson et al., Cell 5: 313-321 (1989), each of which is incorporated herein by reference in its entirety). Using galectin 11
It can be reduced by inactivating or "knocking out" the gene or its promoter. Such an approach can be applied for use in humans when the recombinant DNA construct is directly administered or targeted to the required site in vivo using a suitable viral vector.

Alternatively, endogenous galectin-11 gene expression is complementary to the regulatory region of the galectin-11 gene (ie, the galectin-11 promoter and / or enhancer) and interferes with transcription of the galectin-11 gene in target cells in the body. It can be reduced by targeted deoxyribonucleotide sequences that form a helical structure. Generally, Helene et al., Ann, N. et al. Y. Acad. Sci. 660: 2
7-36 (1992); Helene, C .; , Anticancer Drug
Des. , 6 (6): 569-584 (1991); and Maher, L .;
J. , Bioassays 14 (12): 807-815 (1992).

In yet another embodiment of the invention, the activity of galectin-11 can be reduced using "dominant negative". To this end, defective galectin 11
Constructs, such as mutants that delete all or part of the region of galectin-11 that binds β-galactoside, are used to abolish the activity of galectin-11 on appropriate target cells. It can be used in a therapeutic approach.
For example, a nucleotide sequence that directs host cell expression of galectin 11 in which all or part of the β-galactoside-binding galectin 11 region is modified or deleted may be neutrophil cells, or other galectin 11-expressing nucleotide sequences. Cells or tissues (eg, by any of the in vivo or ex vivo gene therapy methods as described herein). Alternatively, targeted homologous recombination can be utilized to introduce such deletions or mutations into the subject's endogenous galectin-11 gene in neutrophils or other cells expressing galectin-11.

Formulation and Administration Symptoms caused by a decrease in normal or normal levels of galectin-11 activity in an individual may be associated with galectin-11 polypeptides of the invention, or fragments, variants, derivatives, or analogs or agonists thereof. It is understood that administration can be treated. Accordingly, the invention further provides a method of treating an individual in need of increased levels of galectin-11 activity, which method allows such an individual to increase the level of galectin-11 activity in such an individual. Valid,
The step of administering a pharmaceutical composition comprising an effective amount of an isolated galectin-11 polypeptide or fragment, variant, derivative, or analog of the invention (eg, such as the full-length form of galectin-11).

The dosage range required depends on the choice of peptide, the route of administration, the nature of the formulation, the nature of the subject's condition, and the judgment of the attending physician. As a general proposition, the total pharmaceutically effective amount of galectin-11 polypeptide administered parenterally per dose is
It ranges from about 1 μg / kg / day to 10 mg / kg / day of the patient's body weight, but as described above, this is therapeutically determined arbitrarily. More preferably, this dose is at least 0.01 mg / kg / day, and most preferably for humans, this dose is in the range of 0.1-100 mg / kg of subject, or about 0. 0
The range is between 1 mg / kg / day and 1 mg / kg / day. When given continuously, galectin 11 polypeptide is typically administered at a dosage rate of about 1 μg / kg / hour to about 50 μg / kg / hour, which is by injection 1 to 4 times per day. Or by continuous subcutaneous infusion using, for example, a minipump. Intravenous bag solution may also be used. However, the wide variation in dosage required is expected in view of the variety of compounds available and the different efficiencies of various routes of administration. For example, oral administration would be expected to require higher dosages than administration by intravenous injection. Changes in these dosage levels can be adjusted using standard empirical conventions for optimization and are well understood by those of ordinary skill in the art.

Pharmaceutical compositions comprising the galectin-11 polypeptides and polynucleotides of the present invention (including fragments, variants, derivatives or analogs) and galectin-11 agonists and antagonists are combined with a pharmaceutically acceptable carrier. Be customarily prescribed. "Pharmaceutically acceptable carrier" means any type of non-toxic solid, semisolid or liquid excipient, diluent, encapsulating material or formulation auxiliary. In certain embodiments, "pharmaceutically acceptable"
By means approved by the federal or state regulatory agency or listed in the US Pharmacopeia or other generally recognized pharmacopeias for use in animals, and more particularly in humans. A non-limiting example of a suitable pharmaceutical carrier according to embodiments of the present invention is E. W. "Remingto" by Martin
n's Pharmaceutical Sciences "and includes sterile liquids such as water, saline, buffered saline, glycerol, ethanol, and oils (oils of petroleum, animal, vegetable or synthetic origin ( For example, peanut oil, soybean oil, mineral oil, sesame oil, etc.))) are included. The formulation is suitable for the mode of administration and is well within the skill of the art. For example, water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline and aqueous dextrose and glycerol solutions can be used as liquid carriers, especially for injectable solutions. The invention further relates to pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the above compositions of the invention.

The polypeptides and other compounds of the invention can be administered alone or in combination with other compounds (eg, therapeutic compounds). The pharmaceutical compositions of the present invention may be orally, rectally, parenterally, intracystically, vaginal, intraperitoneal, topical (eg, by powder, ointment, drops or transdermal patch), buccal, Or it may be administered as an oral spray or an intranasal spray. The preferred form of systemic administration of the pharmaceutical composition is typically by intravenous injection,
Parenteral injection is mentioned. Other injection routes can be used, such as subcutaneous, intramuscular, substernal, intraarticular or intraperitoneal. Alternative methods for systemic administration include transmucosal and transdermal administration using penetrants such as bile salts or fusidic acids, or other surfactants. In addition, oral administration may also be possible when properly formulated in the enteral or capsule formulation. Administration of these compounds may also be topical and / or localized in the form of ointments, pastes, gels and the like.

Polypeptides used in treatment can also be generated endogenously in the subject, in treatment modalities often referred to as "gene therapy" as described above. Thus, for example, a subject-derived cell is a polynucleotide encoding a polypeptide ex vivo (
(Eg, DNA or RNA), and this is, for example, by the use of retroviral plasmid vectors. The cells are then introduced into the subject.

Chromosome Assays Nucleic acid molecules of the invention also serve for chromosome identification. This sequence is
It is specifically targeted to and can hybridize with a particular location on one chromosome. The mapping of DNA to chromosomes according to the present invention is an important first step in correlating these sequences with genes associated with disease.

Since the galectin 11 gene has been mapped to a precise chromosomal location, the physical location on the chromosome of its sequence can be correlated with genetic map data. Such data is, for example, V. McKusick, Mendelian In
heritance In Man (Johns Hopkins Unive
Rsity, available online through Welch Medical Library). The relationship between genes and diseases that have been mapped to the same chromosomal region is then analyzed by linkage analysis (co-inheritance of physically adjacent genes (c
inheritance)).

Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in normal individuals, then the mutation appears to be the cause of the disease.

Although the present invention has been generally described, the present invention will be more readily understood by reference to the following examples, which are provided by way of illustration and are not limiting. Not intended.

Example 1 Expression and Purification of Galectin 11 in E. coli The DNA sequence encoding the galectin 11 protein in the deposited cDNA clone was replaced by the amino terminal sequence of galectin 11 protein and vector sequence 3 'Amplify with a PCR oligonucleotide primer specific for that gene. Additional nucleotides, including restriction sites to facilitate cloning, are added to the 5'and 3'sequences, respectively.

The oligonucleotide primer for 5'Galectin 11 has the sequence 5'cgc CC ATGG ATGAGCCCCAGGCTGGAGGTG 3 '(SEQ ID NO: 5) (this is the underlined NcoI restriction site and the Galectin 11 nucleotide sequence described in FIG. (Comprising nucleotides 49-69 of number 1)).

The primer for 3 ′ galectin 11 has the sequence 5′cgc AAGCTT TCAGG
AGTGGACACAGTAG3 ′ (SEQ ID NO: 6) (this is underlined Hi
The ndIII restriction site is followed by the galectin 11 nucleotide sequence described in Figure 1 (comprising nucleotides complementary to positions 431-451 of the SEQ ID NO: 1).

This restriction site is compatible with the restriction enzyme sites in the bacterial expression vector pQE60. This pQE60 is used for bacterial expression in these examples. (Qiagen, Inc. 9259 Eton Avenue, Ch.
atsworth, CA, 91311). pQE60 encodes ampicillin antibiotic resistance ("Amp ^r "), and the bacterial origin of replication ("ori"), IP
It contains a TG inducible promoter, a ribosome binding site ("RBS"), a 6-His tag and a restriction enzyme site.

The amplified galectin 11 DNA and pQE60 vector are digested with NcoI and HindIII, then the digested DNA is ligated together. Insertion of the galectin-11 polypeptide DNA into the restriction digested pQE60 vector positions the galectin-11 polypeptide coding region downstream of and operably linked to the vector's IPTG-inducible promoter, and It is placed in frame with the initiation AUG, which is properly positioned for transcription of galectin 11.

The ligation mixture was transformed into competent E. coli using standard procedures. E. coli cells. Such procedures are described in Sambrook et al., Molecular C.
longing: A Laboratory Manual, 2nd edition; Cold
Spring Harbor Laboratory Press, Cold
Spring Harbor, N.M. Y. (1989). E.
E. coli strain M15 / rep4, which contains multiple copies of the plasmid pREP4, which expresses the lac repressor and confers kanamycin resistance (“Kan ^r ”). Perform the described example. This strain is just one of many that are suitable for expressing the galectin 11 protein and is commercially available from Qiagen.

Transformants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA is confirmed by restriction analysis.

Clones containing the desired construct were treated overnight (O / N) with ampicillin (100 μg /
ml) and kanamycin (25 μg / ml) are both grown in liquid cultures in LB medium.

O / N cultures are used at a dilution of approximately 1: 100 to 1: 250 to inoculate large cultures. The cells were examined for optical density at 600 nm between 0.4 and 0.6 (“OD6
00 "). Isopropyl-BD-thiogalactopyranoside (“IPTG”) is then added at a final concentration of 1 mM to inactivate the lacI repressor, thereby inducing transcription from the lac repressor-sensitive promoter. The cells are then incubated for an additional 3-4 hours. The cells are then harvested by centrifugation and disrupted by standard methods. Inclusion bodies are purified from disrupted cells using conventional harvesting techniques and proteins are solubilized from the inclusion bodies to 8M urea. This 8M urea solution containing the solubilized polypeptide was passed through a PD-10 column in 2x phosphate buffered saline ("PBS"), thereby removing urea and exchanging the buffer. , And allow the protein to refold. The polypeptide is purified by a further step of chromatography to remove endotoxin. Then, it is sterilized by filtration.
The filter sterilized protein preparation was stored in 2 × PBS at a concentration of 95 μg / ml.

Example 2 Cloning and Expression of Galectin-11 Protein in Baculovirus Expression System cD encoding the full-length galectin-11 protein in the deposited clone.
The NA sequence is amplified with PCR oligonucleotide primers corresponding to the 5'and 3'sequences of this gene.

The 5'Galectin 11 oligonucleotide primer has the sequence 5'cgc CCC GGG GCCTATGAGCCCCAGGCTGGAGG 3 '(SEQ ID NO: 7) (
It has an underlined SmaI restriction site and nucleotides 49 to 66 of the galectin 11 nucleotide sequence shown in Figure 1 (SEQ ID NO: 1).

The 3'Galectin 11 primer has the sequence 5'cgc GGTACC TCAGGA.
GTGGACACAGTAG3 '(SEQ ID NO: 8) (this is the underlined Asp
The 718 restriction site is followed by the galectin 11 nucleotide sequence shown in Figure 1 (comprising nucleotides complementary to nucleotide positions 432-450 of SEQ ID NO: 1).

Efficient signals for initiation of translation in eukaryotic cells (Kozak, M
． J. Mol. Biol. 196: 947-950 (1987)) is appropriately placed in the vector portion of this construct.

The amplified fragment was transferred from a 1% agarose gel to a commercially available kit (“Gen
clean ", BIO101 Inc. , La Jolla, Ca. ) Is used for isolation. This fragment is then digested with XbaI and again 1%
Purify on agarose gel. This fragment is designated herein as F2.

Galectin 11 protein was quantified by the method of Summers et al. (“A Manual of Meth” in a baculovirus expression system using the vector pA2-GP.
ods for Baculovirus Vectors and Inse
ct Cell Culture Procedures ", Texas Ag
rural Experimental Station Bull
etin No. Expression is performed using the standard method described in 1555 (1987)). This expression vector is an Autographa californi.
It contains the strong polyhedrin promoter of the ca nuclear polyhedrosis virus (AcMNPV), followed by convenient restriction sites. The signal peptide of AcMNPV gp67, which contains the N-terminal methionine, is located just upstream of the BamHI site. The simian virus 40 (“SV40”) polyadenylation site is used for efficient polyadenylation. For easy selection of recombinant virus, the plasmid was engineered into E. coli in the same orientation as the polyhedrin promoter. The β-galactosidase gene from E. coli is inserted, followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequence is flanked on both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA to produce viable virus expressing the cloned polynucleotide.

Many other baculovirus vectors (eg pAc373, pVL941)
, And pAcIM1) are signals that the construct is appropriately positioned for transcription, translation, transport, etc. (eg, if required, as one of skill in the art will readily appreciate).
PA as long as it provides a signal peptide and an in-frame AUG)
It can be used instead of 2-GP. Such a vector is, for example, Lucco.
W et al., Virology 170: 31-39.

This plasmid was digested with the restriction enzyme SmaI using conventional procedures known in the art.
And Asp718 and then dephosphorylated using calf intestinal phosphatase. This DNA was then added to a commercially available kit ("Geneclean" BIO
101 Inc. , La Jolla, Ca), and is isolated from a 1% agarose gel. This vector DNA is designated herein as V2.

Fragment F2 and dephosphorylated plasmid V2 are ligated together using T4 DNA ligase. E. E. coli HB101 cells are transformed with the ligation mixture and spread on culture plates. Bacteria containing plasmids containing the human galectin 11 gene are identified by digesting DNA from individual colonies with XbaI and then analyzing the digestion products by gel electrophoresis. The sequence of the cloned fragment is confirmed by DNA sequencing.
This plasmid is designated herein as pBacgalectin11.

5 μg of the plasmid pBacgalectin11 was added to Felgner et al.,
Proc. Natl. Acad. Sci. USA 84: 7413-7417.
1.0 μg using the lipofection method described by (1987).
Commercially available linearized baculovirus DNA (“BaculoGold bacul
ovirus DNA ", Pharmingen, San Diego, CA.
) And co-transfection with. 1 μg of BaculoGold virus DNA and 5 μg of plasmid pBacgalectin11 were added to 50 μl of serum-free Grace's medium (Life Technologies Inc., Gai).
(thersburg, MD) in a sterile well of a microtiter plate. Afterwards 10 μl Lipofectin plus 90 μl Grace's medium are added, mixed and incubated for 15 minutes at room temperature. The transfection mixture is then added dropwise to Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace's medium without serum. The plate is rocked back and forth to mix the newly added solution. The plate is then incubated at 27 ° C for 5 hours. After 5 hours, the transfection solution is removed from the plate and 1 ml Grace's insect medium supplemented with 10% fetal bovine serum is added. The plate is returned to the incubator and the culture is continued at 27 ° C for 4 days.

Supernatants are collected after 4 days and plaque assayed as described by Summers and Smith, supra. "Blue Gal" (Life Tec
hnologies Inc. , Gaithersburg) is used to allow easy identification and isolation of gal expressing clones (resulting in blue colored plaques). (A detailed description of this type of "plaque assay" can also be found in Life Technologies Inc., Ga.
It can be found on pages 9-10 in the user guide for insect cell culture and baculovirology, distributed by Itersburg).

Four days after serial dilution, the virus is added to the cells. After proper incubation, blue colored plaques are picked up with the tip of an Eppendorf pipette. The agar containing the recombinant virus was then added to Ep containing 200 μl Grace's medium.
Resuspend in a pendorf tube. The agar is removed by a brief centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm dishes. After 4 days, the supernatants of these culture dishes are collected and then stored at 4 ° C. HESSB I, II and I inserted appropriately
Clones containing II are identified by DNA analysis including restriction mapping and sequencing. This is referred to herein as V-galactin 11.

Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS. The cells are infected with recombinant baculovirus V-Galectin 11 at a multiplicity of infection of about 2 (about 1 to about 3). After 6 hours, the medium was removed, and SF900II medium containing no methionine and cysteine (Life Technology) was added.
s Inc. , Available from Gaithersburg). After 42 hours, 5 μCi of ³⁵ S-methionine and 5 μCi of ³⁵ S-cysteine (Amer
(available from sham). Cells are cultured for a further 16 hours, then harvested by centrifugation, lysed and labeled proteins visualized by SDS-PAGE and autoradiography.

Example 3 Cloning and Expression in Mammalian Cells Most of the vectors used to transiently express the galectin-11 polypeptide gene sequence in mammalian cells replicate SV40. Should have a starting point. This allows replication of the vector up to high copy numbers in cells that express the T antigen required for initiation of viral DNA synthesis (eg, COS cells). Any other mammalian cell can also be used for this purpose.

[0207] A typical mammalian expression vector contains promoter elements that mediate the initiation of mRNA transcription, protein coding sequences, and signals necessary for termination of transcription and polyadenylation of the transcript. As an additional element, Ko
Included are zak sequences and intervening sequences flanked by RNA splicing donors and acceptors. High-efficiency transcription is achieved by SV40-derived early and late promoters, retroviruses (eg, RSV, HTLV).
I, HIVI) -derived long terminal repeat (LTR), as well as cytomegalovirus (
CMV) early promoter. However, cellular signals (
The human actin promoter, for example) can also be used. Expression vectors suitable for carrying out the present invention include, for example, pSVL and pMSG (Phar).
macia, Uppsala, Sweden), pRSVcat (ATCC 3
7152), pSV2dhfr (ATCC 37146) and pBC12M.
I (ATCC 67109). Mammalian host cells that can be used include human HeLa, 283, H9 and Jurkat cells, mouse NIH.
3T3 and C127 cells, Cos1, Cos7 and CV1, African green monkey cells, quail QC1-3 cells, mouse L cells and Chinese hamster ovary cells.

Alternatively, the gene can be expressed in stable cell lines containing the gene integrated into a chromosome. Co-transfection with selectable markers such as dhfr, gpt, neomycin, hygromycin allows the identification and isolation of transfected cells.

The transfected gene can also be amplified and overexpressed the encoded protein. DHFR (dihydrofolate reductase) is a useful marker for the development of cell lines that carry hundreds or thousands of copies of the gene of interest. Another useful selectable marker is the enzyme glutamine synthase (GS) (Murph
y et al., Biochem J. et al. 227: 277-279 (1991); Bebbi.
ngton et al., Bio / Technology 10: 169-175 (199).
2)). These markers are used to grow mammalian cells in selective medium and select the cells with the highest resistance. These cell lines contain the amplified gene integrated into the chromosome. Chinese hamster ovary (C
HO) cells are often used in protein production.

The expression vectors pC1 and pC4 represent the Rous sarcoma virus strong promoter (LTR) (Cullen et al., Molecular and Cellula).
r Biology, 438-4470 (March, 1985)), and C.
MV enhancer (Boshart et al., Cell 41: 521-530 (19
85)) fragment. Multiple cloning sites (eg BamH
I, XbaI and Asp718 restriction enzyme cleavage sites) facilitate cloning of the gene of interest. This vector also contains three introns of the rat preproinsulin gene, a polyadenylation signal and a termination signal.

(Example 3 (a): Cloning and Expression in COS Cells) The expression plasmid pgalectin11, the cDNA encoding galectin-11, and the expression vector pcDNAI / Amp (Invitrogen, I) were used.
nc. (More available).

The expression vector pcDNAI / amp contains the following: (1) E. E. coli, effective for growth in E. coli and other prokaryotic cells. origin of replication of E. coli; (
2) Ampicillin resistance gene for selection of plasmid-containing prokaryotic cells; (3) SV40 origin of replication for growth in eukaryotic cells; (4) cDNA by restriction site of polylinker. , A CMV promoter, polylinker, S, which may be conveniently placed under expression control of the CMV promoter and operably linked to the SV40 intron and polyadenylation signal
V40 intron, and polyadenylation sequence.

Galectin 11 protein and HA fused in-frame at its 3'end
The DNA fragment encoding the tag is cloned into the polylinker region of the vector so that recombinant protein expression is directed by the CMV promoter. The HA tag is described by Wilson et al. (Cell 37: 767 (1984)).
Corresponds to the epitope from the influenza hemagglutinin protein described by. Fusion of the HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.

The strategy for plasmid construction is as follows. The galectin 11 cDNA of the deposited clone was cloned into E. For construction of the expression vector for expression of galectin 11 in E. coli, amplification is carried out using primers containing convenient restriction sites as fully described above. To facilitate the detection, purification and characterization of the expressed galectin 11, one of the primers contains a hemagglutinin tag (“HA tag”) as described above.

Suitable primers used in this example include:
The 5'Galectin 11 primer has the sequence

[0216]

[Chemical 4] (SEQ ID NO: 9) and includes the underlined SmaI restriction enzyme site followed by nucleotide sequences 49-66 of FIG. 1 (SEQ ID NO: 1).

[0217]   The 3'Galectin 11 primer has the sequence

[0218]

[Chemical 5] (SEQ ID NO: 8), and an Asp718 restriction enzyme site, followed by nucleotides 432 to 432 of the nucleotide sequence of galectin 11 set forth in FIG. 1 (SEQ ID NO: 1).
It contains a nucleotide complementary to 450.

PCR amplified DNA fragment and vector pcDNAI / Amp
Digest with indIII and XhoI and ligate. This ligation mixture was transformed into E. E. coli SURE strain (Stratagene Cloning Sy
stems, 11099 North Torrey Pines Road,
La Jolla, CA 92037) and the transformed cultures are plated on ampicillin medium plates and then incubated to grow ampicillin resistant colonies. Plasmid DNA
Are isolated from resistant colonies and tested for the presence of fragments encoding galectin-11 by restriction analysis and size fractionation on gels.

For expression of recombinant galectin 11, DEAE-DEXTRA as described above.
Using N (eg, Sambrook et al., MOLECULAR CLONI
NG: A LABORATORY MANUAL, Cold Spring L
Laboratory Press, Cold Spring Harbor, N
ew York (1989)), COS cells are transfected with the expression vector. The cells are incubated under conditions for the expression of galectin-11 by the vector.

The expression of galectin 11 HA fusion protein was radiolabeled and immunoprecipitated (
For example, Harlow et al., ANTIBODIES: A LABORATORY
MANUAL, 2nd Edition; Cold Spring Harbor Labora
tory Press, Cold Spring Harbor, New Yo
rk (1988)). For this purpose, 2 days after transfection, the cells are labeled by incubating in medium containing ³⁵ S-cysteine for 8 hours. The cells and medium were collected and the cells were washed and washed with RIPA buffer containing detergent (150 mM NaCl, 1% as described by Wilson et al., Cited above).
NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50m
Dissolve using MTRIS, pH 7.5). Proteins are precipitated from cell lysates and culture media using HA-specific monoclonal antibodies. next,
The precipitated protein is analyzed by SDS-PAGE gel and autoradiography. Expression products of the expected size are found in cell lysates. An expression product of this expected size is not found in the negative control.

Example 3 (b): Cloning and Expression in CHO Cells Vector pC1 is used for expression of galectin 11 protein. Plasmid pC1 is plasmid pSV2-dhfr [ATCC Deposit No. 37146].
Is a derivative of. Both plasmids contain the mouse DHFR gene under the control of the SV40 early promoter. Chinese hamster ovary cells or other cells lacking dihydrofolate activity, transfected with these plasmids, were transfected with selective media (α-min, MEM, Life T) supplemented with the chemotherapeutic agent methotrexate.
can be selected by growth of the cells in technologies). Amplification of the DHFR gene in cells that are resistant to methotrexate (MTX) is well documented (eg, Alt, FW, Kellems, RM, Bertino,
J. R. , And Schimke, R .; T. , 1978, J .; Biol. Che
m. 253: 1357-1370, Hamlin, J .; L. And Ma, C.I. ,
1990, Biochem. et Biophys. Acta. 1097: 10
7-143, Page, M.S. J. And Sydenham, M .; A. 1991,
Biotechnology Volume 9: 64-68). Proliferation of cells in increasing concentrations of MTX resulted in D, the target enzyme, as a result of amplification of the DHFR gene.
It results in drug resistance due to overexpression of HFR. When the second gene is linked to the DHFR gene, that gene is usually co-amplified and overexpressed. Development of cell lines carrying more than 1,000 copies of the gene
This is the state of the art in this field. Subsequently, when the methotrexate is removed, the cell line contains the amplified gene integrated into the chromosome.

The plasmid pC1 contains a strong promoter of the Rous sarcoma virus long terminal repeat (LTR) (Cullen et al., Molcu) for expression of the gene of interest.
lar and Cellular Biology (March, 1985:
438-4470)), and fragments isolated from enhancers of the human cytomegalovirus (CMV) immediate-early gene (Boshart et al., Cell.
41: 521-530, 1985). Downstream of the promoter is followed by a single restriction enzyme cleavage site allowing integration of the gene: BamHI, Pv.
uII, and NruI. After these cloning sites, the plasmid contains a translation stop codon in all three reading frames, followed by the three introns of the rat preproinsulin gene and a polyadenylation site. Other high efficiency promoters may also be used for expression (eg, human actin promoter, SV40 early or late promoters, or long terminal repeats from other retroviruses such as HIV and HTLVI). Other signals for polyadenylation of mRNA, such as from the human growth hormone or globin gene, can also be used.

Stable cell lines carrying the gene of interest integrated into the chromosome also have gpt
, G418 or hygromycin can be selected for during co-transfection with a selectable marker. Initially, it is advantageous to use more than one selectable marker (eg G418 and methotrexate).

Plasmid pC1 is digested with the restriction enzyme BamHI and then dephosphorylated using calf small intestinal phosphatase by procedures known in the art.
The vector is then isolated from a 1% agarose gel.

The DNA sequence encoding Galectin 11 (ATCC Deposit No. 209053) is amplified using PCR oligonucleotide primers corresponding to the 5'and 3'sequences of the gene.

[0227]   The 5'Galectin 11 primer has the sequence

[0228]

[Chemical 6] (SEQ ID NO: 9) and includes the underlined SmaI restriction enzyme site followed by nucleotide sequences 49-66 of FIG. 1 (SEQ ID NO: 1). When inserted into an expression vector, as described below, the 5'of the amplified fragment encoding human galectin 11
The terminus provides an efficient signal peptide. Efficient signals for translation initiation in eukaryotic cells have been described by Kozac, M. et al. J. Mol. Biol. 196: 9
Appropriately located in the vector portion of the construct as described in 47-950 (1987).

[0229]   The 3'Galectin 11 primer has the sequence

[0230]

[Chemical 7] (SEQ ID NO: 8), and an Asp718 restriction enzyme site, followed by nucleotides 432 to 432 of the nucleotide sequence of galectin 11 set forth in FIG. 1 (SEQ ID NO: 1).
It contains a nucleotide complementary to 450.

The amplified fragment is isolated from a 1% agarose gel as described above, then digested with the endonucleases SmaI and Asp718, then purified again on a 1% agarose gel.

Next, the isolated fragment and the dephosphorylated vector were treated with T4 DNA.
Connect with ligase. Next, E. E. coli HB101 cells were transformed and the plasmid pC1 inserted in the correct orientation with the restriction enzyme SmaI.
Bacteria containing are identified. The sequence of the inserted gene is confirmed by DNA sequencing.

Transfection of CHO-DHFR Cells Chinese hamster ovary cells lacking active DHFR enzyme are used for transfection. 5 μg of the expression plasmid C1 was added to 0.5 μg of the plasmid pSV using the lipofecting method (Felgner et al., Supra).
Co-transfect with neo. The plasmid pSV2-neo contains a dominant selectable marker (the gene neo from Tn5 which encodes an enzyme that confers resistance to a group of antibiotics including G418). Cells are seeded in α-minus MEM supplemented with 1 mg / ml G418. After 2 days, the cells were trypsinized and seeded on hybridoma cloning plates (Greiner, Germany),
Then, the cells are cultured for 10 to 14 days. After this period, single clones were trypsinized and then treated with different concentrations of methotrexate (25 nM, 50 nM, 100 nM,
200 nM, 400 nM) are used to seed 6-well petri dishes. Clones growing at the highest concentration of methotrexate are then transferred to new 6-well plates containing even higher concentrations of methotrexate (500 nM, 1 μM, 2 μM, 5 μM). The same procedure is repeated until the clones grow at a concentration of 100 μM.

Expression of the desired gene product was analyzed by Western blot analysis and SDS-PAGE.
Analyze by.

Example 4 Tissue Distribution of Protein Expression Northern blot analysis is performed to examine galectin 11 gene expression in human tissues using the method described by Sambrook et al. (Cited above) among others. Complete nucleotide sequence encoding galectin 11 protein (
The cDNA probe containing SEQ ID NO: 1) is labeled with ³² P using the redi prime DNA labeling system (Amersham Life Science) according to the manufacturer's instructions. After labeling, the probe was attached to CHROMA SPIN-100.
Purify using a column (Clontech Laboratories, Inc.) according to manufacturer's protocol number PT1200-1. The purified labeled probe is then used to probe various human tissues for galectin 11 mRNA.

Multiple tissue Northern (MTN) blots containing various human tissues (H) or human immune system tissues (IM) were obtained from Clontech and Express.
Probe with labeled probe using Hyb Hybridization Solution (Clontech) according to manufacturer's protocol number PT1190-1. After hybridization and washing, blots are mounted and exposed to film overnight at -70 ° C and the film developed according to standard procedures.

It will be apparent that the present invention can be practiced other than as described in detail in the foregoing description and examples.

Example 5 Galectin-11-Induced Apoptosis in Transfected Cells This example demonstrates that transfection of human Jurkat T cells with a constitutive galectin-11 expression construct induces apoptosis in transfected cells. Shows the data shown.

[0239] T cells are a type of lymphocyte, or "white blood cell," that mediates a cellular immune response to foreign macromolecules, called antigens. Although T cells are required for a normal mammalian immune response, in some cases it is desirable to inhibit their activation: for example, in some autoimmune diseases, a subject's T cells are foreign. It responds to “self-antigens”, ie, macromolecules produced by a subject, and damages the cells and tissues of the subject, rather than the macromolecules of production. Autoimmune T cell responses are systemic lupus erythematosus (SLE), rheumatoid arthritis (RA)
, Insulin-dependent diabetes mellitus, myasthenia gravis, and multiple sclerosis (MS), and contribute to the respective pathophysiology. T cells also cause graft rejection and graft-versus-host disease (GVHD). Graft rejection is caused by an immune response against the transplanted tissue (graft) that is recognized as "foreign" by the recipient (host) T cells. Graft-versus-host disease is caused by transplanted T cells that recognize host-generated macromolecules as "foreign."

(Method) DNA encoding the galectin-11 protein of the deposited cDNA clone
The sequence was amplified using a PCR oligonucleotide primer specific for the amino terminal sequence of galectin 11 protein and a PCR oligonucleotide primer specific for the vector sequence 3'to the gene. The 5'Galectin 11 oligonucleotide primer has the sequence 5'CGCCGCCACCATGAGCCCCAG
It had GC3 '(SEQ ID NO: 10). It contains nucleotides 49-61 of the galectin 11 nucleotide sequence shown in Figure 1 (SEQ ID NO: 1). 3'Galectin 1
One primer has the sequence 5'GGAA TCTAGA TCAGGAGTGGAC 3 '
(SEQ ID NO: 11). It contains an underlined XbaI restriction site followed by a nucleotide sequence complementary to positions 439-450 of the galectin 11 nucleotide sequence shown in Figure 1 (SEQ ID NO: 1).

The amplified galectin 11 fragment was isolated from a 1% agarose gel as described above, digested with endonuclease XbaI, purified again on a 1% agarose gel and restricted with T4 DNA ligase. It was ligated into the multiple cloning site of pEF1.

The pEF1 vector was generated by replacing the CMV promoter on pIRES1neo (Clontech) with the human elongation factor 1a constitutive promoter from pEF-BOS. The EF1a promoter has been shown to be highly active in various cell types (data not shown). This vector also contains the bovine growth hormone poly A signal and the ampicillin resistance gene, a ribosome binding site ("RBS"), a 6-His tag, and a restriction enzyme site. This vector was digested with EcoRI, BamHI, phosphatase using techniques known in the art.

Insertion of the isolated galectin 11 fragment into the restricted pEF1 vector ligates the galectin 11 polypeptide coding region downstream and operably with the elongation factor 1 constitutive promoter of the vector, and It was placed in-frame with the initiation AUG appropriately located for translation of galectin 11. Then E. c
oli cells were transformed with the ligation reaction and the desired construct (pEFLegg11).
) Containing cells were identified using techniques known in the art. Then pEFLe
Cells containing the g11 expression construct were cultured under known conditions, which favored high yields, and the expression construct was isolated from bacterial cell cultures using techniques known in the art.

For detection of apoptosis, human Jurk is used using techniques known in the art.
at T cells were co-transfected with the pEFLeg11 expression construct together with a marker plasmid encoding green fluorescent protein (GFP). The transfected cells were then treated with MitoTracker Red (Molec
urular Probes), mitochondrial transmembrane potentials were determined and analyzed by two-color flow cytometry. Transfected populations were identified by the emission of green fluorescence due to the expression of GFP. Apoptotic cells show a disrupted mitochondrial transmembrane potential and therefore have a lower red fluorescence emission. This is due to the reduced ability to quench the dye MitoTracker Red.

Results Jurkat cells transfected with a constitutive expression plasmid for “Galectin 11” produced significant apoptosis 24 hours after transfection. About 30% of the "Galectin 11" -transfected cells were treated with the insert (
10% of cells transfected with control vector without pEF1)
It showed a decrease in mitochondrial transmembrane potential, comparable to less than (Fig. 5A).

We also have the control vector pEF1 or “Galectin 11”.
The number of GFP-positive cells was followed during 4 days of culture after co-transfection with any of the expression vectors pEF1-Leg11. After transfection with pEF1, there were about 4-fold more viable GFP-positive cells than with pEF1-Leg11 (FIG. 5B).

The present invention is not limited in scope by the particular embodiments described herein, which are intended as illustrations of individual aspects of the invention. In fact
Various modifications of the invention, in addition to those shown and described herein, will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to fall within the scope of the appended claims.

The entire disclosure of all publications, including patents, patent applications, journals, laboratory manuals, books, or other documents, incorporated herein by reference, are hereby incorporated by reference. To be done.

Further, the sequence listings submitted herewith in paper and computer readable form are hereby incorporated by reference in their entireties.

[0250]

[Table 3]

[Brief description of drawings]

FIG. 1 shows the nucleotide sequence of galectin 11 (SEQ ID NO: 1) and deduced amino acid sequence (SEQ ID NO: 2). This protein has a predicted molecular weight of approximately 14.8 kDa.

FIG. 2 shows galectin 11 protein (HJACE54), rat galectin 5
(SEQ ID NO: 3), and shows the region of similarity between the amino acid sequences of human galectin 8 (SEQ ID NO: 4). Identical amino acids shared between these galectins are shaded and conservative amino acid changes are boxed.

FIG. 3 shows the structural and functional characteristics of Galectin 11 (SEQ ID NO: 2) deduced using the default parameters of the computer program shown. The α, β, turn and coil regions; hydrophilic and hydrophobic; amphipathic region; flexible region; antigenic index and surface probability are indicated. Antigenicity index-J
In the ameson-Wolf graph, amino acid residues 65-70 and 118-124 in Figure 1 (SEQ ID NO: 2) correspond to the highly antigenic regions of the indicated galectin 11 polypeptide.

FIG. 4 is the structure of the human galectin 11 gene. The human galectin 11 gene is located on chromosome 11. This figure shows the 11th gene containing the galectin 11 gene.
The structure of a region of the chromosome is shown and the number of nucleotides corresponding to the transcribed (shaded) and untranscribed (open) regions of this region of the chromosome is disclosed. The human galectin 11 gene contains 5 exons. The translation start site is located on the second exon. The numbering of the nucleotides identified in the exons represented by Roman numerals corresponds to that shown in Figure 1 (SEQ ID NO: 1).

FIG. 5A. Jurka with Galectin 11 expression construct (pEF-Leg11).
FIG. 6 is a bar graph showing that transfection of t cells induces apoptosis of transfected cells. Shaded bars indicate% apoptosis of Jurkat cells transfected with the Galectin-11 expression construct, while open bars represent Jurkat transfected with pEF control vector.
The% apoptosis of cells is shown. Apoptosis is mito Tracke
Measured by the two-color cell counting method using rRed.

FIG. 5B is a bar graph showing the survival of successfully transfected GEP-positive cells 4 days post transfection. The survival of the transfected cells depends on the control vector (pEF1) or galectin 11 expression vector (
Tested after co-transfection with either pEF-Leg11). There were about 4-fold more viable GEP positive cells after transfection with pEF1 than after transfection with pEF-Leg11.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61P 11/06 A61P 29/00 4H045 29/00 35/00 35/00 37/02 37/02 37/08 37/08 C07K 16/18 C07K 16/18 C12N 1/15 C12N 1/15 1/19 1/19 1/21 1/21 C12P 21/02 C 5/10 G01N 33/53 D 15/09 ZNA A61K 37 / 02 C12P 21/02 C12N 5/00 A G01N 33/53 15/00 ZNAA (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH , GM, KE, LS, MW, S , SL, SZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CU, CZ, DE, DK, EE, ES, FI, GB, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP , KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor Rosen, Craig Ai. United States Maryland 20882, Leightonsville, Rolling Hill Road 22400 (72) Inventor Ni, Gian United States Maryland 20853, Rockville, Manorfield Road 5502 (72) Inventor Gents, Rainer El. United States Maryland 20850, Rockville, Mount Prospect Drive 13608 F Term (reference) 4B024 BA21 BA31 CA04 DA02 EA02 FA02 GA11 HA01 4B064 AG02 AG28 CA10 CA19 CC24 DA01 4B065 AA90X AA90Y AB01 BA02 CA24 CA44 4C084 AA02 AA13B A32B A2 BA32 DA31 NA31 BA81 ZB132 ZB152 ZB262 ZC352 4C085 AA13 AA14 BB16 DD24 DD33 4H045 AA10 AA11 AA30 BA10 CA40 DA01 DA80 EA22 EA28 FA74

Claims (28)

[Claims] 1. An isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence at least 95% identical to the nucleotide sequence encoding amino acids 1-133 of SEQ ID NO: 2. (B) a nucleotide sequence that is at least 95% identical to the nucleotide sequence that encodes amino acids 2-133 of SEQ ID NO: 2; (c) a nucleotide that encodes amino acids 88-108 of SEQ ID NO: 2; (E) at least 95 in the nucleotide sequence encoding the Galectin 11 polypeptide encoded by the cDNA contained in ATCC Accession No. 209053;
% Nucleotide identity; (f) a nucleotide sequence encoding amino acids 2-333 of SEQ ID NO: 2 except for at least one conservative amino acid substitution; and (g) (a), (b), (c). , (D), (e) or (f) complement. 2. The isolated polynucleotide according to claim 1, wherein the nucleotide sequence is (a) or a complementary sequence thereto. 3. The isolated polynucleotide of claim 2, wherein the nucleotide sequence encodes amino acids 1-133 of SEQ ID NO: 2. 4. The isolated polynucleotide according to claim 1, wherein the nucleotide sequence is (b) or a sequence complementary thereto. 5. The isolated polynucleotide of claim 4, wherein the nucleotide sequence encodes amino acids 2-333 of SEQ ID NO: 2. 6. The isolated polynucleotide of claim 1, wherein the nucleotide sequence is (c) or its complementary sequence. 7. The isolated polynucleotide according to claim 1, wherein the nucleotide sequence is (d) or a sequence complementary thereto. 8. The isolated polynucleotide according to claim 2, wherein the nucleotide sequence is (e) or a complementary sequence thereto. 9. The isolated polynucleotide of claim 8, wherein the nucleotide sequence encodes a galectin-11 polypeptide encoded by the cDNA contained in ATCC Accession No. 209053. 10. The isolated polynucleotide according to claim 1, wherein the nucleotide sequence is (f) or a sequence complementary thereto. 11. The isolated polynucleotide of claim 1, wherein the polynucleotide is DNA. 12. A method for producing a recombinant vector, which comprises a step of inserting the isolated polynucleotide according to claim 1 into a vector. 13. A recombinant vector comprising the polynucleotide according to claim 1. 14. A genetically engineered host cell comprising the polynucleotide of claim 1. 15. A method for producing a galectin-11 polypeptide, the step of culturing the genetically engineered host cell of claim 14 under conditions suitable for producing said polypeptide, And a step of recovering the polypeptide. 16. An isolated galectin-11 polypeptide comprising an amino acid sequence selected from the group consisting of: (a) an amino acid sequence that is at least 95% identical to amino acids 1-133 of SEQ ID NO: 2; ) Amino acid sequence at least 95% identical to amino acids 2-133 of SEQ ID NO: 2; (c) amino acids 88-108 of SEQ ID NO: 2; (d) amino acids 108-120 of SEQ ID NO: 2; and (e) ATCC deposit number An amino acid sequence which is at least 95% identical to the galectin-11 polypeptide encoded by the human cDNA contained in 209053. 17. A pharmaceutical composition comprising the polypeptide of claim 16 and a pharmaceutically acceptable carrier. 18. An isolated antibody that specifically binds to the galectin-11 polypeptide of claim 16. 19. A method for detecting galectin-11 polypeptide in a sample, comprising: a) contacting the sample with the antibody of claim 18 under conditions where an immune complex is formed; and b ) Detecting the presence of the antibody bound to the polypeptide. 20. A method of treating a cell proliferative disorder in a mammal, comprising administering to said mammal a therapeutically effective amount of the polypeptide of claim 16. 21. The method of claim 20, wherein the disorder is selected from the group consisting of cancer, autoimmune disease, inflammatory disease, asthma and allergic disease. 22. A method of diagnosing a disorder of cell proliferation or differentiation in a mammal comprising measuring galectin-11 gene expression in a patient sample. 23. A method of modulating cell growth or differentiation in a mammal, wherein the galectin 11 polypeptide of claim 16 is provided to said mammal in an amount sufficient to stimulate cell growth or differentiation. A method comprising the step of administering at. 24. A method of regulating cell growth or differentiation in a mammal, wherein the galectin-11 polypeptide of claim 16 is added to said mammal in an amount sufficient to inhibit cell growth or differentiation. A method comprising the step of administering at. 25. A method of regulating cell proliferation or differentiation in a mammal, wherein the mammal is provided with the galectin-11 polynucleotide of claim 1.
A method comprising administering in an amount sufficient to stimulate proliferation or differentiation of cells. 26. A method of regulating cell proliferation or differentiation in a mammal, wherein the mammal comprises the galectin-11 polynucleotide of claim 1.
A method comprising the step of administering in an amount sufficient to inhibit cell proliferation or differentiation. 27. A method for treating, preventing or ameliorating a medical condition comprising administering to a mammalian subject a therapeutically effective amount of the polypeptide of claim 16. 28. A method for treating, preventing or ameliorating a medical condition comprising administering to a mammalian subject a therapeutically effective amount of the polynucleotide of claim 1.