JP2009060862A - Label nucleic acid for preventing sample from being mixed-up - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for preventing mix-up where a clinical specimen or an experimental sample may be mixed-up when carrying out manually analyzing operation of the clinical specimen or the experimental sample, and to provide a tool therefor. <P>SOLUTION: A label nucleic acid containing at least one kind or more of nucleic acids is provided to check whether the clinical specimens or the experimental samples are mixed up or not by mixing the label nucleic acid with the clinical specimen or the experimental sample, and detecting the mixed label nucleic acid in the process of the analysis. The set of the labeled nucleic acid and the labeling-identification method by using the label nucleic acid are also provided. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

The present invention relates to a labeled nucleic acid for detecting whether or not a clinical sample or an experimental sample is mixed by mixing a nucleic acid having a specific sequence with a clinical sample or an experimental sample and detecting this sequence information.

Conventionally, a technique for immobilizing DNA on fibers for the purpose of preventing forgery of articles has been disclosed (see Patent Document 1).
Also, a labeling method for discriminating the authenticity of an article, wherein a first compound (signal compound) of a non-particle macromolecule selected from a nucleic acid, an antibody or an antigen, for example, a nucleic acid is introduced into the article or substance during its production. A labeled nucleic acid probe that can bind to the signal compound when the article or substance is genuine is brought into contact with a region that can be occupied by the signal compound and whether this probe hybridizes with the signal compound in this region. A determination method is disclosed (see Patent Document 2).

However, the purpose of these detection systems is to determine the authenticity of the article, and it is premised that the article labeling process is performed during or after the manufacture. In addition, a uniform label type is added to all standard products or lots, and this information is analyzed by a uniform sensor, which is suitable for preventing the mixing of clinical specimens and experimental samples that require individualization. Absent.

An automated analyzer that performs qualitative and quantitative analysis of each component of specimens collected from multiple people as a measure to prevent clinical test mistakes, puts the sample (specimen) in a container, and uses the sample container as an automatic analyzer. Generally, analysis is performed by setting. At this time, an ID using an information recording medium such as a barcode is assigned to each sample container in order to identify which person (or what kind of sample (serum, urine, etc.) is contained in a certain sample container. According to this method, the occurrence of mistakes in which a person who has an abnormality in a specific component of a sample is judged to be normal is reduced due to a sample mistake. In addition, it is possible to save the trouble of registering the sample information in the automatic analyzer, and the technology for automatically reading the barcode attached to the container in the automatic analyzer is described in Patent Document 3, for example. ing.

  However, the sample mix prevention system is effective only for tests in which qualitative / quantitative analysis is completely automated. There is a possibility that confusion will occur.

Patent Publication 2005-226187 WO8707063 Japanese Examined Patent Publication No. 6-64070 Hall, JG et al. PNAS June 18, 2000 No.97, paragraphs 8272-8277 Wakai, J et al. Nucleic Acids Res. 2004 32 (18) E141

The present invention has been made to solve the above-described problems of the prior art. When a manual process is included during an analysis operation of a clinical specimen or an experimental specimen, the sample (clinical specimen or experimental specimen) is mistaken. It is an object of the present invention to provide a method and a tool for preventing the problem.

  As a result of intensive studies to solve the above problems, the present inventor mixed a label nucleic acid with a clinical specimen or an experimental sample, and detected the mixed label nucleic acid during the analysis process to confirm whether the sample was mixed up. As a result, it was found that sample mix-up can be prevented, and the label nucleic acid of the present invention was invented.

That is, this invention provides the label nucleic acid of the following (1)-(22), and the label | marker and identification method using this label nucleic acid.
(1) A labeled nucleic acid comprising one or more kinds of nucleic acids and used for preventing a clinical specimen or an experimental sample from being mixed.
(2) The labeled nucleic acid according to (1) above, wherein the nucleic acid is encapsulated in a microcapsule.
(3) The labeled nucleic acid according to (1) or (2) above, wherein the nucleic acid is 10 to 150 mer.
(4) The nucleic acid is labeled with one or more labels selected from the group consisting of a fluorescent label, a radioisotope label, an electrochemical label, an affinity label, and an epitope label. (3) The labeled nucleic acid according to any one of (3).
(5) The labeled nucleic acid according to any one of (1) to (4) above, comprising two or more nucleic acids.
(6) The labeled nucleic acid according to any one of (1) to (5), wherein the nucleic acid is any one of DNA, RNA, and PNA.
(7) The labeled nucleic acid according to any one of (1) to (6) above, wherein the nucleic acid is modified with a protecting group.
(8) The labeled nucleic acid according to any one of the above (1) to (7), wherein an inhibitor of a nucleolytic enzyme is further mixed.
(9) A set of labeled nucleic acids according to any one of (1) to (8) above, wherein the sequences of the nucleic acids contained in the respective label nucleic acids are different from each other.
(10) A kit comprising the label nucleic acid set according to (9) above, and an invader oligo, a probe, a fret cassette, and a chestnut enzyme for identifying each label nucleic acid by an invader method.

(11) A labeling method for preventing a clinical specimen or an experimental sample from being mixed, wherein the label nucleic acid according to any one of (1) to (8) is mixed with the clinical specimen or the experimental sample. Labeling method.
(12) An identification method for preventing a clinical specimen or experimental material from being mixed, comprising the step of mixing the clinical sample or experimental material with the label nucleic acid according to any one of (1) to (8) above, And a step of detecting the nucleic acid from a clinical specimen or experimental material mixed with the nucleic acid.
(13) The identification method according to (12) above, wherein the label nucleic acid is detected by the same method as the method for analyzing a clinical specimen or an experimental sample.
(14) The identification method according to (12) above, wherein in the step of detecting the nucleic acid, an invader method is used. (15) In the step of detecting the nucleic acid, fluorescence detection, spectrophotometric detection, radiation detection The identification method according to (12) above, wherein one or more detection methods selected from the group consisting of electrochemical detection and immunological detection are used.
(16) In the step of detecting the nucleic acid, a double-stranded molecule generated by hybridization of the nucleic acid and the second nucleic acid is selectively detected using a second nucleic acid having a sequence complementary to the nucleic acid. The identification method according to (12) above, wherein the method is used.
(17) One or more detection methods selected from the group consisting of fluorescence detection, color development detection, luminescence detection, spectrophotometric detection, and electrochemical detection are used for the detection of the double-stranded molecule generated by the hybridization. The identification method according to (16) above, characterized by:
(18) The above-mentioned double-stranded molecule is labeled with one or more labels selected from the group consisting of a fluorescent label, a radioisotope label, an electrochemical label, an affinity label and an epitope label (17) ) Identification method.
(19) An identification method for preventing a clinical specimen or experimental material from being mixed, which includes the following steps:
a) mixing the labeled nucleic acid according to any one of claims 1 to 8 into a clinical specimen or an experimental sample;
b) performing an amplification reaction of the labeled nucleic acid;
c) detecting the product of the amplification reaction;
d) Analyze the result of the detection and confirm whether there is any mistake in the specimen or sample.
(20) The identification method according to (19) above, wherein the amplification reaction is one amplification method selected from the group consisting of PCR, LAMP, and ICAN.
(21) The product of the amplification reaction is detected by one or more detection methods selected from the group consisting of fluorescence detection, spectrophotometric detection, radiation detection, electrophoresis, electrochemical detection, and immunological detection. The identification method according to (19) or (20) above, wherein
(22) The identification method according to any one of (19) to (21) above, wherein an invader method is used in detecting the product of the amplification reaction.

  According to the present invention, it is possible to reduce mistakes in sample and sample mistakes that may occur in clinical sites and biolabs. In addition, if the same method as the method for analyzing clinical samples and experimental samples is used as the method for detecting the labeled nucleic acid, not only can mistakes be reduced, but the detection of the labeled nucleic acid can be used as a positive control. And whether the analysis of the sample is performed normally.

The label nucleic acid of the present invention contains one or more kinds of nucleic acids, mixed with clinical specimens and experimental samples, and detected in the process of analysis by the known method, the sample nucleic acid is mixed. It is possible to check whether there is any.
As the nucleic acid, DNA, RNA, or PNA (peptide nucleic acid) can be used, and a single-stranded nucleic acid or a double-stranded nucleic acid can be used.
The nucleic acid contained in the label nucleic acid of the present invention is usually one kind of nucleic acid, but two or more kinds of nucleic acids having different sequences from each other can be contained. It can also be used by mixing with a sample. When two kinds of nucleic acids are included in the label nucleic acid, the reliability can be improved more than when one kind of nucleic acid is used by detecting each of the two kinds of mixed nucleic acids. it can.
The length of the nucleic acid is preferably 10 to 150 mer, more preferably 18 to 130 mer, from the viewpoints of nucleic acid stability and ease of detection.

The nucleic acid contained in the label nucleic acid of the present invention can be obtained by chemically or enzymatically synthesizing or degrading DNA extracted from a natural product.
Examples of the chemical synthesis method include a solid phase synthesis method and a liquid phase synthesis method. The solid phase synthesis method is a method of chemically synthesizing DNA by a phosphoamidite method, a phosphotriester method, or the like on a support such as a resin, glass bead, or chip. For example, when DNA is synthesized by the phosphoramidite method, the phosphoramidite corresponding to the first base in the oligonucleotide sequence is bound to the surface of the carrier particle, which is a solid phase, via an active group such as an amino group. The phosphoramidite trityl group is eliminated (detrityl) to expose the hydroxyl group, and then the phosphoramidite corresponding to the base to be bound is condensed with the exposed hydroxyl group. In this method, DNA is synthesized by repeating the condensation reaction. In the liquid phase synthesis method, each time a condensation reaction is performed, a reaction product is isolated and produced, and the next nucleotide is condensed.
Examples of the enzymatic synthesis method include a PCR method in which a desired portion of the template DNA is amplified by raising and lowering the temperature of a reaction solution containing a heat-resistant DNA polymerase, a pair of primers, and the template DNA. Alternatively, RNA can be synthesized from DNA by RNA polymerase, and conversely, DNA can be synthesized from RNA by reverse transcriptase.
As a method for obtaining a nucleic acid used in the present invention by degrading DNA extracted from a natural product, animal cells, plant cells, mitochondria, chloroplasts, bacteria, viruses, etc. are used, and after deproteinization treatment, A method of purifying DNA or RNA and decomposing it with a chemical reagent such as a restriction enzyme, ribozyme, or dimethyl sulfate is mentioned.
When PNA (peptide nucleic acid) is used for the label nucleic acid of the present invention, peptide nucleic acid can be synthesized by using the peptide nucleic acid monomer by the Fmoc method or tBoc method, which is a normal peptide synthesis method.

The label nucleic acid of the present invention may be a nucleic acid encapsulated in a microcapsule. By encapsulating the nucleic acid in a microcapsule, the labeled nucleic acid can be stored for a long time. For example, the nucleic acid can be encapsulated in the microcapsule by dispersing the nucleic acid in a suitable solvent and forming a capsule wall or gelling the monomer and prepolymer on the surface thereof. Examples of the capsule wall and gel include gelatin, polyamide, polyester, and polyurea. Examples of the method for encapsulating the nucleic acid in the microcapsule include an underwater drying method, an interfacial polymerization method, a coacervation method, a melt dispersion cooling method, a submerged cured coating method, and the like.
The underwater drying method utilizes a phenomenon in which a polymer is solidified in water to form a wall, and an aqueous solution in which nucleic acid is dissolved is dispersed in an organic solvent in which the polymer is dissolved to form a W / O type primary emulsion. Prepare and pour it into warm water under stirring to prepare a secondary emulsion of (W / O) / W, and finally enclose the nucleic acid in microcapsules by evaporating the solvent under reduced pressure in a stable dispersion state can do.
When detecting the label nucleic acid encapsulated in the microcapsule, the microcapsule can be broken by heating or pressurizing.

The nucleic acid contained in the label nucleic acid of the present invention may be a nucleic acid labeled. Examples of labels for nucleic acids include fluorescent labels, radioisotope labels, electrochemical labels, affinity labels, and epitope labels.
In the present invention, the fluorescent label is a label with a substance having a chemical structure that emits fluorescence, and examples thereof include a label with fluorescein, rhodamine, resorufin, coumarin, Cy3-dUTP, Cy5-dUTP (Amersham Pharmacia Biotech) and the like. It is done. In the present invention, the radioisotope label is a label with a radioisotope that emits radiation by itself, and for example, a radioisotope of carbon or phosphorus can be used as the label. In the present invention, the electrochemical label is a label with an electrochemically active substance, and examples thereof include labels with ferrocene, ferricyanide, metal bipyridine complex and the like. In the present invention, the affinity label refers to a label with a chemical substance having affinity with a specific other chemical substance, and examples thereof include a label with biotin, avidin, GST (glutathione-S-transferase) and the like. Epitope labeling refers to labeling with a substance that becomes an antigen recognized by an antibody. For example, it can be labeled with a compound or protein that becomes an antigen.
These labels are used to detect nucleic acids mixed in a sample (clinical specimen or experimental specimen). That is, fluorescence detection, radiation detection, electrochemical detection, immunological detection, and the like can be performed using these labels. When a nucleic acid is labeled with an affinity label, another label such as an enzyme label can be bound via this affinity label, and the nucleic acid can also be detected with an enzyme label or the like. Examples of enzyme labels include horseradish peroxidase (HRP), alkaline phosphatase (ALP or AP), beta-galactosidase (GAL), firefly luciferase and glucose oxidase (GO).

  The nucleic acid contained in the label nucleic acid of the present invention may be modified with a protecting group. Any protecting group may be used as long as it has a chemical structure different from that of a natural nucleic acid by binding to a nucleic acid molecule. Examples of the protecting group include a protecting group having a trityl skeleton, an acyl skeleton, a carbamate skeleton, and an amidine skeleton. As a result, the nucleic acid contained in the label nucleic acid can be protected and prevented from being degraded by the nucleolytic enzyme.

In addition to the above, the label nucleic acid of the present invention contains substances other than nucleic acids, such as buffers for stably storing nucleic acids, nucleolytic enzyme inhibitors, UV absorbers, UV confusing agents, antioxidants, and preservatives. Or can be mixed.
When a label nucleic acid is added to a specimen or sample, it may be degraded by a nucleolytic enzyme contained in the specimen or sample, and therefore it is particularly preferable to mix a nucleolytic enzyme inhibitor. Inhibitors of nucleolytic enzymes include EDTA, RNase and DNase inhibitors, which are inhibitors of nucleases in general, tetrachloroauric acid, an inhibitor of exonuclease III, and PCMB (p-chloromercuribenzoic acid). Can be mentioned.
Alternatively, the nucleic acid may interact with other substances, such as a polyion complex compound of a nucleic acid / cationic surfactant by reacting with a cationic surfactant having an acidic group.

The invention also provides a set of labeled nucleic acids that are mixed into multiple samples and used to identify each sample. The nucleic acids contained in each label nucleic acid in the set of label nucleic acids of the present invention must be different in sequence from each other so that they can be distinguished. Preferably, each nucleic acid is contained in all other label nucleic acids. It is preferably a set of labeled nucleic acids that have 90% or less homology with the nucleic acids. Here, the sequences being different from each other so that they can be distinguished include cases where only the lengths of the nucleic acids are different.
The kit comprising the label nucleic acid set of the present invention and the label nucleic acid set and reagents for detecting the label nucleic acid provides a highly convenient tool for identifying a plurality of samples.

The labeled nucleic acid of the present invention can be mixed with a clinical specimen or an experimental sample to label the sample in order to prevent a mistake that may occur during the analysis process. By detecting the labeled nucleic acid of the invention, the sample can be identified.
FIG. 1 shows an example of labeling and identification of a clinical specimen or an experimental sample with the label nucleic acid of the present invention. First, a clinical specimen or an experimental sample (01) is collected. Next, the label nucleic acid is mixed before the analysis operation of the clinical specimen or the experimental sample is started or during the analysis operation. It is preferable to mix the labeled nucleic acids before manual operation that is likely to be mistaken in the analysis operation. And it records so that the relationship between the various labeled nucleic acids mixed and the specimen or sample can be clarified later.
It is possible to identify the sample / sample by obtaining information on the label nucleic acid by mixing one or more specific types of nucleic acid label 02 with one clinical sample or experimental sample and detecting the label nucleic acid. It is. The detection of the label nucleic acid can be performed before the analysis, simultaneously with the analysis, or after the analysis.

Examples of the method for detecting the label nucleic acid of the present invention include fluorescence detection, spectrophotometric detection, radiation detection, electrochemical detection, immunological detection, and detection by hybridization. In order to use these detection methods, the label nucleic acid may be labeled in advance. Further, when the mixed label nucleic acid is not in an amount sufficient for detection, a method of amplifying the nucleic acid contained in the label nucleic acid and detecting the amplified nucleic acid may be used. Examples of the method for amplifying nucleic acid include PCR, LAMP, ICAN method and the like.
The LAMP method is a method of amplifying a nucleic acid isothermally using a strand displacement reaction. By designing four types of primers, a loop structure is created at the primer binding site of the first amplification product. Since the loop part has a single-stranded structure, the next primer can anneal and the extension reaction proceeds. Finally, an amplification product that is an integral multiple of the length of the original target sequence accumulates, and it can be confirmed whether the template has increased by observing the cloudiness of the reaction solution (Natomi et al., 2000, Nucleic Acids Res , 28 (12), E63).
The ICAN method is a method of amplifying a gene isothermally using a chimeric primer of DNA and RNA. When the chimeric primer binds to the template, a complementary strand is synthesized by DNA polymerase, and then RNase H cleaves the RNA portion of the chimeric primer and performs an extension reaction with a strand displacement reaction from the cleaved portion. By repeating this cycle, the gene can be amplified (Japanese Patent No. 3433929).

In detecting the label nucleic acid of the present invention, detection may be performed by a method that amplifies the detection signal. For example, when the invader method is used, the reaction proceeds continuously and the fluorescence signal is detected only by carrying out the reaction at an isothermal temperature. Therefore, it is possible to detect without using an amplification reaction such as PCR. Alternatively, the nucleic acid to be detected can be labeled with an enzyme, and the reaction with the enzyme can be continuously performed to amplify the signal.
In detection of a labeled nucleic acid using the invader method (see [Non-Patent Document 1]), a non-fluorescently labeled invader oligo and probe, and a fluorescently labeled fret cassette are used.
The invader oligo is composed of nucleotides having a base sequence complementary to the label nucleic acid. On the other hand, a probe consists of a nucleotide having a base sequence unrelated to the label nucleic acid and a sequence complementary to the label nucleic acid. Here, the flap is disposed on the 5 ′ side of the probe. Then, the invader oligo and the probe are designed so that when the label nucleic acid, the invader oligo and the probe are hybridized, a triple chain is formed at the 3 ′ end of the invader oligo.
When the label nucleic acid, the invader oligo and the probe are hybridized to form a triple chain, the base enzyme recognizes this triple chain and cleaves the probe on the 3 ′ side of the triple chain. As a result, a flap free body consisting of the flap and the next base is generated.
The fret cassette has a sequence that can form a loop by hybridization with itself on the 5 ′ end side, and has a nucleotide complementary to the flap educt on the 3 ′ end side from the hybridizing portion. In addition, the fret cassette has a fluorescent dye and a quencher (luminescence suppressor) adjoining to each other, and the fluorescence of the fluorescent dye is suppressed by the quencher.
When the flap educt is hybridized to such a fret cassette, a triple chain is again formed at the 3 'end of the flap educt. As a result, the above-mentioned chestnut base enzyme recognizes the triple chain again, and the 5 'end of the fret cassette is cleaved. As a result, the fluorescent dye and the quencher are released and fluorescence is generated. The label nucleic acid is detected by the fluorescence generated in this series of invader reactions.

An example of the label nucleic acid detection method of the present invention will be described in more detail with reference to FIG.
Case 1 is a case where the labeled nucleic acid to be mixed with the clinical specimen or experimental sample (FIG. 2, 01) is an unlabeled nucleic acid (FIG. 2, 02) and is detected without an amplification reaction. In this case, the presence of this labeled nucleic acid can be detected by, for example, mass spectrometry. In addition, a molecule that is mixed with a second nucleic acid molecule having a complementary sequence (FIG. 2, 03) and completely or partially double-stranded can be detected by using, for example, electrophoresis. Is possible. In the electrophoresis method (FIGS. 2 and 04), the double-stranded nucleic acid 05 and the single-stranded nucleic acid molecule 06 have different migration distances, so the double-stranded strand after hybridization of the label nucleic acid 02 and the molecule 03 having a complementary sequence thereto. The band 05 of the molecule can be distinguished from the single-stranded band 06 of other labeled nucleic acids that cannot hybridize to complementary sequences.

In the case 1, the labeled nucleic acid can also be detected by the invader method. Specifically, in the invader method using a base enzyme, label nucleic acid, invader oligo and probe are hybridized, and the 3 ′ end of the upstream invader probe is located at the 5 ′ end of the region where the downstream signal probe is bound to the label nucleic acid. Intrusion shape occurs. The DNA enzyme that is a DNA endonuclease recognizes this triple-stranded structure and cleaves the portion of the downstream signal probe that has a triple-stranded structure. This cleavage dissociates the 5 'end of the probe consisting of several to dozens of bases (flap free form), and this binds to the 3' end of the fret cassette where the 5 'end forms a loop structure. invade. Chrybase enzyme recognizes this structure and cleaves the 5 'end of the fret cassette. It becomes possible to detect a fluorescent modifying group in which fluorescence generation is inhibited by FRET (Fluorescence resonance energy transfer) by cleavage.
When the fluorescence is close to FRET, the excited electrons of the fluorescent dye (donor) may move and the excited state of the adjacent fluorescent dye (acceptor) may change. This is a phenomenon in which fluorescence is weakened. By using a non-fluorescent quencher as the acceptor fluorescent dye, the fluorescence intensity can be temporarily suppressed.

Case 2 in FIG. 2 is a case where the label nucleic acid mixed with the clinical specimen or the experimental sample (FIG. 2, 01) is a labeled nucleic acid (FIG. 2, 07), and is detected without an amplification reaction. In this case, the labeled nucleic acid alone is labeled with a specific combination of, for example, a specific fluorescent dye or a plurality of fluorescent dyes. For example, these labeled nucleic acids are concentrated by electrophoresis (FIG. 2, 08). By using a scanner or the like that can detect the dye, it is possible to distinguish the target labeled nucleic acid (FIG. 2, 09) from other labeled nucleic acids (FIG. 2, 10).
In case 2 above, the amplification reaction of the labeled nucleic acid does not occur, but the label signal is amplified by using, for example, an antibody that binds to the label signal, and this antibody is labeled with, for example, Horseradish peroxidase enzyme or Alkaline phosphatase. It is also possible that the final signal is amplified.

In case 3 in FIG. 2, the labeled nucleic acid mixed with the clinical specimen or the experimental sample (FIG. 2, 01) is a low concentration unlabeled nucleic acid (FIG. 2, 11) and can be detected by performing an amplification reaction. This is the case. In order to amplify the labeled nucleic acid, it is possible to use a PCR method, a LAMP method, or an ICAN method as a reaction using a specific primer.
In order to detect the amplified product (FIGS. 2 and 12), electrophoresis, mass spectrometry, or a detection method using a fluorescent dye or an intercalator having electrochemical activity can be used. For example, in the electrophoresis method (FIGS. 2 and 13), the initial added label DNA amount is below the detection sensitivity, but it can be detected as a band (FIGS. 2 and 14) by amplifying the nucleic acid.
In the case 3, the labeled nucleic acid can also be detected by the invader method. Specifically, in the invader method using a base enzyme, a label nucleic acid, an invader oligo and a probe are hybridized, and the 3 ′ end of the upstream invader oligo is located at the 5 ′ end of the region where the downstream signal probe is bound to the label nucleic acid. Intrusion shape occurs. The DNA enzyme that is a DNA endonuclease recognizes this triple-stranded structure and cleaves the portion of the downstream signal probe that has a triple-stranded structure. This cleavage dissociates the 5 'end of the probe consisting of several to dozens of bases (flap free form), and this binds to the 3' end of the fret cassette where the 5 'end forms a loop structure. invade. Chrybase enzyme recognizes this structure and cleaves the 5 'end of the fret cassette. It becomes possible to detect a fluorescent modifying group in which fluorescence generation is inhibited by FRET (Fluorescence resonance energy transfer) by cleavage.

EXAMPLES Hereinafter, although an Example demonstrates this invention, this invention is not limited to these forms.
In Example 1 described below, unlabeled label nucleic acid was mixed with genomic DNA, and this label nucleic acid was detected by measuring the fluorescence intensity of by-products generated by the invader reaction. No label nucleic acid amplification reaction has occurred. As a result, it was possible to specify a sample mixed with a specific label nucleic acid.
In Example 2 below, biotin-labeled nucleic acid was mixed with genomic DNA, and this mixture was hybridized with a probe nucleic acid immobilized on a gold electrode. Furthermore, streptavidin modified with alkaline phosphatase was bound to biotin, and a by-product generated by alkaline phosphatase activity was detected by electrochemical reaction. Therefore, it is possible to specify a sample mixed with a specific label nucleic acid.
In Example 3 below, unlabeled label nucleic acid was mixed with genomic DNA, and this labeled nucleic acid was detected by measuring the fluorescence intensity of by-products generated by PCR amplification and invader reaction of the labeled nucleic acid. Finally, it was possible to identify a sample that had been mixed with a specific nucleic acid label.

In Example 1, unlabeled label nucleic acid (DNA) was detected without an amplification reaction. Purified commercial genomic DNA (Coriell DNA bank, USA) Cat. No. NA17247, NA17252 and NA17266 were added with TAS-1-Ta, TAS-2-Ta and BCR-ABL-labeled nucleic acid (DNA), respectively, and these were added by invader reaction. It was verified whether or not identification was possible. The reason why the invader reaction was selected as the detection method is that the single nucleotide polymorphism has high discrimination ability. Label nucleic acid (DNA) was mixed at a ratio of 100 fmol or 10 fmol per 5 ng of genomic DNA, and an invader reaction was performed with the following reaction composition and conditions:

Reaction composition: Label nucleic acid (DNA) (100,10fmol / ul) 1ul
Genomic DNA (5ng / ul) 1ul
10x Invader buffer 1ul
10x Invader Oligomix 1 or 2 1ul
40x Invader enzyme 0.25ul
Distilled water 5.75ul

10x Invader Buffer, 10x Invader Oligomix 1 and 2, 40x Invader Enzyme, etc. are available from Third Wave Technologies, Inc., Madison, Wisconsin, USA. (Hereinafter referred to as TWT). 10x Invader Oligomix 1 and 2 are reagents that contain optimized oligonucleotide combinations to detect 101 and 102 sequences, respectively.
The base sequence of each labeled nucleic acid (DNA) is as follows.
TAS-1-Ta 101:
TGATGCTGAGACACAGCAGCACACAATCACTGTTGCTCAGTGCCTGCCTCTTCACTACATCCCAAAAATTCACCAAGAAAACGAAGGCATTGGTC
TAS-2-Ta:
TCGCGCCACAGAATCAGTAGGGGCACAGAGATGAAGGCAGCACAGGATGATATCACAAAGAAGCAGAAAAAGGAGACAAGAGACTTGAGGGCTT
BCR-ABL:
CCCTTCAGCGGCCAGCCTGAGGCTCAAAGTCAGATGCTACTGGCCGCTGAAGGGCTTTTGAACTCTGCTTAAATCCAGTGGCTGAGTGGACGATGACATTCAGAAACCCATA
Reaction conditions: After heat denaturation at 95 ° C. for 10 minutes, an invader reaction at 63 ° C. for 2 minutes was performed and cooled to 10 ° C. Fluorescence intensity of the resulting fluorescence response was measured with a TECAN Infinite Reader machine.

The result is shown in FIG. When Oligomix 1 was used (upper graph), the invader reaction occurred only in the NA17247 DNA sample in which TAS-1-Ta was normally mixed, and the fluorescence intensity could be distinguished from other samples. When Oligomix 2 was used (lower graph), the invader reaction occurred only in the NT17252 DNA sample in which TAS-2-Ta was normally mixed, and the fluorescence intensity was distinguishable from other samples. In the NT17266 DNA sample in which BCR-ABL labeled nucleic acids that did not react with Oligomix 1 and 2 were mixed, no increase in fluorescence value was observed in both oligomixes.

In Example 2, labeled label nucleic acid (DNA) was detected without an amplification reaction. For every 5 ng of a purified genome commercially available (Roche, Human Genomic DNA, Cat. No. 11-691-001), mix so that the labeled nucleic acid (DNA) ST-W1499-Bio is 300 fmol or 100 fmol. Detected by electrochemical method. Non-biotinylated labeled nucleic acid BCR-ABL was used as a control, and the total amount of labeled nucleic acid was adjusted to be a constant 300 fmol / 5 ng genomic DNA.
Using the method reported by Wakai et al. (2004), the probe DNA (HS-27W-1499) was immobilized on a gold electrode, and 5 mM potassium ferricyanide was used as the electrolyte, and a differential pulse voltan with respect to the Ag / AgCl reference electrode. The initial electrochemical activity value (I0) was measured by the metric (DPV) method. Wash the gold electrode with distilled water, add 1 μl of labeled DNA mixed with genomic DNA in the presence of 2 × SSC (0.3 M NaCl, 0.03 M Sodium Citrate) salt / electrode, and let stand at room temperature for 15 minutes for hybridization. went. After washing twice with 2 × SSC and removing moisture with nitrogen gas, 1 μl / electrode addition of 20 ng / μl of streptavidin-modified alkaline phosphatase (Roche, Cat. No. 1-681-451) dissolved in 2 × SSC And allowed to stand at room temperature for 30 minutes to carry out a biotin-streptavidin binding reaction. After washing once with 2 × SSC, 50 μl of alkaline phosphatase substrate NBT / BCIP (Roche, Cat. No. 11-093-266-910) was added dropwise and allowed to stand at room temperature for 30 minutes for phosphorylation. Reaction was performed. The phosphorylated substrate precipitated and accumulated on the gold electrode surface. An electrochemical reaction was performed again using 5 mM potassium ferricyanide as an electrolyte, and the obtained current value (I1) was analyzed for the variation rate (ΔI) by the I0 current value and the following calculation formula to measure biotin present on the electrode surface:
Formula 01: ΔI = (I1−I0) × 100 (%)
I0
The base sequences of the labeled nucleic acid (ST-W1499-Bio) and probe DNA (HS-27W-1499) are as follows.
HS-27W-1499:
(HS) -GCAGCAGCAGCGGGAGCTATATTGTTTATCTTGAAACC
ST-W1499-Bio:
TAGCTTCCTCCCTGCAGCAGGGAGACCTGCAGGACACTAAAGAAAACCAGGGAGGAAGCTAGGTTTCAAGATAAACAATATAGCTCCCATCACACAGCTG-Bio
The larger the fluctuation rate (ΔI) of the current value, the more negative the gold surface. Therefore, the more the biotinylated label DNA bound to the probe DNA on the gold surface, the greater the decrease rate of the current value and the negative ΔI.
The results of Example 2 are shown in FIG. In the label DNA mixed with the genomic DNA, the higher the concentration of the biotin-labeled label DNA, the smaller ΔI and the correlation was obtained. Therefore, it is possible to detect the labeled label DNA.

Example 3 is an example of Case 3 in which detection is possible by mixing a low-concentration label nucleic acid with a clinical specimen or an experimental sample and performing an amplification reaction thereof. Purified commercial genomic DNA (Coriell DNA bank, USA) Cat. No. NA17247, NA17252, and NA17266 were added with TAS-1-Ta, TAS-2-Ta, and BCR-ABL labeled DNA, respectively, and PCR and invader reaction were used to add these. It was verified whether identification was possible. The reason why PCR and invader reaction were selected as detection methods is that single nucleotide polymorphisms have high discrimination ability using low-concentration nucleic acids as templates. Label DNA was mixed at a ratio of 100 amol / 5 ng genomic DNA, and an invader reaction was performed with the following reaction composition and conditions:

Reaction composition: Label DNA (100amol / ul) 1ul
Genomic DNA (5ng / ul) 1ul
10x Invader buffer 1ul
10x Invader Oligomix 1 or 2 1ul
40x enzyme mix 0.25ul
Distilled water 5.75ul

10x Invader Buffer, 10x Invader Oligomix 1 and 2, 40x Enzyme Mix, etc. are available from Third Wave Technologies, Inc., Madison, Wisconsin, USA. (Hereinafter referred to as TWT). 10x Invader Oligomix 1 and 2 are reagents that contain optimized oligonucleotide combinations to detect 101 and 102 sequences, respectively.

  Reaction conditions: After heat denaturation at 95 ° C. for 10 minutes, an amplification cycle of 95 ° C. for 15 seconds → 72 ° C. for 45 seconds was repeated 35 times. The amplification enzyme DNA polymerase contained in the enzyme mix was inactivated by heat treatment at 95 ° C. for 10 minutes, and an invader reaction was performed at 63 ° C. for 2 minutes, followed by cooling to 10 ° C. Fluorescence intensity of the resulting fluorescence response was measured with a TECAN Infinite Reader machine.

The result is shown in FIG. When Oligomix 1 was used (upper graph), amplification and invader reaction occurred only in the NA17247 DNA sample in which TAS1-Ta was normally mixed, and the fluorescence intensity was distinguishable from other samples. Further, when Oligomix 2 was used (lower graph), amplification and invader reaction occurred only in the NA17252 DNA sample in which TAS2-Ta was normally mixed, and the fluorescence intensity could be distinguished from other samples. In the NT17266 DNA sample in which BCR-ABL labeled nucleic acids that did not react with Oligomix 1 and 2 were mixed, no increase in fluorescence value was observed.
The amount of the labeled nucleic acid used in this example was 1/100 to 1000 times that of Example 1.
Moreover, the electrophoresis analysis of the PCR product obtained in Example 3 was performed, and the result is shown in FIG. The band corresponding to the amplification product using the labeled nucleic acid as a template was detected only when the TAS-1 amplification reaction composition was used for NA17247 genomic DNA and the TAS-2 amplification reaction composition was used for NA17252 genomic DNA.

The present invention is useful as a tool for preventing the mixing of clinical specimens or experimental samples.

Image of system using nucleic acid label Schematic diagram showing the label nucleic acid detection method used to prevent clinical specimens or experimental samples from being mixed Diagram of fluorescence intensity measurement of invader reaction showing the result of Example 1 The figure of the current value fluctuation measurement of the electrochemical reaction which shows the result of Example 2 Diagram of fluorescence intensity measurement of amplification and invader reaction showing the results of Example 3 Diagram of electrophoretogram showing results of Example 3

Explanation of symbols

01: Clinical specimen or experimental sample
02: Label nucleic acid 03: Hybridization product with a complementary sequence-owning oligonucleotide for detecting a label nucleic acid 04: Electrophoresis gel 05 for detecting a hybridization sample 05: Hybridization product of a labeled nucleic acid and a complementary sequence-owning oligonucleotide for detection Detected object 06: Only the labeled nucleic acid after analysis when there is no oligonucleotide having a complementary sequence for detection 07: Labeled label nucleic acid 08: Electrophoresis gel for detecting the labeled nucleic acid 09: Target labeled label nucleic acid 10: Non-target label Label nucleic acid 11: Low-concentration label nucleic acid 12: Label nucleic acid after amplification reaction 13: Electrophoresis gel 14 for detecting amplification reaction product 14: Amplification product

Claims (22)

A labeled nucleic acid comprising one or more kinds of nucleic acids and used for preventing a clinical specimen or an experimental sample from being mixed. The label nucleic acid according to claim 1, wherein the nucleic acid is encapsulated in a microcapsule. The labeled nucleic acid according to claim 1 or 2, wherein the nucleic acid is 10 to 150 mer. The nucleic acid is labeled with one or more labels selected from the group consisting of a fluorescent label, a radioisotope label, an electrochemical label, an affinity label, and an epitope label. The labeled nucleic acid according to 1. The labeled nucleic acid according to any one of claims 1 to 4, comprising two or more nucleic acids. The labeled nucleic acid according to any one of claims 1 to 5, wherein the nucleic acid is any one of DNA, RNA, and PNA. The labeled nucleic acid according to claim 1, wherein the nucleic acid is modified with a protecting group. Furthermore, the inhibitor of a nucleolytic enzyme is mixed, The labeled nucleic acid in any one of Claims 1-7 characterized by the above-mentioned. The set of label nucleic acids according to any one of claims 1 to 8, wherein the sequences of the nucleic acids contained in the respective label nucleic acids are different from each other. A kit comprising the label nucleic acid set according to claim 9 and an invader oligo, a probe, a fret cassette, and a chestnut enzyme for identifying each label nucleic acid by an invader method. A labeling method for preventing a clinical specimen or an experimental sample from being mixed, wherein the label nucleic acid according to any one of claims 1 to 8 is mixed with the clinical specimen or the experimental sample. An identification method for preventing a clinical specimen or experimental material from being mixed, comprising the step of mixing the label nucleic acid according to any one of claims 1 to 8 with the clinical specimen or experimental material, and a clinical where the nucleic acid is mixed And a step of detecting the nucleic acid from a specimen or experimental material. 13. The identification method according to claim 12, wherein the labeled nucleic acid is detected by the same method as the analysis method of a clinical specimen or an experimental sample. The identification method according to claim 12, wherein an invader method is used in the step of detecting the nucleic acid. The method for detecting nucleic acid uses at least one detection method selected from the group consisting of fluorescence detection, spectrophotometric detection, radiation detection, electrochemical detection, and immunological detection. Identification method of description. In the step of detecting the nucleic acid, a method is used in which a second nucleic acid having a sequence complementary to the nucleic acid is used to selectively detect a double-stranded molecule generated by hybridization of the nucleic acid and the second nucleic acid. The identification method according to claim 12, wherein: The detection of the double-stranded molecule generated by the hybridization uses one or more detection methods selected from the group consisting of fluorescence detection, color detection, luminescence detection, spectrophotometric detection, and electrochemical detection. The identification method according to claim 16. 18. The double-stranded molecule is labeled with one or more labels selected from the group consisting of a fluorescent label, a radioisotope label, an electrochemical label, an affinity label, and an epitope label. Identification method. An identification method for preventing a clinical specimen or experimental material from being mixed, comprising the following steps:
a) mixing the labeled nucleic acid according to any one of claims 1 to 8 into a clinical specimen or an experimental sample;
b) performing an amplification reaction of the labeled nucleic acid;
c) detecting the product of the amplification reaction;
d) Analyze the result of the detection and confirm whether there is any mistake in the specimen or sample. The identification method according to claim 19, wherein the amplification reaction is one amplification method selected from the group consisting of PCR, LAMP, and ICAN. The product of the amplification reaction is detected by one or more detection methods selected from the group consisting of fluorescence detection, spectrophotometric detection, radiation detection, electrophoresis, electrochemical detection and immunological detection. The identification method according to claim 19 or 20. The identification method according to any one of claims 19 to 21, wherein an invader method is used in detection of a product of the amplification reaction.