JP2002521063A - Human CCR-2 gene polymorphism - Google Patents

Abstract

  (57) [Summary] The present invention relates to polymorphisms in the human CCR-2 gene, particularly to the discovery of two polymorphisms in the coding sequence of the CCR-2 gene and 11 polymorphisms in the promoter sequence of the CCR-2 gene. . The present invention also relates to methods and materials for analyzing allelic mutations in the CCR-2 gene, which are useful in diagnosing and treating CCR-2 ligand-mediated diseases such as rheumatoid arthritis and other inflammatory diseases. It is also related to the use of dimorphisms.

Description

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to polymorphisms in the human CCR-2 gene and to the corresponding novel allelic polypeptides encoded thereby. The present invention also relates to methods and materials for analyzing allelic mutations in the CCR-2 gene, which are useful in diagnosing and treating CCR-2 ligand-mediated diseases such as rheumatoid arthritis and other inflammatory diseases. Also related to the use of typeness.

[0002] MCP-1 is a CCR-2 receptor (also known as MCP-1 receptor)
Act through. MCP-2 and MCP-3 are at least partially MCP
It also acts through the -1 receptor.

[0003] MCP-1 is a member of the chemokine family of pro-inflammatory cytokines that mediate leukocyte chemotaxis and activity. MCP-1 is a CC chemokine, one of the most potent and selective T cells and mononuclear cell chemoattractants and activators known. MCP-1 is used for rheumatoid arthritis, glomerulonephritis, pulmonary fibrosis, restenosis (International Patent Application WO 94/09128), alveolitis (Jones et al., 1).
992, J. Immunol., 149, 2147) and the pathophysiology of a number of inflammatory diseases, including asthma. Other disease ranges in which MCP-1 is thought to play a role in pathology include atherosclerosis (see, for example, Koch et al., 1992, J. Cli).
n. Invest., 90, 772-779), psoriasis (Deleuran et al., 1996, J. Dermatological).
Science, 13, 228-236), delayed-type hypersensitiv
ity reaction of the skin), inflammatory bowel disease (Grimm et al., 1996, J. Leukocyte)
Biol., 59, 804-812), multiple sclerosis and brain trauma (Berman et al., 1996, J.I.
mmunol., 156, 3017-3023). MCP-1 inhibitors can also be useful in the treatment of stroke, reperfusion injury, ischemia, myocardial infarction and graft rejection.

[0004] CCR-2 polypeptides include two isomers, CCR-2A and CCR-2.
B are present and they are alternatively spliced variants of the single CCR-2 gene. The following publication may be cited: Organization and differential expression
of the Human Monocyte Chemoattractant Protein 1 Receptor Gene: Evidence
for the role of the carboxy-terminal tail in receptor trafficking, LM W
ong et al J Biol Chem 272, 1038-1045 (1997), especially with reference to FIG. 1; and International Patent Application WO 95/19436, Charo et al.

One example of a known polymorphism is Val64Ile, which may be cited in the following publications:
A chemokine receptor CCR2 allele delays HIV-1 disease progression and is
associated with a CCR5 promoter mutaiton, LG Kostrikis et al Nature Med
icine 4, 350-353 (1998); and The role of CCR5 and CCR2 polymorphisms in
HIV-1 transmission and disease progression, NL Michael et al Nature Med
icine 3, 1160-1162 (1997).

[0006] The CCR-2 gene has been cloned, and EMBL ACCESSION NO.
U80924 (5471 bp), and all positions of a polymorphism in a coding sequence are unless otherwise stated or clear from context, unless otherwise noted.
Regarding the position.

[0007] The genomic sequence of CCR-2 is contained in a BAC (Bacterial Artificial Chromosome) clone, 110P12 (Research Genetics), which contains EMBL ACC.
ESSION NO. U95626 (143068 bp).
All positions of a polymorphism in the promoter region relate to that position unless otherwise specified or clear from context.

[0008] The protein structure of CCR-2 has been disclosed (Molecular structure of chem.
okine receptors, R Horuk, Trends in Pharmaceutical Sciences 15, 159-165 (
1994)).

One approach uses knowledge of polymorphisms to help identify patients who are best suited for treatment with a particular drug (often referred to as “drug genetics”). Pharmacogenetics is also used in pharmaceutical research to support the drug selection process. Polymorphisms are used for mapping the human genome and for elucidating the genetic components of disease. The following references may be cited for detailed background and other uses of polymorphism detection in pharmacogenetics: Linder et al., (1997), Clinical Chemistry, 43,
254; Marshall (1997), Nature Biotechnology, 15, 1249; International Patent Application WO
97/40462, Spectra Biomedical; and Schafer et al. (1998), Nature.
Biotechnology, 16,33.

[0010] Clinical trials have shown that the response of patients treated with medicine is often different. Therefore, there is a need for improved approaches to drug design and treatment.

[0011] Point mutations in polypeptides are mentioned as follows: natural amino acids (
1 or 3 letters), position, new amino acid. For example, (provisionally) "D25K" or "Asp25Lys" means that aspartic acid (D) at position 25 has been changed to lysine (K). Multiple mutations in a single polypeptide are found between square brackets, with individual mutations separated by commas.

The present invention is based on the discovery of two single nucleotide polymorphisms (SNPs) in the coding sequence of the CCR-2 gene and the discovery of 11 SNPs in the promoter sequence of the CCR-2 gene.

According to an aspect of the present invention, there is provided a method of diagnosing a single nucleotide polymorphism in human CCR-2. The method is described in EMBL ACCESSION NO. U80
One or more of positions 2385 and 2649 in the coding sequence of the CCR-2 gene defined by position 924, and / or ACCES
SION NO. 40915, 41047, 41058, 41507, 4507 in the promoter sequence of the CCR-2 gene defined by the position of U95626
Determining the human nucleic acid sequence at one or more of positions 1768, 42401, 42598, 42573, 42723, 42874 and 43018;
And determining human constitution by reference to polymorphisms in the CCR-2 gene.

The term human includes both humans having or suspected of having a CCR-2 ligand-mediated disease and asymptomatic humans who can test for a predisposition or susceptibility to the disease. At each position, the human can be homozygous for the allele, or the human can be heterozygous.

[0015] The term single nucleotide polymorphism includes single nucleotide substitutions, nucleotide insertions and nucleotide deletions, and in the case of insertions and deletions, the insertion or deletion of one or more nucleotides at the position of the gene. Including loss.

In one aspect of the invention, preferably, the diagnostic method described herein comprises 2385
C and / or T are present in a single nucleotide polymorphism at the position.

In another aspect of the present invention, preferably, the diagnostic method described herein comprises 264
G and / or A are present at the single nucleotide polymorphism at position 9.

In another aspect of the present invention, preferably, the diagnostic method described herein comprises 409
A and / or T is present at the single nucleotide polymorphism at position 15.

In another aspect of the present invention, preferably, the diagnostic method described herein comprises a method comprising:
The presence or absence of an ACA insertion at the single nucleotide polymorphism at position 47.

In another aspect of the invention, preferably, the diagnostic method described herein comprises a method comprising:
At position 58, a single nucleotide polymorphism has C and / or A.

In another aspect of the present invention, preferably, the diagnostic method described herein comprises 415
The presence of C and / or A at the single nucleotide polymorphism at position 07.

In another aspect of the invention, preferably, the diagnostic method described herein comprises 417
A and / or T is present at the single nucleotide polymorphism at position 68.

In another aspect of the invention, preferably, the diagnostic method described herein comprises 424
A and / or G are present in the single nucleotide polymorphism at position 01.

In another aspect of the invention, preferably, the diagnostic method described herein comprises 425
The presence or absence of a T insertion at the single nucleotide polymorphism at position 98.

In another aspect of the invention, preferably, the diagnostic method described herein comprises 426
G and / or A are present in the single nucleotide polymorphism at position 73.

In another aspect of the invention, preferably, the diagnostic method described herein comprises 427
At position 23, a single nucleotide polymorphism has C and / or A.

In another aspect of the invention, preferably, the diagnostic method described herein comprises 428
A and / or G is present at the single nucleotide polymorphism at position 74.

In another aspect of the invention, preferably, the diagnostic method described herein comprises 430
A and / or T is present at the single nucleotide polymorphism at position 18.

[0029] The diagnostic method is preferably such that the sequence is difficult to amplify.
refractory mutation system) and restriction fragment length polymorphism.

The allelic variation at position 2385 consists of a single base substitution from C (the disclosed base) to preferably T. The allelic variation at position 2649 consists of a single base substitution from G (the disclosed base) to, preferably, A. The allelic variation at position 40915 is A
Consisting of a single base substitution from (the disclosed base) to preferably T. The allelic variation at position 41047 consists of a mutation from the absence (if disclosed) of the ACA insertion, preferably to the insertion. The allelic variation at position 41058 consists of a single base substitution from C (the disclosed base) to preferably A. The allelic variation at position 41507 is C (
Consisting of a single base substitution from A to the disclosed base). The allelic variation at position 41768 consists of a single base substitution from A (the disclosed base) to preferably T. The allelic variation at position 42401 can be from A (the disclosed base) to preferably G
Consisting of a single base substitution to The allelic variation at position 42598 indicates the absence of the insertion (
(If disclosed)) and preferably a single base substitution at the T insertion. 4267
The allelic variation at position 3 consists of a single base substitution from G (the disclosed base) to, preferably, A. The allelic variation at position 42723 consists of a single base substitution from C (the disclosed base) to preferably A. The allelic variation at position 42874 consists of a single base substitution from A (the disclosed base) to, preferably, G. The allelic variation at position 43018 consists of a single base substitution from A (the disclosed base) to preferably T. Individual constitutions can be any 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 1
It can be determined by reference to the allelic variation at position 2, or 13.

CCR-2 ligand antagonist agents are disclosed in the following publications: US Pat. No. 5,707,815, University of California; International Patent Application WO 98/067.
03, Warner Lambert; and Japanese Patent Application JP09309877-A, Teijin Limited.

A test sample of nucleic acid is a suitable sample of blood, bronchoalveolar lavage, saliva, or other bodily fluid or tissue obtained from an individual. The test sample can be a nucleic acid sequence that is equivalent and corresponds to the sequence in the test sample, in other words, all or a portion of the region in the sample nucleic acid is first amplified using any suitable technique, for example, PCR. It is recognized that allelic variation can then be analyzed.

It will be apparent to those skilled in the art that there are many assays that can be used to detect the presence or absence of a mutant nucleotide at one or more polymorphic positions of the present invention. Usually, detection of allelic variants requires techniques for identifying variants, optionally an amplification reaction, and optionally a signal induction system. Table 1 shows a number of mutation detection techniques, some of which are based on PCR. These can be used in combination with the selections shown in Table 2 for many signal induction systems. In addition, Table 3 shows amplification techniques. Many recent methods for detecting allelic variants are described in Nollau et al., Clin.
hem. 43, 1114-1120, 1997; and in standard textbooks, for example, "Laboratory P
rotocols for Mutation Detection ", Ed. by U. Landegren, Oxford University
Press, 1996 and "PCR", 2nd Edition by Newton & Graham, BIOS Scientifi
Found in c Publishers Limited, 1997.

[Table 1] Abbreviations

[Table 2] Abbreviations (continued)

Table 1-Mutation detection techniques Normal: DNA sequencing, sequencing by hybridization Scanning: PPT ^* , SSCP, DGGE, TGGE, cleavase, heterologous duplex analysis, CMC, enzymatic mismatch cleavage ^* Note: It is not useful for detecting promoter polymorphisms. Base Hybridization Solid Phase Hybridization: Dot Blot, MASDA, Reverse Dot Blot, Oligonucleotide Array (DNA Chip) Solution Phase Hybridization: Taqman®-US-52100
15 and US Pat. No. 5,487,972 (Hoffmann-LaRoche), Molecular B
eacons-Tyagi et al., (1996), Nature Biotechnology, 14, 303; WO 95
/ 13399 (Public Health Inst., New York) Based on stretch: ARMS®, ALEX®-European Patent No. EP332435B1 (Zeneca Limited), COPS-Gibbs et al (1989), Nucl
eic Acids Research, 17, 2347 Based on integration: Mini-sequencing, APEX Based on restriction enzymes: RFLP, restriction sites generating PCR Based on ligation: OLA Other: Invader assay

Table 2-Signal Induction or Detection System Fluorescence: FRET, Fluorescence Quenching, Fluorescence Polarization-UK Patent No. 222899
8 (Zeneca Limited) Others: chemiluminescence, electrochemical luminescence, Raman, radioactivity,
Colorimetry, hybridization protection assay, mass spectrometry Table 3-Further amplification methods SSR, NASBA, LCR, SDA, b-DNA

Preferred mutation detection techniques include ARMS®, ALEX®, CO
Includes PCR, FRET technology based on PS, Taqman, Molecular Beacons, RFLP, and restriction sites.

Particularly preferred methods include ARMS® and RFLP based methods. ARMS® is a particularly preferred method.

In a further aspect, the diagnostic methods of the invention can be used to assess the efficacy of a therapeutic compound in treating a CCR-2 ligand mediated disease.

Assays, eg, reporter-based assays, can be devised to detect one or more of the polymorphism-affected transcription levels and / or message stability.

Therefore, individuals having a specific allelic variation of the CCR-2 gene show differences in the ability to regulate protein biosynthesis under various physiological conditions and have an altered ability to respond to various diseases. . In addition, differences in protein regulation that result from allelic variation directly affect an individual's response to drug treatment. The diagnostic methods of the invention can be useful both for predicting the clinical response of the agent and for determining the therapeutic dose.

In a further aspect, the diagnostic methods of the invention can be used to assess an individual's predisposition and / or susceptibility to a disease mediated by a CCR-2 ligand. This is particularly seen in the development of rheumatoid arthritis and cardiovascular disease, and using the present invention,
In particular, it is possible to recognize individuals who are likely to progress these pathologies.

In a further aspect, the diagnostic methods of the invention are used in the development of novel drug therapies that selectively target one or more allelic variants of the CCR-2 gene. The identification of a link between a particular allelic variation and a predisposition to disease progression or response to drug treatment can have important implications for the design of new drugs. Agents can be designed to modulate the biological activity of the mutation involved in the disease process while minimizing the effect on other mutations.

In a further diagnostic aspect of the invention, the presence or absence of the mutated nucleotide is detected by reference to a lost or acquired, optionally engineered, restriction enzyme recognition site. In the accompanying Example 2, we provide details of properly engineered restriction enzyme sites that have been lost or acquired as a result of the polymorphisms of the present invention.

According to another aspect of the present invention, an EMBL ACCESSION NO. U80924
A human CCR2 gene or a complement thereof or at least one of which comprises a polymorphism corresponding to one or more of positions 2385 and 2649 defined by A fragment of at least 20 bases containing one polymorphism is provided.

The fragments are at least 17 bases, more preferably at least 20 bases, more preferably 30 bases.

According to another aspect of the present invention, EMBL ACCESSION NO. U95626
4091 in the promoter sequence of the CCR-2 gene defined by
5, 41047, 41058, 41507, 41768, 42401, 4259
Polymorphisms corresponding to one or more of positions 8, 42,673, 42723, 42874 and 43018, with T at position 40915, insertion of ACA at 41047, A at position 41058, A at position 41507, T in the 41768th place, 424
G at position 01, insertion of T at position 42598, A at position 42667, A at position 42723,
There is provided a human CCR2 gene or a complementary strand thereof comprising a G at position 42874 or a T at position 43018, or comprising a fragment of at least 20 bases containing at least one polymorphism.

The fragments are at least 17 bases, more preferably at least 20 bases, more preferably 30 bases.

According to another aspect of the present invention, one or more of the following: EMBL ACCESSI
ON NO. Positions 2385 and 2649 as defined by the position of U80924, wherein T is at position 2385 and A is at position 2649; or EMB
L ACCESSION NO. CCR-2 defined by the position of U95626
40915, 41047, 41058, 41 in the promoter sequence of the gene
507, 41768, 42401, 42598, 42573, 42723, 42
At positions 874 and 43018, T is inserted at position 40915, ACA is inserted at position 41047, A is inserted at position 41058, A is inserted at position 41507, T is inserted at 41768, G is inserted at 42401, and T is inserted at 42598. A at 42673, 4272
A nucleotide sequence comprising a human CCR2 gene comprising a single nucleotide polymorphism or a complement thereof or an antisense sequence thereof, wherein A is at position 3, G is at 42874, and T is at 43018; A nucleotide sequence is provided that includes the fragment of at least 20 bases, including type.

[0049] The novel sequences disclosed herein can be used in other aspects of the invention to regulate the expression of intracellular genes through the use of antisense constructs. To enable a method of downstream regulated expression of a gene of the invention in mammalian cells, the exemplary antisense expression constructs can be readily constructed using, for example, a pREP10 vector (Invitrogen Corporation). Transcription is expected that this type of configuration would inhibit the translation of the gene in the transfected cell. Antisense transcripts affect the inhibition of translation of negative gene transcripts and may include the effects described herein (eg, modulation of tissue physiology). Oligonucleotides that are complementary to and hybridize to any portion of the novel gene mRNAs disclosed herein are expected for therapeutic use. U.S. Patent No. 5,639,595, issued June 17, 1997, Identifying New Drugs and Formulations, describes in detail how to identify oligonucleotide sequences found in in vivo activity. It is added to this document by reference. Cells are transformed with an expression vector containing a random oligonucleotide sequence from a known polynucleotide. The cells are then assayed for a phenotype resulting from the desired activity of the oligonucleotide.
Having identified cells having the desired phenotype, the sequence of the oligonucleotide having the desired activity can be identified. Identification can be performed by recovering the vector or by polymerase chain reaction (PCR) amplification, and the sequencing region containing the inserted nucleic acid agent nucleotide molecule can be synthesized for antisense therapy. These antisense molecules contain DNA, phosphorothioate or methylphosphonate
Stable derivatives of NA, RNA, stable derivatives of RNA, such as 2′-O-alkyl RNA, or other oligonucleotide mimetics. U.S. Patent No. 5,652,355 issued July 29, 1997, hybrid oligonucleotide phosphorothioates, and U.S. Patent No. 5,652,356 issued July 29, 1997.
Inverted chimeric and hybrid oligonucleotides describe the synthesis and effects of physiologically stable antisense molecules, the text of which is incorporated herein by reference. Antisense molecules can be introduced into cells by microinjection, liposome encapsulation, or by expression from a vector having an antisense sequence.

According to another aspect of the present invention there is provided a computer readable medium comprising at least one novel polynucleotide sequence of the present invention stored on the medium.
The computer readable medium can be used, for example, for homology searching, mapping, haplotyping, genotyping, or pharmacogenetic analysis or any other bioinformatic analysis. Readers: AD Baxevanis & BFF Ouellett
e, reference is made to Bioinformatics, a typical guide for the analysis of genes and proteins, written by John Wiley & Sons, 1988. Any computer readable medium can be used, for example, a compact disk, tape, floppy disk, hard drive, and computer chip.

The polynucleotide sequences of the present invention and portions thereof, particularly the portions of the single nucleotide polymorphisms identified herein and related portions thereof, relate to haplotypes, such as susceptibility studies treated with a particular agent. It is a valuable source for characterizing individuals and other subgroups. These approaches involve storing the sequence information in a computer readable medium and then using that information in a standard bioinformatics program or searching a sequence listing database using standard search tools such as "GCC" This is most easily promoted. As such, the polynucleotide sequences of the present invention are particularly useful as database elements useful for sequence identification and other search analysis. As used herein, the storage of sequence information in a computer readable medium, and the use of sequence databases related to "polynucleotides or polynucleotide sequences of the present invention" is a matter of tangible nature, such as a computer disk. Encompasses any detectable chemical or physical property of a polynucleotide of the invention, which may reduce conversion or storage into a medium, preferably a computer readable form. For example, chromatographic scan or peak data, photograph scan or peak data, mass spectrographic data, sequence gel (or other) data.

The present invention provides a computer readable medium storing one or more polynucleotide sequences of the present invention. For example, provided is a computer readable medium comprising and stored in a member selected from the group consisting of: a polynucleotide comprising a sequence of a polynucleotide of the present invention, consisting of a polynucleotide of the present invention. A polynucleotide, a polynucleotide comprising a portion of a polynucleotide of the invention (the portion includes at least one polymorphism of the invention), a group of polynucleotide sequences (the group includes at least one Or a portion of a group of data comprising or consisting of a polynucleotide sequence of the present invention or at least one polymorphism identified herein. The sequence may also be identified by computer-based methods, comprising providing a polynucleotide sequence comprising the polymorphism of the invention in a computer-readable medium, wherein the polymorphism comprises the polynucleotide sequence. Comparing with at least one other polynucleotide or polypeptide sequence that identifies identity (homology), ie, screens for the presence of a polymorphism.

The present invention further provides nucleotide primers capable of detecting the polymorphism of the present invention.

According to another aspect of the present invention, an EMBL ACCESSION NO. U80924
2385 and 2649 in the CCR-2 gene defined by the position of
One or more positions and / or ACCESSION NO. U956
4 in the promoter sequence of the CCR-2 gene defined by position 26
0915, 41047, 41058, 41507, 41768, 42401, 4
Allele-specific primers capable of detecting CCR-2 gene polymorphisms at one or more of positions 2598, 42273, 42723, 42874 and 43018 are provided.

[0055] Allele-specific primers are typically used with amplification counterparts in amplification reactions, such as PCR reactions, whereby, for example, for use in an ARMS® assay, the allele at a specific sequence position. One can distinguish between alleles through selective amplification. The allele-specific primer is preferably 17-
50 nucleotides, more preferably about 17-35 nucleotides, more preferably about 17-30 nucleotides.

The allele-specific primer preferably corresponds strictly to the allele to be detected, but also takes into account its derivatives, in which case about 6-8 nucleotides at the three termini correspond to the allele to be detected. , 8, 6, 4, 2 or up to 10 remaining nucleotides can be varied without significantly affecting the properties of the primer.

[0057] Primers are prepared using any of the usual methods of synthesis. An example of such a method is
Standard text, “Protocols for Oligonucleotides and Analogues; Synthe
sis and Properties, ”Methods in Molecular Biology Series; Volume 20; Ed.
Sudhir Agrawal, Humana ISBN: 0-89603-247-7; 1993; found in 1st Edition. If necessary, the primers can be labeled to facilitate detection.

According to another aspect of the present invention, an EMBL ACCESSION NO. U80924
1 at positions 2385 and 2649 of the CCR-2 gene defined by
One or more and / or ACCESSION NO. 4091 in the promoter sequence of the CCR-2 gene defined by the position of U95626
5, 41047, 41058, 41507, 41768, 42401, 4259
An allele-specific oligonucleotide probe capable of detecting a CCR-2 gene polymorphism at one or more of positions 8, 42,673, 42723, 42874 and 43018 is provided.

The allele-specific oligonucleotide probe is preferably 17-50 nucleotides, more preferably about 17-35 nucleotides, more preferably about 17-nucleotides.
30 nucleotides.

The design of such probes will be apparent to those skilled in molecular biology. The probe is
Any suitable length, for example up to 50 bases, up to 40 bases, more suitable up to 30 bases, such as 8-25 or 8-15 bases in length. Usually, the probe contains a nucleotide sequence completely complementary to the corresponding wild-type or mutant locus of the gene. However, if necessary, one or more mismatches are also introduced. However, it does not adversely affect the discrimination power of the oligonucleotide probe. The probes of the present invention have one or more labels and may facilitate detection.

According to another aspect of the present invention, there is provided a diagnostic kit comprising an allele-specific oligonucleotide probe of the present invention and / or an allele-specific primer of the present invention.

The diagnostic kit may include a suitable package and instructions for using the method of the invention. The kit further includes a suitable buffer and a polymerase, such as a thermostable polymerase, for example, taq polymerase.

In another aspect of the invention, single nucleotide polymorphisms of the invention may be used as genetic markers in ligation studies. This is particularly due to the relative high frequency,
385, 41047, 41507 and 42723 (see below). The CCR-2 gene was mapped to chromosome 3p21.3-p24 (Samson et al (1996), Genomics 36, 522-526). Infrequent polymorphisms can be particularly useful for haplotyping, as described below. Haplotypes are a group of alleles found at the connecting polymorphic site (eg, within a gene) of a single (paternal or maternal) chromosome. If the recombination within the gene is random, 2 ⁿ haplotypes will occur, where 2 is the number of alleles for each SNP and n is the number of SNPs.
Certain approaches to identifying mutations or polymorphisms that correlate with clinical response can make use of all haplotypes that can be identified in the group of interest, with concomitant investigation. The frequency of each haplotype is limited by the frequency of the rarest allele, so SNPs with low frequency alleles are particularly useful as markers for low frequency haplotypes. Because certain mutations or polymorphisms associated with certain clinical features, such as inconvenient or abnormal events, appear to be less frequent in the community, less frequent SNPs may help identify these mutations. It can be particularly useful (e.g., Linkage
disequilibrium at the cystathionine beta synthase (CBS) locus and the a
ssociation between genetic variation at the CBS locus and plasma levels
of homocysteine. Ann Hum Genet (1998) 62: 481-90, De Stefano V, Dekou V,
Nicaud V, Chasse JF, London J, Stansbie D, Humphries SE, and Gudnason V;
and Variation at the von willebrand factor (vWF) gene locus is associate
d with plasma vWF: Ag levels: identification of the three novel single n
ucleotide polymorphisms in the vWF gene promoter.Blood (1999) 93: 4277-
83, Keightley AM, Lam YM, Brady JN, Cameron CL, Lillicrap D).

According to another aspect of the present invention, there is provided a method of treating a human in need of treatment with a CCR-2 ligand antagonist agent, the method comprising: i) the human CCR-2 gene Diagnosis of single nucleotide polymorphisms in EM
BL ACCESSION NO. CCR- defined by the location of U80924
One or more of positions 2385 and 2649 in the two genes, and / or
Or EMBL ACCESSION NO. 40915, 41047, 4 in the promoter sequence of the CCR-2 gene defined by the position of U95626
1058, 41507, 41768, 42401, 42598, 42673, 4
Diagnostics, including determining the sequence of the nucleic acid at one or more of positions 2723, 42874 and 43018, and determining human constitution by reference to polymorphisms in the CCR-2 gene; ii) an effective amount of CCR-2 Administration of ligand antagonist.

[0065] Preferred determination of human constitution is clinically useful. Examples of clinical utility include
Determining the antagonist drug or drug groups to administer and / or determining the effective amount of the drug or drug group is included. CCR-2 ligand antagonist drugs are disclosed in the following publications: US Pat. No. 5,707,815, University of California: International Patent Application WO 98/06703, Warner Lambert; and Japanese Patent Application JP0930.
9877-A, Teijin Limited.

According to another aspect of the present invention, an EMBL ACCESSION NO. U80924
1 at positions 2385 and 2649 of the CCR-2 gene defined by
One or more and / or ACCESSION NO. 4091 in the promoter sequence of the CCR-2 gene defined by the position of U95626
5, 41047, 41058, 41507, 41768, 42401, 4259
The use of a CCR-2 ligand antagonist drug in the preparation of a medicament for treating a human CCR-2 ligand mediated disease diagnosed as having a single nucleotide polymorphism at one or more of positions 8, 42,673, 42723, 42874 and 43018 Provide use.

According to another aspect of the present invention, an EMBL ACCESSION NO. U80924
2385 and 2649 in the CCR-2 gene defined by the position of
One or more positions and / or ACCESSION NO. U956
4 in the promoter sequence of the CCR-2 gene defined by position 26
0915, 41047, 41058, 41507, 41768, 42401, 4
A CCR-2 ligand antagonist drug and instructions for administering the drug to a human, diagnostically testing for single nucleotide polymorphisms at one or more of positions 2598, 42273, 42723, 42874 and 43018 A pharmaceutical pack comprising:

The present invention will be described based on the following examples, but is not limited thereto. All temperatures are in degrees Celsius. In the following examples, the following methods and substances were applied unless otherwise specified. AMPLITAQ®, available from Perkin-Elmer Cetus,
Used as a source of NA polymerase. Normal molecular biology techniques are described in the "Molecular Cloning-A Laboratory Manual" Seco
nd Edition, Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laborator
y, 1989). Electropherograms were obtained by standard techniques: data were collected by ABI377 data collection software and waveforms resulting from ABI Prism sequencing analysis (2.1.2).

EXAMPLES Identification of Polymorphisms Method DNA preparation DNA was prepared using protocol I (Molecular Cloni
ng: A Laboratory Manual, p392, Sambrook, Fritsch and Maniatis, 2nd Edit
ion, Cold Spring Harbor Press, 1989). The lysed blood was diluted with an equal volume of standard citrate saline instead of phosphate buffered saline. The sample was extracted with phenol, then with phenol / chloroform, and then with three additional phenol extractions with chloroform. The DNA was dissolved in distilled water.

Template Preparation Templates were prepared by PCR using oligonucleotide primers and annealing temperatures set below. The extension reaction was 72 ° and the denaturation temperature was 9
4 °. Usually, 50 ng of genomic DNA was used for each reaction, PCR was performed for 35 cycles, the first fragment was diluted 1/200, and then the second fragment was amplified. PC
R was performed in two steps (first fragment, then second fragment) to specifically amplify the desired target sequence.

EMBL ACCESSION NO. U80924

[Table 3]

[Table 4]

EMBL ACCESSION NO: U95626

[Table 5]

For dye-primer sequencing, these primers were modified to include the M13 forward and reverse primer sequences (ABI protocol P / N 402114, Applied Biosystems) at the 5 ′ forward and reverse oligonucleotides, respectively. .

Dye Primer Sequencing Dye primer sequencing using M13 forward and reverse primers was performed using the “AMPLITAQ® FS” DNA polymerase.
As described in ABI Protocol P / N 402114 for BI Prism® Dye Primer Cycle Sequencing Core Kit, but with modification of the protocol to an annealing temperature of 45 ° and the final concentration of DMSO in the cycle sequencing mix. It was added to be 5%.

The extension reactions of each base were pooled, precipitated with ethanol / sodium acetate, washed, and suspended in formamide loading buffer.

Electrophoresis was performed on a 4.25% acrylamide gel in an automatic sequencer (ABI 377, Applied Biosystems).

[0077] 2. Result Novel polymorphism EMBL ACCESSION NO. U80924

[Table 6] Allele frequencies were based on an analysis of 20 individuals.

EMBL ACCESSION NO. U95626

[Table 7]

[Table 8]

[Table 9]

[Table 10]

[Table 11]

[Table 12]

[Table 13]

[Table 14]

[Table 15]

[Table 16]

[Table 17] Allele frequencies were determined in a panel of 20 individuals.

Example 2 Diagnostic Assay for Polymorphisms in the Coding Region of the CCR2 Gene The CCR2 gene was cloned and disclosed (EMBL Accession Number U80924 54
71bp), all positions relate to that position unless otherwise stated or apparent from the document. Method: DNA preparation and template preparation were performed as described above.

[0080] nucleotide 2385 C / T Asn260 AA C / AA T

[Table 18]

[Table 19] An SspI restriction enzyme sequence was created by the polymorphism mutation at position 2385 (AATTT)
Digestion of the PCR product with the restriction enzyme SspI (New England Biolabs)
Two polymorphic mutations can be distinguished. The PCR product was digested according to the manufacturer's instructions (New England Biolabs). . . . TAT. AA C. ATT. . . Wild type Not cuttable. . . TAT. AA T. ATT. . . Mutant cleavable full length, size of non-cleavable PCR product is 380 bp (has homology with wild type),
Digestion of the homologous mutation-derived PCR product yields 275 bp and 105 bp products, while digestion of the heterologous PCR product yields 380 bp, 275 bp and 105 bp products.

Nucleotide 2649 G / A Thr (348) AC G / AC A Method (DNA and template preparation are performed as described above)

[Table 20] Diagnostic Primer 2628-2648 TGGAGTGACTTCAACAAACAG (SEQ ID NO: 1) The diagnostic primer contains a single mismatch with the wild-type sequence at the 3 'residue. Constant primer 2821-2841 CATTGGGTGACATAGTCTGTA (SEQ ID NO: 2)

A 213 bp product results from PCR amplification using these primers. The use of diagnostic primers in the wild-type template allows for StuI at the site of polymorphism.
A recognition sequence (AGGCCT) results. . . . AG G CCT. . . Wild type sequence. . . AG A CCT. . . Mutant Sequence When the PCR product from the wild-type template is digested with StuI (New England Biolabs), 191 bp and 22 bp products are generated. The product of the homozygous mutant template is not cleaved, while digestion of the product from the heterozygous mutant template results in 215 bp, 195 bp
And 20 bp.

Diagnostic Assay for Polymorphism in Promoter Region of CCR-2 Gene Human BAC (Bacterial Artificial Chromosome) clone 110P12 (Resear
ch Genetics) contains the CCR2 gene. The complete sequence of clone 110P12 is disclosed (EMBL Accession Number U95626, 143068 bp) and all positions relate to such positions unless otherwise specified or apparent from this document.

A variant at nucleotide positions 42,673, 42,673 (GCATG / AC) has a SphI recognition site (GCATG
Modify C). The PCR product (443 bp) containing the wild-type sequence was transferred to SphI (New Engl
and Biolabs) to yield 189 bp and 254 bp products. The homozygous mutant is not cleaved (443 bp), while digestion of the atypical mutant sequence results in 189 bp.
Products of p, 254 bp and 443 bp are produced.

[Table 21]

Diagnostic Assay for Polymorphism in the Promoter Sequence of the CCR-2 Gene Using Engineered Restriction Enzyme Sites Sau3A site (GATC) is created by engineering nucleotide 40915 nucleotide 40917 (TC). The wild-type sequence (GATC) is cleaved by Sau3A while the mutant sequence (GATC)
GTTC) Not disconnected. Diagnostic primer 40917-40937 5 'CTGCAGTCTCAACCTCAAGC G (Sequence Table 3) Constant primer 40716-40736 5' CTGACTGAAATCTGGGCTGGG (Sequence Table 4) PCR product (221 bp) containing wild-type sequence listing was converted to Sau3A (New England Biolabs).
) Yields 24 bp and 197 bp. The mutated sequence is not cut, but digestion of the heterologous sequence yields 221 bp, 197 bp and 24 bp.

Engineering at nucleotide 41507 41505 creates an AclI site (AACGTT).
A polymorphic mutation at position (C / A) modifies this recognition sequence. Wild type sequence (AACGT
T) is cleaved, but the mutant sequence (AAAGTT) is not cleaved. Diagnostic primer 41485-41505 5 'CTGAGGTTCTTCTTGCTAAGA (Sequence Table 5) Constant primer 41695-41715 5' TAGGATTACAGGTGTGTGCCA (Sequence Table 6) The PCR product (230 bp) containing the wild-type sequence was digested with AclI (New England Biolabs) to give 208 bp. And a product of 22 bp. The PCR product containing the homozygous sequence is not cleaved, but the digestion of the atypical product is 230 bp, 208 bp.
And 22 bp.

Engineering at nucleotides 41768 41766 (GC) results in a NheI recognition sequence (GCTAGC), and the polymorphism at position 41768 (A / T) modifies this recognition sequence. The wild-type sequence (
GCTAGC) is cleaved, but the mutant sequence (GCTTGC) is not. Diagnostic primer 41746-41766 5 'CTTGAACTCAGAAGGTGGAGC (Sequence Table 7) Constant primer 41968-41988 5' ACTTGGAGCAGAGCACCAGCA (Sequence Table 8) A PCR product (242 bp) containing a wild-type sequence (GCTAGC) was purified by NheI (New Eng
Land Biolabs) yields 22 bp and 220 bp. The PCR product containing the mutant sequence (GCTTGC) is not cut, but digestion of the heterologous product yields 242 bp, 220 bp and 22 bp products.

Engineering at nucleotide positions 42401 42403 (GT) generates an ApoI recognition sequence (PuAATTPy), and the polymorphic variant at position 42401 (A / G) modifies this recognition sequence. The wild type sequence (AAATTTT) is cleaved, but the mutant sequence (AAGTTT) is not cleaved. Diagnostic primer 42403-42423 5 'GTGGGTCTTTATACCTGGAAA (Sequence Table 9) Constant primer 42122-42142 5' TGCACAATGTATACATGTAGC (Sequence Table 10) 23 bp and 278 bp by digesting the PCR product (301 bp) containing the wild-type sequence (AAATTT) with ApoI Is generated. Mutant sequence (AAGTTT)
Is not cleaved, but 301 bp, 278
bp and 23 bp products are produced.

Engineering at nucleotides 42723 42724 (AG) results in a MaeII recognition sequence (ACGT).
The polymorphism (C / A) variant at position 42723 modifies this recognition sequence. The wild type sequence (ACGT) is cleaved, but the mutant sequence is not. Diagnostic primer 42724-42744 5 'TGTCTCAGGCAGTCCTGGTAC (SEQ ID NO: 11) Constant primer 42541-42561 5' CCAATGTACAATGTTCCTGAC (SEQ ID NO: 12) Digestion of the PCR product (203 bp) containing the wild-type sequence yields 22 bp and 181 bp products. The product containing the mutant sequence is not cleaved, but digestion of the heterologous product yields 203 bp, 181 bp and 22 bp products.

Engineering at nucleotides 43018 43021 (CA) results in a BsrGI recognition sequence (TGTACA). The wild type sequence (AGTACA) is cleaved, but the mutant sequence (TGTACA) is not. Diagnostic primer 43019-43041 5 'AGTGAGCCCCTGGGTGTGTGTAC (Sequence Table 13) Constant primer 42847-42866 5' GAACTGCAAAGCCTGCACAC (Sequence Table 14) The PCR product (197 bp) containing the wild-type sequence was BsrGI (New England Biolabs).
) Does not digest. Digestion of the PCR product containing the mutant sequence yields 172 bp and 25 bp products, and digestion of the heterologous product yields 197 bp, 172 bp and 25 bp products.

Example 3 Double ARMS in Polymorphisms of Haplotypes 41507 (C / A) and 42573 (G / A) at Positions 41507 and 42573
The ™ assay generates haplotypes at these positions as shown below.

[Table 22]

The description of the artificial sequence in SEQ ID NOs: 1, 3, 5, 7, 9, 11, and 13 is “RF primer engineered RFLP”.

[Sequence list]

──────────────────────────────────────────────────続 き Continuation of front page (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE ), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SL, SZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AL, AM, AT, AU, AZ, BA, BB, BG, BR , BY, CA, CH, CN, CU, CZ, DE, DK, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS , JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor John Edward Norris Morten United Kingdom, SK 10.4 Tigi, Cheshire, Macclesfield, Alderley Park F-term (reference) 4B024 AA11 CA02 CA09 HA12 HA19 4B063 QA12 QA19 QQ43 QR14 QR32 QR55 QR62 QS11 QS16 QS25 QS34 QX02 4C084 AA17 ZA96 ZB11 Z

Claims (11)

[Claims] 1. A method for diagnosing a single nucleotide polymorphism in human CCR-2, comprising the steps of: EMBL ACCESSION NO. Positions 2385 and 26 in the coding sequence of the CCR-2 gene defined by the position of U80924
One or more of position 49 and / or ACCESSION NO. CCR-2 defined by the location of U95626
40915, 41047, 41058, 41 in the promoter sequence of the gene
507, 41768, 42401, 42598, 42573, 42723, 42
Determining the human nucleic acid sequence at one or more of positions 874 and 43018; and determining the human constitution by reference to a polymorphism in the CCR-2 gene. 2. The single nucleotide polymorphism at position 2385 is the presence of C and / or T; and the single nucleotide polymorphism at position 2649 is the presence of G and / or A. The single nucleotide polymorphism at position 40915 is the presence of A and / or T; the single nucleotide polymorphism at position 41047 is the presence or absence of an ACA insertion; The type is the presence of C and / or A; the single nucleotide polymorphism at position 41507 is the presence of C and / or A; the single nucleotide polymorphism at position 41768 is the presence of A and / or T The single nucleotide polymorphism at position 42401 is the presence of A and / or G; the single nucleotide polymorphism at position 42598 is the presence or absence of the T insertion The single nucleotide polymorphism at position 42667 is the presence of G and / or A; the single nucleotide polymorphism at position 42723 is the presence of C and / or A; and the single nucleotide polymorphism at position 42874 The diagnostic method of claim 1, wherein the gender is the presence of A and / or G, and the single nucleotide polymorphism at position 43018 is further defined as being the presence of A and / or T. 3. The method according to claim 2, wherein the sequence is an amplification refractor.
The diagnostic method according to claim 1 or 2, wherein the method is determined by a method selected from a y mutation system) and restriction fragment length polymorphism. 4. One or more of the following: EMBL ACCESSION NO. 23 defined by the location of U80924
Positions 85 and 2649, with T at position 2385 and A at position 2649
Is present; or EMBL ACCESSION NO. CC defined by the position of U95626
40915, 41047, 41058 in the promoter sequence of the R-2 gene
, 41507, 41768, 42401, 42598, 42573, 42723
, 42874 and 43018, where T is 4104
Insertion of ACA at position 7, A at 41058, A at 41507, 41768
T at 42401, T at 42598, A at 42673
There is an A at position 2723, a G at position 42874 and a T at position 43018;
Or a nucleotide sequence comprising a human CCR2 gene or a complement thereof or an antisense sequence thereof comprising a single nucleotide polymorphism; or a fragment of at least 20 bases comprising at least one polymorphism. 5. The EMBL ACCESSION NO. One or more of positions 2385 and 2649 in the CCR-2 gene defined by the position of U80924, and / or EMBL ACCESSION NO. CC defined by the position of U95626
40915, 41047, 41058 in the promoter sequence of the R-2 gene
, 41507, 41768, 42401, 42598, 42573, 42723
Allele-specific primers capable of detecting CCR-2 gene polymorphisms at one or more of positions 42874 and 43018. 6. The EMBL ACCESSION NO. One or more of positions 2385 and 2649 in the CCR-2 gene defined by the position of U80924, and / or EMBL ACCESSION NO. CC defined by the position of U95626
40915, 41047, 41058 in the promoter sequence of the R-2 gene
, 41507, 41768, 42401, 42598, 42573, 42723
An allele-specific oligonucleotide probe capable of detecting a CCR-2 gene polymorphism at one or more of positions 42874 and 43018. 7. A diagnostic kit comprising an allele-specific primer as defined in claim 5 or an allele-specific oligonucleotide probe as defined in claim 6. 8. A method of treating a human in need of treatment with a CCR-2 ligand antagonist agent, the method comprising: i) diagnosing a single nucleotide polymorphism in the human CCR-2 gene, the method comprising:
L ACCESSION NO. CCR-2 defined by the location of U80924
One or more of positions 2385 and 2649 in the gene, and / or EMBL ACCESSION NO. C defined by the position of U95626
40915, 41047, 4105 in the promoter sequence of the CR-2 gene
8, 41507, 41768, 42401, 42598, 42573, 4272
Diagnosis comprising determining the sequence of the nucleic acid at one or more of positions 3, 42874 and 43018, and determining the predisposition of the human by referring to the polymorphism in the CCR-2 gene; and ii) efficacy Administering a CCR-2 ligand antagonist in an amount. 9. An EMBL ACCESSION NO. One or more of positions 2385 and 2649 in the CCR-2 gene defined by the position of U80924, and / or EMBL ACCESSION NO. CC defined by the position of U95626
40915, 41047, 41058 in the promoter sequence of the R-2 gene
, 41507, 41768, 42401, 42598, 42573, 42723
Use of a CCR-2 ligand antagonist agent in the preparation of a medicament for treating a human CCR-2 ligand mediated disease diagnosed as having a single nucleotide polymorphism at one or more of positions 42874 and 43018. 10. A CCR-2 ligand antagonist and EMBL AC
CESSION NO. One or more of positions 2385 and 2649 in the CCR-2 gene defined by the position of U80924, and / or EMBL ACCESSION NO. CC defined by the position of U95626
40915, 41047, 41058 in the promoter sequence of the R-2 gene
, 41507, 41768, 42401, 42598, 42573, 42723
A pharmaceutical pack comprising instructions for administering an agent to a human who has been diagnostically tested for a single nucleotide polymorphism at one or more of positions 42874 and 43018. 11. A computer readable medium comprising at least one nucleotide sequence as defined in claim 4, stored on the medium.