JP2002534984A - Mammalian serine racemase - Google Patents

Abstract

  (57) [Summary] High levels of D-serine occur in the brain of mammals, which are thought to be endogenous ligands for the "glycine site" of the NMDA receptor. We have purified soluble enzymes from rat brain that catalyze the direct racemization of L-serine to D-serine. The purified racemase has a molecular weight of 37 kDa and requires pyridoxal 5'-phosphate for its activity. The enzyme has a high selectivity for L-serine and does not racemize any other amino acids tested. The present inventors have isolated a polynucleotide sequence encoding a serine-racemase of a mammal, including a human. Compounds that modulate the activity of mammalian serine-racemase are useful for treating conditions and diseases involving over-stimulation of the NMDA receptor, such as stroke and various neurodegenerative diseases.

Description

DETAILED DESCRIPTION OF THE INVENTION

The United States Government has a purchase license for the present invention and a USPHS grant M
In limited circumstances, it has the right to require the patentee to license others on reasonable terms provided by the terms of the Research Science Grant DA00074 awarded by H-18501 and the National Institutes of Health. Have.

The present invention relates to the region of the mammalian amino acid racemase enzyme.

[0003] D- amino acid of the invention is remarkable in bacteria, invertebrates (1,2), only D- amino acids have been reported occasionally, the animal tissues contain only L- amino acids considered Had been. Recently, however, D-serine (3-6) and D-aspartic acid (7,8) have been reported in mammalian tissues, especially in the nervous system. Utilizing highly selective antibodies, we have localized D-aspartate in neuroendocrine tissue (9).
On the other hand, the immunohistochemical localization of D-serine closely resembles the N-methyl-D-aspartate (NMDA) receptor for the neurotransmitter glutamate. This means that D
-The results were also consistent with the results of chemical measurements of serine distribution (10, 11).

[0004] In the absence of added glycine, glutamate is unable to activate the NMDA receptor, suggesting that a "glycine site" exists at the receptor (12,13).
D-serine is three times more potent than glycine at this site (14), suggesting that D-serine is an endogenous ligand at this site. D-serine is localized only to type II astrocytes, a form of glial cell that, like the NMDA receptor, is concentrated in gray matter in the same area of the brain ( Ten). Stimulation of the glutamate receptor kainate subtype releases D-serine from type II astrocytes, triggers synaptic release of glutamate, and releases D-serine from astrocytes.
It means physiologically activating the NMDA receptor (10). In most parts of the brain, D-serine is much more similar to NMDA receptors than glycine, but in some areas, glycine and NMDA receptors are commonly localized. ,
This suggests that D-serine is a potent ligand for the receptor in most brain regions, but in some places glycine serves this purpose (11).

[0005] Activation of the NMDA receptor is an important pathological event in stroke and some neurodegenerative diseases, which leads to cell death. Inhibition of NMDA receptor activation is thus
It can also have beneficial effects in the treatment of any condition or disease, including acute or chronic neuronal death or dysfunction, resulting from DA receptor overactivation. Overactivation of the NMDA receptor is found in seizures, epilepsy, and chronic neurodegenerative diseases such as Parkinson's disease, Huntington's disease, motor neuron disease, and Alzheimer's disease. Thus, there is a need in the art to determine how D-serine is formed in the brain so that its concentration can be regulated in diseases associated with NMDA.

[0006] SUMMARY isolated mammalian serine racemase protein and polynucleotide molecules of the invention, as well as to provide methods of making these molecules is an object of the present invention. These and other objects of the invention are provided by one or more embodiments described below.

[0007] One embodiment of the present invention is a preparation of an isolated mammalian serine racemase having a specific activity of at least 0.003 μmol L-serine / mg / hr.

[0008] Another aspect of the present invention is an isolated and purified polynucleotide molecule encoding a mammalian serine racemase.

[0009] Yet another aspect of the invention is a host cell comprising an expression construct comprising a polynucleotide molecule encoding mouse serine racemase.

[0010] Yet another embodiment of the present invention is a method of making a mammalian serine racemase. Host cells containing an expression construct comprising a polynucleotide molecule encoding a mammalian serine racemase are cultured in culture. Mammalian serine racemase is recovered from the medium or the host cells.

[0011] Yet another aspect of the present invention is a method of screening a compound to identify a candidate therapeutic. The test compound is associated with a mammalian serine racemase. The activity of mammalian serine racemase is measured. If the test compound modulates the activity of mammalian serine racemase, it is identified as a candidate therapeutic.

The present invention thus provides a mammalian serine racemase molecule, a polynucleotide sequence encoding the molecule, a host cell, a method of producing a mammalian serine racemase, and a modulator of a mammalian serine racemase. Methods for screening test compounds for identification are provided. In particular, mammalian serine
Modulators of the racemase molecule can be used in therapy to treat acute or chronic nerve death or dysfunction resulting from overactivation of NMDA receptors.

[0013] Isolation of serine racemase according DETAILED DESCRIPTION The inventor of the invention is obtained by first purifying the enzyme that converts L- serine to D- serine. Bacteria contain significant levels of D-serine and many other D-amino acids. Many amino acid racemases have been purified in bacteria,
Serine-specific enzymes have not been previously identified (19-21).

[0014] Serine racemase appears to be a very conserved enzyme. For example,
The optimal pH, as well as the PLP requirement and behavior of the chromatographic system of rat brain enzymes purified by the inventors are similar to the activities characterized by crude silkworm preparations (18). Bacterial amino acid racemase, K _m values, alkaline pH optimum
, And a property similar to serine racemase in PLP requirement. Having an optimal pH at alkaline may reflect the mechanism of racemization because PLP non-enzymatically racemic amino acids at alkaline pH (22).

[0015] Serine racemase exhibits a Km value from L- to D-serine that is similar to the amount of L-serine in the brain and also supports the physiological synthesis of D-serine. is there. Under physiological conditions, the enzyme will mainly produce D-serine due to the very high Km value from D- to L-serine.

[0016] Mammalian serine racemase can be isolated from a homogenate of mammalian brain, such as rat, mouse or preferably human brain. Another form of mammalian serine racemase can be isolated from homogenates of other mammalian brains such as monkeys, pigs, cows, sheep, goats, guinea pigs, and the like. Enzymes can be partially or homogeneously purified using all or part of the method described in Example 1. This method involves ammonium sulfate fractionation, butyl sepharose,
The steps of Q-Sepharose, Mono-Q, and hydroxyapatite chromatography are used sequentially (Table 1).

Preferably, the isolated preparation of mammalian serine racemase comprises at least
0.003, 0.025, 0.075, 1, 2.5, or 5 μmol L-serine / mg / h
Serine can be converted to D-serine. The specific activity of the isolated mammalian serine racemase can be determined, inter alia, by the assay described in Example 2. Other methods known in the art can also be used.

[0018] Serine racemase is a relatively small soluble protein of 37 kDa. Mouse serine racemase has the amino acid sequence shown in SEQ ID NO: 8. Rat serine racemase comprises the amino acid sequence shown in SEQ ID NOs: 6 and 7. Human serine racemase has SEQ ID NO: 2, 3, or
9 includes the amino acid sequence encoded by the nucleotide sequence shown in FIG. The protein contains a pyridoxal 5'-phosphate binding region (ELFQKTGSFKIRGA, amino acids 47-60 of SEQ ID NO: 8), which supports the biochemical prediction that serine racemase is a pyridoxal phosphate binding protein. (Figure 4
And 5).

The present invention also provides polypeptide fragments of mammalian serine racemase. The polypeptide fragment can include a mammalian serine racemase that is shorter than full length, and is at least 6, 8, 10, 13, 25 selected from SEQ ID NOs: 6, 7, 8, or 10.
, 27, 50, 100, 121, 150, 200, 250, or 300 contiguous amino acids, or the amino acid sequence encoded by the nucleotide sequence set forth in SEQ ID NO: 1, 2, 3, or 9 . One such polypeptide fragment is the pyridoxal 5'-phosphate binding region (amino acids 47-60 of SEQ ID NO: 8). Other polypeptide fragments of interest can be identified using routine protein analysis techniques known in the art. These techniques include hydrophobicity and hydrophilicity plots, correlation searches of various motifs, indicators of antigenicity, and Harlow (
Harlow) and Lane, “Antibody Laboratory Manual (ANTIBODIES-A LAB)
ORATORY MANUAL) (Cold Spring Harbor Laboratory, 1988), including but not limited to. The enzyme can be used to produce the mammalian serine racemase polypeptide by enzymatic reactive proteolysis of full length mammalian serine racemase. The polypeptide fragment can be used to generate antibodies, which can then be used to localize racemase in tissue.

[0020] Mammalian serine racemase proteins and polypeptides can also be produced by recombinant DNA methods or by chemical synthesis methods. SEQ ID NOS: 1, 2, 3 in known prokaryotic or eukaryotic expression systems for the production of recombinant serine racemase
Or a coding sequence such as that selected from the nucleotide sequences set forth in 9. Bacterial, yeast, insect, or mammalian expression systems are used, which are known in the art.

Alternatively, chemical synthesis methods such as solid phase peptide synthesis can be used to synthesize mammalian serine racemase proteins or polypeptides. Peptides, analogs,
Or a general means for the production of derivatives is B. Weinstein
Ed., "Chemistry and Biochemistry of Amino Acids, Peptides and Proteins (CHEMISTRY AND BIOCHE
MISTRY OF AMINO ACIDS, PEPTIDES, AND PROTEINS)-Survey of recent developments (AS
URVEY OF RECENT DEVELOPMENTS) (1983).

However, the produced mammalian serine racemase protein does not
It can include changes in the amino acid sequence related to the amino acid sequence encoded by SEQ ID NO: 1, 2, 3, or 9 that do not affect racemase activity. Guidance on determining which amino acid residues are conservatively substituted, inserted, or deleted without loss of serine racemase activity can be obtained from computer programs well known in the art, such as DNASTAR software. You can use it to find it. How the amino acid change affects the functionality of serine racemase can be readily determined by measuring serine racemase activity, as described in Example 2.

A preferred mammalian serine racemase protein is SEQ ID NO: 1, 2, 3, or 9
Has an amino acid sequence that exhibits at least 85%, 90%, 95%, 96%, or 97% identity to an amino acid sequence encoded by a polynucleotide having a coding sequence represented by More preferably, the molecules show at least 98% or 99% identity. The percent identity is determined by the Smith-Waterman homology search algorithm and uses an affine gap search with the following parameters: gap open penalty 12 and gap extension penalty 1. The Smith-Waterman homology search algorithm is based on Smith
h) and Waterman, Adv. Appl. Math. (1981) 2: 482-489.
Are disclosed.

SEQ ID NO: at least 6, 8, 10, 13, 25 selected from 6, 7, 8, or 10
, 27, 50, 100, 121, 150, 200, 250, or 300 contiguous amino acids, or a fusion protein comprising the amino acid sequence encoded by SEQ ID NO: 1, 2, 3, or 9 can also be constructed. The fusion proteins are useful for generating antibodies against the amino acid sequence of mammalian serine racemase and for use in various assay systems. For example, a mammalian serine racemase fusion protein can be used to identify proteins that interact with the enzyme and affect its racemase activity. Physical methods such as protein affinity chromatography, or activity assays based on libraries of protein-protein interactions such as yeast two-hybrid systems or phage display systems can also be used for this purpose. . Such methods are well known in the art and can also be used to screen for drugs.

A mammalian serine racemase fusion protein contains two protein segments fused together by peptide bonds. The first protein segment is at least 6, 8, 10, 13, 25, 27, 5 selected from SEQ ID NO: 6, 7, 8, or 10.
Includes 0, 100, 121, 150, 200, 250 or 300 contiguous amino acids, or the amino acid sequence encoded by SEQ ID NO: 1, 2, 3 or 9. The first protein segment can also be a full length mammalian serine racemase protein. The first protein segment may be N-terminal or C-terminal, whichever is convenient.

[0026] The second protein segment can be a full-length protein or protein fragment, or a polypeptide. Proteins commonly used in the construction of fusion proteins include β-galactosidase, β-glucuronidase, green fluorescent protein (GFP), and blue fluorescent protein (BFP).
), Glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT). Epitope tags including the histidine (His) tag, FLAG tag (Kodak), influenza hemagglutinin (HA) tag, Myc tag, VSV-G tag, and thioredoxin (Trx) tag can be used in the construction of fusion proteins. In addition to constructing fusion proteins, maltose binding protein (MBP), S-tag, Lex A DNA binding domain (DBD) fusion, GAL4 DNA
Binding domain fusions and herpes simplex virus (HSV) BP16 protein fusions are used.

The mammalian serine racemase fusion protein can be produced by covalently linking a first protein segment and a second protein segment, or by standard procedures in the field of recombinant DNA technology. . For example, a DNA construct comprising a nucleotide encoding the second protein segment and a coding sequence selected from the appropriate reading frame SEQ ID NO: 1, 2, 3, or 9 is generated and is known in the art. As has been described, recombinant DNA methods can be used to prepare fusion proteins by expressing the DNA construct in a host cell. Many kits for constructing fusion proteins are available from Promega Corporation (Madison, Wis.), Stratagene (La
Jolla, CA), Clontech (Mountain View, CA), Santa Cruz Biotechnology (San
ta Cruz, CA), MBL International Corporation (MIC; Watertown, MA), and
It is commercially available from companies such as Quantum Biotechnologies (Montreal, Canada; 1-888-DNA-kit).

To obtain a preparation of antibodies that specifically bind to an epitope of a mammalian serine racemase, the isolated mammalian serine racemase protein, polypeptide, or fusion protein can be used as an immunogen. In particular, the antibodies can be used to detect mammalian serine racemase in mammalian brain tissue or a fraction thereof. Antibodies can also be used to detect the presence of a mutation in the gene encoding mammalian serine racemase that results in under- or over-expression of the enzyme, or expression of the enzyme with a different size or electrophoretic mobility. can do.
As described below, antibodies can be used therapeutically to reduce the specific activity of serine racemase.

[0029] Antibodies that specifically bind to an epitope of a mammalian serine racemase protein, polypeptide, or fusion protein can be analyzed by Western blot, ELISA, radioimmunoassay, immunohistochemical assay, immunoprecipitation, or in the art. It can be used in immunochemical assays, including but not limited to other known immunochemical assays, and if they are used in such immunochemical assays, At least 5 times more than the detection signal of any protein
Immunoassays such as 2-fold, 10-fold, or 20-fold higher provide the detection signal. Preferably, an antibody that specifically binds to an epitope of mammalian serine racemase is insensitive to other proteins in an immunochemical assay and is capable of immunoprecipitating the enzyme or a fragment thereof from solution.

A mammalian serine racemase specific antibody is a mammalian serine having an amino acid sequence encoded by a polynucleotide molecule comprising the nucleotide sequence set forth in SEQ ID NO: 1, 2, 3, or 9. -It specifically binds to an epitope present on racemase. Generally, at least 6, 8, 10, or 12 contiguous amino acids are required for epitope formation. However, epitopes that include discontinuous amino acids require additional amino acids, for example, at least 15, 25, or 50 amino acids.

For example, by routine screening of polypeptides of mammalian serine racemase for antigenicity, or by Harlow and Lane
Ne) (1988), Hop and Wood, Proc. Natl. Acad. Sci. USA 78, 3824-28 (1981), Hop and Wood, Mol.
20, 483-89 (1983), and theoretical methods of selecting antigenic regions of proteins using methods such as those disclosed by Sutcliffe et al., Science 219, 660-66 (1983). Can be used to select particularly antigenic epitopes of mammalian serine racemase.

[0032] Any type of antibody known in the art can be generated that specifically binds to an epitope of mammalian serine racemase. For example, polyclonal and monoclonal antibody preparations can be made using standard methods well known in the art. Similarly, single-chain antibodies can be prepared. For example, a single chain antibody that specifically binds to an epitope of mammalian serine racemase can be isolated from a single chain immunoglobulin display library. This is well known in the art and is described, for example, in Hayashi et al., 199
5, Gene 160: 129-30. Single chain antibodies can also be made using DNA amplification methods such as the polymerase chain reaction (PCR), using hybridoma cDNA as a template. Thirion et al., 1996, Eur. J. Cancer Prev. 5: 507-11.

[0033] Single-chain antibodies can be monospecific or bispecific, and can be bivalent or tetravalent. Methods for making tetravalent bispecific single chain antibodies are disclosed, for example, by Coloma and Morrison, 1997, Nat. Biotechnol. 15: 159-63. Methods for making bivalent, bispecific, single-chain antibodies are, inter alia, the
llender) and Boss, 1994, J Biol. Chem. 269: 199-206.

A nucleotide sequence encoding a single chain antibody can be constructed manually or by automated nucleotide synthesis, as shown below, and cloned into an expression construct using standard recombinant DNA techniques. And can be introduced into a cell to express the coding sequence. Alternatively, single-chain antibodies can be produced directly, for example, using the fiber phage method. Verhaar et al., 199
5, Int. J Cancer 61: 497-501; Nicholls et al., 1993, J. Immunol. Meth. 165: 81-91.

For use in therapy, monoclonal and other antibodies may be “humanized” to prevent a patient from mounting an immune response against the antibody. Such antibodies, when used directly in therapy, may be sufficiently similar in sequence to human antibodies or may require some important residues to be changed. For example, sequence differences between rodent antibodies and human sequences can be minimized by substituting residues that differ from the human sequence, e.g., by site-directed mutagenesis of individual residues or by total mutagenesis. There is a method of replacing the complementarity determining regions. Alternatively, humanized antibodies can be produced using the recombinant methods described in GB2188638B. As disclosed in U.S. Pat.No. 5,565,332, an antibody that specifically binds to an epitope of mammalian serine racemase comprises an antigen binding site, either partially or wholly humanized. Can be.

[0036] Other types of antibodies can be constructed and used in the methods of the invention. For example,
For example, chimeric antibodies can be constructed as disclosed in WO 93/03151. Polyvalent and multispecific binding proteins derived from immunoglobulins such as "diabodies" described in WO 94/13804 can also be prepared.

[0037] The antibodies of the present invention can be purified by methods well known in the art. For example, the antibody may be a mammalian serine racemase protein, a polypeptide,
Alternatively, it can be affinity purified by passing through a column to which the fusion protein is bound. Bound antibody can be eluted from the column using a high salt buffer.

In one embodiment of the present invention, serine racemase can be inhibited by administering an antibody that specifically binds to serine racemase to a patient in need of the inhibition. The preparation of such antibodies has been described previously.

The coding sequence for the mammalian serine racemase protein is shown in SEQ ID NOs: 1, 2, 3, and 9. SEQ ID NO: 1 is the coding sequence for mouse serine racemase. SEQ ID NO: 9 contains the coding sequence for mouse serine racemase. SEQ ID NOs: 2 and 3 encode the N- and C-termini of human serine racemase, respectively. The full length cDNA encoding the human enzyme can be obtained using a polynucleotide probe selected from SEQ ID NO: 2, 3, or 9 for screening human cDNA using methods known in the art. You can get it. Alternatively, a human expression library can be screened using the specific antibodies of the invention for cloning a cDNA that expresses human serine racemase.

The isolated and purified mammalian serine racemase polynucleotide molecule of the present invention is subgenomic and does not include the entire chromosome. Preferably, the polynucleotide is free of introns.
The isolated and purified polynucleotide molecule of the present invention can be single-stranded or double-stranded, and has at least 362, 400, 500, 600 selected from SEQ ID NO: 1 or 9.
, 700, 800, 900, or 1000 contiguous nucleotides, or SEQ ID NO: 1,
2, 3 or 9 can be included.

The complementary strand of the nucleotide sequence shown in SEQ ID NOs: 1, 2, 3 and 9 is
It is a contiguous nucleotide sequence forming a Watson-Crick base pair with the contiguous nucleotide sequence of SEQ ID NOs: 1, 2, 3, and 9. The complementary strand of the nucleotide sequence shown in SEQ ID NOs: 1, 2, 3, and 9 is a polynucleotide in the present invention, and can be used, for example, to provide antisense oligonucleotides, primers, and probes. . The antisense oligonucleotides, primers, and probes of the present invention comprise SEQ ID NOs: 1, 2, 3, and 9
At least 11, 12, 15, 20, 25, complementary to the coding sequence shown in
It may include 30, 50, or 100 contiguous nucleotides. The complement of the entire coding sequence can also be used.

A degenerate nucleotide sequence encoding the amino acid sequence of a mammalian serine racemase protein, and at least 85%, 90%, 95%, 96% of the nucleotide sequence shown in SEQ ID NOs: 1, 2, 3 and 9 , 97%, 98%, or 99% identity are also polynucleotides of the invention. Percent sequence identity is determined using, for example, a computer program using the Smith-Waterman algorithm, such as that performed by the MPSRCH program (Oxford Molecular) using an affine gap search with the following parameters: -Open penalty 12 and gap extension penalty 1.

The code set forth in SEQ ID NO: 1, 2, 3, or 9 having at most 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, or 35% base pair mismatch The nucleotide sequence that hybridizes to the sequence or its complement is a polynucleotide of the present invention. For example, wash conditions (2 x SSC (0.3 M sodium chloride, 0.03 M sodium citrate, pH 7.0), 0.1% SDS, twice at room temperature, 30 minutes each wash;
x SSC, 0.1% SDS, wash once at 50 ° C. for 30 minutes; then 2 × SSC, twice at room temperature, wash for 10 minutes each) and SEQ ID NO: 1, 2, 3 or at most Homologous polynucleotide sequences containing about 25-30% base pair mismatches can be identified. More preferably, homologous nucleic acid strands contain 15-25% base pair mismatches, more preferably 5-15% base pair mismatches.

Polynucleotides encoding other mammalian serine racemases can be engineered with appropriate probes or primers to express cDNA in other mammals, such as monkeys, pigs, cows, sheep, goats, or guinea pigs. The library can be identified by screening. Similarly, serine racemase enzymes from non-mammalian species, such as yeast and Drosophila, can be produced using degenerate probes or primers based on the polynucleotide sequences disclosed herein. Can be identified by screening a cDNA expression library derived from the above species. The _Tm value of double-stranded DNA decreases by 1-1.5 ° C for each 1% decrease in homology (Bonner et al., J. Mol. Biol. 81, 123 (1973)). A polynucleotide having a nucleotide sequence as set forth in SEQ ID NO: 1, 2, 3 or 9 is hybridized with a putative homologous polynucleotide, and SEQ ID NO: 1, 2,
Compare the melting temperature of the hybrid with the polynucleotide having 3 or 9 and the polynucleotide completely complementary to this sequence to the melting temperature of the test hybrid, and calculate the number or percentage of base pair mismatches in the test hybrid. hand,
Polynucleotides having mammalian or non-mammalian serine racemase homology can be identified.

[0045] Nucleotide sequences that hybridize under stringent hybridization and / or wash conditions to the coding sequences set forth in SEQ ID NOs: 1, 2, 3, or 9 are also polynucleotides of the invention. Stringent washing conditions are known and understood in the art, for example, see Sambrook et al., "MOLECULAR CLONING: A LABORATORY MANUAL," Second Edition, 1989, pages 9.50-9.51.

In general, stringent hybridization conditions include combinations of temperature and salt concentration that are about 12-20 ° C. below the calculated T _m of the hybrid under consideration. SEQ ID NOS: 1, 2, 3, and 9 with a polynucleotide sequence exhibiting 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity The hybrid Tm value can be calculated, for example, using the formula of Bolton and McCarthy, Proc. Natl. Acad. Sci. USA 48, 1390 (1962): T _m = 81.5 ° C. -16.6 (log ₁₀ [Na ⁺ ]) + 0.41 (% G + C)-0.63 (% formaldehyde)-600 /
l, where l = the length of the hybrid in base pairs. Stringent wash conditions include, for example, 4 x SSC at 65 ° C or 50% at 42 ° C.
Contains formaldehyde, 4 x SSC, or 0.5 x SSC at 65 ° C, 0.1% SDS and the like. High stringency washing conditions include, for example, 0.2 × SSC at 65 ° C.

The polynucleotides of the present invention can be isolated and purified in the absence of other nucleotide sequences using standard nucleic acid purification techniques. For example, restriction enzymes and probes can be used to isolate polynucleotide fragments containing the coding sequence for mammalian serine racemase. The isolated and purified polynucleotide is
A preparation that is completely or free of at least 90% of other molecules.

A complementary DNA (cDNA) molecule that encodes a mammalian serine racemase protein is also a polynucleotide of the present invention. cDNA molecules can be produced using standard mRNA techniques for mammalian serine racemase and using standard molecular biology techniques.
cDNA molecules are subsequently known in the art and are described in Sambrook.
Can be replicated using molecular biology techniques disclosed in manuals such as 1989. Using genomic DNA or cDNA as a template, amplification techniques such as the polymerase chain reaction (PCR) can be used to obtain additional copies of the polynucleotides of the present invention.

Alternatively, synthetic chemistry techniques can be used to synthesize the polynucleotide molecules of the present invention. The degeneracy of the genetic code acknowledges that an alternative nucleotide sequence encoding a mammalian serine racemase protein has been synthesized. All such nucleotide sequences are within the scope of the present invention.

The present invention also provides polynucleotides that can be used to detect a sequence encoding a mammalian serine racemase, for example, in a hybridization protocol such as Northern or Southern blotting, or in situ hybridization. Provide a probe. The polynucleotide of the present invention
The probe is at least 12, 13, 14 selected from SEQ ID NO: 1, 2, 3, or 9
, 15, 16, 17, 18, 19, 20, 30, or 40 or more contiguous nucleotides. A polynucleotide probe of the invention can include a detectable label, such as a radioisotope label, a fluorescent label, an enzymatic reactive label, or a chemiluminescent label.

Using recombinant DNA technology, the polynucleotides of the present invention can be ligated with other polynucleotide sequences to form an expression construct. Such expression constructs can be used in host cells to express all or a portion of a mammalian serine racemase, such as a mouse, rat or human serine racemase. The expression constructs of the present invention include a polynucleotide segment encoding the desired amino acid sequence and a promoter that functions in a particular selected host cell. One of skill in the art can readily select an appropriate promoter from among many cell type-specific promoters known and used in the art. The polynucleotide segment is located downstream of the promoter. Transcription of the polynucleotide segment is initiated from the promoter. The expression construct can also include a transcription terminator that is functional in the host cell. The expression construct can be linear or circular, and if desired,
It can include sequences for self-replication.

[0052] Host cells containing the expression constructs can be either prokaryotic or eukaryotic. Various host cells in mammalian, yeast, bacterial, or insect expression systems are available and can be used to express the construct. Suitable mammalian host cells include, for example, monkey COS cells, Chinese hamster ovary (CHO) cells, human kidney 29
3 cells, human epidermal A431 cells, human Colo205 cells, 3T3 cells, CV-1 cells, other transformed primate cell lines, normal diploid cells, cells derived from in vitro primary culture of tissues Strains, primary explants, HeLa cells, mouse L cells, neonatal hamster kidney cells, HL-60, U937, HaK or Jurkat cells and the like.

[0053] Yeast or prokaryotic host cells can also be used to produce mammalian serine racemase. Suitable yeast strains include Saccharomyces cerevisiae, SchizoSaccharo
myces pombe), Kluyveromyces strain, Candida (C
andida), or any yeast strain capable of expressing a heterologous protein. Suitable bacterial strains include Escherichia coli, Bacillus sabti
lis), Salmonella typhimurium, or any bacterial strain capable of expressing a heterologous protein. If the protein is produced in yeast or bacteria, it may need to be modified using known chemical or enzymatic methods to obtain a functional racemase. Techniques for such modifications are:
It is well known in the art.

[0054] Mammalian serine racemase can also be produced in insect expression systems.
For example, materials and methods for baculovirus / insect cell expression systems are described, for example, in Invit
rogen, San Diego, Calif., USA in kit form (the MaxBat Registere
d TM kit) is commercially available and is also available as Summers and Smith,
Texas Agricultural Experiment Report, 1555 (1987)
Such methods are well known in the art, as described in Station Bulletin No. 1555 (1987).

According to one embodiment of the present invention, the mammalian serine racemase is an isolated and purified polynucleotide molecule encoding the racemase under suitable culture conditions for expressing the recombinant protein. Is produced by culturing a host cell containing The resulting expressed protein can then be purified from either the medium or the host cells using known techniques as disclosed in Example 2.

The racemase can be expressed in a manner that facilitates purification. It can be expressed, for example, as a fusion protein such as maltose binding protein (MBP), glutathione-S-transferase (GST) or thioredoxin (TRX). Kits for expression and purification of such fusion proteins are available from New England BioLab (Beverly, Mass.),
It is commercially available from Pharmacia (Piscataway, NJ) and Invitrogen, respectively. The protein can also be epitope-added and subsequently purified using antibodies specific for the epitope. One such epitope ("Flag
") Is commercially available from Kodak (New Haven, Conn.). Monoclonal antibodies that recognize the "Flag" epitope are also commercially available (Kodak Scientific Imagi
ng Systems).

[0057] The expression constructs can be introduced into host cells using any technique known in the art. These techniques include transferrin-polycation mediated DNA transfer, transfection of naked or encapsulated nucleic acid, liposome-mediated cell fusion, intracellular transport of DNA-coated latex beads, protoplast fusion, viral infection , Electroporation, "gene gun", and calcium phosphate mediated transfection.

[0058] Virus-based vectors can be used to introduce the expression constructs of the present invention into host cells. Recombinant retroviruses are described, for example, in Mann et al., Cell.
33: 153, 1983, Cane and Mulligan, Proc. Natl. A
cad. Sci. USA 81: 6349, 1984 and Miller et al., Human Gene Therapy.
1: 5-14, 1990; U.S. Pat.Nos. 4,405,712, 4,861,719, and 4,980
, 289, and WO 89 / 02,468, WO 89 / 05,349, and WO 90 / 02,806. A recombinant adenovirus vector can be prepared according to the disclosure provided in this application (
Berkner, Biotechniques 6: 616, 1988, and Rosenfeld et al., Science 252: 431.
, 1991, WO 93/07283, WO 93/06223, and WO 93/07282). Adeno-associated virus vectors can also be used to deliver a polynucleotide of the invention to a host cell. In vitro use of adeno-associated virus vectors has been described by Chattajee et al., Science 258: 1485-1488 (1992), Walsh et al., Proc. Natl. Aca.
d. Sci. 89: 7257-7261 (1992); Walsh et al., J. Clin. Invest. 9
4: 1440-1448 (1994), Flotte et al., J Biol. Chem. 268: 3781-379.
0 (1993), Ponnazhagan et al., J Exp. Med. 179: 733-738 (19
94), or Miller et al., Proc. Natl. Acad. Sci. 91: 10183-10187 (
1994), Einerhand et al., Gene Ther. 2: 336-343 (1995), Luo et al., Exp. Hematol. 23: 1261-267 (1995), and Zhou et al., Gene Therapy 3. : 223-229 (1996). The use of these mediators in vivo is described in Flotte et al., Proc. Natl. Acad. Sci. 90:
10613-10617 (1993), and Kaplitt et al., Nature Genet. 8:14.
8-153 (1994).

Other viruses used to construct the vector include the herpes simplex virus (Kit et al., Adv. Exp. Med. Biol. 215: 219, 1989) (ATCC VR-977; ATCC
VR-260); Nature 277: 108, 1979), human immunodeficiency virus (EPO 386,882, Buc
hschacher et al., J. Vir. 66: 2731, 1992), and measles virus (EPO 440,219).
) (ATCC VR-24); A (ATCC VR-67; ATCC VR-1247). Any suitable vector known in the art can also be used to introduce a polynucleotide or expression construct of the invention into a host cell.

For physiological NMDA neurostimulatory transmission, endogenous D-serine is required. D-
Treating brain slices or cultures with D-amino acid oxidase under conditions that completely degrade serine significantly reduces NMDA transmission, a reduction in oxidative activity, as measured neurophysiologically. It is measured similarly, whether by stimulating the action of nitrogen synthase activity or measuring the amount of cyclic GMP. Agents that inhibit mammalian serine racemase can be used to treat conditions or diseases that exhibit NMDA hyperexcitability. In particular, such conditions include those in which the NMDA receptor antagonist has shown efficacy.

For example, activation of the NMDA receptor is an important pathological event in stroke and some neurodegenerative diseases. Inhibitors of serine racemase can be used to reduce the amount of D-serine in the brain and thus reduce the activation of NMDA receptors.
Identification of agents that inhibit serine racemase has therefore led to overactivation of NMDA receptors, such as seizures, epilepsy, and chronic neurodegenerative diseases such as Parkinson's disease, Huntington's disease, motor neuron disease, and Alzheimer's disease Are important in the treatment of any disease caused by acute or chronic neuronal death or dysfunction.

[0062] In one embodiment of the present invention, serine racemase is inhibited using an antisense oligonucleotide. The sequence of the antisense oligonucleotide is complementary to at least a portion of the coding sequence as set forth in SEQ ID NOs: 1, 2, 3, or 9. Preferably, the antisense oligonucleotide has at least 6
Length of nucleotides, but at least 8, 11, 12, 15, 20, 25, 30, 35, 40
, 45, or 50 nucleotides in length. Longer sequences can also be used.

[0063] Antisense oligonucleotides can be composed of deoxyribonucleotides, ribonucleotides, or a combination of both. Of alkyl phosphonates, phosphorothionates, phosphorodithionates, alkyl phosphonothionates, alkyl phosphonates, phosphoramidates, phosphates, carbamates, acetamidodates, carboxymethyl esters, carbonate esters, and phosphate triesters By covalently linking the 5 'end of one nucleotide to the 3' end of another nucleotide by a non-phosphoric diester bond between the nucleotides, the oligonucleotide can be manually or automatically synthesized. Can be synthesized. Brown, 1994, Meth. Mol. Biol. 20: 1
-8, see Sonveaux, 1994, Meth. Mol. Biol. 26: 1-72; Uhlmann et al., 1990, Chem. Rev. 90: 543-583.

In order for a duplex to be formed without hindrance between the antisense molecule and the complementary coding sequence of the polynucleotide encoding mammalian serine racemase, exact complementarity is (although this is desirable). But it is not necessary. For example, there are 2, 3, 4, or 5 or more contiguous nucleotide stretches that are exactly complementary to the coding sequence for mammalian serine racemase, and they are not complementary to adjacent coding sequences When interrupted by a stretch of contiguous nucleotides, an antisense molecule consisting of such a stretch can provide sufficient target specificity for mammalian serine racemase mRNA. Preferably, a stretch of contiguous nucleotides is at least 4, 5, 6, 7, or 8 nucleotides or more in length. Non-complementary intervening sequences are preferably 1, 2
, 3, or 4 nucleotides in length. One skilled in the art can readily use the calculated melting point for an antisense-sense pair to determine the degree of mismatch that is tolerated between a particular antisense oligonucleotide and a particular coding sequence. .

Antisense oligonucleotides can be modified without affecting their ability to hybridize to the coding sequence for mammalian serine racemase.
These modifications can occur within the antisense oligonucleotide, or at one or both termini. For example, the linkage between the nucleoside phosphates can be modified by adding a cholesteryl or diamine moiety with varying numbers of carbon residues between the amino group and the terminal ribose. Modifications of antisense oligonucleotides include modified bases and / or sugars where ribose is replaced with arabinose, or 3 ′ and 5 ′ where 3 ′ hydroxyl or 5 ′ phosphate groups are replaced. Oligonucleotides in which 'is substituted. These modified oligonucleotides can be prepared by methods well known in the art. Agrawal et al., Trends Biotechnol. 10: 152-158,
1992; Uhlmann et al., Chem. Rev. 90: 543-584, 1990;
lmann) et al., Tetrahedron. Lett. 215: 3539-3542, 1987.

[0066] Therapeutic components of the present invention can also include a pharmaceutically acceptable carrier.
Pharmaceutically acceptable carriers are well-known in the art. Such carriers include large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acid, polyglycolic acid, polymerized amino acids, amino acid copolymers, and inactivated virus particles. However, the present invention is not limited to these. For example,
Mineral salts such as hydrogen chloride, hydrogen bromide, phosphate or sulfate, and acetate;
Pharmaceutically acceptable salts can also be used, such as organic acid salts such as propionate, malonate, or benzoate. Therapeutic ingredients can also include liquids such as water, saline, glycerol, and ethanol, and bases such as wetting, emulsifying, or pH buffering agents. U.S. Pat.No. 5,422,120, WO 95/13796, WO 91/14445, or EP 524,96
The liposomes described in 8B1 can also be used as carriers for therapeutic ingredients.
Generally, the therapeutic ingredients of the invention will be prepared in an injectable form, either as a solution or a suspension; however, prior to injection, solutions in a liquid vehicle Alternatively, it can be prepared as a solid form suitable for suspension.

[0067] Administration of the antisense oligonucleotides or antibodies of the invention can include local or systemic administration, including injection, oral administration, gene gun, or catheterized administration. Various methods can be used to administer the therapeutic component directly to a specific site in the body. For example, targeted delivery via receptors can be used to deliver therapeutic components, including antisense oligonucleotides or antibodies, to specific tissues. Methods for delivery via the receptor include, for example, Findeis et al. (1993) Trends in Biotechnol. 11, 202-05;
) Et al. (1994), "Gene therapy: Methods and applications for direct gene transfer (GENE TERAPEUTI).
CS: METHODS AND APPLICATIONS OF DIRECT GENE TRNSFER) "(edited by JA Wolff);
Wu and Wu (1988), J. Biol. Chem. 263, 621-24;
u) et al. (1994), J Biol. Chem. 269, 54246; Zenke et al. (1990), Proc.
Natl. Acad. Sci. USA 87, 3655-59; described by Wu et al. (1991), J. Biol. Chem. 266, 338-42.

When the component comprises an antibody, an effective dose of the component can be from about 5 μg to about 50 μg / kg of the patient's body weight, from about 50 μg to about 5 mg / kg of the patient, about 10 μg / kg of the patient's body weight.
It ranges from 0 μg to about 500 μg, and from about 200 to about 250 μg per kg. Therapeutic ingredients containing antisense oligonucleotides range from about 100 ng to about 200 mg
About 500 ng to about 50 mg, about 1 μg to about 2 mg, about 5 μg to about 500 μg, or about 20 μg
To about 100 μg. Factors such as the mode of action and the effectiveness of transformation and expression are issues to consider, which will affect the dose required for the therapeutic ingredients of the present invention to achieve ultimate efficacy. If more expression is desired over a larger area of the tissue, re-administration of a larger amount of the therapeutic component, or the same but continuous dose, may affect the outcome of effective treatment. Can be used to give. In all cases, routine experimentation in clinical trials will determine the specific range for optimal therapeutic effect.

The present invention provides a method of screening a test compound to identify candidate therapeutics that modulate the activity of a mammalian serine racemase. The modulator is
The specific activity of mammalian serine racemase can be increased or decreased.
The test compound may be a pharmaceutical substance already known in the art or a compound whose pharmacological activity is not previously known. The compound may be naturally occurring or designed in the laboratory. It can be isolated from microorganisms, animals, or plants, can be produced using recombinant techniques, or can be synthesized by chemical synthesis methods known in the art.

The test compound is contacted with a mammalian serine racemase, such as a rat, mouse or human serine racemase. As described in Example 2, the activity of serine racemase can be measured. Any other suitable assay for serine racemase activity can be used.

If the test compound modulates the activity of a mammalian serine racemase, the test compound is identified as a candidate therapeutic. Preferably, the activity of mammalian serine racemase is increased or decreased by at least 50%, 60%, 70% or 80%. Most preferably, the activity is increased or decreased by 90%, 95%, 99% or 100%.

The entire contents of all references cited in this disclosure are incorporated herein by reference. The following examples are provided for illustrative purposes only and do not limit the scope of the invention, which has been described in broad terms above.

[0073] The following materials embodiment, after being used in the embodiment.

Amino acids, aminooxyacetic acid (AOAA), catalase, oxidized glutathione, hydroxylamine, leupeptin, luminol (sodium salt), pepstatin,
Phenylmethylsulfonyl fluoride, pyridoxal 5'-phosphate (PLP), o-phthaldialdehyde (OPA), L-homocysteic acid, and Tris were purchased from Sigma (St.
Louis). D-amino acid oxidase from pig kidney (EC 1.4.3.3)
, Dithiothreitol (DTT), and horseradish peroxidase, Boehrin
ger Mannheim. Ammonium sulfate and KH ₂ PO ₄ were purchased from JT Baker. Butyl Sepharose 4 Fast Flow, Q-Sepharose, Mono Q HR 5/5 were obtained from Pharmacia. Macroprep Ceramic Hydroxyapatite Type I (20 μM) was purchased from Bio-Rad. N-tert-butyloxycarbonyl-L-cysteine (L-Boc-cys) is available from Novabio
Obtained from chem. Other reagents are of analytical grade.

Example 1 This example illustrates the purification of mammalian serine racemase.

[0076] Sixty brains obtained from 10-14 day old Sprague-Dawley rats contained 5 volumes of ice-cold buffer A (10 mM KPi, pH 7.2, 50 mM KCl, 1 mM EDTA, 2 mM DTT, 15 μM PLP, 0.
(2 mM freshly prepared phenylmethylsulfonyl fluoride, 1 μg / ml leupeptin, 1 μg / ml pepstatin) and homogenized using a polytron. All subsequent steps were performed at 4 ° C. The homogenate was centrifuged at 40,000 × g for 20 minutes, and the supernatant was allowed to reach 45% saturation with ammonium sulfate while stirring. After the sedimentation operation for 40 minutes, the solution was centrifuged at 20,000 × g for 20 minutes. Pellets
Resuspended in buffer A with 20% ammonium sulfate. The suspension was left on ice for 1 hour and then centrifuged at 20,000 xg for 20 minutes to remove insoluble aggregates.

[0077] 70 ml of butyl hexane pre-equilibrated with buffer A containing 20% ammonium sulfate
The supernatant was added to the Sepharose column at 3 ml / min. The column was washed with 210 ml of 10% ammonium sulfate and the active fraction was eluted with buffer A containing 5% ammonium sulfate. The eluted material was precipitated by 50% ammonium sulfate and
Concentrated by centrifugation at 000xg. The pellet was resuspended in 6-8 ml of buffer A and 4 liters of buffer B (10 mM KPi, pH 7.2, 50 mM KCl, 1 mM EDTA, 2 mM DTT, 1 mM
(5 μM PLP). After dialysis, the suspension was centrifuged at 20,000 xg for 20 minutes to remove insoluble aggregates, and the supernatant was loaded onto a 3 ml Q-Sepharose column at 0.5 ml / min.

After washing with 10 ml of loading buffer, buffer B containing 250 mM NaCl
Eluted the protein. The eluted material was Centriprep 30 (Amicon, Lexin
gton, Mass.) and KCl-free buffer B to reduce salt concentration to 50 mM
Was diluted. Next, the suspension was loaded onto the Mono Q column at 0.5 ml / min. The column was washed with buffer B containing 150 mM KCl, and protein was removed from 158 mM.
Eluted with a linear gradient of KCl in the range of 188 mM.

The active fractions were pooled, concentrated with Centriplus 30 (Amicon, Lexington, Mass.) And diluted with Buffer B without EDTA and KPi. The procedure is EDTA and
It was repeated once more to reduce the concentration of KPi to 20 μM and 0.75 mM, respectively.
To enhance protein binding to hydroxyapatite, CaCl ₂ was added to this suspension.
Was added (final concentration 300 μM). The protein was applied to a 1 ml hydroxyapatite column at 0.1 ml / min and a linear gradient of 0.75 mM to 400 mM KPi under a buffer containing 50 mM KCl, 2 mM DTT, and 15 μM PLP. Eluted. The purified protein was generally eluted with KPi concentrations ranging from 0.75 mM to 30 mM.

For most applications, the purified protein was further enriched using Centriplus 30. The protein concentration was determined using the Coomassie Plus protein quantification reagent (Pierce
). PLP bound to the enzyme at room temperature was measured by recording the absorbance of the purified protein in the range of 500 nm to 280 nm using a lambda biospectrophotometer (Perkin Elmer). SDS gel electrophoresis showed a single band of the purified protein of approximately 37 kDa (FIG. 1).

The inventors have therefore used the successive steps of ammonium sulfate fractionation, butyl sepharose, Q-sepharose, mono-Q, and hydroxyapatite chromatography to purify the enzyme homogeneously ( table 1). The overall purification from the ammonium sulfate fraction is 12,500. Enzyme activity is obtained in a 30% yield. Interestingly, a clear increase was seen after the Q-Sepharose step, suggesting that the inhibitor was removed.

[0082] Serine racemase is a relatively small soluble protein of 37 kDa. The absorption spectrum shows that proteins that were not detected in small amounts did not provide a basis for enzyme activity. The magnitudes and ratios of absorbance at 280 nm, 340 nm, and 420 nm are very similar to those of known PLP enzymes (20, 23, 24). Essentially, this is only possible if all proteins are racemase requiring PLP.

The enzyme is stable without loss of activity when stored at 4 ° C. for 4 days. Frozen /
Even after two rounds of melting, only a modest decrease in activity occurs. The enzyme appears to be soluble, with no activity detected in the membrane preparation. The enzyme activity shows a sharp pH optima in the alkaline range, the optimal activity being pH 8-9, which is about 10 times higher than at pH 7 (FIG. 2). The enzyme activity is maximal at 37 ° C. and is inactivated by boiling.

Example 2 This example illustrates an assay for serine racemase activity.

The formation of D-serine was monitored by a chemiluminescence assay that specifically detects D-serine. Racemase activity is determined by the presence of 50 mM Tris-HCl (pH 8.0), 18 μl enzyme extract, 1 mM EDTA, 2 mM DTT, 15 μM pyridoxal 5′-phosphate (PLP) and 20 mM L-serine Expressed below. After incubation at 37 ° C. for 0.5 to 8 hours, the reaction was stopped by adding a final concentration of 5% trichloroacetic acid (TCA). A boiled enzyme extract was used as a blank. The precipitated protein was removed by centrifugation, and the supernatant was extracted twice with 1 ml of water-saturated diethyl ether to remove TCA. The concentration of D-serine was determined by incubating the sample with D-amino acid oxidase, which specifically degrades D-amino acids and produces α-keto acid, NH ₃ and hydrogen peroxide (16).

[0086] The production of hydrogen peroxide was quantified by the use of peroxidase and light emitting luminol. An aliquot of the 10 μl sample contains 100 μl of 100 mM Tris-HCl, pH 8.8, 10 U / ml peroxidase, and 8 μM luminol.
of culture medium. After a 10-20 minute delay required to reduce non-specific luminol, 10 μl of D-amino acid oxidase (75 U / ml) was added and the tube was gently mixed with a pipette tip . Maximum luminescence was recorded after 10-15 minutes at room temperature using a Monolight 2010 Luminometer (Analytical Luminescence Laboratory). The amount of D-serine in each sample was calculated relative to a standard curve. Measurements were reliable in the range of 50-2000 pmol D-serine per sample. The addition of a L-serine mM concentration did not change the measured value of D-serine. Alternatively, the amino acid enantiomer is derivatized with L-Boc cysteine and OPA, as described in (17), followed by a carbon 18 reverse phase column (RP18 Spheri- 5, 22 cm x 4.6 mm, Perkin Elmer). The results obtained in the chemiluminescence assay were the same as those obtained using HPLC.

The presence of traces of D-serine in commercially available L-serine reagents resulted in high blank values. Thus, the stock solution of L-serine (100 mM) was always pre-treated with 30 units of D-amino acid oxidase and 500 units of catalase for 3 days to remove D-serine contamination. The enzyme was precipitated by the addition of 5% TCA.
After removal of the TCA by extraction with diethyl ether, the L-serine solution was neutralized with NaOH and could be used without further purification, thereby substantially eliminating the contamination of D-serine. The same purification procedure was applied to L-alanine and L-threonine.

Example 3 This example illustrates that mammalian serine racemase activity follows the Michaelis-Menten type kinetics (FIG. 3).

When observing the conversion of L to D-serine, the K _m is about 10 mM and the V _max is 5 μmol / mg / h. The enzyme can also convert D- to L-serine, which occurs with lower affinity. The K _{m in} this direction is 60 mM, but the V _max is as high as 22 μmol / mg / h.

Example 4 This example demonstrates that the mammalian serine racemase is pyridoxal 5'-phosphate (PLP
) Is required.

Dialysis against 1,000 volumes of purification buffer without PLP for 16 hours results in a loss of enzyme activity, which can be restored by the addition of PLP. Aminooxyacetic acid (AOAA) and hydroxylamine, which inactivate PLP, inhibit enzyme activity (see
Four). Examination of the absorption spectrum of the enzyme confirms the importance of PLP. Thus, normal enzyme preparations show absorption peaks at 420 nm and 340 nm, which is a characteristic of PLP-dependent enzymes. 420 corresponding to the Schiff base complex of lysine and PLP in the active site
The peak at nm disappears with AOAA treatment (FIG. 5).

[0092] The sulfhydryl group can be used because oxidized glutathione significantly reduces enzyme activity.
It appears to be important for enzyme activity (Figure 4). We wondered if the conversion of L to D-serine was a by-product of different enzymatic activities with non-enzymatic racemization resulting in D-serine. Therefore, we monitored the amounts of L and D-serine by HPLC at different incubation times (Table 2). The increase in the production of D-serine proceeds in parallel with the stoichiometric decrease in the amount of L-serine, which makes it impossible for L-serine to be converted to any other compound by the enzyme.

In addition, we examined the purified enzyme for the presence of other enzymatic activities that may indirectly contribute to D-serine generation. The inventors found no evidence for pyruvate aminotransferase activity that there was no change in the amount of L-serine in the presence of serine, pyruvic acid. After extensive incubation of the enzyme with L-serine, we could not detect serine hydroxymethyltransferase activity, as long as glycine formation could not be detected. There was no evidence of serine dehydratase activity with a significant decrease in the amount of L-serine. Serine racemase is very selective for L-serine (Table 3). The enzyme showed 1.5% of the activity on L-serine on L-alanine, while showing no activity on L-threonine or L-aspartic acid.

Example 5 This example illustrates the cloning of a mammalian serine racemase.

The purified rat serine racemase was subjected to internal peptide sequence analysis and the following amino acid peptides were identified: LLIEPTAGVGLAAVLSQHFQTVSPEVK (SEQ ID NO: 6) HLNIQDSVHLTPVLTSSILNQIAGR (SEQ ID NO: 7). A Blast search using the blastp program did not reveal proteins showing significant homology to the peptide.

We used the tblastn program against the EST database,
t Search for proteins (accession number AAl70919 (mouse), AI173393, AA034
539, W89934, AA509764, AA833469) found several distinct ESTs sequences of unknown function covering the N-terminal and C-terminal regions. To obtain a full-length cDNA clone, we designed the following PCR primers based on the EST sequences we found in the database. They contain restriction enzyme sites for SalI and NotI: 5 'ACGCGTCGACCACCATGTGTGCTCAGTACTGC 3' (SEQ ID NO: 4) and 5 '
ATAAGATGCGGCCGCTTAAACAGAAACCGTCTG 3 '(SEQ ID NO: 5).

The full-length cDNA encoding mouse serine racemase was obtained from Clontech (Palo A
lto, CA) cDNA from mouse brain obtained by reverse transcription of polyA RNA purchased from
Was cloned by PCR. The coding sequence is shown in SEQ ID NO: 1. The corresponding deduced amino acid sequence is given in SEQ ID NO: 5.

Example 6 This example illustrates the expression of mammalian serine racemase.

The serine racemase was cloned into SalI / NotI on the mammalian expression vector PRK5. HEK 293 cells were transfected with the full length racemase using the calcium chloride method. Sawa et al., Proc. Natl. Acad
Cells were cultured in Dulbecco's modified Eagle's medium supplemented with penicillin and streptomycin, as described in Sci. USA 94, 11669-74 (1997). The medium was supplemented with 10 mM L-serine for measurement of D-serine production. Forty-eight hours post-transfection, media and cell pellets were analyzed for the presence of D-serine as described above.

Transfection of cells with cDNA encoding full-length serine racemase promoted a very significant increase in D-serine concentration in both the medium and the cell pellet (FIG. 6). Cells transfected with the vector alone show only traces of D-serine.

Example 7 This example illustrates the deduction of the coding sequence for human serine racemase.

Based on the mouse sequence, we searched public databases and found several human ESTS with unknown function that showed high homology to the mouse sequence.
We generated a partial sequence of the human serine racemase gene by aligning the 11 ESTS. The partial sequence includes the following contigs: Contig 1 (SEQ ID NO: 2) Contig 2 (SEQ ID NO: 3)

[0103] Contig 1 represents the N-terminus of human serine racemase, analyzed by a standard DNA alignment program, and contig 2 represents the C-terminus.

[0104]

[Table 1] Purification of serine racemase The enzyme was purified and the fraction was assayed for activity as previously described. The data is representative of typical purification results, and purification was repeated six times with similar results. ^a not detected

[0105]

[Table 2] Racemization of L-serine Racemase activity includes 50 mM Tris-HCl (pH 8.0), 4 mM L-serine, 40 μg / ml purified enzyme, 1 mM EDTA, 2 mM DTT, and 15 μM pyridoxal 5′-phosphate It was measured at 37 ° C. in the culture. Samples were analyzed for amino acid enantiomers by HPLC as described above.

[0106]

[Table 3] Substrate specificity of serine racemase Racemase activity was measured at 37 ° C. in a culture containing 50 mM Tris-HCl (pH 8.0), 20 mM L-amino acid. 40-100 μg / ml purified enzyme, 1 mM EDTA, 2 mM
DTT and 15 μM pyridoxal 5′-phosphate. After 8 hours, the reaction was stopped by the addition of 50% TCA and the samples were analyzed by HPLC as described above. This data is representative of three experiments performed with different preparations, and the three experiments show similar results.

References

[Sequence list]

[Brief description of the drawings]

FIG. 1. SDS / PAGE analysis of purified serine racemase. A 12% polyacrylamide gel was stained with Coomassie blue. Lane 1, molecular weight markers: myosin (200 kDa); β-galactosidase (116.7 kDa); phosphorylase b (9
7.4 kDa); bovine serum albumin (66.3 kDa); glutamate dehydrogenase (55.
Lactate dehydrogenase (36.5 kDa); carbonic anhydrase (31 kDa)
); Trypsin inhibitor (21.5 kDa). Lane 2, Mono Q column eluate containing 1 μg protein. Lane 3, eluate of hydroxyapatite column containing 0.5 ng of purified protein. Silver staining of the purified preparation showed no other bands.

FIG. 2. pH and temperature dependence of racemase activity. Figure 2A: Racemase activity is 37
At 50 ° C., 50 mM MES-Tris (pH 6.0 to 6.5), 50 mM Tris-HCl (pH 6.8 to 8.8)
), 50 mM CAPS-NaOH (pH 9 to 10.5), 20 mM L-serine, 40 to 100 μg / ml purified enzyme, 1 mM EDTA, 2 mM DTT, and 15 μM pyridoxal 5′-phosphate Was analyzed. Figure 2B: Racemase activity at different temperatures, 50 mM Tris
-Hydrochloric acid (pH 8.0), 20 mM L-serine, 40-100 μg / ml purified enzyme, 1 mM EDT
A, measured in culture containing 2 mM DTT and 15 μM pyridoxal 5′-phosphate. The reaction was stopped after 4 hours and analyzed by both chemiluminescence and HPLC assays. The experiment was repeated three times with different preparations with similar results.

FIG. 3. Kinetic parameters of the racemization reaction. The initial rate of racemase activity is at 37 ° C., 50 mM Tris-HCl (pH 8.0), 35 μg / ml purified enzyme, 1 mM ED
TA, 2 mM DTT, 15 μM pyridoxal 5′-phosphate, and different concentrations of L- or
Measured in media containing either D-serine. The reaction was stopped after 2 hours, when less than 10% of the substrate had been consumed. K _m and V _max values, Michaelis - were calculated using the equation Menten. Values are representative of three experiments with different enzyme preparations.

FIG. 4. Inhibition of serine racemase by sulfhydryl oxidation reaction with PLP inhibitor. Figure 4A: Enzyme activity was determined at 37 ° C at 50 mM Tris-HCl (pH 8.0), 20 mM L-
Serine, 40-100 μg / ml purified enzyme, 1 mM EDTA, 2 mM DTT, 10 μM pyridoxal 5′-phosphate, and different concentrations of either aminooxyacetic acid (○) or hydroxylamine (●) In the containing medium. FIG. 4B: Reaction medium and conditions as described in A were used except that DTT was excluded in the last step in enzyme preparation. Enzymes are available at different concentrations of oxidized glutathione (GSSG
) Was pre-incubated for 10 minutes.

FIG. 5: Absorption spectrum of purified serine racemase. Purified enzyme (70 μg / ml) was previously prepared for 10 minutes in the absence (control) or presence (AOAA) of 1 mM aminooxyacetic acid at 10 mM KPi (pH 7.2), 2 mM DTT, 1 mM of
EDTA was pre-incubated with medium containing 10 μM PLP. 420 and 3 when buffer alone or bovine serum albumin was used instead of serine racemase.
No clear peak in absorbance at 40 nm was observed.

FIG. 6. D-serine production in media (left) and in transformed cells (right) of cells transformed with cDNA encoding full-length serine racemase.

FIG. 7: Complete coding sequence of mouse serine racemase (SEQ ID NO: 9)
And its translated amino acid sequence.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12N 9/90 G01N 33/15 Z C12Q 1/533 33/50 Z G01N 33/15 C12N 15/00 ZNAA 33 / 50 5/00 A (31) Priority claim number 60 / 145,953 (32) Priority date July 28, 1999 (July 28, 1999) (33) Priority country United States (US) (81 ) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF) , CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SL, SZ, TZ, UG, ZW) ), EA (AM, Z, BY, KG, KZ, MD, RU, TJ, TM), AE, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CR, CU, CZ, DE, DK, DM, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC , LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor Wollosker Herman Baltimore, MD United States Maryland 111 Suite 906 The Johns Hopkins University (72) Inventor Chess Kevin United States Maryland Baltimore Market Place 111 Suite 906 The Johns Hopkins University (72) Inventor Masaaki Takahashi United States Maryland Baltimore Market Place 111 Suite 906 The Johns Hopkins University (72) Inventor Morte Jean-Pierre Baltimore Marketplace, 111 United States of America Maryland 111 Suite 906 The Johns Hopkins University (72) Inventor Brady Roscoe Oh. Junior United States of America Baltimore, Maryland Marketplace 111 Suite 906 The Johns Hopkins University (72) Inventor Ferris Christopher Dee. United States Maryland Baltimore Market Place 111 Suite 906 The Johns Hopkins University F-Term (Reference) 2G045 AA28 BB20 DA12 DA13 DA14 DA20 FB01 4B024 AA01 BA07 CA04 CA11 DA01 DA02 DA05 DA11 EA01 EA02 EA03 CC03 CC DD11 FF04 FF09 FF11 HH01 KK13 LL01 4B063 QA01 QA18 QQ39 QR19 QR57 QS36 QX02 4B065 AA01X AA57X AA87X AA91Y AA93Y AB01 BA01 CA27 CA44

Claims (38)

[Claims] 1. A preparation of an isolated mammalian serine racemase having a specific activity of at least 0.003 μmol L-serine / mg / h. 2. The preparation according to claim 1, wherein the specific activity is at least 0.025 μmol L-serine / mg / h. 3. The preparation according to claim 1, wherein the specific activity is at least 0.075 μmol L-serine / mg / h. 4. The method according to claim 1, wherein the specific activity is at least 1 μmol L-serine / mg / hour.
The described preparation. 5. The preparation according to claim 1, wherein the specific activity is at least 2.5 μmol L-serine / mg / h. 6. The method according to claim 1, wherein the specific activity is at least 5 μmol L-serine / mg / hour.
The described preparation. 7. The preparation of claim 1, wherein the racemase has an amino acid sequence as set forth in SEQ ID NO: 8. 8. The preparation of claim 1, wherein the racemase has an amino acid sequence as set forth in SEQ ID NO: 10. 9. The preparation according to claim 1, wherein the racemase is derived from a mouse. 10. The preparation according to claim 1, wherein the racemase is derived from a rat. 11. The preparation according to claim 1, wherein the racemase is of human origin. 12. The preparation of claim 1, wherein the racemase comprises an amino acid sequence as set forth in SEQ ID NOs: 6, 7, 8 or 10. 13. The racemase is determined by the Smith-Waterman homology search algorithm using affine gaps with SEQ ID NO: 8, SEQ ID NO: 10, gap open penalty 12 and gap extension penalty 1. An isolated mammal having a specific activity of 0.003 μmol L-serine / mg / hr, wherein the mammal has a sequence selected from the group consisting of SEQ ID NO: 8 or 10 and a sequence showing at least 85% identity. Preparation of serine racemase. 14. An isolated and purified polynucleotide molecule encoding a mammalian serine racemase. 15. The polynucleotide molecule of claim 14, which comprises a coding sequence for a mammalian serine racemase. 16. comprises a nucleotide sequence as set forth in SEQ ID NO: 1.
15. The polynucleotide molecule according to claim 14. 17. comprises a nucleotide sequence as set forth in SEQ ID NO: 2,
15. The polynucleotide molecule according to claim 14. 18. The polynucleotide molecule of claim 14, comprising the nucleotide sequence as set forth in SEQ ID NO: 3. 19. comprising a nucleotide sequence as set forth in SEQ ID NO: 9,
15. The polynucleotide molecule according to claim 14. 20. SEQ ID NO: 1, 2, 3 or 9 as determined by the Smith-Waterman homology search algorithm using affine gaps with a gap open penalty of 12 and a gap extension penalty of 1
An isolated and purified polynucleotide molecule encoding a mammalian serine racemase that exhibits at least 85% identity to a polynucleotide having a coding sequence as set forth in Table 1. 21. An expression vector comprising the polynucleotide molecule according to claim 14. An expression vector comprising the polynucleotide molecule according to claim 19. 23. An expression vector comprising the polynucleotide molecule according to claim 20. 24. A host cell comprising an expression construct comprising a polynucleotide sequence encoding a mammalian serine racemase. 25. A host cell comprising an expression construct comprising a polynucleotide sequence as set forth in SEQ ID NO: 1. 26. A host cell comprising an expression construct comprising a polynucleotide sequence as set forth in SEQ ID NO: 9. 27. A host cell comprising an expression construct comprising the polynucleotide of claim 20. 28. A method for producing a mammalian serine racemase, comprising the steps of: culturing the host cell of claim 24 in a medium; recovering the mammalian serine racemase from the medium or the host cell. . 29. A method for producing a mammalian serine racemase, comprising the steps of: culturing the host cell of claim 25 in a medium; and recovering the mammalian serine racemase from the medium or the host cell. . 30. A method for producing a mammalian serine racemase, comprising the steps of: culturing the host cell of claim 26 in a medium; and recovering the mammalian serine racemase from the medium or the host cell. . 31. A method for producing a mammalian serine racemase, comprising the steps of: culturing the host cell of claim 27 in a medium; recovering the mammalian serine racemase from the medium or the host cell. . 32. A method of screening a compound for identifying a candidate therapeutic comprising the steps of: contacting a mammalian serine racemase with a test compound; measuring the activity of the mammalian serine racemase; Identifying the test compound as a candidate therapeutic if modulating the activity of mammalian serine racemase. 33. The method of claim 32, wherein the candidate therapeutic inhibits the activity of a mammalian serine racemase. 34. The method of claim 32, wherein the candidate therapeutic increases the activity of a mammalian serine racemase. 35. The method of claim 32, wherein the mammalian serine racemase is derived from a mouse. 36. The method of claim 32, wherein the mammalian serine racemase is from a rat. 37. The mammalian serine racemase is of human origin.
32. The method according to 38. Mammalian serine racemase comprising at least 0.003 μmol L
33. The method of claim 32, having a specific activity of -serine / mg / hr.