JP2002516335A - ALG-2LP, ALG-2-like molecules and uses thereof - Google Patents

Abstract

  (57) [Summary] The present invention provides isolated nucleic acid molecules, referred to as hALG-2LP, sALG-2LP and mALG-2LP nucleic acid molecules, that encode proteins involved in the regulation of programmed cell death. The present invention also provides antisense nucleic acid molecules, hALG-2LP, recombinant expression vectors containing sALG-2LP and mALG-2LP nucleic acid molecules, host cells into which these expression vectors have been introduced, and hALG-2LP, sALG- Also provided are non-human transgenic animals into which the 2LP and mALG-2LP genes have been introduced or disrupted. The invention still further provides isolated hALG-2LP, sALG-2LP and mALG-2LP proteins, fusion proteins, antigenic peptides and anti-hALG-2LP, sALG-2LP and mALG-2LP antibodies. Diagnostic methods utilizing the compositions of the invention are also provided.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001] During normal embryonic and adult development of background multicellular organisms invention, is not required or deleterious cells are removed by a process called programmed cell death or apoptosis (Ellis R.
E. et al. (1991) Annual Rev. Cell Biol. 7: 663-698). Programmed cell death occurs in both vertebrate and invertebrate species, and is characterized by unique morphological changes, such as cytoplasmic contraction and chromatin condensation, and specific DNA cleavage into oligonucleosome fragments. Unlike necrosis, programmed cell death or apoptosis is an irreversible process, which in most systems appears to be due to the expression of a particular set of novel “cell death genes”. Loss of regulation of this process (deregu
lation) contribute to the development of several diseases, including neurodegenerative diseases, cancer, immunodeficiencies and autoimmune diseases (Thompson CB et al. (1995) Science 267: 145).
6).

Calcium is thought to play an important regulatory role in programmed cell death or apoptosis (Trump BF et al. (1992) Curr. Opin. Cell Biol. 4
: 227-232). Studies showing that sustained elevation of cytosolic calcium can induce apoptosis in thymocytes (Durant S. et al. (1980) Biochem. B
iophys. Res. Commun. 93: 385-391) provided early evidence. Sustained increases in calcium concentration can activate a number of potentially harmful processes in cells. Some of these processes include activation of hydrolases such as phospholipase A2, calcium-dependent proteases and calcium-dependent endonucleases; destabilization of the cytoskeleton; cells that cause reduced or lack of cell-cell communication Disruption of binding; and activation of expression of immediate early genes such as c-fos, c-jun and c-myc (Zhong LT et al. (1993) Proc. Natl. Acad. Sc
i. USA 90: 4533-4573).

Several mechanisms can interact to lose regulation of intracellular calcium concentration. First, such interactions are organelle-specific, such as anoxia, which inhibits mitochondrial respiration, and thapsigargin (Thast, which inhibits ER Ca ²⁺ -ATPase
Natl. Acad. Sci. USA 87 2466-2470) or activated complement that permeabilizes the plasma membrane.

[0004] Increased cytosolic ionized sodium concentration is also a factor in many cells. ⁺ / Ca²⁺Can result in cytosolic calcium concentration due to the importance of exchange
(Snowdowne, K. W. et al. (1985) J. Biol. Chem. 260, 14998-15007).
Increased cytosolic sodium concentration also increases⁺/ H⁺Activate exchange for pH_iIncrease
Addition can also be provided. Reduced pH_iIs probably phospholipase, protein
Ca for ase and endonuclease²⁺Neutralizes the effects brought about by
This significantly slows the rate of cell death after injury in various cells,
On the other hand, increased pH_iIt usually accelerates the progression to cell death.

Furthermore, activation of membrane receptors by ligand binding and interaction with G proteins often leads to activation of PLC-β and PLC-γ. This, in turn, results in, among other things, the formation of inositol 1,4,5-3 phosphate (IP ₃ ) and 1,2-diacylglycerol. IP ₃ in turn result in the release of Ca ²⁺ from ER, which can lead to penetration of increased Ca ²⁺ into the cell by the formation of calcium influx factor. SUMMARY OF THE INVENTION The present invention provides, at least in part, novel nucleic acid molecules that encode proteins that regulate programmed cell death, such as novel nucleic acids that encode proteins that regulate programmed cell death in cells that express these proteins Provide molecules.
Examples of nucleic acid molecules encoding such proteins include human ALG-2LP, monkey ALG-2LP, also referred to herein as an apoptosis linked gene-2 like protein (ALG-2LP). Mouse ALG-2LP is included. In a preferred embodiment, the hALG-2LP, sALG-2LP, and mALG-2LP proteins interact (eg, bind) with a protein that is a member of the programmed cell death transmission pathway, or a portion or subunit thereof.

[0006] ALG-2 was first identified in a screen for genes involved in apoptosis, and subsequently shown in antisense experiments to be required for fas ligand-induced cell death (Vito P. et al. (1996) Science 27
1: 521-525). ALG-2 comprises 191 amino acids containing two characteristic calcium-binding EF-hand structures.

[0007] The proteins disclosed herein have sequence homology to ALG-2 and are therefore likely to be involved in similar biological processes, eg, to regulate programmed cell death.

Accordingly, apoptosis-related gene-2-like protein molecules, such as hALG-2LP, sALG
-2LP and mALG-2LP can be used to modulate the activity of molecules involved in the programmed cell death pathway, and are novel therapies for the treatment of diseases characterized by deregulated programmed cell death Provide a way. Examples of diseases characterized by unregulated programmed cell death include neurodegenerative diseases such as Alzheimer's disease, (
Dementia associated with Alzheimer's disease (such as Pick's disease), Parkinson's disease and other Lewy diffuse body diseases, multiple sclerosis, amyotrophic lateral sclerosis, progressive supranuclear palsy, Epilepsy, Creutzfeldt-Jakob disease or AIDS-related dementia; or proliferative disorders, such as cancer, such as chronic lymphocytic leukemia or colon cancer.

[0009] Further, since the hALG-2LP, sALG-2LP or mALG-2LP gene is involved in programmed cell death, variant or abnormal hALG-2LP, sALG-2LP or mALG-2LP nucleic acid expression or hALG-2LP, sALG- Diseases characterized by 2LP or mALG-2LP protein activity,
HALG-2LP, sALG-2 containing genetic damage, for example to diagnose neurodegenerative diseases
LP and mALG-2LP genes can be detected.

[0010] Further, another embodiment of the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a hALG-2LP, sALG-2LP or mALG-2LP protein or a biologically active portion thereof ( E.g. cDNA) and hALG-2LP, sALG-2LP or mALG-2LP
And nucleic acid fragments suitable for use as primers or hybridization probes for detecting nucleic acids (eg, mRNA) encoding
In a particularly preferred embodiment, the isolated nucleic acid molecule of the present invention comprises the nucleotide sequence of SEQ ID NO: 1, 4 or 7, accession number As ATCC ^R (TM) plasmid deposited in the DNA insert nucleotide sequence or those nucleotide sequences (SEQ ID NO: 3, 6 or 9) comprising the coding region or complement thereof. In another particularly preferred embodiment, the isolated nucleic acid molecule of the present invention comprises SEQ ID NO: 1.
, 4 or 7, the total length of the nucleotide sequence, accession number Hybridizes to the full length of the nucleotide sequence of the DNA insert of the plasmid deposited at the ATCC ^R or a portion of these nucleotide sequences or at least 32%, 35%, 40%
, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologous nucleotide sequences. In another preferred embodiment, the isolated nucleic acid molecule comprises the amino acid sequence of SEQ ID NO: 2, 5 or 8 or the accession number Encodes the amino acid sequence encoded by the nucleotide sequence of the DNA insert of the plasmid deposited with the ATCC ^R. Preferred hALG-2LP, sALG-2LP or mALG-2LP proteins of the present invention also preferably possess at least one of the activities described herein.

In another embodiment, the isolated nucleic acid molecule of the invention is sufficiently homologous to the amino acid sequence of SEQ ID NO: 2, 5, or 8, eg, wherein the protein or a portion thereof is described herein. Encodes a protein containing an amino acid sequence sufficiently homologous to the amino acid sequence of SEQ ID NO: 2, 5, or 8 or a part thereof so as to retain at least one of the activities described above. Preferably, the proteins encoded by these nucleic acid molecules, or portions thereof, possess the ability to modulate programmed cell death pathway activity. In one embodiment, the proteins encoded by these nucleic acid molecules have SEQ ID NO:
: 2, 5, or 8 amino acid sequence (for example, the entire amino acid sequence of SEQ ID NO: 2, 5, or 8) or accession number At least 38%, 42%, 44% of the amino acid sequence encoded by the nucleotide sequence of the DNA insert of the plasmid deposited at the ATCC ^R.
%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologous. In another preferred embodiment, these proteins are substantially homologous to the entire amino acid sequence of SEQ ID NO: 2, 5, or 8 (encoded by the open reading frames set forth in SEQ ID NO: 3, 6, or 9, respectively). It is a full-length human protein.

[0012] In another preferred embodiment, the hALG-2LP, sALG-2LP or mALG-2LP nucleic acid molecule is derived from a mammal, eg, a human, monkey or mouse, and has SEQ ID NOs: 10, 11, 12, 13, 1.
It contains a calcium binding domain at least 42% or more homologous to 4 or 15 and has the following activities: 1) capable of interacting with molecules involved in the programmed cell death pathway, such as ALG-2 interacting proteins; A) a cell having one or more of the following capable of modulating cell death, eg, programmed cell death, in cells such as brain cells and other cells expressing ALG2-LP (eg, hALG
-2LP, sALG-2LP or mALG-2LP fusion protein).

[0013] In another embodiment, the isolated nucleic acid molecule is at least 15 nucleotides in length and comprises a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1, 4 or 7 or an accession number Under stringent conditions to the nucleotide sequence of the DNA insert of the plasmid deposited with the ATCC ^R. Preferably, the isolated nucleic acid molecule corresponds to a naturally occurring nucleic acid molecule. More preferably, the isolated nucleic acid molecule encodes a naturally occurring human hALG-2LP, sALG-2LP or mALG-2LP or a biologically active portion thereof. In addition, hALG-2LP, sALG-2LP or mALG
Given the disclosure herein of a cDNA sequence encoding -2LP (eg, SEQ ID NO: 1, 4 or 7), antisense nucleic acid molecules (ie, hALG-2LP, sALG-2LP or
Molecules complementary to the coding strand of the mALG-2LP cDNA sequence) are also provided by the invention.

[0014] Another aspect of the present invention relates to vectors, such as recombinant expression vectors, containing the nucleic acid molecules of the present invention and host cells into which such vectors have been introduced. In one embodiment, such host cells are used to produce hALG-2LP, sALG-2LP or mALG-2LP protein by culturing the host cells in a suitable medium. If desired, the hALG-2LP, sALG-2LP or mALG-2LP protein can then be isolated from the medium or host cells.

[0015] Yet another embodiment of the present invention relates to a transgenic non-human animal into which the hALG-2LP, sALG-2LP or mALG-2LP gene has been introduced or modified. In one embodiment, the genome of the non-human animal has hALG-2LP, sALG-2LP as the transgene.
Alternatively, it has been modified by introducing a nucleic acid molecule of the present invention encoding mALG-2LP. In another embodiment, the endogenous ALG-2LP gene in the genome of the non-human animal has been modified, eg, functionally disrupted, by homologous recombination.

[0016] Still another embodiment of the present invention relates to an isolated hALG-2LP, sALG-2LP or mALG-2LP.
It relates to a protein or a part thereof, for example a biologically active part. In a preferred embodiment, the isolated hALG-2LP, sALG-2LP or mALG-2LP protein or a portion thereof modulates programmed cell death in cells, such as brain cells and other cells that express ALG2-LP. it can. In another preferred embodiment, the isolated hALG
The -2LP, sALG-2LP or mALG-2LP protein or a portion thereof may possess the ability of the protein or a portion thereof to regulate programmed cell death in cells, such as brain cells and other cells that express ALG2-LP. Is sufficiently homologous to the amino acid sequence of SEQ ID NO: 2, 5 or 8.

In one embodiment, the biologically active portion of the hALG-2LP, sALG-2LP or mALG-2LP protein includes a domain or motif, preferably a domain or motif having an activity described herein. Is done. This domain may be a calcium binding domain, for example, an EF hand. If the active portion of the protein comprising the calcium binding domain is isolated or obtained from a mammal, e.g., a human, the calcium binding domain may be SEQ ID NO: 10, 11, 12, 13, 14, or 15
At least 38%, 42%, 44%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
Preferably, they are 90%, 95% or more homologous. Also preferably, the biologically active portion of the hALG-2LP, sALG-2LP or mALG-2LP protein comprising a calcium binding domain comprises the following activities: 1) a molecule associated with the programmed cell death pathway, such as ALG-2 It is also capable of interacting with interacting proteins; and 2) also one of the capable of modulating cell death, eg, programmed cell death, in cells such as brain cells and other cells expressing ALG2-LP.

[0018] The invention also provides an isolated preparation of hALG-2LP, sALG-2LP or mALG-2LP protein. In a preferred embodiment, the hALG-2LP, sALG-2LP or mALG-2LP protein has the amino acid sequence of SEQ ID NO: 2, 5, or 8 or an accession number. AT as
Comprising the amino acid sequence encoded by the nucleotide sequence of the DNA insert of plasmid deposited in CC ^R. In another preferred embodiment, the invention relates to an isolated isolate substantially homologous to the amino acid sequence of SEQ ID NO: 2, 5, or 8 (encoded by the open reading frames set forth in SEQ ID NO: 3, 6, or 9, respectively). HA
It relates to LG-2LP, sALG-2LP or mALG-2LP protein. In yet another aspect,
The hALG-2LP, sALG-2LP or mALG-2LP protein has at least 38%, 42%, 44%, 45%, 50%, 55%, 60%, 65% of the amino acid sequence of SEQ ID NO: 2, 5, or 8, respectively. %, 70%
, 75%, 80%, 85%, 90%, 95%, 98% or more homologous. In another aspect,
The hALG-2LP, sALG-2LP or mALG-2LP protein comprises an amino acid sequence that is at least 42% or more homologous to the amino acid sequence of SEQ ID NO: 2, 5 or 8, respectively, and has the following activities: 1) Capable of interacting with molecules involved in the programmed cell death pathway, such as ALG-2 interacting proteins; and 2) cell death in cells such as brain cells and other cells expressing ALG2-LP, such as programmed cell death One or more of which can be adjusted.

Alternatively, the isolated hALG-2LP, sALG-2LP or mALG-2LP protein is
SEQ ID NO: 1, 4, 4 or 7, respectively, or the accession number Hybridizes to the full length of the nucleotide sequence of the DNA insert of the plasmid deposited with the ATCC ^R , e.g., hybridizes under stringent conditions, or at least 32%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%
, 75%, 80%, 85%, 90%, 95%, 98% or more homologous nucleotide sequences. Furthermore, hALG-2LP, sA
Preferably, these forms of LG-2LP or mALG-2LP also have one or more of the activities described herein.

[0020] Operably linking a hALG-2LP, sALG-2LP or mALG-2LP protein (or polypeptide) or a biologically active portion thereof to a non-hALG-2LP, sALG-2LP or mALG-2LP polypeptide To produce a fusion protein. Further, the hALG-2LP, sALG-2LP or mALG-2LP protein or a biologically active portion thereof may be included in a pharmaceutical composition comprising the protein and a pharmaceutically acceptable carrier. it can.

The hALG-2LP, sALG-2LP or mALG-2LP protein or a part or fragment thereof of the present invention is used for producing an anti-hALG-2LP, anti-sALG-2LP or anti-mALG-2LP antibody. be able to. Therefore, the present invention also provides SEQ ID NO: 2, respectively.
Comprising at least 8 amino acid residues of the amino acid sequence shown in 5 or 8, and h
Antibodies raised against ALG-2LP, sALG-2LP or mALG-2LP peptides were hALG-
HALG-2LP, sALG-2LP or mALG-2LP to form a specific immune complex with
HALG-2LP, sALG-2LP or mALG- encompassing ALG-2LP or mALG-2LP epitopes
Also provided is an antigenic peptide of 2LP. Preferably, the antigenic peptide has at least 10 amino acid residues, more preferably at least 15 amino acid residues, even more preferably at least 20 amino acid residues, most preferably at least 30 amino acid residues.
Amino acid residues. The invention further relates to hALG-2LP, sALG-2LP or mA
Provide an antibody that specifically binds to LG-2LP. In one embodiment, the antibodies are monoclonal. In another aspect, the antibody is linked to a detectable substance. In yet another aspect, the antibody is included in a pharmaceutical composition comprising the antibody and a pharmaceutically acceptable carrier.

The present invention also provides for detecting a genetic damage in the hALG-2LP, sALG-2LP or mALG-2LP gene, such that the subject having the damaged gene is a variant or abnormal hALG
-2LP, sALG-2LP or mALG-2LP nucleic acid expression or hALG-2LP, sALG-2LP or mA
It also relates to a method of determining whether a disease characterized by LG-2LP protein activity is at risk (or predisposed) to a disease characterized by unregulated programmed cell death. In a preferred embodiment, the method comprises modifying or influencing the integrity of the gene encoding hALG-2LP, sALG-2LP or mALG-2LP protein in a sample of cells from the subject or hALG-2LP, sALG-2LP. Or mA
Includes detecting the presence or absence of genetic damage characterized by erroneous expression of the LG-2LP gene.

Another embodiment of the present invention is directed to a hALG-2LP, sALG-2LP or mALG-2 in a biological sample.
It relates to a method for detecting the presence of LP. In a preferred embodiment, the method comprises hALG-2LP
So that the presence of sALG-2LP or mALG-2LP is detected in a biological sample
contacting a biological sample with a compound or agent capable of detecting hALG-2LP, sALG-2LP or mALG-2LP protein or hALG-2LP, sALG-2LP or mALG-2LP mRNA. The compound or agent is, for example, hALG-2LP,
With a labeled or labelable nucleic acid probe capable of hybridizing to sALG-2LP or mALG-2LP mRNA or a labeled or labelable antibody capable of binding to hALG-2LP, sALG-2LP or mALG-2LP protein There may be. The invention further provides a method of diagnosing a subject having a disease, for example, characterized by unregulated programmed cell death, based on the detection of hALG-2LP, sALG-2LP or mALG-2LP protein or mRNA. In one embodiment, the method comprises contacting a cell or tissue sample (eg, a brain cell sample) from the subject with an agent capable of detecting hALG-2LP, sALG-2LP or mALG-2LP protein or mRNA; HALG-2LP, sALG-2LP or mALG-2 expressed in a cell or tissue sample
Determine the amount of LP protein or mRNA, compare the amount of hALG-2LP, sALG-2LP or mALG-2LP protein or mRNA expressed in the cell or tissue sample with the control sample, and the cell when comparing to the control sample Or making a diagnosis based on the amount of hALG-2LP, sALG-2LP or mALG-2LP protein or mRNA expressed in the tissue sample. Preferably, the cell sample is a brain cell sample. HALG-2LP, sALG-2LP or mALG-2 in biological samples
Kits for detecting LP are also within the scope of the present invention. DETAILED DESCRIPTION OF THE INVENTION The present invention relates, at least in part, to novel molecules referred to herein as hALG-2LP, sALG-2LP and mALG-2LP nucleic acids and protein molecules that relate to proteins that regulate programmed cell death. Based on discovery.

As used herein, “programmed cell death” refers to a genetically regulated process involved in the normal development of a multicellular organism. This process involves the development of larvae of the nematode C. elegans, metamorphosis of insects, development in mammalian embryos, including the renal morphogenetic zone in the developing kidney, and regression or (eg, post castration) In various normal situations, including atrophy (in the prostrate), elimination occurs in predetermined cells. Programmed cell death is
Includes growth and trophic factor withdrawal, nutrient deprivation, hormonal treatment, UV irradiation, and reactive oxygen species and phosphatase inhibitors in many cells, including okadaic acid, calcium ionophores, and many cancer chemotherapeutic agents Can occur following exposure to toxic and infectious agents. A detailed description of programmed cell death can be found in Trump BF et al. (1995) FASEB J. 9: 219-228
And Lee S. (1993) Curr. Opin. Cell Biol. 5: 286-291, the contents of which are incorporated herein by reference. Thus, by participating in the programmed cell death pathway, the hALG-2LP, sALG-2LP and mALG-2LP proteins can modulate programmed cell death pathway activity, and especially in cells expressing ALG2-LP. Novel diagnostic targets and therapeutics for diseases characterized by lost programmed cell death.

As used herein, “a disease characterized by unregulated programmed cell death” refers to a loss of regulation of programmed cell death, eg, a disease, disorder or condition characterized by up-regulation or down-regulation. As expected. Loss of regulation of programmed cell death can cause loss of regulation of cell proliferation and / or cell cycle progression. Examples of diseases characterized by unregulated programmed cell death include neurodegenerative diseases such as Alzheimer's disease, dementia associated with Alzheimer's disease (such as Pick's disease), Parkinson's disease and other Lewy diffuse body diseases. Multiple sclerosis, amyotrophic lateral sclerosis, progressive supranuclear palsy, epilepsy, Creutzfeldt-Jakob disease or AIDS-related dementia; or a proliferative disease, such as cancer such as chronic lymphocytic leukemia or colon cancer. Included.

[0027] Dysfunction of hALG-2LP, sALG-2LP or mALG-2LP protein can cause diseases characterized by unregulated programmed cell death. Accordingly, one embodiment of the present invention detects a genetic damage in the hALG-2LP, sALG-2LP or mALG-2LP gene, such that the subject having the damaged gene is a variant or abnormal hALG
-2LP, sALG-2LP or mALG-2LP nucleic acid expression or hALG-2LP, sALG-2LP or mA
A method for determining whether one is at risk (or predisposed) to a disease characterized by LG-2LP protein activity, eg, a disease characterized by unregulated programmed cell death.

An apoptosis-related gene-2 like protein nucleic acid molecule described herein, eg,
hALG-2LP, sALG-2LP and mALG-2LP were each generated using the Blast algorithm,
Identified from human, monkey and mouse brain cDNA libraries. A cDNA library was prepared from mRNA isolated from the dissected monkey streak. A homology search of sequences obtained from this cDNA library revealed a 42% homology (144%) with rat ALG-2 protein.
A cDNA sequence with 62) of the amino acids was revealed. Sequence additional clones from the cDNA library and collect multiple sequences as contigs to create a full-length monkey.
The cDNA sequence, SEQ ID NO: 4, was obtained. A monkey clone was used to screen a human heart cDNA library and a mouse whole brain library. By determining the nucleotide sequence of the positive clone, a human sequence, SEQ ID NO: 1 and a partial mouse sequence, SEQ ID NO: 7, were obtained.

The nucleotide sequence of the hALG-2LP cDNA and the predicted amino acid sequence of the hALG-2LP protein are shown in FIG. 1 and in SEQ ID NOs: 1 and 2, respectively. Plasmid containing the full length nucleotide sequence encoding human ALG-2LP (having the DNA insert name) Deposit with ATCC ^R and accession number Was granted. This deposit is held under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for Patent Procedure.
This deposit is made merely as a convenience to those of skill in the art and is not an approval that the deposit is required under 35 USC §112.

The hALG-2LP gene, which is about 1667 nucleotides in length, encodes a protein having a molecular weight of about 32.7 kD and a length of about 284 amino acid residues. This hALG-2LP protein is expressed in all tissues examined (brain, heart, kidney, liver, lung, skeletal muscle, testis, placenta, pancreas, colon, prostate, ovary, small intestine and spleen). No expression was seen in the hypothalamus.

[0030] Amino acid residues 127-139 and 194-206 of the hALG-2LP protein comprise a region showing homology to the calcium binding domain. As used herein, the term “calcium binding domain” refers to an amino acid domain involved in calcium binding, such as the EF hand (eg, Baimbridge KG et al. (1992) TINS 15 (8):
303-308, the contents of which are incorporated herein by reference)
Point out. These EF-hand is usually consensus sequence: having a sequence similar to: EO ·· OO ·· O D KDGD G · O ... E F ·· O O (16 SEQ ID NO:). O may be I, L, V or M, and “•” indicates a position where there is no strongly preferred residue. Each residue described is present in more than 25% of the sequences, and the underlined one is present in more than 80% of the sequences.

The nucleotide sequence of the sALG-2LP cDNA and the predicted amino acid sequence of the sALG-2LP protein are shown in FIG. 2 and in SEQ ID NOs: 4 and 5, respectively. The sALG-2LP gene, which is about 1525 nucleotides in length, encodes a protein having a molecular weight of about 31.8 kD and a length of about 277 amino acid residues.

The nucleotide sequence of the partial mALG-2LP cDNA and the predicted amino acid sequence of the partial mALG-2LP protein are shown in FIG. 3 and in SEQ ID NOs: 7 and 8, respectively. The partial mALG-2LP gene, which is about 1362 nucleotides in length, has a molecular weight of about 31.5 kD and
Encodes a protein that is 4 amino acid residues long.

Various aspects of the invention are described in further detail in the following subsections. I. Isolated nucleic acid molecules One aspect of the invention is an isolated nucleic acid molecule encoding hALG-2LP, sALG-2LP or mALG-2LP or a biologically active portion thereof, and hALG-2LP, sALG-LP. Nucleic acids encoding 2LP or mALG-2LP (eg, hALG-2LP, sALG-2LP or mALG-2LP mR
Sufficient nucleic acid fragments to be used as hybridization probes to identify NA). As used herein, the term “nucleic acid molecule” refers to DNA molecules (eg, cDNA or genomic DNA) and RNA molecules (eg, mRNA
) As well as DNA or RNA analogs made using nucleotide analogs. The nucleic acid molecule may be single-stranded or double-stranded, but preferably is double-stranded.
DNA. An "isolated" nucleic acid molecule is one which has been separated from other nucleic acid molecules present in the natural source of the nucleic acid. Preferably, "isolated"
A nucleic acid does not include sequences that naturally flank the nucleic acid in the genomic DNA of the organism from which the nucleic acid is derived (ie, sequences located at the 5 'and 3' ends of the nucleic acid).
For example, in various embodiments, an isolated hALG-2LP, sALG-2LP or mALG-2LP nucleic acid molecule is a genomic DNA of a cell from which the nucleic acid is derived (eg, a brain cell or other cell that expresses ALG2-LP). Contains less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of the nucleotide sequence that is naturally adjacent to the nucleic acid molecule. In addition, an "isolated" nucleic acid molecule, such as a cDNA molecule, can contain other cellular material or culture media if produced by recombinant techniques, or a chemical precursor or other if chemically synthesized. May not substantially contain any of the above chemical products.

The nucleic acid molecules of the invention, eg, nucleic acid molecules having the nucleotide sequences of SEQ ID NOs: 1, 4, and 7, or portions thereof, employ standard molecular biology techniques and the sequence information provided herein. And can be isolated. For example, all or part of SEQ ID NO: 1, 4 or 7 as a hybridization probe, and (for example, Sambro
ok, J., Fritsh, EF and Maniatis, T. Molecular Cloning: A Laboratory Ma
nual. Second edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laborator
Isolate human, monkey or mouse ALG-2LP cDNA from a human, monkey or mouse brain library, respectively, using standard hybridization techniques (as described in y Press, Cold Spring Harbor, NY, 1989). be able to. further,
Isolating a nucleic acid molecule encompassing all or part of SEQ ID NO: 1, 4 or 7 by using the oligonucleotide primer designed based on the sequence of SEQ ID NO: 1, 4 or 7 by the polymerase chain reaction. it can. For example, (eg, Chirgwin
et al. (1979) Biochemistry 18: mRNA can be isolated from normal brain cells (by the guanidinium-thiocyanate extraction method of 5294-5299) and reverse transcriptase (eg, Gibco / BRL, Bethesda, MD) Moloney MLV reverse transcriptase available from
Alternatively, cDNA can be prepared using AMV reverse transcriptase available from Seikagaku America, Inc., St. Petersburg, FL). Synthetic oligonucleotide primers for PCR amplification can be designed based on the nucleotide sequence shown in SEQ ID NO: 1, 4 or 7. Using standard PCR amplification techniques, the nucleic acids of the invention can be amplified using cDNA or alternatively genomic DNA as a template and appropriate oligonucleotide primers. The nucleic acid thus amplified can be cloned into a suitable vector and characterized by DNA sequence analysis. Furthermore, oligonucleotides corresponding to hALG-2LP, sALG-2LP or mALG-2LP nucleotide sequences can be produced by standard synthetic techniques, eg, using an automated DNA synthesizer.

In a preferred embodiment, the isolated nucleic acid molecule of the present invention comprises the nucleotide sequence set forth in SEQ ID NOs: 1, 4 and 7 or the accession number As the DNA insert of the plasmid deposited with the ATCC ^R. The sequence of SEQ ID NO: 1 is human A
It corresponds to LG2-LP (hALG2-LP) cDNA. This cDNA contains the sequence encoding the hALG-2LP protein (ie, the "coding region", nucleotides 30-88 of SEQ ID NO: 1).
1) and the 5 ′ untranslated sequence (nucleotides 1-29 of SEQ ID NO: 1) and the 3 ′ untranslated sequence (
SEQ ID NO: 1 (nucleotides 882-1667). Alternatively, the nucleic acid molecule can comprise only the coding region of SEQ ID NO: 1 (e.g., nucleotides 30-881 shown separately as SEQ ID NO: 3). The sequence of SEQ ID NO: 4 is
This corresponds to the monkey ALG-2LP (sALG-2LP) cDNA. This cDNA contains a sequence encoding the sALG-2LP protein (ie, the “coding region”, nucleotides of SEQ ID NO: 4).
10-840) and 5 ′ untranslated sequences (nucleotides 1-9 of SEQ ID NO: 4) and 3 ′ untranslated sequences (nucleotides 841-1525 of SEQ ID NO: 4). Alternatively, the nucleic acid molecule can comprise only the coding region of SEQ ID NO: 4 (eg, nucleotides 10-840, shown separately as SEQ ID NO: 6). The sequence of SEQ ID NO: 7 corresponds to the partial monkey ALG-2LP (mALG-2LP) cDNA. This cDNA is partially mALG-2L
Sequence encoding the P protein (ie, the “coding region”, SEQ ID NO: 7
Nucleotides 177-998) and the 5 'untranslated sequence (nucleotides 1-1 of SEQ ID NO: 7)
76) and the 3 'untranslated sequence (nucleotides 999 to 1362 of SEQ ID NO: 7).
Alternatively, the nucleic acid molecule comprises only the coding region of SEQ ID NO: 7 (eg,
Nucleotides 177-998, shown separately as SEQ ID NO: 9).

[0036] In another preferred embodiment, the isolated nucleic acid molecule of the present invention comprises a nucleotide sequence as set forth in SEQ ID NO: 1, 4 or 7, accession number As a nucleic acid molecule that is the complement of the nucleotide sequence of the DNA insert of the plasmid deposited with the ATCC ^R or a portion of these nucleotide sequences. A nucleic acid molecule that is complementary to the nucleotide sequence shown in SEQ ID NO: 1, 4 or 7 hybridizes to the nucleotide sequence shown in SEQ ID NO: 1, 4 or 7, respectively, thereby forming a stable duplex It is sufficiently complementary to the nucleotide sequence shown in SEQ ID NO: 1, 4 or 7 so that it can be used.

[0037] In yet another preferred embodiment, the isolated nucleic acid molecule of the present invention comprises SEQ ID NO: 1.
Nucleotide sequence shown in 4 or 7, accession number At least 32%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% of the nucleotide sequence of the DNA insert of the plasmid deposited at the ATCC ^R or a portion of these nucleotide sequences. , 75%, 80
%, 85%, 90%, 95%, 98% or more nucleotide sequence homology.
In a further preferred embodiment, the isolated nucleic acid molecule of the present invention comprises a nucleotide sequence as set forth in SEQ ID NO: 1, 4 or 7, accession number As well as nucleotide sequences that hybridize to the nucleotide sequence of the DNA insert of the plasmid deposited with the ATCC ^R , or a portion of these nucleotide sequences, eg, under stringent conditions.

Further, the nucleic acid molecule of the present invention may comprise only a part of the coding region of SEQ ID NO: 1, 4 or 7, for example, a fragment or hALG-2LP, sALG-2LP or mALG- which can be used as a probe or primer. It can comprise a fragment encoding a biologically active portion of 2LP. HALG-2LP and sALG from mammals
Depending on the nucleotide sequence determined from the cloning of the -2LP or mALG-2LP gene, hALG-2LP, sALG-2LP or
Probes and primers designed for use in the identification and / or cloning of mALG-2LP homologs and hALG-2LP, sALG-2LP or mALG-2LP homologs from other mammals, such as rats, can be made. . The probe / primer typically comprises a substantially purified oligonucleotide. The oligonucleotide is typically a sense sequence of SEQ ID NO: 1, 4 or 7, SEQ ID NO: 1, 4
Or at least about 12, preferably about 25, more preferably about 40, 50, 75, 100, 150, 200, 3 of the 7 antisense sequences or naturally occurring mutants thereof
It comprises a region of the nucleotide sequence that hybridizes under stringent conditions to 00, 400, 500, 520, 540, 550 or 600 contiguous nucleotides. Primers based on the nucleotide sequence of SEQ ID NO: 1, 4 or 7 include hALG-2LP, sALG
-2LP or mALG-2LP homologs can be used in PCR reactions to clone. Probes based on the hALG-2LP, sALG-2LP or mALG-2LP nucleotide sequence can be used to detect transcripts or genomic sequences encoding the same or homologous proteins. In a preferred embodiment, the probe further comprises a label group attached thereto, for example, the label group may be a radioisotope, a fluorescent compound, an enzyme or an enzyme cofactor. Such probes measure the level of nucleic acid encoding hALG-2LP, sALG-2LP or mALG-2LP in a sample of cells from a subject, for example, hALG-2LP, sALG-2LP or mALG-2LP mRN.
HALG-2LP, sALG-2LP, such as by detecting A levels or determining whether the genomic hALG-2LP, sALG-2LP or mALG-2LP gene is mutated or deleted Alternatively, it can be used as part of a diagnostic test kit for identifying cells or tissues that mis-express the mALG-2LP protein.

In one embodiment, the nucleic acid molecule of the invention is an amino acid sequence of SEQ ID NO: 2, 5 or 8 or an accession number such that the protein or a portion thereof retains the ability to modulate programmed cell death-related activity. Encodes a protein or a part thereof containing an amino acid sequence sufficiently homologous to the amino acid sequence encoded by the nucleotide sequence of the DNA insert of the plasmid deposited with the ATCC ^R. As used herein, the term "sufficiently homologous" refers to the amino acid sequence of SEQ ID NO: 2, 5 or 8 or the accession number such that the protein or a portion thereof can modulate programmed cell death-related activity. The same or equivalent to the amino acid sequence encoded by the nucleotide sequence of the DNA insert of the plasmid deposited at the ATCC ^R (eg, an amino acid residue having a side chain similar to the amino acid residue of SEQ ID NO: 2, 5 or 8) A) a protein having an amino acid sequence containing a minimum number of amino acid residues, or a portion thereof; In another embodiment, the protein has at least 38%, 42%, 44%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, 95%, 98% or more homologous.

The portion of the protein encoded by the hALG-2LP, sALG-2LP or mALG-2LP nucleic acid molecule of the present invention is preferably a biologically active hALG-2LP, sALG-2LP or mALG-2LP protein. Part. As used herein, "hALG-2LP, sALG
The term "biologically active part of -2LP or mALG-2LP" refers to the following activities: 1)
Capable of interacting with molecules involved in the programmed cell death pathway, eg, ALG-2 interacting proteins; and 2) cell death in cells, eg, brain cells and other cells expressing ALG2-LP, eg, programmed cell death. Include one or more of hALG-2LP, sALG-2LP or mALG-2LP, eg, domains / motifs, which have one or more of the following:

A protein associated with another programmed cell death pathway, eg, hALG-2LP, sALG-2LP or mALG-2LP protein that interacts (eg, binds) with ALG-2, or a portion thereof, or biologically thereof. Standard binding assays can be performed to determine the capacity of the active moiety, such as immunoprecipitation and yeast two-hybrid assays as described herein. To determine whether the hALG-2LP, sALG-2LP or mALG-2LP protein or a biologically active portion thereof can regulate programmed cell death in a cell such as a T cell, a T cell, e.g., (Ashwe
T cell hybridomas (as described in ll JD et al. (1990) J. Immunol. 144: 3326) that have been cross-linked with T cell receptors to induce programmed cell death.
3DO), for example, hALG-2LP, sALG-2LP or mALG-2LP cloned into a pLTP vector (as described in Vito P. et al. (1996) Science 271: 521-525).
Nucleic acids encoding proteins or biologically active portions thereof can be transfected. The ability of the transfected nucleic acid molecule to protect the recipient cells from cell death can then be monitored.

Isolating a portion of SEQ ID NO: 2, 5, or 8, respectively, and expressing the encoded portion of a hALG-2LP, sALG-2LP or mALG-2LP protein or peptide (eg, by recombinant expression in vitro) HALG-2LP, sALG-2LP or mALG-2LP by assessing the activity of the encoded portion of the protein or peptide.
Additional nucleic acid fragments that encode biologically active portions of sALG-2LP or mALG-2LP can be prepared.

The present invention further differs from the nucleotide sequence shown in SEQ ID NO: 1, 4 or 7 (and parts thereof) due to the degeneracy of the genetic code, and thus the nucleotides shown in SEQ ID NO: 1, 4 or 7 Includes nucleic acid molecules encoding the same hALG-2LP, sALG-2LP or mALG-2LP protein as encoded by the sequences, respectively. In another embodiment, the isolated nucleic acid molecule of the present invention is a protein having the amino acid sequence shown in SEQ ID NO: 2, 5 or 8, or an accession number. Has a nucleotide sequence that encodes a protein having the amino acid sequence encoded by the nucleotide sequence of the DNA insert of the plasmid deposited with the ATCC ^R. In a still further aspect, the nucleic acid molecule of the present invention comprises (SEQ ID NO: 3, 6
Or encoded by the open reading frame shown in 9) SEQ ID NO:
2, 5, or 8 amino acid sequence or accession number Encodes a full-length human protein substantially homologous to the amino acid sequence encoded by the nucleotide sequence of the DNA insert of the plasmid deposited with the ATCC ^R.

In addition to the hALG-2LP, sALG-2LP and mALG-2LP nucleotide sequences shown in SEQ ID NOs: 1, 4 and 7, results in changes in the amino acid sequence of hALG-2LP, sALG-2LP and mALG-2LP
It is understood by those skilled in the art that DNA sequence polymorphisms may be present within a population (eg, a human population). Such genetic polymorphisms in the hALG-2LP, sALG-2LP, and mALG-2LP genes may exist between individuals in the population due to natural allelic variation. As used herein, the terms "gene" and "recombinant gene" refer to hALG-2LP, sALG-2LP or mALG-2LP protein, preferably mammalian hA
A nucleic acid molecule comprising an open reading frame encoding a LG-2LP, sALG-2LP or mALG-2LP protein. Such natural allelic variations are
Typically, 1-5% differences in the nucleotide sequence of the hALG-2LP, sALG-2LP or mALG-2LP gene can be effected. HALG-2LP, sALG-, which is the result of natural allelic variation and does not alter the functional activity of hALG-2LP, sALG-2LP or mALG-2LP
Any and all such nucleotide variations in 2LP or mALG-2LP and the resulting amino acid polymorphisms are considered to be within the scope of the invention. Furthermore, it encodes hALG-2LP, sALG-2LP or mALG-2LP protein from other species,
Thus, nucleic acid molecules having a nucleotide sequence that differs from the sequence of SEQ ID NO: 1, 4 or 7 are considered to be within the scope of the present invention. HALG-2LP of the present invention, sALG-2LP or
Nucleic acid molecules corresponding to natural allelic variants of the mALG-2LP cDNA and non-human, non-monkey or non-mouse homologues can be used as hybridization probes by standard hybridization techniques under stringent hybridization conditions. Or hALG-2LP, sALG-2LP described herein using a part thereof or
Alternatively, they can be isolated based on their homology to mALG-2LP nucleic acids. Thus, in another embodiment, the isolated nucleic acid molecule of the present invention is at least 15 nucleotides in length, and comprises the nucleotide sequence of SEQ ID NO: 1, 4 or 7 or the accession number Under stringent conditions with a nucleic acid molecule comprising the nucleotide sequence of the DNA insert of the plasmid deposited with the ATCC ^R. In another embodiment, the nucleic acid is at least 30, 50, 100, 250, 300, 350, 400, 450, 500, 5
20, 540, 550 or 600 nucleotides in length. As used herein, the term `` hybridizes under stringent conditions '' refers to hybridization and washing conditions in which nucleotide sequences at least 60% homologous to each other typically remain hybridized to each other. Shall be represented. Preferably, these conditions are such that sequences homologous to each other by at least about 65%, more preferably at least about 70%, even more preferably at least about 75% or more typically remain hybridized to each other. In. Such stringent conditions are known to those skilled in the art, and are described in Current Protocols in Molecular Biology,
John Wiley & Sons, NY (1989), 6.3.1-6.3.6. A preferred non-limiting example of stringent hybridization conditions is about 45 ° C.
Hybridization in 6X sodium chloride / sodium citrate (SSC) followed by one or more washes in 0.2X SSC, 0.1% SDS at 50-65 ° C. Preferably, an isolated nucleic acid molecule of the invention that hybridizes under stringent conditions to the sequence of SEQ ID NO: 1, 4 or 7 corresponds to a naturally occurring nucleic acid molecule. As used herein, a “naturally occurring” nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that occurs in nature (eg, encodes a naturally occurring protein). In one embodiment, the nucleic acid is native human hALG-2
Encodes LP, sALG-2LP or mALG-2LP.

In addition to naturally occurring allelic variants of the hALG-2LP, sALG-2LP or mALG-2LP sequence that may be present in the population, further include hALG-2LP, sALG-2LP or
Without altering the functional performance of the mALG-2LP protein, a mutation is introduced into the nucleotide sequence of SEQ ID NO: 1, 4 or 7 by mutation, thereby encoding the hALG-2LP, sA
One skilled in the art will recognize that mutations in the amino acid sequence of the LG-2LP or mALG-2LP protein can be effected. For example, nucleotide substitutions leading to amino acid substitutions at "non-essential" amino acid residues can be made in the sequence of SEQ ID NO: 1, 4 or 7. “Non-essential” amino acid residues are the wild-type sequence of hALG-2LP, sALG-2LP or mALG-2LP without altering the activity of hALG-2LP, sALG-2LP or mALG-2LP (eg, SEQ ID NO:
: 2, 5 or 8 sequences), whereas "essential" amino acid residues are required for hALG-2LP, sALG-2LP or mALG-2LP activity. For example, amino acid residues conserved between the ALG-2LP proteins of the invention are not expected to be particularly easily modified (eg, conserved aspartate, lysine and glutamate residues present in EF hands). However, other amino acid residues (eg, those that are not conserved or only semi-conserved in the EF hand) may not be essential for activity and, therefore, hALG-2LP, sALG-2LP or mALG
-2 It seems that it can be easily modified without changing the LP activity.

Thus, another aspect of the present invention relates to hALG-2LP, sALG-2LP or mALG-2LP containing mutations at amino acid residues that are not essential for hALG-2LP, sALG-2LP or mALG-2LP activity.
The present invention relates to a nucleic acid molecule encoding an LP protein. Such hALG-2LP, sALG-2LP or mALG-2LP proteins differ in amino acid sequence from SEQ ID NO: 2, 5 or 8, respectively, and still have the hALG-2LP, sALG-2LP and mALG- described herein. Retains at least one of the 2LP activities. In one embodiment, the isolated nucleic acid molecule has the sequence of SEQ ID NO:
: At least 38%, 42%, 44%, 45%, 50%, 55%, 60% for 2, 5, or 8 amino acid sequences
, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more nucleotides encoding a protein comprising a homologous amino acid sequence and capable of regulating programmed cell death Comprising an array.

To determine the two amino acid sequences (eg, SEQ ID NOs: 2, 5 or 8 and mutant forms thereof) or the% homology of the two nucleic acids, align these sequences for optimal comparison purposes (Eg, gaps can be introduced in the sequence of another protein or nucleic acid for optimal alignment with one protein or nucleic acid). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. A position in one sequence (eg, SEQ ID NO: 2, 5, or 8) may be replaced by another sequence (eg, hALG-2LP, sALG-2LP, or mALG-2LP, respectively)
When occupied by the same amino acid residue or nucleotide as the corresponding position in the mutant form of (a), these molecules are homologous at that position (ie, as used herein, the "homologous" amino acid or nucleic acid). "Gender" is equal to the "identity" of an amino acid or nucleic acid). The% homology between two sequences is a function of the number of identical positions shared by the sequences (ie,% homology = number of identical positions / total number of positions x 100).

[0048] Sequence comparison and determination of percent homology between two sequences can be performed using a mathematical algorithm. Preferred, non-limiting examples of mathematical algorithms utilized for sequence comparisons are described in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. U.
SA 90: Karlin and Altschul (1990) Proc.Na modified as in 5873-77.
tl. Acad. Sci. USA 87: 2264-68. Such algorithms are described in NBLAST and XBLAS in Altschul, et al. (1990) J. Mol. Biol. 215: 403-10.
Included in the T program (version 2.0). BLAST nucleotide searches can be performed with the NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to the hALG-2LP, sALG-2LP or mALG-2LP nucleic acid molecules of the invention. Alternatively, a BLAST protein search can be performed using the XBLAST program, score = 50, wordlength = 3 to obtain an amino acid sequence homologous to the hALG-2LP, sALG-2LP or mALG-2LP protein molecules of the present invention. . To obtain gap-aligned alignments for comparative purposes, see Altschul et al., (1997) Nucleic Acids Res.
5 (17): Gapped BLAST can be used as described in 3389-3402. BL
When utilizing the AST and Gapped BLAST programs, the default parameters of the respective programs (eg, XBLAST and NBLAST) can be used. http
See http://www.ncbi.nlm.nih.gov. Another preferred, non-limiting example of a mathematical algorithm utilized for sequence comparison is the algorithm of Myers and Miller, CABIOS (1989). Such an algorithm is included in the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

[0049] The isolated nucleic acid molecule encoding the hALG-2LP, sALG-2LP or mALG-2LP protein, which is homologous to the protein of SEQ ID NO: 2, 5, or 8, respectively, has one or more of the following in the encoded protein: It can be prepared by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of SEQ ID NO: 1, 4 or 7 so that the above amino acid substitutions, additions or deletions are introduced. it can. By standard techniques such as site-directed mutagenesis and mutagenesis by PCR,
Mutations can be introduced into SEQ ID NOs: 1, 4 or 7. Preferably, conservative amino acid substitutions are made at one or more predicted non-essential amino acid residues. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include basic side chains (
Lysine, arginine, histidine), acidic side chains (eg aspartic acid,
Glutamic acid), uncharged polar side chains (eg, glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (eg, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (eg, threonine, valine,
Amino acids having aromatic side chains (eg, tyrosine, phenylalanine, tryptophan, histidine). Therefore, preferably, hA
The predicted nonessential amino acid residue in LG-2LP, sALG-2LP or mALG-2LP is replaced with another amino acid residue from the same side chain family. Alternatively, in another embodiment, mutations can be introduced randomly along all or part of the hALG-2LP, sALG-2LP or mALG-2LP coding sequence, such as by saturation mutagenesis,
The resulting mutant is then described in hALG-2LP, sALG-2LP or mALG described herein.
Screening for -2LP activity can identify mutants that retain hALG-2LP, sALG-2LP or mALG-2LP activity. Following mutagenesis of SEQ ID NO: 1, 4 or 7, the encoded protein can be expressed recombinantly (eg, as described in Examples 3 and 4) and described, eg, herein. Assays can be used to measure protein activity.

[0050] In addition to the nucleic acid molecules encoding hALG-2LP, sALG-2LP or mALG-2LP protein described above, another aspect of the present invention relates to isolated nucleic acid molecules that are antisense thereto. An “antisense” nucleic acid comprises a nucleotide sequence that is complementary to a “sense” nucleic acid that encodes a protein, eg, complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence. Thus, an antisense nucleic acid can hydrogen bond to a sense nucleic acid. The antisense nucleic acid may be complementary to the entire hALG-2LP, sALG-2LP or mALG-2LP coding strand, or to only a portion thereof.
In one embodiment, the antisense nucleic acid molecule is hALG-2LP, sALG-2LP or mALG-2.
Antisense to the "coding region" of the coding strand of the nucleotide sequence encoding LP.

The term “coding region” refers to a region of a nucleotide sequence that comprises codons translated into amino acid residues, for example, the entire coding region of SEQ ID NO: 1 (separately as SEQ ID NO: 3). SEQ ID NO: 4 (shown separately as SEQ ID NO: 6) comprising nucleotides 30 to 881).
And the entire coding region of SEQ ID NO: 7 comprises nucleotides 177-998 (separately shown as SEQ ID NO: 9). In another embodiment, the antisense nucleic acid molecule is antisense to the "non-coding region" of the coding strand of a nucleotide sequence encoding hALG-2LP, sALG-2LP or mALG-2LP. The term “non-coding region” refers to 5 ′ and 3 ′ sequences that flank a coding region that is not translated into amino acids (ie, also referred to as 5 ′ and 3 ′ untranslated regions).
An example of an antisense molecule that is complementary to a fragment of the 5 'untranslated region of SEQ ID NO: 1 and also includes an initiation codon is a nucleic acid molecule that includes nucleotides complementary to nucleotides 20-38 of SEQ ID NO: 1. This antisense molecule has the following nucleotide sequence:
5 'CAGAATCACCATGGCCAGC 3' (SEQ ID NO: 17). An example of an antisense molecule complementary to a portion of the 3 'untranslated region of SEQ ID NO: 1 is nucleotides 885-905 of SEQ ID NO: 1.
Is a nucleic acid molecule containing nucleotides complementary to This antisense molecule has the following nucleotide sequence: 5 'CCCAACCATCTGTGGAGAGTGTG 3' (SEQ ID NO: 18). An example of an antisense molecule that is complementary to a fragment of the 5 ′ untranslated region of SEQ ID NO: 4 and that also includes an initiation codon is a nucleic acid molecule that includes nucleotides complementary to nucleotides 1-15 of SEQ ID NO: 4. This antisense molecule has the following nucleotide sequence: 5 'C
GCGTGGGCATGGCC 3 '(SEQ ID NO: 19). An example of an antisense molecule complementary to a portion of the 3 'untranslated region of SEQ ID NO: 4 is a nucleic acid molecule that includes nucleotides complementary to nucleotides 844-862 of SEQ ID NO: 4. This antisense molecule has the following sequence: 5 '
CCCAACCCATCTGTGGAGA 3 '(SEQ ID NO: 20). An example of an antisense molecule that is complementary to a fragment of the 5 'untranslated region of SEQ ID NO: 7 and that also includes an initiation codon is a nucleic acid molecule that includes nucleotides complementary to nucleotides 170-182 of SEQ ID NO: 7. This antisense molecule has the following nucleotide sequence: 5 'CGGCACGAGCAGC 3' (SEQ ID NO: 21). An example of an antisense molecule complementary to a portion of the 3 'untranslated region of SEQ ID NO: 7 is a nucleic acid molecule that includes nucleotides complementary to nucleotides 992-1008 of SEQ ID NO: 7. This antisense molecule has the following sequence: 5 'GATGCTATGACCCAGCC 3
'(SEQ ID NO: 22).

Given the coding strand sequences encoding hALG-2LP, sALG-2LP and mALG-2LP disclosed herein (eg, SEQ ID NOs: 1, 4 and 7, respectively), Watson-Crick base pairs The antisense nucleic acid of the present invention can be designed according to the rules of the present invention. The antisense nucleic acid molecule is a hALG-2LP, sALG-2LP or mALG-2LP mRN
A may be complementary to the entire coding region, but more preferably, hALG-2LP
, An oligonucleotide that is antisense to only a portion of the coding or non-coding region of sALG-2LP or mALG-2LP mRNA. For example, the antisense oligonucleotide may be complementary to a region around the translation start site of hALG-2LP, sALG-2LP or mALG-2LP mRNA. Antisense oligonucleotides may be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. The antisense nucleic acids of the invention can be constructed using chemical synthesis and enzymatic ligation using methods known in the art. For example, variously modified nucleotides designed to increase the biological stability of naturally occurring nucleotides or molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids Can be used to chemically synthesize an antisense nucleic acid (eg, an antisense oligonucleotide). For example, phosphorothioate derivatives and acridine-substituted nucleotides can be used. Examples of modified nucleotides that can be used to make antisense nucleic acids include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylcuosin, inosine, N6-isopentenyladenine, 1-methyl Guanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosylcuosin, 5'-methoxy Carboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wipexosin, pseudouracil, cuocin, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil , 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (
v), 5-methyl-2-thiouracil, 3- (3-amino-3-N-2-carboxypropyl) uracil, (acp3) w and 2,6-diaminopurine. Alternatively, an antisense nucleic acid can be produced biologically using an expression vector in which the nucleic acid is subcloned in the antisense orientation (ie, the RNA transcribed from the inserted nucleic acid is Which is in the antisense orientation to the target nucleic acid, further described in the following subsection).

The antisense nucleic acid molecules of the invention typically hybridize or bind to the mRNA and / or genomic DNA of a cell in which they encode the hALG-2LP, sALG-2LP or mALG-2LP protein. Administered to a subject or made in situ, thereby suppressing expression of the protein, for example, by inhibiting transcription and / or translation. This hybridization may be due to normal nucleotide complementarity to form a stable duplex or, for example, in the case of an antisense nucleic acid molecule binding to a DNA duplex, specific interactions in the major groove of the duplex. It may be by action. Examples of routes of administration of the antisense nucleic acid molecules of the invention include direct injection at a tissue site. Alternatively, the antisense nucleic acid molecule can be modified to target a selected cell and then administered systemically. For example,
For systemic administration, such as by linking an antisense nucleic acid molecule to a peptide or antibody that binds a cell surface receptor or antigen, to specifically bind to a receptor or antigen expressed on a selected cell surface. The antisense nucleic acid molecule can be modified. Antisense nucleic acid molecules can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of the antisense molecule, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter are preferred.

[0054] In yet another aspect, the antisense nucleic acid molecules of the invention are α-anomeric nucleic acid molecules. The α-anomeric nucleic acid molecule forms a specific double-stranded hybrid with the complementary RNA, in which case, unlike the normal β-unit, these chains extend parallel to each other (Gaultier et al. (1987) Nucleic Acids Res. 15: 6625-6641). Antisense nucleic acid molecules are also known as 2'-o-methyl ribonucleotides (Inoue et al. (1987)
Nucleic Acids Res. 15: 6131-6148) or chimeric RNA-DNA analogs (Inoue et al.
(1987) FEBS Lett. 215: 327-330).

[0055] In yet another aspect, the antisense nucleic acids of the invention are ribozymes. Ribozymes are catalytic RNA molecules with ribonuclease activity that can cleave single-stranded nucleic acids, such as mRNAs, where they have complementary regions. Therefore, hALG-2LP
Catalyzes the cleavage of sALG-2LP or mALG-2LP mRNA transcripts, thereby producing hALG-
Ribozymes (eg, hammerhead ribozymes (described in Haselhoff and Gerlach (1988) Nature 334: 585-591)) can be used to inhibit translation of 2LP, sALG-2LP or mALG-2LP mRNA. HALG-2LP, sALG disclosed herein
-2LP or mALG-2LP cDNA nucleotide sequence (ie, SEQ ID NO:
A ribozyme having specificity for a nucleic acid encoding hALG-2LP, sALG-2LP or mALG-2LP can be designed based on 1, 4, or 7). For example, a Tetrahymena L-19 IVS RN in which the nucleotide sequence of the active site is complementary to the nucleotide sequence cleaved in mRNA encoding hALG-2LP, sALG-2LP or mALG-2LP
Derivatives of A can be constructed. See, for example, Cech et al., U.S. Pat.
1; and Cech et al., U.S. Patent No. 5,116,742. Alternatively, hAL may be used to select a catalytic RNA having a particular ribonuclease activity from a pool of RNA molecules.
G-2LP, sALG-2LP or mALG-2LP mRNA can be used. For example, Bartel,
See D. and Szostak, JW (1993) Science 261: 1411-1418.

Alternatively, the regulatory region of hALG-2LP, sALG-2LP or mALG-2LP (eg, hALG-2LP,
-2LP, sALG-2LP or mALG-2LP promoter and / or enhancer) to target a nucleotide sequence complementary to hALG-2LP, sALG-2LP or
hALG-2LP by forming a triple helix that blocks transcription of the mALG-2LP gene
, SALG-2LP or mALG-2LP gene expression. In general, Helene
, C. (1991) Anticancer Drug Des. 6 (6): 569-84; Helene, C. et al. (1992)
Ann. NY Acad. Sci. 660: 27-36; and Maher, LJ (1992) Bioassays 14 (12
): See 807-15. II. Recombinant Expression Vectors and Host Cells Another aspect of the invention relates to a vector, preferably an expression vector, containing a nucleic acid encoding hALG-2LP, sALG-2LP or mALG-2LP (or a portion thereof). As used herein, the term "vector" refers to a nucleic acid molecule capable of carrying another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double-stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, in which additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (eg, bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (eg, non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. In addition, certain vectors can direct the expression of genes to which they are operably linked. Such vectors are referred to herein as "expression vectors". Generally, expression vectors useful in recombinant DNA technology include:
Usually in the form of a plasmid. Since a plasmid is the most commonly used vector form, "plasmid" and "vector" can be used interchangeably herein. However, the invention is intended to include other forms of expression vectors, such as viral vectors (eg, replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.

A recombinant expression vector of the invention comprises a nucleic acid of the invention in a form suitable for expression of a nucleic acid in a host cell, wherein the recombinant expression vector is administered to the host cell used for expression. It includes one or more regulatory sequences selected on the basis of which it is meant to be operably linked to the nucleic acid sequence to be expressed. “Operably linked” within a recombinant expression vector is such that it can express the nucleotide sequence (eg, in an in vitro transcription / translation system or in a host cell if the vector is introduced into a host cell). The nucleotide sequence of interest is a regulatory sequence (
(One or more). The term "regulatory sequence" is intended to include promoters, enhancers and other expression control elements (eg, polyadenylation signals). Such regulatory sequences include, for example, Goeddel; G
ene Expression Technology: Methods in Enzymology 185, Academic Press, Sa
n Diego, CA (1990). Regulatory sequences include those that direct constitutive expression of the nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells (eg, tissue-specific regulatory sequences). One skilled in the art will recognize that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of the desired protein, and the like. An expression vector of the invention is introduced into a host cell, and thereby comprises a protein or peptide, including a fusion protein or peptide encoded by a nucleic acid as described herein (eg, hALG-2LP, sALG-2LP or mALG). -2LP protein,
Mutant forms of hALG-2LP, sALG-2LP or mALG-2LP, fusion proteins, etc.) can be produced.

[0058] The recombinant expression vectors of the invention can be designed for expression of hALG-2LP, sALG-2LP or mALG-2LP in prokaryotic or eukaryotic cells. For example, in bacterial cells such as Escherichia coli (E. coli), insect cells (using baculovirus expression vectors), yeast cells or mammalian cells, hALG-2LP, sALG-2LP or mALG.
-2LP can be expressed. Suitable host cells are Goeddel, Gene Expression
Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1
990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example, using a T7 promoter regulatory sequence and T7 polymerase.

[0059] Expression of proteins in prokaryotes is often performed in Escherichia coli using vectors containing constitutive or inducible promoters that direct the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus of the recombinant protein. Such fusion vectors typically serve three purposes:
1) increase the expression of the recombinant protein; 2) increase the solubility of the recombinant protein; and 3) facilitate purification of the recombinant protein by acting as a ligand in affinity purification. In fusion expression vectors, a proteolytic cleavage site is often introduced at the junction between the fusion moiety and the recombinant protein so that the recombinant protein can be separated from the fusion moiety after purification of the fusion protein. Such enzymes and their cognate recognition sequences include factor Xa, thrombin and enterokinase. Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith, DB
And Johnson, KS (1988) Gene 67: 31-40), pMAL (New England Biolabs, Beve
rly, MA) and pRIT5 (Parmacia, Piscataway, NJ). In one embodiment, the coding sequence of hALG-2LP, sALG-2LP or mALG-2LP is cloned into a pGEX expression vector and the N-terminal to C-terminal GST-thrombin cleavage site-hALG-2LP, sALG-
A vector encoding a fusion protein comprising 2LP or mALG-2LP is made. The fusion protein can be purified by affinity chromatography using glutathione-agarose resin. Recombinant hALG-2LP, sALG-2LP or mALG-2L not fused to GST by cleavage of the fusion protein with thrombin
P can be recovered.

Examples of suitable inducible non-fused Escherichia coli expression vectors include pTrc (Amann
et al. (1988) Gene 69: 301-315) and pET 11d (Studier et al., Gene Express
ion Technology: Methods in Enzymology 185, Academic Press, San Diego, Ca
lifornia (1990) 60-89). Target gene expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter. Target gene expression from the pET 11d vector relies on transcription from a T7 gn10-lac fusion promoter driven by the co-expressed viral RNA polymerase (T7 gn1). This viral polymerase is supplied by host strains BL21 (DE3) or HMS174 (DE3) from an endogenous lambda prophage carrying the T7 gn1 gene under the transcriptional control of the lacUV5 promoter.

One way to maximize recombinant protein expression in Escherichia coli is to express the protein in a host bacterium that has an impaired ability to proteolytically cleave the recombinant protein (Gottesman. S. ., Gene Expressio
n Technology: Methods in Enzymology 185, Academic Press, San Diego, Cali
fornia (1990) 119-128). Another method is to modify the nucleic acid sequence of the nucleic acid inserted into the expression vector such that the individual codon for each amino acid is one that is preferentially utilized in Escherichia coli (Wada et al., (1992) Nucleic Acids
Res. 20: 2111-2118). Such modifications of the nucleic acid sequences of the present invention can be performed by standard DNA synthesis techniques.

[0062] In another embodiment, the hALG-2LP, sALG-2LP or mALG-2LP expression vector is a yeast expression vector. Examples of vectors for expression in the yeast Saccharomyces cerevisiae include pYepSec1 (Baldari, et al. (1987) Embo J. 6: 2
29-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30: 933-943), pJRY88 (Sch
ultz et al. (1987) Gene 54: 113-123) and pYES2 (Invitrogen Corporation, Sa
n Diego, CA).

Alternatively, hALG can be expressed in insect cells using a baculovirus expression vector.
-2LP, sALG-2LP or mALG-2LP can be expressed. Cultured insect cells (
Baculovirus vectors that can be used for protein expression in, for example, Sf9 cells include the pAc series (Smith et al. (1983) Mol. Cell Biol. 3: 2156-).
2165) and the pVL series (Lucklow and Summers (1989) Virology 170: 31-39).

In yet another embodiment, a nucleic acid of the invention is expressed in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, B. (1987)
Nature 329: 840) and pMT2PC (Kaufman et al. (1987) EMBO J. 6: 187-195). When used in mammalian cells, the control functions of the expression vectors are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus and simian virus 40. For other suitable expression systems, both prokaryotic and eukaryotic, see Sa
mbrook, J., Fritsh, EF and Maniatis, T. Molecular Cloning: A Laborator
y Manual. Second Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Labor
See chapters 16 and 17 of atory Press, Cold Spring Harbor, NY, 1989.

In another embodiment, a recombinant mammalian expression vector can direct expression of a nucleic acid preferentially in a particular cell type (eg, using a tissue-specific regulatory element to express the nucleic acid). Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al. (1987) Genes Dev. 1: 268-277), the lymphoid-specific promoter (Calame and Eaton (1988). Adv. Immunol. 43: 235-275), especially T cell receptors (Winoto and Baltimore (1989) EMBO J. 8: 729-733) and immunoglobulins (Banerji et al. (1983) Cell 33: 729-740). ; Queen and Baltimore (1983
) Cell 33: 741-748), a neuron-specific promoter (eg, a neurofilament promoter; Byrne and Ruddle (1989) PNAS 86: 5473-5).
477), pancreas-specific promoter (Edlund et al. (1985) Science 230: 912-916)
And mammary gland-specific promoters (eg, whey promoter; US Pat. No. 4,873,31)
No. 6 and EP-A-264,166). Also, developmentally regulated promoters such as the mouse hox promoter (Kessel and Gruss (1990) Sci.
ence 249: 374-379) and the α-fetoprotein promoter (Campes and Tilghman).
(1989) Genes Dev. 3: 537-546).

The present invention further provides a recombinant expression vector comprising a DNA molecule of the present invention cloned into the expression vector in an antisense orientation. That is, this DNA
The molecule is operably linked to regulatory sequences such that an RNA molecule that is antisense to hALG-2LP, sALG-2LP or mALG-2LP mRNA can be expressed (by transcription of the DNA molecule). Selecting a regulatory sequence operably linked to the nucleic acid cloned in the antisense orientation, such as a viral promoter and / or enhancer, that directs the continuous expression of the antisense RNA molecule in various cell types;
Alternatively, one can select regulatory sequences that direct constitutive, tissue-specific or cell type-specific expression of the antisense RNA. The antisense expression vector may be in the form of a recombinant plasmid, phagemid or attenuated virus, in which case the antisense nucleic acid is produced under the control of highly efficient regulatory regions and its activity depends on the cell type into which the vector is introduced. Can be determined by For a description of the regulation of gene expression using antisense genes, see Weintraub, H. et al., Antisense RNA.
as a molecular tool for genetic analysis, Reviews-Trends in Genetics, Vo
See l.1 (1) 1986.

Another aspect of the present invention relates to a host cell into which the recombinant expression vector of the present invention has been introduced. The terms "host cell" and "recombinant host cell" are used interchangeably herein. Such terms are understood to refer not only to the particular cell of interest, but also to the progeny or potential progeny of such a cell. Such progeny may not actually be the same as the parent cell, since certain modifications may occur in later generations either due to mutation or environmental effects, but It is included within the scope of the term used in the specification.

The host cell can be any prokaryotic or eukaryotic cell. For example, hALG-2LP, sALG-2LP in bacterial cells such as Escherichia coli, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells).
Alternatively, the mALG-2LP protein can be expressed. Other suitable host cells are known to those skilled in the art.

[0069] Vector DNA can be introduced into prokaryotic or eukaryotic cells by conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" refer to calcium phosphate or calcium chloride co-precipitation, transfection with DEAE-dextran, lipofection or electroporation. DNA)
Refers to various art-recognized techniques for introducing
Suitable methods for transforming or transfecting host cells are described in Sambrook, al. (Molecular Cloning: A Laboratory Manual. Second Edition, Cold Spr.
ing Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY, 1989) and other laboratory manuals.

For stable transfection of mammalian cells, it is known that, depending on the expression vector and transfection technique used, only a small portion of the cells may integrate foreign DNA into their genome. To identify and select for these integrants, generally, a gene encoding a selectable marker (eg, resistance to an antibiotic) is introduced into the host cell along with the gene of interest. Preferred selectable markers include those that confer resistance to drugs such as G418, hygromycin and methotrexate. Nucleic acids encoding selectable markers include hALG-2LP, sA
It can be introduced into a host cell on the same vector as that encoding LG-2LP or mALG-2LP, or it can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (eg, cells that have taken up the selectable marker gene will survive, but other cells will die).

To produce (ie, express) hALG-2LP, sALG-2LP or mALG-2LP protein, a host cell of the invention, such as a cultured prokaryotic or eukaryotic host cell, can be used. Accordingly, the present invention further provides hALG-2 using the host cells of the present invention.
Methods for producing LP, sALG-2LP or mALG-2LP proteins are provided. In one embodiment, the method comprises using a recombinant expression vector encoding hALG-2LP, sALG-2LP or mALG-2LP in a suitable medium until the production of hALG-2LP, sALG-2LP or mALG-2LP protein. Culturing the host cell of the present invention). In another embodiment, the method further comprises removing hALG-2LP, sALG-2 from the medium or host cells.
Isolating LP or mALG-2LP.

[0072] The host cells of the present invention can also be used to produce non-human transgenic animals. These non-human transgenic animals can be used to identify agents or compounds that can ameliorate the deleterious symptoms of a selected disease, such as diseases characterized by unregulated cell death, e.g., drugs, pharmaceuticals, etc. Can be used in a screening assay devised in US Pat. For example, in one embodiment, a host cell of the invention is a neuronal cell into which a coding sequence for hALG-2LP, sALG-2LP or mALG-2LP has been introduced. Further, the method of the present invention provides for the use of exogenous hALG-2
It can be used to produce non-human transgenic animals in which the LP or sALG-2LP sequence has been introduced into the mouse genome or homologous recombinant animals in which the endogenous sALG-2LP or mALG-2LP sequence has been modified. . Such animals include hALG-2LP
To study the function and / or activity of sALG-2LP or mALG-2LP and hALG-2
It is useful for identifying and / or evaluating modulators of LP, sALG-2LP or mALG-2LP activity. As used herein, "transgenic animal"
Is a non-human animal, wherein one or more cells of the animal contain the transgene,
Preferably it is a mammal, more preferably a rodent such as a rat or mouse.
Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians, and the like. The transgene is integrated into the genome of the cell in which the transgenic animal develops and remains in the genome of the mature animal;
Foreign DNA that thereby directs the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal. As used herein, a "homologous recombinant animal" refers to a homologous recombinant animal between an endogenous gene and a foreign DNA molecule introduced into an animal cell, such as an animal embryonic cell, prior to animal development. A non-human animal, preferably a mammal, more preferably a mouse, in which the endogenous sALG-2LP or mALG-2LP gene has been modified by replacement.

The transgenic animal of the present invention can be prepared by introducing a nucleic acid encoding hALG-2LP, sALG-2LP or mALG-2LP into a male pronucleus of a fertilized oocyte, for example, by microinjection or retroviral infection. The oocytes can be produced by generating the pseudopregnant female foster animal. SEQ ID NO: 1, 4 or 7 hALG-2LP, sALG
The -2LP or mALG-2LP cDNA sequence can be introduced as a transgene into the genome of a non-human animal. Alternatively, a non-human, non-monkey or non-mouse homolog of the hALG-2LP, sALG-2LP or mALG-2LP gene, such as the human hALG-2LP, sALG-2LP or mALG-2LP gene (in subsection I above) Further described) can be isolated based on hybridization to hALG-2LP, sALG-2LP or mALG-2LP cDNA and used as a transgene. In order to increase the expression efficiency of the transgene, an intron sequence and a polyadenylation signal can be included in the transgene. hALG
Tissue-specific regulatory sequence (s) can be manipulated into hALG-2LP, sALG-2LP or mALG-2LP transgenes to direct expression of -2LP, sALG-2LP or mALG-2LP protein to specific cells Can be linked. Methods for producing transgenic animals, particularly animals such as mice, by embryo manipulation and microinjection have become conventional in the art, for example, both are described in U.S. Patent No. 4,736,86, both by Leder et al.
Nos. 6 and 4,870,009; U.S. Pat.No. 4,873,191 to Wagner et al .; and Hogan,
B., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press
, Cold Spring Harbor, NY, 1986). Similar methods are used for the production of other transgenic animals. HALG-2LP, sALG-2LP in the genome
Alternatively, a transgenic founder can be identified based on the presence of the mALG-2LP transgene and / or expression of hALG-2LP, sALG-2LP or mALG-2LP mRNA in animal tissues or cells. The transgenic founder can then be used to breed additional animals carrying the transgene. Furthermore, hALG
Transgenic animals carrying a transgene encoding -2LP, sALG-2LP or mALG-2LP can be further crossed to other transgenic animals carrying other transgenes.

To create a homologous recombinant animal, the hALG-2LP, sALG-2LP or mALG-2LP gene has been modified, eg, functionally disrupted, by the introduction of deletions, additions or substitutions. A vector containing at least a part of the hALG-2LP, sALG-2LP or mALG-2LP gene is prepared. The hALG-2LP, sALG-2LP or mALG-2LP gene may be a human gene (eg, from a human genomic clone isolated from a human genomic library screened with the cDNA of SEQ ID NO: 1, 4 or 7). And more preferably a non-human homolog of the human hALG-2LP, sALG-2LP or mALG-2LP gene. For example, as a probe, human ALG-2LP of SEQ ID NO: 1, 4 or 7,
The monkey ALG-2LP or partial mouse ALG-2LP cDNA can be used to isolate the rat ALG-2LP gene from a rat genomic DNA library. Next, this rat ALG-2LP
Suitable homologous recombination vectors can be constructed to modify the endogenous ALG-2LP gene in the rat genome using the gene. In a preferred embodiment, the vector is designed such that upon homologous recombination, the endogenous ALG-2LP gene is functionally disrupted (ie, no longer encodes a functional protein; "knockout")
Vector). Alternatively, the vector can be designed such that upon homologous recombination, the endogenous ALG-2LP gene is mutated or otherwise modified, but still encodes a functional protein (eg, upstream The regulatory region can be altered, thereby altering the expression of the endogenous ALG-2LP protein). For homologous recombination vectors, the foreign hALG-2LP, sA
The modified portion of the ALG-2LP gene has ALG at its 5 'and 3' ends such that homologous recombination occurs between the LG-2LP or mALG-2LP gene and the endogenous ALG-2LP gene in embryonic stem cells.
The additional nucleic acid of the -2LP gene is flanked. Adjacent additional hALG-2LP, sALG-2LP or
The mALG-2LP nucleic acid is of sufficient length to allow for homologous recombination with the endogenous gene. Typically, several kilobases of flanking DNA (both at the 5 'and 3' ends) are included in the vector (for a description of homologous recombination vectors, see, eg, Thomas
, KR and Capecchi, MR (1987) Cell 51: 503). The vector is introduced into the embryonic stem cell line (eg, by electroporation) and the introduced hALG-2LP, sALG-2LP or
Cells in which the mALG-2LP gene is homologously recombined with the endogenous ALG-2LP gene are selected (see, for example, Li, E. et al. (1992) Cell 69: 915). Next, the selected cells are injected into blastocysts of an animal (eg, a mouse) to generate an assembled chimera (eg, Bradley, A., Teratocarcinomas and Embryonic Stem Cells: A Practica
l Edited by Approach, EJ Robertson (IRL, Oxford, 1987) pp. 113-152).
The chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term. Using progeny that carry homologously recombined DNA in germ cells,
DN in which all cells of the animal are homologously recombined by germline transmission of the transgene
Animals containing A can be bred. Methods for constructing homologous recombination vectors and animals are further described in Bradley, A. (1991) Current Opinion in Biotechn.
ology 2: 823-829 and PCT International Publication: WO 90/11354 by Le Mouellec et al.
No. WO 91/01140 by Smithies et al .; WO 92/0 by Zijlstra et al.
968; and WO 93/04169 by Berns et al.

In another embodiment, transgenic non-human animals can be produced that contain a selected system that allows for regulated expression of the transgene. One example of such a system is the cre / loxP recombinase system of bacteriophage P1. For a description of the cre / loxP recombinase system, see, for example, Lakso et al. (1992) PNAS 89: 6232-6236. Another example of a recombinase system is the Saccharomyces cerevisiae FLP recombinase system (O'Gorm
an et al. (1991) Science 251: 1351-1555). When using the cre / loxP recombinase system to regulate transgene expression, an animal containing a transgene encoding both the Cre recombinase and the selected protein is required. For example, the construction of a "double" transgenic animal by mating two transgenic animals, one containing the transgene encoding the selected protein and one containing the transgene encoding the recombinase. Animals can be provided.

The non-human transgenic animal clones described herein may also be
, I. et al. (1997) Nature 385: 810-813 and PCT International Publication Nos. WO 97/07668 and WO 97/07669. Briefly, cells, eg, somatic cells, from a transgenic animal can be isolated and induced to exit the growth cycle and enter the _G0 phase. The quiescent cells can then be fused to enucleated oocytes from the same species of animal from which the quiescent cells were isolated, for example, by use of an electrical pulse. The reconstituted oocyte is then cultured so that it develops into a morula or blastocyst, and then transferred to a pseudopregnant female foster animal. The offspring born from this female foster animal are clones of the animal from which the cells, eg, somatic cells, have been isolated. III. Isolated hALG-2LP, sALG-2LP and mALG-2LP proteins and anti-hALG-2LP
Another aspect of the present invention relates to isolated hALG-2LP, sALG-2LP and mALG-2LP proteins and biologically active portions thereof, and anti-sALG-2LP and anti-mALG-2LP antibodies. -hALG-2LP, anti-sALG-2LP and anti-m
The present invention relates to peptide fragments suitable for use as immunogens for producing ALG-2LP antibodies. An "isolated" or "purified" protein or biologically active portion thereof is a protein that can be used to produce cellular material when produced by recombinant DNA technology, or chemically when chemically synthesized. Substantially free of precursors or other chemical products. The term "substantially free of cell material" includes hALG-2LP, sALG
Included are preparations of hALG-2LP, sALG-2LP or mALG-2LP protein that have been separated from the cellular components of cells in which the -2LP or mALG-2LP protein is naturally or recombinantly produced. In one embodiment, the term "substantially free of cellular material" includes less than about 30% (by dry weight) of non-hALG-2LP, sALG-2LP or mALG-2LP protein (as used herein. Also referred to as "contaminating protein"), more preferably about 20
% Non-hALG-2LP, sALG-2LP or mALG-2LP protein, even more preferably less than about 10% non-hALG-2LP, sALG-2LP or mALG-2LP protein, and most preferably less than about 5% Preparations of hALG-2LP, sALG-2LP or mALG-2LP proteins, including non-hALG-2LP, sALG-2LP or mALG-2LP proteins. hALG
If the -2LP, sALG-2LP or mALG-2LP protein or a biologically active portion thereof is produced recombinantly, it is preferably substantially free of culture medium, i.e., the culture medium is a protein preparation. Less than about 20%, more preferably about 10% of the capacity of
Less than, most preferably less than about 5%. The term "substantially free of chemical precursors or other chemicals" refers to the separation of hALG-2LP, sALG-2LP or mALG-2LP protein from chemical precursors or other chemicals involved in protein synthesis. HALG-2LP, sALG-2LP or mALG-2LP protein preparations. In one embodiment, the term "substantially free of chemical precursors or other chemicals" includes less than about 30% (by dry weight) of chemical precursors or non-hALG-2LP, sAL
G-2LP or mALG-2LP chemical, more preferably less than about 20% chemical precursor or non-hALG-2LP, sALG-2LP or mALG-2LP chemical, even more preferably about 1%
Less than 0% chemical precursors or non-hALG-2LP, sALG-2LP or mALG-2LP chemicals,
And most preferably, less than about 5% of a chemical precursor or a preparation of hALG-2LP, sALG-2LP or mALG-2LP protein comprising non-hALG-2LP, sALG-2LP or mALG-2LP chemistry. In a preferred embodiment, the isolated protein or biologically active portion thereof lacks contaminating proteins from the same animal from which the hALG-2LP, sALG-2LP or mALG-2LP protein is derived. Usually, such proteins are produced, for example, by recombinant expression of human ALG-2LP in non-human cells.

[0077] The isolated hALG-2LP, sALG-2LP or mALG-2LP protein of the invention or a portion thereof can modulate programmed cell death. In a preferred embodiment, the protein or portion thereof comprises an amino acid sequence sufficiently homologous to the amino acid sequence of SEQ ID NO: 2, 5 or 8 such that the protein or portion thereof retains the ability to regulate programmed cell death. Become. The portion of the protein is preferably a biologically active portion as described herein. In another preferred embodiment, hALG-2LP protein (ie, amino acid residues 1-284 of SEQ ID NO: 2), sALG-2LP protein (ie, amino acid residues 1-277 of SEQ ID NO: 5) or mALG-2LP protein (Ie, amino acid residues 1-274 of SEQ ID NO: 8) correspond to SEQ ID NO: 2, 5, or
The amino acid sequence or accession number shown in 8 Of the plasmid deposited with the ATCC ^R
It has the amino acid sequence encoded by the nucleotide sequence of the DNA insert.
In yet another preferred embodiment, the hALG-2LP, sALG-2LP or mALG-2LP protein has an accession number Has the amino acid sequence encoded by the nucleotide sequence that hybridizes to the nucleotide sequence of the DNA insert of the plasmid deposited with the ATCC ^R , for example, under stringent conditions. In yet another preferred embodiment, the hALG-2LP, sALG-2LP or mALG-2LP protein has an accession number At least about 32%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% in the nucleotide sequence of the DNA insert of the plasmid deposited with the ATCC ^R.
, 85%, 90%, 95%, 98% or more homologous nucleotide sequences. Preferred hALG-2LP, sALG-2LP or mALG-2LP of the present invention
The protein is also preferably a hALG-2LP, sALG-2LP or sALG-2LP as described herein.
It also possesses at least one of the mALG-2LP activities. For example, preferred hALG-2LP of the present invention
, SALG-2LP or mALG-2LP protein, accession number As well as amino acid sequences that are encoded by nucleotide sequences that hybridize to the DNA insert of the plasmid deposited with the ATCC ^R , eg, under stringent conditions, and are capable of regulating programmed cell death.

In another embodiment, the hALG-2LP, sALG-2LP or mALG-2LP protein is substantially homologous to the amino acid sequence of SEQ ID NO: 2, 5, or 8, as described in detail in subsection I above. And retains the functional activity of the protein of SEQ ID NO: 2, 5, or 8,
Amino acid sequences differ due to natural allelic variation or mutagenesis. Thus, in another embodiment, the hALG-2LP, sALG-2LP or mALG-2LP protein has at least about 38%, 42%, 44%, 45%, 50% of the entire amino acid sequence of SEQ ID NO: 2, 5 or 8. , 55%
HALG-2LP, sALG comprising an amino acid sequence homologous to 60%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more and described herein. -2LP or mALG-2LP
A protein having at least one activity. In another aspect, the present invention provides:
It relates to a full-length human protein substantially homologous to the amino acid sequence of SEQ ID NO: 2, 5, or 8.

[0079] Biologically active portions of hALG-2LP, sALG-2LP or mALG-2LP proteins include:
Full length hALG-2LP, sALG-2LP or mALG-2LP protein or hALG-2LP, sALG-2LP
Alternatively, a hALG-2LP, sALG-2LP or mALG-2LP protein containing fewer amino acids than the full-length protein homologous to the mALG-2LP protein and exhibiting at least one activity of the hALG-2LP, sALG-2LP or mALG-2LP protein. Amino acid sequence, for example, the amino acid sequence shown in SEQ ID NO: 2, 5 or 8, or hALG-2LP, sALG-2LP
Alternatively, a peptide comprising an amino acid sequence derived from the amino acid sequence of a protein homologous to the mALG-2LP protein is included. Typically, a biologically active moiety (eg, a peptide such as 5, 10, 15, 20, 30, 35, 36, 37, 38, 39, 40, 50, 100
Or more amino acids in length) are of human origin and have at least about 38%, 42%, 44%, 45%, 50%, 55% of SEQ ID NO: 10, 11, 12, 13 or 15 %, 6
0%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologous domains or motifs, e.g., domains showing homology to calcium binding domains such as EF hands Comprising. In addition, other biologically active portions that lack other regions of the protein can be produced by recombinant techniques and evaluated for one or more of the activities described herein. Preferably, hALG-2LP, sALG-2LP
Alternatively, the biologically active portion of the mALG-2LP protein is a biologically active 1
Contain one or more selected domains / motifs or portions thereof.

The hALG-2LP, sALG-2LP and mALG-2LP proteins are preferably produced by recombinant DNA technology. For example, a nucleic acid molecule encoding the protein is cloned into an expression vector (as described above), the expression vector is introduced into a host cell (as described above), and hALG-2LP, sALG- 2LP or mALG-2LP
Express the protein. The hALG-2LP, sALG-2LP or mALG-2LP protein can then be isolated from the cells by a suitable purification scheme using standard protein purification techniques. Using standard peptide synthesis techniques instead of recombinant expression
hALG-2LP, sALG-2LP or mALG-2LP protein, polypeptide or peptide can be chemically synthesized. Further, for example, anti-h (described further below)
Isolate native hALG-2LP, sALG-2LP or mALG-2LP protein from cells (eg, brain cells or other cells expressing ALG2-LP) using ALG-2LP, sALG-2LP or mALG-2LP antibodies can do.

The present invention also provides hALG-2LP, sALG-2LP or mALG-2LP chimera or fusion proteins. As used herein, hALG-2LP, sALG-2LP or mALG-2
LP "chimeric protein" or "fusion protein" is non-hALG-2LP, sALG-2LP
Or hALG-2LP, sALG-2LP or operably linked to a mALG-2LP polypeptide.
comprising a mALG-2LP polypeptide. `` HALG-2LP, sALG-2LP or mALG-2LP polypeptide '' refers to a polypeptide having an amino acid sequence corresponding to hALG-2LP, sALG-2LP or mALG-2LP, while `` non-hALG-2LP, A `` sALG-2LP or mALG-2LP polypeptide '' is different and identical to a protein that is not substantially homologous to a hALG-2LP, sALG-2LP or mALG-2LP protein, e.g., a hALG-2LP, sALG-2LP or mALG-2LP protein. Or a polypeptide having an amino acid sequence corresponding to a protein derived from a different organism. "Operably linked" within the fusion protein
The term hALG-2LP, sALG-2LP or mALG-2LP polypeptide and non-hALG-2LP
, SALG-2LP or mALG-2LP polypeptides are fused together in frame. The non-hALG-2LP, sALG-2LP or mALG-2LP polypeptide can be fused to the N-terminus or C-terminus of the hALG-2LP, sALG-2LP or mALG-2LP polypeptide. For example, in one embodiment, the fusion protein is hALG-2LP
GST-hALG-2L in which the sALG-2LP or mALG-2LP sequence is fused to the C-terminus of the GST sequence
P, GST-sALG-2LP or GST-mALG-2LP fusion protein. Such a fusion protein can facilitate the purification of recombinant hALG-2LP, sALG-2LP or mALG-2LP. In another embodiment, the fusion protein is a hALG-2LP, sALG-2LP or mALG-2LP protein containing a heterologous signal sequence at its N-terminus. In certain host cells (eg, mammalian host cells), the expression and / or secretion of hALG-2LP, sALG-2LP or mALG-2LP can be enhanced through the use of a heterologous signal sequence.

[0082] Preferably, the hALG-2LP, sALG-2LP or mALG-2LP chimera or fusion protein of the invention is produced by standard recombinant DNA techniques. For example, following conventional techniques, e.g., blunt or cohesive ends for ligation, restriction enzyme digestion to provide suitable ends, filling in cohesive ends as appropriate, to avoid unwanted ligation By using alkaline phosphatase treatment and enzymatic ligation, DNA fragments encoding different polypeptide sequences are ligated together in frame. In another embodiment, the fusion gene can be synthesized by a conventional technique including an automatic DNA synthesizer. Alternatively, PCR amplification of gene fragments can be performed using anchor primers that create complementary overhangs between two consecutive gene fragments, which are then annealed and reamplified to produce a chimeric gene sequence (E.g. Current Protocols
in Molecular Biology, edited by Ausubel et al., John Wiley & Sons: 1992). In addition, a number of expression vectors are commercially available that already encode a fusion moiety (eg, a GST polypeptide). GST (hALG-2LP, sALG-2LP or mAL) so that the fusion moiety is linked in-frame to the hALG-2LP, sALG-2LP or mALG-2LP protein.
G-2LP) can be cloned into such an expression vector.

The present invention also provides hALG-2LP, sALG-2LP, sALG-2LP, sALG-2LP, or mALG-2LP agonists (mimics) or hALG-2LP, sALG-2LP, or mALG-2LP antagonists. Alternatively, it relates to homologs of the mALG-2LP protein. In a preferred embodiment, hALG-2LP, sALG-2LP or mALG-2LP agonists and antagonists each stimulate a set of biological activities of a naturally occurring form of hALG-2LP, sALG-2LP or mALG-2LP protein. Or inhibit. Thus, specific biological effects can be elicited by treatment with homologs of limited function. In one embodiment, treatment of a subject with a homolog having a set of biological activities of a naturally occurring form of the protein comprises naturally occurring forms of the hALG-2LP, sALG-2LP or mALG-2LP protein. There are fewer side effects in the subject compared to treatment in form.

Homologs of the hALG-2LP, sALG-2LP or mALG-2LP protein may be created by mutagenesis, eg, by separate point mutations or deletions of the hALG-2LP, sALG-2LP or mALG-2LP protein. Can be. As used herein, "homologue"
hALG-2LP, sALG-2LP or mALG-2LP Refers to a mutant form of the hALG-2LP, sALG-2LP or mALG-2LP protein that acts as an agonist or antagonist of the activity of the ALG-2LP protein. An agonist of the hALG-2LP, sALG-2LP or mALG-2LP protein can retain substantially the same or a set of biological activities of the hALG-2LP, sALG-2LP or mALG-2LP protein. hALG-2LP, sALG-2LP or mALG-2
LP protein antagonists include, for example, hALG-2LP, sALG-2LP or mALG-2LP
By competitively binding to a downstream or upstream member of the hALG-2LP, sALG-2LP or mALG-2LP cascade containing the protein, the hALG-2LP, sALG-2LP or mALG-2
One or more activities of a naturally occurring form of the LP protein can be inhibited. Accordingly, the mammalian hALG-2LP, sALG-2LP or mALG-2LP protein of the present invention and homologs thereof can be either positive or negative regulators of programmed cell death transmission pathway activity.

In another embodiment, a mutant of the hALG-2LP, sALG-2LP or mALG-2LP protein with respect to hALG-2LP, sALG-2LP or mALG-2LP protein agonist or antagonist activity, for example, the absence of a deletion mutant By screening the random sequence library, homologs of the hALG-2LP, sALG-2LP or mALG-2LP protein can be identified. In one embodiment, random library mutagenesis at the nucleic acid level creates a diverse library of hALG-2LP, sALG-2LP or mALG-2LP variants and is encoded by a diverse gene library. For example, possible hALG-2LP,
A degenerate set of sALG-2LP or mALG-2LP sequences contains the individual polypeptides or alternatively contains a set of hALG-2LP, sALG-2LP or mALG-2LP sequences (eg, for phage display) HA by enzymatically linking a mixture of synthetic oligonucleotides to a gene sequence for expression as a set of larger fusion proteins.
A diverse library of LG-2LP, sALG-2LP or mALG-2LP variants can be generated. HALG-2LP, sALG-2LP or possible from degenerate oligonucleotide sequences
There are various methods that can be used to generate a library of mALG-2LP homologs.
Chemical synthesis of the degenerate gene sequence is performed on an automatic DNA synthesizer, and the synthetic gene can then be ligated into an appropriate expression vector. Through the use of a degenerate set of genes, all of the sequences encoding the appropriate set of possible hALG-2LP, sALG-2LP or mALG-2LP sequences can be provided in one mixture. Methods for synthesizing degenerate oligonucleotides are known in the art (eg, Narang, SA (1.
983) Tetrahedron 39: 3; Itakura et al. (1984) Annu. Rev. Biochem. 53: 323
Itakura et al. (1984) Science 198: 1056; Ike et al. (1983) Nucleic Aci
d Res. 11: 477).

In addition, a library of hALG-2LP, sALG-2LP or mALG-2LP protein coding fragments is screened for screening and subsequent selection of homologs of the hALG-2LP, sALG-2LP or mALG-2LP protein. Using hALG-2LP, sALG-2LP or
A diverse population of mALG-2LP fragments can be generated. In one embodiment, a double-stranded PCR fragment of the hALG-2LP, sALG-2LP or mALG-2LP coding sequence is treated with nuclease under conditions where nicks occur only about once per molecule to denature the double-stranded DNA. The DNA was regenerated to generate double-stranded DNA that could contain sense / antisense pairs from different nick products, and S1 from the reformed duplex.
By removing the single-stranded portion by treatment with nuclease, and ligating the obtained fragment library to an expression vector, a library of coding sequence fragments can be prepared. By this method, hALG-2LP, sALG-2
Expression libraries encoding N-terminal, C-terminal and internal fragments of various sizes of the LP or mALG-2LP protein can be obtained.

Several techniques are known in the art for screening gene products of random sequence libraries generated from point mutations or deletions and for screening cDNA libraries for gene products having selected properties. Is known. Such techniques are applicable to the rapid screening of gene libraries generated by random sequence mutagenesis of hALG-2LP, sALG-2LP or mALG-2LP homologs. The most commonly used techniques for screening large gene libraries, which allow easy high-throughput analysis, typically involve cloning the gene library into a replicable expression vector and live-streaming the resulting vector. Rally transforming appropriate cells and expressing the random sequence gene under conditions that facilitate the isolation of a vector encoding the gene whose product was detected by detection of the desired activity. To identify hALG-2LP, sALG-2LP or mALG-2LP homologues, a new technology, Recrusive Ensemble Mutagenesis (REM), which increases the frequency of functional mutants in the library It can be used in combination with screening assays (Arkin and Yourvan (19
92) PNAS 89: 7811-7815; Delgrave et al. (1993) Protein Engineering 6 (3):
327-331).

In one embodiment, a cell-based assay can be utilized to analyze a diverse hALG-2LP, sALG-2LP or mALG-2LP library. For example, libraries of expression vectors can be transformed into cell lines, such as (Ashwell JD et al. (1990) J. Imm
unol. 144: 3326) (as described in 3326) can be transfected into a T cell hybridoma (3DO) that has been cross-linked with a T cell receptor. The effect of hALG-2LP, sALG-2LP or mALG-2LP mutants on programmed cell death can then be detected, for example, by monitoring nuclear chromatin changes. The plasmid DNA can then be recovered from cells that are superior in inhibiting or also stimulating programmed cell death and individual clones can be further characterized.

The isolated hALG-2LP, sALG-2LP or mALG-2LP protein or a portion or fragment thereof can be prepared using standard techniques for polyclonal and monoclonal antibody preparation using either hALG-2LP, sALG-2LP or It can be used as an immunogen to produce antibodies that bind to mALG-2LP. Full length hALG-2LP, sALG-2LP or mALG
The -2LP protein can be used, or alternatively, the invention provides an antigenic peptide fragment of hALG-2LP, sALG-2LP or mALG-2LP for use as an immunogen. hALG-2LP, sALG-2LP or mALG-2LP antigenic peptide is SEQ ID NO: 2,
Comprising at least 8 amino acid residues of the amino acid sequence set forth in 5 or 8, and wherein the antibody raised against the peptide forms a specific immune complex with hALG-2LP, sALG-2LP or mALG-2LP. HALG-2LP, sALG-2LP or mALG-2LP epitopes. Preferably, the antigenic peptide has at least 10 amino acid residues, more preferably at least 15 amino acid residues, even more preferably at least 20 amino acid residues.
Amino acid residues, and most preferably at least 30 amino acid residues. Preferred epitopes encompassed by the antigenic peptide are regions of hALG-2LP, sALG-2LP or mALG-2LP located on the surface of the protein, for example, hydrophilic regions.

Typically, hALG-2LP, sALG-2LP are used to prepare antibodies by immunizing a suitable subject (eg, rabbit, goat, mouse or other mammal) with an immunogen.
Alternatively, use the mALG-2LP immunogen. Suitable immunogenic preparations contain, for example, recombinantly expressed hALG-2LP, sALG-2LP or mALG-2LP protein or chemically synthesized hALG-2LP, sALG-2LP or mALG-2LP peptide. be able to. The preparation can further include an adjuvant, such as Freund's complete or incomplete adjuvant, or a similar immunostimulant. Immunogenic hALG-2LP, sALG-2LP or
Immunization of a suitable subject with a mALG-2LP preparation was performed using polyclonal anti-hALG-2LP,
Induces anti-sALG-2LP or anti-mALG-2LP antibody response.

Thus, another embodiment of the present invention relates to anti-hALG-2LP, anti-sALG-2LP or anti-mALG-2LP.
Related to antibodies. The term "antibody" as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., hALG-2LP.
, A molecule containing an antigen binding site that specifically binds (immunoreacts with) an antigen, such as sALG-2LP or mALG-2LP. Examples of immunologically active portions of an immunoglobulin molecule include F (ab) and F (ab ') ₂ fragments that can be made by treating an antibody with an enzyme such as pepsin. The present invention, hALG-2LP, sALG-2
Polyclonal and monoclonal antibodies that bind to LP or mALG-2LP are provided. As used herein, the term "monoclonal antibody" or "monoclonal antibody composition" refers to only one type of antigen binding capable of immunoreacting with a particular epitope of hALG-2LP, sALG-2LP or mALG-2LP. Refers to the population of antibody molecules containing the site. Thus, a monoclonal antibody composition typically displays a single binding affinity for the particular hALG-2LP, sALG-2LP or mALG-2LP protein with which it immunoreacts.

A polyclonal anti-hALG-2LP, sALG-2LP or mALG-2LP antibody is prepared as described above by immunizing a suitable subject with a hALG-2LP, sALG-2LP or mALG-2LP immunogen. be able to. Anti-hALG-2LP, sALG- in immunized subjects by standard techniques such as enzyme-linked immunosorbent assay (ELISA) using immobilized hALG-2LP, sALG-2LP or mALG-2LP. 2LP or mALG-2LP antibody titers can be monitored over time. If desired, antibody molecules directed against hALG-2LP, sALG-2LP or mALG-2LP can be isolated from mammals (eg, from blood), such as protein A chromatography to obtain an IgG fraction. It can be further purified by well-known techniques. At an appropriate time after immunization, e.g., anti-hALG-2LP, s
When ALG-2LP or mALG-2LP antibody titers are at their highest, antibody-producing cells are obtained from the subject and are first obtained from Kohler and Milstein (1975) Nature 256: 495-497 (also Brown
et al. (1981) J. Immumol. 127: 539-46; Brown et al. (1980) J. Biol. Che.
m. 255: 4980-83; Yeh et al. (1976) PNAS 76: 2927-31; and Yeh et al. (198
2) Hybridoma technology described by Int. J. Cancer 29: 269-75),
More recent human B cell hybridoma technology (Kozbor et al. (1983) Immumol Tod
ay 4:72), EBV-hybridoma technology (Cole et al. (1985), Monoclonal Antibo
dies and Cancer Threapy, Alan R. Liss, Inc., pp. 77-96) or standard techniques such as trioma technology can be used to prepare monoclonal antibodies. Techniques for producing monoclonal antibody hybridomas are well known (generally, RH Kenneth, Monoclonal Antibodies: A New Dimension In B
iological Analyses, Plenum Publishing Corp., New York, New York (1980);
EA Lerner (1981) Yale J. Biol. Med., 54: 387-402; ML Gefter et al.
(1977) Somatic Cell Genet. 3: 231-36). Briefly, as above
Immortal cell lines (typically myeloma) fused to lymphocytes (typically spleen cells) from mammals immunized with hALG-2LP, sALG-2LP or mALG-2LP immunogen Hybridoma cell culture supernatants are screened to identify those hybridomas that produce monoclonal antibodies that bind to hALG-2LP, sALG-2LP, or mALG-2LP.

For the purpose of generating anti-hALG-2LP, sALG-2LP or mALG-2LP monoclonal antibodies, apply any of the many well-known protocols used to fuse lymphocytes with immortalized cell lines. (Eg, G. Galfre et al. (1977)
) Nature 266: 55052; Gefter et al. Somatic Cell Genet., Cited above; Lerner,
Yale J. Biol. Med., Cited above; see Kenneth, Monoclonal Antibodies, cited above). Further, those skilled in the art will recognize that there are many variations of such methods that are also useful. Typically, immortal cell lines (eg, myeloid cell lines) are derived from the same mammalian species as lymphocytes. For example, mouse hybridomas can be produced by fusing lymphocytes from a mouse immunized with an immunogenic preparation of the invention with an immortalized mouse cell line. Preferred immortal cell lines are hypoxanthine,
A mouse myeloid cell line that is sensitive to a culture medium containing aminopterin and thymidine ("HAT medium"). Any of a number of myeloid cell lines, e.g., P3-NS1 / 1
-Ag4-1, P3-x63-Ag8.653 or Sp2 / O-Ag14 myeloid lines can be used as fusion partners according to standard techniques. These myeloma system are available from ATCC ^R.
Typically, HAT-sensitive mouse myeloid cells are fused with mouse spleen cells using polyethylene glycol ("PEG"). The hybridoma cells resulting from the fusion are then selected using HAT medium, which kills unfused and non-productively fused myeloid cells (unfused spleen cells are transformed. Not die after a few days). For example, using a standard ELISA assay, hALG-2L
Hybridoma cells producing the monoclonal antibody of the present invention are detected by screening the hybridoma culture supernatant for antibodies that bind to P, sALG-2LP or mALG-2LP.

Instead of producing a hybridoma that secretes a monoclonal antibody, a recombinant random sequence immunoglobulin library (eg, an antibody phage display library)
Is screened with hALG-2LP, sALG-2LP or mALG-2LP to obtain hALG-2LP, sA
By isolating immunoglobulin library members that bind to LG-2LP or mALG-2LP, monoclonal anti-hALG-2LP, sALG-2LP or mALG-2LP antibodies can be identified and isolated. Kits for making and screening phage display libraries are commercially available (eg, Pharmacia Recombinant Phage Antibody System, catalog number 27-9400-1; and Stratagene SurfZAP ^™ phage display kit ( Phage Display Kit), catalog number 240612). In addition, examples of methods and reagents that can be particularly easily used to generate and screen antibody display libraries are described, for example, in Lander et al. U.S. Patent No. 5,223,409; Kang et al. PCT International Publication No. WO 92/18619. ; Dower et al. PCT
International Publication No. WO 91/17271; Winter et al. PCT International Publication No. WO 92/20791; Markl
and et al. PCT International Publication No. WO 92/15679; Breitling et al. PCT International Publication No. WO
93/01288; McCafferty et al. PCT International Publication No.WO 92/01047; Garrard et al.
PCT International Publication No. WO 92/09690; Ladner et al. PCT International Publication WO 90/02809; F
uchs et al. (1991) Bio / Technology 9: 1370-1372; Hay et al. (1992) Hum. A
ntibod. Hybridomas 3: 81-85; Huse et al. (1989) Science 246: 1275-1281;
Griffiths et al. (1993) EMBO J 12: 725-734; Hawkins et al. (1992) J. Mol
Biol. 226: 889-896; Clarkson et al. (1991) Nature 352: 624-628; Gram e.
t al. (1992) PNAS 89: 3576-3580; Garrad et al. (1991) Bio / Technology 9:
1373-1377; Hoogenboom et al. (1991) Nuc. Acid Res. 19: 4133-4137; Barbas
et al. (1991) PNAS 88: 7978-7982; and McCafferty et al. Nature (1990) 34
8: found at 552-554.

In addition, recombinant anti-hALG-2LPs, such as chimeric and humanized monoclonal antibodies comprising both human and non-human portions, which can be made using standard recombinant DNA techniques, sALG-2LP or mALG-2LP antibodies are within the scope of the invention. Such chimeric and humanized monoclonal antibodies can be prepared by recombinant DNA techniques known in the art, for example, Robinson et al. PCT International Application No.PCT / US86 / 02269;
Akira et al. European Patent Application No. 184,187; Taniguchi, M., European Patent Application No. 171,4
No. 96; Morrison et al. European Patent Application No. 173,494; Neuberger et al. PCT Publication No. WO 86/01533; Cabilly et al. U.S. Patent No. 4,816,567; Cabilly et al.
European Patent Application No. 125,023; Better et al. (1988) Science 240: 1041-1043;
Liu et al. (1987) PNAS 84: 3439-3443; Liu et al. (1987) J. Immumol. 139:
3521-3526; Sun et al. (1987) PNAS 84: 214-218; Nishimura et al. (1987)
Canc. Res. 47: 999-1005; Wood et al. (1985) Nature 314: 446-449; and Shaw.
et al. (1988) J. Natl. Cancer Inst. 80: 1533-1559); Morrison, SL (19
85) Science 229: 1202-1207; Oi et al. (1986) BioTechniques 4: 214; Winte
r U.S. Patent No. 5,225,539; Jones et al. (1986) Nature 321: 552-525; Verhoey
an et al. (1988) Science 239: 1534 and Beidler et al. (1998) J. Immumol
141: 4053-4060.

[0096] Anti-hALG-2LP, sALG-2LP or mALG-2LP antibodies (eg, monoclonal antibodies) can be raised to hALG-2LP, sALG-2LP or mALG-2LP by standard techniques such as affinity chromatography or immunoprecipitation. Can be used to isolate. Anti
-hALG-2LP, sALG-2LP or mALG-2LP antibodies are derived from natural hALG-2LP, sALG-
Purification of 2LP or mALG-2LP and recombinantly produced hALG-2LP, sALG-2LP or mALG-2LP expressed in host cells can be facilitated. In addition, anti-hALG-2LP, sALG-2LP or mALG-2LP antibodies are used to assess the amount and pattern of hALG-2LP, sALG-2LP or mALG-2LP protein expression (eg, cell lysate or cell HALG-2LP, sALG-2LP or mALG-2LP protein (in the supernatant) can be detected. For example, use anti-hALG-2LP, sALG-2LP or mALG-2LP antibodies diagnostically to monitor protein levels in tissues as part of a clinical test method to determine the efficacy of a given treatment regimen can do. Detection can be facilitated by coupling (ie, physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin; Examples of fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; examples of luminescent materials include luminol; examples of bioluminescent materials include Luciferase, luciferin and aequorin are included, and examples of suitable radioactive materials include ¹²⁵ I, ¹³¹ I, ³⁵ S
Or ³ H is included. IV. Pharmaceutical Compositions hALG-2LP, sALG-2LP or mALG-2LP nucleic acid molecule of the invention, hALG-2LP, sALG-2LP or mALG-2LP protein and anti-hALG-2LP, sALG-2LP or mALG-2LP antibody ( (Also referred to herein as an "active compound") can be included in a pharmaceutical composition suitable for administration to a subject, eg, a human. Such compositions typically comprise the nucleic acid molecule, protein or antibody and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" refers to any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents and the like that are compatible with pharmaceutical administration. It shall include absorption delaying agents and the like. The use of such media and agents for pharmaceutically active substances is well-known in the art. Such media can be used in the compositions of the present invention, provided that any conventional media or agent is not contraindicated with the active compound. Supplementary active compounds can also be included in the compositions.

A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, eg, intravenous, intradermal, subcutaneous, oral (eg, inhalation), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal or subcutaneous use are composed of the following ingredients: water for injection, saline solution, fixed oils, sterile such as polyethylene glycol, glycerin, propylene glycol or other synthetic solvents. Diluents; antimicrobial agents such as benzyl alcohol or methyl paraben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetate, citrate or phosphate. And agents for tonicity adjustment, such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions or dispersions (if water-soluble) and sterile injectable solutions or dispersions if necessary. Sterile powder. Suitable carriers for intravenous administration include saline, bacteriostatic water, Cremophor EL ^™ (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like can prevent the action of microorganisms. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

The required amount of active compound (eg, hALG-2LP, sALG-2LP or mALG-2LP protein or anti-hALG-2LP) in a suitable solvent, optionally with any or a combination of the above-listed components, , Anti-sALG-2LP or anti-mALG-2LP antibody), followed by sterile filtration to prepare a sterile injectable solution.
Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for preparing sterile injectable solutions, the preferred methods of preparation are vacuum drying and lyophilization, which involves mixing the active ingredient with any additional desired ingredients from a previously sterile filtered solution. Bring powder.

Generally, oral compositions will include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a liquid carrier for use as a mouthwash, in which case the compound in the liquid carrier is administered orally, swirled, and exhaled or swallowed. It is. Pharmaceutically compatible binding agents, and / or excipient materials can be included as part of the composition. Tablets, pills, capsules, troches and the like can contain any of the following ingredients or compounds of a similar nature: binders such as microcrystalline cellulose, gum tragacanth or gelatin; such as starch or lactose. Disintegrants such as alginic acid, Primogel or corn starch; lubricants such as magnesium stearate or Sterotes; glidants such as colloidal silicon dioxide; sweeteners such as sucrose or saccharin; Or a fragrance such as peppermint, methyl salicylate or orange fragrance.

For administration by inhalation, the compositions are delivered in the form of an aerosol spray from pressurized container or dispenser which contains a suitable propellant, for example a gas such as carbon dioxide, or a nebulizer.

Also, systemic administration may be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, solvents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compound
Formulated in ointments, salves, gels or creams as generally known in the art.

The compounds can also be prepared in the form of suppositories or retention enemas for rectal delivery (eg, with conventional suppository bases such as cocoa butter or other glycerides).

In one embodiment, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters and polylactic acid can be used. Methods for preparing such formulations will be apparent to those skilled in the art. These materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeting infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in US Pat. No. 4,522,811.

It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. As used herein, unit dosage form refers to physically discrete units suitable as unit dosages for the subject to be treated; each unit is associated with a required pharmaceutical carrier. It contains a predetermined amount of active compound calculated to give the desired therapeutic effect. The specifications for the unit dosage forms of the present invention are determined by the unique characteristics of the active compounds and the particular therapeutic effect obtained, as well as the limitations inherent in the art of formulating such active compounds for treatment of an individual, And it depends directly on them.

The nucleic acid molecule of the present invention can be inserted into a vector and used as a gene therapy vector. For example, intravenous injection, topical administration (see US Patent No. 5,328,470)
Or by stereotactic injection (eg, Chen et al. (1994) PNAS 91: 3054-305).
7) can deliver the gene therapy vector to the subject. Pharmaceutical preparations of a gene therapy vector can include the gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is embedded. Alternatively, where a complete gene delivery vector can be produced intact from recombinant cells (eg, a retroviral vector), the pharmaceutical preparation can include one or more cells from which to produce the gene delivery system. it can.

The pharmaceutical compositions can be in a container, pack, or dispenser together with instructions for administration. V. Uses and Methods of the Invention The nucleic acid molecules, proteins, protein homologs and antibodies described herein can be used, for example, in diagnostic assays. An isolated nucleic acid molecule of the invention may comprise hALG-2LP, sALG-2LP or mALG-2LP mRN (eg, in a biological sample).
It can be used to detect genetic damage in the A or hALG-2LP, sALG-2LP or mALG-2LP gene. Further, the anti-hALG-2LP, anti-sALG-2LP or anti-mALG-2LP antibody of the present invention detects hALG-2LP, sALG-2LP or mALG-2LP protein,
Can be isolated and used to modulate hALG-2LP, sALG-2LP or mALG-2LP protein activity.

Accordingly, the present invention relates to hALG-2LP, sALG-2LP or mALG-2LP in a biological sample.
Provide a method for detecting the presence of This method can be used for hALG-2LP, sALG-2LP or mALG
Contacting the biological sample with a compound or agent capable of detecting hALG-2LP, sALG-2LP or mALG-2LP protein or mRNA such that the presence of -2LP is detected in the biological sample . hALG-2LP, sALG-2LP or mALG
Preferred agents for detecting -2LP mRNA are hALG-2LP, sALG-2LP or mAL
A labeled or labelable nucleic acid probe capable of hybridizing to G-2LP mRNA. This nucleic acid probe is, for example, the full length hA of SEQ ID NO: 1, 4 or 7.
LG-2LP, sALG-2LP or mALG-2LP cDNA, or at least 15, 30, 50, 100,
HALG-2LP 250 or 500 nucleotides in length and under stringent conditions
, SALG-2LP or mALG-2LP mRNA or a portion thereof such as an oligonucleotide sufficient to specifically hybridize to mRNA. Preferred agents for detecting hALG-2LP, sALG-2LP or mALG-2LP protein include hALG-2LP, sALG-2
A labeled or detectable antibody capable of binding to LP or mALG-2LP protein. Antibodies can be polyclonal, or more preferably, monoclonal. An intact antibody or a fragment thereof (eg, Fab or F (ab ′) ₂ ) can be used. For a probe or antibody, the term “labeled or labelable” includes direct labeling of the probe or antibody by coupling (ie, physically linking) the detectable substance to the probe or antibody,
Also, indirect labeling of the probe or antibody with reactivity with another reagent that is directly labeled is contemplated. Examples of indirect labeling include detection of the primary antibody using a fluorescently labeled secondary antibody and end labeling of the DNA probe with biotin such that it can be detected with fluorescently labeled streptavidin. Is done. "
The term "biological sample" is intended to include tissues, cells and biological fluids isolated from a subject as well as tissues, cells and fluids present within a subject. That is, the detection method of the present invention can be used for detecting hALG-2LP, sALG-2LP or mALG-2LP mRNA or protein in a biological sample in vitro and in vivo. For example, in vitro techniques for detecting hALG-2LP, sALG-2LP or mALG-2LP mRNA include Northern hybridizations and in situ hybridizations. hALG-2LP, sALG-2LP or mALG
In vitro techniques for detecting LP-2 protein include enzyme-linked immunosorbent assays (EL)
ISA), Western blot, immunoprecipitation and immunofluorescence. Alternatively, hALG-2LP, sALG-2LP or mALG-2LP protein can be detected in a subject in vivo by introducing a labeled anti-hALG-2LP, sALG-2LP or mALG-2LP antibody into the subject. . For example, the antibody can be labeled with a radioactive marker, and its presence and location in a subject can be detected by standard imaging techniques.

[0109] The present invention also encompasses kits for detecting the presence of hALG-2LP, sALG-2LP or mALG-2LP in a biological sample. For example, the kit comprises a labeled or labelable compound or agent capable of detecting hALG-2LP, sALG-2LP or mALG-2LP protein or mRNA in a biological sample; hALG-2 in a sample.
Means for determining the amount of LP, sALG-2LP or mALG-2LP; and hALG in the sample
-2LP, means for comparing the amount of sALG-2LP or mALG-2LP to a reference. The compound or agent can be packaged in a suitable container. The kit can further comprise instructions for using the kit for detecting hALG-2LP, sALG-2LP or mALG-2LP mRNA or protein.

The method of the present invention also detects genetic damage in the hALG-2LP, sALG-2LP or mALG-2LP gene, such that the subject having the damaged gene is as defined herein. Diseases characterized by abnormal or abnormal hALG-2LP, sALG-2LP or mALG-2LP nucleic acid expression or hALG-2LP, sALG-2LP or mALG-2LP protein activity, e.g., programmed cell death with loss of regulation. Can be used to determine whether or not the patient is at risk for the disease. In a preferred embodiment, these methods involve the use of hALG-2LP, sALG-2LP or mALG in a sample of cells from a subject.
Detecting the presence or absence of at least one modification affecting the integrity of the gene encoding the -2LP protein or a genetic damage characterized by misexpression of the hALG-2LP, sALG-2LP or mALG-2LP gene. For example, such genetic damage may be 1
A) deletion of one or more nucleotides from the hALG-2LP, sALG-2LP or mALG-2LP gene; 2) deletion of one or more nucleotides into the hALG-2LP, sALG-2LP or mALG-2LP gene. Addition; 3) substitution of one or more nucleotides of the hALG-2LP, sALG-2LP or mALG-2LP gene; 4) hALG-2LP, sALG-2LP or mALG.
Chromosomal rearrangement of the -2LP gene; 5) alteration of the level of messenger RNA transcripts of the hALG-2LP, sALG-2LP or mALG-2LP gene; 6) hALG-2LP, sALG-, such as genomic DNA methylation patterns. Abnormal modification of 2LP or mALG-2LP gene; 7) hALG-2LP
Presence of non-wild-type splicing pattern of messenger RNA transcript of sALG-2LP or mALG-2LP gene; 8) non-wild-type level of hALG-2LP, sALG-2LP or mALG-2LP protein; 9) hALG-2LP, sALG Loss of the -2LP or mALG-2LP gene alleles; and 10) can be detected by confirming the presence of at least one of inappropriate post-translational modifications of the hALG-2LP, sALG-2LP or mALG-2LP protein. . As described herein, there are a number of assay techniques known in the art that can be used to detect damage in the hALG-2LP, sALG-2LP or mALG-2LP gene.

In some embodiments, the detection of the damage is accomplished by polymerase chain reaction (PCR) such as anchor PCR or RACE PCR (see, eg, US Pat. Nos. 4,683,195 and 4,683,202), or alternatively, by ligation chain reaction (LCR) ( For example, Landegran et al. (198
8) Science 241: 1077-1080; and Nakazawa et al. (1994) PNAS 91: 360-364), the latter of which uses hALG
May be particularly useful for detecting point mutations in the -2LP, sALG-2LP or mALG-2LP gene (Abravaya et al. (1995) Nucleic Acids Res. 23: 675-68).
2). This method involves collecting a sample of cells from a patient, isolating nucleic acids (eg, genomic, mRNA, or both) from the cells of the sample and, if present, hALG-2LP,
One or more primers and a nucleic acid sample that specifically hybridize to the hALG-2LP, sALG-2LP or mALG-2LP gene under conditions such that hybridization and amplification of the sALG-2LP or mALG-2LP gene occur. Contacting and detecting the presence or absence of the amplification product, or detecting the size of the amplification product and comparing its length to a control sample.

In another embodiment, mutations in the hALG-2LP, sALG-2LP or mALG-2LP gene from a sample cell can be identified by an altered restriction enzyme cleavage pattern.
For example, sample and control DNA are isolated, (optionally) amplified, digested with one or more restriction endonucleases, fragment size determined by gel electrophoresis, and compared. Differences in fragment length size between the sample and control DNA indicate mutations in the sample DNA. In addition, sequence-specific ribozymes (see, eg, US Pat. No. 5,498,531) to score for the presence of a particular mutation due to the occurrence or loss of a ribozyme cleavage site
Can be used.

In yet another embodiment, the hALG-2LP, sALG-2LP or mALG-2LP gene is directly sequenced using any of a variety of sequencing reactions known in the art, and the sample hALG-2LP, Mutations can be detected by comparing the sequence of sALG-2LP or mALG-2LP to the corresponding wild-type (control) sequence. Examples of sequencing reactions include Maxim and Gilbert ((1977) PNAS 74: 560) or Sanger ((197
7) Includes those based on the technology developed by PNAS 74: 5463). When performing a diagnostic assay ((1995) Biotechniques 19: 448), base sequencing by mass spectrometry (eg, PCT International Publication WO 94/16101; Cohen et al. (1996) Adv. C
hromatogr. 36: 127-162; and Griffin et al. (1993) Appl. Biochem. Biotechn.
ol. 38: 147-159) can be used.

Other methods for detecting mutations in the hALG-2LP, sALG-2LP or mALG-2LP genes include cleavage to detect mismatched bases in RNA / RNA or RNA / DNA duplexes. Method using protection from agents (Myers et al. (1985) Science 230: 1242; Cotto
n et al. (1988) PNAS 85: 4397; Saleeba et al. (1992) Meth. Enzymol. 217:
286-295), a method to compare the electrophoretic mobilities of mutant and wild-type nucleic acids (Orita
et al. (1989) PNAS 86: 2766; Cotton (1993) Mutat Res 285: 125-144; and H
ayashi (1992) Genet Anal Tech Appl 9: 73-79) and a method for assaying the migration of mutant or wild-type fragments on polyacrylamide gels containing denaturant gradients using denaturing gradient gel electrophoresis (Myers et al. al (1985) Nature
313: 495). Examples of other techniques for detecting point mutations include selective oligonucleotide hybridization, selective amplification and selective primer extension. VI. Use of partial hALG-2LP, sALG-2LP and mALG-2LP sequences The portions or fragments of the cDNA sequences identified herein (and corresponding complete gene sequences) can be used diversely as polynucleotide reagents. . For example, these sequences: (a) map their respective genes on the chromosome; thus, to locate gene regions associated with genetic diseases;
(B) to identify individuals from trace biological samples (tissue typing); and (iii) to aid judicial identification of biological samples. These uses are described in the following subsections.

A. Chromosome Mapping Once the sequence of a gene (or a portion of the sequence) is isolated, the sequence can be used to map the location of the gene on a chromosome. This step is called chromosome mapping. Accordingly, hALG-2LP, sALG-2LP and
hALG-2LP, sALG-2LP on the chromosome using a part or fragment of the mALG-2LP sequence
And the position of the mALG-2LP gene can be mapped. To the chromosome
Mapping hALG-2LP, sALG-2LP and mALG-2LP sequences is an important first step in correlating these sequences with disease-related genes.

Briefly, from the hALG-2LP, sALG-2LP and mALG-2LP sequences, the PCR primers (
HALG-2LP, sALG-2LP or mAL, preferably 15-25 bp in length)
The G-2LP gene can be mapped to a chromosome. Computer analysis of hALG-2LP, sALG-2LP, and mALG-2LP sequences can be used to quickly select primers that do not span more than one exon in genomic DNA, and thus do not complicate the amplification process. Next, PCR of somatic cell hybrids containing individual human chromosomes
These primers can be used for screening. hALG-2LP,
Only those hybrids containing the human genes corresponding to the sALG-2LP and mALG-2LP sequences yield amplified fragments.

[0117] Somatic cell hybrids are produced by fusing somatic cells from different mammals (eg, human and mouse cells). As human and mouse cell hybrids proliferate and divide, they gradually lose human chromosomes in any order but retain mouse chromosomes. Mouse cells cannot grow because they lack certain enzymes, while human cells use a growth medium to maintain a single human chromosome containing the gene encoding the required enzyme. By using various media, a panel of hybrid cell lines can be established. Each cell line in the panel contains either a single human chromosome or a small number of human chromosomes and a set of complete mouse chromosomes, allowing easy mapping of individual genes to specific human chromosomes (D'E
ustachio P. et al. (1983) Science 220: 919-924). In addition, a somatic cell hybrid containing only a fragment of a human chromosome can be produced by using a human chromosome having a translocation and a deletion.

[0118] PCR mapping of somatic cell hybrids is a rapid method for defining specific sequences on specific chromosomes. Three or more sequences can be defined per day using a single thermal cycler. Using the hALG-2LP, sALG-2LP and mALG-2LP sequences to design oligonucleotide primers, sublocalization can be performed on a panel of fragments from a particular chromosome. hAL
Other mapping methods that can also be used to map G-2LP, sALG-2LP or mALG-2LP sequences to their chromosomes include in situ hybridization (Fan, Y. et al. (1990) PNAS, 87 : Pre-screening on labeled flow-sorted chromosomes and pre-selection by hybridization to a chromosome-specific cDNA library.

In addition, the DNA to metaphase chromosomes to provide accurate chromosomal location in one step
Fluorescence in situ hybridization (FISH) of the sequence can be used. Chromosome interspersions can be made using cells whose division has been arrested in metaphase by chemicals such as colsemide, which breaks down the spindle. These chromosomes can be treated with trypsin for some time and then stained with Giemsa. A pattern of light and dark bands appears on each chromosome so that the chromosomes can be individually identified. The FISH technique can be used with DNA sequences as short as 500 or 600 bases.
However, clones larger than 1,000 bases are more likely to bind to only one chromosomal location with sufficient signal intensity for easy detection. Preferably 1,000
Bases, more preferably 2,000 bases, are sufficient to obtain good results in a reasonable amount of time. For a review of this technology, see Verma et al., Human Chromosomes: AM
See anual of Basic Techniques (Pergamon Press, New York 1988).

Reagents for chromosome mapping can be used individually to represent a single chromosome or a single site on that chromosome, or a panel of reagents to represent multiple sites and / or multiple chromosomes Can be used. In practice, reagents corresponding to non-coding regions of the gene are preferred for mapping purposes. The coding sequence is likely to be conserved within the gene family, thus increasing the chance of cross-hybridization during chromosome mapping.

Once a sequence has been mapped to a precise chromosomal location, the physical location of the sequence on the chromosome can be correlated with genetic map data. (Such data is found, for example, in V. McKusick, Mendelian Inheritance in Man, available online through the Johns Hopkins University Welch Medical Library). Then, for example, by linkage analysis (co-inheritance of physically adjacent genes) described in Egeland, J. et al. (1987) Nature, 325: 783-787, the gene mapped to the same chromosome region The association with the disease can be identified.

Furthermore, differences in DNA sequence between affected and unaffected individuals associated with a disease associated with the hALG-2LP, sALG-2LP or mALG-2LP gene can be determined. If the mutation is found in some or all of the affected individuals but not in the unaffected individuals, then the mutation is likely to be a causative agent of the particular disease. Comparison of affected and unaffected individuals generally involves first determining the structure in the chromosome, such as deletions or translocations that are evident from chromosomal interspersions or can be detected using PCR based on their DNA sequence. Including looking for change. Eventually,
Complete sequencing of genes from several individuals can be performed to confirm the presence of the mutation and to distinguish the mutation from a polymorphism.

B. Tissue Typing The hALG-2LP, sALG-2LP, and mALG-2LP sequences of the present invention can also be used to identify individuals from small biological samples. For example, the United States Army is considering the use of restriction fragment length polymorphisms (RFLPs) to identify its personnel. In this technique, an individual's genomic DNA is digested with one or more restriction enzymes and probed on Southern blots to generate unique bands for identification. This method does not have the drawbacks of the current limitations of "Dog Tags", which can be lost, exchanged or deprived, making identification of positives difficult. The sequences of the present invention are useful as additional DNA markers for RFLP (described in US Pat. No. 5,272,057).

In addition, the sequences of the present invention provide the actual base-by-base DN of a selected portion of an individual's genome.
It can be used to provide another technique for determining the A sequence. For example, using the hALG-2LP, sALG-2LP or mALG-2LP sequences described herein, 5 ′ and 3 ′ of the sequence.
Two PCR primers can be prepared from the ends. These primers can then be used to amplify the DNA of an individual and subsequently sequence it.

The panel of corresponding DNA sequences from an individual thus generated will show that each individual has a unique set of such DNA sequences because of allelic differences, Identification can be provided. The sequences of the present invention can be used to obtain such identified sequences from individuals and tissues. HALG-2LP of the present invention, sALG-2LP
Alternatively, the mALG-2LP sequence uniquely represents a portion of the human genome. Allelic variation occurs to some extent in the coding region of these sequences and to a greater extent in the non-coding regions. It is estimated that allelic variation between individual humans occurs at a frequency of about once per 500 bases. Each of the sequences described herein can be used to some extent as a basis against which DNA from an individual can be compared for identification purposes. Since there are more polymorphisms in the non-coding regions, fewer sequences are needed to identify individuals. The non-coding sequences of SEQ ID NOs: 1, 4 and 7 are probably 10-1 resulting in a non-coding amplified sequence of 100 bases each.
A panel of 10,000 primers can be conveniently used to identify positive individuals.
When using predicted coding sequences such as those in SEQ ID NOs: 3, 6, and 9, a more suitable number of primers for identification of positive individuals appears to be 500-2,000.

If a panel of reagents from the hALG-2LP, sALG-2LP or mALG-2LP sequences described herein is used to create a unique identification database for an individual, these same reagents will later be used in that individual. Can be used to identify tissue from Using a unique identification database, positive identification of living or dead individuals can be made from very small tissue samples.

[0127] c. Use of partial hALG-2LP, sALG-2LP and mALG-2LP sequences in forensic biology DNA-based identification techniques can also be used in forensic biology. Forensic biology is a scientific discipline that uses genotyping of biological evidence found at crime scenes, for example, as a means to reliably identify perpetrators of crime. To perform such identification, tissues found at crime scenes, such as hair or skin,
Alternatively, DNA sequences taken from very small biological samples, such as body fluids, eg, blood, saliva or semen, can be amplified using PCR techniques. The amplified sequence can then be compared to a reference, thereby identifying the origin of the biological sample.

The sequences of the present invention can be used to provide a polynucleotide reagent, eg, a PCR primer, that targets a particular locus in the human genome, such as another “identifying marker” (ie, a particular marker). Providing a separate DNA sequence unique to an individual) can increase the reliability of DNA-based judicial identification. As described above, the actual base sequence information can be used for identification as an exact substitute for the pattern formed by the fragments produced by the restriction enzyme. Since there are more polymorphisms in the non-coding region and it is easier to identify individuals using this technique, the sequences targeting non-coding regions of SEQ ID NOs: 1, 4 and 7 Particularly suitable for use. Examples of polynucleotide reagents include hALG-2LP, sA
LG-2LP and mALG-2LP sequences or portions thereof, for example, fragments from the non-coding regions of SEQ ID NOs: 1, 4 and 7 having a length of at least 20 bases, preferably at least 30 bases, are included. .

Furthermore, the hALG-2LP, sALG-2LP and mALG-2LP sequences described herein may be used to identify particular tissues, such as brain tissues, for example, polynucleotides that can be used in in situ hybridization techniques. It can be used to provide reagents, such as labeled or labelable probes. This should be very useful if the forensic pathologist is given tissue of unknown origin.
Such hALG-2LP, for identifying tissue by species and / or organ type,
Panels of sALG-2LP and mALG-2LP probes can be used.

Similarly, these reagents, such as hALG-2LP, sALG-2LP and mALG-2LP primers or probes, evaluate tissue cultures for contamination (ie, for the presence of a mixture of different types of cells in the culture). To evaluate).

The present invention is further illustrated by the following examples, which should not be construed as limiting. The contents of all references, patent applications, patents, and published patent applications cited throughout this application are hereby incorporated by reference.

EXAMPLES Example 1 Identification and Characterization of hALG-2LP, sALG-2LP and mALG-2LP cDNA In this example, hALG-2 was screened by screening an appropriate cDNA library.
-2LP, sALG-2LP and mALG-2LP nucleic acid molecules were identified. First, EST (jlkbc063c04) was identified in a monkey brain cDNA library using Sequence Explorer. Subsequently, a mouse EST (jlmba005e01) was identified in a mouse brain cDNA library, and two human ESTs were also identified by screening a proprietary library.
These positive clones were sequenced and their sequences were compiled.

A BLASTN ^™ search of the EST database revealed the following ESTs with significant homology to hALG-2LP cDNA:

[0134]

[Table 1]

A BLASTN ^™ search of the EST database revealed the following ESTs with significant homology to sALG-2LP cDNA:

[0136]

[Table 2]

A BLASTN ^™ search of the EST database revealed the following ESTs with significant homology to partial mALG-2LP cDNA:

[0138]

[Table 3]

Example 2: Tissue expression of hALG-2LP, sALG-2LP and mALG-2LP genes Northern analysis Human, monkey and mouse multiple tissue northern containing 2 ### (g) g of poly A + RNA per lane (MTN) blot, human MTN I, II and III blots (Clontech, Pal
o Alto, CA) were probed with hALG-2LP specific primers (probes). Filter these filters with 10 ml of Express Hyb hybridization solution (Clontech, Palo Alto
, CA) for 1 hour at 68 ° C, after which 100 ng of ³² P-labeled probe was added. This probe was made using the Stratagene Prime-It kit, catalog number 300392 (Clontech, Palo Alto, CA). Hybridization was continued at 68 ° C. for about 2 hours. The filters were washed twice in a 0.05% SDS / 2 × SSC solution at room temperature for 15 minutes, then in a 0.1% SDS / 0.1 × SSC solution at 50 ° C. for 20 minutes, and then washed together with one intensifying screen. Exposure to autoradiographic film at 80 ° C. overnight. The human and mouse tissues tested included: brain, heart, kidney, liver, lung, skeletal muscle, spleen, testis, placenta, pancreas, colon, prostate, ovary, small intestine and hypothalamus.

There was strong hybridization for all tissues tested, except for the hypothalamus, indicating that the ALG-2LP gene transcript was expressed in these tissues. Example 3 Expression of Recombinant hALG-2LP, sALG-2LP and mALG-2LP Proteins in Bacterial Cells In this example, hALG-2LP, sALG-2LP and mALG-2LP were transformed in Escherichia coli into recombinant glutathione-S- Expressed as a transferase (GST) fusion protein, the fusion protein is isolated and characterized. Specifically, hALG-2LP, sALG-2LP and mALG-2LP are fused to GST, and these fusion proteins are transformed into Escherichia coli,
For example, it is expressed in strain PEB199. Since hALG-2LP, sALG-2LP and mALG-2LP are predicted to be 32.7 kDa, 31.8 kD and 31.5 kd, respectively, and GST is predicted to be 26 kDa, the fusion proteins are approximately 58.7 kDa, 57.8 kD and Predicted to have a molecular weight of 57.5 kD. GST-hALG-2LP, -sALG-2LP and -mALG-2L in PEB199
Expression of the P-fusion protein is induced with IPTG. The recombinant fusion protein is purified from the crude PEB199 strain bacterial lysate by affinity chromatography on glutathione beads. Polyacrylamide gel electrophoresis analysis of the protein purified from the bacterial lysate is used to determine the molecular weight of the resulting fusion protein. Example 4: Expression of recombinant hALG-2LP, sALG-2LP and mALG-2LP protein in COS cells To express the hALG-2LP, sALG-2LP or mALG-2LP gene in COS cells, Invitrogen Corporation (San Diego, CA) using a pcDNA / Amp vector. This vector contains an SV40 origin of replication, an ampicillin resistance gene, an Escherichia coli origin of replication, a CMV promoter followed by a polylinker region, and an SV40 intron and polyadenylation site. All hALG-2LP, sALG-2LP or mALG
HA label fused in-frame (Wil
A DNA fragment encoding son et al. (1984) Cell 37: 767) is cloned into the polylinker region of the vector, thereby placing the expression of the recombinant protein under the control of the CMV promoter.

To construct the plasmid, hALG-2LP,
Amplify the sALG-2LP or mALG-2LP DNA sequence. The 5 'primer contains the hALG-2LP, sALG-2LP or mALG-2LP coding sequence beginning with the restriction site of interest followed by a start codon of about 20 nucleotides; the 3' terminal sequence is another restriction site of interest, translation. It contains a stop codon, an HA tag and a sequence complementary to the last 20 nucleotides of the hALG-2LP, sALG-2LP or mALG-2LP coding sequence. The PCR amplified fragment and pcDNA / Amp vector are digested with appropriate restriction enzymes, and CIAP enzyme (New England Biol.
abs, Beverly, MA). Preferably, the two restriction sites chosen are different, so that the hALG-2LP, sALG-2LP and mALG-2LP genes are inserted in the correct orientation. Transfer the ligation mixture to Escherichia coli cells (Stratag
ene Cloning Systems, available from strains HB101, DH5α, SURE, available from La Jolla, CA), and plate the transformed cultures on ampicillin media plates to select for resistant colonies . Plasmid DNA is isolated from the transformants and examined by restriction analysis for the presence of the appropriate fragment.

Next, COS was performed using calcium phosphate or calcium chloride co-precipitation, transfection with DEAE-dextran, lipofection or electroporation.
Transfect cells with hALG-2LP, sALG-2LP or mALG-2LP-pcDNA / Amp plasmid DNA. Other suitable methods for transfecting host cells are described in Sambrook, J., Fritsh, EF and Maniatis, T., Molecular Cloning: A La
boratory Manual. 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbo
r Laboratory Press, Cold Spring Harbor, NY, 1989.
Radiolabeling ( ³⁵ S-methionine or ³⁵ S-cysteine available from NEN, Boston, MA can be used) and immunoprecipitation using a HA-specific monoclonal antibody (Harlow, E. and Lane, D. Antibodies: A Laboratory) Manual, Cold Spring Ha
rAL Laboratory Press, Cold Spring Harbor, NY, 1988) by hALG-2LP, sALG
-2LP or mALG-2LP protein expression is detected. Briefly, cells are labeled with ³⁵ S-methionine (or ³⁵ S-cysteine) for 8 hours. Next, collect the culture medium,
Solvent (RIPA buffer, 150 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% DOC, 50 mM Tri
lyse the cells using s, pH 7.5). HA for both cell lysate and culture medium
Precipitate with specific monoclonal antibody. Next, the precipitated protein was subjected to SDS-PAGE.
Analyze by

Alternatively, DNA containing the hALG-2LP, sALG-2LP or mALG-2LP coding sequence is cloned directly into the pcDNA / Amp vector polylinker using appropriate restriction sites. The resulting plasmid was transfected into COS cells as described above, and hALG-2LP, sALG-2LP or mALG-LP was obtained by radiolabeling and immunoprecipitation using a monoclonal antibody specific for hALG-2LP, sALG-2LP or mALG-2LP. Detect the expression of 2LP protein. Example 5: Characterization of hALG-2LP, sALG-2LP and mALG-2LP proteins In this example, the amino acid sequences of hALG-2LP, sALG-2LP and mALG-2LP proteins are compared with those of known proteins, Various motifs were identified.

The hALG-2LP protein whose amino acid sequence is shown in FIG. 1 (SEQ ID NO: 2) is a novel protein containing 284 amino acid residues. Amino acid residues 127-139 and 194-206 of SEQ ID NO: 2 (shown separately as SEQ ID NO: 10 and SEQ ID NO: 11, respectively)
It comprises a calcium binding domain, eg, a domain showing high homology to the EF hand.

BLAST search of the protein sequence of human ALG-2LP (Altschul et al. (1990) J. Mol.
Biol. 215: 403) shows that hALG-2LP has the following protein: a promising mouse (prob
able) calcium binding protein (accession number P12815), human Sorcin (accession number P30)
626), mouse accession number 50266, mouse calcium binding protein (accession number S049)
70) and Chinese hamster Sorcin (accession number P05044). Human ALG-2LP at the amino acid level is 44% identical to a promising mouse calcium binding protein (Accession No. P12815) over nucleotides 396-872;
38% identical to human Sorcin (accession number P30626) over nucleotides 444-872; 44% identical to mouse accession number 50266 over nucleotides 396-872; mouse calcium binding protein over nucleotides 396-872 (accession number S04970)
); And 37% identical to Chinese Hamster Sorcin (Accession No. P05044) over nucleotides 444-857.

The sALG-2LP protein whose amino acid sequence is shown in FIG. 2 (SEQ ID NO: 5) is a novel protein containing 277 amino acid residues. Amino acid residues 120-132 and 187-199 of SEQ ID NO: 5 (shown separately as SEQ ID NO: 12 and SEQ ID NO: 13, respectively)
It comprises a calcium binding domain, eg, a domain showing high homology to the EF hand.

BLAST search of the protein sequence of monkey ALG-2LP (Altschul et al. (1990) J. Mol.
According to Biol. 215: 403), sALG-2LP is similar to the following proteins: Promising calcium binding protein of mouse (Accession number P12815), human Sorcin (Accession number P30626) and Chinese hamster Sorcin (Accession number P05044). Indicated.
Human (monkey) ALG-2LP is 42% identical at the amino acid level to a promising mouse calcium binding protein (accession number P12815) over nucleotides 376-831;
38% identical to human Sorcin (accession number P30626) over nucleotides 376-831; and 37% identical to Chinese hamster Sorcin (accession number P05044) over nucleotides 403-816.

The mALG-2LP protein whose partial amino acid sequence is shown in FIG. 3 (SEQ ID NO: 8) is a novel protein containing 274 amino acid residues. Amino acid residues 117-129 and 184-196 of SEQ ID NO: 8 (shown separately as SEQ ID NO: 14 and SEQ ID NO: 15, respectively)
Comprises a calcium binding domain, eg, a domain that shows homology to the EF hand.

BLAST search of protein sequence of partial mouse ALG-2LP (Altschul et al. (1990) J
According to Mol. Biol. 215: 403), mALG-2LP is converted to the following proteins: Promising mouse calcium binding protein (Accession No. P12815), mouse calcium binding protein (Accession No. S04970) and human Sorcin (Accession No. P30626). Similarities have been shown. Partial mouse ALG-2LP is 45% identical to a promising mouse calcium binding protein (accession number P12815) over amino acid residues 115-221; amino acid residue 1
43% identical to mouse calcium binding protein (accession number S04970) over 30-221; and human Sorcin (accession number P30626) over amino acid residues 131-227
) Is 39% identical to Equivalents Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents of the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

[0150]

[Sequence list]

[Brief description of the drawings]

FIG. 1 shows the nucleotide (SEQ ID NO: 1) and amino acid (SEQ ID NO: 2) sequences of human ALG-2LP (hALG-2LP). The coding region not containing the 5 'and 3' untranslated regions of the human ALG-2LP gene is shown in SEQ ID NO: 3.

FIG. 2 shows the monkey ALG-2LP (sALG-2LP) nucleotide (SEQ ID NO: 4) and amino acid (SEQ ID NO: 5) sequences. The coding region not containing the 5 'and 3' untranslated regions of the monkey ALG-2LP gene is shown in SEQ ID NO: 6.

FIG. 3. Partial mouse ALG-2LP (mALG-2LP) nucleotide (SEQ ID NO: 7) and amino acids (
SEQ ID NO: 8) This shows the sequence. The coding region not containing the 5 'and 3' untranslated regions of the mouse ALG-2LP gene is shown in SEQ ID NO: 9.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 43/00 111 A61P 43/00 111 4C084 C07K 14/47 C07K 14/47 4H045 16/18 16/18 17 / 00 17/00 C12N 1/15 C12N 1/15 1/19 1/19 1/21 1/21 5/10 C12P 21/02 C 15/09 ZNA C12Q 1/68 A C12P 21/02 G01N 33/15 Z C12Q 1/68 33/50 Z G01N 33/15 33/574 Z 33/50 C12P 21/08 33/574 C12N 5/00 A // C12P 21/08 C 15/00 ZNAA (81) Designated country EP ( AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, G , ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SL, SZ, UG, ZW), EA (AM, AZ, BY, KG, KZ) , MD, RU, TJ, TM), AE, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CU, CZ, DE, DK, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV , MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, UA, UG, UZ, VN, YU, ZA, ZWF term (reference) 2G045 AA40 DA12 DA13 DA36 FB03 FB07 FB08 FB12 4B024 AA 11 BA41 BA80 CA04 CA09 CA12 DA02 DA06 EA04 GA11 GA16 HA12 HA17 4B063 QA01 QA18 QA19 QQ08 QQ13 QQ20 QQ42 QQ53 QQ79 QR32 QR56 QR62 QR77 QR80 QS25 QS34 QS38 4B064 AG01 AG27 CA02 CA10 CA19 ACAAXAA DAA DA13 CA24 CA25 CA44 CA46 4C084 AA01 AA07 AA13 AA17 BA01 BA08 BA22 BA23 CA53 ZA012 ZB022 ZB092 ZB262 4H045 AA10 AA11 AA20 AA30 BA10 CA46 DA75 DA76 EA20 EA50 FA72 FA74 HA05

Claims (23)

[Claims] 1. a) a nucleic acid molecule encoding a protein comprising the amino acid sequence of SEQ ID NO: 2; b) a nucleic acid molecule encoding a protein comprising the amino acid sequence of SEQ ID NO: 5; c) SEQ ID NO: A nucleic acid molecule encoding a protein comprising the amino acid sequence of SEQ ID NO: 2; d) a nucleic acid molecule encoding a fragment of the protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the fragment comprises at least 15 E) a nucleic acid molecule encoding a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the fragment comprises at least 15 consecutive amino acids of SEQ ID NO: 5 F) a nucleic acid molecule encoding a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein the fragment Comprises at least 15 contiguous amino acids of SEQ ID NO: 8; g) the amino acid sequence of SEQ ID NO: 2, which hybridizes under stringent conditions to a nucleic acid molecule comprising SEQ ID NO: 1. A nucleic acid molecule encoding a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 5, which hybridizes under stringent conditions to a nucleic acid molecule comprising SEQ ID NO: 4. A nucleic acid molecule encoding a naturally occurring allelic variant of a protein comprising; and i) the amino acid sequence of SEQ ID NO: 8, which hybridizes under stringent conditions to the nucleic acid molecule comprising SEQ ID NO: 7 A nucleic acid molecule encoding a naturally occurring allelic variant of a protein comprising: an isolated nucleic acid molecule selected from the group consisting of: 2. The nucleic acid molecule of claim 1, further comprising a vector nucleic acid sequence. 3. The nucleic acid molecule of claim 1, further comprising a nucleic acid sequence encoding a heterologous protein. 4. A host cell containing the nucleic acid molecule of claim 1. 5. The host cell of claim 4, which is a mammalian host cell. 6. A non-human mammalian host cell containing the nucleic acid molecule of claim 1. 7. The isolated region of claim 1, selected from the group consisting of: a) the coding region of SEQ ID NO: 1; b) the coding region of SEQ ID NO: 4; and c) the coding region of SEQ ID NO: 7. Nucleic acid molecule. 8. a) a protein comprising the amino acid sequence of SEQ ID NO: 2; b) a protein comprising the amino acid sequence of SEQ ID NO: 5; c) a protein comprising the amino acid sequence of SEQ ID NO: 8; d) SEQ ID NO: 2 comprising at least 15 contiguous amino acids of SEQ ID NO: 2
A fragment of a protein comprising the amino acid sequence of SEQ ID NO: 5; e) SEQ ID NO: 5 comprising at least 15 contiguous amino acids of SEQ ID NO: 5
A fragment of a protein comprising the amino acid sequence of SEQ ID NO: 8; f) a sequence comprising at least 15 contiguous amino acids of SEQ ID NO: 8.
A fragment of a protein comprising the amino acid sequence of SEQ ID NO: 2; g) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the protein comprises a nucleic acid comprising SEQ ID NO: 1 H) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the protein is a nucleic acid molecule that hybridizes under stringent conditions to the molecule; : 4 encoded by a nucleic acid molecule that hybridizes under stringent conditions to a nucleic acid molecule comprising: i) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 8; Here, the protein is a nucleic acid molecule that hybridizes under stringent conditions to a nucleic acid molecule comprising SEQ ID NO: 7. Ri encoded, isolated protein selected from the group consisting of. 9. The protein of claim 8, further comprising a heterologous amino acid sequence. 10. An antibody that selectively binds to the protein of claim 8. 11. A method comprising culturing the host cell of claim 4 under conditions in which the nucleic acid molecule is expressed, a) a protein comprising the amino acid sequence of SEQ ID NO: 2; b) SEQ ID NO: 5 A) a protein comprising the amino acid sequence of SEQ ID NO: 8; d) a protein comprising at least 15 contiguous amino acids of SEQ ID NO: 2;
A fragment of a protein comprising the amino acid sequence of SEQ ID NO: 5; e) SEQ ID NO: 5 comprising at least 15 contiguous amino acids of SEQ ID NO: 5
A fragment of a protein comprising the amino acid sequence of SEQ ID NO: 8; f) a sequence comprising at least 15 contiguous amino acids of SEQ ID NO: 8.
A fragment of a protein comprising the amino acid sequence of SEQ ID NO: 2; g) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the protein comprises a nucleic acid comprising SEQ ID NO: 1 H) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the protein is a nucleic acid molecule that hybridizes under stringent conditions to the molecule; : 4 encoded by a nucleic acid molecule that hybridizes under stringent conditions to a nucleic acid molecule comprising: i) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 8; Here, the protein is a nucleic acid molecule that hybridizes under stringent conditions to a nucleic acid molecule comprising SEQ ID NO: 7. Ri the encoded method of a protein selected from the group consisting of. 12. In a sample: a) a protein comprising the amino acid sequence of SEQ ID NO: 2; b) a protein comprising the amino acid sequence of SEQ ID NO: 5; c) a protein comprising the amino acid sequence of SEQ ID NO: 8 A) a protein comprising at least 15 contiguous amino acids of SEQ ID NO: 2.
A fragment of a protein comprising the amino acid sequence of SEQ ID NO: 5; e) SEQ ID NO: 5 comprising at least 15 contiguous amino acids of SEQ ID NO: 5
A fragment of a protein comprising the amino acid sequence of SEQ ID NO: 8; f) a sequence comprising at least 15 contiguous amino acids of SEQ ID NO: 8.
A fragment of a protein comprising the amino acid sequence of SEQ ID NO: 2; g) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the protein comprises a nucleic acid comprising SEQ ID NO: 1 H) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the protein is a nucleic acid molecule that hybridizes under stringent conditions to the molecule; : 4 encoded by a nucleic acid molecule that hybridizes under stringent conditions to a nucleic acid molecule comprising: i) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 8; Here, the protein is a nucleic acid molecule that hybridizes under stringent conditions to a nucleic acid molecule comprising SEQ ID NO: 7. Detecting the presence of a protein selected from the group consisting of: i) contacting the sample with a compound that selectively binds to the protein; and ii) binding the compound to the protein in the sample. Determining whether to do so, comprising the steps of: 13. The method according to claim 12, wherein the compound that binds to a protein is an antibody. 14. A kit comprising reagents for use in the method of claim 12, wherein the reagents comprise: a) a protein comprising the amino acid sequence of SEQ ID NO: 2; b) SEQ ID NO: A protein comprising the amino acid sequence of SEQ ID NO: 8; c) a protein comprising the amino acid sequence of SEQ ID NO: 8; d) a protein comprising at least 15 contiguous amino acids of SEQ ID NO: 2;
A fragment of a protein comprising the amino acid sequence of SEQ ID NO: 5; e) SEQ ID NO: 5 comprising at least 15 contiguous amino acids of SEQ ID NO: 5
A fragment of a protein comprising the amino acid sequence of SEQ ID NO: 8; f) a sequence comprising at least 15 contiguous amino acids of SEQ ID NO: 8.
A fragment of a protein comprising the amino acid sequence of SEQ ID NO: 2; g) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the protein comprises a nucleic acid comprising SEQ ID NO: 1 H) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the protein is a nucleic acid molecule that hybridizes under stringent conditions to the molecule; : 4 encoded by a nucleic acid molecule that hybridizes under stringent conditions to a nucleic acid molecule comprising: i) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 8; Here, the protein is a nucleic acid molecule that hybridizes under stringent conditions to a nucleic acid molecule comprising SEQ ID NO: 7. Ri encoded, kits comprising selectively bind to compounds in protein selected from the group consisting of. 15. In a sample: a) a nucleic acid molecule encoding a protein comprising the amino acid sequence of SEQ ID NO: 2; b) a nucleic acid molecule encoding a protein comprising the amino acid sequence of SEQ ID NO: 5; c) A nucleic acid molecule encoding a protein comprising the amino acid sequence of SEQ ID NO: 8; d) a nucleic acid molecule encoding a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the fragment comprises SEQ ID NO: 2 E) a nucleic acid molecule encoding a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 5 F) a nucleic acid molecule encoding a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein The fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 8; g) the amino acid of SEQ ID NO: 2 that hybridizes under stringent conditions to a nucleic acid molecule comprising SEQ ID NO: 1 A nucleic acid molecule encoding a naturally occurring allelic variant of a protein comprising the sequence; h) the amino acid of SEQ ID NO: 5, which hybridizes under stringent conditions to the nucleic acid molecule comprising SEQ ID NO: 4 A nucleic acid molecule encoding a naturally occurring allelic variant of a protein comprising the sequence; and i) the nucleic acid molecule of SEQ ID NO: 8, which hybridizes under stringent conditions to the nucleic acid molecule comprising SEQ ID NO: 7. A nucleic acid molecule encoding a naturally occurring allelic variant of a protein comprising an amino acid sequence. Contacting the sample with a nucleic acid probe or primer that selectively hybridizes to the nucleic acid molecule; and ii) determining whether the nucleic acid probe or primer binds to a nucleic acid molecule in the sample. A method comprising the steps of: 16. The method of claim 15, wherein the sample comprises an mRNA molecule and the sample is contacted with a nucleic acid probe. 17. A kit comprising a reagent for use in the method of claim 15, wherein the reagent comprises: a) a nucleic acid molecule encoding a protein comprising the amino acid sequence of SEQ ID NO: 2; b) a nucleic acid molecule encoding a protein comprising the amino acid sequence of SEQ ID NO: 5; c) a nucleic acid molecule encoding a protein comprising the amino acid sequence of SEQ ID NO: 8; d) the amino acid sequence of SEQ ID NO: 2 A nucleic acid molecule encoding a fragment of a protein comprising the amino acid sequence, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 2; e) a protein comprising an amino acid sequence of SEQ ID NO: 5 A nucleic acid molecule encoding a fragment, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 5; f) the amino acid sequence of SEQ ID NO: 8 A nucleic acid molecule encoding a fragment of a protein comprising the fragment, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 8; g) a stringent nucleic acid molecule comprising SEQ ID NO: 1 A nucleic acid molecule encoding a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 2, which hybridizes under mild conditions; h) stringent to a nucleic acid molecule comprising SEQ ID NO: 4 A nucleic acid molecule encoding a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 5, which hybridizes under the following conditions: i) a nucleic acid molecule comprising SEQ ID NO: 7; A naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 8, which hybridizes under gentle conditions. Selectively kit comprising compounds which hybridize to a nucleic acid molecule selected from the group consisting of a nucleic acid molecule over de. 18. a) a protein comprising the amino acid sequence of SEQ ID NO: 2; b) a protein comprising the amino acid sequence of SEQ ID NO: 5; c) a protein comprising the amino acid sequence of SEQ ID NO: 8; d) SEQ ID NO: 2 comprising at least 15 contiguous amino acids of SEQ ID NO: 2
A fragment of a protein comprising the amino acid sequence of SEQ ID NO: 5; e) SEQ ID NO: 5 comprising at least 15 contiguous amino acids of SEQ ID NO: 5
A fragment of a protein comprising the amino acid sequence of SEQ ID NO: 8; f) a sequence comprising at least 15 contiguous amino acids of SEQ ID NO: 8.
A fragment of a protein comprising the amino acid sequence of SEQ ID NO: 2; g) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the protein comprises a nucleic acid comprising SEQ ID NO: 1 H) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the protein is a nucleic acid molecule that hybridizes under stringent conditions to the molecule; : 4 encoded by a nucleic acid molecule that hybridizes under stringent conditions to a nucleic acid molecule comprising: i) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 8; Here, the protein is a nucleic acid molecule that hybridizes under stringent conditions to a nucleic acid molecule comprising SEQ ID NO: 7. Identifying a compound that binds to a protein selected from the group consisting of: i) contacting the protein or a cell expressing the protein with a test compound; and ii) binding the protein to the test compound. Determining whether the method comprises a step. 19. The binding of the test compound to the protein is determined by: a) detecting binding by direct detection of test compound / protein binding; b) detecting binding using a competitive binding assay; c) using an assay for ALG-2LP activity. 19. The method of claim 18, wherein said binding is detected by a method selected from the group consisting of: 20) a protein comprising the amino acid sequence of SEQ ID NO: 2; b) a protein comprising the amino acid sequence of SEQ ID NO: 5; c) a protein comprising the amino acid sequence of SEQ ID NO: 8; d) SEQ ID NO: 2 comprising at least 15 contiguous amino acids of SEQ ID NO: 2
A fragment of a protein comprising the amino acid sequence of SEQ ID NO: 5; e) SEQ ID NO: 5 comprising at least 15 contiguous amino acids of SEQ ID NO: 5
A fragment of a protein comprising the amino acid sequence of SEQ ID NO: 8; f) a sequence comprising at least 15 contiguous amino acids of SEQ ID NO: 8.
A fragment of a protein comprising the amino acid sequence of SEQ ID NO: 2; g) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the protein comprises a nucleic acid comprising SEQ ID NO: 1 H) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the protein is a nucleic acid molecule that hybridizes under stringent conditions to the molecule; : 4 encoded by a nucleic acid molecule that hybridizes under stringent conditions to a nucleic acid molecule comprising: i) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 8; Here, the protein is a nucleic acid molecule that hybridizes under stringent conditions to a nucleic acid molecule comprising SEQ ID NO: 7. A method of modulating the activity of a protein selected from the group consisting of: i) contacting a cell expressing the protein with a compound that binds to the protein in a concentration sufficient to modulate the activity of the protein. A method comprising the steps of: 21. The method of claim 20, wherein the activity is the regulation of programmed cell death. 22. The method of claim 20, which results in inhibition of programmed cell death. 23. The method of claim 20, which results in stimulation of programmed cell death.