JP2002541832A - Galectin 11 - Google Patents

Abstract

  (57) [Summary] The present invention relates to novel galectins. More particularly, an isolated nucleic acid molecule encoding human galectin 11 is provided. Galectin-11 polypeptides are also provided, as are vectors, host cells, recombinant methods of producing them, and antibodies to galectin-11 polypeptides. The invention further relates to screening methods for identifying agonists and antagonists of galectin 11 activity. Also provided are diagnostic methods for detecting cell proliferative disorders, including autoimmune diseases, cancer and inflammatory diseases, and methods of treating cell proliferative disorders.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001] The present invention relates to novel galectins. More specifically, an isolated nucleic acid molecule encoding human galectin 11 is provided. Galectin-11 polypeptides are also provided, as are vectors, host cells, recombinant methods of producing them, and antibodies to galectin-11 polypeptides. The present invention further provides galectin 11
Screening methods for identifying agonists and antagonists of activity. Also provided are diagnostic methods for detecting cell proliferative disorders, including autoimmune diseases, cancer and inflammatory diseases, and methods of treating cell proliferative disorders.

BACKGROUND OF THE INVENTION Lectins are proteins that bind to specific carbohydrate structures and therefore can recognize specific glycoconjugates. Barondes et al. Biol. Chem. 269 (3
3): 20807-20810 (1994). Galectins are members of a family of β-galactoside binding lectins with related amino acid sequences (for a review, see Barondes et al., Cell 76: 597-598 (199).
4); Barondes et al. Biol. Chem. 269 (33) 2080
7-20810 (1994)). Many glycoproteins, including β-galactoside sugars, are produced by cells, but only a few bind in vitro to known galectins. Such apparent binding specificity suggests a highly specific functional role for galectin.

[0003] Galectin 1 (lectin, galactoside-bound soluble-1) has been conventionally known as LG
Called ALS1, this is also referred to as L-14-1, L-14, RL-14.5.
, Galactin, MGBP, GBP, BHL, CHA, HBP, HPL, HLBP
14, also known as rIML-1) is a homodimer with a subunit of molecular weight 14,500 daltons. Galectin 1 is abundantly expressed in smooth and skeletal muscle and to a lesser extent in many other cell types (Couraud et al., J. Biol. Chem. 264: 131).
0-1316 (1989)). Galectin 1 is thought to specifically bind laminin, highly polylactosamined cellular glycoproteins, and highly polylactosamined lysosomal binding membrane protein (LAMP).
Galectin 1 also lactosamine containing glycolipids found on neurons olfactory, and that specifically binds to integrin a ₇ b ₁ on skeletal muscle cells are shown.

[0004] Other members of the galectin family have also been reported. Galectin 2
Is a homodimer originally found in hepatocellular carcinoma and having a subunit of molecular weight 14,650 daltons (Gitt et al., J. Biol. Chem. 26).
7: 10601 to 10606 (1992)). Galectin 3 (Mac-2, EP
B, also known as CBP-35, CBP-30 and L-29) are abundant in activated macrophages and epithelial cells, and 26,320-30,300
Is a monomer with an apparent molecular weight between daltons (Cheryil et al.,
Proc. Natl. Acad. Sci. USA 87: 7324-7326 (
1990)). Galectin 3 has been found to specifically bind laminin, immunoglobulin E and its receptors, and bacterial lipopolysaccharide. Galectin 4 has a molecular weight of 36,300 daltons and contains two carbohydrate binding domains within a single polypeptide chain (Oda et al., J. Biol.
Chem. 268: 5929-5939 (1993)). Galectins 5 and 6
Are discussed in Barondes et al., Cell 76: 597-598 (1994). Human galectin 7 has a molecular weight of 15,073 daltons and is found primarily in stratified squamous epithelium (Madsen et al., J. Biol. C
hem. 270 (11): 5823-5829 (1995)).

[0005] Animal lectins generally function in regulating cell-cell and cell-matrix interactions often. Galectin 1 has been shown to either promote or inhibit cell adhesion, depending on the cell type in which it resides. Galectin 1, probably laminin - by decay galectin 1 mediated integrin a ₇ b ₁ interaction, cells in skeletal muscle - inhibiting matrix interaction (Cooper et al., J.Cell.Biol.115: 1437~1448 (
1991)). In some non-skeletal muscle cell types, galectin 1 promotes cell-matrix adhesion, presumably by cross-linking the cell surface with the substrate glycoconjugate (
Zhou et al., Arch. Bioch. Biophys. 300: 6-17 (19
93); Skrincosky et al., Cancer Res. 53: 2667-2
675 (1993)).

[0006] Galectin 1 is also involved in cell proliferation (Wells et al., Cell 64: 91-97).
(1991)) and some immune functions (Offner et al., J. Neuroi).
mmunol. 28: 177-184 (1990)). Galectin 1 induces the release of tumor necrosis factor from macrophages (Kajika
wa et al., Life Sci. 39: 1177-1181 (1986)). Galectin 1 has also been demonstrated to have therapeutic activity against autoimmune diseases in animal models for experimental myasthenia gravis and experimental autoimmune encephalomyelitis (Levi et al., Eur. J., respectively). Immunol.13: 500-5
07 (1983); and Offner et al. Neuroimmunol. 2
8: 177-185 (1990)). Furthermore, galectin 1 has been shown to modulate the immune response by mediating T cell apoptosis (Per
Illo et al., Nature 378: 736-739 (1995)).

[0007] Galectin 3 promotes the growth of cells cultured under restrictive culture conditions (Ya
ng et al., Proc. Natl. Acad. Sci. USA 93: 6737-6
742 (June 1996)). Expression of galectin 3 in cells confers resistance to apoptosis, indicating that galectin 3 may be a cell death suppressor that interferes with a common pathway of apoptosis. Ibid. Galectin 3 has also been observed to function in regulating cell adhesion and in activating certain immune cells by cross-linking IgE and IgE receptors.

In recent years, a galectin-like antigen called HOM-HD-21 has been identified as a Hodgkin's disease cDNA
Another galectin, found to be highly expressed in the library and designated PCTA-1, was identified as a specific cell surface marker on human prostate cancer cell lines and carcinomas from patients.

Thus, galectins have been observed to be involved in the regulation of immune cell activity and in various processes such as cell adhesion, proliferation, inflammation, autoimmunity, and tumor cell metastasis. Thus, there is a need in the art for the identification of novel galectins that can serve as useful tools in the development of therapeutics and diagnostics for modulating immune responses, inflammatory diseases and cancer.

(Summary of the Invention) The present invention relates to the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2), ATCC Accession No. 209053, deposited on May 16, 1997 in a bacterial host.
Provided is an isolated nucleic acid molecule comprising or consisting of a polynucleotide encoding a galectin-11 polypeptide having an amino acid sequence encoded by a DNA clone, and fragments, variants, derivatives and analogs thereof.

The present invention also provides a polynucleotide encoding a galectin-11 polypeptide having the amino acid sequence shown in FIG. 6 (SEQ ID NO: 14) (sometimes referred to herein as “
Galectin 11α), and fragments, variants, derivatives and analogs thereof.

The present invention also relates to polynucleotides encoding galectin-11 polypeptides having the amino acid sequence shown in FIGS. 6 and 8 (SEQ ID NO: 16) (sometimes referred to herein as “galectin-11β”), and Isolated nucleic acid molecules comprising fragments, variants, derivatives and analogs of

Galectin 11 in FIG. 1 (SEQ ID NOS: 1 and 2), galectin 11α in FIG. 6 (SEQ ID NOs: 24 and 25), galectin 11β in FIGS.
7) is often referred to herein, for example, collectively as "galectin 11".

The galectin 11 polynucleotide of FIG. 1 (SEQ ID NO: 1) and the galectin 1 of FIG.
The 1α polynucleotide (SEQ ID NO: 24) and the galectin-11β polynucleotide of FIG. 7 (SEQ ID NO: 26) are often referred to herein, for example, collectively as “galectin-11 polynucleotide”.

The present invention also relates to recombinant vectors containing the isolated nucleic acid molecules of the present invention, and host cells containing the recombinant vectors, methods of making such vectors and host cells, and recombinant techniques. To their use for the production of galectin-11 polypeptides.

The present invention further provides an isolated galectin-11 polypeptide having an amino acid sequence encoded by a polynucleotide described herein, including galectin 11 of SEQ ID NO: 2 and galectins 11α and β. And antibodies that bind these polypeptides. The galectin 11 polypeptide of FIG. 1 (SEQ ID NO: 2), the galectin 11α polypeptide of FIG. 6 (SEQ ID NO: 25), and the galectin 11β polypeptide of FIG. 7 (SEQ ID NO: 27) are often referred to herein as, for example, Collectively referred to as "galectin 11 polypeptide".

The present invention also provides a screening method for identifying a compound capable of enhancing or inhibiting a cellular response (eg, apoptosis) induced by galectin-11. In general, these methods involve contacting cells expressing galectin 11, a candidate compound, and a galectin 11 ligand, assaying the cellular response resulting from binding of the ligand to galectin 11, and a standard (galectin 11 and galectin 11). A standard assayed when contact with a galectin-11 ligand is made in the absence of the candidate compound) and the cellular response increased against the standard. A decreased cellular response to the standard indicates that the compound is an agonist, and indicates that the compound is an antagonist.

[0018] In another aspect, screening assays for agonists and antagonists are provided. This assay involves determining the effect of the candidate compound on galectin 11 binding to β-galactoside sugar. For details,
The method comprises contacting a β-galactoside sugar with a galectin 11 polypeptide and a candidate compound, and determining whether galectin 11 binding to the β-galactoside sugar increases or decreases due to the presence of the candidate compound. Deciding whether or not it is.

[0019] The present invention also provides diagnostic methods useful during the diagnosis of disorders associated with increased, decreased, or otherwise abnormal expression of galectin-11.

The present invention further provides a method for treating an individual in need of increasing the level of galectin-11 activity in the body, comprising a therapeutically effective amount of an isolated galectin of the present invention. Administering a composition comprising 11 polypeptides, fragments, variants, derivatives or analogs, or agonists thereof, to such individuals.

[0021] In another embodiment, the present invention provides a method for treating an individual in need of reducing the level of galectin-11 activity in the body, the method comprising a therapeutically effective amount of a subject of the present invention. Administering to such an individual a composition comprising a galectin-11 fragment, variant, derivative, analog or antibody, or a galectin-11 antagonist.

(Detailed Description) The present invention relates to the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2), the amino acid sequence shown in FIG. 6 (SEQ ID NO: 25), and the amino acid sequence shown in FIGS. 2
An isolated nucleic acid molecule comprising a polynucleotide encoding a galectin-11 polypeptide having 7) is provided, the amino acid sequence of which was determined by sequencing the cloned cDNA. The nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1) was obtained by sequencing the HJACE54 plasmid. This plasmid was purchased by American Ty on May 16, 1997.
pe Culture Collection, 10801 Universi
ty Boulevard, Manassas, Virginia,
Accession number 209053 was received. The galectin 11 polypeptides of the present invention share sequence homology with rat galectin 5, chick trigger lectin 3, and human galectin 8 gene products (see, eg, FIG. 2; see SEQ ID NOs: 3-4).

[0023] The present invention further provides fragments, variants,
Derivatives and analogs, and polypeptides encoded by them, and antibodies that bind to these polypeptides are provided.

Definitions The following definitions are provided to facilitate understanding of certain terms used frequently herein.

“Functional activity” or “biological activity” refers to polypeptides, fragments, derivatives, variants and analogs of galectin 11 that are similar (but not identical) to the activity of galectin 11 polypeptide. (Needs to be the same as the activity) (including the mature form as determined in a particular biological assay, regardless of dose dependence). If there is a dose dependence, it need not be the same as the galectin-11 polypeptide, but rather be substantially similar to the galectin-11 polypeptide in a given activity as compared to the galectin-11 polypeptide. Required (i.e., the candidate polypeptide has less than about 25 times less activity, preferably less than about 10 times less activity, and most preferably less than about 1/3 less galactin 11 polypeptide). Activity). Such functional activities include, but are not limited to: biological activity, such as the ability to bind to β-galactoside sugars, the ability to aggregate trypsinized rabbit erythrocytes and / or apoptosis. Ability to induce), antigenicity (ability to bind to galectin-11 polypeptide, or ability to compete with galectin-11 polypeptide for binding to anti-galectin-11 antibody), immunogenicity (to produce antibodies that bind to galectin-11 polypeptide) Ability to form dimers with the galectin-11 polypeptides of the invention, and to bind to other galectins and / or galectin-11 receptors or galectin-11 ligands. Galectin 11
Polynucleotides encoding polypeptides having the functional or biological activity of, as well as the complementary strands of these polynucleotides, are also encompassed by the present invention.

“Polynucleotide” generally refers to any polynucleotide or polydeoxyribonucleotide, whether unmodified RNA or DNA or modified RNA or DNA. Good. "Polynucleotides" include, but are not limited to: single-stranded and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single-stranded RNA and double-stranded RNA, as well as RNA, a mixture of single-stranded and double-stranded regions, a hybrid molecule comprising DNA and RNA, wherein the DNA and RNA may be single-stranded or more typically double-stranded. Or a mixture of a single-stranded region and a double-stranded region). Further, “polynucleotide” refers to RNA or DNA
Alternatively, it refers to a triple-stranded region containing both RNA and DNA. The term polynucleotide also refers to DNA or RNA comprising one or more modified bases, as well as DNA or RNA having backbones modified for stability or for other reasons
including. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. Various modifications have been made to DNA and RNA; thus, a "polynucleotide" is a chemically, enzymatically or metabolically modified form of a polynucleotide typically found in nature And chemical forms of DNA and RNA characteristic of viruses and cells. "Polynucleotide" also embraces relatively short polynucleotides (often called oligonucleotides).

“Polypeptide” refers to any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds (ie, peptide isosteres). "Polypeptide" refers to both short chains (commonly referred to as peptides, oligopeptides or oligomers) and longer chains (commonly referred to as proteins). Polypeptides may contain amino acids other than the 20 genetically encoded amino acids. "Polypeptides" include amino acid sequences that have been modified by either natural processes (eg, post-translational processing) or by chemical modification techniques well known in the art. Such modifications are well described in basic books and more detailed monographs, as well as in a large body of research literature. Modifications can occur in any portion of the polypeptide, including the peptide backbone, amino acid side chains and the amino or carboxy terminus. It is understood that the same type of modification may be present at the same or varying degrees at several sites in a given galectin-11 polypeptide. Also, a given galectin-11 polypeptide may contain many types of modifications. Galectin-11 polypeptides can branch as a result of ubiquitination,
And may be cyclic, branched or unbranched. Cyclic branched polypeptides and branched cyclic polypeptides can result from post-translation natural processes,
Or they can be made by synthetic methods. Modifications include: acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of nucleotides or nucleotide derivatives, covalent attachment of lipids or lipid derivatives, Phosphatidylinositol (phosphotidy)
linositol) covalent bond, crosslink, cyclization, disulfide bond formation, demethylation, formation of covalent crosslinks, formation of cysteine, formation of pyroglutamate,
Formylation, γ-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation (selenoylatio)
n), sulfation, transfer RNA-mediated amino acid addition to proteins (eg, arginylation), and ubiquitination (eg, PROTEINS-STRUCTUR)
E AND MOLECULAR PROPERTIES, 2nd edition, T.E. E. FIG. C
reighton, W.C. H. Freeman and Company, New
York, 1993; , Posttranslati
onal Protein Modifications: Perspecti
ves and Products, pages 1-12, POSTTRANSLAT
IONAL COVALENT MODIFICATION OF PROTE
INS, B. C. Edited by Johnson, Academic Press, New
York, 1983; Seifter et al., "Analysis for pro.
tein modifications and nonprotein co
factors ", Meth Enzymol (1990) and Ratta
"Protein Synthesis: Posttranslation
al Modifications and Aging ", Ann NY A
cad Sci (1992) 663: 48-62).

A “variant,” as the term is used herein, is different from the reference polynucleotide or polypeptide, respectively, but retains the functional or biological activity of galectin-11. It is a polynucleotide or a polypeptide. Representative variants of a polynucleotide differ in nucleotide sequence from another, reference polynucleotide. Changes in the nucleotide sequence of the variant may or may not change the amino acid sequence of the polypeptide encoded by the reference polynucleotide. Nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as described below. Representative variants of a polypeptide differ in amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference polypeptide and its variants are closely similar throughout and, in many regions, identical. A variant polypeptide and a reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions in any combination. The substituted or inserted amino acid residue may or may not be one encoded by the genetic code. A variant of a polynucleotide or a variant of a polypeptide can be naturally occurring, such as an allelic variant, or can be a variant that is not known to occur naturally. Non-naturally occurring variants of polynucleotides and polypeptides can be made by mutagenesis techniques or by direct synthesis.

As used herein, “antibody” includes polyclonal and monoclonal antibodies, chimeric antibodies, single-chain antibodies, and humanized antibodies, and Fab fragments. Fab fragments include the products of a Fab expression library or other immunoglobulin expression libraries.

Galectin 11 nucleotide sequence identified as SEQ ID NO: 1 was assembled from partially homologous ("overlapping") sequences obtained from the deposited clone. The overlapping sequence was assembled into a single highly contiguous nucleotide sequence that resulted in the final sequence identified as SEQ ID NO: 1.

Thus, SEQ ID NO: 1 and translated SEQ ID NO: 2 are sufficiently accurate and otherwise suitable for various uses well known in the art, and are described in further detail below. . For example, SEQ ID NO: 1 is useful for designing a nucleic acid hybridization probe that detects the nucleic acid sequence contained in SEQ ID NO: 1 or the cDNA contained in the deposited clone. These probes also hybridize to nucleic acid molecules in a biological sample, thereby enabling the various forensic and diagnostic methods of the present invention. Similarly, the polypeptide identified from SEQ ID NO: 2 can be used, for example, to generate an antibody that specifically binds to the protein galectin-11.

Further, unless otherwise indicated, all nucleotide sequences determined herein by sequencing DNA molecules are from an automated DNA sequencer (eg, from Applied Biosystems, Inc.). Model 3
73), and all amino acid sequences of the polypeptides encoded by the DNA molecules determined herein are determined by D, as determined above.
Inferred by translation of the NA sequence. Thus, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. The nucleotide sequence determined by automation is typically at least about 90% identical to the actual nucleotide sequence of the DNA molecule being sequenced, more typically at least about 95% to at least about 99.9%. Are identical. The actual sequence can be more accurately determined by other approaches, including manual DNA sequencing methods well known in the art. As is also known in the art, a single insertion or deletion in the determined nucleotide sequence, as compared to the actual sequence, causes a frameshift in translation of the nucleotide sequence, such that the determined nucleotide sequence The predicted amino acid sequence encoded is completely different from the amino acid sequence actually encoded by the DNA molecule to be sequenced. These differences are
It begins at the point of such an insertion or deletion.

Thus, for applications where accuracy is required in the nucleotide or amino acid sequence, the present invention relates only to the generated nucleotide sequence identified as SEQ ID NO: 1 and the deduced translated amino acid sequence identified as SEQ ID NO: 2. Not AT
Also provided is a sample of plasmid DNA containing the human cDNA for galectin 11 deposited with the CC. The nucleotide sequence of the deposited galectin 11 clone can be readily determined by sequencing the deposited clone, according to known methods. The putative galectin-11 amino acid sequence can then be confirmed from such a deposit. In addition, the amino acid sequence of the protein encoded by the deposited clone can be determined by peptide sequencing or the deposited human galectin 11 cDN.
It can be determined directly by expressing the protein in a suitable host cell containing A, collecting the protein, and determining its sequence.

Using the information provided herein, eg, the nucleotide sequence in FIG. 1, a nucleic acid molecule of the invention encoding a galectin-11 polypeptide can be prepared using standard cloning and screening procedures (eg, starting material Procedure for cloning cDNA using mRNA as a primer). As an illustration of the present invention, the nucleic acid molecule set forth in FIG. 1 (SEQ ID NO: 1) is a G1 phase Jurkat T
Found in a cell-derived cDNA library. This gene has also been identified in a cDNA library generated from human neutrophils and human fetal adrenal glands.
Polynucleotides of the invention can also be obtained from natural sources, such as mRNA or genomic DNA, using techniques known in the art, or can be chemically synthesized using techniques known in the art. .

The human galectin 11 gene is located on chromosome 11 and contains five exons (see, eg, FIG. 4). The nucleotide sequence of the galectin-11 cDNA of FIG. 1 (SEQ ID NO: 1) is 865 nucleotides long (830 nucleotides minus the polyA tail of the cDNA) and encodes a predicted open reading frame of 133 amino acid residues. The nucleotide sequence shown in FIG.
) Has a putative start codon at nucleotides 49-51 (located in the second exon of this gene). Galectin 11 protein (SEQ ID NO: 2) shown in FIG. 1 comprises rat galectin 5, chick trigger lectin 3, and human galectin 8
(See, eg, FIG. 2). In addition, as further discussed below, galectin 11 induces apoptosis of transfected T cells (see, eg, Example 5 and FIGS. 5A and 5B). These findings indicate that galectin 11 functions in a manner similar to other previously characterized galectins, and therefore that galectin 11 is important in regulating cell proliferation disorders, autoimmune diseases, cancer and inflammatory diseases It indicates that.

The nucleotide sequence of the galectin 11 cDNA of FIG.
It is 337 nucleotides long. It is one of two alternative splicing forms of galectin-11 and is called galectin 11α. Other forms (galectin 11β) differ in that only 7 nucleotides have been lost (FIG. 6).
(Nucleotides 136 to 142, as shown in (SEQ ID NO: 24)). See FIG. The sequence of galectin 11β is shown in the sequence listing as SEQ ID NO: 26.
The resulting translation products of these splicing variants are likely to differ only at the N-terminus. The amino acid sequences of galectins 11α and β are, respectively, SEQ ID NO: 2
5 and 27 are shown in the sequence listing. The differences between the two proteins are highlighted in FIG.

[0037] Galectin-11 polypeptide contains two carbohydrate binding domains (CARD domains) separated by a linker sequence. The first carbohydrate binding domain comprises the first 121 amino acid residues of galectin 11α (SEQ ID NO: 25) and galectin 11β
(SEQ ID NO: 27) consists of the first 142 amino acids. The 29 amino acid residues after the first CARD domain are the linker sequence. Finally, the last 125 amino acid residues in each protein are the C-terminal CARD domain. Preferred polypeptides of the invention comprise a CARD domain, either N-terminal or C-terminal.
Polynucleotides encoding such polypeptides are also provided.

[0038] Allelic variants, orthologs, and / or species homologs are also provided herein. SEQ ID NOs: 1-2, 24-2 using procedures known in the art.
5, 26-27, or the full length gene, allelic variant, splice variant, full length coding portion, ortholog, and / or species homolog of the gene corresponding to the deposited clone may be sequenced as disclosed herein. Or the clones deposited with the ATCC. For example, allelic variants and / or species homologs make appropriate probes or primers from the sequences provided herein, and appropriate nucleic acid sources for allelic variants and / or desired homologs Can be isolated and identified by screening.

As the skilled artisan will appreciate, due to the potential for sequencing errors discussed above and the variability in processing sites of different known proteins, the deposited cDNA
The putative galectin-11 polypeptide encoded by contains approximately 133 amino acid residues, but can be anywhere from 125 to 150 amino acids.

As indicated, the nucleic acid molecules of the invention may be in the form of RNA (eg, mRNA)
Alternatively, it can be in the form of DNA, including, for example, cDNA and genomic DNA obtained by cloning or produced synthetically. The DNA can be double-stranded or single-stranded. Single-stranded DNA or RNA can be the coding strand, also known as the sense strand, or the non-coding strand, also called the complementary or antisense strand.

An “isolated” nucleic acid molecule intends a nucleic acid molecule, DNA or RNA that has been removed from its native environment (eg, if the nucleic acid is naturally occurring, its natural environment). It has therefore been modified "by the hand of man" from its natural state. For example, a recombinant DNA molecule contained in a vector is considered isolated for the purposes of the present invention. Further examples of isolated DNA molecules include recombinant DNA molecules that are maintained in a heterologous host cell, or (partially or substantially) purified DNA molecules in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of a DNA molecule of the present invention. Isolated nucleic acid molecules according to the present invention further include those molecules that have been produced synthetically. In a specific embodiment, the “isolated” nucleic acid molecule of the invention includes galectin 11, disclosed in FIG. 1 (SEQ ID NO: 1), FIG.
All or a part of the coding region of galectin 11α disclosed in (SEQ ID NO: 24) or galectin 11β disclosed in SEQ ID NO: 26. The term "isolated" refers to both genomic DNA or cDNA libraries, whole whole cell or mRNA preparations, genomic DNA preparations (including those separated by electrophoresis and transcribed into blots) Neither the prepared whole cell genomic DNA preparation nor the other compositions for which the techniques do not show the distinguishing characteristics of the polynucleotide / sequence of the invention.

An isolated nucleic acid molecule of the invention is a DNA molecule comprising an open reading frame (ORF) or a portion of the ORF shown in FIG. 1 or 6 (SEQ ID NO: 1, 24 or 26); It includes sequences substantially different from DNA molecules, but still includes DNA molecules that encode the galectin 11 protein due to the degeneracy of the genetic code. Of course, this genetic code is well known in the art. Thus, making such degenerate variants is routine for those skilled in the art.

In certain embodiments, the present invention relates to an isolated nucleic acid molecule encoding the full-length galectin-11 polypeptide shown in FIG. 1 (SEQ ID NO: 2) and an ATCC deposit number on May 16, 1997. A galectin-11 nucleic acid molecule encoding a galectin-11 polypeptide sequence encoded by a cDNA clone contained in a plasmid deposited as 209053 is provided. In a further embodiment, N
A nucleic acid molecule encoding a full-length galectin-11 polypeptide lacking a terminal methionine is provided. The present invention further provides an isolated nucleic acid molecule having the nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1) or the nucleotide sequence of a galectin-11 cDNA contained in the above deposited clone, or complementary to one of the above sequences Nucleic acid molecule having a specific sequence. Such isolated nucleic acid molecules (particularly DN
A) include, but are not limited to, probes for generating a genetic map by in situ hybridization using chromosomes and probes for detecting the expression of the galectin-11 gene in human tissues (eg, by Northern blot analysis). Have no use. The invention further provides a polynucleotide encoding a polypeptide comprising the full length amino acid sequence shown as SEQ ID NO: 25 or 27, with or without an N-terminal methionine.

In certain embodiments, the polynucleotides of the present invention are at least 15, at least 50, at least 100, at least 125, at least 500 or at least 1000 contiguous nucleotides, but have a length of 300
kb, 200 kb, 100 kb, 50 kb, 15 kb, 10 kb, 7.5 kb,
5 kb, 2.5 kb, 2.0 kb or 1 kb or less. In a further embodiment, a polynucleotide of the invention comprises a portion of a coding sequence, but does not comprise all or a portion of any introns, as disclosed herein. In another embodiment, a polynucleotide comprising a coding sequence does not include a coding sequence for a genomic flanking gene (ie, 5 'or 3' to the galectin 11 gene of interest on chromosome 2). In another embodiment, the polynucleotide of the invention comprises:
1000, 500, 250, 100, 50, 25, 20, 15, 10, 5, 4,
It does not contain more coding sequences than 3, 2, or 1 genomic flanking genes.

The present invention is further directed to fragments of the isolated nucleic acid molecules described herein. The nucleotide sequence of the deposited cDNA, the nucleotide sequence shown in FIGS. 1 and 6 (SEQ ID NOS: 1, 24, and 26), or a fragment of the isolated nucleic acid molecule having the complement thereof, is at least about Fragments of 15 nt, and more preferably at least about 20 nt, and more preferably at least about 30 nt, and even more preferably at least about 40 nt are contemplated. For example, by a fragment of at least 20 nt in length, the nucleotide sequence of the deposited cDNA or c shown in FIG. 1 (SEQ ID NO: 1) or FIG.
Fragments containing 20 or more contiguous bases from the nucleotide sequence as set forth in the DNA or its complement are contemplated. Also, according to the present invention, 50, 100, 150, 200, 2 of the sequence shown in FIG.
50, 300, 350, 365, 370, 375, 380, 400, 450, 5
00, 550, 600, 650, 700, 750, 800, 850 contiguous nucleotides, their complements, or DNA fragments contained within the deposited clone. The invention also includes the deposited cDNA or fragments corresponding to most, if not all, of the nucleotide sequence as shown in FIG. 1 (SEQ ID NO: 1) or its complement. In a further embodiment, a polynucleotide fragment of the invention comprises amino acids 1-14, 1-20, 1-40, 1-66, 2-67, 3 of the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2).
-8, 3-67, 5-108, 5-128, 10-17, 10-20, 12-1
6, 13-20, 13-68, 14-67, 23-40, 20-50, 40-
108, 41-60, 47-61, 47-108, 47-128, 50-100
, 61-80, 65-108, 65-128, 66-108, 76-88, 81
-100, 88-108, 88-128, 95-101, 101-133, 10
8 to 120, 114 to 128 and / or 114 to 128. In a preferred embodiment, the polynucleotide fragment of the invention comprises:
Encodes a polypeptide that demonstrates galectin-11 functional activity. The fragments of the invention have many uses, including but not limited to diagnostic probes and primers as discussed herein.

Preferred nucleic acid fragments of the present invention include nucleic acid molecules encoding the epitope-bearing portion of the galectin 11 protein. In particular, such nucleic acid fragments of the invention include nucleic acid molecules encoding polypeptides comprising amino acid residues from about 65-70 and 118-124 of FIG. 1 (SEQ ID NO: 2). The present inventors have determined that the above polypeptide fragment is an antigenic region of the galectin 11 protein. Methods for determining other such epitope-bearing portions of the galectin-11 protein are described in detail below.

In another embodiment, the present invention provides polynucleotides that hybridize under stringent hybridization conditions to all or a portion of a galectin-11 polynucleotide (including fragments) described herein. , Its complementary strand, c included in ATCC Deposit No. 209053 (May 16, 1997)
Provided is an isolated nucleic acid molecule comprising or consisting of a DNA clone, or a fragment thereof. “Stringent hybridization conditions” refers to 50% formamide, 5 × SSC (750 mM NaCl,
75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6)
)) Overnight incubation at 42 ° C in a solution containing 5x Denhardt's solution, 10% dextran sulfate, and 20 µg / ml denatured sheared salmon sperm DNA, then filter at 65 ° C in 0.1x SSC. It means washing.

[0048] Galectin 11 under lower stringency hybridization conditions
Nucleic acid molecules that hybridize to the polynucleotide are also contemplated. Changes in hybridization stringency and signal detection are mainly due to
Formamide concentration (lower percentage of formamide results in reduced stringency); achieved by manipulation of salt conditions or temperature. For example,
Low stringency conditions were 6 × SSPE (20 × SSPE = 3M NaC
1; 0.2M NaH ₂ PO ₄ ; 0.02M EDTA, pH 7.4), 0.5%
Incubate overnight at 37 ° C. in a solution containing SDS, 30% formamide, 100 μg / ml salmon sperm blocking DNA, then 1 × SSPE, 0
. Wash at 50 ° C. with 1% SDS. Further, to achieve lower stringency, washes performed after stringent hybridization can be done at higher salt concentrations (eg, 5 × SSC).

Note that variations on the above conditions can be achieved by the inclusion and / or replacement of alternative blocking reagents used to suppress background in hybridization experiments. Representative blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercial proprietary formulations. The inclusion of specific blocking reagents may require modification of the above hybridization conditions due to compatibility issues.

[0050] Depending on the polynucleotide that hybridizes to a portion of the polynucleotide, approximately 15 nucleotides (nt), and more preferably at least approximately 20,
Even more preferably at least about 30, 50, 60, 75, 100, 15
0, 175, 200, 250, 300, 350 nt, preferably about 30-7
A polynucleotide (either DNA or RNA) that hybridizes to 0 nt, or 80-150 nucleotides, or the full length of the reference polynucleotide is contemplated. By a portion of the polynucleotide that is at least "20 nt long", for example, 20 or more contiguous nucleotides from the nucleotide sequence of the reference polynucleotide are contemplated (eg, the deposited cDNA or FIG. 1 (SEQ ID NO: 1)). Nucleotide sequences as shown in In certain embodiments, the polynucleotide comprises nucleotides 0-20, 0-25, 0-30, 0-50, 51-100, 80-100 of the nucleotide sequence disclosed in FIG. 1 (SEQ ID NO: 1).
, 101-200, 201-300, 301-400, 401-450, 451
~ 500, 501-550, 551-600, 601-700, 701-750
, 751-780, and / or 780-820. In other specific embodiments, the polynucleotide comprises amino acid residues 1-14, 10-20, 20-50, 50-1 of the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2).
Hybridizes with the nucleotide sequence encoding 00, 100-133. In certain embodiments, the polynucleotide comprises nucleotides 1-20, 1-25, 1-30, 1-50, 51 of the nucleotide sequence disclosed in SEQ ID NO: 24.
-100, 80-100, 101-200, 201-300, 301-400,
401-450, 451-500, 501-550, 551-600, 601-
700, 701-750, 751-800, 801-850, 851-900,
901-950, 951-1,000, 1,001-1050, 1,051-1
, 100, 1, 101 to 1, 150, 1, 151 to 1, 200, 1, 201 to 1
, 250, and / or 1,251-1,337. In other specific embodiments, the polynucleotide comprises amino acid residues 1-14, 10-20, 20-50, 50-100, of the amino acid sequence set forth in SEQ ID NO: 25.
Hybridizes with a nucleotide sequence encoding 100-130, 130-160, 160-210, 210-240 and / or 240-275. In certain embodiments, the polynucleotide comprises nucleotides 1-20, 1-25, 1-30, 1-50, 51 of the nucleotide sequence disclosed in SEQ ID NO: 26.
-100, 80-100, 101-200, 201-300, 301-400,
401-450, 451-500, 501-550, 551-600, 601-
700, 701-750, 751-800, 801-850, 851-900,
901-950, 951-1,000, 1,001-1050, 1,051-1
, 100, 1, 101 to 1, 150, 1, 151 to 1, 200, 1, 201 to 1
, 250, and / or 1,251 to 1,330. In other specific embodiments, the polynucleotide comprises amino acid residues 1-14, 10-20, 20-50, 50-100, of the amino acid sequence set forth in SEQ ID NO: 27.
100-130, 130-160, 160-210, 210-240, 240-
Hybridizes with the nucleotide sequence encoding 270 and / or 270-296. These polynucleotides have uses, including but not limited to diagnostic probes and primers as discussed above and in more detail below.

Of course, the poly A sequence (eg, FIG. 1 (SEQ ID NO: 1), FIG. 6 (SEQ ID NO: 24)
Alternatively, a polynucleotide that hybridizes only to the 3 ′ terminal poly (A) region (tract) of galectin-11 cDNA shown in SEQ ID NO: 26 or the complementary stretch of T (or U) residue is a part of the nucleic acid of the present invention. Not included in the polynucleotide of the present invention used for hybridization with Because such a polynucleotide hybridizes to any nucleic acid molecule comprising a poly (A) stretch or its complement, such as, in particular, any double-stranded cDNA clone created using an oligo dT primer. Because you do.

As indicated, a nucleic acid molecule of the invention that encodes a galectin 11 polypeptide is a nucleic acid molecule that encodes the amino acid sequence of the polypeptide itself; the coding sequence and additional sequences (eg, amino acids) for the polypeptide. A sequence encoding a leader or secretory sequence (eg, a preprotein sequence, or a proprotein sequence, or a preproprotein sequence); additional non-coding sequences (eg, introns and non-coding 5 ′ and 3 ′ sequences (eg,
RNA processing (splicing signal and polyadenylation signal (
For example, for ribosome binding and mRNA stability, including but not limited to transcribed and untranslated sequences) with or without the additional coding sequences described above. Peptide coding sequence,
An additional coding sequence that encodes an additional amino acid (eg, an amino acid that provides additional functionality); Thus, the sequence encoding the polypeptide can be fused to a marker sequence, such as a sequence encoding a peptide that facilitates purification of the fusion polypeptide. In certain preferred embodiments of this aspect of the invention, the marker amino acid sequence is a tag provided in a hexa-histidine peptide (e.g., a pQE vector (Qiagen, Inc.), especially many of which are commercially available. Is possible).
See, for example, Gentz et al., Proc. Natl. Acad. Sci. USA 86
: 821-824 (1989), hexa-histidine provides for convenient purification of the fusion protein. The "HA" tag is another peptide useful for purification, corresponding to an epitope derived from the influenza hemagglutinin protein, which is described in Wilson et al., Cell 37: 767-77.
8 (1984). As discussed below, other such fusion proteins include galectin 11 fused to Fc at the N-terminus or C-terminus.

[0053] The present invention is also directed to polynucleotide fragments of the polynucleotides of the present invention. In the present invention, "polynucleotide fragment" refers to a short polynucleotide having a nucleic acid sequence, which nucleic acid sequence is located within the deposited clone (ie, the polypeptide encoded by the cDNA within the deposited clone). Encode), a portion of the nucleic acid sequence contained in SEQ ID NOs: 1, 24
Or a part of the nucleic acid sequence represented by SEQ ID NO: 2, 25 or 27, or a part of the polynucleotide sequence encoding the polypeptide of SEQ ID NO: 2, 25 or 27. The nucleotide fragments of the present invention preferably have a length of at least about 15 nt, and more preferably at least about 20 nt.
nt, and more preferably at least about 30 nt, and even more preferably at least about 40 nt, at least about 50 nt, at least about 75 nt, or at least about 150 nt. For example, the fragment "
At least 20 nt in length "is the cD contained in the deposited clone.
It is intended to include 20 or more contiguous bases from the NA sequence or the nucleotide sequence shown in SEQ ID NO: 1, 24, or 26. “Approximately” in this context includes the values specifically recited and values that are larger or smaller by several nucleotides (5, 4, 3, 2, or 1) at either or both termini. These nucleotide fragments include, but are not limited to, use as diagnostic probes and primers as discussed herein. Of course, larger fragments (eg, 50, 150,
(500, 600, 2000 nucleotides).

Further, typical examples of the polynucleotide fragment of the present invention include, for example, about nucleotide numbers 1-48, 49-99, 100-150, 151-
201, 202-252, 253-303, 304-354, 355-405,
Fragments containing or consisting of the sequences from 406 to 450, 451 to 501, and 502 to the end of SEQ ID NO: 1 or the complement thereof, or the cDNA contained in the deposited clone. In this context, “approximately” includes the greater or lesser range up to a few nucleotides (5, 4, 3, 2, or 1), particularly at the recited range and either or both termini. . Preferably, these fragments encode a polypeptide having biological activity. More preferably, these polynucleotides may be used as probes or primers as discussed herein. Polynucleotides that hybridize to these nucleic acid molecules under stringent hybridization conditions or lower stringency conditions are also encompassed by the present invention, as are the polypeptides encoded by these polynucleotides. Included in the present invention.

The exact formulation, route of administration, and dosage of the compound of the present invention to be administered can be chosen by the individual physician in view of the condition of the patient (eg, Fingl et al.,
1975, "The Pharmacological Basis of T
herapeutics. "Ch. 1 p. 1). Other methods are known to those skilled in the art and are within the scope of the present invention.

[0056] However, many polynucleotide sequences (eg, EST sequences) are publicly available and accessible through sequence databases. Some of these sequences are related to SEQ ID NO: 1 and may have been publicly available prior to conception of the present invention. Preferably, such related polynucleotides are specifically excluded from the scope of the present invention. Listing all related sequences is cumbersome. Therefore, preferably, the present invention is the nucleotide sequence described by the general formula a-b (where, a ¹ is any integer of from 1 to 851 of SEQ ID NO: 1, b 15-865 is SEQ ID NO: 1 Wherein both a and b correspond to the nucleotide residue positions set forth in SEQ ID NO: 1 and where b is a + 14 or greater), excluding one or more polynucleotides .

The present invention further relates to variants of the nucleic acid molecules of the invention, which variants encode a protein (ie, a fragment), analog or derivative of the galectin 11 protein. Variants can occur naturally, for example, as natural allelic variants. By "allelic variant" is intended one of several alternative forms of a gene occupying a given locus on the chromosome of an organism. Genes II,
Lewin, B .; Hen, John Wiley & Sons, New York
(1985). Non-naturally occurring variants can be made using mutagenesis techniques known in the art.

[0058] Such variants include nucleotide substitutions, which may include one or more nucleotides,
Includes variants made by deletion or addition. Amino acids 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 141 of the polypeptide of the invention
5, 20, 25, 30, 35, 40, 50 or 20 to 15, 15 to 10, 10
Particularly preferred are variants in which the nucleotide sequence encoding -51-5, 1-3, or 1-2 is substituted, deleted or added in any combination. The variants can be modified in the coding region, the non-coding region, or both regions. Modifications in the coding region may produce conservative or non-conservative amino acid substitutions, deletions or additions. Among these, silent substitutions, additions and deletions are particularly preferred, which do not alter the properties and activities of the galectin-11 protein or a portion thereof. In this respect, conservative substitution is particularly preferred.

A further embodiment of the present invention provides (a) nucleotides encoding amino acids 1-133 of SEQ ID NO: 2: (b) nucleotides encoding amino acids 2-133 of SEQ ID NO: 2: (c) ATCC Deposit No. 209053 The nucleotide sequence of the galectin-11 polypeptide encoded by the cDNA contained therein: (d) SEQ ID NO: 2
5 nucleotides encoding amino acids 1-275: (e) nucleotides encoding amino acids 1-296 of SEQ ID NO: 27: (f) nucleotides encoding amino acid residues 1-121 of SEQ ID NO: 25: (g) SEQ ID NO: 27 amino acid residues 1 to
Nucleotides encoding 142: (h) Nucleotides encoding amino acids 2-275 of SEQ ID NO: 25: (i) Nucleotides encoding amino acid residues 2-296 of SEQ ID NO: 27: (j) Amino acids 151-151 of SEQ ID NO: 25 Nucleotides encoding 275: or (k) at least 75%, 80%, 8% relative to fragments and other polynucleotide sequences of the invention as described herein.
5%, or 90% identical, and more preferably at least 95%, 96%, 9
Includes an isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence that is 7%, 98% or 99% or 98-99% identical. Polynucleotides that hybridize to these nucleic acid molecules under stringent hybridization conditions or lower stringency conditions are also encompassed by the present invention, as are the polypeptides encoded by these polynucleotides. Included in the present invention.

For example, a polynucleotide having a nucleotide sequence that is at least 95% “identical” to a reference nucleotide sequence that encodes a galectin-11 polypeptide of the invention, wherein the polynucleotide sequence encodes a galectin-11 polypeptide. It is intended that the nucleotide sequence of the polynucleotide be identical to the reference sequence, except that it may contain up to 5 nucleotide mismatches for every 100 nucleotides of the reference nucleotide sequence. In other words, up to 5% of the nucleotides of the reference sequence can be deleted or replaced with another nucleotide to obtain a polynucleotide having a nucleotide sequence that is at least 95% identical to the reference nucleotide sequence, Alternatively, as many as 5% of the total nucleotides in a reference sequence can be inserted into the reference sequence. These mutations of the reference sequence may occur at the 5 ′ or 3 ′ terminal position of the reference nucleotide sequence or anywhere between those terminal positions, and may result in nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. Are individually dispersed between The query sequence can be the entire sequence set forth in SEQ ID NO: 1, the ORF (open reading frame), or any of the fragments identified as described herein.

As a practical matter, any particular nucleic acid molecule may have, for example, at least 75%, 80%, 85%, 90%, 92%, 95%, 9
Whether it is 6%, 97%, 98%, or 99% identical is determined, for example, by Bestf
it program (Wisconsin Sequence Analysis)
Package, Version 8 for Unix, Genetics
Computer Group, University Research P
ark, 575 Science Drive, Madison, WI 537.
It can be determined conventionally using known computer programs such as 11). Bestfit is described in Smith and Waterman, Advances.
in Applied Matrices 2: 482-489 (1
981) using the local homology algorithm to find the best segment of homology between the two sequences. When using Bestfit or any other sequence alignment program to determine whether a particular sequence is 95% identical to, for example, a reference sequence according to the present invention, the parameters, of course, are: It is set to be calculated over the entire length of the reference nucleotide sequence and to allow for gaps in homology up to 5% of the total nucleotide number of the reference sequence.

A preferred method for determining the best overall match (also referred to as an overall sequence alignment) between a query sequence (a sequence of the invention) and a subject sequence is described in Brutlag et al. Comp. App. Biosci. 6: 237-245 (
1990)) using the FASTDB computer program based on the algorithm. In sequence alignment, the query and subject sequences are both DNA sequences. RNA sequences can be compared by converting U to T. The results of the above overall sequence alignment are given as percent identity (%). Preferred parameters used in FASTDB alignment of DNA sequences to calculate percent identity are: Matrix = Unitary, k-tu
ple = 4, Mismatch Penalty = 1, Joining Pen
alty = 30, Randomization Group Length = 0
, Cutoff Score = 1, Gap Penalty = 5, Gap Si
ze Penalty 0.05, Window Size = 500 or the length of the nucleotide sequence of interest (whichever is shorter).

According to this embodiment, if the subject sequence is shorter than the query sequence due to a 5 ′ or 3 ′ deletion (not due to an internal deletion), a manual correction must be made to the result . This is equivalent to FASTDB when calculating percent identity.
This is because the program does not consider the 5 'and 3' truncations of the subject sequence. For a subject sequence truncated at the 5 'end or 3' end, the percent identity to the query sequence is the query sequence, which is 5 'and 3' of the subject sequence that are not matched / aligned as a percentage of the total bases of the query sequence. Is corrected by calculating the number of bases Whether nucleotides are matched / aligned is determined by the result of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity and calculated by the FASTDB program described above using the specified parameters to arrive at the final percent identity score. This corrected score is used for the purpose of the present invention. Only those bases outside of the 5 'and 3' bases of the subject sequence that are not matched / aligned with the query sequence, as indicated by FASTDB alignment, are calculated for the purpose of manually adjusting the percent identity score.

For example, a 90 base subject sequence is aligned with a 100 base query sequence to determine percent identity. The deletion occurs at the 5 'end of the subject sequence, so the FASTDB alignment does not show a match / alignment at the first 10 bases at the 5' end. 1
Zero unpaired bases represent 10% of the sequence (number of bases at the unmatched 5 'and 3' ends / total number of bases in the query sequence), so that 10% is FASTD
It is subtracted from the percent identity score calculated by the B program.
If the remaining 90 bases match exactly, the final percent identity is 90%. In another example, a 90 base subject sequence is compared to a 100 base query sequence. In this case, the deletion is an internal deletion, so that no base is present 5 'or 3' of the subject sequence which does not match / align with the query. In this case, FASTD
The percent identity calculated by B is not manually corrected. Again, only the 5 'and 3' bases of the subject sequence that do not match / align with the query sequence are manually corrected. Other manual corrections are not made for the purposes of this embodiment.

[0065] Galectin-11 variants may include alterations in the coding region, non-coding region, or both. Particularly preferred are polynucleotide variants that contain modifications that produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded polypeptide. Nucleotide variants generated by silent substitutions due to the degeneracy of the genetic code are preferred. Further, variants in which 5 to 10, 1 to 5, or 1 to 2 amino acids are substituted, deleted, or added in any combination are also preferable. Galectin-11 polynucleotide variants may be used for various reasons, such as optimizing codon expression for a particular host (human
Codons in RNA are E. coli, which is changed to a preferred codon by a bacterial host such as E. coli). In further embodiments, variants may include sequence changes in sequences located outside of the conserved domain. A naturally occurring galectin-11 variant is called an "allelic variant"
And refers to one of several alternative forms of a gene occupying a given locus on the chromosome of an organism. (Genes II, Lewin, B., edited by John
Wiley & Sons, New York (1985)). These allelic variants can vary at either the polynucleotide and / or polypeptide level and are included in the present invention. Alternatively, non-naturally occurring variants may be produced by mutagenesis techniques or by direct synthesis.

Using known methods of protein engineering and recombinant DNA technology, variants are
It can be made to improve or alter the properties of galectin-11 polypeptide. For example, one or more amino acids can be deleted from the N-terminus or C-terminus of a secreted polypeptide without substantial loss of biological function. Ron et al. Bio
l. Chem. 268: 2984-2988 (1993).
Alternatively, a modified KGF protein having heparin binding activity was reported even after deletion of the 27 amino-terminal amino acid residues. Similarly, interferon γ
Showed up to 10-fold higher activity after deleting 8-10 amino acid residues from the carboxy terminus of this protein (Dobeli et al., J. Biotec).
hnology 7: 199-216 (1988)).

Furthermore, a wealth of evidence demonstrates that variants often retain biological activity similar to that of a naturally occurring protein. For example, Gayl
e and coworkers (J. Biol. Chem 268: 22105-221).
11 (1993)) performed an extensive mutational analysis of the human cytokine IL-1a. They used random mutagenesis to generate more than 3,500 individual IL-
The 1a mutant was created. Multiple mutations were tested at all possible amino acid positions. The researchers found that "most of the molecules can be changed with little effect on either [binding activity or biological activity]." (See summary). In fact, of the more than 3,500 nucleotide sequences tested, only 23 unique amino acid sequences produced proteins with significantly different activities than the wild type.

In addition, deletion of one or more amino acids from the N-terminus or C-terminus of a polypeptide may result in alteration or deletion of one or more biological functions, but not other biological functions. Activity may still be retained. For example, the ability of a deletion variant to induce and / or bind an antibody that recognizes a secreted form is determined when fewer than the majority of residues in the secreted form are removed from the N-terminus or C-terminus. Seems to be retained. Whether a particular polypeptide lacking the N- or C-terminal residue of a protein retains such immunogenic activity depends on the conventional methods described herein, and If not, it can be easily determined by a conventional method known in the art.

Accordingly, the present invention further includes galectin-11 polypeptide variants that exhibit substantial biological activity. Such variants include deletions, insertions, inversions, repeats, and substitutions that are selected according to general rules known in the art, with little effect on activity.

This application relates to the nucleic acid sequences disclosed herein (eg, the nucleic acid sequences shown in FIG. 1 or 6 (SEQ ID NO: 1, 24, or 26), the nucleic acid sequence of the deposited cDNA clone, and A nucleic acid sequence encoding a polypeptide having an N- and / or C-terminally deleted amino acid sequence disclosed below as mn of SEQ ID NO: 2, 25, or 27 and at least 75%, 80%, 85%, 90%, 92%, 95
%, 96%, 97%, 98% or 99% identical nucleic acid molecules, regardless of whether they encode a polypeptide having galectin 11 functional activity. This is because even if a particular nucleic acid molecule does not encode a polypeptide having galectin-11 functional activity, one of skill in the art will recognize methods for using that nucleic acid molecule (eg, hybridization probes or polymerase chain reaction (PCR) ) As a primer). The use of the nucleic acid molecule of the present invention which does not encode a polypeptide having a galectin-11 functional activity includes, in particular, (1) isolating a galectin-11 gene or an allelic or splice variant thereof in a cDNA library. (2) Verma et al., Human Chromosomes: AM
annual of Basic Technologies, Pergamon P
metaphase chromosomal spread (spread) to provide the exact chromosomal location of the galectin 11 gene, as described in the Res., New York (1988).
In situ hybridization (eg, "FISH") to (3)
A) use in linkage analysis as a marker for chromosome 11; and (4) Northern blot analysis to detect galectin 11 mRNA expression in specific tissues.

However, the nucleic acid sequence disclosed herein as shown in FIG. 1 or 6 (SEQ ID NO: 1, 24 or 26), the nucleic acid sequence of the deposited cDNA clone,
At least 75%, 80%, 8% of the nucleic acid encoding the polypeptide shown in FIG. 1 or 6 (SEQ ID NO: 2, 25 or 27), and fragments thereof.
Preferred are nucleic acid molecules having a sequence that is 5%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical, which in fact encodes a polypeptide having galectin 11 functional activity I do. By a "polypeptide having galectin-11 functional activity", the functional activity of a galectin-11 protein of the invention (e.g., the same as, but not necessarily identical to, the full (full-length) galectin-11 and mature galectin-11) as measured in a particular assay. Polypeptides that exhibit (although not necessarily) activity are contemplated. Galectin-11 protein activity can be measured, for example, by a β-galactoside sugar (eg, thiodigalactoside or lactose) binding assay, an assay for apoptosis, and / or an aggregation of trypsinized rabbit erythrocytes, as further described below. It can be measured using an assay.

Of course, due to the degeneracy of the genetic code, one skilled in the art will appreciate the nucleic acid sequence of the deposited cDNA, the nucleic acid sequence shown in FIG. 1 or 6 (SEQ ID NO: 1, 24 or 26), FIG. At least 75%, 80% of the nucleic acid encoding the polypeptide shown in SEQ ID NO: 2, 25 or 27, or a fragment thereof.
Numerous nucleic acid molecules having a sequence that is%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical encode a "polypeptide having galectin 11 functional activity" Understand right away. Indeed, since many degenerate variants of these nucleotide sequences encode the same polypeptide, this will be apparent to one of skill in the art, even without performing the above-described comparative assays. Further, it is recognized that for such nucleic acid molecules that are not degenerate variants, a reasonable number will also encode a polypeptide having galectin-11 activity. This is because, as described further below, one skilled in the art will recognize that amino acid substitutions that do not significantly or possibly significantly affect the function of a protein (eg, replacing one aliphatic amino acid with a second aliphatic amino acid) Substitution with amino acid)
Because they are fully aware of

For example, guidance on how to make phenotypically silent amino acid substitutions can be found in Bowie et al., Deciphering the Message in P.
protein Sequences: Tolerance to Amino
Acid Substitutions, Science 247: 1306-
1310 (1990), where the authors show that the protein is surprisingly tolerant of amino acid substitutions.

The first strategy exploits the tolerance of amino acid substitutions by natural selection during the course of evolution. By comparing amino acid sequences in different species, conserved amino acids can be identified. These conserved amino acids appear to be important for protein function. In contrast, amino acid positions where substitutions have been tolerated by natural selection indicate that these positions are not critical to protein function. Thus, positions that tolerate amino acid substitutions can be modified, but still maintain the biological activity of the protein.

A second strategy uses genetic engineering to introduce amino acid changes at specific positions in the cloned gene to identify regions important for protein function. For example, site-directed mutagenesis or alanine scanning mutagenesis (
Introducing one alanine mutation at each residue in the molecule) can be used. (Cunni
ngham and Wells, Science 244: 1081-1085 (
1989)). The resulting mutant molecules can then be tested for biological activity.

As the authors mention, these two strategies have revealed that proteins are surprisingly tolerant of amino acid substitutions. The authors further indicate which amino acid changes appear to be tolerated at specific amino acid positions in the protein. For example, amino acid residues that are mostly buried (within the tertiary structure of the protein) require nonpolar side chains, but are generally poorly conserved as features of surface side chains. In addition, conservative conservative amino acid substitutions include substitutions of Ala, Val, Leu, and Ile for aliphatic or hydrophobic amino acids;
er and Thr substitutions; acidic residues Asp and Glu substitutions; amide residues Asn and Gln substitutions, basic residues Lys, Arg, and His substitutions; aromatic residues Phe, Tyr, and Trp substitutions and small size amino acid substitutions for Ala, Ser, Thr, Met, and Gly.

For example, a site-specific mutation at the amino acid level of galectin 11 in FIG. 1 (SEQ ID NO: 2) can be made by replacing a specific amino acid with a conservative amino acid.
Preferred conservative mutations include: A, G, I, substituted for M1.
L, S, T, or V; A, G, I, L, T, M, or V substituted for S2; R;
H or K substituted with 4; A, G, I, S, T, M or V substituted with L5
D substituted with E6; A, G, I, L, S, T or M substituted with V7; S1
A, G, I, L, T, M or V substituted with 0; K or R substituted with H11; G, I, L, S, T, M or V substituted with A12; substituted with L13 A
, G, I, S, T, M, or V; N substituted with Q15; A substituted with G16;
I, L, S, T, M, or V; A, G, I, S, T, M, or V substituted for L17; A, G, I, L, T, M, or V substituted for S18 A, I, L, S, T, M or V substituted with G20; N substituted with Q21; A, G, I, L, S, T or M substituted with V22; A substituted with I23 , G, L, S, T, M
A, G, L, S, T, M or V substituted with I24; A, G, I, L, S, T or M substituted with V25; H or K substituted with R26 G
A, I, L, S, T, M, or V substituted with 27; A, G, substituted with L28
I, S, T, M, or V; A, G, I, L, S, T, or M substituted for V29; A, G, I, S, T, M, or V substituted for L30; Q31 N replaced with
D substituted with E32; H substituted with K34, or R; K substituted with H35;
Or R; W substituted for F36, or Y; A, G, I, L substituted for T37;
S, M, or V; A, G, I, L, S, T, or M substituted for V38; S3
A, G, I, L, T, M, or V substituted with 9; A, G, I substituted with L40
, S, T, M, or V; H substituted with R41, or K; E substituted with D42.
N substituted with Q43; G, I, L, S, T, M or V substituted with A44;
G, I, L, S, T, M or V substituted with A45; K or R substituted with H46; G, I, L, S, T, M or V substituted with A47; substituted with V49 A, G, I, L, S, T, or M; A, G, I, L, S,
M, or V; A, G, I, S, T, M, or V substituted with L51; H, or K substituted with R52; G, I, L, S, T, M, or substituted with A53 V;
A, G, I, L, T, M, or V substituted with S54; W substituted with F55, or Y; G, I, L, S, T, M, or V substituted with A56; substituted with D57 E; H substituted with R58, or K; A, G, I, L, S substituted with T59.
M, or V; A, G, I, S, T, M, or V substituted for L60; G, I, L, S, T, M, or V substituted for A61; F, substituted for W62, or Y;
A, G, L, S, T, M, or V substituted for I63; A, G substituted for S64
, I, L, T, M, or V; H substituted with R65, or K; F substituted with W66, or Y; A, I, L, S, T, M, or V substituted with G67; Q68.
N substituted with K; H substituted with K69, or R; H substituted with K70, or R
A, G, I, S, T, M, or V substituted for L71; A substituted for I72;
G, L, S, T, M, or V; A, G, I, L, T, M, or V substituted for S73; G, I, L, S, T, M, or V substituted for A74. W substituted for F76, or Y; A, G, I, S, T, M, or V substituted for L77; F78;
W substituted with Y or F; F substituted with Y79 or W; N substituted with Q81
H substituted with R82, or K; W substituted with F83, or Y; W substituted with F84, or Y; D substituted with E85; A, G, I, L substituted with V86;
S, T, or M; A, G, I, S, T, M, or V substituted for L87; L8
A, G, I, S, T, M, or V substituted with 8; A, G, I substituted with L89
, S, T, M, or V; W substituted for F90, or Y; N substituted for Q91
D substituted with E92; A, I, L, S, T, M or V substituted with G93;
A, I, L, S, T, M, or V substituted for G94; A, G substituted for L95
, I, S, T, M, or V; H substituted with K96, or R; A, G, I, S, T, M, or V substituted with L97; G, I, L, substituted with A98. S, T,
M, or V; A, G, I, S, T, M, or V substituted for L99; N100
Q substituted with G; A, I, L, S, T, M or V substituted with G101; Q10
N substituted with 2; A, I, L, S, T, M or V substituted with G103; L1
A, G, I, S, T, M, or V substituted with G04; A, I substituted with G105
, L, S, T, M, or V; G, I, L, S, T, M, or V substituted for A106; A, G, I, L, S, M, or V substituted for T107. A, G, I, L, T, M, or V substituted for S108; A, G, I, L substituted for M109
, S, T, or V; Q substituted with N110; N substituted with Q111; Q112
N substituted with; G, I, L, S, T, M, or V substituted with A113; L11
A, G, I, S, T, M, or V substituted with 4; D substituted with E115; Q1
N substituted with 16; A, G, I, S, T, M or V substituted with L117; R
H substituted for 118, or K; D substituted for E119; A substituted for L120
, G, I, S, T, M, or V; H substituted with R121, or K;
A, G, L, S, T, M, or V substituted with S; A, G, I substituted with S123
, L, T, M, or V; A, I, L, S, T, M, or V substituted with G124; A, G, I, L, T, M, or V substituted with S125; A substituted for A, G, I, L, S, T or M; N substituted for Q127; A, G, I, S, T, M or V substituted for L128; F or W substituted for Y129 V
A, G, I, L, S, T, or M substituted with 131; K substituted with H132,
Or R; A, G, I, L, T, M, or V substituted with and / or S133.

Using these same principles, similar conservative substitutions can be made in the polypeptide of SEQ ID NO: 25 or 27.

The resulting constructs can be routinely screened for activities or functions described throughout this specification and known in the art. Preferably, the resulting construct has increased and / or decreased galectin-11 activity or function, while retaining the remaining galectin-11 activity or function. More preferably, the resulting construct has more than one increased and / or reduced galectin 11 activity or function, while retaining the remaining galectin 11 activity or function.

In addition to conservative amino acid substitutions, variants of galectin 11 may include (i) substitutions with one or more non-conservative amino acid residues, wherein the substituted amino acid residues are May or may not be an encoded amino acid residue, or (ii) substitution with one or more amino acid residues having a substituent, or (iii) another compound (eg, Fusion of the mature polypeptide with a compound (eg, polyethylene glycol) to increase the stability and / or solubility of the peptide, or (iv) additional amino acids (eg, an IgG Fc fusion region peptide, or leader or secretion) Sequence, or a sequence that facilitates purification). Such variant polypeptides are considered to be within the purview of those skilled in the art given the teachings herein.

For example, a galectin-11 polypeptide variant comprising an amino acid substitution of a charged amino acid with another charged or neutral amino acid has improved properties (eg, less aggregation) Protein can be produced. Aggregation of a pharmaceutical formulation results in both reduced activity and increased clearance due to the immunogenic activity of the aggregate. (Pinkard et al., Clin. Exp. Immuno.
l. 2: 331-340 (1967); Robbins et al., Diabetes.
36: 838-845 (1987); Cleland et al., Crit. Rev .. T
herapeutic Drug Carrier Systems 10: 3
07-377 (1993)).

For example, preferred non-conservative substitutions for galectin 11 of FIG. 1 (SEQ ID NO: 2) include: D, E, H, K, R, N, Q, F, W substituted for M1. ,
Y, P, or C; D, E, H, K, R, N, Q, F, W, Y,
P or C; D, E, H, K, R, A, G, I, L, S, T,
M, V, N, Q, F, W, Y, or C; D, E, A, G, I,
L, S, T, M, V, N, Q, F, W, Y, P, or C; D substituted for L5,
E, H, K, R, N, Q, F, W, Y, P, or C; H, K,
R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; V
D, E, H, K, R, N, Q, F, W, Y, P, or C substituted with 7; D, E, H, K, R, A, G, I, L substituted with P8 , S, T, M, V, N, Q, F,
W, Y, or C; D, E, H, K, R, A, G, I, L, S, substituted for C9
T, M, V, N, Q, F, W, Y, or P; D, E, H, K substituted for S10
, R, N, Q, F, W, Y, P, or C; D, E, A, G,
I, L, S, T, M, V, N, Q, F, W, Y, P, or C; D, E, H, K, R, N, Q, F, W, Y substituted for A12 , P, or C; D, E, H, K, R, N, Q, F, W, Y, P, or C substituted with L13; D substituted with P14
, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; D, E, H, K, R, A, G, I, L, S, T, M,
V, F, W, Y, P, or C; D, E, H, K, R, N, Q substituted for G16
, F, W, Y, P, or C; D, E, H, K, R, N, Q,
F, W, Y, P, or C; D, E, H, K, R, N, Q, F substituted for S18
, W, Y, P, or C; D, E, H, K, R, A, G, I,
L, S, T, M, V, N, Q, F, W, Y, or C; D, E substituted for G20
, H, K, R, N, Q, F, W, Y, P, or C; D, E,
H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; V
D, E, H, K, R, N, Q, F, W, Y, P, or C substituted with 22;
D, E, H, K, R, N, Q, F, W, Y, P, or C substituted with 3;
D, E, H, K, R, N, Q, F, W, Y, P, or C substituted with V; D, E, H, K, R, N, Q, F, W, substituted with V25 Y, P, or C; D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C substituted with R26; D, E, H, K, R, N, Q, F, W, Y, P, or C; D, E, H, K, R, N, Q, F, W, Y, P substituted for L28 Or C; D, E, H, K, R, N, Q, F, W, Y, P, or C substituted with V29
D, E, H, K, R, N, Q, F, W, Y, P, or C substituted with L30;
D, E, H, K, R, A, G, I, L, S, T, M, V, F,
W, Y, P, or C; H, K, R, A, G, I, L, S, T substituted for E32.
, M, V, N, Q, F, W, Y, P, or C; D, E, H,
K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; K
34, D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y
, P, or C; D, E, A, G, I, L, S, T, M, V,
N, Q, F, W, Y, P, or C; D, E, H, K, R, N substituted for F36
, Q, A, G, I, L, S, T, M, V, P, or C; D substituted for T37,
E, H, K, R, N, Q, F, W, Y, P, or C; D, E substituted for V38
, H, K, R, N, Q, F, W, Y, P, or C; D, E,
H, K, R, N, Q, F, W, Y, P, or C; D, E, H substituted for L40
, K, R, N, Q, F, W, Y, P, or C; D, E, A,
G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; H, K, R, A, G, I, L, S, T substituted with D42 , M, V, N, Q, F, W, Y, P
Or C; D, E, H, K, R, A, G, I, L, S, T,
M, V, F, W, Y, P, or C; D, E, H, K, R, N substituted for A44
, Q, F, W, Y, P, or C; D, E, H, K, R, N,
Q, F, W, Y, P, or C; D, E, A, G, I, L, S substituted for H46
, T, M, V, N, Q, F, W, Y, P, or C; D, E,
H, K, R, N, Q, F, W, Y, P, or C; D, E, H substituted for P48
, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C;
D, E, H, K, R, N, Q, F, W, Y, P or C substituted with V49; T
D, E, H, K, R, N, Q, F, W, Y, P, or C substituted with 50; L5
D, E, H, K, R, N, Q, F, W, Y, P, or C substituted with 1; R52
D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P
Or C; D, E, H, K, R, N, Q, F, W, Y, P,
Or C; D, E, H, K, R, N, Q, F, W, Y, P, or C substituted with S54; or D, E, H, K, R, N, Q, substituted with F55. A, G, I, L, S,
T, M, V, P, or C; D, E, H, K, R, N, Q, F substituted for A56
, W, Y, P, or C; H, K, R, A, G, I, L, S,
T, M, V, N, Q, F, W, Y, P, or C; D, E, A substituted for R58
, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; D, E, H, K, R, N, Q, F, W, Y, P, or C; D, E, H, K, R, N, Q, F, W, Y, P, or C substituted for L60; D, E, H, K, substituted for A61. R, N, Q, F, W, Y, P, or C; D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V substituted with W62. , P, or C; D, E, H, K, R, N, Q, F, W, Y, P, or C substituted with I63
D, E, H, K, R, N, Q, F, W, Y, P, or C substituted for S64;
D, E, A, G, I, L, S, T, M, V, N, Q, F, W,
Y, P, or C; D, E, H, K, R, N, Q, A, G, I substituted for W66
, L, S, T, M, V, P, or C; D, E, H, K, R,
N, Q, F, W, Y, P, or C; D, E, H, K, R, A substituted for Q68
, G, I, L, S, T, M, V, F, W, Y, P, or C; D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C
D, E, A, G, I, L, S, T, M, V, N, Q, F, W substituted for K70
, Y, P, or C; D, E, H, K, R, N, Q, F, W,
Y, P, or C; D, E, H, K, R, N, Q, F, W, Y substituted with I72
, P, or C; D, E, H, K, R, N, Q, F, W, Y,
P or C; D, E, H, K, R, N, Q, F, W, Y, P substituted for A74
Or C; D, E, H, K, R, A, G, I, L, S, T,
M, V, N, Q, F, W, Y, or C; D, E, H, K, R substituted for F76
, N, Q, A, G, I, L, S, T, M, V, P, or C; D, E, H, K, R, N, Q, F, W, Y, P or C; D substituted with F78
, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C;
D, E, H, K, R, N, Q, A, G, I, L, S, T, M,
V, P, or C; D, E, H, K, R, A, G, I, L, S substituted for P80
, T, M, V, N, Q, F, W, Y, or C; D, E, H,
K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; R82
D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P
Or C; D, E, H, K, R, N, Q, A, G, I, L,
S, T, M, V, P, or C; D, E, H, K, R, N, Q substituted for F84
, A, G, I, L, S, T, M, V, P, or C; H, K,
R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; V
D, E, H, K, R, N, Q, F, W, Y, P, or C substituted with 86; L8
D, E, H, K, R, N, Q, F, W, Y, P, or C substituted with 7; L88
D, E, H, K, R, N, Q, F, W, Y, P, or C substituted with L89; D, E, H, K, R, N, Q, F, W, substituted with L89 Y, P or C; D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P or C substituted with F90; substituted with Q91 D, E, H, K, R, A, G, I, L, S, T, M,
V, F, W, Y, P, or C; H, K, R, A, G, I, L substituted for E92
, S, T, M, V, N, Q, F, W, Y, P, or C; D substituted for G93,
E, H, K, R, N, Q, F, W, Y, P, or C; D, E substituted for G94
, H, K, R, N, Q, F, W, Y, P, or C; D, E,
H, K, R, N, Q, F, W, Y, P, or C; D, E, A substituted for K96
, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; D, E, H, K, R, N, Q, F, W, Y, P, or C; D, E, H, K, R, N, Q, F, W, Y, P, or C substituted for A98; D, E, H, K, substituted for L99. R, N, Q, F, W, Y, P, or C; D, E, H, K, R, A, G, I, L, S, T, M, V, F, W substituted for N100 , Y, P,
Or C; D, E, H, K, R, N, Q, F, W, Y, P,
Or C; D, E, H, K, R, A, G, I, L, S, T,
M, V, F, W, Y, P, or C; D, E, H, K, R,
N, Q, F, W, Y, P, or C; D, E, H, K, R,
N, Q, F, W, Y, P, or C; D, E, H, K, R,
N, Q, F, W, Y, P, or C; D, E, H, K, R,
N, Q, F, W, Y, P, or C; D, E, H, K, R,
N, Q, F, W, Y, P, or C; D, E, H, K, R,
N, Q, F, W, Y, P, or C; D, E, H, K, R,
N, Q, F, W, Y, P, or C; D, E, H, K, R,
A, G, I, L, S, T, M, V, F, W, Y, P, or C; D, E, H, K, R, A, G, I, L, S substituted for Q111 , T, M, V, F, W, Y, P,
Or C; D, E, H, K, R, A, G, I, L, S, T,
M, V, F, W, Y, P, or C; D, E, H, K, R,
N, Q, F, W, Y, P, or C; D, E, H, K, R,
N, Q, F, W, Y, P, or C; H, K, R, A, G,
I, L, S, T, M, V, N, Q, F, W, Y, P, or C; D, E, H, K, R, A, G, I, L, S substituted for Q116 , T, M, V, F, W, Y, P,
Or C; D, E, H, K, R, N, Q, F, W, Y, P,
Or C; D, E, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, P, or C; H, K, R, A, G, I,
L, S, T, M, V, N, Q, F, W, Y, P, or C; D, E, H, K, R, N, Q, F, W, Y, P substituted for L120 Or C; D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C substituted with R121
D, E, H, K, R, N, Q, F, W, Y, P, or C substituted for I122;
D, E, H, K, R, N, Q, F, W, Y, P, or C substituted for S123;
D, E, H, K, R, N, Q, F, W, Y, P, or C substituted for G124;
D, E, H, K, R, N, Q, F, W, Y, P, or C substituted for S125;
D, E, H, K, R, N, Q, F, W, Y, P, or C substituted for V126;
D, E, H, K, R, A, G, I, L, S, T, M, V,
F, W, Y, P, or C; D, E, H, K, R, N, Q,
F, W, Y, P, or C; D, E, H, K, R, N, Q,
A, G, I, L, S, T, M, V, P, or C; D, E, substituted for C130
H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P
D, E, H, K, R, N, Q, F, W, Y, P, or C substituted with V131
D, E, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, P, or C; and D, E, H, K, R, N, substituted with S133.
Q, F, W, Y, P, or C. Using these same principles, similar non-conservative substitutions can be made in the polypeptide of SEQ ID NO: 25 or 27.

[0083] The resulting constructs can be routinely screened for activities or functions described throughout this specification and known in the art. Preferably, the resulting construct has increased and / or decreased galectin-11 activity or function, while retaining the remaining galectin-11 activity or function. More preferably, the resulting construct has more than one increased and / or reduced galectin-11 activity or function, while retaining the remaining galectin-11 activity or function.

Further, more than one amino acid (eg, 2, 3, 4, 5, 6, 7, 8, 9, and 10) may be as described above (either conservative or non-conservative). It can be replaced with a substituted amino acid. Substituted amino acids, galectin 11 full-length protein, mature, or proprotein and formula ^{m-n [m 1 -n 1} ,, m 1 -n 2, m 1 -
^{n 3, m 2 -n 1,} m 2 -n 2, m 2 -n 3, m 3 -n 1, m 3 -n 2, and m ³ -n ^3]
Can occur in N-terminal deletion mutants and C-terminal deletion mutants having

A further embodiment of the invention comprises at least one amino acid substitution, but no more than 50 amino acid substitutions, even more preferably no more than 40 amino acid substitutions, even more preferably no more than 30 amino acid substitutions. And even more preferably a galectin 1 having an amino acid sequence comprising no more than 20 amino acid substitutions
A polypeptide comprising the amino acid sequence of one polypeptide. Of course, at least one, but 10, 9, 8, 7, 6, 5, 4, 3, 2 in increasing priority order
It is highly preferred for polypeptides to have an amino acid sequence that comprises the amino acid sequence of a galectin-11 polypeptide, including no more than one amino acid substitution.
In certain embodiments, additions, substitutions, and / or amino acid sequences of SEQ ID NO: 2, 25, or 27, or fragments thereof (eg, the mature form and / or other fragments described herein) are provided. The number of deletions is 1-5,
5-10, 5-25, 5-50, 10-50, or 50-150, with conservative amino acid substitutions being preferred.

(Vector, Host Cell, and Protein Production) The present invention also relates to a vector containing the isolated DNA molecule of the present invention, a host genetically engineered using the polynucleotide and / or the recombinant vector of the present invention. It relates to the production of galectin-11 polypeptides and fragments, variants, variants, derivatives, and analogs thereof by cells and recombinant techniques.

[0087] The galectin-11 polynucleotide can be ligated to a vector containing a selectable marker for propagation in a host. Generally, a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it can be packaged in vitro using a suitable packaging cell line and then transduced into host cells.

In one embodiment, the DNA of the present invention comprises a suitable heterologous control element (eg, a promoter or enhancer) (eg, phage λ, to name a few).
PL promoter, E. E. coli lac promoter, trp promoter and tac promoter, SV40 early promoter and SV40 late promoter, and the promoter of the retroviral LTR. Other suitable promoters and enhancers are known to those skilled in the art.

In embodiments in vectors containing expression constructs, these expression constructs further include sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation. The coding portion of the transcript expressed by this construct preferably includes a translation initiation codon first and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.

As indicated, the expression vectors preferably include at least one selectable marker. Such markers include dihydrofolate reductase or G418 neomycin resistance for eukaryotic cell culture, and E. coli. Includes a tetracycline, kanamycin or ampicillin resistance gene for culturing in E. coli and other bacteria. Representative examples of suitable hosts include bacterial cells (eg, E. coli,
Streptococcus staphylococci, Bacillus
subtilis, Streptomyces and Salmonella
typhimurium cells); fungal cells (eg, yeast cells); insect cells (eg, Drosophilia S2 and Spodoptera Sf9 cells);
Animal cells (for example, CHO cells, COS cells, Hela cells, C127 cells,
T3 cells, BHK cells, HEK293 cells, and Bowes melanoma cells)
As well as, but not limited to, plant cells. Suitable culture media and conditions for the above-described host cells are known in the art.

Selection of suitable vectors and promoters for expression in a host cell
Techniques that are well known and essential for expression vector construction, introduction of the vector into the host, and expression in the host are routine in the art. A wide variety of expression vectors can be used to express the galectin-11 polypeptides and fragments, variants, derivatives, and analogs of the present invention.
Such vectors include chromosomal vectors, episomal vectors, and virus-derived vectors (eg, bacterial plasmid-derived vectors, bacteriophage-derived vectors, yeast episome-derived vectors, yeast chromosome element vectors, and virus-derived vectors (eg, baculovirus, papovavirus). (Eg, SV40), vaccinia virus, adenovirus, fowlpox virus, pseudorabies virus, and retrovirus), and vectors (eg, plasmids and bacteriophage genetic elements (eg, cosmids and phagemids)) derived from combinations thereof. And vectors that can be used for expression in accordance with this aspect of the invention. Maintaining the polynucleotide to express the growth, or any suitable vectors for expression can be used. The appropriate nucleotide sequence may be any of a variety of known techniques (see, eg, Ausubel et al., Eds., 1989, Cur
Rent Protocols in Molecular Biology,
Green Publishing Associates, Inc. And J
ohn Wiley & Sons, Inc. , A technology shown in New York)
Can be inserted into an expression vector system.

Among the preferred vectors for use in bacteria are pQE70, pQE6
0 and pQE-9 (available from QIAGEN, Inc.); pBS vector, Phasescript vector, Bluescript vector, pNH8
A, pNH16a, pNH18A, pNH46A (Stratagene Cl
oning Systems, Inc. And ptrc99a
, PKK223-3, pKK233-3, pDR540, pRIT5 (Phar
macia.). Among preferred eukaryotic vectors are pWL
NEO, pSV2CAT, pOG44, pXT1 and pSG (Stratag
and pSVK3, pBPV, pMSG and pSV
L (available from Pharmacia). Other suitable vectors will be readily apparent to one skilled in the art.

[0093] The present invention also relates to host cells containing the vector constructs discussed herein, and further using one of the techniques known in the art, for one or more heterologous control regions (eg, promoters and / or Or a host cell comprising a nucleotide sequence of the invention operably linked to an enhancer). As discussed above,
The host cell is a higher eukaryotic cell (eg, a mammalian cell (eg, a human-derived cell)).
Or lower eukaryotic cells (eg, yeast cells) or host cells can be prokaryotic cells (eg, bacterial cells). Host strains may be chosen which modulate the expression of the inserted gene sequences, or modify and process the gene product in the specific fashion desired. Expression from a particular promoter can be elevated in the presence of a particular inducer; thus, expression of the engineered polypeptide can be controlled. In addition, different host cells have characteristic and specific mechanisms for the translation and post-translational processing and modification of proteins (eg, glycosylation, phosphorylation, cleavage). Appropriate cell lines can be chosen to ensure the desired modification and processing of the foreign protein expressed.

For secretion of the translated protein into the lumen of the endoplasmic reticulum, into the periplasmic space, or into the extracellular milieu, appropriate secretion signals are generated within the desired polypeptide using techniques known in the art. Can be incorporated into These signals can be endogenous to the polypeptide or they can be heterologous signals.

The introduction of the construct into the host cell can be performed by calcium phosphate transfection, DE
It can result from AE-dextran-mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection or other methods. Such a method is described in Davis et al., Basic Method.
It is described in many standard laboratory manuals, such as s In Molecular Biology (1986). Galectin-11 polypeptides can, in fact, be expressed by host cells that lack the recombinant vector.

The polypeptide may be expressed in a modified form, such as a fusion protein, including a polypeptide linked via a peptide bond to a heterologous protein sequence (of a different protein), and may contain not only secretion signals but also May also include additional heterogeneous functional domains. For example, the region of additional amino acids, particularly charged amino acids, may be used to improve stability and persistence in a host cell during purification or during subsequent manipulation and storage, such that the N-terminal Can be added to Also, peptide moieties can be added to the polypeptide to facilitate purification. Such regions can be removed prior to final preparation of the polypeptide. In particular, the addition of peptide moieties to polypeptides to cause secretion or excretion, improve stability, and to facilitate purification is well known in the art, and is well known in the art. is there. Alternatively, such fusion proteins can be made by protein synthesis techniques (eg, by use of a peptide synthesizer).

[0097] Preferred fusion proteins contain a heterologous region from an immunoglobulin that is useful for solubilizing the protein. For example, EP-A-O 464 533 (Canadian correspondence application 2)
No. 045869) discloses a fusion protein comprising various portions of the constant region of an immunoglobulin molecule together with another human protein or portion thereof. In many cases, the Fc portion in a fusion protein is sufficiently advantageous for use in therapy and diagnosis, thus resulting, for example, in improved pharmacokinetic properties (EP-A 0232).
262). On the other hand, for some uses, it is desirable that the Fc portion can be deleted after the fusion protein has been expressed, detected and purified in the advantageous manner described. This is when the Fc moiety proves to be an obstacle to its use in therapy and diagnosis (eg, when the fusion protein is to be used as an antigen for immunization). In drug discovery, for example, human proteins such as hIL5- have been fused to Fc portions for the purpose of high-throughput screening assays to identify antagonists of hIL-5. Bennett et al. Md.
Recog. 8: 52-58 (1995), and Johanson et al. B
iol. Chem. 270 (16): 9449-9471 (1995).

Galectin-11 protein can be prepared by ammonium sulfate precipitation or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, and lectin chromatography. It can be recovered from recombinant cell culture and purified by well-known methods, including chromatography. Most preferably, high performance liquid chromatography ("HPLC") is used for purification.

The polypeptides of the present invention can be obtained from natural purified products, products of chemical synthesis procedures, and prokaryotic or eukaryotic hosts (eg, bacterial cells, yeast cells, plant cells, insect cells, teleost cells, (Including bird cells and mammalian cells) by recombinant techniques. Depending on the host used in the recombinant production procedure,
The polypeptides of the invention can be glycosylated or non-glycosylated. In addition, the polypeptides of the invention may also contain, or in some cases lose, an altered starting methionine residue as a result of a host-mediated process. Thus, it is well known in the art that, in general, the N-terminal methionine encoded by the translation initiation codon is removed with high efficiency from any protein after translation in all eukaryotic cells. Although the N-terminal methionine in most proteins is also effectively removed in most prokaryotes, for some proteins this prokaryotic removal process involves:
It is inefficient, depending on the nature of the amino acid to which the N-terminal methionine is covalently attached.

In addition to including host cells containing the vector constructs discussed herein, the present invention also provides primar of vertebrate (particularly mammalian) origin.
y) Including host cells, secondary host cells, and immortalized host cells. These host cells have been engineered to delete or replace endogenous genetic material (eg, galectin-11 coding sequences) and / or have been genetically operably linked to a galectin-11 polynucleotide of the invention. Engineered to contain a substance (eg, a heterologous polynucleotide sequence) and endogenous galectin 1
Activate, alter, and / or amplify one polynucleotide. For example, techniques known in the art include operably linking, via homologous recombination, a heterologous control region (eg, promoter and / or enhancer) and an endogenous galectin-11 polynucleotide sequence to form a novel transcription unit. (See, for example, US Pat. No. 5,641, issued June 24, 1997)
No. 670; U.S. Pat. No. 5,733,761 published Mar. 31, 1998; International Publication No. WO 96/29411 published Sep. 26, 1996;
International Publication No. WO 94/12650 published Aug. 4, 994; Koll
er et al., Proc. Natl. Acad. Sci. USA 86: 8932-8
935 (1989); and Zijlstra et al., Nature 342: 43.
See 5-438 (1989). Each of these disclosures is incorporated by reference in their entirety).

In addition, polypeptides of the invention can be chemically synthesized using techniques known in the art (eg, Creighton, 1983, Proteins: Stru.
cultures and Molecular Principles, W.C. H.
Freeman & Co. , N .; Y. And Hunkapiller et al., Na
cure, 310: 105-111 (1984)). For example, a polypeptide corresponding to a fragment of a galectin-11 polypeptide can be synthesized by use of a peptide synthesizer. In addition, if desired, nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the galectin-11 polypeptide sequence. Non-classical amino acids include, but are not limited to, the D isomer of a normal amino acid, 2,4-diaminobutyric acid, a-aminoisobutyric acid, 4-aminobutyric acid, Abu, 2-aminobutyric acid, g -Abu, e-A
hx, 6-aminohexanoic acid, Aib, 2-aminoisobutyric acid, 3-aminopropionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-
Butylalanine, phenylglycine, cyclohexylalanine, b-alanine,
Fluoroamino acids, designer amino acids (eg, b-methyl amino acids), Ca
-Methyl amino acids, Na-methyl amino acids, and common amino acid analogs. Further, the amino acid can be D (dextrorotary) or L (levorotary).

The present invention relates to methods for, for example, glycosylation, acetylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, antibody molecules or other cellular activities during or after translation. Includes galectin-11 polypeptides that are differentially modified, such as by binding to a ligand. Any of a number of chemical modifications can be performed by known techniques, including but not limited to: cyanogen bromide,
Trypsin, chymotrypsin, papain, V8 protease, specific chemical cleavage by NaBH _4; acetylation, formylation, oxidation, reduction; metabolic synthesis in the presence of tunicamycin; like.

Additional post-translational modifications included by the present invention include, for example: N-linked or O-linked carbohydrate chains (N- or C-terminal processing), chemical moieties to the amino acid backbone , Chemical modification of N- or O-linked carbohydrate chains, and addition or deletion of N-terminal methionine residues as a result of prokaryotic host cell expression. The polypeptide may also be modified with a detectable label (eg, an enzymatic, fluorescent, isotopic or affinity label) to allow for detection and isolation of the protein.

The present invention also provides chemically modified derivatives of the polypeptides of the present invention that may provide additional advantages, such as increased solubility, stability and circulation time, or reduced immunogenicity of the polypeptide. (See US Pat. No. 4,179,337). The chemical moiety for derivatization can be selected from water-soluble polymers such as polyethylene glycol, ethylene glycol / propylene glycol copolymer, carboxymethyl cellulose, dextran, polyvinyl alcohol, and the like. The polypeptide can be modified at random positions in the molecule or at predetermined positions in the molecule, and can include one, two, three or more attached chemical moieties.

The polymer can be of any molecular weight and can be branched or unbranched. For polyethylene glycol, the preferred molecular weight is between about 1 kDa and about 100 kDa for ease of handling and manufacture (the term "about" means that in the preparation of polyethylene glycol, some molecules may have higher molecular weights than indicated). Heavy and some are lighter than the indicated molecular weight). The desired therapeutic profile (eg, the desired duration of sustained release, in some cases effects on biological activity, ease of handling, degree of antigenicity or lack of antigenicity, and Other sizes may be used, depending on other known effects of polyethylene glycol). For example, polyethylene glycol is about 200; 500; 1000; 1500; 2000;
2500; 3000; 3500; 4000; 4500; 5000; 5500;
000; 6500; 7000; 7500; 8000; 8500; 9000; 95
00; 10,000; 10,500; 11,000; 11,500; 12,000
0; 12,500; 13,000; 13,500; 14,000; 14,500
15,000; 15,000; 16,000; 16,500; 17,000;
17,500; 18,000; 18,500; 19,000; 19,500: 2
0,000; 25,000; 30,000; 35,000; 40,000; 5
0,000; 55,000; 60,000; 65,000; 70,000; 75
8,000; 80,000; 85,000; 90,000; 95,000; or 100,000 kDa.

As described above, polyethylene glycol may have a branched chain. Branched polyethylene glycols are described, for example, in: US Pat. No. 5,643.
Morpurgo et al., Appl. Biochem. Biotech
nol. 56: 59-72 (1996); Vorovjev et al., Nucleos.
ids Nucleotides 18: 2745-2750 (1999)
And Caliceti et al., Bioconjug. Chem. 10: 638-
646 (1999), the disclosure of each of which is incorporated by reference.

A polyethylene glycol molecule (or other chemical moiety) should be attached to a protein in view of its effect on the functional or antigenic domains of the protein. There are a number of conjugation methods available to those of skill in the art (see, for example, EP 0 401 384 (P in G-CSF, incorporated herein by reference).
EG), Malik et al., Exp. Hematol. 20: 1028-
1035 (1992) (pegylation of GM-CSF using tresyl chloride)
report)) also see)). For example, polyethylene glycol can be covalently linked via an amino acid residue by a reactive group (eg, a free amino or carboxyl group). Reactive groups are groups to which activated polyethylene glycol molecules can bind. Amino acid residues having a free amino group may include lysine residues and N-terminal amino acid residues; amino acid residues having a free carboxyl group include aspartic acid residues, glutamic acid residues and C-terminal amino acid residues Residues may be mentioned. Sulfhydryl residues can also be used as a reactive group for attaching polyethylene glycol molecules. Preferred for therapeutic purposes is attachment at an amino group, such as attachment at the N-terminus or lysine group.

As suggested above, polyethylene glycol can be attached to proteins via linkage to any of a number of amino acid residues. For example, polyethylene glycol can be attached to a protein via a covalent bond to a lysine residue, a histidine residue, an aspartic acid residue, a glutamic acid residue, or a cysteine residue. Using one or more reaction chemistry, certain amino acid residues of a protein (eg,
Conjugated polyethylene glycol to lysine, histidine, aspartic acid, glutamic acid, or cysteine) or to more than one type of amino acid residue of the protein (eg, lysine, histidine, aspartic acid, glutamic acid, cysteine and combinations thereof) Obtaining It may be desirable to obtain a protein that has been chemically modified, especially at the N-terminus. Using polyethylene glycol as an example of a composition of the invention, various polyethylene glycol molecules (depending on molecular weight, branching, etc.), proteins (polypeptides) in the reaction mixture
The ratio of polyethylene glycol molecules to molecules, the PEGylation to be performed (pe
gylation) reaction types and methods of obtaining the selected N-terminally pegylated protein. A method for obtaining an N-terminal PEGylated preparation (ie, if necessary,
Separating this moiety from other monoPEGylated moieties) can be obtained by purification of the N-terminal pegylated material from a population of pegylated protein molecules. Selective proteins chemically modified with N-terminal modifications can be obtained by reductive alkylation utilizing the different reactivity (lysine to N-terminal) of different types of primary amino acid groups available for derivatization in a particular protein. Can be achieved. Under the appropriate reaction conditions, substantially selective derivatization of the N-terminal protein at the carbonyl group containing polymer is achieved.

As described above, pegylation of the proteins of the invention can be achieved in a number of ways.
For example, polyethylene glycol can be attached to the protein either directly or through a linker. A linkerless system for attaching polyethylene glycol to proteins is described in Delgado et al., Crit. Re
v. Thera. Drug Carrier Sys. 9: 249-304 (1
992); Francis et al. , Intern. J. of Hematol. 6
8: 1-18 (1998); U.S. Pat. No. 4,002,531; U.S. Pat.
No. 349,052; WO 95/06058; and WO 98/32466 (
Each of which is incorporated herein by reference).

One of the systems for attaching polyethylene glycol directly to amino acid residues of a protein without an intervening linker is a tresylated M
Use PEG. This is tresylchloride
e) Monomethoxypolyethylene glycol (ClSO ₂ CH ₂ CF ₃ )
MPEG). Upon reaction of the protein with the tresylated MPEG, the polyethylene glycol is directly attached to the amino groups of the protein. Accordingly, the present invention includes a protein-polyethylene glycol conjugate produced by reacting the protein of the present invention with a polyethylene glycol molecule having a 2,2,2-trifluoroethanesulfonyl group.

[0111] Polyethylene glycol can also be attached to proteins using a number of different intervening linkers. For example, U.S. Patent No. 5,612,460, the entire disclosure of which is incorporated herein by reference, discloses a urethane linker for connecting polyethylene glycol to a protein. The protein-polyethylene glycol conjugate, where the polyethylene glycol is attached to the protein by a linker, is also a compound of the protein (eg, M
MPEG activated with PEG-succinimidyl succinate, 1,1'-carbonyldiimidazole, MPEG-2,4,5-trichlorophenyl carbonate, MPEG-p-nitrophenol carbonate, and various MPEGs −
Succinate derivative). Numerous additional polyethylene glycol derivatives and reaction chemistries for attaching polyethylene glycol to proteins are described in WO 98/32466, which is incorporated herein by reference in its entirety. PEGylated protein products produced using the reaction chemistry described herein are included within the scope of the present invention.

[0112] The number of polyethylene glycol moieties attached to each protein of the invention (ie, the degree of substitution) can also vary. For example, a PEGylated protein of the invention
On average 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20
It can be linked to the above polyethylene glycol molecules. Similarly, the average degree of substitution per protein molecule is 1-3, 2-4, 3-5, 4-6, 5-7, 6-8
, 7-9, 8-10, 9-11, 10-12, 11-13, 12-14, 13-
15, 14-16, 15-17, 16-18, 17-19 or 18-20 within such ranges as polyethylene glycol moieties. Methods for determining the degree of substitution are described, for example, in Delgado et al., Crit. Rev .. Thera. Drug Ca
rrer Sys. 9: 249-304 (1992).

[0113] Galectin-11 polypeptides of the present invention can be monomeric or multimeric (ie, dimers, trimers, tetramers and higher multimers). Accordingly, the present invention relates to monomers and multimers of the galectin 11 polypeptides of the present invention, their preparation, and compositions containing them (preferably, therapeutic agents). In certain embodiments, a polypeptide of the invention is a monomer, dimer, trimer, or tetramer. In a further embodiment, the multimer of the invention is at least a dimer, at least a trimer, or at least a tetramer.

The multimers encompassed by the present invention can be homomers or heteromers. As used herein, the term homomer refers to only the polypeptide corresponding to the amino acid sequence of SEQ ID NO: 2, or SEQ ID NO: 25 or SEQ ID NO: 27, or the amino acid sequence encoded by the cDNA contained in the deposited clone. (Including fragments, variants, splicing variants, and fusion proteins (corresponding to those described herein)). These homomers can include galectin-11 polypeptides having the same or different amino acid sequences. In certain embodiments, a homomer of the invention is a multimer comprising only galectin-11 polypeptides having the same amino acid sequence. In another specific embodiment, a homomer of the invention is a multimer comprising a galectin-11 polypeptide having a different amino acid sequence. In certain embodiments, a multimer of the invention is a homodimer (eg, comprising a galectin 11 polypeptide having the same or a different amino acid sequence), or a homotrimer (eg, an identical and / or different amino acid sequence). (Including galectin 11 polypeptide having). In a further embodiment, the homomeric multimer of the invention is at least a homodimer, at least a homotrimer, or at least a homotetramer.

As used herein, the term heteromer refers to a multimer comprising one or more heterologous polypeptides (ie, polypeptides of different proteins) in addition to a galectin-11 polypeptide of the invention. In certain embodiments, a multimer of the invention is a heterodimer, heterotrimer, or heterotetramer. In a further embodiment, the heteromeric multimer of the invention is at least a heterodimer, at least a heterotrimer, or at least a heterotetramer.

The multimers of the present invention can be the result of hydrophobic, hydrophilic, ionic and / or covalent bonds, and / or can be bound directly, for example, by a liposome formulation. Thus, in one embodiment, a multimer of the invention (such as, for example, a homodimer or homotrimer) is a polypeptide of the invention comprising:
Formed when in contact with each other in solution. In another embodiment, a heteromultimer of the invention (such as, for example, a heterotrimer or heterotetramer) is an antibody against a polypeptide of the invention (such as a fusion protein of the invention) in solution. (Including antibodies to a heterologous polypeptide sequence of the same). In other embodiments, the multimers of the invention are formed by covalent binding to and / or between the galectin-11 polypeptides of the invention. Such covalent linkages are described in the polypeptide sequence (eg, as set forth in SEQ ID NOs: 2, 25, or 27, or clone HJAC
(Contained in the polypeptide encoded by E54). In one case, the covalent bond is a bridge between cysteine residues located within the polypeptide sequence. It interacts in the native (ie, naturally occurring) polypeptide. In other cases, the covalent bond is the result of a chemical or recombinant operation. Alternatively, such a covalent bond can include one or more amino acid residues contained in a heterologous polypeptide sequence in a galectin-11 fusion protein. In one example, a covalent bond is between heterologous sequences contained in a fusion protein of the invention (see, eg, US Pat. No. 5,478,925). In certain instances, a covalent bond is between heterologous sequences contained in a galectin 11-Fc fusion protein of the invention (as described herein). In another specific example, the covalent linkage of a fusion protein of the invention is between heterologous polypeptide sequences from another protein that can form a covalently linked multimer, such as, for example, osteoprotegerin (eg, (See International Publication No. WO 98/49305, the contents of which are hereby incorporated by reference in its entirety). In another embodiment, two or more polypeptides of the invention are linked via a peptide linker. For example, see US Pat. No. 5,073,627.
And peptide linkers such as those described in US Pat. Proteins comprising multiple polypeptides of the invention, separated by a peptide linker, can be produced using conventional recombinant DNA techniques.

Another method for preparing a multimeric polypeptide of the invention involves the use of a polypeptide of the invention fused to a leucine zipper or isoleucine zipper polypeptide sequence. Leucine zipper and isoleucine zipper domains are polypeptides that facilitate multimerization of proteins, where they are found. Leucine zippers were originally identified in several DNA binding proteins (Landschulz et al., Science 240: 1).
759, (1988)), and has since been found in a variety of different proteins. Among the known leucine zippers, peptides and derivatives that naturally dimerize or trimer exist naturally. Examples of suitable leucine zipper domains for producing the soluble multimeric proteins of the invention are those described in PCT application WO 94/10308, which is incorporated herein by reference. Recombinant fusion proteins comprising a polypeptide of the invention fused to a polypeptide sequence that dimerizes or trimers in solution are expressed in a suitable host cell. The resulting soluble multimer fusion protein is recovered from the culture supernatant using techniques known in the art.

[0118] Trimeric polypeptides of the invention may provide the advantage of enhanced biological activity. Preferred leucine zipper and isoleucine moieties preferentially form trimers. One example is pulmonary surfactant protein D (S
Leucine zipper derived from PD). This is because Hoppe et al. (FEB)
S Letters 344: 191, (1994)) and U.S. Patent Application Serial No. 08 / 446,922, which is incorporated by reference. Other peptides derived from naturally occurring trimeric proteins can be used to prepare the trimeric polypeptides of the invention.

In a further preferred embodiment, a Galectin-11 polynucleotide of the invention is fused to a polynucleotide encoding a “FLAG” polypeptide.
Thus, galectin 11-FLAG fusion proteins are encompassed by the present invention. F
The LAG antigenic polypeptide can be fused to the galectin 11 polypeptide of the invention at either the amino terminus or the carboxy terminus or both. In a preferred embodiment, the galectin 11-FLAG fusion protein is pFLA
G-CMV-5a expression vector or pFLAG-CMV-1 expression vector (S
igma, St .; (Available from Louis, MO, USA). A
ndersson S.A. J. et al. Biol. Chem. 264: 8222-29
(1989); Thomsen, D .; R. Proc. Natl. Acad.
Sci. USA, 81: 659-63 (1984); and Kozak, MN.
308: 241 (1984), each of which is incorporated herein by reference. In a further preferred embodiment, the galectin 11-FLAG fusion protein is an anti-FLAG monoclonal antibody (also
(Available from Sigma).

The multimers of the present invention can be generated using chemical techniques known in the art. For example, a polypeptide that is desirably included in a multimer of the present invention can be chemically cross-linked using linker molecules, and linker molecule length optimization techniques known in the art (e.g., See U.S. Patent No. 5,478,925, incorporated herein by reference). Further, the multimer of the present invention
It can be generated using techniques known in the art to form one or more intramolecular crosslinks between cysteine residues located within the sequence of the polypeptide desired to be included in the multimer ( See, for example, US Pat. No. 5,478,925, which is incorporated herein by reference in its entirety). Further, the polypeptides of the present invention can be modified conventionally by the addition of cysteine to the C-terminus or N-terminus of the polypeptide, or the addition of biotin. Techniques known in the art can then be applied to generate multimers containing one or more of these modified polypeptides (eg, US Pat. No. 5,478, incorporated herein by reference in its entirety). 925). In addition, techniques known in the art can be applied to generate liposomes containing the polypeptide components desired to be included in the multimers of the invention (eg, US Pat. See patent 5,478,925).

Alternatively, the multimers of the present invention can be generated using genetic engineering techniques known in the art. In one embodiment, the polypeptides comprised in the multimers of the invention are recombinantly produced using fusion protein techniques described herein or known in the art (eg, in their entirety). See U.S. Patent No. 5,478,925, which is incorporated herein by reference). In certain embodiments, the polynucleotide encoding the homodimer of the invention comprises a polynucleotide sequence encoding a polypeptide of the invention, wherein the polynucleotide sequence encoding the polypeptide of the invention is replaced by a sequence encoding the linker polypeptide, and then further from the original C-terminus to the N-terminal direction. And in the opposite direction,
It is produced by linking to a synthetic polynucleotide (lacking the leader sequence) encoding the translation product of the polypeptide (eg, US Pat. No. 5,478, incorporated herein by reference in its entirety). 925). In another embodiment, recombinant techniques described herein or known in the art are applied to produce a recombinant polypeptide of the invention. It contains a transmembrane domain (or hydrophobic or signal peptide) and can be incorporated into liposomes by membrane reconstitution techniques (see, eg, US Pat. , 478, 925).

Galectin 11 Polypeptides and Fragments The present invention further provides an isolated galectin 11 polypeptide having the amino acid sequence encoded by the deposited cDNA, the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2) Amino acid residues 1-133), the amino acid sequence shown in FIG. 1 lacking the amino-terminal methionine (amino acid residues 2-133 of SEQ ID NO: 2), the amino acid shown in FIG. 1 (SEQ ID NO: 2), and / or A polypeptide encoded by a polynucleotide that hybridizes under stringent hybridization conditions to a polynucleotide sequence encoding a polypeptide having the amino acid sequence contained in the deposited clone; and fragments of these polypeptides. Variants, derivatives and To provide a log.

The polypeptides of the present invention are preferably provided in an isolated form. An "isolated polypeptide" intends a polypeptide that has been removed from its native environment. Thus, a polypeptide produced in and / or contained within a recombinant host cell is considered isolated for the purposes of the present invention. Also, "isolated polypeptide" intends a polypeptide that has been partially or substantially purified from a recombinant host cell. For example, a recombinantly produced version of the galectin-11 polypeptide is described by Smith and Johnson, G.
ene 67: 31-40 (1988).

It is recognized in the art that the amino acid sequence of some of the Galectin-11 polypeptides can be altered without significantly affecting the structure or function of the protein. If such differences in sequence are contemplated, it should be remembered that there are important regions of the protein that determine activity.

Accordingly, the present invention further provides a galectin-11 polypeptide that exhibits substantial galectin-11 polypeptide functional activity or a protein moiety as discussed below.
And a variant of the galectin-11 polypeptide containing the protein region of Such variants include deletions, insertions, inversions, repeats, and type substitutions.

As set forth in detail above, guidance on which amino acid changes are likely to be phenotypically silent is provided by Bowie, J. et al. U. "Deciphe
ring the Message in Protein Sequence
s: Tolerance to Amino Acid Substitti
ons (decoding messages in protein sequences: tolerance to amino acid substitutions) ", Science 247: 1306-1310 (1990).

Accordingly, fragments, variants, derivatives or analogs of the polypeptide of FIG. 1 or 6 (SEQ ID NO: 2, SEQ ID NO: 25 or SEQ ID NO: 27), or fragments of the polypeptide encoded by the deposited cDNA, modifications The body, derivative or analog may comprise (i) at least one amino acid residue having a conservative or non-conservative amino acid residue (preferably a conservative amino acid residue, and more preferably at least one amino acid residue; (Conserved amino acid residues) and such substituted amino acid residues may or may not be the amino acid residues encoded by the genetic code, or (ii) ) One or more amino acid residues containing a substituent, or (iii) a mature polypeptide comprising the polypeptide. One that is fused to another compound, such as a compound that increases the half-life of the peptide (eg, polyethylene glycol), or (iv) the additional amino acid is a mature polypeptide (eg, an IgG Fc fusion region peptide or leader sequence or secretion) Sequence or sequence used for purification of the mature polypeptide or proprotein sequence). Such fragments, variants, derivatives and analogs are deemed to be within the skill of the art in light of the teachings herein.

Of particular interest is the replacement of one or more charged amino acids with other charged amino acids, and neutral or negatively charged amino acids. The latter results in a protein with a reduced positive charge and improves the characteristics of the galectin 11 protein. Prevention of agglomeration is highly desirable. Aggregation of proteins not only results in a loss of activity, but can also be a problem when preparing pharmaceutical formulations. Because they are
Because it can be immunogenic (Pinkard et al., Clin. Exp. Im.
munol. 2: 331-340 (1967); Robbins et al., Diabe.
tes 36: 838-845 (1987); Cleland et al., Crit. R
ev. Therapeutic Drug Carrier Systems
10: 307-377 (1993)).

As indicated, changes in insignificant properties (eg, conservative amino acid substitutions that do not significantly affect protein folding or activity) are preferred (see Table 2).

[0130]

[Table 1] In certain embodiments, the amino acid sequence of FIG. 1 or FIG.
Or 27) the number of additions, substitutions and / or deletions, and / or any of the polypeptide fragments described herein are 50, 40, 35,
30, 25, 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5
, 4, 3, 2, or 1, or 15 to 20, 15 to 10, 5 to 10, 1 to 5
, 1-3, or 1-2.

A galectin 11 polypeptide, fragment or the like of the present invention, which is essential for function;
Amino acid residues of the variants, derivatives or analogs can be obtained by methods known in the art (eg, site-directed mutagenesis or alanine scan mutagenesis (alani
ne-scanning mutagenesis) (Cunningham and Wells, Science 244: 1081-1085 (1989)). The latter procedure introduces one alanine mutation at each residue in the molecule. The resulting mutant molecule may then have a biological or functional activity (eg, receptor binding, β-galactosidase (eg, thiodigalactoside or lactose) binding, the ability to aggregate trypsinized rabbit erythrocytes, or Ability to induce apoptosis in vivo). Sites important for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al., J. Mol. Biol. 22).
4: 899-904 (1992) and de Vos et al., Science 25.
5: 306-312 (1992)).

The present invention also relates to polypeptides as described above, wherein at least 75%, 80%, 85%, 9%
0%, 95%, 96%, 97%, 98%, or 99%, or 97-99%
Includes polypeptides that are identical. For example, a polypeptide having an amino acid sequence that is at least 95% "identical" to the reference amino acid sequence of a galectin 11 polypeptide is that the amino acid sequence of the polypeptide is
It is intended to be identical to the reference sequence, except that it can contain up to 5 amino acid changes for each 100 amino acids of the reference amino acid of the galectin 11 polypeptide. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to the reference amino acid sequence, up to 5% of the amino acid residues in the reference sequence can be deleted or replaced with another amino acid. Amino acids of up to 5% of the total amino acid residues obtained or in the reference sequence can be inserted into the reference sequence. These alterations in the reference sequence may be distributed individually within the residues in the reference sequence, or in one or more contiguous groups within the reference sequence, at the amino-terminal or carboxy-terminal positions of the reference amino acid sequence. It can occur anywhere between positions, or between their terminal positions.

[0133] As a practical matter, for example, if any particular polypeptide is
(SEQ ID NO: 2, 25 or 27), the deposited cDNA
Whether the amino acid sequence encoded by the clone, or a fragment thereof, is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical is Bestfit A known computer program such as a program (Wisconsin Sequence Analysis)
is Package, Version 8 for Unix, Geneti
cs Computer Group, University Research
h Park, 575 Science Drive, Madison, WI
53711) can be routinely determined. For example, if Bestfit or any other sequence alignment program is used to determine whether a particular sequence is 95% identical to a reference sequence according to the present invention, the parameters will, of course, have a percentage identity of It is calculated relative to the total length of the reference amino acid sequence and is set to allow for gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence.

In another embodiment, the identity between a reference (query) sequence (a sequence of the invention) and a subject sequence, also referred to as an overall sequence alignment, is determined by the method of Brutlag et al.
omp. App. Biosci. 6: 237-245 (1990)). FA
Preferred parameters used in the STDB amino acid alignment are: Matrix = PAM 0, k-tuple = 2, Mismatch
Penalty = 1, Joining Penalty = 20, Randomi
zation Group Length = 0, Cutoff Score = 1
, Window Size = length of array, Gap Penalty = 5, Gap
Size Penalty = 0.05, Window Size = 500 or the length of the amino acid sequence of interest (whichever is shorter). According to this embodiment, when calculating the overall percent identity, if the subject sequence is shorter than the query sequence due to N- or C-terminal deletions, not due to internal deletions, FAST
Manual corrections are made to the results, taking into account the fact that the DB program does not account for the N-terminal and C-terminal truncations of the subject sequence. For subject sequences truncated at the N- and C-termini to the query sequence, the percent identity is the number of residues in the query sequence that are N- and C-terminal to the subject sequence that do not match / align with the corresponding subject residue. Is calculated as a percentage of the total bases of the query sequence. The determination of whether residues are matched / aligned is determined by the result of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity calculated by the above FASTDB program using the specified parameters, leading to a final percent identity score. This final percent identity score is what is used for the purposes of this embodiment. Only N- and C-terminal residues of the subject sequence that do not match / align with the query sequence are considered for the purpose of manually adjusting the percent identity score. That is, only the query residue positions outside the farthest N- and C-terminal residues of the subject sequence. For example, a subject sequence of 90 amino acid residues can be used to determine percent identity.
Aligned with 0 residue query sequence. This deletion occurs at the N-terminus of the subject sequence, so the FASTDB alignment shows no match / alignment for the first 10 residues at the N-terminus. Ten unpaired residues represent 10% of the sequence (number of unmatched N- and C-terminal residues / total number of residues in query sequence). As a result, FASTD
10% is subtracted from the percent identity score calculated by the B program. If the remaining 90 residues were perfectly matched, the final percent identity is 90%. In another example, a 90 residue subject sequence is compared to a 100 residue query sequence. This deletion is now an internal deletion and there are no residues at the N- or C-terminus of the subject sequence that do not match / align with the query. In this case, FA
The percent identity calculated by the STDB is not manually corrected. Once again, only residue positions outside the N- and C-termini of the subject sequence that do not match / align with the query sequence, as shown in the FASTDB alignment, are manually corrected. No other manual corrections are made for the purposes of this embodiment.

The polypeptides of the present invention have uses, including but not limited to molecular weight markers on SDS-PAGE gels or on molecular sieve gel filtration columns, using methods well known to those skilled in the art.

The present invention also includes fragments of the polypeptides of the present invention described above. In certain embodiments, these fragments are at least 20, 25, 30,
40, 50, 75, 90, 100, 110, 120, 125 or 130 amino acid residues long.

In the context of the present invention, a “polypeptide fragment” is an amino acid sequence contained in SEQ ID NO: 2, 25 or 27 or a part of the amino acid sequence encoded by the cDNA contained in the deposited clone. Say. Protein (polypeptide) fragments are “free-standing”.
Or may be comprised within a larger polypeptide (the fragment forming a part or region, most preferably as a single continuous region)
. Representative examples of the polypeptide fragment of the present invention include, for example, 1 to 20, 21 to 40, 41 to 60, 61 to 80, 81 to 1 with respect to the end of the coding region.
Fragments containing or consisting of about the number of amino acids from 00, 101 to 120 or 121 are included. Further, the polypeptide fragment may be about 20, 30, 40, 50, 60, 70, 80, 90, 100, 110,
It can be 120 or 130 amino acids long. In this context, “about” includes the specifically recited ranges or values, as well as some (5, 5, 3, 2, or 1).
A) greater or lesser ranges or values (at either extreme or both extremes). Polynucleotides encoding these polypeptides are also encompassed by the present invention.

[0138] Even when deletion of one or more amino acids from the N-terminus of a protein results in an alteration in the loss of one or more biological functions of the protein, other functional activities (eg, biological activities) , The ability to multimerize, the ability to bind to galectin-11 ligand)
It can still be retained. For example, the ability of a truncated galectin-11 mutein to induce and / or bind to an antibody that recognizes a complete or mature form of a polypeptide is determined by the majority of the residues of the complete or mature polypeptide. If less is removed from the N-terminus, it is retained. Whether a particular polypeptide lacking the N-terminal residue of a complete polypeptide retains such immunological activity is described herein or otherwise known in the art. Can be readily determined by conventional methods. It is likely that galectin ll-tein lacking a greater number of N-terminal amino acid residues may retain some biological or immunological activity. In fact, as few as 6 galectins 1
Peptides composed of one amino acid residue can often elicit an immune response.

Thus, polypeptide fragments include the secreted galectin-11 protein as well as the mature form. More preferred polypeptide fragments include
The secreted galectin 11 protein, or the mature form lacking a continuous series of residues from the amino acid terminus or the carboxy terminus, or both, may be mentioned. For example, any number of amino acids (ranging from 1 to 60) may contain secreted galectin 11
It can be deleted from the amino acid terminus of either the polypeptide or the mature form. Similarly, any number of amino acids (ranging from 1 to 30) can be deleted from the carboxy terminus of the secreted galectin 11 protein or the mature form. Further, any combination of the above amino terminal deletion and carboxy terminal deletion is preferred. Similarly, polynucleotides encoding these polypeptide fragments are also preferred.

In one embodiment, the present invention further provides a galectin-11 polypeptide as shown in FIG. 1 or FIG. 6 (SEQ ID NO: 2, 25 or 27), or encoded by the cDNA of the deposited clone. A polypeptide in which one or more residues have been deleted from the amino terminus of the amino acid sequence of In particular, in one embodiment, the N-terminal deletion of a galectin-11 polypeptide may be described by the general formula m-133. Where m is an integer from 1 to 128 corresponding to the position of the amino acid sequence identified in SEQ ID NO: 2, and preferably the N-terminus identified in the N-terminal deletion identified herein Corresponds to one of the amino acid residues. In certain embodiments, the N-terminal deletion of a Galectin-11 polypeptide of the invention comprises or consists of the following amino acid residues of SEQ ID NO: 2:

[0141]

Embedded image Polynucleotides encoding these polypeptides are also encompassed by the present invention.

As noted above, even if deletion of one or more amino acids from the C-terminus of a protein results in alteration of one or more biological functions of the protein, other functional activities (eg, Biological activity, the ability to multimerize, the ability to bind galectin-11 ligand) can still be retained. For example, truncated galectin 11 mutein
The ability to induce and / or bind to an antibody that recognizes the complete or mature form of the polypeptide is such that less than the majority of residues of the complete or mature polypeptide are removed from the C-terminus. The case is generally kept.
Whether a particular polypeptide lacking the C-terminal residue of a complete protein retains such immunological activity is described herein or otherwise known in the art. Can be easily determined by conventional methods. It is not unlikely that a galectin-11 mutein with a number of C-terminal amino acid residues deleted could retain some biological or immunological activity. In fact, peptides composed of as few as 6 galectin 11 amino acid residues can often elicit an immune response.

Accordingly, a further embodiment of the present invention relates to the C-terminal deletion of a galectin 11 polypeptide as described in general formulas 1-n. Where n is an integer from 6 to 132 corresponding to the position of the amino acid residue identified in SEQ ID NO: 2, and preferably is identified in the C-terminal deletion specified herein. Corresponds to one of the C-terminal amino acid residues. In certain embodiments, the C-terminal deletion of a Galectin-11 polypeptide of the invention comprises or consists of the following amino acid residues of SEQ ID NO: 2: M-1 to H-132; V-131; M-1 to C-13
0; M-1 to Y-129; M-1 to L-128; M-1 to Q-127;
V-126; M-1 to S-125; M-1 to G-124; M-1 to S-123;
M-1 to I-122; M-1 to R-121; M-1 to L-120; M-1 to E-
119; M-1 to R-118; M-1 to L-117; M-1 to Q-116;
M-1 to L-114; M-1 to A-113; M-1 to Q-11
2; M-1 to Q-111; M-1 to N-110; M-1 to M-109;
S-108; M-1 to T-107; M-1 to A-106; M-1 to G-105;
M-1 to L-104; M-1 to G-103; M-1 to Q-102; M-1 to G-
101; M-1 to N-100; M-1 to L-99; M-1 to A-98;
L-97; M-1 to K-96; M-1 to L-95; M-1 to G-94;
G-93; M-1 to E-92; M-1 to Q-91; M-1 to F-90;
L-89; M-1 to L-88; M-1 to L-87; M-1 to V-86;
E-85; M-1 to F-84; M-1 to F-83; M-1 to R-82;
Q-81; M-1 to P-80; M-1 to Y-79; M-1 to F-78;
L-77; M-1 to F-76; M-1 to P-75; M-1 to A-74;
S-73; M-1 to I-72; M-1 to L-71; M-1 to K-70;
K-69; M-1 to Q-68; M-1 to G-67; M-1 to W-66;
R-65; M-1 to S-64; M-1 to I-63; M-1 to W-62;
A-61; M-1 to L-60; M-1 to T-59; M-1 to R-58;
D-57; M-1 to A-56; M-1 to F-55; M-1 to S-54;
A-53; M-1 to R-52; M-1 to L-51; M-1 to T-50;
V-49; M-1 to P-48; M-1 to A-47; M-1 to H-46;
A-45; M-1 to A-44; M-1 to Q-43; M-1 to D-42;
R-41; M-1 to L-40; M-1 to S-39; M-1 to V-38;
T-37; M-1 to F-36; M-1 to H-35; M-1 to K-34;
P-33; M-1 to E-32; M-1 to Q-31; M-1 to L-30;
V-29; M-1 to L-28; M-1 to G-27; M-1 to R-26;
V-25; M-1 to I-24; M-1 to I-23; M-1 to V-22;
Q-21; M-1 to G-20; M-1 to P-19; M-1 to S-18;
L-17; M-1 to G-16; M-1 to Q-15; M-1 to P-14;
L-13; M-1 to A-12; M-1 to H-11; M-1 to S-10;
C-9; M-1 to P-8; M-1 to V-7; and M-1 to E-6. Polynucleotides encoding these polypeptides are also included in the present invention.

In addition, any of the N-terminal or C-terminal deletions listed above can be combined to produce an N-terminal deleted galectin-11 polypeptide or a C-terminal deleted galectin-11 polypeptide. The present invention also provides polypeptides having one or more amino acid deletions from both the amino and carboxyl termini, which can be generally described as having residues mn of SEQ ID NO: 2, n and m are integers as described above. Polynucleotides encoding these polypeptides are also included in the present invention.

In a preferred embodiment, a polypeptide of the invention comprises or consists of the following amino acid residues of SEQ ID NO: 2: M-1 to L-40; M-1 to W-
66; P-3 to L-40; L-5 to L-40; L-5 to S-108; L-5 to L
-128; P-3 to L-128; L-5 to L-128; L-5 to G-124; C
-9 to C-130; L-13 to L-40; P-14 to L-40; L-40 to S-.
108; A-47 to S-108; A-47 to L-128; R-65 to S-108
R-65 to L-128; L-88 to S-108; L-88 to L-128;
108-L-120; or L-114-L-128. Polynucleotides encoding these polypeptides are also included in the present invention.

Also included is a nucleotide sequence that encodes a polypeptide consisting of a portion of the complete galectin 11 amino acid sequence encoded by the cDNA clone contained in ATCC Accession No. 209053, wherein this portion corresponds to ATCC Accession No. 209
053 to any number of amino acid residues from 1 to about 123 amino acids from the amino terminus of the complete amino acid sequence encoded by the cDNA clone contained in
Any number of amino acid residues from 1 to about 123 amino acids from the carboxy terminus of the complete amino acid sequence encoded by the cDNA clone contained in CC Accession No. 209053, or any of the above amino and carboxyl terminal deletions Eliminate combinations. Polynucleotides encoding all of the above deletion mutant polypeptide forms are also provided.

[0147] The present invention also provides at least 80%, 85%, 90%, 92%, 95%, 96%, 96%,
A protein comprising polypeptides that are 97%, 98% or 99% identical. In a preferred embodiment, the present application provides that at least 80%, 85%, 90%, 92% %, 95%, 96%, 97%, 98
% Or 99% identical polypeptides. Polynucleotides encoding these polypeptides are also included in the present invention.

Further preferred polypeptide fragments comprise or consist of the following amino acid residues of SEQ ID NO: 2: M-1 to Q-15; S-2 to G-16;
P-3 to L-17; R-4 to S-18; L-5 to P-19; E-6 to G-20;
V-7 to Q-21; P-8 to V-22; C-9 to I-23; S-10 to I-24.
H-11 to V-25; A-12 to R-26; L-13 to G-27;
L-28; Q-15 to V-29; G-16 to L-30; L-17 to Q-31; S
-18 to E-32; P-19 to P-33; G-20 to K-34;
35; V-22 to F-36; I-23 to T-37; I-24 to V-38; V-2
5-S-39; R-26 to L-40; G-27 to R-41; L-28 to D-42
V-29 to Q-43; L-30 to A-44; Q-31 to A-45;
H-46; P-33 to A-47; K-34 to P-48; H-35 to V-49; F
-36 to T-50; T-37 to L-51; V-38 to R-52; S-39 to A-.
53; L-40 to S-54; R-41 to F-55; D-42 to A-56;
3-D-57; A-44 to R-58; A-45 to T-59; H-46 to L-60.
A-47 to A-61; P-48 to W-62; V-49 to I-63;
S-64; L-51 to R-65; R-52 to W-66; A-53 to G-67; S
-54 to Q-68; F-55 to K-69; A-56 to K-70; D-57 to L-.
R-58 to I-72; T-59 to S-73; L-60 to A-74; A-6
1-P-75; W-62-F-76; I-63-L-77; S-64-F-78
R-65 to Y-79; W-66 to P-80; G-67 to Q-81;
R-82; K-69 to F-83; K-70 to F-84; L-71 to E-85;
-72 to V-86; S-73 to L-87; A-74 to L-88; P-75 to L-.
89; F-76 to F-90; L-77 to Q-91; F-78 to E-92; Y-7
9-G-93; P-80-G-94; Q-81-L-95; R-82-K-96
F-83 to L-97; F-84 to A-98; E-85 to L-99;
N-100; L-87 to G-101; L-88 to Q-102; L-89 to G-1
03; F-90 to L-104; Q-91 to G-105; E-92 to A-106;
G-93 to T-107; G-94 to S-108; L-95 to M-109; K-9
6-N-110; L-97-Q-111; A-98-Q-112; L-99-A
-113; N-100 to L-114; G-101 to E-115; Q-102 to Q
-116; G-103 to L-117; L-104 to R-118; G-105 to E
-119; A-106 to L-120; T-107 to R-121; S-108 to I
-122; M-109 to S-123; N-110 to G-124;
-125; Q-112 to V-126; A-113 to Q-127; L-114 to L
-128; E-115 to Y-129; Q-116 to C-130; L-117 to V
-131; R-118 to H-132; and E-119 to S-133. These polypeptide fragments retain the biological activity of the Galectin-11 polypeptides of the invention and / or may be useful for generating or screening antibodies, as described further below. Polynucleotides encoding these polypeptide fragments are also included in the present invention.

In another embodiment, the present invention further relates to a deletion of one or more residues from the amino terminus of the amino acid sequence of galectin-11 polypeptide set forth in SEQ ID NO: 25 or encoded by the cDNA of the deposited clone. Provide the lost polypeptide. In particular, in one embodiment, the N-terminal deletion of the galectin-11 polypeptide is described by the general formula m-275, where m is 2 to the position of the amino acid residue identified in SEQ ID NO: 25. Is an integer of ２270, and preferably corresponds to one of the N-terminal amino acid residues identified in the N-terminal deletion specified herein. In certain embodiments, the N-terminal deletion of a Galectin 11 polypeptide of the invention comprises or consists of the following amino acid residues of SEQ ID NO: 25: V-2-S-275; S-275; L-4 to S-2
75; Q-5 to S-275; G-6 to S-275; V-7 to S-275; V-8
P-9 to S-275; L-10 to S-275; D-11 to S-2.
75; A-12 to S-275; H-13 to S-275; R-14 to S-275;
F-15 to S-275; Q-16 to S-275; V-17 to S-275; D-1
8-S-275; F-19-S-275; Q-20-S-275; C-21-S
-275; G-22 to S-275; C-23 to S-275; S-24 to S-27
5; L-25 to S-275; C-26 to S-275; P-27 to S-275; R
-28 to S-275; P-29 to S-275; D-30 to S-275; I-31
A-32-S-275; F-33-S-275; H-34-S-
275; F-35 to S-275; N-36 to S-275; P-37 to S-275
R-38 to S-275; F-39 to S-275; H-40 to S-275;
41-S-275; T-42-S-275; K-43-S-275; P-44-
S-275; H-45 to S-275; V-46 to S-275; I-47 to S-2
75; C-48 to S-275; N-49 to S-275; T-50 to S-275;
L-51 to S-275; H-52 to S-275; G-53 to S-275; G-5
4-S-275; R-55-S-275; W-56-S-275; Q-57-S
-275; R-58 to S-275; E-59 to S-275; A-60 to S-27
5; R-61 to S-275; W-62 to S-275; P-63 to S-275; H
-64 to S-275; L-65 to S-275; A-66 to S-275; L-67
-S-275; R-68 to S-275; R-69 to S-275; G-70 to S-
275; S-71 to S-275; S-72 to S-275; F-73 to S-275
L-74 to S-275; I-75 to S-275; L-76 to S-275;
77-S-275; L-78-S-275; F-79-S-275; G-80-
S-275; N-81 to S-275; E-82 to S-275; E-83 to S-2
75; V-84 to S-275; K-85 to S-275; V-86 to S-275;
S-87 to S-275; V-88 to S-275; N-89 to S-275; G-9
0-S-275; Q-91-S-275; H-92-S-275; F-93-S
-275; L-94 to S-275; H-95 to S-275; F-96 to S-27
5; R-97 to S-275; Y-98 to S-275; R-99 to S-275; L
-100 to S-275; P-101 to S-275; L-102 to S-275; S
-103 to S-275; H-104 to S-275; V-105 to S-275; D
-106 to S-275; T-107 to S-275; L-108 to S-275; G
-109 to S-275; I-110 to S-275; F-111 to S-275; G
-112 to S-275; D-113 to S-275; I-114 to S-275; L
-115 to S-275; V-116 to S-275; E-117 to S-275; A
-118 to S-275; V-119 to S-275; G-120 to S-275; F
-121 to S-275; L-122 to S-275; N-123 to S-275; I
-124 to S-275; N-125 to S-275; P-126 to S-275; F
-127 to S-275; V-128 to S-275; E-129 to S-275; G
-130 to S-275; S-131 to S-275; R-132 to S-275; E
-133 to S-275; Y-134 to S-275; P-135 to S-275; A
-136 to S-275; G-137 to S-275; H-138 to S-275; P
-139 to S-275; F-140 to S-275; L-141 to S-275; L
-142 to S-275; M-143 to S-275; S-144 to S-275; P
-145 to S-275; R-146 to S-275; L-147 to S-275; E
-148 to S-275; V-149 to S-275; P-150 to S-275; C
-151 to S-275; S-152 to S-275; H-153 to S-275; A
-154 to S-275; L-155 to S-275; P-156 to S-275; Q
-157 to S-275; G-158 to S-275; L-159 to S-275; S
-160 to S-275; P-161 to S-275; G-162 to S-275; Q
-163 to S-275; V-164 to S-275; I-165 to S-275; I
-166 to S-275; V-167 to S-275; R-168 to S-275; G
-169 to S-275; L-170 to S-275; V-171 to S-275; L
-172 to S-275; Q-173 to S-275; E-174 to S-275; P
-175 to S-275; K-176 to S-275; H-177 to S-275; F
-178 to S-275; T-179 to S-275; V-180 to S-275; S
-181 to S-275; L-182 to S-275; R-183 to S-275; D
-184 to S-275; Q-185 to S-275; A-186 to S-275; A
-187 to S-275; H-188 to S-275; A-189 to S-275; P
-190 to S-275; V-191 to S-275; T-192 to S-275; L
-193 to S-275; R-194 to S-275; A-195 to S-275; S
-196 to S-275; F-197 to S-275; A-198 to S-275; D
-199 to S-275; R-200 to S-275; T-201 to S-275; L
-202 to S-275; A-203 to S-275; W-204 to S-275; I
-205 to S-275; S-206 to S-275; R-207 to S-275; W
-208 to S-275; G-209 to S-275; Q-210 to S-275; K
K-212 to S-275; L-213 to S-275; I
-214 to S-275; S-215 to S-275; A-216 to S-275; P
-217 to S-275; F-218 to S-275; L-219 to S-275; F
-220 to S-275; Y-221 to S-275; P-222 to S-275; Q
-223 to S-275; R-224 to S-275; F-225 to S-275; F
-226 to S-275; E-227 to S-275; V-228 to S-275; L
-229 to S-275; L-230 to S-275; L-231 to S-275; F
-232 to S-275; Q-233 to S-275; E-234 to S-275; G
-235 to S-275; G-236 to S-275; L-237 to S-275; K
-238 to S-275; L-239 to S-275; A-240 to S-275; L
-241 to S-275; N-242 to S-275; G-243 to S-275; Q
-244 to S-275; G-245 to S-275; L-246 to S-275; G
-247 to S-275; A-248 to S-275; T-249 to S-275; S
-250 to S-275; M-251 to S-275; N-252 to S-275; Q
-253 to S-275; Q-254 to S-275; A-255 to S-275; L
-256 to S-275; E-257 to S-275; Q-258 to S-275; L
-259 to S-275; R-260 to S-275; E-261 to S-275; L
-262 to S-275; R-263 to S-275; I-264 to S-275; S
-265 to S-275; G-266 to S-275; S-267 to S-275; V
-268 to S-275; Q-269 to S-275; and L-270 to S-27.
5. Polynucleotides encoding such polypeptides are also included in the present invention.

A further embodiment of the present invention relates to a C-terminal deletion of a galectin 11 polypeptide described by general formulas 1-n. Where n is an integer from 6 to 275 corresponding to the position of the amino acid residue identified in SEQ ID NO: 25, and preferably is identified in the C-terminal deletion specified herein. Corresponds to one of the C-terminal amino acid residues. In certain embodiments, the C-terminal deletion of a Galectin-11 polypeptide of the invention comprises or consists of the following amino acid residues of SEQ ID NO: 25: M-1 to H-274; V-273; M-1 to C-272;
M-1 to Y-271; M-1 to L-270; M-1 to Q-269; M-1 to V-
268; M-1 to S-267; M-1 to G-266; M-1 to S-265;
M-1 to R-263; M-1 to L-262; M-1 to E-26
1; M-1 to R-260; M-1 to L-259; M-1 to Q-258;
E-257; M-1 to L-256; M-1 to A-255; M-1 to Q-254;
M-1 to Q-253; M-1 to N-252; M-1 to M-251; M-1 to S-
250; M-1 to T-249; M-1 to A-248; M-1 to G-247;
1 to L-246; M-1 to G-245; M-1 to Q-244; M-1 to G-24
M-1 to N-242; M-1 to L-241; M-1 to A-240;
L-239; M-1 to K-238; M-1 to L-237; M-1 to G-236;
M-1 to G-235; M-1 to E-234; M-1 to Q-233; M-1 to F-
M-1 to L-231; M-1 to L-230; M-1 to L-229; M-
M-1 to E-227; M-1 to F-226; M-1 to F-22
5; M-1 to R-224; M-1 to Q-223; M-1 to P-222;
Y-221; M-1 to F-220; M-1 to L-219; M-1 to F-218;
M-1 to P-217; M-1 to A-216; M-1 to S-215; M-1 to I-
214; M-1 to L-213; M-1 to K-212; M-1 to K-211;
M-1 to G-209; M-1 to W-208; M-1 to R-20
7; M-1 to S-206; M-1 to I-205; M-1 to W-204;
A-203; M-1 to L-202; M-1 to T-201; M-1 to R-200;
M-1 to D-199; M-1 to A-198; M-1 to F-197; M-1 to S-
196; M-1 to A-195; M-1 to R-194; M-1 to L-193;
M-1 to V-191; M-1 to P-190; M-1 to A-18
9; M-1 to H-188; M-1 to A-187; M-1 to A-186;
Q-185; M-1 to D-184; M-1 to R-183; M-1 to L-182;
M-1 to S-181; M-1 to V-180; M-1 to T-179; M-1 to F-
178; M-1 to H-177; M-1 to K-176; M-1 to P-175;
M-1 to Q-173; M-1 to L-172; M-1 to V-17
1; M-1 to L-170; M-1 to G-169; M-1 to R-168;
V-167; M-1 to I-166; M-1 to I-165; M-1 to V-164;
M-1 to Q-163; M-1 to G-162; M-1 to P-161; M-1 to S-
160; M-1 to L-159; M-1 to G-158; M-1 to Q-157;
M-1 to L-155; M-1 to A-154; M-1 to H-15
M-1 to S-152; M-1 to C-151; M-1 to P-150;
V-149; M-1 to E-148; M-1 to L-147; M-1 to R-146;
M-1 to P-145; M-1 to S-144; M-1 to M-143; M-1 to L-
142; M-1 to L-141; M-1 to F-140; M-1 to P-139;
M-1 to G-137; M-1 to A-136; M-1 to P-13
5; M-1 to Y-134; M-1 to E-133; M-1 to R-132;
S-131; M-1 to G-130; M-1 to E-129; M-1 to V-128;
M-1 to F-127; M-1 to P-126; M-1 to N-125; M-1 to I-
124; M-1 to N-123; M-1 to L-122; M-1 to F-121; M-
M-1 to V-119; M-1 to A-118; M-1 to E-11
7; M-1 to V-116; M-1 to L-115; M-1 to I-114;
D-113; M-1 to G-112; M-1 to F-111; M-1 to I-110;
M-1 to G-109; M-1 to L-108; M-1 to T-107; M-1 to D-
106; M-1 to V-105; M-1 to H-104; M-1 to S-103;
M-1 to P-101; M-1 to L-100; M-1 to R-99
M-1 to Y-98; M-1 to R-97; M-1 to F-96; M-1 to H-95;
M-1 to L-94; M-1 to F-93; M-1 to H-92; M-1 to Q-91.
M-1 to G-90; M-1 to N-89; M-1 to V-88; M-1 to S-87;
M-1 to V-86; M-1 to K-85; M-1 to V-84; M-1 to E-83;
M-1 to E-82; M-1 to N-81; M-1 to G-80; M-1 to F-79;
M-1 to L-78; M-1 to F-77; M-1 to L-76; M-1 to I-75;
M-1 to L-74; M-1 to F-73; M-1 to S-72; M-1 to S-71;
M-1 to G-70; M-1 to R-69; M-1 to R-68; M-1 to L-67;
M-1 to A-66; M-1 to L-65; M-1 to H-64; M-1 to P-63;
M-1 to W-62; M-1 to R-61; M-1 to A-60; M-1 to E-59;
M-1 to R-58; M-1 to Q-57; M-1 to W-56; M-1 to R-55;
M-1 to G-54; M-1 to G-53; M-1 to H-52; M-1 to L-51;
M-1 to T-50; M-1 to N-49; M-1 to C-48; M-1 to I-47;
M-1 to V-46; M-1 to H-45; M-1 to P-44; M-1 to K-43;
M-1 to T-42; M-1 to T-41; M-1 to H-40; M-1 to F-39;
M-1 to R-38; M-1 to P-37; M-1 to N-36; M-1 to F-35;
M-1 to H-34; M-1 to F-33; M-1 to A-32; M-1 to I-31;
M-1 to D-30; M-1 to P-29; M-1 to R-28; M-1 to P-27;
M-1 to C-26; M-1 to L-25; M-1 to S-24; M-1 to C-23;
M-1 to G-22; M-1 to C-21; M-1 to Q-20; M-1 to F-19;
M-1 to D-18; M-1 to V-17; M-1 to Q-16; M-1 to F-15;
M-1 to R-14; M-1 to H-13; M-1 to A-12; M-1 to D-11.
M-1 to L-10; M-1 to P-9; M-1 to V-8; M-1 to V-7; and M-1 to G-6. Polynucleotides encoding such polypeptides are also included in the present invention.

A further embodiment of the present invention relates to a polypeptide fragment comprising or consisting of an amino acid sequence represented by the general formulas m to n, wherein m
And n each correspond to any one of the amino acid residues specified above for these symbols. Polynucleotides encoding these polypeptides are also included in the present invention.

In yet another embodiment, the present invention further provides a polypeptide in which one or more residues have been deleted from the amino terminus of the amino acid sequence of galectin 11 polypeptide set forth in SEQ ID NO: 27. In particular, in one embodiment, galectin 11
The N-terminal deletion of a polypeptide can be described by the general formula m-296, wherein:
m is 2 to 29 corresponding to the position of the amino acid residue identified in SEQ ID NO: 27.
Is an integer of 1 and preferably corresponds to one of the N-terminal amino acid residues identified in the N-terminal deletion specified herein. In certain embodiments, the N-terminal deletion of a Galectin-11 polypeptide of the invention comprises or consists of the following amino acid residues of SEQ ID NO: 27: S-2 to S-296;
S-296; F-4 to S-296; S-5 to S-296; C-6 to S-296;
S-7 to S-296; G-8 to S-296; G-9 to S-296; S-10 to S
-296; L-11 to S-296; C-12 to S-296; H-13 to S-29
6; D-14 to S-296; D-15 to S-296; F-16 to S-296; W
R-17 to S-296; R-18 to S-296; P-19 to S-296; A-20
-S-296; C-21 to S-296; R-22 to S-296;
296; D-24 to S-296; G-25 to S-296; H-26 to S-296
A-27 to S-296; A-28 to S-296; R-29 to S-296;
30-S-296; G-31-S-296; P-32-S-296; S-33-
S-296; R-34 to S-296; C-35 to S-296; T-36 to S-2
96; Q-37 to S-296; V-38 to S-296; D-39 to S-296;
F-40 to S-296; Q-41 to S-296; C-42 to S-296; G-4
3-S-296; C-44-S-296; S-45-S-296; L-46-S
-296; C-47 to S-296; P-48 to S-296; R-49 to S-29.
6; P-50 to S-296; D-51 to S-296; I-52 to S-296;
-53 to S-296; F-54 to S-296; H-55 to S-296; F-56
N-57 to S-296; P-58 to S-296; R-59 to S-.
296; F-60 to S-296; H-61 to S-296; T-62 to S-296.
T-63 to S-296; K-64 to S-296; P-65 to S-296;
66-S-296; V-67-S-296; I-68-S-296; C-69-
S-296; N-70 to S-296; T-71 to S-296; L-72 to S-2
H-73 to S-296; G-74 to S-296; G-75 to S-296;
R-76 to S-296; W-77 to S-296; Q-78 to S-296; R-7
9-S-296; E-80-S-296; A-81-S-296; R-82-S
-296; W-83 to S-296; P-84 to S-296; H-85 to S-29
6; L-86 to S-296; A-87 to S-296; L-88 to S-296; R
-89 to S-296; R-90 to S-296; G-91 to S-296; S-92
S-93 to S-296; F-94 to S-296; L-95 to S-
296; I-96 to S-296; L-97 to S-296; F-98 to S-296.
L-99 to S-296; F-100 to S-296; G-101 to S-296;
N-102 to S-296; E-103 to S-296; E-104 to S-296;
V-105 to S-296; K-106 to S-296; V-107 to S-296;
S-108 to S-296; V-109 to S-296; N-110 to S-296;
G-111 to S-296; Q-112 to S-296; H-113 to S-296;
F-114 to S-296; L-115 to S-296; H-116 to S-296;
F-117 to S-296; R-118 to S-296; Y-119 to S-296;
R-120 to S-296; L-121 to S-296; P-122 to S-296;
L-123 to S-296; S-124 to S-296; H-125 to S-296;
V-126 to S-296; D-127 to S-296; T-128 to S-296;
L-129 to S-296; G-130 to S-296; I-131 to S-296;
F-132 to S-296; G-133 to S-296; D-134 to S-296;
I-135 to S-296; L-136 to S-296; V-137 to S-296;
E-138 to S-296; A-139 to S-296; V-140 to S-296;
G-141 to S-296; F-142 to S-296; L-143 to S-296;
N-144 to S-296; I-145 to S-296; N-146 to S-296;
P-147 to S-296; F-148 to S-296; V-149 to S-296;
E-150 to S-296; G-151 to S-296; S-152 to S-296;
R-153 to S-296; E-154 to S-296; Y-155 to S-296;
P-156 to S-296; A-157 to S-296; G-158 to S-296;
H-159 to S-296; P-160 to S-296; F-161 to S-296;
L-162 to S-296; L-163 to S-296; M-164 to S-296;
S-165 to S-296; P-166 to S-296; R-167 to S-296;
L-168 to S-296; E-169 to S-296; V-170 to S-296;
P-171 to S-296; C-172 to S-296; S-173 to S-296;
H-174 to S-296; A-175 to S-296; L-176 to S-296;
P-177 to S-296; Q-178 to S-296; G-179 to S-296;
L-180 to S-296; S-181 to S-296; P-182 to S-296;
G-183 to S-296; Q-184 to S-296; V-185 to S-296;
I-186 to S-296; I-187 to S-296; V-188 to S-296;
R-189 to S-296; G-190 to S-296; L-191 to S-296;
V-192 to S-296; L-193 to S-296; Q-194 to S-296;
E-195 to S-296; P-196 to S-296; K-197 to S-296;
H-198 to S-296; F-199 to S-296; T-200 to S-296;
V-201 to S-296; S-202 to S-296; L-203 to S-296;
R-204 to S-296; D-205 to S-296; Q-206 to S-296;
A-207 to S-296; A-208 to S-296; H-209 to S-296;
A-210 to S-296; P-211 to S-296; V-212 to S-296;
T-213 to S-296; L-214 to S-296; R-215 to S-296;
A-216 to S-296; S-217 to S-296; F-218 to S-296;
A-219 to S-296; D-220 to S-296; R-221 to S-296;
T-222 to S-296; L-223 to S-296; A-224 to S-296;
W-225 to S-296; I-226 to S-296; S-227 to S-296;
R-228 to S-296; W-229 to S-296; G-230 to S-296;
Q-231 to S-296; K-232 to S-296; K-233 to S-296;
L-234 to S-296; I-235 to S-296; S-236 to S-296;
A-237 to S-296; P-238 to S-296; F-239 to S-296;
L-240 to S-296; F-241 to S-296; Y-242 to S-296;
P-243 to S-296; Q-244 to S-296; R-245 to S-296;
F-246 to S-296; F-247 to S-296; E-248 to S-296;
V-249 to S-296; L-250 to S-296; L-251 to S-296;
L-252 to S-296; F-253 to S-296; Q-254 to S-296;
E-255-S-296; G-256-S-296; G-257-S-296;
L-258 to S-296; K-259 to S-296; L-260 to S-296;
A-261 to S-296; L-262 to S-296; N-263 to S-296;
G-264 to S-296; Q-265 to S-296; G-266 to S-296;
L-267 to S-296; G-268 to S-296; A-269 to S-296;
T-270 to S-296; S-271 to S-296; M-272 to S-296;
N-273 to S-296; Q-274 to S-296; Q-275 to S-296;
A-276 to S-296; L-277 to S-296; E-278 to S-296;
Q-279 to S-296; L-280 to S-296; R-281 to S-296;
E-282 to S-296; L-283 to S-296; R-284 to S-296;
I-285 to S-296; S-286 to S-296; G-287 to S-296;
S-288 to S-296; V-289 to S-296; Q-290 to S-296;
L-291-S-296. Polynucleotides encoding such polypeptides are also included in the present invention.

A further embodiment of the present invention relates to a C-terminal deletion of a galectin 11 polypeptide described by general formulas 1-n. Here, n is an integer from 6 to 295 corresponding to the position of the amino acid residue identified in SEQ ID NO: 27, and is preferably identified at the C-terminal deletion specified herein. Corresponds to one of the C-terminal amino acid residues. In certain embodiments, the C-terminal deletion of a Galectin-11 polypeptide of the invention comprises or consists of the following amino acid residues of SEQ ID NO: 27: M-1 to H-295; V-294; M-1 to C-293;
M-1 to Y-292; M-1 to L-291; M-1 to Q-290; M-1 to V-
289; M-1 to S-288; M-1 to G-287; M-1 to S-286;
M-1 to R-284; M-1 to L-283; M-1 to E-28
2; M-1 to R-281; M-1 to L-280; M-1 to Q-279;
E-278; M-1 to L-277; M-1 to A-276; M-1 to Q-275;
M-1 to Q-274; M-1 to N-273; M-1 to M-272; M-1 to S-
271; M-1 to T-270; M-1 to A-269; M-1 to G-268;
1 to L-267; M-1 to G-266; M-1 to Q-265; M-1 to G-26
4; M-1 to N-263; M-1 to L262; M-1 to A-261; M-1 to L
-260; M-1 to K-259; M-1 to L-258; M-1 to G-257; M
M-1 to E-255; M-1 to Q-254; M-1 to F-2
53; M-1 to L-252; M-1 to L-251; M-1 to L-250; M-1
M-1 to E-248; M-1 to F-247; M-1 to F-246.
M-1 to R-245; M-1 to Q-244; M-1 to P-243; M-1 to Y
-242; M-1 to F-241; M-1 to L-240; M-1 to F-239; M
M-1 to A-237; M-1 to S-236; M-1 to I-2
M-1 to L-234; M-1 to K-233; M-1 to K-232; M-1
M-1 to G-230; M-1 to W-229; M-1 to R-228
M-1 to S-227; M-1 to I-226; M-1 to W-225;
-224; M-1 to L-223; M-1 to T-222; M-1 to R-221; M
M-1 to A-219; M-1 to F-218; M-1 to S-2
17; M-1 to A-216; M-1 to R-215; M-1 to L-214; M-1
M-1 to V-212; M-1 to P- 211; M-1 to A-210.
M-1 to H-209; M-1 to A-208; M-1 to A-207;
-206; M-1 to D-205; M-1 to R-204; M-1 to L-203; M
M-1 to V-201; M-1 to T-200; M-1 to F-1
M-1 to H-198; M-1 to K-197; M-1 to P-196; M-1
M-1 to Q-194; M-1 to L-193; M-1 to V-192.
M-1 to L-191; M-1 to G-190; M-1 to R-189; M-1 to V
-188; M-1 to I-187; M-1 to I-186; M-1 to V-185; M
M-1 to G-183; M-1 to P-182; M-1 to S-1
81; M-1 to L-180; M-1 to G-179; M-1 to Q-178; M-1
M-1 to L-176; M-1 to A-175; M-1 to H-174.
M-1 to S-173; M-1 to C-172; M-1 to P-171;
-170; M-1 to E-169; M-1 to L-168; M-1 to R-167; M
M-1 to S-165; M-1 to M-164; M-1 to L-1
63; M-1 to L-162; M-1 to F-161; M-1 to P-160; M-1
M-1 to G-158; M-1 to A-157; M-1 to P-156.
M-1 to Y-155; M-1 to E-154; M-1 to R-153; M-1 to S
-152; M-1 to G-151; M-1 to E-150; M-1 to V-149; M
-1 to F-148; M-1 to P-147; M-1 to N-146; M-1 to I-1
M-1 to N-144; M-1 to L-143; M-1 to F-142; M-1
M-1 to V-140; M-1 to A-139; M-1 to E-138.
M-1 to V-137; M-1 to L-136; M-1 to I-135;
-134; M-1 to G-133; M-1 to F-132; M-1 to I-131; M
M-1 to L-129; M-1 to T-128; M-1 to D-1
27; M-1 to V-126; M-1 to H-125; M-1 to S-124; M-1
M-1 to P-122; M-1 to L-121; M-1 to R-120.
M-1 to Y-119; M-1 to R-118; M-1 to F-117;
-116; M-1 to L-115; M-1 to F-114; M-1 to H-113; M
M-1 to G-111; M-1 to N-110; M-1 to V-1
09; M-1 to S-108; M-1 to V-107; M-1 to K-106; M-1
M-1 to E-104; M-1 to E-103; M-1 to N-102.
M-1 to G-101; M-1 to F-100; M-1 to L-99; M-1 to F-;
M-1 to L-97; M-1 to I-96; M-1 to L-95; M-1 to F-
94; M-1 to S-93; M-1 to S-92; M-1 to G-91; M-1 to R-
90; M-1 to R-89; M-1 to L-88; M-1 to A-87; M-1 to L-
86; M-1 to H-85; M-1 to P-84; M-1 to W-83; M-1 to R-
82; M-1 to A-81; M-1 to E-80; M-1 to R-79; M-1 to Q-
78; M-1 to W-77; M-1 to R-76; M-1 to G-75; M-1 to G-
74; M-1 to H-73; M-1 to L-72; M-1 to T-71; M-1 to N-
70; M-1 to C-69; M-1 to I-68; M-1 to V-67; M-1 to H-.
66; M-1 to P-65; M-1 to K-64; M-1 to T-63;
62; M-1 to H-61; M-1 to F-60; M-1 to R-59; M-1 to P-.
M-1 to N-57; M-1 to F-56; M-1 to H-55; M-1 to F-
M-1 to A-53; M-1 to I-52; M-1 to D-51; M-1 to P-
M-1 to R-49; M-1 to P-48; M-1 to C-47; M-1 to L-
46; M-1 to S-45; M-1 to C-44; M-1 to G-43;
42; M-1 to Q-41; M-1 to F-40; M-1 to D-39;
M-1 to Q-37; M-1 to T-36; M-1 to C-35; M-1 to R-
34; M-1 to S-33; M-1 to P-32; M-1 to G-31;
M-1 to R-29; M-1 to A-28; M-1 to A-27; M-1 to H-
26; M-1 to G-25; M-1 to D-24; M-1 to Q-23;
22; M-1 to C-21; M-1 to A-20; M-1 to P-19;
M-1 to W-17; M-1 to F-16; M-1 to D-15; M-1 to D-
14; M-1 to H-13; M-1 to C-12; M-1 to L-11; M-1 to S-.
M-1 to G-9; M-1 to G-8; M-1 to S-7; M-1 to C-6. Polynucleotides encoding such polypeptides are also included in the present invention.

A further embodiment of the present invention relates to a polypeptide fragment comprising or consisting of an amino acid sequence represented by the general formulas mn, wherein m
And n each correspond to any one of the amino acid residues specified above for these symbols. Polynucleotides encoding these polypeptides are also included in the present invention.

FIG. 2 provides a comparison of Galectin-11 polypeptide with other galectins. Identical amino acids shared between galectins are shaded, while conservative amino acid changes are boxed. By examining the shaded and / or boxed regions of amino acids, one of skill in the art can readily identify conserved domains between the two polypeptides. Amino acid sequences present within these conserved, shaded and / or enclosed domains are encompassed by preferred polypeptide fragments of the present invention. Similar analyzes of full-length galectin 11α and galectin 11β are considered to be within the skill of the art in light of the teachings provided herein.

Representative examples of polypeptide residue fragments of the present invention include, for example, approximately amino acids 1-2 of the galectin-11 polypeptide shown in FIG. 1 (SEQ ID NO: 2).
0, 1-66, 5-108, 5-128, 21-40, 40-108, 41-6
0, 47-108, 47-128, 61-80, 65-108, 65-128,
81-100, 88-108, 88-128, 108-120; 114-128
And 101-terminal fragments. In this context, “approximately” includes the particularly recited range, at either or both ends, that is greater or less than 5, 5, 3, 3, 2, or 1 amino acid. Representative examples of polypeptide residue fragments of the present invention include, for example, about amino acid numbers 1-20, 1-66, 5-108, 5-128, 21-40,
40-108, 41-60, 47-108, 47-128, 61-80, 65
108, 65-128, 81-100, 88-108, 88-128, 108-
120; 114-128; 129-150; 145-175; 170-200;
195-225; 220-250; and 245-275. Further representative examples of polypeptide residue fragments of the present invention include, for example, about amino acids 1-20, 1-66, 5-108 of SEQ ID NO: 27.
, 5-128, 21-40, 40-108, 41-60, 47-108, 47-
128, 61-80, 65-108, 65-128, 81-100, 88-10
8, 88-128, 108-120; 114-128; 129-150; 145
-175; 170-200; 195-225; 220-250; 245-275.
And 270-296 fragments. A polypeptide comprising such an amino acid sequence is provided, as well as a polynucleotide encoding such a polypeptide.

Preferably, the polynucleotide fragment of the present invention encodes a polypeptide exhibiting galectin 11 functional activity. "Functionally active" galectin 11
Is a polypeptide related to the full-length (complete) galectin-11 protein.
A polypeptide capable of displaying one or more functional activities is meant. Such functional activities include, but are not limited to: biological activity, antigenicity [binding to anti-galectin 11 antibody (or galectin 1 for binding thereof).
1 compete with the polypeptide), immunogenicity (ability to generate an antibody that binds to the galectin 11 polypeptide), and ability to form a multimer with the galectin 11 polypeptide of the present invention.

Particularly preferred fragments of the present invention are fragments characterized by the structural or functional properties of Galectin-11. Such fragments include the α-helix of galectin 11 and the α-helix forming region (“α region”).
), Β sheet and β sheet forming region (“β region”), turn and turn forming region (“turn region”), coil and coil forming region (“coil region”), hydrophilic region, hydrophobic region, α parents Amphiphilic region, β-amphiphilic region, surface-forming region, and high antigenic index region (ie, having an antigenic region of three or more consecutive amino acid residues each having an antigenic index of 1.5 or more) And amino acid residues. Certain preferred regions are those shown in FIG. 3 and include, but are not limited to, regions of the type described above identified by analysis of the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2). Such preferred regions include: Garnier-Robson predicted α, β, turn, and coil regions; Chou-Fasman predicted α, β, turn, and coil regions; Kyte-Doolittle Predicted hydrophilic and hydrophobic regions;
Eisenberg α and β amphipathic regions; Emini surface-forming regions; and Jameson-Wolf high antigenic index regions. These are predicted using the default parameters of these computer programs. Polynucleotides encoding these polypeptides are also included in the present invention.

In a further embodiment, a polynucleotide of the invention encodes a functional property of Galectin-11. Preferred embodiments of the present invention in this regard include:
Α-helix and α-helix forming region (“α region”) of galectin 11, β
Sheet and beta sheet formation region ("beta region"), turn and turn formation region (
"Turn regions"), coils and coil-forming regions ("coil regions"), hydrophilic regions, hydrophobic regions, alpha amphiphilic regions, beta amphiphilic regions, flexible regions, surface forming regions, and high antigens Fragments, including the sex index region, are included.

As described above, the data representing the structural or functional properties of galectin 11 shown in FIG. 1 and / or Table I are based on the DNA set on the default parameters.
* Generated using various modules and algorithms of STAR. In a preferred embodiment, the data presented in columns VIII, XII and XIII of Table 1 can be used to determine regions of galectin 11 that exhibit a high degree of potency for antigenicity. Highly antigenic regions are listed in columns VIII, XII and XII
Determined by selecting values from the data presented in I that indicate the region of the polypeptide that is likely to be exposed on the surface of the polypeptide in circumstances where antigen recognition can occur in the process of initiating an immune response Is done.

Certain preferred regions at these points are shown in FIG. 3, but may be presented or identified by using the representation of the data presented in FIG. 3, as shown in Table 1. . Using the DNA * STAR computer algorithm (set on the original default parameters) used to generate FIG.
The data of FIG. 3 was presented in tabular form (see Table 1). Using this tabular form of the data of FIG. 3, the specific boundaries of the preferred area can be easily determined.

The preferred regions shown in FIG. 3 and Table I include, but are not limited to, regions of the above type identified by analysis of the amino acid sequence shown in FIG. As shown in FIG. 3 and Table I, such preferred regions include Garnier-Robson predicted α, β, turn, and coil regions, Chou-Fasman predicted α, β, and turn regions, K
the hydrophilic region of yte-Doolittle, the α and β amphipathic regions of Eisenberg, the flexible region of Karplus-Schulz, the surface forming region of Emini; and the Jameson-Wolf high antigenic index region.

[0163]

[Table 2] FIG. 2 provides a comparison of this galectin-11 polypeptide with other galectins. The same amino acids shared between these galectins are shaded, while conservative amino acid changes are boxed. By examining the shaded and / or boxed region of amino acids, one of skill in the art can readily identify conserved domains between the two polypeptides. Amino acid sequences between these conserved, shaded and / or boxed domains are included in preferred polypeptide fragments of the invention.

Among the highly preferred fragments in this regard are those that include a region of galectin 11 that combines several structural features (eg, some of the features set forth above).

Other preferred polypeptide fragments include biologically active galectin 11
It is a fragment. Biologically active fragments are fragments that exhibit an activity similar, but not necessarily identical, to that of the galectin-11 polypeptide. The biological activity of the fragments may include an improved desired activity or a reduced unwanted activity. Polynucleotides encoding these polypeptides are also encompassed by the present invention. Representative examples of polypeptide residue fragments of the present invention include, for example, the galectin-11 polypeptide (SEQ ID NO: 2) shown in FIG. Amino acid numbers 1 to 20,
1-66, 5-108, 5-128, 21-40, 40-108, 41-60,
47-108, 47-128, 61-80, 65-108, 65-128, 81
-100, 88-108, 88-128, 108-120; 114-128; and 101-last fragment. In this context, "approximately"
At either or both termini, include those that are several amino acids, five amino acids, four amino acids, three amino acids, two amino acids, or one amino acid larger or smaller than the range specifically mentioned.

As those skilled in the art will appreciate, galectin-11 polypeptides of the present invention (eg, epitope-bearing fragments of galectin-11, etc.) can be used to bind immunoglobulins (IgG
) Can be combined with a portion of the constant domain to produce a chimeric polypeptide. IgG
Fusion proteins with disulfide-linked dimer structures by moieties may also be more efficient at binding and neutralizing other molecules than the monomeric galectin-11 protein or protein fragment alone (Funtoulakis
J. et al. Biochem. 270: 3958-3964 (1995)).

As will be appreciated by those skilled in the art, and as discussed above, the polypeptides of the present invention that include an immunogenic or antigenic epitope can be fused to other polypeptide sequences. For example, a polypeptide of the invention may comprise an immunoglobulin (IgA
, IgE, IgG, IgM) or portions thereof (CH1, CH2,
CH3, or any combination thereof and portions thereof)
A chimeric polypeptide can result. Such fusion proteins can facilitate purification and increase half-life in vivo. This is shown for a chimeric protein consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of a mammalian immunoglobulin. See, for example, EP 394,827; Traunecker et al., Nature 331.
: 84-86 (1988). Enhanced delivery of antigen across the epithelial barrier to the immune system has been demonstrated for antigens (eg, insulin) bound to FcRn binding partners (eg, IgG or Fc fragments) (eg, PCT Publication WO 96 /). 22024 and WO 99/04813
checking). IgG fusion proteins having a disulfide-linked dimer structure due to IgG partial disulfide bonds have also been found to be more effective at binding and neutralizing other molecules than monomeric polypeptides or fragments thereof alone. See, eg, Footoulakis et al. Bioche
m. 270: 3958-3964 (1995). Nucleic acids encoding the above-described epitopes may also be epitope tags (eg, hemagglutinin ("HA")).
Tag or flag tag) in combination with the gene of interest to aid in the detection and purification of the expressed polypeptide. For example, the system described by Janknecht et al. Allows for easy purification of non-denatured fusion proteins expressed in human cell lines (Janknecht et al., 1991, Proc. Natl.
Acad. Sci. ScL USA 88: 8972-897). In this system, the gene of interest is subcloned into a vaccinia recombination plasmid such that the open reading frame of the gene is translationally fused to an amino-terminal tag consisting of six histidine residues. This tag acts as a matrix binding domain for the fusion protein. Extracts from cells infected with this recombinant vaccinia virus can be loaded onto a Ni2 + nitriloacetic acid-agarose column and histidine-tagged proteins can be selectively eluted with imidazole-containing buffers.

[0168] Additional fusion proteins of the invention can be produced via the techniques of gene shuffling, motif shuffling, exon shuffling, and / or codon shuffling (collectively referred to as "DNA shuffling"). DNA shuffling can be used to modulate the activity of a polypeptide of the invention, and such methods can be used to generate polypeptides with altered activity, and agonists and antagonists of the polypeptide . Generally, U.S. Patent Nos. 5,605,793; 5,811,238;
5,830,721; 5,834,252; and 5,837,45
No. 8, and Patten et al., Curr. Opinion Biotechn
ol. 8: 724-33 (1997); Harayama, Trends Bi.
otechnol. 16 (2): 76-82 (1998); Hansson et al.
J. Mol. Biol. 287: 265-76 (1999); and Loren.
zo and Blasco, Biotechniques 24 (2): 308-
13 (1998) (these patents and publications are incorporated herein by reference in their entirety). In one embodiment, SEQ ID NO: 1
Polynucleotides corresponding to and changes in the polypeptides encoded by these polynucleotides can be achieved by DNA shuffling. DNA shuffling involves assembling two or more DNA segments by homologous recombination or site-specific recombination to produce a change in the polynucleotide sequence. In another embodiment, the polynucleotide of the invention or its encoded polypeptide may be altered by subjecting it to error-prone PCR, random nucleotide insertion or random mutagenesis by other methods before recombination. . In another embodiment, one or more components, motifs, sections, portions, domains, fragments, etc., of a polynucleotide encoding a polypeptide of the invention comprise one or more components, motifs, one or more heterologous molecules.
Can be combined with sections, parts, domains, fragments, etc.

The polypeptide of the present invention has the polynucleotide sequence shown in FIG. 1 (SEQ ID NO: 1).
), Its complement, and / or a polypeptide encoded by a polynucleotide that hybridizes (eg, under stringent hybridization conditions) to a nucleotide sequence contained in the deposited clone.

Assay for Functional Activity of Galectin-11 The functional and / or biological activity of the galectin-11 polypeptides, fragments, variants, derivatives and analogs of the present invention can be assayed by various methods. .

For example, in one embodiment assaying for the ability to bind to a galectin-11 polypeptide or to compete with a galectin-11 polypeptide for binding to an anti-galectin-11 antibody, in one embodiment, various assays known in the art are used. Immunoassays can be used, including radioimmunoassays, ELISAs
, "Sandwich" immunoassays, immunoradiometric assays and diffusion sedimentation reactions, immunodiffusion assays, in situ immunoassays (e.g., using colloidal gold, enzyme or radioisotope labels), Western blots, sedimentation reactions,
Competitive and non-competitive assay systems using techniques such as agglutination assays (eg, gel agglutination assays, hemagglutination assays), complement binding assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays But are not limited to these. Many means for detecting binding in an immunoassay are known in the art and are within the scope of the present invention.

In another embodiment, the ability of the galectin-11 polypeptides, fragments, variants, derivatives and analogs of the present invention to bind β-galactoside sugars is determined using or using assays known in the art. It can be determined by customary modification. For example, the lactose binding activity of the expressed galectin-11 polypeptide and its fragments, variants, derivatives, or analogs can be measured by asialofetuin (asialofe) immobilized on nitrocellulose (Amersham).
tuin) (Sigma) by immunodetection of in situ binding activity (Madsen et al., J. Biol. Chem. 270 (11): 58).
23-5829 (1995)). For example, in one assay, 30 μg of asialofetuin dissolved in 3 μl of water is spotted on a 1 cm ² piece of nitrocellulose. The nitrocellulose pieces were then placed in a 24-well tissue culture plant and buffer B (58 mM NA ₂ HPO ₄ , 1
8 mM KH ₂ PO ₄ , 75 mM NaCl, 2 mM EDTA, and 3% B
(SA, pH 7.2) with constant stirring at 22 ° C. overnight. After the incubation, the blocking medium was aspirated and the nitrocellulose pieces were buffered A (58 mM NA ₂ HPO ₄ , 18 mM KH ₂ PO ₄ , 7 mM).
Wash 3 times in 5 mM NaCl, 2 mM EDTA, 4 mM β-mercaptoethanol and 0.2% BSA, pH 7.2). Cell (preferably COS cell) extract containing 1% BSA and either with or without 150 mM lactose (105 μl primary extract, 1 in buffer A)
Prepare 5 μl of 10% BSA and either 30 μl of 0.75 M lactose in buffer A or 30 μl of buffer A). The immobilized asialofetuin is incubated with the extract for 2 hours and washed 5 times in buffer A. The nitrocellulose pieces were then placed in PBS (58 mM Na ₂ HPO ₄ , 18 mM KH ₂ PO ₄ , 75 mM NaCl, 2 mM EDTA, pH 7.2.
) Is fixed in 2% formalin for one hour to prevent loss of bound galectin-11. After extensive washing in PBS, the strips were incubated for 2 hours at 22 ° C. with rabbit anti-galectin-11 polyclonal serum (generated using techniques known in the art) diluted 1: 100 in PBS. Is done. The strip is then washed in PBS and incubated with a peroxidase labeled goat anti-rabbit antibody (DAKO). After a 2 hour incubation at 22 ° C., the strip is washed in PBS and the substrate is added. The nitrocellulose pieces are incubated until color develops, and the reaction is stopped by washing in distilled water.

The ability of the galectin-11 polypeptides, fragments, variants, derivatives and analogs of the invention to aggregate trypsinized rabbit erythrocytes can be routinely assayed using techniques known in the art.

The ability of the galectin-11 polypeptides, fragments, variants, derivatives and analogs of the present invention to induce T cell apoptosis is determined by the techniques described herein (see, eg, Example 5). ) May be determined otherwise using techniques known in the art or routinely modifying the techniques. For example, Per
illo et al., Nature 378: 736-739 (1995); Chinn.
aiyan et al., Cell 81: 505-512 (1995); Boldin et al. Biol. Chem. 270: 7795-7798 (1995); Kis.
chkel et al., EMBO J .; 14: 5579-5585 (1995); Chi.
Nnaiyan et al. Biol. Chem. 271: 4961-4965 (1
996), the contents of each of which is incorporated herein by reference in its entirety.

Galectin-11 polynucleotides and polypeptides, and fragments, variants, derivatives and analogs thereof; and antibodies, agonists and antagonists thereto, can be tested in vivo for the desired therapeutic or prophylactic activity. For example, such compounds can be tested in a suitable animal model system before testing in humans. Such animal models include, but are not limited to, rats, mice, chickens, cows, monkeys, rabbits, and the like. Using such tests, dosages for delivery to human patients can also be routinely determined. For in vivo testing prior to administration to humans, any animal model system known in the art can be used (see, eg, Levi et al., Eur.
J. Imun. 13: 500-507 (1983); and Offner et al., J.
. Neuroimmunol 28: 177-184 (1990)). For example, a useful animal model for studying treatment of human MS is experimental allergic encephalomyelitis (EAE). EAE is an experimentally induced disease that shares many of the same clinical and pathological symptoms of MS (Martin et al., A.
nn. Rev .. Immunol. 10: 153-187 (1992); Hafl.
er et al., Immunology Today 10: 104-107 (1989).
)). Several studies in rodents have shown that, like MS, CD4 ⁺ T cells are involved in the pathophysiology of EAE (Tragott et al., Cel.
lul Immunology 91: 240-254 (1985); Be.
n-Nun, Eur. J. Immunol. 11: 195-199 (1981)
Pettinel et al., J .; Immunol. 127: 1420-1423 (1
981)). EAE can be induced in certain strains of mice by immunization with myelin in adjuvant. This immunization is based on the myelin basic protein (M
Activates CD4 ⁺ T cells specific for BP) and proteolipid (PLP) (Bernard et al., J. Immunol. 114: 1537-1540 (1
975); Chou et al. Immunol. 130: 2183-2186 (1
983); Kurcrowo et al. Immunol. 148: 3776-37
82 (1992)). The activated T cells enter the central nervous system and their local effects are associated with both anatomical pathology and clinical signs of the disease (eg, ascending hind limb paresis resulting in paralysis). cause. As discussed above, galectin 1 has been demonstrated to suppress the clinical and histological signs of experimental autoimmune encephalomyelitis in rats (Offner et al., J. Neuro.
oimmunol. 28: 177-184 (1990)).

It is utilized both to study the role of the polypeptides, variants, derivatives and analogs of the present invention as suppressors of the immune response, and to determine effective dosages to do so. Another model system to obtain is experimental autoimmune myasthenia gravis (EAMG) in rabbits. EAMG is an autoimmune disease induced by immunization with purified acetylcholine receptor protein (AChR) and is considered a good model for the human disease myasthenia gravis. As further discussed above, galectin 1 has been demonstrated to have prophylactic and therapeutic effects on experimental autoimmune myasthenia gravis in rabbits (Levi et al., Eur. J. Immunol. 13). : 500-50
7 (1983)).

Other model assays known in the art that can be used to determine the desired therapeutic or prophylactic activity of a compound of the invention (eg, as a suppressor of an immune response) include mixed lymphocyte reactions. These include, but are not limited to, T cell proliferation in the assay (an art-recognized model for allograft rejection) and mouse allograft models known in the art.

To routinely determine which galectin-11 polypeptides, fragments, variants, derivatives and analogs of the invention exhibit the functional activity of galectin-11 and the optimal concentration at which these compounds exhibit this activity In addition, assays described herein or otherwise known in the art can be applied. These assays can be further utilized to identify molecules that enhance (agonists) or inhibit (antagonists) the functional activity of galectin-11.

Epitopes The invention encompasses polypeptides comprising or consisting of:
An epitope of a polypeptide having the amino acid sequence of SEQ ID NO: 2, 25, or 27; an epitope of a polypeptide sequence encoded by the polynucleotide sequence contained in ATCC Accession No. 209053; A polynucleotide encoded by a polynucleotide that hybridizes to the complement or the complement of the sequence contained in ATCC Accession No. 209053 under stringent hybridization conditions or lower stringency hybridization conditions as defined above. Epitope of the peptide sequence. The invention further includes: a polynucleotide sequence encoding an epitope of a polypeptide sequence of the invention (eg, a sequence disclosed in SEQ ID NO: 1, 24, or 26); A polynucleotide sequence of the complement of the nucleotide sequence; and a polynucleotide sequence that hybridizes to the complementary strand under stringent hybridization conditions or lower stringency hybridization conditions as defined above.

The term “epitope” as used herein refers to a portion of a polypeptide that has antigenic or immunogenic activity in an animal, preferably a mammal, and most preferably a human. . In a preferred embodiment, the invention includes a polypeptide comprising an epitope, as well as a polynucleotide encoding the polypeptide. An "immunogenic epitope," as used herein, is defined as a portion of a protein that elicits an antibody response in an animal, and may be formed by any method known in the art (e.g., for the production of antibodies described below). Method). (See, eg, Geysen et al., Proc. Natl. Acad. Sci.
ScL USA 81: 3998-4002 (1983)). The term “antigenic epitope”, as used herein, refers to the antibody as determined by any method known in the art (eg, the immunoassays described herein). It is defined as a part of a protein that can immunospecifically bind to an antigen. Immunospecific binding excludes non-specific binding, but need not necessarily exclude cross-reactivity with other antigens. Antigenic epitopes do not necessarily require immunogenicity.

[0181] Fragments that function as epitopes can be generated by any conventional means. (See, for example, Houghten, Proc. Natl. Acad. Sci.
USA 82: 5131-5135 (1985) (U.S. Pat.
No. 1).

Accordingly, the antigenic epitope-bearing peptides and polypeptides of the present invention are useful, for example, for raising antibodies (including monoclonal antibodies) that specifically bind to the polypeptides of the present invention. Preferred antigenic epitopes include the antigenic epitopes disclosed herein, as well as two of these antigenic epitopes,
Any combination of three, four, five or more. Antigenic epitopes can be used as target molecules in immunoassays (eg, Wi
lson et al., Cell 37: 767-778 (1984); Sutcliffe.
e, et al., Science 219: 660-666 (1983)).

[0183] Similarly, immunogenic epitopes can be used to elicit antibodies, for example, according to methods well known in the art. (See, eg, Sutcliffe et al., Supra); Wils.
on et al., supra; Chow et al., Proc. Natl. Acad. Sci. USA
82: 910-914; and Bittle et al. Gen. Virol. 6
6: 2347-2354 (1985)). Preferred immunogenic epitopes include the immunogenic epitopes disclosed herein, as well as any combination of two, three, four, five or more of these immunogenic epitopes. A polypeptide comprising one or more immunogenic epitopes can be presented to elicit an antibody response against an animal system (eg, rabbit or mouse) with a carrier protein (eg, albumin), or the polypeptide can be If long enough (at least about 25 amino acids), the polypeptide can be presented without a carrier. However, immunogenic epitopes containing as few as 8 to 10 amino acids have been shown to be sufficient to raise antibodies capable of (at least) binding to the linear epitopes of the denatured polypeptide. (Eg, in Western blotting).

The antigenic epitope-bearing peptides and polypeptides of the present invention are preferably
At least 7, 9, 15, 20, 25, 30, 35, 40, 45, 50 amino acid sequences (SEQ ID NO: 2, 25, or 27) shown in FIG. 1 or 6 , 75, 100, 110 or 120 consecutive amino acid residues. In the present invention, the antigenic epitope is preferably at least 4
, At least 5, at least 6, at least 7, more preferably at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, It comprises a sequence of at least 20, at least 25, at least 30, at least 40, at least 50, and most preferably from about 15 to about 30 amino acids.
Preferred polypeptides comprising an immunogenic or antigenic epitope are at least 10 amino acid residues, 15 amino acid residues, 20 amino acid residues, 25 amino acids in length.
Amino acid residue, 30 amino acid residue, 35 amino acid residue, 40 amino acid residue, 45
Amino acid residue, 50 amino acid residue, 55 amino acid residue, 60 amino acid residue, 65
Amino acid residue, 70 amino acid residue, 75 amino acid residue, 80 amino acid residue, 85
Amino acid residues, 90 amino acid residues, 95 amino acid residues, or 100 amino acid residues. Non-limiting additional preferred antigenic epitopes include the antigenic epitopes disclosed herein, as well as portions thereof.

Non-limiting examples of antigenic polypeptides or peptides that can be used to generate galectin 11-specific antibodies include polypeptides comprising about amino acid residues 65-70 in FIG. 1 (SEQ ID NO: 2). And about 118-
124-containing polypeptides. As indicated above, the present inventors have determined that the above polypeptide fragment is an antigenic region of the galectin 11 protein.

[0186] The epitope-bearing peptides and polypeptides of the present invention can be produced by any conventional means. See generally, Houghten, R.A. A. Proc. Na
tl. Acad. Sci. USA 82: 5131-5135 (1985). This simultaneous multiple peptide synthesis (SMPS) process also provides for Hou
No. 4,631,211 (1986) to Ghten et al.

The epitope-bearing polypeptides of the present invention can be used to elicit antibodies according to methods well known in the art, including in vivo immunization, in vitro immunization, and phage display methods. , But not limited to them. See, for example, Sutcliffe et al., Supra; Wilson et al., Supra; and Bi.
ttle et al. Gen. Virol. , 66: 2347-2354 (1985).
)checking. When using in vivo immunization, animals can be immunized with the free peptide; however, anti-peptide antibody titers can be obtained by attaching the peptide to a macromolecular carrier (eg, keyhole limpet hemocyanin (KLH) or tetanus toxoid). It can be boosted by coupling. For example, a peptide containing a cysteine residue can be attached to a carrier using a linker such as maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other peptides have more common binding agents (eg, , Glutaraldehyde). Animals such as rabbits, rats, and mice can be used with either free peptide or carrier-bound peptide, for example, by adding an emulsion (about 100 μg of peptide or carrier protein with Freund's adjuvant or any known to stimulate an immune response). With other adjuvants) and / or intradermally. Several booster injections may be required, for example, at intervals of about two weeks, to provide useful titers of the anti-peptide antibody, such as free peptide adsorbed on a solid surface. Can be detected by an ELISA assay using The titer of the anti-peptide antibody in the serum from the immunized animal is determined by the choice of the anti-peptide antibody (eg, by adsorption to the peptide on a solid support and elution of the selected antibody according to methods well known in the art). Can be elevated.

(Antibodies) Additional polypeptides of the invention include polypeptides, polypeptide fragments, and polypeptides of the invention (as determined by immunoassays well known in the art for assaying specific antibody-antigen binding). Alternatively, antibodies and T cell antigen receptors (TCRs) that immunospecifically bind to a variant of SEQ ID NO: 2 and / or an epitope
). Antibodies of the present invention include polyclonal, monoclonal, multispecific, human, humanized or chimeric, single chain, Fab
Fragments, F (ab ') fragments, fragments produced by Fab expression libraries, anti-idiotype (anti-Id) antibodies (including, for example, anti-Id antibodies to the antibodies of the invention), and epitope binding of any of the above Fragments, including but not limited to fragments. The term "antibody," as used herein, refers to an immunoglobulin molecule, and an immunologically active portion of an immunoglobulin molecule (ie, a molecule that includes an antigen-binding site that immunospecifically binds to an antigen). ). The immunoglobulin molecules of the invention can be of any type (eg, IgG, IgE, IgM, IgD, IgA, and IgY), class (eg, IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2).
Or a subclass.

More preferably, these antibodies are human antigen-binding antibody fragments of the invention and include, but are not limited to, Fab, Fab 'and F (
ab ′) ₂ , Fd, single-chain Fv (scFv), single-chain antibody, disulfide-bonded F
v (sdFv), and fragments containing either the VL or VH domains. Antigen binding antibody fragments (including single chain antibodies) may comprise the variable region alone or in combination with all or a portion of the following: hinge region, CH
One domain, CH2 domain, and CH3 domain. Antigen binding fragments that also include any combination of variable regions with the hinge, CH1, CH2, and CH3 domains are also included in the invention. The antibody of the present invention
It can be from any animal source, including birds and mammals. Preferably, the antibody is human, murine (eg, mouse and rat), donkey, sheep, rabbit, goat, guinea pig, camel, horse, or chicken. As used herein, a "human" antibody includes an antibody having the amino acid sequence of a human immunoglobulin and is isolated from a human immunoglobulin library or transgenic for one or more human immunoglobulins. And from, for example, Kucherlapati et al., US Patent No. 5,939.
No. 598, which do not express endogenous immunoglobulins.

The antibodies of the present invention can be monospecific, bispecific, trispecific or more multispecific. Multispecific antibodies can be antibodies of different specificity for a polypeptide of the invention. Multispecific antibodies can be specific for different epitopes of a polypeptide of the invention, or can be specific for both a polypeptide of the invention and a heterologous epitope (eg, a heterologous polypeptide or a solid support material). Can be specific. For example, PCT publications WO 93/17715; WO 92/08
802; WO 91/00360; WO 92/05793; Tutt et al.
J. Immunol. 147: 60-69 (1991); U.S. Patent No. 4,474.
No. 4,893, No. 4,714,681, No. 4,925,648, No. 5,
Nos. 573,920 and 5,601,819; Kostelny et al. Im
unol. 148: 1547-1553 (1992).

The antibodies of the present invention can be described or specified in terms of the epitopes or portions of the polypeptides of the present invention that they recognize or specifically bind. The epitope or polypeptide portion may be, for example, by N-terminal and C-terminal positions.
It may be specified by size at consecutive amino acid residues, as described herein or as listed in the tables and figures. Preferred epitopes of the present invention include amino acids 65-70 and amino acids 118-124 of SEQ ID NO: 2.
And polynucleotides encoding these epitopes.
Accordingly, the present invention includes antibodies that specifically bind to a polypeptide of the present invention and allow for elimination of the polypeptide of the present invention.

The antibodies of the present invention may also be described or specified for their cross-reactivity. Book
Binds any other analog, ortholog or homolog of the polypeptide of the invention
No antibodies are included. At least 95% less than the polypeptide of the invention.
At least 90%, at least 85%, at least 80%, at least 75%, less
At least 70%, at least 65%, at least 60%, at least 55% and
At least 50% identity (methods known in the art and as described herein)
Antibodies that bind to a polypeptide having
Included in the present invention. Less than 95%, less than 90%, 8 relative to the polypeptide of the invention
Less than 5%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, 5
Less than 5% and less than 50% identity (methods known in the art and as used herein)
Antibodies that do not bind to a polypeptide having (when calculated using the described method)
The body is also included in the present invention. In certain embodiments, the cross-reactivity is
Any single specific antigenic or immunogenic polypeptide disclosed herein
Or their specific antigenicity and / or immunogens of 2, 3, 4, 5 or more
It relates to combinations of raw polypeptides. Stringent hybridization
Under conditions (as described herein) to a polynucleotide of the invention.
Binds to the polypeptide encoded by the hybridizing polynucleotide
Antibodies are further included in the present invention. The antibody of the present invention may also be a polypeptide of the present invention.
Can be described or specified for their binding affinity to Favorable knot
5 × 10^-2Less than M, 10^-2Less than M, 5 × 10^-3Less than M, 10 ^-3 Less than M, 5 × 10^-FourLess than M, 10^-FourLess than M, 5 × 10^-FiveLess than M, 10^-FiveLess than M
, 5 × 10^-6Less than M, 10^-6Less than M, 5 × 10^-7Less than M, 10^-7Less than M, 5 × 1
0^-8Less than M, 10^-8Less than M, 5 × 10^-9Less than M, 10^-9Less than M, 5 × 10^-TenM
Less than 10^-TenLess than M, 5 × 10^-11Less than M, 10^-11Less than M, 5 × 10^-12Less than M
, 10^-12Less than M, 5 × 10^-13Less than M, 10^-13Less than M, 5 × 10^-14Less than M, 1
0^-14Less than M, 5 × 10^-15Less than M or 10^-15A dissociation constant less than M or Kd
And a binding affinity having

The invention also relates to any method known in the art for determining competitive binding (
For example, as determined by the immunoassay described herein)
An antibody that competitively inhibits the binding of the antibody to the epitope of the present invention is provided. In preferred embodiments, the antibody competitively inhibits binding to the epitope by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, or at least 50%. .

The antibodies of the present invention can act as agonists or antagonists of the polypeptide of the present invention. For example, the invention includes antibodies that disrupt, either partially or completely, the interaction of the receptor / ligand with a polypeptide of the invention. Preferably, the antibodies of the present invention bind to an antigenic epitope disclosed herein or a portion thereof. The invention features both receptor-specific antibodies and ligand-specific antibodies. The invention also features receptor-specific antibodies that do not prevent ligand binding but prevent activation of the receptor. Receptor activation (ie, signal transduction) can be determined by techniques described herein, or otherwise known in the art. For example, receptor activation is determined by immunoprecipitation followed by Western blot analysis (eg, as described above) to detect receptor phosphorylation (eg, tyrosine or serine / threonine) or its substrate. obtain. In certain embodiments, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, or at least 50% ligand activity or receptor in the absence of the antibody. Antibodies that inhibit activity are provided.

The present invention also recognizes receptor-specific antibodies that interfere with both ligand binding and receptor activation, and recognizes receptor-ligand complexes, and preferably recognizes unbound receptors or unbound ligands. Characterized by antibodies that do not specifically recognize. Similarly, the present invention includes neutralizing antibodies that bind to a ligand and prevent binding of the ligand to the receptor, as well as binding to the ligand, thereby preventing receptor activation, but preventing the ligand from binding to the receptor. Not including antibodies. Also included in the invention are antibodies that activate the receptor. These antibodies can act as receptor agonists, ie, enhance or activate any or all of the biological activities of ligand-mediated receptor activation (eg, receptor dimerization). By inducing). The antibody can be specified as an agonist, antagonist or inverse agonist for a biological activity, including a specific biological activity of the peptides of the invention disclosed herein. The above antibody agonists can be made using methods known in the art. See, for example, PCT Publication WO 96/40281; U.S. Pat. No. 5,811,097; D
eng et al., Blood 92 (6): 1981-1988 (1998); Che.
n et al., Cancer Res. 58 (16): 3668-3678 (1998)
Harrop et al., J .; Immunol. 161 (4): 1786-1794 (
1998); Zhu et al., Cancer Res: 58 (15): 3209-32.
14 (1998); Yoon et al. Immunol. 160 (7): 3170
-3179 (1998); Prat et al. Cell. Sci. 111 (Pt2
): 237-247 (1998); Pitard et al. Immunol. Me
methods 205 (2): 177-190 (1997); Liauard et al., Cytokine 9 (4): 233-241 (1997); Carlson
J. et al. Biol. Chem. 272 (17): 11295-11301 (19
97); Taryman et al., Neuron 14 (4): 755-762 (19
95); Muller et al., Structure 6 (9): 1153-1167.
(1998); Bartunek et al., Cytokine 8 (1): 14-20.
(1996), all of which are incorporated herein by reference in their entirety.

The antibodies of the present invention can be used for, but not limited to, purifying, detecting and targeting polypeptides of the present invention, including, for example, both in vitro and in vivo diagnostic and therapeutic methods. Not done. For example, the antibodies have use in immunoassays for qualitatively and quantitatively measuring levels of a polypeptide of the invention in biological samples. See, for example, Harlow et al., An.
tibodies: A Laboratory Manual, (Cold S
spring Harbor Laboratory Press, 2nd edition, 19
88), which is hereby incorporated by reference in its entirety.

As discussed in more detail below, the antibodies of the invention can be used either alone or in combination with other compositions. The antibody may further be recombinantly fused at the N-terminus or C-terminus to a heterologous polypeptide, or chemically conjugated (including covalent and non-covalent) to the polypeptide or other composition. . For example, the antibodies of the invention can be recombinantly fused or conjugated to molecules and effector molecules useful as labels in detection assays, such as heterologous polypeptides, drugs, radionuclides or toxins. For example, PCT publication WO92 / 0
8495; WO 91/14438; WO 89/12624; U.S. Patent No. 5,31.
4,995; and EP 396,387.

The antibodies of the present invention may be modified (ie, covalently attached).
Attachment) includes derivatives (by covalent attachment of any type of molecule to the antibody) that do not prevent the antibody from producing an anti-idiotypic response. For example, without limitation, antibody derivatives include, for example, glycosylation, acetylation, pegylation, phosphorylation, and the like.
n), amidation, known protecting / blocking group
Antibodies that have been modified by derivatization, proteolytic cleavage, ligation to cellular ligands or other proteins, and the like. Numerous optional chemical modifications can be performed by known techniques, including but not limited to specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, and the like. Further, the derivative may contain one or more non-classical amino acids.

The antibodies of the present invention can be produced by any suitable method known in the art.
Polyclonal antibodies to an antigen of interest can be produced by various procedures well known in the art. For example, a polypeptide of the invention can be administered to a variety of host animals, including, but not limited to, rabbits, mice, rats, and the like, to induce the production of serum containing polyclonal antibodies specific for the antigen. . Various adjuvants can be used to increase the immunological response, depending on the host species, and mineral gels such as Freund (complete and incomplete), aluminum hydroxide (
mineral gel), surfactants such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions,
Keyhole limpet hemocyanin, dinitrophenol, and BCG (bacilli Calmette-Guerin) and corynebacterium parvum
Including but not limited to potentially useful human adjuvants. Such adjuvants are also well-known in the art.

[0200] Monoclonal antibodies can be prepared using a wide variety of techniques known in the art, including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof. For example, monoclonal antibodies can be produced using the following hybridoma techniques known in the art and include, for example, Harr
low et al., Antibodies: A Laboratory Manual,
(Cold Spring Harbor Laboratory Press
Hammerling et al., Monoclonal An.
tibodies and T-Cell Hybridomas 563-6
81 (Elsevier, NY 1981), the above references being incorporated by reference in their entirety. As used herein, the term "monoclonal antibody" is not limited to antibodies produced through hybridoma technology. The term "monoclonal antibody" refers to an antibody derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method derived from the method by which it was generated.

Methods for producing and screening for specific antibodies using hybridoma technology are routine and well known in the art, and are discussed in detail in the Examples (eg, Example 16). In a non-limiting example, a mouse can be immunized with a polypeptide of the invention or a cell expressing such a peptide. Once immune application is detected (eg, antigen-specific antibodies are detected in mouse serum)
The mouse spleen is collected and the spleen cells are isolated. The splenocytes are then fused by well known techniques to any suitable myeloma cells (eg, cells from cell line SP20 available from the ATCC). Hybridomas are selected and cloned by limiting dilution. Next, the hybridoma clones are assayed for cells secreting antibodies capable of binding the polypeptide of the invention by methods known in the art. Ascites fluid containing generally high levels of antibodies
) By immunizing mice with a positive hybridoma clone,
Can be produced.

Thus, the present invention provides a method of producing an antibody produced by a method comprising culturing a monoclonal antibody and a hybridoma cell secreting the antibody of the present invention, preferably The hybridoma is obtained by fusing myeloma cells with splenocytes isolated from a mouse immunized with the antigen of the present invention, and then hybridoma clones secreting antibodies capable of binding to the polypeptide of the present invention.
It is produced by screening hybridomas resulting from the fusion.

[0203] Antibody fragments that recognize a particular epitope can be generated by known techniques. For example, Fab and F (ab ') 2 fragments of the present invention comprise (Fa
It can be produced by proteolytic cleavage of immunoglobulin molecules using an enzyme such as papain (to produce the b-fragment) or pepsin (to produce the F (ab ') 2 fragment). The F (ab ') 2 fragment contains the variable region, the light chain constant region and the CH1 domain of the heavy chain.

For example, the antibodies of the present invention can also be produced using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of phage particles that carry the polynucleotide sequences that encode them. In certain embodiments, such phage can be utilized to display antigen binding domains expressed from a reper trimer or combinatorial antibody library (eg, human or mouse). Phage expressing an antigen binding domain that binds to the antigen of interest can be selected or identified using the antigen (eg, using a labeled antibody or antigen bound or captured to a solid surface or beads). The phage used in these methods is typically a phage having the antibody domain of a Fab, Fv or disulfide stabilized Fv recombinantly fused to either the phage gene III protein or the phage gene VIII protein. Filamentous phage containing fd and M13 binding domains expressed from. Examples of phage display methods that can be used to make the antibodies of the invention include the methods disclosed below: Brinkman et al. Immun
ol. Methods 182: 41-50 (1995); Ames et al. I
mmunol. Methods 184: 177-186 (1995); Ket.
treborough et al., Eur. J. Immunol. 24: 952-958
(1994); Persic et al., Gene 187 9-18 (1997); B
urton et al., Advances in Immunology 57: 191.
-280 (1994); PCT Application No. PCT / GB91 / 01134; PCT
Published WO 90/02809; WO 91/10737; WO 92/0104
7; WO 92/18619; WO 93/11236; WO 95/1598
WO 95/20401; and U.S. Patent Nos. 5,698,426; 5,223,409; 5,403,484; 5,580,717; and 5,427. No. 5,750,753; No. 5,821,0
No. 47; 5,571,698; 5,427,908; 5,51
No. 6,637; No. 5,780,225; No. 5,658,727; No. 5
Nos. 5,733,743 and 5,969,108, each of which is hereby incorporated by reference in its entirety.

As described in the above references, after phage selection, the regions encoding the phage-derived antibodies may be used to generate whole antibodies, including human antibodies, or any other desired antigen-binding fragment. Can be isolated and used, and can be expressed in any desired host, including, for example, mammalian cells, insect cells, plant cells, yeast and bacteria, as described in detail below. For example, techniques for recombinantly producing Fab, Fab ', and F (ab') 2 fragments can also be used using methods known in the art, and such methods are disclosed below. : PC
T-Publication WO 92/22324; Mullinax et al., BioTechnique.
es 12 (6): 864-869 (1992); and Sawai et al., AJR.
I 34: 26-34 (1995); and Better et al., Science.
240: 1041-1043 (1998) (these references are incorporated by reference in their entirety).

Examples of techniques that can be used to produce single-chain Fvs and antibodies include US Pat. Nos. 4,946,778 and 5,258,498; Huston.
Et al., Methods in Enzymology 203: 46-88 (19
91); Shu et al., PNAS 90: 7995-7999 (1993); and Skerra et al., Science 240: 1038-1040 (1988). For some uses, including in vivo use of antibodies in humans and in vitro detection assays, the use of chimeric, humanized or human antibodies may be preferred. A chimeric antibody is a molecule in which different portions of the antibody are derived from different animal species (eg, an antibody having a variable region derived from a mouse monoclonal antibody and a human immunoglobulin constant region). Methods for producing chimeric antibodies are known in the art. For example, Morris
on, Science 229: 1202 (1985); Oi et al., BioTec.
hniques 4: 214 (1986); Gillies et al., (1989) J.
. Immunol. Methods 125: 191-202; U.S. Pat.
Nos. 807,715; 4,816,567; and 4,816,397, which are incorporated herein by reference in their entirety.
. A humanized antibody is an antibody molecule from a non-human species antibody that binds to a desired antigen having one or more complementarity determining regions (CDRs) from a non-human species and framework regions from a human immunoglobulin molecule. . Often, framework residues within the human framework regions are replaced with corresponding residues from a CDR donor antibody to alter (preferably improve) antigen binding. These framework substitutions are identified by methods well known in the art, and include, for example, the use of Cs to identify framework residues important for antigen binding.
By modeling the interaction of DR and framework residues, and by sequence comparison to identify abnormal framework residues at specific positions. (For example,
Queen et al., U.S. Patent No. 5,585,089; Riechmann et al., Na.
332: 323 (1988), which are incorporated herein by reference in their entirety. ) Antibodies can be humanized using various techniques known in the art, including: CDR-grafting (EP 239).
PCT Publication WO 91/09967; US Patent No. 5,225,53.
9, No. 5,530,101 and 5,585,089), veneering or resurfacin.
g) (European Patents 592,106; 519,596; Padlan, M.
molecular Immunology 28 (4/5): 489-498 (
1991); Studnicka et al., Protein Engineerin.
g 7 (6): 805-814 (1994); Roguska et al., PNAS 9
1: 969-973 (1994)), and chain shuffling (chai).
n shuffling) (U.S. Patent No. 5,565,332).

[0207] Fully human antibodies are particularly desirable for therapeutic treatment of human patients. Human antibodies can be produced by various methods known in the art, including the phage display method described above using an antibody library derived from human immunoglobulin sequences. U.S. Pat. Nos. 4,444,887 and 4,716,111; and PCT Publication W
O 98/46645, WO 98/50433, WO 98/24893, W
See also O 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741; each of which is incorporated herein by reference in its entirety.

[0208] Human antibodies can also be produced using transgenic mice, which are unable to express functional endogenous immunoglobulin, but are capable of expressing human immunoglobulin genes. For example, a complex of a human heavy chain immunoglobulin gene and a human light chain immunoglobulin gene can be introduced randomly or by homologous recombination into mouse embryonic stem cells. Alternatively, the human variable region, constant region, and diversity region (diversity)
region) can be introduced into mouse embryonic stem cells in addition to the human heavy and light chain genes. The mouse heavy and light immunoglobulin genes can be rendered non-functional separately or simultaneously with the introduction of a human immunoglobulin locus by homologous recombination. In particular, homozygous deletion of the JH region prevents endogenous antibody production. The modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice. The chimeric mice are then bred to produce homozygous offspring that express human antibodies. The transgenic mouse is treated with a selected antigen (eg, all or a portion of a polypeptide of the invention).
For immunization in the usual manner. Monoclonal antibodies directed against the antigen can be obtained from the immunized transgenic mice using conventional hybridoma technology.
The human immunoglobulin transgenes retained in the transgenic mice rearrange during B cell differentiation, and subsequently undergo class switching and somatic mutation. Thus, by using such techniques, therapeutically useful IgG antibodies,
It is possible to produce IgA, IgM and IgE antibodies. For an overview of this technology for producing human antibodies, see Lonberg and Huszar, I.
nt. Rev .. Immunol. 13: 65-93 (1995).
For a detailed discussion of this technology for producing human and human monoclonal antibodies, as well as protocols for producing such antibodies, see, e.g.,
PCT Publication WO98 / 24893; WO92 / 01047; WO96 / 3409
6; WO 96/33735; EP 0 598 877; US Pat.
13,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,885,793; 5,916,7
No. 71; and 5,939,598, which are incorporated herein by reference in their entirety. Further, Abgenix, Inc. (Fr
Companies such as EEmont, CA) and Genpharm, San Jose, CA can engage in providing human antibodies to selected antigens using techniques similar to those described above.

Human antibodies that fully recognize the selected epitope were identified as “guided (gui
ded) selection ". In this approach,
Selected non-human monoclonal antibodies (eg, mouse antibodies) are used to guide the selection of human antibodies that fully recognize the same epitope. (Jespers
Et al., Bio / technology 12: 899-903 (1988)).

In addition, antibodies to the polypeptides of the invention may in turn be utilized to generate anti-idiotype antibodies that "mimic" the polypeptides of the invention using techniques well known to those of skill in the art. (Eg, Greenspan and Bona, FASEB
J. 7 (5): 437-444; (1989) and Nissinoff, J.
. Immunol. 147 (8): 2429-2438 (1991). E.g., bind and multimerize polypeptides
) and / or antibodies that competitively inhibit the binding of the polypeptide of the invention to its ligand are used to produce anti-idiotypes that "mimic" the multimerization and / or binding domains of the polypeptide. And thus binds and neutralizes the polypeptide and / or its ligand.
Neutralization of such anti-idiotypes or Fab fragments of such anti-idiotypes can be used in therapeutic regimens to neutralize polypeptide ligand. For example, such anti-idiotype antibodies can be used to bind a polypeptide of the invention and / or to bind its ligand / receptor, thereby blocking its biological activity.

The polypeptides of the invention and fragments, variants, derivatives or analogs thereof, or cells expressing them, also serve as immunogens for producing antibodies immunospecific for the galectin-11 polypeptides of the invention. Can be used. the term"
"Immunospecific" means that the antibodies have a substantially greater affinity for the polypeptides of the present invention than their affinity for other related polypeptides of the prior art.

As used herein, the term “antibody” (Ab) or “monoclonal antibody”
(MAb) is meant to include intact molecules and fragments thereof (eg, Fab and F (ab ′) ₂ fragments) that can bind antigen. Fab, Fab ′, and F (ab ′) ₂ fragments lack the Fc fragment of intact antibody more rapidly from the circulation and may have smaller non-specific tissue binding of the intact antibody (Wahl et al. J. Nucl.Med.2
4: 316-325 (1983)).

[0213] Antibodies according to the present invention can be prepared by any of a variety of standard methods using the galectin-11 immunogens of the present invention. For example, antibodies raised against the full-length galectin-11 polypeptide can be used to convert fragments, variants, derivatives, analogs, or cells bearing the polypeptide or epitope into mammals (preferably, non-human) using conventional protocols. And can be obtained by administration. For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. As an example, the hybridoma technology (Kohl
er et al., Nature 256: 495-497 (1975)), trioma technology, human B cell hybridoma technology (Kozbor et al., Immunology T).
day 4:72 (1983)) and EBV-hybridoma technology (Col.
e, MONOCLONAL ANTIBODIES AND CANCER
THERAPY, pp. 77-96; Lis, Inc. , 1985
). In addition, techniques for the production of single chain antibodies (US Pat. No. 4,946,946)
, 778) can also be adapted to produce single-chain antibodies to the polypeptides of the invention. In addition, transgenic mice or other organisms, including other mammals, can be used to express humanized antibodies.

Antibodies of the present invention can be obtained by methods known in the art for localizing and activity of a polypeptide sequence of the present invention (eg, methods for imaging these polypeptides, in suitable physiological samples). Methods for measuring their level, etc.). Antibodies also have immunoassay and therapeutic uses as agonists and antagonists of galectin-11. Further, the antibodies of the invention can be used to isolate or identify clones expressing the polypeptide, or to purify the polypeptide by affinity chromatography.

(Polynucleotide encoding antibody) The present invention further provides a polynucleotide comprising a nucleotide sequence encoding the antibody of the present invention and a fragment thereof. The present invention also provides antibodies (preferably as specifically defined above) under stringent or lower stringency hybridization conditions (preferably, which specifically bind to a polypeptide of the present invention, preferably , An antibody that binds to a polypeptide having the amino acid sequence of SEQ ID NO: 2).

[0216] A polynucleotide can be obtained by any method known in the art, and the nucleotide sequence of the polynucleotide is determined. For example, if the nucleotide sequence of the antibody is known, the polynucleotide encoding the antibody can be constructed from chemically synthesized oligonucleotides (eg, Kutmeier).
Et al., BioTechniques 17: 242 (1994)), which briefly comprises the following steps: synthesis of overlapping oligonucleotides containing portions of the sequence encoding this antibody; Annealing and ligation of these oligonucleotides, followed by amplification of the ligated oligonucleotides by PCR.

Alternatively, a polynucleotide encoding an antibody can be produced from nucleic acid from a suitable source. If no clone is available containing the nucleic acid encoding the particular antibody, but the sequence of the antibody molecule is known, the nucleic acid encoding the immunoglobulin can be chemically synthesized or obtained from a suitable source ( For example, an antibody cDNA library, or a cDNA library generated from any tissue or cell that expresses the antibody (eg, a hybridoma cell selected for expression of an antibody of the invention), or a nucleic acid isolated therefrom (Preferably poly A + RNA)), for example, to identify a cDNA clone from a cDNA library encoding the antibody, using PCR amplification using synthetic primers capable of hybridizing to the 3 'and 5' ends of the sequence. Or use oligonucleotide probes specific for a particular gene sequence. It may be obtained by cloning. P
The amplified nucleic acid generated by the CR can then be cloned into a replicable cloning vector using any method known in the art.

Once the nucleotide sequence and the corresponding amino acid sequence of the antibody have been determined,
The nucleotide sequence of an antibody can be determined by methods known in the art for manipulating nucleotide sequences (eg, recombinant DNA technology, site-directed mutagenesis, PCR, etc. (eg,
Sambrook et al., 1990, Molecular Cloning, AL.
laboratory Manual, 2nd edition, Cold Spring Har
bor Laboratory, Cold Spring Harbor, NY
And Ausubel et al., Eds. 1998, Current Protocols.
in Molecular Biology, John Wiley & Sons
, NY. These are both incorporated herein by reference in their entirety. )) Can be used to generate antibodies with different amino acid sequences to make, for example, amino acid substitutions, deletions, and / or insertions.

In certain embodiments, the amino acid sequences of the variable domains of the heavy and / or light chains are identified by methods well known in the art for identification of complementarity determining region (CDR) sequences (eg, sequences Other heavy chains, to determine the region of hypervariability,
And by comparing the variable region of the light chain with the known amino acid sequence). Using conventional recombinant DNA techniques, one or more CDRs can be inserted into a framework region as described above (eg, into a human framework region to humanize a non-human antibody). . The framework region can be naturally occurring or a consensus framework region, and can preferably be a human framework region (eg, for the listed human framework regions, see Chothia et al., J. Mol. Biol.278: 457-479 (1
998)). Preferably, the polynucleotide generated by the combination of the framework regions and the CDRs encodes an antibody that specifically binds a polypeptide of the invention. Preferably, as discussed above, one or more amino acid substitutions can be made within the framework regions, and preferably, the amino acid substitutions improve the binding of the antibody to its antigen. Further, such methods can produce antibody molecules that lack one or more intrachain disulfide bonds,
It can be used to make amino acid substitutions or deletions of cysteine residues in one or more of the variable regions involved in intrachain disulfide bonds. Other changes to polynucleotides are encompassed by the present invention and in the art.

Furthermore, by splicing genes from mouse antibody molecules of appropriate antigen specificity with genes from human antibody molecules of appropriate biological activity,
Techniques developed to produce "chimeric antibodies" (Morrison et al., Proc
. Natl. Acad. Sci. 81: 851-855 (1984); Neub.
Erger et al., Nature 312: 604-608 (1984); Take.
Da et al., Nature 314: 452-454 (1985)). As noted above, a chimeric antibody is a molecule in which different portions are derived from different animal species, such molecules having variable regions derived from the constant regions of mouse mAbs and human immunoglobulins (eg, humanized antibodies). .

Alternatively, the techniques described for the production of single chain antibodies (US Pat. No. 4,946,946)
No. 778; Bird, Science 242: 423-42 (1988); H
Uston et al., Proc. Natl. Acad. Sci. USA 85: 587
9-5883 (1988); and Ward et al., Nature 334: 544.
-54 (1989)) may be adapted for the production of single chain antibodies. Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide. E. FIG. Techniques for the assembly of functional Fv fragments in E. coli can also be used (Sk
erra et al., Science 242: 1038-1041 (1988)).

Methods for Producing Antibodies The antibodies of the present invention can be produced by any method known in the art for synthesizing antibodies, particularly by chemical synthesis, or preferably, by recombinant expression techniques. obtain.

The antibodies of the present invention, or fragments, derivatives or analogs thereof (eg,
Recombinant expression of a heavy or light chain of an antibody of the invention or a single chain antibody of the invention) requires the construction of an expression vector containing a polynucleotide encoding the antibody. Once a polynucleotide encoding the antibody molecule or antibody heavy or light chain, or portions thereof, (preferably containing the heavy or light chain variable domains) of the invention is obtained, the production of the antibody molecule is Can be produced by recombinant DNA technology using techniques well known in the art. Accordingly, methods for preparing a protein by expression of a polynucleotide containing a nucleotide sequence encoding an antibody are described herein. Methods well known to those skilled in the art can be used for the construction of expression vectors containing antibody-encoding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Accordingly, the present invention provides a replicable vector comprising a nucleotide sequence encoding an antibody molecule of the present invention, or a heavy or light chain thereof, or a variable domain of a heavy or light chain, operably linked to a promoter. I will provide a.
Such vectors contain the constant region of the antibody molecule (eg, PCT Publication WO86 /
05807; PCT Publication WO 89/01036; and US Pat. No. 5,122.
, 464), and the variable domains of the antibody can be cloned into such a vector for expression of the entire heavy or light chain.

The expression vector is transferred to a host cell by conventional techniques, and the transfected cells are then cultured by conventional techniques to produce an antibody of the present invention. Accordingly, the invention includes host cells comprising a polynucleotide encoding an antibody of the invention, or a heavy or light chain thereof, or a single chain antibody of the invention, operably linked to a heterologous promoter. In a preferred embodiment for expression of a double-chain antibody, the vector encoding both the heavy and light chains is co-expressed in a host cell for expression of the entire immunoglobulin molecule, as detailed below. Can be done.

[0225] A variety of host expression vector systems can be utilized to express the antibody molecules of the present invention. Such host expression systems represent vehicles in which the coding sequence of interest can be produced and subsequently purified, but also can be used in situ when transformed or transfected with sequences encoding the appropriate nucleotides. 1 represents a cell capable of expressing the antibody molecule of the invention. These include bacteria (eg, E. coli, B. subtilis) transformed with a recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vector containing the sequence encoding the antibody.
Such as microorganisms; yeast transformed with a recombinant yeast expression vector containing a sequence encoding an antibody (eg, Saccharomyces, Pichia); and a recombinant virus expression vector containing a sequence encoding an antibody (eg, baculovirus). Infected insect cell lines; plant cell lines infected with a recombinant viral expression vector (eg, cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or a recombinant plasmid expression vector containing a sequence encoding an antibody (eg, a Ti plasmid ); Or a promoter derived from the genome of a mammalian cell (eg, the metallothionein promoter) or a promoter derived from a mammalian virus (eg, the adenovirus late promoter; A virus 7.5K promoter) mammalian cell systems harboring recombinant expression constructs containing (e.g., COS, CHO, BHK, 293,3T
3 cells). Preferably, Escheri
Bacterial cells such as chia coli, and more preferably, eukaryotic cells, particularly for the expression of whole recombinant antibody molecules, are used for expression of recombinant antibody molecules. For example, mammalian cells, such as Chinese hamster ovary cells (CHO), combined with vectors, such as the major intermediate early gene promoter element from human cytomegalovirus, are effective expression systems for antibodies. (Foecking et al., Gene 45: 101 (1986); Cocket
et al., Bio / Technology 8: 2 (1990)).

In bacterial systems, a number of expression vectors may be advantageously selected depending upon the use intended for the expression of the antibody molecule. For example, if large quantities of such a protein are to be produced, a vector that directs high-level expression of a fusion protein product that is easily purified may be desirable for the production of a pharmaceutical composition of the antibody molecule. In such a vector, the sequence encoding the antibody can be individually linked in frame with the vector along with the region encoding lacZ, resulting in the production of a fusion protein.
. coli expression vector pUR278 (Ruther et al., EMBO J. 2: 1).
791 (1983)); pIN vector (Inouye & Inouye, Nuc)
leic Acids Res. 13: 3101-3109 (1985); Va
n Heake & Schuster, J.A. Biol. Chem. 24: 5503
-5509 (1989)), but are not limited thereto. pGE
The X vector can also be used as a fusion protein with glutathione S-transferase (GST) to express foreign polypeptides. Generally, such fusion proteins are soluble and can be readily purified from lysed cells by adsorption and binding to matrix glutathione-agarose beads, followed by elution in the presence of free glutathione. The pGEX vector is designed to include a thrombin or factor Xa protease cleavage site so that the cloned target gene product can be released from the GST moiety.

In an insect system, Autographa californica nuclear polynucleosis virus (Aut)
ograph californica nuclear polyhedr
Osis virus (AcNPV) is used as a vector for expressing a foreign gene. The virus is Spodoptera frugi
Proliferate in perda cells. Sequences encoding this antibody can be individually cloned into non-essential regions of the virus, such as the polyhedrin gene, and Ac
It can be placed under the control of an NPV promoter (eg, a polyhedrin promoter).

In mammalian host cells, a number of viral-based expression systems may be utilized. If an adenovirus is used as the expression vector, the sequence of interest encoding the antibody may be ligated to an adenovirus transcription / translation control complex (eg, the late promoter and tripartite leader sequence). This chimeric gene can then be inserted into the adenovirus genome by in vitro or in vivo recombination. Insertion into a non-essential region of the viral genome (eg, region E1 or E3) results in a recombinant virus that survives in the infected host and can express the antibody molecule. (Eg, Logan & Shenk, Proc. Natl. Ac
ad. Sci. ScL USA 81: 355-359 (1984)). Certain initiation signals may also be required for efficient translation of the inserted antibody-encoding sequence. These signals include the ATG start codon and adjacent sequences. In addition, this initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be increased by including appropriate transcription enhancer elements, transcription terminators, etc. (Bitt
ner et al., Methods in Enzymol. 153: 51-544 (1
987)).

In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (eg, glycosylation) and processing (eg, cleavage) of protein products may be important for the function of the protein. Different host cells have characteristic and unique mechanisms for the post-translational processing and modification of protein and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells that have the cellular machinery for proper processing of the primary transcript, glycosylation of the gene product, and phosphorylation can be used. Such mammalian host cells include CHO, VERY, BHK, Hela, COS, M
DCK, 293, 3T3, WI38, and especially breast cancer cell lines (eg, BT
483, Hs578T, HTB2, BT20 and T47D) and normal mammary gland cell lines (such as CRL7030 and Hs578Bst).

For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines that stably express the antibody molecule can be engineered. Rather than using an expression vector that contains the viral origin of replication, the host cell may have appropriate expression control elements (such as
For example, promoters, enhancers, sequences, transcription terminators, polyadenylation sites, etc.), and DNA controlled by selectable markers. Following the introduction of the foreign DNA, the engineered cells can be allowed to grow for 1-2 days in an enriched media, and are then switched to a selective media. The selectable marker on the recombinant plasmid confers resistance to selection, and the cell stably integrates the plasmid into its chromosome and proliferates to form cell foci,
This in turn allows it to be cloned and expanded into cell lines. This method can be advantageously used to engineer cell lines that express the antibody molecule. Such engineered cell lines may be particularly useful in screening and evaluating compounds that interact directly or indirectly with the antibody molecule.

A number of selection systems can be used, including herpes simplex virus thymidine kinase (Wigler et al., Cell 11: 223 (1977)), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Sz).
ybalski, Proc. Natl. Acad. Sci. USA 48:20
2 (1992)), and adenine phosphoribosyltransferase (Low)
y et al., Cell 22: 817 (1980)), which can be used in tk-, hgprt- or aprt- cells, respectively. Also, antimetabolite resistance can be used as a basis for selection of the following genes: dhfr, which confers resistance to methotrexate (Wig
ler et al., Natl. Acad. Sci. USA 77: 357 (1980);
O'Hare et al., Proc. Natl. Acad. Sci. USA 78:15
27 (1981)); gpt, which confers resistance to mycophenolic acid (
Mulligan & Berg, Proc. Natl. Acad. Sci. USA
78: 2072 (1981)); neo, which is an aminoglycoside G-418.
(Clinical Pharmacy 12: 488-
505; Wu and Wu, Biotherapy 3: 87-95 (199
1); Tolstoshev, Ann. Rev .. Pharmacol. Toxi
col. 32: 573-596 (1993); Mulligan, Science.
e 260: 926-932 (1993); and Morgan and And.
erson, Ann. Rev .. Biochem. 62: 191-217 (199
3); May 1993, TIB TECH 11 (5): 155-215); and hygro, which confers resistance to hygromycin (Sante)
rre et al., Gene 30: 147 (1984)). Methods well known in the art of recombinant DNA technology can be routinely applied to select a desired recombinant clone,
And such methods are described below: for example, Ausubel et al. (
Ed.), Current Protocols in Molecular Bi
, John Wiley & Sons, NY (1993); Krieg.
ler, Gene Transfer and Expression, AL
laboratory Manual, Stockton Press, NY (1
990); and chapters 12 and 13, Dracopoli et al. (Eds.), Cur.
rent Protocols in Human Genetics, Joh
n Wiley & Sons, NY (1994); Colverre-Graph.
in et al. Mol. Biol. 150: 1 (1981), which are hereby incorporated by reference in their entirety.

The expression level of an antibody molecule can be increased by vector amplification (for review, see
Bebbington and Hentschel, The use of ve
ctors based on gene amplification fo
r the expression of cloned genes in
mammarian cells in DNA cloning, vol. 3 (A
Cademic Press, New York, 1987).
If the marker in the vector system expressing the antibody is amplifiable, an increase in the level of inhibitor present in the culture of the host cell will increase the number of copies of the marker gene. Since the amplification region is linked to the antibody gene, production of the antibody also increases (Crouse et al., Mol. Cell. Biol. 3: 257 (19
83)).

Host cells can be co-transfected with two expression vectors of the invention, a first vector encoding a polypeptide derived from the heavy chain and a second vector encoding a polypeptide derived from the light chain. . The two vectors may contain the same selectable marker that allows for equal expression of the heavy and light chain polypeptides. Alternatively, a single vector can be used, which can encode and express both heavy and light chain polypeptides. In such situations, the light chain should be placed before the heavy chain in order to avoid excessive toxic free heavy chains (Prodfoot, Nature 322: 52 (1986); Ko).
hler, Proc. Natl. Acad. Sci. USA 77: 2197 (
1980)). The coding sequence for the heavy and light chains can be cDNA or genomic DN
A.

Once an antibody molecule of the present invention is produced by an animal, chemically synthesized, or recombinantly expressed, any of the methods known in the art for the purification of immunoglobulin molecules are available. Methods, for example, chromatography (eg, ion exchange,
Affinity (especially due to affinity for specific antigens after protein A)
And size column chromatography), centrifugation, solubility differences, or any other standard technique for protein purification. further,
The antibodies of the invention or fragments thereof can be fused to a heterologous polypeptide sequence as described herein or otherwise known in the art, to facilitate purification.

The present invention relates to a polypeptide of the invention (or a part thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90,
Or 100 amino acids), which are recombinantly fused or chemically linked (including both covalent and non-covalent bonds) to produce a fusion protein. This fusion need not be direct, but can occur via a linker sequence. The antibody may comprise a polypeptide of the invention (or a portion thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 8 of the polypeptide).
(0, 90, or 100 amino acids). For example, by fusing or binding a polypeptide of the invention to an antibody specific for a particular cell surface receptor, either in vitro or in vivo, to target the polypeptide of the invention to a particular cell type Antibodies can be used to Antibodies fused or conjugated to the polypeptides of the present invention can also be used in in vitro immunoassays and purification methods using methods known in the art. See, for example, Harbor et al., Supra, and PCT Publication WO 93/212.
32; EP 439,095; Naramura et al., Immunol. Lett.
39: 91-99 (1994); U.S. Patent No. 5,474,981; Gilli.
es et al., PNAS 89: 1428-1432 (1992); Fell et al.
Immunol. 146: 2446-2452 (1991). These are incorporated by reference in their entirety.

The present invention further includes compositions comprising a polypeptide of the present invention fused or conjugated to a domain other than the variable region of the antibody. For example, a polypeptide of the invention can be fused or conjugated to the Fc region of an antibody, or a portion thereof. The portion of this antibody fused to the polypeptide of the invention comprises the constant region, hinge region, CH1 domain, C
It may include the H2 domain, and the CH3 domain, or any combination of all or part of the domain. These polypeptides can also be fused or conjugated to portions of the above antibodies to form multimers. For example, an Fc portion fused to a polypeptide of the invention can form a dimer through disulfide bonds between the Fc portions. Higher multimeric forms can be made by fusing the polypeptide to portions of IgA and IgM. Methods for fusing or binding the polypeptides of the present invention to an antibody moiety are known in the art. For example, U.S. Patent Nos. 5,336,603; 5,622,929; 5,359,04.
No. 6, No. 5,349,053; No. 5,447, 851; No. 5,112
, No. 946; EP 307, 434; EP 367, 166; PCT Publication WO9
6/04388; WO91 / 06570; Ashkenazi et al., Proc. N
atl. Acad. Sci. USA 88: 10535-10538 (1991)
); Zheng et al. Immunol. 154: 5590-5600 (199
5); and Vil et al., Proc. Natl. Acad. Sci. USA 89
: 11337-11341 (1992), which is incorporated by reference in its entirety.

As discussed above, the polypeptide corresponding to the polypeptide, polypeptide fragment, or variant of SEQ ID NO: 2 may be used to increase the in vivo half-life of the polypeptide, or The antibodies can be fused or conjugated to the antibody portions described above for use in immunological assays using methods known in the art.
In addition, a polypeptide corresponding to SEQ ID NO: 2, 25, or 27 may be fused or conjugated to the antibody portion described above to facilitate purification. One reported example describes a chimeric protein consisting of the first two domains of a human CD4 polypeptide and various domains of the constant regions of the heavy or light chains of a mammalian immunoglobulin (EP 394). , 827; Traunecker et al., Nature.
e 331: 84-86 (1988)). Disulfide-linked dimer structure (IgG
The polypeptides of the present invention, which are fused or conjugated to an antibody having (due to) are also more efficient at binding and neutralizing other molecules than monomeric secreted proteins or protein fragments alone. (Funtoulak)
is et al. Biochem. 270: 3958-3964 (1995)). Often, the Fc portion of the fusion protein is beneficial in therapy and diagnostics,
Thus, for example, it may result in improved pharmacokinetic properties (EP A 232
, 262). Alternatively, it may be desirable to delete the Fc portion after the fusion protein has been expressed, detected, and purified. For example, if the fusion protein is used as an antigen for immunization, the Fc portion can interfere with therapy and diagnosis. For example, in drug discovery, human proteins such as hIL-5
Fc portions have been fused for the purpose of high-throughput screening assays to identify antagonists of L-5 (Bennett et al., J. Mole.
color Recognition 8: 52-58 (1995); Joha
nson et al. Biol. Chem. 270: 9449-9471 (1995)
)checking).

Further, the antibodies or fragments thereof of the present invention can be fused to a marker sequence, such as a peptide that facilitates purification. In a preferred embodiment, the marker amino acid sequence is a hexa-histidine peptide, such as a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chats).
tags provided in worth, CA, 91311), and many of these marker amino acid sequences are commercially available. For example, Gentz et al., Proc.
. Natl. Acad. Sci. USA 86: 821-824 (1989), hexa-histidine provides for convenient purification of the fusion protein. Other peptide tags useful for purification include the “HA” tag corresponding to an epitope from the influenza hemagglutinin protein (Wilson et al., Ce.
11 37: 767 (1984)), and the "flag" tag.

The present invention relates to an antibody or fragment thereof, conjugated to a diagnostic or therapeutic agent.
Further included. Antibodies can be used, for example, in clinical testing procedures (eg,
As part of the development of tumors (to determine the efficacy of
Can be used diagnostically to monitor progress. Detection can detect antibodies
Can be facilitated by linking with other materials. Examples of detectable substances include
, Various enzymes, prosthetic groups, fluorescent substances, luminescent substances, bioluminescent substances, radioactive substances,
Positron emitting metal and non-radioactive paramagnetic gold using various positron emission tomography
Genus ions. The detectable substance is an antibody (or its fragment).
Media), either directly to the agent or using techniques known in the art.
Linking, either indirectly, via a linker known in the art, for example).
Or conjugated. For example, antibodies for use as diagnostics according to the present invention
No. 4,741,900 for metal ions that can be conjugated to
See also. Examples of suitable enzymes include horseradish peroxidase, alkaline
Phosphatase, β-galactosidase, or acetylcholinesterase
Examples of suitable prosthetic group complexes include streptavidin / bioti
And avidin / biotin; examples of suitable fluorescent materials include
Riferon, fluorescein, fluorescein isothiocyanate, rhodamine
, Dichlorotriazinylamine fluorescein, dansyl chloride or phyco
Erythrin; examples of luminescent materials include luminol;
Examples of light substances include luciferase, luciferin and aequorin.
And examples of suitable radioactive materials include radioisotopes (eg, iodine
(¹³¹I,¹²⁵I,^{one two Three}I,¹²¹I), carbon (¹⁴C), sulfur (³⁵S), tritium ( ^Three H), indium (^115mIn,^113mIn,¹¹²In,¹¹¹In) and Techne
Titanium (⁹⁹Tc,^99mTc), thallium (²⁰¹Ti), gallium (⁶⁸Ga,⁶⁷Ga
),palladium(¹⁰³Pd), molybdenum (⁹⁹Mo), xenon (¹³³Xe)
(¹⁸F),¹⁵³Sm,¹⁷⁷Lu,¹⁵⁹Gd,¹⁴⁹Pm,¹⁴⁰La,¹⁷⁵Yb,¹⁶⁶
Ho,⁹⁰Y,⁴⁷Sc,¹⁸⁶Re,¹⁸⁸Re,¹⁴²Pr,¹⁰⁵Rh,⁹⁷Ru)
It is.

Further, the antibody or fragment thereof may be a therapeutic moiety (eg, a cytotoxin (eg, a cytostatic or cytocidal agent)), a therapeutic agent, or a radiometal ion (eg, an α-emitter (eg, 213Bi)). Etc.). Cytotoxic or cytotoxic agents include any agents that are harmful to cells. Examples include paclitaxol, cytochalasin B, gramicidin D, ethidium bromide, emetin, mitomycin, etoposide, teniposide (t
enoposide), vincristine, vinblastine, colchicine (col)
chicin), doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mitramycin, actinomycin D, 1-dehydrotestosterone,
Glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin, and analogs or homologs thereof. Therapeutic agents include antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine (5
-Fluorouracil decarbazine, alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclophosphamide (cyclothospamide), busulfan, myptominositol, dibromotositol, dibromotositol, dibromostomitol And cis-dichlorodiamineplatinum (II) (DDP) cisplatin), anthracyclines (eg, daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (eg, dactinomycin (formerly actinomycin), bleomycin, mitramycin, And anthramycin (AMC)),
And anti-mitotic agents (eg, vincristine and vinblastine).

The conjugates of the present invention can be used to modify a given biological response, and the therapeutic or drug moiety is not to be construed as limited to classical chemotherapeutic agents. For example, the drug moiety can be a protein or polypeptide having the desired biological activity. Such proteins include, for example, toxins (eg, abrin, ricin A, Pseudomonas exotoxin, or diphtheria toxin); proteins (eg,
Tumor necrosis factor, a-interferon, β-interferon, nerve growth factor,
Platelet-derived growth factor, tissue plasminogen activator, apoptotic agent (eg, TNF-α, TNF-β, AIM I (International Publication WO 97/338)
No. 99), AIM II (see WO 97/34911), Fas ligand (Takahashi et al., Int. Immunol).
. 6: 1567-1574 (1994)), VEGI (International Publication No. WO 99/2).
No. 3105)), thrombotic or anti-angiogenic agents (eg, angiostatin or endostatin); or biological response modifiers (eg, lymphokines, interleukin-1 (“IL-1”)) , Interleukin-2 ("
IL-2 "), interleukin-6 (" IL-6 "), granulocyte macrophage colony stimulating factor (" GM-CSF "), granulocyte colony stimulating factor (" G-CS
F "), or other growth factors).

Antibodies can also be attached to a solid support, which is particularly useful for immunoassays or purification of the target antigen. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.

Techniques for conjugating such therapeutic moieties to antibodies are well known and include, for example, Arn
on et al., Monoclonal Antibodies For Immun.
targeting Of Drugs In Cancer Therap
y "Monoclonal Antibodies And Cancer T
Herapy, Reisfeld et al. (eds.), pages 243-56 (Alan RL).
iss, Inc. 1985); Hellstrom et al., "Antibodies.
For Drug Delivery "Controlled Drug D
elivery (2nd edition), Robinson et al. (eds.), pp. 623-53 (Ma
rcel Dekker, Inc. 1987); Thorpe, "Antibo
dy Carriers Of Cytotoxic Agents In C
ancer Therapy: A Review ”Monoclonal An
tibodies'84: Biological And Clinical
Applications, Pinchera et al. (Eds.), Pages 475-506 (1
985); “Analysis, Results, And Future Pr.
Ospective Of The Therapeutic Use Of
Radiolabeled Antibody In Cancer Ther
apy "Monoclonal Antibodies For Cancer
Detection And Therapy, Baldwin et al. (Eds.), 3
03-16 (Academic Press 1985), and Thorp.
e, et al., "The Preparation And Cytotoxic Pr.
operations Of Antibody-Toxin Conjugate
s ", Immunol. Rev .. 62: 119-58 (1982).

Alternatively, the antibody is conjugated to a second antibody and is described in US Pat. No. 4,676,980 (
This can form an antibody heteroconjugate as described by Segal in its entirety, which is incorporated herein by reference.

Antibodies with or without a therapeutic moiety that binds to the antibody, administered alone or in combination with cytotoxic factors and / or cytokines, can be used as therapeutics.

Immunophenotyping The antibodies of the present invention can be utilized for immunophenotyping cell lines and biological samples. The translation products of the genes of the invention are useful as cell-specific markers or, more specifically, as cell markers that are differentially expressed at various stages of differentiation and / or maturation of a particular cell type. obtain. Monoclonal antibodies directed against specific epitopes, or combinations of epitopes, allow for the screening of cell populations expressing the marker. A variety of techniques can be employed with monoclonal antibodies to screen for cell populations that express the marker, including magnetic separation using magnetic beads coated with the antibody, solid matrices (ie, "Panning" using antibodies attached to plates), and flow cytometry (see, e.g., U.S. Patent No. 5,985,660; and Morrison et al., Cell, 96: 737-49 (1999)). Can be

[0247] These techniques are useful for hematological malignancies (ie, minimal residual disease (MRD) in patients with acute leukemia).
And screening of specific populations of cells as can be found with "non-self" cells in transplantation to prevent graft versus host disease (GVHD). Alternatively, these techniques allow for the screening of hematopoietic stem and progenitor cells that can undergo proliferation and / or differentiation as can be found in human umbilical cord blood.

Assays for Antibody Binding Antibodies of the invention can be assayed for immunospecific binding by any method known in the art. Immunoassays that can be used include Western blots, radioimmunoassays,
ELISA (enzyme-linked immunosorbent assay), "sandwich" immunoassay, immunoprecipitation assay, sedimentation reaction, gel diffusion sedimentation reaction, immunodiffusion assay, agglutination assay, complement binding assay, immunoradiometric assay, fluorescent immunoassay, protein A Examples include, but are not limited to, competitive and non-competitive assay systems that use techniques such as immunoassays. Such assays are conventional and well known in the art (eg, Ausubel et al., Eds., 1994, Current Protocol, which is incorporated by reference herein in its entirety).
ls in Molecular Biology, Volume 1, John Wil
eye & Sons, Inc. , New York). Exemplary immunoassays are briefly described below (although these are not intended to be limiting).

The immunoprecipitation protocol generally involves a RIPA buffer (1% NP-40 or Triton X-100, 1% NP-40 or Triton X-100, supplemented with a protein phosphatase inhibitor and / or a protease inhibitor (eg, EDTA, PMSF, aprotinin, sodium vanadate)). % Sodium deoxycholate, 0.1%
SDS, 0.15 M NaCl, 0.01 M sodium phosphate (pH 7.2)
) Lysing a population of cells in a lysis buffer such as 1% Trasylol, adding the antibody of interest to the cell lysate, and incubating at 4 ° C. for a certain period of time (eg, 1-4 hours). Adding protein A sepharose beads and / or protein G sepharose beads to the cell lysate, incubating at 4 ° C. for about 1 hour or more, washing the beads in lysis buffer, and SDS / sample buffer Resuspending the beads in the solution. The ability of the antibody of interest to immunoprecipitate a particular antigen, for example, by Western blot analysis,
Can be evaluated. One of skill in the art will be aware of parameters that can be modified to increase the binding of the antibody to the antigen and reduce the background (eg, pre-clearing cell lysate using Sepharose beads). obtain.
For further discussion on immunoprecipitation protocols, see, for example, Ausubel
Ed., 1994, Current Protocols in Molecul.
ar Biology, Volume 1, John Wiley & Sons, Inc. ,
See New York, 10.16.1.

Western blot analysis generally involves the steps of preparing a protein sample, a polyacrylamide gel (eg, 8% -20% SDS-depending on the molecular weight of the antigen).
Electrophoresis of the protein sample in PAGE), transferring the protein sample from the polyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon, a blocking solution (eg, PBS with 3% BSA or skim milk powder) Blocking the membrane in a washing buffer (eg, PB
Washing the membrane in S-Tween 20), blocking the membrane with a primary antibody (antibody of interest) diluted in blocking buffer, washing the membrane in washing buffer A secondary antibody (recognizing the primary antibody, eg, recognizing the primary antibody, conjugated to an enzyme substrate (eg, horseradish peroxidase or alkaline phosphatase) or a radioactive molecule (eg, ³² P or ¹²⁵ I) diluted in blocking buffer , Anti-human antibody), washing the membrane in a wash buffer, and detecting the presence of the antigen. One of skill in the art will be aware of parameters that can be modified to increase the signal detected and reduce background noise.
For further discussion on Western blot protocols, see, for example, Au
Ed. subel et al., 1994, Current Protocols in Mo.
Lectural Biology, Volume 1, John Wiley & Sons,
Inc. , New York, 10.8.1.

ELISA comprises preparing an antigen, coating the wells of a 96-well microtiter plate with the antigen, conjugate to a detectable compound such as an enzyme substrate (eg, horseradish peroxidase or alkaline phosphatase). Adding the antibody of interest to the wells and incubating for a certain period of time, and detecting the presence of the antigen. In an ELISA, the antibody of interest need not be conjugated to the detectable compound; instead, a second antibody conjugated to the detectable compound (recognizing the antibody of interest) is added to the well. It can be added. Further, instead of coating the well with the antigen, the antibody can be coated on the well. In this case, a second antibody conjugated to a detectable compound can be added following addition of the antigen of interest to the coated wells. One skilled in the art will be aware of parameters that can be modified to increase the signal detected, and other variations of ELISAs known in the art. For further discussion on ELISA, see, for example, Aus
Edited by Ubel et al., 1994, Current Protocols in Mol.
ecology Biology, Volume 1, John Wiley & Sons, I
nc. , New York, 11.2.1.

The binding affinity of the antibody to the antigen and the off-rate of the antibody-antigen interaction (of
f-rate) can be determined by competitive binding assays. Competitive binding assays
One example is a radioimmunoassay, which is an increasing amount of radioimmunoassay.
In the presence of an unlabeled antigen, a labeled antigen with the antibody of interest (eg,^ThreeH or^{1 twenty five} I) Incubation and detection of antibody bound to labeled antigen.
The affinity of the antibody of interest for a particular antigen, and the binding off-rate,
Can be determined from data by Chard plot analysis. Competition with the second antibody is also
Can be determined using a radioimmunoassay. In this case, the antigen is used in increasing amounts of non-
In the presence of a labeled second antibody, a labeled compound (eg,^ThreeH or¹²⁵I)
And incubated with the desired antibody. Other suitable radioactive materials include:
Radioisotopes (eg, iodine (¹³¹I,¹²⁵I,^{one two Three}I,¹²¹I), carbon (¹⁴C)
,sulfur(³⁵S), tritium (^ThreeH), indium (^115mIn,^113mIn,¹¹²I
n,¹¹¹In) and technetium (⁹⁹Tc,^99mTc), thallium (²⁰¹Ti
),gallium(⁶⁸Ga,⁶⁷Ga), palladium (¹⁰³Pd), molybdenum (⁹⁹M
o), xenon (¹³³Xe), fluorine (¹⁸F),¹⁵³Sm,¹⁷⁷Lu,¹⁵⁹Gd,^{14 9} Pm,¹⁴⁰La,¹⁷⁵Yb,¹⁶⁶Ho,⁹⁰Y,⁴⁷Sc,¹⁸⁶Re,¹⁸⁸Re,¹⁴²P
r,¹⁰⁵Rh,⁹⁷Ru), but is not limited thereto.

Therapeutic Uses The present invention further relates to antibody-based therapies, wherein the antibodies are used to treat one or more of the disclosed diseases, disorders or conditions in animals, Preferably to a mammal, and most preferably to a human patient. Therapeutic compounds of the invention include antibodies of the invention (including fragments, analogs and derivatives thereof, as described herein) and nucleic acids encoding the antibodies of the invention (described herein). Including, but not limited to, fragments, analogs and derivatives thereof, and anti-idiotype antibodies). An antibody of the invention may comprise a disease, disorder or condition associated with aberrant expression and / or activity of a polypeptide of the invention (including any one or more of the diseases, disorders or conditions described herein). (Including but not limited to) treatment, inhibition or prevention. For treating, detecting and / or preventing a disease, disorder or condition associated with abnormal expression and / or activity of a polypeptide of the invention,
Relieve symptoms associated with these diseases, disorders or conditions,
It is not limited to these. The antibodies of the present invention may be provided in pharmaceutically acceptable compositions as known in the art or as described herein.

One summary of how the antibodies of the present invention can be used therapeutically is to treat locally or systemically in the body, or (eg, by complement (CDC) or by effector cells (ADCC)). Due to the direct cytotoxicity of the antibody (as mediated)
And binding the polynucleotide or polypeptide of the invention. Some of these approaches are described in more detail below. Given the teachings provided herein, one of skill in the art would recognize, without undue experimentation, how to use the antibodies of the present invention for diagnostic, monitoring, or therapeutic purposes. Understand.

Antibodies of the present invention can be used, for example, to increase the number or activity of effector cells that interact with the antibody, other monoclonal or chimeric antibodies, or lymphokines or hematopoietic growth factors (eg, IL-2, IL-3 and IL
-7, etc.).

The antibodies of the invention can be administered alone or in combination with other types of treatment, such as radiation therapy, chemotherapy, hormonal therapy, immunotherapy and anti-tumor agents.
Generally, administration of a species-derived or species-reactive product that is the same species as the patient (in the case of antibodies) is preferred. Thus, in a preferred embodiment, a human antibody,
Fragment derivatives, analogs, or nucleic acids are administered to a human patient for treatment or prevention.

The polynucleotides or polypeptides (including fragments thereof) of the present invention
This book is for both immunoassays related to
High affinity for the polypeptide or polynucleotide of the invention and / or
Strong, in vivo inhibitory and / or neutralizing antibodies, fragments thereof, or even
Alternatively, it is preferable to use that region. Such antibodies, fragments,
The region is preferably a polynucleotide or polypeptide of the invention (of which
(Including fragmentation). The preferred binding affinity is 5
× 10^-2M, 10^-2M, 5 × 10^-3M, 10^-3M, 5 × 10^-FourM, 10^-FourM, 5
× 10^-FiveM, 10^-FiveM, 5 × 10^-6M, 10^-6M, 5 × 10^-7M, 10^-7M, 5
× 10^-8M, 10^-8M, 5 × 10^-9M, 10^-9M, 5 × 10^-TenM, 10^-TenM,
5 × 10^-11M, 10^-11M, 5 × 10^-12M, 10^-12M, 5 × 10^-13M, 10^{- 13} M, 5 × 10^-14M, 10^-14M, 5 × 10^-15M, and 10^-15Less than M
Dissociation constant or binding affinity with Kd.

Gene Therapy In certain embodiments, a nucleic acid comprising a sequence encoding an antibody or a functional derivative thereof treats a disease or disorder associated with aberrant expression and / or activity of a polypeptide of the invention. Administered for gene therapy purposes to inhibit or prevent. Gene therapy refers to therapy performed by the administration of an expressed or expressible nucleic acid to a subject. In this embodiment of the invention, the nucleic acids produce their encoded protein, which mediates a therapeutic effect.

[0259] Any of the methods for gene therapy available in the art can be used according to the present invention. An exemplary method is described below.

For a general review of methods for gene therapy, see Goldspiel et al., Cli.
natural Pharmacy 12: 488-505 (1993); Wu and Wu, Biotherapy 3: 87-95 (1991); Tolstos.
hev, Ann. Rev .. Pharmacol. Toxicol. 32: 573
-596 (1993); Mulligan, Science 260: 926-.
932 (1993); and Morgan and Anderson, Ann.
Rev .. Biochem. 62: 191-217 (1993); May, TIB.
TECH 11 (5): 155-215 (1993). Methods generally known in the recombinant DNA art that can be used are Ausubel
Et al. (Ed.), Current Protocols in Molecular
Biology, John Wiley & Sons, NY (1993); and Kriegler, Gene Transfer and Express.
ion, A Laboratory Manual, Stockton Pre
ss, NY (1990).

In a preferred aspect, the compound contains a nucleic acid sequence encoding an antibody, wherein the nucleic acid sequence expresses the antibody, or a fragment or chimeric protein thereof, or a heavy or light chain thereof, in a suitable host. Part of. In particular, such nucleic acid sequences have a promoter operably linked to the antibody coding region, wherein the promoter is inducible or constitutive, and optionally tissue-specific. In another particular embodiment, a nucleic acid molecule is used in which the sequence encoding the antibody and any other desired sequences are flanked by regions that promote homologous recombination at the desired site in the genome, thus rendering the antibody Provides intrachromosomal expression of the encoding nucleic acid (Koller and Smithies, Proc. N
atl. Acad. Sci. USA 86: 8932-8935 (1989);
Zijlstra et al., Nature 342: 435-438 (1989)).
In certain embodiments, the expressed antibody molecule is a single-chain antibody; or the nucleic acid sequence comprises a sequence encoding both the heavy and light chains of the antibody or a fragment thereof.

Delivery of nucleic acid to a patient can be direct (where the patient is directly exposed to the nucleic acid or nucleic acid-bearing vector) or indirect (where the cells are first transduced with the nucleic acid in vitro). Converted and then implanted into the patient). These two approaches are known, respectively, as in vivo gene therapy or as ex vivo gene therapy.

In certain embodiments, a nucleic acid sequence is administered directly in vivo, where the nucleic acid sequence is expressed to produce an encoded product. This can be accomplished by a number of methods known in the art, such as by constructing them as part of a suitable nucleic acid expression vector and administering it intracellularly (eg, defective or attenuated retroviruses). Viral or other viral vectors (US Pat. No. 4,980,980)
, 286), or by direct injection of naked DNA, or by microparticle bombardment (eg, a gene gun; Biol).
istic, Dupont), or by coating with lipids or cell surface receptors or transfectants, or by encapsulation in liposomes, microparticles, or microcapsules, or by allowing them to enter the nucleus. By administration in conjunction with a known peptide, and administration in conjunction with a ligand that undergoes receptor-mediated endocytosis (eg, Wu and Wu, J. Biol. Chem. 262: 44).
29-4432 (1987)), which can be used to target cell types that specifically express the receptor. In another embodiment, a nucleic acid-ligand complex may be formed, wherein the ligand comprises a fusogenic viral peptide that disrupts endosomes, such that the nucleic acid avoids lysosomal degradation. In yet another embodiment, nucleic acids can be targeted in vivo for cell-specific uptake and expression by targeting specific receptors (eg, PCT Publication Nos. WO92 / 06180; WO92 / No. 22635; WO92 / 2
No. 0316; WO 93/14188, WO 93/20221). Alternatively, the nucleic acid can be introduced inside the cell and integrated by homologous recombination into host cell DNA for expression (Koller and Smi).
thes, Proc. Natl. Acad. Sci. USA 86: 8932.
-8935 (1989); Zijlstra et al., Nature 342: 435.
-438 (1989)).

In a specific embodiment, a viral vector comprising a nucleic acid sequence encoding an antibody of the invention is used. For example, a retroviral vector can be used (M
iller et al., Meth. Enzymol. 217: 581-599 (1993)
)checking). These retroviral vectors contain the necessary components for correct packaging of the viral genome and correct integration into host cell DNA. Nucleic acid sequences encoding antibodies used in gene therapy are cloned into one or more vectors, which facilitates delivery of the gene into a patient. Further details on retroviral vectors can be found in Boesen et al., Bi.
Others, see 6: 291-302 (1994), which describes the use of retroviral vectors to deliver the mdrI gene to hematopoietic stem cells to make them more resistant to chemotherapy. Can be issued. Other references describing the use of retroviral vectors in gene therapy are: Clowes et al. Clin. Invest. 93: 644-651 (19
94); Kiem et al., Blood 83: 1467-1473 (1994);
almons and Gunzberg, Human Gene Therapy
4: 129-141 (1993); and Grossman and Wils.
on, Curr. Opin. in Genetics and Level. 3
: 110-114 (1993).

[0265] Adenoviruses are other viral vectors that can be used in gene therapy. Adenoviruses are particularly attractive vehicles for delivering genes to the respiratory epithelium. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are the liver, central nervous system, endothelial cells, and muscle. Adenovirus has the advantage that it can infect non-dividing cells. Kozarsky and Wilson, Current
Opinion in Genetics and Development
3: 499-503 (1993) provides an overview of adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5: 3-10.
(1994) showed the use of adenovirus vectors to transfer genes to the airway epithelium of rhesus monkeys. Other examples of the use of adenovirus in gene therapy include
Rosenfeld et al., Science 252: 431-434 (1991).
Rosenfeld et al., Cell 68: 143-155 (1992); Ma.
Strangeli et al. Clin. Invest. 91: 225-234 (
1993); PCT Publication No. WO 94/12649; and Wang et al., Gen.
e Therapy 2: 775-783 (1995). In a preferred embodiment, an adenovirus vector is used.

Adeno-associated virus (AAV) has also been proposed for use in gene therapy (Walsh et al., Proc. Soc. Exp. Biol. Med. 204:
289-300 (1993); U.S. Patent No. 5,436,146).

Another approach to gene therapy involves transferring the gene to cells in tissue culture by such methods as electroporation, lipofection, calcium phosphate mediated transfection, or viral infection. Usually, the method of transfer involves the transfer of a selectable marker to the cells. The cells are then placed under selection to isolate cells that take up and express the transferred gene. The cells are then delivered to the patient.

In this embodiment, the nucleic acid is introduced into the cells prior to in vivo administration of the resulting recombinant cells. Such introduction can be performed by any method known in the art, including, but not limited to: transfection, electroporation, microinjection, viruses including nucleic acid sequences. Vector or bacteriophage vector infection, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, spheroplast fusion, and the like. Numerous techniques are known in the art for introducing foreign genes into cells (eg, Loeffler and Behr, Met).
h. Enzymol. 217: 599-618 (1993); Cohen et al., M.
eth. Enzymol. 217: 618-644 (1993); Cline,
Pharmac. Ther. 29: 69-92m (1985)),
And if the necessary developmental and physiological functions of the recipient cells are not disrupted, they can be used in accordance with the present invention. The technique should provide for a stable transfer of the nucleic acid into the cell, so that the nucleic acid is expressible by the cell, and preferably is hereditary and expressible by the progeny of the cell.

[0269] The resulting recombinant cells can be delivered to a patient by various methods known in the art. Recombinant blood cells (eg, hematopoietic stem cells or hematopoietic progenitor cells) are preferably administered intravenously. The amount of cells contemplated for use depends on the desired effect, patient condition, etc., and can be determined by one skilled in the art.

Cells into which nucleic acids can be introduced for purposes of gene therapy include any desired available cell type, including but not limited to: epithelial cells, endothelial cells,
Keratinocytes, fibroblasts, muscle cells, hepatocytes; blood cells such as T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes; various stem or progenitor cells; In particular, hematopoietic stem cells or hematopoietic progenitor cells (eg, cells obtained from bone marrow, umbilical cord blood, peripheral blood, fetal liver, etc.).

In a preferred embodiment, the cells used for gene therapy are autologous to the patient.

In embodiments where recombinant cells are used in gene therapy, the nucleic acid sequence encoding the antibody is introduced into the cell such that the nucleic acid sequence is expressible by the cell or its progeny, and then the recombinant cell is Administered in vivo for therapeutic effect. In a specific embodiment, stem cells or progenitor cells are used. Any stem and / or progenitor cells that can be isolated in vitro and maintained in vitro can potentially be used according to this embodiment of the invention (
For example, PCT Publication No. WO 94/08598: Temple and Ande
rson, Cell 71: 973-985 (1992); Rheinwald
, Meth. Cell Bio. 21A: 229 (1980); and Pit
Telkow and Scott, Mayo Clinic Proc. 61: 7
71 (1986)).

In a specific embodiment, the nucleic acid to be introduced for the purpose of gene therapy contains an inducible promoter operably linked to the coding region so that expression of the nucleic acid is properly transcriptionally induced. It can be controlled by controlling the presence or absence of the factor. Proof of therapeutic or prophylactic activity.

The compounds or pharmaceutical compositions of the invention are preferably tested in vitro prior to use in humans, and then in vivo for the desired therapeutic or prophylactic activity. For example, in vitro assays to demonstrate the therapeutic or prophylactic utility of a compound or pharmaceutical composition include the effect of the compound on a cell line or patient tissue sample. The effect of a compound or composition on a cell line and / or tissue sample can be determined utilizing techniques known to those of skill in the art, including, but not limited to, rosette formation assays and cell lysis assays. In vitro assays that can be used to determine whether administration of a particular compound is indicated, according to the present invention, include in vitro cell culture assays, in which a patient tissue sample grows in culture, The compound is then exposed or otherwise administered, and the effect of such compound on the tissue sample is observed.

Diagnosis and Prognosis Certain diseases such as, but not limited to, autoimmune diseases: lupus erythematosus (SLE), rheumatoid arthritis (RA), insulin-dependent diabetes mellitus, multiple sclerosis (MS) Giant cell arteritis, polyarteritis nodosa, myasthenia gravis, scleroderma, and graft-versus-host disease; transplant rejection; mammalian cancer, including but not limited to: melanoma, kidney Certain tissues in mammals with astrocytoma, Hodgkin's disease, breast cancer, ovarian cancer, prostate cancer, bone cancer, liver cancer, lung cancer, pancreatic cancer, and spleen cancer; inflammatory disease; asthma; and allergic disease) Has significantly altered (eg, increased or decreased) levels of galectin when compared to a corresponding “standard” mammal (ie, a mammal of the same species without the disease). It believed to express the mRNA encoding the emissions 11 polypeptide and galectin 11 polypeptides. In addition, altered levels of galectin-11 polypeptide as compared to serum from a mammal of the same species without the disorder may result in altered levels of a specific bodily fluid from a mammal with the disorder (eg, serum, plasma, Urine, and cerebrospinal fluid). Thus, the present invention provides a useful diagnostic method during diagnosis. This includes assaying the expression level of a gene encoding a galectin-11 polypeptide in a mammalian cell or body fluid, and comparing the gene expression level to a standard galectin-11 gene expression level, Thereby, an increase or decrease in gene expression levels above the norm is indicative of the disease.

If the diagnosis had already been made according to the usual methods, the present invention is useful as a prognostic indicator, whereby patients with altered galectin-11 gene expression will express this gene at normal levels. Experience worse clinical results compared to patients who do.

By “assaying the level of expression of a gene encoding a galectin 11 polypeptide”, the level of galectin 11 polypeptide or mRNA encoding a galectin 11 polypeptide in a first biological sample can be directly (eg, Either by measuring or estimating absolute polypeptide or mRNA levels) or relative (eg, by comparing to galectin-11 polypeptide or mRNA levels in a second biological sample). It is intended to be measured and evaluated qualitatively or quantitatively.

[0278] Nucleic acids for diagnosis may be obtained from a biological sample of a subject (eg, blood, urine, saliva,
Tissue biopsy, or autopsy material) using techniques known in the art. Genomic DNA can be used directly for detection, or can be amplified enzymatically prior to analysis by using PCR or other amplification techniques. RNA or cDNA can also be used in a similar manner. Deletions and insertions can be detected by an altered size of the amplified product as compared to the normal genotype. Point mutations are
It can be identified by hybridizing the amplified DNA to a labeled galectin 11 nucleotide sequence. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase digestion or by differences in melting temperatures. D
NA sequence differences also by changes in the electrophoretic mobility of DNA fragments in gels (with or without denaturing agents) or by direct DNA sequencing (see, eg, Myers et al., Science 230; 1242 (1985)). Can be detected. Sequence changes at specific positions may also be revealed by nuclease protection assays (eg, RNase and S1 protection) or chemical cleavage methods (Cotton et al., Proc. Natl. Acad. Sci. US).
A 85: 4397-4401 (1985)). In another embodiment, an array of oligonucleotide probes comprising a galectin-11 polynucleotide sequence or a fragment thereof can be constructed, for example, to perform efficient screening for genetic mutations. Array technology methods are well known and have general applicability and can be used to address a variety of questions in molecular genetics, including gene expression, gene linkage, and gene variability (eg, Chee
Et al., Science 274: 610-613 (1996). Diagnostic assays provide a process for diagnosing or determining susceptibility to a particular disease through detection of mutations in the galectin-11 gene by the described method. I do.

[0279] In addition, certain diseases can be diagnosed by methods comprising determining abnormally reduced or increased levels of galectin 11 polypeptide or mRNA from a sample obtained from a subject. Decreased or increased expression is
It can be measured at the RNA level using any of the methods well known in the art. These methods include, but are not limited to: Northern blot analysis (Harada et al., Cell 63: 303-312 (1990);
1 nuclease mapping (Fijita et al., Cell 49: 357- 367)
(1987)), RNAse protection, polymerase chain reaction (PCR), reverse transcription (RT-PCR) in combination with polymerase chain reaction (Makino et al., Te.
chnique 2: 295-301 (1990)), reverse transcription RT-LCR combined with ligase chain reaction), and other hybridization methods.

Assaying galectin-11 polypeptide levels in a biological sample can be done by any of the techniques known in the art. These techniques include, but are not limited to: radioimmunoassays, competitive binding assays, western blot analysis, and enzyme-linked immunosorbent assays (EL
ISA), as well as other antibody-based technologies. For example, galectin-11 polypeptide expression in tissues can be studied by classical immunohistological methods (Jalka
Nen et al. Cell. Biol. 101: 976-185 (1985)
Jalkanen, M .; J. et al. Cell. Biol. 105: 308
7-3096 (1987)).

Suitable labels are known in the art, and enzyme labels (eg, glucose
Oxidase), and radioisotopes (eg, iodine (¹³¹I,¹²⁵I,^{one two Three}I,^{1 twenty one} I), carbon (¹⁴C), sulfur (³⁵S), tritium (^ThreeH), indium (^115m
In,^113mIn,¹¹²In,¹¹¹In) and technetium (⁹⁹Tc,^99mTc
),thallium(²⁰¹Tl), gallium (⁶⁸Ga,⁶⁷Ga), palladium (¹⁰³Pd
),molybdenum(⁹⁹Mo), xenon (¹³³Xe), fluorine (¹⁸F),¹⁵³Sm, ¹⁷⁷ Lu,¹⁵⁹Gd,¹⁴⁹Pm,¹⁴⁰La,¹⁷⁵Yb,¹⁶⁶Ho,⁹⁰Y,⁴⁷Sc,¹⁸⁶
Re,¹⁸⁸Re,¹⁴²Pr,¹⁰⁵Rh,⁹⁷Ru); a luminescent label (eg, luminol)
); And fluorescent labels (eg, fluorescein and rhodamine) and
Contains otine.

Thus, in another aspect, the invention relates to a diagnostic kit for a disease or susceptibility to a disease, comprising: (a) a galectin 11 polynucleotide, preferably SEQ ID NO: 1, 24 Or (b) a nucleotide sequence complementary to the nucleotide sequence of (a); (c) a galectin 11 polypeptide of the present invention, preferably a polypeptide of SEQ ID NO: 2, 25 or 27 or a fragment thereof. Or (d) an antibody against the galectin-11 polypeptide of the present invention, preferably an antibody against the polypeptide of SEQ ID NO: 2, 25 or 27.

In any such kit, (a), (b), (c) or (d) is
It is understood that it can include substantial components.

Thus, the present invention also provides a diagnostic method useful during the diagnosis of a disorder, comprising the step of measuring the expression level of a polynucleotide of the present invention in cells or body fluids from an individual; Comparing the measured gene expression level to a standard level of polynucleotide expression level, whereby an increase or decrease in gene expression level relative to the standard is indicative of the disorder.

In yet another embodiment, the invention includes a kit for analyzing a sample for the presence of a proliferative and / or cancerous polynucleotide from a test subject. In a general embodiment, the kit comprises at least one polynucleotide probe comprising a nucleotide sequence that specifically hybridizes to a polynucleotide of the invention, and a suitable container. In this particular embodiment, the kit comprises two polynucleotide probes defining an internal region of a polynucleotide of the invention, wherein each probe contains a 31 'mer end internal to this region. With two chains. In a further embodiment, the probe may be useful as a primer for polymerase chain reaction amplification.

If the diagnosis of the disorder has already been made according to conventional methods, the present invention is useful as a prognostic indicator, whereby patients exhibiting enhanced or suppressed polynucleotide expression of the present invention are closer to standard levels Experience poor clinical results as compared to patients expressing this gene at the level.

[0287] By "measuring (expressing) the expression level of the polynucleotide of the present invention", the level of the polypeptide of the present invention or mRNA encoding the polypeptide of the present invention is determined.
Can be determined directly (eg, by determining or assessing absolute protein or mRNA levels) or relative (eg, polypeptides in a second biological sample) in a first biological sample. Level or mRNA
Qualitatively or quantitatively, either by comparison to a level). Preferably, the polypeptide or mRNA level in the first biological sample is measured or evaluated and compared to a standard polypeptide or mRNA level, wherein the standard is obtained from an individual without a disorder. Determined by averaging levels obtained from a second biological sample obtained or from a population of individuals without the disorder. As will be recognized in the art, once a standard polypeptide or mRNA level is known, it can be used repeatedly as a standard for comparison.

By “biological sample” is intended any biological sample obtained from an individual, a body fluid, a cell line, a tissue culture or other source, comprising a polypeptide or mRNA of the present invention. As shown, biological samples may express body fluids (eg, semen, lymph, serum, plasma, urine, synovial fluid and cerebrospinal fluid) containing polypeptides of the invention, and polypeptides of the invention. Includes tissue sources found. Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art. If the biological sample contains mRNA, a tissue biopsy is the preferred source.

The methods provided above can preferably be applied to diagnostic methods and / or kits where the polynucleotides and / or polypeptides of the invention are bound to a solid support. In one exemplary method, the support is provided in US Pat. No. 5,837.
, 832, 5,874,219 and 5,856,174, which can be "gene chips" or "biological chips." Further, using such a gene chip to which the polynucleotide of the present invention is bound, polymorphism between the isolated polynucleotide sequence of the present invention and a polynucleotide isolated from a test subject can be determined. Can be identified. The knowledge of such polymorphisms (ie, their location and their presence) is useful in identifying disease loci for many disorders, including cancerous diseases and conditions. Such methods are described in U.S. Patent Nos. 5,858,659 and 5,856,104.
The U.S. patents referred to above are incorporated herein by reference in their entirety.

Screening Assays for Galectin 11 Agonists or Antagonists Abnormalities in the expression of galectin 11 are responsible for many biological functions, including many pathologies. Therefore, it is desirable to find compounds and drugs that enhance the activity of galectin 11 or suppress the activity of galectin 11. The present invention also provides a method of screening compounds to identify those that enhance or suppress the activity of galectin-11. Agonists are compounds that increase the natural biological function of galectin 11 or that function in a manner similar to galectin 11, while antagonists reduce or eliminate such function.

Accordingly, embodiments of the present invention identify compounds that interact with (eg, bind to) a galectin-11 polypeptide of the invention, and compounds that interfere with or enhance the interaction of galectin-11 with its cognate ligand. As well as compounds that modulate the galectin 11 gene (ie, modulate the level of galectin 11 gene expression) or modulate the level of galectin 11 functional or biological activity. The assay also includes compounds that bind a galectin-11 gene regulatory sequence (eg, a promoter sequence), and a galectin-11 gene.
Can be used to identify compounds that can modulate the gene expression of a. For example, Pl
att, J.A. Biol. Chem. 269: 28558-28562 (1994)
), Which is incorporated by reference herein in its entirety.

Thus, the polypeptides of the present invention can be used to evaluate the binding of a small substrate to a ligand, for example, in a mixture of cells, cell-free preparations, chemical libraries, and natural products. These substrates and ligands can be natural substrates and ligands or can be structural or functional mimetics. Coliga
n et al., Current Protocols in Immunology 1
(2): See Chapter 5 (1991). Examples of additional compounds that can be screened include peptides (eg, random peptide libraries (eg, L
Am et al., Nature 354: 84-86 (1991)), and molecular libraries consisting of D- and L-amino acids from combinatorial chemistry; phosphopeptides (random-directed phosphopeptide libraries or parts). Members of a highly degenerate directional peptide library (eg,
(Including, but not limited to, Songyang et al., Cell 72: 767-778 (1993)); antibodies (monoclonal, humanized, anti-idiotype, chimeric, or single-chain antibodies, and Fabs). , F (
ab ') 2, and FAB expression library fragments, including, but not limited to, epitope-binding fragments thereof; and soluble peptides, including but not limited to peptides found in small organic or inorganic molecules). But not limited to these.

A number of experimental methods can be used to select and detect compounds that bind a galectin-11 polypeptide of the invention and thereby modulate galectin-11 expression or activity. These methods include protein affinity chromatography, affinity blotting, immunoprecipitation, cross-linking, and library-based methods (eg, protein probing, phage display, two-hybrid systems (Fields and Song, Nature 340: 24).
5-246 (1989)), as well as a modified version of the two-hybrid system (Gyuris et al., Cell 75: 791-803 (1993); Zerv).
os et al., Cell 72: 223-232 (1993))). See generally, Phizicky et al., Microbiol. Re
v. 59: 94-123 (1995).

The principle behind the assay to identify compounds that bind to the galectin 11 polypeptide of the invention is that under conditions that allow the two components to interact and bind, thus forming a complex. , Preparing a reaction mixture of the galectin 11 polypeptide and the test compound. The complex can be detected in the reaction mixture and purified using techniques known in the art. Thus, the assay can simply test the binding of the candidate compound to galectin-11.

In addition, the assay comprises combining the candidate compound with a solution containing the galectin-11 polypeptide to form a mixture, and the galectin-11 cognate ligand of galectin-11 contained in the mixture (eg, the surface of T cells A compound comprising a β-galactoside sugar and / or a molecule expressed in a) to determine the ability to aggregate trypsinized rabbit erythrocytes or induce T cell apoptosis; Comparing the ability observed for the galectin-11 polypeptide under the same or similar conditions but without the compound, in the same or similar solution, can be simply included. Of this candidate molecule,
The ability to interfere with the binding of galectin-11 to the cognate ligand is reflected in a decrease in the binding of labeled galectin-11 to the cognate ligand compared to its ability in the absence of the candidate molecule. Molecules that interfere with the ability of galectin-11 to elicit a cellular response (eg, apoptosis) resulting from the binding of galectin-11 to its cognate ligand are antagonists. Molecules that enhance the cellular response induced by galectin-11 are agonists when mixed with galectin-11 or when they can induce a similar cellular response in the absence of galectin.

The galectin-11 polynucleotides, galectin-11 polypeptides, and galectin-11 antibodies of the present invention can also be used to construct assays that detect the effect of added compounds on the production of galectin-11 mRNA and protein in cells. Can be used. For example, ELISA uses monoclonal and polyclonal antibodies by standard methods known in the art to measure the secreted level of galectin-11 protein or the level of galectin-11 protein associated with cells. It can be constructed and used to discover factors (also called antagonists or agonists, respectively) that can inhibit or enhance the production of galectin 11 from appropriately engineered cells or tissues. Standard methods for performing screening assays are well understood in the art.

Examples of potent galectin-11 antagonists include antibodies or, in some cases, oligonucleotides closely related to galectin-11 or a cognate ligand thereof (eg, a fragment of galectin-11 or a ligand of galectin-11). Or small molecules that bind to a protein, or cognate ligand, but do not elicit a response, thereby disrupting the activity of galectin-11.

Thus, in another aspect, the invention relates to screening for identifying agonists, antagonists, ligands, receptors, substrates, enzymes, etc. for galectin-11 polypeptides; or compounds that decrease or enhance galectin-11 production. With respect to the kit, the kit comprises: (a) a galectin-11 polypeptide of the invention, eg, a polypeptide of SEQ ID NO: 2, 25 or 27; (b) a galectin-11 ligand, eg, a T cell (C) a cell membrane expressing galectin 11 ligand, which is preferably a T cell membrane; (d) a compound containing β-galactoside sugar; or (e) preferably a compound of SEQ ID NO: 2, 25 or 27 Against the galectin-11 polypeptide of the present invention, which is a polypeptide Encompasses body, the.

It is understood that in any such kit, (a), (b), (c), (d), or (e) may include substantial components.

Compounds identified via assays as disclosed herein can be used, for example, in creating the biological function of the galectin 11 gene product and in cell growth (
cell growth, cell proliferation
) And differentiation, and may be useful for regulating apoptosis. For example, antibodies to galectin-11 and galectin-11 polypeptides, fragments, derivatives, variants, or analogs of the invention can be used to suppress galectin-11 activity and treat abnormalities resulting from elevated galectin-11. Combinations of these identified compounds having a pharmaceutically acceptable carrier (eg, a carrier as described herein), and disorders of proliferation and immune regulation (autoimmune diseases, cancer, and Their administration for treating or preventing (including but not limited to, inflammatory diseases) is also encompassed by the present invention.

Prophylactic and Therapeutic Methods Although the following discussion specifically relates to human patients, it should be understood that these teachings are also applicable to any animal that expresses galectin-11. is there.

As noted above, galectin 11 shares significant homology with other galectins. Further, as disclosed herein, galectin 11 induces apoptosis of T cell lines, similar to galectin 1. In addition, as discussed above, galectin 1 is responsible for cell proliferation and some immune functions (eg, against autoimmune diseases in experimental animal models of myasthenia gravis and experimental animal models of autoimmune encephalomyelitis). Therapeutic activity).
Thus, galectin 11, like galectin 1, is active in growth regulatory activity (eg, cell differentiation and / or cell proliferation), immunomodulatory activity, cell-cell and cell-substrate interactions, and apoptosis. It seems.

Apoptosis, or programmed cell death, is a physiological mechanism involved in the deficiency of peripheral T lymphocytes of the immune system, and its dysregulation can lead to a number of different pathogenic processes. Diseases associated with increased cell survival or inhibition of apoptosis include cancer (eg, follicular lymphoma, cancer with a p53 mutation, and hormone-dependent tumors (colon, heart, pancreatic, melanoma, retina) Blastoma, glioblastoma, lung cancer, intestinal cancer, testicular cancer, gastric cancer, neuroblastoma, myxoma, fibroid, lymphoma, endothelioma, osteoblastoma, bone giant cell tumor, osteosarcoma, cartilage Autoimmune disorders (eg, multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, bile cirrhosis,
Behcet's disease, Crohn's disease, polymyositis, systemic lupus erythematosus and immune-associated glomerulonephritis and rheumatoid arthritis), and viral infections (eg, herpes virus, poxvirus,
And adenovirus), inflammation; graft-versus-host disease, acute graft rejection, and chronic graft rejection. In a preferred embodiment, the galectin 11 of the present invention
The polynucleotides, polypeptides and / or antagonists of the invention are used to inhibit the growth, progression, and / or metastasis of cancer (especially those listed above).

Additional diseases or conditions associated with increased cell survival that can be treated or detected by a galectin-11 polynucleotide or polypeptide, or agonist or antagonist, include the progression and / or metastasis of a malignant disease and associated Disorders, including but not limited to: leukemia (
Acute leukemia (including, for example, acute lymphoblastic leukemia, acute myeloid leukemia (including myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and chronic leukemia (eg, chronic myeloid leukemia) (Granulocytic) leukemia and chronic lymphocytic leukemia))
Polycythemia vera, lymphomas (eg, Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors (sarcomas and carcinomas (eg, fibrosarcoma, mucus) Sarcoma, liposarcoma, chondrosarcoma,
Osteogenic sarcoma, chordoma, hemangiosarcoma, endothelial sarcoma (endotheliosarcoma)
a), lymphatic sarcoma, lymphatic endothelioma, periosteoma, mesothelioma, Ewing tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal Cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous carcinoma, papillary carcinoma, papillary carcinoma, cystic carcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatocellular carcinoma, cholangiocarcinoma, choriocarcinoma, seminoma, embryo Stage cancer, Wilms tumor, cervical cancer, testicular tumor, lung cancer, small cell lung cancer, bladder cancer, epithelial cancer, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma ,
Pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma (menangi)
oma), melanomas, neuroblastomas, and retinoblastomas).

Diseases associated with increased apoptosis that can be treated or detected by a galectin 11 polynucleotide or polypeptide, and an agonist or antagonist of galectin 11 include: AIDS; neurodegenerative disorders (eg, Alzheimer's disease) Autoimmune disorders (eg, multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis) ,
Behcet's disease, Crohn's disease, polymyositis, systemic lupus erythematosus and immune-associated glomerulonephritis and rheumatoid arthritis), myelodysplastic syndrome (eg, aplastic anemia), graft versus host disease , Ischemic injury (such as caused by myocardial infarction, stroke and reperfusion injury), liver injury (eg, hepatitis-related liver injury, ischemia / reperfusion injury, cholestasis)
toxicosis (such as caused by alcohol), septic shock, cachexia and anorexia.

Any method that neutralizes or enhances galectin-11 activity modulates growth-regulating activity (eg, cell proliferation), immunomodulatory activity, cell-cell and cell-substrate interactions, and apoptosis Can be used to

Galectin-11 polypeptides or polynucleotides (as described herein, such as galectin-11 fragments, variants, derivatives, and analogs,
And agonists and antagonists of galectin 11) are useful in treating immune system deficiencies or disorders by activating or inhibiting the proliferation, differentiation, or migration (chemotaxis) of immune cells. Can be Immune cells
It develops through a process called hematopoiesis that produces myeloid cells (platelets, red blood cells, neutrophils, and macrophages) and lymphoid cells (B and T lymphocytes) from pluripotent stem cells. The etiology of these immune deficiencies or disorders may be genetic, physical, eg, cancer or any autoimmune disorder, or acquired (eg, chemotherapy or toxin). ) Or infectious. In addition, galectin-11 polynucleotides or polypeptides can be used as markers or detectors for certain immune system diseases or disorders.

Galectin-11 polynucleotides or polypeptides (including fragments, variants, derivatives and analogs of galectin-11 as described herein, as well as agonists and antagonists of galectin-11) are defective in hematopoietic cells. Or it may be useful in treating or detecting a disorder. As discussed further below, in an approach to treat disorders associated with the reduction of certain (or many) types of hematopoietic cells using galectin-11 polypeptides or polynucleotides or agonists and antagonists of galectin-11. Hematopoietic cells (
(Including pluripotent stem cells). Examples of immunological deficiency syndromes include, but are not limited to: blood protein disorders (
For example, agammaglobulinemia, hypogammaglobulinemia), ataxia telangiectasia, unclassifiable immunodeficiency, DiGeorge syndrome, HIV infection, HTLV
-BLV infection, leukocyte adhesion deficiency syndrome, lymphopenia, phagocytic bactericidal dysfunction, severe combined immunodeficiency (SCID), Viscott-Aldrich disorder, anemia, thrombocytopenia, or hemoglobinuria.

In addition, galectin 11 polypeptides or polynucleotides (including fragments, variants, derivatives and analogs of galectin 11 as described herein, as well as agonists and antagonists of galectin 11) are also hemostatic. It can be used to modulate activity (to stop bleeding) or thrombolytic activity (clot formation). For example, by increasing haemostatic or thrombolytic activity, galectin-11 polynucleotides or polypeptides can cause blood coagulation disorders (eg, afibrinogenemia, factor deficiency), blood platelet disorders (eg,
Thrombocytopenia), or wounds resulting from trauma, surgery or other causes. Alternatively, it can reduce hemostatic or thrombolytic activity,
Galectin 11 polynucleotide or polypeptide or galectin 11
Can be used to inhibit or dissolve coagulation. These molecules are important in treating a heart attack (infarction), stroke, or scar.

Galectin-11 polynucleotides or polypeptides (including fragments, variants, derivatives and analogs of galectin-11 as described herein, as well as agonists or antagonists of galectin-11) may also be present in autoimmune disorders. May be useful for treating or detecting. As disclosed herein, galectin 11 induces apoptosis of T cell lines (Example 5, FIG.
A and FIG. 5B). Many autoimmune disorders result from inappropriate recognition of self as a foreign substance by immune cells. This improper recognition results in an immune response that leads to destruction of the host tissue. Therefore, administration of a galectin-11 polypeptide or polynucleotide that can inhibit an immune response, particularly T cell proliferation, differentiation, or chemotaxis, can be an effective treatment to prevent autoimmune disorders.

Examples of autoimmune disorders that can be treated or detected include, but are not limited to: Addison's disease, hemolytic anemia, antiphospholipid syndrome, rheumatoid arthritis, dermatitis, allergic cerebrospinal cord Inflammation, glomerulonephritis, Goodpasture's syndrome, Graves' disease, multiple sclerosis, myasthenia gravis, neuritis, ocular conjunctivitis, bullous pemphigoid, pemphigus, polyendocrine disease, purpura, Reiter's disease, stiff Man syndrome, autoimmune thyroiditis, systemic lupus erythematosus, autoimmune pulmonary inflammation, Guian-
Barre syndrome, insulin-dependent diabetes, and autoimmune inflammatory eye disease.

Similarly, allergic reactions and conditions such as, for example, asthma (particularly allergic asthma) or other respiratory problems are also treated with galectin-11 polypeptides or polynucleotides or galectin-11 agonists or antagonists. obtain. In addition, these molecules can be used to treat anaphylaxis, hypersensitivity to antigenic molecules, or blood group incompatibility.

Galectin 11 polynucleotides or polypeptides (including fragments, variants, derivatives and analogs of galectin 11 as described herein, as well as agonists or antagonists of galectin 11) may also inhibit organ rejection or It can be used to treat and / or prevent graft versus host disease (GVHD). Organ rejection is caused by host immune cells destroying the transplanted tissue via an immune response. Similarly, the immune response is also involved in GVHD, where exogenous transplanted immune cells destroy host tissues. Administration of a galectin-11 polypeptide or polynucleotide or a galectin-11 agonist or antagonist that inhibits the immune response, particularly T cell proliferation, differentiation, or chemotaxis, is an effective treatment to prevent organ rejection or GVHD. possible.

Similarly, galectin-11 polypeptides or polynucleotides (including fragments, variants, derivatives and analogs of galectin-11 as described herein, and agonists or antagonists of galectin-11) also include Can be used to control inflammation. For example, a galectin-11 polypeptide or polynucleotide or a galectin-11 agonist or antagonist can inhibit proliferation and differentiation of cells involved in the inflammatory response. These molecules may be infected (eg, septic shock, sepsis, or systemic inflammatory response syndrome (SIRS)), ischemic reperfusion injury, endotoxin death, arthritis, complement-mediated hyperacute rejection, nephritis, cytokines or Chemokine-induced lung injury, inflammatory bowel disease, inflammation associated with Crohn's disease, or cytokines (eg, TNF or IL-1)
Can be used to treat inflammatory conditions, including inflammation resulting from overproduction of both chronic and acute conditions.

Galectin-11 polypeptides or polynucleotides (including fragments, variants, derivatives and analogs of galectin-11 as described herein, and agonists and antagonists of galectin-11) include neoplasms It can be used to treat or detect a hyperproliferative disorder. Galectin 11
Or agonists or antagonists of galectin 11 can inhibit the growth of a disorder through direct or indirect interactions. Alternatively, a galectin-11 polypeptide or polynucleotide, or an agonist or antagonist of galectin-11 can proliferate other cells that can inhibit a hyperproliferative disorder.

For example, by increasing the immune response, especially by increasing the antigenicity of the hyperproliferative disorder, or by expanding, differentiating, or recruiting T cells.
Hyperproliferative disorders can be treated. This immune response can be increased by either enhancing an existing immune response or initiating a new immune response. Alternatively, reducing the immune response can also be a method of treating a hyperproliferative disorder, such as a chemotherapeutic agent.

Examples of hyperproliferative disorders that can be treated or detected by a galectin-11 polynucleotide or polypeptide include, but are not limited to, neoplasms that exist: colon, abdomen, bone, breast, digestion Organs, liver, pancreas, prostate,
Peritoneum, endocrine glands (adrenal gland, parathyroid gland, pituitary, testis, ovary, thymus, thyroid), eyes,
Head and neck, nerves (central and peripheral), lymphatic system, pelvis, skin, soft tissue, spleen, breast, and genitourinary tract.

Similarly, other hyperproliferative disorders can also be treated or detected by a galectin-11 polynucleotide or polypeptide, or an agonist or antagonist of galectin-11. Examples of such hyperproliferative disorders include, but are not limited to: hypergammaglobulinemia, lymphoproliferative disorders, paraproteinemia, purpura, sarcoidosis, Sezary syndrome, Waldenstrom Macroglobulinemia, Gaucher disease, histiocytosis, and any other hyperproliferative diseases, as well as neoplasms found in the organ systems listed above.

One preferred embodiment utilizing a polynucleotide of the present invention is to inhibit abnormal cell division by the present invention and / or gene therapy using a fusion protein or fragment thereof.

Thus, the present invention provides a method for treating a cell proliferative disorder by inserting a polynucleotide of the present invention into an abnormally growing cell, wherein the polynucleotide comprises Is shown.

Another embodiment of the present invention provides a method of treating a cell proliferative disorder in an individual, the method comprising: Administering to multiple cells. In a preferred embodiment, the polynucleotide of the present invention is a DNA construct comprising a recombinant expression vector effective in expressing a DNA sequence encoding the polynucleotide. In another preferred embodiment of the invention, the D encoding the polynucleotide of the invention
The NA construct is inserted into the cells to be treated using a retroviral vector, or more preferably, an adenoviral vector (GJ. Nabel et al., PNAS 1999 96: 324-326, which is described herein. Which is incorporated herein by reference). In a most preferred embodiment, the viral vector is defective and transforms only proliferating cells, not non-proliferating cells.
Further, in a preferred embodiment, the polynucleotides of the present invention inserted into proliferative cells, either alone or in combination or fusion with other polynucleotides, are then exposed to an external stimulus (ie, magnetic, specific (Eg, small molecule, chemical, or drug administration), which acts on the promoter upstream of the polynucleotide to induce expression of the encoded protein product. Thus, the beneficial therapeutic effects of the invention can be unambiguously modulated (ie, increase, decrease, or inhibit the expression of the invention) based on this external stimulus.

The polynucleotides of the present invention may be useful in suppressing oncogene or antigen expression. “Inhibition of oncogene expression” can be used to suppress gene transcription, degrade gene transcripts (pre-message RNA), inhibit splicing, disrupt messenger RNA, prevent post-translational modification of proteins, Or disruption of the normal function of the protein.

For topical administration to abnormally growing cells, the polynucleotides of the invention can be administered by any method known to those of skill in the art, including transfection, electroporation, These include, but are not limited to, microinjection of cells, or in vehicles (eg, liposomes, lipofectin), or as naked polynucleotides, or any of the other methods described throughout this specification. The polynucleotide of the present invention can be prepared by a known gene delivery system (for example, retroviral vector (Gilboa, J. Virology 44: 845 (
1982); Hocke, Nature 320: 275 (1986); Wil.
Son et al., Proc. Natl. Acad. Sci. U. S. A. 85: 301
4), vaccinia virus system (Chakrabarty et al., Mol. Cell
Biol. 5: 3403 (1985)) or other effective DNA known to those of skill in the art.
Delivery systems (including, but not limited to, Yates et al., Nature 313: 812 (1985)). These references are exemplary only and are incorporated herein by reference. To specifically deliver or transfect abnormally growing cells and to avoid using non-dividing cells, retroviruses known to those skilled in the art, or adenoviruses (anywhere in the art and herein) Preferably, a delivery system (as described) is used. Host DNA replication requires retroviral DNA for integration, and retroviruses cannot replicate themselves due to the lack of retroviral genes required for their life cycle. By using such a retroviral delivery system for the polynucleotides of the present invention, the genes and constructs target abnormally growing cells and do not use non-dividing normal cells.

[0324] The polynucleotides of the present invention may be used to control cell proliferative disorders in internal organs, body cavities, etc.
It can be delivered directly to the disease site. The polynucleotides of the present invention can also be administered to a disease site during a surgical procedure.

By “cell proliferative disease” is meant any human or animal disease or disorder that affects any one or any combination of organs, cavities, or body parts, which is benign , Whether malignant or malignant, is characterized by one or more local abnormal growths of a cell, group of cells, or tissue.

Any amount of a polynucleotide of the present invention can be administered, so long as the polynucleotide of the present invention has a biologically inhibitory effect on the growth of the treated cells. Further, more than one of the polynucleotides of the present invention can be administered simultaneously to the same site. By "biologically inhibit", partial or total growth inhibition of a cell and proliferation or growth (g
reduction) rate is implied. The biological inhibitory dose can be determined by assessing the effect of a polynucleotide of the invention on target malignant or abnormally growing cell growth in tissue culture, tumor growth in animals and cell culture, or any known to those of skill in the art. Can be determined by other methods.

The present invention further relates to antibody-based therapies, wherein the therapy comprises treating an anti-polypeptide antibody and an anti-polynucleotide antibody in a mammalian (preferably human) patient to treat one or more of the described disorders. Administering to the subject. Methods for producing polyclonal and monoclonal antibodies of anti-polypeptide and anti-polynucleotide antibodies are described in detail elsewhere herein. Such antibodies can be provided in a pharmaceutically acceptable composition as known in the art or as described herein.

A summary of the methods by which the antibodies of the present invention can be used therapeutically is that polynucleotides or polypeptides of the present invention can be administered locally or totally in the body or by the direct cytotoxicity of the antibody ( For example, binding (as mediated by complementing cells (CDC) or effector cells (ADCC)). Some of these approaches are described in more detail below. With the teachings provided herein, one of skill in the art will understand, without undue experimentation, how to use the antibodies of the present invention for diagnostic, monitoring, or therapeutic purposes.

In particular, the antibodies, fragments and derivatives of the present invention treat a subject having or developing a cell proliferative disorder and / or a cell differentiation disorder as described herein. Useful for. Such treatment includes administering one or more doses of the antibody or fragment, derivative or conjugate thereof.

The antibodies of the present invention can be advantageously used, for example, in combination with other monoclonal or chimeric antibodies, or in combination with lymphokines or hematopoietic growth factors, depending on the number of effector cells that interact with the antibody or Helps to increase activity.

[0331] High affinity and / or affinity for a polypeptide or polynucleotide of the invention
Are potent in vivo inhibitory and / or neutralizing antibodies, fragments thereof or
The region may be a polynucleotide or polypeptide (fragment thereof) of the invention.
For both immunoassays and the treatment of disorders related to them.
It is preferred to use Such antibodies, fragments or regions are preferably
Preferably, the polynucleotide or polypeptide (including fragments thereof)
). Preferred binding affinity is 5 × 10^-6M, 10 ^-6 M, 5 × 10^-7M, 10^-7M, 5 × 10^-8M, 10^-8M, 5 × 10^-9M, 10 ^-9 M, 5 × 10^-TenM, 10^-TenM, 5 × 10^-11M, 10^-11M, 5 × 10^-12M
, 10^-12M, 5 × 10^-13M, 10^-13M, 5 × 10^-14M, 10^-14M, 5 × 1
0^-15M and 10^-15Dissociation constants below M, ie binding affinity with Kd, are mentioned.
It is.

In addition, as described elsewhere herein, the polypeptides of the present invention can be either directly or indirectly, alone, as fusion proteins, or in combination with other polypeptides. And is useful in inhibiting angiogenesis of proliferating cells or tissues. In a most preferred embodiment, the anti-angiogenic effect is
It can be achieved indirectly, eg, through inhibition of hematopoietic cells, tumor-specific cells (eg, tumor-associated macrophages) (Joseph IB et al., J Natl Ca
ncer Inst, 90 (21): 1648-53 (1998), which is incorporated herein by reference. Antibodies directed to the polypeptides or polynucleotides of the invention can also directly or indirectly inhibit angiogenesis (Witte L et al., Cancer Metastasis Re.
v. 17 (2): 155-61 (1998), which is incorporated herein by reference).

The polypeptides of the present invention (including fusion proteins) or fragments thereof,
It may be useful in inhibiting proliferating cells or tissues through the induction of apoptosis. The polypeptide is a death domain receptor (eg, tumor necrosis factor (T
(NF) receptor 1, CD95 (Fas / APO-1), TNF receptor-related apoptosis-mediated protein (TRAMP) and TNF-related apoptosis-inducing ligand (TRAIL) receptors 1 and 2)
Either directly or indirectly, it can act to induce apoptosis of proliferating cells and tissues (Schulze-Osthoff K et al., Eur J.
Biochem 254 (3): 439-59 (1998), which is hereby incorporated by reference. Further, in another preferred embodiment of the invention, the polypeptide can be administered through other mechanisms (eg, in the activation of other proteins that activate apoptosis), or alone or in small molecule drugs or adjuvants (eg, Either in combination with apoptonin, alectin, thioredoxin, anti-inflammatory protein)
Apoptosis can be induced through stimulation of expression of this protein (eg, M
ut Res 400 (1-2): 447-55 (1998), Med H
ypotheses. 50 (5): 423-33 (1998), Chem Bi.
ol Interact. Apr 24; 111-112: 23-34 (199
8), J Mol Med. 76 (6): 402-12 (1998), Int.
J Tissue React; 20 (1): 3-15 (1998), which are all incorporated herein by reference).

The polypeptides of the present invention (including fusion proteins or fragments thereof) are useful in inhibiting the metastasis of proliferating cells or tissues. Inhibition can be a direct result of the administration of the polypeptide, or an antibody directed to this polypeptide as described herein, or indirectly (eg, to inhibit metastasis). (Eg, activation of expression of a protein (eg, α4 integrin)) (eg, Curr Top Microbiol Imm)
unol 1998; 231: 125-41, which is incorporated herein by reference). Such therapeutic effects of the present invention can be achieved either alone or in combination with small molecule drugs or adjuvants.

In another embodiment, the present invention provides a composition comprising a polypeptide of the invention (eg, comprising a polypeptide or polypeptide antibody that associates with a heterologous polypeptide, heterologous nucleic acid, toxin, or prodrug). ) To a target cell that expresses a polypeptide of the invention. A polypeptide or polypeptide antibody of the invention can be associated with a heterologous polypeptide, heterologous nucleic acid, toxin, or prodrug via hydrophobic, hydrophilic, ionic, and / or covalent interactions.

The polypeptides of the invention, fusion proteins therewith, or fragments thereof can be directly (eg, vaccinated with an immune response, such that the polypeptides of the invention respond to proliferative antigens and immunogens). "As occurs when" or indirectly (eg, as in activating the expression of a protein (eg, a chemokine) known to enhance the immune response to this antigen and immunogen). Useful in enhancing the immunogenicity and / or antigenicity of proliferating cells or tissues.

Galectin 11 polypeptides or polynucleotides (including fragments, variants, derivatives and analogs of galectin 11 as described herein, and agonists and antagonists of galectin 11) treat infectious agents Or it can be used to detect. For example, an infectious disease can be treated by increasing the immune response, particularly by increasing the proliferation and differentiation of B and / or T cells. The immune response can be increased either by enhancing an existing immune response or by initiating a new immune response. Alternatively, the galectin-11 polypeptide or polynucleotide may also directly inhibit the infectious agent without necessarily eliciting an immune response.

A virus is an example of an infectious agent that can cause a disease or condition that can be treated or detected by a galectin-11 polynucleotide or polypeptide.
Examples of viruses include, but are not limited to, the following families of DNA viruses and RNA viruses: Arbovirus, Adenoviridae, Arenaviridae, Arterivirus, Virnaviridae, Bunyaviridae, Karichi. Viridae, sarcoviridae, coronaviridae, dengue virus, EBV, HIV, flaviviridae, hepadnaviridae (hepatitis), herpesviridae (eg, cytomegalovirus, herpes simplex, shingles), Mononegavirus (for example, Paramyxoviridae, Morbillivirus, Rhabdoviridae), Orthomyxoviridae (for example, influenza A, influenza B and parainfluenza), papiro Maviridae (papilloma virus), Papovaviridae, Parvoviridae, Picornaviridae, Poxviridae (eg, pox or vaccinia), Reoviridae (eg, rotavirus), Retroviridae (HTLV-I, HTLV-). II, lentivirus), and Togaviridae (eg, rubivirus). Viruses that fall within these families can cause a variety of diseases or conditions, including but not limited to: arthritis,
Bronchiolitis, respiratory syncytial virus, encephalitis, ocular infections (eg, conjunctivitis, keratitis), chronic fatigue syndrome, hepatitis (types A, B, C, E
Type, chronic activity, delta), Japanese encephalitis, Junin, Rift Valley fever, yellow fever, meningitis, opportunistic infections (eg, AIDS), pneumonia, Burkitt's lymphoma, chickenpox, hemorrhagic fever, measles, epidemic ear Lower inflammation, parainfluenza, rabies, cold, polio, leukemia, rubella, sexually transmitted diseases, skin diseases (eg, capoge, warts), and viremia. Any of these conditions or diseases can be treated or detected using a galectin-11 polypeptide or polynucleotide, or agonist or antagonist, of the present invention. In certain embodiments, the polynucleotides, polypeptides or agonists or antagonists of the invention are used to treat: meningitis, dengue, EBV, and / or hepatitis (eg, hepatitis B) . In a further particular embodiment, the polynucleotides, polypeptides or agonists or antagonists of the invention are used to treat patients who are unresponsive to one or more other commercially available hepatitis vaccines. In a more specific embodiment, a polynucleotide, polypeptide or agonist or antagonist of the invention is used to treat AIDS.

Similarly, bacterial or fungal factors that can cause a disease or condition and that can be treated or detected by a galectin-11 polynucleotide or polypeptide, and / or agonist or antagonist of the present invention include the following Gram-negative bacteria: And Gram-positive bacteria and fungi, but are not limited to: Actinomycetales (eg, Coryneb)
acterium, Mycobacterium, Norcardia), Cr
yptococcus neoformans, Aspergillosis,
Bacillaceae (eg, Anthrax, Clostridium)
, Bacteroidaceae, Blastomycosis, Bordet
ella, Borrelia (for example, Borrelia burgdorfef)
ri), Brucellosis, Candidiasis, Campylob
acter, Coccidioidomycosis, Cryptococco
sis, Dermatocycoses, E.C. coli (for example, Entero)
toxogenic E. coli and Enterohemorrhgic
E. FIG. coli), Enterobacteriaceae (Klebsiel)
la, Salmonella (eg, Salmonella typhi, and Salmonella paratyphi), Serratia, Yer
sinia), Erysipelothrix, Helicobacter, L
egionellosis, Leptospirosis, Listeria,
Mycoplasmatales, Mycobacterium leprae
, Vibrio cholerae, Neisseriaceae (for example, A
cinebacter, Gonorrhea, Menigococcal)
, Meisseria meningitidis, Pasteurellac
ea Infections (e.g., Actinobacillus, Hea
mophilus (eg, Heamophilus influenza B)
Type), Pasteurella), Pseudomonas, Ricketts
iaceae, Chlamydiaceae, Syphilis, Shigel
la spp. , Staphylococcal, Meningiococca
1, Pneumococcal and Streptococcal (eg,
Streptococcus pneumoniae and Group BS
treptococcus). These bacteria or fungi can cause the following diseases or conditions, including but not limited to: bacteremia, endocarditis, ocular infections ( Conjunctivitis, tuberculosis, uveitis), gingivitis, opportunistic infections (eg, AIDS-related infections), periungualitis, prosthesis-related infections, reiter's disease, respiratory tract infections (eg, pertussis or pyometra), sepsis, lime Disease, cat scratching disease, dysentery, paratyphoid fever, food poisoning, typhoid, pneumonia, gonorrhea, meningitis (eg, meningitis A and B meningitis), chlamydiasis, syphilis, diphtheria, Leprosy, paratuberculosis , Tuberculosis, lupus, botulism, gangrene, tetanus, impetigo, rheumatic fever, scarlet fever, sexually transmitted diseases, skin diseases (eg, cellulitis,
Dermatocycoses), toxicemia, urinary tract infections, wound infections. Galectin-11 polypeptides or polynucleotides, or agonists or antagonists, of the invention can be used to treat or detect any of these conditions or diseases. In certain embodiments, the polynucleotides, polypeptides, agonists or antagonists of the invention are used to treat: tetanus, diphtheria, botulism, and / or meningitis B.

In addition, parasitic agents that cause a disease or condition that can be treated or detected by a galectin-11 polynucleotide or polypeptide, agonist or antagonist include, but are not limited to, the following families: Amebiasis, Babesissis , Coccidiosis, C
ryptosporidiosis, Dientamoebiasis, Dou
line, Ectoparasitic, Giardiassis, Helmin
thiasis, Leishmaniasis, Theileriasis, T
oxoplasmosis, Trypanosomiasis, and Tric
homonas and Sporozoans (eg, Plasmodium)
virax, Plasmodium falciparium, Plasmod
ium malariae and Plasmodium ovale). These parasites can cause various diseases or conditions, including but not limited to: scabies, tsutsugamushi disease, eye infections, intestinal infections (eg, Dysentery, giardiasis, liver disease, lung disease, opportunistic infections (eg, AIDS-related), malaria, pregnancy complications (pregn)
ancy complication) and toxoplasmosis. Galectin-11 polypeptides or polynucleotides, or agonists or antagonists, can be used to treat or detect any of these conditions or diseases. In certain embodiments, the polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat malaria.

Preferably, treatment with a polypeptide or polynucleotide and / or agonist or antagonist of the present invention is by administering an effective amount of the polypeptide to the patient, or by removing cells from the patient and allowing the cells to carry out the treatment. Either by supplying the polypeptide of the invention and returning the engineered cells to the patient (ex vivo treatment). In addition, the polypeptides or polynucleotides of the present invention can be used as an antigen in a vaccine to elicit an immune response against an infectious disease.

Tissue regeneration using galectin-11 polynucleotides or polypeptides (including galectin-11 fragments, variants, derivatives, and analogs described herein, as well as agonists and antagonists of galectin-11). The leading cells can differentiate, proliferate, and attract. (Science 276
: 59-87 (1997). B) Using tissue regeneration, birth defects,
Trauma (wounds, burns, incisions or ulcers), age-related diseases (eg, osteoporosis, osteoarthritis, periodontal disease, liver failure), surgery (including cosmetic plastic surgery), fibrosis, It can repair, replace, or protect tissue that has been damaged by reperfusion injury, or systemic cytokine damage.

Tissues that can be regenerated using the present invention include: organs (eg, pancreas, liver, intestine, kidney, skin, endothelium), muscle tissue (smooth, skeletal or cardiac)
Vascular tissue (including vascular endothelium), nervous tissue, hematopoietic tissue, and skeletal (eg, bone, cartilage, tendon, and ligament) tissue. Preferably, the regeneration results in no or reduced scarring. Regeneration may also include angiogenesis.

In addition, galectin-11 polynucleotides or polypeptides (including galectin-11 fragments, variants, derivatives, and analogs, and galectin-11 agonists and antagonists described herein) may be present in tissues that are difficult to heal. Regeneration can be increased. For example, increased tendon / ligament regeneration hastens recovery time after injury. Galectin-11 polynucleotides or polypeptides, or agonists or antagonists of the invention, can also be used prophylactically in approaches to avoid injury. Particular diseases that can be treated include tendinitis, carpal tunnel syndrome, and other tendon or ligament defects. Further examples of tissue regeneration of unhealed wounds include pressure ulcers, ulcers associated with valve regurgitation, surgical wounds, and trauma wounds.

Similarly, neural and brain tissue can also be regenerated by using a galectin-11 polynucleotide or polypeptide of the invention, or an agonist or antagonist, to proliferate and differentiate neural cells. Diseases that can be treated using this method include diseases of the central and peripheral nervous system, neuropathy, or mechanical and traumatic disorders such as spinal cord injury, head trauma, cerebrovascular disease, and stroke. )). In particular, diseases associated with peripheral nerve injury, peripheral neuropathy (eg, resulting from chemotherapy or other medical therapy), localized neuropathy, and central nervous system diseases (eg, Alzheimer's disease, Parkinson's disease, Huntington's choreography) Disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome) can all be treated with galectin-11 polynucleotides or polypeptides, or galectin-11 agonists or antagonists.

Galectin-11 polynucleotides or polypeptides, or agonists or antagonists of the invention may have chemotactic activity. Chemotactic molecules cause cells (eg, monocytes, fibroblasts, neutrophils, T cells, mast cells, eosinophils, epithelial cells and / or endothelial cells) to become specific sites in the body (eg, inflammation, (Site of infection or hyperproliferation). The migrated cells can then repel and / or heal certain traumas or abnormalities.

A galectin-11 polynucleotide or polypeptide, or agonist or antagonist, of the present invention may increase chemotactic activity of a particular cell.
These chemotactic molecules are then used to treat inflammation, infection, hyperproliferative disorders, or any immune system disorder by increasing the number of cells that target specific sites in the body. obtain. For example, chemotactic molecules can be used to treat wounds and other trauma to tissues by attracting immune cells to the site of injury. The chemotactic molecule of the present invention can also attract fibroblasts, which can be used to treat wounds.

It is also anticipated that the galectin-11 polynucleotides or polypeptides, or agonists or antagonists, of the present invention will be able to inhibit chemotactic activity. These molecules can also be used to treat disorders. Accordingly, the galectin-11 polynucleotides or polypeptides, or agonists or antagonists, of the present invention can be used as chemotactic inhibitors.

A composition of Galectin 11 of the present invention (eg, a Galectin 11 polypeptide,
Nervous system disorders that can be treated with polynucleotides and / or agonists or antagonists) include nervous system damage and diseases or disorders that result in either axonal transection, neuronal loss or degeneration, or demyelination. But not limited to them. Nervous system lesions that can be treated in accordance with the present invention in patients (including human and non-human mammal patients) include the following lesions of either the central nervous system (including the spinal cord, brain) or the peripheral nervous system But not limited to: (1) ischemic lesions (including cerebral infarction or cerebral ischemia, or spinal cord infarction or ischemia) where oxygen deprivation in parts of the nervous system causes damage or death of neurons; ) Traumatic lesions (including lesions caused by physical injury or surgery-related lesions) (eg, lesions that cut parts of the nervous system or compression injuries); (3) parts of the nervous system are malignant tissues ( This is either a nervous system with malignancy or a malignancy derived from non-nervous tissue) malignant lesions that are destroyed or damaged by; Infectious lesions that are destroyed or damaged (eg, by an abscess or associated with infection by human immunodeficiency virus, herpes zoster or herpes simplex virus, or associated with Lyme disease, tuberculosis, syphilis); 5) degenerative lesions in which parts of the nervous system are destroyed or damaged as a result of the degenerative process (including degenerative processes such as Parkinson's disease, Alzheimer's disease, Huntington's disease, or amyotrophic lateral sclerosis (ALS)) (6) a pathology associated with a nutritional disease or disorder in which a portion of the nervous system is destroyed or damaged by a metabolic nutritional disorder or disease, such as a metabolic nutritional disorder or disorder. Disorders include vitamin B12 deficiency, folate deficiency, Wernicke disease, tobacco-alcohol amblyopia, (7) Neurological lesions associated with systemic disease, including, but not limited to, Kiafava-Vinami disease (primary degeneration of the corpus callosum) and alcoholic cerebellar degeneration. Diabetic neuropathy, Bell's palsy), systemic lupus erythematosus, cancer or sarcoma) but not limited to;
(8) lesions caused by toxic substances, including alcohol, lead, or certain neurotoxins; and (9) demyelinating lesions in which parts of the nervous system are destroyed or damaged by demyelinating diseases. , Multiple sclerosis, human immunodeficiency virus-related neuropathy, transverse neuropathy or various etiologies, progressive multifocal leukoencephalopathy, and central pontine myelinolysis).

In a preferred embodiment, galectin-11 polypeptides, polynucleotides, or agonists or antagonists of the invention are used to protect neurons from the deleterious effects of cerebral hypoxia. According to this embodiment, the galectin 11 composition of the invention is used to treat or prevent neuronal damage associated with cerebral hypoxia. In one aspect of this embodiment, a galectin-11 polypeptide, polynucleotide, or agonist or antagonist of the invention is used to treat or prevent neuronal damage associated with cerebral ischemia. In another aspect of this embodiment, a galectin-11 polypeptide, polynucleotide, or agonist or antagonist of the invention is used to treat or prevent neuronal damage associated with cerebral infarction. In another aspect of this embodiment, a galectin-11 polypeptide, polynucleotide, or agonist or antagonist of the invention is used to treat or prevent stroke-related neuronal damage. In a further aspect of this embodiment, a galectin-11 polypeptide, polynucleotide, or agonist or antagonist of the invention is used to treat or prevent nerve cell damage associated with a heart attack.

Compositions of the invention useful for treating or preventing a nervous system disorder can be selected by testing for biological activity in promoting neuronal survival or differentiation. For example (but not by way of limitation), a galectin-11 composition of the invention that elicits any of the following effects may be useful according to the invention: (1) increased survival time of neurons in culture; (2) increased sprouting of neurons in culture or in vivo; (3) increased production of neuron-associated molecules (eg, for motor neurons, choline acetyltransferase or acetylcholinesterase) in culture or in vivo; or (4) 2.) Symptoms of reduced neuronal dysfunction in vivo. Such an effect can be measured by any method known in the art. In a preferred, non-limiting embodiment, the increased survival of neurons is determined by methods described herein or otherwise known in the art (eg, Arakawa et al. (J. Ne.)
urosci. 10: 3507-3515 (1990)); increased sprouting of neurons can be measured by methods known in the art (eg, Pestronk et al. (Exp. Neurol. 70: 65-
82 (1980)) or Brown et al. (Ann. Rev. Neurosci.
4: 17-42 (1981)); increased production of neuron-associated molecules is known in the art and can be performed using techniques that depend on the molecule to be measured. Motor neuron dysfunction may be measured by assays, enzyme assays, antibody binding, Northern blot assays, etc .; and assessing the physical symptoms of motor neuron damage (eg, weakness, motor neuron conduction velocity or functional impairment) Can be measured by

In certain embodiments, motor neuron disorders that can be treated according to the present invention include, but are not limited to, the following: infarction, infection, exposure to toxins, trauma, surgical Disorders such as injury, degenerative diseases or malignancies that can affect motor neurons and other components of the nervous system, and amyotrophic lateral sclerosis and, but not limited to, progressive spinal muscular atrophy; Progressive bulbar palsy, primary lateral sclerosis, infantile and juvenile muscular atrophy, progressive bulbar palsy in children (
Disorders that selectively affect neurons, including Fachio-Ronde syndrome), polio and post-polio syndrome, and hereditary kinesthetic neuropathy (Charcot-Marie-Tooth disease).

Further examples of neurological disorders that can be treated or detected using the polynucleotides, polypeptides, agonists, and / or antagonists of the invention include:
Brain disorders (eg, metabolic brain disorders (including phenylketonuria such as maternal phenylketonuria, pyruvate carboxylase deficiency, pyruvate dehydrogenase complex deficiency, Wernicke encephalopathy, cerebral edema)) Brain neoplasms such as cerebellar neoplasms (including subventricular neoplasms, ventricular neoplasms such as choroid plexus neoplasms, hypothalamus neoplasms, supratentorial neoplasms, Canavan's disease), such as cerebellar ataxia Cerebellar disorders (including spinocerebellar degeneration (eg, ataxia telangiectasia), cerebellar coordination disorder, Friedreich's ataxia, Machado-Joseph disease, Olive bridge cerebellar atrophy), cerebellar neoplasms such as subtentive neoplasms Organisms, diffuse cerebral sclerosis (eg, periaxial encephalitis, bulbous cell leukodystrophy, metachromatic leukodystrophy and subacute sclerosing panencephalitis), cerebrovascular disorders (eg, Arterial disease (including carotid thrombosis, carotid stenosis and moyamoya disease), cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral atherosclerosis, cerebral arteriovenous malformations, cerebral artery disease, cerebral embolism And thrombosis (eg, carotid thrombosis, sinus thrombosis and Wallenberg syndrome), cerebral hemorrhage (eg, epidural hematoma, subdural hematoma and subarachnoid hemorrhage), cerebral infarction, cerebral ischemia (eg, Transient cerebral ischemia, subclavian artery stealing syndrome and vertebral base failure), vascular dementia (eg, multiple cerebral infarction dementia), vitiligo periplasm, vascular headache (eg, cluster headache, migraine), Dementia (eg, AIDS dementia complex, presenile dementia (eg, Alzheimer's disease and Creutzfeldt-Jakob disease), senile dementia (eg, Alzheimer's disease and progressive supranuclear palsy), vascular dementia (eg, Encephalitis (including periaxial encephalitis, viral encephalitis (eg, pandemic encephalitis, Japanese encephalitis, St. Louis encephalitis, tick-borne encephalitis and West Nile fever)), acute disseminated cerebrospinal cord Inflammation, meningoencephalitis (eg, uveoencephalitis syndrome, post-encephalitis Parkinson's disease and subacute sclerosing panencephalitis), cerebral malacia (eg, periatrial vitiligo), epilepsy (eg, generalized epilepsy (including lighting paralysis)) Apsans epilepsy, myoclonic epilepsy (including MERRF syndrome, tonic-clonic epilepsy), partial epilepsy (eg, complex partial epilepsy, frontal and temporal lobe epilepsy), post-traumatic epilepsy, status epilepticus (eg, (Including persistent partial epilepsy)), Harel-Folden-Spatz syndrome, hydrocephalus (eg, Dandy-Walker syndrome and And normal pressure hydrocephalus)
, Hypothalamic disorders (eg, hypothalamic neoplasms), cerebral malaria, narcolepsy (
Cataplexy, including cataplexy), medullary polio, cerebral pseudotumor, Rett syndrome, Reye syndrome, thalamus disease, toxoplasmosis, intracranial tuberculoma and Zellweger syndrome, central nervous system infections (eg, AIDS dementia complex, brain abscess, Subdural pyogenesis, encephalomyelitis (eg, equine encephalomyelitis, Venezuelan equine encephalomyelitis, necrotizing hemorrhagic encephalomyelitis),
Visna, cerebral malaria, meningitis (eg, arachnoid, aseptic meningitis (eg, viral meningitis (including lymphocytic choriomeningitis)), bacterial meningitis (hemophilus meningitis) , Including Listeria meningitis), meningococcal meningitis (e.g., Waterhouse-Friedericken syndrome, pneumococcal meningitis, and meningitis tuberculosis), fungal meningitis (e.g., cryptococcal medulla) Meningitis), subdural effusion, meningoencephalitis (eg, uveo-meningoencephalitis syndrome), myelitis (eg, transverse myelitis), neurosyphilis (eg,
Spinal fistula), polio (including medullary polio and post-polio syndrome), prion diseases (eg, Creutzfeldt-Jakob syndrome, bovine spongiform encephalopathy, Gerstmann-Stroisler syndrome, kuru, scrapie), cerebral toxoplasmosis,
Central nervous system neoplasms (eg, brain neoplasms (cerebellar neoplasms (eg, subtentive neoplasms))
, Ventricular neoplasms (eg, choroid plexus neoplasms), hypothalamic and supratentorial neoplasms, meningeal neoplasms, spinal neoplasms (including epidural neoplasms), demyelinating diseases (eg, , Canavan's disease), diffuse cerebral sclerosis (including diffuse cerebral sclerosis such as adrenoleukodystrophy, periaxial encephalitis, squamous cell leukodystrophy, metachromatic leukodystrophy),
Allergic encephalomyelitis, necrotizing hemorrhagic encephalomyelitis, progressive multifocal leukoencephalopathy, multiple sclerosis, central pontine myelinolysis, transverse myelitis, neuromyelitis optica, scrapie, lordosis, chronic fatigue syndrome , Visna, hypertension syndrome, meningopathy, spinal cord disease (eg, congenital myotonia, amyotrophic lateral sclerosis), spinal muscular atrophy (eg, Werdnig-Hoffman disease), spinal cord compression, spinal cord Neoplasms (eg, epidural neoplasms), syringomyelia, spinal fistula, stiff man syndrome, mental retardation (eg, Angelma)
n syndrome, cat barking syndrome, de Lange syndrome, Down syndrome), gangliosidosis (eg, gangliosidosis G (M1), Zandhov's disease, Tay-Sachs disease), heart nap disease, homocystinuria, Lawrence-moon -Beadle syndrome, Resh-Nyhan syndrome, maple syrup disease, mucolipidosis (
For example, fucose storage disease), erythropoietic celloidosis, ophthalmorenal syndrome, phenylketonuria (eg, maternal phenylketonuria), Prader-Willi syndrome, Rett syndrome, Rubinstein-Tevi syndrome, tuberous sclerosis , WAGR syndrome,
Nervous system abnormalities (eg, forebrain, neural tube defects (eg, encephalopathy (water encephalopathy (hy
))), Arnold-Chiari malformations, cerebral hernia, meningocele, meningocele, malunion (eg, cystic spina bifida and occult spina bifida), hereditary sensory neuropathy and motor neurons Disorders (including Charcot-Marie disease), hereditary ocular atrophy, Refsum's disease, hereditary spastic paraplegia,
Werdnig-Hoffman disease, hereditary motor and sensory neuron disorders (eg, congenital anesthesia and familial autonomic disorders), neurotic manifestations (
For example, dementia (including Gerstmann syndrome), amnesia (eg, retrograde amnesia), apraxia, neuropathic bladder disorder, cataplexy, impaired transmission (eg, hearing impairment (
Deafness, partial hearing loss, including loudness recruitment and tinnitus, speech disorders (eg, aphasia (including alexia, name aphasia, Broca aphasia and Wernicke aphasia), dyslexia (eg, acquired Dyslexia), language development disorders, speech disorders (eg, aphasia (including name aphasia, Broca aphasia and Wernicke aphasia)), dysarthria, communication disorders (eg, speech disorders (dyslexia, reverberant language, silence and Stuttering), dysphonia (eg, ataxia and hoarseness),
Decerebrate stiffness, delirium, fasciculation, hallucinations, meningopathy, movement disorders (eg, Angel
man syndrome, ataxia, athetosis, chorea, ataxia, hypokinesia, hypotonia, myoclonus, tics, torticollis and tremor), hypertonia (eg, stiffness (eg, stiff man syndrome), muscle Spasticity, paralysis (for example, facial paralysis (
Gastric palsy, hemiplegia, ophthalmoplegia (eg, diplopia, Duane's syndrome, Horner's syndrome, chronic progressive external ophthalmoplegia (eg, Keen's syndrome)), bulbar palsy, tropical Spastic paraparesis, paraplegia (eg, Brown-Secar syndrome, quadriplegia), respiratory and vocal cord paralysis, paresis), phantom limb, taste disorders (eg, anesthesia and dysphagia), visual impairment (eg, , Amblyopia, blindness, color blindness, diplopia, semi-blindness, scotoma and subnormal vision), sleep disorders (eg, hypersomnia (including Kleine-Levin syndrome), insomnia, and sleepwalking), spasticity (eg, , Trismus), loss of consciousness (eg, coma, persistent vegetative state and syncope) and dizziness, neuromuscular disorders (eg, congenital myotonia, amyotrophic lateral sclerosis, Lambert-Eaton myasthenia) Syndrome, motor neuron disease, muscular atrophy (e.g., spinal muscular atrophy,
Charcot-Marie disease and Werdnig-Hoffman disease), post-polio syndrome,
Muscular dystrophy, myasthenia gravis, atrophic myotonia, congenital myotony, nemarin myopathy, familial periodic limb paralysis, polyparamyoclonus (param)
yloclonus), tropical spastic paraparesis and stiff man syndrome),
Peripheral nervous system disorders (eg apical pain), amyloid neuropathy, autonomic nervous system disorders (eg Ardy syndrome, Barre-Lieou syndrome, familial autonomic dysfunction, Horner syndrome, reflex sympathetic dystrophy and Shy-
Dräger syndrome), cranial nerve diseases (for example, acoustic nerve disease (for example, acoustic neuroma (2
Neurofibromatosis), facial nerve disorders (eg, facial neuralgia, Mercarson-Rosenthal syndrome, oculomotor disorders (including amblyopia, nystagmus, oculomotor paralysis),
Ophthalmoplegia (eg, Duane's Syndrome, Horner's Syndrome, Chronic Progressive External Ophthalmoplegia (including Keynes' Syndrome)), Strabismus (eg, Internal and External Strabismus), Optic Nerve, Optic Neuropathy (eg, Eye Atrophy) (Including hereditary ocular atrophy), optic disc crystal space, optic neuritis (eg, optic neuromyelitis, papillary edema), trigeminal neuralgia, vocal cord paralysis, demyelinating disease (eg, optic neuromyelitis and lordosis) , Diabetic neuropathy (eg, diabetic foot), nerve crush syndrome (eg, carpal tunnel syndrome, tarsal tunnel syndrome), thoracic outlet syndrome (eg, cervical rib syndrome), ulnar nerve crush syndrome, neuralgia (
For example, causalgia, cervical and neuralgia, facial and trigeminal neuralgia), neuritis (
For example, experimental allergic neuritis, optic neuritis, polyneuritis, polyradiculoneuritis and radiculitis (eg, polyradiculitis), hereditary motor and sensory neuronal disorders (eg, Charcot-Marie disease), hereditary eye atrophy,
Refsum's disease, hereditary spastic paraplegia and Werdnig-Hoffman disease, hereditary sensory and autonomic neuronal disorders (including congenital analgesia and familial autonomic disorders), POEMS syndrome, sciatica, taste Sweating and tetany).

In accordance with yet a further aspect of the present invention, galectin-11 polynucleotides or polypeptides, and agonists or antagonists of galectin-11, are used to modulate epithelial cell proliferation and basal keratinocytes for therapeutic purposes, eg, for wound healing purposes. Processes for utilization are provided to stimulate and to stimulate hair follicle production and skin wound healing. Galectin-11 polynucleotides or polypeptides, and agonists or antagonists of galectin-11, may be clinically useful in stimulating wound healing, including: surgical wounds, resected wounds, deep wounds (dermis and epidermis) Ocular wounds, tooth tissue wounds, oral wounds, diabetic ulcers, skin ulcers,
Elbow ulcers, arterial ulcers, venous stasis ulcers, heat or chemical burns, and other abnormal wound healing conditions (eg, uremia, malnutrition, vitamin deficiency, and steroids, radiotherapy) And complications associated with systemic treatment with antineoplastic drugs and antimetabolites). Galectin-11 polynucleotides or polypeptides, as well as galectin-11 agonists or antagonists, can be used to promote skin recovery after skin loss.

Galectin-11 polynucleotides or polypeptides, as well as galectin-11 agonists or antagonists, can be used in wound beds.
Can be used to increase the attachment of skin grafts to the skin and to stimulate re-epithelialization from the wound bed. The following are types of grafts in which a galectin 11 polynucleotide or polypeptide, a galectin 11 agonist or antagonist can be used to increase adhesion to the wound bed: autograft, artificial skin, allograft (Allograft), autograft, autoepidermal graft (autoep)
dermic graft, avascular graft, Blair-
Brown grafts, bone grafts, embryonic tissue grafts, dermal grafts, delayed grafts, skin grafts, epidermal grafts, fascia grafts, full thickness skin grafts, xenografts
ogous graft, xenograft, allograft (
homologous graft, proliferative graft, lamellar graft, reticular graft, mucosal graft, Olie-Tielsch graft, omental graft (omenpal)
graft, patch graft, stalk graft, full thickness graft (penetrat)
ing graft, split skin grafts, split skin grafts. Galectin-11 polynucleotides or polypeptides, as well as galectin-11 agonists or antagonists, can be used to promote skin strength and improve the appearance of aged skin.

Galectin-11 polynucleotides or polypeptides, as well as galectin-11 agonists or antagonists, may also alter hepatocyte proliferation and epithelial cell proliferation in lung, breast, pancreas, stomach, small intesting, and large intestine. Likely to occur. Galectin-11 polynucleotides or polypeptides, as well as galectin-11 agonists or antagonists, can be used in epithelial cells (eg, sebocytes, hair follicles, hepatic parenchymal cells, alveolar epithelial cells type II pneumocyte, mucin production). Goblet cells, and other epithelial cells, and their precursors contained in the skin, lung, liver, and gastrointestinal tract). Galectin-11 polynucleotides or polypeptides, agonists or antagonists can promote proliferation of endothelial cells, keratinocytes, and basal keratinocytes.

Galectin-11 polynucleotides or polypeptides, as well as galectin-11 agonists or antagonists, can also be used to reduce intestinal toxic side effects resulting from irradiation, chemotherapeutic treatment or viral infection. Galectin 11 polynucleotide or polypeptide, and galectin 11
May have a cytoprotective effect on the small intestinal mucosa. Galectin-11 polynucleotides or polypeptides, as well as galectin-11 agonists or antagonists, can also stimulate the healing of mucositis (oral mucosa) resulting from chemotherapy and viral infection.

Galectin-11 polynucleotides or polypeptides, as well as galectin-11 agonists or antagonists, can be used to adequately regenerate the skin (ie, hair follicles, sweat glands, And regrowth of sebaceous glands), and can be used further in the treatment of other skin defects such as psoriasis. Galectin-11 polynucleotides or polypeptides, as well as galectin-11 agonists or antagonists, can be used to induce epidermolysis bullosa, a frequent open and painful blister by promoting re-epithelialization of these lesions, into the intrinsic dermis. Can be used to treat defects in epidermal adhesion. Galectin-11 polynucleotides or polypeptides, and agonists or antagonists of galectin-11, also treat gastric and duodenal ulcers, and by scarring of the lining of the mucosa and more rapidly regenerating the lining of the glandular and duodenal mucosa. Can be used to help heal. Inflammatory bowel diseases (eg, Coulomb's disease and ulcerative colitis) are diseases that result in disruption of the mucosal surface of the small or large intestine, respectively. Thus, galectin-11 polynucleotides or polypeptides, as well as galectin-11 agonists or antagonists, promote resurfacing of mucosal surfaces to aid more rapid healing and prevent the development of inflammatory bowel disease Can be used to Treatment with a galectin-11 polynucleotide or polypeptide, an agonist or antagonist of galectin-11 is expected to have a significant effect on the production of mucosa throughout the gastrointestinal tract, and the intestinal mucosa may be ingested or surgically treated. Can be used to protect against harmful substances after surgery. Galectin-11 polynucleotides or polypeptides, as well as galectin-11 agonists or antagonists, can be used to treat diseases associated with galectin-11 expression.

In addition, galectin-11 polynucleotides or polypeptides, as well as galectin-11 agonists or antagonists, can be used to prevent and cure lung damage due to various pathological conditions. Galectin-11 polynucleotides or polypeptides, and / or agonists or antagonists of galectin-11, can stimulate proliferation and differentiation to prevent or treat acute or chronic lung injury, and induce alveolar and bronchial
lar) may promote epithelial repair. For example, bronchial epithelium and alveoli (aveol)
Emphysema (which results in progressive loss of alveoli) and inhalation damage (ie, resulting from smoke inhalation and burns), resulting in necrosis of i), are caused by galectin 11 polynucleotides or polypeptides, galectin 11 Can be effectively treated using agonists or antagonists. Also, galectin-11 polynucleotides or polypeptides, as well as galectin-11 agonists or antagonists, can be used to stimulate the proliferation and differentiation of alveolar epithelial cell type II, which can be used to stimulate the vitreous membrane disease in immature infants. For example, it can help treat or prevent diseases such as infant respiratory distress syndrome and bronchopulmonary dysplasia.

Galectin-11 polynucleotides or polypeptides, as well as galectin-11 agonists or antagonists, can stimulate the proliferation and differentiation of hepatic parenchymal cells and, therefore, hepatic diseases and conditions, such as fulminant hepatic failure caused by cirrhosis , Hepatitis virus and toxic agents (ie, liver damage caused by acetaminophen, carbon tetrachloride, and other art-known hepatotoxins)).

Additionally, galectin-11 polynucleotides or polypeptides, as well as galectin-11 agonists or antagonists, can be used to treat or prevent the development of diabetes mellitus. In patients newly diagnosed with Type I and Type II diabetes, if some islet cell functions remain, galectin-11 polynucleotides or polypeptides, and agonists or antagonists of galectin-11, may cause the persistence of the disease. It can be used to maintain its islet function, such as to reduce, delay or prevent sexual development. Also, galectin-11 polynucleotides or polypeptides, as well as galectin-11 agonists or antagonists, can be used as an aid in islet cell transplantation to improve or promote islet cell function.

Galectin-11 polynucleotides or polypeptides, or galectin-11 agonists or antagonists, can be used to treat cardiovascular disorders, including peripheral arterial disease such as limb ischemia.

Cardiovascular disorders include arterio-arterial fistulas.
stula), arteriovenous fistula, cerebral arteriovenous congenital anomaly, congenital heart defect (congeni)
tal heart defects), cardiovascular abnormalities such as pulmonary valve atresia, and scimitar syndrome. Congenital heart defects include aortic constriction, triatrial heart, coronary vessel anomalies.
, Cross heart, right thoracic heart, patent ductus arteri
osus), Ebstein malformation, Eisenmenger complex, left ventricular dysgenesis syndrome, left thoracic heart, tetralogy of Fallot, transposition of great arteries, right ventricle of both great vessels, tricuspid regurgitation, remnant ductus arteriosus , And heart septal defect
ts) (eg, aortopulmonary septum defect)
eptal defect, endocardial bed deficiency, Ryutanbache syndrome, trilogy of Fallot, ventricular heart septum (ventricular heart sep)
tal defects))).

Cardiovascular disorders also include arrhythmias, carcinoid heart disease, high cardiac output (hi
gh cardiac output, low cardiac output (low cardiac)
output), cardiac tamponade, endocarditis (including bacterial), cardiac aneurysm,
Cardiac arrest, congestive heart failure, congestive cardiomyopathy, paroxysmal dyspnea, cardiac edema, cardiac hypertrophy, congestive cardiomyopathy, left ventricular hypertrophy, right ventricular hypertrophy, post-infarction cardiac rupture (post-inf)
arct heart rupture, ventricular septal rupture, heart valve disease,
Myocardial disease, myocardial ischemia, endocardial effusion, epicarditis (including infarct and tuberculosis),
Air pericardiopathy, post-pericardiotomy syndrome, right heart disease, rheumatic heart disease, ventricular dysfunction, hyperemia, cardiovascular pregnancy complication (cardiovascular pregnancy)
complications, scimitar syndrome, cardiovascular syphilis, and heart diseases such as cardiovascular tuberculosis.

The arrhythmia includes sinus arrhythmia, atrial fibrillation, atrial flutter, bradycardia, extrasystole, Adams-Stokes syndrome, leg block, sinoatrial block, long QT syndrome (long
QT syndrome, accessory contractions, Lone-Gangong-Levine syndrome, Mahaim-type pre-excita syndrome
sion syndrome), Wolf-Parkinson-White syndrome, sinus dysfunction syndrome, tachycardia, and ventricular fibrillation. Tachycardia includes paroxysmal tachycardia,
Supraventricular tachycardia, ventricular specific rhythm promotion, atrioventricular nodal reentrant tachycardia (atrioventri
Circular nodal reentry tachycardia), ectopic atrial tachycardia, ectopic junctional tachycardia, sinoatrial nodal reentry tachycardia (sinoatrial no)
dal reentry tachycardia), sinus tachycardia, torsade
De pointes, and ventricular tachycardia.

[0366] Heart valve diseases include aortic valve dysfunction, aortic stenosis, heart murmur (hea).
murmurs), aortic valve prolapse, mitral valve prolapse, tricuspid valve prolapse, mitral dysfunction, mitral stenosis, pulmonary valve regurgitation, pulmonary valve dysfunction, pulmonary valve stenosis, tricuspid Examples include atresia, tricuspid dysfunction, and tricuspid stenosis.

Cardiomyopathy includes alcoholic cardiomyopathy, congestive cardiomyopathy, hypertrophic cardiomyopathy, hypovalvular aortic stenosis, hypovalvular pulmonary stenosis, restricted cardiomyopathy, Chagas cardiomyopathy, intracardiac Membrane fibroelastosis, endocardial myocardial fibrosis, Keynes syndrome, myocardial reperfusion injury, and myocarditis.

Myocardial ischemia includes angina, coronary aneurysm, coronary atherosclerosis, coronary artery thrombosis, coronary vasospasm, myocardial infarction, and myocardial stunnin
g) coronary artery disease.

Cardiovascular diseases also include aneurysms, angiogenesis, hemangiomatosis, bacterial hemangioma symptoms, Hippel-Lindau disease (Hippel-Lindau disease).
), Klipel-Tornonnay-Weber Syndrome, Sturge-Weber Syndrome,
Vasomotor edema, aortic disease, Takayasu arteritis, aortitis, Lurish syndrome,
Arterial occlusive disease, arteritis, arteritis, arteritis nodosa, cerebrovascular disorder, diabetic vascular disorder, diabetic retinopathy, embolism, thrombosis, acrolysis, hemorrhoid, liver Venous obstruction disorder, hypertension, hypotension, ischemia, peripheral vascular disorder, phlebitis, pulmonary vein obstruction disease, hypertension, hypotension, ischemia, peripheral vascular disease, phlebitis, pulmonary vein obstruction disease, Raynaud's disease, CREST syndrome, Retinal vein occlusion, scimitar syndrome, superior vena cava syndrome, telangiectasia, telangiectasia ataxia (atasia tela)
ngectasia), hereditary hemorrhagic telangiectasia, varicocele, varicose veins, varicose ulcers, vasculitis, and vascular diseases such as venous insufficiency.

[0370] Aneurysms include dissecting aneurysms, pseudoaneurysms, infected aneurysms, ruptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary aneurysms, cardiac aneurysms, and iliac aneurysms Is mentioned.

[0371] Arterial occlusive diseases include arteriosclerosis, intermittent claudication, carotid stenosis, fibromuscular dysplasia, mesenteric vascular occlusion, Moyamoya disease, renal artery occlusion, retinal artery occlusion, and obstructive thrombus Vasculitis.

Cerebrovascular disorders include carotid artery disease, cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arteriovenous malformations, cerebral artery disease, cerebral embolism and thrombosis, Carotid thrombosis, sinus thrombosis, Wallenberg syndrome, cerebral hemorrhage, epidural hematoma, subdural hematoma, subarachnoid hemorrhage (subaraxhnoid he
morrhage), cerebral infarction, cerebral ischemia (including transient), subclavian artery steal syndrome, periventricular leukomalac
ia), vascular headache, cluster headache, migraine, and vertebral base (vertebro)
basilar) dysfunction.

[0393] Embolisms include air embolism, amniotic fluid embolism, cholesterol embolism, toe cyanosis syndrome, fat embolism, pulmonary embolism, and thromboembolism. Thrombosis includes coronary thrombosis, hepatic vein thrombosis, retinal vein occlusion, carotid thrombosis,
Sinus thrombosis, Wallenberg syndrome, and thrombophlebitis.

As ischemia, cerebral ischemia, ischemic colitis, partition syndrome (compartme
nt syndrome, anterior compartment syndrome
ment syndrome, myocardial ischemia, reperfusion injury, and peripheral limb ischemia. As vasculitis, aoritis, arteritis, Behce (Behce)
t) Syndrome, Churg-Strauss syndrome, mucocutaneous lymph node syndrome, obstructive thrombotic vasculitis, irritable vasculitis, Schönlein-Henoch purpura (Schoenl)
ein-Henoch purpura), allergic cutaneous vasculitis and Wegener's granulomatosis.

Galectin-11 polynucleotides or polypeptides, or galectin-11 agonists or antagonists, are particularly effective for the treatment of dangerous limb ischemia and coronary artery disease.

The galectin-11 polypeptide can be administered using any method known in the art, including direct needle injection at the site of delivery, intravenous injection, topical administration, catheter injection. , Biolistic injection, particle accelerators, gel foam sponge depots, other commercially available depot materials, osmotic pumps, solid pharmaceutical formulations for oral or suppository, intraoperative decanting or topical application, aerosol delivery. But not limited to these. Such methods are known in the art. Galectin-11 polypeptides can be administered as part of a Therapeutic, described in more detail below. Methods for delivering Galectin-11 polynucleotides are described in more detail herein.

The naturally occurring equilibrium between an endogenous stimulator and an inhibitor of angiogenesis is that in which inhibitory effects predominate. Rastinejad et al., Cell 5
6: 345-355 (1989). In the rare cases where neovascularization occurs under normal physiological conditions (eg, wound healing, organ regeneration, embryonic development, and the female reproductive process), angiogenesis is tightly regulated and spatially and temporally Is determined. Pathological conditions of angiogenesis (eg, characterizing solid tumor growth)
Under these conditions, control of these adjustments is not possible. Unregulated angiogenesis becomes pathological and maintains the progression of many neoplastic and non-neoplastic diseases. Many serious diseases are governed by abnormal neovascularization, including solid tumor growth and metastasis, arthritis, some types of ocular disorders and psoriasis. For example, Mo
ses et al., Biotech. 9: 630-634 (1991); Folkman.
Et al. Engl. J. Med. 333: 1775-1763 (1995);
Auerbach et al. Microvasc. Res. 29: 401-411
(1985); Folkman, Advances in Cancer Re.
Academic P, edited by search, Klein and Weinhouse
Resz, New York, pp. 175-203 (1985); Patz, Am
. J. Opthalmol. 94: 715-743 (1982); and Fol.
See the review by Kman et al., Science 221: 719-725 (1983). In many pathological conditions, the process of angiogenesis contributes to the disease state. For example, significant data has been accumulated that suggests that solid tumor growth is dependent on angiogenesis. Folkman and Klagsbrunn, S
science 235: 442-447 (1987).

The present invention provides for the treatment of a disease or disorder associated with neovascularization by administration of a polynucleotide and / or polypeptide of the invention, and an agonist or antagonist of the invention. Malignant and metastatic conditions that can be treated with the polynucleotides and polypeptides of the present invention, or agonists or antagonists, include the malignancies, solid tumors, and cancers described herein, as well as others known in the art. (For a review of such disorders, see Fishman
Et al., Medicine, 2nd ed. B. Lippincott Co. , Ph
iladelphia (1985)). Accordingly, the present invention provides a method of treating an angiogenesis-related disease and / or disorder, the method comprising: administering a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and / or agonist of the present invention to a subject. Administering to an individual in need of treatment. For example, the polynucleotides, polypeptides, antagonists and / or agonists of the present invention can be utilized in various additional ways to therapeutically treat cancer or tumors. The polynucleotide of the present invention,
Cancers that can be treated with polypeptides, antagonists and / or agonists include prostate cancer, lung cancer, breast cancer, ovarian cancer, gastric cancer, pancreatic cancer, laryngeal cancer, esophageal cancer, testicular cancer, liver cancer, parotid gland cancer, bile duct cancer , Colon cancer, rectal cancer, cervical cancer, uterine cancer, endometrial cancer,
Solid tumors including kidney, bladder, and thyroid cancers; primary tumors and metastases; melanomas; glioblastomas; kaposi's sarcoma; leiomyosarcoma; non-small cell lung cancer; colorectal cancer; advanced (adv
anced) malignancies; and tumors arising from the blood (eg, leukemia). For example, the polynucleotides, polypeptides, antagonists and / or agonists of the present invention can be delivered locally to treat cancers such as skin cancer, head and neck tumors, breast tumors and Kaposi's sarcoma.

In yet other aspects, the polynucleotides, polypeptides, antagonists and / or agonists of the invention can be utilized to treat the surface morphology of bladder cancer, for example, by intravesical administration. Polynucleotides, polypeptides of the invention,
Antagonists and / or agonists can be delivered directly to the tumor or near the tumor site via injection or catheter. Of course, as the skilled artisan will appreciate, the appropriate mode of administration will vary depending on the cancer being treated.
Other modes of delivery are discussed herein.

The polynucleotides, polypeptides, antagonists and / or agonists of the present invention may be useful in treating other disorders, including angiogenesis, in addition to cancer. These disorders include, but are not limited to: benign tumors (eg, hemangiomas, acoustic neuromas, neurofibromas, trachoma, and purulent granulomas); atherosclerotic plaques; ocular angiogenesis Diseases (eg, diabetic retinopathy,
Immature retinopathy, macular degeneration, corneal transplant rejection, neovascular glaucoma, retro lens fibroplasia, rubeosis, retinoblastoma, uveitis, and pterygium of the eye (
Rheumatoid arthritis; psoriasis; delayed wound healing; endometriosis; angiogenesis; granulation; hyperplastic scars (keloids); pseudoarticular fractures; Vascular adhesion; myocardial angiogenesis; coronary collaterals (coro);
arteriovenous malformations; ischemic limb angiogenesis; Osler-Webber syndrome; plaque neovascularization; telangiectasia; hemophilic joints; angiofibromas Fibromuscular dysplasia; wound granulation; Crohn's disease; and atherosclerosis.

For example, in one aspect of the present invention, treating hyperplastic scars and keloids comprises administering a polynucleotide, polypeptide, antagonist and / or agonist of the present invention to the hyperplastic scars or keloids. A method is provided for doing so.

In one embodiment of the invention, polynucleotides, polypeptides, antagonists and / or agonists are injected directly into hyperplastic scars or keloids to prevent the progression of these lesions. This treatment is particularly valuable in the prophylactic treatment of conditions known to result in the development of hyperplastic scars and keloids (eg, burns), and preferably during the time when the proliferative phase progresses (for the first injury). (After about 14 days) but before the onset of hyperplastic scars or keloids. As mentioned above, the present invention also relates to neovascular diseases of the eye (eg,
(Including corneal neovascularization, neovascular glaucoma, proliferative diabetic retinopathy, post-lens fibroplasia and macular degeneration).

Further, the polynucleotides and polypeptides of the present invention (agonists and / or
Or ocular disorders associated with neovascularization that can be treated with an angiogenesis (including, but not limited to, antagonists) include, but are not limited to: neovascular glaucoma, diabetic retinopathy, retinoblastoma, retro lens fibrosis Hyperplasia, uveitis, immature retinopathy, macular degeneration, corneal transplant neovascularization, and other inflammatory diseases of the eye, tumors of the eye,
And diseases associated with choroidal or iris neovascularization. For example, Waltma
n et al., Am. J. Ophthal. 85: 704-710 (1978) and G
Artner et al., Surv. Ophthal. 22: 291-32 (1978)
)).

Thus, in one aspect of the invention, a therapeutically effective amount of a compound (as described above)
For treating ocular neovascularization diseases such as corneal neovascularization (including corneal transplant neovascularization), which comprises administering to a patient the cornea such that the formation of blood vessels is inhibited. Is provided. Briefly, the cornea is tissue that usually lacks blood vessels. However, in certain pathological conditions, capillaries can extend from the marginal pericorneal plexus to the cornea. When the cornea becomes vascularized, the cornea also becomes cloudy, resulting in impaired vision for the patient. If the cornea is completely opaque, vision loss can be complete. A wide variety of disorders can result, for example, in corneal neovascularization, including: corneal infections (eg, trachoma, herpes simplex keratitis, leishmaniasis and onchocerciasis), immunological processes (eg, graft rejection) And Stevens-Johnson syndrome)
As a complication of alkaline burns, trauma, inflammation (of any cause), toxic and nutrient deficiencies, and wearing contact lenses.

In a particularly preferred embodiment, the invention can be prepared for topical administration in saline (in combination with any of the preservatives and antibacterials commonly used in ophthalmic preparations) and eye drops It can be administered in the form. Solutions or suspensions may be prepared in their pure form and administered several times a day. Alternatively, the anti-angiogenic composition prepared as described above can also be administered directly to the cornea. In a preferred embodiment, the anti-angiogenic composition is prepared with a mucoadhesive polymer that binds to the cornea. In a further embodiment, an anti-angiogenic factor or an anti-angiogenic composition may be utilized as an adjunct to conventional steroid therapy. Topical treatment may also be useful prophylactically in corneal lesions that are known to have a high potential to induce an angiogenic response (eg, chemical burns). In these cases, treatment (possibly combined with steroids) can be started immediately to help prevent subsequent complications.

In another embodiment, the above compounds may be injected by an ophthalmologist directly under the guidance of a microscope into the corneal stroma. While the preferred injection site may vary in the form of individual lesions, the goal of administration is to place the composition on the advancing surface of the vasculature (ie, distributed between the blood vessels and the normal cornea). ). In most cases, this would be peril (peril) to "protect" the cornea from advancing blood vessels.
imbic) including corneal injections. This method can also be used immediately after corneal injury to prevent corneal neovascularization prophylactically. In this situation, the substance can be injected into the perilimbic cornea dispersed between the corneal lesion and the edge of its unwanted potential blood supply. Such methods can also be used to prevent capillary infiltration of the implanted cornea in a similar manner. In a sustained release form, injections may be 2 to 3
Only three times may be required. Steroids may also be added to the injection solution to reduce inflammation resulting from the injection itself.

In another aspect of the present invention, the method includes administering to a patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and / or agonist of the present invention so as to inhibit blood vessel formation. A method for treating neovascular glaucoma is provided. In one embodiment, the compound may be administered topically to the eye to treat early forms of neovascular glaucoma. In other embodiments, the compound can be implanted by injection into the area of the anterior chamber angle. In other embodiments, the compound may also be located at any location so that the compound is continuously released into the aqueous humor. In another aspect of the invention, a proliferative diabetic comprising administering to the patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and / or agonist such that blood vessel formation is inhibited. Methods are provided for treating retinopathy.

In a particularly preferred embodiment of the invention, proliferative diabetic retinopathy is directed to the aqueous humor or the vitreous to increase the local concentration of polynucleotides, polypeptides, antagonists and / or agonists in the retina. It can be treated by injection. Preferably, this treatment should be started before the acquisition of a serious disease requiring photocoagulation.

In another aspect of the present invention, the method comprises administering to a patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and / or agonist of the present invention to the eye such that blood vessel formation is inhibited. Provided are methods for treating post lens fibroplasia. The compound may be administered locally via intravitreal injection and / or via intraocular implantation.

Further, the polynucleotides, polypeptides, agonists and / or
Or disorders that may be treated with an agonist include, but are not limited to: hemangiomas, arthritis, psoriasis, angiofibromas, atherogenic plaques, delayed wound healing, granulation, hemophilic joints, Hyperplastic scars, pseudoarticular fractures, Osler-Weber syndrome, purulent granulomas, scleroderma, trachoma, and vascular adhesions.

Additionally, disorders and / or conditions that can be treated with the polynucleotides, polypeptides, agonists and / or agonists include, but are not limited to: solid tumors, blood born Tumors (eg, leukemia), tumor metastases, Kaposi's sarcoma, benign tumors (eg, hemangiomas, acoustic neuromas, neurofibromas, trachoma, and purulent granulomas), rheumatoid arthritis,
Psoriasis, ocular angiogenesis disorders (eg, diabetic retinopathy, immature retinopathy, macular degeneration, corneal transplant rejection, neovascular glaucoma, retrolental fibroplasia, rubeosis, retinoblastoma, and uveitis), Delayed wound healing, endometriosis, angiogenesis, granulation, hyperplastic scar (keloid), pseudoarticular fracture, scleroderma, trachoma, vascular adhesion, myocardial neovascularization, coronary collaterals ( coronary collaterals), collateral collaterals, arteriovenous malformations, ischemic limb angiogenesis, Ausler-Weber syndrome,
Plaque neovascularization, telangiectasia, hemophilic joints, angiofibroma, fibromuscular dysplasia, wound granulation, Crohn's disease, atherosclerosis, birth control drugs (
By controlling menstruation, by preventing angiogenesis required for embryo implantation, pathogenic consequences (eg, cat scratch disease (Rochele minalia qu
diseases with angiogenesis such as (intosa), ulcers (Helicobacter pylori), bartonellosis and bacterial hemangioma symptoms).

In one aspect of the birth control method, an amount of the compound sufficient to block embryo implantation is administered before or after sexual intercourse and fertilization occurs, and thus is an effective method of birth control, presumably "post-hoc (Morning after) method. The polynucleotides, polypeptides, agonists and / or agonists of the present invention may also be used in controlling menstruation or administered either as a peritoneal lavage in the treatment of endometriosis or for peritoneal transplantation. Can be done.

The polynucleotides, polypeptides, agonists and / or agonists of the invention can be incorporated into surgical sutures to prevent stitch granulomas.

The polynucleotides, polypeptides, agonists and / or agonists of the invention can be utilized in a wide variety of surgical procedures. For example, in one aspect of the invention, the composition (eg, in the form of a spray or film) comprises:
It may be used to coat or spray the area prior to tumor removal to separate normal surrounding tissue from malignant tissue and / or to prevent spread of disease to surrounding tissue. In another aspect of the invention, the composition (eg, in the form of a spray) is delivered via an endoscopic procedure to coat a tumor or to inhibit angiogenesis at a desired location. obtain. In yet another aspect of the present invention, a surgical mesh coated with the anti-angiogenic composition of the present invention can be utilized in any procedure where a surgical mesh can be utilized. For example, in one embodiment of the present invention, a surgical mesh laden with an anti-angiogenic composition provides support for the structure and releases a certain amount of anti-angiogenic factors. It can be used during abdominal cancer resection surgery (eg, after colectomy).

In a further aspect of the invention, the polynucleotides, polypeptides, agonists and / or agonists of the invention are recruited to a tumor after resection so that local recurrence of the cancer and formation of new blood vessels at the site are inhibited. A method is provided for treating a tumor resection site comprising administering to the resection margin. In one embodiment of the invention, the anti-angiogenic compound is administered directly to the site of tumor excision (eg, smearing, brushing, or otherwise excising the tumor margin with an anti-angiogenic compound). Applied by coating). Alternatively, the anti-angiogenic compound may be incorporated into a known surgical paste prior to administration. In a particularly preferred embodiment of the invention, the anti-angiogenic compound is applied after hepatectomy for malignancy and after neurosurgery.

In one aspect of the invention, the polynucleotides, polypeptides, agonists and / or agonists of the invention can be used in a wide variety of tumors, such as breast tumors,
(Including colon, brain and liver tumors). For example, in one embodiment of the present invention, an anti-angiogenic compound may be administered to a site of a neurological tumor after resection so that the formation of new blood vessels at that site is inhibited.

The polynucleotides, polypeptides, agonists and / or agonists of the invention can also be administered with other anti-angiogenic factors. Representative examples of other anti-angiogenic factors include the following: anti-invasive factors, retinoic acid and its derivatives, paclitaxel, suramin, tissue inhibitors of metalloproteinase-1, tissue inhibitors of metalloproteinase-2, Plasminogen activation inhibitor-1, plasminogen activation inhibitor-2 and various forms of lighter "group d" transition metals.

The lighter “Group d” transition metals include, for example, vanadium, molybdenum, tungsten, titanium, niobium and tantalum species. Such transition metal species can form a transition metal complex. Suitable complexes of the above transition metal species include oxo transition metal complexes.

[0399] Representative examples of vanadium complexes include oxovanadium complexes such as vanadate complexes and vanadyl complexes. Suitable vanadate complexes include metavanadate and orthovanadate complexes such as, for example, ammonium metavanadate, sodium metavanadate and sodium orthovanadate. Suitable vanadyl complexes include, for example, vanadyl acetylacetonate and vanadyl sulfate (including vanadyl sulfate hydrates such as vanadyl sulfate monohydrate and vanadyl sulfate trihydrate).

[0400] Representative examples of tungsten complexes and molybdenum complexes also include oxo complexes. Suitable oxotungsten complexes include tungstate complexes and tungsten oxide complexes. Suitable tungstate complexes include ammonium tungstate, calcium tungstate, sodium tungstate dihydrate and tungstic acid. Suitable tungsten oxides include tungsten (IV) oxide and tungsten (VI)
Oxides. Suitable oxomolybdenum complexes include molybdate,
Molybdenum oxide and molybdenyl complexes. Suitable molybdate complexes include ammonium molybdate and its hydrates, sodium molybdate and its hydrates, and potassium molybdate and its hydrates. Suitable molybdenum oxides include molybdenum (VI) oxide,
Molybdenum (VI) oxide and molybdic acid. Suitable molybdenyl complexes include, for example, molybdenyl acetylacetonate. Other suitable tungsten and molybdenum complexes include, for example, hydroxo derivatives from glycerol, tartaric acid and sugars.

A wide variety of other anti-angiogenic factors may also be utilized in the context of the present invention. Representative examples include: platelet factor 4; protamine sulfate; sulfated chitin derivative (prepared from queen crab shell) (Murata et al., Cancer Res. 51: 22-26; 1991)
Sulfated polysaccharide peptidoglycan complex (SP-PG) (the function of this compound may be enhanced by the presence of steroids (eg, estrogens) and tamoxifen citrate); staurosporine; regulators of substrate metabolism (eg, Including proline analogs, cis hydroxyproline, d, L-3,4-dehydroproline, thiaproline, α, α-dipyridyl, aminopropionitrile fumarate)
4-propyl-5- (4-pyridinyl) -2 (3H) -oxazolone; methotrexate; mitozantrone; heparin; interferon; 2 macroglobulin-serum; ChIMP-3 (Pavloff et al., J. Bio. Chem. 267).
: 17321-17326, 1992); chymostatin (Tomkinson et al., Biochem J. 286: 475-480, 1992); cyclodextrin tetradecasulfate; eponemycin; camptothecin; fumagillin (
Ingber et al., Nature 348: 555-557, 1990); sodium gold thiomalate ("GST"; Matsubara and Ziff, JC).
lin. Invest. 79: 1440-1446, 1987); anti-collagenase-serum; α2-antiplasmin (Holmes et al., J. Biol. Chem.).
. 262 (4): 1659-1664, 1987);
nal Cancer Institute); lobenzarit disodium (
N- (2) -carboxyphenyl-4-chloroanthronic acid (chloroa
nthronic acid) disodium, ie "CCA"; Tak
euchi et al., Agents Actions 36: 312-316,199.
2); Thalidomide; Angostatic steroid; AGM-1470; carboxyaminoimidazole (carboxynaminomidazole)
); And metalloproteinase inhibitors (eg, BB94).

Thus, in one aspect, the present invention relates to a method for enhancing apoptosis, cell proliferation, cell differentiation, or other cell proliferative activity regulated by galectin 11, wherein the method comprises an increased level of In an individual in need of a galectin-11 functional or biological activity, a therapeutically effective amount of a galectin-11 polypeptide, fragment, variant, derivative or analog or agonist capable of increasing a galectin-11 mediated cellular response is provided. Administering. In certain embodiments, galectin-11 mediated signaling is increased to treat diseases that exhibit reduced apoptosis.

Given the activity regulated by galectin 11, standard levels or “
It is readily apparent that substantially altered (increased or decreased) galectin 11 expression levels in an individual as compared to "normal" levels will result in a pathological condition as described above. It is also apparent to one skilled in the art that the galectin-11 polypeptides of the present invention exert their modulation of activity on any of the target cells. Thus, it is clear that conditions in an individual caused by a decrease in normal or normal levels of galectin-11 activity can be treated by administration of a galectin-11 protein or agonist thereof.

In addition to treating diseases associated with elevated or decreased levels of galectin-11 activity, the present invention also provides galectin-11 polypeptides or polynucleotides (fragments, variants, (Including derivatives and analogs, as well as agonists and antagonists) to increase the biological activity associated with galectin-11.

For example, hematopoiesis can be stimulated using any method that increases galectin concentration and / or activity. Using these methods, hematopoiesis can be stimulated using the galectin-11 polypeptide and nucleotide sequences described herein. In certain embodiments, the galectin-11 polypeptides and polynucleotides are used in erythropoietin therapy, which is directed at assisting the blood's ability to carry oxygen. Galectin-11 treatments within the scope of the present invention include, but are not limited to, patients who generally require a blood transfusion (eg, trauma victims, surgical patients, dialysis patients, and various blood compositions). Related disorders (eg, hemophilia, cystic fibrosis, pregnancy, menstrual disorders, precocious early anemia, spinal cord injury, space flight, aging, various neoplastic disease states, etc.). Necessary for supporting the oxygen carrying capacity of blood,
Examples of patient conditions that are within the scope of the present invention include, but are not limited to: treatment of blood disorders characterized by hypoerythropoiesis or deficiency of erythropoiesis, anemia associated with chronic renal failure, Stimulation of the reticulocyte response, generation of iron kinetic effects (eg, plasma ion turnover and bone marrow transit time effects), changes in red blood cell mass, stimulation of hemoglobin C synthesis, and increased levels of hematocrit in vertebrates. The invention also provides a treatment for enhancing the oxygen carrying capacity of the individual (eg, causing the individual to experience hypoxia).

The present invention also encompasses combinations of galectin-11 polypeptides and polynucleotides described herein with other recommended or conventional hematopoietic treatments. Thus, for example, galectin 11 is a compound that alone exhibits an erythropoiesis stimulating effect (eg, erythropoietin, testosterone, progenitor cell stimulating factor, insulin-like growth factor, prostaglandin, serotonin, cyclic AMP, prolactin, and triiodothyro). Nin (triiodothyzonine)
)). Also, compounds commonly used to treat aplastic anemia (eg, methenolene, stanozolol, and nandrolen); compounds commonly used to treat iron deficiency anemia (eg, iron preparations) ); Compounds commonly used to treat pernicious anemia (
For example, vitamin B12 and / or folic acid); and compounds commonly used to treat hemolytic anemia (eg, corticosteroids (eg, corticoids)). For example, Resegotti et al., 198
1, Panminerva Medica, 23: 243-248; Kurtz
McGon, 1982, FEBS Letters, 14a: 105-108;
igle et al., 1984, Kidney Int. , 25: 437-444; and Pavlovic-Kantera, 1980, Expt. Hematol
. 8 (Supplement 8) 283-291.

Compounds that enhance or act synergistically with the effects of erythropoietin are also useful as adjuvants herein, and these compounds
Including but not limited to: adrenergic agonists, thyroid hormones, androgens, hepatic erythropoiesis factor, erythrotropin (erythrr)
otropin), and erythrogenin (eg, Dunn, “Current Concepts in Erythrop”).
oiesis ", John Wiley and Sons (Chichest
er, England, 1983); Weiland et al., 1982, Blut,
44: 173-175; Kalmani, 1982, Kidney Int. ,
22: 383-391; Shahidi, 1973, New Eng. J. Me
d. Urabe et al., 1979, J. Am. Exp. Med. ,
149: 1314-1325; Billat et al., 1982, Expt. Hema
tol. 10: 133-140; Naughton et al., 1983, Acta.
Haemat, 69: 171-179; Cognote et al., Summary 364, Pr.
receiveds 7th Intl. Cong. of Endocrino
logy (Quebec City, Quebec, July 1-7, 1984)
And Rothman et al., 1982, J .; Surg. Oncol. , 20: 1
05-108).

A method of stimulating hematopoiesis comprises administering to a patient a hematopoietic effective amount (ie, an amount that results in blood cell formation) of a pharmaceutical composition containing galectin-11. Galectin 11 is administered to a patient by any suitable technique including, but not limited to, parenteral, sublingual, topical, pulmonary, and intranasal, and these techniques are discussed further herein. Is done. The pharmaceutical composition optionally comprises one or more members of the group consisting of: erythropoietin, testosterone, progenitor cell stimulating factor, insulin-like growth factor, prostaglandin, serotonin, cyclic AMP, prolactin, bird. Iodothyronine (triiodothyzoni)
ne), methenolone, stanozolol, and nandrolone, iron preparations, vitamin B12, folic acid and / or corticosteroids. Galectin 11 and the cotreatment drug are separate,
Or by the same route of administration and simultaneously or at different times, e.g.
It is delivered appropriately depending on the clinical condition of the patient.

Several approaches are available for treating abnormal conditions related to underexpression of galectin-11 and its activity, or for treatments where elevated or decreased levels of galectin-11 are desired. One approach is to provide an isolated galectin-11 polypeptide, fragment, variant, derivative or analog of the invention, or a compound that activates galectin-11, to an individual in need of increased levels of galectin-11 in the body. Administering a therapeutically effective amount of (ie, an agonist as described above), optionally in combination with a pharmaceutically acceptable carrier. Alternatively, gene therapy can be used to effect the endogenous production of galectin 11 by relevant cells in a subject. For example,
A polynucleotide of the invention can be engineered for expression in a replication-defective retroviral vector using techniques known in the art. The retroviral expression construct can then be isolated and RNA encoding a polypeptide of the invention
Can be introduced into a packaging cell transduced with a retroviral plasmid vector containing, so that the packaging cell now produces infectious viral particles containing the gene of interest. These producer cells manipulate the cells in vivo and can be administered to a subject for expression of the polypeptide in vivo. For an overview of gene therapy, see Gene Therapy and
other Molecular Genetic-based Thera
peupic Approaches, Chapter 20 (and references cited therein), Human Molecular Genetics, T Strac.
han and AP Read, BIOS Scientific Public
See shers Ltd (1996).

In addition, treatment may be administered, for example, in the form of gene replacement therapy. In particular, one or more copies of the nucleotide sequence of Galectin-11 of the present invention, which directs the production of a Galectin-11 gene product that exhibits normal function, can be used to transfer other particles (eg, liposomes, and liposomes) that introduce DNA into cells. In addition to gene activation matrices), they can be inserted into appropriate cells in a patient or animal subject using vectors, including but not limited to: adenovirus, adeno-associated virus, retrovirus and herpes virus Vector. Since the galectin-11 gene is expressed in neutrophils, such a gene replacement technique should be able to deliver the galectin-11 gene sequence to these cells in the patient, or
It should involve direct administration of such a galectin-11 polynucleotide sequence to the site of the cell where the sequence of one gene is to be expressed. Alternatively, using targeted homologous recombination, the defective endogenous galectin 11 gene and / or its regulatory sequence (
(Eg, promoter and enhancer sequences), or "stimulate (" stimulate "other dormant galectin-11 activity in appropriate tissues or cell types.
turn on) ".

Further methods that can be utilized to increase the overall level of galectin 11 expression and / or activity of galectin 11 are to patients at locations and numbers sufficient to ameliorate abnormal symptoms in cell growth regulation. The introduction of a suitable galectin 11 expressing cell, preferably an autologous cell. Such cells can be either recombinant or non-recombinant. Among the cells that can be administered to increase the overall level of expression of the galectin 11 gene in a patient are normal cells that express the galectin 11 gene. Cell-based gene therapy techniques are well known to those skilled in the art. See, for example, Anderson et al., U.S. Patent No. 5,399,349; and Mulligan and Wilson U.S. Patent No. 5,460,959.

In cases where the activity of galectin-11 is in excess, several approaches are utilized to reduce or inhibit the activity of galectin-11 using molecules derived from the polypeptide and polynucleotide sequences described above. Accordingly, a further aspect of the invention relates to a method of treating an individual in need of a reduced level of galectin-11 activity in the body, comprising the step of treating such an individual with a galectin-11 of the invention acting as an antagonist of galectin-11. Administering a composition comprising a therapeutically effective amount of the polypeptide, fragment, variant, derivative or analog, optionally in combination with a pharmaceutically acceptable carrier. Preferably,
Galectin-11 activity is reduced to treat diseases that exhibit increased apoptosis or other cellular proliferative activity regulated by galectin-11. Polypeptides, derivatives, variants and analogs of the invention that function as antagonists of galectin-11 can generally be identified using the assays described below and other techniques known in the art. A preferred antagonist for use in the present invention is a galectin 11-specific antibody.

Thus, one embodiment of the present invention provides an antibody or fragment of the present invention, for example, with an effective amount of a pharmaceutically acceptable carrier to inhibit (ie, reduce) galectin-11 activity. Administering an inhibitor compound (antagonist) such as a variant, derivative or analog to the subject.

In another approach, galectin-11 activity can be reduced or inhibited by decreasing the level of expression of the galectin-11 gene. In specific embodiments,
An antagonist according to the present invention is a nucleic acid corresponding to the sequence contained in SEQ ID NO: 1,
Or its complementary strand, and / or a nucleic acid corresponding to the nucleotide sequence contained in the deposited clone 209053, or its complementary strand. In one embodiment, this is achieved through the use of antisense sequences, either internally generated by the organism or administered separately (eg, O'Connor).
, J. et al. Neurochem. (1991) 56: 560, Oligodeoxy.
nucleotides as Antisense Inhibitors
of Gene Expression, CRC Press, Boca Ra
ton, FL (1988)). Antisense technology can be used to control gene expression through antisense DNA or RNA, or through triple helix formation. Antisense technology is described, for example, in Okano, J. et al. Neu
rochem. 56: 560 (1991); Oligodeoxynucleo.
tides as Antisense Inhibitors of Gen
e Expression, CRC Press, Boca Raton, FL
(1988). Triple helix formation is described, for example, by Lee et al., N.
ucleic Acids Research 6: 3073 (1979); C
ooney et al., Science 241: 456 (1988); and Derv.
et al., Science 251: 1360 (1991).
These methods are based on the binding of the polynucleotide to complementary DNA or RNA.

For example, the use of c-myc and c-myb antisense RNA constructs to inhibit the growth of the non-lymphocytic leukemia cell line HL-60 and other cell lines has been described previously (Wickstrom et al. 1988); Anfossi et al. (198)
9)). These experiments were performed in vitro by incubating cells with oligoribonucleotides. A similar procedure for in vivo applications is
WO 91/15580. Briefly, a pair of oligonucleotides for a given antisense RNA is generated as follows: a sequence complementary to the first 15 bases of the open reading frame is provided with a 5 terminal EcoRI site and a 3 terminal HindIII. Adjacent to the site. Next, the oligonucleotide pair is heated at 90 ° C. for 1 minute and then 2 × ligation buffer (20 mM TR
Annealed in IS HCl pH 7.5, 10 mM MgCl ₂ , 10 mM dithiothreitol (DTT) and 0.2 mM ATP) and then ligated into the EcoR1 / HindIII site of the retroviral vector PMV7 (WO91 / 15580).

For example, the 5 ′ coding portion of a polynucleotide encoding a galectin 11 polypeptide of the present invention can be used to design an antisense RNA oligonucleotide of about 10-40 base pairs in length. DNA oligonucleotides are designed to be complementary to regions of the gene involved in transcription, thereby inhibiting the transcription and production of the galectin-11 polypeptide. Antisense RNA oligonucleotides are
It hybridizes to mRNA in vivo and blocks translation of the mRNA molecule into a polypeptide.

In one embodiment, a galectin-11 antisense nucleic acid of the invention is produced intracellularly by transcription from an exogenous sequence. For example, a vector or a portion thereof is transcribed to produce an antisense nucleic acid (RNA) of the invention. Such a vector contains a sequence encoding a galectin-11 antisense nucleic acid. Such a vector can remain episomal or integrate chromosomally, as long as it can be transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art. The vector can be a plasmid, virus, or other vector known in the art, used for replication and expression in vertebrate cells. Expression of the sequence encoding galectin 11 or a fragment thereof may be by any promoter known in the art to work in vertebrate, preferably human cells. Such a promoter can be inducible or constitutive. Such promoters include, but are not limited to, the SV40 early promoter region (Bernoist and Chambon, Nature 29: 304-
310 (1981)), the 3 'long terminal repeat of Rous sarcoma virus (Yamamot).
o et al., Cell 22: 787-797 (1980)), the herpes thymidine promoter (Wagner et al., Proc. Natl. Acad. Sci. US.
A. 78: 1441-1445 (1981)), the regulatory sequence of the metallothionein gene (Brinster et al., Nature 296: 39-42 (1982)).
Promoters included in etc.

[0418] The antisense nucleic acids of the present invention include a sequence complementary to at least a portion of the RNA transcript of the galectin 11 gene. However, absolute complementarity is preferred but not required. As used herein, a sequence "complementary to at least a portion of an RNA" refers to a sequence that has sufficient complementarity to hybridize to the RNA and form a stable duplex. Thus, in situations where the galectin-11 antisense nucleic acid is double-stranded, a single strand of double-stranded DNA can be tested, or triplex formation can be assayed. The ability to hybridize depends on both the degree of complementarity and the length of the antisense nucleic acid. In general, the larger the hybridizing nucleic acid, the more base mismatches with galectin 11 RNA, which may include and still form a stable duplex (or in some cases a triplex). One skilled in the art can ascertain a significant degree of mismatch by use of standard means to determine the melting point of the hybridized complex.

Oligonucleotides that are complementary to the 5 ′ end of the message (eg, 5 ′ untranslated sequences up to and including the AUG start codon) should work most efficiently at inhibiting translation. is there. However, sequences complementary to the 3 'untranslated sequence of mRNA have been shown to be effective in inhibiting translation of mRNA as well. Generally, Wagner, R.A. , 1994, Nature 372: 333-3.
See 35. Therefore, 5′- or 3 ′ of galectin 11 shown in FIG.
Oligonucleotides complementary to any of the -untranslated non-coding regions can be used in antisense approaches to inhibit translation of endogenous galectin 11 mRNA. Oligonucleotides complementary to the 5 'untranslated region of the mRNA should include the complement of the AUG start codon. Antisense oligonucleotides complementary to the mRNA coding region are less efficient inhibitors of translation, but can be used in accordance with the present invention. Whether designed to hybridize to the 5 ', 3' or coding region of the galectin 11 mRNA, the antisense nucleic acid should be at least 6 nucleotides in length, and preferably Oligonucleotides ranging from ~ 50 nucleotides in length. In certain aspects, the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides.

A polynucleotide of the invention can be DNA or RNA, or a chimeric mixture, or a derivative or modified version thereof, single-stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone to improve, for example, molecular stability, hybridization, and the like.
The oligonucleotides may be linked to other additional groups such as peptides (eg, to target host cell receptors in vivo) or factors that facilitate transport across cell membranes (eg, Letsinger et al., 1989, Proc. Natl.
. Acad. Sci. U. S. A. 86: 6553-6556; Lemaitr
e et al., 1987, Proc. Natl. Acad. Sci. 84: 648-65
2; see PCT Publication No. WO 88/09810 (published December 15, 1988)), or the blood-brain barrier (eg, PCT Publication No. WO 89/10134).
(Published April 25, 1988)), a hybridization-triggered cleavage.
agent) (eg, Kroll et al., 1988, BioTechniques,
6: 958-976), or intercalating agents (eg, Zo
n, 1988, Pharm. Res. 5: 539-549). For this purpose, the oligonucleotide can be conjugated to another molecule, such as a peptide, a hybridization-triggered crosslinker, a transport agent, a hybridization-triggered cleavage agent, and the like.

An antisense oligonucleotide can include at least one modified base moiety, wherein the base moiety is selected from the group including, but not limited to: 5-fluorouracil, 5-bromouracil, 5 -Chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2
-Thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylcuosin, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D- Mannosylcuosin, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2
-Methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v
), Wybutoxosine, pseudouracil, cuocin, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxy Acetic acid (v), 5-methyl-2-thiouracil,
3- (3-amino-3-N-2-carboxypropyl) uracil, (acp3)
w, and 2,6-diaminopurine.

An antisense oligonucleotide can also include at least one modified sugar moiety selected from the group including, but not limited to: arabinose, 2-fluoroarabinose, xylulose, and hexose.

In yet another embodiment, the antisense oligonucleotide comprises at least one modified phosphate backbone selected from the group including, but not limited to: phosphorothioate, phosphorodithioate, phosphorothioate Amidothioate, phosphoramidate, phosphorodiamidate, methylphosphonate, alkyl phosphotriester, and formacetal or analogs thereof.

[0424] In yet another embodiment, the antisense oligonucleotide is an a-anomeric oligonucleotide. The a-anomeric oligonucleotide has a complementary R
Forms a specific double-stranded hybrid with NA, as opposed to the normal b-unit,
The chains are parallel to each other (Gautier et al., 1987, Nucl. Acid
s Res. 15: 6625-6641). This oligonucleotide is 2'-
0-methylribonucleotide (Inoue et al., 1987, Nucl. A
cids Res. 15: 6131-148), or chimeric RNA-DN
A analog (Inoue et al., 1987, FEBS Lett. 215: 3).
27-330).

A polynucleotide of the present invention can be prepared by standard methods known in the art (eg,
An automatic DNA synthesizer (such a device is available from Biosearch, Applied B
(commercially available from iosystems, etc.). For example, phosphorothioate oligonucleotides can be prepared using the method of Stein et al.
8, Nucl. Acids Res. 16: 3209), wherein the methylphosphonate oligonucleotide is a controlled pore glass.
d pore glass) polymer support (Sarin et al., 1988, Pro
c. Natl. Acad. Sci. U. S. A. 85: 7448-7451).

Although antisense nucleotide complements to the galectin 11 coding region sequence may be used, complements to their transcribed, untranslated regions are most preferred.

Potential galectin-11 antagonists according to the present invention also include catalytic RNAs, ie, ribozymes (see, eg, PCT International Publication WO 90/11364 (19
Published October 4, 1990); Sarver et al., Science 247: 1222.
-1225 (1990)). Ribozymes that cleave mRNA at a site-specific recognition sequence can be used to destroy galectin 11 mRNA,
The use of hammerhead ribozymes is preferred. The hammerhead ribozyme is located at the position dictated by the adjacent region forming a complementary base pair with the target mRNA,
Cleaves the mRNA. The only requirement is that the target mRNA has the following two base sequence: 5'-UG-3 '. The construction and production of hammerhead ribozymes is well known in the art and haseloff and Gerla.
ch, Nature 334: 585-591 (1988). Many potential hammerhead ribozyme cleavage sites are associated with galectin 11
(FIG. 1; SEQ ID NO: 1). Preferably, the ribozyme is engineered such that its cleavage recognition site is located near the 5 'end of galectin 11 mRNA; that is, to increase efficiency and minimize intracellular accumulation of non-functional mRNA transcripts I do. A ribozyme-encoding DNA construct can be introduced into a cell in the same manner as described above for introducing antisense-encoding DNA.

In the case of the antisense approach, the ribozymes of the invention can be composed of modified oligonucleotides (eg, improved in stability, targeting, etc.) and delivered to cells expressing galectin 11 in vivo. It should be. A ribozyme-encoding DNA construct can be introduced into a cell in the same manner as described above for the introduction of antisense encoding DNA. A preferred method of delivery involves using a DNA construct that "encodes" a ribozyme under the control of a strong constitutive promoter (such as, for example, a pol III or pol II promoter), and thus transfected. Cells are endogenous galectin 1
It produces enough ribozyme to destroy one message and inhibit translation. Because ribozymes are catalytic, unlike antisense molecules, lower intracellular concentrations are required for efficiency.

[0429] Endogenous galectin-11 gene expression can also be measured by targeted homologous recombination (eg, Sm
ties, et al., Nature 317: 330-234 (1985); Tho.
mas et al., Cell 51: 503-512 (1987); Thompson et al., Cell 5: 313-321 (1989), each of which is incorporated herein by reference in its entirety. Using Galectin 11
It can be reduced by inactivating or "knocking out" the gene or its promoter. Such an approach can be adapted for use in humans where the recombinant DNA construct is directly administered or targeted in vivo at the required site using an appropriate viral vector.

Alternatively, endogenous galectin-11 gene expression is complementary to a galectin-11 gene regulatory region (ie, a galectin-11 promoter and / or enhancer), preventing triple transcription of the galectin-11 gene in target cells in the body. It can be reduced by targeted deoxyribonucleotide sequences that form a helical structure. See generally, Helene et al., Ann, N .; Y. Acad. Sci. 660: 2
7-36 (1992); Helene, C .; , Anticancer Drug
Des. , 6 (6): 569-584 (1991); and Maher, L. et al.
J. , Bioassays 14 (12): 807-815 (1992).

In yet another embodiment of the present invention, the activity of galectin-11 can be reduced using a “dominant negative”. For this purpose, the defective galectin 1
1 (such as, for example, a mutant that deletes all or part of the region of galectin 11 that binds β-galactoside) to eliminate the activity of galectin 11 on appropriate target cells. It can be used in gene therapy approaches. For example, a nucleotide sequence that directs host cell expression of galectin 11 in which all or part of the region of galectin 11 that binds β-galactoside is modified or deleted is a neutrophil cell, or a nucleotide sequence that expresses galectin 11 (Eg, by any of the methods for gene therapy in vivo or ex vivo, as described herein). Alternatively, targeted homologous recombination
Such deletions or mutations can be utilized to introduce the subject's endogenous galectin-11 gene in neutrophils or other cells that express galectin-11.

Utilizing antagonist / agonist compounds, the growth and proliferation of polypeptides of the invention against neoplastic cells and tissues (proli
feration) effect. That is, it stimulates a tumor agonist,
Thereby delaying or preventing abnormal cell growth and proliferation (eg, in tumorigenesis or proliferation).

[0433] Antagonists / agonists may also be employed to inhibit hypervascular disease and prevent proliferation of epithelial lens cells following extracapsular cataract surgery. Prevention of the mitogenic activity of the polypeptides of the invention may also be required in cases such as restenosis following balloon angioplasty.

An antagonist / agonist may also be utilized to prevent scar tissue growth during wound healing.

[0435] Antagonists / agonists may also be used to treat the diseases described herein.

Accordingly, the present invention relates to disorders or diseases, including, but not limited to, those disorders or diseases listed throughout this application that are associated with overexpression of a polynucleotide of the present invention, including (but not limited to): Methods are provided for treating a patient by administering a) an antisense molecule directed to a polynucleotide of the invention, and / or (b) a ribozyme directed to a polynucleotide of the invention.

Formulations and Administration Symptoms caused by a decrease in standard or normal levels of galectin-11 activity in an individual are indicated by galectin-11 polypeptides, or fragments, variants, derivatives, or analogs of the invention, or agonists thereof. It is understood that treatment can be by administration. Accordingly, the invention further provides a method of treating an individual in need of an increased level of galectin-11 activity, the method comprising providing such an individual with an increased level of galectin-11 activity in such an individual. An effective,
Administering a pharmaceutical composition comprising an effective amount of an isolated galectin-11 polypeptide or fragment, variant, derivative, or analog of the invention (eg, such as the full-length form of galectin-11).

The present invention provides methods of treatment, inhibition and prevention by administering to a subject an effective amount of a compound or pharmaceutical composition of the invention, preferably an antibody of the invention. In a preferred aspect, the compound is substantially purified (eg, substantially free of substances that limit its effect or produce undesired side effects). The subject is preferably an animal, including but not limited to animals such as cows, pigs, horses, chickens, cats, dogs, and the like, and is preferably a mammal, and most preferably a human.

The required dosage range depends on the choice of peptide, the route of administration, the nature of the formulation, the nature of the condition of the subject, and the judgment of the attending physician. As a general proposition, the total pharmaceutically effective amount of galectin-11 polypeptide administered parenterally per dose is:
It ranges from about 1 μg / kg / day to 10 mg / kg / day of the patient's body weight, but as noted above, this is determined therapeutically. More preferably, the dose is at least 0.01 mg / kg / day, and most preferably for humans, the dose is in the range of 0.1-100 mg / kg of the subject, or about 0.1 mg / kg. 0
The range is between 1 mg / kg / day and 1 mg / kg / day. When given continuously, galectin-11 polypeptides are typically administered at a dosage rate of about 1 μg / kg / hr to about 50 μg / kg / hr, which is obtained by 1-4 injections per day. Or by continuous subcutaneous infusion using, for example, a minipump. An intravenous bag solution may also be used. However, wide variations in the required dosage are to be expected in view of the variety of compounds available and the differing efficiencies of various routes of administration. For example, oral administration is expected to require higher dosages than administration by intravenous injection. Changes in these dosage levels can be adjusted using standard empirical practices for optimization and are well understood by those skilled in the art.

Pharmaceutical compositions comprising the galectin-11 polypeptides and polynucleotides (including fragments, variants, derivatives or analogs) of the present invention, and agonists and antagonists of galectin-11, are combined with a pharmaceutically acceptable carrier. Can be customarily prescribed. By "pharmaceutically acceptable carrier" is meant any non-toxic solid, semi-solid or liquid excipient, diluent, encapsulating material or formulation aid. In certain embodiments, "pharmaceutically acceptable"
By means means approved by a federal or state government authority or listed in the United States Pharmacopeia or animals, and more particularly in other commonly recognized pharmacopeias for use in humans. Non-limiting examples of suitable pharmaceutical carriers according to this embodiment are described in E.I. W. "Remington's by Martin
Pharmaceutical Sciences, and include sterile liquids such as water, saline, buffered saline, glycerol, ethanol, and oils (oils of petroleum, animal, vegetable or synthetic origin, such as peanuts). Oil, soybean oil, mineral oil, sesame oil, etc.). The formulation is appropriate for the mode of administration, and is well within the skill of the art. For example, water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can be employed as liquid carriers, particularly for injectable solutions. The invention further relates to pharmaceutical packs and kits comprising one or more containers filled with one or more components of the composition of the invention.

The polypeptides and other compounds of the present invention can be administered alone or in combination with other compounds (eg, therapeutic compounds). Pharmaceutical compositions of the invention may be orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (eg, by powder, ointment, drop or transdermal patch), buccally, Or they can be administered as an oral or nasal spray. Preferred forms for systemic administration of the pharmaceutical compositions are typically by intravenous injection,
Parenteral injections are included. Other injection routes may be used, for example, subcutaneous, intramuscular, substernal, intraarticular or intraperitoneal. Alternative means for systemic administration include transmucosal and transdermal administration using penetrants such as bile salts or fusidic acid, or other surfactants. In addition, if properly formulated in enteral or capsule formulations, oral administration may also be possible. The administration of these compounds may also be topical and / or localized, in the form of ointments, pastes, gels and the like.

The polypeptides used for treatment can also be produced endogenously in a subject, in a treatment modality often referred to as “gene therapy” as described above. Thus, for example, a cell from a subject can be a polynucleotide encoding a polypeptide ex vivo (
(Eg, DNA or RNA), and this is by way of example, using a retroviral plasmid vector. The cells are then introduced into the subject.

The formulations and methods of administration used when the composition comprises nucleic acids or immunoglobulins are described above; further suitable formulations and routes of administration are
It may be selected from the formulations and routes described herein below.

Various delivery systems are known and can be used to administer the compounds of the invention (eg, liposomes, microparticles, microcapsules, encapsulation in recombinant cells capable of expressing the compounds). , Receptor-mediated endocytosis (
See, for example, Wu and Wu, J. et al. Biol. Chem. 262: 4429-443
2 (1987)), construction of nucleic acids as part of retroviruses or other vectors). Methods of introduction include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The compound or composition may be administered by any convenient route, such as by infusion or bolus injection, by absorption through epithelial or mucosal linings such as oral, rectal and intestinal mucosa, and other It can be administered together with a biologically active agent. Administration can be systemic or local. In addition, the pharmaceutical compounds or compositions of the present invention can be administered by any suitable route, including intraventricular and intrathecal injections; intraventricular injection can be, for example, an intraventricularly attached reservoir such as an Ommaya reservoir. It may be desirable to introduce it into the central nervous system (which can be facilitated by a catheter). Pulmonary administration may also be used, for example, with the use of an inhaler or nebulizer, and formulation with an aerosolizing agent.

In a specific embodiment, it may be desirable to administer the pharmaceutical compounds or compositions of the invention locally to the area in need of treatment;
For example, by local injection during surgery, topical application (eg, in combination with post-surgical wound dressing), by injection, by catheter, by suppository, or by implants (such as sialastic membranes). Including porous membranes or fibers, which are porous, non-porous, or glue-like materials). Preferably, when administering a protein of the invention, including an antibody, care must be taken to use materials to which the protein does not absorb.

In another embodiment, the compound or composition may be delivered in a vesicle, especially a liposome (Langer, Science 249: 1527-1533 (
1990); Treat et al., Liposomes in the Therap.
y of Infectious Disease and Cancer, L
opez-Berstein and Fidler (eds.), Liss, New
York, pp. 353-365 (1989); Lopez-Berstein,
See pages 317-327 of the same book; see broadly the same book).

In yet another embodiment, the compound or composition can be delivered in a controlled release system. In one embodiment, a pump may be used (Lang
er, (supra); Sefton, CRC Crit. Ref. Biomed. E
ng. 14: 201 (1987); Buchwald et al., Surgery 88.
: 507 (1980); Saudek et al. Engl. J. Med. 321:
574 (1989)). In another embodiment, a polymeric material may be used (Medical Applications of Control).
led Release, Langer and Wise (eds.), CRC Pre
s. , Boca Raton, Florida (1974); Control.
ed Drug Bioavailability, Drug Product
Design and Performance, Smolen and Bal
1 (eds), Wiley, New York (1984); Ranger and P.
eppas, J .; Macromol. Sci. Rev .. Macromol. Ch
em. 23:61 (1983); Levy et al., Science 2
28: 190 (1985); During et al., Ann. Neurol. 25: 3
51 (1989); Howard et al. Neurosurg. 71: 105 (
1989)). In yet another embodiment, the controlled release system is positioned proximal to the therapeutic target, ie, the brain, thereby requiring only a portion of the systemic dose (eg, Goodson, Medical Applic.
nations of Controlled Release, (supra), 2nd
Vol. 115-138 (1984)).

Other controlled release systems are discussed in a review by Langer (Science 249: 1527-1533 (1990)).

In a specific embodiment, where the compound of the invention is a protein-encoding nucleic acid, the nucleic acid is such that it is part of a suitable nucleic acid expression vector and is intracellular. By administration (eg, by use of a retroviral vector (see US Pat. No. 4,980,286)), or by direct injection, or by microparticle bombardment (eg, a gene gun; Biolis).
tic, Dupont) or by coating with lipids or cell surface receptors or transfectants, or in conjunction with a homeobox-like peptide known to enter the nucleus (eg,
Joliot et al., Proc. Natl. Acad. Sci. USA 88:18
64-1868 (1991)), and the like, to enhance the expression of the encoded protein. Alternatively, the nucleic acid can be introduced intracellularly and integrated into host cell DNA by homologous recombination for expression.

[0450] The present invention also provides pharmaceutical compositions. Such compositions comprise a therapeutically effective amount of the compound, and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" has been approved by the Federal regulatory authority or the U.S. Government for use in animals, and more particularly in humans, or Means listed in the recognized pharmacopeias.
The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers include sterile liquids such as water and oils, including oils of petroleum, animal, plant, or synthetic origin (eg, peanut oil, soybean oil, mineral oil, sesame oil, and the like). Can be Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, skim milk powder, glycerol, propylene , Glycol, water, ethanol and the like. The composition may also contain minor amounts of wetting or emulsifying agents, or pH buffering agents, if desired. These compositions may take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release formulations and the like. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. Examples of suitable pharmaceutical carriers are described in W. "Reming by Martin
ton's Pharmaceutical Sciences ". Such compositions comprise a therapeutically effective amount of the compound, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient. The formulation should suit the mode of administration.

In a preferred embodiment, the composition is formulated according to conventional procedures, as a pharmaceutical composition adapted for intravenous administration to humans. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to ease pain at the site of the injection. Generally, the components are either separated or mixed together in a single dosage form, for example, in an ampoule or sachet (s) representing a fixed amount of active agent.
Supplied as a lyophilized powder or water-free concentrate in a sealed container such as an acetette. If the composition is to be administered by infusion, the composition can be dispensed into infusion bottles containing sterile pharmaceutical grade water or saline. When the composition is administered by injection, the components can be mixed prior to administration.
An ampoule of sterile water for injection or saline can be provided.

The compounds of the present invention may be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids and the like, and sodium, potassium, ammonium, calcium, ferric hydroxide, Isopropylamine, triethylamine,
Salts formed with cations such as those derived from 2-ethylaminoethanol, histidine, procaine, and the like.

The amount of a compound of the invention that is effective in this treatment (suppression and prevention of a disease or disorder associated with abnormal expression and / or activity of a polypeptide of the invention) is determined by standard clinical techniques. Can be done. In addition, in vitro assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be used in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses can be extrapolated from dose-response curves derived from in vitro or animal model test systems.

For antibodies, the dosage administered to a patient is typically 0.1 mg / kg to 100 mg / kg of the patient's body weight. Preferably, the dosage administered to a patient is between 0.1 mg / kg and 20 mg / kg of the patient's body weight, more preferably between 1 mg / kg and 10 mg / kg of the patient's body weight. Generally, human antibodies have a longer half-life in the human body than antibodies from other species, due to the immune response to the foreign polypeptide. Thus, low dosages and infrequent administration of human antibodies are often possible. In addition, the dosage and frequency of administration of the antibodies of the invention can be reduced by enhancing antibody uptake and tissue penetration (eg, into the brain) by modification (eg, such as lipidation). .

The present invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more components of the pharmaceutical composition of the present invention. Notification in the form prescribed by governmental agencies regulating the manufacture, use or sale of pharmaceutical or biological products may optionally accompany such containers. This notice,
Reflects the agency's approval of manufacture, use or sale for human administration.

Diagnostics and Imaging Labeled antibodies that specifically bind to a polypeptide of interest, and derivatives and analogs thereof, are used for diagnostic purposes to detect abnormal expression of a polypeptide of the invention and Diseases and / or disorders associated with / or activity may be detected, diagnosed or monitored. The present invention provides for the detection of abnormal expression of a polypeptide of interest, comprising the steps of (a) using one or more antibodies specific for the polypeptide of interest in a cell or body fluid of an individual. Assaying for the expression of the polypeptide of
And (b) comparing the gene expression level to a standard gene expression level, thereby increasing or decreasing the assayed polypeptide gene expression level compared to the standard expression level. Show abnormal expression.

The present invention provides a diagnostic assay for diagnosing a disorder, the assay comprising:
a) assaying the expression of the polypeptide of interest in cells or body fluids of an individual using one or more antibodies specific for the polypeptide of interest; and (b) Comparing the level of gene expression, whereby an increase or decrease in the assayed polypeptide gene expression level compared to its standard expression level is indicative of a particular disorder. For cancer, the presence of relatively high amounts of transcripts in biopsy tissue from an individual may indicate a predisposition for the development of the disease, or provide a means for detecting the disease before the actual clinical symptoms appear. Can provide. A more conclusive diagnosis of this type may allow health professionals to use preventive measures, or allow early aggressive treatment, thereby preventing the development or further progression of cancer.

Assaying galectin-11 polypeptide levels in a biological sample can occur using antibody-based techniques. For example, the expression of a galectin-11 polypeptide in a tissue can be studied using classical immunohistological methods (eg, Jalkanen, M et al., J. Cell. Biol. 101: 97).
6-985 (1985); Jalknen, M et al. Cell. Biol. 1
05: 3087-3096 (1987)). Other antibody-based methods useful for detecting galectin-11 polypeptide gene expression include immunoassays such as the enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA). Suitable antibody assay labels are known in the art and include, for example, enzyme labels such as glucose oxidase, radioisotopes (eg, iodine ( ¹³¹ I, ¹²⁵ I, ¹²³ I, ¹²¹ I), carbon ( ¹⁴ C). ), sulfur ⁽³⁵ C), tritium ⁽³ H), indium ^{(115m In, 113m In, 112} In, 111 In), and technetium ⁽⁹⁹ Tc, ^99m Tc), thallium ⁽²⁰¹ Ti), gallium ⁽⁶⁸ Ga
, ⁶⁷ Ga), palladium ⁽¹⁰³ Pd), molybdenum ⁽⁹⁹ Mo), xenon ⁽¹³³ X
e), fluorine ^{(18 F), 153 Sm,} 177 Lu, 159 Gd, 149 Pm, 140 La, 175 Y
b, ¹⁶⁶ Ho, ⁹⁰ Y, ⁴⁷ Sc, ¹⁸⁶ Re, ¹⁸⁸ Re, ¹⁴² Pr, ¹⁰⁵ Rh, ⁹⁷ Ru)
Luminescent labels (eg, luminol); and fluorescent labels (eg, fluorescein and rhodamine), and biotin.

[0459] Techniques known in the art can be applied to label polypeptides of the present invention (including antibodies). Such techniques include the use of bifunctional binders (eg, US Pat. Nos. 5,756,065; 5,714,631; 5,619).
96,239; 5,652,361; 5,505,931; 5,489,425; 5,435,990; 5,428,139; Nos. 5,342,604; 5,274,119; 4,994,5
No. 60; and 5,808,003 (the contents of each of which are incorporated herein by reference in their entirety), but are not limited thereto.

One aspect of the invention is the detection and diagnosis of a disease or disorder associated with aberrant expression of a polypeptide of interest in an animal, preferably a mammal, and most preferably a human. In one embodiment, the diagnosis comprises: a) administering to the subject (eg, parenterally, subcutaneously, or intraperitoneally) an effective amount of a labeled molecule that specifically binds the polypeptide of interest. B) to allow for preferential enrichment of the labeled molecule at the site in the subject where the polypeptide is expressed (and because unbound labeled molecule is removed to background levels); C) determining a background level; and d) detecting a labeled molecule in the subject such that the background level is exceeded. Detection of the labeled molecule indicates that the subject has a particular disease or disorder associated with abnormal expression of the polypeptide of interest. Background levels can be determined by a variety of methods, including comparing the amount of labeled molecule detected with standard values previously determined for a particular system.

A radioisotope (eg,¹³¹I,¹²¹I,^99mTc, (¹³¹I,¹²⁵I,^{one two Three}I,^{12 1} I), carbon (¹⁴C), sulfur (³⁵C), tritium (^ThreeH), indium (^115mI
n,^113mIn,¹¹²In,¹¹¹In) and technetium (⁹⁹Tc,^99mTc)
,thallium(²⁰¹Ti), gallium (⁶⁸Ga,⁶⁷Ga), palladium (¹⁰³Pd)
,molybdenum(⁹⁹Mo), xenon (¹³³Xe), fluorine (¹⁸F),¹⁵³Sm,^{17 7} Lu,¹⁵⁹Gd,¹⁴⁹Pm,¹⁴⁰La,¹⁷⁵Yb,¹⁶⁶Ho,⁹⁰Y,⁴⁷Sc,¹⁸⁶R
e,¹⁸⁸Re,¹⁴²Pr,¹⁰⁵Rh,⁹⁷Ru), radiopaque material, or nuclear magnet
Labeled with an appropriate detectable imaging moiety, such as a material detectable by gas resonance
Galectin 11 polypeptide-specific antibodies or antibody fragments
Mammals to be examined for damage (eg, parenterally, subcutaneously, or
(Intracavity). The size of the subject and the imaging system used
It is understood in the art to determine the amount of imaging portion required to produce an image.
It is. In the case of a radioisotope moiety, the
The amount is usually^99mTc is in the range of about 5-20 millicuries. Then labeled
The resulting antibody or antibody fragment is located in a cell containing the galectin-11 protein.
Is stored preferentially in the device. In vivo tumor imaging is described by S.D. W. Burchiel et al.
, "Immunopharmacokinetics of Radiolab
eled Antibodies and Their Fragments "
(Tumor Imaging: The Radiochemical Det
section of the Action of Cancer, S.E. W. Burchiel and
And B. A. Rhodes, Masson Publishing Inc. (
1982)).

In addition, to detect a galectin-11 ligand, any galectin-11 polypeptide whose presence can be detected can be administered. For example, a galectin-11 polypeptide labeled with a radiopaque material or other suitable compound, as discussed above for labeled antibodies, can be administered and visualized in vivo. Further, such galectin-11 polypeptides can be used in in vitro diagnostic procedures.

Depending on several variables, including the type of label used and the mode of administration,
The time interval after administration is 6-48 hours, allowing the labeled molecules to concentrate preferentially at the site of the subject and allowing unbound labeled molecules to be cleared to background levels. Or 6 to 24 hours or 6 to 12 hours. In another embodiment, the time interval after administration is 5-20 days or 5-10 days.

In one embodiment, monitoring a disease or disorder comprises repeating the method for diagnosing the disease or disorder (eg, 1 month after first diagnosis, 6 months after initial diagnosis, first diagnosis One year later).

[0465] The presence of the labeled molecule can be detected in the patient using methods known in the art for in vivo scanning. These methods depend on the type of label used. One of skill in the art can determine the appropriate method for detecting a particular label. Methods and devices that can be used in the diagnostic methods of the present invention include computerized tomography (CT), whole body scans such as proton emission tomography (PET), magnetic resonance imaging (MRI), and ultrasound diagnostics But not limited thereto.

In certain embodiments, the molecule is labeled with a radioisotope and detected from the patient using a radioresponsive surgical instrument (Thurston et al., US Pat. No. 5,441,050). . In another embodiment, the molecule is labeled with a fluorescent compound and detected in a patient using a fluorescence-responsive scanning device.
In another embodiment, the molecule is labeled with a positron emitting metal and is detected in the patient using proton emission tomography. In yet another embodiment, the molecule is labeled with a paramagnetic label and is labeled with a magnetic resonance image (M
(RI) in the patient.

[0467] The present invention provides kits that can be used in the above methods. In one embodiment, the kit comprises an antibody (preferably a purified antibody) of the invention in one or more containers. In certain embodiments, a kit of the invention comprises a substantially isolated polypeptide comprising an epitope that is specifically immunoreactive with the antibodies contained in the kit. Preferably, the kit of the present invention further comprises a control antibody that does not react with the polypeptide of interest. In another specific embodiment, the kits of the invention provide for binding of an antibody to a polypeptide of interest (eg, the antibody is a detectable substrate (eg, a fluorescent, enzymatic, radioactive or luminescent compound). Or a second antibody that recognizes the first antibody or can be conjugated to a detectable substrate).

In another specific embodiment of the invention, the kit is used for screening diagnostic sera containing antibodies specific for proliferative and / or cancerous polynucleotides and polypeptides. It is a kit. Such a kit can include a control antibody that does not react with the polypeptide of interest. Such a kit may comprise a substantially isolated polypeptide antigen comprising an epitope specifically immunoreactive with at least one anti-polypeptide antigen antibody. In addition, such kits can be used to detect binding of the antibody to an antigen (eg, the antibody can be conjugated to a fluorescent compound such as fluorescein or rhodamine, which can be detected by flow cytometry). Means. In certain embodiments, the kit may comprise a recombinantly produced polypeptide antigen or a chemically synthesized polypeptide antigen. The polypeptide antigens of the kit can also be attached to a solid support.

In a more particular embodiment, the detection means of the above kit comprises a solid support to which the polypeptide antigen is attached. Such kits also include a non-attached reporter-labeled anti-human antibody. In this embodiment, binding of the antibody to the polypeptide antigen can be detected by binding of the reporter-labeled antibody.

In a further embodiment, the present invention includes a diagnostic kit for use in screening serum containing an antigen of a polypeptide of the present invention. The diagnostic kit comprises a substantially isolated antibody that is specifically immunoreactive with a polypeptide or polynucleotide antigen, and means for detecting binding of the polynucleotide or polypeptide antigen to the antibody. . In one embodiment, the antibody is:
Attached to a solid support. In certain embodiments, the antibodies can be monoclonal antibodies. The detection means of the kit may include a second labeled monoclonal antibody. Alternatively or additionally, the detection means may include a labeled competitor antigen.

In one diagnostic configuration, a test serum is reacted with a solid phase reagent having a surface-bound antigen obtained by a method of the invention. Binding a specific antigen-antibody to this reagent,
After removing unbound serum components by washing, the reagent is reacted with a reporter-labeled anti-human antibody to bind the reporter to the reagent, depending on the amount of the anti-antigen antibody bound to the solid support. The reagent is washed again to remove unbound labeled antibody, and the amount of reporter bound to the reagent is determined. Typically, a reporter is an enzyme that is detected by incubating this solid phase in the presence of a suitable fluorometric, luminescent or colorimetric substrate (Sigma, St. Louis, MO).

[0472] The solid surface reagent in the assays described above converts protein material to solid support material (
For example, prepared by known techniques for attachment to polymeric beads, dipsticks, 96-well plates or filtration materials). These methods of attachment generally include non-specific adsorption of proteins to a support or chemically active groups (eg, activated carboxyl, hydroxyl, or aldehyde groups) on a solid support. Covalent attachment of the protein (typically via a free amine group). Alternatively, streptavidin-coated plates can be used with biotinylated antigen.

Accordingly, the present invention provides an assay system or kit for performing this diagnostic method. The kit generally comprises a support having a surface-bound recombinant antigen, and a reporter-labeled anti-human antibody for detecting the surface-bound anti-antigen antibody.

Chromosome assays The nucleic acid molecules of the invention are also useful for chromosome identification. This sequence is human
It can be specifically targeted to a particular location on the chromosome and hybridize to that location. Mapping DNA to chromosome according to the present invention is an important first step in correlating these sequences with genes associated with disease.

Since the galectin-11 gene has been mapped to a precise chromosomal location, the physical location of the sequence on the chromosome can be correlated with genetic map data. Such data is described, for example, in V.A. McKusick, Mendelian In
heritance In Man (Johns Hopkins Unive)
rsity, available online through the Welch Medical Library). The relationship between the disease and the gene mapped to the same chromosomal region is then analyzed by linkage analysis (simultaneous inheritance of physically close genes (c
oinheritance)).

Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If the mutation is observed in some or all of the affected individuals but not in normal individuals, then:
The mutation appears to be responsible for the disease.

Having described the invention in general, the invention will be more readily understood by reference to the following examples, which are provided for purposes of illustration and are not limiting. Not intended.

EXAMPLES Example 1 Expression and Purification of Galectin 11 in E. coli The DNA sequence encoding the galectin 11 protein in the deposited cDNA clone was replaced with the amino terminal sequence of the galectin 11 protein and the vector sequence 3 'Amplify using PCR oligonucleotide primers specific for that gene. Additional nucleotides containing restriction sites to facilitate cloning are added to the 5 'and 3' sequences, respectively.

The 5 ′ galectin 11 oligonucleotide primer has the sequence 5 ′ cgc CC ATGG ATGAGCCCCAGGGCTGGAGGTG3 ′ (SEQ ID NO: 23) (
This is due to the underlined NcoI restriction site and galectin 11 described in FIG.
Nucleotide sequence (SEQ ID NO: 1).

The primer for 3 ′ galectin 11 has the sequence 5 ′ cgc AAGCTT TCAGG
AGTGGACACAGTAG3 '(SEQ ID NO: 6) (this is underlined Hi
Following the ndIII restriction site has the galectin 11 nucleotide sequence set forth in FIG. 1 (comprising nucleotides complementary to positions 431-451 of the SEQ ID NO: 1).

This restriction site is compatible with the restriction enzyme site in the bacterial expression vector pQE60. This pQE60 is used for bacterial expression in these examples. (Qiagen, Inc. 9259 Eton Avenue, Ch.
atsworth, CA, 91311). pQE60 encodes ampicillin antibiotic resistance ("Ampr") and has a bacterial origin of replication ("ori"), IP
Includes a TG-inducible promoter, a ribosome binding site ("RBS"), a 6-His tag and a restriction enzyme site.

The amplified Galectin-11 DNA and pQE60 vector are digested with NcoI and HindIII, and the digested DNAs are ligated together. Insertion of the galectin-11 polypeptide DNA into the restriction digested pQE60 vector places the galectin-11 polypeptide coding region downstream of and operably linked to the vector's IPTG-inducible promoter; and It is located in frame with the appropriately positioned starting AUG for transcription of galectin-11.

The ligation mixture was transformed into competent E. coli using standard procedures. E. coli cells. Such a procedure is described in Sambrook et al., Molecular C.
loning: A Laboratory Manual, 2nd edition; Cold
Spring Harbor Laboratory Press, Cold
Spring Harbor, N.M. Y. (1989). E. FIG.
E. coli strain M15 / rep4, which contains multiple copies of the plasmid pREP4, which expresses the lac repressor and confers kanamycin resistance ("Kanr"), and is described herein. The following example is performed. This strain is just one of many that is suitable for expressing the galectin-11 protein and is commercially available from Qiagen.

Transformants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA is confirmed by restriction analysis.

The clones containing the desired construct were cloned overnight (O / N) with ampicillin (100 μg /
ml) and kanamycin (25 μg / ml) in liquid culture in LB medium supplemented.

The large culture is inoculated using the O / N culture at a dilution of about 1: 100 to 1: 250. The cells were grown at an optical density at 600 nm between 0.4 and 0.6 ("OD6
00 "). Then, isopropyl-BD-thiogalactopyranoside ("IPTG") is added at a final concentration of 1 mM to induce transcription from the lac repressor sensitive promoter by inactivating the lacI repressor. The cells are then incubated for an additional 3-4 hours. The cells are then collected by centrifugation and disrupted by standard methods. Inclusion bodies are purified from disrupted cells using conventional harvesting techniques, and proteins are solubilized from the inclusion bodies into 8M urea. This 8M urea solution containing the solubilized polypeptide is passed through a PD-10 column in 2x phosphate buffered saline ("PBS"), thereby removing the urea and replacing the buffer. And the protein is folded again. The polypeptide is purified by an additional step of chromatography to remove endotoxin. It is then sterilized by filtration. Filter sterilized protein preparation at a concentration of 95 μg / ml in 2 × PBS
Saved while.

Example 2: Cloning and Expression of Galectin-11 Protein in Baculovirus Expression System cD encoding full-length galectin-11 protein in the deposited clone
The NA sequence is amplified using PCR oligonucleotide primers corresponding to the 5 'and 3' sequences of this gene.

The 5 ′ galectin 11 oligonucleotide primer has the sequence 5 ′ cgc CCC GGG GCCTATGAGCCCCAGCGCTGGAGG 3 ′ (SEQ ID NO: 7) (
It has an underlined SmaI restriction site and nucleotides 49-66 of the galectin 11 nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1).

The 3 ′ galectin 11 primer has the sequence 5 ′ cgc GGTACTCAGGA
GTGGACACAGTAG3 '(SEQ ID NO: 8) (this is the underlined Asp
Following the 718 restriction site has the galectin 11 nucleotide sequence shown in Figure 1 (comprising nucleotides complementary to nucleotides 432-450 of the SEQ ID NO: 1).

An efficient signal for the initiation of translation in eukaryotic cells (Kozak, M.
. , J. et al. Mol. Biol. 196: 947-950 (1987)) is appropriately placed in the vector portion of this construct.

The amplified fragment was prepared from a 1% agarose gel using a commercially available kit (“Gen
eclean ", BIO101 Inc. , La Jolla, Ca. ). The fragment was then digested with XbaI and again 1%
Purify on agarose gel. This fragment is designated herein as F2.

Using the vector pA2-GP, the galectin-11 protein was transferred from Summers et al. (“A Manual of Meth” in a baculovirus expression system.
ods for Baculovirus Vectors and Inse
ct Cell Culture Procedures ", Texas Ag
ricultural Experimental Station Bullet
etin No. 1555 (1987)). This expression vector is Autographa californi.
It contains the strong polyhedrin promoter of the ca nuclear polykaryotic virus (AcMNPV), followed by convenient restriction sites. The AcMNPV gp67 signal peptide, which includes the N-terminal methionine, is located just upstream of the BamHI site. The simian virus 40 ("SV40") polyadenylation site is used for efficient polyadenylation. For easy selection of recombinant viruses, E. coli is oriented in the same direction as the polyhedrin promoter. The β-galactosidase gene from E. coli is inserted, followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequence is flanked on both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA to generate a viable virus expressing the cloned polynucleotide.

[0493] Many other baculovirus vectors (eg, pAc373, pVL941
, And pAcIM1), as will be readily appreciated by those skilled in the art, are signals in which the construct is properly positioned for transcription, translation, transport, etc. (eg, where required,
PA as long as it provides in-frame AUG and signal peptide).
Can be used instead of 2-GP. Such vectors are, for example, Lucko
et al., Virology 170: 31-39.

The plasmid was transformed with the restriction enzyme SmaI using conventional procedures known in the art.
And Asp718, followed by dephosphorylation using calf intestinal phosphatase. This DNA was then converted to a commercially available kit ("Geneclean" BIO
101 Inc. , La Jolla, Ca) using a 1% agarose gel. This vector DNA is designated herein as V2.

The fragment F2 and the dephosphorylated plasmid V2 are ligated together using T4 DNA ligase. E. FIG. E. coli HB101 cells are transformed with the ligation mixture and spread on culture plates. Bacteria containing the plasmid with the human galectin 11 gene are identified by digesting DNA from individual colonies with XbaI, and then analyzing the digested product by gel electrophoresis. The sequence of the cloned fragment is confirmed by DNA sequencing.
This plasmid is designated herein as pBacgalectin11.

5 μg of the plasmid pBacgalectin11 was transferred to Felgner et al.
rc. Natl. Acad. Sci. USA 84: 7413-7417 (
1987) using the lipofection method described in US Pat.
irrus DNA, "Pharmingen, San Diego, CA. ) And co-transfected. 1 μg of BaculoGold virus DN
A and 5 μg of plasmid pBacgalectin11 were added to 50 μl of serum-free Grace's medium (Life Technologies Inc., Gaithh).
(M. ersburg, MD) in a sterile well of a microtiter plate. Thereafter, 10 μl Lipofectin and 90 μl Grace's medium are added, mixed and incubated at room temperature for 15 minutes. The transfection mixture is then added dropwise to Sf9 insect cells (ATCC CRL 1711) seeded on a 35 mm tissue culture plate with 1 ml of serum-free Grace's medium. The plate is rocked back and forth to mix the newly added solution. The plate is then incubated at 27 ° C. for 5 hours. After 5 hours, the transfection solution was removed from the plate and 1 m supplemented with 10% fetal calf serum.
Add 1 Grace insect medium. The plate is returned to the incubator and the culture is continued at 27 ° C. for 4 days.

After 4 days, supernatants are collected and plaque assays are performed as described by Summers and Smith, supra. "Blue Gal" (Life Tec
hnologies Inc. Agarose gel containing Gaitersburg, Inc., is used to allow easy identification and isolation of clones expressing gal (resulting in blue-colored plaques). (A detailed description of this type of “plaque assay” is also available from Life Technologies Inc., Ga.
(see pages 9-10 in the User's Guide for Insect Cell Culture and Baculovirology, distributed by itersburg).

After 4 days of serial dilution, the virus is added to the cells. After appropriate incubation, the blue colored plaque is picked up with the tip of an Eppendorf pipette. The agar containing the recombinant virus was then mixed with 200 μl Grace's medium in Ep.
Resuspend in a pendorf tube. The agar is removed by brief centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells seeded on a 35 mm dish. Four days later, the supernatants of these culture dishes are collected and then stored at 4 ° C. HESSB I, II and I properly inserted
Clones containing II are identified by DNA analysis, including restriction mapping and sequencing. This is named V-galectin 11 in this specification.

Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS. The cells are infected with recombinant baculovirus V-galectin 11 at a multiplicity of infection ("MOI") of about 2 (about 1 to about 3). After 6 hours, the medium was removed and SF900II medium without methionine and cysteine (LifeTech).
noologies Inc. , Available from Gaithersburg). After 42 hours, 5 μCi of ³⁵ S-methionine and 5 μCi of ³⁵ S-cysteine (available from Amersham) are added. The cells are cultured for an additional 16 hours, then harvested by centrifugation, lysed, and labeled protein
Visualize by DS-PAGE and autoradiography.

Example 3 Cloning and Expression in Mammalian Cells Most vectors used to transiently express galectin-11 polypeptide gene sequences in mammalian cells are SV40 replication. Should have a starting point. This allows for replication of the vector up to high copy numbers in cells (eg, COS cells) that express the T antigen required for initiation of viral DNA synthesis. Any other mammalian cells can also be used for this purpose.

A typical mammalian expression vector contains a promoter element that mediates the initiation of transcription of mRNA, a protein coding sequence, and signals necessary for termination of transcription and polyadenylation of the transcript. Additional elements include enhancers, Kozak sequences, and intervening sequences flanked by donor and acceptors of RNA splicing. High efficiency transfer is SV40
Early and late promoters from retroviruses (eg, R
Long terminal repeats (LTRs) from SV, HTLVI, HIVI) as well as the early promoter of cytomegalovirus (CMV). However, cellular signals such as the human actin promoter can also be used. Expression vectors suitable for practicing the present invention include, for example, pSVL and pM
SG (Pharmacia, Uppsala, Sweden), pRSVcat
(ATCC 37152), pSV2dhfr (ATCC 37146) and pBC12MI (ATCC 67109). Mammalian host cells that can be used include human HeLa, 283, H9 and Jurkat cells,
Mouse NIH3T3 and C127 cells, Cos1, Cos7 and CV1,
African green monkey cells, quail QC1-3 cells, mouse L cells, and Chinese hamster ovary cells.

Alternatively, the gene can be expressed in a stable cell line that contains the gene integrated into a chromosome. Co-transfection with a selectable marker such as dhfr, gpt, neomycin, hygromycin allows identification and isolation of transfected cells.

The transfected gene can also be amplified and express large amounts of the encoded protein. DHFR (dihydrofolate reductase) is a useful marker for the development of cell lines that carry hundreds or thousands of copies of the gene of interest. Another useful selectable marker is the enzyme glutamine synthase (GS) (Murph
y et al., Biochem J. et al. 227: 277-279 (1991); Bebbi.
ngton et al., Bio / Technology 10: 169-175 (199).
2)). Using these markers, mammalian cells are grown in selective media and cells with the highest resistance are selected. These cell lines contain the amplified gene integrated into the chromosome. Chinese hamster ovary (C
HO) cells are often used in the production of proteins.

The expression vectors pC1 and pC4 are compatible with the Rous sarcoma virus strong promoter (LTR) (Cullen et al., Molecular and Cellula).
r Biology, 438-4470 (March, 1985)), and C
MV enhancer (Boshart et al., Cell 41: 521-530 (19
85)). Multiple cloning sites (eg, BamH
I, XbaI and Asp718 restriction enzyme cleavage sites) facilitate cloning of the gene of interest. This vector also contains three introns of the rat preproinsulin gene, a polyadenylation signal and a termination signal.

(Example 3 (a): Cloning and Expression in COS Cells) The expression plasmid pgalectin11 was replaced with the cDNA encoding galectin 11 by the expression vector pcDNAI / Amp (Invitrogen, I
nc. (Available from Co., Ltd.).

The expression vector pcDNAI / amp contains the following: E. coli, effective for growth in E. coli and other prokaryotic cells. E. coli origin of replication; (
2) the ampicillin resistance gene for selection of prokaryotic cells containing the plasmid; (3) the SV40 origin of replication for growth in eukaryotic cells; (4) the polylinker restriction site A CMV promoter, a polylinker, a S linker, which can be conveniently placed under expression control of the CMV promoter and operably linked to the SV40 intron and polyadenylation signal.
V40 intron, and polyadenylation signal.

Galectin 11 Protein and HA In-Frame Fused at its 3 ′ End
The DNA fragment encoding the tag is cloned into the polylinker region of the vector so that recombinant protein expression is driven by the CMV promoter. The HA tag is described in Wilson et al. (Cell 37: 767 (1984)).
Corresponds to the epitope derived from the influenza hemagglutinin protein. Fusion of the HA tag to the target protein allows for easy detection of the recombinant protein using an antibody that recognizes the HA epitope.

The strategy for plasmid construction is as follows. The galectin-11 cDNA of the deposited clone was cloned into E. coli. For construction of the expression vector for expression of galectin-11 in E. coli, amplification is performed using primers containing convenient restriction sites as fully described above. One of the primers contains a hemagglutinin tag ("HA tag") as described above to facilitate detection, purification and characterization of the expressed galectin-11.

Suitable primers for use in this example include the following.
The 5 'galectin 11 primer has the sequence 5' cgc CCCGGG gccatcA
TGGCCTATCATGAGCCCGAGCTGGGAG 3 ′ (SEQ ID NO: 9
) And comprises the underlined SmaI restriction enzyme site followed by the nucleotide sequence 49-66 of FIG. 1 (SEQ ID NO: 1).

The 3 ′ galectin 11 primer has the sequence 5 ′ cgc GGTACTCAGGA
It has a GTGGACACAGTAG 3 '(SEQ ID NO: 8) and comprises nucleotides complementary to the Asp718 restriction enzyme site, followed by nucleotides 432-450 of the nucleotide sequence of galectin 11 described in FIG. 1 (SEQ ID NO: 1).

The PCR amplified DNA fragment and the vector pcDNAI / Amp were
Digest with indIII and XhoI and ligate. The ligation mixture is coli SURE strain (Stratagene Cloning Sy
stems, 11099 North Torrey Pines Road,
(Available from La Jolla, CA 92037), and the transformed culture is plated on ampicillin medium plates and then incubated to grow ampicillin-resistant colonies. Plasmid DNA
Are isolated from resistant colonies and tested for the presence of the fragment encoding galectin 11 by restriction analysis and size fractionation on a gel.

For expression of recombinant galectin 11, DEAE-DEXTRA as described above
N (see, eg, Sambrook et al., MOLECULAR CLONI).
NG: A LABORATORY MANUAL, Cold Spring L
laboratory Press, Cold Spring Harbor, N
ew York (1989)), transfect COS cells with an expression vector. The cells are incubated under conditions for expression of galectin-11 by the vector.

The expression of the galectin-11 HA fusion protein was determined by radiolabeling and immunoprecipitation (
See, for example, Harlow et al., ANTIBODIES: A LABORATORY.
MANUAL, 2nd edition; Cold Spring Harbor Labora
tory Press, Cold Spring Harbor, New Yo
rk (using the method described in 1988)). For this purpose, two days after transfection, the cells are labeled by incubating them for 8 hours in a medium containing 35S-cysteine. The cells and media are collected, and the cells are washed and detergent-containing RIPA buffer (150 mM NaCl, 1% as described in Wilson et al., Cited above).
NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50
Dissolve using mM TRIS, pH 7.5). A protein lysate,
And from the culture medium using an HA-specific monoclonal antibody. Next, the precipitated protein is analyzed by SDS-PAGE gel and autoradiography. An expression product of the expected size is found in the cell lysate. An expression product of this expected size is not seen in the negative control.

Example 3 (b): Cloning and Expression in CHO Cells The vector pC1 is used for the expression of the galectin-11 protein. Plasmid pC1 is plasmid pSV2-dhfr [ATCC accession number 37146].
Is a derivative of Both plasmids contain the mouse DHFR gene under the control of the SV40 early promoter. Chinese hamster ovary cells or other cells lacking dihydrofolate activity, transfected with these plasmids, are selected from selective media (α minus MEM, Life T) supplemented with the chemotherapeutic agent methotrexate.
(e.g., technologies). Amplification of the DHFR gene in methotrexate (MTX) resistant cells is well documented (eg, Alt, FW, Kellems, RM, Bertino,
J. R. And Schimke, R .; T. 1978; Biol. Che
m. 253: 1357-1370, Hamlin, J. M .; L. And Ma, C.I. ,
1990, Biochem. et Biophys. Acta. 1097: 10
7-143, Page, M.P. J. And Sydenham, M .; A. 1991,
Biotechnology 9: 64-68). Cell growth in increasing concentrations of MTX resulted in the target enzyme D
Overexpression of HFR results in drug resistance. When a second gene is linked to the DHFR gene, that gene is usually co-amplified and over-expressed. The development of cell lines that carry more than 1,000 copies of a gene
State of the art in the field. Subsequently, when the methotrexate is removed, the cell line contains the amplified gene integrated into the chromosome.

[0515] Plasmid pC1 is a strong promoter of the Rous sarcoma virus long terminal repeat (LTR) (Cullen et al., Molecula) for expression of the gene of interest.
r and Cellular Biology (March, 1985: 43).
8-4470)), and a fragment isolated from an enhancer of the immediate early gene of human cytomegalovirus (CMV) (Boshart et al., Cell 4).
1: 521-530, 1985). Downstream of the promoter is followed by a single restriction enzyme cleavage site to allow for gene integration: BamHI, PvuI.
I, and NruI. After these cloning sites, the plasmid contains a translation stop codon in all three reading frames, followed by three introns of the rat preproinsulin gene and a polyadenylation site. Other high efficiency promoters may also be used for expression (eg, the human actin promoter, the SV40 early or late promoter, or long terminal repeats from other retroviruses (eg, HIV and HTLVI)).
Other signals for polyadenylation of mRNA, such as from the human growth hormone or globin gene, can also be used.

Stable cell lines carrying the gene of interest integrated into the chromosome are also gpt
, G418 or hygromycin during co-transfection with a selectable marker. Initially, it is advantageous to use more than one selectable marker (eg, G418 and methotrexate).

The plasmid pC1 is digested with the restriction enzyme BamHI and then dephosphorylated using bovine intestinal phosphatase by procedures known in the art.
Next, the vector is isolated from a 1% agarose gel.

The DNA sequence encoding galectin 11 (ATCC Accession No. 209053) is amplified using PCR oligonucleotide primers corresponding to the 5 ′ and 3 ′ sequences of the gene.

The 5 ′ galectin 11 primer has the sequence 5 ′ cgc CCCGGG gccatc
It has ATGGCCTATCATGAGCCCAGGCTGGGAG 3 ′ (SEQ ID NO: 9) and includes an underlined SmaI restriction enzyme site followed by the nucleotide sequence 49-66 of FIG. 1 (SEQ ID NO: 1). As described below, when inserted into an expression vector, the 5 'end of the amplified fragment encoding human galectin 11 provides an efficient signal peptide. Efficient signals for translation initiation in eukaryotic cells are described in Kozac, M .; J. Mol. Biol. 196: 947-95
0 (1987) is appropriately located in the vector portion of the construct.

The 3 ′ galectin 11 primer has the sequence 5 ′ cgc GGTACTCAGGA
It has a GTGGACACAGTAG 3 '(SEQ ID NO: 8) and comprises nucleotides complementary to the Asp718 restriction enzyme site, followed by nucleotides 432-450 of the nucleotide sequence of galectin 11 described in FIG. 1 (SEQ ID NO: 1).

The amplified fragment is isolated from a 1% agarose gel as described above, then digested with the endonucleases SmaI and Asp718, and then purified again on a 1% agarose gel.

Next, the isolated fragment and the dephosphorylated vector were converted to T4 DNA
Connect with ligase. Next, E. coli HB101 cells and the plasmid pC1 inserted in the correct orientation using the restriction enzyme SmaI.
Bacteria containing are identified. The sequence of the inserted gene is confirmed by DNA sequencing.

Transfection of CHO-DHFR cells Chinese hamster ovary cells lacking active DHFR enzyme are used for transfection. 5 μg of the expression plasmid C1 was ligated with 0.5 μg of plasmid pSV using the lipofecting method (Felgner et al., Supra).
Co-transfect with neo. Plasmid pSV2-neo contains a dominant selectable marker (neo, a Tn5-derived gene encoding an enzyme that confers resistance to a group of antibiotics, including G418). Cells are seeded in α-min MEM supplemented with 1 mg / ml G418. Two days later, the cells were trypsinized and plated on hybridoma cloning plates (Greiner, Germany),
Then, the cells are cultured for 10 to 14 days. After this period, a single clone was trypsinized and then different concentrations of methotrexate (25 nM, 50 nM, 100 nM,
(200 nM, 400 nM) into a 6-well petri dish. The clones growing at the highest concentration of methotrexate are then transferred to a new 6-well plate containing higher concentrations of methotrexate (500 nM, 1 μM, 2 μM, 5 μM). The same procedure is repeated until the clone grows at a concentration of 100 μM.

[0524] Expression of the desired gene product was determined by Western blot analysis and SDS-PAGE.
Analyze by

Example 4: Tissue Distribution of Protein Expression Northern blot analysis is performed to determine galectin-11 gene expression in human tissues, particularly using the method described by Sambrook et al. (Cited above). The entire nucleotide sequence encoding the galectin 11 protein (
The cDNA probe containing SEQ ID NO: 1) is labeled with 32 P using a redi prime DNA labeling system (Amersham Life Science) according to the manufacturer's instructions. After labeling, the probe was replaced with CHROMA SPIN-10.
Purify using a 0 column (Clontech Laboratories, Inc.) according to the manufacturer's protocol number PT1200-1. Various human tissues are then examined for galectin 11 mRNA using the purified labeled probe.

Multiple (MTN) blots of multiple tissues, including various human tissues (H) or human immune system tissues (IM), were obtained from Clontech and Express.
The Hyb hybridization solution (Clontech) is probed with a labeled probe according to the manufacturer's protocol number PT1190-1. After hybridization and washing, the blot is mounted and exposed to film overnight at -70 ° C, and the film is developed according to standard procedures.

It is apparent that the present invention can be practiced other than as specifically described in the foregoing description and examples.

Example 5 Galectin-11-Induced Apoptosis in Transfected Cells This example demonstrates that transfection of a constitutive galectin-11 expression construct into human Jurkat T cells induces apoptosis of transfected cells. The data shown is shown.

T cells are a type of lymphocyte that mediates a cellular immune response to foreign macromolecules (called antigens), or “leukocytes”. T cells are required for a normal mammalian immune response, but in some cases it is desirable to inhibit their activation: For example, in some autoimmune diseases, a subject's T cells Rather than producing macromolecules, they respond to "self-antigens", ie, macromolecules produced by a subject, and damage cells and tissues of the subject. Autoimmune T cell responses include systemic lupus erythematosus (SLE), rheumatoid arthritis (RA)
, Found in subjects with insulin-dependent diabetes, myasthenia gravis, and multiple sclerosis (MS), and contribute to their respective pathophysiology. T cells also cause graft rejection and graft versus host disease (GVHD). Graft rejection is caused by an immune response to the transplanted tissue (graft) that is recognized as "foreign" by the recipient (host) T cells. Graft versus host disease is caused by transplanted T cells that recognize host-produced macromolecules as "foreign."

(Method) DNA encoding galectin 11 protein of deposited cDNA clone
The sequence was amplified using a PCR oligonucleotide primer specific for the amino terminal sequence of the galectin 11 protein and a PCR oligonucleotide primer specific for the vector sequence 3 'to the gene. The 5 'galectin 11 oligonucleotide primer has the sequence 5' CCGCCGCACCATGAGCCCCCAG
GC3 '(SEQ ID NO: 10). It contains nucleotides 49-61 of the galectin 11 nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1). 3 'galectin 1
One primer had the sequence 5′GGAA TCTAGA TCAGGAGTGGAC3 ′
(SEQ ID NO: 11). It contains an underlined XbaI restriction site followed by a nucleotide sequence complementary to positions 439-450 of the galectin 11 nucleotide sequence (SEQ ID NO: 1) shown in FIG.

The amplified galectin-11 fragment was isolated from a 1% agarose gel, digested with endonuclease XbaI, purified again on a 1% agarose gel, and restricted using T4 DNA ligase as described above. It was ligated to the multiple cloning site of pEF1.

The pEF1 vector was generated by replacing the CMV promoter on pIRESneo (Clontech) with a human elongation factor 1a constitutive promoter from pEF-BOS. The EF1a promoter has been shown to be very active in various cell types (data not shown). This vector also contains a bovine growth hormone poly A signal and ampicillin resistance gene, a ribosome binding site ("RBS"), a 6-His tag, and a restriction enzyme site. This vector was digested with EcoRI, BamHI, and phosphatase using techniques known in the art.

Insertion of the isolated galectin-11 fragment into the restricted pEF1 vector comprises linking the galectin-11 polypeptide coding region downstream and operably downstream of the elongation factor 1 constitutive promoter of the vector, and Placed in frame with the starting AUG, which was properly positioned for translation of galectin-11. Then, E. c
Oli cells were transformed with the ligation reaction and the desired construct (pEFLeg11
) Were identified using techniques known in the art. Then, pEFLe
Cells containing the g11 expression construct were cultured under known conditions that favored high yields, and the expression construct was isolated from bacterial cell cultures using techniques known in the art.

For detection of apoptosis, human Jurk was detected using techniques known in the art.
at T cells were co-transfected with the pEFLeg11 expression construct along with a marker plasmid encoding green fluorescent protein (GFP). The transfected cells were then transferred to MitoTracker Red (Molec
ultraprobes), the transmembrane potential of mitochondria was determined and analyzed by two-color flow cytometry. Transfected populations were identified by emission of green fluorescence due to GFP expression. Apoptotic cells display a disrupted mitochondrial transmembrane potential and therefore have lower red fluorescence emission. This is due to the reduced ability to quench the dye MitoTracker Red.

(Results) Jurkat cells transfected with the constitutive expression plasmid for “Galectin 11” developed significant apoptosis 24 hours after transfection. About 30% of the “galectin 11” transfected cells had the insert (
10% in cells transfected with control vector without pEF1)
A decrease in mitochondrial transmembrane potential was shown, which was less than (Figure 5A).

We also have control vector pEF1 or “galectin 11”
The number of GFP positive cells was followed during 4 days of culture after co-transfection with either of the expression vectors pEF1-Leg11. After transfection with pEF1, there were about 4 times more viable GFP positive cells than transfection with pEF1-Leg11 (FIG. 5B).

Example 6: Construction of N-terminal and / or C-terminal deletion mutants The following general method can be used to clone an N-terminal or C-terminal deletion galectin 11 deletion mutant . Generally, two oligonucleotide primers of about 15-25 nucleotides are derived from the desired 5 'and 3' positions of the polynucleotide of SEQ ID NO: 1. The 5 'and 3' positions of the primers are determined based on the desired galectin-11 polynucleotide fragment. Initiation codons and stop codon are added, if necessary, to the 5 'and 3' primers, respectively, to express the galectin-11 polypeptide fragment encoded by the polynucleotide fragment. Preferred galectin-11 polynucleotide fragments are those encoding the N-terminal and C-terminal deletion variants disclosed above in the "Galectin-11 Polynucleotide Fragments and Polypeptide Fragments" section herein. .

Additional nucleotides, including restriction sites to facilitate cloning of the Galectin-11 polynucleotide fragment in the desired vector, can also be added to the 5 ′ and 3 ′ primer sequences. Galectin-11 polynucleotide fragments are amplified from genomic DNA or from a deposited cDNA clone using appropriate PCR oligonucleotide primers and conditions discussed herein or known in the art. Galectin-11 polypeptide fragments encoded by the galectin-11 polynucleotide fragments of the invention can be expressed as full-length polypeptides and purified in a similar general manner, but with specific fragments and full-length Conventional modifications may be required due to differences in chemical and physical characteristics between the polypeptides.

By way of example, and not by way of limitation, a polynucleotide encoding a galectin-11 polypeptide fragment (L-5 to L-128) is amplified and cloned as follows: The polynucleotide sequence encoding the N-terminal portion of the polypeptide fragment beginning with 5 is used to generate a 5 'primer that includes a restriction enzyme site in frame, followed by a start codon. The polynucleotide sequence encoding the C-terminal portion of the galectin-11 polypeptide fragment terminating in L-128 is used to generate a complementary 3 'primer containing a restriction enzyme site in-frame followed by a stop codon.

The amplified polynucleotide fragment and expression vector are digested with a restriction enzyme that recognizes a site in the primer. The digested polynucleotides are then ligated together. The galectin-11 polynucleotide fragment is inserted into the restricted expression vector, preferably such that the galectin polypeptide fragment coding region is located downstream from the promoter. This ligation mixture was subjected to standard procedures and to competent E. coli as described in the Examples herein. E. coli cells. Plasmid DNA was isolated from resistant colonies and identification of cloned DNA was performed by restriction analysis, PCR and D
Confirmed by NA sequencing.

Example 7: Protein fusion of galectin 11 Galectin 11 polypeptide is preferably fused to another protein.
These fusion proteins can be used for various applications. For example, galectin 1
Fusion of one polypeptide to His tag, HA tag, Protein A, IgG domain and maltose binding protein facilitates purification (see Example 5; see also EP A 394,827). Traunecker et al., Nature, 331: 84-86 (1988)). Similarly, IgG-1, I
Fusion to gG-3 and albumin increases half-life in vivo. Nuclear localization signals fused to galectin-11 polypeptides can target proteins to specific subcellular locations. On the other hand, covalent heterodimers or homodimers are
The activity of the fusion protein may be increased or decreased. Fusion proteins can also create chimeric molecules with more than one function. Finally, the fusion protein may increase the solubility and / or stability of the fusion protein as compared to a non-fusion protein. All types of the above fusion proteins can be made by modifying the following protocol outlining the fusion of the polypeptide to an IgG molecule, or the protocol described in Example 3.

[0521] Briefly, the human Fc portion of an IgG molecule can be PCR amplified using primers spanning the 5 'and 3' ends of the sequences described below. These primers should also have convenient restriction sites to facilitate cloning into expression vectors, preferably mammalian expression vectors.

For example, if pC4 (Accession No. 209646) is used, the human Fc portion can be ligated into a BamHI cloning site. Note that the 3 'BamHI site should be destroyed. Next, the vector containing the human Fc portion is
The galectin-11 polynucleotide was re-restricted with amHI, the vector was linearized, and isolated by the PCR protocol described in Example 1.
It is linked to this BamHI site. Note that the polynucleotide is cloned without a stop codon, otherwise no fusion protein will be produced.

When a naturally occurring signal sequence is used to produce a secreted protein, pC4 does not require a second signal peptide. Alternatively, if a naturally occurring signal sequence is not used, the vector can be modified to include a heterologous signal sequence (see, eg, WO 96/34891).

[0545] Human IgG Fc region:

[0546]

Embedded image .

Example 8 Production of Antibodies (a. Hybridoma Technology) The antibodies of the present invention can be prepared by various methods. (Current Pr
otocols, see Chapter 2). As one example of such a method, cells expressing galectin 11 are administered to an animal to induce the production of serum containing polyclonal antibodies. In a preferred method, a preparation of the galectin-11 protein is prepared and purified to be substantially free of natural contaminants. Such a preparation is then introduced into an animal to produce a higher specific activity polyclonal antiserum.

[0555] Monoclonal antibodies specific for the galectin-11 protein are prepared using hybridoma technology (Kohler et al., Nature 256: 4).
95 (1975); Kohler et al., Eur. J. Immunol. 6: 511
(1976); Kohler et al., Eur. J. Immunol. 6: 292 (1
976); Hammerling et al .: Monoclonal Antibodi.
es and T-Cell Hybridomas, Elsevier, N .;
Y. 563-681 (1981)). Generally, an animal (preferably a mouse) is immunized with a galectin-11 polypeptide, or more preferably, with cells expressing a secreted galectin-11 polypeptide. Such polypeptide-expressing cells are preferably supplemented with 10% fetal calf serum (inactivated at about 56 ° C.) in any suitable tissue culture medium, and contain about 10 g / l of non-essential amino acids, about 1 2,000U / m
E supplemented with 1 penicillin and about 100 μg / ml streptomycin
Cultured in arrle modified Eagle's medium.

The splenocytes of such mice are extracted and fused with a suitable myeloma cell line. Any suitable myeloma cell line can be used according to the present invention;
It is preferred to use the parental myeloma cell line (SP2O) available from CC. After fusion, the resulting hybridoma cells are selectively maintained in HAT medium, and then are described in Wands et al. (Gastroenterology 80: 225-232 (
1981)) by cloning by limiting dilution. The hybridoma cells obtained through such selection are then assayed to identify clones secreting antibodies capable of binding galectin-11 polypeptide.

Alternatively, additional antibodies capable of binding galectin-11 polypeptide may be generated in a two-step procedure using anti-idiotypic antibodies. Such methods take advantage of the fact that antibodies are themselves antigens, and thus it is possible to obtain antibodies that bind to a second antibody. According to this method, an animal, preferably a mouse, is immunized using a protein-specific antibody. The spleen cells of such animals are then used to produce hybridoma cells. The hybridoma cells are then screened to identify clones that produce an antibody that can block the ability of the antibody to bind to a galectin-11 protein-specific antibody. Such antibodies include anti-idiotypic antibodies to galectin-11 protein-specific antibodies and are used to immunize animals to induce the formation of additional galectin-11 protein-specific antibodies.

For in vivo use of the antibody in humans, the antibody is “humanized”. Such antibodies can be produced by using a genetic construct derived from a hybridoma cell producing the monoclonal antibody described above. Methods for producing chimeric and humanized antibodies are known in the art and are discussed herein (for a review, see Morrison, Science 229: 120).
2 (1985); Oi et al., BioTechniques 4: 214 (1986).
Cabilly et al., U.S. Patent No. 4,816,567; Taniguchi.
Morrison et al., EP 173494; Neub.
Erger et al., WO 8615333; Robinson et al., WO 87026.
71; Boulianne et al., Nature 312: 643 (1984); N.
Euberger et al., Nature 314: 268 (1985)).

(B) Isolation of Antibody Fragments Directed to Galectin-11 Polypeptide from a Library of scFvs The naturally occurring V gene isolated from human PBLs was exposed to or exposed to a donor. A library of antibody fragments containing reactivity to galectin 11 that could not be constructed (see, eg, US Pat. No. 5,885,793, which is incorporated herein by reference in its entirety). .

Library rescue.

A library of scFvs is constructed from human PBL RNA as described in PCT Publication WO 92/01047. To rescue phage displaying antibody fragments, approximately 10 ⁹ E. coli harboring phagemids were rescued. E. coli is used to inoculate 50 ml of 2 × TY (containing 1% glucose and 100 μg / ml ampicillin) (2 × TY-AMP-GLU) and shake with O.
. 8 of O. D. Propagate to growth. Using 5 ml of this culture, 50 ml of 2 × T
Y-AMP-GLU was inoculated and 2 × 108 TU Δgene 3 helper (M13Δ
Gene III, see PCT Publication No. WO 92/01047) is added and the culture is incubated at 37 ° C. for 45 minutes without shaking, and then for 45 minutes at 37 ° C. with shaking. The culture is incubated at 4000 r. p.
m. And pellet the pellet in 2 liters of 2 × TY (100 μg / ml).
(Containing ampicillin and 50 μg / ml kanamycin) and grow overnight. The phage is prepared as described in PCT Publication WO 92/01047.

The M13Δ gene III is prepared as follows: M13Δ gene III helper phage does not encode the gene III protein. Thus, phage displaying antibody fragments (phagemids) have a greater binding avidity for the antigen. During phage morphogenesis, infectious M13Δgene III particles are generated by growing helper phage in cells carrying a pUC19 derivative that supplies the wild-type gene III protein. The culture is incubated for 1 hour at 37 ° C. without shaking, then further incubated at 37 ° C. with shaking. The cells are centrifuged (IEC-Centra 8, 400 rpm).
. For 10 minutes) and 300 ml of 2 × TY broth (2 × TY-AMP-KAN) containing 100 μg / ml ampicillin and 25 μg / ml kanamycin
And grown overnight at 37 ° C. with shaking. Phage particles
Purify and concentrate from culture medium by two PEG precipitations (Sambrook et al., 1990), resuspend in 2 ml PBS, and filter with 0.45 μm filter (M
Inert NML; Sartorius) to give a final concentration of about 10 ¹³ transducing units / ml (ampicillin resistant clone).

[0556] Library panning.

[0557] Immunotubes (Nunc) was used to prepare 100 μg of the polypeptide of the present invention.
Coat overnight in PBS with 4 ml of either 10 / ml or 10 μg / ml. Tubes are blocked with 2% Marvel-PBS at 37 ° C. for 2 hours, then washed three times in PBS. Approximately 10 ¹³ TU of phage is applied to the tube and incubated for 30 minutes at room temperature while tumbling up and down on a turntable, and then allowed to stand for an additional 1.5 hours. Place the tube in PBS 0.1% T
Wash 10 times with ween-20 and 10 times with PBS. 1 ml of 100 mM
The phage was eluted by adding triethylamine and spinning up and down on a wheel for 15 minutes, after which 0.5 ml of 1.0 M Tris-H was added to the solution.
Neutralize immediately with Cl, pH 7.4. The eluted phages were then incubated with the bacteria for 30 minutes at 37 ° C., so that
Mid-logarithmic growth of E. coli. E. coli TG1. Then, E. E. coli is plated on a TYE plate containing 1% glucose and 100 μg / ml ampicillin. The resulting bacterial library is then rescued with the Δ gene 3 helper phage as described above to prepare phage for the next round of selection. This process was then repeated for all four rounds of affinity purification,
On the fourth and fourth rounds, the tube was washed with PBS, 0.1% Tween-20 for 2 times.
Increase to 0 times and 20 times with PBS.

Characterization of the binder.

Using phage eluted from the third and fourth rounds of selection, E. coli coli
HB 2151 is infected and soluble scFv is generated from a single colony for the assay (Marks et al., 1991). 50 mM bicarbonate, pH 9.
ELISAs are performed using microtiter plates coated with any of the polypeptides of the invention in 10 pg / ml. Positive clones in the ELISA are further characterized by PCR fingerprinting (see, eg, PCT Publication WO 92/01047), and then sequencing. These EL
ISA-positive clones can also be prepared using techniques known in the art, such as epitope mapping, binding affinity, receptor signal transduction, the ability to block or competitively inhibit antibody / antigen binding, and competitive agonist activity or competition. Antagonist activity, etc.).

Example 9 Galectin 11 for High Throughput Screening Assay
Protein Production The following protocol produces a supernatant containing the galectin-11 polypeptide to be tested. This supernatant can then be used in the screening assays described in Examples 14-21.

First, poly-D-lysine (644 587 Boehringer-Man
nheim) stock solution (1 mg / ml in PBS) in PBS (17-516F Biowhittaker without calcium or magnesium) at 1: 2.
Dilute to 0 to make working solution 50 μg / ml. 200 μl of this solution is added to each well (24 well plate) and incubated for 20 minutes at room temperature. Ensure that the solution is distributed over each well (Note: a 12-channel pipettor can be used with tips on every other channel). The poly-D-lysine solution is aspirated off and rinsed with 1 ml PBS (phosphate buffered saline). PBS should be left in the well until just before plating the cells, and the plate can be pre-coated with polylysine up to two weeks before.

293T cells (no cells beyond P + 20) were treated at 2 × 10 ⁵ cells / well with 0.5 ml of DMEM (Dulbecco modified Eagle's medium) (4.
5 G / L glucose and L-glutamine (12-604F Biowhite)
taker)) / 10% heat-inactivated FBS (14-503F Biowhi)
ttaker) / 1 × Penstrep (17-602E Biowhitta)
ker). Grow cells overnight.

The following day, in a sterile solution container (basin), 300 μl Lipofectamine (1
8324-012 Gibco / BRL) and 5 ml Optimem I (
Mix 31985070 Gibco / BRL) / 96 well plates together. Using a small volume multi-channel pipettor, place about 2 μg of the expression vector containing the polynucleotide insert produced by the method described in Examples 8-10 into a suitably labeled 96-well round bottom plate. Aliquot. Using a multichannel pipettor, 50 μl of Lipofectamine / Opti
Add the mem I mixture to each well. Mix by pipetting up and down gently. Incubate at room temperature for 15-45 minutes. After about 20 minutes, add 150 μl Optimem I to each well using a multi-channel pipettor. As a control, one plate of vector DNA lacking the insert should be transfected with each set of transfections.

[0564] Preferably, the transfection is performed in a team
tag-teaming). By forming a tag team,
The time effort is halved and cells do not spend too much time on PBS. First, A removes the medium from the four 24-well plates of cells, and then B rinses each well with 0.5-1 ml of PBS. Mr. A then aspirated off the PBS rinse, and Mr. B. used a 12-channel pipettor with a tip every other channel and 200 μl of DNA.
The / Lipofectamine / Optimem I complex is added to each row on a 24-well plate, first to odd wells, then to even wells. Incubate at 37 ° C. for 6 hours.

While incubating the cells, either 1% BSA in DMEM with 1 × penstrep or HGS CHO-5 medium containing 2 mM glutamine and 1 × penstrep (116.6 mg / L CaCl 2 (anhydrous Product); 0.00130 mg / L CuSO4-5H2O; 0.050 mg / L Fe (NO3) 3-9H2O; 0.417 mg / L FeSO4-7H2O;
11.80 mg / L KCl; 28.64 mg / L MgCl2; 48.84 m
g / L MgSO4; 6995.50 mg / L NaCl; 2400.0 mg /
L NaHCO3; 62.50 mg / L NaH2PO4-H2O; 71.02
mg / L Na2HPO4; 0.4320 mg / L ZnSO4-7H2O; 0
. 002 mg / L arachidonic acid; 1.022 mg / L cholesterol;
070 mg / L DL-α-tocopherol acetate; 0.0520 mg / L linoleic acid; 0.010 mg / L linolenic acid; 0.010 mg / L myristic acid; 0.010 mg / L oleic acid; 0.010 mg / L palmito oleic acid; 0.010 mg / L palmitic acid; 10
0 mg / L Pluronic F-68; 0.010 mg / L stearic acid; 2.20 mg / L Tween 80; 4551 mg / L D-glucose; 1
30.85 mg / ml L-alanine; 147.50 mg / ml L-arginine-HCl; 7.50 mg / ml L-asparagine-H2O; 6.65 mg /
ml L-aspartic acid; 29.56 mg / ml L-cystin 2HCl-H
20; 31.29 mg / ml L-cystin-2HCl; 7.35 mg / ml L-glutamic acid; 365.0 mg / ml L-glutamine; 18.75 mg / ml
ml of glycine; 52.48 mg / ml L-histidine-HCl-H2O; 1
06.97 mg / ml L-isoleucine; 111.45 mg / ml L-leucine; 163.75 mg / ml L-lysine HCL; 32.34 mg / ml L
-Methionine; 68.48 mg / ml L-phenylalanine; 40.0 mg /
ml L-proline; 26.25 mg / ml L-serine; 101.05 mg / ml
ml L-threonine; 19.22 mg / ml L-tryptophan; 91.7
9 mg / ml L-Tyrosine-2Na-2H2O; 99
. 65 mg / ml L-valine; 0.0035 mg / L biotin; 3.24 m
g / L D-Ca pantothenic acid; 11.78 mg / L choline chloride; 4.65 m
g / L folic acid; 15.60 mg / L i-inositol; 3.02 mg / L niacinamide; 3.00 mg / L pyridoxal HCL; 0.031 mg / L
L pyridoxine HCL; 0.319 mg / L riboflavin; 3.17 mg / L
L thiamine HCL; 0.365 mg / L thymidine; 0.680 mg / L vitamin B12; 25 mM HEPES buffer; 2.39 mg / L Na hypoxanthine; 0.105 mg / L lipoic acid; 0.081 mg / L of putrescine sodium-2HCL; 55.0 mg / L of sodium pyruvate; 0.0067 mg
/ L sodium selenite; 20 μM ethanolamine; 0.122 mg /
L ferric citrate; methyl complexed with 41.70 mg / L linoleic acid
B-cyclodextrin; methyl-B-cyclodextrin complexed with 33.33 mg / L oleic acid; methyl-B-cyclodextrin complexed with 10 mg / L retinal acetate (adjusted osmolality to 327 mOsm) )
Prepare an appropriate culture medium. (1 L for 10% BSA stock solution
100 g of BSA (81-068-3 Bayer) was dissolved in DMEM).
The medium is filtered and 50 μl are collected in a 15 ml polystyrene conical for the endotoxin assay.

The transfection reaction is terminated at the end of the incubation period, preferably in a tag team. Mr. A aspirates off the transfection medium, while Mr. B adds 1.5 ml of the appropriate medium to each well. Incubate at 37 ° C. for 45 or 72 hours depending on the medium used:
45% for 1% BSA or 72 hours for CHO-5.

On day 4, 600 μl using a 300 μl multichannel pipettor
Was aliquoted into one 1 ml deep well plate and the remaining supernatant was
Aliquot into the deep wells. Then, the supernatant from each well was prepared in Examples 11-1.
7 can be used.

If activity is obtained in any of the assays described below using the supernatant, the activity may be directly from galectin-11 polypeptide (eg, as a secreted protein) or from other proteins. It is particularly understood that it is derived either from galectin-11 which induces expression (this protein is then secreted into the supernatant). Accordingly, the invention further provides a method of identifying a protein in a supernatant that is characterized by activity in a particular assay.

Example 10 Construction of GAS Reporter Constructs One signaling pathway involved in cell differentiation and proliferation is Jak-STA.
Called the T path. The proteins activated in the Jak-STAT pathway are:
Binds to the gamma activation site "GAS" element or interferon sensitive response element ("ISRE"), located in the promoters of many genes. Binding of the protein to these elements alters the expression of the relevant gene.

The GAS and ISRE elements are recognized by signal transducers and activators of transcription, a class of transcription factors called “STATs”. There are six members of the STAT family. S
tat1 and Stat3, like Stat2 (like a broad response to IFNα), are present in many cell types. Stat4 is more restricted and absent in many cell types, but is found in T helper class I cells after treatment with IL-12. Stat5 was originally called breast growth factor, but has been found at higher concentrations in other cells, including bone marrow cells. It can be activated in tissue culture cells by many cytokines.

STATs are activated and translocate from the cytoplasm to the nucleus upon tyrosine phosphorylation by a set of kinases known as the Janus Kinase (“Jak”) family. Jak is representative of a unique family of soluble tyrosine kinases and includes Tyk2, Jak1, Jak2, and Jak3. These kinases show significant sequence similarity and are generally catalytically inactive in resting cells.

Jak is activated by a wide range of receptors as summarized by the table below. (Schidler and Darnell, Ann. Rev. Bio.
chem. 64: 621-51 (1995). The family of cytokine receptors that can activate Jak can be divided into two groups: (a
) Class 1 is IL-2, IL-3, IL-4, IL-6, IL-7, IL-9
, IL-11, IL-12, IL-15, Epo, PRL, GH, G-CSF,
Including receptors for GM-CSF, LIF, CNTF, and thrombopoietin; and (b) class 2 includes IFN-a, IFN-g, and IL-10
including. Class 1 receptors include a conserved cysteine motif (a set of four conserved cysteines and one tryptophan), and a WSXWS motif (a membrane-proximal region encoding Trp-Ser-XXX-Trp-Ser (SEQ ID NO: 5)). To share.

Thus, upon binding of the ligand to the receptor, Jak is activated, which in turn activates STAT, which then migrates and binds to the GAS element. This entire process is involved in the Jak-STAT signaling pathway.

Thus, Jak reflected by the binding of GAS or ISRE elements
-Activation of the STAT pathway can be used to indicate proteins involved in cell growth and differentiation. For example, growth factors and cytokines are available from Jak-STA.
It is known to activate the T pathway. (See table below). Therefore,
By using a GAS element linked to a reporter molecule, Jak-S
Activators of the TAT pathway can be identified.

[0575]

[Table 3] To construct a synthetic GAS containing the promoter elements used in the biological assays described in Examples 11-12, a GAS-SV40 promoter sequence is generated using a PCR-based strategy. The 5 'primer is
Includes four tandem copies of the GAS binding site found in the IRF1 promoter and previously demonstrated to bind to STAT upon induction with a range of cytokines (Rothman et al., Immunity 1: 457. -4
68 (1994)), other GAS or ISRE elements may be used instead. The 5 'primer also contains an 18 bp sequence complementary to the SV40 early promoter sequence and is adjacent to the XhoI site. The sequence of the 5 'primer is as follows:

[0576]

Embedded image The downstream primer is complementary to the SV40 promoter and
adjacent to the dIII site:

[0577]

Embedded image .

The PCR amplification is performed using the SV40 promoter template present in the B-gal: promoter plasmid obtained from Clontech. The resulting PCR fragment is digested with XhoI / HindIII and subcloned into BLSK2- (Stratagene). Sequencing using forward and reverse primers confirms that the insert contains the following sequence:

[0579]

Embedded image When this GAS promoter element is linked to the SV40 promoter,
Next, the GAS: SEAP2 reporter construct is manipulated. Here, the reporter molecule is secreted alkaline phosphatase, or “SEAP”. However, obviously, in either this or other examples, any reporter molecule can replace SEAP. Known reporter molecules that can be used in place of SEAP include chloramphenicol acetyltransferase (C
AT), luciferase, alkaline phosphatase, β-galactosidase, green fluorescent protein (GFP), or any protein detectable by an antibody.

The synthetic GAS-SV40 promoter element identified by the above sequence was combined with HindIII and XhoI to create a GAS-SEAP vector.
Is used to effectively replace the SV40 promoter with the amplified GAS: SV40 promoter element and subcloned into the pSEAP-promoter vector obtained from Clontech. However, this vector does not contain the neomycin resistance gene and is therefore not preferred for mammalian expression systems.

Thus, to create a stable mammalian cell line that expresses a GAS-SEAP reporter, the GAS-SEAP cassette was removed from the GAS-SEAP vector using SalI and NotI and GAS-SEAP / Neo To make the vector, these restriction sites in the multiple cloning site are used to create a backbone vector containing the neomycin resistance gene (eg, pGFP).
-1 (Clontech)). Once the vector has been transfected into mammalian cells, the vector can then be used as a reporter molecule for GAS binding as described in Examples 11-12.

Other constructs can be made using the above description and replacing GAS with a different promoter sequence. For example, the construction of a reporter molecule comprising NFK-B and EGR promoter sequences is described in Examples 14 and 13. However, many other promoters can be replaced using the protocols described in these examples. For example, SRE, IL-2, NFAT, or osteocalcin promoters alone or in combination (eg, GAS / NF-KB / EGR, G
AS / NF-KB, Il-2 / NFAT, or NF-KB / GAS). Similarly, other cell lines (eg, HELA (epithelial cells), HUVECs (endothelial cells), Reh (B cells), Saos-2 (osteoblasts), HUVACs (aortic cells), or cardiomyocytes) are Can be used to test the activity of the construct.

Example 11: High Throughput Screening Assay for T Cell Activity The following protocol is used to identify factors and that supernatants containing polypeptides of the invention proliferate and promote T cells. T cell activity is assessed by determining whether or not to differentiate. The activity of T cells was determined by GA prepared in Example 10.
Evaluate using the S / SEAP / Neo construct. Thus, factors that increase SEAP activity exhibit the ability to activate the Jak-STATS signaling pathway. The T cells used in this assay were Jurkat T cells (ATCC Deposit No. TI
B-152), but in Molt-3 cells (ATCC accession number CRL-1552).
) And Molt-4 cells (ATCC Deposit No. CRL-1582) cells may also be used.

[0584] Jurkat T cells are lymphoblastic CD4 + Th1 helper cells. Approximately 2 million Jurkat cells were converted to DMR to create a stable cell line.
GAS-SEAP using IE-C (Life Technologies)
/ Neo vector (transfection procedure described below). Transfected cells are seeded at a density of approximately 20,000 cells / well, and transfectants that are resistant to 1 mg / ml genticin are selected. Grow resistant colonies, then
Test their response to increasing concentrations of interferon gamma. 3 shows the dose response of selected clones.

In particular, the following protocol obtains enough cells for 75 wells containing 200 μl of cells. Thus, to produce enough cells for multiple 96-well plates, either this is scaled up or performed in multiples. Jurkat cells were transformed with RP containing 1% Pen-Strep
Maintain in MI + 10% serum. 2.5 ml OPTI-M in a T25 flask
Combine 10 μg of plasmid DNA with EM (Life Technologies). 2.5 ml OPTI-ME containing 50 μl DMRIE-C
Add M and incubate at room temperature for 15-45 minutes.

During the incubation period, the cell concentration was counted, the required number of cells (10 ⁷ per transfection) was spun down, and the final concentration was 10 ⁷ cells / m
Resuspend in OPTI-MEM to l. Then 1 ml of 1 × 10 ⁷ cells in OPTI-MEM is added to the T25 flask and incubated at 37 ° C. for 6 hours. After incubation, 10 ml of RPMI + 15% serum is added. P Jurkat: GAS-SEAP stable reporter strain with RPMI + 10% serum,
Maintain 1 mg / ml Geneticin and 1% Pen-Strep in. These cells are treated with a supernatant containing a galectin-11 polypeptide or a galectin-11-derived polypeptide, as produced by the protocol described in Example 9.

Cells should be washed on the day of treatment with the supernatant and 500,00 / ml
It should be resuspended in fresh RPMI + 10% serum to a density of 0 cells. The exact number of cells required will depend on the number of supernatants screened.
Approximately 10 million cells are required for one 96-well plate (100 million cells for 10 plates).

Transfer cells to a triangular reservoir boat to dispense cells into a 96-well dish using a 12-channel pipette. Transfer 200 μl of cells to each well using a 12-channel pipette (thus, 1 per well)
Add 00,000 cells).

After seeding all plates, 50 μl of supernatant is transferred directly from a 96-well plate containing supernatant to each well using a 12-channel pipette. further,
The dose of exogenous interferon gamma (0.1, 1.0, 10 ng) was added to well H
9, Add to wells H10 and H11 and use as additional positive controls for the assay.

A 96-well dish containing Jurkat cells treated with the supernatant is placed in an incubator for 48 hours (note: this time can be varied between 48 and 72 hours)
. 35 μl of sample from each well is then transferred to an opaque 96-well plate using a 12-channel pipette. The opaque plate should be covered (using a cellophane cover) and stored at −20 ° C. until the SEAP assay is performed according to Example 15. The plate containing the remaining treated cells is placed at 4 ° C. and, if desired, serves as a source of material to repeat the assay on a particular well.

[0591] As a positive control, 100 units / ml of interferon gamma can be used, which is known to activate Jurkat T cells. Typically, more than 30-fold induction is observed in the positive control wells.

The above protocol can be used to generate both transient and stable transfected cells, which will be apparent to those skilled in the art.

Example 12: High Throughput Screening Assay to Identify Myeloid Activity Galectin by determining whether galectin 11 proliferates and / or differentiates myeloid cells using the following protocol Evaluate 11 myeloid activities. The activity of myeloid cells was measured using GAS / SEAP / produced in Example 10.
Evaluate using Neo construct. Therefore, factors that increase SEAP activity are J
Figure 4 shows the ability to activate the ak-STATS signaling pathway. The myeloid cells used in this assay are U937 (pre-monocytic cell line), but TF-1, HL60, or KG1 may also be used.

To transiently transfect U937 cells with the GAS / SEAP / Neo construct produced in Example 10, the DEAE-Dextran method (
Kharbanda et al., 1994, Cell Growth & Differ.
entry, 5: 259-265). First, 2 × 10e ⁷ U937 cells are collected and washed with PBS. U937 cells are usually
Grow in RPMI 1640 medium containing 10% heat-inactivated fetal bovine serum (FBS) supplemented with 00 units / ml penicillin and 100 mg / ml streptomycin.

Next, 0.5 mg / ml DEAE-Dextran, 8 μg of GAS-SE
AP2 plasmid DNA, 140 mM NaCl, 5 mM KCl, 375 μM
_{Na 2 HPO 4 · 7H 2 O} , 1mM MgCl 2, and 675μM CaCl ₂
The cells are suspended in 1 ml of 20 mM Tris-HCl (pH 7.4) buffer containing Incubate at 37 ° C. for 45 minutes.

The cells were washed with RPMI 1640 medium containing 10% FBS and then washed with 10% FBS.
Resuspend in ml of complete medium and incubate at 37 ° C for 36 hours.

GAS-SEAP / U937 stable cells are obtained by growing cells in 400 μg / ml G418. G418-free medium is used to grow routinely, but every 1-2 months the cells are grown at 400 μg / ml G418 for two passages.
Should be regrown in.

The cells are tested by collecting 1 × 10 ⁸ cells, which is enough for ten 96-well plate assays, and washing with PBS. Suspend cells at a final density of 5 × 10 ⁵ cells / ml in 200 ml of growth medium as described above. Plate 200 μl of cells per well (ie, 1 × 10 ⁵ cells / well) in a 96-well plate.

Add 50 μl of the supernatant prepared by the protocol described in Example 9. Incubate at 37 ° C for 48-72 hours. As a positive control, 10
0 units / ml of interferon gamma may be used, which is known to activate U937 cells. Typically, more than 30-fold induction is observed in positive control wells. Supernatant was purified by SE according to the protocol described in Example 15.
Perform AP assay.

Example 13: High Throughput Screening Assays to Identify Neuronal Activity As cells undergo differentiation and proliferation, a group of genes is activated via many different signaling pathways. One of these genes, EGR1 (early growth response gene 1), is induced in various tissues and cell types upon activation. EG
The R1 promoter is responsible for such induction. EGR bound to a reporter molecule
One promoter can be used to assess cell activation by galectin-11.

In particular, the following protocol is used to assess neuronal activity in the PC12 cell line. PC12 cells (rat pheochromosome (phenochrom)
proliferating and / or differentiating by activation with a number of mitogens, such as TPA (tetradecanoylphorbol acetate), NGF (nerve growth factor), and EGF (epidermal growth factor). Is known. Activates EGR1 gene expression during this treatment. Thus, by stably transfecting PC12 cells with a construct containing the EGR promoter linked to a SEAP reporter, activation of PC12 cells by galectin-11 can be assessed.

The EGR / SEAP reporter construct can be assembled according to the following protocol.
EGR-1 promoter sequence (-633 to +1) (Sakamoto K et al., O.
ncogene 6: 867-871 (1991)) can be PCR-amplified from human genomic DNA using the following primers:
3 ′ (SEQ ID NO: 17) 5 ′ GCGAAGCTTCCGCGACTCCCCGGATCCGCCCTC-3
'(SEQ ID NO: 18).

The EGR1 amplification product can then be inserted into this vector using the GAS: SEAP / Neo vector created in Example 10. Restriction enzyme XhoI / H
The GAS: SEAP / Neo vector is linearized using indIII and GA
Remove the S / SV40 stuffer. The EGR1 amplification product is subjected to restriction treatment using these same enzymes. Ligate the vector and the EGR1 promoter.

To prepare a 96-well plate for cell culture, the coating solution (
Collagen Type I (Upstate Biotech Inc. Cat. No. 08
-115) in 1% dilution with 30% ethanol (sterile filtration)
Add 2 ml per m plate or 50 ml per well in a 96 well plate and air dry for 2 hours.

PC12 cells were plated on pre-coated 10 cm tissue culture dishes supplemented with 10% horse serum (JRH BIOSCIENCES, Cat. No. 124) supplemented with penicillin (100 units / ml) and streptomycin (100 μg / ml).
49-78P) RPMI-164 with 5% heat-inactivated fetal bovine serum (FBS)
Grow routinely in Medium 0 (Bio Whitaker). A 1 to 4 split is performed every 3 to 4 days. Remove cells from plate by scraping and resuspend by pipetting up and down more than 15 times.

The EGR / SEAP / Neo construct was purified using the Lipofecta described in Example 11.
Transfect PC12 using the mine protocol. EGR-S
EAP / PC12 stable cells are obtained by growing the cells in 300 μg / ml G418. G418-free medium is used for conventional growth, but every 1-2 months, cells should be regrown in 300 μg / ml G418 for 2 passages.

To assay for neuronal activity, 10 cm plates with cells at approximately 70-80% confluence are screened by removing old media. The cells are washed once with PBS (phosphate buffered saline). The cells were then transferred to low serum medium (1% horse serum and 0.5% FBS with antibiotics).
In RPMI-1640).

The next morning, remove the medium and wash the cells with PBS. The cells are scraped off the plate and the cells are suspended in 2 ml of low serum medium. Count the cell number and add lower serum medium to reach a final cell density of 5 × 10 ⁵ cells / ml.

Add 200 μl of the cell suspension to each well of a 96-well plate (1 × 1
0 equal to ⁵ cells / well). 50 μl of the supernatant produced according to Example 9
Add at 7 ° C for 48-72 hours. As a positive control, PC via EGR
A growth factor known to activate 12 cells can be used (eg, 50 ng / μl nerve growth factor (NGF)). Typically, more than 50-fold SEAP induction is seen in positive control wells. The supernatant was purified by SEA according to Example 15.
Perform P assay.

Example 14: High Throughput Screening Assay for T Cell Activity NF-KB (nuclear factor KB) has a wide variety of agents, including the inflammatory cytokines IL-1 and TNF, CD30 and CD40. , Lymphotoxin-α and Lymphotoxin-β), are transcription factors that are activated by exposure to LPS or thrombin, and by expression of certain viral gene products. As transcription factors, NF-KB is the expression of genes involved in immune cell activation, regulates apoptosis (NF-KB appears to protect cells from apoptosis),
Regulates B and T cell development, antiviral and antimicrobial responses, and multiple stress responses.

In unstimulated conditions, NF-KB is retained in the cytoplasm with I-KB (inhibitor KB). However, upon stimulation, I-KB is phosphorylated and degraded, causing a shuttle of NF-KB to the nucleus, thereby activating transcription of the target gene. Target genes activated by NF-KB include IL-2, IL-6, GM-CSF, ICAM-1 and class 1
MHC.

[0610] Due to its central role and the ability to respond to a range of stimuli, NF-
A reporter construct utilizing the KB promoter element is used to screen the supernatant produced in Example 9. Activators or inhibitors of NF-KB are useful for treating disease. For example, an inhibitor of NF-KB may be used to treat a disease associated with acute or chronic NF-KB activation (eg, rheumatoid arthritis).

To construct a vector containing the NF-KB promoter element, the PCR
Is used. The upstream primer has an NF-KB binding site (
GGGGACTTTCCC) (SEQ ID NO: 19), four tandem copies, SV40
Contains an 18 bp sequence complementary to the 5 'end of the early promoter sequence and is adjacent to the XhoI site: 5': GCGGCCTCGAGGGGACTTTTCCCGGGGACTTTCC
GGGGACTTCCGGGACTTTCCATCCTGGCCATCTCAA
TTAG: 3 '(SEQ ID NO: 20).

The downstream primer is complementary to the 3 ′ end of the SV40 promoter,
And adjacent to the HindIII site: 5 ': GCGGCAAGCTTTTTCAAAGCCTAGGC: 3' (SEQ ID NO: 21).

The PCR amplification is performed using the SV40 promoter template present in the pB-gal: promoter plasmid obtained from Clontech.
The resulting PCR fragment is digested with XhoI and HindIII and subcloned into BLSK2- (Stratagene). T7 and T
Sequencing with the three primers confirms that the insert contains the following sequence:

[0616]

Embedded image The SV40 minimal promoter element present in the pSEAP2-promoter plasmid (Clontech) is then replaced with this NF-KB / SV40 fragment using XhoI and HindIII. However, this vector does not contain the neomycin resistance gene and is therefore not preferred for mammalian expression systems.

To generate a stable mammalian cell line, the NF-KB / SV40 / SEAP cassette was transformed using the restriction enzymes SalI and NotI as described above for NF-KB / SEA.
Remove from P vector and insert into vector containing neomycin resistance.
Specifically, after restriction treatment of pGFP-1 with SalI and NotI, NF-
The KB / SV40 / SEAP cassette was inserted into pGFP-1 (Clontech) to replace the GFP gene.

Once the NF-KB / SV40 / SEAP / Neo vector has been prepared, stable Jurkat T cells are prepared according to the protocol described in Example 11.
And maintain. Similarly, a method for assaying supernatants containing these stable Jurkat T cells is also described in Example 11. As a positive control, exogenous TNFα (0.1, 1, 10 ng) is added to wells H9, H10, and H11, typically 5-10 fold activation is observed.

Example 15 Assay for SEAP Activity As a reporter molecule for the assays described in Examples 12 and 13,
SEAP activity was measured according to the following general procedure for Tropix Phospho-
Assay using the light Kit (catalog number BP-400). Tr
The opix Phospho-light Kit supplies the dilution buffer, assay buffer, and reaction buffer used below.

Fill the dispenser with 2.5 × dilution buffer and dispense 15 μl of 2.5 × dilution buffer to Optiplate containing 35 μl of supernatant. Seal the plate with a plastic sealer and incubate at 65 ° C. for 30 minutes. Separate the Optiplate to avoid uneven heating.

Cool the sample to room temperature for 15 minutes. Empty the dispenser and fill with assay buffer. Add 50 μl of assay buffer and incubate at room temperature for 5 minutes. Empty the dispenser and fill with reaction buffer (see table below). Add 50 μl reaction buffer and incubate for 20 minutes at room temperature. Since the intensity of the chemiluminescent signal is time-dependent and it takes about 10 minutes to read 5 plates on a luminometer, process 5 plates at a time and start a second set after 10 minutes Should be.

Read the relative light unit in the luminometer. Set H12 as blank and print the result. An increase in chemiluminescence indicates a reporter activity.

[0623]

[Table 4] Example 16: High Throughput Screening Assay to Identify Changes in Small Molecule Concentration and Membrane Permeability Binding of a ligand to a receptor alters intracellular levels of small molecules such as calcium, potassium, and sodium and pH. , As well as changing the membrane potential are known. These changes can be measured in assays that identify supernatants that bind to receptors on particular cells. The following protocol describes an assay for calcium, but this protocol is easily modified to detect changes in potassium, sodium, pH, membrane potential, or any other small molecule detectable by a fluorescent probe Can be done.

The following assays measure changes in fluorescent molecules (Molecular Probes) that bind small molecules using a fluorimetric imaging plate reader (“FLIPR”). Clearly, any fluorescent molecule that detects a small molecule is a calcium fluorescent molecule, fluo-4 (Molecular Probes), used herein.
, Inc. Catalog number F-14202).

For adherent cells, cells are seeded at 10,000-20,000 cells / well in Co-star black 96-well plates with clear bottoms. Plate CO ₂
Incubate for 20 hours in the incubator. The adherent cells were washed in a Biotek washer with 200 μl HBSS (Hank's Balanced Salt).
Solution), leaving 100 μl of buffer after the last wash.

The stock solution of 1 mg / ml fluo-4 was added to 10% pluronic acid (puro
nic acid) Made with DMSO. To load cells with fluo-4,
12 μg / ml fluo-4 (50 μl) is added to each well. The plate is incubated for 60 minutes at 37 ° C. in a CO ₂ incubator. The plate is washed four times with HBSS in a Biotek washer, leaving 100 μl of buffer.

For non-adherent cells, the cells are spun down from the culture medium. 50 cells
Resuspend to 2-5 x 10 ⁶ cells / ml with HBSS in a ml conical tube. To 1 ml of the cell suspension, 4 μl of a 10% pluronic acid DMSO solution of 1 mg / ml fluo-4 is added. Next, place the tube in a 37 ° C water bath for 30-
Leave for 60 minutes. The cells are washed twice with HBSS, resuspended at 1 × 10 ⁶ cells / ml, and distributed to the microplate at 100 μl / well. Plate 10
Centrifuge at 00 rpm for 5 minutes. Next, place the plate on Denley CellW
After washing once with 200 μl in ash, the final volume was 100 μl by aspiration step
To

For non-cell based assays, each well contains a fluorescent molecule, such as fluo-4. The supernatant is added to the wells and a change in fluorescence is detected.

To measure the fluorescence of intracellular calcium, FLIPR was adjusted to the following parameters:
Set: (1) System gain is 300-800 mW; (2)
Exposure time is 0.4 seconds; (3) Camera F / Stop is F / 2;
(4) excitation is 488 nm; (5) emission is 530 nm; and (6)
Sample addition is 50 μl. The increase in emission at 530 nm is due to intracellular Ca ⁺⁺ Galectin-11 or galectin-11 induced by increasing concentration
Exhibit extracellular signaling events caused by any of the molecules
.

Example 17: High Throughput Screening Assay to Identify Tyrosine Kinase Activity Protein tyrosine kinases (PTKs) represent a diverse group of transmembrane and cytoplasmic kinases. Within the receptor protein tyrosine kinase (RPTK) family there is a range of receptors for mitogenic and metabolic growth factors, including PDGF, FGF, EGF, NGF, HGF and the insulin receptor subfamily. In addition, there is a large RPTK family for which the corresponding ligand is unknown. RPTK ligands include mainly secreted low molecular weight proteins, but also include membrane-bound and extracellular matrix proteins.

Activation of RPTK by ligand involves ligand-mediated receptor dimerization, which results in transphosphorylation of the receptor subunit and activation of cytoplasmic tyrosine kinase. Cytoplasmic tyrosine kinases include the src family (
For example, receptor-related tyrosine kinases of src, yes, lck, lyn, fyn), and non-receptor-bound and cytosolic protein tyrosine kinases such as the Jak family. These members are members of the cytokine superfamily (eg, interleukins, interferons, GM
-CSF and leptin).

Because of the wide range of known factors that can stimulate tyrosine kinase activity, it is of interest to identify whether galectin-11 or a molecule induced by galectin-11 can activate the tyrosine kinase signaling pathway. Accordingly, the following protocol is designed to identify such molecules that can activate the tyrosine kinase signaling pathway.

Target cells (eg, primary keratinocytes) were purchased from Nalge Nunc (Naperville, Ill.) At a density of about 25,000 cells / well.
Inoculate well Loprodyne Silent Screen Plate. The plate is sterilized by rinsing twice with 100% ethanol for 30 minutes, rinsing with water and drying overnight. Some plates were prepared with 100 ml of cell culture grade type I collagen (50 mg / ml), gelatin (2%) or polylysine (
50 mg / ml) (all of which are available from Sigma Chemicals (St. L.)
oois, MO) or Becton Dickinso
n (Bedford, MA), coated with 10% Matrigel or calf serum for 2 hours, rinsed with PBS, and stored at 4 ° C. Seed 5,000 cells / well in growth medium and use the manufacturer's Alamar Biosie
nces, Inc. As described by (Sacramento, CA), ala
Cell proliferation on these plates is assayed by indirect quantification of cell numbers after 48 hours using marBlue. Becton Dickinson
(Falcon plate cover # 3071 from Bedford, MA)
Cover Loprodyne Silent Screen Plate. Fal
Con Microtest III cell culture plates can also be used in some growth experiments.

To prepare the extract, A431 cells are seeded (20,000 / 200 ml / well) on nylon membranes of Loprodyne plates and cultured overnight in complete medium. Cells are incubated in serum-free basal medium for 24 hours and allowed to rest. EGF (60 ng / ml) or 50 μl of the supernatant generated in Example 12
After treatment for 0 minutes, the medium was removed and 100 ml of extraction buffer (20 mM HEP)
ES pH 7.5, 0.15 M NaCl, 1% Triton X-100, 0
. 1% SDS, 2 mM Na ₃ VO ₄ , 2 mM Na ₄ P ₂ O ₇ and Boher
A mixture of protease inhibitors (# 1836170) obtained from Ninger Mannheim (Indianapolis, Ind.) is added to each well and the plate is shaken on a rotary shaker at 4 ° C. for 5 minutes. Next, the plate was evacuated to a vacuum transfer manifold.
fold) and filter the extract through a 0.45 mm membrane at the bottom of each well using house vacuum. The extracts are collected in a 96-well capture / assay plate at the bottom of the vacuum manifold and immediately placed on ice. To obtain an extract clarified by centrifugation, the contents of each well are taken out after solubilization with a surfactant for 5 minutes, and centrifuged at 4 ° C., 16,000 × g for 15 minutes.

The filtered extract is tested for the level of tyrosine kinase activity. Although a number of methods for detecting tyrosine kinase activity are known, one of the methods is described herein.

Generally, the tyrosine kinase activity of the supernatant is assessed by determining its ability to phosphorylate tyrosine residues on a particular substrate (biotinylated peptide). Biotinylated peptides that can be used for this purpose include PSK1 (cytokinase kinase cd)
c2-p34, corresponding to amino acids 6-20) and PSK2 (corresponding to amino acids 1-17 of gastrin). Both peptides are substrates for a series of tyrosine kinases and are available from Boehringer Mannheim.

The tyrosine kinase reaction is set up by adding the following components in order. First, after adding 10 μl of 5 μM biotinylated peptide, the ATP / Mg ²⁺ (
10 μl of 5 mM ATP / 50 mM MgCl ₂ , 5 × assay buffer (40
mM imidazole hydrochloride, pH 7.3, 40 mM β-glycerophosphate, 1 mM
EGTA, 100 mM MgCl ₂ , 5 mM MnCl ₂ , 0.5 mg / ml
Add 10 μl of BSA, 5 μl of sodium vanadate (1 mM) and finally 5 μl of water. The components are mixed gently and the reaction mixture is pre-incubated for 2 minutes at 30 ° C. The reaction is started by adding 10 μl of control enzyme or filtered supernatant.

Next, the tyrosine kinase assay reaction is stopped by adding 10 μl of 120 mM EDTA, and the reaction is placed on ice.

Tyrosine kinase activity is measured by transferring a 50 μl aliquot of the reaction mixture to a microtiter plate (MTP) module and incubating at 37 ° C. for 20 minutes. Thereby, streptavidin (streptava)
din) Associate coated 96-well plate with biotinylated peptide.
Wash MTP module four times with 300 μl / well PBS. Next, anti-phosphotyrosine conjugated to horseradish peroxidase.
sine) 75 μl of antibody (anti-P-Tyr-POD (0.5 u / ml)) is added to each well and incubated at 37 ° C. for 1 hour. Wash wells as described above.

Next, a peroxidase substrate solution (Boehringer Mannheim)
) Add 100 μl and incubate at room temperature for at least 5 minutes (up to 30 minutes). The absorbance of the sample at 405 nm is measured using an ELISA reader. The level of bound peroxidase activity was quantified using an ELISA reader, which reflects the level of tyrosine kinase activity.

Example 18: High Throughput Screening Assay to Identify Phosphorylation Activity The major cells as potential alternatives and / or complements of the protein tyrosine kinase activity assay described in Example 16 Assays that detect activation (phosphorylation) of internal signaling intermediates may also be used.
For example, as described below, one particular assay is Erk-1 and Erk-2.
Tyrosine phosphorylation of the kinase can be detected. However, Raf, JNK, p38
Phosphorylation of MAP, Map Kinase Kinase (MEK), MEK Kinase, Src, Muscle Specific Kinase (MuSK), IRAK, Tec and other molecules such as Janus, and any other phosphoserine, phosphotyrosine or phosphothreonine molecule , Erk-1 or Erk with these molecules in the following assays
It can be detected by replacing rk-2.

Specifically, the wells of the 96-well ELISA plate were filled with protein G (1 μg /
Make assay plate by coating with 0.1 ml for 2 hours at room temperature (RT). The plates are then rinsed with PBS and blocked with 3% BSA / PBS for 1 hour at RT. Next, protein G plates were loaded with Erk-1 and Erk-1.
Two commercially available monoclonal antibodies against rk-2 (100 ng / well) (S
Treat (1 hour at RT) with ant Cruz Biotechnology. (This step can be easily modified by replacing the monoclonal antibody that detects any of the above molecules to detect other molecules). After rinsing 3-5 times with PBS, plates are stored at 4 ° C. until use.

A431 cells are seeded at 20,000 / well in 96-well Loprodyne filter plates and cultured overnight in growth medium. Next, the cells were placed in a basal medium (D
After starvation in MEM) for 48 hours, EGF (6 ng / well) or Example 9
5. Treat with 50 μl of the supernatant obtained in the above for 5-20 minutes. The cells are then solubilized and the extract is filtered directly into the assay plate.

After incubating with the extract for 1 hour at RT, the wells are rinsed again. As a positive control, a commercially available MAP kinase preparation (10 ng / well)
Is used instead of the A431 extract. The plates were then plated with Erk-1 and Erk-1.
Treatment with a commercially available polyclonal (rabbit) antibody (1 μg / ml) that specifically recognizes the phosphorylated epitope of rk-2 kinase (1 hour at RT). The antibody is biotinylated by standard procedures. Next, the conjugated polyclonal antibody was combined with europium streptavidin and europium fluorescence enhancer and Wallac DELF.
Quantification is by continuous incubation (time-resolved fluorescence) in an IA device. An increase in the fluorescent signal above the background indicates galectin-11 or phosphorylation by the molecule induced by galectin-11.

Example 19 Method for Determining Alterations in the Galectin 11 Gene RNA isolated from whole families or individual patients presenting the phenotype of interest (eg, disease) is isolated. Next, cDNA is generated from these RNA samples using protocols known in the art (see Sambrook).
Next, this cDNA is used as a template for PCR using primers surrounding the target region in SEQ ID NO: 1. Suggested PCR conditions are Sid
ransky, D .; Et al., Science 252: 706 (1991), consisting of 35 cycles of 95 ° C. for 30 seconds; 52-58 ° C. for 60-120 seconds; and 70 ° C. for 60-120 seconds.

[0646] Next, the PCR product was purified using SequiTherm Polymerase (Epi
and sequencing using primers labeled at the 5 'end with T4 polynucleotide kinase. Galectin 11
The intron-exon boundaries of the selected exons are also determined and the genomic PCR products are analyzed to confirm the results. Next, a PCR product having a suspected mutation in galectin 11 is cloned and sequenced to confirm the results of direct sequencing.

The galectin-11 PCR product was prepared according to the method of Holton, T .; A. And Graham
, M .; W. , Nucleic Acids Research, 19: 1156.
(1991) and cloned into a T-tail vector and sequenced with T7 polymerase (United States Biochemical).
Affected individuals are identified by mutations in galectin 11 that are not present in unaffected individuals.

[0648] Genomic rearrangements are also observed as a way to determine alterations in the gene corresponding to galectin-11. Full length galectin-11 cDNA amplified according to Example 1
With digoxigenin deoxy-uridine 5'-triphosphate (Boehringer
Nick translation using Mannheim) and Johnso
n, Cg. Et al., Methods Cell Biol. 35: 73-99 (19
FISH is performed as described in 91). For specific hybridization of galectin 11 to the locus, a large excess of human cot-1 DNA is used to hybridize with the labeled probe.

Chromosomes are counterstained with 4,6-diamino-2-phenylidol and propidium iodide to generate a combination of C and R bands. Aligned images for accurate mapping were obtained using a triple band filter set (Chroma T).
technology, Brattleboro, VT) and a cooled charge-coupled device camera (Photometrics, Tucson, AZ) and a variable excitation wavelength filter (Johnson, Cv. et al., Genet.
Anal. Tech. Appl. , 8:75 (1991)). Isee Gra
physical Program System (Invision Cor.
image collection, analysis and chromosome segment length measurements are performed using the method of the present invention (portation, Durham, NC). Chromosomal changes in the genomic region of galectin 11 (hybridized by the probe) are identified as insertions, deletions and translocations.
These changes in galectin 11 are used as diagnostic markers for related diseases.

Example 20 Method of Detecting an Abnormal Level of Galectin-11 in a Biological Sample A galectin-11 polypeptide can be detected in a biological sample, and an increase or decrease in galectin-11 levels is detected. If so, this polypeptide is a marker for a particular phenotype. It is understood that there are a number of detection methods and, therefore, those skilled in the art can modify the following assays to suit their particular needs.

For example, an antibody sandwich ELISA is used to detect galectin 11 in a sample, preferably a biological sample. The wells of the microtiter plate were loaded with a specific antibody against galectin 11 at a final concentration of 0.2-10 μg / ml.
Coating using This antibody is either monoclonal or polyclonal and is produced by the method described in Example 8. The wells are blocked so that non-specific binding of galectin 11 to the wells is reduced.

Next, the coated wells were subjected to RT using a galectin 11-containing sample.
And incubate for more than 2 hours. Preferably, serial dilutions of the sample should be used to confirm the results. Next, the plate is washed three times with deionized or distilled water to remove unbound galectin 11.

Then, 50 μl of the specific antibody-alkaline phosphatase conjugate was added to 25 to 400 n.
g and incubate at room temperature for 2 hours. The plate is again washed three times with deionized or distilled water to remove unbound conjugate.

Add 75 μl of 4-methylumbelliferyl phosphate (MUP) or p-nitrophenyl phosphate (NPP) substrate solution to each well and incubate for 1 hour at room temperature. The reaction is measured with a microtiter plate reader. A standard curve is generated using serial dilutions of control samples, and the galectin 11 concentration is plotted on the X-axis (log scale) and the fluorescence or absorbance on the Y-axis (linear scale). The standard curve is used to interpolate the galectin-11 concentration in the sample.

Example 21 Formulations The present invention also provides a method for administering a disease or disorder (eg, any one of the diseases or disorders disclosed herein) to a subject by administering to the subject an effective amount of a therapeutic agent. Like above)
Are provided. A polynucleotide or polypeptide of the present invention (including fragments and variants), agonists or antagonists thereof, and / or antibodies thereto, in combination with a pharmaceutically acceptable carrier form (eg, a sterile carrier), depending on the therapeutic agent. Is meant.

Therapeutic agents can be determined by taking into account the clinical condition of the individual patient (particularly the side effects of treatment with the therapeutic agent alone), site of delivery, method of administration, dosing regimen, and other factors known to those of skill in the art. prescription and dosing in a manner that complies with good medical practice. Therefore, the “effective amount” intended in the present specification is determined in view of such considerations.

As a general suggestion, the total pharmaceutically effective amount of a therapeutic agent administered parenterally per dose is in the range of about 1 μg / kg / day to 10 mg / kg / day of the patient's body weight,
As noted above, this is left to therapeutic discretion. More preferably, for this hormone, the dose is at least 0.01 mg / kg / day, most preferably between about 0.01 mg / kg / day and about 1 mg / kg / day for a human. When administered continuously, typically the therapeutic agent is administered from about 1 μg / kg / hour to about 50 μg / kg.
Administered either by injection 1 to 4 times daily or by continuous subcutaneous infusion (eg using a minipump) at a dosing rate of / hour. Intravenous bag solutions may also be used. The duration of treatment needed to observe the change and the post-treatment interval at which the response occurs
It seems to vary depending on the desired effect.

Therapeutic agents can be administered orally, rectally, parenterally, intracistemally.
y), may be administered intravaginally, intraperitoneally, topically (such as by a powder, ointment, gel, drop, or transdermal patch), buccally or orally or as a nasal spray. “Pharmaceutically acceptable carrier” refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or any type of formulation auxiliary. As used herein, the term "
"Parenteral" refers to modes of administration, including intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.

Therapeutic agents of the invention are also suitably administered by sustained release systems. Suitable examples of sustained release therapeutic agents include oral, rectal, parenteral, intracisternal, vaginal, intraperitoneal, topical (such as by powder, ointment, gel, drop, or transdermal patch), It is administered orally or orally or as a nasal spray. “Pharmaceutically acceptable carrier” refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or any type of formulation auxiliary. As used herein, the term "parenteral" refers to intravenous, intramuscular,
Refers to modes of administration including intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.

Therapeutic agents of the invention are also suitably administered by sustained release systems. Suitable examples of sustained release therapeutic agents include suitable polymeric substances (eg, semipermeable polymer matrices in the form of shaped articles (eg, films or microcapsules)), suitable hydrophobic substances (eg, in acceptable quality oils). Or an ion exchange resin, and poorly soluble derivatives (eg, poorly soluble salts).

As the sustained release matrix, polylactide (US Pat. No. 3,773,919)
No. EP 58,481), a copolymer of L-glutamic acid and γ-ethyl-L-glutamate (Sidman et al., Biopolymers 22: 547-5).
56 (1983)), poly (2-hydroxyethyl methacrylate) (Lang
er et al. Biomed. Mater. Res. 15: 167-277 (19
81), and Langer, Chem. Tech. 12: 98-105 (19
82)), ethylene vinyl acetate (Langer et al., Ibid.) Or poly-D
-(-)-3-hydroxybutyric acid (EP133,988).

Sustained release therapeutic agents also include compositions of the present invention encapsulated in liposomes (see generally, Langer, Science 249: 1527-1533 (1990).
); Treat et al., Liposomes in the Therapy of
Infectious Disease and Censor, Lopez
-Berestein and Fidler (eds.), Liss, New Yo
rk, 317-327 and 353-365 (1989)). Liposomes containing a therapeutic agent can be prepared by methods known per se:
DE 3,218,121; Epstein et al., Proc. Natl. Acad.
Sci. USA 82: 3688-3692 (1985); Hwang et al., Pr.
oc. Natl. Acad. Sci. USA 77: 4030-4034 (19
80); EP52,322; EP36,676; EP88,046; EP143.
, 949; EP 142,641; Japanese Patent Application No. 83-118008; U.S. Patent Nos. 4,485,045 and 4,544,545;
02,324. Typically, liposomes are small (about 200-800 °) monolayers, where the lipid content is greater than about 30 mol% cholesterol and the selected proportion is adjusted for optimal therapeutic agents. You.

In a still further embodiment, a Therapeutic Agent of the invention is delivered by a pump (Langer, supra; Sefton, CRC Crit. Ref. Biome).
d. Eng. 14: 201 (1987); Buchwald et al., Surgery.
88: 507 (1980); Saudek et al. Engl. J. Med. 3
21: 574 (1989)).

Other controlled release systems are described in Langer (Science 249: 1527-1515).
33 (1990)).

For parenteral administration, in one embodiment, generally, the therapeutic agent will be administered to a recipient in a desired degree of purity, in a pharmaceutically acceptable carrier, ie, the dosage and concentration employed. It is formulated by mixing it with non-toxic and compatible with other ingredients of the formulation in a unit dosage injectable form (solution, suspension or emulsion). For example, the formulation is preferably free of oxidizing agents and other compounds known to be harmful to therapeutic agents.

Generally, the formulations are prepared by uniformly and intimately contacting the therapeutic agent with a liquid carrier or a finely divided solid carrier or both. Next, if necessary, the product is shaped into the desired formulation. Preferably, the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline, Ringer's solution and dextrose solution. Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as are liposomes.

The carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability. Such substances are non-toxic to recipients at the dosages and concentrations employed, and include such substances as phosphate, citrate, succinate, acetic acid and other organic acids or salts thereof. Antioxidants such as ascorbic acid; low molecular weight (less than about 10 residues) polypeptides (eg, polyarginine or tripeptide); proteins such as serum albumin, gelatin or immunoglobulins; polyvinylpyrrolidone Amino acids such as glycine, glutamic acid, aspartic acid or arginine; monosaccharides, disaccharides and other carbohydrates, including cellulose or derivatives thereof, glucose, mannose or dextrin; chelates such as EDTA Agent: sugar alcohol such as mannitol or sorbitol ; Counterions such as sodium; and /
Or a non-ionic surfactant such as polysorbate, poloxamer or PEG.

Therapeutic agents will typically comprise from about 0.1 mg / ml to 100 mg / ml, preferably 1 mg / ml to 100 mg / ml.
Formulated in such vehicles at a concentration of 〜１０10 mg / ml and a pH of about 3-8. It is understood that the use of the particular excipients, carriers or stabilizers described above results in the formation of polypeptide salts.

Any therapeutic agent used for therapeutic administration can be sterile. Sterility is readily achieved by filtration through sterile filtration membranes (eg, a 0.2 micron membrane). Generally, the therapeutic agent will be placed in a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.

Therapeutic agents are typically stored in unit or multi-dose containers, for example, sealed ampules or vials, as an aqueous solution or a lyophilized formulation for reconstitution.
As an example of a lyophilized formulation, sterile filtered 1% (w / v) into 10 ml vials
) Fill 5 ml of aqueous therapeutic solution and freeze-dry the resulting mixture. The lyophilized therapeutic agent is reconstituted with bacteriostatic water for injection to prepare an infusion solution.

The present invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more components of the therapeutic of the present invention. A notice in the form of a government agency that regulates the manufacture, use or sale of pharmaceuticals or biological products may accompany such containers, and may be issued by the government regarding manufacture, use or sale for human administration. Represents institutional approval. In addition, therapeutic agents may be used in combination with other therapeutic compounds.

Therapeutic agents of the invention can be administered alone or in combination with an adjuvant. Adjuvants that can be administered with the therapeutics of the invention include, but are not limited to, alum, alum and deoxycholic acid (ImmunoAg), MTP-PE (Biocine Corp.), QS2.
1 (Genentech, Inc.), BCG, and MPL. In certain embodiments, a Therapeutic of the invention is administered in combination with alum. In another specific embodiment, a Therapeutic Agent of the Invention is administered in combination with QS21. Additional adjuvants that can be administered with the therapeutics of the invention include, but are not limited to: monophosphoryl lipid immunomodulators, Adj
uVax 100a, QS-21, QS-18, CRL1005, aluminum salt, MF-59, and Virosomal adjuvant technology. Vaccines that can be administered with the therapeutics of the invention include, but are not limited to: MMR (measles, mumps, rubella), polio, varicella, tetanus / diphtheria, A Hepatitis, hepatitis B, influenza B, pertussis (w
A vaccine directed at protection against hoping cough, pneumonia, influenza, Lyme disease, rotavirus, cholera, yellow fever, Japanese encephalitis, poliomyelitis, rabies, typhoid fever, and pertussis. The combination may be administered either concomitantly (eg, as a mixture, separately but simultaneously or in parallel); or sequentially. This includes a presentation in which the combined agents are administered together as a therapeutic mixture, and the combined agents are administered separately but simultaneously (eg, through separate intravenous lines to the same individual). Procedures are also included. "Combination" administration further includes separately administering one of the compounds or agents given first, followed by the second.

Therapeutic agents (Therapeutic) of the present invention may be administered alone or in combination with other therapeutic agents. Therapeutic agents that can be administered with the therapeutic agents of the present invention include, but are not limited to: other members of the TNF family, chemotherapeutic agents, antibiotics, steroidal and non-steroidal anti-inflammatory agents Conventional immunotherapeutic agents, cytokines and / or growth factors. The combination may be administered, for example, either simultaneously, as a mixture, separately but simultaneously or concurrently; or sequentially. This includes presentations where the combined agents are administered together as a therapeutic mixture, and also procedures where the combined agents are administered separately but simultaneously (eg, through separate intravenous lines to the same individual). Also includes. "Combination" administration further includes separately administering one of the compounds or agents given first, followed by the second.

In one embodiment, a Therapeutic Agent of the Invention is administered in combination with a member of the TNF family. A TNF molecule, T, which can be administered with a therapeutic of the invention.
NF-related or TNF-like molecules include, but are not limited to: soluble forms of TNF-α, lymphotoxin-α, (LT-α, TN
F-β), LT-β (found in the complex heterotrimer LT-α2-β), OPGL, FasL, CD27L, CD30L, CD40L,
-1BBL, DcR3, OX40L, TNF-γ (International publication number WO96 / 14
328), AIM-I (International Publication Number WO97 / 33899), Endokine (
endokine) -α (International Publication No. WO98 / 07880), TR6 (International Publication No. WO98 / 30694), OPG, and Neutrokine (neut)
rokine) -α (International Publication No. WO 98/18921), OX40, and nerve growth factor (NGF), and soluble form of Fas, soluble form of CD30
, Soluble form of CD27, soluble form of CD40 and soluble form of 4-IBB
, TR2 (International Publication Number WO96 / 34095), DR3 (International Publication Number WO9
7/33904), DR4 (International Publication Number WO98 / 32856), TR5 (International Publication Number WO98 / 30693), TR6 (International Publication Number WO98 / 3069).
4), TR7 (International Publication No. WO98 / 41629), TRANK, TR9 (International Publication No. WO98 / 56892), TR10 (International Publication No. WO98 / 542)
02), 312C2 (WO 98/06842) and TR12,
And soluble forms of CD154, soluble forms of CD70, and soluble forms of CD153.

In certain embodiments, a Therapeutic Agent of the invention is administered in combination with an antiretroviral agent, a nucleoside reverse transcriptase inhibitor, a non-nucleoside reverse transcriptase inhibitor and / or a protease inhibitor. Nucleoside reverse transcriptase inhibitors that can be administered in combination with the therapeutic agents of the invention include the following,
Not limited to: RETROVIR ^™ (Zidovudine / AZT), VIDE
Z ^™ (didanocine / ddI), HIVID ^™ (zarcitabine / ddC), ZER
IT ^™ (stavudine / d4T), EPIVIR ^™ (lamivudine / 3TC), and COMBIVIR ^™ (zidovudine / lamivudine). Non-nucleoside reverse transcriptase inhibitors that may be administered in combination with the therapeutic agents of the present invention include, but are not limited to: VIRAMUNE ^™ (nevirapine), RESCRI
PTOR ^™ (delavirdine) and SUSTIVA ^™ (efavirenz). Protease inhibitors that can be administered in combination with the therapeutic agents of the present invention include:
Examples include, but are not limited to: CRIXIVAN ^™ (indinavir), NORVIR ^™ (ritonavir), INVIRASE ^™ (saquinavir)
And VIRACEPT ^™ (Nelfinavir). In certain embodiments, the antiretroviral agent, nucleoside reverse transcriptase inhibitor, non-nucleoside reverse transcriptase inhibitor, and / or protease inhibitor is for treating AIDS and / or preventing or treating HIV infection. In addition, it can be used in any combination with the therapeutic agent of the present invention.

In another embodiment, a Therapeutic Agent of the Invention may be administered in combination with an anti-opportunistic infection agent. Anti-opportunistic infection agents that can be administered in combination with the therapeutic agents of the present invention include, but are not limited to: TRIMETHOP
RIM-SULFAMETHOXAZOLE ^™ , DAPSON ^™ , PENTA
MIDINE ^™ , ATOVAQONE ^™ , ISONIAZID ^™ , RIFAM
PIN ^TM , PYRAZINAMIDE ^TM , ETHAMBUTOL ^TM , RIFAB
UTIN ^™ , CLARITROMYCIN ^™ , AZITTHROMYCIN ^™ ,
GANICLOVIR ^™ , FOSCARNET ^™ , CIDOFOVIR ^™ , F
LUCONAZOLE ^™ , ITRACONAZOLE ^™ , KETOCONAZO
LE ^™ , ACYCLOVIR ^™ , FAMCICOLVIR ^™ , PYRIMETH
AMINE ^™ , LEUCOVORIN ^™ , NEUPOGEN ^™ (filgrastim / G-CSF), and LEUKINE ^™ (sargramostine (sargra)
most) / GM-CSF). In certain embodiments, a therapeutic agent of the invention is used to prevent or prevent an opportunistic Pneumocystis carinii pneumonia infection in TRIMETHOPRIM-SULFAMETHOXAZ.
OLE ^™ , DAPSONE ^™ , PENTAMIDINE ^™ , and / or AT
Used in any combination with OVAQUAONE ^™ . In another specific embodiment, the therapeutic agent of the present invention is administered with ISONIAZID ^™ , RIFA to prevent or prevent opportunistic Mycobacterium avium complex infection.
MPIN ^™ , PYRAZINAMIDE ^™ , and / or ETHAMBUTO
As used in any combination with L ^TM. In another specific embodiment, the therapeutic agent of the invention is used to prophylactically treat or prevent opportunistic Mycobacterium tuberculosis infection, RIFABUTIN ^™ , CLARIT.
As used in any combination with HROMYCIN ^TM, and / or Azithromycin ^TM. In another specific embodiment, a Therapeutic of the Invention comprises a GANCI to treat or prevent an opportunistic cytomegalovirus infection prophylactically.
Used in any combination with CLIVIR ^™ , FOSCARNET ^™ , and / or CIDOFOVIR ^™ . In another specific embodiment, the therapeutic agent of the invention is used to prophylactically treat or prevent opportunistic fungal infections.
ZOLE ^™ , ITRACONAZOLE ^™ , and / or KETOCONAZ
Used in any combination with OLE ^™ . In another specific embodiment, the therapeutic agent of the invention comprises ACYCLOVIR ^™ and / or FA for the prophylactic treatment or prevention of opportunistic herpes simplex virus type I and / or II infections.
Used in any combination with MCICOLVIR ^™ . In another specific embodiment, the therapeutic agent of the present invention comprises PYRIMETHAMINE ^™ and / or PYRIMETHAMINE ^™ for prophylactically treating or preventing an opportunistic Toxoplasma gondii infection.
Or used in any combination with LEUCOVORIN ^™ . In another specific embodiment, the therapeutics of the invention are used in any combination with LEUCOVORIN ^™ and / or NEUPOGEN ^™ to preventively treat or prevent opportunistic bacterial infections.

In a further embodiment, a Therapeutic of the Invention is administered in combination with an antiviral agent. Antiviral agents that can be administered with the therapeutics of the invention include acyclovir, ribavirin, amantadine, and remantidine (remantidine).
tidine), but is not limited thereto.

In a further embodiment, a Therapeutic of the Invention is administered with an antibiotic. Antibiotics that can be administered with the therapeutics of the invention include amoxicillin, β
Lactamase, aminoglycoside, β-lactam (glycopeptide), β-lactamase, clindamycin, chloramphenicol, cephalosporin, ciprofloxacin, ciprofloxacin, erythromycin, fluoroquinolones,
Examples include, but are not limited to, macrolide antibiotics, metronidazole, penicillins, quinolones, rifampin, streptomycin, sulfonamide, tetracycline, trimethoprim, trimethoprim-sulfamethoxazole, and vancomycin.

Conventional non-specific immunosuppressants that can be administered with the therapeutic agents of the present invention include steroids, cyclosporin, cyclosporin analogs, cyclophosphamide methylprednisone, prednisone, azathioprine, FK-506, 15-deoxyspell Guarin (15-deoxyspergualin), and response T
Examples include, but are not limited to, other immunosuppressants that act by inhibiting the function of cells.

In certain embodiments, a Therapeutic Agent of the Invention is administered in combination with an immunosuppressant. Immunosuppressant preparations that can be administered with the therapeutics of the invention include ORT
^{HOCLONE TM (OKT3), SANDIMMUNE TM} / NEORAL TM / S
ANGDYA ^™ (cyclosporine), PROGRAF ^™ (tacrolimus), CE
Examples include, but are not limited to, LLCEPT ^™ (mycophenolate), azathioprine, glucocorticosteroids, and RAPAMUNE ^™ (sirolimus). In certain embodiments, immunosuppressive agents can be used to prevent rejection of organ or bone marrow transplants.

In a further embodiment, a Therapeutic Agent of the Invention is administered alone or in combination with one or more intravenous immunoglobulin preparations. Intravenous immunoglobulin preparations that can be administered in combination with the therapeutic agents of the present invention include GAMMER ^™ , IV
Examples include, but are not limited to, EEGAM ^™ , SANDOGLOBULIN ^™ , GAMMAGARD S / D ^™ and GAMIMUNE ^™ . In certain embodiments, a Therapeutic of the invention is administered in combination with an intravenous immunoglobulin preparation in transplantation therapy (eg, bone marrow transplantation).

In a further embodiment, a Therapeutic of the Invention is administered alone or in combination with an anti-inflammatory agent. Anti-inflammatory agents that can be administered with the therapeutic agents of the present invention include glucocorticoid and non-steroidal anti-inflammatory agents, aminoaryl carboxylic acid derivatives, aryl acetic acid derivatives, aryl butyric acid derivatives, aryl carboxylic acids, aryl propionic acid derivatives, pyrazoles, Pyrazolones, salicylic acid derivatives, thiazinecarboxamides, e-acetamidocaproic acid, S-adenosylmethionine, 3-amino-4-hydroxybutyric acid, amixetrine
e), bendazac, benzidamine, bucolome, difenpyramide, ditazole, emorfazone, guaiazulene, nabumetone, nimesulide, orgothein, oxaseprol, paranyline, perisoxal,
Pifoxime, procazone, proxazole, and tenidap,
It is not limited to these.

[0684] In another embodiment, a composition of the present invention is administered in combination with a chemotherapeutic agent. Chemotherapeutic agents that can be administered with the therapeutic agents of the invention include antibiotic derivatives (eg, doxorubicin, bleomycin, daunorubicin, and dactinomycin); anti-estrogens (eg, tamoxifen); antimetabolites (eg, fluorouracil, 5 -FU, methotrexate, floxuridine, interferon α-2b, glutamic acid, plicamycin
, Mercaptopurine, and 6-thioguanine); cytotoxic agents (eg, carmustine, BCNU, lomustine, CCNU, cytosine arabinoside, cyclophosphamide, estramustine, hydroxyurea, procarbazine, mitomycin, busulfan, cis-platin) And vincristine sulfate); hormones (eg, medroxyprogesterone, estramustine sodium phosphate, ethinyl estradiol, estradiol, megestrol acetate, methyltestosterone, diethylstilbestrol diphosphate, chlorotrianisene, and test lactone); Nitrogen mustard derivatives (eg, mephalen, chlorambucil, mechlorethamine (ni Roger emissions mustard) and thiotepa); steroids and combinations (e.g., betamethasone sodium); and others (
Examples include, but are not limited to, dicarbazine, asparaginase, mitotene, vincristine sulfate, vinblastine sulfate, and etoposide.

In certain embodiments, a Therapeutic Agent of the Invention is administered in combination with CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone) or in any combination of the components of CHOP. In another embodiment, a Therapeutic Agent of the Invention is administered in combination with Rituximab. In a further embodiment, the therapeutic of the invention comprises Rituxmab and CHOP
Or with any combination of components of Rituxmab and CHOP.

[0686] In a further embodiment, a Therapeutic Agent of the Invention is administered in combination with a cytokine. Cytokines that can be administered with the therapeutic agents of the present invention include IL
2, IL3, IL4, IL5, IL6, IL7, IL10, IL12, IL13
, IL15, anti-CD40, CD40L, IFN-γ and TNF-α. In another embodiment, the therapeutic agent of the present invention may comprise any interleukin (IL-1α, IL-1β, IL-2, IL-3, IL-4
, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-1
1, IL-12, IL-13, IL-14, IL-15, IL-16, IL-1
7, including, but not limited to, IL-18, IL-19, IL-20 and IL-21).

[0686] In a further embodiment, a Therapeutic of the Invention is administered in combination with an angiogenic protein. Angiogenic proteins that can be administered with the therapeutic agents of the invention include glioma-derived growth factor (GDGF) as disclosed in European Patent No. EP-399816; platelet-derived as disclosed in European Patent No. EP-682110. Growth Factor A (PDGF-A); Platelet-Derived Growth Factor B (PDGF-B) as disclosed in European Patent No. EP-282317; International Publication No. WO 92/0
Placental Growth Factor (PIGF) as disclosed in US Pat.
Orthh Factors, 4: 259-268 (1993); placental growth factor 2 (PIGF-2); vascular endothelial growth factor (VEGF) as disclosed in International Publication No. WO 90/13649; European Patent No.EP-5064
Vascular endothelial growth factor A (VEGF-A) as disclosed in International Publication No. W;
Vascular endothelial growth factor 2 (VEGF-2) as disclosed in O96 / 39515
Vascular endothelial growth factor B (VEGF-3); vascular endothelial growth factor B-186 (VEGF-B186) as disclosed in International Publication No. WO 96/26736; as disclosed in International Publication No. WO 98/02543. Vascular endothelial growth factor D (VE
GF-D); vascular endothelial growth factor D (VEGF-D) as disclosed in International Publication No. WO 98/07732; and vascular endothelial growth factor E (VEGF-E) as disclosed in German Patent No. DE19639601. ), But is not limited thereto. The above references are incorporated herein by reference.

In a further embodiment, a Therapeutic of the Invention is administered in combination with a hematopoietic growth factor. Hematopoietic growth factors that can be administered with the therapeutic agents of the present invention include LEU
KINE ^™ (SARGRAMOSTIM ^™ ) and NEUPOGEN ^™ (FIL
GRASTIM ^™ ), but is not limited thereto.

In a further embodiment, a Therapeutic of the Invention is administered in combination with a fibroblast growth factor. Examples of fibroblast growth factors that can be administered with the therapeutic agent of the present invention include FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, and FG.
F-6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-11,
Examples include, but are not limited to, FGF-12, FGF-13, FGF-14, and FGF-15.

In a further embodiment, a Therapeutic Agent of the Invention is administered in combination with another treatment or prophylactic regime (eg, radiation therapy).

Example 22 Method of Treating a Decreased Level of Galectin 11 The present invention relates to a method for treating an individual in need of increasing the level of a polypeptide of the present invention in the body, the method comprising: Administering to such an individual a composition comprising a therapeutically effective amount of an agonist of the present invention (including a polypeptide of the present invention). It is further understood that conditions caused by reduced levels of normal or normal expression of galectin 11 of the present invention in an individual can be treated by administering galectin 11 of the present invention. Accordingly, the present invention also provides a method of treating an individual in need of increasing levels of this galectin-11 polypeptide. The method includes administering to such an individual an amount of a galectin-11-containing therapeutic agent that increases the galectin-11 activity level in such individual.

For example, a patient with reduced levels of galectin-11 polypeptide will take the polypeptide at a daily dose of 0.1-100 μg / kg for six consecutive days. The exact details of the dosing regimen based on administration and formulation are provided in Example 13.

Example 23 Method of Treating Elevated Galectin 11 Levels The present invention also relates to a method for treating an individual in need of reducing the level of a polypeptide of the invention in the body, the method comprising: Administering to such an individual a composition comprising a therapeutically effective amount of an antagonist of the invention (including a polypeptide and an antibody of the invention).

In one example, antisense technology is used to inhibit the production of galectin 11 of the present invention. This technique uses galectin 11 from various etiologies such as cancer.
Is an example of a method for lowering the level of.

For example, patients diagnosed with abnormally elevated levels of galectin-11 can receive antisense polynucleotides at 0.5, 1.0, 1.5, 2.0 and 3.0 m.
It is administered intravenously at g / kg / day for 21 days. If the treatment is well tolerated, the treatment is repeated after a 7 day washout period. The formulation of this antisense polynucleotide is provided in Example 20.

Example 24 Treatment Methods Using Gene Therapy-Ex Vivo One method of gene therapy transplants fibroblasts capable of expressing a galectin-11 polypeptide into a patient. Generally, fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in a tissue culture medium and divided into small pieces. A small chunk of tissue is placed on the wet surface of a tissue culture flask and approximately 10 pieces are placed in each flask. The flask is inverted, closed tightly, and left overnight at room temperature. After 24 hours at room temperature, the flask is inverted, the tissue mass remains fixed at the bottom of the flask, and fresh medium (eg, Ham's F12 medium containing 10% FBS, penicillin and streptomycin) is added. The flask is then incubated at 37 ° C. for about one week.

At this point, fresh medium is added and then changed every few days. After another two weeks of culture, a monolayer of fibroblasts appears. This monolayer is trypsinized,
Scale up to a larger flask.

PMV-7 (Kirsc) flanked by Moloney murine sarcoma virus long terminal repeats
hmeier, P .; T. Et al., DNA, 7: 219-25 (1988)).
After digestion with RI and HindIII, it is treated with calf intestinal phosphatase.
The linear vector is fractionated on an agarose gel and purified using glass beads.

The cDNA encoding galectin 11 of the present invention was ligated to the 5 ′ and 3 ′ end sequences as described in Example 1, respectively, using PCR primers and having appropriate restriction sites and start / stop codons. It can be amplified using PCR primers corresponding to the sequence. Preferably, the 5 'primer contains an EcoRI site and the 3' primer contains a HindIII site. Equal amounts of Moloney murine sarcoma virus linear skeleton and amplified EcoRI and HindIII
The fragments are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions suitable for joining the two fragments. next,
The ligation mixture is used to transform bacteria HB101. It is then plated on agar containing kanamycin to confirm that the vector has correctly inserted galectin-11.

[0699] Amphotropic pA317 or GP + am12 packaging cells were
Grow to confluent density in tissue culture in Dulbecco's Modified Eagle's Medium (DMEM) containing 0% calf serum (CS), penicillin and streptomycin. Next, the MSV vector containing the galectin 11 is added to the medium and the packaging cells are transduced with the vector. At this time, the packaging cells produce infectious virus particles containing the galectin 11 gene (
Here, this packaging cell is called a producer cell).

[0700] Fresh media is added to the transduced producer cells, and the media is then harvested from 10 cm plates of confluent producer cells. The used medium containing the infectious virus particles is filtered through a Millipore filter to remove the detached producer cells before using this medium to infect fibroblasts. Remove the medium from the subconfluent plate of fibroblasts and immediately replace with the medium from the producer cells. Remove this medium and replace with fresh medium. If the titer of the virus is high, virtually all fibroblasts will be infected and no selection is necessary. If the titer is very low, it is necessary to use a retroviral vector with a selectable marker such as neo or his. Once the fibroblasts have been efficiently infected, the fibroblasts are analyzed to determine if galectin 11 is being produced.

The engineered fibroblasts are then implanted into a host, either alone or after being grown to confluence on cytodex 3 microcarrier beads.

Example 25 Gene Therapy Using Endogenous Galectin-11 Gene Another method of gene therapy according to the present invention uses the endogenous galectin-11 sequence of the present invention, for example, in US Pat. No. 5,641,670. (Issued June 24, 1997); International Publication No. WO 96/29411 (published September 26, 1996); International Publication No. WO 94/12650 (published August 4, 1994); Koller et al., Pr.
oc. Natl. Acad. Sci. USA, 86: 8932-8935 (19
89); and Zijlstra et al., Nature, 342: 435-438 (
1989) operably linked to a promoter via homologous recombination. The method involves the activation of a gene that is present in the target cell, but is not expressed or expressed at a lower level than desired in the cell.

A polynucleotide construct comprising a promoter and a targeting sequence is generated. This target sequence is homologous to the 5 'non-coding sequence of the endogenous galectin 11 sequence, adjacent to the promoter. The targeting sequence is sufficiently close to the 5 'end of the galectin-11 sequence so that the promoter is operably linked to the endogenous sequence during homologous recombination. The promoter and targeting sequence can be amplified using PCR. Preferably, the amplified promoter contains different restriction sites on the 5 'and 3' ends. Preferably, 3 ′ of the first targeting sequence
The ends contain the same restriction sites as the 5 'end of the amplified promoter, and the 5' ends of the second targeting sequence contain the same restriction sites as the 3 'end of the amplified promoter.

The amplified promoter and the amplified targeting sequence are digested with appropriate restriction enzymes and subsequently treated with bovine intestinal phosphatase. The digested promoter and the digested targeting sequence are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions appropriate for ligation of these two fragments. The construct is size fractionated on an agarose gel and then purified by phenol extraction and ethanol precipitation.

In this example, the polynucleotide construct is administered as a naked polynucleotide via electroporation. However, the polynucleotide construct can also be administered with a transfection facilitating agent (eg, liposomes, viral sequences, viral particles, precipitants, etc.). Such methods of delivery are known in the art.

[0706] Once the cells are transfected, homologous recombination occurs and the promoter is operably linked to the endogenous galectin-11 sequence. This results in expression of the galectin-11 in the cell. Expression can be detected by immunological staining or any other method known in the art.

[0707] Fibroblasts are obtained from a subject by skin biopsy. The obtained tissue was used for DMEM +
Place in 10% fetal calf serum. Fibroblasts in the logarithmic or early stationary phase are trypsinized and rinsed with nutrient media from the surface of the plastic. An aliquot of the cell suspension is removed for counting and the remaining cells are subjected to centrifugation. The supernatant is aspirated and the pellet is washed with 5 ml of electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCl, 5 mM K
(Cl, 0.7 mM Na ₂ HPO ₄ , 6 mM dextrose). The cells are recentrifuged, the supernatant is aspirated, and the cells are resuspended in electroporation buffer containing 1 mg / ml acetylated bovine serum albumin. This final cell suspension contains about 3 × 10 ⁶ cells / ml. Electroporation should be performed immediately after resuspension.

[0708] Plasmid DNA is prepared according to standard techniques. For example, to construct a plasmid for targeting to a locus corresponding to a polynucleotide of the present invention, plasmid pUC18 (MBI Fermentas, Amherst, NY
) Is digested with HindIII. The CMV promoter is amplified by PCR with an XbaI site at the 5 'end and a BamHI site at the 3' end. Two galectin-11 non-coding sequences are amplified via PCR: one non-coding sequence (fragment 1) is amplified with a HindIII site at the 5 'end and an XbaI site at the 3'end; The coding sequence (fragment 2)
Amplification is provided with a BamHI site at the 5 'end and a HindIII site at the 3' end. This CMV promoter and galectin 11 fragment (1 and 2)
With the appropriate enzymes (CMV promoter-XbaI and BamHI; galectin 11 fragment 1-XbaI; galectin 11 fragment 2-BamHI)
And ligate together. The resulting ligation product is digested with HindIII and ligated with the HindIII digested pUC18 plasmid.

The plasmid DNA was placed in a sterile cuvette with a 0.4 cm electrode gap (B
io-Rad). The final DNA concentration is generally at least 120μ
g / ml. Then 0.5 ml of the cell suspension (containing about 1.5 × 10 ⁶ cells) is added to the cuvette and the cell suspension and DNA solution are mixed gently. Electroporation is performed using a Gene-Pulser device (Bio-Rad). The capacitance and voltage are set to 960 μF and 250-300 V, respectively. Increasing the voltage decreases cell viability, but dramatically increases the percentage of viable cells that stably integrate the introduced DNA into their genome. Given these parameters, a pulse time of about 14 to 2
0 mSec should be observed.

The plasmid DNA was placed in a sterile cuvette with a 0.4 cm electrode gap (B
io-Rad). The final DNA concentration is generally at least 120μ
g / ml. Then 0.5 ml of the cell suspension (containing about 1.5 × 10 ⁶ cells) is added to the cuvette and the cell suspension and DNA solution are mixed gently. Electroporation is performed using a Gene-Pulser device (Bio-Rad). The capacitance and the voltage are respectively 960 μm
F and 250-300V. Increasing the voltage decreases cell viability, but dramatically increases the percentage of viable cells that stably integrate the introduced DNA into their genome. Given these parameters, a pulse time of about 14-20 mSec
Should be observed.

The electroporated cells are maintained at room temperature for about 5 minutes, then the contents of the cuvette are gently removed using a sterile transfer pipette. The cells were placed in a pre-warmed nutrient medium (D with 15% bovine serum) in a 10 cm dish.
(MEM) add directly to 10 ml and incubate at 37 ° C. The next day, the medium was aspirated and replaced with 10 ml of fresh medium and an additional 16-24
Incubate for hours.

The engineered fibroblasts are then injected into the host, either alone or after being grown to confluence on cytodex 3 microcarrier beads. Here, the fibroblasts produce a protein product. The fibroblasts can then be introduced into a patient as described above.

Example 26: Methods of Treatment Using Gene Therapy-In Vivo Another aspect of the invention is the use of in vivo gene therapy methods to treat disorders, diseases, and conditions. This gene therapy method involves the use of naked nucleic acids (DNA, RN) in animals to increase or decrease galectin-11 polypeptide expression.
A, and antisense DNA or RNA). The galectin-11 polynucleotide can be operably linked to a promoter or any other genetic element required for expression of the galectin-11 polypeptide by the target tissue. Techniques and methods for such gene therapy and delivery include:
Known in the art, for example, WO 90/11092, WO 98/11779.
U.S. Patent Nos. 5,693,622; 5,705,151; 5,580,859; Tabata et al., (1997) Cardiovasc. Res. 35 (3):
470-479; Chao J et al., (1997) Pharmacol. Res.
35 (6): 517-522; WolfJ. A. , (1997) Neuromu
scul. Disord. 7 (5): 314-318, Schwartz B.R.
Et al. (1996) Gene Ther. 3 (5): 405-411; Tsur
Umi Y et al. (1996) Circulation 94 (12): 3281.
See -3290 (hereby incorporated by reference).

[0714] Galectin-11 polynucleotide constructs can be produced by any method that delivers an injectable substance to the cells of an animal, such as injection into the interstitial space of tissue (heart, muscle, skin, lung, liver, intestine, etc.). Can be delivered. Galectin-11 polynucleotide constructs can be delivered in a pharmaceutically acceptable liquid or aqueous carrier.

The term “naked” polynucleotide, DNA or RNA, refers to any delivery vehicle (viral sequence, viral particle, liposome formulation, lipofectin, or lipoprotein) that acts to assist, facilitate, or facilitate entry into cells. (Including a precipitant and the like). However, galectin-11 polynucleotides can also be prepared in liposome formulations (eg, Felgn), which can be prepared by methods well known to those skilled in the art.
er P.R. L. Et al. (1995) Ann. NY Acad. Sci. 772: 1
26-139 and Abdallah B.A. Et al. (1995) Biol. Cel
185 (1): 1-7).

The galectin-11 polynucleotide vector construct used in the gene therapy method is preferably a construct that is not integrated into the host genome and does not contain sequences that allow it to replicate. Any strong promoter known to those of skill in the art
Can be used to drive the expression of Unlike other gene therapy techniques, one major advantage of introducing a naked nucleic acid sequence into a target cell is the transient nature of polynucleotide synthesis in that cell. Studies have shown that non-replicating DNA sequences can be introduced into cells to provide production of the desired polypeptide for a period of up to six months.

This galectin-11 polynucleotide construct can be used in tissues (muscle, skin,
Brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gallbladder, stomach, intestine, testis, ovary, uterus, rectum, nervous system, eyes, glands, and connective tissue To the interstitial space of the patient). The interstitial space of this tissue may be intercellular fluid, mucopolysaccharide matrix (reticulum fibers of organ tissue, elastic fibers in the walls of blood vessels or chambers, collagen fibers of fibrous tissue), or connective tissue sheath Includes the same matrix in muscle cells or in bone hiatus. This is also the space occupied by the circulating plasma and the lymph of the lymph channels. Delivery of muscle tissue to the interstitial space is preferred for reasons discussed below. They can be conveniently delivered by injection into the tissue containing these cells. They are preferably delivered to and expressed in differentiated, persistent, non-dividing cells, but are delivered and expressed in non-differentiated cells or in fully differentiated cells (eg, blood stem cells). Or dermal fibroblasts). In vivo, muscle cells are particularly competent in their ability to take up and express polynucleotides.

For naked Galectin-11 polynucleotide injection, effective dosages of DNA or RNA range from about 0.05 g / kg to about 50 mg / kg body weight.
Preferably, the dosage will be from about 0.005 mg / kg to about 20 mg / kg, and more preferably, from about 0.05 mg / kg to about 5 mg / kg.
Of course, as the skilled artisan will appreciate, this dosage will vary according to the tissue site of the injection. Appropriate and effective dosages of nucleic acid sequences can be readily determined by one skilled in the art, and will depend on the condition being treated and the route of administration. The preferred route of administration is by parenteral injection into the interstitial space of the tissue. However, other parenteral routes may also be used, including, for example, inhalation of an aerosol formulation, particularly for delivery to lung or bronchial tissue, the throat, or the mucous membrane of the nose. In addition, naked galectin-11 polynucleotide constructs can be delivered to arteries during angioplasty by the catheter used in this procedure.

The dose response effect of injected Galectin-11 polynucleotide in muscle in vivo is determined as follows. M encoding galectin 11 polypeptide
Suitable galectin-11 template DNA for RNA production was prepared using standard recombinant DN
Prepared according to A methodology. The template DNA, which can be either circular or linear, is either used as naked DNA or complexed with liposomes. The quadriceps of the mouse are then injected with various amounts of template DNA.

[0720] Female and male Balb / C mice, 5-6 weeks of age, were given 0.3 ml of 2.5%
Anesthetize by injecting Avertin intraperitoneally. A 1.5 cm incision is made in the anterior thigh and the quadriceps are visualized directly. Galectin 11 template DNA was
. Inject in a 1 ml carrier with a 1 cc syringe through a 27 gauge needle for 1 minute into the knee at about 0.5 cm from the distal insertion site of the muscle at a depth of about 0.2 cm. The suture is placed over the injection site for future positioning and the skin is closed with a stainless steel clip.

After an appropriate incubation time (eg, 7 days), a muscle extract is prepared by cutting out all four animals. Every 15 μm section of each quadriceps is histochemically stained for galectin-11 protein expression. A time course for galectin-11 protein expression can be performed in a similar manner, except that four animals from different mice are harvested at different times. Galectin 1 in muscle after injection
Persistence of 1 DNA can be determined by Southern blot analysis after preparing total cellular DNA and HIRT supernatant from injected and control mice. Using the results of the above experiments in mice, using naked galectin-11 DNA,
It can be used to extrapolate appropriate dosages and other treatment parameters in humans and other animals.

Example 27 Galectin-11 Transgenic Animals Galectin-11 polypeptides can also be expressed in transgenic animals. Mouse, rat, rabbit, hamster, guinea pig, pig, mini pig (
micro-pig), goats, sheep, cattle and non-human primates (eg,
Any species of animal, including, but not limited to, baboons, monkeys and chimpanzees, can be used to make transgenic animals. In certain embodiments, the techniques described herein or otherwise known in the art include:
Used as part of a gene therapy protocol for expression of a polypeptide of the invention in humans.

Any technique known in the art for introducing a transgene (ie, a polynucleotide of the present invention) into an animal can be used to introduce the transgenic animal into a founder line (fou).
ndr line). Such techniques are described in Pronuclear Microinjection (Paterson et al., Appl. Microbiol. Biotec).
hnol. 40: 691-698 (1994); Carver et al., Biotec.
hnology (NY) 11: 1263-1270 (1993); Wright
Biotechnology (NY) 9: 830-834 (1991); and Hoppe et al., U.S. Patent No. 4,873,191 (1989); germline (Van der Putten et al., Proc. Natl. Acad. Sci.
USA 82: 6148-6152 (1985)), retrovirus-mediated gene transfer into blastocysts or embryos; gene targeting in embryonic stem cells (Thompson
Et al., Cell 56: 313-321 (1989)); Electroporation of cells or embryos (Lo, 1983, Mol Cell. Biol. 3: 1803).
-1814 (1983)); introduction of a polynucleotide of the present invention using a gene gun (see, for example, Ulmer et al., Science 259: 1745 (1993)); nucleic acid into embryonic pluripotent stem cells Introduction of the construct and retransfer of this stem cell into the blastocyst; and sperm-mediated gene transfer (La
vitrano et al., Cell 57: 717-723 (1989)); and the like. For a review of such techniques, Gordon, "Transgenic An," incorporated herein by reference in its entirety.
imals ", Intl. Rev .. Cytol. 115: 171-229 (19
89).

[0724] Any technique known in the art can be used to generate transgenic clones containing the polynucleotides of the invention (eg, cultured, quiescently induced embryonic, fetal or adult cells). Nuclear transfer into the nucleus of enucleated oocytes from cells (Campell et al., Nature 380: 64-66 (1996); Will)
Mut et al., Nature 385: 810-813 (1997)).

The present invention provides transgenic animals that have the transgene in all of their cells, as well as animals that have the transgene in some (but not all) cells (ie, mosaic animals or chimeras). I do. The transgene can be a single transgene or a concatamer (eg, head-to-head tandem or head-to-head).
Tail tandem). This transgene can also be obtained, for example, from the teachings of Lasko et al. (Lasko et al., Proc. Natl. Ac.
ad. Sci. USA 89: 6322-2236 (1992)) and can be selectively introduced into specific cell types and activated. The regulatory sequences required for such cell type-specific activation will depend on the particular cell type of interest, and they will be apparent to those skilled in the art. If it is desired that the polynucleotide transgene be integrated into the chromosomal site of the endogenous gene, gene targeting is preferred. Briefly, when such a technique is used, a vector containing several nucleotide sequences homologous to the endogenous gene is transformed into a nucleotide sequence of the endogenous gene through homologous recombination with a chromosomal sequence. And designed to disrupt the function of the nucleotide sequence. The transgene can also be selectively introduced into a particular cell type, thus, for example, by Gu et al. (Gu et al., Science 26
5: 103-106 (1994)), and endogenous genes are inactivated only in the introduced cell type. The regulatory sequences required for such cell type-specific inactivation will depend on the particular cell type of interest, and they will be apparent to those skilled in the art. The contents of each of the documents listed in this paragraph are incorporated herein by reference in their entirety.

[0725] Any of the galectin-11 polynucleotides disclosed throughout this specification can be used to generate transgenic animals. For example, galectin 11
The DNA encoding the protein can be inserted into the vector using, for example, primers such as the following: 5 ′ primer containing the underlined SmaI restriction site shown below:

[0727]

Embedded image And a 3 'primer sequence comprising the underlined Asp718 restriction site followed by nucleotides complementary to positions 432-450 of the galectin 11 nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1).

[0728]

Embedded image . In addition to these two examples, other fragments of galectin 11 can also be inserted into the vector to create a transgenic with ubiquitous expression.

Alternatively, the polynucleotide of the present invention can be inserted into a vector that controls tissue-specific expression via a tissue-specific promoter. For example, a construct having a transferrin promoter expresses a galectin-11 polypeptide in the liver of the transgenic animal. Thus, DNA encoding the full-length galectin-11 protein can also be inserted into a vector for tissue-specific expression using the following promoter: 5 'containing the underlined SmaI restriction site shown below. Primer:

[0730]

Embedded image And a 3 'primer containing an underlined Asp178 restriction site as shown below:

[0731]

Embedded image In a transgenic animal, in addition to expressing the polypeptide of the present invention in a ubiquitous or tissue-specific manner, expression of the polypeptide (eg, developmentally or chemically regulated) by various other means. It is also routine for one of ordinary skill in the art to create constructs that regulate the expression of a gene.

[0732] Once a transgenic animal has been produced, expression of the recombinant gene can be assayed using standard techniques. Initial screening can be accomplished by Southern blot analysis or PCR techniques, and analysis of animal tissue can confirm that transgene integration has occurred. Transgene mRNA expression levels in tissues of transgenic animals can also be determined by Northern blot analysis, in situ hybridization analysis and reverse transcriptase P analysis of tissue samples obtained from the animals.
It can be assessed using techniques including, but not limited to, CR (rt-PCR). Samples of the transgenic gene-expressing tissue can also be assessed immunocytochemically or immunohistochemically using antibodies specific for the transgene product.

Once founders are generated, they can be crossed, inbred, outbred or crossed to produce colonies of a particular animal. Examples of such mating strategies include, but are not limited to: outcrossing of founders with more than one integration site to establish another lineage; additive expression of each transgene By effect, inbreeding of separate strains to produce complex transgenics expressing higher levels of the transgene; certain routines for both enhancing expression and eliminating the need to screen animals by DNA analysis. Crosses of heterozygous transgenic animals that produce animals homozygous for the integration site; crosses of separate homozygous lines to generate compound heterozygous or homozygous lines; and the desired experimental model Crosses to place the transgene on a suitable different background.

The transgenic animals of the present invention can be used to elaborate the biological functions of galectin-11 polypeptides, study conditions and / or disorders associated with aberrant galectin-11 expression, and treat such conditions and / or disorders. It has uses, including but not limited to animal model systems useful for screening for compounds that are effective for improvement.

Example 28 Galectin-11 Knockout Animals Endogenous galectin-11 gene expression also inactivates or “knocks out” the galectin-11 gene and / or its promoter using targeted homologous recombination. (Eg, Smithies et al., Na
cure 317: 230-234 (1985); Thomas and Cape.
cchi, Cell 51: 503-512 (1987); Thompson et al., Cell 5: 313-321 (1989);
Which is hereby incorporated by reference in its entirety). For example, a DN homologous to an endogenous polynucleotide sequence (either the coding or regulatory region of this gene).
A variant, non-functional polynucleotide (or completely unrelated DNA sequence) of the present invention flanked by A is used in vivo with or without a selectable and / or negative selectable marker. Cells expressing the polypeptide of the invention can be transfected. In another embodiment, techniques known in the art are used to cause knockout in cells that contain, but do not express, the gene of interest. Insertion of this DNA construct via targeted homologous recombination results in inactivation of the targeted gene. Such an approach is particularly suitable for the research and agricultural fields that can be used to generate progeny of animals with targeted genes in which modifications to embryonic stem cells are inactive (eg, Thomas and Ca).
pecchi 1987 and Thompson 1989, supra). However, this approach requires that the recombinant DNA construct be administered directly to the required site in vivo, using an appropriate viral vector, as will be apparent to those skilled in the art,
Or, if targeted, may be routinely adapted for use in humans.

In a further embodiment of the present invention, cells that are genetically engineered to express a polypeptide of the present invention or that are genetically engineered to not express a polypeptide of the present invention (eg, a knockout) are Administered to the patient in vivo. Such cells can be obtained from patients (ie, animals including humans) or MHC compatible donors, and include fibroblasts, bone marrow cells, blood cells (eg, lymphocytes), adipocytes, muscle cells, endothelial cells, and the like. But not limited to them. The cells can be transformed, for example, by transduction (using viral vectors and preferably vectors that incorporate the transgene into the cell genome) or transfection procedures (plasmids, cosmids, YACs, naked DNA, electroporation, liposomes, etc.). (Including, but not limited to, use) to introduce a coding sequence for a polypeptide of the invention into a cell, or to bind to the coding sequence and / or a polypeptide of the invention. To destroy the array,
Genetically engineered in vitro using recombinant DNA technology. The coding sequence of a polypeptide of the present invention may be placed under the control of a strong constitutive or inducible promoter or promoter / enhancer to achieve expression and, preferably, secretion of the galectin-11 polypeptide. Engineered cells that express and preferably secrete a polypeptide of the present invention can be introduced systemically into a patient, for example, in the circulation or intraperitoneally.

Alternatively, the cells can be incorporated into a matrix and transplanted into the body (
For example, genetically engineered fibroblasts can be transplanted as part of a skin graft); genetically engineered endothelial cells can be transplanted as part of a lymphoid or vascular graft (eg, Anderson et al., US Pat. No. 5,399,349 and Mu
See lligan and Wilson, U.S. Patent No. 5,460,959. Each of these is hereby incorporated by reference in its entirety).

If the cells to be administered are non-autologous or non-MHC compatible cells, they may be administered using well-known techniques that would prevent the generation of a host immune response against the transduced cells. For example, the cells can be introduced in a capsular form, which does not allow the introduced cells to be recognized by the host immune system, while allowing the components to exchange with the immediate extracellular environment.

The knockout animals of the present invention detail the biological function of the galectin-11 polypeptide, study conditions and / or disorders associated with abnormal galectin-11 expression, and ameliorate such conditions and / or disorders And has uses including, but not limited to, animal model systems useful in screening for effective compounds.

Example 29: Assay Detection Stimulation or Inhibition of B Cell Proliferation and Differentiation The generation of a functional humoral immune response depends on the interaction between B lineage cells and their microenvironment.
It requires both soluble and cognate signaling. The signal may carry a positive stimulus (allowing the cells of the B lineage to sustain programmed development) or a negative stimulus (instructing the cell to block the current generation pathway). To date, IL-2, IL-4, IL-5, IL-6, IL-7, IL
Numerous stimulatory and inhibitory signals have been found to affect B cell responsiveness, including -10, IL-13, IL-14 and IL-15. Interestingly, these signals are weak effectors themselves, but can be combined with various costimulatory proteins to induce activation, proliferation, differentiation, homing, resistance, and cell death in B cell populations.

One of the most studied classes of B cell costimulatory proteins is the TNF superfamily. Within this family, CD40, CD27 and CD30
Together with their respective ligands, CD154, CD70 and CD153, they have been found to modulate various immune responses. Assays that allow detection and / or observation of the proliferation and differentiation of these B cell populations and their progenitor cells determine the effects that various proteins can have on these B cell populations in terms of proliferation and differentiation It is a valuable tool in doing. Listed below are B
Two assays designed to allow the detection of differentiation, proliferation, or inhibition of cell populations and their precursors.

In Vitro Assay-Purified Galectin-11 proteins, or truncated forms thereof, for the ability to induce activation, proliferation, differentiation or inhibition and / or cell death in B cell populations and their precursors evaluate. Galectin-11 protein activity on purified human tonsillar B cells (qualitatively 0.1-1
(Measured over a dose range of 000 ng / mL) is evaluated in a standard B lymphocyte costimulation assay. In this assay, purified tonsillar B cells were used as priming factors in formalin-fixed Staphylococcus.
Culture in the presence of either Aureus Cowan I (SAC) or immobilized anti-human IgM antibody. Secondary signals, such as IL-2 and IL-15, were measured by SAC and IgM as measured by tritiated thymidine incorporation.
Induces B cell proliferation in cooperation with crosslinking. New synergists can be easily identified using this assay. This assay uses magnetic beads (MACS
And b) isolating human tonsillar B cells by depletion. The resulting cell population is greater than 95% B cells as assessed by CD45R (B220) expression.

Each sample of the various dilutions is placed in an individual well of a 96-well plate, and the culture medium (10% FBS, 5 × 10 ⁻⁵ M 2ME, 100 U / ml)
Add 10 ⁵ B cells in a total volume of 150 μl suspended in RPMI 1640 containing penicillin, 10 μg / ml streptomycin, and 10 ⁻⁵ dilution of SAC. Growth or inhibition was initiated 72 hours after addition of the factor, starting with 3H-
Quantification with thymidine (6.7 Ci / mM) with a 20 h pulse (1 μCi / well). Positive and negative controls are IL2 and medium, respectively.

(In Vivo Assay)-BALB / c mice received only buffer or 2 mg /
kg galectin-11 protein, or a truncated form thereof, is injected twice daily (
Intraperitoneally). Mice were given this treatment for 4 consecutive days, at which point they were sacrificed and various tissues and sera were collected for analysis. Comparison of H & E sections from normal spleen and spleen treated with galectin-11 protein resulted in activity of galectin-11 protein in spleen cells, eg, diffusion of peri-arterial lymphatic sheath and / or nucleation of red pulp region Significant increase in cellularity of
(Which may indicate activation of differentiation and proliferation of the B cell population). Using immunohistochemical studies with the B cell marker, anti-CD45R (B220), any physiological changes to spleen cells (eg, spleen tissue disruption) infiltrate established T cell areas. Determine if it is due to increased B cell presentation within the vaguely defined B cell compartment.

Using flow cytometric analysis of spleens from mice treated with galectin-11 protein, the galectin-11 protein was identified as ThB +, CD45R (B
220) Indicates whether the ratio of dull B cells is specifically increased above that observed in control mice.

Further, the putative consequences of the in vivo presentation of increased mature B cells is that serum I
g is a relative increase in titer. Therefore, serum IgM and IgA levels are compared between buffer-treated and galectin-11 protein-treated mice.

The tests described in this example tested the activity of galectin-11 protein. However, one of skill in the art can readily modify the exemplified studies to test the activity of a galectin-11 polynucleotide (eg, gene therapy), the activity of a galectin-11 agonist, and / or antagonist.

Example 30 T Cell Proliferation Assay A CD3-induced proliferation assay is performed on PBMC and measured by ³ H-thymidine incorporation. This assay is performed as follows. 96-well plates were loaded with 100 mAb against CD3 (HIT3a, Pharmingen).
μl / well, or isotype matched control mAb (B33.1) (
(1 μg / ml in 0.05 M bicarbonate buffer, pH 9.5) at 4 ° C. overnight, then wash three times with PBS. PBMCs were isolated from human peripheral blood by F / H gradient centrifugation and plates coated with mAbs in RPMI containing 10% FCS and P / S in the presence of various concentrations of galectin-11 protein. Add to ⁴ wells (5 × 10 ⁴ / well) (200 μl total)
. The relevant protein buffer and medium alone are controls. After 48 hours of culture at 37 ° C., the plate was spun at 1000 rpm for 2 minutes and
μl of supernatant was removed and stored at −20 ° C. for measurement of IL-2 (or other cytokines) if an effect on growth was observed. 0.5 μC per well
supplemented medium 100μl containing ³ H-thymidine i, and 18 at 37 ° C.
Incubate for 24 hours. Wells were collected and ³ H thymidine incorporation was used as an indicator of proliferation. Anti-CD3 alone is a positive control for proliferation. IL-2 (1
00U / ml) is also used as a control to enhance proliferation. A control antibody that does not induce T cell proliferation is used as a negative control for the effect of galectin-11 protein.

The study described in this example tested the activity of the galectin-11 protein. However, one of skill in the art can readily modify the illustrated studies to test the activity of galectin-11 polynucleotides (eg, gene therapy), agonist and / or antagonist activity of galectin-11.

Example 31 Effect of Galectin-11 on MHC Class II, Costimulatory and Adhesion Molecule Expression, and Cell Differentiation of Monocytes and Monocyte-Derived Human Dendritic Cells Dendritic cells were found in peripheral blood Produced by the growth of proliferating progenitors: adherent PBMC or purified monocyte fractions are made up of GM-CSF (50 ng / ml) and I
Incubate with L-4 (20 ng / ml) for 7 to 10 days. These dendritic cells have the characteristic phenotype of immature cells (CD1, CD80, CD86, CD40 and M
HC class II antigen expression). Treatment with activators such as TNF-α causes rapid changes in surface phenotype (MHC class I and II, increased expression of costimulatory and adhesion molecules, down-regulation of FCγRII, up-regulation of CD83). Occurs. These changes are associated with increased antigen presenting ability and functional maturation of dendritic cells.

The FACS analysis of the surface antigen is performed as follows. Cells are treated with increasing concentrations of Galectin-11 or LPS (positive control) for 1-3 days, washed with PBS containing 1% BSA and 0.02 mM sodium azide, then 1:20
Incubate with diluted appropriate FITC- or PE-labeled monoclonal antibody for 30 minutes at 4 ° C. After a further wash, the labeled cells are analyzed by flow cytometry on a FACScan (Becton Dickinson).

(Effects on Cytokine Production) Cytokines produced by dendritic cells, particularly IL-12, are important in initiating T cell dependent immune responses. IL-12
Strongly influences the development of Th1 helper T cell immune responses and cytotoxic T
Induces cellular and NK cell functions. Using an ELISA, the IL
Measure -12 release. Dendritic cells (10 ⁶ / ml) are treated with increasing concentrations of galectin 11 for 24 hours. LPS (100 ng / ml) is added to the cell culture as a positive control. The supernatant from the cell culture is then collected and a commercially available ELISA kit (eg, R & D Systems (Minneapolis)
s, MN)) to analyze for IL-12 content. Use the standard protocol provided in the kit.

Effect on MHC class II, costimulatory and adhesion molecule expression. Three main families of cell surface antigens: adhesion molecules, molecules involved in antigen presentation, and Fc receptors can be identified on monocytes. Modulation of the expression of MHC class II antigens and other costimulatory molecules (eg, B7 and ICAM-1) can alter the ability of monocytes to present antigen and induce T cell activation. Increased expression of the Fc receptor may correlate with improved monocyte cytotoxic activity, cytokine release and phagocytosis.

[0753] FACS analysis is used to test for surface antigens as follows. Monocytes are treated with increasing concentrations of Galectin-11 or LPS (positive control) for 1-5 days, washed with PBS containing 1% BSA and 0.02 mM sodium azide, and then diluted 1:20 with the appropriate FITC-labeled monoclonal antibody or PE
Incubate with labeled monoclonal antibody for 30 minutes at 4 ° C. After further washing, the labeled cells were washed with FACScan (Becton Dickinson).
Analyze by flow cytometry in).

(Monocyte Activation and / or Increased Survival) For molecules that activate (or inactivate) monocytes and / or increase monocyte survival (or decrease monocyte survival) Assays are known in the art and can be routinely applied to determine whether a molecule of the invention functions as a monocyte inhibitor or activator. Galectin 11, an agonist or antagonist of galectin 11, can be screened using the three assays described below. For each of these assays, peripheral blood mononuclear cells (PBMCs) were
Centrifugation through istopaque gradients (Sigma) resulted in single donor leukopacks (American Red Cross, Baltimo).
re, MD). Monocytes are counter-currently centrifuged elutriated (count
erflow centrifugal elimination)
Isolate from MC.

Monocyte Survival Assay Human peripheral blood monocytes gradually lose viability when cultured in the absence of serum or other stimuli. Their death results from an internally regulated process (apoptosis). Addition of activators, such as TNFα, to the culture dramatically improves cell survival and prevents DNA fragmentation. Propidium iodine (
Apoptosis is measured using PI) staining as follows. Monocytes, 100n
Culture for 48 hours in serum-free medium (positive control) in polypropylene tubes in the presence of g / ml TNF-α (negative control) and in the presence of various concentrations of compound to be tested. Cells are suspended at a concentration of 2 × 10 ⁶ / ml in PBS containing PI at a final concentration of 5 μg / ml, and then incubated for 5 minutes at room temperature before FACScan analysis. PI incorporation has been shown to correlate with DNA fragmentation in this test paradigm.

Effect on Cytokine Release An important function of monocytes / macrophages is their regulatory activity on other cell populations of the immune system through the release of cytokines after stimulation. An ELISA for measuring cytokine release is performed as follows.
Human monocytes are incubated at a density of 5 × 10 ⁵ cells / ml with increasing concentrations of galectin 11 and in the absence of galectin 11 under the same conditions. For the production of IL-12, the cells were transfected with IFN in the presence of galectin-11.
(100 U / ml) overnight. Then LPS (10 ng / ml) is added. Conditioned media is collected after 24 hours and stored frozen until use.
The measurement of TNF-α, IL-10, MCP-1 and IL-8 was then performed using commercially available E
LISA kits (eg, R & D Systems Minneapolis,
MN) and apply standard protocols provided in the kit.

(Oxidative burst) Purified monocytes were collected from 96
Plate well plates at 2-1 × 10 ⁵ cells / well. Galectin 11
Of increasing concentrations of culture medium (RPMI 1640 + 10%
FCS, glutamine and antibiotics). After 3 days of incubation, the plate is centrifuged and the medium is removed from the wells. In a monolayer of macrophages, 0.2 ml of a phenol red solution (140 mM N
aCl, 10 mM potassium phosphate buffer pH 7.0, 5.5 mM dextrose, 0.56 mM phenol red and 19 U / ml HRPO) are added along with the stimulant (200 nM PMA). The plate is incubated at 37 ° C. for 2 hours and the reaction is stopped by adding 20 μl of 1N NaOH per well. Read the absorbance at 610 nm. H ₂ produced by macrophages
To calculate the amount of O _2, performed for each experiment a standard curve of H ₂ O ₂ solution of known molarity.

The study described in this example tested the activity of the galectin-11 protein. However, one skilled in the art will appreciate that the activity of a galectin-11 polynucleotide (eg, gene therapy), the activity of an agonist of galectin-11, and / or the activity of galectin-1
To test the activity of one antagonist, the illustrated studies can be readily modified.

Example 32 Biological Effects of Galectin 11 Astrocytes and Neuronal Assays As described above, recombinant galectin 11 expressed and purified in Escherichia coli was used to survive cortical neuronal cell survival. , For promoting neurite outgrowth or phenotypic differentiation, and for inducing proliferation of glial fibrillary acidic protein immunopositive cells, astrocytes. Selection of cortical cells for bioassays is based on the widespread expression of FGF-1 and FGF-2 in cortical structures and previously reported enhancement of cortical neuron survival resulting from FGF-2 treatment. A thymidine incorporation assay can be used, for example, to elucidate the activity of galectin 11 on these cells.

In addition, FGF to cortical or hippocampal neurons in vitro
Previous reports describing the biological effects of -2 (basic FGF) have demonstrated an increase in both neuronal survival and neurite outgrowth (Wallike,
P et al., "Fibroblast growth factor promote."
s survival of dissociated hippocampa
l neurons and enhances neuroite extend
Sion "Proc. Natl. Acad. Sci. USA 83: 3012
3016 (1986), the assays in this document are incorporated by reference in their entirety). However, reports from experiments performed on PC-12 cells indicate that these 2
This suggests that the two responses are not necessarily synonymous and may depend not only on which FGF is being tested, but also on which receptor is expressed in the target cell. The ability of galectin-11 to induce neurite outgrowth was determined using a primary cortical neuron culture paradigm, for example, FGF-2 using a thymidine incorporation assay.
Can be compared with the response obtained in

[0764] Fibroblast and Endothelial Cell Assays Human lung fibroblasts are obtained from Clonetics (San Diego, Calif.) And are maintained in growth media from Clonetics. Dermal microvascular endothelial cells are obtained from Cell Applications (San Diego, CA). For proliferation assays, human lung fibroblasts and dermal microvascular endothelial cells can be cultured at 5,000 cells / well in growth media in 96-well plates for 1 day. The cells are then incubated for one day in 0.1% BSA basal medium. After replacing the medium with fresh 0.1% BSA medium, the cells are incubated with the test protein for 3 days. Alamar Blue (Almar Bi
oscenses, Sacramento, CA) is added to each well to a final concentration of 10%. The cells are incubated for 4 hours. Cell viability is measured by reading on a CytoFluor fluorescence reader. For PGE ₂ assays, the human lung fibroblasts, one day in 96-well plates 5,00
Culture at 0 cells / well. After changing the medium to 0.1% BSA basal medium, the cells are incubated with FGF-2 or galectin 11 with or without IL-1α for 24 hours. The supernatant is collected and the EIA kit (C
assay for PGE ₂ by Ayman, Ann Arbor, MI). For the IL-6 assay, human lung fibroblasts are cultured at 5,000 cells / well in a 96-well plate for 1 day. After changing the medium to 0.1% BSA basal medium, the cells are incubated with FGF-2 or Galectin 11 with or without IL-1α for 24 hours. Supernatants were collected and purified by ELISA kit (Endogen, Cambridge, MA).
Assay for L-6.

[0764] Human lung fibroblasts were cultured in basal medium with FGF-2 or Galectin 11 for 3 hours.
Days, then Alamar to assess its effect on fibroblast proliferation
Add Blue. FGF-2 exhibits a stimulus of 10 to 2500 ng / ml that can be used comparable to stimulation with galectin-11.

[0764] Parkinson's Model The loss of motor function in Parkinson's disease is due to striatal dopamine deficiency resulting from degeneration of dopaminergic projection neurons in the substantia nigra. An animal model of Parkinson's disease that has been extensively characterized is 1-methyl-4phenyl 1,2,3
, 6-tetrahydropyridine (MPTP). In the CNS,
MPTP is taken up by astrocytes and is mediated by monoamine oxidase B
-Catalyzed to -methyl-4-phenylpyridine (MPP ⁺ ) and released.
Subsequently, MPP ⁺ is actively accumulated in dopaminergic neurons by the high-affinity reuptake transporter of dopamine. MPP ⁺ is then enriched in mitochondria by an electrochemical gradient and selectively inhibits nicotidoamine adenine diphosphate: ubiquinone oxidoreductase (complex I), thereby preventing electron transfer and Generates active oxygen.

It has been demonstrated in a tissue culture paradigm that FGF-2 (basic FGF) has trophic activity on substantia nigra dopaminergic neurons (Ferrari)
Dev. Biol. 1989). In recent years, Dr. Unsicker's group has demonstrated that administration of FGF-2 in a striatum gel foam implant results in near complete protection of substantia nigra dopaminergic neurons from the toxicity associated with MPTP exposure ( Otto and Unsicker, J. Neuroscien.
ce, 1990).

[0766] Based on data using FGF-2, galectin 11 has shown that galectin 11 has a role in enhancing dopaminergic neuron survival in vitro.
Galectin-11 can also be evaluated to determine if it has an effect similar to that of GF-2, and galectin 11 also inhibits the activity of dopaminergic neurons in the striatum, M
It can be tested in vivo for protection from damage associated with PTP treatment. The potential effect of galectin 11 is first tested in vitro in a dopaminergic neuron cell culture paradigm. Cultures are prepared by dissecting mesencephalic plates from Wister rat embryos on day 14 of gestation. Tissues were dissociated with trypsin and placed on coverslips coated with polyortinin-laminin at 200,000 cells / c.
Seeded at a density of m ² . The cells are maintained in Dulbecco's modified Eagle's medium and F12 medium containing hormone supplement (NI). After 8 days in vitro, the cultures are fixed with paraformamide and processed for immunohistochemical staining with tyrosine hydroxylase, a specific marker for dopaminergic neurons. Separate cell cultures are prepared from embryonic rats. The culture medium is changed every three days, and the factor is also added every time.

Since dopaminergic neurons are isolated from animals at day 14 of gestation (the time of development is past the stage at which dopaminergic progenitor cells proliferate), the increase in the number of tyrosine hydroxylase immunopositive neurons was determined in vitro. 2 shows an increase in the number of surviving dopaminergic neurons. Thus, if galectin 11 acts to prolong dopaminergic survival, it suggests that galectin 11 may be involved in Parkinson's disease.

The study described in this example tested the activity of the galectin-11 protein. However, those skilled in the art will recognize that the activity of the galectin 11 polynucleotide (eg,
Gene therapy), agonists and / or antagonists of galectin 11 can be readily modified from the illustrated studies.

Example 33: Effect of Galectin-11 Polypeptide on Proliferation of Vascular Endothelial Cells On the first day, human umbilical vein endothelial cells (HUVEC) were transformed with 2-5 × 10 ⁴ cells / 35
At a mm dish density, 4% fetal bovine serum (FBS), 16 units / ml heparin, and 50 units / ml endothelial cell growth supplement (ECGS, Biotec)
hniques, Inc.). On day 2, the medium was replaced with M199 containing 10% FBS, 8 units / ml heparin, the galectin 11 protein of SEQ ID NO: 2 and a positive control (eg, VEGF
And basic FGF (bFGF)) at various concentrations. On days 4 and 6, the medium is replaced. On day 8, cell counts were determined using Coulter Count.
er.

[0770] An increase in the number of HUVEC cells indicates that galectin 11 can proliferate vascular endothelial cells.

The study described in this example tests activity on the galectin-11 protein. However, one of ordinary skill in the art can readily modify the illustrated studies to test the activity of a polynucleotide (eg, gene therapy) encoding a galectin-11 polypeptide, an agonist and / or antagonist of a galectin-11 polypeptide.

(Example 34: Stimulating effect of galectin 11 on proliferation of vascular endothelial cells) For evaluation of mitotic activity of growth factors, colorimetric MTS (3- (4,5-dimethylthiazol-2-yl)- 5- (3-carboxymethoxyphenyl) -2- (
4-sulfophenyl) 2H-tetrazolium) assay was performed using the electron conjugate reagent PMS
(Phenazine methosulfate) (CellTiter 96A)
Q, Promega). Cells are seeded in 96-well plates in 0.1 mL of serum-supplemented medium (5,000 cells / well) and allowed to attach overnight. 0.
After 12 hours serum starvation in 5% FBS, conditions (bFGF, VEGF ₁₆₅ or galectin 11 in 0.5% FBS) with or without heparin (8 U / ml) are added to the wells for 48 hours. 20 mg of the MTS / PMS mixture (1: 0.05) is added per well and allowed to incubate at 37 ° C. for 1 hour before measuring absorbance at 490 nm in an ELISA plate reader. Background absorbance from control wells (same medium, no cells) is reduced, and 7 wells are run for each condition in parallel. Leak
Et al., In Vitro Cell. Dev. Biol. 30A: 512-518
(1994).

The tests described in this example tested activity on the galectin-11 protein. However, one skilled in the art can readily modify the illustrated studies to test the activity of a galectin-11 polynucleotide (eg, gene therapy), an agonist and / or antagonist of galectin-11.

Example 35 Inhibition of PDGF-Induced Stimulation of Vascular Smooth Muscle Cell Proliferation HAoSMC proliferation can be measured, for example, by BrdUrd uptake.
Briefly, subconfluent, quiescent cells grown on 4-chamber slides are transfected with CRP or FITC labeled AT2-3LP.
The cells are then pulsed with 10% bovine serum and 6 mg / ml BrdUrd. Twenty-four hours later, immunocytochemistry was performed using a BrdUrd staining kit (Zyme
d Laboratories). Briefly, the cells were incubated with a biotinylated mouse anti-BrdUrd antibody at 4 ° C. after exposure to a denaturing solution.
For 2 hours and then with streptavidin peroxidase and diaminobenzidine. After counterstaining with hematoxylin, the cells are mounted for microscopic examination and BrdUrd positive cells are counted. The BrdUrd index is calculated as the ratio of BrdUrd positive cells to the total number of cells. In addition, simultaneous detection of BrdUrd staining (nuclei) and FITC uptake (cytoplasm) was performed for individual cells by light field illumination and dark field UV.
This is done by using fluorescent light simultaneously. Hayashida et al. Biol. Ch
em. 6: 271 (36) 21985-21992 (1996).

The study described in this example tests activity on the galectin-11 protein. However, one skilled in the art can readily modify the illustrated studies to test the activity of a galectin-11 polynucleotide (eg, gene therapy), an agonist and / or antagonist of galectin-11.

Example 36 Stimulation of Endothelial Migration Using this example, we explore the potential of galectin 11 to stimulate lymphocyte endothelial cell migration.

The endothelial cell migration assay was performed using a 48-well microchemotactic chamber (Neurop
robe Inc. Fabin, W., Cabin John, MD; J. et al. I
Munological Methods 1980; 33-239-247
). Polyvinylpyrrolidone-free polycarbonate filter with a pore size of 8 μm (Nucleopore Corp. Cumb)
(Ridge, MA) is coated with 0.1% gelatin for at least 6 hours at room temperature and dried under sterile air. The test substance is diluted to the appropriate concentration in M199 supplemented with 0.25% bovine serum albumin (BSA) and
Place 5 μl of the final dilution in the lower chamber of the modified Boyden instrument. The sub-confluent early passage (2-6) HUVEC or BMEC culture is washed and trypsinized for the minimum time necessary to achieve cell detachment. After placing the filter between the lower and higher chambers, 1% F
2.5 × 10 ⁵ cells suspended in 50 μl M199 containing BS are seeded in the higher chamber. The device is then allowed to migrate for 5 hours at 37 ° C.
They are incubated in a humidified chamber containing a% CO _2. After the incubation period, the filter is removed and the top of the filter with immobile cells is scraped off with a rubber policeman. The filter was fixed using methanol and Giemsa solution (Diff-Quick, Baxter, Mc
Stain using (Grow Park IL). Migration is quantified by counting 3 random high power field (40 ×) cells in each well, and all groups are performed in quadruplicate.

The study described in this example tests activity on the galectin-11 protein. However, one skilled in the art can readily modify the illustrated studies to test the activity of a galectin-11 polynucleotide (eg, gene therapy), an agonist and / or antagonist of galectin-11.

Example 37: Stimulation of Nitric Oxide Production by Endothelial Cells Nitric oxide released by vascular endothelium is thought to be a mediator of vascular endothelial relaxation. Thus, galectin-11 activity can be assayed by determining the production of nitric oxide by endothelial cells on galectin-11.

[0780] Nitric oxide was added to 96 wells of confluent microvascular endothelial cells after 24 hours of starvation and subsequent 4 hours of exposure to various levels of positive control (eg, VEGF-1) and galectin-11. Measure in plate. Nitric oxide in the medium is determined by using the Griess reagent to determine the total nitrite after reduction of nitrate from nitric oxide by nitrate reductase. The effect of galectin-11 on nitric oxide release is tested against HUVEC.

[0781] Briefly, NO release from cultured HUVEC monolayers was measured using a NO meter (I
so-NO, World Precision Instruments In
c. ) Measurement is performed using a NO-specific polarographic electrode connected to (1049). Calibration of the NO element is performed according to the following equation:

[0782] _{2KNO 2 + 2KI + 2H 2 SO} 4 = 2NO + I 2 + 2H 2 O + 2K 2 SO 4 Standard calibration curves, grades with concentrations of KNO ₂ (0,5,10,25,5
0, 100, 250 and 500 nmol / L) in a calibration solution containing KI and H ₂ SO ₄ . The specificity of the Iso-NO electrode for NO has been previously determined by measuring NO from authentic NO gas (1050). The culture medium is removed and the HUVEC is washed twice with Dulbecco's phosphate buffered saline. The cells were then filtered with 5 ml of filtered Krebs.
-Henseleit solution is batched into a 6-well plate and the cell plate is placed on a slide warmer (Lab Line Instruments).
Inc. ) Keep on. Maintain temperature at 37 ° C. The NO sensor probe is inserted vertically into the well, and before the addition of the different conditions, the tip of the electrode is
Maintain 2 mm below the surface of the solution. S-Nitrosoacetylpenicillamine (SNA
P) is used as a positive control. The amount of NO released is expressed in picomoles per 1 × 10 ⁶ endothelial cells. All values reported are the average of 4-6 measurements in each group (cell culture wells). Leak et al., Biochem. an
d Biophys. Res. Comm. 217: 96-105 (1995).

The studies described in this example test for activity on the galectin-11 protein. However, one skilled in the art can readily modify the illustrated studies to test the activity of a galectin-11 polynucleotide (eg, gene therapy), an agonist and / or antagonist of galectin-11.

Example 38: Effect of Galectin 11 on Navel Formation in Angiogenesis Another step in angiogenesis is umbilical formation. It is characterized by endothelial cell differentiation. This bioassay measures the ability of microvascular endothelial cells to form capillary-like structures (hollow structures) when cultured in vitro.

[0785] CADEC (microvascular endothelial cells) was purchased from Cell Applications.
, Inc. Purchased as proliferating (passage 2) cells from Cell APpl
cultures in the I.CATIONs CADME growth medium and used at passage 5. For the in vitro angiogenesis assay, the wells of a 48-well cell culture plate were harvested using the Attachment Factor from Cell Applications.
Coat with Medium (200 ml / well) for 30 minutes at 37 ° C. CADMECs are seeded into coated wells at 7,500 cells / well and grown overnight in growth media. The growth medium was then added to 300 mg Ce
ll Applications' Chord Formation Media
um (control buffer or galectin 11 (0.1-100 ng / ml)
And the cells are cultured for an additional 48 hours. The number and length of capillary-like navels are quantified through the use of a Boeckeler VIA-170 video image analyzer. All assays are performed in triplicate.

[0786] Commercially available (R & D) VEGF (50 ng / ml) is used as a positive control. b-estradiol (1 ng / ml) is used as a negative control. An appropriate buffer (no protein) is also used as a control.

The studies described in this example test activity on the galectin-11 protein. However, one skilled in the art can readily modify the illustrated studies to test the activity of a galectin-11 polynucleotide (eg, gene therapy), an agonist and / or antagonist of galectin-11.

Example 39: Angiogenic Effect on Chick Chorioallantoic Membrane Chick allantois (CAM) is a well-established system for testing angiogenesis. Angiogenesis in the CAM is easily visible and quantifiable. The ability of galectin 11 to stimulate angiogenesis in the CAM can be tested. Fertilized eggs of White Leghorn chicken (Gallus gallus) and Japanese quail (Coturnix coturnix) were cultured at 37.8.
Incubate at 80 ° C and 80 ° C humidity. The differentiated CAMs of 16 day old chicken and 13 day old quail embryos are studied using the following method.

On the fourth day of development, a window is created on the egg shell of a chicken egg. The embryo is checked for normal development and the egg is sealed with Cellotape®. They are further hatched until day 13. Thermanox cover slips (Nunc, Naperville, Ill.) Are cut into discs about 5 mm in diameter. The sterile, salt-free growth factor is dissolved in distilled water and about 3.3 mg / 5 ml is pipetted onto the disc. After air drying, the inverted disc is added to the CAM. Three days later, the specimens are fixed in 3% glutaraldehyde and 2% formaldehyde and rinsed in 0.12 M sodium cacodylate buffer. Pictures of these specimens are taken using a stereomicroscope (Wild M8) and embedded for half sectioning and ultrathin sectioning as described above. Control is performed using only the carrier disk.

The study described in this example tests activity on the galectin-11 protein. However, one skilled in the art can readily modify the illustrated studies to test the activity of a galectin-11 polynucleotide (eg, gene therapy), an agonist and / or antagonist of galectin-11.

Example 40: Angiogenesis Assay Using Matrigelii Implants in Mice The in vivo angiogenesis assay for galectin-11 shows that an existing capillary network is encapsulated in a transplanted capsule of mouse extracellular matrix material (Matrigel). Measure the ability to form new blood vessels. The protein is mixed with liquid Matrigel at 4 ° C., and the mixture is then injected subcutaneously into mice, where it solidifies. After 7 days, the Matrigel solid "plug" is removed and examined for the presence of new blood vessels. Matrigel, Becton Dick
inson Labware / Collaborative Biomedic
Purchased from al Products.

[0792] When thawed at 4 ° C, the Matrigel material is a liquid. Matrige
1 is mixed with Galectin 11 at 150 ng / ml at 4 ° C. and placed in a cold 3 ml syringe. Female C57B1 / 6 mice (about 8 weeks of age) were injected with Matrige
and a mixture of the experimental protein are injected at two sites (0.5 m
1 / site). Seven days later, the mice were sacrificed by cervical dislocation and Matrigel
Remove the plug and wash (ie, remove all cohesive film and fibrous tissue). The entire plug of replication was fixed in neutral buffered 10% formaldehyde, embedded in paraffin, and used with Masson's Trichrome.
A section was prepared for histological examination after staining with the kit. Sections from three different regions of each plug are processed. Selected sections are stained for the presence of vWF. The positive control for this assay was bovine basic FGF (150 ng / ml)
It is. Matrigel alone is used to determine the basal level of angiogenesis.

The study described in this example tests activity on the galectin-11 protein. However, one skilled in the art can readily modify the illustrated studies to test the activity of a galectin-11 polynucleotide (eg, gene therapy), an agonist and / or antagonist of galectin-11.

Example 41: Rescue of ischemia in a rabbit lower limb model To study the in vivo effects of galectin-11 on ischemia, a rabbit hind limb ischemia model was previously described (Takeshita, S. et al.). , Am JP
atol 147: 1649-1660 (1995)) by surgical removal of one femoral artery. Resection of the femoral artery results in retrograde growth of thrombus and occlusion of the foreign iliac artery. As a result, blood flow to the ischemic limb is dependent on collateral vessels originating from the iliac artery (Takeshita, S. et al., Am J. Patho.
1 147: 1649-1660 (1995)). The 10-day interval allows for post-operative recovery and the development of endothelial collateral vessels in rabbits. 10 days after surgery (day 0)
After performing baseline angiography, the iliac artery of the ischemic limb was
Galectin-11 naked expression plasmid is described (Riessen, R. et al., Hum Gene Ther. 4: 749-758 (1993); Lecle
rc, G .; J. et al. Clin. Invest. 90: 936-944 (1992)
Transfection by the arterial gene transfer technique using a hydrogel-coated balloon catheter as in)). When Galectin-11 is used in the treatment, a single bolus of 500 mg Galectin-11 protein or control is delivered through the infusion catheter to the iliac artery of the ischemic limb in one minute.
On day 30, various parameters are measured in these rabbits: (a) B
P ratio-blood pressure ratio of ischemic limb systolic pressure to normal limb systolic pressure; (b)
Blood flow and flow preservation-rest FL: blood flow and max FL during unexpanded state:
Blood flow during full dilation (also an indirect scale of vascular volume), and flow preservation is reflected in the maximum FL: static FL ratio; (c) angiographic values- It is measured by angiography of collateral vessels. Values are determined by the percentage of circles in the overlapping grid with intersecting opacified arteries divided by the total number in rabbit thighs; (d) Capillary density-collateral capillaries determined in light microscopic sections taken from hind limbs number.

The studies described in this example test activity on the galectin-11 protein. However, one skilled in the art can readily modify the illustrated studies to test the activity of a galectin-11 polynucleotide (eg, gene therapy), an agonist and / or antagonist of galectin-11.

(Example 42: Effect of galectin 11 on vasodilation) Since dilation of vascular endothelium is important for lowering blood pressure, spontaneously hypertensive rats (S
Test the ability of galectin-11 polypeptide to affect blood pressure in HR). Increasing doses (0, 10, 30, 100, 300 and 900 mg / kg) of galectin 11 are administered to 13-14 week old spontaneously hypertensive rats (SHR). Data are expressed as mean ± SEM. Statistical analysis is performed with a two-tailed t-test, and statistical significance is defined as p <0.05 for response to buffer alone.

The study described in this example tests activity on the galectin-11 protein. However, one skilled in the art can readily modify the illustrated studies to test the activity of a galectin-11 polynucleotide (eg, gene therapy), an agonist and / or antagonist of galectin-11.

Example 43: Rat Ischemic Skin Flap Model Evaluation parameters include skin blood flow, skin temperature, and Factor VIII immunohistochemistry or endothelial alkaline phosphatase reaction. Galectin-11 expression during cutaneous ischemia is studied using in situ hybridization.

The study in this model is divided into three parts: a) ischemic skin b) ischemic skin wound c) normal wound.

The experimental protocol includes: a) a single stem full thickness random flap of 3 × 4 cm (muscle flap over the waist of the animal) b) resected wound on ischemic skin (flap) (4) C) topical treatment of resected wounds with galectin 11 (day 0, 1, 2, 3 and 4 after wounding) in the following different dosage ranges: 1 mg -100 mg d) Wound tissues at 3, 5, 7, 10, 14, and 21 days after wounding were used for histological, immunohistochemical and in situ studies Sampling.

The study described in this example tests activity on the galectin-11 protein. However, one skilled in the art can readily modify the illustrated studies to test the activity of a galectin-11 polynucleotide (eg, gene therapy), an agonist and / or antagonist of galectin-11.

Example 44 Peripheral Artery Disease Model Angioplasty treatment with galectin 11 is a new therapeutic strategy to obtain a restoration of blood flow around ischemia in the case of terminal arterial disease. This experimental protocol involves: a) ligating one side of the femoral artery to create hindlimb ischemic muscle and acting on the other side of the hindlimb as a control b) dosage range of 20 mg-500 mg C) intravenously and / or intramuscularly three times a week (possibly more) for 2-3 weeks c). At two and three weeks, galectin-11 expression and histology are collected. A biopsy is also performed on the other side of the normal muscle of the contralateral hind limb.

The study described in this example tests activity on the galectin 11 protein. However, one skilled in the art can readily modify the illustrated studies to test the activity of a galectin-11 polynucleotide (eg, gene therapy), an agonist and / or antagonist of galectin-11.

Example 45: Ischemic myocardial disease model Galectin 11 is evaluated as a potent mitogen that can stimulate the development of collateral vessels and reconstitute new vessels after coronary artery occlusion. Changes in galectin 11 expression are investigated in situ. The experimental plasmids include: a) The heart is exposed through the left thoracotomy in rats. Immediately occlude the left coronary artery with thin sutures (6-0) and occlude the thorax b) Galectin-11 protein in a dosage range of 20 mg-500 mg, intravenously and / or intramuscularly for 1 week C. 3 times (possibly more) for 2 to 4 weeks c) At 30 days post-operative, hearts are removed and sectioned for morphometry and analyzed in situ.

The study described in this example tests activity on the galectin-11 protein. However, one skilled in the art can readily modify the illustrated studies to test the activity of a galectin-11 polynucleotide (eg, gene therapy), an agonist and / or antagonist of galectin-11.

Example 46: Rat Corneal Wound Healing Model This animal model shows the effect of galectin 11 on neovascularization. This experimental protocol involves: a) making a 1-1.5 mm long cut from the center of the cornea into the stromal layer b) placing the spatula under the cut lip facing the outer corner of the eye Insert c) Create pocket (its base is 1-1.5 mm from the end of the eye) d) Place a pellet containing 50 ng to 5 ug of galectin 11 in the pocket e) Galectin 11 treatment May also be applied topically to corneal injury at dosages ranging from 20 mg to 500 mg (treated daily for 5 days).

The studies described in this example tested activity on the galectin-11 protein. However, those skilled in the art will readily appreciate exemplary studies for testing the activity of a galectin-11 polynucleotide (eg, gene therapy), and for testing the activity of a galectin-11 agonist and / or antagonist. Can be modified.

Example 47 Diabetic Mice and Glucocorticoid Impaired Wound Healing Model A. Diabetic db + / db + Mouse Model To demonstrate that galectin 11 can accelerate the healing process, inheritance of wound healing The experimental diabetic mouse model is used. The full thickness wound healing model in db + / db + mice is a well-characterized, clinically relevant, and reproducible model of impaired wound healing. Healing of diabetic wounds depends on granulation tissue formation and re-epithelialization rather than contraction (Gartner, MH et al., J. Su).
rg. Res. 52: 389 (1992); Greenhalgh, D.C. G. FIG. Et al., Am. J. Pathol. 136: 1235 (1990)).

[0809] Diabetic animals have many unique characteristics observed in type II diabetes.
Homozygous (db + / db +) mice show their normal heterozygous (db +
/ + M) Obese compared to littermates. Mutant diabetic (db + / db +) mice have a single autosomal recessive mutation (db +) on chromosome 4 (Colem).
et al., Proc. Natl. Acad. Sci. USA 77: 283-29
3 (1982)). Animals exhibit polyphagia, polydipsia and polyuria. Mutant diabetic mice (db + / db +) have elevated blood glucose, increased or normal insulin levels, and suppressed cell-mediated immunity (Mande)
J. l et al. Immunol. 120: 1375 (1978); Debray-S
achs, M.A. Et al., Clin. Exp. Immunol. 51 (1): 1-7 (
1983); Leiter et al., Am. J. of Pathol. 114: 46:
46-55 (1985)). Peripheral neuropathy, myocardial complications, and microvascular injury, basement membrane thickening and glomerular filtration abnormalities have been described in these animals (Norido, F. et al., Exp. Neurol).
. 83 (2): 221-232 (1984); Robertson et al., Diab.
etes 29 (1): 60-67 (1980); Giacomelli et al., L.
ab Invest. 40 (4): 460-473 (1979); Colema.
n, D. L. , Diabetes 31 (Supplement): 1-6 (1982)). These homozygous diabetic mice develop hyperglycemia which is similar to human type II diabetes and is resistant to insulin (Mandel et al., J. Immunol. 1).
20: 1375-1377 (1978)).

The characteristics observed in these animals suggest that healing in this model may be similar to that observed in human diabetes (Greenhalghg)
Et al., Am. J. of Pathol. 136: 1235-1246 (1990).
).

[0813] Genetically diabetic female C57BL / KsJ (db + / db +) mice and their non-diabetic (db + / + m) heterozygous littermates are used in this study (Jackson Laboratories). These animals are purchased at the start of the study at 6 and 8 weeks of age. Animals are housed individually and provided food and water ad libitum. All operations are performed using aseptic techniques. This experiment, Hum
an Genome Sciences, Inc. Institutional
Animal Care and Use Committee and t
he Guidelines for the Care and Useo
f Follow the rules and guidelines of Laboratory Animals.

The wound protocol was adapted from previously reported methods (Tsuboi, R. and Rif.
Kin, D.C. B. , J. et al. Exp. Med. 172: 245-251 (1990).
). Briefly, on the day of wound creation, animals were injected intraperitoneally with Avertin (0.01 mg / mL), 2,2,2-tribromoethanol and 2-methyl-2-butanol dissolved in deionized water. Anesthetize. The dorsal area of the animal is shaved and the skin is washed with a 70% ethanol solution and iodine. The surgical area is dried with sterile gauze before making the wound. An 8 mm full thickness wound is then made using a Keyes tissue punch. Immediately after wound creation, the surrounding skin gently stretches, eliminating the spread of the wound. These wounds remain open for the duration of the experiment. The application of this treatment is given topically for 5 consecutive days starting on the day of wound creation. Prior to treatment, the wound is gently washed with sterile saline and gauze sponge.

The wounds are visually inspected and photographed at a fixed distance on the day of surgery, and are performed at 2 day intervals thereafter. Wound closure is determined by daily measurements on days 1-5 and day 8. Wounds are measured horizontally and vertically using calibrated Jameson calipers. A wound is considered healed if the granulation tissue is no longer visible and the wound is covered by a continuous epithelium.

Galectin 11 is administered in a vehicle for 8 days using different ranges of doses of galectin 11 from 4 mg to 500 mg per wound per day. The vehicle control group received 50 mL of vehicle solution.

Animals are euthanized on day 8 using an intraperitoneal injection of sodium pentobarbital (300 mg / kg). The wound and surrounding skin are then harvested for histology and immunohistochemistry. Tissue specimens are placed in 10% neutral buffered formalin in a tissue cassette between biopsy sponges for further processing. Three groups of 10 animals each (5 diabetic and 5 non-diabetic controls) are evaluated: 1) vehicle placebo control, 2) untreated group; and 3).
The treated group.

The wound closure is analyzed by measuring the area in the vertical and horizontal axes and obtaining the total area of the wound. Contraction is then assessed by establishing the difference between the initial wound area (day 0) and the post-treatment wound area (day 8). The wound area on day 1 is the corresponding size of a 64 mm ² skin punch. The calculation is made using the following formula: (open area on day 8)-(open area on day 1) / (open area on day 1). Specimens were fixed in 10% buffered formalin, and paraffin-embedded blocks were sectioned perpendicular to the wound surface (5 mm), and
g Cut using a microtome. Conventional hematoxylin-eosin (H
& E) Staining is performed on bisected wound sections. The histological examination of this wound is used to assess whether the healing process and the morphological appearance of the repaired skin are altered by treatment with galectin-11. This assessment included confirmation of the presence of cell accumulation, inflammatory cells, capillaries, fibroblasts, reepithelialization and epithelial maturation (G
Reenhalgh, D .; G. FIG. Et al., Am. J. Pathol. 136: 123
5 (1990)). The calibrated lens micrometer is used for blind observer (blin).
Deed observer).

[0817] Tissue sections were also prepared using a polyclonal rabbit anti-human keratin antibody, ABC
Immunohistochemical staining is performed using the Elite detection system. Human skin is used as a positive tissue control, while non-immune IgG is used as a negative control. Keratinocyte proliferation is determined by assessing the extent of wound re-epithelialization using a calibrated lens micrometer.

Proliferating cell nuclear antigen / cyclin (PCNA) in skin specimens was
The A antibody (1:50) is demonstrated by using the ABC Elite detection system. Human colon cancer is provided as a positive tissue control, and human brain tissue is used as a negative tissue control. Each specimen contained sections with omission of the primary antibody and replacement with non-immunized mouse IgG. The ranking of these sections is based on the degree of growth on a scale of 0-8, with the lower side of this scale reflecting slight growth and the higher side reflecting vigorous growth.

The experimental data is analyzed using a one-tailed t-test. A p-value less than 0.05 is considered significant.

B. Steroid Impaired Rat Model Inhibition of wound healing by steroids has been well documented in various in vitro and in vivo systems (Wahl, SM Glucocorticoids).
and Wound hearing. Anti-Inflammatory
Steroid Action: Basic and Clinical A
spectras. 280-302 (1989); Wahl, S .; M. J. et al. Im
munol. 115: 476-481 (1975); Werb, Z .; J. et al. E
xp. Med. 147: 1684-1694 (1978)). Glucocorticoids inhibit angiogenesis and increase vascular permeability (Ebert, RH, et al., An. In.
tern. Med. 37: 701-705 (1952), fibroblast proliferation, and collagen synthesis (Beck, LS et al., Growth Factors. 5).
: 295-304 (1991); Haynes, B .; F. J. et al. Clin. I
nvest. 61: 703-797 (1978)).
And by producing a transient decrease in circulating monocytes (Haynes, B .;
F. J. et al. Clin. Invest. 61: 703-797 (1978); W
ahl, S .; M. , "Glucocorticoids and wound
healing ", Antiinflammation Steroid Ac
Tion: Basic and Clinical Aspects, Acad
emic Press, New York, 280-302 (1989)),
Delays wound healing. Systemic administration of steroids to impaired wound healing is a well-established phenomenon in rats (Beck, LS et al., Growth F
actors. 5: 295-304 (1991); Haynes, B .; F. Et al.,
J. Clin. Invest. 61: 703-797 (1978); Wahl,
S. M. , "Glucocorticoids and wound sound.
ing ", Antiinflammatory Steroid Action Action
: Basic and Clinical Aspects, Academic
Press, New York, 280-302 (1989); Pierc
e, G. F. Proc. Natl. Acad. Sci. USA 86:22
29-2233 (1989)).

To demonstrate that galectin-11 can accelerate the healing process, rats (
In this rat, healing is impaired by systemic administration of methylprednisolone) in a full-thickness excised wound.
The effect of multiple topical applications of galectin 11 on the initial skin wound is evaluated.

[0827] Young adult male Sprague Dawley rats weighing 250-300 g (C
harles River Laboratories) is used in this example. The animals are purchased at the age of 8 weeks and are 9 weeks old at the start of the study. The healing response of rats was determined by systemic administration of methylprednisolone (17
mg / kg / rat, intramuscular). Animals are housed individually and provided food and water ad libitum. All operations are performed using aseptic techniques. This work is described in Human Genome Sciences, Inc. Insit
universal Animal Care and Use Committe
e and the Guidelines for the Care an
d. Perform according to the rules and guidelines of Use of Laboratory Animals.

The wound protocol is subsequently performed according to section A above. On the day of wounding, animals are anesthetized with an intramuscular injection of ketamine (50 mg / kg) and xylazine (5 mg / kg). The dorsal area of the animal is shaved and the skin is washed with a 70% ethanol solution and an iodine solution. The surgical area is dried with sterile gauze before making the wound. An 8 mm full thickness wound is created using a Keyes tissue punch. These wounds remain open for the duration of the experiment. Application of the test material is given topically, once daily for 7 consecutive days starting on the day of the wound, followed by administration of methylprednisolone. Prior to treatment, the wound is gently washed with sterile saline and gauze sponge.

The wounds are visually inspected and photographed at a fixed distance at the end of the day of the wound and day of surgery. Wound closure is determined by daily measurements on days 1-5 and day 8. Wounds are measured horizontally and vertically using calibrated Jameson calipers. A wound is considered healed if the granulation tissue is no longer visible and the wound is covered by a continuous epithelium.

Galectin-11 is administered in a vehicle for 8 days using different ranges of doses of galectin-11 from 4 mg to 500 mg per wound per day. The vehicle control group received 50 mL of vehicle solution.

Animals are euthanized on day 8 using an intraperitoneal injection of sodium pentobarbital (300 mg / kg). The wound and surrounding skin are then harvested for histology. Tissue specimens are placed in 10% neutral buffered formalin in a tissue cassette between biopsy sponges for further processing.

[0827] Four groups of 10 animals each (5 with methylprednisolone and 5 without glucocorticoid) are evaluated: 1) untreated group 2) vehicle placebo control 3) galectin 11 treated group .

[0827] Wound closure is analyzed by measuring the area in the vertical and horizontal axes and obtaining the total area of the wound. The closure was then replaced with the initial wound area (day 0).
And assessing the difference between the wound area after treatment (day 8).
The wound area on day 1 is the corresponding size of a 64 mm ² skin punch. The calculation is made using the following formula: (open area on day 8)-(open area on day 1) / (open area on day 1).

The specimens are fixed in 10% buffered formalin and the paraffin-embedded blocks are sectioned perpendicular to the wound surface (5 mm) and cut using an Olympus microtome. Conventional hematoxylin-eosin (H & E) staining is performed on bisected wound sections. Histological examination of this wound allows assessment of whether the healing process and the morphological appearance of the repaired skin are improved by treatment with Galectin-11. A calibrated lens micrometer is used by a blind observer to determine the distance of the wound gap.

The experimental data is analyzed using a one-tailed t-test. A p-value less than 0.05 is considered significant.

The study described in this example tested activity on galectin-11. However, those skilled in the art will readily appreciate exemplary studies for testing the activity of a galectin-11 polynucleotide (eg, gene therapy), and for testing the activity of a galectin-11 agonist and / or antagonist. Can be modified.

Example 48: Lymphedema animal model The purpose of this experimental approach was to test the therapeutic effect of galectin-11 on lymphangiogenesis and re-establishment of the lymphatic circulation in the rat hind limb. The goal is to create an appropriate and consistent lymphedema model. Efficacy can be measured by measuring the swelling volume of the affected limb, the amount of lymphatic vasculature,
Measured by whole blood plasma protein, and histopathology. Acute lymphedema,
Observe for 7-10 days. Perhaps more importantly, the chronic progression of edema lasts between three to four species.

[0832] Prior to the start of surgery, a blood sample is drawn for protein concentration analysis. About 3
Male rats weighing 50 g are dosed with pentobarbital. Subsequently, the right limb is shaved from the knee to the buttocks. The shaved area is wiped with gauze soaked in 70% EtOH. Withdraw blood for serum total protein test. Circumferential and volume measurements are taken (0.5 cm above the heel in the middle part of the dorsal foot) after making two measurement levels before injecting the dye into the foot. Inject 0.05 ml of 1% Evan's Blue on the dorsum of the skin intradermally on both the right and left feet. Circumference and volume measurements are then taken after injection of the dye into the paw.

Using the knee joint as a landmark, an incision is made circumferentially in the middle of the leg to place the femoral canal. The flap is cut out and separated using forceps and a hemostat. After the femoral canal has been placed, the lymph vessels flowing along and down the vessel are placed.
The major lymph vessels in this area are then either electrocoagulated or sutured and ligated.

Using a microscope, the muscles behind the legs (semitendinosi
s) and near the adductor muscle). The popliteal lymph nodes are then placed. The two proximal and two distal lymph vessels of the popliteal node and the distal blood supply are then connected by suture. The popliteal lymph nodes and any accompanying fat tissue are then removed by cutting connective tissue.

Care is taken to control for minor bleeding resulting from this procedure. After occlusion of the lymphatic vessels, the flap is sealed by using liquid skin (Vetbond) (AJ Buck). The separate skin edges are sealed to the underlying muscle tissue, leaving a gap of about 0.5 cm around the leg. The skin may also be anchored when necessary by suturing to the underlying muscle.

Animals are housed individually using mesh (no bedding) to avoid infection. The collected animals are checked daily through the optimal edema peak. This peak typically occurs for up to 5-7 days. The plateau edema peak is then observed. To assess the intensity of lymphedema, the circumference and volume of two designated locations on each limb are measured before manipulation and daily for 7 days. The effect of plasma proteins on lymphedema is determined and it is also investigated whether protein analysis is a useful test perimeter. The weights of both the control and edema paw are evaluated at two points.
The analysis is performed in a blind manner.

[0838] Circumference measurement: Measure the limb circumference using a cloth tape measure under short-term gas anesthesia to prevent limb movement. Measurements are taken by two different persons at the ankle bone and the dorsal foot, and then these two readings are averaged. Read,
Obtained from both control and edema paw.

[0839] Volume measurement: On the day of surgery, animals are anesthetized with pentobarbital and tested prior to surgery. For daily volume measurements, animals are placed under short-term halothane anesthesia (rapid fixation and quick recovery), both legs are shaved and equally marked on the legs using a water-resistant marker. The legs are first dipped in water, then dipped into the device to each significant level, and then the Buxco edema software (Chen / Vict).
or). The data is recorded by one person, while the other dips into the marked area.

[0839] Blood-Plasma Protein Measurement: Blood is removed, centrifuged, and serum separated prior to surgery, and then conclusions are made for total protein and Ca2 + comparison.

[0841] Limb Weight Comparison: After blood is drawn, the animals are prepared for tissue collection.
The limb is cut with quiltine, then both the experimental and control legs are ligated and cut and weighed. A second weighing is performed by removing the tibio-cacaneal joint and weighing the foot.

Histological Preparation: Transverse muscle located behind the knee (popliteal) area is excised and placed in a metal mold, filled with freezeGel, immersed in cold methylbutane, and cut at -80EC until cut into labeled sample bags. To place. At the time of the cut, the muscle is observed for lymphatic vessels under a fluorescent microscope.

The study described in this example tested activity on galectin-11. However, those skilled in the art will readily appreciate exemplary studies for testing the activity of a galectin-11 polynucleotide (eg, gene therapy), and for testing the activity of a galectin-11 agonist and / or antagonist. Can be modified.

Example 49: Inhibition of TNFα-Induced Adhesion Molecule Expression by Galectin-11 Recruitment of lymphocytes to areas of inflammation and angiogenesis was due to cell surface adhesion molecules (CAM) on lymphocytes and vascular endothelium. Between the specific receptor-ligand interaction. This adhesion process involves intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1) in both normal and pathological settings.
), Followed a multi-step cascade involving endothelial cell (EC) and endothelial leukocyte adhesion molecule-1 (E-selectin) expression. The expression of these and other molecules on the vascular endothelium determines the efficiency with which leukocytes can adhere to the local vasculature and extravasate to local tissues during the development of an inflammatory response. Local concentrations of cytokines and growth factors are involved in regulating the expression of these CAMs.

[0845] Tumor necrosis factor-α (TNF-α), a potent pro-inflammatory cytokine, is a stimulator of all three CMA in endothelial cells and can be involved in a wide variety of inflammatory responses, often Brings physical consequences.

[0846] The potential of galectin-11 to mediate suppression of TNF-α-induced CAM expression can be tested. The amount of CAM expression in the TNF-α treated protein EC when co-stimulated with multiple BMP family proteins using a modified ELISA assay, which uses EC as a solid phase sorbent, was determined. Measure.

To perform this experiment, human umbilical vein endothelial cell (HUVEC) cultures were obtained from pooled cord harvest and grown in growth medium (EGM-2; supplemented with 10% FCS and 1% penicillin / streptomycin). Clonetics, San Die
(go, CA) in a humidified incubator at 37 ° C. with 5% CO ₂ . HUVECs are seeded at a concentration of 1 × 10 ⁴ cells / well in EGM medium in 96-well plates at 37 ° C. for 18-24 hours or until confluent. Subsequently, the monolayer is washed three times with a serum-free solution of RPMI-1640 supplemented with 100 U / ml penicillin and 100 mg / ml streptomycin, and at 37 ° C. for 24 hours with the given cytokines and / or growth factors. Processed. After incubation, the cells are then evaluated for CAM expression.

[0848] Human umbilical vein endothelial cells (HUVEC) are grown to confluence in standard 96-well plates. Growth medium is removed from the cells and replaced with 90 μl of 199 medium (10% FBS). Samples for testing and positive or negative controls are added to the plate in triplicate (10 μl volume). Plates are incubated at 37 ° C. for either 5 hours (selectin and integrin expression) or 24 hours (integrin expression only). The plate is aspirated, the medium is removed and 100 μl of 0.1%
Paraformaldehyde-PBS (with Ca ++ and Mg ++) is added to each well. The plate is kept at 4 ° C. for 30 minutes. The fixative is then removed from the wells and the wells are washed once with PBS (+ Ca, Mg) + 0.5% BSA and drained. Do not allow this well to dry. Add 10 μl of diluted primary antibody to test and control wells. Anti-ICAM
-1-Biotin, anti-VACM-1-Biotin and anti-E-selectin-
Biotin at a concentration of 10 μg / ml (1: 0.1 mg / ml stock antibody 1:
10 dilution). The cells are incubated for 30 minutes at 37 ° C. in a humidified environment. The wells are washed three times with PBS (+ Ca, Mg) + 0.5% BSA.

[0849] Then, 20 μl of the diluted ExtraAvidin-Alkaline Ph
Osphotase (1: 5,000 dilution) is added to each well and
And incubate for 30 minutes. Wells were added with PBS (+ Ca, Mg) +0.5
Wash three times with% BSA. One tablet of p-nitrophenol phosphate (p
NPP) is dissolved in 5 ml of glycine buffer (pH 10.4). 100 μl of pNPP substrate in glycine buffer is added to each test well. Triplicate standard wells were prepared with ExtraAvidin-Alkaline Pho in glycine buffer.
Working dilution of sphotase (1: 5,
000 (10 ⁰ )> 10 ^−0.5 > 10 ⁻¹ > 10 ^−1.5 ). 5 μl of each dilution is added to triplicate wells, and the resulting AP content in each well is 5.
50 ng, 1.74 ng, 0.55 ng and 0.18 ng. Then 100
μl of pNPP reagent must be added to each of the standard wells. The plate must be incubated at 37 ° C. for 4 hours. 3M NaO
Add a volume of 50 μl of H to all wells. The result is quantified at 405 nm in a plate reader. The background subtraction option is used in blank wells filled with glycine buffer only. This template is set to indicate the concentration of AP conjugate in each standard well (5.50).
ng; 1.74 ng; 0.55 ng; 0.18 ng). The results are shown as the amount of bound AP conjugate in each sample.

The studies described in this example tested activity on galectin-11. However, those skilled in the art will readily appreciate exemplary studies for testing the activity of a galectin-11 polynucleotide (eg, gene therapy), and for testing the activity of a galectin-11 agonist and / or antagonist. Can be modified.

Example 50: Galectin 11 regulates cell cycle and inhibits cancer cell proliferation Carbohydrate binding The amino acid sequence of the C-terminal domain of galectin 11 is significantly scattered from the galectin consensus sequence, And most of the conserved residues in the carbohydrate contacting regions found in other galectins are absent in galectins. Therefore, the ability of galectin 11 to bind to carbohydrates was tested. Lysates from HeLa cells transfected with galectin 11α or β cDNA were mixed with lactosyl-Sepharose 4B and bound proteins were eluted with SDS sample buffer.
Both unbound fractions and eluted material were analyzed by immunoblot using an antibody specific for the internal peptide of galectin-11. Galectin 11 does not bind to lactosyl-Sepharose 4B, while in the same experiment lactose binding was
As expected, it was obtained for galectin-3.

Tissue Distribution of Galectin 11 mRNA Northern blot analysis shows that galectin 11 mRNA is almost undetectable in many tissues tested, as opposed to galectin-3 mRNA, which is detected in almost all tissues. showed that. This result indicates that galectin 11
It is not due to the quality of the cDNA probe. This is because strong signals were observed in Northern blots of mRNA from cells transfected with galectin-11 cDNA using the same probe. However, using a more sensitive procedure, RT-PCR, galectin 11 mRNA was detectable in heart, spleen, thymus and peripheral blood leukocytes. This is also
It was present at low levels in lung, skeletal muscle, kidney, spleen, prostate, testis, ovary and colon, but was barely detectable in brain and liver. Galectin 11mR
Although NA was not detected in many of the cell lines tested, its expression was detected in peripheral blood monocytes and multinucleated cells, as well as in myeloid cell lines, U937, HL-60 and KU-812, B cell line Wil-. 2, and in breast cancer cell line HBL-100 by RT-PCR. However, although immunoblot analysis using anti-peptide antibodies detected proteins in lysates from galectin-11 transductants, the procedure did not include galectin-11 proteins in those cell lines.

Induction of Galectin-11 Expression by Stress Signaling Since the galectin-11 clone was isolated from a G1 arrested Jurkat cell library, expression of the message under these conditions and under conditions that induced cell stasis was I am interested in evaluating. HeLa-S3 and Jurk
at cells, thymidine to synchronize cells at the G1-S border, or G1
Treated with theophylline and dibutyryl-cAMP for cell synchronization. Both treatments induced galectin-11 expression. Galectin 11 mRNA
The AU-rich element in and its restricted expression pattern suggest that the galectin-11 gene product is inducible. Indeed, when HL-60 cells were treated with PMA and ionomycin, galectin 11 mRNA was rapidly induced within 0.5 hours, but the message decreased rapidly 2 hours after treatment, and 4 hours later. Was no longer detectable.

Cell cycle arrest by ectopic expression of galectin-11 The fact that galectin-11 was isolated from cDNA from the G1 phase arrested Jurkat cell line indicates that this protein functions in cell cycle regulation. Suggest that you can. To test this possibility, the human cervical cancer cell line HeL
a was co-transfected with a vector containing the complete cDNA for galectin 11 (both α and β), and green fluorescent protein (GFP) cDNA.

When comparing control vector-transfected HeLA cells,
Significantly increased percentage of cells expressing A-labeled galectin 11 were G cells in the cell cycle.
A lower percentage of cells were found in phase 1 and at the expense of S and G2 / M phases (data not shown). Similar results were obtained with the breast cancer cell line, MC
Obtained using F-7 (data not shown). The effects of the α and β forms of galectin 11 were comparable.

[0857] Another member of the galectin family, galectin-9, which also comprises
(Including two CRDs) were studied for comparison. Hemagglutinin (HA) labeled galectin-9 and galectin 11α were used such that their expression levels in transfected cells could be compared by immunoblot using anti-HA antibodies. In spite of using the same recipient cell line and the same procedure, in each transductant the level of galectin-9 was much higher than the level of galectin-11. Similarly, galectin-9 expression did not have any noticeable effect on the cell cycle, but galectin 11 induced G1 arrest in a dose-dependent manner.

To confirm the above findings, an adenovirus-based transfection system was used, which is known to have very high transfection efficiency in various cell types. Therefore, replication-deficient adenovirus containing galectin 11 was used to infect Ape-19 cells. Initial experiments confirmed that nearly 100% of the cells were infected based on the expression of GFP as measured by flow cytometry. Cells transfected with a significantly higher percentage of galectin 11 were in G1 phase and were compared to control transductants. G1
Experiments were performed to show that the accumulation of cells in the nodazole was a consequence of G1 arrest rather than an accelerated transition from M to G1, where nocodazole (which destroys the spindle and thus he cells A drug known to prevent termination of mitosis) is added to the cells after transfection. Forty-eight hours after treatment, most cells transfected with the control virus have terminated G1;
A significant portion of cells infected with virus that were blocked in mitosis while expressing either the α or β isoform of galectin 11 remained G1.

(Inhibition of Cancer Cell Growth by Ectopic Expression of Galectin 11) The cell cycle arrest activity of galectin 11 indicates that cells transfected with galectin 11 do not grow. Colony formation assays were performed to officially demonstrate suppression of cell proliferation resulting from ectopic expression of galectin-11. HeLa cells were co-transfected with galectin 11d DNA along with the construct of the puromycin resistance gene. Control transductants formed many colonies,
Galectin-11 transductants formed only a few colonies two weeks after selection in puromycin-containing media. The effect of galectin-11 expression on inhibition of cell proliferation was measured more quantitatively by using a colorimetric assay. Significantly fewer cells were compared to galectin 1 compared to control transductants.
Obtained from one transductant.

The present invention is not limited by the specific embodiments described herein, but is intended to be an illustration of one of the individual aspects of the invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims.

The entire disclosure of all publications (including patents, patent applications, scholarly articles, research manuals, books or other materials) cited herein is hereby incorporated by reference. You.

In addition, sequence listings provided in paper and computer readable form are incorporated by reference herein in their entirety.

[0862]

[Table 5] (Canada) Applicant will continue to operate with the Commissioner of Patents until the Canadian patent is issued based on the application, or the application is refused or abandoned and cannot be reinstated or withdrawn. Requesting that only an independent expert nominated by the Authorized Company provide a sample of the deposited biological material referred to in the application, the applicant shall comply with the rules for publication of the international application. Before completion of the preparations, the International Bureau must be informed in writing.

(Norway) The applicant hereby assumes that until the application has been published (by the Norwegian Patent Office) or has been decided without the publication by the Norwegian Patent Office, Request that it be done only for the house. A request to this effect shall be filed by the applicant with the Norwegian Patent Office before the time when the application is made publicly available under sections 22 and 33 (3) of the Norwegian Patent Act. If such a request is made by the applicant, any request for the provision of a sample by a third party shall indicate the expert employed. The expert is a list of certified experts prepared by the Norwegian Patent Office (list of
Recognized experts), or
In each case, it can be any person approved by the applicant.

(Australia) The applicant hereby gives the sample of the microorganism,
Alternatively, prior to lapsing, rejection or withdrawal of the application, the subject is a skilled adder who has no interest in the invention.
ssee) (Australia Patent Law 3.25 (3)).

(Finland) The applicant hereby filed that the application was filed (Patent and
Until published (by the Board of Patents and Regulations) or without publication and subject to a decision by the National Patent and Legislative Commission, the sample will be provided only to experts in the art. ,Claim.

[0866] Applicants hereby request that samples of microorganisms be made available only to professionals. Such a request must be made by the applicant to the International Bureau before the regulatory preparations for international publication of the application have been completed. ATCC Accession No. 209059 (Denmark) The applicant hereby assumes that until the application has been published (by the Danish Patent Office) or has been decided by the Danish Patent Office without being published, Request that this be done only to experts. A request to this effect shall be made by the applicant to the Danish Patent Office prior to the time the application is made publicly available under sections 22 and 33 (3) of the Danish Patent Act. If such a request is made by the applicant, any request for the provision of a sample by a third party shall indicate the expert employed. The expert is a list of certified experts prepared by the Danish Patent Office (list of
Recognized experts), or
In each case, it can be any person approved by the applicant.

(Sweden) The applicant hereby assumes that until the application has been published (by the Swedish Patent Office) or has been decided without the publication by the Swedish Patent Office, the donation of samples is Request that it be done only for the house. A request to this effect shall be made by the applicant to the International Bureau prior to the expiration of 16 months from the priority date (preferably PCT Application's Gui).
Format PCT / RO / 13 described in annex Z of Volume I of de
4). If such a request is made by the applicant, any request for the provision of a sample by a third party shall indicate the expert employed. The expert is a list of accredited experts created by the Swedish Patent Office (list
to any of the recognized experts), or
Alternatively, it may be any person approved by the applicant in each case.

(Netherlands) The applicant hereby states that, under the provisions of Patent Act 31F (1), the microorganisms may be specialized until the date of issuance of the Dutch patent, or until the date the application is rejected, withdrawn or lapped. Request that this be done only in the form of sample delivery to the house. The request to this effect shall be filed by the applicant prior to the date on which the application is made publicly available under section 22C or 25 of the Dutch Patent Law, whichever comes first. Shall be submitted to the Bureau.

[Sequence list]

[Brief description of the drawings]

FIG. 1 shows the nucleotide sequence of galectin 11 (SEQ ID NO: 1) and the deduced amino acid sequence (SEQ ID NO: 2). This protein has an estimated molecular weight of about 14.8 kDa. The complementary strand of the nucleotide sequence of SEQ ID NO: 1 is shown in SEQ ID NO: 12.

FIG. 2 shows galectin 11 protein (HJACE54), rat galectin 5
(SEQ ID NO: 3) and the region of similarity between the amino acid sequences of human galectin 8 (SEQ ID NO: 4). Identical amino acids shared between these galectins are shaded and conservative amino acid changes are boxed. By examining the shadowed and / or boxed regions of amino acids, one of skill in the art can readily identify conserved domains between the two polypeptides. These conserved domains are preferred embodiments of the present invention.

FIG. 3 shows the structural and functional characteristics of Galectin 11 (SEQ ID NO: 2) estimated using the default parameters of the indicated computer program. α region, β region, turn region and coil region; hydrophilic and hydrophobic; amphiphilic region; flexible region; antigenic index and surface probability. Antigenicity index-Ja
In the meson-Wolf graph, the positive peak is galectin 11
The location of the highly antigenic region of the protein (ie, the region where the epitope-bearing peptide of the present invention can be obtained) is indicated. The domains defined by this graph (eg, including amino acid residues 65-70 and 118-124 in FIG. 1 (SEQ ID NO: 2)) are contemplated by the present invention. This corresponds to the indicated highly antigenic region of the galectin 11 polypeptide. The data shown in FIG. 3 is also represented in tabular form in Table 1. This column is labeled with the titles "residue", "position", and Roman numerals I-XIII. The column titles refer to the following features of the amino acid sequence shown in FIGS. 1 and 3 and in Table 1: "residues": amino acid residues of SEQ ID NO: 2 and FIG. 1; "positions"; Position of the corresponding residue in FIG. 1; I: α-region-Garnier-Robson;
II: α region-Chou-Fasman; III: β region-Garnier-R
obson; IV: β region-Chou-Fasman; V: turn region-Gar
nier-Robson; VI: turn region-Chou-Fasman; VII
: Coil region-Garnier-Robson; VIII: hydrophilicity plot-K
ix: α, amphipathic region-Eisenberg;
X: β, amphipathic region-Eisenberg; XI: flexible region-Karplu
s-Schulz; XII: Antigenicity Index-Jamson-Wolf; and XI
II: Surface probability plot-Emini.

FIG. 4 shows the structure of the human galectin 11 gene. The human galectin 11 gene is located on chromosome 11. This figure shows the eleventh gene containing the galectin 11 gene.
1 shows the structure of a region of a chromosome and discloses the number of nucleotides corresponding to the transcribed (shaded) and non-transcribed (open) portions of this region of the chromosome. The human galectin 11 gene contains five exons. The translation start site is located on the second exon. The numbering of the nucleotides identified in the exons represented by Roman numerals corresponds to that shown in FIG. 1 (SEQ ID NO: 1).

FIG. 5A shows Jurka with galectin-11 expression construct (pEF-Leg11).
4 is a bar graph showing that transfection of t cells induces apoptosis of transfected cells. Shaded bars indicate% apoptosis of Jurkat cells transfected with galectin-11 expression construct, while open bars indicate Jurkat cells transfected with pEF control vector.
The percentage of cell apoptosis is shown. Apoptosis is mitoTracke
It was measured by a two-color cell count method using rRed.

FIG. 5B is a bar graph showing the survival of successfully transfected GEP positive cells 4 days after transfection. The survival of the transfected cells was determined by control vector (pEF1) or galectin-11 expression vector (
tested after co-transfection with either of pEF-Leg11). There were about 4 times more viable GEP positive cells after transfection with pEF1 than after transfection with pEF-Leg11.

FIG. 6 shows the nucleotide sequence (SEQ ID NO: 24) and deduced amino acid sequence (SEQ ID NO: 25) of the complete galectin 11α cDNA and protein, respectively.

FIG. 7 is a schematic diagram showing the relative positions of eight exons containing the galectin 11 gene. The differences created by alternative splicing between galectin 11α and galectin 11β, which give rise to different N-termini among the variants, are also shown (galectin 11α is 7 nucleotides longer at the 5 ′ end of exon 2).

FIG. 8 shows the differences between the polypeptide sequences of galectin 11α and galectin 11β. The complete nucleotide sequence and amino acid sequence of galectin 11β are shown in the sequence listing as SEQ ID NOs: 26 and 27, respectively.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 37/00 C07K 14/47 4H045 37/08 16/18 C07K 14/47 C12N 1/15 16/18 1 / 19 C12N 1/15 1/21 1/19 C12P 21/02 C 1/21 G01N 33/15 Z 5/06 33/50 Z 5/10 33/53 D C12P 21/02 33/68 G01N 33/15 C12N 15/00 ZNAA 33/50 A61K 37/02 33/53 C12N 5/00 A 33/68 E (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB , GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG ), AP (GH, GM, KE, LS, MW) SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CR, CU, CZ, DE, DK, DM, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN , IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (71) Hoya Institute for Allergy and Immunology United States of America Cali Orunia State 92121 San Diego Science Center Drive 10355 (72) invention have two, Jian United States Maryland 20853, Rockville, manners field 5502 (72) inventor Rosen, Craig rays. United States Maryland 20882, Layton'sville, Rolling Hill Road 22400 (72) Inventor Genz, Rainer L. United States Maryland 20850, Rockville, Mount Prospect Drive 13608 (72) Inventor Ryu, Futon California 92130, USA, San Diego, Mensha Place 4351 F-term (reference) 2G045 AA40 BB20 CB01 DA12 DA13 DA14 DA36 DA77 DA78 FB03 4B024 AA01 AA11 BA80 CA04 CA07 CA09 CA20 DA02 DA03 DA06 EA02 EA04 GA11 GA13 GA18 GA19 GA25 HA13 HA14 4B064 AG01 AG28 CA02 CA05 CA06 CA10 CA19 CC01 CC24 CE12 DA01 DA13 4B065 AA26X AA58X AA72X AA90X AA93BA14 BA10 AC14 BA10 AA02 AA07 AA13 BA01 BA08 BA21 BA22 BA23 CA17 CA18 CA23 CA59 MA66 NA14 ZA592 ZB072 ZB112 ZB132 ZB262 4H045 AA10 AA11 AA20 AA30 BA10 BA41 CA40 DA75 DA80 EA20 EA50 FA71 FA74 GA26

Claims (20)

[Claims] 1. An isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence that is at least 95% identical to the nucleotide sequence encoding amino acids 1-133 of SEQ ID NO: 2 (B) a nucleotide sequence that is at least 95% identical to the nucleotide sequence encoding amino acids 2-133 of SEQ ID NO: 2; (c) is at least 95% identical to the nucleotide sequence encoding amino acids 1-275 of SEQ ID NO: 25 (D) a nucleotide sequence that is at least 95% identical to the nucleotide sequence encoding amino acids 2-275 of SEQ ID NO: 25; (e) a nucleotide sequence that is at least 95% identical to the nucleotide sequence encoding amino acids 1-296 of SEQ ID NO: 27 (F) SEQ ID NO: A nucleotide sequence that is at least 95% identical to the nucleotide sequence encoding 27 amino acids 2-296; and (g) the complement of (a), (b), (c), (d), (e) or (f). body. 2. The isolated polynucleotide according to claim 1, wherein the nucleotide sequence is (a) or a sequence complementary thereto. 3. The isolated polynucleotide according to claim 1, wherein the nucleotide sequence is (c) or a sequence complementary thereto. 4. The isolated polynucleotide according to claim 1, wherein the nucleotide sequence is (e) or a sequence complementary thereto. 5. A method for producing a recombinant vector, comprising a step of inserting the isolated polynucleotide according to claim 1 into a vector. 6. A recombinant vector comprising the polynucleotide according to claim 1. 7. A genetically engineered host cell comprising the polynucleotide of claim 1. 8. A method for producing a galectin-11 polypeptide, which comprises culturing the genetically engineered host cell of claim 7 under conditions suitable for producing the polypeptide. And recovering the polypeptide. 9. An isolated galectin 11 polypeptide comprising an amino acid sequence selected from the group consisting of: (a) an amino acid sequence that is at least 95% identical to amino acids 1-133 of SEQ ID NO: 2; A) an amino acid sequence at least 95% identical to amino acids 1-275 of SEQ ID NO: 25; (c) an amino acid sequence at least 95% identical to amino acids 1-296 of SEQ ID NO: 27; 121; (e) amino acids 1-142 of SEQ ID NO: 27; and (e) amino acids 151-275 of SEQ ID NO: 25. 10. The isolated polypeptide according to claim 9, wherein said amino acid sequence is (a). 11. The isolated polypeptide of claim 9, wherein said amino acid sequence is (b). 12. A pharmaceutical composition comprising the polypeptide of claim 9 and a pharmaceutically acceptable carrier. 13. An isolated antibody that specifically binds to the polypeptide of claim 9. 14. An isolated antibody that specifically binds to the polypeptide of claim 10. 15. A method for detecting a galectin-11 polypeptide in a sample, comprising: a) contacting the antibody of claim 13 with the sample; and b) the antibody bound to the polypeptide. Detecting the presence of the method. 16. A method for detecting a galectin-11 polypeptide in a sample, comprising: a) contacting the antibody of claim 14 with the sample; and b) the antibody bound to the polypeptide. Detecting the presence of the method. 17. A method of treating a cell proliferative disorder in a mammal, comprising administering to the mammal a therapeutically effective amount of the polypeptide of claim 9. 18. The method of claim 17, wherein said disorder is selected from the group consisting of cancer, autoimmune disease, inflammatory disease, asthma and allergic disease. 19. A method for regulating the growth or differentiation of a cell in a mammal, comprising administering to the mammal the galectin-11 polypeptide of claim 9 in an amount sufficient to inhibit the growth or differentiation of the cell. Administering to the subject. 20. A method for regulating the growth or differentiation of a cell in a mammal, wherein the galectin-11 polypeptide according to claim 1 is added to the mammal in an amount sufficient to suppress the growth or differentiation of the cell. Administering to the subject.