JP2002505341A - Enhanced prodrug activation - Google Patents

Abstract

(57) Abstract: A prodrug activator comprising a) a localization domain and b) a prodrug activation domain for activating the prodrug in a target cell.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001] The present invention relates to an agent for activating a prodrug in a target cell. The present invention also relates to a method of activating a prodrug using a novel drug.

[0002] Enzyme prodrug therapy (EPT) involves the use of enzymes to activate prodrugs in therapy. Prodrugs are typically pharmacologically inactive or relatively inactive compounds that can be converted in vivo to an active species that has a therapeutic effect (Connors 1995 Gene Therapy 2, 702; Springer and Nicolescu-Duvaz 1996 Adv Drug Deliv Res 22, 351). One particular use of EPT is in the treatment of tumors.

[0003] Initially, prodrugs were developed that utilize the body's innate enzymes for activation. For example, cyclophosphamide (CP) and its isomers, and ifosfamide
(IF) produces a nitrogen mustard that is activated by the P450 family of enzymes and damages DNA, and mitomycin C (MMC) is activated mainly by NADPH: cytochrome C (P450) reductase and is strongly alkylated. An agent is produced (eg, Bligh et al., 1990, Cancer Research 50, 7789). The therapeutic index of these first prodrugs depends on the differential susceptibility of the target cells to DNA damage, rather than on selective delivery to the target cells. This DNA damage is only a problem when the cells divide, and therefore, tumor target cells that are actively dividing or will undergo cell division will be damaged, but not normal organs or The differentiated cells of the tissue do not divide and remain alive. Tumors have not been shown to contain particularly high levels of enzymes that can activate this class of prodrugs (Forrester et al. 1990 Ca
rcinogenesis 11, 2163). It is believed that prodrugs such as CP, IF and MMC are largely activated in the liver to therapeutic metabolites, which are then distributed by circulation to tumor sites. Even if the tumor has some ability to metabolize the prodrug, down-regulation of its activity is likely to contribute to drug resistance (eg, Bligh et al. 1990 supra).

The finding that tumor cells are relatively inefficient in terms of prodrug metabolism has led to the concept of delivering normal human enzymes directly to tumors in order to obtain high local concentrations of activating compounds (eg, Chen et al. 1996 Cancer Research 56, 1331). Recently, for example, in experimental systems, direct introduction of a gene encoding P450 into tumor cells using a viral vector can increase the efficacy of CP, resulting in tumors that exhibit markedly reduced growth and regression. (Chen et al., 1996, supra).
This related enzyme activity can selectively target tumor cells by one of several means. In one such approach, a tumor-selective monoclonal antibody or fragment, such as a single-chain antibody (scFv), is conjugated to the enzyme, either synthetically or by production of a recombinant protein. The protein is administered to the patient and is localized to the tumor by specific recognition of the tumor surface by the antibody. Administering a non-toxic prodrug,
The bound conjugate allows activation only at the tumor site (B
agshawe 1987 Br J Cancer 56, 531). This technique is called ADEPT (antibody-dependent prodrug activation). Another approach is to use a DNA-based delivery system, such as a plasmid, to transfer DNA encoding the enzyme (gene-dependent enzyme prodrug therapy, GDEPT) (e.g., Vile et al. 1993 Cancer Res 53, 3860) or viral Using (virus-dependent enzyme prodrug VDEPT) (e.g. Huber et al. 1991 PNAS 88,
8039) delivery to target cells. In these cases, tumor specificity may be provided by incorporating a targeting ligand into the delivery vehicle, or by using a tumor-specific promoter (eg, Harris et al. 1994 Gen.
e Therapy 1, 170 and references therein). Recent developments have described a combination of the ADEPT and GDEPT methods. By this method, a gene fusion is constructed such that the gene encoding the antibody targeting moiety is fused to the gene encoding the prodrug activating enzyme. The gene fusion is delivered to the target tissue as DNA or in a gene delivery vehicle such as a viral vector (WO98 / 55607).

[0005] Another class of prodrugs exhibits selective toxicity to tumors through reductive activation that occurs in a severe hypoxic environment, a unique physiological feature of tumors. Hypoxia is an abnormally low level of oxygen that is found in most solid tumors larger than about 1 mm in diameter (Coleman 1988 J Nat Canc Inst 80, 310; Vaupel et al. Cancer Res 4
9, 6449). A hypoxic environment induces reductive events that can generate reduced derivatives of various chemical groups (Workman and Stratford 1993 Cancer and Metastasis Revie
ws, 12, 73-82). A typical bioreducing drug is the antibiotic mitomycin C (
MMC) and porphyromycin (POR), but N-oxides such as tirapazamine (Tirapazamine, TRZ) (Zeeman et al. 1986 Inst J Radiot Oncol Biol Phys 12,
1239), and quinones such as indolequinone E09 (Bailey et al. 1992 Int JR
adiot Oncol Biol Phys 22, 649), cyclopropamitosen
es) (EP-A-0868137) and mitozantrone (activated by cytochrome P450 3A4 (Patterson 1993 Cancer Metast Rev 12, 119; Patterson 1994 Biochem.
Many other compounds have been evaluated, including the tertiary amine-N-oxide analog (AQ4N) of Pharm Oncol Res 6, 533). To date, the most promising of these compounds are tirapazamine (TRZ, 3-amino-1,2,4-benzotriazine-1,4-
Dioxide). Tirapazamine is metabolized to mono-N-oxide (SR4317) and to a lesser extent the free base SR4330. Because neither the two- or four-electron reduction products are genotoxic, they are thought to involve the one-electron radical of tirapazamine rather than a stable metabolite (A. Cahill and INHWhite 1990, Carci
nogenesis, 11, 1407). It is thought that nitroxide anion free radicals are generated, which act directly on DNA and cause DNA strand breaks (JMBrown 1993 Br).
J Cancer 67, 1163). Although tirapazamine increases cell killing in hypoxic conditions, it exhibits significant levels of toxicity even at moderate oxygen tensions. This is beneficial. This is because the degree of hypoxia varies throughout the tumor, and absolutely low levels of oxygen cannot be maintained at any time. Thus, tirapazamine, for example, has a higher tumor cell killing potential than mitomycin C, which is activated only at significantly lower oxygen tensions (reviewed in JMBrown, supra). Tirapazamine is toxic because it acts on the bone marrow when used at high doses, causing myelosuppression. Therefore, current clinical use is dominated by doses that reduce toxicity, and in fact, the doses required for a pronounced therapeutic effect are close to the maximum tolerated dose (Adam et al. 1992 I
nt J Radiat Onc Biol Phys 22, 717). Early studies have shown that cytochrome P450 plays a key role in the metabolism of tirapazamine, but its role in activation and cytotoxicity has not yet been elucidated (Walton et al. Biochem Pharmacol.
44, 251). However, there is increasing evidence that P450 reductase plays a more important role. Patterson et al. (Patterson et al. 1995 Br J Cancer 72, 1144)
In a panel of breast cancer lines, the activity of P450 reductase has a range, indicating that the hypoxic toxicity of tirapazamine directly correlates with endogenous P450 reductase levels. Similar correlations were found in two bladder cancer lines (Xu et al. 1994 Br J Cancer
242). Recently, the introduction of full-length cDNA for human P450 reductase into tumor cells, and showing that overexpression of the gene for P450 reductase in tumor cells significantly increases the sensitivity to tirapazamine (TRZ), indicated that tirapazamine metabolism Formal evidence for the importance of P450 reductase in E. coli was obtained (Patterson et al. 1997 Br J Cancer 76 (10), 1338-1347). These are P4
This is the first data showing that 50 reductases can be used in gene therapy applications.

[0006] These studies of increased prodrug activation by introducing normal human enzymes, such as P450 and P450 reductase, into cells indicate that normal mammalian enzymes can be utilized in a variety of available ways. I understand. These include the above GD
EPT, VDEPT and ADEPT methods are included. On the other hand, hematopoietic cells engineered ex vivo to include the gene can be used for enzyme delivery (WO9
8/55607). Delivery of prodrug activating enzymes, such as P450 and P450 reductase, directly to tumors can reduce the dose of prodrug that is administered systemically to patients, and thus reduce systemic toxicity. All approaches with enzyme prodrug therapy rely on achieving a difference in prodrug activation in diseased tissue compared to normal tissue (Chen et al. 1996; T. Connors (supra); Patterso
n et al. 1997).

[0007] The use of natural enzymes in the EPT approach is attractive, for example, because it can avoid unwanted immune responses, but some drugs, such as P450s, still cause some systemic toxicity in the liver The disadvantage is that there is a transformation.
Thus, a variety of different non-human enzyme prodrug combinations were sought.
These are, by definition, not present in any human cells. Thus, if the delivery is tumor specific, there would be no toxic side effects derived from prodrug activation in normal tissues such as the liver. For example, the thymidine kinase enzyme (HSVTk) from herpes simplex virus can phosphorylate the prodrug ganciclovir (GCV) to produce a nucleoside analog, which is then further phosphorylated by cellular kinases. To produce a nucleotide (ganciclovir triphosphate) having a function of blocking DNA synthesis (FLMoolten 1986 Cancer Res 46, 5276). This HSVTk approach is S-phase specific, thus killing only actively growing tumor cells. Therefore, it is not suitable in all cases. Another example is CB
There is the use of E. coli nitroreductase to reduce compounds related to 1954 to produce DNA damaging metabolites (Anlezark et al. 1992 Biochem Pharmacol 44, 2289). The combination of many different enzymes prodrug others have been devised, for example, carboxypeptidase G _2, penicillin amidase, alkaline phosphatase, beta-lactamase and cytosine deaminase capable of activating a prodrug by hydrolysis (Knox et al. 1995 Biochem Introduction to Pharmacol 49, 1641, as well as T. Conno
rs (supra); Springer and Nicolescu-Duvaz 1996 (supra).

[0008] Several factors complicate all of the various enzyme prodrug therapies described to date. There are unique problems with different drug / enzyme combinations and different modes of delivery. In ADEPT, for example, the enzyme is delivered to the outside of the cell, but in most cases the active drug must cross the cell membrane, which restricts the chemical design. Also, this active drug must spread throughout the tumor to be effective. The high level of activation at one site resulting from the use of high affinity antibodies results in the depletion of the prodrug in most tumors and the easy efflux of the active compound into the circulation, thus reducing efficacy. And the potential for systemic toxicity may increase. In addition, repeated administration of the prodrug is required. Thus, in general, the ADEPT method is deficient because it has the potential to deliver the active compound into the circulation. In addition, if an intracellular cofactor such as NADPH is required for enzyme activity, a surrogate cofactor must be co-administered to the extracellular environment. This limits, for example, the use of bacterial nitroreductase in the ADEPT method (Knox et al. 1995 Biochem Pharmacol 49, 1641). The VDEPT / GDEPT method is advantageous when intracellular cofactors are present. This is because the enzyme activates the drug only intracellularly, so that accidental release of the enzyme into the blood circulation does not result in systemic activation and toxicity. However, GDEPT and VDEPT methods cannot deliver the relevant gene to all cells in the tumor, which means that many cells in the tumor do not die,
Therefore, intracellular binding of the enzyme is an obvious disadvantage. Therefore, it is desirable for the VDEPT and GDEPT methods to have some way of extending cell killing beyond cells that have been initially engineered. This is due to the `` bystander e
ffect) "(Freeman et al. 1993 Cancer Res 53, 5274). Such effects have been observed, for example, with HSV Tk, where many cells have died in addition to cells containing the Tk gene. However, this mechanism is a bit controversial. This is because the active metabolite, the highly charged triphosphate, cannot cross the cell membrane without the help of metabolic cooperation via gap junctions (T. Connors (supra) and Hamel et al. 1996 Cancer Res 56, 2697). Outlined in). In fact, the "bystander effect" of Tk may not be the actual metabolic effect, but rather the result of an accidental and thus unpredictable immunological response. Bystander effects have been observed with cyclophosphamide activation by P450 in tumors. In this case, the highly toxic acreolin (a
(creolin) metabolites mediate this effect but do not cause systemic toxicity due to their relatively short lifespan (Chen and Waxman 1995 Cancer Res 55, 581). On the other hand, neighboring cells can take up intermediate metabolites such as 4-hydroxycyclophosphamide. Bystander effects have also been observed with aziridine, CB1954,
It can be reduced by DT diaphorase or by bacterial nitroreductase with fairly high efficiency to produce powerful alkylating agents (Knox
1988 Biochem Pharmacol 37, 4661; Bridgewater 1997 Hum Gene Therapy 8, 70
9), which was not always observed (Clark et al. 1997 Gene Therapy 4).
, 101-110; Patterson and Stratford, observations not published). Any bystander effect increases in proportion to the concentration of active metabolite produced. Therefore, it is desirable to increase the activity of the prodrug activating enzyme to increase the concentration of the active metabolite.

Thus, despite the appeal of enzyme prodrug therapy, each of the approaches used to date has several disadvantages. To maximize the potential of enzyme prodrug therapy, it is important to use delivery systems and enzyme / drug combinations that exhibit effective target cell-specific cell killing. Preferably, the number of target cells to be destroyed is also increased by creating a large bystander effect with minimal systemic toxicity. The present invention is intended to meet these needs.

According to one aspect of the present invention, a) a localization domain (where the localization domain is not a tumor selection antibody); and b) a prodrug for activating a prodrug in target cells. A prodrug activator is provided, comprising a drug activated domain.

[0011] The localization domain and the prodrug activation domain preferably comprise an amino acid sequence or are in the form of a nucleic acid sequence encoding such a domain.

[0012] In a preferred embodiment, the prodrug activator of the invention is in the form of a fusion protein. Proteins include peptides and polypeptides.

On the other hand, these domains may be co-administered. Co-administration does not necessarily mean simultaneous administration. It is also possible to administer one domain before or after the other domain.

“Target cell” simply refers to a cell in which the activator is naturally or targeted, or in which a portion of the delivery system is capable of transfection or transduction.

In another aspect of the invention, there is provided a prodrug activator comprising at least one expressible nucleic acid sequence encoding a cytochrome P450, wherein one or each nucleic acid sequence comprises 1 It is operably linked to one or more constitutive expression control regulatory elements, or one or more inducible expression control regulatory elements.

[0016] In another embodiment, a modified form comprising a prodrug activator or prodrug activation domain or engineered to express a prodrug activator or prodrug activation domain It is a form of hematopoietic stem cells.

Thus, according to another aspect of the present invention, a modified hematopoietic stem cell (M) comprising at least one expressible nucleotide sequence encoding a prodrug activation domain
A prodrug activator comprising HSC) is provided. Here, the one or each nucleotide sequence is operably linked to one or more constitutive expression control regulatory elements or one or more inducible expression control regulatory elements.

The present invention also provides a nucleic acid vector comprising the nucleic acid sequence of the present invention.

The present invention also provides a viral vector comprising the nucleic acid sequence of the present invention.

The present invention also provides a prodrug activator, nucleic acid vector, viral vector, or transduced cell of the present invention for use in medicine.

The present invention also provides a pharmaceutical composition comprising a prodrug activator, nucleic acid vector, viral vector, or transduced cell of the present invention for use in medicine.

In a further aspect, the invention relates to a method of treating a human or animal patient suffering from a condition such as cancer (especially solid tumors), cerebral malaria, ischemic heart disease or rheumatoid arthritis, or ischemia, hypoxia. Alternatively, there is provided a method for treating a condition characterized by low glucose.

In a further aspect, the present invention provides a method of producing a virus strain comprising introducing a nucleic acid sequence of the present invention into the genome of a virus. Preferably, the method of the invention comprises introducing a nucleic acid sequence into said genome by homologous recombination between said genome and a vector of the invention.

[0024] In a further aspect, the present invention provides a method of producing MHSC, comprising introducing a vector of the present invention into a hematopoietic cell line (HSC).

Various preferred features and embodiments of the present invention are described by way of non-limiting examples in conjunction with the accompanying drawings.

DETAILED DESCRIPTION OF THE DRAWINGS FIG . 1A shows the sequence of P450 reductase (P450R). SEQ ID NO: 1 is an mRNA
SEQ ID NO: 2 shows the amino acid sequence (partial, GenBank accession number: S90469).

FIG. 1B shows the functional domains of P450 reductase.

FIG. 2A shows P450R without anchor. SEQ ID NO: 3 shows the coding DNA sequence. SEQ ID NO: 4 shows the amino acid sequence.

FIG. 2B shows FAD and NADPH binding (FN) fragments. Among them, SEQ ID NO: 5 shows a coding DNA sequence, and SEQ ID NO: 6 shows an amino acid sequence.

FIG. 3A shows the SV40 large T antigen NLS fragment. SEQ ID NO: 10 shows the coding DNA sequence (complementary strands 4442-4422), and SEQ ID NO: 11 shows the amino acid sequence.

FIG. 3B shows basic fibroblast growth factor (bFGF). SEQ ID NO: 19 is 18
The coding DNA sequence for the kD isoform is shown, and SEQ ID NO: 20 shows the amino acid sequence.

FIG. 3C shows the Antennapedia homeobox peptide (pAntp). SEQ ID NO: 53 shows the coding sequence of the homeobox domain, SEQ ID NO: 54 shows the amino acid sequence.

FIG. 3D shows the herpes simplex virus type 1 (HSV-1) segment protein VP-22. SEQ ID NO: 55 is a coding DNA sequence (complementary sequence 1063 of GenBank sequence X14112).
91-105486), and SEQ ID NO: 56 shows the amino acid sequence.

FIG. 3E shows exotoxin A (PEA) of Pseudomonas aeruginosa.
SEQ ID NO: 33 shows the coding DNA sequence for domain II, and SEQ ID NO: 34 shows the amino acid sequence.

FIG. 3F shows a single-chain Fv fragment (ScFv) for ST4 with a translation initiation signal and a secretory signal peptide. SEQ ID NO: 25 shows the DNA sequence for the translation initiation signal and signal peptide of ST4-ScFv (WO98 / 55607), and SEQ ID NO: 27 shows the amino acid sequence.

FIG. 4 shows human cytochrome P450 2B6. SEQ ID NO: 45 shows an mRNA sequence, and SEQ ID NO: 46 shows an amino acid sequence.

FIG. 5 shows an IRES (internal ribosome entry sequence). SEQ ID NO: 52 shows the IRES sequence derived from the FMDV (R100) + SacI (start) and XhoI (end) linkers.

FIG. 6A shows PKAHRE, an MLV-based single transcription unit vector. Expression of the therapeutic gene is controlled by a hypoxia-responsive promoter (3xPGK). The gene encoding the prodrug activating enzyme is replaced with the described nlsLAcZ gene.

FIG. 6B shows an ML using the CMV enhancer instead of the MLV enhancer (shaded frame).
The V-type vector COI is shown. The gene encoding the prodrug activating enzyme is inserted into either the Bam / Sal / Hpa polylinker or the Stu / Xho polylinker. In addition, a different gene can be inserted into each polylinker.

FIG. 8 shows a retroviral vector for conferring multidrug susceptibility. V
P22-FN confers enhanced sensitivity to tirapazamine. P450-FN confers enhanced sensitivity to cyclophosphamide. P450-FN + VP22-FN is
Confers enhanced sensitivity to mitomycin C, tirapazamine, and cyclophosphamide.

Prodrug Activation Domain The prodrug activation domain is typically a prodrug activating enzyme or an active fragment of a prodrug activating enzyme, but is any domain that activates a prodrug. Good. Although the number of prodrug activating enzymes known in the art continues to grow, it is believed that any of these may be available. Suitable prodrug activating enzymes may be natural or genetically engineered, and specifically, cytochrome P450, cytochrome P450 reductase, thymidine kinase, nitroreductase, cytosine deaminase, DT-diaphorase, NAD
PH: Cytochrome c P450 reductase, and carboxy - peptidases G ₂ and the like.

The prodrug activating enzyme can be delivered to a tumor site for the treatment of cancer. In each case, when treating the patient, a suitable prodrug is used in combination with the appropriate prodrug activating enzyme. Appropriate prodrugs are administered together with the vector. Prodrugs include, for example, etoposide phosphate (in combination with alkaline phosphatase, Senter et al. 1988 Proc N
atl Acad Sci 85: 4842-4846); 5-fluorocytosine (in combination with cytosine deaminase; Mullen et al. 1994 Cancer Res 54: 1503-1506); doxorubicin-Np-hydroxyphenoxyacetamide (in combination with penicillin-V-amidase) Kerr et al. 1990 Cancer Immunol Immunother 31: 202-206); para-N-bis (2-chloroethyl) aminobenzoylglutamate (in combination with carboxypeptidase G2); cephalosporin nitrogen mustard carbamate (in combination with β-lactamase) ); SR4233 (in combination with P410 reductase); ganciclovir (in combination with HSV thymidine kinase, Borrelli et al. 1988 Proc Natl Acad Sci 85: 7572-7576);
Combination of mustard prodrug and nitroreductase (Friedlos et al. 1997 J Me
d Chem 40: 1270-1275); and cyclophosphamide (in combination with P450, Chen et al. 1
996 Cancer Res 56: 1331-1340).

Suitable prodrug activating enzymes for use in the present invention include, for example, 5-
Thymidine phosphorylase, which activates the fluoro-uracil prodrugs capcetabine and fluturon; thymidine kinase from herpes simplex virus, which activates ganciclovir; Cytochrome P450 to alter; cytosine deaminase to activate 5-fluorocytosine. Preferably, a human-derived enzyme is used.

As mentioned above, preferably this is in the form of a prodrug activating enzyme. The prodrug activating enzyme used to treat the patient will be administered in combination with a suitable prodrug.

[0045] Preferably, the enzyme is cytochrome P450 or cytochrome P450 reductase.

[0046] Cytochrome P450 is a superfamily of membrane-bound hemethiolate proteins (Nelson et al. 1996 Pharmacogenetics 6: 1-42) and is present in both prokaryotes and eukaryotes. These enzymes are named cytochromes because they form a complex with carbon monoxide under reducing conditions to produce an absorption maximum at about 450 nm. In cells, these enzymes are detected in either the endoplasmic reticulum (microsomes) or mitochondria. These are important monooxygenases involved in the metabolism of steroid hormones, inactivation of drugs, detoxification of toxins / xenobiotics, and also in the oxidation of food additives, environmental pollutants, carcinogens and other natural or synthetic drugs. is there.
Some cytochrome P450s also have isomerase, reductase, dehydrase, nitric oxide synthase, or esterase activity (
Rendic & Di Carlo 1997 Drug Metab Rev 29: 413-580).

[0047] Cytochrome P450 is a terminal oxidase of the electron transfer system, and its enzymatic action is
Requires two-electron donation from reduced pyridine nucleotides such as NADPH. This electron transfer process, and P450, are necessary interaction with NADPH-dependent cytochrome P450 oxidoreductase and cytochrome b ₅ is the redox partner (flavoprotein). Reduced cytochrome P450 binds oxygen and its substrate. In doing so, the enzyme catalyzes the introduction of one oxygen atom into the substrate and the other oxygen atom into water. One typical enzymatic reaction is the introduction of a hydroxyl group to a substrate by P450, for example, 4-hydroxylation of cyclophosphamide by cytochrome P450 2B6. In addition, the expression and enzymatic activity of cytochrome P450 proteins can be induced or inhibited by certain xenobiotics, organic substrates, or drugs. A specific example is induction of the CYP2B isoform by barbiturate.

The definition of this enzyme includes: monooxygenase hemethiolate, which is naturally associated with the membrane, which requires an electron transfer system for enzyme activity, which requires molecular oxygen, as used herein. The term cytochrome P450 as used includes mammalian cytochrome P450 genes, e.g., P450 2B1, P450 2B6, P450 2A6, P450 2C6, P450 2C8.
, P450 2C9, P450 2C11, and P450 3A4. Each of these genes has been linked to the activation of the anticancer drug cyclophosphamide or ifosfamide.

Generation of P450 Mutants for Improved P450-based Enzyme Prodrug Therapy The enzymatic activity of cytochrome P450 can be improved by random site-directed mutagenesis or directed evolution. To perform site-directed mutagenesis,
The impact of amino acid substitutions on cytochrome P450 structure and function must be well understood. In contrast, this prior knowledge of P450 is less important for directed evolution. Furthermore, the frequency of beneficial mutations is generally low compared to deleterious mutations. It may be necessary to repeat the recombination and selection cycle many times in order to combine the beneficial mutations to obtain an improved gene. In this case, multiple beneficial mutations may occur per round instead of one, and directed evolution (especially DNA shuffling) is more likely to be random mutagenesis. Better than. Nevertheless, regardless of which approach is taken, obtaining excellent mutants from a library of millions of different mutants requires a powerful and efficient method of selection or screening.

Directed evolution involves random oligonucleotide mutagenesis (Horwitz & Loeb 19
86 PNAS 83: 7405-9), chemical mutagenesis (Sweasy & Loeb 1993 PNAS 90: 4626-3)
0), error-prone PCR (Cadwell & Joyce 1994 PCR Methods Appl. 3: S136-40), or DNA shuffling (Stemmer 1994a Nature 370: 389-91; Zhao & Arnold 199).
7 PNAS 94: 7997-8000). All of these methods result in libraries of DNA inserts that can be ligated into expression vectors for selection or screening in a bacterial or mammalian cell environment. However, methods other than DNA shuffling are limited by the size of the operable DNA insert. One typical study found that a 1 kb fragment was too large to cause erroneous PCR, but that DNA shuffling could reconstruct DNA fragments up to 2.7 kb in size ( Stemmer 1994b PNAS
91: 10747-51).

Since most P450 coding sequences are larger than 1 kb, DNA shuffling is an appropriate method for gene modification of P450. Stemmer Method (Stemmer 1
994a Nature 370: 389-91; Stemmer 1994b PNAS 91: 10747-51)
The 50 coding sequence is randomly fragmented by DNase I. Pool and purify the 10-50 bp fragment. Overlap extension of these fragments is performed by repeated thermal cycles without primers in the presence of DNA polymerase. Subsequently, PCR is performed in the presence of the specific 5'- and 3'-primers to obtain the full-length gene. Also in this process, point mutations are introduced by the polymerase. Alternatively, Arnold's attachment extension method (StEP, Zhao et al. 1998 Nat Biotechnol 16: 258
-61) can also be used. The relevant P450 coding sequence is denatured and extension initiated by the given 5'- and 3'-primers. The primer is then catalyzed by DNA polymerase and undergoes very short extension. These extended primers are separated from the template by heat, and then again randomly annealed to the template. In each denaturation and annealing / extension cycle, some of the extension fragments will randomly anneal to different templates (template exchange), resulting in the production of recombinants. This recombination cycle is repeated until a full-length gene is generated.

As a smaller example, shuffling the coding DNA sequence of a related human P450 isoform known to be capable of metabolizing oxaazaphosphorins (eg, cyclophosphamide) provides a means for this prodrug. It is possible to obtain more desirable enzymes. Examples of this include CYP2A6 (Yamano et al. 1990 Biochemistr
y 29: 1322-9 & Genbank accession number M33316), CYP2B6 (Yamano et al. 1989 Biochemistry
28: 7340-8 & Genbank accession number M29874), CYP2C8 (Okino et al. 1987 J Biol Chem. 26
2: 16072-9 & Genbank accession number M17397), CYP2C9 (Romkes et al. 1991 Biochemistry 3).
0: 3247-3255; Errata 1993 Biochemistry 32: 1390 & Genbank accession number M61855 or M61857), CYP2C18 (Goldstein et al. 1991 Biochemistry 30, 3247-3255 & Ge
nbank accession number M61856), CYP2C19 (Romkes et al. 1991 Biochemistry 30: 3247-3255; errata 1993 Biochemistry 32: 1390 & Genbank accession number M61854), CYP3A4 (Gonzal
ez et al. 1988 DNA 7: 79-86 & Genbank accession number M18907; Beaune et al. 1986 Proc. Natl
Acad. Sci. USA 83: 8064-8068 & Genbank accession number M14096; Spurr 1989 Hu.
m. Genet. 81: 171-4 & Genbank accession number X12387; Bork et al. 1989 J. Biol. Chem. 2
64: 910-919 & Genbank accession number J04449).

As a larger approach, improved enzymes for cyclophosphamide or other related prodrugs can be obtained by shuffling two or more subfamilies of mammalian P450s. An example of this is rat CYP2A1 (Mat
sunaga 1990 Biochemistry 29: 1329-41 & Genbank accession number M33312), mouse CYP
2A4 (Squires and Negishi 1988 J. Biol. Chem. 263: 4166-71 & Genbank accession number M19319), human CYP2A6, rabbit CYP2A10 (Peng et al. 1993 J. Biol. Chem. 268:
17253-60 & Genbank accession number L10236), rat CYP2B1 (Fujii-Kuriyama et al. 1982 P
roc. Natl. Acad. Sci. USA 79: 2793-7 & Genbank accession number J00719), rabbit C
YP2B4 (Gasser et al. 1988 Mol. Pharmacol. 33: 22-30 & Genbank accession number M20856),
Human CYP2B6, mouse CYP2B9 (Noshiro 1988 Biochemistry 27: 6434-6443 & Genba
nk accession number M21855), dog CYP2B11 (Graves et al. 1990 Arch.Biochem.Biophys. 281
: 106-115 & Genbank accession number M92447), rabbit CYP2C1 (Leighton et al. 1984 Biochem
istry 23: 204-210 & Genbank accession number K01521), human CYP2C8, human CYP2C9, rat CYP2C11 (Yoshioka et al. 1987 J. Biol. Chem. 262: 1706-11 & Genbank accession number U3
3173 or J02657), human CYP2C18, human CYP2C19, monkey CYP2C20 (Komori et al. 19
Acta 1171: 141-6 & Genbank accession number S53046), hamster CYP2C25 (Sakuma et al. 1994 Mol. Pharmacol. 45: 228-36 & Genbank accession number X63022)
), Mouse CYP2C29 (Matsunaga et al. 1994 Biochim. Biophys. Acta 1184: 299-301 &
Genbank accession number D17674), goat CYP2C31 (Zeilmaker et al. 1994 Biochem. Biophys.
Res. Commun. 200: 120-5 & Genbank accession number X76502), pig CYP2C42 (Nissen et al.
1998 Anim.Genet. 29: 7-11 & Genbank accession number Z93098), rat CYP3A1 (Gonzale
1985 J. Biol. Chem. 260: 7435-7441 & Genbank accession number M10161), human CYP3
A3 (Molowa et al. 1986 Proc. Natl.Acad.Sci. USA 83: 5311-5 & Genbank Accession No. No.D00408), monkey CYP3A8 (Komori et al. 1992 Bio
chim. Biophys. Acta 1171: 141-6 & Genbank accession number S53047), and dog CYP3
A12 (Ciaccio et al. 1991 Biochim. Biophys. Acta 1088: 319-322 & Genbank accession number X54915). However, the ability of some of the above isoforms to metabolize oxaazaphosphorins remains unknown.

Localization Domain Intracellular Localization Domain In the first embodiment, the localization domain is an intracellular localization domain.

The intracellular localization domain serves to link the prodrug activation domain to a site in the cell, thereby increasing the efficacy of the prodrug activation domain. As a result, the required dose of prodrug is reduced and the therapeutic index is increased.

In this preferred embodiment, the target site in the target cell is the site in the cell where the activated prodrug acts. Thus, the fusion protein delivers the prodrug activation domain to a compatible location in the target cell. This improves the potency of the activated prodrug.

An intracellular localization domain is typically a peptide or polypeptide that can bind preferentially or specifically to a site in a cell, such as an organelle. For example, an intracellular localization domain can have a specific binding partner in an intracellular membrane, such as a nuclear or mitochondrial membrane. Alternatively, or in addition, the intracellular localization domain may be one that is specifically taken up by an organelle (eg, nucleus or mitochondria) in the target cell. In this case, the intracellular localization domain is preferably a nuclear localization domain. Suitable nuclear localization domains for use in the present invention include nuclear localization signals derived from SV40 large T antigen, nucleoplasmin, c-myc.

The potency of an active prodrug will be proportional to the concentration of the active metabolite at the site of action in the cell. Many active compounds cause toxic effects by acting directly on the DNA of tumor cells. Free radicals are activated tirapazamine (TPZ
) Causes DNA strand breaks as in (Cahill and White, supra), but alkylating agents such as CP, mitomycin C, and CB1954 crosslink DNA and cause breakage during replication (Bligh 1990, Cancer Res. 50, 7789; Knox et al. 19
88, Biochem. Pharmacol. 37, 4661). Due to the short half-life of some of these compounds, it was speculated that some of the activating enzymes might be found in the nucleus (J
.M. Brown supra). Indeed, both cytochrome P450 and P450 reductase activity can be detected in nuclear fractions (Cahill and White, supra; Friedman et al. 1).
989 Biochem. Pharmacol. 38, 3075). We have shown that transduction of full-length P450 reductase cDNA into target cells localizes the P450 reductase protein to the endoplasmic reticulum (ER) in the cytoplasm [AV Patterson 1997, supra, FIG. 1]. This protein has an ER membrane anchor sequence and is usually found at this site (GCM Smith et al.
1994 Proc. Natl. Acad. Sci 91, 8710). The active portion of this enzyme will protrude into the cytosol, so that activated metabolites will be generated in the ER. Also, in this case, these activated metabolites should naturally and passively diffuse into the nucleus.
Deletion of the ER anchor sequence does not inhibit protein folding, nor does it impair the ability to bind to cofactors and the ability to donate electrons (Smith et al., Supra). Although P450 reductase is naturally a membrane-associated component of the ER, we thought that it could be retargeted to the nucleus and chromatin to increase the local activation of prodrug toxicity at the target site. Thus, in a preferred embodiment, the intracellular localization domain is a nuclear-associated domain. The first step to enhance the delivery of metabolites to DNA is to target P450 reductase to the nucleus. A wide variety of peptide signals have been identified that mediate the transport of proteins into the nucleus (reviewed in EA Nigg 1997, Nature 386, 779). For example, nuclear localization signals have been identified in, but not limited to, the following proteins:

SV40 large T antigen: PKKKRKV nucleoplasmin: KRPAATKKAGQAKKKK c-myc: PAAKRVKLD [Signal is represented by conventional single letter amino acid code. ER anchor sequence for P450 reductase (defined as residues 1-60: TD
Removal of Porter et al. 1990, Biochem 29, 9814) yields P450 reductase without the anchor (alP450 reductase). When the anchor is replaced with a nuclear localization signal (NLS), P450 reductase is no longer localized to the ER and is found primarily in the nucleus. Furthermore, increasing the local concentration of P450 reductase in the nucleus increases the sensitivity to cell killing by tirapazamine (TPZ). This derivative is called NLS-alP450 reductase.

The P450 reductase gene was shown to be organized in a functional domain corresponding to the exon structure of the gene. In particular, domains that bind to FMN, FAD, and NADPH have been identified (TD Porter et al. 1990 Biochem. 29, 9814). Because these domains are structurally and functionally separated, they can be expressed as protein fragments and still associate with their individual cofactors. For example, peptides ranging from residues 242 to 677 bind to FAD and NADPH, and furthermore, this domain (FN fragment) has been shown to be able to transfer electrons to a series of one-electron receptors (Smith et al.). Supra). To increase the efficiency of targeting to the nucleus, an FN fragment containing only the active region involved in electron transfer to the foreign electron acceptor is used. This nuclear targeting signal is fused to residues 242 to 677 of P450 reductase. The smaller proteins thus obtained have easier access to the nucleus. Another advantage is that there is no loss of electrons due to transfer to FMN or P450, so transfer to foreign electron acceptors is possible. As a further advantage,
The smaller size allows room for the transfer of other genes into certain GDVs (eg, retroviral vectors) that have limited capacity. This derivative is NLS-
It is called FN.

P450 reductase is a charged molecule and contains a lysine and arginine rich region
(EA Shephard et al. 1992, Arch. Biochem. BioPhys., 294, 168). This positive charge is advantageous in retaining it in the nucleus, and also allows for the placement of proteins in DNA. However, in order to optimize the retention in the nucleus and the localization to chromatin, further fusions are also conceivable. Examples of such fusions include fusion with a transcription factor, a fast-moving group protein, a nuclear membrane protein, or any protein with the desired nuclear localization ability.

Transcellular Localization Domain In the second embodiment, the localization domain is a transcellular localization domain.

In this aspect, the localization domain delivers the prodrug activation domain to neighboring cells and increases the number of cells that can be treated. The spread of prodrug action outside the activated cells is called the "bystander" effect. Such treatment has already been done by spreading active metabolites to neighboring cells. This approach has two major disadvantages. That is, because the metabolites are delivered to the whole body at the same time, there is a risk that the whole body will be exposed to the poison, and that the metabolites will be diluted during the transport between cells. The present invention relates to prodrugs with low membrane permeability of active metabolites, for example,
It is particularly useful when using nucleotide analogs produced by thymidine kinase or cytosine deaminase, nitrogen mustard produced by cytochrome P450 metabolism, and tirapazamine radical produced by P450 reductase.
Such prodrugs are useful because they allow the activating enzyme, but not the metabolite, to cross the membrane. Useful transcellular activation domains include the third helix domain of Drosophila antennapedia homeobox peptide, herpes simplex virus VP22 protein, basic fibroblast growth factor (bFGF / FGF2), secreted single chain antibody (s.scFv ), And Pseudomonas aeruginosa exotoxin (PE
Toxin-derived transmembrane transport signals such as A). In addition, membrane translocating sequences such as Kaposi fibroblast growth factor and transcription factor kB.
quence) is also useful.

The active metabolite of tirapazamine (TPZ) is unstable enough to limit bystander effects. For this reason, the efficacy of this enzyme is impaired by the VDEPT method or GDEPT method, in which many cells may not be able to accommodate the gene. To increase the bystander effect of drugs such as tirapazamine (TPZ), we have developed a novel method for distributing enzymes across target tissues, instead of doing the metabolite distribution as previously done. A method was devised. To this end, a transcellular targeting signal (TTS) is used instead of the ER membrane anchor, which allows export from cells and import into neighboring cells. In one embodiment, the TSS
Also confers target cell specificity.

The export / import or transcellular targeting signal (TSS) can be obtained from a wide variety of biological systems, but need not necessarily be mechanically linked to the mechanism that mediates export / import.

Suitable TTSs include, for example, the following:

Basic fibroblast growth factor (bFGF or FGF2): This factor is secreted in many cells, despite the lack of the classic secretory signal sequence. The bFGF receptor is up-regulated in many tumor types and interacts with bFGF to rapidly internalize the ligand and any macromolecules linked to it [Baldi
n et al 1990 EMBO J. 9, 1511; Sosnowski et al 1996, J. Biol. Chem. 271,
33647, and references cited therein]. bFGF is P450 reductase or FAD
Fusion to the / NADPH fragment forms a protein that is exported and taken up by any cell that displays the FGF receptor. This complex is transported into the nucleus. Other signals such as classical secretion signals and NLS can be added to ensure efficient export from any producer cell and efficient nuclear import in any target cell. These derivatives include bFGF-P450R and bFGF-F
N.

• pAntp: This is a 60 amino acid polypeptide corresponding to the homeobox domain contained in the third exon of the Drosophila antennapedia protein. It has the property of penetrating cells and translocating to the nucleus (Joliot et al 1991 Pro).
c. Nat. Acad. Sci., 88, 1864). Because smaller peptides from pAntp also have import activity, the fusion protein may be internalized (Der
ossi et al 1994, J. Biol. Chem. 269, 1044). Since it is unclear how successful this peptide is exported from the cell, a classical secretion signal is introduced into the fusion. An anchor-free P450 reductase is fused to a secretory signal sequence to mediate export of the Drosophila antennapedia protein from the homeobox domain and mediate import into the nucleus of adjacent cells. These derivatives are Ant-P450 and Ant-FN.

• VP22 protein from herpes simplex virus: This is a 301 aa virion structural protein. This protein is naturally exported from infected cells, imported into neighboring cells, and further translocated into the nucleus and incorporated into chromatin. VP22
Is similarly exported / imported and placed in a predetermined position. [Elliott and O'Hare 1997; WO97 / 05265] When P450 reductase without anchor is fused to VP22, the fusion protein is distributed to the nucleus of adjacent cells. These derivatives are VP-P450 reductase and VP-FN. Preferably, the VP22 domain and the P450 reductase domain are separated by a flexible linker (Somia et al, infra).

Truncated Pseudomonas aeruginosa (Pseudomo) encoding translocation domain (II)
nas aeruginosa) Exotoxin A (PEA) (I. Pastan and D. Fitzgerald 1991 Science)
254, 1173; J. Hwang et al 1987, Cell, 48, 129): A translocation domain is a targeting ligand such as a single-chain antibody, preferably a ligand that recognizes a tumor cell-specific antigen (eg, SI Chen et al 1997 Nature,
385, 78 and references cited therein) and NLS-alP450 reductase. When secreted, the fusion protein coalesces on the tumor cell surface, undergoes translocation, and is imported into the cell. These derivatives are PEA-5T4-P450 reductase and 5T4-PEA-FN. Specifically, the targeting ligand is
A single chain antibody directed against the oncofetal antigen 5T4, but with any scFv, eg, HER-2
It is possible to use scFv or the like (JK Batra et al 1992, Proc Nat
l Acad Sci 89, 5867). The present invention is not necessarily limited to the use of single-chain antibodies, and it may be preferable to use double-chain antibody Fab domains.

• Synthetic or natural membrane translocation sequence (MTS): Another suitable transcellular targeting domain is the hydrophobic region of the signal peptide, generally a membrane translocation sequence (MTS).
)is called. These are found in many naturally occurring genes (eg, transcription factor kB, kaposi fibroblast growth factor), but may also be synthetic peptides selected to have MTS function. These MTSs can be used as carriers to deliver short peptides into living cells (e.g., Lin et.
al 1995, Inhibition of nuclear translocation of transcription factor NG-kB by synthetic peptides containing a cell-penetrating motif and a nuclear localization sequence, J. Biol. Chem 270, 1425
Five). Such peptides can be located at the N-terminus or C-terminus of the peptide and have been shown to have the ability to translocate full-length proteins (e.g., Rojas et al 1998, fusion proteins with cell membrane permeability). Engineering production of Nature, Biotechnology, 16, 370). For example, Kaposi fibroblast growth factor MTS has been fused to a bacterial enzyme encoding glutathione-S-transferase. Expression of the MTS-enzyme protein in E. coli showed that the purified protein was readily incorporated into mouse cells.

Next, the use of MTS in gene therapy applications will be described. MTS is fused to all or an active part of a prodrug activating enzyme such as P450 reductase or nitroreductase, and is preferably converted to a derivative of an enzyme that can be secreted from a producer cell, for example, a 5T4scFv fusion protein. The resulting fusion protein is taken up by surrounding cells, resulting in an increase in the number of cells that can activate the prodrug. The secretion signal need not necessarily be associated with a targeting ligand, such as a scFv, and any suitable secretion signal sequence can be used. The addition of a secretion signal can release the fusion protein from the producing cell if the cell cannot release the protein naturally or if the cell cannot release the protein as a result of cell death.

[0073] In Biochemistry related domains third embodiment, the localization domain is the biochemical related domains. Biochemistry-related domain refers to a second prodrug activation domain when the product of one prodrug activation domain is delivered to another prodrug activation domain. In one preferred embodiment, this additional domain can be another enzyme when the product of the first enzyme is delivered directly to the second enzyme.
This achieves biochemical coordination with and without nuclear and cell penetration targeting. One example of a biochemical association is where cytochrome P450 and NADPH cytochrome reductase are involved in prodrug metabolism. P450 reductase donates electrons to cytochrome P450, and biochemical reactions are enhanced by proximity. The fusion can be increased by fusing the two proteins, thereby enhancing the effect of electron transfer to the adjacent protein domain. This is useful, for example, for the activation of cyclophosphamide. This can be enhanced by the supply of excess cytochrome P450 (eg, Chen et al., 19
96, Cancer res. 56,1331; Patent Publication No. WO 96/04789), it is known that P450 reductase is suboptimal for cytochrome P450 activity even when these enzymes are in equimolar ratio. Is limited to the percentage that is
n et al., 1993 Gene, 125, 49). Enhancement of cytochrome P450 activity by biochemical cooperation with P450 reductase has been described for bacterial systems (A. Parikh et al., 1997, Natur).
e Biotechnology, 15,784), but there is no proposal for gene therapy.

Certain prodrugs are metabolized to another product depending on the prodrug activation domain involved in the transformation, or a combination of prodrug activation domains allows metabolism of one prodrug Sometimes. For example, P450 and P4
There is some evidence that both 50 reductases contribute to the hypoxic toxicity of Tirapazamine (Walton et al., 1992 supra, JMBrown ip.cit.). Similarly, the ability of P450 to hydroxylate cyclophosphamide depends on the transfer of electrons from P450 reductase, suggesting that increased activity of both enzymes may enhance prodrug metabolism. We show that the combination of prodrug activation domains can maximize the toxic potential of one or more prodrugs. The arrangement of this combination will be specified by the particular prodrug combination. By way of example, a number of arrangements are outlined below.

[0075] The P450 coding region may be a P450 reductase coding region or as outlined above.
Fused to one of the derivatives of P450R. Although fusions between cytochrome P450 and P450 reductase have been described previously, none of the specific coding sequences described herein have been described, nor have they been described in the context of gene therapy applications ( Blake et al., 1996 FEBS Lett 397: 210; cytochrome P450 3A4 fused to P450 reductase, MSShet et al., 1993 Proc. Natl. Acad. Sci. 90, 11748; rat cytochrome P4501A1, fused to yeast P450 reductase. Sakaka et al., 1994 Cytochrome P
450 8 ^th Int.conference Ed.MCLechner pp429-432; Chun et al., 1996 Arch Bio
chem Biophys 330: 48). Proximalization of the protein in the fusion enhances the transfer of electrons to P450, thereby enhancing the metabolism of prodrugs such as cyclophosphamide.

The biochemistry-related domain may be in the form of a macrophage. In this embodiment, the macrophages will express the enzyme that activates the prodrug.

[0077] As indicated above, it is preferred that P450 is in close proximity to P450 reductase.
Here we have discovered that P450 reductase is present in human macrophages. Here we have found that P450 is not expressed in macrophages, but also found that macrophages can be engineered to express P450. Furthermore, it has been shown that such engineered macrophages can be used to activate prodrugs such as cyclophosphamide. Other examples of prodrugs are provided elsewhere herein.

Preferably, the macrophages are engineered to constitutively or regulatedly express the gene encoding the prodrug activating enzyme. Examples of suitable promoters are the cytomegalovirus CMV promoter and the hypoxia response element (HRE). However, other promoters may be used and those skilled in the art will know.

The prodrug activator that can be expressed by macrophages is P450
It is not limited to. Other prodrug activators such as cytosine deaminase can also be used. Such agents are known to those skilled in the art.

In a particularly preferred embodiment of the present invention, there is provided a macrophage capable of expressing P450. Preferably, P450 is CYP2B6. Preferably, p450 is under the control of a CMV promoter. These prodrug activators can be used in therapy in combination with the prodrug cyclophosphamide.

As described below, macrophages can also be used as one method of delivery.

Chemically Related Domains In a fourth embodiment, the localization domain is a chemical related domain. By chemical-related domain is meant a domain that alters the intracellular chemical environment so as to optimize conditions for the activity of the prodrug activation domain. For example, the bioreductive activation of certain prodrugs depends on a hypoxic environment. There are drugs such as Tirapazamine, whose activation is reversed by molecular oxygen (JMBrown Br. J. Cancer 1993
, 67, 1163). Tirapazamine is activated by NADPH-dependent reductases such as P450 reductase. In the present invention, in order to reduce molecular oxygen from the cells, in order to favor the conditions for the bioreduction of Tirapazamine,
Another protein is further used. One case is the supplementation of cytochrome P450 enzyme to P450R.
It is. Cytochrome P450 is a monooxygenase that enhances the hypoxic environment for P450 reductase that activates Tirapazamine by reducing molecular oxygen. Enhancement of cytochrome P450 activity by P450 reductase has been proposed in microbial systems, but enhancement of P450 reductase activity by cytochrome P450 has not previously been proposed in any field.

The chemical-related domains can also be used in conjunction with intracellular, cell-penetrating or biological-related domains.

We will use P450s to utilize molecular oxygen to further enhance the activation of drugs such as Tirapazamine (TPZ) and MMC by assisting in maintaining a hypoxic environment. Suggest that you can. Co-administration of cyclophosphamide with Tirapazamine to mice has been shown to enhance tumor cell killing (SAHolden et al., 1992, J. Nat. Canc. Inst 84, 187). Without intending to be bound by any theory, this is believed to be one of the in vivo discoveries of the concept of enhancement described above. Here we show that co-administration of cytochrome P450 and P450 reductase results in enhanced sensitivity of cells to Tirapazamine. Yet another advantage of the combination of cytochrome P450 and P450 reductase is its utility in combination drug treatment with cyclophosphamide and Tirapazamine. Other combinations of prodrug activating enzymes and derivatives include the following: For example, the fusion protein 450FN can be co-expressed with a P450 reductase or derivative to enhance CP and Tirapazamine activation. Other
Drug combinations include mitomycin C and Tirapazamine.

Mitochondrial-associated mitochondrial DNA (mt-DNA) is a highly sensitive target for DNA adduct formation. The mt-DNA genome is saturated (94.4%) with barely overlapping, functional, essential coding sequences, and mt-DNA damage is potentially more cytotoxic than nuclear DNA damage. This is because the probability of causing damage in important code areas is much greater. In addition, mt-DNA is highly susceptible to alkylation by chain scissors that produce active metabolites or radicals because it does not have histones to protect the DNA from attack. Mitochondria has been shown to be an important target for drugs such as MMC (Pritsos et al., 1997 Oncol Res 6-7,333).

For a central role for mitochondria in the apoptotic response,
Evidence also points out (Henkart and Grinstein 1996 J Exp Med 183,1
293; Papa and Skulachev 1996; Decaudin et al., 1998 Int J Oncol 12, 141). Changes in mitochondrial function and structure precede the apoptotic state of the nucleus (
Petit et al., 1997 Mol Cell Biochem 174,185). This appears to involve the release of protease-like apoptosis-inducing proteins normally sequestered in the intermembrane space. It is released in response to disruption of the mitochondrial membrane by mitochondrial swelling due to the opening of so-called permeable transition pores in its inner membrane.
Definitively, increasing levels of reactive oxygen species (ROS) are known to induce mitochondrial porosity (Skulachev 1996 FEBS Lett 397,7; Susin et al., 199).
7).

By targeting the prodrug activating enzyme to mitochondria, it is intended to increase the toxicity of the prodrug to cells and stimulate the apoptotic response pathway.

The first step to enhance the delivery of prodrug metabolites to mitochondrial DNA is to import the prodrug activating enzyme into mitochondria. The import pathway to mitochondria is well documented. Mitochondrial proteins are synthesized as preprotein precursors containing an amino-terminal presequence. Few proteins without these amino-terminal extensions are localized in mitochondria. These presequences are necessary and in some cases this is sufficient for import (Verner and Schatz 1988 Sci.
ence 241,1307; Fenton 1995 Amer J Human Genetics 57,235). Pre-array is one
Although the homology of the following sequence is deleted, both the basic and hydroxylated amino acids are enriched, and both the acidic amino acids and the long chain hydrophobic portion are deleted, so that the amphipathic α helix and Beta sheet conformation can be formed.
In the present invention, the DNA sequence encoding the mitochondrial import signal is
Fused to coding sequence for prodrug activating enzyme. Suitable import sequences are described in Verner and Schatz 1988 and Fenton 1995. The fusion protein is expressed in target cells and the fusion protein is imported into mitochondria.

As background information on hematopoietic stem cells (HSCs) , monocytes and derivatives differentiated from them, macrophages, are derived from a repository of embryonic cells called HSCs, which can give rise to a variety of distinct cell types. You. HSCs are found in fetal liver, spleen and bone marrow in mammals, but are normally only found in bone marrow after birth and throughout adult life. HSC is cell-
Differentiates into various cell lines under the influence of microenvironmental factors such as cell interactions and the presence of soluble cellular cytokines.

[0090] Four major cell lines arise from HSCs. These include erythroid (erythroid), megakaryocytic (platelets), myeloid (granulocytes and mononuclear phagocytes) and lymphoid (
Lymphocytes). In particular, myeloid and lymphoid cell lines are important for the functioning of the immune system.

Bone marrow hematopoiesis is initiated in the liver of a human fetus at approximately 6 weeks of gestation. From studies of which colonies grew in vitro from individual stem cells, the first progenitor cells derived from HSCs were colony forming units (CFU), which could become granulocytes, erythrocytes, monocytes and megakaryocytes, (CFU-GEMM).

The maturation of these cells occurs under the influence of a network of variously named tissue-specific protein regulators, including growth factors, cytokines and interleukins. In general, there are no functional or structural features that distinguish different classes of growth factors. Most factors appear to be able to stimulate a number of biological responses that are critically dependent on the state of differentiation of their target cells. For example, one of the hematopoietic growth factors, granulocyte colony stimulating factor (G-CSF), stimulates the proliferation of immature bone marrow cells and activates bacterial killing by mature neutrophils. Erythropoietin (EPO) and thrombopoietin (TPO) are structurally similar cytokines,
Supports the growth and differentiation of the erythroid and megakaryocyte lines, respectively, and more primitive precursors, respectively (Gotoh et al., 1997 Ann Hematol 75: 207-213). TPO initiates its biological effects by binding to the Mpl receptor, a member of the hematopoietic receptor family (Broudy et al., 1997 Blood 89: 1896-1904). HOXB4 has been shown to be a key regulator of hematopoietic cell proliferation very early but not late (Sauvagea
u et al., 1995 Genes Dev 9: 1753-1765). Soluble Kit ligand protein (Kl) acts as a ligand for the transmembrane tyrosine kinase receptor C-kit, stimulating mast cells and erythroid precursors (91EP-810609). IL- as an interleukin
1, Includes Il-2, IL-3, IL-4, IL-5, Il-6 and IL-12, which activate HSC
(“Molecular biology and Biotechnology Ed RA Meyers 1995
VCH Publishers Inc p392-397).

[0093] These mediators are important in the positive regulation of hematopoiesis and are mainly derived from stromal cells in the bone marrow, but are also produced from the mature forms of differentiated myeloid and lymphoid cells. Although there are many effective growth factor combinations to use, the combination of IL-3 and IL-6 with or without other factors such as stem cell factor (SCF) active on primate cells is best. Achieved results (Bodine et al., 1989 P
roc Natl Acad Sci 86: 8897-8901; luskey et al., 1992 Blood 80: 396-402; Fraser et al., 1990 Blood 76: 1071-1076). Other cytokines (such as TGFβ) appear to down regulate hematopoiesis.

[0094] CFU-GM cells are precursors to both neutrophils and mononuclear phagocytes. As CFU-GM differentiates along the neutrophil pathway, several distinct morphological stages are observed.
Myeloblasts develop into promyelocytes and myelocytes, which mature and are released into the circulation as neutrophils. Unidirectional differentiation of cells from CFU-GM to mature neutrophils is probably the result of acquiring specific growth / differentiation factor receptors at each stage of development.

Surface differentiation markers disappear or appear on the cells as they develop into granulocytes. For example, MHC class II molecules and CD38 are expressed on CFU-GM but not on mature neutrophils. As other surface molecules acquired during the differentiation process
CD13, the low-density CD14, CD15, β ₁ integrins (integrin), VLA-4, CD18β 2 attached to a chain beta ₂ integrin CD11a, b and c, include complement receptors as well as CD16Fcγ receptor.

[0096] CFU-GM, which takes the monocyte pathway, results in the first proliferating monoblast. These differentiate into promonocytes and eventually become mature circulating monocytes. Circulating monocytes are considered a replacement pool for tissue-retaining macrophages. Another form of macrophage involves the reticulum system.

As with mature neutrophils, mature monocytes and macrophages lose CD34. But,
Unlike neutrophils, they continue to express significant levels of MHC class II molecules. These molecules are clearly important for the presentation of antigen to T cells. Monocytes also acquire many of the same surface molecules as mature neutrophils.

[0098] In addition to macrophages, classical antigen presenting cells (APCs), including follicular dendritic cells, Langerhans cells, and finger process cells, are present at birth. Although their origin is still unclear, it is likely that most are derived from bone marrow stem cells. One possibility is that they are from the same CFU-GEMM progenitor cells. Morphological, cytochemical and functional differences will therefore be due to local microenvironmental effects such as cytokines. Alternatively, APCs may be derived from different stem cells and represent distinct lineages.

In the first stage of differentiation into colony forming cells (such as CFU-GEMM), HSCs
And express CD34. Thus, HSCs usually contain cell surface cell glycoprotein CD
It is characterized by the presence of 34 (and possibly CD33).

In the next stage of erythroid, myeloid monocyte and megakaryocytic differentiation, the erythroid live burst forming unit-erythroid (BFUE) cells carry the antigens CD33 and CD34, Antigens disappear during subsequent differentiation. The bone marrow monocytic lineage containing CFU-GM cells carries CD33 but not CD34, and this CD33 subsequently disappears.
The megakaryocyte lineage initially becomes CFUMega cells bearing CD34, which also disappears thereafter.

Another important system of antigens on HSCs and other cells is the MHC (major histocompatibility complex) class II group. The majority of HSCs were found to carry the antigen designated DR, express the antigen designated DP during differentiation, and subsequently express the antigen designated DQ. Thus, MHC class II DR antigens characterize relatively early stem cells.

Methods for the isolation of HSCs and their maintenance and differentiation in culture are described in the literature (Santiago-Schw
artz et al. 1992 J Leuk Biol 52: 274-281; Charbord et al., 1996 Br J Haematol 94:44
9-454; Dao et al., 1997 Blood 89: 446-456; Piacibello et al., 1997 Blood 89: 2644-26.
53) as well as in WO 91/09938. Methods for retrovirus-mediated gene transfer of HSCs and transfer to patients have also been described (Dunbar et al., 1996 Hum Gene Ther 7:
231-253).

Fusion Protein In the present invention, if a fusion protein is required, the domains are fused by constructing a hybrid DNA molecule. A hybrid molecule specifies the amino acid sequence of an additional molecule that is covalently linked to a DNA sequence that specifies all or an active portion of the prodrug activation domain. If co-administration is required rather than a fusion, a suitable gene delivery vector designed to ensure co-administration in one cell, with two genes encoding a prodrug activation domain and an additional protein (GDV). For example, a unique promoter / enhancer
Can be used to express additional proteins from separate expression cassettes in the same vector, or the inclusion of two coding sequences separated by an internal ribosome entry site IRES allows co-administration.
To achieve.

Thus, in another aspect, the invention is a nucleic acid encoding at least one component of an agent described herein, wherein the nucleic acid is capable of expressing at least one component of the agent in a target cell. I will provide a. Preferably, the invention provides a nucleic acid encoding a fusion protein described herein, wherein the nucleic acid is capable of expressing the fusion protein in a target cell.

In another aspect, the invention provides a nucleic acid vector containing a nucleic acid encoding at least one component of the system, wherein the vector is capable of delivering the nucleic acid to a target cell. Preferably, the invention provides a nucleic acid vector containing a nucleic acid encoding a fusion protein, wherein the vector is capable of delivering the nucleic acid to a target cell. Suitable vectors according to the invention include viral vectors, especially retroviral vectors.

[0106] Nucleic Acids The present invention also provides a nucleic acid encoding the fusion protein of the present invention. These can be constructed using a standard set of recombinant DNA methods. Nucleic acid is RNA or DN
Although it may be A, it is preferably DNA. In the case of RNA, the operation can be performed via a cDNA intermediate. Generally, a nucleic acid sequence encoding a first region is prepared,
Suitable restriction sites are provided at the 5 'and / or 3' end. Advantageously, standard laboratory vectors, such as plasmid vectors based on pBR322 or pUC19 (see below)
Manipulate the array inside. For the exact details of the appropriate technique, see Sambrook et al.
Reference may be made to Molecular Cloning (Cold Spring Harbor, 1989) or similar standard reference book.

[0107] The nucleic acid encoding the second region can be similarly located in a similar vector system. Publications or databases such as Genbank can be referenced to confirm the origin of the nucleic acid.

Expression Vectors and Host Cells Nucleic acids encoding the fusion proteins according to the invention or components thereof can be incorporated into vectors and further manipulated. Vectors used herein (
Or plasmid) refers to a discrete element used to introduce heterologous DNA into a cell for its expression or replication. The choice and use of such vehicles is within the skill of the art. Many vectors are available and the selection of the appropriate vector depends on the purpose of the vector, whether it is used for DNA amplification or DNA expression, the size of the DNA to be inserted into the vector, and transformation with the vector. Host cells to be used. Each vector contains various components depending on its function (amplification of DNA or expression of DNA) and its compatible host cells. Vector components include, but are not limited to, one or more of the following in general: origin of replication, one or more marker genes, enhancer elements,
Promoter, transcription termination and signal sequences.

[0109] Expression vectors include any vector capable of expressing a nucleic acid operably linked to a regulatory sequence, such as a promoter region capable of expressing DNA. Thus, an expression vector includes a recombinant DNA or RNA construct, such as a plasmid, phage, recombinant virus or other vector, that when introduced into a suitable host cell, results in expression of the cloned DNA. Suitable expression vectors are known to those of skill in the art, and include those that can replicate in eukaryotic and / or prokaryotic cells, as well as those that remain episomal or those that integrate into the host cell genome. For example, a DNA encoding the fusion protein according to the invention may be placed in a vector suitable for expression of the cDNA in mammalian cells, for example, a vector based on the CMV enhancer, such as pEVRF (Matthias et al., (1989) NAR 17,6418). Can be inserted.

The construction of the vector according to the invention utilizes conventional ligation techniques. Cut, remodel, and isolate the isolated plasmid or DNA fragment to create the required plasmid.
To reconnect to the desired configuration. If desired, analysis to confirm the correct sequence in the constructed plasmid is performed in a known manner. Construction of expression vector, in vitro
Prepare transcripts, introduce DNA into host cells, and evaluate expression and function
Suitable methods for performing an analysis for the same are known to those skilled in the art. The presence, amplification and / or expression of the gene can be determined, for example, by using appropriately labeled probes based on the sequences provided herein, using Southern blots of the prior art, Northern blots for quantifying mRNA transcription, It can be measured directly from the sample by dot blot (DNA or RNA analysis) or in situ hybridization. Those skilled in the art will readily recall how to modify these methods, if desired.

Delivery System In the present invention, the hybrid DNA molecule is transferred to any suitable gene delivery vehicle GDV
Can be delivered to a target cell population. GDV includes, but is not limited to, DNA formulated in a lipid or protein complex, or administered as naked DNA via injection or biolistic delivery, retrovirus, adenovirus, herpes Viruses, such as viruses, vaccinia virus, and adeno-associated virus. GDV can be designed by those skilled in the art of recombinant DNA technology and gene expression to express a fusion protein at the appropriate level and cell specificity required for a particular application. Alternatively, the novel combination of prodrug activating enzymes is delivered by cells such as monocytes, macrophages, lymphocytes or hematopoietic stem cells. In particular, a novel cell-dependent delivery system is used. In this system, genes encoding prodrug activating proteins and protein combinations are introduced ex vivo into macrophages, monocytes or monocyte stem cell precursors, and then into a patient.

As is known in the art, a vector is a means that allows or facilitates the transfer of one substance from one environment to another. In the present invention, by way of illustration, some vectors used in recombinant DNA technology contain segments of DNA (heterologous cD
It allows the introduction of substances such as heterologous DNA segments such as NA segments) into target cells. In some cases, after entering the target cell, the vector
It has a role in maintaining DNA inside cells or may act as a unit of DNA replication. Examples of vectors used in recombinant DNA techniques include plasmids, chromosomes,
Artificial chromosomes or viruses are included.

[0113] Vectors can be delivered by viral or non-viral techniques.

Non-viral delivery systems include, but are not limited to, DNA transfection methods. Here, transfection involves the process of using a non-viral vector to deliver a gene to a target mammalian cell.

Typical transfection methods include electroporation, DNA biolistics, lipid-mediated transfection, compact DNA-mediated transfection, liposomes, immunoliposomes, lipofectin, cationic agent-mediated, cationic facial amphiphiles ( cationic facial amphiphiles) (CFA) (
Nature Biotechnology 1996 14; 556), polyvalent cations such as spermine, cationic lipids or polylysine, 1,2, -bis (oleoyloxy) -3- (trimethylammonio) propane (DOTAP) -cholesterol complex (Wolff and Trubetskoy 1
998 Nature Biotechnology 16: 421) and combinations thereof.

[0116] Virus delivery systems include, but are not limited to, adenovirus vectors, adeno-associated virus (AAV) vectors, herpes virus vectors,
Rovirus vector, lentivirus vector, poxvirus vector, pox-associated virus vector, pox-lentivirus vector or baculovirus vector.

Examples of retroviruses include, but are not limited to: mouse leukemia virus (MLV), human immunodeficiency virus (HIV), equine infectious anemia virus (EIAV), mouse mammary tumor virus (MMTV), Rous sarcoma virus (RSV)
), Fujinami sarcoma virus (FuSV), Moloney mouse leukemia virus (Mo-MLV)
, FBR mouse osteosarcoma virus (FBR MSV), Moloney mouse sarcoma virus (Mo-MSV)
), Eberson mouse leukemia virus (A-MLV), avian myelocytosis virus-29 (
MC29), and avian erythroblastosis virus (AEV).

A detailed list of retroviruses can be found in Coffin et al. (“Retroviruses” 1997 Cold Sprin
g Harbor Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus pp 758-763).

Details of the genomic structure of some retroviruses can be found in the literature. To illustrate, details about HIV and Mo-MLV can be found in the NCBI Genbank (Genome Accession Nos. AF033819 and AF033811, respectively).

[0120] Retroviruses fall into two broad categories: "simple" and "complex." Retroviruses can even be divided into seven groups.
Five of these groups present retroviruses with oncogenic potential. The remaining two groups are lentiviruses and spumaviruses. A review of these retroviruses can be found in Coffin et al., 1997 (ibid).

Lentivirus groups can even be further divided into “primates” and “non-primates”. Examples of primate lentiviruses include human immunodeficiency virus (HIV), the pathogen responsible for human acquired immunodeficiency syndrome (AIDS), and simian immunodeficiency virus (SIV). The non-primate lentivirus group includes the archetyped "slow virus" visna / maedivirus (VMV) and related goat arthritis-encephalitis virus (CAEV), equine infectious anemia virus (EIAV), and more recently Includes feline immunodeficiency virus (FIV) and bovine immunodeficiency virus (BIV).

The difference between the lentivirus family and other types of retroviruses is that the lentivirus is capable of infecting both dividing and non-dividing cells.
In contrast, other retroviruses, such as MLV, are used, for example, in muscle, brain, lung and liver.
Inability to infect non-dividing cells, such as those that form visceral tissue.

Each retroviral genome encodes virion proteins and enzymes, gag
, Pol and env. In the provirus, these genes are flanked on both ends by a region called the long terminal repeat (LTR). LTRs are involved in proviral integration and transcription. LTRs also serve as enhancer-promoter sequences and can regulate viral gene expression. Encapsulation of retroviral RNA occurs by a psi sequence located at the 5 'end of the viral genome.

The LTR itself is an identical sequence that can be divided into three elements called U3, R and U5. U3 is derived from a unique sequence at the 3 'end of RNA. R is both ends of RNA
And U5 is derived from a unique sequence at the 5 'end of the RNA. The size of the three elements can vary considerably between different retroviruses.

The basic molecular organization of the infectious retroviral RNA genome is (5 ′) R-U5-gag, pol, env-
U3-R (3 '). In defective retroviral vectors, gag, pol and env
Is absent or does not work. The R regions at both ends of the RNA are repetitive sequences. U5 and U3 represent unique sequences at the 5 'and 3' ends of the RNA genome, respectively.

The range and tropism for the host varies between different types of retroviruses. In some cases, this specificity may limit the transduction ability of the recombinant retroviral vector. For this reason, many gene therapy methods have used MLV. A specific MLV with an envelope called 4070A is known as an amphotropic virus, which can also infect human cells. This is because the envelope protein "docks" with a phosphate transport protein that is conserved between humans and mice. Because this transporter is ubiquitous, these viruses can infect many cell types.

However, in some cases, particularly from a safety perspective, it is beneficial to target specifically restricted cells. Replacing the env gene with a heterologous env gene is one example of a technique or approach used to specifically target certain cell types. This technique is called pseudotyping, an example of which is WO-A-98 /
05759, WO-A-98 / 05754, WO-A-97 / 17457, WO-A-96 / 09400 and WO-A-91 / 00047.

The term “recombinant retroviral vector” (RRV) refers to the ability to infect a target cell.
A vector with sufficient retroviral genetic information to package an RNA genome in the presence of a packaging component in a virulent viral particle. Infection of a target cell involves reverse transcription and integration into the target cell genome.
The RRV in use typically carries a non-viral coding sequence to be delivered to the target cells by the vector. RRV has no ability to replicate independently in the final target cell to produce infectious retrovirus particles.

In a typical recombinant retrovirus for use in gene therapy, at least a portion of one or more of the gag, pol and env protein coding regions essential for replication can be removed from the virus. This renders the retrovirus replication defective. A virus that has the ability to replace the removed portion with an additional NOI to integrate the genome into the host genome, but cannot propagate the modified virus genome itself due to deletion of structural proteins. It may be produced. When integrated into the host genome, expression of the NOI occurs, resulting in, for example, a therapeutic and / or diagnostic effect. Thus, transfer of the NOI into the site of interest is typically accomplished by incorporating the NOI into a recombinant viral vector, packaging the modified viral vector into a virion coat, and treating the target cell or population of target cells, such as a target cell population. By transducing the site.

The replication defective retroviral vector is typically propagated and, for example, by using a combination of this recombinant vector with a packaging or helper cell line, suitable retroviral vectors for subsequent transduction. Prepare a viral vector. That is, three packaging proteins can be arranged in trans.

A “packaging cell line” contains one or more retroviral gag, pol and env genes. Packaging cell lines produce the proteins required for retroviral DNA packaging, but lack the psi region and cannot complete encapsulation. However, when a recombinant vector carrying the NOI and psi region is introduced into a packaging cell line, a helper protein can package the psi-positive recombinant vector, producing a recombinant virus stock. This viral stock can be used to transform cells and to introduce NOI into the genome of target cells. Preference is given to using a psi packaging signal called psiplus, which contains additional sequences spanning from upstream of the splice donor to downstream of the gag start codon (Bender et al., 1987). . This has been shown to increase the titer of the virus.

Recombinant viruses whose genomes lack all of the genes necessary to make the proteins of the virus are only transduced once and cannot grow. These viral vectors that allow only the first transduction of target cells are known as replication-defective vectors. Thus, the NOI can be introduced into a host / target cell without the production of potentially harmful retroviruses. A summary of available packaging lines is given in Coffin et al., 1997 (ibid).

Retroviruses carrying the gag, pol and env viral coding regions in separate expression plasmids that are independently transfected into packaging cell lines
Preferably, a packaging cell line is used. This method is sometimes referred to as the three-plasmid transfection method (Soneoka et al., 1995).
Since three recombination events are required for the production of ruth, the possibility of producing a replication-competent virus is reduced. Since recombination is greatly facilitated by homology, it is also possible to reduce or eliminate homology between the vector and helper genomes to reduce the problem of producing replication-competent helper viruses.

An alternative to a stably transfected packaging cell line is to use a transiently transfected cell line. Transient transfection can be usefully used to measure the level of vector production during vector development. In this regard, transient transfection avoids the time required to create a stable vector-producing cell line and is also used where the vector or retroviral packaging components are toxic to the cells. Can be done.
The components typically used to make retroviral vectors include gag / po
Included are a plasmid encoding the l protein, a plasmid encoding the env protein, and a plasmid containing the NOI. Vector production involves the transient transfection of one or more of these components into cells containing other necessary components. If the vector encodes a gene that interferes with host cell replication, such as a toxic gene or a cell cycle inhibitor or a gene that induces apoptosis, it may be difficult to create a stable vector-producing cell line. One can use transient transfection to produce the vector before the cells die. Also, cell lines have been developed that use transient transfection to produce titer levels of vector comparable to those obtained from stable vector-producing cell lines (Pear et al., 1993).

In both experimental and practical applications, it is highly desirable to use high titer virus preparations. As a technique to increase virus titer,
Includes the use of i-plus packaging signals and the concentration of virus strains. Alternatively, the titer was improved by using another envelope protein such as the G protein from vesicular stomatitis virus after concentration to 10 ⁹ / ml (Co
sset et al., 1995). Another technique is a split intron system for retroviral vector construction. This will be described later.

In addition to manipulating retroviral vectors in terms of increasing vector titers,
Retroviral vectors have been designed to induce the production of specific NOIs in transformed cells. As already mentioned, the most common design of retroviral vectors involves replacing the retroviral sequence with one or more NOIs to create a replication defective vector. There are three main techniques currently used for regulating NOI expression.

[0137] 1. The simplest techniques are to use the promoter in the retrovirus 5 'LTR to control the expression of the cDNA encoding the NOI, or to enhance the LTR enhancer / promoter to provide tissue-specific expression or inducibility. Is to change. If multiple NOIs have been inserted, additional downstream NOIs can be expressed from polycistronic mRNA by using internal ribosome entry sites.

[0138] 2. The NOI can be operably linked to an internal heterologous promoter.
This configuration makes the choice of promoter more flexible. The additional NOI can be expressed directly from the 5 'LTR, or the LTR can be mutated to repress expression following infection of the target cell.

[0139] 3. The NOI is inserted in the 5 'LTR with the regulatory control element in the reverse orientation. Genomic sequences including enhancers, promoters, introns and 3 'regions may be included. By this method, it would be possible to achieve tightly regulated tissue-specific gene expression.

In addition, we herein configure retroviral vectors, particularly lentiviral vectors, as single transcription unit vectors and place the HRE / promoter constructs of the present invention within the 3 ′ LTR, resulting in It has been shown to be particularly advantageous to make the 3 'LTR duplication also result in duplication of regulatory sequences (i.e. the provirus 5' LTR contains an HRE / promoter construct overlapping from the 3 'LTR). We have now shown that this configuration synergistically enhances the activation response to hypoxia. In conclusion, it is preferable to use a retroviral vector that contains the HRE / promoter of the present invention in the LTR. More specifically, the HRE / promoter construct is inserted (optionally with additional regulatory sequences such as tissue-specific enhancer elements) into the 3'U3 region, or 5'U5 region, most preferably the 3'U3 region of the retroviral vector. can do. Preferably, neither NOI is inserted into the LTR. This is because the two copies produced in the provirus can reduce the size of the NOI that can be accommodated by the retrovirus. Instead, N
The OI is preferably inserted into the region of the retroviral vector normally occupied by the env gene.

The NOI may or may not include a selectable marker. If the vector contains a NOI that is not a selectable marker, the vector can be introduced by co-transfection into packaging cells with a selectable marker present on another plasmid. This strategy has the attractive advantage for gene therapy that a single protein is expressed in the final target cell and the potential for toxicity or antigenicity of the selectable marker is avoided. However, if the inserted gene is not selective, this technique has the disadvantage that it is more difficult to generate cells that produce high titer vector strains. Moreover, it is usually more difficult to determine the titer of the vector.

Conventional methodologies for designing retroviral vectors expressing two or more proteins have relied on three general strategies. These include: (i) m transcribed from one promoter and spliced in different ways
Expression of different types of proteins derived from RNA, (ii) the use of promoters and internal promoters in the 5 'LTR to drive transcription of different cDNAs, and (iii)
Use of an internal ribosome entry site (IRES) to allow translation of a single mRNA, or multiple coding regions of a fusion protein, which may be expressed after an open reading frame.

Vectors containing internal heterologous promoters have been widely used to express multiple genes. An internal promoter is a virus that drives gene expression.
Allows use of promoter / enhancer combinations other than LTR. It has been demonstrated that multiple internal promoters can be included in one retroviral vector, thereby allowing at least three different cDNAs to be expressed from their respective promoters.

Lentivirus Lentivirus groups can be divided into "primate" and "non-primate". Examples of primate lentiviruses include human immunodeficiency virus (HIV), which is the causative agent of human acquired immunodeficiency syndrome (AIDS), and simian immunodeficiency virus (S
IV) is included. Non-primate lentivirus groups include the archetype "slow virus" Visna / Maedivirus (VMV) and related goat arthritis-encephalitis virus (CAEV), equine infectious anemia virus (EIAV) and only recently Includes feline immunodeficiency virus (FIV) and bovine immunodeficiency virus (BIV).

The difference between the lentivirus family and other types of retroviruses is that the lentivirus is capable of infecting both dividing and non-dividing cells.
In contrast, other retroviruses, such as MLV, are incapable of infecting non-dividing cells, such as cells forming muscle, brain, lung, and liver tissue. Therefore,
Lentiviral vectors are advantageous for use in the present invention. This is because, in contrast to certain other retroviruses, which require cell division for stable uptake, lentiviruses are capable of infecting a wide range of non-dividing cells.

A number of vectors have been developed based on various members of the lentivirus subfamily of the retroviridae, and many of these are the subject of patent applications (WO-A-98 / 18815;
WO-A-97 / 12622). Preferred lentiviral vectors are based on HIV, SIV or EIAV. The simplest vectors constructed from HIV-1 have the complete HIV genome, except for a partial deletion of the env coding region or replacement of the nef coding region. Since these vectors clearly express gag / pol and all of the accessory genes, only the envelope is required to produce infectious virions. Among the accessory genes, vif, vpr, vpu and nef are not essential. However, more recently, vectors that have deleted most or all of the cofactors, but still are effective vectors, such as Blom
er et al., 1997 and Kim et al., 1998. Thus, the lentiviral vectors of the invention preferably lack at least one accessory gene, more preferably all of the accessory genes.

One of the preferred general formats of HIV-based lentiviral vectors is the HIV 5 'LTR and leader, some gag coding region sequences (to provide packaging functions), a reporter cassette, a rev response element. (RRE) and 3 'LTR. In these vectors, gag / pol, accessory gene products and envelope function are supplied from a single plasmid or two or more co-transfected plasmids or by co-infection of vector-containing cells with HIV. More recently, the construction of lentiviral vectors has become more sophisticated. For example, self-inactivating HIV vectors have been produced in which the HIV LTR has been deleted to limit expression of the internal cassette (Myoshi et al., 1998).

In one preferred embodiment, the lentiviral vector of the invention is a non-primate lentiviral vector, for example, EIAV. We have recently shown that the amount of vector genomic sequence required from non-primate lentiviruses to produce an effective cloning vector is significantly less than that described for HIV vectors. We have shown that the smallest EIAV vector lacking much of the region of the gag gene is sufficient for effective packaging and indeed results in higher virus titers. For example, a minimal EIAV genomic vector typically contains a promoter 1
And optionally one enhancer capable of inducing the expression of the retroviral vector genome, which in turn contains the following elements from EIAV: one R region and one U5 region 5 'Part of the LTR; sequence from the 5' untranslated region of the gag gene containing one functional packaging signal and part of the gag coding sequence; insert site for the gene of interest, and 3 'from the EIAV LT
R. The 3 'LTR is at least polypurine and R-U5 regions from EIAV, and U3
It may be a hybrid LTR containing sequences from another source to replace all or part of the region. Alternatively, the R region in the 5 ′ and 3 ′ LTRs may be replaced. WO-A-96 / 33623 describes a method for replacing both the U3 and R regions of the retroviral vector genome.

Preferably, a portion of the gag gene comprises less than the first 350 nucleotides of the gag coding region, more preferably the first 150 or the gag coding region.
Those containing only 109 nucleotides, particularly those containing only the first approximately 109 nucleotides, are particularly preferred.

In a particularly preferred embodiment of the first aspect of the invention, the retrovirus
Use the hCMV-MIE promoter enhancer to drive RNA transcript expression. For example, the U3 region enhancer may be replaced with the hypoxia responsive enhancer (HRE) of the present invention and the SV40 or MLV promoter.

The minimal EIAV vector also lacks the S2, Tat, Rev and dUTPase genes, but can still be used for vector production or transduction of dividing and non-dividing cells. This viral genome typically integrates gagpol and env functions
By supplying in trans, it can be packaged in cells. For example, gagpol and env encoding DNA sequences can be co-transfected into a cell with a minimal vector, as described generally above for retroviruses. Preferably, the gagpol sequence is of non-primate lentiviral origin. To maximize gagpol expression, it is particularly advantageous to include a leader sequence between the end of the 5 'LTR and the ATG start codon of gag upstream of the gagpol code sequence. It may also be desirable to include Rev and / or RRE sequences. However, this is not essential and can be eliminated by codon optimization of EIAV gagpol.

Retroviral Split Intron Technology Transcription of proviral DNA regenerates full-length viral RNA genomic molecules and subgenomic-sized RNA molecules produced by RNA processing. Typically, the total RNA product serves as a template for the production of viral proteins. RNA
Product expression is achieved by combining RNA transcript splicing and ribosomal frameshifting during translation.

[0153] Splicing of RNA transcripts is performed in higher eukaryotic cells by a nuclear RNA processing apparatus (spliceosomes) that recognizes consensus sequences with short boundaries between sequences to be spliced. These common splice sites follow the so-called "GT-AG rule" (however, GT is of course GU in the RNA sequence). The 5 'site, or splice donor (SD), has a highly conserved GT dinucleotide at the first exon-intron boundary, and the 3' site, or splice acceptor (SA), is the second exon-intron. It has highly conserved AG dinucleotides at intron boundaries. These consensus sequences direct the splicing process. Splice sites were shown to be general. That is, it is not specific for a particular RNA precursor and can be spliced by any cell. The splice process also relies on the presence of a sequence within the region that is eliminated by the splice, called the branch site. The branch site is usually between 18 and 40 nucleotides upstream of the 3 'SA and will identify the closest SA for connection to the 5' SD as a valid splice site.

Unlike most cellular mRNAs in which all introns are spliced effectively, newly synthesized retroviral RNAs need to be classified into two groups. One group acts as genomic RNA unspliced, while the other group is spliced into subgenomic RNA.

In a simple retrovirus, a group of newly synthesized retroviral RNAs remain unspliced as genomic RNA and m for gag and pol.
Functions as RNA. The other group is spliced, fusing the 5 'portion of the genomic RNA to a downstream gene, most commonly env. Splicing is performed using a splice donor located upstream of gag and a splice acceptor near the 3 'end of pol. The intron between the splice donor and the splice acceptor, which is removed by splicing, contains the gag and pol genes. This splicing produces mRNA for the envelope (Env) protein. Typically, the splice donor is upstream of gag, but in viruses such as ASLV, the splice donor is located at the second and third codons inside the gag gene, and consequently is common to Gag. Two
Generates a primary Env translation product containing the three amino-terminal amino acid residues. The Env protein is synthesized on membrane-bound polyribosomes and transported to the plasma membrane by the cell's vesicle transport pathway, where it is incorporated into viral particles.

Complex retroviruses produce both single and multiple spliced transcripts that encode not only the env gene product, but also a set of unique regulatory and accessory proteins in these viruses. Complex retroviruses, such as lentiviruses, and especially HIV, provide a striking example of the different splicing complexity that can occur during retroviral infection. For example, it is now known that HIV-1 is capable of producing more than 30 different mRNAs by suboptimal splicing from primary genomic transcripts. This selection process appears to be adjustable. This is because mutations that disrupt competing splice receptors can result in altered splice patterns and can affect the infectivity of the virus.

The retroviral vectors of the present invention can take advantage of the ability of higher eukaryotic cells to splice sequences between 5'SD and 3'SA. In a split-intron technique, a retroviral vector is constructed that includes a first nucleotide sequence (NS) capable of generating a functional splice donor (FSDS) and a second NS capable of generating a functional splice acceptor (FSAS). In this case, the first NS is present in the sequence (U3 region) in the 3 ′ LTR of the retroviral vector, downstream of the second NS. The sequences within these 3 'LTRs overlap in the 5' LTR as a result of reverse transcription of the RNA form of the retroviral vector into a DNA form that integrates into the host cell genome. Splicing using these sites in the retrovirus does not occur because the first NS that can produce FSDS is downstream of the second NS that can produce FSAS. However, in the reverse transcribed DNA form of the vector, such as an integrated provirus, the first NS is upstream of the second NS and can therefore function in a 5 ′ splice donor-3 ′ splice acceptor pairing. ) Is formed. As a result, when transcription occurs from the provirus, the RNA produced is FSD
It is capable of being spliced to remove intervening sequences between S and FSAS. Depending on the nature of the sequence spliced from the RNA transcript produced from the provirus, this process has several applications.

One preferred embodiment in which it is better to use split-intron technology involves a hybrid vector system (see above). In this system, the retroviral genome delivered to a primary target cell by a primary viral vector, such as an adenovirus vector, is positioned such that the first NS is downstream of the second NS. Therefore, the first NS as a splice donor and the second NS as a splice acceptor
Splice removal of the sequence between the first NS and the second NS using NS should not occur. Because they are in the wrong direction. However, viral particles packaged by the primary target cells can be used to infect secondary target cells. In this secondary target cell, reverse transcription and integration of the viral genome typically occurs. This results in the FSDS
Will be located in the 5 'LTR, ie upstream of the FSAS, so that a functional splice donor / splice acceptor arrangement is obtained. Then, splicing is performed to remove the sequence between the FSDS and FSAS.

[0159] Between the 5 'LTR and the second NS in the retroviral vector, FSA in the provirus
The nucleotide sequence found between S and FSDS can include the nucleic acid sequence of interest (NOI). Sequences essential for the production of virus particles, e.g. env or g
The agpol sequence can be included in the NOI. Since this NOI is removed by splicing from the proviral transcript, the provirus cannot produce viable viral particles. Thus, for example, an adenoretroviral vector containing a NOI group encoding a gene component of interest, such as a viral component and a therapeutic polypeptide, wherein the virus particles formed in the primary target cells are subjected to secondary This makes it possible to construct a vector having the added safety property that the virus component cannot be produced when introduced into a target cell.

In another embodiment, it is possible for the NOI to be expressed in a secondary target cell and not in the primary target cell. In an alternative of this embodiment, the removal of the intervening sequence between FSDS and FSAS in the proviral RNA transcript causes one of the regulatory sequences 5 'to the FSDS in the proviral genome to be deleted in the proviral genome. Is located near the 5 'end of the NOI that was 3' to the FSAS, and when this intervening sequence was present, this regulatory sequence was not operably linked to the NOI. However, this results in the regulatory sequence being operably linked to the NOI, and can induce transcription from the NOI. This regulatory sequence may be upstream of the NOI in the retroviral vector, but in one preferred embodiment the regulatory sequence is N
So that it is downstream of the OI, upstream of the first NS in the retrovirus vector and U of the 3 ′ LTR.
There are regulatory sequences in three regions. Therefore, reverse transcription of retroviral RNA occurs in secondary target cells only when the regulatory sequence is located 5 'to the NOI.

Thus, in summary, the NOI located between the FSDS and the FSAS (and thus upstream of the second NS in the retroviral vector) typically contains the viral RNA transcripts produced by provirus in secondary target cells. Sequence that is removed from the product by splicing. Thus, such NOIs include, but are not limited to, retroviral sequences necessary for the assembly of retroviral particles in the primary target cell. These include env sequences, gagpol sequences, sequences encoding essential accessory genes and / or packaging sequences. Thus, but not by way of general limitation, NOIs located downstream of FSAS in the proviral genome (and therefore also downstream of the second NS in a retroviral vector) typically include therapeutic production.
A sequence encoding a gene product that is desired to be expressed in a secondary target cell, such as a product.

In the context of the adenoretroviral hybrid system, the retroviral vector includes not only the retroviral genomic sequences present in the primary adenoretroviral vector, but also the virus produced in the primary target cell, It should be understood that reference is made to include subsequent RNA genomes packaged in the particle.

As discussed above, a functional splicing sequence also requires a branch sequence that is found on the 5 'side of FSAS (and thus the second NS), and therefore a suitable branch sequence must be present. Must. For the construction of the split-intron vector, for example, in order to prevent splicing in the retroviral RNA genome transcribed in the primary target cell, the functional aspects of the existing functional splice donor are considered. Inactivation is required. Typically, this can be achieved using standard techniques by mutating the GT dinucleotide consensus sequence to, for example, a GC.

Adenovirus Adenovirus is a double-stranded, linear DNA virus that does not pass through an RNA intermediate.
There are more than 50 different adenoviruses of different human serotypes, divided into six subgenus based on the homology of the gene sequences, all showing comparable genetic organization. Human adenovirus C subgenus serotypes 2 and 5 (with 95% sequence homology) are most commonly used in adenovirus vector systems and are usually involved in younger upper respiratory tract infections.

The adenovirus / adenovirus vector of the invention may be of human or animal origin. For adenoviruses of human origin, preferred adenoviruses are classified into subgenus C, and in particular type 2 (Ad2), type 5 (Ad5), type 7 (Ad7) or type 12 (Ad12).
) Is an adenovirus. More preferably, it is an Ad2 or Ad5 adenovirus. Of the various adenoviruses of animal origin, avian adenovirus such as canine adenovirus, mouse adenovirus or CELO virus (Cotton et al., 1993) can be used. For animal adenoviruses, it is preferred to use adenoviruses of canine origin, especially CAV2 adenovirus strains (eg, the Manhattan strain or A26 / 61 (ATCC VR-800)). Other adenoviruses of animal origin include those cited in patent application WO-A-94 / 26914, which is incorporated herein by reference.

As mentioned above, the organization of the adenovirus genome is similar in all adenovirus genera, and specific functions are generally located in the same place for each serotype studied. The adenovirus genome contains at each end an inverted terminal repeat (ITR), an encapsidation sequence (Psi), an early gene and a late gene. The main early genes are intermediate early (E1a), delayed early (E1b, E2a
, E2b, E3 and E4), and intermediate region sequences (see diagram below). Among these, the genes contained in the E1 region are particularly required for virus transmission. Major late genes are contained in the L1 to L5 regions. The genome of the Ad5 adenovirus has been completely sequenced and is available in the database (see in particular Genbank accession number M73260). Similarly, the sequences of other adenoviral genomes or, in some cases, all sequences have been determined.

For use as a recombinant vector, adenoviruses are typically modified to be incapable of replicating in infected cells.

Thus, the constructs described in the prior art are adenoviruses in which the E1 region essential for viral replication has been deleted and a heterologous DNA sequence has been inserted therein (Levrero et al., 1991;
Gosh-Choudhury et al., 1986). In addition, to improve the properties of the vector,
It has been proposed to create other deletions or modifications of the adenovirus genome.
Then, a heat-sensitive point mutation was introduced into the ts125 mutant, making it possible to inactivate the 72 kDa DNA binding protein (DBP). Preferably, the recombinant adenovirus vector used in the present invention contains a deletion in the E1 region of the genome. More specifically, the adenovirus vector contains deletions in the E1a and E1b regions. According to a particularly preferred method, the E1 region comprises nucleotide 454 in the Ad5 adenovirus sequence.
Inactivated by the deletion of a PvuII-BglII fragment extending from nt to nucleotide 3328 (Genbank accession number M73260). In another preferred embodiment, the E1 region is inactivated by deletion of a HinfII-Sau3A fragment extending from nucleotide 382 to nucleotide 3446.

Other adenoviral vectors contain a deletion of the E4 region, another region essential for viral replication and / or transmission. The E4 region regulates late gene expression,
Involved in stabilizing RNA, reducing protein expression in host cells, and in the efficiency of viral DNA replication. Thus, adenoviral vectors lacking the E1 and E4 regions have greatly reduced viral gene expression and transcriptional background noise. Such vectors include, for example, patent applications WO-A-94 / 28152, WO-A-95 / 02697,
WO-A-96 / 22378. Furthermore, a vector carrying a variant of the IVa2 gene has been described (WO-A-96 / 10088).

According to a preferred variant, the recombinant adenovirus vector used in the present invention further comprises a deletion in the E4 region of said genome. More specifically, deletion of the E4 region affects all open reading frames. The exact example may include a deletion of nucleotides 33466-35535 or 33093-35535. In particular, preferred vectors include deletions of the entire E4 region. This is nucleotides 35835-32
It may have a deletion or excision of the MaeII-MscI fragment corresponding to 720. Another type of deletion of the E4 region is described in patent application WO-A-95 / 02, hereby incorporated by reference.
697 and WO-A-96 / 22378.

Alternatively, only the functional part of E4 is deleted. This part contains at least the ORF3 and ORF6 frames. As an example, each of these coding sequences
Nucleotides 34801-34329, respectively, in the form of PvuII-AluI and BglII-PvuII fragments
And 34115-33126 can be deleted from the genome. Virus Ad2
E4 region of dl808 or virus Ad5 dl1004, Ad5 dl1007, Ad5 dl1011 or Ad
Deletion of the E4 region of 5 dl1014 can also be used within the framework of the present invention.

The above positions are in the wild-type Ad5 adenovirus sequences, which are publicly available and accessible in the database. Although there may be small variations between the various adenovirus serotypes, these positions are common for constructing the recombinant adenovirus of the present invention from any serotype, especially adenoviruses Ad2 and Ad7. It can be applied to

In addition, the adenovirus produced can have other modifications in the genome. In particular, other regions may be deleted to increase the capacity of the virus and reduce side effects related to the expression of the viral genes. Thus, in particular, all or part of the E3 or IVa2 region can be deleted. However, for the E3 region, it may be particularly preferable to preserve the portion encoding the gp19K protein. This protein can, indeed, allow an adenoviral vector not to be subject to an immune response that (i) limits its action and (ii) may have undesirable side effects. According to a particular method, the E3 region is deleted and gp19
The sequence encoding the K protein is reintroduced under the control of a heterologous promoter.

The polynucleotide / NOI of the present invention can be inserted at various sites in the recombinant genome. It can be inserted into the E1, E3 or E4 region as a replacement for a deleted or extra sequence. It also contains the necessary sequences in cis for virus production (IT
(R sequence and capsid forming sequence) at any other site.

The E2 region is a precursor of the 72 kDa DNA binding protein, DNA polymerase, and the 55 kDa terminal protein (TP) required for protein priming to initiate DNA synthesis (8
0kDa) is essential.

Another method for making more defective viruses is to "gut" the virus, keeping only the terminal repeats necessary for virus replication. "Removed" or "empty" viruses can be propagated to high titers using a 293 cell line first generation helper virus.

Recombinant adenoviruses are typically used in capsid forming cell lines, cell lines capable of complementing one or more defective functions in the recombinant adenovirus genome in trans. Produced. One of these cell lines is, for example, cell line 293, which has incorporated a portion of the adenovirus genome. More precisely, cell line 293 is a human renal germ cell line, containing the left end (approximately 11-12%) of the genome of adenovirus 5 serotype (Ad5), the left ITR, the capsid formation. Region, E1a and
It includes the E1 region including E1b, the region encoding the protein pIX, and part of the region encoding the protein pIVa2. This cell line is capable of transcomplementing a recombinant adenovirus defective in the E1 region, ie, lacking all or part of the E1 region, and producing a viral stock with a high titer. This cell line also has the ability to produce a virus stock that contains a heat-sensitive E2 mutation at an acceptable temperature (32 ° C.).

Other cell lines capable of complementing the E1 region are particularly human embryonic carcinoma cells A549 (WO-A-94 /
28152) or human retinoblasts (Hum. Gen. Ther. (1996) 215). In addition, cell lines capable of transcomplementing multiple adenovirus functions have been described, for example, cell lines that complement the E1 and E4 regions (Yeh et al., 199
6a, b; Krougliak et al., 1995) and cell lines that complement the E1 and E2 regions (WO-A-94
/ 28152, WO-A-95 / 02697, WO-A-95 / 27071).

Recombinant adenovirus usually introduces viral DNA into the encapsidation system and then lyses the cells after about 2 or 3 days (as the kinetics of the adenovirus cycle is 24-36 hours). Made by doing. In order to carry out the process, the viral DNA introduced is optionally in bacteria (WO-A-96 / 25506) or in yeast (WO-A-96 / 25506).
WO-A-95 / 03400) may be a complete recombinant virus genome constructed and transfected into the cells. Recombinant viruses can also be used to infect the capsid formation system. Viral DNA can also be introduced in the form of fragments, each of which carries a portion of the recombinant viral genome and a region of homology, in which homology between the various fragments after introduction into the capsid forming cells is obtained. It is possible to reconstruct the recombinant viral genome by strategic recombination.

[0180] Replicating adenoviruses can also be used for gene therapy. For example,
The E1a gene can be inserted into a first generation virus under the control of a tumor-specific promoter. Theoretically, when the virus is injected into a tumor, it can specifically replicate in the tumor but not in surrounding normal cells. This type of vector can be used to kill tumor cells directly by lysis or to deliver “suicide genes” such as the herpes simplex virus thymidine kinase gene (HSV tk) to infected and bystander cells. ) Can be killed after treatment with ganciclovir. Viral genes can be placed under the control of hypoxia response regulatory elements.

A hybrid vector system A hybrid adenovirus / retrovirus system can also be used, where the characteristics of the adenovirus are combined with the genetic stability of the retrovirus. These hybrid viral vectors transduce target cells with an adenovirus, and the target cells then become transient retroviral producer cells that can stably infect neighboring cells.

The hybrid viral vector system of the present invention comprises one or more primary viral vectors encoding a secondary viral vector, wherein the primary vector (s) infects a first target cell, and wherein Capable of expressing a secondary viral vector,
The secondary vector is capable of transducing a second target cell.

[0183] Thus, the gene vector of the present invention comprises a primary vector produced in vitro that encodes a gene necessary for producing a secondary vector in vivo.
In use, the secondary vector carries one or more selection genes for insertion into a second target cell. The selection gene may be one or more marker genes and / or therapeutic genes (see above).

The primary viral vector (s) may be any of a variety of different viral vectors, such as retroviral (including lentiviral), adenoviral, herpes viral or poxviral vectors, or In the case of multiple primary virus vectors, a mixture of vectors of different viral origins may be used. In each case, the primary viral vector is preferably defective in its inability to replicate independently. Thus, they have the ability to enter the target cell and deliver the secondary vector sequence, but not to replicate and continue to infect the target cell.

Where the hybrid viral vector system includes one or more primary vectors encoding a secondary vector, all primary vectors are usually used simultaneously to infect the first target cell population. Preferred is a single primary viral vector that encodes all components of the secondary viral vector.

A preferred single or multiple primary viral vector is an adenoviral vector. Adenovirus vectors have significant advantages over other viral vectors in the titers obtainable from in vitro culture. Adenovirus particles are also relatively stable compared to enveloped virus particles, and are therefore easier to purify and store.

[0187] The secondary viral vector is preferably a retroviral vector, more preferably a lentiviral vector. The secondary vector is produced in the first target cell by expression of genes essential for the construction and packaging of the defective viral vector particle. Secondary vectors are defective in their inability to replicate independently. Thus, when a secondary retroviral vector transduces a second target cell, it loses its ability to propagate further by replication to the target cell.

[0188] Secondary vectors can be produced from expression of genes essential for the production of retroviral vectors encoded by the DNA of the primary vector. Such genes include the gag-pol gene from a retrovirus, the envelope gene from an enveloped virus, and a defective retroviral genome containing one or more therapeutic genes. Defective retroviral genomes generally contain terminal sequences that allow reverse transcription, at least a portion of the long 5 'terminal repeat (LTR), at least a portion of the 3' LTR, and a packaging signal.

Importantly, the secondary vector has incorporated therein one or more safety features that eliminate the possibility of recombination, producing an independently replicating infectious virus. Is safe in use in vivo.

To ensure that there is a replication defect, the secondary vector can be encoded by multiple transcription units, which can be located in one or more adenovirus vectors or other primary vectors. . Therefore, a transcription unit encoding the secondary vector genome, a transcription unit encoding gag-pol, and a transcription unit encoding env can be obtained. Alternatively, two or more of these can be combined. For example, nucleic acid sequences encoding gag-pol and env, or env and genome, can be combined in a single transcription unit. Methods for accomplishing this are known in the art.

A transcription unit as described herein is a nucleic acid region containing coding sequences and signals for achieving expression of these coding sequences, independently of any other coding sequences. Thus, each transcription unit generally comprises at least one promoter, one enhancer and one polyadenylation signal.
The promoter and enhancer of the transcription unit encoding the secondary vector are as follows:
Preferably, it has a strong activity or a strong inducibility in the first target cell under the conditions for producing the secondary viral vector. Promoters and / or enhancers may be constitutively effective or may be tissue or temporally restricted in their activity.

The safety properties that can be incorporated into the hybrid viral vector system are described below. One or more properties may be present.

First, sequence homology between sequences encoding components of the secondary vector can be avoided by deletion of regions of homology. The regions of homology allow genetic recombination to occur. In one particular embodiment, a secondary retroviral vector is constructed using three transcription units. The first transcription unit contains the retroviral gag-pol gene under the control of a non-retroviral promoter and enhancer. The second transcription unit contains the retroviral env gene under the control of a non-retroviral promoter and enhancer. The third transcription unit contains the defective retroviral genome under the control of a non-retroviral promoter and enhancer. In the native retroviral genome, the packaging signal is arranged such that a portion of the gag sequence is required for proper functioning. Thus, usually, when a retroviral vector system is constructed, a packaging signal containing a part of the gag gene remains in the vector genome. However, in the case of the present invention, the defective retroviral genome contains minimal packaging signals, which do not contain sequences in the first transcription unit that are homologous to the gag sequence. Also, in retroviruses such as Moloney murine leukemia virus (MMLV), there is a small overlapping region between the 3 'end of the pol coding sequence and the 5' end of env. The corresponding region of homology between the first and second transcription units has been removed by altering the sequence at either the 3 'end of the sequence encoding pol or the 5' end of env and the encoded region. Codon usage can be changed without changing the amino acid sequence of the protein.

Second, the potential of a replication-competent secondary viral vector was determined by reducing the envelope proteins of other retroviruses or other enveloped viruses so as to avoid regions of homology between the env and gag-pol components. And can be avoided by pseudotyping the genome of one retrovirus. In one particular embodiment, a retroviral vector is constructed from three components:
The first transcription unit contains the retroviral gag-pol gene under the control of a non-retroviral promoter and enhancer. The second transcription unit contains the env gene from an alternative enveloped virus under the control of a non-retroviral promoter and enhancer. The third transcription unit contains the defective retroviral genome under the control of a non-retroviral promoter and enhancer. The defective retroviral genome contains minimal packaging signals, which do not contain sequences homologous to the gag sequence of the first transcription unit.

[0195] Pseudotyping can also include, for example, a retroviral genome based on a lentivirus, such as HIV or equine infectious anemia virus (EIAV), and the envelope protein has an amphotropic, termed, for example, 4070A. ) It can be an envelope protein. Alternatively, the retroviral genome may be based on MMLV,
The envelope protein may be a protein from another virus that can produce a non-toxic amount in the first target cell, such as influenza hemagglutinin or vesicular stomatitis virus G protein. In other alternatives, the envelope protein may be a mutant or a modified envelope protein, such as a genetically engineered envelope protein. Modifications can be made or selected to introduce targeting ability, or to reduce toxicity, or for other purposes.

Third, the potential of a replication-competent retrovirus was constructed in a specific way.
It can be erased by using a different transfer unit. The first transcription unit gags under the control of a promoter-enhancer that is active in the first target cell, such as an hCMV promoter-enhancer or a tissue-restricted promoter-enhancer.
-Contains pol coding region. The second transcription unit encodes a retroviral genomic RNA capable of being packaged into a retroviral particle. The second transcription unit contains retroviral sequences necessary for packaging, integration and reverse transcription, and also contains sequences encoding the envelope virus env protein and one or more therapeutic gene coding sequences. .

In a preferred embodiment, the hybrid virus vector system according to the invention comprises a single or multiple adenovirus primary vectors encoding a retrovirus secondary vector. The adenovirus vector used in the present invention can be derived from a human adenovirus or an adenovirus that does not normally infect humans. Preferably, the vector is derived from adenovirus type 2 or adenovirus type 5 (Ad2 or Ad5) or an avian adenovirus such as a mouse adenovirus or a CELO virus. The vector may be a replication-competent adenovirus vector, but is more preferably a defective adenovirus vector.
Adenovirus vectors can be defective by deleting one or more components required for viral replication. Typically, each adenovirus vector is
It contains at least one deletion in the E1 region. To produce infectious adenoviral vector particles, passage of the virus in a human embryonic fibroblast cell line, such as a human 293 cell line containing an integrated copy of the remainder of Ad5, such as the E1 gene, This deletion can be complemented. The capacity for insertion of heterologous DNA into such vectors is up to approximately 7 kb. Thus, such vectors are useful for constructing a system of the invention that includes three separate recombinant vectors, each containing one of the transcription units essential for retrovirus secondary vector construction.

Other adenovirus vectors, in which other adenovirus genes have been further deleted, are known in the art, and these vectors are also suitable for use in the present invention. Some of these second generation adenovirus vectors exhibit reduced immunogenicity (eg,
E1 + E2 deletion, Gorziglia et al., 1996; E1 + E4 deletion, Yeh et al., 1996). Wide deletions serve to provide additional cloning capacity to introduce multiple genes into the vector. For example, a 25 kb deletion has been described (Lieber et al., 1996) and a cloning vector has been reported in which the entire viral genome has been deleted which allows the introduction of heterologous DNA of 35 kb or more (Fisher et al., 1996). ). Using such a vector, the adenovirus primary vector of the present invention encoding two or three transcription units for the construction of a retrovirus secondary vector can be prepared.

The embodiments of the present invention described above solve one of the major problems associated with adenovirus and other viral vectors, namely, the transient expression of genes from such vectors. Retroviral particles generated from the primary target cell infect the secondary target cell, and the gene expression of the secondary target cell is stably maintained because the genome of the retroviral vector is integrated into the host cell genome. The secondary target cells are
It does not express significant amounts of viral protein antigens and is less immunogenic than cells transduced with adenovirus vectors.

The use of a retroviral vector as a secondary vector is also advantageous, as it allows for some degree of cell discrimination, for example by being able to target fast dividing cells. In addition, retroviral integration allows for stable expression of therapeutic genes in target tissues, including stable expression in proliferating target cells.

Preferably, the primary viral vector selectively infects a particular cell type or one or more cell types. More preferably, the primary vector is a targeting vector, i.e. has an altered tissue tropism as compared to the native virus, said vector targeting a particular cell. The term "targeting vector" is not necessarily linked to the term "target cell". "Target cell" simply refers to a cell that can be infected or transduced by a vector, whether a natural vector or a targeting vector.

[0202] Primary target cells for the vector system according to the present invention include, but are not limited to, hematopoietic cells (monocytes, macrophages, lymphocytes, granulocytes or any of these precursor cells), endothelium. Includes cells, tumor cells, stromal cells, astrocytes or glial cells, muscle cells, and epithelial cells.

Thus, a primary target cell capable of producing a secondary viral vector according to the present invention may be any of the above cell types. In a preferred embodiment, the primary target cells according to the invention are defective containing the primary transcription unit for the retrovirus gag-pol and a secondary transcription unit capable of producing a packaged defective retroviral genome. Monocytes or macrophages infected with the adenovirus vector. In this case, it is preferred that at least the second transcription unit is under the control of a promoter-enhancer that is selectively active at a site of disease in the body, such as an ischemic site or the microenvironment of a solid tumor. In a particularly preferred embodiment of this aspect of the invention, the second transcription unit, when the genome is inserted into a secondary target cell, reduces the expression of the viral env gene and allows for efficient expression of the therapeutic gene. Is constructed to be produced.

[0204] The secondary viral vector may also be a targeting vector. For retroviral vectors, this can be achieved by modifying the envelope protein. The envelope protein of the retroviral secondary vector must be a non-toxic envelope or an envelope that can be produced in non-toxic amounts in the primary target cell, such as an MMLV amphotropic envelope or a modified amphotropic envelope. There is. The safety feature in such cases is preferably the lack of region or sequence homology between the retroviral components.

[0205] The secondary target cell population may be similar to the primary target cell population. For example, delivery of a primary vector of the invention to tumor cells results in the replication and generation of additional vector particles that can further transduce tumor cells. Alternatively, the secondary target cell population may be different from the primary target cell population. In this case, the primary target cells serve as endogenous factories in the body of the individual to be treated, producing additional vector particles that can infect the secondary target cell population. For example, the primary target cell population may be hematopoietic cells transduced in vivo or ex vivo by a primary vector. The primary target cells are then delivered or migrate to a site in the body, such as a tumor, to produce secondary vector particles capable of transducing, for example, tumor cells in a solid tumor.

The present invention allows for the localized production of high titers of defective retroviral vector particles in vivo at or near the site where the therapeutic protein is required, enabling efficient characterization of secondary target cells. Bring introduction. This is more efficient than using defective adenovirus or retrovirus vectors alone.

The present invention also allows for the production of retroviral vectors, such as MMLV-based vectors, in cells that do not divide and that divide slowly in vivo. Conventionally, production of MMLV-based retroviral vectors has been performed in tissue culture compatible cells or in v
It was only possible with fast dividing cells, such as tumor cells dividing fast in vivo. Extending the range of cell types capable of producing retroviral vectors can deliver genes to solid tumor cells, most of which are slow to divide, and transform non-dividing cells such as endothelial cells and various hematopoietic lineage cells into therapeutic proteins. Advantageously used as an endogenous factory for the production of the product.

The promoter / enhancer "inducible" or "regulated" means that expression can be selectively activated.
For example, it means that expression can be altered in response to extracellular stimuli. "Constitutive expression", as opposed to "regulated", means that a substantially constant amount is produced. Constitutive expression occurs, for example, continuously without the need for external stimuli.

Preferably, the nucleic acid in the vector according to the invention is operably linked to an expression control sequence capable of causing the selective expression of the fusion protein in the target cell. The expression control sequence may be, for example, a promoter or enhancer that is selectively active in certain cell types, including target cells, or a promoter or enhancer that is selectively active in certain conditions, such as hypoxic conditions. It may be. Expression control sequences capable of causing selective expression under hypoxic conditions are known as hypoxia response elements (Dachs et al., 1997 Nature Medicine 3, 515).

[0210] The nucleic acid is released only when macrophages enter the tumor, eg, due to hypoxia.
It can be under the control of a specifically activated promoter. This allows
Facilitates local delivery of the prodrug activating enzyme. This aspect of the invention is particularly useful for prodrugs that themselves are significantly activated under conditions such as hypoxia that are selectively present in tumors, such as Tirapazamine, RSU1069, EO9 and mitomycin C.

The nucleic acid may be under the control of the expression of certain expression control elements, usually a promoter or promoter and enhancer. The enhancer and / or promoter is selected in a hypoxic or ischemic or low glucose environment such that the nucleic acid is selectively expressed in a particular tissue of interest in the environment of a tumor, arthritic joint or other ischemic site. Active. Thus, any significant biological or detrimental effects of the nucleic acid on the treated individual can be reduced or eliminated.
Enhancer elements or other elements that provide for regulated expression can be present in multiple copies. Similarly, or in addition, enhancers and / or promoters can be selectively active in one or more specific cell types, such as any one or more of macrophages, endothelial cells, or combinations thereof. . Further examples include non-replicating cells that ultimately differentiate after division, such as respiratory airway epithelial cells, hepatocytes, myocytes, cardiomyocytes, synovial cells, primary mammalian epithelial cells, and macrophage neurons.

The term “promoter” has its ordinary meaning in the art, for example, Jacob-Mo
Used for RNA polymerase binding site in nod theory.

[0213] The term "enhancer" refers to a DN that binds to other protein components of the transcription initiation complex.
A sequence, which facilitates the initiation of transcription dictated by its associated promoter.

Preferably, the promoter of the invention is tissue-specific. That is, they remain almost "silent" in other tissue types, but can drive transcription of nucleic acids in one tissue.

The term “tissue-specific” refers to the selection that activity is not restricted to one single tissue type, but nevertheless is active in one group of tissues and less active or silent in another group. Means a sexually active promoter. A desirable property of the promoters of the present invention is that they have relatively low activity, even in target tissues, in the absence of an activated hypoxic regulatory enhancer element. One way to achieve this is to use a "silencer" element that represses the activity of the selected promoter in the absence of hypoxia.

[0216] Some of the tissue-specific promoters described above may be particularly advantageous in the practice of the present invention. In most cases, these promoters can be isolated as convenient restriction digests, which are suitable for cloning into the chosen vector. Alternatively, the promoter fragment can be isolated using the polymerase chain reaction. Cloning of the amplified fragment can be facilitated by incorporating a restriction site at the 5 'end of the primer.

Suitable promoters for cardiac-specific expression include promoters from the mouse heart α-myosin heavy chain (MHC) gene. Suitable vascular endothelial-specific promoters include the Et-1 promoter and the von Willebrand factor promoter.

Prostate-specific promoters include the human glandular kallikrein-1 (hKLK2) gene and the 5 ′ flanking region of the prostate-specific antigen (hKLK3).

Examples of promoters / enhancers that are cell-specific include macrophage-specific promoters or enhancers, such as the CSF-1 promoter-enhancer, or elements from the mannose receptor gene promoter-enhancer (Roulex et al., 1994). Exp Cell Res 214: 113-119). Alternatively, a promoter or enhancer element selectively active on neutrophils, or a lymphocyte-specific enhancer such as the IL-2 gene enhancer can be used.

[0220] High expression of therapeutic genes under hypoxic conditions can be induced by the presence of one or more hypoxic response enhancer (HRE) elements. The HRE element contains a polynucleotide sequence that can be located either upstream (5 ') or downstream (3') of the promoter and / or therapeutic gene. HRE enhancer element (H
REE) is typically a cis-acting element, usually about 10-300 bp long,
Acts on the promoter to increase transcription of the gene under the control of the promoter. Preferably, said promoter and enhancer elements are such that expression of genes regulated by these elements is minimized in the presence of a healthy supply of oxygen,
It is selected to be up-regulated under hypoxic or anoxic conditions.

The term “hypoxia” refers to a condition under which a particular organ or tissue does not receive sufficient oxygen supply.

[0222] Hypoxia responsive elements also include, for example, erythropoietin HRE elements (HRE
E1), muscle pyruvate kinase (PKM), HRE element, B-enolase (enolase 3; ENO3) HRE element, endothelin-1 (ET-1) HRE element and metallothionein II (MTII) HRE element .

A further example of a hypoxia-regulating enhancer is the binding element for the transcription factor HIF-1 (Dachs et al., 1997 Nature Med 5: 515; Wang and Sememnza 1993 Proc.
Natl Acad Sci USA 90: 4304; Firth et al., 1994 Proc Natl Acad Sci USA 91: 6496.
). Hypoxia response enhancer elements have also been found to be associated with multiple genes, including the erythropoietin (EPO) gene (Madan et al., 1993 Proc Natl Ac
ad Sci 90: 3928; Semenza and Wang 1992 Mol Cell Biol 1992 12: 5447-5454
). Another HREE is the muscle glycolytic enzyme pyruvate kinase (PKM) gene (Takenaka et al., 1
989 J Biol Chem 264: 2363-2367), the human muscle-specific β-enolase gene (ENO3;
Peshavaria and Day 1991 Biochem J 275: 427-433) and endothelin-1 (E
T-1) gene (Inoue et al., 1989 J Biol Chem 264: 14954-14959).

[0224] When the enzyme activation domain is expressed from macrophages, the promoter and / or enhancer must be constitutively efficient. Examples of constitutive promoters such as cytomegalovirus (CMV) are known in the art and any of them can be used. One preferred promoter-enhancer combination is the human cytomegalovirus (hCMV) major immediate early (MIE) promoter / enhancer combination. The present inventors have found that macrophages engineered to express a prodrug activating enzyme such as P450 give particularly good results constitutively, for example in the treatment of cancer. This is particularly surprising.

Host Cells and Target Cells The polynucleic acid constructs, nucleic acid vectors and viral vectors of the present invention can be introduced into various host cells. A host cell is a prokaryotic cell, for example, a bacterial cell,
And eukaryotic cells, such as yeast cells and higher eukaryotic cells (insect cells, mammalian cells such as humans, etc.). Non-viral and viral vectors can be propagated using host cells, for example, to prepare a nucleic acid vector comprising a polynucleotide of the invention or to prepare a high titer viral stock.

Alternatively, host cells comprising a polynucleic acid sequence / NOI of the invention can be used in therapies discussed below, for example, using macrophages for ex vivo therapy.

[0227] Non-viral nucleic acids and viral vectors are typically introduced into host cells using techniques known in the art, such as transformation or transfection. Viral vectors can also be introduced into host cells by infection.

A target cell in the context of the present invention typically means a cell of or from an organism that one wishes to treat, rather than merely a cell line. Target cells can be removed from the organism and returned after treatment, or can be targeted in vivo. Thus, for example, tumor cells in vivo can be considered target cells.

Examples of target cells include tumor cells (see tumor table below), especially low
Tumor cells under oxygen conditions. The target cells are located in the center of the solid tumor mass.
Arrested cells or HSC or CD34 capable of undergoing such cell division⁺Like a cell
Such stem cells may be used. Alternatively or additionally, the target cell is the monocyte precursor CD33 ⁺ It may be a cell or a precursor of a differentiated cell such as a bone marrow progenitor cell. Target cells are also neurons, astrocytes, glial cells, microglial cells, macrophages
It can be a differentiated cell such as a diocyte, monocyte, epithelial cell, endothelial cell or hepatocyte. Mark
Target cells are transfected or transduced in vitro after isolation from the individual
Or transfected or transduced directly in vivo.

[0230] Desirable host cells / target cells are cells in which EPAS is expressed, and more preferably EPAS.
Includes cells that express AS but not HIF-1 (or much lower levels).

In a particularly preferred embodiment, hematopoietic stem cells such as macrophages are used as host cells / target cells. As described above, HSCs are pluripotent stem cells that arise in all blood cell lines of mammals. HSCs differentiate into various cell lines under the influence of microenvironmental factors such as cell-cell interactions and the presence of soluble cell cytokines. Four major cell lines arise from HSCs. These include the erythroid lineage (red blood cells); the megakaryocyte lineage (platelets), the myeloid lineage (granulocytes and monocytes), and the lymphocyte lineage (lymphocytes). The maturation of these cells occurs under the influence of a network of variously named tissue-specific protein regulators, including growth factors, cytokines and interleukins.

Macrophages derived from blood stream derived monocytes have been used as vehicles to deliver targeting drugs and therapeutic genes to solid tumors. Macrophages have been shown to continually enter solid tumors and aggregate at sites of poor angiogenesis in breast cancer. Moreover, the extent of ischemia-induced necrosis in these tumors was positively correlated with the extent of intratumoral macrophage infiltration.

Monocytes and macrophages also infiltrate ischemic lesions that are characteristic of the symptoms of other diseases including cerebral malaria, coronary heart disease and rheumatoid arthritis. Thus, monocytes and macrophages are suitable host cells for use in the present invention. In particular, monocytes and / or macrophages comprising vectors such as the polynucleotides and / or viral vectors of the invention may be used in ex vivo and in vivo methods for treating diseases associated with hypoxia. Suitable for

Methods for the isolation of HSCs and their maintenance and identification in culture are described in the art (Santi
ago-Schwartz et al., 1992; Charbord et al., 1996; Dao et al., 1997; Piacibello et al., 1997) and WO-A-91 / 09938. Transfer of retroviral genes into human HSCs has been reported in a general sense (Duphar and Emmons, 1994). Methods for transducing HSCs via retroviruses and transferring them to patients have also been described by Dunbar et al., 1996.

According to in vivo mouse studies, pretreatment of donor mice with 5-fluorouracil prior to bone marrow harvest induced progenitor cell division and increased the susceptibility to retroviral infection and integration by It has been shown to improve transduction efficiency. Use of cell lines capable of producing at least 10 ⁵ viral particles co-culture and 1ml per target cell and the retrovirus producer cell line was also improved the efficiency (Bodine et al., 1991). Successful gene transfer into long-term repopulating cells can be achieved by stably reconstituting multiple hematopoietic cell lines with cells carrying 1 to 50% or more of the proviral genome, effectively eliminating all recipients. Achieved in mice (Fraser et al., 1990).

When a vector is used in the present invention for in vivo delivery of a nucleic acid sequence to HSC, the vector is preferably a targeting vector capable of targeting CD34 + HSC.

The term “targeting vector” refers to a specific cell type, usually a common or similar phenotype, in a host organism whose ability to infect / transfect cells in a cell or to be expressed in a target cell. Means a vector that is restricted to cells. One example of a targeting vector is a targeting retroviral vector that has a genetically modified envelope protein that binds to cell surface molecules found only on a limited number of cell types in the host organism. Another example of a targeting vector is a promoter and / or that allows the expression of one or more retroviral transcripts only in the proportions of the cell type of the host organism.
Alternatively, it is a targeting vector containing an enhancer element. Therefore,
The vector contains a CD34, such as an antibody or immunoglobulin-like molecule directed against CD34.
May be provided. When introduced into an individual to be treated, such a vector will specifically transfect CD34 ⁺ HSC. The vector can be administered systemically and circulated peripherally.

Therapeutic Uses The present invention is believed to have broad therapeutic potential, inter alia, depending on the choice of one or more NOIs, prodrug activation domains and / or prodrugs. Additionally or alternatively, the present invention is useful for treating the disorders listed in WO-A-98 / 09985. For ease of reference, the parts of the table are listed here: macrophage inhibitory activity and / or T cell inhibitory activity and consequently anti-inflammatory activity; anti-immune activity, ie cellular activity including responses not associated with inflammation. And / or an inhibitory effect on the humoral immune response; the ability of macrophages and T cells to adhere to extracellular matrix components and fibronectin and the inhibition of up-regulated fas receptor expression in T cells; Inhibition of immune response and inflammation, i.e. arthritis, rheumatoid arthritis, inflammation associated with hypersensitivity, allergic reactions, asthma, systemic lupus erythematosus, collagen disease, and other autoimmune diseases, inflammation associated with atherosclerosis , Arteriosclerosis,
Atherosclerotic heart disease, reperfusion injury, cardiac arrest, myocardial infarction, vascular inflammation disorder, dyspnea syndrome or other cardiopulmonary disease, inflammation associated with peptic ulcer, ulcerative colitis and other gastrointestinal disorders, Liver fibrosis, cirrhosis or other liver diseases, thyroiditis or other glandular diseases, glomerulonephritis or other renal and urinary diseases, otitis or other ENT diseases, dermatitis or other skin diseases, periodontal Disease or other dental disease, orchitis or epididymal-orchitis, infertility, testicular disease related to testicular trauma or other immunity, placental dysfunction, placental dysfunction, habitual miscarriage, eclampsia, Preeclampsia and other immune and / or inflammation related gynecological disorders, posterior uveitis, middle uveitis, anterior uveitis, conjunctivitis, chorioretinitis, uveoretinitis, optic neuritis, intraocular Inflammation, for example, the net Flame or alveolar macular edema, sympathetic ophthalmia, scleritis,
Retinitis pigmentosa, immunity and inflammatory components of degenerative fondus disease, inflammatory components of eye trauma, eye inflammation caused by infection, proliferative vitreous-retinopathy, acute ischemic optic neuropathy Excessive scarring (eg after glaucoma filtration surgery), immune and / or inflammatory response to eye transplantation and other immune and inflammation related ophthalmic diseases, immunity and / or in both the central nervous system (CNS) or other organs Inflammation associated with an autoimmune disease or condition or disorder for which inflammation suppression is beneficial, Parkinson's disease, complex and / or side effects from treatment of Parkinson's disease, AIDS
Dementia complications associated with HIV, encephalitis associated with HIV, Devic's disease, Sydenham's chorea, Alzheimer's disease and other degenerative diseases, CNS symptoms or disorders, inflammatory component of seizures, polio sequelae (Post-polio syndrome), immune and inflammatory components of mental illness, myelitis, encephalitis, subacute sclerosing panencephalitis, encephalomyelitis, acute neuropathy, subacute neuropathy, chronic neuropathy, Guillaim-Bar (Guillaim) -Barre) syndrome, Sydenham chora, myasthenia gravis, pseudocerebral tumor, Down syndrome, Huntington's chorea, amyotrophic lateral sclerosis, CNS compression or inflammatory component of CNS trauma or infection of the CNS, Inflammatory components of muscular atrophy and dystrophy, and diseases, symptoms or disorders related to immune and inflammation of the central and peripheral nervous systems, post-traumatic inflammation, septic shock, infectious diseases Inflammatory complications or side effects of surgery, complications and / or side effects of bone marrow transplantation or other transplants, inflammation and / or immune complications and side effects of gene therapy (eg, due to infection by a viral carrier), or inflammation associated with AIDS Inhibiting or inhibiting a humoral and / or cellular immune response, treating or reducing a monocyte or leukocyte proliferative disorder (eg, leukemia) by reducing the amount of monocytes or lymphocytes, the cornea,
Prevention and / or treatment of transplant rejection in the case of transplantation of natural or artificial cells, tissues and organs, such as bone marrow, organs, lenses, pacemakers, natural or artificial skin tissue.

In particular, the polynucleotides, nucleic acid vectors, viral vectors and host cells of the present invention can be used for treating tumors. Examples of tumors that can be treated according to the present invention include, but are not limited to: sarcomas, including osteogenic and soft tissue sarcomas, breast, lung, bladder, thyroid, prostate, Colon, rectum, pancreas,
Cancers such as stomach, liver, uterus, and ovarian cancer, lymphomas including Hodgkin's disease and non-Hodgkin's disease lymphoma, neuroblastoma, melanoma, myeloma, Wilms tumor, and acute lymphoblastic leukemia and acute Leukemias, including myeloblastic leukemias, gliomas and retinoblastomas.

A particularly advantageous feature of the invention is that the nucleic acid sequence is expressed in hypoxic cells and not in cells under normoxic conditions. Thus, the nucleic acid sequences, nucleic acid vectors, viral vectors and host cells of the invention can be used in the clinical management of a range of conditions characterized by hypoxia. Examples of symptoms characterized by the symptoms of hypoxia include stroke, deep vein thrombosis, pulmonary embolism, and renal failure. Cardiac tissue cell death, called myocardial infarction, is largely due to tissue damage caused by ischemia and / or reperfusion after ischemia. Other examples include cerebral malaria, rheumatoid arthritis.

The nucleic acid sequences, nucleic acid vectors, viral vectors and host cells of the present invention are particularly preferably used for clinical management of solid tumors such as ovarian tumors, especially tumors including tumor cells under hypoxic conditions. Treatment may also affect the rate of tumor growth, slow the rate of tumor growth or even shrink the tumor mass, but does not necessarily result in complete apoptotic / necrotic death of all malignant cells in the patient.

The nucleic acid sequences, nucleic acid vectors, viral vectors and host cells of the present invention also include
It can also be used for preventive medicine. Thus, for example, the prodrugs used in the present invention may also have a therapeutic effect through prophylaxis. For example, if the risk of developing cancer is determined to be high, the present invention can be used to vaccinate at-risk individuals.

The suitability of prophylaxis is believed to be based on a genetic predisposition to cancer, for example, breast or ovarian cancer due to one or more mutations in the BRCA-1, BRCA-2, or other related genes ( Cornelisse et al., 1996).

Administration Thus, the nucleic acid sequences, nucleic acid vectors, and viral vectors of the present invention
It can be used to deliver a therapeutic gene to a human or animal in need of treatment.

The nucleic acid sequences of the present invention can be administered directly as naked nucleic acid constructs, preferably further as nucleic acid constructs comprising flanking sequences homologous to the host cell genome. Uptake of naked nucleic acid constructs by mammalian cells can be enhanced by a number of known techniques, including biolistic transformation and lipofection. Alternatively, the nucleic acid sequence can be administered as part of a nucleic acid vector, including a plasmid vector or a viral vector, preferably a lentiviral vector.

Preferably, a pharmaceutical composition is prepared by combining a delivery vehicle (ie, a naked nucleic acid construct or a viral vector containing, for example, a polynucleotide) with a pharmaceutically acceptable carrier or diluent. Accordingly, the present invention also provides a pharmaceutical composition for treating an individual by gene therapy, the composition comprising one or more deliverable therapeutic and / or diagnostic NOIs or made therefrom. Or a therapeutically effective amount of a nucleic acid sequence, vector or viral vector of the invention comprising the resulting virus particles, and a pharmaceutically acceptable carrier, diluent, excipient or adjuvant. The pharmaceutical composition can be used for humans or animals.

The choice of pharmaceutical carrier, excipient or diluent can be selected for the intended route of administration and standard pharmaceutical practice. Suitable carriers and diluents are isotonic saline,
For example, a phosphate buffered saline solution is included. Pharmaceutical compositions may assist or augment any suitable binders, lubricants, suspensions, coatings, lysing agents, and viruses as carriers, excipients, or diluents, and enter the target site. The pharmaceutical composition can include (or in addition to) other carrier agents (eg, a lipid delivery system); the pharmaceutical composition can be parenteral, intramuscular, intravenous, intracerebral, subcutaneous, intraocular, or transdermal. It can be formulated for administration.

Where appropriate, the pharmaceutical compositions can be administered orally, in the form of inhalants, suppositories or vaginal suppositories, topically in the form of lotions, solutions, creams, ointments or powders, by means of skin patches. In the form of tablets containing excipients such as starch or lactose,
Or in capsules or ovules, alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavoring or coloring agents, or Alternatively, the pharmaceutical composition can be administered parenterally, for example, intratraversally, intravenously, intramuscularly, or subcutaneously. For parenteral administration, the compositions will best be used in the form of a sterile aqueous solution which may contain other substances, for example, enough salts or monosaccharides to make the solution isotonic with blood. . For buccal or sublingual administration, the compositions may be administered in the form of tablets or lozenges which can be formulated in a conventional manner.

The pharmaceutical composition is administered in such a way that the nucleic acid sequence / vector containing the therapeutic gene for gene therapy is incorporated into cells at an appropriate location.

The active ingredient in such compositions comprises from about 0.1% to about 99% by weight of the formulation. "
"Pharmaceutically acceptable" means that the active ingredient must be compatible with the other ingredients of the composition and must be physiologically acceptable to the patient.

Pharmaceutical compositions for use according to the present invention can be formulated in conventional manner using readily available pharmaceutical or veterinary methods. Thus, the active ingredient may be incorporated into one or more of the usual carriers, diluents and / or excipients, optionally with other active substances, to produce tablets, pills, powders, troches, sachets and the like.
Common galenic (such as, cachet, elixir, suspensions, emulsions, solutions, syrups, aerosols, soft and hard gelatin capsules, suppositories, sterile injectable solutions, sterile package powders, etc. galenic) Formulation can be made.

Examples of suitable carriers, excipients, and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, Polyvinylpyrrolidone, cellulose, water syrup water, water / ethanol, water / glycol, water / polyethylene glycol, propylene glycol, methylcellulose, methylhydroxybenzoic acid, propylhydroxybenzoic acid, talc,
Fatty substances such as magnesium stearate, mineral oil or hard fats or suitable mixtures thereof. The composition can further include lubricants, wetting agents, emulsifying agents, suspending agents, preservatives, sweetening agents, flavoring agents, and the like. The formulations may be formulated so as to provide quick, sustained or delayed release of the active ingredient after administration to the patient, using methods well known in the art.

The compositions are preferably formulated in a unit dosage form, for example, so that each dose contains from about 0.1 to about 500 mg of the active ingredient.

The exact dose of the active ingredient and the length of treatment will depend on a number of factors, including the age and weight of the patient, the particular condition being treated and its severity, and the route of administration. Generally, an effective dose will be on the order of about 0.01 mg / kg to about 20 mg / kg body weight per day, for example, about 0.05 to about 10 mg / kg per day, and will be administered one or more times per day. Thus, a suitable dose for an adult may be 10 to 100 mg per day, for example 20 to 50 mg per day.

Administration can be by any suitable method known in the art and includes, for example, oral, parenteral (eg, intramuscular, subcutaneous, intraperitoneal or intravenous), rectal or topical administration.

When a nucleic acid sequence of the invention is delivered to a cell by a viral vector of the invention,
The amount of virus administered ranges from 10 ³ to 10 ¹⁰ pfu, preferably 10 ⁵ to 10 ⁸ pfu, more preferably 10 ⁶ to 10 ⁷ pfu. When injected, typically 1-10 ml of virus in a suitable pharmaceutically acceptable carrier or diluent is administered.

When a nucleic acid sequence / vector is administered as a naked nucleic acid, the amount of nucleic acid administered typically ranges from 1 μg to 10 mg, preferably from 100 μg to 1 mg.

When the NOI is under the control of an inducible regulatory sequence, it is only necessary to induce gene expression during the treatment. Once the condition has been treated, the inducer is removed and NOI expression ceases. This is clearly a clinical advantage. For example, such a system administers the antibiotic tetracycline and its tet repressor / V
It is involved in activating gene expression through action on the P16 fusion protein. Other systems involve inducing HRE using desferrioxamine.

The use of a tissue-specific promoter will aid in the treatment of diseases using the polynucleotides / vectors of the invention. For example, some neurological disorders are due to aberrant expression of specific gene products in tiny cell subsets. Being able to express the therapeutic gene only in the affected cell type concerned is advantageous, especially if such a gene is toxic if expressed in other cell types.

The modified HSCs of the present invention are administered to a patient or at-risk individual in an appropriate formulation. The formulation can include isotonic saline, buffered saline or tissue culture media. The cells may be administered by bolus injection or by intravenous injection or directly into the tumor site or into the bone marrow, for example at a concentration of between about 10 ⁶ and 10 ¹² cells / dose, preferably at least 10 ⁸ or 10 ¹⁰ cells / dose. Is administered.

The individual can initially take treatment to deplete the bone marrow of stem cells, or
One or more cytokines, such as G-CSF, can be used to increase the mobility of stem cells into the peripheral blood, or one or more cytokines can be used to enhance bone marrow regrowth . Combinations of these treatments are also contemplated. The treatments of the present invention can also be combined with currently available anti-cancer treatments.

If the vector used for stem cell genetic engineering encodes a prodrug activating enzyme, the individual afflicted with cancer can further be administered to a corresponding prodrug using a suitable regimen according to principles known in the art. Is treated with

When HSCs are removed from the individual to be treated and transfected or transduced with the vector in vitro, the cells are typically cultured before and after the introduction of one or more NOIs. Proliferated in HSCs can be cultured in vitro under appropriate conditions or subjected to appropriate signals in vivo, resulting in other cell types, including endothelial cells, bone marrow cells, dendritic cells, and neutrophils and lymphocytes. Has the ability to differentiate into immune effector cells such as mononuclear phagocytes and NK cells.

This involves the use of tissue culture methods known in the art, including exposure to cytokines and / or growth factors for the maintenance of HSCs (Santiago-Schwartz et al., 19
92; Charbord et al., 1996; Dao et al., 1997; Piacibello et al., 1997). An agent that induces HSC differentiation may be added.

In addition to responding to hypoxia, HRE elements are known to respond to chemical inducers that mimic hypoxia. Two of these chemical inducers are known and these are cobalt chloride and desferrioxamine (Meliillo et al., 1996; Wa
ng and Semenza 1993b). Thus, the products of the present invention using HRE are also compounds that mimic hypoxia, such as neuroblastoma (Blatt, 1994), β thalassemia (b
eta thalassemia) (Giardina and Grady, 1995), Alzheimer's disease (Crappe
r et al., 1994), VEGF deficiency (Beerrepoot et al., 1996), erythropoietin deficiency (W
ang and Semenza, 1993b) and enhanced tumor chemotherapy (Voest et al.)
1993) can be used to treat disorders where the chemical activator desferrioxamine or similar chemicals are administered. The products of the present invention can be administered simultaneously, sequentially or separately with a compound that mimics hypoxia.

The routes of administration and dosages described are intended only as a guide and a skilled practitioner (physician) can readily determine the optimal route and dosage for any particular patient and condition. Would.

The suitability of a prophylaxis is believed to be based on a genetic predisposition to cancer, for example, breast or ovarian cancer due to one or more mutations in the BRCA-1, BRCA-2, or other related genes ( Cornelisse et al., 1996 Pathol Res Pract 192: 684-693).

It has now been recognized that it is important to identify patients as to whether a particular product is safe and effective. This is based on the recognition that genetic alterations can contribute to the variable effects of drugs in different individuals.

Thus, the present invention provides a method of testing an individual's DNA for polymorphisms of drug metabolizing enzymes, and then administering, if appropriate, a prodrug activator of the invention.

In accordance with the present invention, standard molecular biology techniques within the skill of the art can be used. Such techniques are fully described in the literature. See, for example, Sambrook et al., (1989) Molecular Cloning; laboratory manual; Hames and Glover (1985-1997) DNA Cloning: apr.
actical approach (DNA cloning: a practical approach), Volume I-IV (2nd edition); Methods for genetic manipulation of immunoglobulin genes are described in McCafferty et al. (McCafferty et al., (1996)
"Antibody Engineering: A Practical Approach".

It is recognized that features from the various parts, aspects and embodiments of the invention described above are generally equally applicable to other parts, aspects and embodiments, mutatis mutandis. Should be done.

The present invention will now be described in more detail with reference to the following non-limiting examples.

Although the invention is illustrated with reference to the use of human NADPH: cytochrome c reductase in gene therapy, the invention is intended to improve enzyme activity from any species and by methods of protein engineering. Any modified P450 reductase, as well as any other natural, engineered or synthetic prodrug activating enzyme;
For example DT diaphorase, thymidine kinase, in E.coli nitroreductase and carboxypeptidase G ₂ can be applied.

Example 1 : Addition of nuclear targeting peptide to P450R [Figure 7.1] Peptide or protein fusions are prepared by making hybrid DNA molecules using standard methods well known to those skilled in recombinant DNA technology. You. See, for example, the literature, for example, Sambrook et al., 1989 Molecular Cloning; A Laboratory Approach; Molecular Cloning; Laboratory Methods; Hames and Glover (1985-1997) DNA Cloning: apr.
Actical approach (DNA cloning: practical approach), I-IV (second edition). The hybrid gene is inserted into a vector suitable for introduction into a mammalian cell. Many types of vectors available are described in detail (eg, Le
ver and Goodfellow 1995, Brit. Med. Bull. 51, Number 1, Gene Therapy) These will be known to the ordinary practitioner. For example, to produce a retroviral vector capable of expressing the prodrug activating enzyme described in this and the following examples, the relevant coding region may be modified by using a transcript containing the P450 coding sequence in hCMV.
-Insert into a retroviral vector produced from a strong promoter such as the MIE promoter. A suitable plasmid is pHIT111 (Soneoka et al., 1995 Nucl. A
cids Res. 23; 628-633), and insert the required gene in place of the LacZ gene using standard techniques. The resulting plasmid is then transfected into a FLYRD18 or FLYA13 packaging cell line (Cosse et al., 1995 J. Virol. 69; 74).
30-7436), and select transfectants at 1 mg / ml for G418 resistance. G418 resistant packaging cells produce high titers of recombinant retrovirus capable of infecting human cells. The virus preparation can then be used to infect human cancer cells and injected in vivo into tumors. The prodrug activating enzyme is then expressed from the tumor cells.

In pHIT111, the MoMLV LTR promoter-enhancer is used for expression of a therapeutic gene in target cells. The vector can also be modified such that the therapeutic gene is transcribed from an internal promoter-enhancer that is primarily active or has hypoxia regulatory elements in tumor cells. A suitable HRE-containing enhancer consists of the truncated HSV TK promoter with three copies of mouse PGK HRE (F
irth et al., 1994 Proc Natl Acad Sci USA 91: 6496-6500). For example, a synthetic oligonucleotide described in WO95 / 21927 is inserted between the Nhe1 and Xba1 sites in the 3 ′ LTR of pHIT111 (Soneoka et al., Supra), and the gene expression in the target cell is under hypoxic control Create a retroviral vector. An alternative retroviral vector constructed in the same way is pKAHRE shown in FIG. 6a. Another vector backbone that can be used is shown in FIG. 6b.

In order to manipulate and analyze the coding sequence of the P450R gene, it is subcloned into a mammalian cell expression vector as follows.

SEQ ID NO: 1. Human P450R cDNA (Shephard et al., 1992, Arch. Biochem. Biophy. 2
94: 168, GenBank accession number S90469, see FIG. 1a.) P450 reductase cDNA is obtained as a EcoRI fragment from human placenta cDNA by conventional PCR amplification and ligated with pBlueScript II vector to form P450R.1.

In order to construct a nuclear targeting derivative of P450 reductase, the ER anchor domain is removed to create an anchorless P450 reductase (alP450) and a nuclear localization signal is added.

[0279] The functional domain of P450 reductase is shown in Figure 1b.

SEQ ID NO :. The alP450R sequence is shown in FIG. 2A.

P450 reductase with SV40NLS substituted for the ER domain (alP450R,
The sequence (see FIG. 2a, SEQ ID NO: 3) is derived from plasmid pP450R.1.
Obtained by R amplification using the following primers: NLS-alP450 5'-primer: SEQ ID NO: 7.

[0282] It contains the following components: 1. Kozak leader sequence (Peakman et al., 1992, Patent Publication No. EP048617)
0-A / 2, GenBank accession number A18727). Underlined lowercase letters.

2. SV40 large T antigen nuclear import signal sequence (Fiers et al., 1978, Nature 273: 1
13, see also Nigg 1997, Nature 386: 779, GenBank accession number V01380).

3. 5 ′ region of alP450R (Smith et al., 1994, PNAS 91: 8710, FIG. 3A).

AlP450 3′-primer: SEQ ID NO: 8. The 3 'region of alP450R.

CTAGCTCCAC ACGTCCAGGG AGTAG (25 mer) The resulting PCR fragment is subcloned into the SmaI site of the multiple cloning region of the pCIneo vector (from Promega).

SEQ ID NO: 9. pCINeo multicloning site gctagctcga gaattcacgcg tggtacctct agagtcgaCC CGGGcggccg c (NheI-XhoI-EcoRI-MluI-XbaI-AccI / SalI-SmaI-NotI) The final fusion configuration is shown in FIG. 7.1.

Example 2 Addition of Nuclear Targeting Peptide to Functional Domain (FN) of P450R [FIG. 7.2] Functional fragment of P450 reductase (FN fragment; (Smith et al., 1994, PNAS 91: 8710)) Shown in 2B. The nuclear targeting FN is constructed as follows: Generate a PCR fragment of the DNA sequence encoding the following fusion protein.

SEQ ID NOs: 10 and 11. SV40NLS (FIG. 3) SEQ ID NOS: 5 and 6. FN fragment of P450 reductase (P450 reductase FN fragment is shown in FIG. 2B) The PCR fragment is amplified from pP450R.1 (Example 1) using the following primers: FN 5 ′ primer: SEQ ID NO: 12. It contains the Kozak translation initiation sequence (lowercase), the SV40NLS (uppercase) and the 5 'region of the FN fragment (bold, underlined), as shown in the following sequence: FN 3'-primer: SEQ ID NO: 13. 3 ′ coding region of FN fragment CTAGCTCCAC ACGTCCAGGG AGTAG (24 mer) The PCR fragment is subcloned into the SmaI site of the pCIneo vector to prepare SV40NLS-FN (FIG. 7.2).

Example 3 Construction of bFGF-alP450R Expression Vector [FIG. 7.3] The fusion is prepared as described in Example 1.

The 18 kD isoform of bFGF (Prats et al., 1989, PNAS 86: 1836, see FIG. 4B; GenBank accession number J04513) comprising the 18 kD isoform of bFGF at the N-terminus and the anchorless P450 reductase at the C-terminus Build the hybrid protein (FIG. 2A). This raises bFGF from the bFGF-pUC18 plasmid (obtained from R & D systems) to create a bFGF fragment, and
It is performed using two PCR reactions that generate alP450R from 450R.1. The two fragments are then digested with SalI and ligated together. The following primers are used: bFGF 5 'primer: SEQ ID NO: 14. This is a primer for the 5 'coding region of the 18 kD isoform with the Kozak leader sequence (underlined).

Cccgccgcca ccatgg cagc cgggagcatc accacg (36 mer) bFGF 3 ′ primer: SEQ ID NO: 15. This is a primer for the 3 'coding region of bFGF with a leading SalI restriction site (shown in uppercase).

GgcgGTCGACgct cttagcagacat attggaaga (32 mer) a1P450R 5 ′ primer: SEQ ID NO: 16. This is a primer for the 5 'coding region of a1P450R with a leading SalI restriction site (shown in uppercase).

GgcgGTCGAC tcc tctgtcagag agagcagctt tg (35 mer) a1P450R 3 ′ primer: SEQ ID NO: 17. It is a primer for the 3 'coding region of a1P450R.

Ctagctccac acgtccaggg agtag (24 mer) The two PCR fragments bFGF and alP450R are then digested with SalI, purified and subsequently ligated together. The ligated DNA was then used to prepare the mammalian expression vector pCI
It is subcloned into the Smal site of neo (Figure 7.3) (Figure 7.3).

In some cases, it is preferred that the domains of the protein be separated by a flexible linker. For example, but not limited to, the sequence (Gly-Gly-Gly-Gly-
Ser) ₃ (Somia et al., 1993 PNAS 90, 7889). This is a method well known to those skilled in recombinant DNA technology and protein expression.

For example, to place a flexiblelink between the junction of TTS and the alP450 or FN protein domain, the following fragment is generated using an alternative set of PCR primers.

Primer SalI-flexlink-alP450R: SEQ ID NO: 18. Bold sequences represent rare codons in highly expressed genes (Haas et al., 1996 Curr. Biol., 6, 315). The underlined sequence is the 5 'region of alP450R.

[0299] Example 4 Construction of bFGF-FN Expression Vector [FIG. 7.4] A cDNA fragment encoding a fusion protein product of an 18 kD bFGF protein (see FIG. 3B) and an FN domain (FIG. 2B) was obtained using a bFGF / PUC18 plasmid (R & D systems). And the FN fragment is obtained from plasmid pP450R.1 using the following primers:

BFGF Primer: See Example 3 for bFGF 5 ′ and 3 ′ primers.

FN 5'-c primer: SEQ ID NO: 21. This is the 5th of FN with a leading SalI restriction site.
'Coding region primer.

GgcgGTCGAC cgc cagtacgagc ttgtggtcca ca (35 mer) FN 3 ′ primer: SEQ ID NO: 13. 3 'coding region of FN fragment.

CTAGCTCCAC ACGTCCAGGG AGTAG (24 mer) The two PCR fragments bFGF and FN are then digested with SalI, purified and subsequently ligated to each other. The ligated DNA is then subcloned into the SmaI site of the mammalian expression vector pCIneo (FIG. 7.4).

To place a flexible linker between the bFGF and FN domains, use an alternative 5 ′ primer: Primer SalI-flexlink-FN: SEQ ID NO: 22 Bold sequences represent rare codons in highly expressed genes (Haas et al., 1996 Curr. Biol.,
6, 315). The underlined sequence is the 5 'region of FN.

Example 5 Construction of pAntp-alP450R Expression Vector [FIG. 7.5] SEQ ID NOS: 53 and 54. Antenna pedia protein homeobox peptide of Drosophila melanogaster (pAntp, Laughon et al., 1986 Mol. Ce
ll. Biol. 6: 4676).

A cDNA fragment encoding a fusion protein product of PAntp and alP450R was prepared by using a plasmid
PCR amplification of pAntp from p903G (Joliot et al., 1991 PNAS 88: 1864) and plasmid
Amplification of anchorless P450R from pP450R.1 is obtained using the following primers:

PAntp 5 'primer: SEQ ID NO: 23. This is the Kozak reading sequence (underlined)
Is a primer for the 5 'coding region of pAntp.

Cccgccgcca ccatgg aacg caaacgcgga aggcagacat (40 mer) pAntp 3 ′ primer: SEQ ID NO: 24. This is a primer for the 3 'coding region with a SalI restriction site.

GgcgGTCGACgtt ctccttcttc cacttcatgc gccga (38 mer) alP450R 5 'primer: SEQ ID NO: 16. It has a leading SalI restriction site
Primer for 5 'coding region.

GgcgGTCGACtcc tctgtcagag agagcagctt tg (35 mer) a1P450R 3 ′ primer: SEQ ID NO: 17. This is a primer for the 3 'coding region.

Ctagctccac acgtccaggg agtag The two PCR fragments pAntp and alP450R are then digested with SalI, purified and subsequently ligated together. The ligated DNA is then transferred to a mammalian expression vector p
It is subcloned into the Smal site of CIneo (Figure 8.5).

As described in the previous examples, alternative primers can be used to insert flexible linkers.

To enhance the secretion of the pAntp fusion from the cell, a secretion signal can be added to the N-terminus. A suitable signal is derived from the single chain antibody sequence of 5T4 (FIG. 3F).

The pAntp secretion 5 ′ primer: SEQ ID NO: 28. This places a Kozak translation initiation site and secretion signal at the 5 'end of the pAntp peptide. The sequence corresponding to pAntp is in upper case and the Kozak start sequence is underlined.

Ccaccatgggatgg agctgtatcatcctcttcttggtagcaacagctacaggtgtccactccaaacgcggaa
ggcagacaGAACGCAAACGCGGAAGGCAGACAT (105 mer) Example 6 Construction of pAntp-FN Expression Vector [FIG. 7.6] As in Example 5, the cDNA fragment encoding the fusion protein product of pAntp is pAntp.
Obtained by PCR amplification from a plasmid containing tp, such as p903G. The FN fragment (see FIG. 2B) is obtained from plasmid pP450R.1 using the following primers: See Example 5 for the 5 ′ and 3 ′ primers of pAntp.

See Example 4 for FN 5 ′ and 3 ′ primers.

The two PCR fragments pAntp and FN are then digested with SalI, purified and subsequently ligated together. The ligated DNA is then subcloned into the SmaI site of the mammalian expression vector pCIneo (FIG. 7.6). Alternatively, the pAntp secretion 5 'primer, SEQ ID NO: 28, can be used.

Example 7 Construction of VP-alP450R expression vector [FIG. 7.7] SEQ ID NOS: 55 and 56 Herpes simplex virus type 1 segment protein VP22 (Elliot and O'Hare 1997 Cell 88: 223, GenBank accession number: X14112) The fusion protein product of VP22 fused to alP450R was amplified by PCR from a plasmid containing VP-22, pGE109. And by PCR amplification from plasmid pP450R.1, using the following primers: VP225 5 ′ primer: SEQ ID NO: 29. This is a primer for the 5 'coding region with the Kozak reading sequence (underlined).

Cccgccgcca ccatg acctc tcgccgctcc gtgaag (36 mer) VP22 3 ′ primer: SEQ ID NO: 30. This is a primer for the 3 'coding region and contains a SalI restriction site.

GgcgGTCGACctc gacgggccgt ctggggcgag a (34mer) See Example 3 for the 5 'and 3' primers of alP450R.

The two PCR fragments, VP-22 and alP450R, are then digested with SalI, purified and subsequently ligated together. The ligated DNA is then subcloned into the Smal site of the mammalian expression vector pCIneo (Figure 7.7).

Example 8 Construction of VP-FN Expression Vector [FIG. 7.8] As in Example 7, a cDNA fragment encoding a VP22 fusion protein product (see FIG. 3D) was amplified from pGE109 by PCR amplification and an FN fragment (see FIG. 3D). FIG. 2B) is the plasmid pP450R.
Obtained from 1 using the following primers:

See Example 7 for VP22 5 'and 3' primers.

See Example 4 for FN 5 ′ and 3 ′ primers.

Subsequently, the two PCR fragments, pAntp and FN, were digested with SalI and purified, followed by
Connect with each other. Thereafter, the ligated DNA was transferred to the mammalian expression vector pCIneo S
Subcloning into the maI site (Fig. 7.8).

Example 9A Construction of 5T4scFv-PEA-alP450R Expression Vector [FIG. 7.9] Construction of this fusion protein involves PCR amplification of three DNA fragments and subsequent ligation to form a full-length insert. The first fragment encodes the protein product of a single chain variable antibody fragment against the tumor antigen 5T4.

[0327] SEQ ID NO: 26. 5T4 scFV coding sequence (Figure 3F). It is obtained from a convenient plasmid containing this sequence, pPs-5T4, by PCR using the following primers:

Fragment 1: 5T4 scFv 5T4 scFv 5 'primer: SEQ ID NO: 31. This primer provides the translation initiation and secretion signal regions from the 5T4scFv sequence (FIG. 3F).

Ccaccatggg atggagctgt atca (24-mer) 5T4scFv 3 ′ primer: SEQ ID NO: 32. This is a primer for the 3 'region of the 5T4scFv fragment with a HindIII restriction site.

GgccAAGCTTccg tttgatttcca gcttggag (32 mer) Fragment 2: PEA fragment SEQ ID NOs: 33 and 34. Protein of domain II of Pseudomonas aeruginosa exotoxin A (PEA, GenBank accession numbers K01397 and M23348) (FIG. 3E). This is obtained by PCR amplification using the following primers:

PEA 5′-primer: SEQ ID NO: 35. This is a primer for the 5 'coding region with a HindIII restriction site.

GgcgAAGCTTggc agcctggccg cgctgaccgcg ca (36 mer) PEA 3 ′ primer: SEQ ID NO: 36. This is a primer for the 3 'coding region with an EcoRI restriction site.

GgcgGAATTCgtt ggccgcgccc cggtcgtcgtt (34 mer) Fragment 3: alP450R The third cDNA encoding alP450R (see FIG. 2A) was transformed into plasmid pP by PCR amplification.
Obtained from 450R.1 using the following primers:

AlP450R 5'-primer: SEQ ID NO: 37. This is a primer for the 5 'coding region with an EcoRI site.

GgcgGAATTCtca gctcttagca gacattggaa g (34 mer) alP450R 3 ′ primer: As in SEQ ID NO: 17 of Example 3.

The first and second PCR fragments are digested with HindIII and then ligated together. afterwards,
The ligation product and the third PCR fragment are digested with EcoRI and ligated to form a full-length insert. The full length insert is subcloned into the SmaI site of the pCIneo expression vector (
(Figure 7.9).

Example 9B Construction of 5T4scFv-alP450R-MTS Expression Vector [FIG. 7.13] Construction of this fusion protein requires PCR amplification of three DNA fragments and subsequent ligation to form a full-length insert. The first fragment encodes the protein product of a single-chain variable antibody fragment against tumor antigen 5T4, as in Example 9A.

SEQ ID NO: 26. 5T4scFV The coding sequence of FIG. 3F. It is obtained by PCR from a convenient plasmid containing this sequence, pPs-5T4, using the following primers:

Fragment 1: 5T4scFv 5T4scFv 5 'primer: SEQ ID NO: 31. This primer provides a translation initiation signal and a secretory signal region from the 5T4scFv sequence (FIG. 3F).

Ccaccatggg atggagctgt atca (24-mer) 5T4 scFv 3 ′ primer: SEQ ID NO: 32. This is a primer for the 3 'region with a HindIII restriction site.

GgccAAGCTTccg tttgatttcca gcttggag (32 mer) Fragment 2: alP450R The second cDNA encoding alP450R (see FIG. 2A) was transformed into plasmid pP by PCR amplification.
Obtained from 450R.1 using the following primers:

AlP450R 5′-primer: SEQ ID NO: 38. This is a primer for the 5 'coding region with a HindIII restriction site.

GgccAAGCTTtca gctcttagca gacattggaa g (34 mer) alP450R 3 ′ primer: SEQ ID NO: 39. This is the 3 'of alP450R with EcoRI restriction site
Primer for coding region.

GccgGAATTCgct ccacacgtcc agggagtag (32-mer) Fragment 3: The third fragment encoding the MTS membrane translocation sequence (MTS) is obtained by PCR amplification using the following primers.

MTS 5′-primer: SEQ ID NO: 40. This is a primer for the 5 'coding region with an EcoRI restriction site.

GccgGAATTCgca gccgttcttc tccctgttct tcttgccgca ccc (46 mer) MTS 3 ′ primer: SEQ ID NO: 41. This is the primer for the 3 'coding region.

Ttagggtgcg gcaagaagaa cagggagaag aacggctgc (39 mer) The first and second PCR fragments are digested with HindIII and then ligated together. afterwards,
The ligation product and the third PCR fragment are digested with EcoRI and ligated to form a full-length insert. The full length insert is subcloned into the SmaI site of the pCIneo expression vector (
(Figure 7.13).

Example 10A: Construction of ST4scFv-PEA-FN expression vector [FIG. 7.10] The construction of this vector involves PCR amplification and subsequent ligation of these DNA fragments to construct an insert. The first fragment encodes the protein product of a single chain variable antibody fragment against the tumor antigen 5T4 and is obtained as in Example 9A.

A second cDNA fragment encoding the domain II protein of Pseudomonas aernginosa exotoxin A (PEA, GenBank accession numbers K01397 and M23348) is obtained as in Example 9A.

The PEA 5 ′ and 3 ′ primers are as in Example 9A.

A third cDNA fragment encoding FN (see FIG. 2B) is obtained by PCR amplification from plasmid pP450R.1, using the following primers: FN5 ′ primer: SEQ ID NO: 32. This is a primer for the 5 'coding region with an EcoRI restriction site.

GgcgGAATTCcgc cagtacgagc ttgtggtcca ca (35 mer) FN3 ′ primers: These are as in Example 4.

The first and second PCR fragments are digested with HindIII and then ligated together. The ligation product and the third PCR fragment are digested with EcoRI and ligated to construct a full-length insert. This full-length insert is subcloned into the SmaI site of the pCIneo expression vector [Fig.
.Ten].

Example 10B: Construction of 5T4scFv-FN-MT8 expression vector Construction of this vector involves PCR amplification and then ligating the three DNA fragments to construct an insert. The first fragment encodes the protein product of a single chain variable antibody fragment against the tumor antigen 5T4 and is obtained as in Example 9A.

The second fragment encoding FN (see FIG. 2B) is obtained by PCR amplification from plasmid pP450R.1, using the following primers: FN5 ′ primer: SEQ ID NO: 43. This is a primer for the 5 'coding region with a HindIII restriction site.

GgccAGGTTCcgc cagtacgagc ttgtggtcca ca (35 mer) FN3 ′ primer: SEQ ID NO: 44. This induces a 3 'coding region with an EcoRI restriction site.

The third fragment encoding gccgGAATTCcta gctccacacg tccagggagt ag (35 mer) MTS is obtained by PCR amplification as in Example 9B.

The first and second PCR fragments are digested with HindIII and then ligated together. Next, the ligation product and the third PCR fragment are digested with EcoRI and ligated to construct a full-length insert. This full-length insert is subcloned into the Smal site of the pCIneo expression vector [Figure 7.14].

Example 11: Construction of P4502B6 / FN fusion protein [FIG. 7.11] SEQ ID NO: 33 P4502B6 coding region (Yamano et al. 1989 Biochemistry, 28, 7340;
GenBank accession number JO2864) (Figure 4). This was converted from NheI to Xho using the following primers:
Subcloning into pCI-Neo as an I fragment.

2B6Nhe5 ′ primer: SEQ ID NO: 34 ggcgGCTAGCcagaccatggaactcagcg (29 mer) 2B6 3 ′ primer: SEQ ID NO: 35 This primer has a modified C-terminus of the protein by removing the stop codon and replacing it with an XhoI site. This PCR fragment is digested with NheI and XhoI and subcloned into pCINeo to produce pCI-Neo containing truncated P450.

GgcgCTCGAGgcggggcaggaagcggatctgg (32 mer) A flexi-linked FN fragment is constructed using the following primers.

Flexi-FN5 ′ primer: SEQ ID NO: 36. This is the SalI restriction site followed by the N of the FN fragment.
A variable linker at the end is placed. Rare codons in this linker are in lower case and the sequence in FN is underlined. The SalI site is the case above.

[0363] FN3 ′ primer: same as in Example 4 CTAGCTCCAC ACGTCCAGGG AGTAG (24mer) 2B6 PCR fragment was digested with NheI and XhoI, ligated to the FN fragment digested with SalI, this fragment was purified and then digested with XhoI / SmaI Link to pCIneo [Figure 7.11].

Example 12: Construction of dual expression cassette of P450 and P450R [FIG. 7.12] P4502B6 is subcloned as a NheI / XhoI fragment into pCINeo using the following primers: 2B6 Neo5 ′ primer: SEQ ID NO: 37 ggcgGCTAGC cagaccatggaactcagcg 2B6 Terminal 3 'primer: SEQ ID NO: 38. This primer has a true translation termination signal.

5 ′ ggcgCTCGAG tcagcggggcaggaagcggatctgg SEQ ID NO: 39. Internal ribosome entry site from FMDV R100 (IRES, FIG. 5, Escarmis et al., 1992 Vinus res. 26, 113).

This is inserted into the XhoI site of the plasmid pCI-Neo containing the 2B6 sequence as described above.
Using appropriate 5 ′ and 3 ′ primers from the sequence shown in FIG. 6, IRES was converted to XhoI /
Isolated as a SalI fragment. The resulting plasmid was digested with SalI and X derived from P450R.1.
Insert the hoI / SalI fragment. The final configuration is shown in Figure 7.12.

Example 13: Construction of a dual expression cassette for P450 / FN and VP-FN A combination of a coding region having an active portion of P450 and P450R is constructed. For example, P45
There is co-expression of 0FN and VP-FN.

The fusion construct described in FIG. 8.8 of Example 8 was inserted into the HpaI site of the retroviral vector COI (FIG. 6b), and the fusion construct described in FIG. 7.11 of Example 11 was inserted into the XhoI site of the COI. Enter. This results in cyclophosphamide, tirapazamine and mitomycin.
A vector conferring C-maximal sensitivity results (FIG. 8).

Example 14A: Construction of Retrovirus Vector Expressing Modified Prodrug Activating Enzyme An RRV is prepared using a packaging cell line system such as FLYRD18 (Cosset et al.). The plasmid vector containing the vector genome to be packaged is transfected into the packaging cell line as described (Cosset FL et al., 1995, J Virol 69, 7430-7436) to obtain a producer cell line. A suitable plasmid containing the vector genome is pHIT111 (Soneoka Y et al., 1995, Nucl Acids Res 23,
628-633). Using standard molecular biology techniques, insert the required therapeutic gene in place of the LacZ gene in pHIT111. Similarly, in place of the retroviral enhancer, regulatory and / or enhancer elements such as HRE may be replaced with pHIT111.
Into the retroviral LTR in the cell to ensure that the expression of the therapeutic gene is regulated. This plasmid is then co-transfected into FLYRD18 cells (eg, pSV2neo) with the appropriate selectable marker gene, and the transfected cells are selected in 1 mg / ml G418 (Sigma). Another vector is PKAHRE, a single transcription unit vector based on MLV (FIG. 6). The expression of the therapeutic gene is controlled by a hypoxia responsive promoter (3xPGK, Dachs et al., Op. Cit.). The gene encoding the prodrug activating enzyme is replaced with the indicated nlsLAcZ. An alternative vector that is particularly suitable for expression of multiple transcription units is COI (FIG. 6). This is an MLV-based vector with a CMV enhancer (dotted box) in place of the MLV enhancer. The gene encoding the prodrug activating enzyme is inserted into either the Bam / Sal / Hpa polylinker or the Stu / Xho polylinker. If necessary, the end of the fragment to be inserted is modified with a suitable linker to create a suitable compatible restriction site. Alternatively, various genes can be inserted into each polylinker site.
(FIG. 8).

Alternatively, a lentivirus may be used, which is described in more detail in Example 14B.

Example 14B Construction of EIAV Vector Genome Expressing P450 Construction Details peg HRElacZ is described in Patent Application No. 9901906.9, and is repeated below. pE
GASUS4 (or pEGASUS1), pONY4.0, pONY4.1, pONY3.1, pHORSE3.1 are PCT / GB98 / 0
3876, but also described below.

A trimer containing the -307 / -290 sequence of mouse PGK in the native orientation linked to the OBhrel SV40 promoter (Firth et al., 1995) (italic).

[0373] This promoter sequence is defined as OBhrel. The resulting plasmid is called plasmid OB37.

The pEGASUS-4 (or pEGASUS-1) hypoxia responsive promoter is a lentiviral vector pEGASUS-1 (or pEGASUS-
4 (+)) and the related vector pONY2.1. Both are derived from the infectious provirus EIAV clone pSPEIAV19 (Payne et al., 1998; accession number U01866). The construction of these plasmids is described below (UK patent application 97271).
Excerpt from 35.7).

The pONY2.1 plasmid pONY1 was constructed by inserting the ELAV 5 ′ LTR into pBluescript II KS ⁺ (Stratagene). The ELAV 5 'LTR is composed of pfu polymerase and the following primers: 5'GCATGGACCTGTGGGGTTTTTATGAGG and 3'GCATGAGCTCTGTAGGA
It was amplified by PCR from pSPEIAV19 using TCTCGAACAGAC. The amplified product was blunt-ended by filling in the 5 'overhang, and inserted into BssHII-cut pBluescript II KS ⁺ , which was blunt-ended by removing the 3' overhang using T4 DNA polymerase. This construct was called pONY1 and its orientation was 5 ′ → 3 ′ to β-galactosidase of pBluescript II KS ⁺ . Sequencing of pONY1 revealed no mutations.

The env region of pSPEIAV19 was deleted by removing the HindIII / HindIII fragment, thereby preparing pSPEIAV19ΔH. Next, the MluI / MluI (216/8124) fragment of pSPEIAV19 △ H was inserted into pONY1 cut with MluI to prepare a wild-type provirus clone (pONY2 △ H) in pBluescript II KS ⁺ . BssHII digestion of pBluescript II KS ⁺ (619/792) yielded a multiple cloning site. This was blunt ended by filling in the 5 'overhang, cut with BglII and NcoI (within 1901/4949 pol), blunt ended by filling in the 5' overhang and ligated into pONY2ΔH. The direction is 3 'to the EIAV sequence.
5 '. This was called pONY2.1.

PSPCMV was added to pSP72 (Promega; Genbank accession number X65332) with pLNCX (Genbank accession number M2).
8246) (PstI / HindIII). The β-galactosidase gene was inserted from pTIN414 (Cannon et al., 1996) into pSPCMV (XhoI / SphI) to generate pSPlacZ. The 5 'end of the β-galactosidase gene is pAD.RSVbgal (Stratford-Perri
caudet et al., 1992) and replaced with the SV40T antigen nuclear localization signal, pSPnlslacZ (Xho
I / ClaI). The CMV nuclear-localized and non-nuclear-localized β-galactosidase from pSPlacZ and pSPnlslacZ was excised with PstI, and in the 5 ′ → 3 ′ direction of EIAV, the Ps of pONY2.1 was removed.
Inserted at the tI site. These were called pONY2.1nlslacZ and pONY2.1lacZ.

PEGASUS-1 This is an EIAV-based vector containing only 759 nt of the EIAV sequence (268nt-675nt and 7942nt-8292nt). Using the primers PPTEIAV + (Y8198): GACTACG ACTAGT GTATGTTTAGAAAAACAAGG and 3 ′ NEGSpeI (Y8199): CTAGGCT ACTAGT ACTGTAGGATCTCGAGAAG, pONY2.1 to P
Obtained by CR amplification. This product was purified, digested with SpeI, ligated into pBSII KS ⁺ prepared by digestion with SpeI and treating with alkaline phosphatase. E. coli
The colonies obtained after transformation into XL-1Blue were screened for those in which the 3'LTR was present in the direction in which the U5 region of the 3'LTR was distal to the NotI site of the pBSIIKS ⁺ linker. The cloned insert was sequenced and shown to contain only one mutation from the EIAV clone pSPEIAV19. This was an insertion of a "C" between bases 3 and 4 of the R region. The same mutation was found in the template used in the PCR reaction. This clone was called pBS.3'LTR.

Next, the reporter gene cassette CMV promoter / LacZ was inserted into the PstI site of pBS.3′LTR. The CMV / LacZ cassette was obtained as a PstI fragment from pONY2.1. The ligation reaction that ligated the fragments was transformed into E. coli XL-1 Blue. The CMV / LacZ insert was transfected into cell line 293T using standard methods by transfecting several clones with the LacZ gene distal to the 3 'LTR, using standard methods.
The activity of the cZ cassette was evaluated. Clones showing blue cells 48 hours after transfection after development with X-gal were selected for further use and pBS
Called CMVLacZ.3'LTR.

By including approximately 400 base pairs from the 5 ′ end of the full length CMV promoter as defined above, the expression vector pCI-ENeo, an inducer of pCI-Neo (Promega; Genbank accession number U47120) The 5 ′ region of the EIAV vector was constructed therein. This 400 bp fragment was prepared using primers VSAT1 (GGGCTATATG AGATCT TGAATAATAAAATG TGT) and VSAT2 (TATTAATA AC TAGT ) and pHIT60 as template (Soneoka et al., 1995).
Obtained by CR amplification. This product was digested with BglII and SpeI and similarly digested pCI-N
Connected to eo.

An EIAV genomic fragment spanning the R region to nt 150 of the gag coding region (nt 268 to 675) was
Using pSPEIAV19 as template DNA, primer [The underlined sequence anneals to the EIAV R region.]) And 3'PSLNEG (GCTGAGC TCTAGA G
TCCTTTTCTTT TACAAAGTTGG). The 5 'region of primer CMV5'EIAV2 contains the sequence immediately upstream of the transcription start site of the CMV promoter and can be cut with SacI (bold). 3 '
PSINEG binds 3 'of the EIAV packaging sequence determined by deletion analysis and Xb
Includes aI site.

The PCR product was truncated with SacI and XbaI and ligated into pCI-Eneo prepared for ligation by digestion with the same enzymes. By this operation, the start site of the EIAVR region is located at the transcription start site of the CMV promoter, and the transcript thus generated is used for EIAV to extend to the 3 'side of the packaging signal and to the true start position. Placed on the site. Clones that were deemed correct when evaluated by restriction analysis were sequenced. A clone called pCI-Eneo 5'EIAV was selected for further study.

In the next step, the CMVLacZ and 3 ′ LTR cassettes of pBS.CMVLacZ.3′LTR were transferred to pCI-Eneo.
Introduced to 5'EIAV. pBS.CMVLacZ.3'LTR was digested with ApaI, the 3 'overhang was removed with T4 DNA polymerase, and then digested with NotI. The fragment containing the CMVLacZ.3'LTR was purified by standard molecular biology techniques. A vector for ligation with this fragment was made from pCIEneo.5'EIAV by digesting with SalI and then filling in the 5 'overhangs with T4 DNA polymerase. This DNA was then digested with NotI and purified before use in the ligation reaction. After transformation into E. coli XL-1Blue, colonies were screened for the presence of the insert by restriction analysis to identify the required clone, designated pEGASUS-1 (actually the EIAV R-U5-psi region). EIAV just downstream
See the one that shows the mutant pEGASUS-4 (+) of pEGASUS-1 containing RRE (see below for details).

Further improvements were made to the EIAV vector pEGASUS-1 by introducing additional elements to enhance the pEGASUS-4 (+) titer. A convenient site for the introduction of such an element is between XbaI and 3 ′ of the packaging signal, and the CE of pEGASUS-1.
There is a SalI site upstream of the MV / LacZ cassette. For example, an RRE from EIAV can be inserted into this site.

The EIAV RRE as defined above was obtained by PCR amplification as follows. EIAV
To obtain two parts of RRE, two amplifications were performed using pONY2.10LacZ as template. The 5 'element is obtained using primers ERRE1 (TTCTGTCGACGAATCCCAGGGGGAATCTCAAC) and ERRE2 (GTCACCTTCCAG AGGGCCCTGGCTAAGCATAACAG), and the 3' element is ERRE3 (CTGTTATG CTTAGCCAGGGCCCTCTGGAAGGTGAC) and ERRE4 (AATTGCTGACCCC
CAAA ATAGCCATAAG). As these products anneal to each other, they can be used in a second PCR reaction to obtain DNA "encoding" the EIAV RRE. In the second PCR amplification, the first 10 cycles are set without using the primers ERRE1 and ERRE4, then these primers are added to the reaction solution, and the amplification is further performed for 10 cycles. The obtained PCR product and pEGASUS-1 were digested with SalI, ligated, and transformed into Escherichia coli XL-1Blue. Clones in which the EIAV RRE was in either positive or negative orientation were selected for further study. These vector plasmids were called pEGASUS-4 (+) (see FIG. 20) and pEGASUS-4 (-).

PONY HRE luc / lac The CMV promoter of pONY2.1 was excised as an XbaI / AscI fragment and replaced with an oligonucleotide containing a MluI / XbaI site. As a result, the MluI / XbaI fragment isolated from OB37 is inserted, and pONY HRE luc / lac is produced. Luciferase coding sequence
It is removed as an NcoI fragment and the backbone is religated to create pONY HRElac. Similarly, l
The acZ is removed as XbaI / SalI, then the backbone is religated to create pONY HREluc.

The pEGHRELacZ / luc CMP promoter lacZ cassette is excised from the EIAV vector plasmid pEGASUS-1 with EcoRI and replaced with a synthetic oligonucleotide containing SacI and Bsu36 sites. This resulted in pONY HRE luc as SacI / Bsu36 and SacI / EcoRI fragments, respectively.
And cloning of the HREluc / HRE lac cassette derived from pONY HRE lac. The final vectors are called pEG-HRE-lacZ and pEG-HRE-luc.

Using a similar approach, the pEGHRE vector may be constructed to express a therapeutic gene, such as any of the therapeutic genes listed above, in place of the lacZ or luc genes. These were pEG-HRE-lacZ or SacI / Bsu36 and SacI / EcoRI, respectively.
The lacZ / luc fragment may be excised from pEG-HRE-luc and cloned into the pEGHRE vector by ligating a suitable fragment containing the coding sequence. An example of a therapeutic gene that can be used is the gene encoding the anti-angiogenic factor thrombospondin-1 (Genbank accession number X04665).

To construct a replication-incompetent EIAV vector system, we started with the infectious proviral clone pSPEIAV19 described by Payne et al. (1994, J Gen Virol. 75: 425-9). (Accession number U01866) was used. The first vector based on EIAV corresponds to coordinates 5835/6571 according to the numbering system of Payne et al. (Ibid).
It was constructed by simply deleting the env portion by removing the HindIII / HindIII fragment. This fragment was converted to pTIN500 (Cannon et al. 1996 J. Virol. 70: 8234-8240
) Was replaced with a puromycin resistance gene under the control of the SV40 early promoter to create pESP.

Thus, a further vector system comprising three transcription units was constructed, producing the following: 1) vector genomic RNA; 2) env and 3) gag-pol. To ensure that each component was fully produced, the env and gag-pol transcription units were transcribed from promoter-enhancers active in the selected human packaging cell line. In this way, sufficient gag-pol and, most likely, tat is produced to ensure sufficient production of transducible vector particles.

A vector genome having a reporter gene in the pol region of the genome was constructed as follows. The plasmid represented by pONY1 was constructed by inserting the EIAV LTR amplified by PCR from pSPEIAV19 into pBluescript II KS + (Stratagene). The 5 'LTR of the EIAV clone pSPEIAV19 was amplified with the following primers: 5' GCATGGACCTGTGGGGTTTTTATGAGG 3 'GCATGAGCTCTGTAGGATCTCGAACAGAC with pfu polymerase.

The amplification product was blunt-ended by filling in the 5 ′ overhang, and blunt-ended by removing the 3 ′ overhang using T4 DAN polymerase, Bss HII-cut pBluescri.
Inserted into pt II KS +. This construct is called pONY1 and its orientation is pBluescript II
5 ′ → 3 ′ for β-galactosidase of KS +. Sequencing of pONY1 revealed no sudden mutations.

The pSEIAV19 env region was deleted at the HindIII / HindIII sites to create pSPEIAV19DH. The vector genome pSPEIAV19DH was cut with MluI (216/8124) and cut with MluI (21
6) Inserted into pONY1 to make pONY2. Bss HII digestion of pBluescript II KS + (619/79
2) was performed to obtain a plurality of cloning sites. It was blunt-ended by filling in the 5 'overhang, cut with Bgl II and Nco I (1901/4949), and ligated to pONY2, which was blunt-ended by filling in the 5' overhang. Its orientation is 3 with respect to the EIAV sequence
'→ 5'. This was called pONY2.1. pSPCMV is pLNCK (Accession number M28246) (Ps
tI / HindIII) was inserted into pSP72 (Promega). The β-galactosidase gene was converted from pTIN414 (Cannon PM et al., J. Virol. 70, 8234-8240) to pSP72 (XhoI
/ Spn I) to produce pSPlacZ. p-terminal 5'-end of β-galactosidase gene
Replaced with SV40T antigen nuclear localization signal from AD.RSVbgal (J. Clin. Invet. 90: 626-630, 1992). pAD.RSVbgal was cut with XhoI / ClaI and inserted into XhoI / ClaI pSPlacZ to produce pSPnlslacZ. Cleavage of CMV nuclear-localized and non-nuclear-localized β-galactosidase from pSPlacZ and pSPnlslacZ with Pst I, in the 5 ′ → 3 ′ direction of EIAV,
It was inserted into the PstI site of pONY2.1. These were called pONY2.1nlslacZ and pONY2.1lacZ.

The gag-pol gene is expressed from the hCMV-MIE promoter-enhancer. In particular, gagpol pSPEIAV19DH was cut with Mlu I (216/8124) and Mlu I cut (216) pCI-Neo (Pro
mega)) to produce pONY3.

The vector genome pONY2.1lacZ contains 1377 nt of gag. RNA secondary structure prediction () was used to identify potential core loop structures in the leader and the 5 'end of gag. Based on these predictions, four deletions were made in the gag region of pONY2.1lacZ. Deletions were made by PCR mutagenesis using standard techniques.

PONY2.11lacZ pONY2.11lacZ contains 1377 nt of gag (deletion from position 1901 nt).

PONY2.11lacZ contains 354 nt of gag (deletion from position 878 nt).

PONY3.1 In pONY3, there is an extended 5 'untranslated region before the start of the gagpol coding sequence. This unique long sequence is thought to attenuate the expression of the gagpol cassette.
To improve gagpol expression, pONY3 is modified to remove the remaining 5 'LTR.
This is done by cutting pONY3 with Nar I and EcoRV. This 2.4 kb fragment is called pB
Inserted into the Cla I and EcoRV sites of luescript KS + (Stratagene), construct pBSpONY
Make 3.0. Cut pBSpONY3.0 with XhoI and EcoRV. This 2.4kb fragment is p
Insertion into Xho I and Eco RV of ONY3 to create pONY3.1.

By this operation, the 5 ′ LTR up to the Nar I site in the primer binding region (386nt) is removed. This construct doubles the titer and increases protein expression (FIG. 9).

Like pONY3, pONY3.1 encodes gag, gagpol, Tat, S2 and Rev. Since S2 mutagenesis experiments showed that S2 was not required in either the production system or the EIAV vector genome, gagpol expression constructs without S2 could be designed. The two constructs pHORSE and pHORSE3.1 are made.

PHORSE pHORSE uses pONY3 as the template DNA to prepare EGAGP5'OUTER / EGAGPINNER3 and EGAGP
Prepared by PCR amplification with 3'OUTER / EGAGPINNER5. Purify two PCR products,
Pool and re-amplify using primers EGAGP5'OUTER / EGAGP3'OUTER. This product is inserted into the XhoI and SalI sites of pSP72 to create pSP72EIAVgagpolO'lap. pONY3 is cut with PvuII and NcoI and the 4.3 kb fragment is inserted into pSP72EIAVgagpolO'lap cut with PvuII and NcoI to create pSPEGP. This is Xho I and S
Cut with al I (4.7 kb) and insert into XCI and Sal I sites of pCI-Neo. This construct is called pCIEGP. RRE is excised from pEGASUS with Sal I (0.7 kb) and inserted into the Sal I site of the pCIEGP construct to produce pHORSE.

When this construct is assayed for protein expression in the presence or absence of pCI-Rev (construct expressing the EIAV Rev open reading frame, see above), Rev dependence is observed as expected. . However, protein expression is significantly lower than from pONY3.1. Furthermore, when used for virus production, the titer is found to be 100 times lower than that from pONY3.1.

PHORSE3.1 Unexpectedly, the leader sequence of pONY3.1 (gag383-524n from the end of U5 of the 5 ′ LTR)
tOR (including the sequence up to the start of ATG) into pHORSE to create pHORSE3.1,
Improved protein expression and virus production. pHORSE3.1, pHORSE 1.5 kb XhoI
It is made by replacing / XbaI with the 1.6 kb XhoI / XbaI of pONY3.1. pHORSE3.
The titer obtained by 1 is the same as for pONY3.1. The slightly lower titer of pHORSE3.1 compared to pONY3.1 may be due to the need for co-transfection of the four plasmids with pHORSE3.1 (due to the Rev dependency of this system). Thus, it can be concluded that a minimal EIAV vector system should have this leader in order to obtain maximum gagpol expression.

PONY4 and pONY4.1 pONY2.11 lacZ contains a deletion of gag such that only the 373 bp gagORF remains. pONY4 is
It was created by replacing the 5 'LTR with the CMV LTR from pEGASUS-1. PEGASUS-1
Was digested with Bgl II / Xho I to release a 3.2 kb fragment (including the CMV LTR).
Inserted into pSP72 cut with / XhoI. This construct was named pSPPEG213. this
PONY digested with Hpa I / Nar I and digested with 1.3 kb fragment (including CMV LTR) with Nae I / Nar I
2.11 Inserted into lacZ. pONY4.1 is located downstream of the lacZ gene (between the Sfu I and Sal I sites).
Includes deletions (2.1 kb) where tat, S2, env, rev and RRE have been removed or significantly truncated. pONY4.1 was prepared by cutting with Sfu I / Sal I, blunt-ending with Klenow polymerase, and religating. pONY4G, pONY4 l
By replacing the acZ gene (Sac II / Kpn I and then blunted with Klenow polymerase) with that of GFP from pEGFP-N1 (Clontech) as a blunt fragment (HI / Xba I then blunted with Klenow polymerase) Produced.

Cleavage pegHRElacZ with the inducible HRE pEGHREP450 NotI (HRE enhancer / SV40 promoter and lacZ
The 3.9 kb fragment containing the gene is purified). This fragment was then cut with NotI pBluesc
Insert into ript KS + (Stratagene) to create pBHRElacZ. The direction is such that the lac Z gene and the Amp gene are in the same direction. Here, this plasmid can be used to insert any nucleotide sequence of interest instead of lacZ via the NcoI / sphI site under the control of HRE. This cassette can then be inserted into the EIAV vector genomic plasmid pegHRElacZ via the Not I site.

The P450 is PCR amplified using primers 5 ′ P450 and 3 ′ P450 (accession number M29874, also known as CYP2B). The target for PCR may be liver cDNA or a plasmid containing P450.

5 ′ P450 (SEQ ID NO: 59) TTTTCAGA CCATGG AACTCAGCGTCC (underlined = Not I) 3 ′ P450 (SEQ ID NO: 60) ATC GCATGC TCAGCGGGGCAGGAAGCGGATC (underlined = SphI) P450 PCR fragment was cut with NcoI, and 0.3 kb fragment Was purified and cut with NcoI
Insert into cZ. This gives the plasmid pBHREP450del. This PCR fragment is
AtII / SphI digested, 1.3 kb fragment, AatII / SphI digested plasmid pBHREP
Insert into 450del (3.9 kb purification). This gives the plasmid pBHREP450. This is cut with Not I and inserted into Not I cut pegHRElacZ to obtain pegHREP450.

PONY4HREP450 pBHREP450 was cut with NotI / sphI to release a 1.8 kb HREP P450, which was
PONY4, which can be blunt-ended with A polymerase, and cut with Pst I to blunt-end.
Insert into 0 to obtain pONY4HREP450.

PONY4.1HREP450 pBHREP450 was cut with NotI / sphI to release a 1.8 kb HRE P450, which was
PONY4, which can be blunt-ended with A polymerase, and cut with Pst I to blunt-end.
Insert into 1 to obtain pONY4.1HREP450.

The constitutive CMV pEGASUS4P450 pBHREP450 was cut with BsmI / SphI to give a 1.5 kb fragment, which could be blunt-ended with T4 DNA polymerase, cut with XhoI / SplI, and blunted with T4 DNA polymerase. Insert into the terminated pEGASUS4 to create pEGASUS4P450.

PONY4.0P450 pBHREP450 was cut with BsmI / SphI to give a 1.5 kb fragment, which could be blunt-ended with T4 DNA polymerase, cut with XhoI, and blunt-ended with T4 DNA polymerase.
Insert into Y4.0 to create pONY4.0P450.

PONY4.1P450 pBHREP450 was cut with BsmI / SphI to give a 1.5 kb fragment, which could be blunt-ended with T4 DNA polymerase, cut with XhoI, and blunt-ended with T4 DNA polymerase.
Insert into Y4.0 to create pONY4.1P450.

Production VSV-G pseudotyped EIAV The above vector genome can be used for co-transfection of three plasmids with the EIAV gagpol expression plasmid pONY3.1 and the VSV-G envelope to produce an EIAV virus vector.

Due to the toxicity of VSV-G, it is necessary to have some form of expression regulation. Temperature sensitive VSV-G cell lines are described in TE671.

A tet induction system has also been described (J Virol 1999 Jan; 73 (1): 576-84 Apacka).
ging cell line for lentivirus vectors. (Kafri T, van Praag H, Ouyang L, Gage FH, Verma IM.).

Rabies-G pseudotyped EIAV The above vector genome can be used for co-transfection of three plasmids with the EIAV gagpol expression plasmid pONY3.1 and the rabies-G envelope to produce an EIAV virus vector.

[0417] Example 15: Enhanced prodrug-activating enzyme in laboratory scale by standard techniques using the monocyte / macrophage or stem cells for delivering (Sandlie and Michaelsen 1996 "Antibody Technology: A Practical Approach (Antibody engineering: a practical approach) "Mc
Cafferty et al., Eds., Chapter 9), and on a large scale (e.g., CellPro
Peripheral blood mononuclear cells are isolated from human peripheral blood. By increasing the density of adherent cells (especially monocytes) by attaching to plastic overnight, and culturing the adherent cells for one to three weeks, cells can be differentiated along the macrophage differentiation pathway. Alternatively, the density of cells can be increased by CD14 immunomagnetic cell sorting. CD14: LPS and LBP receptors (Wright SD et al. (1990) Science 249: 1
431). By this method, 95-99% purity from peripheral blood and> 90 without loss of viability
Separation yields can be obtained with% recovery. Using a variety of transfection methods, including particle-mediated DNA delivery (biolistics), electroporation, and cationic material-mediated transfection (e.g., using Superfect, Qiagen) Alternatively, the vector can be introduced into monocytes or macrophages. Each of these methods is performed according to the manufacturer's instructions, taking into account the parameters to be modified to obtain optimal results as specified by the individual manufacturer.
Alternatively, defective adenovirus vectors (Microbix Inc or Quantum Biotechno
logies Inc) or a viral vector such as a retroviral vector such as those described in FIG.

[0418] Stem cells were obtained from G-CSF and / or cyclophosphamide (Cassel et al. 1993 Exp Hema
After mobilization according to tol. 21, 585), it is collected from peripheral blood. G-CSF (Amgen) is administered subcutaneously at a dose of 10 g / kg / day for 7 days. Apheresis and enrichment of stem cells is performed using the CellPro stem cell separator system (Cassel et al., Supra). The enriched stem cell population was treated with 4 g / ml protamine sulfate and 20 ng / ml IL-3 (Sandoz), 50 ng / ml IL-6 (Sandoz
), 100 ng / ml in the presence of SCF (Amgen), and cultured at 10 ⁵ cells / ml in spent culture medium of PPV producer cells (Example 1) (Santiago-Schwartz et al 1992, J. Leuk. Biol. 52
Charboed et al., 1996, Br. J. Haematol. 94, 449; Dao et al., 1997, Blood, 8
9, 446; Piacibello et al., 1997 Blood 89, 2644). Dunbar et al. (1996 Hum Gene Ther
Other cytokines and / or autologous stromal cells prepared as described in 7, 231) may be added. After 24 hours, the cells are centrifuged and resuspended in fresh RRV containing medium containing growth factors and protamine sulfate as described above. 2 more
This operation is repeated after 4 hours, and the cells are further cultured for up to 48 hours. The cells were then trypsinized and plasma light A (Plasma-Lyt
e Wash several times in fresh medium by resuspension in A). Total reinfusion volume is approximately 25
~ 50ml. Inject into the patient for up to 2 hours. The number of cells to be injected should be at least 10 ⁵ cells, up to the order of 10 ¹² .

Cells can also mature along the bone marrow differentiation pathway prior to re-infusion according to published methods (Haylock et al. (1992) Blood 80: 1405-1412).

[0420] Monocytes, macrophages or stem cells are transfected with an expression vector capable of expressing the enhanced prodrug activating enzyme in human cells. Retroviral vectors including the lentiviral vectors described above are preferred.
For constitutive high level expression, the hCMV-MIE promoter-enhancer pCI (Pr
omega) to express enhanced prodrug activating enzymes. For hypoxia-induced expression, the hCMV promoter is replaced with a promoter containing at least one HRE.

Example 16: Sensitivity of human tumor cells containing modified prodrug activating enzyme to cyclophosphamide, tirapazamine and mitomycin C. Human tumor cell lines (Houlbrook et al. 1994, Oncol (Life Aci. Adv.) 13, 69). ) Is Ameri
Obtained from can Type Culture Collection and grown as a monolayer in RPMI 1640 medium supplemented with 2 mM glutamine and 10% (v / v) fetal calf serum.

Using the technique of electroporation as described in Patterson et al. (Ibid), plasmids are introduced into human cancer cell lines, particularly breast cancer MCF-7, MDA468, T47D and NSCLC cell lines. Conveniently, exponentially growing cells are harvested with a cell scraper,
After washing, a `` cytomix '' buffer (Van den Hoff et al. 1992, Nucl.
Res. 20, 2902. Resuspend 5 × 10 ⁶ cells with 10 μg of linearized plasmid) and electroporate at 4 ° C., 960 μF, 280 V, BioRad. Cells are plated at low density and selected for survival in antibiotic G418. Individual G418 resistant colonies are picked and expanded to produce independent clones. These clones are analyzed for the subcellular distribution of the P450R protein and further below and for the enzymatic activities described by Patterson et al. Alternatively, the gene is delivered by retroviral transfection of the cells described by Soneoka et al. (Supra).

To assay for P450 reductase, first 10 mM HEPES (pH 7.4), 1 mM EDTA, 0 mM
Prepare cell lysates by freezing and thawing cells in liquid nitrogen in a buffer containing 0.5 mM benzamide, 0.5 mM PMSF, 1 μg / ml trypsin inhibitor. 1600
g, remove residue by centrifugation at 4 ° C. Divide the resulting supernatant into two aliquots. One aliquot is stored as a complete cell lysate after adding glycerol to 10%. The other aliquot is centrifuged at 105,000g for 45 minutes at 2 ° C. The resulting membrane pellet is dried and resuspended in TRIS buffered saline (pH 7.4).

P450 reductase activity is determined spectrophotometrically by measuring NADPH-dependent reduction of cytochrome c. Reactions were 400 μl cytochrome c (50 μM final concentration), 100 μl 10 mM KCN (1 mM final concentration) and 10-300 μg protein lysate (whole cell lysate or membrane fraction (10-100 μl) Capacity)). 100 mM of this reaction
Make up to 100 μl with phosphate buffer pH 7.6. The reaction was equilibrated to 37 ° C and 20 μl of 10 mM N
Start by adding ADPH (final concentration 200 μl). The reduction rate of cytochrome c is NAD
Monitor for 3 min at 550 nm against a blank without PH. The initial rate of the reaction is calculated and expressed as reduced cytochrome c (nmol / min / mg dissolved protein) assuming an extinction coefficient of 21 mM ^-1 . The concentration of P450 is determined from the CO (carbon monoxide) binding spectrum (Omura and Sato, 1964, J. Biol. Chem. 239, 2370).

The location of the enzyme in the cells is analyzed by confocal microscopy. The cells are grown on coverslips for analysis by confocal microscopy. The cell monolayer is washed, fixed with 1: 1 acetone: ethanol, blocked with 0.1% BSA, and then
Rabbit anti-human P450 reductase polyclonal antibody (Smith GCM, Tew
After incubation with DG and Wolf CR 1994 PNAS USA 91 8710-8714), the cells are treated with an anti-rabbit IgG FITC-conjugated secondary antibody (Becton Dickinson). Transfer cells to BioRad M
Check using RC1000 or MRC1004. Distribution of wild-type P450R, alP450R and FN
Compare with the distribution of LS derivative.

The prodrug sensitivity of the cells is analyzed as follows.

I) Tirapazamine IC ₅₀ Tirapazamine is described by Seng and Ley (1972, Angew., Chem., Int. XI. 1009) and Adams et al. (1984, Br. J. Cancer, 49, 571). Synthesize using standard chemical techniques.

A dose response curve is determined using the MTT proliferation assay. This is based on the ability of viable cells to convert soluble tetrazolium salt MTT to purple formazan crystals (Mossman 1983 J. Immunol. Methods. 65, 55). Incubating the parallel 96-well plates containing 10 ³ cells / well Cells were seeded at a density of up to 8 days. The plates are assayed daily for formazan production, and cell numbers are obtained from a standard curve of optical density versus cell number generated daily. The IC ₅₀ value, the concentration of drug required to reduce the optical density by 50% relative to the untreated control, is used as a measure of the sensitivity of the cells to a particular treatment. The cells are exposed to tirapazamine for 3 hours under hypoxic conditions and grown for 96 hours prior to the MTT assay. Hypoxia is generally maintained as described by Patterson et al. 1995 (ibid.), Modified by Patterson et al. I do.

Ii) Cyclophosphamide IC ₅₀ Cyclophosphamide (CP) is obtained from Sigma Chemical Company. Plate 4 × 10 ⁴ cells per well of a 6-well culture dish for drug sensitivity testing. Add CP 20 hours after sowing. The cells are allowed to grow for up to 7 days. Final viable cell numbers are determined by the MTT assay described above or by staining live cells with trypan blue dye exclusion as described by Chen et al. (1996 supra).

Iii) Mitomycin C (MMC) IC ₅₀ Mitomycin C is obtained from Sigma Chemical Company. For drug sensitivity testing, 5 × 10 ³ cells are plated in wells of a 96-well microtiter plate, and after 16 hours, they are treated with MMC diluent for 3 hours. Cells are grown for 7 days and cell viability is then assayed by the MTT assay described above (Bligh et al. 1990 supra).
.

Example 17: Analysis of Bystander Effect by Co-Culture Cells engineered to express the TTS-P450R fusion protein and non-engineered cells (control cells) are mixed at various ratios. The cell viability after treatment with the prodrug is evaluated, and the IC ₅₀ of the similarly cultured cultured cells and control cells is compared. A bystander effect is induced when the percentage of cell death exceeds the initial percentage of engineered cells in the mixture. To determine whether cell-to-cell contact is required, control cells are seeded on a dish and engineered cells are introduced into the COSTAR insert. Drug is added, and the survival of control cells is used as an indicator of the diffusion factor arising from the engineered cells. A method for examining the bystander effect for ep is described in Chen et al. (supra).

Example 18 Analysis of the In Vivo Efficacy of Enhanced Prodrug Activating Enzymes Tumor cell line xenografts engineered to express various enhanced prodrug activating enzymes or combinations thereof are nude Prepare with mouse. Mice are treated with increasing concentrations of the relevant prodrug and tumor growth and cell survival are compared to alternative flank control xenografts.

Female homozygous (nu ⁺ / nu ⁺ ) athymic Swiss nude mice 20-30 g are used. Exponentially growing tumor cells, such as MCF-7 or MDA231 (2 × 10 ⁷ /0.2 ml / injection site) are injected subcutaneously in the flank. Each mouse is injected with two grafts, one on the flank with a control tumor and the other with a tumor expressing a prodrug-activating enzyme. Optionally, further processing is performed, for example, when using MCF-7 cells, mice are pre-injected with a 17-β estradiol pellet one day before injection of tumor cells (Che
n et al. 1996 supra). When tumors reached a size of about 50 to 100 mm ^2, to start the chemical treatment after between normal after injection 5-6 weeks. The drug is administered at appropriate doses by intraperitoneal or intratumoral injection, usually twice in 24 hours.

Some animals are sacrificed at appropriate time points, usually 4 to 48 hours after drug treatment, and their tumors are analyzed for prodrug expression and effects. Tumors are chopped, freeze-thawed, sonicated and collagenase treated (500 μg /
destroy by standard methods such as (ml). Assays for enzyme activity and cell viability are as described above. Some animals are maintained and tumor size is measured using topical calipers.

Example 19 Analysis of the Effect of Intratumoral Delivery of Vectors Expressing Enhanced Prodrug Activating Enzymes Human tumor xenografts are prepared as described above. When the xenograft reaches approximately 50 mm, the vector preparation is injected with a 22 gauge needle. Each tumor is injected at least 5 times to distribute the vector throughout the tumor. Forty-eight hours after vector injection, animals are treated with prodrug and tumors are analyzed as described above.

Example 20 Macrophages Expressing Prodrug Activating Enzyme Human primary macrophages were isolated from peripheral blood by standard methods. They were analyzed for the expression of P450 gene and P450 reductase gene. Surprisingly, they expressed P450 reductase, but not P450.

An adenovirus vector containing the CMV promoter (Ad.CMV) or the hypoxia responsive HRE promoter (ad.ObHRE) was constructed. The human cytochrome P4502B6 gene was inserted into these vectors. P450 expression could be detected in engineered macrophages. The macrophages were treated with cyclophosphamide and, unlike other cells such as similarly engineered tumor cells, they did not die. However, when P450 engineered macrophages were added to tumor cells or steric tumor spheres, they died in the presence of cyclophosphamide. Macrophages can be used as marker proteins (in this case, GFP
), All tumor cells survived. This effect is most effective with Ad.CMV-P450, probably due to constitutive expression. However, Ad.HRE-P4
50 also resulted in significant killing, indicating that this system could impose tumor selectivity.

Example 21: Killing of human tumor spheres by macrophages engineered to express human P450 The results of this experiment are shown in FIG. The top three panels show spheres treated with engineered macrophages but not with cyclophosphamide (CPA). They all have discontinuous edges and appear solid. The lower panel shows what happens when cyclophosphamide (CPA) is added. When Ad.CMV-P450 macrophages are used, the spheres are completely destroyed and cannot be handled in the next analysis. Ad
When HRE-P450 is used, the spheres become smaller and more diffuse in appearance, very brittle and difficult to handle. When Ad.CMV-GFP is used, the sphere is normal. Tumor target is Ad.CMV-P
Particular emphasis is placed on total destruction by 450.

[Brief description of the drawings]

FIG. 1A is a diagram showing a P450 reductase sequence. FIG. 1B shows a functional domain of P450 reductase.

FIG. 2 is a diagram showing derivatives of P450 reductase.

FIG. 3 is a diagram showing a transcellular targeting sequence.

FIG. 4 is a diagram showing human cytochrome P450 2B6.

FIG. 5 is a diagram illustrating an IRES.

FIG. 6 is a diagram showing a retroviral vector.

FIG. 7 is a diagram showing a gene fusion construct.

FIG. 8 is a diagram showing a retroviral vector that confers multidrug susceptibility.

FIG. 9 shows the results of macrophage delivery of P450.

FIG. 10 is a diagram showing a P450 PCR fragment.

FIG. 11 is a diagram showing pegHRELacZ.

FIG. 12 is a diagram showing pBHRELacZ.

FIG. 13 is a diagram showing pBHREp450del.

FIG. 14 is a diagram showing pBHREP450.

FIG. 15 is a diagram showing pegHREP450.

FIG. 16 is a diagram showing pONY4.

FIG. 17 is a diagram showing pONY4.1.

FIG. 18 is a diagram showing pONY4HREP450.

FIG. 19 is a diagram showing pONY4.1HRE450.

FIG. 20 is a diagram showing pEGASUS-4.

FIG. 21 is a diagram showing pEGASUS4P450.

FIG. 22 is a diagram showing pONY4.0P450.

FIG. 23 is a diagram showing pONY4.1P450.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 9/10 A61P 29/00 4C087 29/00 35/00 35/00 43/00 111 43/00 111 C12N 7/00 C12N 5/10 9/02 7/00 A61K 37/50 9/02 C12N 5/00 B 15/09 ZNA 15/00 ZNAA (31) Priority claim number 9902081.0 (32) Priority date 1999 January 29, 1999 (Jan. 29, 1999) (33) Priority claim country United Kingdom (GB) (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG) , AP (GH, GM, K E, LS, MW, SD, SL, SZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AL, AM, AT, AU, AZ, BA , BB, BG, BR, BY, CA, CH, CN, CU, CZ, DE, DK, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO , RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, UA, UG, US, UZ, VN, YU, ZW (72) Inventor Patterson, Adam, Bourne United Kingdom Orel 5 0 SNL, Ashton-under-line, Mosley , Woodend View 1 (72) Inventors Kingsman, Susan, Mary United Kingdom OEX 52 2S F Oxon, Islip, Middle Street, Greystones (72) Inventor Kang, On United Kingdom OEX 14 1 EX S Oxon. Abingdon, Gibson Closed 59 (72) Inventor Griffiths, Ray United Kingdom O.X.117 Earl Oxon. Didcot, Lady Glove, The Hedgelows, Humber Close 1 (72) Inventor Mitropheinas, Kyriakos United Kingdom OEX 41 Esset Oxford, Warwick Street 85 F-term (reference) 4B024 AA01 AA11 BA08 CA04 CA07 CA10 CA20 DA02 DA03 EA02 EA04 FA02 FA20 GA14 HA17 4B050 CC04 CC05 DD11 LL01 LL05 4B065 AA93Y AA94X AB01 AC14 BA03 CA24 CA28 CA44 CA46 4C076 AA95 FF68 4C084 AA02 BA44 CA01 CA53 NA15 ZA451 ZA452 ZB1 1 ZB1 ZB1 ZB1 ZB1 ZB1 ZB1 ZB1 ZB1 ZB1 ZB1 ZB1 ZB1 ZB1 ZB2 Z1 ZB1 ZB1 ZB1 ZB1 ZB1 ZB1 ZB1 not Continued】

Claims (30)

[Claims] 1. a) a localization domain (where the localization domain is not a tumor selection antibody); and b) a prodrug activation domain for activating the prodrug in a target cell. Prodrug activator. 2. The prodrug activator according to claim 1, wherein the localization domain comprises an intracellular or transcellular localization domain. 3. The prodrug activator of claim 1, wherein the localization domain comprises a biochemistry-related domain. 4. The prodrug activator of claim 1, wherein the localization domain comprises a chemically related domain. 5. The prodrug activator according to claim 1, wherein the localization domain comprises a mitochondrial import domain. 6. The prodrug activator according to claim 1, wherein the prodrug activation domain is a prodrug activating enzyme. 7. The prodrug activator according to claim 6, wherein the prodrug activating enzyme is cytochrome P450 or cytochrome P450 reductase. 8. The prodrug activator according to claim 7, wherein the cytochrome P450 is cytochrome P450 2B6. 9. The prodrug activator according to claim 1, which is in the form of a fusion protein. 10. The prodrug activator according to claim 1, which is in the form of a nucleic acid sequence encoding a localization domain and a prodrug activation domain. 11. At least one expressible nucleic acid sequence encoding a cytochrome P450, wherein one or each of the nucleic acid sequences comprises one or more constitutive expression control regulatory elements or one or more inducible nucleic acid sequences. A prodrug activator operably linked to an expression control regulatory element. 12. A modified hematopoietic stem cell (MHSC) comprising at least one expressible nucleic acid sequence encoding a prodrug activation domain, wherein one or each of the nucleic acid sequences comprises one or more Operably linked to a constitutive expression control regulatory element or one or more inducible expression control regulatory elements of
Prodrug activator. 13. The prodrug activator according to claim 12, wherein the MHSC is a macrophage. 14. The prodrug activator according to claim 12, wherein the nucleic acid sequence encodes a prodrug activating enzyme. 15. The prodrug activator according to claim 14, wherein the prodrug activating enzyme is cytochrome P450 or cytochrome P450 reductase. 16. The cytochrome P450 is cytochrome P450 2B6.
2. The prodrug activator according to item 1. 17. The prodrug activator according to claim 11, wherein the constitutive expression control regulatory element is a cytomegalovirus promoter. 18. A nucleic acid vector comprising the nucleic acid sequence according to claim 10. 19. A viral vector comprising the nucleic acid sequence according to claim 10. 20. The virus vector according to claim 19, wherein the virus vector is a retrovirus vector, an adenovirus vector, an adeno-associated virus vector, a poxvirus vector, or a pox-associated virus vector. 21. The virus vector according to claim 20, wherein the virus vector is a lentivirus vector. 22. A prodrug activator according to any one of claims 1 to 17, a nucleic acid vector according to claim 18, or a nucleic acid vector according to claim 18, for use in medicine.
22. The virus vector according to any one of 9 to 21. 23. The prodrug activator according to any one of claims 1 to 17, optionally mixed with a pharmaceutically acceptable diluent, excipient or carrier. A pharmaceutical composition comprising a nucleic acid vector or the virus vector according to any one of claims 19 to 21. 24. A prodrug activator according to any one of claims 1 to 17, in the manufacture of a medicament for the treatment of tumors, inflammation, atherosclerotic vessels and dystrophic muscle fiber terminals. Use of the nucleic acid vector according to any one of claims 19 to 21 or the virus vector according to any one of claims 19 to 21. 25. A prodrug activator according to any one of claims 1 to 17, a nucleic acid vector according to claim 18, or a virus vector according to any one of claims 19 to 21. Introduced cells. 26. The prodrug activator delivery system of any one of claims 1 to 11, comprising one or more retroviral non-viral expression vectors, adenoviruses or plasmids. 27. A target cell and a prodrug, such that the prodrug is activated when the prodrug activator according to any one of claims 1 to 17 is localized. A method for activating a prodrug, which comprises contacting under conditions that allow uptake by a prodrug. 28. A method for producing a virus strain, comprising introducing the nucleic acid sequence according to any one of claims 10 to 16 into the genome of a virus. 29. The method of claim 28, comprising introducing a nucleic acid sequence into the genome of the virus by homologous recombination between the genome and the vector of claim 18. 30. The method for producing MHSC according to any one of claims 12 to 16, comprising introducing the viral vector according to any one of claims 19 to 21 into hematopoietic stem cells.