JP2002543792A - Supply and integration of transposon sequences by vector - Google Patents

Abstract

SUMMARY OF THE INVENTION The present invention relates to transposons, preferably transposons, and transposase-encoding nucleotide sequences, most preferably transposons, transposase-encoding nucleotide sequences, and transposase expression. And a nucleotide sequence encoding a polypeptide that regulates the expression of a non-integrated viral vector, preferably a non-integrated viral vector. Methods for using this non-integrating vector are also provided.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001] BACKGROUND vectors of the present invention is directed to a carrier used to introduce genetic material into cells. Vectors are generally classified as viral and non-viral. To date, viral vectors have shown much higher efficiency in gene delivery than the corresponding non-viral vectors. Viral vectors are further divided into those that integrate into the genome of the cell and those that remain unintegrated. Integrative viruses provide stable gene transfer to the progeny of the original target cell. The prototype of an integrating viral vector is a retrovirus. In contrast, non-integrating vectors provide only transient transduction, whether viral or non-viral. This is because the introduced gene is degraded or lost with cell division. Prototypes of non-integratable viral vectors are adenovirus or herpes virus-based. To date, most clinical studies have used retrovirus-based or adenovirus-based non-integrated vectors.

[0002] Retroviral vectors have the advantage of having a long-term effect due to the nature of integration into the host cell genome. However, they are difficult to produce at high titers, most only infect dividing cells, and are relatively unstable and susceptible to inactivation in vivo. As a result, the success of retroviral vectors in gene therapy by direct in vivo gene delivery has been limited; instead, in ex vivo or in vitro systems, typically those using explanted host cells. , More often to succeed. Transgenic cells transfected ex vivo or in vivo can be administered to a patient as a therapy. These methods are potentially useful in therapies involving hematopoietic cells, to a lesser extent muscle cells and hepatocytes, but involve less infectious target tissues or organs, such as the heart, lungs and brain It is not practical in gene therapy.

[0003] Adenovirus-based vectors, in contrast, are easy to produce at high titers, infect dividing and nondividing cells, and are relatively stable, It is efficiently supplied in vivo. A major disadvantage of adenovirus vectors is the limited duration of transgene expression. This is due to the property that these vectors are not replicated, ie, are not integrated into the genome of the cell. This can be problematic because the transgene expression is transient and the adenovirus vector must be re-administered, and typically a neutralizing antibody against the adenovirus capsid protein is made in the animal. is there. Due to the transient expression of the transgene, the use of adenovirus-based vectors is aimed at short-term gene therapy of acute symptoms.

[0004] Transposons are mobile genetic elements that can integrate genes into the host genome. Naturally occurring transposons usually contain a transposase-encoding gene flanked by cis-acting sequences at both ends of the transposon (FIG. 1). The terminal sequence is recognized by the transposase enzyme, which then cuts the entire transposon from its location in the chromosome,
It is then reinserted into another location on the genome ("excise and integrate" mechanism: Figure 1). In theory, the transposon system could be used to integrate the gene of interest into the host genome. This is due to supplying the cell with a gene of interest flanked by essential cis-acting sequences, as well as a functional source of transposase.

[0005] However, most transbosons are species-specific, and in mammals,
No functional nonretroviral transposon system has yet been found. To date, the integration of the gene of interest into the genome of mammalian cells by transposons has been successful in only one case (Ivics et al. Cell 91, 501-510 (1997); WO98 / 40510).
. On the other hand, WO97 / 15679 (Kelly and Wilson) reports that the transgene was successfully integrated into the genome of mammalian cells using an adenovirus incorporating a retrotransposon system. However, with retrotransposons, integration into the genome does not occur until the host cell divides, thus greatly limiting the utility of this method in in vivo gene therapy. To date, there have been no reports of successfully modifying non-integrative viral vectors, such as adenovirus, to have transposon-derived integration capabilities that can function in vertebrate cells.

[0006] In summary e.g. genomic analysis and gene therapy of the present invention, from the point that they can use the nucleic acid delivery system, viral vectors for delivering the nucleic acid to be incorporated in the absence of cell division in cells is desired. Furthermore, the advantages of non-integrated viral vectors, such as those based on adenovirus or herpes simplex virus, call for non-integrated viral vectors that allow for long-term expression of transgenes provided by the vector. The present invention facilitates integration of a heterologous polynucleotide into the genome of a vertebrate, preferably the genome of a mammal, such as a human, mouse, rat, primate, sheep, cow, and pig, most preferably the human genome. To do
It combines the well-known advantages of non-integratable viral vectors with the unique functions of a newly created transposon system, the SB transposase system.

The implications of the present invention for the future of gene therapy are exciting and far-reaching. For example, in the transposon supply vector by this adenovirus, a transposon is used instead of a retrotransposon. When using a retrotransposon, the target cell must be dividing or inducing division in order for the polynucleotide provided by the supply vector to integrate into the genome. In contrast, transposon sequences are integrated into genomic DNA, whether or not the cell is dividing. Here, "genomic DNA" is chromosomal DNA
And both extrachromosomal DNA.

[0008] The addition of integration capabilities to non-integratable viral vectors opens up entirely new therapeutic possibilities. This is because such viruses can be used primarily for applications involving long-term production of polypeptides. In accordance with the present invention, polypeptides are continuously expressed from the genomic DNA of a cell and from the stably integrated coding sequence until the cell dies. Cell genomic DNA
Long-term expression of the polypeptide from the coding sequence incorporated therein is also advantageous because it reduces the need for re-administration of the vector. Furthermore, when the transposon is excised from the vector in the cell, the vector will self-destruct and will therefore be present in the cell for a shorter period of time. This is an advantage. This is because the innate immune mechanism and cytotoxicity derived from the expression of the viral gene reduces the possibility of destroying cells infected with the vector of the present invention.

The present invention relates to a non-integrated polynucleotide comprising a polynucleotide flanked by inverted repeats that bind to a transposase, and a polynucleotide encoding a transposase operably linked to a control sequence containing an operator sequence. Provide the vector. The transposase may be an SB polypeptide having the amino acid sequence of SEQ ID NO: 9 or having an amino acid sequence at least about 80% homologous to the amino acid sequence of SEQ ID NO: 9. Said inverted repeat may comprise the nucleotide sequence of SEQ ID NO: 7 or 8. The inverted repeats described above are represented by SEQ ID NOs: 2 and 3.
, 4 or 5 nucleotide sequences.

[0010] The non-integrated vector may be a non-integrated plasmid vector. Alternatively, the non-integrated vector comprises a non-integrated vector comprising the polynucleotide, the inverted repeat, the polynucleotide encoding the transposase, and a repetitive terminal repeat flanking the combination of control sequences. A type virus vector, for example, an adenovirus-based vector. The adenovirus-based vector may be a helper-dependent adenovirus vector.

[0011] The polynucleotide flanked by inverted repeats may include non-coding sequences. Alternatively, the polynucleotide may include a coding sequence operably linked to a control sequence. Said operator sequence may be a lac operator or a tetracycline response element.

[0012] Optionally, the non-integratable vector may further comprise a polynucleotide encoding a control polypeptide. If the operator sequence comprises a lac operator sequence, the polynucleotide encoding the control polypeptide encodes LacI. Where the operator sequence comprises a tetracycline responsive element, the polynucleotide encoding the control polypeptide encodes a polypeptide that binds under appropriate conditions to the tetracycline responsive element, for example, tTA or rtTA.

[0013] Alternatively, the non-integrative vector alters expression of the polynucleotide flanked by inverted repeats that bind to the transposase, the polynucleotide encoding the transposase, and the polynucleotide encoding the transposase. It may include a polynucleotide encoding a control polypeptide.
A polynucleotide encoding a transposase can be operably linked to a control sequence that includes an operator sequence.

The present invention relates to a method for producing a transgenic cell, comprising transfecting a transgenic cell having a genomic DNA containing a polynucleotide flanked by inverted repeats such that a transposase is expressed in the cell. Provided is a method as described above comprising contacting a cell with a non-integrating vector of the invention for production. In some respects, the polynucleotide encoding the transposase may include an operator sequence. If the operator sequence is a lac operator, transposase expression may include maintaining the absence of the LacI polypeptide in the cell, or adding IPTG to the cell. In some respects, the non-integratable vector further comprises a polynucleotide encoding a control polypeptide, and the control polypeptide binds to the operator sequence under appropriate conditions and encodes a transposase. Regulates polynucleotide expression. For example, if the operator sequence includes a lac operator sequence, the polynucleotide encoding the control polypeptide is
Code LacI. If the operator sequence includes a tetracycline response element, the polynucleotide encoding the control polypeptide is tTA or rtTA
Code. The cells used in the method may be mammalian cells, for example, human cells. The method can be performed in vivo, ex vivo, or in vitro.

The present invention relates to a method for producing a transgenic organism, which comprises transgenic organisms having a genomic DNA containing a polynucleotide flanked by inverted repeats such that the transposase is expressed in the cell. Provided is a method as described above, comprising contacting a cell with a non-integrating vector of the invention for production.

[0016] Another aspect of the invention is a method of altering the phenotype of a cell or organism, comprising a polynucleotide flanked by inverted repeats such that the transposase is expressed in the cell. Contacting the cell with a non-integrating vector of the invention to produce a transgenic cell or organism carrying genomic DNA, and the phenotype of the transgenic cell, transgenic organism, or progeny thereof is reversed. Determining whether the alteration has been made relative to a cell or organism that does not carry the polynucleotide flanked by the directional repeats.

[0017] As yet another aspect, the present invention relates to a method for producing a nucleic acid supply system. This method
Non-integrative adenovirus-based viral vector comprising a polynucleotide flanked by inverted repeats that bind to a transposase, and a polynucleotide encoding a transposase operably linked to a control sequence that includes an operator sequence Constructing, for example, a helper-dependent adenovirus vector, and then packaging the non-integrated adenovirus-based viral vector under conditions in which the transposase is not expressed. The operator sequence can be a lac operator, and packaging can include maintaining the presence of LacI. This is because LacI inhibits the expression of the polynucleotide encoding the transposase. This non-integrative vector further comprises La as a polynucleotide encoding a regulatory polypeptide.
It may include a polynucleotide encoding cI. The operator sequence may be a tetracycline response element, in which case the non-integrated vector further comprises:
A polynucleotide encoding a control polypeptide can include a polynucleotide encoding tTA or rtTA.

The present invention also relates to a method for preparing a nucleic acid supply system, comprising: a polynucleotide flanked by inverted repeat sequences binding to a transposase, a polynucleotide encoding the transposase, and expression of the polynucleotide encoding the transposase The invention also relates to a method for producing such a method, comprising constructing a non-integrating adenovirus-based viral vector, eg, a helper-dependent adenovirus vector, comprising a polynucleotide encoding a control polypeptide that modifies the expression vector.
The method further comprises packaging the non-integrative adenovirus-based viral vector under conditions that suppress transposase expression. The non-integratable vector may further include an operator sequence operably linked to the transposase-encoding polynucleotide. If the operator sequence comprises a lac operator sequence, the polynucleotide encoding the control polypeptide encodes LacI, and the LacI inhibits expression of the transposase-encoding polynucleotide. If the operator sequence includes a tetracycline response element, the polynucleotide encoding the control polypeptide encodes tTA or rtTA.

The present invention further relates to a method of treating a mammal, eg, a human, comprising administering a non-integrating viral vector to a patient. The non-integratable viral vector comprises a polynucleotide encoding a therapeutic agent operably linked to a first regulatory sequence, a polynucleotide encoding a therapeutic agent flanked by inverted repeats that bind to a transposase, and a first regulatory sequence. Combination with an array,
And a polynucleotide encoding a transposase operably linked to a second control sequence containing an operator sequence. Alternatively, the non-integrative viral vector comprises a polynucleotide encoding a therapeutic agent operably linked to a first control sequence, a polynucleotide encoding a therapeutic agent flanked by inverted repeats that bind to a transposase. A combination of a nucleotide and a first control sequence, a polynucleotide encoding a transposase, and a polynucleotide encoding a control polypeptide that alters the expression of the polynucleotide encoding the transposase. The non-integratable viral vector can be administered to a patient's organs or tissues, such as the liver, nervous system, brain, lung, skin, cardiovascular system, heart, hematopoietic system, bone marrow, or muscle. The therapeutic agent can be a polypeptide or an RNA molecule. Said patient may be a patient with a genetic disease characterized by reduced production of certain polypeptides or RNA below normal.

The present invention also provides a method of treating a mammal, eg, a human, comprising explanting a patient's cells, and a polynucleotide encoding a therapeutic agent operably linked to a first regulatory sequence. A combination of a polynucleotide encoding a therapeutic agent flanked by inverted repeats binding to a transposase and a first control sequence, and encoding a transposase operably linked to a second control sequence comprising an operator sequence The explanted cells are contacted with a non-integrating viral vector containing the polynucleotide to be treated. Alternatively, the explanted cells are combined with a polynucleotide encoding a therapeutic agent operably linked to a first control sequence, a polynucleotide encoding a therapeutic agent flanked by inverted repeats that bind to a transposase, and A non-integrative viral vector comprising a combination with a control sequence, a polynucleotide encoding a transposase, and a polynucleotide encoding a control polypeptide that alters expression of the polynucleotide encoding the transposase is contacted. The transgenic cells are then transplanted into a patient to induce production of a therapeutic agent in the patient. The cells may be hematopoietic stem cells, hepatocytes, myoblasts, fibroblasts, keratinocytes, endothelial cells, or tumor cells, such as cancer cells. The therapeutic agent can be a polypeptide or RNA.

Detailed Description of the Invention Non-Integrative Vector As used herein , the term "non-integrative vector" refers to a polynucleotide that integrates into the genomic DNA of a host cell at a rate that is hardly detectable. Preferably, the non-integratable vector cannot integrate into the genomic DNA of the host cell. In some aspects of the invention, the non-integratable vector has an integration capability conferred by the presence of a transposon. However, what integrates into the genome of the host cell is a transposon, not a non-integratable vector. As used herein, the terms "host cell", "target cell" and "cell" are interchangeable to refer to a eukaryotic cell, preferably a human cell, into which a non-integrative vector of the invention has been, or has been, introduced. Used for

As used herein, the term “polynucleotide” refers to a polymer of nucleotides of any length, either ribonucleotides or deoxyribonucleotides, and includes both double- and single-stranded DNA and RNA. In. Polynucleotides can include non-coding sequences such as nucleotide sequences having various functions, eg, coding sequences, and control sequences. Coding sequences, non-coding sequences, and control sequences are defined below.
Polynucleotides can be obtained directly from natural materials or can be prepared by recombinant, enzymatic or chemical methods. Polynucleotides may be linear or dendritic in structure. The polynucleotide may be, for example, a part of a vector such as an expression vector or a cloning vector, or a fragment. Unless otherwise noted,
The terms of the present invention are meant to include one or more.

[0023] Non-integrating vectors include, but are not limited to, non-integrating plasmid vectors and non-integrating viral vectors. Non-integratable vectors may also be provided for cloning, ie, amplification of a polynucleotide. Non-integratable vectors can also be used to introduce transposon elements into host cells.
Typically, a non-integrated plasmid vector is capable of replicating in a bacterial host, such as E. coli. Typically, non-integrative viral vectors are capable of replicating in eukaryotic cells.

[0024] Preferably, the non-integrated vector is a non-integrated viral vector. Non-integrative viral vectors contain a nucleotide sequence that is provided for replication and packaging of the polynucleotide under appropriate conditions. Non-limiting examples of preferred non-integrating viral vectors include adenovirus, herpes simplex virus (HSV), alphavirus, simian virus 40, picornavirus, and vaccinia virus. Another example of a preferred non-integrating viral vector is adeno-associated virus (AAV), which is non-integrative in cells of some tissues. Preferably, the non-integrative viral vector is an adenovirus, HSV, or
AAV, more preferably adenovirus or HSV, most preferably adenovirus. The advantages of non-integratable viral vectors are many, including high titer production, stability in vivo, and efficient infection of host cells.

The adenovirus vector of the invention contains a repetitive terminal repeat (ITR), which is required for replication of the adenovirus vector during packaging. In a preferred embodiment of the invention, a "helper-dependent (HD)" adenovirus vector is used (eg WO 97/15679; Parks et al., Proc. Natl. Acad. Sc).
i. USA, 93, 13565-13570 (1996); Hardy et al., J. Virol., 71, 1842-1849 (
1997)). HD adenovirus vectors are known in the art as "solid (gut
ted) or "gutless" adenovirus vectors. HD adenoviruses typically show a significantly lower immune response than normal adenoviruses, and are able to better insert transposon-related components within the construct. HD adenovirus vectors contain, at a minimum, the repetitive terminal repeats (ITRs) present in the adenovirus.

[0026] Optionally, the non-integratable vector may further comprise a feed carrier that can be used to supply the vector. For example, the vector can be encapsulated in liposomes or concentrated by a nucleic acid concentrating agent such as a polycationic polypeptide (eg, a polylysine-containing polypeptide or polyethyleneimine). Alternatively, if the vector is a viral vector, the vector can be packaged by methods appropriate for the particular vector. Such methods are known in the art (for adenovirus, for example, Becker et al., Methods i
n Cell Biol., 43 (PtA), 161-189 (1994); Parks et al., Proc. Natl. Acad.
Sci. USA, 93, 13565-13570 (1996)).

In the present invention, a nucleotide sequence encoding a transposon, a transposase that mediates transposon excision and insertion in various combinations using the non-integrated vector, preferably a non-integrated viral vector, and / or
Nucleotide sequences encoding regulatory polypeptides that control transposase expression can be provided to host cells. Preferably, the non-integratable vector comprises a transposon, more preferably both a transposon and a nucleotide sequence encoding a transposase. Most preferably, the non-integratable vector comprises a transposon, a nucleotide sequence encoding a transposase, and a nucleotide sequence encoding a control polypeptide.

Transposons The non-integrative vectors of the present invention can include transposon elements (also referred to herein as transposons). A transposon comprises a polynucleotide flanked by cis-acting nucleotide sequences on both ends. The present invention is not limited to the use of any particular transposon element. This is because it is expected that the non-integrative vector of the present invention can be used to supply, without limitation, any transposon that functions in a target cell. Preferably, a transposon is excised from the non-integratable viral vector and can be integrated into the genomic DNA of the cell, whether or not the cell is dividing. A polynucleotide is a cis-acting nucleotide sequence if at least one cis-acting nucleotide sequence is located 5 'to the polynucleotide and at least one cis-acting nucleotide sequence is located 3' to the polynucleotide. Flanked by arrays. The cis-acting nucleotide sequence contains at least one inverted repeat (IR) at each end of the transposon to which a transposase, preferably a transposase within the SB family, binds. The SB family transposase is described in detail below.

Each inverted repeat preferably includes one or more direct repeats. The nucleotide sequence of this tandem repeat is preferably the following common tandem repeat (
At least about 80% homologous to SEQ ID NO: 1). The length of the tandem repeat is typically about 25 to about 35 base pairs, preferably about 29 to about 31 base pairs. Nevertheless, inverted repeats optionally contain only a single tandem sequence. In this case, the tandem repeat is a polynucleotide that is not, in fact, a repeat, but is still at least about 80% homologous to the common tandem repeat described in detail below.

In some aspects of the invention, there are two direct repeats for each inverted repeat. This tandem repeat (in this embodiment the number is four) is described in detail below.
Have similar polynucleotides. The inverted repeat located 5 ', ie, to the left of the transposon of this embodiment is typically the first direct repeat (ie, the left outer repeat), the intervening region, and the second direct repeat. Sequence (ie, the left inner repeat). The inverted repeat located 3 'to the right of the transposon of this embodiment, ie, to the right, is the first direct repeat (ie, the right inner repeat).
, An intervening region, and a second direct repeat (ie, right outer repeat).

[0031] Since they are inverted on the transposon, the tandem repeats in the 5 'inverted repeat of the transposon are relative to the tandem sequences in the 3' inverted repeat of the transposon. To indicate the opposite direction. The length of the intervening region within the inverted repeat is generally at least about 150 base pairs, preferably at least about 160 base pairs. The length of this intervening region is preferably about 200 base pairs or less, more preferably about 200 base pairs.
It is less than 180 base pairs. The nucleotide sequence of the intervening region in one inverted repeat may or may not be similar to the nucleotide sequence of the intervened region in the other inverted repeat.

Although most transposons have complete inverted repeats, the inverted repeats that bind the SB protein are preferably at least about 80%, and preferably at least about 90%, homologous to the common tandem repeat. Tandem repeats.
A preferred consensus direct repeat is 5'-CMSWKKRRGTCRGAAGTTTACATACACTTAAK (SEQ ID NO: 1).
). Where M is A or C, S is G or C, W is A or T, K is G or T,
And R is G or A. The putative core binding site of the SB protein is nucleotides 3-31 of SEQ ID NO: 1.

[0033] Nucleotide homology is defined as a comparison of a tandem repeat to SEQ ID NO: 1 and is defined as the two polynucleotides (ie, the nucleotide sequence of the candidate tandem repeat and the nucleotide sequence of SEQ ID NO: 1). Residues) are aligned so that the same number of nucleotides is greatest along their sequence. In order to maximize the number of shared nucleotides, gaps may be included in one or both sequences in creating the alignment, but still maintain the proper order of nucleotides in each sequence. A candidate tandem repeat is a tandem repeat that is compared to the sequence of SEQ ID NO: 1.

[0034] Preferably, the two nucleotide sequences are compared using the Blastn program of the BLAST2 search algorithm, version 2.0.11. This is based on Tatiana, et al., FEM
S Microbiol Lett, 174, 247-250 (1999), and http: // www.
Available at .ncbi.nlm.nih.gov / gorf / bl2.html. Preferably, default values are used for all parameters of the BLAST2 search. For example, reward for mat
ch = 1, penalty for mismatch = -2, open gap penalty = 5, extension gap p
enalty = 2, gap x dropoff = 50, expect = 10, wordsize = 11, and filter on. In comparing two nucleotide sequences by the BLAST search algorithm, nucleotide homology is simply referred to as homology.

Examples of tandem repeats that bind to the SB protein include the left outer repeat 5′-GTTGAAGTC
GGAAGTTTACATACACTTAA-3 '(SEQ ID NO: 2); left inner repeat 5'-CAGTGGGTCAGAAGTTT
ACATACACTAAG-3 '(SEQ ID NO: 3); right inner repeat 5'-AACTCACATACAATTGAAGACTGGG
TGAC-3 '(SEQ ID NO: 4); and right outer repeat 5'-ATTCCACATACATTTGAAGGCTGAAGTTG
-3 '(SEQ ID NO: 5). As described above, the right tandem repeat sequence (SEQ ID NOs: 4 and 5)
Represents as it would be on a transposon. That is, the nucleotides are in the reverse order of comparing the homology with the polynucleotide of the left-side repeat sequence (SEQ ID NOs: 2 and 3). Preferably, the inverted repeat sequence (
SEQ ID NO: 5) is 3 'to the right of the transposon, ie, to the right, and the transposon comprises two direct repeats within each inverted repeat.

In one embodiment, the direct repeat comprises at least the following sequence: ACATACAC (SEQ ID NO: 6). One preferred inverted repeat sequence of the invention is SEQ ID NO: 7: 5'-AGTTGAAGTC GGAAGTTTAC ATACACTTAA GTTGGAGTCA TTAAAACTCG TTTTTCAACT ACACCACAAA TTTCTTGTTA ACAAACAATA GTTTTGGCAA GTCAGTTAGG ACATCTACTT TGTGCATGATC ACAAGTCAG TATTCATCTCAGTCATTAGTTCATCAGTCATTACTTCATCAGTCATTACTTCATCAGTCATTACTTAGTCATTAG One preferred inverted repeat sequence is SEQ ID NO: 8: 5'-TTGAGTGTAT GTTAACTTCT GACCCACTGG GAATGTGATG AAAGAAATAA AAGCTGAAAT GAATCATTCT CTCTACTATT ATTCTGATAT TTCACATTCT TAAAATAAAG TGGTGATCCT AACTGACCTT AAGACAGGGA ATCTTAGTATCAG GGATTAGATCTATCAG GGATTAGA TGA

This inverted repeat (SEQ ID NO: 8) contains the poly A signal AATAAA at nucleotides 104-109. This poly A signal can be used by the coding sequence present in the transposon, resulting in the addition of a poly A tail to the mRNA. Typically, the addition of a poly A tail to an mRNA increases the stability of the mRNA as compared to the same mRNA without the poly A tail.

The polynucleotide flanked by inverted repeats (IR) may include coding or non-coding sequences. As used herein, "coding sequence" refers to a polynucleotide that encodes an RNA and, when placed under the control of appropriate regulatory sequences, expresses the encoded RNA. The RNA may be a biologically active RNA, for example, an mRNA or a ribozyme. The mRNA is translated in the host cell and produces a biologically active polypeptide. The boundaries of the coding region are generally determined by a translation start codon at the 5 'end and a translation stop codon at the 3' end.

A “control sequence” is a nucleotide sequence that controls the expression of a coding sequence to which it is operably linked. Examples of control sequences are, without limitation, promoters, enhancers, transcription start sites, translation start sites, translation stop sites, transcription stop sites, and polyA signals. The term “operably linked” refers to a juxtaposition of components, wherein the components are juxtaposed such that they are in a relationship permitting them to function in their intended manner. When a control sequence is operably linked to a coding region, expression of the coding region is achieved under conditions compatible with the control sequence. For convenience and for reasons which will become apparent hereinafter, the control sequence operably linked to the coding sequence flanked by the IRs is referred to herein as the first control sequence.

[0040] The promoter present in the first control sequence operably linked to the coding region is one that functions in the target cell, such as a regulated promoter, such as an inducible and repressible promoter. Examples of regulatable promoters are tissue-specific promoters, ie, promoters that are not expressed unless present in cells that make up a particular tissue. An example of a tissue-specific promoter is, without limitation, the alpha1 anti-trypson promoter expressed in hepatocytes. Optionally, the promoter is a constitutive promoter, such as the cytomegalovirus early promoter or the SV40 early promoter.

Transposase The non-integrative vector of the present invention optionally contains a coding sequence encoding a transposase. If the transposase mediates the excision of a transposon from a non-integrative vector of the invention, followed by integration of the transposon into the genomic DNA of the target cell, the present invention provides for the use of a particular transposase. Not limited.

A preferred transposase for use in the present invention is “Sleeping Beau
ty) "transposase, which is referred to herein as SB transposase or SB polypeptide (Z. Ivics et al., Cell, 91, 501-510 (1997); WO98 / 40510).
). The SB transposase can bind to the inverted repeats of SEQ ID NOs: 7 and 8 and the direct repeats (SEQ ID NOs: 2-5) and the common direct repeat (SEQ ID NO: 1) from the transposon. The SB transposase has a paired-like domain with a leucine zipper, possibly one or more nuclear localization domains, from its amino terminus to the carboxy terminus, as detailed in WO 98/40510. (NLS), and the catalytic domain containing the DD (34) E box and glycine rich box. This SB family polypeptide includes a polypeptide having the amino acid sequence of SEQ ID NO: 9. Preferably, the SB family polypeptides also include those having an amino acid sequence having at least about 80%, more preferably at least about 90%, and most preferably 95% amino acid homology to SEQ ID NO: 9.

Amino acid homology is defined as a comparison of a polypeptide of the SB family to SEQ ID NO: 9, and is defined as the residue of the aforementioned two amino acid sequences (ie, the candidate amino acid sequence and the amino acid sequence of SEQ ID NO: 9). The groups are determined by aligning the groups such that the number of identical amino acids is maximized along their sequence. In order to maximize the number of identical amino acids, gaps may be made in one or both sequences in making the alignment, but still maintain the proper order of amino acids in each sequence. The candidate amino acid sequence is an amino acid sequence to be compared with the amino acid sequence of SEQ ID NO: 9. Candidate amino acid sequences can be isolated from natural materials, or made by recombinant techniques, or synthesized chemically or enzymatically.

Preferably, the two amino acid sequences are compared using the Blastp program of the BLAST2 search algorithm, version 2.0.11. This is based on Tatiana, et al., FEMS Mi
crobiol Lett, 174, 247-250 (1999), and http: //www.ncb
Available at i.nlm.nih.gov/gorf/bl2.html. Preferably, default values are used for all parameters of the BLAST2 search. For example matrix = BLOSUM62,
open gap penalty = 11, extension gap penalty = 1, gap x dropoff = 50, e
xpect = 10, wordsize = 3, and filter on. In comparing two amino acid sequences by the BLAST search algorithm, amino acid homology is simply referred to as homology. Preferably, the SB polypeptide has a molecular weight of about 35 kD to about 40 kD on an about 10% SDS polyacrylamide gel.

[0045] SB polypeptides useful in some aspects of the invention include the active analogs or active fragments of SEQ ID NO: 9. An active analog or active fragment of a SB polypeptide is one that can mediate the excision of a transposon from a non-integrated vector, preferably a non-integrated viral vector. The active analog or active fragment can bind to the inverted and direct repeats of SEQ ID NOs: 7 and 8 (SEQ ID NOs: 2-5) and the common direct repeat (SEQ ID NO: 1) from the transposon.

Active analogs of SB polypeptides include polypeptides having amino acid substitutions that do not lose the ability to excise the transposon from a non-integratable vector. The replacement amino acid can be selected from other amino acids in the class to which the subject amino acid belongs. For example, non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and tyrosine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, aspartate and glutamate. Positively charged (basic) amino acids include arginine, lysine and histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Examples of preferred conservative substitutions include Ar to maintain a positive charge.
Lys in place of g and vice versa; Glu in place of Asp to maintain a negative charge, and vice versa; Ser in place of Thr in order to maintain free -OH; and in order to maintain free NH ₂ Has a substitution for Gln instead of Asn.

As used herein, the term “active analog” also includes modified polypeptides. Modification of the polypeptides of the present invention includes chemical and / or enzymatic derivatization of one or more constituent amino acids, such as side chain modifications, backbone modifications, and N- and C-terminal modifications, such as acetylation. Includes hydroxylation, methylation, amidation, as well as binding of carbohydrates or lipids, cofactors and the like. Active fragments of a polypeptide include those portions of the polypeptide having one or more contiguous or non-contiguous amino acid deletions or additions such that the resulting polypeptide can excise the transposon from the non-integrating vector. .

[0048] The coding sequence encoding the SB polypeptide may comprise the nucleotide sequence of SEQ ID NO: 10 encoding the amino acid sequence of SEQ ID NO: 9. In addition to the amino acid substitutions that will necessarily alter the nucleotide sequence encoding the SB polypeptide, it encodes an SB polypeptide having the same amino acid sequence as a certain SB protein, for example, the amino acid sequence of SEQ ID NO: 9, There are alternative nucleotide sequences in which the degeneracy of the three letter codon used to define is utilized. Such gene codon degeneracy is well-known in the art and is therefore considered part of this disclosure. In addition, certain nucleotide sequences can be modified to use preferred codons for certain cell types. Such modifications are known to those skilled in the art and are therefore considered part of this disclosure.

When the non-integratable vector contains both a transposon and a polynucleotide encoding a transposase, it is preferable to control the expression of the polynucleotide encoding the transposase. This allows the vector to be manipulated, eg, constructed and propagated, under conditions where transposase expression is substantially reduced. Thus, a non-integratable vector containing a sequence encoding a transposase preferably also contains control sequences operably linked to the coding sequence encoding the transposase. A control sequence operably linked to a coding sequence encoding a transposase is referred to herein as a "second" control sequence, unless otherwise specified.

[0050] Preferably, the second control sequence includes a promoter that functions in the target cell. For example, in some aspects of the invention, the promoter is a constitutive promoter, such as a cytomegalovirus promoter. Preferably, such a promoter will not function in the cell used to construct and / or propagate the non-integratable vector prior to introducing the vector into the target cell.
For example, in another aspect, a regulated promoter is preferred. It is expected that minimizing transposase expression during the operation of the vector, for example during packaging of a non-integrating viral vector, would allow for the production of a complete vector, which would be beneficial. . In this regard, preferred promoters are, for example, regulatable promoters, such as inducible and repressible promoters.

An example of a regulatable promoter is a tissue-specific promoter, that is, a promoter that is not expressed unless it is present in cells constituting a specific tissue. An example of a tissue-specific promoter is, without limitation, the alpha1 anti-trypson promoter expressed in hepatocytes. Other examples of regulatable promoters are, without limitation, promoters driven by heavy metal ions, increased temperature, or hormones. Other methods of controlling transposase expression known in the art can also be used. Alternatively, methods can be used that control the ability of the transposase to bind to the inverted repeat of the transposon and mediate excision of the transposon from the nuclear vector and integration into the genomic DNA of the host cell.

[0052] Optionally and preferably, the second control sequence further comprises an additional nucleotide sequence which serves to control the expression of the operably linked coding sequence. For example, the second control sequence may further include an operator sequence operably linked to a promoter present therein. As used herein, the term “operator sequence” refers to a nucleotide sequence to which a control polypeptide can bind to alter the expression of an operably linked coding sequence. As used herein, the term "control polypeptide" includes a polypeptide that binds to a control sequence and inhibits or activates the initiation of transcription of a coding sequence operably linked to the control sequence. Preferably, the control polypeptide is associated with an operator sequence.

An example of an operator sequence is a lac operator sequence. The lac operator is
A nucleotide sequence to which the LacI repressor protein binds and suppresses the initiation of transcription. It is known in the art to use the lac operator to control the expression of an operably linked coding sequence (eg, Beckwith, lac: The
Genetic System, The Operon, Miller et al. (Eds.), Cold Spring Harbor Lab
oratory Press, New York, 11-30 (1980); Fieck et al., Nucleic Acids Res.,
20, 1785-1791 (1992)). Another example of an operator sequence is the tetracycline response element (TRE). A TRE is a nucleotide sequence to which an inducer polypeptide binds under certain conditions to induce expression. The use of TREs to control the expression of an operably linked coding sequence is known in the art (see, for example, US Pat. Nos. 5,464,758 (Gossen et al.) And 5,814,618 (Bujard et al.)). )
.

Regulatory Polypeptides The non-integrative vectors of the present invention may further include a coding sequence encoding a regulatory polypeptide. As noted above, regulatory polypeptides include those that repress or activate the initiation of transcription of a coding sequence. Preferably, the effect of the regulatory polypeptide can be modified by the addition of certain compounds. An example of a control polypeptide is lala in the absence of isopropyl β-D-thiogalactopyranoside (IPTG).
c LacI repressor binding to the operator. With the addition of IPTG, the Lacl repressor no longer binds to the lac operator and therefore no longer suppresses transcription initiation. Preferably, the regulatory polypeptide binds to a region of the second regulatory sequence to affect transposase expression.

Another example of a regulatory polypeptide is tTA and rtTA. tTA binds to the TRE in the absence of tetracycline or an analog thereof to induce transcription. A preferred analog of tetracycline is doxycycline. In the presence of tetracycline or its analogs, tTA does not induce transcription. rtTA does not bind to the TRE in the absence of tetracycline or an analog thereof, and thus does not induce transcription of an operably linked coding sequence. In the presence of tetracycline or its analogs, rtTA induces transcription.

[0056] The polynucleotide encoding the control polypeptide is preferably operably linked to the control sequence. Such control sequences are referred to herein as "third" control sequences unless otherwise noted. The third control sequence is preferably a promoter that functions in the target cell, such as a regulated promoter, such as an inducible promoter and a repressible promoter. An example of a regulatable promoter is a tissue-specific promoter, ie, a promoter that is not expressed unless it is present in the cells that make up a particular tissue. An example of a tissue-specific promoter is, without limitation, the alpha-1 anti-trypson promoter expressed in hepatocytes. Optionally, the promoter is a constitutive promoter, such as the cytomegalovirus early promoter or
It is the early promoter of SV40.

Method of Use The present invention also relates to a method of using the above non-integrated vector, preferably a non-integrated virus vector. In some preferred aspects, the methods of using the non-integrating vectors of the invention involve inserting the polynucleotide flanked by the IRs into the genome of the target cell. Such a method involves contacting a cell with a non-integrating vector containing a polynucleotide flanked by inverted repeats that bind to the transposase, and providing the cell with a suitable transposase. Cutting out the transposon from the vector and inserting it into the genomic DNA of the target cell. As used herein, the term "contacting" refers to physically mixing a cell with a vector of the invention such that the vector enters the cell.

The polynucleotide flanked by inverted repeats may include coding or non-coding sequences, as described in the section “Transposons”. For example, in functional genomics applications, it may be desirable to simply disrupt the function of the coding sequence present in the target cell. Therefore, the polynucleotide to be genetically integrated in that case is
It need not encode an RNA or polypeptide, and preferably has a translation termination site and / or
Or a nucleotide sequence such as a transcription termination site. In another application, the production of an RNA or polypeptide, in particular a biologically active polypeptide or RNA, in a transgenic cell or organism is intended, in which case the polynucleotide to be genetically integrated by the method is: It is selected to encode the desired polypeptide.

In another application, the integrated polynucleotide functions as a marker, ie, encodes a detectable or selectable marker. As used herein, "marker" refers to a particular nucleotide sequence that can be detected by conventional methods, such as hybridization or the polymerase chain reaction (PCR). As used herein, the terms "detectable marker" and "selectable marker" refer to a polypeptide capable of detecting the presence of the marker in a cell, or a cell expressing the marker, respectively. Refers to a coding sequence that encodes a polypeptide that can be used to select. Non-limiting examples of detectable markers are fluorescent proteins (eg, blue-green, red, yellow), luciferase, and beta-galactosidase. Without limitation, examples of selectable markers define the puromycin resistance, a product polypeptide of the neo gene that defines G418 resistance
puro is a dihydrofolate reductase mutant that defines methotrexate resistance.

[0060] In one aspect of the method, the transposase is provided in trans. For example, a cell that has been contacted with a non-integrating vector containing a transposon can be further contacted with a second non-integrating vector that contains a coding sequence encoding a transposase. Alternatively, the cells can be contacted with the transposase in different forms. For example, the cells can be contacted with an mRNA encoding a transposase, or can be contacted with a transposase polypeptide.

However, in a preferred embodiment of the method, the transposase is provided in cis.
For example, a non-integrative vector containing a transposon can further include a coding sequence that encodes a transposase. Preferably, the transposase is a transposase belonging to the SB family, as described above, or an active analog or fragment thereof. The coding sequence encoding the transposase can be operably linked to a promoter such that the transposase is expressed when the vector enters a cell.

Alternatively and preferably, as described in the section “Transposase”, the coding sequence encoding the transposase is operably linked to control sequences that can include promoter and operator sequences. Such a method of the invention comprising contacting a cell with a non-integrative vector comprising a transposon, and a polynucleotide encoding a transposase operably linked to an operator sequence, preferably comprises The non-integratable vector further includes a polynucleotide encoding a control polypeptide. Polynucleotides encoding control polypeptides are described in the "Control Polypeptides" section.

Preferably, the control polypeptide is expressed when the vector enters the cell, and alters the expression of the transposase. The effect of a regulatory polypeptide can be altered by the addition or removal of certain compounds. For example, if the control polypeptide is a Lacl repressor, transposase will not be expressed unless binding of Lacl to the lac operator sequence is suppressed. Using IPTG,
LacI can be inhibited from binding to the lac operator sequence.

When the control polypeptide is tTA or rtTA, the control polypeptide must bind to a tetracycline response element in order to express the transposase. Tetracycline or an analog thereof can be used to alter the binding of these regulatory polypeptides to a tetracycline response element. Altered action of the regulatory polypeptide results in expression of the transposase, followed by excision of the transposon from the vector, and its integration into the genomic DNA of the target cell.

When a cell is contacted with the non-integrative vector of the present invention, the vector is preferably in a form that allows entry into the cell. For example, the non-integrated vector can be introduced as naked DNA by methods known in the art. Alternatively, and preferably, the non-integratable vector can be encapsulated in a supply carrier such as a liposome or a nucleic acid condensing agent. Alternatively, if the vector is a viral vector, preferably an adenovirus vector, it can be packaged by methods appropriate for that particular vector.

Cells contacted with the non-integrating vector of the present invention include cells in vitro (ie, cultured cells), ex vivo cells (ie, cells removed from the body of a subject),
Alternatively, it may be a cell in vivo (ie, a cell in the body of a subject). Preferably, the cells are in vitro, ex vivo or in vivo cells, more preferably in vitro or ex vivo cells, most preferably in vitro cells. The present invention is not limited by the type of cells to be contacted. Can be introduced.

A transgenic cell can be produced by inserting a transposon into the genome of a target cell using the non-integrated vector of the present invention. As used herein, the term "transgenic" refers to a cell containing a transposon provided by a non-integrating vector of the invention, provided that the transposon contains a nucleotide sequence endogenous to the cell. It doesn't matter. For example, if the host cell is a human cell and the transposon contains a polynucleotide encoding human adenosine deaminase, the host cell is considered transgenic.

Optionally, the method of the invention comprises altering the phenotype of the cell. In this method of the invention, the transgenic cells are produced and the cells are observed to determine if the phenotype of the transgenic cells has been altered compared to cells that do not contain the transposon. . The altered phenotype can be detected by methods known in the art.

Another aspect of the present invention is to use the above-described method to produce a transgenic organism that carries a particular marker sequence or expresses a particular polypeptide in one or more cells. it can. Methods for producing transgenic animals are known in the art, and undue experimentation is not required to incorporate the methods of the present invention into these methods. For example, mouse embryonic stem cells can be contacted with a non-integrative vector of the present invention. The transgenic animal may be mosaic, or all cells of the animal will carry the transposon. In one respect, the polypeptide encoded by the coding sequence within the transposon is a product that is separated from cells. For example, a transgenic animal can be used as a bioreactor to produce large amounts of the polypeptide in milk, urine, blood, eggs, or other material readily collected from the animal.

[0070] Optionally, the method of the invention may comprise altering the phenotype of the animal. In this aspect of the invention, a transgenic cell is produced, which is then used to produce a transgenic animal. Observe the resulting transgenic animal,
Determine if the phenotype of the transgenic cell is altered relative to a cell that does not carry the transposon.

Another aspect of the present invention relates to the treatment of animals by causing the cells of the animal to produce a therapeutic agent. The method may comprise treating the animal in vivo by administering to the animal a non-integrating vector of the invention, more preferably a non-integrating viral vector, most preferably an adenoviral vector.
The non-integratable vector contains a transposon containing a polynucleotide encoding the therapeutic agent. The non-integratable vector can be administered or targeted to animal organs or tissues, for example, to the liver, nervous system, brain, lung, skin, cardiovascular system, heart, hematopoietic system, bone marrow, and muscle. it can.

The supply of the non-integrating vector can be performed in any conventional manner, with no restrictions other than those imposed by the purpose or target. For example, the vector can be supplied by injection or infusion intravenously, intramuscularly, subcutaneously, intradurally, or intracranial, or by inhalation. Using a conventional adenovirus vector, by inhalation,
Successful in vivo transduction of lung epithelial cells (Bellon et al., Human Gene The
r., 8, 15-25 (1997)). If desired, methods for targeted delivery of the vector to particular types of cells can be used. Such methods are known in the art. Optionally and preferably, within said animal, a compound, such as IP
By altering the presence of TG or tetracycline, or an analog thereof, transposase is expressed, and thus a transposon is excised from the non-integratable vector and inserted into the genomic DNA of the cell carrying the vector.

In addition to directly introducing a therapeutic nucleic acid in vivo, the gene therapy of the present invention involves transducing cells ex vivo, followed by administration of the resulting transgenic cells to a patient. In. Ex vivo applications may envisage the use of cells explanted from the patient or other cells, and may further include transduction and transplantation of cells explanted from a different species than the patient. At this point of the invention, cells are explanted from a patient and contacted with a non-integrating vector of the invention, more preferably a non-integrating viral vector, most preferably an adenovirus. The non-integratable vector contains a transposon containing a polynucleotide encoding the therapeutic agent. Next, the explanted cells contacted with the vector are transplanted into an animal to produce a therapeutic agent in the animal. Examples of cells that can be used include, but are not limited to, hematopoietic stem cells, hepatocytes, myoblasts, fibroblasts, keratinocytes, endothelial cells, tumor cells, and cancer cells.

The therapeutic agent encoded by the transposon may be a polypeptide or an RNA molecule. The treatment method of the present invention is useful for treating a genetic disease, for example, replacement of a defective gene, supply of a polypeptide drug, or supplementation of metabolic activity. Examples of conditions within the scope of treatment with the non-integratable vectors of the present invention include cystic fibrosis, diabetes, cardiovascular disease, cancer,
And brain dysfunction. For example, using the adenovirus vector of the present invention,
Functional CFTR coding sequences can be incorporated into the lungs of patients with cystic fibrosis. Similarly, using the adenovirus vector of the present invention, a polynucleotide encoding a TPA can be supplied to cardiac cells of a heart disease patient in order to increase low levels of tissue plasminogen activator (TPA). it can.

The present invention relates to a method for introducing a coding sequence encoding a polypeptide that enhances, recruits, or elicits a patient's immune response into a genome of normal or cancer cells in vivo, for treating cancer. Non-integrating vectors can be used. For example,
Mammalian cells can secrete one or more cytokines or express surface molecules that attract cells of the immune system. In another application, the non-integrative vectors of the invention are used to transgenicly provide normal cells with protection against the toxic side effects of chemotherapy, for example, by expressing a coding sequence that confers resistance to the drug. Cells can be made.

Another approach involves activating a prodrug. For example, using the adenovirus vector of the present invention, a herpes simplex virus-derived thymidine kinase (HSV-t
Transgenic cancer cells can be engineered in a patient to express k). Upon administration of a nucleotide analog, such as ganciclovir or acyclovir, it is incorporated into the nucleic acid of the transgenic cell, resulting in the death of the cell. Optionally, this non-integrative vector is constitutively expressed from the adenovirus for additional short-term effects, as well as HSV-tk coding sequences suitable for transposons intended to be integrated into host cells. It also contains the HSV-tk coding sequence to be performed.

[0077] The presence of a transposon of the invention in the genomic DNA of a target cell can be confirmed by several methods known in the art. For example, if the integrated polynucleotide functions as a marker, hybridization or PC
R allows the marker to be detected. If the integrated polynucleotide encodes a detectable or selectable marker, that marker can be detected.

Another aspect of the invention relates to the generation of a transposon supply system. The production of transposon supply systems can be in various combinations, including transposons (described in the section “Transposons”), polynucleotides encoding transposases (described in the section “Transposases”), and / or regulatory poly- And constructing a non-integrative viral vector containing a polynucleotide encoding the peptide (described in the section "Control Polypeptides"). Preferably, the non-integratable vector comprises a transposon, more preferably both a transposon and a polynucleotide encoding a transposase. Most preferably, the non-integratable vector comprises a transposon, a polynucleotide encoding a transposase, and a polynucleotide encoding a control polypeptide.

The production of the transposon supply system also includes the packaging of the non-integrative viral vector. Packaging methods will vary depending on the type of viral vector used, and are known in the art. The expression of the transposase during packaging will excise the transposon from the non-integrative viral vector, thus reducing the efficiency of the packaging. In this respect of the invention, if the viral vector comprises both a transposon and a nucleotide sequence encoding a transposase, preferably the non-integrated viral vector is packaged under conditions such that the transposase is not expressed. I do.

The invention is illustrated by the following examples. Specific examples, substances, amounts and methods
It should be construed broadly according to the scope and intent of the invention. Example 1 Construction of AdSB10, an Adenovirus that Transduces SB Transposase To test for the adenovirus-mediated supply of transposase function,
An adenovirus vector transducing the SB10 transposase was constructed and packaged by homologously inserting the SB10 sequence into the adenovirus genome (FIG. 3). The coding sequence for the SB10 transposase was removed from pSB10 by digestion with BamHI and SalI. Construction of pSB10 is described in Ivics et al., Cell, 91, 501-510 (199
It is detailed in 7).

The BamHI / SalI fragment containing the coding sequence for the SB10 transposase was ligated into pACCMV.p
LpA (Becker et al., Methods in Cell Biol., 43 (PtA), 161-189 (1994); Glu
zman et al., Eucaryotic Viral Vectors, Gluzman (ed.), 187-192, Cold Spri
ng Harbor Laboratory Press, New York (1982)) to create pACCMVSB10 by ligation between the BamHI and SalI sites downstream of the cytomegalovirus early promoter sequence. pACCMVSB10 contains adenovirus sequences in the region of crossover units (mu) 0 to 17, in which the E1 region of mu1.3 to 9.3 is interrupted by the promoter and transgene sequences described above. .

PACCMVSB10 was co-transfected with pJM17 into human 293 cells by standard methods (eg, Larregina et al., Gene Ther., 5, 563-568 (19
98)). pJM17 (McGrory et al., Virol., 163, 614-617 (1998)) has a mu3.7
Contains the complete adenovirus genome interrupted by the plasmid sequence at position. By homologous recombination (FIG. 3, crossover), the sequence in the pACCMVSB10 construct, including the promoter and transgene, replaces the region with the inserted sequence at mu3.7, resulting in the adenovirus genome The adenovirus genome with the CMV early promoter and the SB10 coding sequence inserted between mu1.3 and 9.3 in the result.

[0083] Clear cell pathology (due to recombinant virus infection) was observed in the cells within 10 days, and the supernatant was collected for plaque purification. Next, the virus purified from plaques was amplified to obtain large amounts of virus preparation. Southern blot results of the virus with the inserted probe for SB10 were consistent with a homologous insertion into the adenovirus genome. Also, the presence of the inserted SB10 (primers I and II: 5'-CCGCGTTCCGGGTCAAAGTTGGCG (SEQ ID NO: 11) and 5'-GTCACATCCAG
CATCACAGGC (SEQ ID NO: 12)) and homologous recombination between the pACCMVSB10 plasmid and the adenovirus genome (primers III and IV (5′-GGAAGGCTACCCGAAACGTTT (
PC to confirm SEQ ID NO: 13) and 5'-CCAAGTTGCTGTCCAACGCC (SEQ ID NO: 14)
R analysis was performed. These results indicated the successful packaging of pACCMVSB10. This packaged pACCMVSB10 was named AdSB10.

Example 2 Intracellular Expression of Transposase SB by AdSB10 To determine whether AdSB10 can express the SB transposase protein, extracts of 293 cells infected with the virus were subjected to Western blot analysis.
The extracted proteins were separated by SDS polyacrylamide gel electrophoresis and electrotransferred onto a nitrocellulose support. Next, the SB protein on the blot was searched using a polyclonal antibody against the C-terminal peptide of the SB protein predicted from the coding sequence of the SB protein. As a result, in the lane to which the extract of 293 cells infected with AdSB10 was added, a clear band (SB arrow) of the substance exhibiting anti-SB immunoreactivity was observed, but in the control (293 cell) lane. It was clearly shown that there was none. These results indicate that transduction of 293 cells with AdSB10 resulted in the expression of a substance having anti-SB immunoreactivity in the target cells.

Example 3 Intracellular Function of Transposase SB Expressed by AdSB10 To examine the function of SB transposase expressed by AdSB10, HeLa cells were transduced. When the purified vector is transduced into HeLa cells, the adenovirus vector efficiently binds to the cell surface, is taken up internally, and then the endosome containing the virion capsid is released, and translocates to the nucleus, Then the genome accumulates. Once the adenovirus vector genome is delivered into the nucleus, its CMV promoter mediates the expression of the SB transposase enzyme.

Transduction of HeLa cells with AdSB10 was performed one day before (FIG. 5, No. 4), one day (No. 3) or two days (No. 2) before transfection with pT / Neo. pT / neo and
Co-transfection with pSB10 was used as a positive control.
pT / neo contains a neo coding sequence operably linked to the SV40 promoter / enhancer and SB40 polyadenylation signal, all flanked by inverted repeats. The construction of pT / neo is detailed in Ivics et al., Cell, 91, 501-510 (1997). All cultured cells were plated on day 4 on selective medium containing G418.

Co-transfection with pSB10 (# 5) increased its G418 resistant colony formation 13.2 fold compared to cells transfected with pT / neo alone (# 1). AdSB10 infection increased the frequency of G418-resistant colony formation by 2.4-6.4 fold. This is due to the T / T10 expression by SB10 transposase expressed from infected AdSB10.
Indicates that transposition of the neo sequence has occurred. In cells infected with AdSB10 prior to transfection with the pT / neo transposon, it was observed that the frequency of metastasis mediated by the SB encoded by AdSB10 was highest (number 4). These results
This shows that the SB10 transposase protein expressed in cells transduced by AdSB10 was able to induce metastasis and insert new genetic material into the chromosome of target cells.

Example 4 Generation of AdT / neo, an Adenovirus Transducing the neo Transposon To determine whether transfer occurs from the adenovirus genome to the cell genome,
AdT / neo was built and packaged. AdT / neo is an adenovirus containing a transposon containing the neo gene as a selectable marker. The neo transposon with the flanking sequence containing the SV40 early promoter and inverted repeats (FIG. 2) was ligated as a KpnI / SalI fragment into the pACCMV.pLpA plasmid (FIG. 3), which was then Cotransfect human 293 cells with pJM17 as described in the packaging of AdSB10 (Example 1). About 19 days after co-transfection, the monolayer cells were completely lysed. Thereafter, the medium is collected and several freeze-thaw cycles are performed to lyse the remaining viable bacteria. The cell debris is precipitated by centrifugation, and the 293 cells are infected using the virus-containing supernatant. Following the pathological symptoms of the cells, the established Hirt method (Hir
t, J. Mol. Biology., 26, 365-369 (1967)) to extract viral DNA from cells.

Example 5 Examination of Transfer from Adenovirus Genome to Host Cell Genome To demonstrate transfer in cultured mammalian cells, the AdT / neo described in Example 4 was used.
The vector can be used with a plasmid that expresses SB10 transposase. In this experiment, pSB10 was transfected before or after infection with this AdT / neo vector.
Transfect HeLa cells. The expressed SB transposase excises the SV-neo transposon from the adenovirus vector and integrates it into the host cell genome. Colony formation in the presence of the neomycin analog G418 can test for the presence of this new genetic material. To ensure that all cells were transduced, the host cells were contacted with various concentrations of the vector, and two days later, cells were serially diluted 10-fold in selective medium containing G418. To determine the efficiency of the process. DNA extracted from G418-resistant clones was analyzed by Southern blot analysis to confirm that
By confirming the presence of the sequence of the chromosome sandwiching the transposon, stable introduction of the neo sequence by transposition is confirmed.

Two days after infection, HeLa cells are sub-cultured in selective medium containing G418 and two weeks later, drug-resistant colony formation is assessed. The increased frequency of drug resistant colony formation in cells transfected with pSB10 as compared to non-transfected cells indicates that SB transposase cuts the neo expression cassette from the adenovirus vector genome and the neo expression cassette Is transferred into and integrated into the host cell genome. Furthermore, by identifying the sequence sandwiching the neo expression cassette in the cell genome (by reverse PCR or PCR using a linker), it is confirmed that the neo sequence is inserted by transposition. Evidence of transposition in these experiments indicates that SB transposase translocates from the adenovirus genome via excision of the transposon from the adenovirus vector genome as a substrate, followed by insertion of the transposon into the host cell genome. It is proved that the metastasis can be mediated.

To test that the following two functions are provided by independent vectors:
HeLa cells were simultaneously or sequentially treated with AdSB10 for the provision of transposase function by the vector and AdT / ne for the provision of transposon function by the vector.
o and infected by. Two days later, the cells are plated on selective medium containing G418, and two weeks later, drug-resistant colonies are evaluated. AdSB10 infection increases the frequency of drug-resistant colony formation compared to AdT / neo alone infection, indicating that the transfer of the neo expression cassette from the AdT / neo genome to the host cell chromosome May provide evidence of being mediated by SB transposase expressed from the AdSB10 vector. Molecular analysis of the sequences flanking the integrated neo cassette confirms gene transfer resulting from transposition. The evidence of transposition predicted in this experiment demonstrates that both the transposon and transposase components supplied from different vectors function to mediate transposition from the vector genome to the host cell genome.

Example 6 Preparation of the Adenovirus Genome Containing the Transposase Coding Region and the T / neo Transposon It seems to be a vector. However, in the process of packaging a transposon and an adenovirus containing a transposase coding sequence, transposase expression will result in transposon excision, thus interrupting the packaging process. This problem is solved by controlling transposase expression during packaging.

Control of Transposase Expression by Tetracycline Control of transfer from a single vector by tetracycline would require the introduction of the following three functions. (i) transposon function; (ii) transposase function under transcriptional control by a tetracycline response element (TRE); and (iii) binding to the TRE in response to the presence or absence of tetracycline and the expression of SB transposase. Transcription unit for controlling tetracycline transactivator (FIG. 6).

When controlling the expression of transposase by using TRE, transposase is not expressed unless tetracycline transactivator is simultaneously expressed in the same cell. Furthermore, this tetracycline transactivator has a form in which the binding to TRE is activated by tetracycline (rtTA or tet-ON
(Gossen et al., Science, 268, 1766-1769 (1995)), or a form inhibited by tetracycline (called tTA or tet-OFF) (Gossen et al., Proc. Na
tl. Acad. Sci. USA, 89, 5547-5551 (1992)). tet-ON
Alternatively, the transcription unit encoding tet-OFF is contained in the vector construct together with the transposon function and the SB transposase function (FIG. 6).

By packaging the vector containing tet-OFF (FIG. 6a) in the presence of tetracycline (or a tetracycline analog), the expression of SB transposase is suppressed, and thus the complete Complete packaging of the vector is possible. Secondly, the use of tetracycline in the absence of tetracycline to transduce target cells activates TRE-regulated SB transposase expression, thus causing metastasis by SB in transduced target cells. Becomes possible.

By packaging the vector containing tet-ON (FIG. 6b) in the absence of tetracycline (or a tetracycline analog), the expression of SB transposase is also suppressed, and thus the above three-component vector Packaging is possible. Next, use in the presence of tetracycline to transduce target cells activates TRE-regulated SB transposase expression, thus allowing SB to develop metastasis in that target cell .

Control of transposase expression and transposon function in cells In order to control transposon translocation, the transposase controlled by TRE is used to control transposase expression and transposon response to tetracycline. Must be able to control functions. This ability was tested (FIG. 8). The plasmid pT / neo containing the transposon is described in Ivics et al., Cell, 91, 501-510 (1997). ppATRES is a plasmid containing a TRE-controlled SB transposase expression cassette. ppATRES is the same as pTRES below.

[0098] The SB transposase expression cassette controlled by the TRE was converted from pSB10 to SB
The transposase coding sequence was removed and constructed by inserting it into the multiple cloning site of pTRE (Clontech). Next, this expression cassette is
It was introduced into the XhoI site of the pLPBL1 adenovirus vector plasmid (FIG. 7). The resulting construct was called ppATRES. ppATRESTOFF is a tet-OFF transcription unit (Clont
ech, Palo Alto, California).
This was constructed by inserting the transcription unit as a fragment from XhoI to BseRI. pCMVSB10 is the same as pSB10.

Cells were transformed using these plasmids in the combinations shown in FIG.
As expected, no transposon translocation was observed in cells transfected with pTneo and ppATRES (determined by increased formation of G418-resistant colonies). In contrast, cells transfected with both pTneo and ppATRESTOFF showed transposon transposition only in the absence of Dox (
(FIG. 8). These results indicate that transposase controlled by TRE can control transposase expression and metastasis in cells.

Co-linear Supply of Transposon and Transposase Expression Functions It will be most effective if both the transposon and transposase functions are supplied to target cells and tissues as part of the same vector. This ability was tested in plasmid transfection experiments. Plasmid pLPBLTNeo containing T / Neo was digested with SacI and SalI, and the fragment was digested with pLPBL1
Was constructed. pLPBLSBTNeo is a T / neo transposon and C
Plasmid containing the coding sequence for SB transposase linked to the MV promoter, which was constructed as follows.

The fragment containing CMV-SB10 was obtained from pSB10 by digestion with EcoRI and SalI. Next, it was inserted between EcoRI and SalI in pLPBL1 and the plasmid pLPB1 was inserted.
L / CMVSB10 was obtained. T / Neo was excised from pLPBL / TNeo with XhoI and SalI,
Next, it was inserted into the SalI site of pLPBL / SMVSB10 to obtain pLPBLSBTNeo. From pLPBLSBTNeo, a fragment containing SBTNeo was cut out with the restriction enzyme AscI,
It was inserted into the AscI site of pDelta28 to construct pDelta28SBTNeo. From pLPBLSBTNeo, a fragment containing the TRESTONTneo fragment was excised with the restriction enzyme AscI, and inserted into the AscI site of pDelta28 to obtain pDelta28TRES.
I built TONTneo.

Cells were transfected with these plasmids in the combinations shown in FIG. Contains both transposon and transposase functions in cis
When the pLBPLSBTNeo construct was used, it was observed that the frequency of formation of G418-resistant colonies was increased three-fold compared to cells transfected with pSB10 and pLBPLTNeo simultaneously. These results indicate that the transposon and transposase functions can be supplied by the same supply vector, and that the transposon and transposase functions are simultaneously supplied in cis, thereby actually increasing the frequency of transposition. .

[0103] Transposon Construction Vector plasmid containing the transposase and tetracycline transactivator over Ad-TRESTON / TNeo (Figure 6b) to construct as follows. The coding sequence for the SB transposase was removed from pSB10 and inserted into the multicloning site of pTRE (Clontech). TRE by restriction endonucleases XhoI and HindIII
And the sequence containing the coding sequence of SB transposase was excised and inserted into the receiving vector pLPBL1 to obtain pTRES. An XhoI site was created at position 2350 of the plasmid pTet-On (Clontech) by PCR-based site-directed mutagenesis. Then, from the pTet-On, as an XhoI fragment,
The coding sequence of Tet-On was cut out and inserted into pTRES to obtain pTRESTON.

Finally, the restriction endonucleases SalI and NdeI were used to remove NeT from pT / NeoHSVTK
o Transboson cut out. The plasmid pHSVTK106 (BRL, Rock
(ville, Maryland) by cutting out HSV-tk and inserting it into pT / Neo,
pT / NeoHSVTK was constructed. By digesting pT / NeoHSVTK with SalI and NdeI, only the Neo transposon was removed, but HSV-tk was not. This Ne
o Both sites of the transposon were blunted and inserted into the blunted ApaI site of pTRESTON to yield pTRESTON / TNeo. pTRESTON / TNeo is cleaved with a restriction endonuclease, inserted into plasmid pΔ28, and packaged under appropriate conditions to obtain a helper-dependent adenovirus vector Ad-TRESTON / TNeo (FIG. 6b).

The complete disclosure of all patents, patent applications, and literature cited herein, as well as data from nucleic acid and protein databases, such as the access numbers for GenBank and EMBL,
Incorporate in the text. Modifications and variations of this invention will be apparent to those skilled in the art without departing from the scope and spirit of this invention, and the invention is not unduly limited to the illustrative embodiments.

Description of SEQ ID NO: SEQ ID NO: 1 common tandem repeat sequence SEQ ID NO: 2 tandem repeat sequence SEQ ID NO: 3 tandem repeat sequence SEQ ID NO: 4 tandem repeat sequence SEQ ID NO: 5 tandem repeat sequence SEQ ID NO: 6 tandem repeat sequence SEQ ID NO: 7 reverse repeat Sequence SEQ ID NO: 8 Inverted repeat sequence SEQ ID NO: 9 Amino acid sequence of SB transposase SEQ ID NO: 10 Nucleotide sequence encoding SEQ ID NO: 9 SEQ ID NO: 11 Primer SEQ ID NO: 12 Primer SEQ ID NO: 13 Primer SEQ ID NO: 14 Primer

[Sequence list]

[Brief description of the drawings]

FIG. 1 illustrates the mechanism of action of a functional transposon. In this illustration, the transposase (gene X) coding sequence is between the cis-acting inverted repeats of the transposon.

FIG. 2 is an example of a transposon supply vector by an adenovirus. In this example, the transposase coding sequence and the integrated polynucleotide (neo)
Are both present on the same vector and are flanked by repetitive terminal repeats (ITR) of adenovirus (Ad). pA: polyadenylation sequence, p: promoter, SV: promoter of simian virus 40.

FIG. 3 illustrates the crossover phenomenon between pACCMVSB10 and pJM17 in the production of the transposase supply vector AdSB10 by adenovirus. cmv: human cytomegalovirus promoter, mu: crossover unit, I, II, III and IV: location of PCR primers.

FIG. 4 is a Western blot showing that human 293 cells transduced with AdSV10, a transposase supply vector by adenovirus, produce “Sleeping Beauty (SB)” transposase. kd: kilodalton.

FIG. 5 shows the transposase supply vector AdSB10 by adenovirus, and
Successful transposition of the T / neo sequence in HeLa cells treated with plasmid pT / neo containing the neo gene operably linked to the SV40 early promoter and flanked by cis-acting elements of the SB transposon system. It is a graph shown. pSB1
0: plasmid containing the nucleotide sequence encoding SB transposase.

FIG. 6 illustrates tetracycline-controlled transcription from a transposon-supplied vector by an adenovirus. Panel A shows tetracycline (TET
) Activate protein (tTA) so that transposase expression is suppressed in the presence of
Are constitutively expressed. Panel B shows constructs that constitutively express a recombinant activated protein (rtTA) that has been modified to have the opposite activity such that transposase expression is suppressed in the absence of tetracycline. AdITR: repetitive terminal repeat of adenovirus, TRE: tetracycline response element, pA: polyadenylation sequence, SV: promoter of simian virus 40, neo: coding sequence for conferring resistance to neomycin analog G418, cmv: human site Megalovirus promoter.

FIG. 7 is a plasmid map of pLPBL1.

FIG. 8 is a graph showing transposase expression and transposon function controlled by TRE in response to the tetracycline analog doxycycline.
+ Dox and -Dox: presence and absence of doxycycline, respectively.

FIG. 9 is a graph showing the control of intracellular transposon function when a transposase and a transposon are present on the same vector.

FIG. 10 (A) is a double-stranded nucleic acid sequence encoding an SB protein (SEQ ID NO: 10). FIG. 10 (B) shows the amino acid sequence of SB transposase (SEQ ID NO: 9). Key functional domains are highlighted. NLS: Bipartite nuclear localization signal, DDE domain catalyzing translocation (Doak, et al., Proc. Natl. Acad. Sci., USA, 91, 94).
2-946 (1994)), the boxes marked D and E, DD (34) E box: two invariant aspartic acid residues D (153) and D (244), and one Catalytic domain containing glutamic acid residue E (279) (but the last two residues are 43 amino acids apart).

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 43/00 105 C12N 5/00 B C12N 5/10 A61K 37/02 (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ) , BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH CN, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG , KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (71) Applicant McIver, Earl Scott United States of America, Minnesota 55416, Sent Louis Park Street, Glen Hurst Avenue South 3745 (71) Applicant Aguilar-Cordova, Estardo United States, Texas 77035, Houston, Omeara Drive 4310 (72) Inventor Macaiva -Earl. Scott United States, Minnesota 55416, St. Louis Park, Glenhurst Avenue South 3745 (72) Inventor Aguilar-Cordova, Estard United States, Texas 77035, Houston, Omeara Drive 4310 F-term (reference) 4B024 AA01 AA20 CA20 DA02 DA03 EA02 EA04 FA02 GA11 HA17 4B065 AA90X AA95Y AB01 BA01 CA44 4C084 AA02 BA03 CA18 MA05 NA10 NA13 ZB21 4C086 AA01 EA16 MA02 MA05 NA13 ZB21 4C087 AA01 BB54 BC83 MA05 NA13 ZB21

Claims (93)

[Claims] 1. A non-integrating vector comprising a polynucleotide flanked by inverted repeats that bind to a transposase, and a polynucleotide encoding the transposase operably linked to a control sequence that includes an operator sequence. . 2. The non-integratable vector of claim 1, wherein said transposase is an SB polypeptide. 3. The non-integratable vector of claim 2, wherein the amino acid sequence of the SB polypeptide is at least about 80% homologous to the sequence of SEQ ID NO: 9. 4. The SB polypeptide has the amino acid sequence of SEQ ID NO: 9.
The non-integrated vector according to claim 3. 5. The non-integratable vector according to claim 2, wherein said inverted repeat comprises the sequence of SEQ ID NO: 7 or 8. 6. The method of claim 2, wherein said inverted repeat comprises a direct repeat polynucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 2, 3, 4, and 5. Integration vector. 7. The non-integrated vector according to claim 1, which is a non-integrated virus vector. 8. An adenovirus-based vector comprising said polynucleotide, an inverted repeat, a polynucleotide encoding a transposase, and a repetitive terminal repeat flanking a combination of control sequences. Item 2. The non-integrated vector according to Item 1. 9. The non-integrated vector according to claim 8, which is a helper-dependent adenovirus vector. 10. The non-integratable vector of claim 1, wherein the polynucleotide flanked by inverted repeats comprises a non-coding sequence. 11. The control sequence is a first control sequence, and the polynucleotide flanked by the inverted repeats comprises a coding sequence operably linked to a second control sequence. The non-integrative vector of claim 1. 12. The non-integratable vector of claim 1, wherein said operator sequence is selected from the group consisting of a lac operator and a tetracycline response element. 13. The non-integratable vector of claim 1, further comprising a polynucleotide encoding a control polypeptide. 14. The non-integratable vector of claim 13, wherein said operator sequence comprises a lac operator sequence, and wherein said polynucleotide encoding said control polypeptide encodes LacI. 15. The operator sequence comprises a tetracycline responsive element, and the polynucleotide encoding the control polypeptide encodes a polypeptide that binds to the tetracycline responsive element under appropriate conditions.
14. The non-integrative vector according to claim 13. 16. The non-integratable vector according to claim 15, wherein said regulatory polypeptide is selected from the group consisting of tTA and rtTA. 17. The non-integrated vector according to claim 1, which is a plasmid vector. 18. A polynucleotide flanked by inverted repeats that bind to a transposase, a polynucleotide encoding a transposase, and a polynucleotide encoding a control polypeptide that alters the expression of the polynucleotide encoding the transposase. A non-integrative vector comprising. 19. The transposase is an SB polypeptide.
Non-integratable vector. 20. The non-integratable vector of claim 19, wherein the amino acid sequence of the SB polypeptide is at least about 80% homologous to the sequence of SEQ ID NO: 9. 21. The non-integratable vector of claim 20, wherein said SB polypeptide has the amino acid sequence of SEQ ID NO: 9. 22. The non-integratable vector of claim 19, wherein said inverted repeat comprises the sequence of SEQ ID NO: 7 or 8. 23. The method of claim 19, wherein said inverted repeat comprises a direct repeat polynucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 2, 3, 4, and 5. Integration vector. 24. The non-integrated vector according to claim 18, which is a non-integrated virus vector. 25. An adenovirus-based comprising a repetitive terminal repeat flanking a combination of said polynucleotide, an inverted repeat, a polynucleotide encoding a transposase, and a polynucleotide encoding a control polypeptide. 20. The non-integrative vector according to claim 18, which is a vector. 26. The helper-dependent adenovirus vector.
Non-integratable vector. 27. The transposase-encoding polynucleotide is operably linked to a control sequence comprising an operator sequence.
18 non-integratable vectors. 28. The non-integratable vector of claim 27, wherein said operator sequence comprises a lac operator sequence, and wherein the polynucleotide encoding said control polypeptide encodes LacI. 29. The operator sequence comprising a tetracycline response element, and wherein the polynucleotide encoding the regulatory polypeptide is tT
28. The non-integratable vector of claim 27, wherein the vector is selected from the group consisting of A and rtTA. 30. The non-integratable vector of claim 18, wherein said polynucleotide flanked by inverted repeats comprises a non-coding sequence. 31. The non-integratable vector of claim 18, wherein said polynucleotide flanked by inverted repeats comprises a coding sequence operably linked to a control sequence. 32. The non-integrative vector according to claim 24, which is a plasmid vector. 33. A method for producing a transgenic cell, comprising operably linking a cell to a selected polynucleotide flanked by inverted repeats that bind to a transposase, and a control sequence comprising an operator sequence. A genomic DNA containing the selected polynucleotide by contacting the non-integrating vector comprising the polynucleotide encoding the selected transposase, and thereby expressing the transposase in the cell. Forming said transgenic cell. 34. The non-integrative vector comprising the polynucleotide,
35. The method of claim 33, which is an adenovirus vector comprising a repetitive terminal repeat flanking a combination of an inverted repeat, a polynucleotide encoding a transposase, and a regulatory sequence. 35. The non-integrated vector is a plasmid vector.
34. The method of claim 33. 36. The transposase is an SB polypeptide.
the method of. 37. The method according to claim 37, wherein the operator sequence is a lac operator.
33 ways. 38. The method of claim 37, wherein expressing the transposase comprises maintaining the absence of LacI polypeptide in the cell. 39. The method according to claim 39, wherein expressing the transposase is performed on the cells.
38. The method of claim 37, comprising adding IPTG. 40. The non-integrative viral vector further comprises a polynucleotide encoding a control polypeptide, wherein the control polypeptide binds to the operator sequence under appropriate conditions, and 34. The method of claim 33, which controls the expression of a polynucleotide encoding the transposase of the above. 41. The method of claim 40, wherein said operator sequence comprises a lac operator sequence, and wherein the polynucleotide encoding said control polypeptide encodes LacI. 42. The operator sequence comprises a tetracycline response element and the polynucleotide encoding the control polypeptide is tTA
41. The method of claim 40, wherein 43. The operator sequence comprises a tetracycline response element and the polynucleotide encoding the control polypeptide is rtTA
41. The method of claim 40, wherein 44. The method of claim 33, wherein said polynucleotide flanked by inverted repeats comprises a polynucleotide selected from the group consisting of a non-coding sequence and a coding sequence. 45. The method of claim 33, wherein said cells are mammalian cells. 46. The method of claim 45, wherein said mammalian cells are human cells. 47. The method of claim 33, which is performed in vivo. 48. The method of claim 33, wherein said method is performed ex vivo. 49. The method of claim 33, wherein said method is performed in vitro. 50. A method for producing a transgenic organism, comprising: selecting a polynucleotide flanked by inverted repeats that bind to a transposase; a polynucleotide encoding the transposase; and a polynucleotide encoding the transposase. Contacting a non-integrating vector comprising a polynucleotide encoding a control polypeptide that alters the expression of a nucleotide, and thereby expressing the transposase in the cell, thereby comprising the selected polynucleotide. Forming a transgenic organism carrying genomic DNA. 51. The non-integrative vector comprising the polynucleotide,
52. The method of claim 50, which is an adenovirus vector comprising a repetitive terminal repeat flanking a combination of an inverted repeat, a polynucleotide encoding a transposase, and a regulatory sequence. 52. The non-integrated vector is a plasmid vector.
The method of claim 50. 53. The transposase is an SB polypeptide.
the method of. 54. The method of claim 50, wherein said transposase-encoding polynucleotide comprises a control sequence comprising an operator sequence. 55. The method of claim 54, wherein said operator sequence comprises a lac operator sequence. 56. The operator sequence comprising a tetracycline response element, and wherein the polynucleotide encoding the regulatory polypeptide is tTA
55. The method of claim 54, wherein 57. The operator sequence comprising a tetracycline response element, and wherein the polynucleotide encoding the control polypeptide is rtTA
55. The method of claim 54, wherein 58. The method of claim 50, wherein said polynucleotide flanked by inverted repeats comprises a polynucleotide selected from the group consisting of a non-coding sequence and a coding sequence. 59. The method of claim 50, wherein said cells are mammalian cells. 60. The method of claim 59, wherein said mammalian cells are human cells. 61. The method of claim 50, which is performed in vivo. 62. The method of claim 50, wherein said method is performed ex vivo. 63. The method of claim 50, wherein said method is performed in vitro. 64. A method for altering the phenotype of a cell, the cell being operable with a selected polynucleotide flanked by inverted repeats binding to a transposase, and a control sequence comprising an operator sequence. Contacting a non-integrating vector comprising a polynucleotide encoding a transposase ligated to, thereby expressing the transposase in the cell, thereby comprising the polynucleotide flanked by the inverted repeats. Forming a transgenic cell carrying the genomic DNA consisting of, and whether the phenotype of the transgenic cell or its progeny has been altered relative to a cell not carrying the selected polynucleotide. Determining the above. 65. A method of altering the phenotype of an organism, comprising the steps of: selecting a polynucleotide flanked by inverted repeats that bind to a transposase, a polynucleotide encoding a transposase, and a control polypeptide. Contacting a non-integrating vector comprising the encoding polynucleotide, resulting in expression of the transposase in the cell, results in possession of the genomic DNA comprising the polynucleotide flanked by the inverted repeats. And determining whether the phenotype of the transgenic organism or its progeny has been altered relative to a cell that does not carry the selected polynucleotide. The method comprising: 66. A method for preparing a nucleic acid supply system, comprising: a polynucleotide flanked by inverted repeat sequences binding to a transposase; and a transposase operably linked to a control sequence comprising an operator sequence. Constructing a non-integrated adenovirus-based viral vector comprising the polynucleotide, and packaging the non-integrated adenovirus-based viral vector under conditions in which the transposase is not expressed. The method comprising: 67. The method of claim 66, wherein said adenovirus-based viral vector is a helper-dependent adenovirus vector. 68. The operator sequence according to claim 68, wherein the operator sequence is a lac operator.
66 ways. 69. The method of claim 67, wherein said packaging comprises maintaining the presence of LacI such that LacI suppresses expression of a polypeptide encoding said transposase. 70. The non-integrative viral vector further comprises a polynucleotide encoding a regulatory polypeptide, wherein the polynucleotide is La
67. The method of claim 66, wherein said method encodes cI and said operator sequence comprises a lac operator sequence. 71. The non-integrative viral vector further comprises a polynucleotide encoding a regulatory polypeptide, wherein the polynucleotide is a tT
67. The method of claim 66, wherein A encodes and the operator sequence comprises a tetracycline response element. 72. The non-integrative viral vector further comprises a polynucleotide encoding a control polypeptide, wherein the polynucleotide is rt
67. The method of claim 66, wherein the TA encodes and the operator sequence comprises a tetracycline response element. 73. A method for producing a nucleic acid supply system, comprising: a polynucleotide flanked by inverted repeat sequences binding to a transposase; a polynucleotide encoding the transposase; and altering the expression of the polynucleotide encoding the transposase. Constructing a non-integrated adenovirus-based viral vector comprising a polynucleotide encoding a control polypeptide; and conditions for inhibiting the expression of the transposase by using the non-integrated adenovirus-based viral vector. Packaging underneath. 74. The method of claim 73, wherein said adenovirus-based viral vector is a helper-dependent adenovirus vector. 75. The method of claim 73, wherein said non-integrating viral vector further comprises an operator sequence operably linked to said transposase-encoding polynucleotide. 76. The operator sequence comprises a lac operator sequence, and the polynucleotide encoding the control polypeptide encodes LacI, and the LacI directs expression of the transposase-encoding polypeptide. 78. The method of claim 75, wherein said inhibiting. 77. The operator sequence comprising a tetracycline response element, and wherein the polynucleotide encoding the regulatory polypeptide is tTA
76. The method of claim 75, wherein 78. The operator sequence comprises a tetracycline response element and the polynucleotide encoding the control polypeptide is rtTA
76. The method of claim 75, wherein 79. A method of treating a mammalian patient, comprising: administering to the patient a polynucleotide encoding a therapeutic agent operably linked to a first control sequence; and an operator sequence. A polynucleotide encoding a transposase operably linked to the second control sequence, wherein the combination of the polynucleotide encoding the therapeutic agent and the first control sequence binds to the transposase. Administering a non-integrating viral vector flanked by sequences. 80. The method of claim 79, wherein said non-integrating viral vector is administered to an organ or tissue of a patient. 81. The method of claim 80, wherein said organ or tissue is selected from the group consisting of liver, nervous system, brain, lung, skin, cardiovascular system, heart, hematopoietic system, bone marrow, and muscle. 82. The method of claim 79, wherein said therapeutic agent is a polypeptide. 83. The method of claim 79, wherein said therapeutic agent is an RNA molecule. 84. The patient has a genetic disease characterized by substandard production of a polypeptide or RNA, and the therapeutic agent comprises the polypeptide or RNA. the method of. 85. A method of treating a mammalian patient, comprising: administering to said patient a polynucleotide encoding a therapeutic agent operably linked to a first control sequence; a polynucleotide encoding a transposase; A polynucleotide encoding a control polypeptide that alters expression of the polynucleotide encoding the transposase, wherein the combination of the polynucleotide encoding the therapeutic agent and the first control sequence binds to the transposase. Administering a non-integrating viral vector flanked by directional repeats. 86. A method of treating a mammalian patient, comprising: (a) explanting the patient's cells; (b) allowing the explanted cells to act on a first regulatory sequence. A polynucleotide encoding a transposase operably linked to a second control sequence comprising an operator sequence, wherein the polynucleotide encodes the therapeutic agent. Contacting a non-integrative viral vector, wherein the combination of the polynucleotide and the first control sequence is flanked by inverted repeats that bind to the transposase; and (c) implanting the transgenic cells into a patient. And producing the therapeutic agent in the patient. 87. The method of claim 86, wherein said cells are selected from the group consisting of hematopoietic stem cells, hepatocytes, myoblasts, fibroblasts, keratinocytes, endothelial cells and tumor cells. 88. The method of claim 87, wherein said cells are cancerous tumor cells. 89. The method of claim 86, wherein said therapeutic agent is a polypeptide. 90. The method of claim 86, wherein said therapeutic agent is an RNA molecule. 91. The patient has a genetic disease characterized by substandard production of a polypeptide or RNA, and the therapeutic agent comprises the polypeptide or RNA. the method of. 92. The method of claim 86, wherein said patient is a human. 93. A method of treating a mammalian patient, comprising: (a) explanting cells of the patient; (b) operably linking the explanted cells to a first regulatory sequence. A polynucleotide encoding a therapeutic agent, a polynucleotide encoding a transposase, and a polynucleotide encoding a control polypeptide that alters the expression of the polynucleotide encoding the transposase. Contacting a non-integrating viral vector, wherein the combination of the encoding polynucleotide and the first control sequence is flanked by inverted repeats that bind to a transposase; and (c) placing the transgenic cell in a patient Implanting to produce said therapeutic in said patient.