JP2003125799A - Method for detecting nucleic acid - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for detecting a target nucleic acid by which the sequence of a nucleic acid probe can be designed without considering the site recognizing a restriction enzyme of the target nucleic acid, and which requires no elongation reaction of a polymerase, and further to provide a sensor usable therefor. SOLUTION: This method for detecting the target nucleic acid in a specimen comprises a step for bringing the specimen into contact with the first nucleic acid probe labeled by a donor fluorescent material, and the second nucleic acid probe labeled by an acceptor material under a hybridization condition, and a step for detecting the change of fluorescent intensity emitted after exciting the donor fluorescent material. Each of the first and the second nucleic acid probes has a sequence complemental to the target nucleic acid and different from each other, and forms a nucleic acid probe-target nucleic acid complex in which the fluorescent energy transfer is caused between the donor fluorescent material and the acceptor material when hybridizing with the target nucleic acid.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a method for easily and highly sensitively detecting a target nucleic acid in a sample.

[0002]

2. Description of the Related Art Recently, techniques for obtaining genetic information have been actively developed. In the medical field, it has become possible to treat diseases at a molecular level by analyzing disease-related genes. In addition, genetic diagnosis has made it possible to provide tailor-made medical treatment for each patient. In the pharmaceutical field, genetic information is used to identify protein molecules such as antibodies and hormones and use them as drugs. In the fields of agriculture and food, many products using genetic information have been produced.

Conventionally, Southern blotting method, Northern blotting method, differential display method and the like have been used as a method for obtaining such genetic information. Recently, a minute nucleic acid detecting sensor generally called a DNA microarray has been used. It is being used. These DNA microarrays are the same as the above-mentioned conventional techniques in that target nucleic acids are detected by utilizing hybridization between nucleic acids. One, however, may be processed at one time a large amount of nucleic acid fragments such as several hundreds of thousand kinds from thousands in small groups board such as a glass slide, the most effective technology in the future genetic analysis techniques It seems to be.

At present, various types of DNA microarrays are commercially available. The outline of the gene analysis method using them is as follows.

That is, after a nucleic acid probe having a sequence complementary to the target nucleic acid or nucleic acid fragment to be detected is immobilized on a substrate such as a slide glass, the target nucleic acid labeled with a fluorescent label or the like is hybridized, and then hybridized. The signal of soybean target nucleic acid is detected.

[0006]

However, the method using the DNA microarray requires an advanced technique of immobilizing the nucleic acid probe on the substrate at a high density as described above. Further, the current immobilization technology has a problem that the amount of nucleic acid probe immobilized on the substrate varies greatly.

As described above, the sample containing the target nucleic acid must be labeled in advance by the user, and a dedicated reagent is required for the operation for that purpose. Further, in the most used labeling method at present, since a part of the thymine base in the target nucleic acid is labeled with the labeling substance Cy3 or Cy5, the incorporation rate of the labeling substance depends on the sequence and length of the nucleic acid. different.

As a method for solving the above problems,
A method utilizing fluorescence energy transfer between two kinds of substances has been proposed. Fluorescent energy transfer occurs when one substance is a fluorescent substance (donor fluorescent substance) and the wavelength emitted from this fluorescent substance overlaps with the absorption wavelength of the other substance (acceptor substance). That is, when the two are sufficiently close to each other, even when the donor fluorescent substance is irradiated with excitation light, the fluorescence emitted from the donor fluorescent substance is absorbed by the acceptor substance, and as a result, the fluorescence emitted from the donor fluorescent substance is almost detected. Not done. At this time, the acceptor substance does not necessarily have to be a fluorescent substance, but a fluorescent substance in which fluorescence emitted from the donor fluorescent substance becomes excitation light can also be an acceptor substance. In this case also, even if the donor fluorescent substance is irradiated with the excitation light, the fluorescence emitted from the donor fluorescent substance becomes the excitation light of the acceptor substance, and as a result, fluorescence from the donor fluorescent substance is hardly detected and fluorescence of the acceptor substance is not detected. Only detected.

The following method has been proposed as a method for detecting a nucleic acid utilizing the fluorescence energy transfer between such two kinds of substances.

Japanese Patent Publication No. 05-15439 discloses a method using a nucleic acid probe which is composed of a sequence complementary to a target nucleic acid and which is labeled with two kinds of substances forming a fluorescence energy transfer pair. In this method, the nucleic acid probe is designed so that a specific restriction enzyme site is formed when the nucleic acid probe and the target nucleic acid form a double strand. Therefore, when the nucleic acid probe exists as a single strand, fluorescence from the donor fluorescent substance is not detected even when the excitation light for the donor fluorescent substance is irradiated, but the nucleic acid probe hybridizes to form a double strand, Then, the double strand is cleaved by the restriction enzyme, the fluorescence energy is not transferred between the donor fluorescent substance and the acceptor substance, and the fluorescence by the donor fluorescent substance is detected.

Japanese Unexamined Patent Publication No. 11-123083 also discloses a method using a nucleic acid probe labeled with two kinds of substances that also form a fluorescence energy transfer pair. This nucleic acid probe is a single-stranded restriction enzyme designed to project in a single-stranded state at the 5'end thereof in addition to a sequence complementary to the target nucleic acid when hybridized with the target nucleic acid. It has a part that can form a recognition site. The portion capable of forming this single-stranded restriction enzyme recognition site is between the two types of substances forming the fluorescence energy transfer pair. According to this method, when this nucleic acid probe hybridizes with a target nucleic acid, a complete double strand is formed by an extension reaction by a polymerase using the target nucleic acid as a template, and at the same time, this protruding portion is also limited by extension by a polymerase. Since the enzyme site is formed, by cleaving the nucleic acid probe-target nucleic acid double strand with a restriction enzyme, fluorescence emitted from the donor fluorescent substance can be detected. On the other hand, since the restriction enzyme recognition site in the nucleic acid probe that has not hybridized remains a single strand, it is not cleaved by the restriction enzyme and fluorescence is not detected by the donor fluorescent substance.

In the method utilizing fluorescence energy transfer between the two kinds of substances described above, it is not necessary to immobilize the nucleic acid probe and it may be dissolved in the reaction solution. This, unlike immobilization, facilitates control of the amount of nucleic acid probe used for nucleic acid detection. Further, the target nucleic acid does not need to be labeled by the user beforehand.

However, these methods have the following problems.

First, in the method of Japanese Patent Publication No. 05-15439,
The sequence of the nucleic acid probe must be designed so that a certain restriction enzyme site is always formed when forming a double strand with the target nucleic acid. Therefore, the design of the nucleic acid probe is very limited.

The method disclosed in Japanese Patent Laid-Open No. 11-123083 is different from the method described in Japanese Patent Publication No. 05-15439.
Nucleic acid probe sequences do not necessarily require the restriction enzyme sites present in the target nucleic acid sequence. However, it requires an extension reaction with a polymerase.

The present invention is intended to solve the above-mentioned problems of the prior art. The sequence of the nucleic acid probe can be designed without considering the restriction enzyme recognition site of the target nucleic acid, and the extension reaction of polymerase is required. An object of the present invention is to provide a method for detecting a target nucleic acid that does not exist.

[0017]

The present invention relates to a method of detecting a target nucleic acid in a sample, which method comprises labeling a sample with a first nucleic acid probe labeled with a donor fluorescent substance and an acceptor substance. A step of contacting with a second nucleic acid probe under hybridization conditions,
Here, each of the first nucleic acid probe and the second nucleic acid probe has a sequence complementary to the target nucleic acid and different from each other, and thus, when hybridizing to the target nucleic acid, the donor fluorescence is generated. Forming a nucleic acid probe-target nucleic acid complex such that fluorescence energy transfer occurs between the substance and the acceptor substance; and detecting a change in fluorescence intensity emitted after exciting the donor fluorescent substance. .

The fluorescence intensity may be the fluorescence intensity emitted by the donor fluorescent substance. Alternatively, the fluorescence intensity is
It may be the fluorescence intensity emitted by the acceptor substance.

[0019]

BEST MODE FOR CARRYING OUT THE INVENTION Embodiments of the present invention will be described below with reference to the attached FIGS.

FIG. 1 schematically shows the nucleic acid probe used in the present invention. As shown in FIG. 1, the nucleic acid probes 3 and 4 used in the present invention are at least two, typically a pair of single-stranded nucleic acids having a sequence complementary to the target nucleic acid, and are labeled with the labels 1 and 2. I have each. As shown in the figure, the nucleic acid probe is usually single-stranded and can be produced based on the sequence of the nucleic acid of interest using conventional chemical synthetic methods or recombinant methods. Commercially available sequences may be used. Usually, one of the labels 1 and 2 is a donor fluorescent substance, and the other is an acceptor substance. Nucleic acid probes 3 and 4 have a sequence complementary to the nucleic acid sequence,
These complementary sequences differ from each other and are selected to hybridize to adjacent positions on the target nucleic acid molecule, which causes fluorescent energy transfer between the donor and acceptor fluorophore on each nucleic acid probe. The fluorescence energy transfer between the donor fluorescent substance and the acceptor substance can also be controlled by the labeling position of these substances on each nucleic acid probe.

A typical combination of a donor fluorescent substance and an acceptor substance is fluorescein isocyanate (F
ITC) / Tetramethylrhodamine isocyanate (T
RITC), FITC / Texas Red, FITC / N
-Hydroxysuccinimidyl 1-pyrene butyrate (PYB), FITC / iocin isothiocyanate (EITC), N-hydroxysuccinimidyl 1-pyrenesulphonate (PYS) / FITC, FITC /
Rhodamine X, FITC / tetramethylrhodamine (T
AMRA), N- (4-aminobutyl) -N-ethylisoluminol (ABEI) / TAMRA, but not limited thereto. That is, as long as the condition that the fluorescence wavelength emitted from the excited donor fluorescent substance overlaps with the absorption wavelength or the excitation light wavelength of the acceptor substance is satisfied, any combination of other substances can be used. These target substances can be introduced into the nucleic acid probe by methods known to those skilled in the art.

In the following embodiments of the present invention, a combination of FITC / TRITC is used as an example of the above combination. The excitation light and fluorescence wavelengths of FITC are 490 and 520 nm, respectively, and TRIT
The excitation light and fluorescence wavelengths of C are 541 nm and 572 nm, respectively.

The nucleic acid probe designed as described above does not need to be immobilized on a solid phase as in many other nucleic acid detection methods used by being dissolved in a reaction solution. FIG. 2 schematically shows a hybridization reaction between such a nucleic acid probe and a target nucleic acid. As shown in FIG. 2, since these two kinds of nucleic acid probes and the target nucleic acid hybridize at a ratio of 1: 1: 1, the same amount of these two kinds of nucleic acid probes is required in the reaction tank 5. It may be dissolved at a certain concentration.

Next, a sample containing the target nucleic acid 6 is added to this reaction solution, a sufficient hybridization reaction is carried out under appropriate conditions, and when the target nucleic acid is present in the sample, two nucleic acid probes-target nucleic acid Chain 7 is formed. Target nucleic acid 6 can be in single-stranded or double-stranded form. For example, when detecting a gene expressed in cells, target nucleic acid 6 may be a single-stranded form of cDNA synthesized from mRNA extracted from cells. Also, when the intracellular gene is directly measured, the target nucleic acid 6 may be in a double-stranded form. When the target nucleic acid 6 has a double-stranded form, it is usually denatured into a single-stranded form. Nucleic acid denaturing conditions are a method known to those skilled in the art, and usually used by denaturing into a single strand in advance by high temperature or high alkali. Hybridization between a nucleic acid probe and a target nucleic acid is performed by Sambrook et al. (198).
9) Molecular Cloning: A Lab
oratory Manual, 2nd edition, volumes 1-3,
Cold Spring Harbor Labora
It is performed by a method described in a laboratory manual such as Tory and is known to those skilled in the art. Typically, hybridizations are carried out under so-called "stringent" hybridization conditions, which typically result in sodium ion salt concentrations (about 1.0M at pH 7.0-8.3 (less than about 1.0M. Usually, a sodium ion salt concentration of about 0.01-1.0 M), and a short probe (eg, 1
A temperature of at least about 30 ° C for nucleic acids (0-50 nucleotides) and at least about 60 ° C for long probes (eg, more than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide, in which case
Lower temperatures may be employed.

Next, the target nucleic acid is detected by measuring the fluorescence intensity.

The detection of the target nucleic acid can be carried out by measuring the fluorescence intensity emitted by the excited donor fluorescent substance. When the target nucleic acid is present in the sample, the fluorescence emitted from the donor fluorescent substance existing in the two types of nucleic acid probe-target nucleic acid double strands 7 is obtained even if the donor fluorescent substance is irradiated with excitation light after the hybridization reaction. Is not detected. This is because fluorescence energy transfer occurs in this double-stranded molecule. On the other hand, when the target nucleic acid was not present in the sample and was not hybridized with the target nucleic acid, it was excited because there was not enough acceptor substance around the donor fluorescent substance to cause fluorescence energy transfer. The fluorescence emitted from the donor fluorescent substance is detected.

As described above, the reaction liquid after the hybridization reaction is irradiated with excitation light for the donor fluorescent substance, the fluorescence intensity of the donor fluorescent substance is analyzed, and the amount is compared with the amount of the donor fluorescent substance-labeled nucleic acid probe before addition of the sample. By doing so, the target nucleic acid in the sample can be detected.

Further, when the acceptor substance is also a fluorescent substance like the donor fluorescent substance, it is possible to detect the target nucleic acid in the sample by analyzing the fluorescence derived from the donor fluorescent substance as described above. However, the target nucleic acid in the sample can also be detected by simultaneously analyzing the fluorescence derived from the acceptor substance.

That is, when the donor fluorescent substance is irradiated with excitation light after the hybridization reaction, when the target nucleic acid is present in the sample, the two types of nucleic acid probes formed and the double-stranded molecule formed by the target nucleic acid Since fluorescence energy transfer occurs, fluorescence from the acceptor substance is detected. On the other hand, when the target nucleic acid is not present in the sample and the nucleic acid probe-target nucleic acid duplex is not formed, fluorescence energy transfer does not occur between the donor fluorescent substance and the acceptor substance, and therefore fluorescence from the acceptor substance is not generated. Not detected.

In this way, the target nucleic acid in the sample can be detected by irradiating the donor fluorescent substance with excitation light in the reaction solution after hybridization and analyzing the fluorescence intensity of the acceptor substance.

Further, since the fluorescence intensity depends on the amount of the fluorescent substance that emits the fluorescence, in any case, the calibration curve can be prepared to quantitatively detect the nucleic acid probe-target nucleic acid duplex. It is possible.

The present invention will be described in detail below with reference to examples.

[0033]

Example As shown below, a single-stranded oligonucleotide T1 (SEQ ID NO: 1) consisting of 35 bases as a target nucleic acid
Was used. Further, as a nucleic acid probe, a single-stranded oligonucleotide P1 (SEQ ID NO: 2) consisting of a sequence complementary to 16 bases on the 5'end side of the single-stranded oligonucleotide T1 and having a 5'end modified with FITC, and It consists of a sequence complementary to the 16 bases on the 3'terminal side of the single-stranded oligonucleotide T1, and its 3'terminal is TRITC.
Modified single-stranded oligonucleotide P2 modified by
(SEQ ID NO: 3) was used. T1: 5'cggctagtacgcagccccgcg
atgctgacgcatacg3 ′ P1: 5 ′ (FITC) -ggctgcgtactag
ccg3 'P2: 5'cgtatgcgtcagcatc- (TR
ITC) 3'First, the above-mentioned modified single-stranded oligonucleotides P1 and P
2 of TE buffer (10 mM Tris-HCl,
After dissolution in 1 mM EDTA, pH 7.2), 100 ul aliquots were dispensed into 4 glass cuvettes.

Next, the single-stranded oligonucleotide T1 was dissolved in the above solution. At this time, in each of the four cuvettes, the single-stranded oligonucleotide T1 was dissolved so that the final concentration was different. That is, final concentrations 1, 1
It was dissolved so as to be 0, 50, 100 pmol / 100 ul and used as sample liquids A, B, C and D, respectively.

Then, after carrying out a hybridization reaction at room temperature for 4 hours, each of the sample solutions A, B, C and D was irradiated with excitation light of 490 nm, and the fluorescence intensities at 572 nm were compared.

The results are shown in FIG. Here, the ratio of the fluorescence intensity value of each sample liquid to the sample liquid D is shown for the fluorescence intensity value at 572 nm.

As shown in FIG. 3, the relationship of fluorescence intensity in each sample solution is A <B <C <D, which is almost proportional to the concentration of the single-stranded oligonucleotide T1 dissolved in each sample. It became clear that the fluorescence intensity increases.

The above results indicate that the present invention is very effective in quantitative detection of a specific target nucleic acid or nucleic acid fragment.

[0039]

EFFECTS OF THE INVENTION A method for easily and highly sensitively detecting a target nucleic acid in a sample is provided. There is provided a nucleic acid detection method which does not require labeling of the target nucleic acid and which does not require extension reaction of a restriction enzyme or a polymerase to detect the target nucleic acid unlike the conventional methods for detecting the target nucleic acid.

[0040]

[Sequence list]                           SEQUENCE LISTING <110> Matsushita Electric Industrial Co., Ltd. <120> A method for detecting a target nucleic acid <130> Artificial sequence listing <140> H13-0038 <141> 2001-10-23 <160> 3 <170> PatentIn Ver. 2.1 <210> 1 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: target sequence <400> 1 cggctagtac gcagcccgcg atgctgacgc atacg 35 <210> 2 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: probe <400> 2 ggctgcgtac tagccg 16 <210> 3 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: probe <400> 3 cgtatgcgtc agcatc 16

[Brief description of drawings]

FIG. 1 is a diagram showing an outline of two kinds of nucleic acid probes used in the present invention.

FIG. 2 is a diagram showing an outline of a method for detecting a target nucleic acid of the present invention.

FIG. 3 is a diagram showing a measurement result by the method for detecting a target nucleic acid of the present invention. After hybridization with the nucleic acid probe, four samples of A, B, C, and D having different concentrations of the target nucleic acid were irradiated with excitation light of 490 nm for the donor fluorescent substance, and the fluorescence intensity at 572 nm was measured.
The vertical axis represents the fluorescence intensity of each sample as a ratio of each sample solution to sample A. .

[Description of symbols] 1 donor fluorescent substance 2 acceptor substance 3 single-stranded nucleic acid probe 4 having a sequence complementary to the sequence of the target nucleic acid 4 single-stranded nucleic acid probe 5 having a sequence complementary to the sequence of the target nucleic acid 5 reaction Tank 6 Target nucleic acid 7 Nucleic acid probe-Target nucleic acid double strand

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) G01N 33/58 C12N 15/00 A (72) Inventor Hirokazu Sugihara 1006 Kadoma, Kadoma, Osaka Prefecture Matsushita Electric Industrial In-house F-term (reference) 2G043 AA01 BA16 DA02 EA01 FA06 KA02 KA05 2G045 AA35 DA12 DA13 DA14 FB02 FB07 FB12 GC15 4B024 AA11 AA20 CA09 HA14 4B063 QA01 QQ43 QR56 QS28 QS34 QX02

Claims (3)

[Claims] 1. A method for detecting a target nucleic acid in a sample, which comprises hybridizing the sample with a first nucleic acid probe labeled with a donor fluorescent substance and a second nucleic acid probe labeled with an acceptor substance. Contacting under conditions wherein each of the first nucleic acid probe and the second nucleic acid probe has a sequence complementary to the target nucleic acid and different from each other, whereby the target A nucleic acid probe-target nucleic acid complex is formed such that fluorescence energy transfer takes place between the donor fluorophore and the acceptor fluorophore when hybridized to a nucleic acid; and emitted after exciting the donor fluorophore. Detecting changes in fluorescence intensity. 2. The method according to claim 1, wherein the fluorescence intensity is a fluorescence intensity emitted by the donor fluorescent substance. 3. The method according to claim 1, wherein the fluorescence intensity is a fluorescence intensity emitted by the acceptor substance.