KR20020003215A - Retroviral vectors comprising functional and non-functional splice donor and splice acceptor sites - Google Patents

Abstract

The present invention seeks to provide a novel retroviral vector. In particular, the present invention seeks to provide a novel retroviral vector capable of effective expression of one NOI- or a plurality of NOIs- at one or more desired target sites. The present invention also relates to a novel vector for preparing a high dose of vector virion that integrates a safe form for use in vivo and which can provide effective expression of one NOI- or multiple NOIs- at one or more desired target sites. We want to provide one system.

Description

Functional and non-functional splice donor and splice acceptor sites. Retroviral vectors comprising functional and non-functional splice donor and splice acceptor sites.

Gene therapy may include, for example, the addition, substitution, deletion, supplementation, manipulation, etc. of one or more nucleotide sequences at one or more target sites, And any one or more of them. If the target site is the target cell, then the cell will be part of the tissue or organ. General guidelines for gene therapy are provided in Molecular Biology (Ed Robert Meyers, Pub. VCH, pp 556-558).

Through further embodiments, gene therapy can also be performed by substituting or replenishing a gene for which the nucleotide sequence, such as a gene, is defective; A pathogenic nucleotide sequence such as a gene or an expression product thereof can be removed; A nucleotide sequence such as a gene or an expression product thereof can be added or introduced to produce, for example, a more favorable phenotype; A nucleotide sequence such as a gene or an expression product thereof may be added or introduced (for example, to select cells modified over unmodified cells) for selection purposes; The cells may be used for the treatment of a disease state or condition such as cancer (Schmidt-Wolf and Schmidt-Wolf, 1994, Annals of Hematology 69: 273-279), cardiovascular, neurological, inflammatory or infectious can be manipulated at the molecular level to treat or prevent other disease states such as infectious disease; Antibodies can provide a method by any one or more that can be manipulated and / or introduced to elicit an immune response, such as a genetic vaccination.

In recent years, retroviruses have been proposed for use in gene therapy. Originally, retroviruses are RNA viruses that have a different life cycle than lytic viruses. In this regard, retroviruses are infectious agents that replicate through DNA intermediates. When a retrovirus infects a cell, its genome is converted to DNA form by reverse transcriptase. DNA replication serves as a template for the generation of virus encoded proteins required for the combination of the novel RNA genome and the infecting viral particles.

There are many retroviruses such as the following: murine leukemia virus (MLV), human immunodeficiency virus (HIV), equine infectious anemia virus (EIAV) Mammary leukemia virus (Mo-MLV) is a rare malignant tumor of the lungs, which is the most common malignant tumor of the lung. , FBR murine osteosarcoma virus (FBR MSV), Moloney murinesarcoma virus (Mo-MLV), Abelson murine leukemia virus (A-MLV) Avian myelocytomatosis virus-29, MC29, and avian erythroblastosis virus (AEV).

Details of retroviruses were based on Coffin et al ("Retroviruses" 1997 Cold Spring Harbor Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus pp 758-763).

Details of the genome structure of certain retroviruses are known. As an example, details of HIV can be obtained from NCBI Genbank (i.e., Genome Accession No. AF033819).

In essence, all wild-type retroviruses contain three major coding domains, gag, pol, and env, which encode essential virion proteins. Nonetheless, retroviruses can be broadly divided into two categories: "simple" and "complex." This classification is distinguished by their genomic organization. A simple retrovirus usually only delivers basic information. Alternatively, the composite retrovirus also encodes additional regulatory proteins derived from multiple spliced messages.

Retroviruses can be further subdivided into seven groups. Five of these groups represent retroviruses with the potential for carcinogenicity. The other two groups are lentiviruses and spumaviruses. These viruses are described in "Retroviruses" (1997 Cold Spring Harbor Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus pp 1-25).

All carcinogenic members except for the human T-cell leukemia virus-bovine leukemia virus (HTLV-BLV) group are simple retroviruses. HTLV, BLV and lentivirus and foam virus are composite retroviruses. The best studied carcinogenic retroviruses are Rous sarcoma virus (RSV), murine breast cancer virus (MMTV), murine leukemia virus (MLV) and human T-cell leukemia virus (HTLV).

The lentivirus group can be further classified as "primate" and "non-primate". Examples of primate lentiviruses are human immunodeficiency virus (HIV), causative agents of human auto-immunodeficiency syndrome (AIDS), and simian immunodeficiency virus (SIV). The non-primate lentivirus group has been associated with the introduction of related chlorine arthritis-encephalitis virus (CAEV), equine infectious anemia virus (EIAV), the more recent feline immunodeficiency virus (FIV) Viruses include the representative " slow virus " visna / maedi virus as well as the bovine immunodeficiency virus (BIV).

The difference between the lentivirus family and other retroviral forms is that lentiviruses can infect both dividing and non-dividing cells (Lewis et al , 1992 EMBO. J 11: 3053-3058, Lewis and Emerman 1994 J. Virol. 68: 510-516). Alternatively, other retroviruses such as MLV can not infect non-dividing cells, such as those that constitute muscle, brain, lung, or liver tissue, for example.

During the infection process, retroviruses initially attach to specific cell surface receptors. While entering the susceptible host cell, the retroviral RNA genome is copied to the DNA that is transferred into the maternal virus by the reverse transcriptase encoded by the virus. The DNA is then transferred to the host cell nucleus, which is fused to the host genome. At this stage it is called a typical provirus. Pro viruses are stable on the host chromosome during cell division and are transcribed like other cellular proteins. Pro viruses encode proteins and packaging tissues necessary for further virus creation, and can sometimes break away from the cells by a process called "budding".

As already mentioned, each retroviral genome consists of genes called gag, pol, and env that encode virion proteins and enzymes. In pro viruses, these genes are located at both ends by a region called long terminal repeat (LTRs). LTRs are responsible for the fusion and transcription of pro viruses. They are also provided as enhancer-promoter sequences. In other words, LTRs can regulate the expression of viral genes. Wrapping of retroviral RNAs with a protein membrane occurs by the psi sequence located at the 5 'end of the viral genome.

The LTRs themselves are identical to sequences that can be divided into three elements called U3, R, and U5. U3 is derived from a sequence unique to the 3 'end of the RNA. R is derived from repeating sequences at both ends of RNA and U5 is derived from a sequence unique to the 5 'end of RNA. The size of the three elements can vary considerably among different retroviruses.

For the understanding of each case, the simple general structure (unscaled) of RNA and the DNA form of the retroviral genome are shown in Figure 29 and show the basic features of LTRs and the relative positions of gag, pol and env.

As shown in Fig. 29, the basic molecular sieve of the infected retroviral RNA genome is (5 ') R-U5-gag, pol, env-U3-R (3'). In defective retroviral vector genomic gag, pol and env are absent or non-functional. The R region at both ends of the RNA is a repeating sequence. U5 and U3 represent unique sequences at the 5 'and 3' ends of the RNA genome, respectively.

The reverse transcription of virion RNA into double stranded DNA occurs in the cytoplasm and involves two jumps of reverse transcriptase from the 5 'end to the 3' end of the template molecule. The result of this jump is a copy of the sequence located at the 5 'and 3' ends of the virion RNA. These sequences are fused together at both ends of the viral DNA to form long terminal repeats (LTRs) containing the R U5 and U3 regions. At the end of the reverse transcription, the viral DNA is transferred to a nucleus randomly inserted into the chromosomal DNA with the aid of virion integrase to form a stable provirus, called a preintegration complex (PIC), a retroviral genome . The number of sites that can be integrated into the host cell genome is very large and widely distributed.

Regulation of pro-viral transcription is largely left to the non-coding sequence of the viral LTR. The transfer start position is at the boundary between U3 and R in the left LTR (as shown in Figure 29) and the position of the poly (A) addition (termination portion) is at the boundary between R and U5 in the right LTR ). U3 contains most of the transcriptional regulatory elements of the pro virus, and has a promoter and a complex promoter sequence that is a viral transcription activator protein that reacts with cells differently. Some retroviruses have one or more of the following genes: tat, rev, tax, and rex, which encode proteins involved in the regulation of gene expression.

Transcription of proviral DNA recreates the full length viral RNA genome and subgenomic RNA molecules generated by the RNA process. Typically, all RNA products serve as templates for the production of viral proteins. Expression of the RNA product consists of a combination of RNA transcript splicing and ribosome frame shifting during translation.

RNA splicing is the process by which an intervening or "intronic" RNA sequence is removed and the remaining "exonic" sequences are ligated to provide a continuous reading frame for translation. The primary transcription of retroviral DNA is modified in many ways and is very similar to cellular mRNA. However, unlike most cellular mRNAs, all introns are efficiently spliced, and newly synthesized retroviral RNAs must be converted into two groups. One population is not spliced to act as genomic RNA and the other population is spliced to provide subgenomic RNA.

Full-length unsprilled retroviral RNA transcripts serve two functions: (i) they encode gag and pol gene products; and (ii) they are packaged as progeny virion particles as genomic RNA. Subgenomic RNA molecules provide mRNA for residues of viral gene products. All spliced retroviral transcripts have a first exon over the U5 region of the 5 'LTR. The last exon retains the U3 and R regions, which are large in size but always encoded by the 3 'LTR. The composition of the RNA structure residues depends on the number of splicing events and the choice of alternative splice sites.

In simple retroviruses, a population of newly synthesized retroviral RNAs is not spliced to act as mRNA for genomic RNA and gag and pol. Other groups are spliced, fusing the 5 'portion of the genomic RNA to the downstream gene, usually env. Splicing is accomplished by the use of a splice donor near the top of the gag and a splice acceptor near the 3 'end of the pol. The intron between the splice donor and the splice acceptor removed by splicing includes the gag and pol genes. This splicing event produces mRNA for the coat protein. Typically, the splice donor is at the top of the gag, but in a virus such as ASLV, the splice donor is located in a small number of codons and the gag gene is usually the main Env translation with a few amino-terminal amino acid residues along with Gag Product. Env proteins are synthesized in membrane-bound polyribosomes and transported into vesiculartraffic of cells and incorporated into viral particles.

Composite retroviruses generate both env gene products as well as single and multiple splice copies that encode specific control and accessory proteins for these viruses. Composite retroviruses such as lentiviruses, and especially HIV, provide a prominent example of alternative splicing complexity that can occur during retroviral infection. For example, HIV-1 is now known to be able to produce over 30 different mRNAs by sub-selective splicing from major genomic transcripts. This selection process appears to be controlled by mutations that can cause shifts in the splicing pattern and disrupt competitive splice acceptors that can affect the virus infection (Purcell and Martin 1993 J Virol 67: 6365-6378).

The relative proportion of full-length RNA and subgenomic-size RNA varies in infected cells, and modulation of these transcription levels is a potential regulatory step during retroviral gene expression. For retroviral gene expression, both unspliced RNA and spliced RNA are carried to the cytoplasm and the proper ratio of unplated RNA to spliced RNA must be maintained for efficient retroviral gene expression. Other classes of retroviruses have evolved into a unique solution to this problem. Simple retroviruses using only full-length and single spliced RNAs regulate the cytoplasmic proportions of these species, which have been only partially restricted by the use of variable-efficient splice sites or by the combination of several cis-acting elements, with their genomes. Composite retroviruses, which direct the synthesis of single and multiple spliced RNAs, have been shown to interact with other genomes through the interaction of RNA sequences with the protein product of one of the accessory genes, such as rev in HIV-1 and rex in HTLV-1 Regulates the transport and possible splicing of subgenomic-sized RNA species.

Regarding the structural genes gag, pol and env themselves and more closely, gag encodes the internal structural proteins of the virus. Gag is mature protein MA (matrix), CA (capsid) and NC (nucleocapsid) by protein hydrolysis. The pol gene encodes a reverse transcriptase (RT) containing two DNA polymerases and is associated with RNase H activity and integrase (IN) that regulate genomic replication. The env gene encodes a surface glycoprotein (SU) glycoprotein and a transmembrane (TM) protein that specifically form complexes that interact with cell receptor proteins. This interaction ultimately fuses the viral membrane with the cell membrane.

The Env protein is a viral protein that plays a major role in coating viral particles and causing viruses to enter target cells. The envelope glycoprotein complex of retroviruses contains two polypeptides, an external glycosylated hydrophilic polypeptide (SU) and a membrane-spanning protein (TM). At the same time, it forms an oligomeric " knob " or " knobbed spike " on the surface of the virion. Both polypeptides are encoded by the env gene and are synthesized in the form of precursors of polyproteins separated by protein hydrolysis during migration to the cell surface. Although the non-isolated Env protein binds to the receptor, the segregation event itself is necessary to activate the fusion potential of the protein and is necessary for the virus to enter the host cell. Typically, both SU and TM proteins are glycosylated at multiple sites. However, as an example by MLV, TM, it is not glycosylated in some viruses.

Although SU and TM proteins are not always required for the construction of outer membrane virions, they play an essential role in the invasion process. In this regard, the SU domain binds to a receptor molecule - sometimes a specific receptor molecule - in the target cell. Binding is believed to activate the membrane fusion-inducing of the TM protein after fusion of the virus with the cell membrane. Segregation resulting from the short-term removal of the cytoplasmic termini of other viruses, particularly MLV, TM, appears to play an important role in elucidating the overall fusion activity of proteins (Brody et al 1994 J Virol 68: 4620-4627; Rein et al 1994 J Virol 68: 1773-1781). The cytoplasmic " tail " at the end of the membrane-spanning portion of TM remains inside the viral membrane and is significantly different in the length of various retroviruses.

Therefore, the specificity of SU / receptor interactions can limit the host range and tropism of retroviruses. In some cases, the specificity may limit the transduction potential of the recombinant retroviral vector. Here, transduction involves the use of viral vectors to deliver non-viral genes to target cells. For this reason, many gene therapy experiments have used MLV. Certain MLVs with an envelope protein called 4070A are known to be amphotropic viruses and also infect human cells because of the coat protein " docks " that carry phosphate-carrying proteins that are conserved between humans and rats . These carriers are so widespread that these viruses can infect many cell types. However, in some cases, it may be beneficial, especially from a stability point of view, to a particularly limited target cell. Because of this, several groups have studied other mouse ecotropic retroviruses, in particular, to infect human cells, in that their amphotropic viruses usually infect only the mouse cells. The outer protein fragments were replaced with erythropoietin moieties to produce recombinant retroviruses that specifically bind to human cells expressing erythropoietin on cell surfaces such as red blood cell water precursors (Maulik and Patel 1997 &Quot; Molecular Biotechnology: Therapeutic Applications and Strategies " 1997 Wiley-Liss Inc. pp 45).

In addition to gag, pol, and env, the complex retroviruses also include "accessory" genes that code accessory and auxillary proteins. Auxiliary and crude proteins usually contain the reproductive or structural gene, gag, pol And < RTI ID = 0.0 > env. ≪ / RTI > These complementary proteins are different from the proteins involved in gene expression regulation, such as proteins encoded by tat, rev, tax, and rex. Examples of such helper genes include one or more of vif, vpr, vpx, vpu, and nef. Auxiliary genes can be found, for example, in HIV (see "Retroviruses" Ed. Coffin et al Pub. CSHL 1997, pp 802-803). Non-essential co-proteins can function in a particular cell type while providing at least partial dual function of the function provided by the cell protein. Typically, the accessory gene is located between the pol and env, which is the lower part of the env containing the overlapping portion of the U3 region or env of the LTR and each other.

Composite retroviruses have developed regulatory mechanisms that use transcription factors encoded by the virus as well as cell transcription factors. The protein of the trans-acting virus acts as an activator of RNA transcription induced by LTRs. The transcriptional trans-activator of lentiviruses is encoded by the tat gene of the virus. Tat is described as a TAR that binds to a stable stem-loop of the RNA secondary structure and plays a role in optimally positioning Tat in the trans-activating transcription.

As previously mentioned, retroviruses have been proposed as delivery systems (otherwise referred to as delivery vehicles or delivery vectors) to deliver NOI or multiple NOIs specifically to one or more sites of interest. Delivery occurs by in vitro, ex vivo, in vivo or by binding thereof. When used at present, retroviruses are typically referred to as retroviral vectors or recombinant retroviral vectors. Retroviral vectors have been developed to study the life cycle of retroviruses from various angles, including receptor use, reverse transcription and RNA packaging (Miller, 1992 Curr Top Microbiol Immunol 158: 1-24).

In the use of recombinant retroviral vectors typical in gene therapy, at least one or more of the gag, pol and env protein coding regions may be removed from the virus. This makes the retroviral vector to be replication-defective. Although the removed part is replaced by NOI to generate a virus that can fuse its genome into the host genome, the altered viral genome can not propagate itself with the lack of structural proteins. When fused to the host genome, the expression of NOI results from, for example, the results that appear in the therapeutic effect. Thus, delivery of NOI to a site of interest generally involves fusion of NOI to a recombinant viral vector; Packaging modified virus vectors into virion coats; And by transduction of a position of interest such as a target cell or target cell entity.

For example, many retroviral vectors (preparing appropriate concentrations of retroviral vectors) are propagated for sequential transduction of the site of interest by the combination of a package or by use of a helper cell line and a recombinant vector It is possible to separate.

In some cases, proliferation and separation require their individual insertion into the host cell to produce a " packaging cell line " with separation of the gag, pol and env genes of the retrovirus. The package cell line forms the protein necessary to package the retroviral DNA, but can not be surrounded by a protein membrane due to the lack of the psi region. However, when a recombinant vector carrying the NOI and psi regions is inserted into the packaged cell line, the helper protein can package a psi-positive recombinant vector to produce a recombinant virus stock. This can be used to infect cells that introduce NOI into the genome of the cell. The genome of a recombinant virus lacking all the genes needed to make the viral protein can only infect it once and can not multiply. Therefore, NOI is inserted into the host cell genome without the possibility of deleterious retroviruses. An overview of useful package lines is provided in "Retroviruses" (1997 Cold Spring Harbor Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmun p 449).

The design of the retroviral package cell line has evolved to address the problems that have often been raised in previous designs, particularly those that form spontaneous helper viruses. Reduction and elimination of homology between the genome and helper of the vector reduces the problem of helper virus formation, since recombination is much facilitated by homology. More recently, packaged cells have developed that the gag, pol and env viral coding regions are independently infected with a packaged cell line and transferred to a separate expression plasmid such that the three recombination results are required for wild-type virus formation. This method is sometimes referred to as three plasmid cell infection methods (Soneoka et al 1995 Nucl. Acids Res. 23: 628-633).

Transient cell infections can also be used to measure vector formation when vectors are formed. In this regard, transient cell infections are avoided by avoiding the long time needed to generate stable vector-forming cell lines and when the vector or retroviral package components are toxic to the cells. Generally, the components necessary to generate the retroviral vector include a plasmid encoding a Gag / Pol protein, a plasmid encoding an Env protein, and a plasmid containing NOI. Vector generation requires transient cellular infections of cells of one or more of these components, including other necessary components. If the vector encodes a toxin gene or genes that regulate the replication of the host cell, such as a cell cycle inhibitor or a gene that induces apoptosis, it may be difficult to generate a stable vector-producing cell line, Can be used to form vectors before they die. In addition, cell lines are formed using transient infections that produce vectors at an appropriate level compared to levels obtained from stable vector-producing cell lines (Pear et al 1993, Proc Natlcad Sci 90: 8392-8396).

For the toxicity of HIV proteins that make it difficult to produce stable HIV-based packaged cells, HIV vectors are usually made by transient cellular infections of vectors and helper viruses. Researchers have even replaced the HIV Env protein with a protein from vesicular stomatitis virus (VSV). Insertion of the Env protein of VSV is accomplished by transient infiltration of the HIV / VSV-G vector with an appropriate amount of 5 x 10 ⁵ (10 ⁸ later) concentration (Naldini et al 1996 Science 272: 263-267) Adjust the concentration. Therefore, transient cell infections of HIV vectors will provide a useful method for generating high-dose vectors (Yee et al 1994 PNAS. 91: 9564-9568).

With respect to vector titration, a common use of retroviral vectors is to use appropriate amounts of transduced particles (typically less than 10 ⁸ particles / ml) obtainable in in vitro cultures and many of the traditional biochemical and physical chemistry techniques to concentrate and purify the virus Has been largely limited by the sensitivity of the enveloped virus.

By way of example, the use of centrifugation (Fekete and Cepko 1993 Mol Cell Biol 13: 2604-2613), hollow fiber filtration (Paul et al 1993 Hum Gene Ther 4: 609-615) and tangential (tangential) flow filtration (Kotani et al. 1994 Hum Gene Ther 5: 19-28) have been developed for the enrichment of retroviral vectors. A 20-fold increase in viral load can be achieved, but the relative weakness of the retroviral Env protein limits its ability to concentrate the retroviral vector, and viral enrichment generally results in poor recovery of infected virions. This problem can be solved by replacing the retroviral Env protein with a more stable VSV-G protein, thereby enabling more efficient vector enrichment as described above in better yield, but the VSV-G protein is highly toxic to the cell There are disadvantages.

Helper-viral pre-vector titers of 10 < ⁷ > cfu / ml can be obtained with generally available vectors, but experiments can often result in very low amounts of vector stock. However, for practical reasons, a particularly high amount of virus is preferred, especially when a large number of cells are infected. In addition, high titers are required to transduce a large percentage of any cell type. For example, the frequency of human hematopoietic stem cell infections strongly depends on the vector titration, and the useful frequency of infection occurs only in very high amounts of stock (Hock and Miller 1986 Nature 320: 275-277; Hogge and Humphries 1987 Blood 69: 611 -617). In this case, it is not sufficient to expose the cells to larger volumes of virus to compensate for lower virus titers. In contrast, in some cases, the concentration of the infected vector virion will be important in promoting efficient transduction.

Researchers are trying to generate high-volume vectors for use in gene delivery. As an example, comparisons of different vector designs have been found to help define the essential elements needed for high-volume virus production. Early studies on other retroviral vector designs have shown that almost all of the internal protein-encoding regions of MLVs can be deleted without eliminating the infectivity of the vector (Miller et al 1983 Proc Natl Acad Sci 80: 4709-4713) . This initial vector retained only a portion of the 3 ' end of the env -coding region. Subsequent studies have shown that env gene-coding sequences can be eliminated without further reduction in vector titres (Miller and Rosman 1989 Biotechnique 7: 980-990; Morgenstern and Land 1990 Nucleic Acids Res 18: 3587-3596) . Only short viral regions adjacent to viral LTRs and LTRs, including the segments necessary for plus- and minus-strand DNA priming and the necessary packaging for virion of viral RNA, are included in vector trans- mission It was deemed necessary. Nevertheless, the titers of the viruses obtained with these initial vectors were much lower than the ancestral helper virus titers by about 10-fold.

Additional experiments have shown that sequence retention at the 5 ' end of the gag gene significantly increases the viral vector titration, which is due to an increase in package efficiency to virion of viral RNA (Armentano et al 1987 J Virol 61: 1647-1650; Bender et al 1987 J Virol 61: 1639-1646, Adam and Miller 1988 J Virol 62: 3802-3806). gag reading frame is such an effect since the mutation in the stop codon in the cleavage or gag codon did not show any effect on the vector a suitable amount of (reading frame) was not due to viral protein synthesis from the gag region of the vector (Bender et al 1987 ibid ). These experiments indicated that sequences necessary for effective packaging of genomic RNA in MLVs were larger than the psi signal defined previously by deletion analysis (Mann et al 1983 ibid ). To obtain high titers (from 10 ⁶ to> 10 ⁷ ), it was important that this larger signal, called psi plus, was induced in retroviral vectors. This signal has been described to extend from the top of the splice donor to the bottom of the gag start codon (Bender et al 1987 ibid ). Because of this location, these signals are deleted in spliced env expression transcripts. This confirms that only full-length transcripts containing all three genes essential for the virus life cycle are packaged.

Some other approaches to developing high affinity vectors for gene delivery include: (i) a defective viral vector such as adenovirus, adeno-associated virus (AAV), herpes virus and pox virus, and (ii) And the use of retroviral vector designs.

Adenovirus is a double-stranded, linear DNA that does not cross the RNA intermediate. There are 50 different human serotypes of adenoviruses divided into six subgroups based on genetic low sequence homology. The natural targets of adenoviruses are respiratory and gastrointestinal epithelium, which usually only show mild signs. Serotypes 2 and 5 (with 95% sequence homology) are most commonly used in adenoviral vector systems and are generally associated with upper respiratory tract infections in younger individuals.

Adenovirus has no hull and is a twenty-sided dodecahedron. A typical adenovirus consists of a DNA virus enveloped by a 140-nm protein membrane. The twenty-sided symmetry of the virus consists of 152 capsomere: 240 hexon and 12 penton. The center of the particle contains a 36 kb linear double DNA covalently linked at the 5 'end with a terminal protein (Terminal Protein (TP)) that acts as a primer for DNA replication. DNA has a length of repeated terminal repeats (ITR) and various serotypes.

The entry of adenovirus into cells involves a series of distinct events. Adherence of the virus to the cell occurs through interaction between the viral fibrous material (37 nm) on the cell and the fibrous receptor. These receptors have recently been identified as the Ad2 / 5 serotype and have been designated as CAR (Coxsackie and Adeno Receptor, Tomko et al (1997 Proc Natl Acad Sci 94: 3352-2258)). Internal translocation of the virus into the endosome through the? V? 3 and? V? 5 integrin of the cells is mediated by the viral RGD sequence in the Fenton-based capsid protein (Wickham et al ., 1993 Cell 73: 309 -319). Following internal migration, endosomes are disrupted by a process known as endosomolysis, an event believed to be preferentially promoted by the? V? 5 integrin of cells (Wickham et al ., 1994 J Cell Biol 127: 257- 264). Moreover, there is recent evidence that Ad5 fibroblasts bind with high affinity to the MHC class 1 alpha 2 domain at the surface of certain cell types, including human epithelia and B lymphoblast cells (Hong et al , 1997 EMBO 16: 2294-2306).

In addition, the virus is displaced into the nucleus where activation of the initial zone occurs followed by DNA replication and activation of the late zone. Transcription, replication and packaging of adenoviral DNA require both host and viral functional organs.

Viral gene expression can be divided into early (E) and late (L) stages. The latter stage is defined by the onset of viral DNA replication. Adenovirus structural proteins are generally synthesized during later stages. After adenovirus infection, host cell mRNA and protein synthesis is inhibited in infected cells with the most serotypes. The cytolytic cycle of adenoviruses to adenovirus 2 and 5 is highly effective and results in about 10,000 virions per infected cell depending on the synthesis of excess viral proteins and DNA that are not incorporated into virions. Early adenovirus transcription entails the synthesis of viral RNA prior to the initiation of complex sequences or DNA replication interrelated with biochemical events.

The schematic diagram shown in Figure 30 is an adenovirus genome that indicates the relative orientation and location of early and late gene transcription.

The organization of the adenoviral genome is similar to that of all adenoviral virus groups, and the specific function is generally located within the same position of each studied serotype. Early cytoplasmic messenger RNAs are complementary to four defined non-contact regions on viral DNA. These zones were designated as E1-E4. The initial transcripts are classified into an initial intermediate (E1a), an initial delayed (E1b, E2a, E2b, E3 and E4) and an array of intermediate regions.

The initial gene is expressed within about 6-8 hours after infection and is derived from the 7 promoter in the gene block E1-4.

The E1a region is contained within the transcriptional transactivation of viruses and cellular genes as well as transcriptional repression of other sequences. The E1a gene exerts moderate functional regulation of all other early adenovirus messenger RNAs. An active E1a product is required to transduce sufficient regions E1b, E2a, E2b, E3 or E4 in normal tissues. However, the E1a function can be ignored. Cells may be engineered to provide E1a- similar functions or may naturally contain such functions. The virus can also be manipulated to ignore the E1a function. The virus package signal overlaps the E1a enhancer (194-358 nt).

The E1b region affects virus and cellular metabolism and host protein blockade. It also contains a gene (3525 to 4088 nt) encoding the pIX family that is essential for the packaging of full-length viral proteins and critical for viral thermostability. The E1b zone is required for the event of a normal virus in the later stages of infection. The E1b product is active in the host nucleus. Mutations generated within the E1b sequence represent deletions in the late viral mRNA accumulation as well as damage in inhibition of host cell transport normally found at the late stage of adenovirus infection. E1b is required to alter the function of host cells in which processing and delivery are altered by the late gene product of the virus. This product then results in the release of virus packs and virions. E1b produces a 19 kD protein that prevents apoptosis. E1b also produces a 55 kD protein that binds to p53. See WO 96/17053 for the observation of adenoviruses and their replication.

The E2 region is essential when encoding 80 kD precursors of the 72 kD DNA binding protein, DNA polymerase and the 55 kD terminal protein (TP) required for protein priming to initiate DNA synthesis.

The 19 kD protein (gp19K) is encoded in E3 and is involved in modulating the host immune response to the virus. Expression of these proteins is up-regulated in response to TNF alpha during the first phase of infection, which binds and prevents migration of the MHC class I antigen to the epithelial surface, resulting in recognition of adenoviral infected cells by T lymphocytes . E3 zone can be without being a study in the laboratory, removed by deleting the 1.9kb XbaⅠ segment.

The E4 region is involved in reducing host protein synthesis and increasing DNA replication of the virus.

There are five families of late genes, all of which are initiated from major late promoters. Expression of late genes involves a very complex post-transcriptional regulatory mechanism, including RNA splicing. The fibrous protein is encoded within the L5 region. The adenovirus genome is flanked by a terminal repeat that is 103 base pairs in Ad5 and is essential for DNA replication. After 30 to 40 hours, the production of the infectious virus is completed.

Adenovirus can be modified to be used as a vector for gene transfer, which is important for the induction of the E2, E3 and E4 promoters by E1 gene deletion. The E1-replication defective virus may be propagated in a cell line that provides E1 polypeptide in the trans, such as human embryonic kidney cell line 293. Therapeutic genes or genes may be inserted by recombination within the position of the E1 gene. Expression of the gene is derived from the E1 promoter or heterologous promoter.

Much more weakened adenoviral vectors have been developed by deleting some or all of the E4 open reading frames (ORFs). However, certain second-generation vectors do not appear to exhibit long-term gene expression even when DNA appears to be retained. Thus, the function of one or more E4 ORFs indicates that it is capable of enhancing gene expression from at least a particular viral promoter carried out by the virus.

Another approach to generating more defective viruses is the "gut" of viruses that keep only the terminal repeats necessary for viral replication. A "defective" or "parenchyma" virus can grow at a high dose of the first generation helper virus within the 293 cell line, but it is difficult to distinguish "defective" vectors from helper viruses.

Also, replication-competent adenoviruses can be used for gene transfer. For example, the E1A gene can be inserted into the first generation virus under the control of a tumor-specific promoter. Theoretically, it can be specifically replicated in tumors after insertion of the virus into the tumor, but not in the surrounding normal cells. This type of vector is a herpes-simple-viral thymidine-kinase gene (HSV) that can kill tumor cells directly by digestion or kill infected cells and baculovirus cells treated with ganciclovir suicide gene " such as < RTI ID = 0.0 > tk ). < / RTI > Adenovirus defective in E1b only can also be used specifically for antitumor therapy in Phase I clinical trials. Polypeptides encoded by E1b can block p53-mediated apoptosis, preventing cells from killing themselves in response to a viral infection. Thus, within the normal non-tumor cells in the absence of E1b, the virus can not block apoptosis and therefore does not produce and spread the infectious virus. In p53-deficient tumor cells, the E1b defective virus can grow and spread to adjacent p53-deficient tumor cells, but not normal cells. This type of vector may also be used to deliver therapeutic genes such as HSV tk .

Adenoviruses provide advantages as vectors over other gene therapy vector systems with the following adducts:

It is a double-stranded DNA virus with no envelope that is capable of in vivo and in vitro transfection of a wide range of cell types, both human and non-human origin. Such cells may be post-mitotic cells such as respiratory tract epithelial cells, hepatocytes, muscle cells, cardiac myocytes, synovial cells, early mammalian epithelial cells and neurons, and endogenous differentiated cells such as mononuclear cells Which may be excluded).

Adenoviral vectors can also transduce non-dividing cells. This is important for diseases such as cystic fibrosis with slow turnover rate of affected cells in lung epithelial cells. In fact, some attempts are under way using adenovirus-mediated transfer of the cystic fibrosis transporter (CFTR) to the lungs of suffering adult cystic fibrosis patients.

Adenovirus has been used as a vector for gene therapy and heterologous gene expression. The large (36 kilobase) genome can accommodate up to 8 kb of externally inserted DNA and effectively replicate within complementary cell lines to produce high titers of up to 10 ¹² . Thus, adenovirus is one of the best systems to study gene expression in early non-replicating cells.

Expression of the virus or an external gene from the adenoviral genome does not require cell replication. Adenovirus vectors enter the cell by receptor mediated endocytosis. Adenoviral vectors are hardly integrated into the host chromosome when they enter the cell. Instead, it functions episomally in the host nucleus (independent of the host genome) as a linear genome. Thus, the use of recombinant adenoviral vectors reduces the problems associated with random integration into the host genome.

Human malignancy and adenovirus infection have nothing to do with human malignancy. Weakened adenovirus strains are developed and used in humans as live vaccines.

However, currently adenoviral vectors have some major limitations in therapeutic use in vivo. These are: (i) transient gene expression-adenoviral vectors are generally kept episomal, do not replicate and pass on to the next offspring, (ii) because of their inability to replicate, target cell proliferation can lead to dilution of the vector (Iii) cells that express an adenoviral vector at low levels due to an immune response to the adenovirus protein are destroyed, and (iv) an inability to achieve an effective therapeutic indicator after in vivo delivery Accumulation of the vector and expression of the transferred gene in only a portion of the target cell.

If the characteristics of the adenovirus can be combined with the genetic stability of the retrovirus / lentivirus, it is essential that the adenovirus be used to transduce the target cell into a transient retrovirus producing cell capable of stably infecting neighboring cells.

In addition to manipulating retroviruses and adenoviral vectors in terms of increasing the amount of the vector, the retroviral vector may also be engineered to self-inactivate.

As an example, the first self-inactivating retroviral vector was constructed by deleting transcription enhancers or enhancers and promoters within the U3 region of the 3 'LTRs. After a single copy of the vector, this change is replicated in both the 5 'and 3' LTRS generating inactive pro virus (Yu et al 1986 Proc Natl Acad Sci 83: 3194-3198; Dougherty and Temin 1987 Proc Natl Acad Sci 84: 1197-1201; Hawley et al 1987 Proc Natl Acad Sci 84: 2406-2410; Yee et al 1987 Proc Natl Acad Sci 91: 9564-9568). However, the promoter (s) within the LTRs within this vector will still be active. This strategy was used to eliminate the effects of enhancers and promoters in viral LTRs on transcription from internally located genes. These effects include increased expression (Jolly et al 1983 Nucleic Acids Res 11: 1855-1872) or inhibition of transcription (Emerman and Temin 1984 Cell 39: 449-467). This strategy can also eliminate the down-transfer from genomic DNA to 3 'LTR (Herman and Cooffin 1987 Science 236: 845-848). This is of particular concern in human gene therapy, which is crucial in preventing the accidental activation of endogenous oncogenes. The disadvantage of this strategy is that when compared to a vector with complete LTRs, a low potency of the self-inactivating vector and complete LTRs by recombining with the viral sequence in the retroviral package cells used to generate the vector itself or the vector stock (stock) (At least 10-fold less) of the current vector aligned to produce the virus.

In addition to manipulating the retroviral vector in terms of increasing vector potency, the retroviral vector is also designed to induce the production of a specific NOI (typically a marker protein) within the transduced cells. As has been described, the most common retroviral vector designs include repetitions of retroviral sequences with one or more NOIs that generate replication-defective vectors. The simplest approach is to use a promoter in the 5 'LTR of the retrovirus that controls expression of the cDNA encoding the NOI, or to change the enhancer / promoter of the LTR to provide tissue-specific expression or inducibility. A single coding region is also expressed by using an internal promoter that allows for greater flexibility in promoter selection.

A strategy for expressing such a gene of interest is as in the case of hypoxanthine-guanine phosphoribosyl trasferase ( hprt ), which promotes the selection of vector transducing vectors (Miller et al 1983 Proc Natl Acad Sci 80: 4709-4713). When the NOI is a selectable marker, the vector is most conveniently carried out. If the vector contains NOI, but not a selectable marker, the vector is a selectable marker present on a separate plasmid, This strategy has an interesting advantage in that a single protein is expressed in the ultimately targeted cells and the possible toxicity or antigenicity of the selectable marker is nullified, but the inserted < RTI ID = 0.0 > If the gene is not selectable, this approach will produce a high enough amount of vector stock It has the more difficult disadvantage. Moreover it is more difficult to generally determine the appropriate amount of vector.

The current methodology used to devise retroviral viruses that express two or more proteins depends on three general strategies. (I) expression of other proteins from mRNA transcribed and spliced from one promoter; (Ii) the use of promoters and internal promoters in the 5 'LTRs that direct transcription of other cDNAs; And (iii) an internal ribosome entry site (IRES) that enables translation of multiple coding regions from a single mRNA or fusion protein that can be expressed from one open reading frame.

A vector containing an internal promoter has been widely used to express a large number of genes. The internal promoter makes it possible to utilize a promoter / enhancer combination rather than a viral LTR to direct gene expression. It has been shown that multiple internal promoters can be contained within retroviral vectors and express at least three different cDNAs each from its own promoter (Overell et al 1988 Mol Cell Biol 8: 1803-1808).

While there are many such modified retroviral vectors that can be used for the expression of NOIs in a variety of mammalian cells, most of these retroviral vectors are derived from the rat oncoretrovirus, which can not be transduced into non- Lt; RTI ID = 0.0 > retrovirus < / RTI >

For example, a widely used vector (Cepko et al 1984 Cell 37: 1053-1062) using another splicing to express a gene from the viral LTR SV (X) is a neomycin phosphotransferase neomycin phosphostransferase) gene. A model of this type of vector is the parental virus, MO-MLV, in which the Gag and Gag-Pol proteins are translated from full-length virus mRNA and the Env protein is generated from the spliced mRNA. One of the proteins encoded by the vector is translated from full-length RNA, whereas splicing, which splice donor near the 5 'LTR, is spliced to the splice acceptor just above the second gene, Lt; RTI ID = 0.0 > RNA < / RTI > The drawback of this strategy is that the foreign gene is inserted into the intron of the spliced gene. This can provide another splice acceptor that can affect the ratio of spliced RNA to non-spliced RNAs or interfere with the generation of spliced RNA encoding the second gene product (Korman et < RTI ID = 0.0 > al. 1987 Proc Natl Acad Sci 84: 2150-2154). These effects are not predictable and can affect the generation of encoded genes.

Other modified retroviral vectors can be divided into two classes depending on their splicing ability.

The first class of modified retroviral vectors labeled with the pBABE vector (Morgenstern et al 1990 Nucleic Acid Research 18: 3587-3596) includes mutations in a splice donor (GT or GC) that inhibits splicing of viral transcripts do. This splicing inhibition is advantageous for two reasons: first, it ensures that all viral transcripts contain the package signal, so that all can be packaged in producer cells. Second, it prevents potential splice splicing between the viral splice donor and the splice acceptor of the possible cryptos of the inserted gene.

A second class of modified retroviral vectors, denoted N2 (Miller et al 1989 Biotechniques 7: 980-990) and more recently denoted MFG (Dranoff et al 1993 Proc Natl Acad Sci 19: 3979-3986) Includes an intron. All of these vectors use a normal splice donor found within the package signal. However, their respective splice acceptors (SAs) are different. For N2, the SA is found in the "extended" package signal (Bender et al 1987 ibid ). In the case of MFG, a unique SA (found in pol , see Figure 1) is used. In both of these vectors, splicing has been shown to significantly enhance gene expression in transduced cells (Miller et al 1989 ibid ; Krall et al 1996 Gene Therapy 3: 37-48). This observation generally supports the earlier finding that splicing can enhance mRNA translation (Lee et al 1981 Nature 294: 228-232; Lewis et al 1986 Mol Cell Biol 6: 1998-2010; Chapman et al 1991 Nucleic Acid Res 19: 3979-3986). One possible reason for this is that the same instrument included in transcript splicing can also help the transcript from the nucleus.

There is little research on another splicing in a retroviral lentivirus system that can infect non-dividing cells, unlike the modified retroviral vectors described above (Naldini et al 1996 Science 272: 263-267) . The only lentiviral vectors so far published are derived from HIV-1 (Kim et al 1997 J Virol 72: 811-816) and FIV (Poeschla et al 1998 Nat Med 4: 354-357). These vectors still contain viral-induced splice donor and acceptor sequences (Naldini et al 1996 ibid ).

The present invention relates to vectors.

In particular, the present invention relates to a novel system for packaging and expressing genetic material in retroviral particles.

More specifically, the present invention is capable of expressing retroviral particles capable of delivering a nucleotide sequence of interest (abbreviated below as "NOI") - or a plurality of NOIs - to one or more target sites ≪ / RTI >

In addition, the present invention relates to novel retroviral vectors particularly useful in gene therapy.

BRIEF DESCRIPTION OF THE DRAWINGS The invention will be further described by means of the embodiments referred to in the following figures.

Figure 1 shows the structure of the retroviral pro viral genome.

Figure 2 shows the addition of a small T splice donor pLTR.

Figure 3 shows a schematic description of pL-SA-N.

Figure 4 shows a schematic description of pL-SA-N with splice donor deletion.

Figure 5 shows the sequence of MLV pICUT.

Figure 6 shows the insertion of a splice donor at the CMV / R junction of the EIAV LTR plasmid.

Figure 7 shows insertion of a splice acceptor into pEGASUS-1.

Figure 8 shows the removal of the wild type splice donor from the EIAV vector.

9 shows a combination of pCMVLTR + SD and pEGASUS + SA (no SD).

10 shows the structure of pEICUT- LacZ .

Fig. 11 shows the sequence of pEICUT- LacZ .

Figure 12 shows the vector configuration in both cell infected and transduced cells.

Figure 13 shows gene expression restriction of packaged cells or transfected cells.

Figure 14 shows the MLV pICUT Neo- p450 vector structure, which limits hygromycine expression of producer cells and 2B6 (p450 isoform) expression of transduced cells.

Figure 15 shows a sequence comparison of the wild-type MMLV sequence with the mutation env (m4979A) from the 3 'end of the pol gene.

Figure 16 shows the sequence of the fully modified env gene m4979A.

Figure 17 shows a restricted gene expression construct; 4070A envelope into the first cell; P450 as the second cell.

Figure 18 shows the use of introns to limit the expression of NOI (in this example, p450) in a second cell.

19 shows a schematic description of the transfer vector -pE1sp1A.

Figure 20 shows a schematic illustration of the pE1sp1A structure.

Figure 21 shows a schematic illustration of the pE1RevE structure.

Figure 22 shows a schematic illustration of the pE1HORSE3.1- gagpol construct.

Figure 23 shows a schematic description of the pE1PEGASUS4-genomic construct.

24 shows a schematic illustration of the pCI- Neo structure.

Figure 25 shows a schematic illustration of the pCI-Rab construct.

Figure 26 shows a schematic illustration of the pE1Rab structure.

Figure 27a shows a schematic description of a natural splice shape in a retrovirus vector.

Figure 27b shows a schematic description of the shape of the splice in a known retroviral vector.

FIG. 27C shows a schematic view of a splice shape according to the present invention.

28 shows a schematic description of a hybrid virus vector system according to the present invention.

Figure 29 shows a schematic diagram of RNA and DNA formation of the retroviral genome.

Figure 30 shows a schematic representation of adenovirus showing the relative orientation and location of early and late gene transcription.

31 shows a schematic view of a splicing mechanism.

Figure 32 shows a schematic illustration of the pTRONIN structure.

Figure 33 shows the pTRONIN sequence.

Figure 34 shows a schematic illustration of the PCR reaction used to amplify the region from the top of the small T splice donor to the bottom of the splice acceptor.

Figure 35 shows a schematic illustration of the pTRONIN-1 construct.

Figure 36 shows the pTRONIN-1 sequence.

More specifically:

Figure 1 shows the structure of the retroviral pro viral genome. In this respect, the simplest retroviruses, such as the rat and Onco retroviruses, have three open reading frames; gag, pol, and env . Frame shifts during gag translation (frameshift) lead to pol translation. Env expression and translation is achieved by splicing between the indicated splice donor (SD) and the splice acceptor (SA). The package signal is represented by Psi and is contained only within the full-length transcript - not the env expressing the sub-genomic transcript when this signal is removed during the splice event.

Figure 2 schematically illustrates the insertion of a small T splice donor into the pLTR. Wherein the small t-splice donor sequence is inserted into the LTR vector which is the lower of the transcription start and not the top of the R sequence so that the reverse transcription (within the last construct) U3-splice donor-R- The RNA transcripts " inherited " and expressed at the ends contain a splice donor sequence near their 5 ' ends.

Figure 3 shows a schematic description of pL-SA-N. The consensus splice acceptor (T / C) nNC / TAG-G (Mount 1982 Nucleic Acids Res 10: 459-472) and the branch point are both underlined and in bold text. Arrows indicate intron / exon junctions. Where the consensus splice acceptor sequence is inserted into the Stu1 / BamHl site of pLXSN. Such positioning will therefore allow these acceptors to interact with the top of the splice donor (eventually in the RNA transcript).

Figure 4 shows a schematic description of pL-SA-N with splice donor deletion. The change from gT to gC is accomplished by performing a PCR reaction on a pL-SA-N vector with two oligonucleotides shown below. The resulting product is then cloned into pL-SA-N with Spe1 - Asc1 to replace the wild-type splice donor gT with gC. Both Spe1 and Asc1 were shown in bold and the mutations in Spe1 oligonucleotide were shown in bold capital letters.

Figure 5 shows the sequence of MLV pICUT.

Figure 6 shows the insertion of a splice donor at the CMV / R junction of the EIAV LTR plasmid. PCR is performed with two oligonucleotides outlined below, and the resulting PCR product clones Sac1- BamH1 into a CMVLTR in which equivalent fragments have been removed. Arrows in the Sac1 oligonucleotide indicate the start of transcription, and the new insert is in uppercase with the underlined splice donor sequence. The start of R is italicized.

Figure 7 shows insertion of a splice acceptor into pEGASUS-1. The double stranded oligonucleotides described herein below are inserted into Xho1-Bpu1 < 2 > 102, which degrades pEGASUS-1 and produces the plasmid pEGSUS + SA. These two consensus splice acceptors (T / C) nNC / TAG-G (Mount 1982 ibid ) and the bifurcation points are both underlined and in bold text. Arrows indicate intron / exon junctions.

Figure 8 shows the removal of the wild type splice donor from the EIAV vector. The splice donor sequence is removed by overlapping PCR using the oligonucleotide described below and the template pEGASUS + SA. First, a separate PCR reaction is performed with oligo 1 + 2 and oligo 3 + 4. The resulting amplified product is then eluted and used in conjunction with the third PCR reaction. Oligos 2 and 4 are added after 10 cycles of this third reaction. The resulting product clones Sac1-Sal1 into pEGASUS + SA to generate the plasmid pEGASUS + SA (no SD). The point mutations that change the wild type splice donor from GT to GC are shown in bold in oligo 1 and complementary oligo 3.

9 shows a combination of pCMVLTR + SD and pEGASUS + SA (no SD). Here, the Mlu 1 fragment of pEGASUS + SA (no SD) is inserted into the unique Mlu 1 site of the pCMV-LTR.

10 shows the structure of pEICUT- LacZ . This is accomplished by inserting the Xho1-Bpu1 102 LacZ fragment from pEGASUS-1 and inserting it into the Xho1-Bpu1 102 site of pEICUT-1 as outlined below.

Fig. 11 shows the sequence of pEICUT- LacZ .

Figure 12 shows the vector configuration in both cell infected and transduced cells. Wherein the starting pICUT vector does not include any splice donor on top of the splice acceptor (in which case the consensus splice is derived from IgSA), and thus the resulting RNA transcript will not be spliced. Thus, all transcripts will be full-length transcripts that contain package signal A. However, during transfection, the splice donor (in this case, the small-T spliced donor), is transferred to the splice acceptor, that is, the splice donor, The donor is included and therefore maximum splicing is achieved (B).

Figure 13 shows gene expression restriction of packaged cells or transfected cells. Restriction of gene expression in this case is achieved by locating the hygromycin ORF at the top of the neomycin ORF into the MLV pEICUT (a). By this cloning strategy, the resultant vector will express an RNA transcript that expresses only hygromycin in the cell infected cells because the ribosome 5 'cap-dependent translation effectively reads only the top of the ORF. However, during transfection, the hygromycin is contained within the functional intron, and thus is deleted from the mature transcript (b), and the neomycin ORF is translated into the 5 'cap-dependent form.

Figure 14 shows the MLV pICUT Neo- p450 vector structure, which limits hygromycine expression of producer cells and 2B6 (p450 isoform) expression of transduced cells. The starting vector for this structure is the pICUT vector of FIG. 13 including both hygro and neo . The neo gene is replaced with the complete p450 2B6 cDNA as follows: The complete 2B6 cDNA is obtained by RT-PCR on human liver RNA (Clontech) using the following primers:

5'ttcgatgatcaccaccatggaactcagcgtcctcctcttccttgcac3 '

5'ttcgagccggctcatcagcggggcaggaagcggatctggtatgttg3 '

This produces a complete 2B6 cDNA with the optimized kosak sequence on the side with the unique Bcl I and NgoM 1 sites. These cDNAs are cloned into the Bcl - NgoM 1 site of pICUT- Hyg - Neo , replacing Neo with p450 (see (A) below). The proviral DNA constructs in both cell infected cells (B) and transduced cells (C) are shown below.

Figure 15 shows a sequence comparison of the wild-type MMLV sequence with the mutation env (m4979A) from the 3 'end of the pol gene.

Figure 16 shows the sequence of the fully modified env gene m4979A.

Figure 17 shows a restricted gene expression retroviral vector in which the first NOI (4070A envelope OFR) is expressed in the initiation vector and the second NOI (in this case, p450) is expressed only after vector replication. After replication of the 4070A gene, the gene is located within the functional intron and is thus removed during RNA splicing.

Figure 18 shows that the 5 'end of the p450 gene (the flush to the splice donor) is found only at the 3' end of the p450 gene (which is flushed to the SA) after replication and thus the functional p450 gene Lt; RTI ID = 0.0 > (from < / RTI > spliced mRNA).

The present invention seeks to provide a novel retroviral vector.

In particular, the present invention seeks to provide a novel retroviral vector capable of effective expression of one NOI- or a plurality of NOIs- at one or more desired target sites.

The present invention also relates to a novel vector for preparing a high dose of vector virion that integrates a safe form for use in vivo and which can provide effective expression of one NOI- or multiple NOIs- at one or more desired target sites. We want to provide one system.

According to a first aspect of the present invention there is provided a retroviral vector consisting of a functional splice donor site (FSDS) and a functional splice acceptor site (FSAS); Wherein said FSDS and FSAS are on the side of the first nucleotide sequence of interest (NOI); The FSDS is on top of the FSAS; Wherein said retroviral vector is derived from a retroviral vector; Wherein said retroviral vector comprises a first nucleotide sequence (NS) capable of yielding a functional splice donor site (FSDS); A second NS capable of yielding a functional splice acceptor site (FSAS); A third NS capable of yielding a non-functional splice donor site (NFSDS); A fourth NS capable of yielding a non-functional splice acceptor site (NFSAS); The first NS is below the second NS; The third and fourth NS are on top of the second NS; Retroviral vectors can be spliced after reverse transcription of the retroviral full-vector at the desired target site.

According to a second aspect of the present invention there is provided a retroviral vector wherein the retroviral pro-vector is composed of a retroviral package signal; The second NS is located under the retrovirus package signal so that splicing can be prevented at the first target site.

According to a third aspect of the present invention there is provided a retrovirus vector wherein the second NS is located below the first NOI so that the first NOI can be expressed at the first target site.

According to a fourth aspect of the present invention, the second NS is located on top of a plurality of cloning sites to provide a retrovirus vector into which one or more additional NOIs can be inserted.

According to a fifth aspect of the present invention there is provided a retroviral vector wherein said second NS is a nucleotide which encodes an immunological molecule or a portion thereof.

According to a sixth aspect of the present invention there is provided a retroviral vector wherein said immunological molecule is an immunoglobulin.

According to a seventh aspect of the present invention, the second NS is provided with a retroviral vector which is a nucleotide sequence encoding an immunoglobulin heavy cahin variable region.

According to an eighth aspect of the present invention, the vector is provided with a retrovirus vector further comprised of a functional intron.

According to a ninth aspect of the present invention there is provided a retroviral vector wherein the functional intron is positioned so as to limit the expression of at least one NOIs within the desired target site.

According to a tenth aspect of the present invention, there is provided a retrovirus vector wherein the target site is a cell.

According to an eleventh aspect of the present invention, the vector or the pre-vector is provided with a retroviral vector derivable from an Onco retrovirus or a lentivirus.

According to a twelfth aspect of the present invention, the vector is provided with a retroviral vector derivable from MMLV, MSV, MMTV, HIV-1 or EIVA.

According to a thirteenth aspect of the present invention, the retroviral vector is provided with a retrovirus vector which is an integrated provirus.

According to a fourteenth aspect of the present invention there is provided a retroviral particle obtainable from a retroviral vector.

According to a fifteenth aspect of the present invention there is provided a cell transfected or transduced with a retroviral vector.

According to a sixteenth aspect of the present invention there is provided a retroviral vector or viral particle or cell for use as a medicine.

According to a seventeenth aspect of the present invention there is provided a retroviral vector or viral particle or cell for the production of a pharmaceutical composition that delivers one or more NOIs to the target site by the same need.

According to an eighteenth aspect of the present invention there is provided a method comprising cell infecting or transducing a cell by the use of a retroviral vector or viral particle or cell.

According to a nineteenth aspect of the present invention, the delivery system comprises one or more non-retroviral expression vector (s), adenovirus (s) or plasmid (s) for delivery of a NOI or a plurality of NOIs to a first target cell Or a combination thereof, and a retroviral vector for delivering one NOI or a plurality of NOIs to a second target cell.

According to a twentieth aspect of the present invention, a retroviral vector is provided.

According to a twenty-first aspect of the present invention there is provided the use of a functional intron which limits the expression of one or more NOIs in a desired target cell.

According to a twenty-second aspect of the present invention, the use of a reverse transcriptase that transfers the first NS from the 3 ' end of the retroviral pro-vector to the 5 ' end of the retroviral vector so that a functional intron can be generated during transfection / RTI >

According to a twenty-third aspect of the present invention, there is provided a hybrid viral vector system for gene transfer in vivo, the system consisting of one or more first viral vectors encoding a second viral vector, The first vector or vectors can infect the first target cell and thus express a second viral vector capable of transducing the second target cell.

According to a twenty-fourth aspect of the present invention, said first vector is obtainable from or based on an adenoviral vector system, said second viral vector being obtainable from a retroviral vector, preferably a lentiviral vector, or A hybrid virus vector system based thereon is provided.

According to a twenty-fifth aspect of the present invention, there is provided a hybrid viral vector system wherein said lentiviral vector is constructed in a cleaved-intron form or is capable of delivering it.

According to a twenty-sixth aspect of the present invention, there is provided a lentiviral vector system wherein said lentivirus is constructed in a cleaved-intron form or is capable of delivering it.

According to a twenty-seventh aspect of the present invention there is provided an adenoviral vector system wherein said adenoviral vector is constructed or is capable of delivering a cleaved-intron shape.

According to a twenty-eighth aspect of the present invention there is provided a vector or plasmid based on or obtainable from one or more entities represented by pE1sp1A, pCI-Neo, pE1RevE, pE1HORSE3.1, pE1PEGASUS4, pCI-Rab, pE1Rab.

According to a twenty-ninth aspect of the present invention there is provided a retroviral vector which enables different expression of NOI in a target cell.

Another aspect of the invention includes a hybrid virus vector system for in vivo gene delivery, wherein the system comprises a first viral vector encoding a second viral vector, wherein the first vector comprises a first target cell To express a second viral vector capable of transducing a second target cell, said first vector being obtainable from or based on an adenoviral vector system, said second The viral vectors are obtainable from, or based on, retroviral vectors, preferably lentiviral vectors.

Another aspect of the invention includes a hybrid virus vector system for in vivo gene delivery, wherein the system comprises a first viral vector encoding a second viral vector, wherein the first vector comprises a first target cell To express a second viral vector capable of transducing a second target cell, said first vector being obtainable from or based on an adenoviral vector system, said second The viral vector may be derived from or based on a retroviral vector, preferably a lentiviral vector; The viral vector system consists of a functional splice donor site (FSDS) and a functional splice acceptor site (FSAS); Wherein said FSDS and FSAS are on the side of the first nucleotide sequence of interest (NOI); The FSDS is on top of the FSAS; Wherein said retroviral vector is derived from a retroviral vector; Wherein said retroviral vector comprises a first nucleotide sequence (NS) capable of yielding a functional splice donor site (FSDS); A second NS capable of yielding a functional splice acceptor site (FSAS); A third NS capable of yielding a non-functional splice donor site (NFSDS); A fourth NS capable of yielding a non-functional splice acceptor site (NFSAS); The first NS is below the second NS; The third and fourth NS are on top of the second NS; Retroviral vectors can be spliced after reverse transcription of the retroviral full-vector at the desired target site.

Another aspect of the present invention includes a self-inactivating (SIN) retroviral vector consisting of a functional splice donor site (FSDS) and a functional splice acceptor site (FSAS); Wherein said FSDS and FSAS are on the side of the first nucleotide sequence of interest (NOI); The FSDS is on top of the FSAS; Wherein said retroviral vector is derived from a retroviral vector; Wherein said retroviral vector comprises a first nucleotide sequence (NS) capable of yielding a functional splice donor site (FSDS); A second NS capable of yielding a functional splice acceptor site (FSAS); A third NS capable of yielding a non-functional splice donor site (NFSDS); A fourth NS capable of yielding a non-functional splice acceptor site (NFSAS); The first NS is below the second NS; The third and fourth NS are on top of the second NS; Retroviral vectors can be spliced after reverse transcription of the retroviral full-vector at the desired target site.

Preferably the retroviral vector further comprises a second NOI; The second NOI is located below the functional splice acceptor site.

Preferably the retroviral pro-vector is further comprised of a second NOI; The second NOI is located below the functional splice acceptor site.

Preferably the second NOI or expression product thereof is or consists of a therapeutic or diagnostic agent.

Preferably, the first NOI or expression product thereof is or consists of one or more agents having selectivity (i.e., marker elements), viral essential elements, or a portion thereof, or a combination thereof.

Preferably the first NS is at or near the 3 ' end of the retroviral pro-vector; Preferably the 3 ' end is composed of a U3 region and an R region; Preferably, the first NS is located between the U3 zone and the R zone.

Preferably the U3 region of the retroviral pro-vector and / or the first NS consists of the NS which is the third NOI; The NOI is one or more transcriptional regulatory elements, coding sequences or portions thereof.

Preferably the first NS is obtainable from the virus.

Preferably, the first NS is an intron or a portion thereof.

Preferably the intron is obtainable from the small t-intron of the SV40 virus.

Preferably the vector component is adjusted. In one preferred aspect of the invention, the vector component is regulated by hypoxia.

In another preferred aspect of the invention, the vector component is controlled by a tetracycline on / off system.

Thus, the present invention provides a delivery system using retroviral vectors.

The retroviral vector of the delivery system of the present invention consists of a functional splice donor site (FSDS) and a functional splice acceptor site (FSAS) on the side of the first NOI. The retroviral vector is formed as a result of reverse transcription of a retroviral pre-vector composed of a plurality of NOIs.

When the FSDS is located at the top of the FSAS, the intervening sequence (s) can be spliced. In general, splicing removes the "RNA sequence" and the residual "exon" sequence of the intervening or "in-discussion" ligated to provide a contiguous sequence for translation.

The splicing process is shown in Fig.

In this figure, Y represents a sequence inserted between deletions as a result of splicing.

Preferably, the intervening sequence (or intron) is positioned such that the retrovirus package signal is deleted at the target site.

The inherent splicing shape of the retroviral vector is shown in Figure 27A. The splicing shape of known vectors is shown in Figure 27B. The splicing shape according to the present invention is shown in Fig.

Preferably, the intervening sequence is positioned to be deleted at the desired target site, and the retroviral vector is self-inactivated.

In the context of the present invention, splicing can not occur if the FSDS is located below the FSAS.

Likewise, if the FSDS is a non-functional splice donor site (NFSDS) and / or if the FSAS is a non-functional acceptor site (NFSAS), then splicing can not occur.

Preferably, the fourth NS can yield a non-functional splice donor site.

Preferably the fourth NS can yield a splice donor site of non-functional cryptosystems.

Preferably the fourth NS can yield a non-functional splice acceptor site.

Preferably, the fourth NS can yield a splice acceptor site of non-functional cryptosystem.

Preferably, the fourth NS can yield a non-functional splice donor site.

Preferably, the fourth NS is located within the retrovirus package signal.

An example of NFSDS is a mutated FSDS in which the FSDS can no longer be recognized by the splicing mechanism.

The term " splice donor site " includes authenticated or unproven, natural and artificially induced or inducible splice donor sites.

The term " cipher " splice donor site includes a splice donor site located within a package signal that also includes a previously unproven splice donor site.

The term " splice acceptor site " includes proven or unproven natural and artificially induced or inducible splice acceptor sites.

The term " cryptographic " splice acceptor site includes a splice acceptor site located within a package signal that also includes a previously unproven splice acceptor site.

The term " splice site " refers to a proven or unproven, natural and artificially induced or inducible splice donor and / or splice acceptor site including splice donor and cryptographic splice acceptor sites .

The term " cryptographic " splice site includes a splice donor and / or cryptographic splice acceptor site of cryptography located in a package signal that also includes a previously unproven splice donor or splice acceptor site.

In the context of the present invention, each NS may be any suitable nucleotide sequence. For example, each sequence may be independently DNA or RNA-these may be prepared synthetically or prepared by use of recombinant DNA technology, separated from natural sources, or combinations thereof. The sequence may be a sensor sequence or an antisense sequence. May be a plurality of sequences that may be directly or indirectly combined with each other or a combination thereof.

In the context of the present invention, each NOI can be any suitable nucleotide sequence. For example, each sequence may be independently DNA or RNA-these may be prepared synthetically or prepared by use of recombinant DNA technology, separated from natural sources, or combinations thereof. The sequence may be a sensor sequence or an antisense sequence. May be a plurality of sequences that may be directly or indirectly combined with each other or a combination thereof.

The first NOI includes, but is not limited to, one or more selectable markers that have been successfully used in retroviral vectors: bacterial neomycin and hygromycin, which exhibit resistance to G418 and hygromycin, respectively, (Palmer et al 1987 Proc Natl Acad Sci 84: 1055-1059; Yang et al 1987 Mol Cell Biol 7: 3923-3928); A mutant mouse gihydrofolate reductase gene ( dhfr ) that is resistant to methotrexate (Miller et al 1985 Mol Cell Biol 5: 431-437); A bacterial gpt gene (Mann et al 1983 Cell 33: 153-159) that allows growth in a medium containing mycophenolic acid, xanthine and aminopterin; A bacterial hisD gene (Donas and Mulligan 1988 Proc Natl Acad Sci 85: 6460-6464) that allows growth in a medium free of histidine and containing histidino; Multiple drug resistance genes ( mdr ) (Guild et al 1988 Proc Natl Acad Sci 85: 1595-1599; Pastan et al 1988 Proc Natl Acad Sci 85: 4486-4490), which exhibit resistance to various drugs, and puromycin Bacterial genes that are resistant to phleomycin (Morgenstern and Land 1990 Nucleic Acid Res 18: 3587-3596).

All of these markers are predominantly selectable markers, enabling the selective selection of most cells expressing these genes. [beta] -galactosidase may also be considered a predominant marker; beta -galactosidase expressing cells can be selected by using a fluorescence-activated cell sorter. In effect, cell surface proteins provide selectable markers for cells that have not yet produced proteins. Cells expressing proteins can be selected by using fluorescent antibodies to proteins and cell classifiers. Other selectable markers included within the vector include hprt and HSV thymidine kinase, which allow cells to grow in media containing hypoxanthine, amethoterin and thymidine.

The first NOI may, for example, contain a non-coding sequence that is a retroviral package site or non-sense sequence that makes the second NOI non-functional in the pre-vector, but when removed by splicing the vector The second NOI represents functional expression.

In addition, the first NOI can encode viral essentials such as env encoding the Env protein, which can reduce the complexity of the production system. By way of example, within the adenoviral vector this makes it possible for the retroviral vector and envelope to be shaped in a single adenoviral vector under the same promoter control, providing a simpler system and allowing for more sequences in the adenoviral vector Leave capacity. In one aspect, this additional sequence may be the gag-pol cassette itself. Thus, in one adenoviral vector it can produce retroviral vector particles. Previous studies (Feng et al 1997 Nature Biotechnology 15: 866) required the use of multiple adenoviral vectors.

If the retroviral component comprises an env nucleotide sequence, all or part of the sequence may be an amphotropic Env protein or an influenza haemagglutinin (HA) designated, for example, 4070A, or a vascular stromal virus G VSV-G) < / RTI > protein, all or part of another env nucleotide sequence. substituting env gene (heterologous) env gene is an example of the release of the technique or method referred to as pseudo type (pseudotyping). Pseudo-typing is not new, and examples include WO-A-98/05759, WO-A-98/05754, WO-A-97/17457, WO- et al. (1997 Cell 90, 841-847).

In one preferred aspect, the retroviral vector of the invention is a sttotyped. In this respect, pseudotyping has one or more advantages. For example, in the case of lentivirus, the env gene product of HIV basic vector restricts these vectors to infect only cells expressing a protein called CD4. However, if the env genes in these vectors are replaced with env sequences from other RNA viruses, they will have a broader infection spectrum (Verma and Somia 1997 Nature 389: 239-242). For example, the researchers pseudotyped HIV-based vectors with glycoproteins from VSV (Verma and Somia 1997 ibid ).

In addition, the Env protein may be a mutated or modified Env protein, such as a designed Env protein. Modifications can be created or selected for introducing target capabilities or for reducing toxicity or for other purposes (Valsesia-Wittman et al 1996 JVirol 70: 2056-2064; Nilson et al 1996 Gene Therapy 3: 280-286 Fielding et al 1998 Blood 9: 1802 and references).

Suitable second NOI coding sequences include, but are not limited to, cytokines, chemokines, hormones, antibodies, engineered immunoglobulin-like molecules, single chain antibodies, fusion proteins, enzymes, Antisense RNAs, transdominant negative mutations of the target protein, toxins, conditional toxins, antigens, tumor suppressor proteins and growth factors, membrane proteins, vasoactive proteins and peptides, anti-viral proteins and ribozyme ) And its derivatives (such as those linked to a receptor group). The term " therapeutic " When these are included, such coding sequences can be optionally linked to appropriate promoters which can be generally promoters that direct the expression of the ribozyme (s) or other promoters or promoters.

The second NOI coding sequence may encode a segment of the fusion protein or coding sequence.

The retroviral vectors of the invention can be used to deliver a second NOI, such as a pre-drug activating enzyme, to the tumor site for cancer treatment. In each case, a suitable pre-dose can be used to treat an individual (such as a patient) in combination with a suitable pre-drug activating enzyme. Suitable prodrugs are administered in combination with a vector. Examples of pre-drugs include etoposide phosphate (with alkaline phosphate, Senter et al 1988 Proc Natl Acad Sci 85: 4842-4846); 5-fluorocytosine (in conjunction with cytosine deaminase, Mullen et al 1994 Cancer Res 54: 1503-1506); (Kerr et al 1990 Cancer Immunol Immunother 31: 202-206) with Doxorubicin-Np-hydroxyphenoxyacetamide (Phenicillin-V-Amidase); Para- N-bis (2-chloroethyl aminobenzonyl glutamate) (with carboxypeptidase G2); Cephalosporin nitrogen mustard carbamate Ganciclovir (in conjunction with HSV thymidine kinase, Borrelli et al 1988 Proc Natl Acad Sci 85: 7572-7576), mustard preclean (together with? -lactamase), SR4233 (with P450 reductase) - Drugs (with Nitrogen reductase, Friedlos et al. 1997 J Med Chem 40: 1270-1275) and Cyclophosphamide

(In combination with P450, Chen et al 1996 Cancer Res 56: 1331-1340).

The vector of the present invention can be delivered to the target site by a virus or non-viral vector.

As is well known in the art, vectors are a means of enabling or facilitating the transfer of entities from one environment to another. As an example, some vectors used in recombinant DNA technology allow entities such as DNA segments (such as heterologous DNA segments, such as heterologous cDNA segments) to be transferred into target cells. When transferred arbitrarily into the target cell, the vector is made to retain the heterologous DNA in the cell or to serve as a unit for DNA replication. Examples of vectors used in the recombinant DNA technology include plasmids, chromosomes, artificial chromosomes or viruses and the like.

Non-viral delivery systems include, but are not limited to, DNA translation methods. Wherein the cell infection comprises using a non-viral vector that delivers the gene to the target mammalian cell.

Common cell infecting methods include, but are not limited to, electroporation, DNA biolistics, lipid-mediated cell infections, compressed DNA-mediated cell infections, liposomes, immunoliposomes, lipofectins, -Mediated, cationic facial amphiphiles (CFAs) (Nature Biotechnology 1996 14: 556), and combinations thereof.

Virus delivery systems include, but are not limited to, adenoviral vectors, adeno-associated virus vectors (AAV), herpes virus vectors, retrovirus vectors, lentivirus vectors, baculoviral vectors or pox viral vectors no. Other examples of vectors include an ex vivo delivery system including, but not limited to, electroporation, DNA biolistic, lipid-mediated cell infections, and compressed DNA-mediated cell infections.

The vector delivery system of the present invention can consist of a first vector produced in the laboratory that encodes the gene necessary to generate a second vector in vivo.

The first viral vector or vectors may be various viral vectors, such as retroviruses, adenoviruses, herpesviruses or poxvirus vectors, or a mixture of vectors of different viral origins in the case of multiple first viral vectors. In any case, the first viral vector is defective in that it is preferably not capable of independent replication. Thus, they can enter the target cell and transduce the second vector sequence, but can not replicate to infect additional target cells.

If the hybrid virus vector system consists of one or more first vectors encoding the second vector, then all two or three first vectors will generally be used to simultaneously infect or transfect the first target cell group.

Preferably a single first viral vector encoding all components of the second viral vector.

The preferred single or multiple first viral vectors are adenoviral vectors.

Adenoviral vectors for use in the present invention may be derived from human adenoviruses or adenoviruses that generally do not infect humans. Preferably the vector is derived from adenovirus type 2 or adenovirus type 5 (Ad2 or Ad5) or avian adenovirus such as murine adenovirus or CELO virus (Cotton et al 1993 J Virol 67: 3777-3785). The vector may be a replication competent adenoviral vector, but more preferably a defective adenoviral vector. Adenoviral vectors become defective by deletion of one or more components required for viral replication. Generally, each adenoviral vector includes deletions in at least the E1 region. For the generation of infectious adenoviral vector particles, this deletion is associated with the passage of the virus in a human embryonic fibrous cell line, such as a human 293 cell line, which contains an integrated copy of the left part of Ad5, including the E1 gene . The ability to insert heterologous DNA into these vectors can amount to about 7 kb. Thus, such a vector is useful according to the invention in the structure of a system consisting of three distinct recombinant vectors each containing one of the necessary transcriptional units for the structure of the second retroviral vector.

Other adenoviral vectors containing deletions in addition to other adenoviral genes are known in the art, and these vectors are also suitable for use in the present invention. Some of these second generation adenoviral vectors exhibit reduced immunogenicity (i.e., E1 + E2 deletion Gorzigilia et al 1996 J Virol 70: 4173-4178; E1 + E4 deletion Yeh et al 1996 J Virol 70: 559-565 ). Extended deletion provides additional cloning ability for multiple gene introduction in a vector. For example, a 25 kb deletion has been described (Lieber et al 1996 J Virol 70: 8944-8960), and cloning vectors have been reported in which all viral genes have been deleted that allow the introduction of more than 35 kb of heterologous DNA (Fisher et al 1996 Virolology 217: 11-22). Such a vector may be used in accordance with the present invention to generate an adenovirus first vector encoding two or three transcription units for the structure of the retroviral second vector.

The second viral vector is preferably a retroviral vector. The second vector is generated by expression of the essential gene for assembly and packaging of defective viral vector particles within the first target cell. This is defective in that independent replication is not possible. Therefore, when the second retroviral vector transduces a second target cell, it is impossible to spread the target cell by replication.

In general, the term " retroviral vector " includes retroviral nucleic acids that are infectable but not replication by themselves. This is a replication flaw. In general, the retroviral vector is composed of one or more NOI (s) for delivery to the target cell, and preferably consists of a retroviral origin. Retroviral vectors also include functional splice donor sites (FSDS); And a functional splice acceptor site (FSAS); Non-functional splice donor site (NFSDS); And a functional splice site (NFSS), the sequence (s) sandwiched between the FSDS and the FSAS can be spliced. The retroviral vector may further comprise a non-retroviral sequence such as a non-retroviral control sequence within the U3 region that may affect the expression of NOI (s) when the retroviral vector is integrated into the target cell as a pro-virus . Retroviral vectors do not need to contain elements from just one single retrovirus. It is therefore possible to have two further retroviruses or elements derivable from other sources in connection with the present invention.

In general, the term " retroviral full-vector " refers to a first nucleotide sequence (NS) that contains a retroviral vector genome as described above, but which can yield a functional splice donor site (FSDS); A second NS capable of yielding a functional splice acceptor site (FSAS); Non-functional splice donor site (NFSDS); And a functional splice site (NFSS); The first NS is located below the second NS; The third and fourth NS are located at the top of the second NS and the retroviral vector can be spliced after the reverse transcription of the retroviral pro-vector at the target site.

The term " retroviral vector particle " refers to a packaged retroviral vector and preferably indicates that it can bind to and enter the target cell. As discussed above, the components of the particles can be modified against wild-type retroviruses. For example, the Env proteins in the proteinaceous coatings of the particles can be genetically modified to change their targeting specificity or to achieve some other desired function.

Retroviral vectors of this aspect of the invention are derivable from murine oncol retroviruses such as MMLV, MSV or MMTV; Or from lentiviruses such as HIV-1, ELAV; Or from other retroviruses.

The retroviral vectors of the present invention can be modified so that the splice donor site of the retrovirus is non-functional.

The retroviral vectors of the present invention can be modified so that the splice acceptor site of the retrovirus is non-functional.

The term " strain " includes, but is not limited to, silence, incapacity, mutation or elimination of a splice donor or splice acceptor site.

Vectors such as MLV basal vectors with mutated native splice donor sites are known in the art. An example of such a vector is pBABE (Morgenstern et al 1990 ibid ).

The second vector may be generated from the essential gene expression for retroviral vector generation encoded in the DNA of the first vector. These genes may include the gag-pol gene from retroviruses, the envelope-enveloped virus containing one or more therapeutic or diagnostic NOIs (s), and the env gene from the defective retroviral vector. The defective retroviral vector contains a sequence and a packaging signal that is generally capable of reverse transcription at least in part of the 3 'LTR, at least in part of the 5' long terminal repeat (LTR).

If the second vector is to be cloned defective, the second vector may be encoded by a single or a plurality of transcription units located within one or more adenoviral vectors or other first vectors. Thus, they may be transcription units encoding a second vector genome, transcription units encoding gag-pol , and transcription units encoding env . Also, one or more of these may be combined. For example, nucleic acid sequences encoding gag-pol and env or env and the genome can be joined within a single transcription unit. Methods to accomplish this are well known in the art.

The transcription unit described herein is a region of nucleic acid containing a signal for achieving expression of such a coding sequence independently of the coding sequence and other coding sequences. Thus, each transcriptional unit generally consists of at least one promoter, enhancer and polyadenylation signal.

The term " promoter " is used in the sense of the field to refer to the RNA polymerase binding site of the Jacobson-Monod theory of gene expression.

The term " enhancer " includes DNA sequences that bind to other protein components of the transcription initiation complex and facilitate transcription initiation as indicated by its associated promoter.

The promoter and enhancer of the transcription unit encoding the second vector may preferably be strongly active or strongly induced in the first target cell under conditions for the production of the second viral vector. Promoters and / or enhancers are either constitutively effective or are tissue or time limited in their activity. Examples of suitable tissue limited promoters / enhancers are highly active in tumor cells, such as the MUC1 gene, the CEA gene, or a promoter / enhancer from the 5T4 antigen gene. An example of a temporally restricted promoter / enhancer is one that is responsive to ischaemia and / or hypoxia, such as a hypoxic response element or a promoter / enhancer of the grp78 or grp94 gene. One preferred promoter-enhancer combination is the major intermediate early (MIE) promoter / enhancer combination of human cytomegalovirus (hCMV).

Other desirable additional components include entities that enable effective expression of one NOI or a plurality of NOIs.

In one preferred aspect of the invention there is hypoxic or ischemic regulatable expression of a second vector component. In this regard, hypoxia is a potent regulator of gene expression in a wide range of other cell types and is involved in the hypoxia-inducible factor-1 binding to the same type of DNA recognition site as the hypoxia responsive elements (HREs) Inducible facotr-1, HIF-1; Wang and Semenza 1993 PNAS. (USA) 90: 430). Dachs et al. (1997 Nature Med. 5: 515) reported that in order to regulate the expression of markers and therapeutic genes by human fibrosarcoma cells in response to hypoxia in solid tumors in vitro and in vivo, The multiple binding form of HRE from the phosphoglycerate kinase-1 (PGK-1) gene (Firth et al 1994, PNAS 91 (14): 6496-6500) was used. Also, the fact that labeled glucose deficiency is also present in the ischemic region of the tumor can be used to activate heterologous gene DNA expression, particularly NOI according to the present invention in tumors. The truncated 632 base pair sequence of the grp 78 gene promoter, which is known to be activated by glucose deficiency, is able to induce expression of the reporter gene at high levels in vivo in rats and tumors (Gazit et al 1995 Cancer Res. 55: 1660 ).

Another method of regulating the expression of these components is described by Gossen and Bujard (1992) as described for the production of gal, pol and VSV-G proteins of retroviruses by Yoshida et al (1997 Biochem Biophys Res Comm 230: 426) Proc Natl Acad Sci 89: 5547). ≪ / RTI > In general, such regulatory systems have also been used in the present invention to regulate the generation of the pre-vector genome. This confirms that no vector components are expressed from adenoviral vectors in the absence of tetracycline.

Stable features that can be incorporated into a hybrid virus vector system are described below. There may be one or more of these characteristics.

The second vector also has advantages in vivo use in that it is used to integrate into one or more features that eliminate the possibility of recombination to produce an infectious virus capable of independent replication. These features are included in previously published studies (Feng et al 1997 ibid ). In particular, the structure of retroviral vectors from the three components as described below has not been described by Feng et al ( ibid ).

First, the sequence homology between the sequences encoding the components of the second vector is nullified by deletion of the homology region. Homologous regions allow genetic recombination to occur. In a particular embodiment, three transcription units are used to structure the second retroviral vector. The first transcription unit contains the retroviral gag-pol gene under the control of a non-retroviral promoter and enhancer. The second transcription unit contains the retroviral env gene under the control of a non-retroviral promoter and enhancer. The third transcription unit consists of a defective retroviral genome under the control of a non-retroviral promoter and enhancer. Within the native retroviral genome, the package signal is located in this part of the gag sequence required for proper function. Generally, when a retroviral vector system is constructed from it, a package signal comprising a portion of the gag gene remains in the vector genome. In this case, however, the defective retroviral genome contains a minimal package signal that does not contain a sequence homologous to the gag sequence in the first transcription unit. There is also a small overlap between the 3 'end of the pol coding sequence and the 5' end of the env in retroviruses such as the Moloney murine and leukemia virus (MMLV), for example. The corresponding homology region between the first and second transcription units is removed by changing the sequence at the 3 ' end of the pol coding sequence or the 5 ' end of the env to change the codon usage, rather than the amino acid sequence of the encoded protein .

The possibility of a second replication competent second viral vector is nullified by pseudotyping the genome of one retrovirus with the Env protein of another retrovirus or other envelope-enveloped virus so that the homology region between the env and gag-pol components is nullified . The defective retroviral genome contains a minimal package signal that does not contain sequences homologous to the gag sequence in the first transcription unit.

In a particular embodiment, the retroviral vector is constructed from the following three components: the first transcription unit comprises a retroviral gag-pol gene under the control of a non-retroviral promoter and enhancer. The second transcription unit contains the env gene from another envelope-enveloped virus under the control of the non-retroviral promoter and enhancer. The third transcription unit consists of a defective retroviral genome under the control of a non-retroviral promoter and enhancer. The defective retroviral genome contains a minimal package signal that does not contain sequences homologous to the gag sequence in the first transcription unit.

Third, the possibility of replication competent retroviruses can be eliminated by using two transcription units that have been constructed in a special way. The first transcription unit comprises a gag-pol coding region under the control of a promoter-enhancer that is active in the first target cell, such as the hCMV promoter-enhancer or tissue-restricted promoter-enhancer. The second transcription unit encodes a retroviral genomic RNA that can be packaged into retroviral particles. The second transcription unit contains retroviral sequences necessary for packaging, integration and reverse transcription, and also env protein coding sequences of envelope-enveloped viruses and coding sequences for one or more therapeutic genes.

In this example, transcription of the env and NOI coding sequences is designed such that the Env protein is preferentially produced in the first target cell while the NOI expression product is preferentially produced in the second target cell.

A suitable intron splicing arrangement is described later in Example 5 and is shown in Figures 17 and 27c. Wherein the splice donor site is located at the bottom of the splice acceptor site in the retroviral genome sequence that is delivered by the first vector to the first target cell. Therefore, splicing will be absent or rare in the first target cell, and Env protein will be preferentially expressed. However, if the vector genome undergoes a reverse process and integration into a second target cell, the functional splice donor sequence will be located within the 5 'LTR that is the top of the functional splice acceptor sequence. Splicing splices the env sequence and the transcript of the resulting NOI.

Expression of NOI in the second sequence of this example is restricted to the second target cell and expression in the first target cell is prevented as follows: This sequence is described later in Example 6 and shown in FIG. The first fragment of the NOI comprising the promoter-enhancer and the 5 ' end of the coding sequence and the naturally or artificially induced or inducible splice donor sequence are inserted at the 3 ' end of the retroviral genomic construct on top of the R- . The second fragment of NOI, which contains all the sequences necessary to complete the coding region, is located below the natural or artificially induced or inducible splice acceptor sequence located beneath the package signal in the retroviral genome structure. Upon reverse transcription and integration of the retroviral genome within the second tank cell, the promoter and functional splice donor sequence of the 5 'fragment of NOI is located at the 3' end of the functional splice acceptor and NOI. Transcription and splicing from the promoter then allows translation of the NOI in the second target cell.

In a preferred embodiment, the hybrid virus vector system according to the invention consists of a single or multiple adenovirus first vector encoding the retrovirus second vector.

The preferred embodiments of the invention described describe one of the major problems associated with adenoviral vectors and other viral vectors, namely the transient expression of genes from these vectors. The resulting retroviral particle from the first target cell can transduce a second target cell and gene expression in the second target cell remains stable due to integration of the retroviral vector genome into the host cell genome. The second target cell can not express a significant amount of the viral protein antigen and is less immunogenic than the cell transduced with the adenoviral vector.

The use of retroviral vectors as a second vector is advantageous because it allows, for example, the targeting of rapidly dividing cells, thus allowing some degree of cell discrimination. Moreover, retroviral integration allows stable expression of the therapeutic gene in the target tissue, including stable expression upon proliferation of the target cell.

The use of the novel retroviral vector designs of the present invention is also advantageous in that gene expression may be confined to the first or second target site. In this way, single or multiple NOIs may be preferentially expressed at the second target site and may not be expressed or expressed insufficiently at a biologically significant level at the first target site. As a result, possible toxicity and antigenicity of NOI can be negated.

Preferably, the first viral vector preferentially transduces a particular cell type or cell type.

More preferably, the first vector is a targeted vector, i.e., the vector is targeted to a particular cell, with a changed histological stellarity compared to the native virus.

The term " targeted vector " is not always connected to the term " target site " or " target cell ".

A " target site " refers to a site in which the vector is unique or targeted, or can be infected or transfected with a cell.

The " first target site " refers to the first site in which the vector is unique or targeted or can be infected or transfected into the cell.

A " second target site " refers to a second site in which the vector is unique or targeted or can be infected or transfected with cells.

A " target cell " simply indicates a cell in which the vector is native or targeted, or capable of cell infection or transduction.

A " first target cell " simply indicates the first cell in which the vector is native or targeted or can be infected or transfected with the cell.

A " second target cell " simply represents a second cell in which the vector is native or targeted or can be infected or transfected with the cell.

The preferred adenovirus first vector according to the invention is also preferably a targeted vector in which the tissue star is changed from the wild-type adenovirus. Adenovirus vectors are described, for example, in Krasnykh et al 1996 J. Virol 70: 6839-6846; Wickham et al 1996 J. Virol 70: 6831-6838; Stevenson et al 1997 J. Virol 71: 4782-4790; Wickham et al 1995 Gene Therapy 2: 750-756; Douglas et al Neuromuscul. Disord 7: 284-298; Can be modified to produce a targeted adenoviral vector as described in Wickham et al 1996 Nature Biotechnology 14: 1570-1573.

The first target cells for the vector system according to the invention include hematopoietic cells (including mononuclear cells, macrophages, lymphocytes, granulocytes or their progenitor cells); Endothelial cells; Chaoyang cells; Stromal cells; Astrocytes or glial cells; Muscle cells; And epithelial cells.

Thus, the first target cell according to the present invention capable of producing a second viral vector may be any of the cell types described above.

In a preferred embodiment, the first target cell according to the present invention comprises a first transcriptional unit for retroviral gag-pol and a second transcriptional unit capable of producing a packageable defective retroviral genome 0.0 > monocytes < / RTI > or macrophages. In this case, the at least second transcription unit is preferably under the control of a promoter-enhancer that is preferentially active in the locus of the disease in vivo, such as the micro-environment of an ischemic site or solid tumor.

In a particularly preferred embodiment, the second transcription unit reduces the expression of a viral essential element such as a viral env gene on the insertion into the second target cell of the genome, and the effective expression of therapeutic and / or diagnostic NOI or NOIs Lt; RTI ID = 0.0 > intron < / RTI >

The packaged cells may be packaged cells in vivo in the body of the individual being treated or may be cells cultured in vitro , such as tissue culture cell lines. Suitable cell lines include mammalian cells such as murine and fibroblast-derived cell lines or human cell lines. Preferably, the packaged cell line is a human cell line such as, for example, HEK293, 293-T, TE671, HT1080.

In addition, the packaged cells can be cells derived from an individual to be treated, such as monocytes, macrophages, blood cells or fibroblasts. Cells can be isolated from individuals, and the package and vector components are administered ex vivo and followed by re-administration of self-packaging cells. In addition, the package and vector components may be administered as packaged cells in vivo. Methods for introducing retroviral packages and vector components into individual cells are well known in the art. For example, one approach is to introduce other DNA sequences required to produce retroviral vector particles, such as the env coding sequence, the gag-pol coding sequence, and the defective retroviral genome into cells simultaneously by transient triple cell infection (Landau & Littman 1992 J. Virol. 66, 5110; Soneoka et al 1995 Nucleic Acids Res 23: 628-633).

The second viral vector may also be a targeted vector. In the case of retroviral vectors this can be achieved by modifying the Env protein. Retrovirus The Env protein of the second vector needs to be a non-toxic envelope or a sheath that is non-toxic in the first target cell, such as an MMLV amphotropic envelope or a modified amphotropic envelope have. A stable feature in this case is preferably deletion of the region or sequence homology between the retroviral components.

Preferably, the envelope enables transduction of human cells. Examples of suitable env genes include, but not of the hemagglutinin (HA) of MLV from ampo tropic env, RD114 feline leukemia virus env or flu (influenza) viruses, such as VSV-G, 4070 env limited thereto. The Env protein may be capable of binding to a limited number of receptors on human cells and may be a designed envelope containing targeting moieties. The env and gag-pol coding sequences are transcribed from the active promoter and optionally the enhancer in the selected package cell line, and the transcription units are terminated by the polyadenylation signal. For example, a suitable promoter-enhancer combination from the human immediate-early (hCMV-MIE) gene and the polyadenylation signal from SV40 can be used if the packaged cell is a human cell. Other suitable promoter and polyadenylation signals are well known in the art.

The second target cell population may be the same as the first target cell population. For example, delivery of the first vector of the present invention to cacao cells leads to replication and generation of additional vector particles capable of transducing additional tumor cells.

The second cell group may be different from the first cell group. In this case, the first target cell acts as an endogenous production site in the body of the treated individual and produces additional vector particles capable of transducing a second target cell population. For example, the first target cell population may be hematopoietic cells transduced by the first vector in vivo or ex vivo. The first target cell is then transferred to or transferred to a site in the body, such as a tumor, to produce a second vector that can be transduced, for example, as being mitotically active in a solid tumor.

The retroviral vector particles according to the present invention will also be able to transduce cells that are slow-dividing and non-lentiviral, such as MLV, which are not effectively transduced. Slowly-dividing cells, including certain tumor cells, divide once every 3-4 days. Although tumors contain rapidly dividing cells, some of the cells in the cortex, especially the cells in the center of the tumor, occasionally divide. The target cells may also be stem cells such as growth-restricted cells or hematopoietic stem cells or CD34-positive cells capable of cell division such as cells in the central part of the tumor mass. Furthermore, the target cells may be differentiated cells such as neurons, astrocytes, glial cells, microglial cells, macrophages, mononuclear cells, epithelial cells, endothelial cells, hepatocytes, Lt; / RTI > The target cell may be transfected in vitro or directly in vivo after isolation from a human individual.

The present invention enables localized production of high amounts of defective retroviral vector particles in vivo at or near the site where the activity of the therapeutic protein or proteins is required for effective transduction results of the second target cell. This is more effective than using a defective adenoviral vector or a defective retroviral vector alone.

The present invention also enables the generation of retroviral vectors such as MMLV-based vectors in non-dividing and slow-dividing cells in vivo. Previously, it was possible to generate MMLV-based retroviral vectors only in fast dividing cells such as tissue-culture-modified cell proliferation in the laboratory or in fast dividing tumor cells in vivo.

The expansion of the range of cell types capable of producing retroviral vectors is advantageous in delivering the genes to cells of solid tumors that are slowly dividing, and can be used for the production of endothelial cells and various hematopoietic lineage cells as endogenous production lines for the production of therapeutic protein products Which is advantageous for the use of the same non-dividing cells.

Delivery of one or more therapeutic genes by the vector system according to the present invention may be used alone or in combination with other therapeutic or therapeutic agents.

For example, retroviral vectors of the invention can be used to deliver one or more NOIs (s) useful for the treatment of diseases listed in WO-A-98/05635. Provides a portion of the list for reference: Cancer, inflammation or inflammatory disease, skin disorder, heat, cardiovascular effects, bleeding, coagulation and acute reaction, cachexia, loss of appetite, acute infection, HIV infection, Host reaction, autoimmune disease, perfusion injury, meningitis, migraine and aspirin-dependent anti-thrombosis; Tumor growth, invasion and spread, angiogenesis, metastasis, malignant, swollen and malignant pleural effusion; Cerebral ischemia, ischemic heart disease, osteoarthritis, rheumatoid arthritis, osteoporosis, asthma, multiple arteriosclerosis, neurodegeneration, Alzheimer's disease, atherosclerosis, seizures, vasculitis, Crohn's disease and ulcerative colitis; Periodontitis, gingivitis; Psoriasis, atopic dermatitis, chronic ulcer, epidermal blistering; Corneal ulceration, retinopathy and surgical wound healing; Rhinitis, allergic conjunctivitis, eczema, hypersensitivity; Stenosis, hemorrhagic heart failure, endometriosis, atherosclerosis or internal sclerosis.

Moreover, or alternatively, the retroviral vectors of the invention can be used to deliver one or more NOIs (s) useful in the treatment of disorders listed in WO-A-98/07859. For reference, we provide a part of the list: cytokine and cell proliferation / differentiation activity; Immunodeficiency or immunostimulatory activity (i. E., Treatment of immune deficiency, including infection by human immunodeficiency virus, modulation of lymphocyte cell growth, treatment of cancer and many autoimmune diseases, prevention of graft rejection or induction of tumor immunity for); Modulation of hematopoiesis, i. E., Myeloid or lymphatic disease; Enhancing the growth of the skeleton, cartilage, tendons, ligaments and nervous tissues, i.e., wound healing, treatment of burns and ulcers, periodontal disease and neurodegeneration; Inhibition and activation of follicle-stimulating hormone (modulation of fertilization); Chemical major / chemical motive activity (ie, for aggregation of specific cell types into sites of wound or infection); Hemostatic and platelet activation (i.e., for treating hemophilia and seizures); Anti-inflammatory activity (for the treatment of septic shock or Crohn's disease); As an antimicrobial agent; Moderators of metabolism or behavior; As analgesics; Treatment of certain deficit disorders; Psoriasis treatment in human or veterinary medicine.

Moreover, or alternatively, the retroviral vectors of the invention can be used to deliver one or more NOIs (s) useful in the treatment of disorders listed in WO-A-98/09985. For reference, we provide a part of the list: macrophage inhibition and / or T cell inhibitory activity and thus anti-inflammatory activity; An inhibitory effect on cellular and / or humoral immune responses including anti-immune activity, i.e., non-inflammatory response; Inhibit the ability of macrophages and T cells to adhere to the external matrix component and fibronectin, as well as up-regulated fas receptor expression in T cells; Inflammatory bowel disease, arthritis, rheumatoid arthritis, hypersensitivity related inflammation, allergic reaction, asthma, systemic lupus erythematosis, collagen disease and other autoimmune diseases, atherosclerosis related inflammation, atherosclerosis, atherosclerotic heart disease, Heart failure, myocardial infarction, vascular inflammatory disorder, respiratory distress syndrome or other cardiovascular diseases, inflammation associated with pepsin ulcers, ulcerative colitis and other diseases of the stomach, liver fibrosis, liver cirrhosis or other liver diseases, , Glomerulonephritis or other renal and urological disorders, diverticulitis or other otorhinolaryngological diseases, dermatitis or other skin disorders, periodontal disease or other dental disease, testicular or testicular epididymitis, sterility, testicular shock or other immune- Placental dysfunction, placental dysfunction, addictive abortion, convulsions, pre-convulsions and other immunizations And / or inflammatory-related gynecological diseases, posterior uveitis, central uveitis, anterior uveitis, conjunctivitis, chorioretinitis, uveitic retinitis, optic neuritis, intraocular inflammation such as retinitis or conjunctivochal edema, sympathetic neuritis, scleritis, conjunctivitis pigmentum Inflammatory components of eye shock, eye inflammation caused by infection, proliferative clear-retinopathy, acute ischemic optic nerve impairment, excessive scarring, glaucoma, irritable bowel syndrome, (CNS) or autoimmunity in other organs, immunologic and / or inflammatory conditions associated with autoimmunity in the central nervous system (CNS) or other organs, immunological and / or inflammatory responses to ocular transplantation, / Or complications and / or side effects from the treatment of inflammation, Parkinson's disease, Parkinson's disease, AIDS-related dementia complex HIV-related brain disease, Devic's disease, Syde neuropathy, acute neuropathy, subacute neuropathy, neuropathy, neurodegenerative disorders, neurodegenerative diseases, conditions or disorders of cholestasis, Alzheimer ' s disease and CNS, inflammatory components of psychotic disorders, Neuropsychiatric disorders, chronic neuropathy, Guillem-Barre syndrome, Sydenham chorea, myasthenia gravis, quasi-tumor brain, Down's syndrome, Huntington's disease, amyotrophic lateral sclerosis, CNS stress or CNS Inflammatory components of shock or CNS infection, inflammatory components of muscle atrophy and malnutrition, and immune and inflammation related diseases, conditions or disorders of the central and peripheral nervous system, post-impact inflammation, septic shock, infectious disease, inflammatory complications or side effects of surgery , Bone marrow transplantation or other graft complications and / or side effects, inflammation and / or immunological complications and side effects of gene therapy due to infection with a viral carrier, or salts associated with AIDS , Treating or ameliorating a mononuclear cell or lymphoid proliferative disease such as leukemia by suppressing or inhibiting the hemorrhagic and / or cellular immune response, reducing the amount of mononuclear cells or lymph cells, keratocytes, bone marrow, organs, lens, Prevention and / or treatment of graft rejection in the case of transplantation of natural or artificial cells, tissues and organs such as pacemakers, natural or artificial skin tissue.

In accordance with the present invention, therapeutic NOIs or NOIs are preferentially expressed in a second target cell population and regulate therapeutic NOI or NOIs production such that they are not expressed or expressed at a biologically significant level in the first target cell Method is further provided.

The present invention also relates to a method for the treatment of viral infections by gene therapy comprising a therapeutically effective amount of a retroviral vector of the invention consisting of one or more deliverable therapeutic and / or diagnostic NOI (s) or viral particles produced by or from the same And provides a pharmaceutical composition for treating an individual. The pharmaceutical composition may be compatible with humans or animals. In general, the physician will determine the most appropriate dose for the individual subject and will determine the various actual dosages depending on age, weight and response of the particular individual.

Optionally, the composition is comprised of a pharmaceutically acceptable carrier, diluent, excipient or adjuvant. The choice of pharmaceutical carrier, excipient, diluent is selected according to the route of administration and standard pharmaceutical practice. The pharmaceutical composition includes, in addition to the carrier, excipient or diluent, any suitable binder, lubricant, suspending agent, solubilizer, and other carriers that assist or increase the introduction of the virus at the target location (such as the lipid delivery system).

Where appropriate, the pharmaceutical composition may be in the form of any one or more of: inhalation, suppository, or pre-uterine form, locally in the form of a lotion, solution, cream, ointment or dusting powder, skin patch, In the form of tablets containing excipients such as starch or lactose, in the form of elixirs, solutions or suspensions, including capsules or ovules, fragrances or coloring agents, alone or in admixture with excipients, May be administered parenterally in intrathecal, intravenous, intramuscular or subcutaneous administration. For parenteral administration, the composition may best be used in the form of a sterile solution containing, for example, salts or other ingredients of a monosaccharide to make a blood isotope. Oral or sublingual administration of the composition is in the form of tablets or lozenge lozenges formulated in conventional manner.

In a further aspect of the present invention there is provided a method for producing a viral vector comprising a first viral vector capable of infecting a first target cell and encoding a second viral vector capable of transducing a second viral vector capable of transducing a second target cell, Lt; RTI ID = 0.0 > viral < / RTI >

Thus, in this particular embodiment the gene vector of the invention is a hybrid viral vector system for gene delivery which enables the production of defective infectious particles from the target cells. Therefore, the gene vector of the present invention is composed of the first vector prepared in the laboratory that encodes the gene necessary for generating the second vector in vivo. In use, the second vector carries one or more selected genes for insertion into a second target cell. The selected gene may be one or more marker genes and / or therapeutic genes. The marker gene encodes a selectable and / or detectable protein.

Further perspectives on this particular aspect of the invention follow, which are applicable to the above-described aspects of the present invention.

In yet another aspect, the invention provides a target cell that is infected by a first viral vector or vectors and is capable of producing an infectious second viral vector particle.

In a further aspect, the invention provides a method of treating a human or non-human mammal comprising administering a hybrid virus vector system or target cell infected by a first viral vector as described herein.

The first viral vector or vectors may be various viral vectors, such as retroviruses, adenoviruses, herpes viruses or poxvirus vectors, or a mixture of different viral origin vectors in the case of multiple first viral vectors. In any case, the first viral vector is defective in that it is preferably not independently replicable. Thus, they can enter the target cell and deliver a second vector sequence, but can not replicate to infect additional target cells.

In this case, if the hybrid virus vector system is composed of one or more first vectors encoding the second vector, the two or all three first vectors will generally infect the first target cell at the same time. Preferably a single first viral vector encoding all components of the second viral vector.

The preferred single or multiple first viral vectors are adenoviral vectors. Adenoviral vectors have significant advantages over other viral vectors at an appropriate amount that can be obtained from in vitro culture. Adenoviral particles are also relatively stable compared to other envelope-enveloped viruses, and thus are more readily purified and stored. However, current adenoviral vectors have a major limitation in therapeutic use in vivo because gene expression from defective adenoviral vectors is only transient. Since the vector genome does not replicate, target cell proliferation causes dilution of the vector. Adenovirus protein expressing cells are also destroyed by the immunological response generated against the adenovirus protein even at low levels.

The second virion vector is preferably a retroviral vector. The second viral vector is generated by expression of an essential gene for assembly and packaging of defective viral vector particles within the first target cell. This is defective in that it can not do independent replication. Thus, when a second viral vector is transduced into a second target cell, replication to the target cell is not possible by replication. The second vector may be generated from the expression of the essential gene for retroviral vector generation encoded in the DNA of the first vector. Such genes may include a gag-pol gene from retrovirus, a coat gene from envelope-enveloped virus, and a retroviral genome with a linkage comprising one or more therapeutic genes. The defective retroviral genome generally comprises a sequence capable of reverse transcription, at least a portion of a 5 'long terminal repeat (LTR), at least a portion of a 3' LTR, and a packaging signal.

Importantly, the second vector is also stable for use in vivo in that the integrated vector is one or more stable features that eliminate the possibility of recombination to produce an infectious virus capable of independent replication.

To confirm that there is a replication defect, the second vector may be encoded by a single or two or more adenoviral vectors or a plurality of transcription units located within another first vector. Thus, there may be a second vector genom encoding transcription unit, a gag-pol encoding transcription unit and an env encoding transcription unit. Two or more of these may also be combined. For example, gag-pol and env or env and genomic encoding nucleic acid sequences can be combined within a single transcription unit. Methods to accomplish this are known in the art.

As described herein, the transcription unit is a nucleic acid comprising a coding sequence and a region of a signal for accomplishing the expression of such coding sequence independently of other coding sequences. Thus, each transcription unit generally consists of at least one promoter, enhancer and polyadenylation signal. The promoter and enhancer of the transcription unit encoding the second vector may preferably be strongly active or strongly induced in the first target cell under conditions for the production of the second viral vector. Promoters and / or enhancers may be structurally effective or may be tissue or time limited in their activity. Examples of suitable tissue limited promoters / enhancers are highly active in tumor cells, such as the MUC1 gene, the CEA gene, or a promoter / enhancer from the 5T4 antigen gene. An example of a temporally restricted promoter / enhancer is one that is responsive to ischaemia and / or hypoxia, such as a hypoxic response element or a promoter / enhancer of the grp78 or grp94 gene. One preferred promoter-enhancer combination is the major intermediate early (MIE) promoter / enhancer combination of human cytomegalovirus (hCMV).

Hypoxic or ischemic regulatable expression of the second vector component is particularly useful under certain circumstances. Hypoxia is a potent regulator of gene expression in a wide variety of other cell types and is involved in hypoxia-inducible facotr-1 binding to the same type of DNA recognition site as the hypoxia responsive elements (HREs) 1, HIF-1; Wang and Semenza 1993 PNAS. (USA) 90: 430). Dachs et al. (1997 Nature Med. 5: 515) reported that in order to regulate the expression of markers and therapeutic genes by human fibrosarcoma cells in response to hypoxia in solid tumors in vitro and in vivo, The multiple binding form of HRE from the phosphoglycerate kinase-1 (PGK-1) gene (Firth et al 1994, PNAS 91 (14): 6496-6500) was used. Also, the fact that labeled glucose deficiency is also present in the ischemic region of the tumor can be used to activate heterologous gene DNA expression, particularly NOI according to the present invention in tumors. The truncated 632 base pair sequence of the grp 78 gene promoter, which is known to be activated by glucose deficiency, is able to induce expression of the reporter gene at high levels in vivo in rats and tumors (Gazit et al 1995 Cancer Res. 55: 1660 ).

Stable features that can be incorporated into a hybrid virus vector system are described below. One or more of these features may be present.

First, the sequence homology between the sequences encoding the components of the second vector is nullified by deletion of the homology region. Homologous regions allow genetic recombination to occur. In a particular embodiment, three transcription units are used to structure the second retroviral vector. The first transcription unit contains the retroviral gag-pol gene under the control of a non-retroviral promoter and enhancer. The second transcription unit contains the retroviral env gene under the control of a non-retroviral promoter and enhancer. The third transcription unit consists of a defective retroviral genome under the control of a non-retroviral promoter and enhancer. Within the native retroviral genome, the package signal is located in this part of the gag sequence required for proper function. Generally, when a retroviral vector system is constructed from it, a package signal comprising a portion of the gag gene remains in the vector genome. In this case, however, the defective retroviral genome contains a minimal package signal that does not contain a sequence homologous to the gag sequence in the first transcription unit. There is also a small overlap between the 3 'end of the pol coding sequence and the 5' end of the env in retroviruses such as the Moloney murine and leukemia virus (MMLV), for example. The corresponding homology region between the first and second transcription units is removed by changing the sequence at the 3 ' end of the pol coding sequence or the 5 ' end of the env to change the codon usage, rather than the amino acid sequence of the encoded protein .

The possibility of a second replication competent second viral vector is nullified by pseudotyping the genome of one retrovirus with the Env protein of another retrovirus or other envelope-enveloped virus so that the homology region between the env and gag-pol components is nullified . In a particular embodiment, the retroviral vector is constructed from the following three components: the first transcription unit comprises a retroviral gag-pol gene under the control of a non-retroviral promoter and enhancer. The second transcription unit contains the env gene from another envelope-enveloped virus under the control of the non-retroviral promoter and enhancer. The third transcription unit consists of a defective retroviral genome under the control of a non-retroviral promoter and enhancer. The defective retroviral genome contains a minimal package signal that does not contain sequences homologous to the gag sequence in the first transcription unit.

Pseudotyping may be, for example, a retroviral genome based on a lentivirus, such as HIV or a horse and infectious anemia virus (EIAV), and the envelope protein may be, for example, a 4070A named amphotropic envelope protein. The retroviral genome can also be based on MMLV and the coat protein can be a protein from other viruses that can be produced in a non-toxic amount within the first target cell, such as an influenza hemagglutinin aggregate or vascular stomatitis virus G protein have. The coat protein may also be a mutant or a modified coat protein such as a designed coat protein. Variations may be created or selected for inducing targeting, eliminating toxicity, or for other purposes.

Third, the possibility of replication competent retroviruses can be eliminated by using two transcription units that have been constructed in a special way. The first transcription unit comprises a gag-pol coding region under the control of a promoter-enhancer that is active in the first target cell, such as the hCMV promoter-enhancer or tissue-restricted promoter-enhancer. The second transcription unit encodes a retroviral genomic RNA that can be packaged into retroviral particles. The second transcription unit contains retroviral sequences necessary for packaging, integration and reverse transcription, and also env protein coding sequences of envelope-enveloped viruses and coding sequences for one or more therapeutic genes.

In a preferred embodiment, the hybrid virus vector system according to the invention consists of a single or multiple adenoviral virus encoding a second retroviral vector. Adenoviral vectors for use in the present invention may be derived from human adenoviruses or adenoviruses that generally do not infect humans. Preferably the vector is derived from adenovirus type 2 or adenovirus type 5 (Ad2 or Ad5) or avian adenovirus such as murine adenovirus or CELO virus (Cotton et al 1993 J Virol 67: 3777-3785). The vector may be a replication competent adenoviral vector, but more preferably a defective adenoviral vector. Adenoviral vectors become defective by deletion of one or more components required for viral replication. Generally, each adenoviral vector includes deletions in at least the E1 region. For the generation of infectious adenoviral vector particles, this deletion is associated with the passage of the virus in a human embryonic fibrous cell line, such as a human 293 cell line, which contains an integrated copy of the left part of Ad5, including the E1 gene . The ability to insert heterologous DNA into these vectors can amount to about 7 kb. Thus, such a vector is useful according to the invention in the structure of a system consisting of three distinct recombinant vectors each containing one of the necessary transcriptional units for the structure of the second retroviral vector.

Other adenoviral vectors containing deletions in addition to other adenoviral genes are known in the art, and these vectors are also suitable for use in the present invention. Some of these second generation adenoviral vectors exhibit reduced immunogenicity (i.e., E1 + E2 deletion Gorzigilia et al 1996 J Virol 70: 4173-4178; E1 + E4 deletion Yeh et al 1996 J Virol 70: 559-565 ). Extended deletion provides additional cloning ability for multiple gene introduction in a vector. For example, a 25 kb deletion has been described (Lieber et al 1996 J Virol 70: 8944-8960), and cloning vectors have been reported in which all viral genes have been deleted that allow the introduction of more than 35 kb of heterologous DNA (Fisher et al 1996 Virolology 217: 11-22). Such a vector may be used in accordance with the present invention to generate an adenovirus first vector encoding two or three transcription units for the structure of the retroviral second vector.

The described embodiments of the invention address one of the major problems associated with adenoviruses and other viral vectors, namely the problem that gene expression from such vectors is transient. The resulting retroviral particle from the first target cell can transduce a second target cell and gene expression in the second target cell remains stable due to integration of the retroviral vector genome into the host cell genome. The second target cell can not express a significant amount of the viral protein antigen and is less immunogenic than the cell transduced with the adenoviral vector.

The use of retroviral vectors as a second vector is advantageous because it allows, for example, the targeting of rapidly dividing cells, thus allowing some degree of cell discrimination. Moreover, retroviral integration allows stable expression of the therapeutic gene in the target tissue, including stable expression upon proliferation of the target cell.

Preferably, the first viral vector preferentially transduces a particular cell type or cell type. More preferably, the first vector is a targeted vector, i.e., the vector is targeted to a particular cell, with a changed histological stellarity compared to the native virus. The term " targeted vector " is not always connected to the term " target site " or " target cell ".

Thus, a first target cell according to the present invention capable of producing a second viral vector may be any of the above cell types. In a preferred embodiment, the first target cell according to the present invention comprises a first transcriptional unit for retroviral gag-pol and a second transcriptional unit capable of producing a packageable defective retroviral genome ≪ / RTI > infected mononuclear cells or macrophages. In this case, the at least second transcription unit is preferably under the control of a promoter-enhancer that is preferentially active in the locus of the disease in vivo, such as the micro-environment of an ischemic site or solid tumor. In a particularly preferred embodiment of this aspect of the invention, the second transcription unit reduces the expression of a viral essential element such as a viral env gene upon insertion into a second target cell of the genome, and a therapeutic and / or diagnostic NOI Or introns that allow effective expression of NOIs are generated.

The second viral vector may also be a targeted vector. In the case of retroviral vectors this can be achieved by modifying the envelope protein. The envelope protein of the second vector of retroviruses needs to be a non-toxic envelope or a sheath that is produced in a non-toxic amount within the first target cell, such as an MMLV amphotropic envelope or a modified amphotropic envelope. A stable feature in this case is preferably deletion of the region or sequence homology between the retroviral components.

The second target cell population may be the same as the first target cell population. For example, delivery of the first vector of the present invention to the cajol cells results in the replication and generation of additional vector particles that can transduce additional tumor cells. The second cell group may be different from the first cell group. In such a case, the first target cell acts as an endogenous production site in the body of the individual being treated and produces additional vector particles capable of transducing a second target cell population. For example, the first target cell population may be hematopoietic cells transduced by the first vector in vivo or ex vivo. The first target cell is then transferred to or transferred to a site in the body, such as a tumor, to produce a second vector that can be transduced, for example, as being mitotically active in a solid tumor.

The present invention enables localized production of high amounts of defective retroviral vector particles in vivo at or near the site where the activity of the therapeutic protein or proteins is required for effective transduction results of the second target cell. This is more effective than using a defective adenoviral vector or a defective retroviral vector alone.

The present invention also enables the generation of retroviral vectors such as MMLV-based vectors in non-dividing and slow-dividing cells in vivo. Previously, it was possible to generate MMLV-based retroviral vectors only in fast dividing cells such as tissue-culture-modified cell proliferation in the laboratory or in fast dividing tumor cells in vivo. The expansion of the range of cell types capable of producing retroviral vectors is advantageous in delivering the genes to cells of solid tumors that are slowly dividing, and can be used for the production of endothelial cells and various hematopoietic lineage cells as endogenous production lines for the production of therapeutic protein products Which is advantageous for the use of the same non-dividing cells.

Delivery of one or more therapeutic genes by the vector system according to the present invention may be used alone or in combination with other therapeutic or therapeutic agents. Diseases that can be treated include, but are not limited to: cancer, neurological disease, genetic disease, heart disease, stroke, arthritis, viral infections and immune system diseases. Suitable therapeutic genes include, but are not limited to, tumor suppressor proteins, enzymes, pro-drug activation enzymes, immunomodulatory molecules, antibodies, engineered immunoglobulin-like molecules, fusion proteins, hormones, membrane proteins, vasoactive proteins or peptides, chemokine, anti-viral proteins, antisense RNA and ribozymes.

In a preferred embodiment of the therapeutic method according to the present invention, the gene encoding the pre-drug activating enzyme is delivered to the tumor site using the vector system of the invention, and the individual is treated with the appropriate pre-drug. Examples of pre-drugs include ethoposide phosphate (in conjunction with alkaline phosphates, Senter et al 1988 Proc Natl Acad Sci 85: 4842-4846); 5-fluorocytosine (in conjunction with cytosine deaminase, Mullen et al 1994 Cancer Res 54: 1503-1506); Doxorubicin-Np-hydroxyphenoxyacetamide (with Penicillin-V-amidase, Kerr et al 1990 Cancer Immunol Immunother 31: 202-206); Para-N-bis (2-chloroethyl) aminobenzoylglutamate (with carboxypeptidase) G2); Cephalosporin nitrogen mustard carbamate (with? -Lactamase); SR4233 (with P450 reductase); Ganciclovir (in conjunction with HSV thymidine kinase, Borrelli et al 1988 Proc Natl Acad Sci 85: 7572-7576); (Friedlos et al. 1997 J Med Chem 40: 1270-1275) and cyclophosphamide (in conjunction with P450, Chen et al 1996 Cancer Res 56: 1331-1340).

According to the present invention, a method for regulating the generation of a therapeutic gene so that the therapeutic gene is expressed preferentially in the second target cell group and insufficiently expressed or expressed at a biologically significant level in the first target cell / RTI >

Standard molecular biology techniques within the skill of the art in the context of the present invention can be used. These techniques are fully described in the literature. For example, Sambrook et al (1989) Molecular Cloning; a laboratory manual; Hames and Glover (1985-1997) DNA Cloning; a practical approach, Volumes I-IV (second edition); Methods for the engineering of immunoglobulin genes are given in McCafferty et al (1996) "Antibody Engineering: A Practical Approach".

In summary, the present invention is directed to novel delivery systems suitable for introducing one or more NOIs into target cells.

In one broad aspect, the invention relates to a retroviral vector consisting of a functional splice donor site (FSDS) and a functional splice acceptor site (FSAS); Wherein said FSDS and FSAS are on the side of the first nucleotide sequence of interest (NOI); The FSDS is on top of the FSAS; Wherein said retroviral vector is derived from a retroviral vector; Wherein said retroviral vector comprises a first nucleotide sequence (NS) capable of yielding a functional splice donor site (FSDS); A second NS capable of yielding a functional splice acceptor site (FSAS); A third NS capable of yielding a non-functional splice donor site (NFSDS); A fourth NS capable of yielding a non-functional splice acceptor site (NFSAS); The first NS is below the second NS; The third and fourth NS are on top of the second NS; Splicing of the retroviral vector occurs as a result of the reverse transcription of the retroviral transfer vector at the desired target site.

In a broader aspect, the invention includes a hybrid virus vector system for in vivo gene delivery, wherein the system comprises one or more first viral vectors encoding a second viral vector, wherein the first vector comprises a first A second viral vector capable of infecting the target cell and thus capable of transducing a second target cell can be expressed.

Preferably the first vector is obtained from or based on an adenoviral vector system, or the second viral vector is obtainable or based on a retroviral vector, preferably a lentiviral vector.

(Example 1) Structure of split-intron MLV vector

(I) Insertion of a small -T splice donor:

The starting plasmid for this construct is pLXSN (Miller et al 1989 ibid ); First, these constructs are degraded into Nhe 1 and re-ligated skeletons that produce LTR (U3-R-U5). This plasmid into the oligonucleotide containing the splice donor sequence between the Kpn 1- Bbe 1 sites is inserted. Also included within these oligonucleotides are the MLV R sequences up to Kpn 1 at the bottom of the splice donor. The resulting plasmid is designated 3 ' LTR-SD (see Fig. 2).

(Ii) insertion of a splice acceptor

The splice acceptors used in these constructs (including the junctions-A residues between 20 and 40 bases, which are the top of the splice acceptor involved in the formation of intron lariats (Aebi et al 1987 Trends in Genetics 3: 102 -107) is derived from immunoglobulin heavy chain variable region mRNA (Bothwell et al. 1981 Cell 24: 625-637) but with a consensus / optimized acceptor site. These sequence signals are also present in pCI (Promega). The acceptor sequence is vector pL-SA-N with the first: an oligonucleotide of the double helix to produce (note SV40 promoter is lost from pLNSX during cloning) is inserted into the BamH 1- Stu 1 site of pLXSN. See Figure 3 for an overview of the cloning strategy.

(Iii) removal of the original splice donor from pL-SA-N

Removal of the splice donor contained within the gag sequence of pL-SA-N is achieved by directed mutagenesis of the PCR primer site. Two oligonucleotides are used to PCR amplify the Asc 1 and Spe 1 unique site spanning regions of pL-SA-N. Also, the change from agGTaag to agGCgga, which is also found in the splicing negative pBABE vector (Morgenstern et al 1990 ibid ), is integrated into Spe1-spanning oligonucleotides. See Figure 4 for an overview of the cloning strategy.

(Iv) Cloning of pL (noSD) into 3 'LTR-SD

The pL (noSD) SA-N plasmid contains the normal MLV-induced 3'LTR. This was inserted into the Nhe 1 from pL (noSD) SA-N, it is replaced by an Nhe 1 decomposition 3'LTR-SD vector fall off as the 3'LTR-SD sequence by. The resulting plasmid, designated pICUT (Intron Created Upon Trasnduction), contains all the features of this new generation of retroviral vectors (see FIG. 5 for sequence data).

(Example 2) Structure of split-intron lentiv vector

The structure of the initiation EIAV lentivirus expression vector (see WO 99/32646).

The starting point for the structure of the split-function lentiviral vector is designated pEGASUS-1 (see WO 99/32646). This vector is derived from the infectious proviral EIAV clone pSEEIAV19 (accession number: U01866; Payne et al 1994). His structure is outlined as follows: first; The EIAV LTR amplified by PCR is cloned into pBluescript II KS + (Stratagene). The Mlu I / Mlu I (216/8124) fragment of pSEEIAV19 was inserted to generate a wild-type proviral clone (pONY2) in pBluescript II KS + (Fig. 1). The env region is deleted by the removal of Hind III / Hind III fragments to generate pONY2-H. Furthermore Bal Ⅱ / Nco Ⅰ fragment was deleted and, galactosidase gene of β- go induced by the HCMV IE enhancer / promoter in the pol (1901/4949) is inserted in its position. This is the designated pONY2.10nls LacZ . In order to reduce the EIAV sequence to 759 base pairs and also to exclude the first transcript from the CMV promoter: first; Sequences surrounding the EIAV polypurine tract and 3 'LTR are PRC amplified from pONY2.10nls LacZ using primers.

PPTEIAV + (Y8198): GACTACG ACTAGT GTATGTTTAGAAAAACAAGG

3 'NEG Spe I (Y8199): CTAGGCTA CTAGT ACTGTATCTCGAACAG

The PCR product is cloned into pBluescript II KS +; Within pBluescript II KS +, U5 is oriented so that it is adjacent to Not 1.

Then, the reporter gene if the cassette is the CMV promoter / LacZ from pONY2.10nls LacZ is removed by Pst 1 digest (digest), the LacZ gene is deleted pBs.3'LTR direction so as to be adjacent to 3'LTR Pst 1 site And this vector is pBS CMV LacZ. 3'LTR.

The 5 'region of the EIAV vector is rescued in the expression vector pCIE neo , which is a derivative of pCI neo (Promega) modified by the inclusion of about 400 base pairs derived from the 5 ' end of the entire CMV promoter, as described above. These 400 base pair fragments are obtained by PCR amplification with a proimer:

VSAT1: (GGGCTATATGAG ATCT TGAATAATAAAATGTGT) and

VSAT2: (TATTAATA ACTAGT ) and

The template is pHIT60 (Soneoka et al 1995 Nucleic Acids Res 23: 628-633). Product is digested with Bgl Ⅱ and Spe Ⅰ, it is cloned into the Bgl Ⅱ pCIE- Neo and Spe Ⅰ site.

A fragment of the EIAV genome running from the R region to nt 150 of the gag coding region (nt 268 to 675) is amplified from pSEIAV with primers:

CMV5 'EIAV2:

(Z0591) (GCTACGCAGAGCTCGTTTAGTGAACC GGGCACTCAGATTCTG : underlined sequences anneal EIAV R region (anneal)) and

3 'PSI.NEG (GCTGAGC TCTAGA GTCCTTTTCTTTTACAAAGTTGG)

The resulting PCR product is flanked by the Xba 1 and Sac 1 sites. It is truncated and cloned into the pCIE- Neo Xba 1- Sac 1 site. The resulting plasmid shown in pCIE- neo 5'EIAV comprises a start of EIAv R zone at the transfer starting point of the CMV promoter. CMV / LacZ / 3LTR cassette is transferred into the Apa 1 to Not 1 fragment from pBS.CMV LacZ .3LTR, this Sal 1- Not 1 disassembled pCIE- neo 5'EIAV (vector before the Sal 1 and Apa 1 sites are T4 Neo 5 ' EIAV plasmid by cloning into a " polished " blunt end and inserting each Not 1 digest). The resulting plasmid is designated pEGSUS-1.

For use as a gene transfer vector, pEGSUS-1 requires both gag / pol and env expression provided by in trans transfection by packaged cells. For the source of gag / pol , the EIAV gagpol expression plasmid (pONY3) expresses the gag-pol gene from the hCMV-MIE promoter-enhancer and encodes the Mul I / Mul I fragment from pONY2- And inserted into the plasmid pCI- neo (Promega). For the source of env ; The pRV583 VSV-G expression plasmid is conventionally used. These three vectors are used in three plasmid co-cell infections as described for MLV-based vectors (Soneoka et al 1995 Nucleic Acids Res. 23: 628-633) It is 10 ⁴ to 10 ⁵ lac Z forming units per ml on the cells.

the structure of the EIAV lentivirus version vector of pICUT; Named pEICUT

In a first pEGASUS-1 into pEICUT to structure the Xma 1- Sex A1 fragment is removed from pEGASUS-1, the terminal is "getting dull 'by T4 polymerase, the plasmid re-ligated in the skeleton SV40- Neo A plasmid containing only the CMV-R-U5 of pEGASUS-1 carrying the cassette is generated. This plasmid is named CMVLTR. In order to insert a splice donor at the edge of CMV-R, it is shown in Fig. 6, and PCR is carried out with two oligonucleotides as shown in the legend of Fig. The resulting plasmid was named pCMVLTR + SD. The same immunoglobulin-based consensus splice acceptor for MLV pICUT is used in the EIAV version. This is inserted into the Xho I- Bpu 1102 site of pEGASUS-1 using oligonucleotides as described in FIG. 7 to generate the plasmid pEGASUS + SA. The wild-type splice donor of EIAV is subjected to overlapping PCR using oligonucleotides using pEGASUS + SA as a template to generate the plasmid pEGASUS + SA (no SD) and the method as described in Fig. Then the Mul 1- Mul 1 fragment from pEGASUS + SA (no SD) to generate pEICUT-1 is inserted into the Mul 1 site of pCMVLTR + SD to generate a pEICUT-1 (see Fig. 9). LacZ can be transfected from pEGASUS-1 to pEICUT-1 by Xho 1- Bpu1 102 digestion and insertion to generate pEICUT-Z (see Figure 10; see SEQ ID NO: 11 for sequence data).

Both the MLV and EIAV pICUT vectors contain a strong splice acceptor at the top of the splice donor and therefore no functional intron (the intron requires a splice donor located 5 'of the splice acceptor). For this reason, when the vector is infected into a producer cell, the resulting transcript will not be spliced. Thus, the package signal will not be lost, and as a result the maximum package can be achieved (see FIG. 12).

However, due to the unique method of retroviral replication, the transcript produced by the integrated pICUT vector upon transduction will be different from that transfected as described above. This is because the 3 ' U3 promoter (up to the 5 ' start of R) is replicated during replication and the 5 ' promoter is used in the transfected cells. For this reason, transcripts produced by the integrated pICUT vector at the time of transfection will not contain a strong splice donor 5 'of a strong splice acceptor located at the top of the neo ORF. These transcripts will thus contain a functional intron within the 5 'UTR (untranslated region) and will be spliced to the fullest and translated.

Another advantage of this vector described above is that it is possible to limit gene expression to packaged or transduced cells since introns are produced only at transduction. An example of how this is achieved is outlined in FIG. The strategy involves the cloning of a second gene (in this case, hygromycin) on top of the splice acceptor. This SelctaVector Hygro; pull out the hygromycin cDNA on a Sal Ⅰ fragment from (Ingenius Oxfordshire, UK), it is achieved by this cloned into the Xho1 site of pICUT. These vectors selectively express hygromycin in the cell infected cells and neomycin in the transfected cells. This is because only the first gene in any mRNA transcript is translated by ribosomes without the aid of internal ribosome binding sites (IRESs). Within the cell-infected cells, these genes will become hygromycin. However, since the hygromycin open reading frame (ORF) is contained within the functional intron within the transduced cells, this gene will be removed from the mature mRNA, thus enabling neo ORF translation.

Vectors with such cell-specific gene expression can be used clinically for a variety of reasons; By way of example, the expression of a resistant marker may be restricted to the producer cell - which is required - and is not restricted within the immunogenic transducing cell. As another example, expression of ricin and toxin genes and predominantly positive signal proteins may be restricted to transduced cells that are selectively required to inhibit cell growth or to kill cells, It can not be restricted within the producer cell to prevent. Figure 14 is Neo only expressed in the producer cell, within the transduced cells pre-drug shows a Neo -p450 MLV pICUT structures -p450 2B6 isoform expressed only.

Another benefit of generating introns during transduction is that the necessary elements for vector function can be located within the functional intron generated during transfection and can be removed from the transfected cell transcript. Viral transcripts, along with both the MLV and lentiviral pICUT vectors, for example, are generated during transfection and contain a functional Psi package signal within the intron removed from the transfected cell transcript (Bender et al 1987 for the position of Psi in See MLV; see patent application GB9727135.7 for Psi in EIAV).

The benefits from this arrangement are:

(I) ribosomes reinforce translation from the resulting transcripts in the presence of the Psi second structure - if present - "stumble" (Krall et al 1996 ibid and references).

(Ii) in the absence of a package signal, the vector is inactivated and transcript packaging by endogenous retroviruses is prevented.

(Iii) undesired pre-mature translation initiation is prevented when viral essential elements such as gag (and other proteinaceous ATG translation initiation sites) are removed from the transcript expressed in the transduced cells. This is a particular benefit if the package signal is extended to gag as in the case of both EIAV and MLV pICUT vectors.

(Iv) Promoters, enhancers, and inhibitors are located within introns generated during transfection, thus mimicking other transcript sequences such as those generated from CMV containing this entity in introns (Chapman et al 1991 ibid ).

.

In summary, the novel pICUT vector system described in the present invention promotes the following arrangement:

(I) reduced packaging of transcripts in the maximal packaging and producer cells

(Ii) intron-enhanced translation of transcripts in the transplanted cells as much as possible and thus splicing

(Iii) restriction of gene and / or viral essential element expression to live cells or transduced cells

(Iv) Enhanced stable characteristics when the vector is inactivated

(Example 3) Structure of MMLV prototropic env gene having minimal homology with pol gene and gag-pol transcription cassette

Within the Moloney murine leukemia virus (MMLV), the first about 60 bps of the env coding sequence overlaps the sequence at the 3 'end of the pol gene. The homology region between these two genes is eliminated to prevent the possibility of recombination between them in cells expressing these two genes.

The first approximately 60 bps DNA sequence of the env coding sequence is altered while retaining the amino acid sequence of the encoded protein as follows. The synthetic oligonucleotides were constructed to change the codon usage of the env 5'-end (see Figure 15) and inserted into the remainder of env as follows.

The starting plasmid for the re-construction of the 5'end of the 4070A gene was pCI plasmid (Soneka et al 1995 ibid ) cloned into the Xba 1- Xba 1 fragment containing the 4070A gene from pHIT456 to construct pCI-4070A ). PCR reactions were carried out on pCI-4070A with pliers A and B (Figure 15) to generate 600 base pair products. This product was cloned between Nhe 1 and Xho 1 sites of pCI-4070A. The resulting structure was sequenced across the Nhe 1 / Xho 1 region. Even though the amino acid sequence of the resulting gene is identical to the original 4070A, the homology region with the pol gene is eliminated.

The complete sequence of the modified env gene m4070A is shown in Fig. This sequence is inserted into the expression vector pCI (Promega) by standard techniques. The CMV gag-pol transcription unit is obtained from pHIT60 (Soneka et al 1995 ibid ).

(Example 4) Deletion of gag sequence from retrovirus package signal

The DNA fragment containing the LTR and minimal functional package signal was obtained from the retroviral vector MFG (Bandara et al 1993 Proc Natl Acad Sci 90: 10764-10768) or MMLV proviral DNA by PCR reaction with the following oligonucleotide primers do:

Hind IIIR: GCATTAAAGCTTTGCTCT

L523: GCCTCGAGCAAAAATTCAGACGGA

This PCR fragment contains MMLV nucleotides + 1 to +523 and thus does not contain a gag coding sequence starting at + 621 (Shinnick et al 1981 Nature 293: 543-548 based on the MMLV nucleotide sequence).

PCR fragments can be used to construct retroviral genomic vectors by digestion with HindIII and XhoI restriction enzymes and sub-cloning using standard techniques. Such a vector does not include homology with the gag coding sequence.

(Example 5) Structure of defective retroviral genome

A transcription unit capable of generating a defective retroviral genome is shown in Fig. It contains the following elements: a hypoxic-regulated promoter enhancer consisting of 3 copies of the 72bp-repeat enhancer deleted gene HRE and SV40 promoter from PGK-pGL3 (Promega); An MMLV sequence comprising R, U5 and a package signal; m4070Adml coding sequence (Example 3); Splice acceptor; Cloning sites for insertion of coding sequences for therapeutic proteins; A polypyrimidine track from MMLV; A second copy of the HRE-containing promoter-enhancer; A splice donor site; And a second copy of R, U5

Upon integration of the reverse transcription and vector into a second target cell, the splice donor is introduced at the top of the env gene, which causes it to be cleared from the mRNA by splicing, thereby allowing effective expression of the therapeutic gene only in the second target cell (See FIG. 17).

(Example 6) Construction of conditional expression vector for cytochrome P450

Figure 18 shows the structure of the retroviral expression vector cDNA coding sequence from the sheet korom P450 gene in the two halves so that accurate splicing is possible to allow expression of P450 only at the time of transfection. Thus limiting expression within the transduced cells.

1) The starting plasmid for the construction of these vectors is pLNSX (Miller and BK et al. 1989 BioTechniques 7: 980-990). A spontaneous splice donor (... agGTaag ...) contained within the pLNSX package signal is mutated by PCR mutagenesis with the synthetic oligonucleotide of the ALTERED SITED II mutagenization kit (Promega) and sequence:

5'-caaccaccgggagGCaagctggccagcaactta-3 '

2) The CMV promoter from the pCI expression vector (Promega) is isolated by PCR using the following two oligonucleotides:

Primer 1: 5'-atcggctagcagatcttcaatattggccattagccatat-3 '

Primer 2: 5-atcgagatctgcggccgcttacctgcccagtgcctcacgaccaa-3 '

This produces a fragment containing the CMV promoter with a 5 ' Nhe 1 site (primer 1) and a 3' Not 1 and Xba 1 site (primer 2). This was cut with Not 1 and Xba 1 and cloned into pLNSX from the Not 1- Xba 1 fragment removed.

3) The 5 'end of the cytochrome P450 cDNA coding sequence is separated by RT-PCR from human liver RNA (Clontech) with the following primers:

Primer 3:

5'-atcggcggccgcccaccatggaactcagcgtcctcctcttccttgcaccctagg-3 '

Primer 4:

5'-atcggcggccgcacttacCtgtgtgcccaggaaagtatttcaagaagccag-3 '

This amplifies the 5 ' end of p450 from ATG to residue 693 (number from translation initiation site Yamano et al 1989 Biochem 28: 7340-7348). The Not 1 site and the optimized " Kozak " translation initiation signal are also included on the 5 'end of the fragment. Another Not 1 site and a consensus splice donor sequence (also found in pCI and originally derived from the human beta globin gene) has a residue 704 of P450 (the complementary residue is shown in upper case in primer 4) Is included on the 3 'end of the sequence (derived from primer 4) with a GT splice donor pair in which the flush is located. This fragment is digested to Not 1 and cloned into the Not 1 digested plasmid generated in step 2.

4) The Nhe 1- Nhe 1 fragment removed during the cloning of step 2 is reintroduced into the plasmid of step 3. This produces a retroviral vector as described in Fig. 17 but loses the 3 ' terminal P450.

5) The 3 'end of P450 is isolated by RT-PCR from human liver RNA (Clontech) using the following primers:

Primer 5:

actgtgatcataggcacctattggtcttactgacatccactttctctccccacaggcaagtttaca

aaacctgcaggaatcaatgcttacatt-3 '

Primer 6: actgatcgatttccctcagccccttcagcggggcaggaagc-3 '

This creates a PCR amplified at the 3 'end of residue 705 (uppercase in primer 5) and extends the past translation termination codon. The Bcl 1 restriction site and consensus splice acceptor and branch point (also found in pCI, originally derived from the immunoglobulin gene) at the top of residue 705 are contained within the 5 'end of this product and are generated by primer 5' do. The Cla 1 site is contained at the 3 'end of the product under the termination codon and is generated by primer 6. This PCR product is digested with Bcl < 1 > and Cla1 and cloned into the vector of step 3 into the Bcl- 1- Cla1 fragment removed to produce a retroviral vector as shown in Fig.

The following examples describe the structure of an adenovirus system that can be used for the transient production of lentiviruses in vitro or in vivo.

The first generated recombinant adenovirus

The first generated adenovirus vector generally consists of deletion of the E1 and E3 regions of the virus, which enables the insertion of foreign DNA into the left arm of the virus adjacent to the left inverted terminal repeat (ITR). The virus package signals 194 to 358 nt overlap with the E1a enhancer and are thus mostly within the E1 deleted vector. Such a sequence may translocate to the right end of the viral genome. Thus 3.2 kb can be deleted within the E1 deleted vector (358-3525 nt).

Adenoviruses can package 105% of the genome length, thus allowing the addition of an extra 2.1 kb. Thus, the cloning capacity within the E1 / E3 deleted viral vector is 7-8 kb (2.1kb + 1.9kb (removal of E3) + 3.2kb (removal of E1)). The recombinant adenovirus is unable to replicate the non-E1 complementary cell line due to the absence of the essential E1 early gene. The 293 cell line was developed by Graham et al . (1977 J Gen Virol 36: 59-74) and contains about 4 kb from the left end of the Ad5 genome, which includes the ITR, the packaging signal, E1a, E1b and pIX. The cells stably express the E1a and E1b gene products but do not express the late protein IX even if the pIX sequence is in E1b. Within the non-complementary cells, the E1 deleted virus transduces the cells and is transported to the nucleus, but there is no expression from the E1 deleted genome.

The first generated adenovirus production system

Microbix biosystem - nbl gene science

Schematic of Figure 19 shows a general strategy used to generate recombinant adenovirus using microbio systems.

A common strategy involves cloning the foreign DNA into an E1 shuttle vector in which the E1 region from 402 to 3328 bp is replicated by an external DNA cassette. Recombinant plasmids are co-infected into 293 cells with pJM17 plasmid. pJM17 involves insertion of the prokaryotic pBRX vector (including ampicillin resistance and bacterial ori sequences) into the E1 region in the deletion of the E3 region and in the 3.7 map unit. Therefore, these 40 kb plasmids are too large to be packaged as adenonucleotides, but they can be propagated in bacteria. 293 cells in the recombinant cells results in the substitution of the amp ^r and ori sequences with the insert of the external DNA.

(Example 7) Structure of transfer plasmid for generation of adenovirus including EIAV component

Four adenoviruses need to be generated to generate lentiviral vectors: the genome, gagpol , envelope (rabies G) and Rev. Lentiviral components are expressed from heterologous promoters and include intron and polyadenylation signals where necessary (for high expression of gagpol , Rev and rabies envelope ). When these four viruses are transduced into E1a minus cells, the adenoviral component will not be expressed, but a heterologous promoter will enable expression of the retroviral component. An example is outlined in the structure of the EIAV adenovirus system of Example 1 (Application No. 9727135.7). EIAV is based on a minimal system in which non-essential EIAV encoded proteins (S2, Tat or envelope) are absent. The envelope used to pseudo-type EIAV is the rabies envelope (G protein). This is well documented in pseudotyped EIAV (Application No. 9811152.9).

Transfer plasmid

The structure of the transfer plasmid containing the EIAV component is described below. The transfer plasmid is pE1spA (Fig. 20).

Recombinant transfer plasmids can be used to make recombinant adenoviruses by homologous recombination in 293 cells.

The following description of the plasmid is added.

A) pE1RevE - Rev structure

Plasmid pCI-Rev is cleaved into Apa LI and Cla I. The 2.3 kb band encoding EiAV Rev is a Klenow polymerase blunt end and inserted into the Eco RV site of pE1sp1A to generate plasmid pE1RevE (Figure 21).

B) pE1HORSE 3.1 - gagpol structure

pHORSE 3.1 was cleaved with Sna BI and Not I. The 6.1 kb band encoding EiAV gagpol was inserted into pE1RevE digested with Sna BI and Not I (the 7.5 kb band was purified). This produces the plasmid pE1HORSE3.1 (Figure 22).

C) pE1PEGASUS - genome structure

pEGASUS4 was cleaved into Bgl II and Not I. The 6.8 bands containing the EIAV vector genome were inserted into pE1RevE digested with Bgl II and Not I (the 6.7 kb band was purified). This produces the plasmid pE1PEGASUS (Figure 23).

D) pCI-Rab - rabies structure

To construct pE1Rab, the light-bottle open reading frame was inserted into pCI- Neo (Fig. 24) by digesting the plasmid pSA91RbG with Nsi I and Ahd I. The 1.23 kb band was blunt-ended with T4 DNA polymerase and inserted into pCI- Neo digested with Sma I. This produces the plasmid pCI-Rab (Figure 25).

F) pE1Rab - rabies structure

pCI-Rab was cleaved into Sna BI and Not I. The 1.9b band encoding the rabies envelope was inserted into pE1RevE digested with Sna BI and Not I (the 7.5b band was purified). This produces the plasmid pE1Rab (Figure 26).

(Example 8) Structure of pTRONIN

It was decided to include the LacZ receptor rather than titrating neomycin resistance required for pICUT. It was cloned into pICUT such that the LacZ gene was expressed from the LTR and the neomycin gene was expressed from the internal SV40 promoter. The structure was made as follows:

First, pHIT111 (Soneoka et al 1995 ibid ) was degraded to RsrII and partially to BamH1. A 4144 bp fragment (including the LacZ-SV40 Neo sequence) was cloned into Bcl1-RsrII digested pICUT to make pICUT-ZN. The upper LTR from this plasmid was then replaced with the 5 'CMV LTLR from pHIT111 (Soneoka et al 1995 ibid ). This is accomplished by taking a Sca1-BsteII fragment containing 5 ' CMV LTLR to displace the 5 ' LTR from similarly resolved pICUT-ZN with Sca1-BstEII. The resulting plasmid is designated pTRONIN (see Figure 13 and the sequence of Figure 32).

RT-PCR was performed on pTRONIN transduced HT1080 cells to study the splicing event in pTRONIN (Jone et al 1975 Cell 6: 245-252). This was done by first extracting RNA from cells transduced with Trizol (Gibco) as described by the manufacturer. Next, the first standard cDNA was synthesized from these RNAs using a random primer and a Universal Riboclone cDNA synthesis system as described by the manufacturer.

Finally, two primers were used for the PCR reaction. The first primer (5'-gttaacactagtaagcttg-3 ') was designed to anneal the bottom of the U3 start of the transcription rather than the top of the small T SD sequence (primer A1). The second primer was designed to anneal the bottom of the splice acceptor in the reverse direction (primer A2) (5'-gattagttgggtaacgccaggg-3 '). This primer thus amplifies between the regions from the top of the small T splice donor to the bottom of the splice acceptor. As a result, this PCR reaction selects both full-length and spliced messages (see FIG. 34).

Once complete, the PCR reaction was separated on a 1% agarose gel. This analysis indicated that there were two products from the pTRONIN transduced cells. All smaller than full-length transcripts indicate that splicing has occurred. Both fragments are gel-extracted, cloned, sequenced, and one product is a transcript produced by a splicing reaction between a small T splice donor (copied to the 5 'LTR during reverse transcription) and a splice acceptor Respectively. Instead, another large product included a splice event between the splice acceptor and the splice donor of a pre-unproven cipher contained within the package signal (mapping to positions 810-811 of the wild-type MLV; cag Sequence context of GT taag (in bold GT splice donor).

To further study the splice donor of these crypts, mutations were made in pTRONIN by the following method: the first two oligonucleotides were synthesized. The first spanning both the BST II site and the splice Donner GT of the cipher (span). These oligonucleotides contain a GT-to-GC splice donor point change (in bold). Bste II sites appear in uppercase. His sequence appears below.

Cgttg

tttaaccgagacctcatcacccag GC taagatcaaggtc-3 '

The second oligonucleotide is in the reverse direction and spans the unique Pme1 site (underlined):

5'-gcccagt gtttaaac actcgag-3 '

These two oligonucleotides were used in PCR reactions with pTRONIN as template. The PCR product was cloned into pTRONIN, which was digested with BstE11 and Pme1 and similarly cleaved with BstE11 and Pme1, thus replacing the coding splice donor GT with a mutant GC. This vector was named pTRONIN-1 (see Figure 35 and the sequence of Figure 36).

The pTRONIN-1 vector was compared to pTRONIN: RT-PCR analysis indicated that pTRONIN-1 produced one major transcript at the time of transfection, unlike the two transcripts from pTRONIN. When sequenced, these products showed that sequences were expected from the splicing reaction between small T SD and splice acceptor. Thus, the mutation of GT from GC to Donner's splice cipher disables its function.

When the titers were compared, pTRONIN-1 showed an appropriate amount 5 to 10 times higher than pTRONIN. This is consistent with the fact that there is no splice donor at the top of the splice acceptor until transduction and thus no splicing during virus generation. The fact that mutation in the donor of the cipher improves the titration improves the splicing (and elimination of the resulting package signal) between the splice acceptor and the splice acceptor in the producer cell until it is eliminated.

Another explanation for the splicing degree of the pTRONIN-1 vector at the time of transduction is to compare its titratable amount against the control group (pHIT111 Soneka et al ibid ) after one time blood entry. To do this, virus preparations were generated from two vectors by transient cell infecting methods (see Soneka et al ibid ) and then transfected with the package line FLYRD18 (Cosset et al J. Virol. 69: 7430-6) Respectively. Two days later, each supernatant from this package line was collected, filtered at 0.45, and titrated. For the control group pHIT111 appropriate amount from the transient generation, and since then FLYRD18 is each 1 × 10 ⁶ / ml and 5 × 10 ⁶ / ml. For pTRONIN-1, the titre from transient production is similarly 1 x 10 ⁶ / ml. However, titers from FLYRD18 cells (after transfection) fell below 50 / ml. Therefore, the titratable amount for the pHIT111 control group was reduced to more than 100,000 times. This explains that the splicing event is effective and almost all of the transcripts are spliced and packaged.

summary

The present invention is directed to a novel delivery system suitable for introducing one or more NOIs into a target cell.

In one preferred aspect, the invention includes a retroviral vector consisting of a functional splice donor site (FSDS) and a functional splice acceptor site (FSAS); Wherein said FSDS and FSAS are on the side of the first nucleotide sequence of interest (NOI); The FSDS is on top of the FSAS; Wherein said retroviral vector is derived from a retroviral vector; Wherein said retroviral vector comprises a first nucleotide sequence (NS) capable of yielding a functional splice donor site (FSDS); A second NS capable of yielding a functional splice acceptor site (FSAS); A third NS capable of yielding a non-functional splice donor site (NFSDS); A fourth NS capable of yielding a non-functional splice acceptor site (NFSAS); The first NS is below the second NS; The third and fourth NS are on top of the second NS; Retroviral vectors can be spliced after reverse transcription of the retroviral full-vector at the desired target site.

Put another way, this view is that the order of the SD and SA is reversed and the functional SD site (FSDS) and the functional splice acceptor site (FSAS) generated from the pre-vector that makes the splicing non- And a novel delivery system composed of one or more NOIs.

This aspect of the invention is referred to as the " split-intron " view. A schematic diagram showing this aspect of the present invention is shown in Fig. In contrast, Figures 27a and 27b show splicing shapes in known retroviral vectors.

Yet another broad aspect of the present invention includes a novel delivery system consisting of one or more adenoviral vector components capable of packaging one or more of the lentiviral vector components optionally constructed in a split intron form.

This aspect of the invention in a general sense can be referred to as a hybrid virus vector system. In this particular case, the combination of the adenoviral component and the retroviral component may be referred to as a dual hybrid virus vector system.

A schematic diagram showing this aspect of the present invention is shown in Fig.

These and other broad aspects of the invention are discussed herein.

All publications described in the above specification are incorporated herein by reference. Various modifications and variations of the described methods and systems of the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. While the invention has been described in conjunction with certain preferred embodiments thereof, it is to be understood that the invention as claimed should not be unduly limited to such specific embodiments. Various modifications of the methods described in order to practice the invention, which will be apparent to those skilled in the art of molecular biology and related fields, should be within the scope of the following claims.

Claims (49)

FSDS and FSAS are on the side of the first nucleotide sequence of interest (NOI); The FSDS is on top of the FSAS; Wherein said retroviral vector is derived from a retroviral vector; Wherein said retroviral vector comprises a first nucleotide sequence (NS) capable of yielding a functional splice donor site (FSDS); A second NS capable of yielding a functional splice acceptor site (FSAS); A third NS capable of yielding a non-functional splice donor site (NFSDS); A fourth NS capable of yielding a non-functional splice acceptor site (NFSAS); The first NS is below the second NS; The third and fourth NS are on top of the second NS; A retroviral vector (FSDS) consisting of a functional splice donor site (FSDS) and a functional splice acceptor site (FSAS), characterized in that the retroviral vector can be spliced after the retroviral vector- 2. The retroviral vector according to claim 1, wherein the NFSS is NFSDS 2. The retroviral vector of claim 1, wherein the NFSS is a non-functional splice acceptor site (NFSAS). 4. Retroviral vector according to any one of claims 1 to 3, characterized in that the retroviral vector is further constituted by a second NOI at the bottom of the FSAS 5. The retroviral vector of claim 4, wherein the retroviral vector comprises a second NOI at the bottom of the second NS. 6. A retroviral vector according to claim 4 or 5, characterized in that the second NOI or expression product thereof is or consists of a therapeutic agent or a diagnostic agent. A retroviral vector according to any one of the preceding claims, wherein the first NOI or expression product thereof is or consists of a medicament, viral essential element or part thereof, having one or more selectivity (i.e., marker elements) The first NS is preferably at or near the 3 'end of a retroviral pro-vector consisting of a U3 region and an R region, preferably the first NS is a U3 region RTI ID = 0.0 > R < / RTI > 9. The retroviral vector of claim 8, wherein the U3 region and / or the first NS of said retroviral vector consists of one or more transcriptional regulatory elements, a coding sequence or a third NOI which is a part thereof. The method of any one of the preceding claims, wherein the first NS is obtainable from a virus. 11. The retroviral vector of claim 10, wherein the first NS is an intron or a portion thereof. 12. A retroviral vector according to claim 11, characterized in that the intron is obtainable from a small t-intron of the SV40 virus. 9. The method of any one of the preceding claims, wherein the retroviral transfer vector comprises a retrovirus package signal; Wherein the second NS is located below the retrovirus package signal so that splicing can be prevented at the first target site. 14. The retrovirus vector according to claim 13, wherein the retrovirus package signal comprises NFSDS. 15. The retrovirus vector according to claim 14, wherein the retrovirus package signal is composed of NS which is NFSAS The method of any one of the preceding claims, wherein the second NS is located at the bottom of the first NOI so that the first NOI can be expressed at the first target site. The method of any one of the preceding claims, wherein the second NS is located at the bottom of the first NOI so that the first NOI can be expressed at the first target site and the retroviral vector is enriched. The method of any one of the preceding claims, wherein the second NS is located on top of a plurality of cloning sites so that one or more additional NOIs can be inserted. The method of any one of the preceding claims, wherein the second NS is a nucleotide sequence encoding an immunological molecule or a portion thereof. 20. A retroviral vector according to claim 19, wherein said immunological molecule is an immunoglobulin 21. The method of claim 20, wherein the second NS is a nucleotide sequence encoding an immunoglobulin heavy chain variable region. The vector according to any one of the preceding claims, wherein the vector is additionally constituted by a functional intron. 23. The retroviral vector of claim 22, wherein the functional intron is positioned such that the package signal is deleted at a desired target site. 24. The retroviral vector of claim 23, wherein said retroviral vector is a self-inactivating (SIN) vector. 24. The retroviral vector of claim 23, wherein the functional intron is positioned so as to limit the expression of at least one NOIs within the desired target site. 26. The method of claim 25, wherein the target site is a cell, The vector according to any one of the preceding claims, wherein the vector or the pre-vector is derived from a mouse and a Onco retrovirus or a lentivirus. 29. A retroviral vector according to claim 27, wherein the vector is derivable from MMLV, MSV, MMTV, HIV-1 or EIAV The retroviral vector according to any one of the preceding claims, wherein the retroviral vector is an integrated provirus Retroviral particles obtainable from a retroviral vector according to any one of the preceding claims A retroviral vector according to any one of claims 1 to 29 or a cell infected or transduced with the retroviral particle according to claim 30 A retroviral vector according to any one of claims 1 to 29 for use as a drug or a viral particle according to claim 30 or a cell according to claim 31 A retroviral vector according to any one of claims 1 to 29 for the manufacture of a pharmaceutical composition for delivering NOA < RTI ID = 0.0 > NOA < / RTI > to a target site according to the same need, or a viral particle according to claim 30 or a cell according to claim 31 use A method comprising cell infecting or transducing a cell by using the retroviral vector according to any one of claims 1 to 29 or the virus particle according to claim 30 or by using the cell according to claim 31 One or more non-retroviral expression vector (s), adenovirus (s), or plasmid (s), or combinations thereof, and one NOI or multiple NOIs to deliver one NOI or multiple NOIs to the first target cell 29. A retroviral vector according to any one of claims 1 to 29, or a viral particle according to claim 30, or a delivery system for a cell according to claim 31, comprising a retroviral vector for delivery to a second target cell A retroviral precursor-vector as defined under any of the claims above Use of functional introns to limit the expression of one or more NOIs within a desired target cell The use of reverse transcription to transfer the first NS from the 3 'end of the retroviral pre-vector to the 5' end of the retroviral vector so that the functional intron is produced during transfection A hybrid for gene delivery in vivo consisting of one or more first viral vectors capable of encoding a second viral vector capable of transducing a second target cell to infect a first target cell and expressing a second viral vector, Virus vector system 40. A method according to claim 39, wherein said first vector is obtainable from or based on an adenoviral vector, and / or said second viral vector is preferably derived from or based on a lentiviral vector. system 41. Use of a hybrid virus vector system according to claims 39 and 40, characterized in that the lentiviral vector has a split-intron shape Characterized in that the lentiviral vector is constructed in a split-intron form or can carry it. Lt; RTI ID = 0.0 > lentiviral < / RTI > vector system is characterized in that the lentiviral vector can be constructed or delivered in a split- An adenoviral vector system characterized in that the adenoviral vector can be constructed or delivered in a split-intron form a vector or plasmid based on or obtainable from one or more entities represented by pE1sp1A, pCI-Neo, pE1RevE, pE1HORSE3.1, pE1PEGASUS4, pCI-Rab, pE1Rab A first viral vector capable of encoding a second viral vector capable of transducing a second target cell to infect a first target cell and express a second viral vector; Characterized in that the first vector is obtainable from or based on an adenoviral vector and the second viral vector is preferably derived from or based on a lentiviral vector, A first viral vector capable of encoding a second viral vector capable of transducing a second target cell to infect a first target cell and express a second viral vector; Said first vector being obtainable from or based on an adenoviral vector, said second viral vector being preferably obtainable from or based on a lentiviral vector; Wherein the retrovirus is comprised of a vector functional splice donor site (FSDS) and a functional splice acceptor site (FSAS); Wherein said FSDS and FSAS are on the side of the first nucleotide sequence of interest (NOI); The FSDS is on top of the FSAS; Wherein said retroviral vector is derived from a retroviral vector; Wherein said retroviral vector comprises a first nucleotide sequence (NS) capable of yielding a functional splice donor site (FSDS); A second NS capable of yielding a functional splice acceptor site (FSAS); A third NS capable of yielding a non-functional splice donor site (NFSDS); A fourth NS capable of yielding a non-functional splice acceptor site (NFSAS); The first NS is below the second NS; The third and fourth NS are on top of the second NS; Wherein the retroviral vector can be spliced after reverse transcription of the retroviral full-vector at the desired target site. FSDS and FSAS are on the side of the first nucleotide sequence of interest (NOI); The FSDS is on top of the FSAS; Wherein said retroviral vector is derived from a retroviral vector; Wherein said retroviral vector comprises a first nucleotide sequence (NS) capable of yielding a functional splice donor site (FSDS); A second NS capable of yielding a functional splice acceptor site (FSAS); A third NS capable of yielding a non-functional splice donor site (NFSDS); A fourth NS capable of yielding a non-functional splice acceptor site (NFSAS); The first NS is below the second NS; The third and fourth NS are on top of the second NS; Characterized in that the retroviral vector can be spliced after the reverse transcription of the retroviral vector (s) at the desired target site, wherein the retroviral vector is capable of self-inactivating the functional splice donor site (FSDS) and the functional splice acceptor site (SIN) retrovirus vectors As generally described herein, retroviral vectors capable of differentiating expression of NOIs in target cells