CN1357048A - Enhanced prodrug activation - Google Patents

Abstract

A prodrug activating agent comprising: a) a localisation domain and b) a prodrug activation domain for activating a prodrug in a target cell.

Description

Strengthen prodrug activation

The present invention relates to the activator of activation prodrug in target cell.The invention still further relates to method with described new activator activation prodrug.

Enzyme prodrug therapy (EPT) relates to uses the enzyme activation prodrug in treatment.Prodrug is generally the pharmacy inertia that can be converted into the active form with therapeutic action in vivo or relative inertness compound, and (Connors summarizes in 1995 Gene Therapy 2,702; Springer and Niculescu-Duvaz 1996 Adv Drug Deliv Res 22,351).EPT is used in particular in the oncotherapy.

The prodrug of initial development utilizes inherent enzyme realization activation in the body, for example utilizes P450 enzyme system activation endoxan (CP) and isomer ifosfamide thereof to produce the mustargen of damage dna; Mainly by NADPH: cytochrome C (P450) reductase enzyme activation ametycin (MMC) produces effective alkylating agent (for example Bligh etc. 1990, Cancer Research 50,7789).The therapeutic index of the prodrug that these are important does not depend on the selectivity transmission to target cell, but depends on the different susceptibility of target cell to dna damage.Described damage just effectively therefore will damage to divide to enliven and maybe will develop into fissional tumour cell, and the differentiation and maturation cell of normal organ and tissue is not divided, and therefore can not sustain damage when cell fission.Still do not confirm that tumour has the high-caliber especially enzyme (1990 Carcinogenesis 11,2163 such as Forrester) that can activate such prodrug.It is believed that mainly activating preceding medicine such as CP, IF and MMC in liver becomes the therapeutic metabolite, is distributed to tumor locus by circulation with described treatment metabolite then.Even it is believed that when tumour has the ability of certain metabolic precursor thereof medicine, the downward adjusting of described enzymic activity also can cause drug resistance (for example Bligh etc. 1990 is the same).

Find that tumour cell is not a metabolic precursor thereof medicine very effectively, make that having produced enzyme with normal human subject is directly delivered to tumour with the theory that reaches partial high density activating compounds 1996 Cancer Research 56,1331 such as (for example) Chen.For example in experimental system, prove recently, directly transfer to the effectiveness that can strengthen CP in the tumour cell, make described tumor growth obviously slow down even disappear (Chen etc. 1996 are the same) with will the encode gene of P450 of virus vector.Can be by a kind of in the several methods optionally with relevant enzymic activity target tumor cell.A kind of method be by synthetic finish the back or produce recombinant protein tumor-selective monoclonal antibody or fragment such as single-chain antibody (scFv) and enzyme are puted together.Described albumen gives to be confined to tumor locus by means of described antibodies specific identification tumor surface behind the patient.The non-toxic precursors medicine that is given is only activated (Bagshawe summarizes in 1987 Br J Cancer 56,531) at tumor locus by institute's bonded conjugate.This method is called ADEPT (antibody dependent prodrug activation).Another kind method is to be the transfer system on basis such as plasmid (gene dependent enzyme prodrug therapy GDEPT) (1993 Cancer Res 53 such as Vile for example in order to DNA, 3860) or the DNA of virus vector (viral dependent enzyme prodrug therapy VDEPT) (for example 1991PNAS 88,8039 such as Huber) the described enzyme of will encoding be passed to target cell.In these methods, the target part mixed transmit carrier or obtain tumour-specific 1994 Gene Therapy 1,170 and reference wherein such as (for example) Harris with tumor-specific promoters.Nearest progress has been described the integrated process of ADWPT and GDEPT method, has made up the gene fusion thing by this, makes the gene fusion of gene with coding prodrug activation enzyme of encoding said antibody targeting moiety.With DNA or gene delivery vector such as virus vector the gene fusion thing is passed to (WO 98/55607) in the target tissue.

Another kind of prodrug has selective toxicity because the reductibility activation takes place to tumour in the environment of the severe hypoxia of unique physiological characteristic for tumour.Hypoxemia is the situation of unusual low levels of oxygen, sees solid tumor (the Coleman 1988 J NatCanc Insts 80,310 of most of diameters greater than about 1mm; Cancer Res 49,6449 such as Vaupel).Low-oxygen environment conduction can produce the reductive derivative of various chemical group family reduction reaction (Workman and Stratford1993 Cancer and Metastasis Reviews, 12,73-82).Canonical biometric reduction medicine has microbiotic, ametycin (MCC) and methylmitomycin (POR), but estimated many other compounds and comprised N-oxide compound such as Tirapazamine (TRZ) (1986 Inst JRadiot Oncol Biol Phys 12 such as Zeeman, 1239) and quinones such as indoles and quinone E09 (1992Int J Radiot Oncol Biol Phys 22 such as Bailey, 649), cyclopropamitosenes (EP-A-0868137) and by the tertiary amine of Cytochrome P450 3A4 activatory rice holder anthracene (AQ4N)-N oxide compound analogue (Patterson 1993 Cancer Metast Rev 12,119; Patterson 1994Biochem Pharm Oncol Res 6,533).That up to now, have in these compounds that exploitation is worth most is Tirapazamime (TRZ; 3-amino-1,2,4-phentriazine-1,4-dioxide).It is metabolised to an oxynitride (SR4317) and on lower degree metabolism be free alkali SR4330.Two electronics or quadrielectron reduzate all do not have genotoxicity, so think the single electron free radical that relates to Tirapazamine rather than stable metabolite (A.Cahill and I.N.H.White 1990, Carcinogenisis, 11,1407).The nitroxide radical anion that it is believed that generation directly acts on DNA induce dna splitting of chain (J.M.Brown summarizes in 1993 Br J Cancer 67,1163).The cell killing activity of Tirapazamine under hypoxia condition strengthens, but shows toxicity to a certain degree when the moderate oxygen tension.This is very important, because the hypoxemia degree changes, and can not keep activatory ametycin stronger (J.M.Brown summarizes in document cited above) when low-down oxygen tension more only of effectiveness that absolute low-level oxygen makes the Tirapazamime killing tumor cell within a certain period of time in whole tumour.Tirapazamime causes that because of acting on marrow bone marrow depression has toxicity really when high dosage.So present clinical application is subjected to the influence of dose-limiting toxicity, in fact reach the needed dosage of obvious therapeutic action near maximum tolerated dose (1992 Int J Radiat Omc Biol Phys 22,717 such as Adam).The research work at initial stage shows that Cytochrome P450 has tangible effect in the metabolism of Tirapazamime, but its effect in activation and cytotoxicity still indeterminate Biochem Pharmacol 44,251 such as () Walton.Yet more and more evidences shows that the P450 reductase enzyme plays a part even more important.Patterson etc. have shown that in 1995 Br J Cancer 72,1144 the P450 reductase enzyme has the activity of certain limit in one group of breast cancer cell line, and the low oxygen toxicity of Tirapazamime is directly relevant with endogenous P450 reductase enzyme level.In 2 bladder cancer cell lines, obtain similar dependency (1994 Br J Cancer 242 such as Xu).Recently because confirm that the full-length cDNA of people P450 reductase enzyme transferred to tumour cell and in tumour cell overexpression P450 reductase gene significantly improve susceptibility to Tirapazamime, so obtained the importance of P450 reductase enzyme in Tirapazamime (TRZ) metabolism vaild evidence (1997 Br J Cancer 76 (10) such as Patterson, 1338-1347).These data show that first P450 can be used for the gene therapy purposes.

These strengthen studies show that of prodrug activation by normal people's fermentoid such as P450 and P450 reductase enzyme are transferred to cell, can use the normal mammalian enzyme in various available strategies.These strategies comprise above-mentioned GDEPT, VDEPT and ADEPT method.Can use the external engineered hematopoietic cell that contains described gene on the other hand and transmit described enzyme WO 98/55607.Directly prodrug activation enzyme such as P450 and P450 reductase enzyme are delivered to tumour and can the minimizing system give the dosage of patient's prodrug, therefore reduce general toxicity.All enzyme prodrugs therapy methods depend on healthy tissues to be compared, and (Chen etc. 1996 in the difference activation of prodrug in diseased tissue; T.Connors is the same; Patterson etc. 1997).

Although it is noticeable because for example can avoid unwanted immune response that natural enzyme is used for the EPT strategy, its shortcoming is that some drugs such as P450 still can transform at liver generation medicine, therefore may produce certain general toxicity.So studied the combination of various different human enzyme prodrugs in addition.Because clear and definite they be not present among any human cell, so, then do not have prodrug and in healthy tissues such as liver, activate the toxic side effects that causes if to transmit be tumour-specific.For example the thymidine kinase of hsv (HSVTk) can make prodrug gancyclovir (GCV) phosphorylation produce nucleoside analog, nucleoside analog is further produced blocking dna synthetic Nucleotide (gancyclovir triphosphate) (F.L.Moolten 1986 Cancer Res 46,5276) by the cell kinase phosphorylation subsequently.The HSVTk method is that the S phase is specific, thereby only kills and wounds the active tumour cell of propagation, so it is not all to be suitable in all cases.Another example is to use and can reduces the compound relevant with GB1954 and produce the intestinal bacteria nitroreductase (1992 Biochem Pharmacol 44,2289 such as Anlezark) of the metabolite of damage dna.Designed the combination of many other different enzyme precursor medicines, for example carboxypeptidase G ₂, penicillin amidase, alkaline phosphatase, β-Nei Xiananmei and Isocytosine deaminase can the hydrolytic activation prodrug (Knox etc. summarize in the preface among the 1995 Biochem Pharmacol 49,1641 and the document of the T.Connors that quotes in the book; Document Spring that quotes in the book and Niculescu-Duvaz 1996).

Countless factors makes all various enzyme-prodrug therapy strategies described so far complicated.There is different particular problems in different pharmaceutical/enzyme combination with different transfer modes.In ADEPT, for example described enzyme is delivered to outside, yet in most of the cases described active medicine must stride across cytolemma, and this produces various restrictions to chemical design.Described active medicine also must permeate into whole tumour body and play a role.Use high-affinity antibody to produce the prodrug that high-caliber activation may be exhausted most of tumour, make described active compound influent circulation fully, reduce thus and render a service and increase general toxicity at a position.Need to repeat to give prodrug in addition.So, general because the ADEPT strategy has active compound is transmitted into the potential possibility of round-robin and has defective.In addition, if described enzymic activity needs cofactor such as NADPH in the cell, then may the alternate cofactor must be administered to extracellular environment jointly, this has limited and for example used bacterium nitroreductase (1995 Biochem Pharmacol 49,1641 such as Knox) in the ADEPT strategy.If there is cofactor in the cell, then the VDEPT/GDEPT strategy has advantage, because described enzyme will only activate described medicine in cell, will can not cause general activation and toxicity so anything unexpected release enzyme is gone into circulation.But GDEPT and VDEPT strategy can not be passed to genes involved in all tumour cells, this means that the many cells in the tumour are not are not killed and wounded, and make the interior restriction of cell of described enzyme become a significant disadvantages.So in VDEPT and GDEPT strategy, preferably have and a certain cell killing extended to method beyond the former engineering cell.This is called " bystander effect " (1993 Cancer Res 53,5274 such as Freeman).For example observed this effect, wherein, also killed and wounded many cells except containing the extracellular of Tk gene with HSV Tk.Yet, described mechanism is slightly somewhat suspicious, because do not assist by means of the metabolism that connects by the gap, the triphosphate active metabolite of high loading can not be by cytolemma 1996 Cancer Res 56,2697 such as (summarize in the T.Connors document that this paper quotes and) Hamel.Tk " bystander effect " is so may to be actually accident be that the immunne response that can not expect causes, rather than real metabolism.Endoxan is observed bystander effect in the P450 activation in tumour.Propose in this case, high toxicity acreolin metabolite mediates described effect, but can not cause general toxicity because it fugitive relatively (Chen and Waxman 1995Cancer Res 55,581).On the other hand, adjacent cells can absorb intermediate metabolites such as 4-hydroxyl endoxan.With can also being observed onlooker's effect by DT diphosphatase reductive aziridine (aziridin) GB 1954, but aziridine is produced effective alkylating agent and has stronger effect (Knox 1988 Biochem Pharmacol 37,4661 by the reduction of bacterium nitroreductase; Bridgewater 1997 Hum Gene Therapy 8,709), can not observe this situation (1997 Gene Therapy 4 such as Clark, 101-110 although be; Patterson and Stratford, unexposed observed result).Any bystander effect will with the proportional increase of active metabolism substrate concentration that produces.So the activity that preferably strengthens the prodrug activation enzyme is to improve the concentration of active metabolite.

So although the enzyme prodrug therapy is noticeable, all there is shortcoming perhaps in each method of Shi Yonging so far.In order to make enzyme prodrug therapy effect maximization, importantly select transfer system and enzyme/drug regimen for use with the specific cell killing of effective target cell.In addition, preferably improve institute's destructive target cell quantity by the high bystander effect that produces general toxicity minimum.The objective of the invention is to satisfy these needs.

One aspect of the present invention provides the prodrug activation agent, and it comprises:

A) locating structure territory; With

B) the prodrug activation structural domain of activation prodrug in target cell;

And wherein said locating structure territory is not a tumor-selective antibody.

Described locating structure territory and prodrug activation structural domain preferably include aminoacid sequence or are the nucleotide sequence form of the described structural domain of coding.

In the preferred embodiment of the invention, described prodrug activation agent is the fusion rotein form.Albumen comprises peptide and polypeptide.

On the other hand, described structural domain can be in company with giving.Give in company with giving not necessarily to be meant simultaneously.May be to give to give another kind of structural domain before or after a kind of structural domain.

No matter " target cell " is natural if just being meant or the described medicine of target or transfer system integral part can transfection or the cell of transduction.

On the other hand, the invention provides the prodrug activation agent of the expressible nucleic acid sequence that comprises at least a Codocyte cytochrome p 450, wherein said or each nucleotide sequence operability is connected to one or more composing type regulating and controlling elements or one or more inducible expression regulating and controlling element.

In another embodiment, described activator is the form of modifying hemopoietic stem cell (MHSC), and wherein said hemopoietic stem cell comprises described prodrug activation agent or described prodrug activation structural domain or expresses it through through engineering approaches.

Therefore, another aspect of the present invention provides and comprises the prodrug activation agent of modifying hemopoietic stem cell (MHSC), described modification hemopoietic stem cell contains the expressed nucleotide sequence of a kind of prodrug activation structural domain of encoding at least, and wherein said or each nucleotide sequence operability is connected to one or more constitutive expression regulating and controlling elements or one or more inducible expression regulating and controlling element.

The present invention also provides the nucleic acid carrier that comprises according to nucleotide sequence of the present invention.

The present invention also provides and comprises nucleotide sequence virus vector of the present invention.

The present invention also is provided for prodrug activation agent of the present invention, nucleic acid carrier, virus vector or the transducer cell of medicine.

The present invention also is provided for the medicinal compositions that comprises prodrug activation agent of the present invention, nucleic acid carrier, virus vector or transducer cell of medicine.

The present invention further provides treatment and suffer from the mankind of following illness or the method for animal patient, described illness is cancer (especially solid tumor), encephalic malaria, ischemic heart disease, rheumatoid arthritis or be characterized as the illness of ischemic, hypoxemia or low sugar for example.

Advance on the one hand, the invention provides the method for production virus strain, comprise nucleotide sequence of the present invention is introduced viral genome.The homologous recombination that this method preferably includes between described genome and the carrier of the present invention is introduced described viral genome with described nucleotide sequence.

In addition further aspect, the invention provides the method that produces MHSC, comprise carrier of the present invention introduced hematopoietic cell strain (HSC).

By limiting examples various preferable feature of the present invention and embodiment are described referring now to accompanying drawing, wherein:

Figure 1A is depicted as P450 reductase enzyme sequence;

Figure 1B is depicted as the functional domain of P450 reductase enzyme;

Figure 2 shows that P450 reductase enzyme derivative; Figure 3 shows that and stride the cell-targeting sequence; Figure 4 shows that human-cytochrome P450 2B6; Figure 5 shows that IRES; Figure 6 shows that retrovirus vector; Figure 7 shows that the gene fusion construction; Figure 8 shows that and give multiple drug susceptibility retrovirus vector; With the result who Figure 9 shows that scavenger cell transmission P450; Figure 10 shows that P450 PCR fragment; Figure 11 shows that pegHRELacZ; Figure 12 shows that pBHRELacZ; Figure 13 shows that pBHREp450del; Figure 14 shows that pBHREP450; Figure 15 shows that pegHREP450; Figure 16 shows that pONY4; Figure 17 shows that pONY4.1; Figure 18 shows that pONY4HREP450; Figure 19 shows that pONY4.1HRE450; Figure 20 shows that pEGASUS-4; Shown in Figure 21 is pEGASUS4P450; Shown in Figure 22 is pONY4.0P450; Shown in Figure 23 is pONY4.1P450.

Accompanying drawing describes in detail

Figure 1A is depicted as P450 reductase sequence. SEQ ID NO:1 is mRNA sequence (section Divide GenBank registration number: S90469); SEQ ID NO:2 is depicted as its amino acid sequence.

Figure 1B is depicted as the functional domain of P450 reductase.

Fig. 2 A is depicted as non-grappling P450R. SEQ ID NO:3 is depicted as the dna encoding order Row. SEQ ID NO:4 is depicted as its amino acid sequence.

Fig. 2 B shows that FAD and NADPH are in conjunction with (FN) fragment, wherein SEQ ID NO:5 Be the dna encoding sequence, SEQ ID NO:6 is its amino acid sequence.

Fig. 3 A is depicted as SV40 large T antigen NLS fragment. SEQ ID NO:10 is DNA Coded sequence (complementary series 4442-4422), SEQ ID No:11 is its amino acid sequence.

Fig. 3 B is depicted as basic fibroblast growth factor (bFGF). SEQ ID No:19 Be the dna encoding sequence of 18kD isotype, SEQ ID No:20 is its amino acid sequence.

Fig. 3 C is depicted as feeler foot homology frame peptide (pAntp). SEQ ID No:53 is homeodomain Coded sequence, SEQ ID No:54 is its amino acid sequence.

Fig. 3 D is depicted as herpes simplex types 1 virus (HSV-1) tegument protein VP22. SEQ ID NO:55 is the dna encoding sequence (complementary series of GenBank sequence X 14112 106391 ... 105486), SEQ ID NO:56 is its amino acid sequence.

Fig. 3 E is depicted as ETA (PEA). SEQ ID NO:33 is the territory The dna encoding sequence of II, SEQ ID NO:34 is its amino acid sequence.

Fig. 3 F is depicted as has the ST4 scFv sheet that beginning signal and secreting signal peptide are opened in translation Section (ScFv). SEQ ID NO:25 is that beginning signal and signal peptide DNA are opened in the translation of ST4-ScFv Sequence (WO98/55607), SEQ ID NO:27 is its amino acid sequence.

Figure 4 shows that human-cytochrome P450 2B6. SEQ ID NO:45 is the mRNA order Row, SEQ ID NO:46 is its amino acid sequence.

Figure 5 shows that IRES (internal ribosome enters sequence). SEQ ID NO:52 is FMDV (R100)+the IRES sequence of SacI (beginning) and XhoI (end) joint.

Fig. 6 A is depicted as PKAHRE: a kind of single transcript unit carrier based on MLV. The expression (3 * PGK) of hypoxemia effect promoter control therapeutic gene. The described pro-drug of encoding NlsLAcZ gene shown in the gene of activating enzymes is substituted by.

Fig. 6 B is depicted as COI: a kind of with the alternative MLV enhancer (shade of cmv enhancer Frame) the carrier based on MLV. The gene of described prodrug activation enzyme of encoding inserts Bam/Sal/Hpa polylinker or Stu/Xho polylinker. On the other hand can be with not Gene together inserts each polylinker.

Figure 8 shows that the retrovirus vector of giving multiple drug sensitiveness. VP22-FN Enhancing is to the sensitiveness of Tirapazamine. P450-FN strengthens the sensitiveness to endoxan. P450-FN adds VP22-FN to be strengthened mitomycin C, Tirapazamine and ring phosphinylidyne The sensitiveness of amine. The prodrug activation domain

Described prodrug activation enzyme is generally prodrug activation enzyme or prodrug activation enzyme Active fragment; Although it can be the domain of any activation pro-drug. This area Know the prodrug activation enzyme of more and more most amounts, can use wherein any. Suitable The prodrug activation enzyme can be natural or the through engineering approaches enzyme, comprise Cytochrome P450, thin Born of the same parents' cytochrome p 450 reductase, thymidine kinase, nitroreductase, cytosine deaminase, DT-Diphosphatase, NADPH: cytochrome P-450 reductase and CPG2.

The prodrug activation enzyme can be passed to tumor locus with the treatment cancer. Every kind of feelings Under the condition, suitable pro-drug and suitable prodrug activation enzyme unite be used for the treatment of described The patient. Suitable pro-drug is given in conjunction with carrier. The example of pro-drug comprises: phosphorus The acid etoposide (uses the 1988 Proc Natl Acad such as Senter with alkaline phosphatase Sci 85:4842-4846); 5-flurocytosine (uses Mullen etc. with cytosine deaminase 1994 Cancer Res.54:1503-1506); Adriamycin-N-para hydroxybenzene oxygen yl acetamide (with Penicillin-V amidase uses together, the 1990 Cancer Immonol Immunother such as Kerr 31:202-206); Two (2-chloroethyl) the aminobenzoyl glutamic acid of right-N-are (with CPG2 one Rise and use); Carbamic acid cynnematin mustargen (using with beta-lactamase); SR4233 (with The P450 reductase uses together); DHPG (uses Borrelli with the HSV thymidine kinase Deng 1988 Proc Natl Acad Sci 85:7572-7576); Use with nitroreductase Mustard seed pro-drug (the 1997 J Med Chem 40:1270-1275 such as Friedlos) and endoxan (using the 1996 Cancer Res 56:1331-1340 such as Chen with P450).

The example that is used for appropriate precursors medicine activating enzymes of the present invention comprises: thymidine phosphorylase, Its activation 5-FU pro-drug capcetabine and doxifluridine; The herpe simplex disease The thymidine kinase of poison, it activates DHPG; Cytochrome P450, it will be such as the ring phosphinylidyne The prodrug activation of amine is DNA infringement agent; And cytosine deaminase, it activates 5-fluorine born of the same parents Pyrimidine. The enzyme in best end user source.

As mentioned above, be preferably prodrug activation enzyme form.The prodrug activation enzyme that is used for the treatment of the patient will give in conjunction with the suitable precursor medicine.

Described enzyme is preferably Cytochrome P450 or cytochrome P450 reductase.

Cytochrome P450 is a protoheme-thiolate superfamily protein (1996 Pharmacogenetics 6:1-42 such as Nelson) that is incorporated into film, is present in prokaryotic organism and eukaryote.These enzymes are named as cytopigment, are because they form mixture with carbon monoxide under the condition of reductibility, produce maximum absorbance at about 450nm.In endocytoplasmic reticulum (microsome) or plastosome, all can detect them.For detoxification and oxidation food chemistry material, environmental pollutants, carcinogen and other natural or synthetic chemical of steroid hormone metabolism, medicine inactivation, toxin/external element, they are important monooxygenases.And the part Cytochrome P450 has extra isomerase, reductase enzyme, dehydratase, nitric oxide synthase or esterase activity (referring to Rendic﹠amp; Di Carlo 1997 Drug Metab Rev 29:413-580).

Because Cytochrome P450 is the terminal oxidase in the electron transport chain, the electronics that provides two to derive from reductive pyridine nucleotide such as NADPH is provided in its effect.This electron transfer process needs P450 and its redox mating partner (flavoprotein) NADPH-dependent cell cytochrome p 450 oxydo-reductase and cytochrome b5 to interact.The reductive Cytochrome P450 is bonded to oxygen and its substrate.Sauerstoffatom of this enzyme catalysis mixes its substrate and another Sauerstoffatom mixes in the water then.Typical enzyme reaction is that P450 mixes substrate with hydroxyl, for example Cytochrome P450 2B6 4-hydroxylation endoxan.In addition, the expression of cytochrome P 45 albumen and enzymic activity can be induced or suppress to some xenobiotic, organic substrates or medicine, and for example barbiturate(s) is induced isotype CYP2B.

This enzyme is defined as follows:

Monooxygenase

The protoheme thiolate

Be incorporated into the natural of film

Enzymic activity needs electron transport chain

Need molecular oxygen

Term Cytochrome P450 used herein comprises mammalian cell cytochrome p 450 gene such as P450 2B1, P450 2B6, P450 2A6, P450 2C6, P450 2C8, P450 2C9, P450 2C11 and P450 3A4.Connected wherein each gene with activation cancer therapy drug endoxan or ifosfamide.Produce the P450 mutant to improve enzyme prodrug therapy based on P450

Site-directed mutagenesis or orthogenesis can improve the enzymic activity of Cytochrome P450 at random.Site-directed mutagenesis need be understood the influence of the 26S Proteasome Structure and Function of amino acid replacement pair cell cytochrome p 450 fully.In contrast, unimportant to the existing understanding of P450 to orthogenesis.And useful mutation is generally low than detrimental mutation.Need a plurality of round-robin reorganization and select to make up useful sudden change to improve gene.So orthogenesis especially DNA rearrangement is better than random mutagenesis, can produce a plurality of useful sudden changes rather than single useful sudden change because each is taken turns.However, two kinds of methods all need powerful and effective choice or screening method suddenly change with acquisition advantage from the library of countless mutant.

Can pass through random oligonucleotide mutagenesis (Horwitz﹠amp; Loeb 1986 PNAS 83:7405-9), chemomorphosis (Sweasy﹠amp; Loeb 1993 PNAS 90:4626-30), fallibility PCR (Cadwell﹠amp; Joyce 1994 PCR Methods Appl.3:S136-40) or DNA reset (Stemmer 1994a Nature 370:389-91; Zhan﹠amp; Arnold 1997 PNAS 94:7997-8000) carry out orthogenesis.All these methods all produce DNA and insert the fragment library, and DNA inserts fragment and can be connected in the expression vector, to select in bacterium or mammalian cell environment or to screen.Yet non-DNA rearrangement technology is subject to exercisable DNA and inserts clip size.In a kind of cross-section study, find that the 1-kb fragment can not produce fallibility PCR too greatly, and the DNA rearrangement can be ressembled high dna fragmentation (Stemmer 1994b PNAS 91:10747-51) to the 2.7kb size.

Because most of P450 encoding sequences are greater than 1-kb, it is the appropriate method of improving the P450 gene that DNA resets.Adopt StemmerShi method (Stemmer 1994a Nature 370:389-91; Stemmer 1994b PNAS 91:10747-51) makes relevant P450 encoding sequence random fragmentation with DNA enzyme I.Merge the also fragment of purifying 10-50bp size.In the presence of archaeal dna polymerase, do not need primer that these fragments are carried out overlap by the multiple thermal cycling and extend.Then specific 5 '-and 3 '-primer in the presence of, through PCR acquisition full-length gene.In addition, also introduce point mutation in the method with polysaccharase.On the other hand, can use ArnoldShi staggered extension method (StEP, 1998 Nat Biotechnol 16:258-61 such as Zhao).Can make relevant P450 encoding sequence sex change and with 5 ' of regulation-and 3 '-primer guiding.Described then primer stands the catalytic extension of very brief archaeal dna polymerase.Separate from template with the primer of hot method, it is annealed at random get back to described template these extensions.In each sex change and annealing/extension circulation, fragment and different templates (template conversion) that part prolongs are annealed at random, cause producing recombinant chou thus.Repeat this reorganization circulation till producing full-length gene.

As example on a small scale, can recombinate known can metabolism oxygen azepine Phosphorus (oxazaphosphorines) acquisition the better enzyme of this prodrug as the dna encoding sequence of the relevant people P450 isotype of endoxan.Comprise CYP2A6 (1990Biochemistry 29:1322-9﹠amp such as Yamano; Genbank registration number M33316), CYP2B6 (1989 Biochemistry 28:7340-8﹠amp such as Yamano; Genbank registration number M29874), CYP2C8 (1987 J Biol Chem.262:16072-9﹠amp such as Okino; Genbank registration number M17397), CYP2C9 (1991 Biochemistry 30:3247-3255 such as Romkes; Erratum 1993 Biochemistry 32:1390﹠amp; Genbank registration number M61855 or M61857), CYP2C18 (1991 Biochemistry 30 such as Goldstein, 3247-3255﹠amp; Genbank registration number M61856), CYP2C19 (1991 Biochemistry 30:3247-3255 such as Romkes; Erratum 1993 Biochemistry 32:1390﹠amp; Genbank registration number M61854) and CYP3A4 (1988 DNA 7:79-86﹠amp such as Gonzalez; Genbank registration number M18907; 1986 Proc.Natl.Acad.Sci.U.S.A.83:8064-8068﹠amp such as Beaune; Genbank registration number M14096; Spurr 1989 Hum.Genet 81:171-4﹠amp; Genbank registration number X12387; 1989 J.Biol.Chem.264:910-919﹠amp such as Bork; Genbank registration number J04449).

For fairly large method, the Mammals P450 of two or more subtribes of can recombinating is to produce improved enzyme at endoxan or other associated precursors medicine.Comprise rat CYP2A1 (Matsunaga 1990 Biochemistry 29:1329-41﹠amp; Genbank registration number M33312), mouse CYP2A4 (Squires and Negishi 1988 J.Biol.Chem.263:4166-71﹠amp; Genbank registration number M19319), people CYP2A6, rabbit CYP2A10 (1993 J.Biol.Chem.268:17253-60﹠amp such as Peng; Genbank registration number L10236), rat CYP2B1 (1982 Proc.Natl.Acad.Sci.U.S.A.79:2793-7﹠amp such as Fujii-Kuriyama; Genbank registration number J00719), rabbit CYP2B4 (1988 Mol.Pharmacol.33:22-30﹠amp such as Gasser; Genbank registration number M20856), people CYP2B6, mouse CYP2B9 (Noshiro 1988 Biochemistry 27:6434-6443﹠amp; Genbank registration number M21855), dog CYP2B11 (1990 Arch.Biochem.Biophys.281:106-115﹠amp such as Graves; Genbank registration number M92447), rabbit CYP2C1 (1984Biochemistry 23:204-210﹠amp such as Leihgton; Genbank registration number K01521), people CYP2C8, people CYP2C9, rat CYP2C11 (1987 J.Biol.Chem.262:1706-11﹠amp such as Yoshioka; Genbank registration number U33173 or J02657), people CYP2C18, people CYP2C19, monkey CYP2C20 (1992 Biochim.Biophys.Acta 1171:141-6﹠amp such as Komori; Genbank registration number S53046), hamster CYP2C25 (1994 Mol.Pharmacol.45:228-36﹠amp such as Sakuma; Genbank registration number X63022), mouse CYP2C29 (1994 Biochim.Biophys.Acta 1184:299-301﹠amp such as Matsunaga; Genbank registration number D17674), goat CYP2C31 (1994 Biochem.Biophys.Res.Commun.200:120-5﹠amp such as Zeilmaker; Genbank registration number X76502), pig CYP2C42 (1998 Anim.Genet.29:7-11﹠amp such as Nissen; Genbank registration number Z93098), rat CYP3A1 (1985 J.Biol.Chem.260:7435-7441﹠amp such as Gonzalez; Genbank registration number M10161), people CYP3A3 (1986 Proc.Natl.Acad.Sci.U.S.A.83:5311-5﹠amp such as Molowa; Genbank registration number D00003), people CYP3A4, people CYP3A5, people CYP3A7 (1989 J.Biochem.105:161-3﹠amp such as Komori; Genbank registration number D00408), monkey CYP3A8 (1992 Biochim.Biophys.Acta 1171:141-6﹠amp such as Komori; Genbank registration number S53047) and dog CYP3A12 (1991 Biochim.Biophys.Acta 1088:319-322﹠amp such as Ciaccio; Genbank registration number X54915).Yet, still do not understand the ability of the above listed isotype metabolism of part oxygen azepine phosphorus.Locating structure territory in the cell of locating structure territory

In first embodiment, described locating structure territory is locating structure territory in the cell.

The locating structure territory is used for making the prodrug activation structural domain to have Subcellular Localization in the cell, thereby improves the effect of prodrug activation structural domain.This makes needed prodrug dosage reduce again, thereby improves therapeutic index.

In this embodiment preferred, the target site in target cell is the ubcellular position of activatory prodrug effect.So fusion rotein is delivered to region of interest in the target cell with the prodrug activation structural domain.This has improved the effect of activation prodrug.

In the described cell locating structure territory be generally can be preferentially or specificity be combined in the peptide or the polypeptide of ubcellular position such as a kind of organoid.For example, the locating structure territory can have specific binding partner in the described cell in cell inner membrance such as nuclear membrane or mitochondrial membrane.In the perhaps described cell locating structure territory can be specifically by a kind of organoid in the target cell as nuclear or plastosome picked-up, in the perhaps described cell locating structure territory in conjunction with above-mentioned specific binding partner after, absorbed by a kind of organoid in addition.Therefore, the locating structure territory is preferably and appraises and decides the bit architecture territory in the cell.Be applicable to that locating structure territory in the nuclear of the present invention comprises that SV40 large T antigen, nucleoplasmin and c-myc's appraises and decides the bit architecture territory.

It is believed that the effect of active precursor medicine is directly proportional with active metabolism substrate concentration in the ubcellular site of action.Many active compounds mediate its toxic action by the direct effect to tumour cell DNA.Free radical causes the DNA splitting of chain, activated T irapazamine (TPZ) i.e. is so (Cahill and White are in the book of being quoted), and alkylating agent such as CP, ametycin and CB1954 then make DNA crosslinked, and (Bligh etc. 1990 to cause shearing when duplicating, Cancer Res.50,7789; Knox etc. 1988, Biochem.Pharmacol.37,4661).The transformation period of these compounds of known portions, can see (J.M.Brown is in the book of being quoted) in the nuclear so infer the part activating enzymes, (Cahill and White are in the book of being quoted in fact partly can to detect Cytochrome P450 and P450 reductase activity at nuclear; 1989 Biochem.Pharmacol.38 such as Friedman, 3075).We are known when total length P450 reductase enzyme cDNA is delivered to target cell, and the P450 reductase enzyme protein is positioned the endoplasmic reticulum (ER) [A.V.Patterson 1997 Fig. 1 in the book of being quoted] in the tenuigenin.The P450 reductase enzyme protein has ER film anchor and sequence, and sees this part (1994Proc.Natl.Acad.Sci.91 such as G.C.M.Smith, 8710) usually.The active part of described enzyme is released in the cytosol, so active metabolite produces and freely passive subsequently diffusing in the nuclear at ER.Disappearance ER anchor sequence can not influenced described proteic folding or it is in conjunction with cofactor and ability (Smith etc. are in the book of being quoted) that electronics is provided.The P450 reductase enzyme be natural ER film in conjunction with component, yet think might be with in the enzyme target nuclear for we, further targeting staining matter is to reach raising at the partial prodrug activation of target site.Therefore, in a preferred embodiment, the locating structure territory is the nuclear binding domains in the cell.The first step that the increase metabolite is passed to DNA is that P450 reductase enzyme target is examined.Identified various with protein transport to nuclear in peptide signal (E.A.Nigg summarizes in 1997, and Nature 386,779), include but not limited to the nuclear localization signal of in following albumen, identifying :-

SV40 large T antigen PKKKRKV

Nucleoplasmin KRPAATKKAGQAKKKK

c-myc PAAKRVKLD

[signal sequence is recorded as conventional single amino acids code letter].

Remove the ER anchor of P450 reductase enzyme and sequence, the P450 reductase enzyme (alP450 reductase enzyme) that generation can not anchor.If replace anchor sequence with nuclear localization signal (NLS), then the P450 reductase enzyme no longer is positioned ER, but is mainly seen in the nuclear.In addition, the raising of the partial concn of P450 reductase enzyme in nuclear makes described cell improve the susceptibility that Tirapazamine (TPZ) kills and wounds.This derivative is called the NLS-alP450 reductase enzyme.

Confirmed that the P450 reductase gene can form the functional domain of the exons structure that is equivalent to described gene.Identified structural domain (1990 Biochem.29 such as T.D.Porter, 9814) especially in conjunction with FMN, FAD and NADPH.These structural domains all disperse on 26S Proteasome Structure and Function, make them can be expressed as protein fragments and still can be in conjunction with its corresponding cofactor.For example, the verified peptide of containing residue 242-677 can be in conjunction with FAD and NADPH, so this structural domain (FN fragment) can be with the various single electron acceptors of electron transport (Smith etc. are in the book of being quoted).Only contain participation with the FN fragment of electron transport in order to improve the efficient of target nuclear, can to use to the active zone of external source electron acceptor(EA).The residue 242-677 of nuclear target signal and P450 reductase enzyme is merged.What produce is easier to enter in the nuclear than small protein.Other benefit is that electronics is delivered to FMN and P450 and can not be lost, and therefore can be used for giving the external source electron acceptor(EA) with electron transport.Another benefit is that less size is that the GDV of some finite capacity such as the extra gene of retrovirus vector have been abdicated the space.This derivative is called NLS-FN.

The P450 reductase enzyme is a charged molecule, contains to be rich in Methionin and arginic section (E.A.Shephard etc. 1992, Arch.Biochem.BioPhys., 294,168).This positive charge helps to remain in the nuclear, even described albumen can be positioned on the DNA.Yet keep optimization even further chromatin location in the nuclear for making, can design other fusions.For example can be and transcription factor, GenBank AAB00145, nuclear envelope albumen or any proteic fusions of appraising and deciding the position effect with needs.Stride the cellular localization structural domain

In second embodiment, described locating structure territory is to stride the cellular localization structural domain.

In described locating structure territory aspect this prodrug activation structural domain is delivered to flanking cell, thereby increases the treatment cell count.The expansion of the effect of prodrug beyond its active cells is called " onlooker " effect.This is diffused into flanking cell by previous active metabolite and realizes.Two shortcomings of this method are: thus it simultaneously metabolite is delivered to that whole body produces the toxic danger of general and between cell and cell in dilute metabolite.The present invention is specially adapted to active metabolite and strides the few prodrug of film diffusion, and for example thymidine kinase and Isocytosine deaminase produce the mustargen of nucleotide analog, Cytochrome P450 metabolism generation, the Tirapazamine free radical that the P450 reductase enzyme produces.This is because it provides the activating enzymes rather than the metabolite of striding film.Useful stride the transmembrane transport signal that the cell activation structural domain comprises the 3rd spirane structure territory, hsv VP22 albumen, Prostatropin (bFGF/FGF2), excretory single-chain antibody (s.scFv) and toxin such as the Pseudomonas aeruginosa exotoxin A (PEA) of fruit bat feeler foot homology frame peptide.Such as the film transit sequence of Kaposi fibroblast growth factor and transcription factor kB also is the useful cell activation structural domain of striding.

The unstable of the active metabolite of Tirapazamine (TPZ) is enough to limit any bystander effect, makes described enzyme not accept the VDEPT of described gene or the effect in the GDEPT strategy weakens in most cells.In order to improve the bystander effect of medicine such as Tirapazamine (TPZ), we have designed and have made enzyme be distributed to the novel method of entire target tissue rather than above-described metabolite diffusion profile.For this reason with guaranteeing that the transcellular target signal (TTS) that transports and be transported into flanking cell from described cell replaces ER film anchor.TTS also gives the target cell specificity in one embodiment.

Transporting/be transported into or stride cell-targeting signal (TTS) can obtain from different classes of biosystem, and needn't be correlated with on mechanics on the mode that transports-be transported into of their mediations.

The part example of suitable TTS is as follows:

-basic fibroblast the factor (bFGF or FGF2).Although lack typical secretory signal sequence, but many cell secreted alkaline inoblast factors.The bFGF acceptor to adjusted, is to make the part that is connected with it and the quick internalization of any giant molecule [1990 EMBO such as Baldin J.9,1511 with the bFGF results of interaction in many tumor types; Sosnowski etc. 1996, J.Biol.Chem.271,33647 and the reference wherein quoted].The segmental fusions of bGFG and P450 reductase enzyme or FAD/NADPH produces and transported, then by the albumen of the cellular uptake of any FGF of having acceptor.This mixture is transported in the nucleus.Can add other signal, for example typical secretion signal and NLS, with guarantee from any generation cell effectively transport and effective nuclear in any target cell is transported into.This derivative is called bFGF-P450R and bFGF-FN.

-pAntp。It is 60 amino acid whose polypeptide that are equivalent to be contained in the homology mount structure territory in the 3rd exon of fruit bat rqikiwfqnrrmkwkk.It has the characteristic (1991 Proc.Nat.Acad.Sci. such as Joliot, 88,1864) that penetrates cell and transfer to nuclear.The less peptide that derives from pAntp also has the activity of being transported into, and fusion rotein can be by internalization (1994.J.Biol.Chem.269 such as Derossi, 1044).Unclear is that how this peptide transports from cell effectively, so typical secreting signal peptide is contained in the fusion rotein.Non-anchor type P450 reductase enzyme and secretory signal sequence are merged, to mediate to transporting of fruit bat rqikiwfqnrrmkwkk homology mount structure territory and being transported into to flanking cell nuclear.This derivative is Ant-P450 reductase enzyme and Ant-FN.

-derive from the VP22 albumen of hsv.It is to have 301 amino acid whose virosome structural protein, and it transports from cells infected is natural, is taken in, is transported to and examines and be docked on the chromatin by flanking cell then.Transport/be transported into and locate like the protein that merges with VP22.[Elliott and O ' Hare 1997; WO97/05265].Non-anchor P450 reductase enzyme and VP22 merge, and fusion rotein is distributed to the nuclear of flanking cell again.This derivative is VP-P450 reductase enzyme and VP-FN.The preferred flexible joint separates VP22 and P450 reductase enzyme structural domain (seeing below Somia etc.).

Brachymemma Pseudomonas aeruginosa exotoxin A (PEA) (I.Pastan and D.Fitzgerald 1991 Science, 254,1173 of-coding translocation domain (II); J.Hwang etc. 1987, Cell, 48,129).Translocation domain is merged single-chain antibody to target part such as single-chain antibody, preferred tumor cell specific antigens (1997 Nature such as S.I.Chen for example, 385,78 and reference wherein), and merge reductase enzyme to NLS-alP450.Fusion rotein is secreted and is docked in tumor cell surface, shifts and is transported in the described cell.This derivative is PEA-5T4-P450 reductase enzyme and 5T4-PEA-FN.For example, described target part is the single-chain antibody of anticancer embryonal antigen 5T4, but can use any scFv, for example the scFv of anti-HER-2 (J.K.Batra etc. 1992, Proc Natl Acad Sci 89,5867).The present invention not necessarily is limited to the application single-chain antibody, can preferably use double-stranded monoclonal antibody structural domain in some cases.

-synthetic or natural membranes transit sequence (MTS).The cell-targeting structural domain of striding that another is suitable is the signal peptide hydrophobic region, is commonly referred to film transit sequence (MTS).These are found in many natural genes, and for example transcription factor kB, Kaposi fibroblast growth factor or they can be the synthetic peptides that is selected to the MTS function.These MTS can be as the carrier that small peptide is transmitted into viable cell (for example Lin etc. 1995, suppress the nuclear transmission of transcription factor NG-kB with the synthetic peptide that contains permeable primitive of cytolemma and nuclear localization sequence, and J.Biol.Chem 270,14255).This class peptide can be positioned at the N-end or the C-end of peptide, and confirms that this class peptide can transport full-length proteins (for example Rojas etc. 1998 has the genetically engineered of the fusion rotein of cell membrane permeability, Nature Biotechnology, 16,370).For example can be with the bacterial enzyme of Kaposi fibroblast growth factor MTS and coding for glutathion-S-transferring enzyme.At expression in escherichia coli MTS-zymoprotein, confirm that this purifying protein is easy to be absorbed by mouse cell.

We describe how MTS is used for gene therapy now.MTS can be merged the whole or active part of fusion to prodrug activation enzyme such as P450 reductase enzyme or nitroreductase, preferred merge to the derivative of described enzyme for example can be from the cell that is produced excretory 5T4scFv fusion rotein.The fusion rotein that the peripheral cell picked-up produces, thus the cell count that can activate prodrug increased.Secretion signal needn't combine with target part such as scFv, can use any suitable secretory signal sequence.Can not discharge under the proteic situation naturally or because of necrocytosis at described cell, add secretion signal and can make the generation cell discharge described fusion rotein.Biochemical binding domains

In locating structure territory described in the 3rd embodiment is biochemical binding domains.We are defined as the second prodrug activation structural domain with biochemical binding domains, thereby make a kind of product of prodrug activation structural domain pass to another kind of prodrug activation structural domain.In a preferred embodiment, described another structural domain can be another kind of enzyme, makes the product of kind of the enzyme of winning directly be passed to second kind of enzyme.This can realize and can or cannot combine with nuclear and the biochemistry of striding cell-targeting combination.Biochemical bonded example is for participating in metabolic Cytochrome P450 of prodrug and NADPH cytochrome reductase.P450 offers Cytochrome P450 with electronics, and described biochemical reaction strengthens by proximity effect.Prepare described two kinds of proteic fusion roteins and can strengthen proximity effect, thereby improve the efficient that transfer transport is given adjacent protein structure domain.This activation to for example endoxan is useful, wherein can (for example Chen etc. 1996, Cancer Res.56,1331 by supplying with the activation that excessive Cytochrome P450 strengthens endoxan; Patent is announced WO 96/04789), but be inferior ideal P450 reductase enzyme (for example 1993 Gene such as G.Truan, 125,49) even the active rate of endoxan also is subject to known pair cell cytochrome p 450 activity when mol ratios such as described enzyme is.In bacterial system, described by biochemistry and combined the activity (A.Parikh etc. 1997, Nature Biotechnology, 15,784) that strengthens Cytochrome P450, but do not proposed to use it for gene therapy with the P450 reductase enzyme.

According to the prodrug activation structural domain that participates in transforming can be different products with some prodrug metabolism, perhaps strengthens the metabolism of prodrug by the combination of prodrug activation structural domain.For example, evidence suggests that P450 and P450 reductase enzyme all can cause the low oxygen toxicity (Walton etc. 1992 are in the book of being quoted, and J.M.Brown is in the book of being quoted) of Tirapazamine.Equally, the ability that P450 can the hydroxylation endoxan depends on the transfer transport of P450 reductase enzyme, illustrates that the raising of described two kinds of enzymic activitys can strengthen the metabolism of prodrug.We confirm that the combination of prodrug activation structural domain can maximize the toxic action of one or more prodrugs.The combined of described activation domain will be depended on concrete prodrug combination.It is combined to summarize several as an example :-

Merge to the coding region of P450 reductase enzyme the coding region of P450 or the derivative of more than one described P450R.The fusions of Cytochrome P450 and P450 reductase enzyme is not still described specific coding sequence as herein described and is not mentioned gene therapy purposes aspect (1996 FEBS Lett 397:210 such as Blake as previously mentioned; Cytochrome P450 3A4 and P450 reductase enzyme merge, 1993 Proc.Natl.Acad.Sci.90 such as M.S.Shet, 11748; Rat cell cytochrome p 450 1A1 and yeast P450 reductase enzyme merge, the 8th international conference of 1994 Cytochrome P450s such as T.Sakaka, editor M.C.Lechner, 429-432 page or leaf; 1996 Arch Biochem Biophys 330:48 such as Chun).Described proteic adjacency in described fusions is strengthened transfer transport to P450, thus the metabolism that improves prodrug such as endoxan.

Biochemical binding domains also can be the scavenger cell form.Described in this embodiment scavenger cell will be expressed the prodrug activation enzyme.

As mentioned above, the contiguous P450 reductase enzyme of preferred P450.We find that now the P450 reductase enzyme is present in the human macrophage.We find that at present P450 does not express in scavenger cell, but we also find and can express P450 by engineered scavenger cell.We confirm that further the scavenger cell of this class engineering can be used for activating prodrug such as endoxan.The example of other prodrug other place in this specification sheets provides.

Preferred engineering scavenger cell composing type or the modulated expression prodrug activation enzyme of encoding.Suitable promotor example is cytomegalovirus CMV promotor and hypoxia responsive element (HRE); Although can use other promotor, and they also are well known by persons skilled in the art.

Can not be subject to P450 by the prodrug activation agent that scavenger cell is expressed.Can use other prodrug activation agent such as Isocytosine deaminase.This class prodrug activation agent will be well known by persons skilled in the art.

In particularly preferred embodiment of the present invention, provide the scavenger cell that to express P450.Preferred P450 is CYP2B6.Preferred P450 is under the control of CMV promotor.Such prodrug activation agent can be united the prodrug endoxan and is used for the treatment of.

Scavenger cell also can adopt transmission method as described later.The Chemical bond territory

In the 4th embodiment, described locating structure territory is the Chemical bond structural domain.The Chemical bond structural domain is meant that changing cell internalizing learns the structural domain of environment with the active condition of optimization prodrug activation structural domain.The Bioreductively-activated low-oxygen environment that depends on of some prodrug for example.Medicine that has such as the activation of Tirapazamine are reversed (J.M.Brown summarizes in Br.J.Cancer 1993,67,1163) by molecular oxygen.NADPH dependency reductase enzyme such as P450 reductase enzyme activation Tirapazamine.Available in the present invention other albumen removes the molecular oxygen of cell, to help the condition of biological reducing Tirapazamine.An example provides the cytochrome P 450 enzymes with P450R.Cytochrome P450 is a kind of monooxygenase and with redox molecule oxygen, thereby strengthens the low-oxygen environment of the P450 reductase enzyme of activation Tirapazamine.In microflora, proposed to strengthen the Cytochrome P450 activity with the P450 reductase enzyme, but before all do not propose to strengthen the P450 reductase activity going up in all senses by Cytochrome P450.

Described Chemical bond structural domain also can with cell in, stride cell or biochemical binding domains uses simultaneously.

Because P450 utilizes molecular oxygen, so our suggestion can be used for it by promoting to keep the activation of low-oxygen environment with further enhancing medicine such as Tirapazamine (TPZ) and MMC.Verified mouse in company with giving endoxan and Tirapazamine can strengthen killing tumor cell (S.A.Holden etc. 1992, J.Nat.Canc.Inst.84,187).Although wish not to be subjected to the restriction of any theory, may this be interior discovery of body of above-mentioned reinforcement notion.We confirm that now companion gives Cytochrome P450 and the P450 reductase enzyme can strengthen cell to Tirapazamine susceptibility.Uniting the further advantage that gives Cytochrome P450 and P450 reductase enzyme is the availability that it has commissural arch phosphamide and Tirapazamine pharmacological agent.The combination of other prodrug activation enzyme and derivative is as follows: for example fusion rotein 450FN can be strengthened CP activation and Tirapazamine activation in company with giving with P450 reductase enzyme or derivative.The other medicines combination comprises ametycin and Tirapazamine.The plastosome combination

Mitochondrial DNA (mt-DNA) is the extremely sensitive target that dna adduct forms.Mt-DNA be full of Feng Yu extremely low function is arranged and important encoding sequence (94.4%) because it is quite high to produce the probability of damage at important encoding sequence, so that the cytotoxicity of dna damage is examined in the mt-DNA damage is higher.In addition, mt-DNA does not have histone to protect described DNA to exempt from attack, so it is very responsive to the alkanisation of the splitting of chain agent of active metabolite or generation free radical.Proved that plastosome is the important target (1997Oncol Res 6-7 such as Pritsos, 333) of medicine such as MMC.

Also have fingerprint evidence to go out plastosome and in the effect of apoptosis, play keying action (Henkart and Grinstein 1996 J Exp Med 183,1293; Papa and Skulachev 1996; 1998 Int J Oncol 12,141 such as Decaudin).Before the nuclear feature of apoptosis occurs is the change (1997 Mol Cell Biochem 174,185 such as Petit) of mitochondrial function and structure.This it seems the proteic release that relates to usually hidden protease inducing apoptosis at intermembrane space.The mitochondrial swelling that causes because of the opening in so-called infiltration transhipment hole on its inner membrance in the effect of plastosome film destroy discharges described albumen.Importantly, the level of known activity oxygen kind (ROS) raises and can induce plastosome hole (Skulachev 1996 FEBS Lett397,7; Susin etc. 1997).

Imagination can improve the toxicity of prodrug to described cell with prodrug activation enzyme target plastosome, and stimulates described apoptosis effect path.

The first step that enhancing prodrug metabolite is passed to Mitochondrial DNA is that described prodrug activation enzyme is transported in the plastosome.Synthetic conduct contains the mitochondrial protein of the amyloid protein precursor of N-terminal presequence.The albumen that does not seldom have described N-terminal director sequence is positioned plastosome.Described presequence is essential, and is transported into needs (Verner and Schatz 1988 Science 241,1307 can satisfying in some cases; Fenton 1995 Amer J HumanGenetics 57,235).Although presequence lacks the homology of former sequence, they are rich in alkalescence and hydroxylation amino acid, lack acidic amino acid and long hydrophobicity extension, therefore can form amphipathic alpha-helix and beta sheet configuration.The dna sequence dna that in the present invention the coding line plastochondria is transported into signal merges to the encoding sequence of prodrug activation enzyme.Suitable is transported into sequence description in Verner and Schatz 1988 and Fenton 1995.Described fusion rotein is transported in the plastosome after expressing in target cell.Hemopoietic stem cell (HSC)

Information as a setting, the protoblast storage source that monocyte and differentiation derivative scavenger cell thereof must be called oneself HSC, they can produce multiple different cell type.In Mammals, HSC finds in fetal liver, spleen and marrow, but after birth and in the life of whole adult, only finds them in marrow usually.Such as cell-cell interaction with exist under the microenvironment factor affecting of the soluble cell factor, HSC is divided into various cell lineages.

Produce four kinds of main cell lineages by HSC.These pedigrees comprise: red corpuscle class pedigree (red corpuscle); Megalokaryocyte pedigree (thrombocyte); Marrow pedigree (granulocyte and mononuclear phagocyte); With lymph pedigree (lymphocyte).Particularly, marrow pedigree and lymph pedigree are critical for functions of immune system.

In the human foetus's in about 6 weeks of gestation liver, begin myelopoiesis.The wherein research that has gone out colony by individual stem cell growth in vitro has shown that first progenitor cell that derives from HSC is for can produce granulocyte, red corpuscle and Megakaryocytic colony forming unit (CFU) (CFU-GEMM).

Under the influence of tissue specificity albumen instrumentality network, the maturation of these cells takes place, wherein provided the many titles of described instrumentality, comprise somatomedin, cytokine and interleukin.Substantially, the function of as broad as long different classes of somatomedin or constitutional features.Most of factors be it seems can stimulate multiple biological respinse, and key depends on the different differentiation states of its target cell.For example, a kind of hemopoieticgrowth factor granulocyte colony-stimulating factor (G-CSF) stimulates the propagation of immature myeloid cell and activates ripe neutrophilic granulocyte killing and wounding bacterium.Erythropoietin (EPO) and thrombopoietin (TPO) are the cytokines of structural similitude, support red corpuscle class pedigree and megalokaryocyte pedigree and the more propagation and the differentiation (1997 Ann Hematol 75:207-213 such as Gotoh) of original ancestry respectively.TPO starts its biological effect (1997 Blood89:1896-1904 such as Broudy) by being incorporated into hematopoietic receptor family one member Mpl acceptor.Shown that HOXB4 is very early stage important instrumentality, rather than late period hematopoietic cell proliferation important instrumentality (1995 Genes Dev 9:1753-1765 such as Sauvageau).Solubility Kit ligandin (Kls) works as the part of striding film tyrosine kinase receptor C-kit, and stimulates mastocyte and red corpuscle class ancestors (91EP-810609).Interleukin comprises IL-1, IL-2, IL-3, IL-4, IL-5, IL-6 and IL-12, they can activate HSC (referring to " Molecular Biology and Biotechnology edits RA Meyers1995 VCH Publishers Inc 392-397 page or leaf).

These media are important in just the regulating of hemopoiesis, and mainly derive from the stroma cell in the marrow, but they are also produced by the medullary cell and the lymphoidocyte of the differentiation of mature form.Have many successful combinations of. growth factors to use, but IL-3 and IL-6 and or do not obtained optimum (1989 Proc Natl Acad Sci 86:8897-8901 such as Bodine with the combination of other activated factor (such as STEM CELL FACTOR (SCF)) on initiating cell; 1992 Blood 80:396-402 such as Luskey; 1990 Blood 76 such as Fraser; 1071-1076).Other cytokine (such as TGF β) can be regulated hemopoiesis downwards.

The CFU-GM cell is the precursor of neutrophilic granulocyte and mononuclear phagocyte.Because therefore CFU-GM can observe several different morphology stages along the differentiation of neutrophilic granulocyte approach.Myeloblast is grown and to be promyelocyte and myelocyte, and their are ripe and be discharged in the circulation as neutrophilic granulocyte.By CFU-GM may be the result who obtains particular growth/differentiation factor receptors in different developmental phases to the unidirectional differentiation of ripe neutrophilic granulocyte.

Because described cell development is a granulocyte, thereby the surperficial differentiation marker on the described cell disappears or appearance.For example, II class MHC and CD38 express on CFU-GM, but do not express on sophisticated neutrophilic granulocyte.Other surface molecular that obtains in atomization comprises CD13, low-density CD14, CD15, β ₁Integrin, VLA-4, with CD18 β ₂The β that chain is relevant ₂Integrin CD11a, b and c, complement receptor and CD16Fc γ acceptor.

Adopt the CFU-GM of monocyte approach to produce the proliferative monoblast at first.These cytodifferentiation are promonocyte, are divided into ripe circulating monocytic cell at last.Circulating monocytic cell is considered to be detained the exchange pool of the scavenger cell of tissue.Multi-form scavenger cell comprises the retina endothelial system.

The same with sophisticated neutrophilic granulocyte, sophisticated monocyte and scavenger cell have been lost CD34.Yet different with neutrophilic granulocyte, they continue to express the II class MHC molecule of conspicuous level.These molecules are important for giving the T cell with angtigen presentation obviously.Monocyte is also the same with sophisticated neutrophilic granulocyte to obtain these many surface moleculars.

Except that scavenger cell, there is the typical antigen presenting cell (APC) of great majority during birth, comprise follicular dendritic cell, Langerhans cell and interdigitating cell.Although its origin is still unclear, may derive from bone marrow stem cell by great majority.A kind of possibility is, they derive from identical CFU-GEMM precursor, and then the difference of cellular form, cytochemistry and function can be because the influence of local microenvironment, such as cytokine.Perhaps, APC may derive from different stem cells, and represents independent differentiation pedigree.

In the fs that is divided into colony forming cell (such as CFU-GEMM), HSC expresses CD33 and CD34.Therefore, HSC can come characterized according to the existence of the cell gC D34 (may be CD33) of cell surface usually.

In the next stage that is divided into red corpuscle class pedigree, myelomonocyte pedigree and megalokaryocyte pedigree, the burst forming unit of important red corpuscle class pedigree-red corpuscle class (BFUE) cell carries antigens c D33 and CD34, but these antigens are lost in differentiation afterwards.The myelomonocyte pedigree that comprises the CFU-GM cell is carried CD33, but does not carry CD34, and this CD33 loses subsequently.The initial CFU maxicell that carries CD34 that produces of megalokaryocyte pedigree, CD34 is forfeiture subsequently also.

On HSC and other cell a more important antigen systems be II class MHC (main histocompatibility complex) group.Have been found that most of HSC carry the antigen that is called DR, and express the antigen that is called DP, express the antigen that another is called DQ then at differentiation phase.Therefore, II class MHC DR antigen is the feature of early stage relatively stem cell.

Separate HSC and in culture, keep and the method for breaking up in this area (1992 J Leuk Biol 52:274-281 such as Santiago-Schwartz; 1996 Br JHaematol 94:449-454 such as Charbord; 1997 Blood 89:446-456 such as Dao; 1997Blood 89:2644-2653 such as Piacibello) and be known among the WO91/09938.The HSC transduction of retrovirus mediation and the method (1996 Hum GeneTher 7:231-253 such as Dunbar) that is transferred to the patient have also been described.Fusion rotein

In the present invention who needs fusion rotein, merge described structural domain by making up the hybrid dna molecule.The aminoacid sequence of the given additional molecules of this hybrid molecule, described additional molecules are covalently bond to the dna sequence dna of the whole or active part of given prodrug activation structural domain.Companion gives rather than fusion rotein if desired, and two genes of then will encode prodrug and additional proteins mix designed suitable gene delivery vector (GDV) to guarantee in company with giving cell.For example additional proteins can be expressed with the different expression cassettes of different promotor/enhansers from identical carrier, and in other words, the inclusion of two encoding sequences being separated by internal ribosome entry site IRES will realize that companion gives.

Therefore, the invention provides the nucleic acid of at least one drug component described herein of coding on the other hand, this nucleic acid can be expressed at least one drug component in target cell.The present invention preferably provides the nucleic acid of coding fusion rotein described herein, and this nucleic acid can be expressed described fusion rotein in target cell.

On the other hand, the invention provides the nucleic acid carrier of the nucleic acid that contains at least one described system components of encoding, this carrier can be passed to target cell with described nucleic acid.The present invention preferably provides the nucleic acid carrier of the nucleic acid that contains encoding said fusion protein, and this carrier can be passed to target cell with described nucleic acid.Comprise virus vector, especially retrovirus vector according to suitable carrier of the present invention.Nucleic acid

The present invention also provides the nucleic acid of code book invention fusion rotein.Adopt the standard recombinant dna methodology can make up these nucleic acid.Described nucleic acid can be RNA or DNA, is preferably DNA.If RNA can operate by the cDNA intermediate.In general, the nucleotide sequence in first district of preparation coding places 5 ' and/or 3 ' end with suitable restriction site.Can be at the standard laboratory carrier as sequence (seeing below) as described in operating easily in based on the plasmid vector of pBR322 or pUC19.Can or in detail the similar canonical reference book of appropriate technology be described in detail accurately with reference to the molecular cloning (ColdSpring Harbor, 1989) of Sambrook etc.

Equally, the nucleic acid in coding second district can provide in similar carrier system.Can determine the nucleic acid source with reference to public publication document or database such as Genbank.Expression vector and host cell

Coding partly can be mixed in the carrier for further operation according to nucleic acid or its component of fusion rotein of the present invention.Carrier used herein (or plasmid) is meant and is used for exogenous DNA introduced cell so that its expression or the gapping element that duplicates.The selection of this class carrier and use are fully in those skilled in the art's technical scope.Can adopt many carriers, the selection of suitable carrier will be depended on earmarking of described carrier, promptly whether be used for DNA cloning or DNA express, insert carrier DNA size and use the carrier transformed host cells.According to its function (DNA amplification or expressible dna) and with the host cell of its coupling, every kind of carrier contains various components.Described carrier component generally comprises but is not limited to one or both following components: replication orgin, one or more marker gene, enhancer element, promotor, transcription pausing sequence and signal sequence.

Expression vector comprises any carrier that can express operability and the adjusting sequence that can express described DNA such as the nucleic acid that promoter region is connected.So expression vector is meant recombinant DNA or the RNA construction that causes the DNA expression of being cloned when introducing the suitable host cell, for example plasmid, phage, recombinant virus or other carrier.Suitable expression vector is well known to those skilled in the art, comprise can eukaryotic cell and/expression vector that duplicates in the prokaryotic cell prokaryocyte and keep the free expression vector or be integrated into the expression vector of host cell gene group.For example, coding inserts the carrier that is adapted at expressing in the mammalian cell cDNA according to the DNA of fusion rotein of the present invention, for example based on cmv enhancer carrier such as pEVRF (Matthias etc., (1989) NAR 17,6418).

Make up carrier of the present invention and can adopt conventional interconnection technique.With isolating plasmid or dna fragmentation need mode cutting, tailing and reclosing with what produce required plasmid.Analyze the correct sequence that confirms in the constructed plasmid when needing in a known way.Construction of expression vector, external preparation transcript, DAN introduced host cell and the appropriate method analyzed with evaluation expression and fusion is well known by persons skilled in the art.Employing is according to the probe of the suitable mark of sequence provided by the invention, for example directly with existence, amplification and/or the expression of gene in RNA blotting, dot blot (DNA or RNA analyze) or the in situ hybridization test sample of conventional southern blotting technique method, quantification of mrna transcript.When needing, those skilled in the art will design these methods of how improving easily.Transfer system

Can described hybrid dna molecule be passed to the target cell group by any suitable gene delivery vector GDV in the present invention.This includes but not limited to be formulated in lipid or the albumen composition or transmits the DNA that gives, virus as retrovirus, adenovirus, simplexvirus, vaccinia virus, adeno associated virus as naked DNA by injection or biological emission.The those skilled in the art of recombinant DNA technology and field of gene expression can design the cell specific expression fusion rotein that GDV requires with proper level and specific end use.In other words, the available monocyte of the combination of described new prodrug activation enzyme, scavenger cell, lymph-node cell or hemopoietic stem cell transmission.Can use new cell dependency transfer system especially.Introduce scavenger cell, monocyte or monocyte stem cell precursor outside the genosome of prodrug activation enzyme and the protein combination of in this system, will encoding, and then introduce in patient's body.

As well-known in the art, carrier is permission or promotes a kind of entity to be transferred to the instrument of another kind of environment from a kind of environment.According to the present invention, and as an example, some carrier that is used for recombinant DNA technology allows to be transferred to target cell such as the entity of DNA section (such as the allogeneic dna sequence DNA section, such as allos cDNA section).Optional is that in case be in the target cell, described carrier then can be used for allogeneic dna sequence DNA is maintained in the described cell, maybe can be used as dna replication dna unit.The example that is used for the carrier of recombinant DNA technology comprises plasmid, karyomit(e), artificial chromosome or virus.

Described carrier can be by virus or non-virus technology transmission.

Non-viral system includes but not limited to the DNA infection protocol.At this, transfection comprises uses non-virus carrier gene to be passed to the process of target mammalian cell.

Typical transfection method comprise transfection, closely (compacted) DNA mediation of electroporation, the biological emission of DNA (biolistics), lipid mediation transfection, liposome, immunoliposome, lipofectin reagent, (NatureBiotechnology 1,996 14 for transfection, the cationic surface amphiphile (CFA) of cationoid reagent mediation; 556), polyvalent cation such as spermine, cation lipid or polylysine, 1, two (oily acyloxy)-3-(trimethylammonium ammonium) propane (DOTAP) of 2--cholesterol mixture (Wolff and Trubetskoy 1998 Nature Biotechnology 16:421) and their composition.

The viral system includes but not limited to adenovirus carrier, adeno associated virus (AAV) carrier, herpesvirus vector, retrovirus vector, lentiviral vectors, poxvirus, pitting associated virus (pox-associated virus), acne slow virus or baculovirus vector.

The example of retrovirus comprises: muroid leukosis virus (MLV), human immunodeficiency virus (HIV), equine infectious anemia virus (EIAV), mouse mammary tumour virus (MMTV), Rous sarcoma virus (RSV), not lucky nanometer sarcoma virus (FuSV), Moloney muroid leukosis virus (Mo-MLV), FBR muroid osteosarcoma virus (FBR MSV), Moloney muroid sarcoma virus (Mo-MSV), Ai Beierxun muroid leukosis virus (A-MLV), birds myelocytomatosis virus-29 (MC29) and birds protoerythrocyte hyperplasia virus (AEV).

In (" Retroviruses " 1997 Cold Spring Harbour LaboratoryPress edit: JM Coffin, SM Hughes, HE Varmus 758-763 page or leaf) such as Coffin, can find detailed retrovirus table look-up.

Can find details in the art about the genome structure of some retrovirus.As an example, can from NCBI Genbank, find details (the genome registration number is respectively AF033819 and AF033811) about HIV and Mo-MLV.

Retrovirus can roughly be divided into two classes: i.e. " simply " and " complexity " retrovirus.Retrovirus even can be further divided into 7 groups.Wherein 5 groups is the retrovirus with carcinogenic potential.All the other 2 groups is slow virus and spumescence Tobamovirus virus (spumavirus).The summary of these retroviruss sees Coffin etc., 1997 (the same).

Slow virus group even can be further divided into " primates " and " non-human primate " slow virus.The example of primates slow virus comprises human immunodeficiency virus (HIV) (being the virulence factor of human autoimmune deficit syndrome (AIDS)) and simian immunodeficiency virus (SIV).The non-human primate Slow virus group comprises prototype " slow virus " Wei Sina/chronic progressive pneumonia virus of sheep (VMV) and relevant arthritis-Encephalitis virus (CAEV), equine infectious anemia virus (EIAV) and feline immunodeficiency virus (FIV) and the bovine immunodeficiency virus of describing recently (BIV).

Difference between lentiviridae and other type retrovirus is that slow virus has the ability that infects somatoblast and Unseparated Cell.On the contrary, can not infect Unseparated Cell such as other retrovirus of MLV, such as the cell of configuration example such as muscle, brain, lung and liver organization.

Each retrovirus genome all comprises the gene that is called gag, pol and env, their coding virosome albumen and enzymes.In provirus, the flank at these gene two ends is for being called the zone of long terminal repeat (LTR).LTR is responsible for proviral integration and transcribes.They also work and the expression of may command virogene as enhanser-promoter sequence.The dressing shell of retrovirus RNA takes place by means of the psi sequence that is positioned at viral genome 5 ' end.

LTR itself is identical sequence, and they can be divided into three kinds of elements, and they are called U3, R and U5.U3 derives from described RNA 3 ' and holds distinctive sequence.R is obtained from described RNA two ends repeating sequences, holds distinctive sequence and U5 derives from described RNA 5 '.In different retroviruss, the size of these three kinds of elements can noticeable change.

The basic molecular structure of infectivity retrovirus rna gene group is (5 ') R-U5-gag, pol, env-U3-R (3 ').In defective type retrovirus vector genome, may there be or have function in gag, pol and env.The Zone R at these RNA two ends is tumor-necrosis factor glycoproteinss.On behalf of rna gene group 5 ' and 3 ', U5 and U3 hold distinctive sequence respectively.

Host range between the different retroviruss is different with tissue tropism.In some cases, this specific specificity can limit the transduction potentiality of recombinant retrovirus carrier.Therefore, MLV is used in many gene therapy tests.Specific MLV with the envelope protein that is called 4070A is called amphophilic virus, and it also can the infected person cell, because conservative phosphoric acid translocator " docks " between its envelope protein and people and the mouse.This translocator is ubiquitous, so these viruses can infect many cell types.

Yet in some cases, especially from the angle of safety, it is useful that it may limit cell to the specificity guiding.Replacing described env gene with allos env gene is to be used for technology of selectively targeted some cell type or policy instance.This technology is called pseudotyping, can find example in WO-A-98/05759, WO-A-98/05754, WO-A-97/17457, WO-A-96/09400 and WO-A-91/00047.

Term " recombinant retrovirus carrier " (RRV) is meant such carrier, and it has enough retrovirus genetic information, existing under the situation of packing composition, allow with the rna gene group be packaged as can target cell infection virion.The infection of target cell comprises reverse transcription and is integrated in the target cell genome.The RRV that uses carries by the non-encoding viral sequence of described carrier transfer to target cell.RRV can not be independently duplicated, to produce the infectious retrovirus particle in final target cell.

Be used for the typical recombinant retrovirus carrier of gene therapy, can removing one or more at least a portion gag, pol and the env protein-coding region from virus.This makes that retrovirus vector is a replication defect type.The part of removing even can replace with a kind of NOI so that produce the virus that its genome conformity can be gone into host genome, but the viral genome of wherein modifying itself is irreproducible owing to lack structural protein.In the time of in being integrated into host genome, described NOI expresses, and produces and for example treats and/or diagnose effect.Therefore, pass through usually: NOI is integrated in the recombinant viral vector; The virus vector of modifying is packaged in the virosome shell; And allow transduction purpose site, such as target cell or targeted cell population, and described NOI is transferred to the purpose site.

Usually adopt the combination of package cell line or auxiliary cell line and recombinant vectors, breeding is duplicated and is lacked limit type retrovirus vector, for example to prepare the retrovirus vector of suitable titre, is used for the transduction in follow-up for example purpose site.Described three kinds of packaging proteins promptly can transly be provided.

" package cell line " contains one or more in retrovirus gag, pol and the env gene.Described package cell line produces the required albumen of packing retrovirus DNA, but because cause can not the dressing shell in shortage psi district.Yet when the recombinant vectors that will carry NOI and psi district was introduced package cell line, described accessory protein can be packed the positive recombinant vectors of psi, produces the recombinant virus original seed.This virus original seed can be used for transducer cell, so that described NOI is introduced in the target cell genome.Because verified it can increase virus titer, so the preferred psi packaging signal that is called psi+ that uses, it contains the additional sequences in the downstream from the donor splicing site upstream to the gag initiator codon.

Its genome lacks the recombinant virus of making all required genes of viral protein, only can transduce once, and irreproducible.These virus vector of taking turns target cell of only transduceing are called as replication-defective vector.Therefore, described NOI is introduced host/target cell genome, and do not produce potential deleterious retrovirus.In (1997) (the same) such as Coffin, summarized available packing system.

The preferred use wherein carried the retrovirus package cell line in gag, pol and env encoding viral district in independently being transfected into the isolating expression plasmid of package cell line.This strategy is sometimes referred to as three plasmid transfection methods (Soneoka etc., 1995), has reduced the potentiality that replication-competent virus produces, because the generation of wild-type virus needs three recombination event.Because homology obviously promotes reorganization, so reduce or eliminate homology between described carrier and the subsidiary's genome also to be used for alleviating the problem that produces reproducible helper virus.

The alternative method of stable transfection package cell line will adopt transient transfection clone.When the development carrier, transient transfection can advantageously be used for measuring the level that carrier produces.Aspect this, transient transfection has been avoided producing the stable required long period of carrier production clone, if this carrier or retrovirus packing composition pair cell are toxic, then also can use transient transfection.The component that is commonly used to produce retrovirus vector comprises the proteic plasmid of coding Gag/Pol, the coding proteic plasmid of Env and contains the plasmid of NOI.The generation of carrier comprises to be gone into to contain in the cell of other required component with one or more transient transfections in these components.If the gene that this vector encoded has virus gene or coded interference host cell to duplicate, gene such as cell cycle inhibitor or cell death inducing, then may be difficult to produce stable carrier production clone, but transient transfection can be used for producing described carrier before necrocytosis.In addition, utilize transient transfection, developed the carrier titre level of generation and the clone of being on close level (Pear etc., 1993) of the carrier production clone that gets self stabilization.

In experiment and application in practice, all be starved of the virus formulation that uses high titre.The technology that improves virus titer comprises aforesaid psi+ packaging signal and virus stock solution used concentration.In addition, adopt the different envelope proteins such as the G albumen of vesicular stomatitis virus virus titer to be increased to concentration up to 10 ⁹/ ml (Cosset etc., 1995).Another kind of technology is the fracture intron system that makes up retrovirus vector.This will be described below.

Except operating the retrovirus vector, also designed the retrovirus vector of inducing producing specificity NOI in transducer cell for improving the carrier titre.As previously mentioned, the most frequently used retrovirus vector design comprises with one or more NOI replacement retrovirus sequences, produces replication-defective vector.About the adjusting that NOI expresses, three kinds of methods of main at present use.

1. used the simplest method that the promotor among the retrovirus 5 ' LTR is used for controlling the expression of the cDNA of coding NOI, or the enhancers/promoters that changes LTR is to provide tissue specific expression or inducibility.When inserting a plurality of NOI, extra downstream NOI can utilize internal ribosome entry site to express from polycistronic mRNA.

2. described NOI can be connected with inner allogeneic promoter operability.This arrangement makes promotor select to have greater flexibility.Extra NOI still can express from 5 ' LTR and maybe can make the LTR sudden change to prevent the expression behind the target cell infection.

3.NOI insert 5 ' LTR with reverse adjusting controlling elements.Can comprise and contain enhanser, promotor, intron and 3 ' district.Therefore can realize closely regulating tissue-specific genetic expression.

In addition, we have proved that now retrovirus vector, especially lentiviral vectors are assembled into single transcription unit carrier has advantage, HRE/ promotor construction of the present invention is among the 3 ' LTR, makes the 3 ' LTR that produces duplicate and cause duplicate (being that proviral 5 ' LTR will contain the HRE/ promotor construction that duplicates from 3 ' LTR) of regulating sequence.Our verified this arrangement can be with the activating effect of cooperative mode enhancing to hypoxemia.Therefore the preferred retrovirus vector that contains HRE/ promotor of the present invention among its LTR that uses.More precisely, 3 ' the U3 district or 5 ' the U5 district of retrovirus vector, most preferably 3 ' U3 district as described in HRE/ promotor construction (randomly with any extra adjusting sequence as tissue-specific enhancer's element) can insert.Preferably NOI is not inserted LTR, because in provirus, produce the size that two copies may reduce the open ended NOI of retrovirus vector.Yet, preferably NOI is inserted the section be generally the retrovirus vector that the env gene occupies.

Described NOI can comprise or not comprise selective marker.If this carrier contains the NOI that is not selective marker, then can by with the selective marker cotransfection that is present on another plasmid, this carrier is introduced packing cell.This strategy for the attractive advantage of gene therapy is: express single albumen in final target cell, and avoided the possible toxicity and the antigenicity of selective marker.Yet when the gene that is inserted can not be selected, the shortcoming of this method was more to be difficult to make the cell that produces high titre carrier liquid storage.In addition, more be difficult to measure the titre of this carrier usually.

Be used at present designing the method for expressing two or more proteic retrovirus vector, depend on three kinds of general strategies.These strategies comprise: (i) express different albumen by a kind of alternatively spliced mRNA of promoter transcription; (ii) use promotor and internal promoter among the 5 ' LTR, drive transcribing of different cDNA, (iii) use internal ribosome entry site (IRES) element, with allow by or single mRNA or by translating a plurality of coding regions from the fusion rotein that an open reading-frame (ORF) is expressed.

The carrier that contains inner allogeneic promoter has been widely used for expressing a plurality of genes.Internal promoter makes and the promotor/enhanser combination that can utilize non-viral LTR drives genetic expression.A plurality of internal promoters can be included in the retrovirus vector, verified it can be from least three kinds of different cDNA of promoter expression of himself.Slow virus

Slow virus group can be divided into " primates " and " non-human primate " slow virus.The example of primates slow virus is included as the human immunodeficiency virus (HIV) and the simian immunodeficiency virus (SIV) of the virulence factor of human autoimmune deficit syndrome (AIDS).The non-human primate Slow virus group comprises prototype " slow virus " Wei Sina/chronic progressive pneumonia virus of sheep (VMV) and relevant arthritis-Encephalitis virus (CAEV), equine infectious anemia virus (EIAV) and feline immunodeficiency virus (FIV) and the bovine immunodeficiency virus of describing recently (BIV).

Difference between lentiviridae and other type retrovirus is that slow virus has the ability that infects somatoblast and Unseparated Cell.On the contrary, can not infect Unseparated Cell such as other retrovirus of MLV, such as the cell of configuration example such as muscle, brain, lung and liver organization.So, preferably use lentiviral vectors in the present invention, because slow virus can infect various Unseparated Cells, on the contrary, some other retrovirus needs cell fission with stable integration.

On the basis of the different members of Retroviridae lentiviridae, many carriers have been developed, the theme (WO-A-98/18815 that wherein many carriers are patent applications; WO-A-97/12622).Preferred lentiviral vectors is based on HIV, SIV or EIAV.The simplest carrier that is made of HIV-1 is except that disappearance part env coding region or replace the nef coding region, has whole HIV genomes.Particularly these vector expressions gag/pol, so all auxiliary genes all only needs coating to produce infectious viral particle.In auxiliary gene, vif, vpr, vpu and nef are nonessential.Yet, described recently effectively but lacked the carriers of great majority or all cofactors, Blomer etc. for example, 1997 and Kim etc., 1998.Therefore lentiviral vectors of the present invention preferably lacks at least one auxiliary gene, more preferably lacks all auxiliary genes.

General preferred form based on the lentiviral vectors of HIV is HIV 5 ' LTR and leader sequence, some gag coding region sequence (so that packaging function to be provided), reporter gene box, rev response element (RRE) and 3 ' LTR.In these carriers, gag/pol, auxiliary gene product and coating function or by the simple substance grain or by the plasmid supply of two or more cotransfection perhaps provide by the cell that contains carrier with the HIV cotransfection.Recently, further improved the lentiviral vectors structure.For example, produced the HIV carrier of self inactivation, wherein lacked HIV LTR, expression is limited to inner box (Myoshi etc. 1998).

In preferred embodiments, lentiviral vectors of the present invention is non-human primate lentiviral vectors such as EIAV.We confirm recently, produce effective cloning vector and need derive from the amount of vector gene group sequence of non-human primate slow virus basically less than about the described amount of HIV carrier.The basic EIAV carrier that we have confirmed to lack the big section of gag gene is enough to effective packing, and produces higher virus titer really.So basic EIAV genome carrier comprises promotor usually and optional containing can be instructed the genomic enhanser of the retrovirus that contains following EIAV element successively: the part 5 ' LTR that contains a R-district and a U5 district; Derive from the sequence of 5 ' non-translational region of the gag gene that contains a functional package signal and part gag encoding sequence; The insertion site of goal gene and the 3 ' LTR of EIAV.Described 3 ' LTR can be hybrid LTR, contains polypurine tract and the R-U5 district of EIAV at least and replaces the sequence in another all or part of source of described U3 district.Perhaps, can replace Zone R in 5 ' and 3 ' LTR.WO-A-96/33623 has described the method for replacing genomic U3 of retrovirus vector and Zone R.

The gag Gene Partial preferably contains the interior Nucleotide of preceding 350 Nucleotide of gag coding region, more preferably only contains preceding 150 or 109 Nucleotide of gag coding region, especially preferably only preceding approximately 109 Nucleotide.

In the first aspect present invention particularly preferred embodiment, hCMV-MIE promotor enhanser is used for instructing the expression of retrovirus rna transcription thing.Low oxygen effect enhanser for example of the present invention (HRE) and SV40 or MLV promotor can be replaced U3 district enhanser.

Basic EIAV carrier also lacks S2, Tat, Rev and dUTP enzyme gene, but still can be used for the generation of carrier or be used for transduction division and Unseparated Cell.Usually by trans gagpol of providing and env function described viral genome is packaged in the cell.For example the dna sequence dna of encoding gag pol and env is gone in the cell with the underlying carrier cotransfection of aforesaid general retrovirus.The gagpol sequence preference is non-human primate slow virus source.Particularly advantageous is to contain leader sequence between the ATG initiator codon of the gag of the end of 5 ' LTR and gagpol encoding sequence upstream, expresses so that maximum gagpol to be provided.In addition, preferably contain Rev and/or RRE sequence,, and can eliminate by the codon optimization of EIAVgagpol although this not necessarily.The fracture intron technology of retrovirus

The RNA molecule of transcribing the viral RNA genome size that produces total length again of proviral DNA and the subgene group size that produces by RNA processing, the RNA molecule.Usually, all RNA products are all as the template that produces viral protein.By the combination of montage of rna transcription thing and translate duration ribosomal frameshift, finish the expression of RNA product.

Add multiplexer (spliceosome) and in higher eukaryotic cell, carry out the montage of rna transcription thing by being identified in RNA with the short consensus sequence on the border of montage sequence.These total splice sites are followed so-called ' GT-AG rule ' (although GT is GU naturally in the RNA sequence).5 ' site or donor splicing site (SD) have the GT dinucleotides of high conservative on the border of first exon, 3 ' site or acceptor splicing site (SA) have high conservative AG dinucleotides on second exon-intron border.These consensus sequences are given montage process directivity.Confirmed that splice site is that kind of an attribute-they do not have the specificity of specific RNA precursor, can be by any cell montage.Described montage process also depends on is treating that montage falls the existence of the sequence that is called branch sites in the described section.Branch sites generally is positioned between 18-40 the Nucleotide of 3 ' SA upstream, and thinks that it is accredited as the nearest SA of correct splice site to be connected to 5 ' SD.

With wherein all introns are different by the most cells mRNA of effectively montage, new synthetic retrovirus RNA must change two colonies into.A colony keeps not montage, and with as geneome RNA, and another colony carries out montage, so that subgenomic RNA to be provided.

In simple reverse record virus, the new synthetic retrovirus RNA of a colony keeps not montage, with as geneome RNA and as the mRNA of gag and pol.Another colony carries out montage, and to downstream gene, the most common is env with 5 ' meromixis of geneome RNA.Finish montage with donor splicing site that is positioned at the gag upstream and near pol 3 ' terminal acceptor splicing site.The intron of removing between donor splicing site and acceptor splicing site, by montage contains gag and pol gene.This montage incident produces the proteic mRNA of coating (Env).Described donor splicing site is usually located at the gag upstream, but in some virus such as ASLV, donor splicing site is arranged in the minority codon of gag gene, produces an Env translation product, comprises and Gag common minority amino terminal amino acid residue.Env albumen is synthetic in conjunction with polysome at film, and the vesica by cell transports and be transported to plasma membrane, and it is added in the virion at this.

Complicated retrovirus had both produced simple shear and had connect transcript, also produced many montages transcript, their env gene products of not only encoding, and also the coding array is for these viruses unique adjusting albumen and accessory protein.Complicated retrovirus is such as slow virus, and HIV especially provides the outstanding example of contingent alternative splicing complicacy during retroviral infection.For example, known now, HIV-1 can be by inferior suitable montage, by the different mRNAs of first genome transcript generation more than 30 kinds.Can cause the variation of splice mode owing to destroy the sudden change of competitive acceptor splicing site, and can influence the infectivity of virus, therefore it seems that this chosen process is regulated.

Retrovirus vector of the present invention can utilize the ability of the sequence between senior eukaryotic cell montage 5 ' SD and the 3 ' SA.In fracture intron technology, make up first and contain nucleotide sequence (NS) and second retrovirus vector that can produce the NS of functional acceptor splicing site (FSAS) that can produce functional donor splicing site (FSDS); Wherein a NS is arranged in the downstream of the 2nd NS and is present in the sequence of the 3 ' LTR (U3 district) of retrovirus vector, and this sequence is because the rna form reverse transcription of retrovirus vector is to be integrated into the dna form of host cell gene group and to duplicate in 5 ' LTR.Because first NS that can produce FSDS is positioned at second downstream that can produce the NS of FSAS, so utilize these site montages in retrovirus vector, not carry out.Yet, in the provirus of reverse transcription dna form as integration of described carrier, be the upstream that a described NS is positioned at the 2nd NS now, it is right to produce functional 5 ' donor splicing site-3 ' acceptor splicing site thus.Therefore, when producing from provirus when transcribing, the RNA of generation can be removed intervening sequence between FSDS and the FSAS by montage.According to the character from the sequence of the rna transcription thing montage that produced by provirus, this method has several purposes.

Can preferably use the preferred embodiment of fracture intron technology to relate to hybrid vector system (referring to above).In this system, a NS was positioned at the 2nd NS downstream as described in the genomic layout of retrovirus that is passed to first target cell as adenovirus carrier by first virus vector made.Therefore, can not adopt a NS to make donor splicing site and the 2nd NS and do the acceptor splicing site montage and fall sequence between a NS and the 2nd NS, because their anisotropy.Yet the virion of first target cell packing can be used for infecting second target cell.In second target cell, reverse transcription and virus genomic integration generally can take place.This will produce functional donor splicing site/acceptor splicing site layout, because after this FSDS will be arranged in 5 ' LTR, i.e. and the upstream of FSAS.Montage takes place then to remove the sequence between FSDS and the FSAS.

5 ' the LTR and the nucleotide sequence between the 2nd NS that see in the retrovirus vector between proviral FSAS and the FSDS can contain purpose nucleotide sequence (NOI).Described NOI can contain the essential sequence of generation virion for example env or gagpol sequence.Because NOI will fall from the montage of provirus transcript, so provirus can not produce the live virus particle.This will for example allow to make up the NOI adenovirus retrovirus vector that contains coding virus component and goal gene product such as therapeutical peptide, and it has the additional security features that can not produce described virus component in first target cell when the virion that assembles is introduced second target cell.

An embodiment allows NOI to express in second target cell and can not express in first target cell again.In an alternative method of this embodiment, removing the intervening sequence between the FSDS and FSAS in the provirus rna transcription thing makes and is arranged in 5 ' of provirus genome FSDS and regulates the 5 ' end that the sequence vicinity is arranged in 3 ' the NOI of provirus genome FSAS, thereby making the present operability of described adjusting sequence be connected to NOI and can instruct from NOI transcribes, when described intervening sequence existed, described adjusting sequence can not operability be connected to NOI.Although regulate the upstream that sequence can be arranged in the NOI of retrovirus vector, in preferred embodiments, the adjusting sequence is arranged in the upstream of a NS in U3 district of 3 ' LTR of retrovirus vector, is located at the downstream of described NOI.So, to have only when the reverse transcription thing of retrovirus RNA occurs in second target cell, described adjusting sequence is positioned at 5 ' of NOI.

So in a word, the NOI that (therefore is arranged in the upstream of the 2nd NS of retrovirus vector) between FSDS and FSAS is the sequence that the common viral RNA transcript that produces from the provirus second target cell cuts.So this class NOI can include but not limited to the needed retrovirus sequence of assembling counter-transcription-ing virus particle in first cell.Sequence and/or packaging sequence comprising env sequence, gagpol sequence, the essential auxiliary gene of coding.Therefore be arranged in the downstream (being positioned at retrovirus vector the 2nd NS downstream thus) of the FSAS of provirus genome but generally including generally to be not limited to encode wishes the gene product expressed second target cell sequence as the treatment product.

Will be recognized that aspect the adenovirus crossing system reference substance of retrovirus vector comprises reverse transcription genome sequence that is present in first adenovirus carrier and the rna gene group that is packaged into virion subsequently in first target cell after the generation.

As mentioned above, functional montage sequence also needs to be found in the branched sequence of 5 ' also contiguous FSAS (therefore contiguous the 2nd NS), so should there be suitable branched sequence.Also should be appreciated that to make up the functional inactivation that the fracture intron needs existing functional donor splicing site, for example to prevent montage in the retrovirus rna gene group that first target cell is transcribed.Usually adopt standard technique can make the sudden change of GT dinucleotides consensus sequence for example sport GC and reach this requirement.Adenovirus

Adenovirus is a kind of double-stranded linear DNA virus, and it is without the RNA intermediate.Gene order homology according to all show comparable heredity tissues is divided into 6 subgroups with different people serotype adenovirus more than 50 kinds.Adenovirus hominis C group serotype 2 and 5 (having 95% sequence homology) is most commonly used in the adenovirus system, and is relevant with youthful upper respiratory tract infection usually.

Adenovirus/adenovirus carrier of the present invention can people source or animal-origin.About the adenovirus in people source, preferred adenovirus is for to classify in the adenovirus of C group especially 2 types (Ad2), 5 types (Ad5), 7 types (Ad7) or 12 types (Ad12).Be more preferably Ad2 or Ad5 adenovirus.In the various adenovirus of animal-origin, can use hepatitis infectiosa canis virus, mouse adenovirus or avian adenoviruses, such as CELO virus (Cotton etc., 1993).About the animal adenovirus, the adenovirus in advantageous applications dog source is CAV2 adenopathy strain [for example manhattan strain or A26/61 (ATCC VR-800)] especially.The adenovirus of other animal-origin is included in the adenovirus of quoting among the application WO-A-94/26914, and the document is attached to herein by reference.

As mentioned above, the structure of adenoviral gene group is similar in all adeno-associated virus, and specific function generally is positioned at the same position of every kind of serotype being studied.The adenoviral gene group is included in each inverted terminal repeat sequence (ITR), dressing shell sequence (Psi), early gene and late gene.Main early gene has been categorized as a series of early stage (E1a) immediately, has postponed early stage (E1b, E2a, E2b, E3 and E4) and intermediate zone (intermediate region) (ginseng figure below).The gene that wherein contains the E1 district especially is that viral proliferation is necessary.Main late gene is included in the L1-L5 district.The genome of the Ad5 adenovirus that checked order fully, but and acquisition (registering M73260 number referring to Genbank especially) in the database.Equally, part or all of (as Ad2, Ad7, the Ad12) to other adenoviral gene group also checks order.

For as recombinant vectors, adenovirus is modified so that it can not duplicate at cells infected usually.

Therefore, the construction of Miao Shuing comprises adenovirus (Levrero etc., 1991 of wherein inserting allogeneic dna sequence, lacking the essential E1 district of virus replication in the prior art; Gosh-Choudhury etc., 1986).And, in order to improve the character of carrier, proposed to produce in the adenoviral gene group other disappearance or modification.Therefore, the ts125 mutant is introduced in the heat sensitivity point mutation, made inactivation 72kDa DNA-conjugated protein (DBP) become possibility.Be used for recombinant adenoviral vector of the present invention and preferably comprise a disappearance in its genomic E1 district.More precisely, it comprises a disappearance in E1a and E1b district.According to particularly preferred mode, the E1 district by disappearance in the Ad5 adenoviral sequence from Nucleotide 454 to Nucleotide 3328 PvuII-BglII fragment and inactivation (Genbank registers M73260 number).In another preferred embodiment, described E1 district by disappearance from Nucleotide 382 to Nucleotide 3446 HinfII-Sau3A fragment and inactivation.

Other adenovirus carrier lacks virus replication and/or breeds another essential district, i.e. E4 district.The E4 district participates in regulating late gene expression, stablizes the nRNA in late period, reduces the host cell proteins expression and participates in effective replication-competent virus DNA.So wherein lack E1 district and E4 district adenovirus carrier viral gene expression and to transcribe background noise very low.This class carrier has been described in and for example applies for WO-A-94/28152, WO-Q-95/02697, WO-A-96/22378.The carrier (WO-A-96/10088) of the IVa2 gene that carries modification has been described in addition.

According to preferred varient, be used for recombinant adenoviral vector of the present invention and have disappearance in its genomic E4 district in addition.More particularly, the disappearance in the E4 district influences all open reading-frame (ORF)s.The disappearance that can mention as example accurately is Nucleotide 33466-35535 or 33093-35535.Particularly preferred carrier comprises the disappearance in whole E4 district.This can realize being equivalent to segmental disappearance of MaeII-MscI or the excision of Nucleotide 35835-32720.Disappearance in the E4 district of other type is described in application WO-A-95/02697 and WO-A-96/22378, and described document is attached to herein by reference.

Perhaps, lack only E4 funtion part.This part comprises ORF3 and ORF6 frame at least.As an example, these encoder block can be respectively with the PvuII-AluI that is equivalent to Nucleotide 34801-34329 and 34115-33126 respectively and BglII-PvuII pieces from genomic deletion.In framework of the present invention, also can utilize the disappearance in the E4 district of virus of A d2 dl808 and virus of A d5 dl1004, Ad5dl1007, Ad5 dl1011 or Ad5 dl1014.

The position that more than provides is meant open and can be at the wild-type Ad5 adenoviral sequence of database acquisition.Although less variation may reside between the different adenoviral serotypes, these positions are applicable to that generally by any serotype, especially adenovirus Ad2 and Ad7 make up recombinant adenovirus of the present invention.

In addition, the adenovirus that is produced can have other variation in its genome.Particularly can lack other district to increase the capacity and the reduction side effect relevant of virus with viral gene expression.Therefore, especially can lack all or part of E3 or IVa2 district.Yet about the E3 district, the preferred especially proteic part of coding gp19K that keeps.This albumen can prevent that really adenovirus carrier from becoming immunoreactive object, and described immune response (i) will limit its effect and (ii) may have unwanted side effect.According to concrete mode, can lack the E3 district, be introduced in the proteic sequence of coding gp19K under the allogeneic promoter control again.

Polynucleotide/NOI of the present invention can insert the different loci of described recombination group.It can insert, and conduct lacks or E1, E3 or the E4 district of the surrogate of superfluous sequence.It also can insert any site (ITR sequence and dressing shell sequence) beyond the viral necessary sequence of trans generation.

Because the 80kDa precursor that E2 district coding 72kDa DNA is conjugated protein, archaeal dna polymerase and initiation start the 55kDa terminal protein (TP) of DNA synthetic protein requirement is so it is essential.

The alternative method of the more virus of manufacturing defect with described virus complete " removing internal organ ", only keeps the required terminal repeat of virus replication.In 293 clones, make " removing internal organ " or " asplanchnic " viral growth paramount titre with first-generation helper virus.

Recombinant adenovirus produces in dressing h system usually, and described clone can the genomic one or more functional defects of trans-complementation recombinant adenovirus.Wherein a kind of clone for example has been integrated into wherein 293 clones for the part of adenoviral gene group.More precisely, clone 293 is the people's kidney embryo cell lines that contain the genomic left distal end of serotype 5 adenovirus (Ad5) (about 11-12%), the part in the district of the district of ITR, dressing shell district, the E1 district that comprises E1a and E1b, proteins encoded pIX and proteins encoded pIVa2 on the left of described left distal end comprises.This clone can trans-complementation E1 district defective type (that is to say, lack all or part of E1 district) recombinant adenovirus, that is to say, lacks all or part of E1 district and can produce the viral original seed (stock) with high titre.This clone can also contain the viral original seed of heat sensitivity E2 sudden change in addition in generation under the permissible temperature (32 ℃).

Described especially can complementary E1 district based on other of human lung cancer cell A549 (WO-A-94/28152) or human retina's cell (Hum.Gen.Ther. (1996) 215) clone.But also described can several adenovirus functions of trans-complementation clone, clone (Yeh etc., 1996a, the b in for example complementary E1 and E4 district; Krougliak etc., 1995) and the clone in complementary E1 and E2 district (WO-A-94/28152, WO-A-95/02697, WO-A-95/27071).

Usually by viral DNA being introduced dressing h system, lysing cell (adenovirus life cycle kinetics be 24-36 hour) after about 2-3 days then, thereby generation recombinant adenovirus.In order to finish described process, the viral DNA of being introduced can be complete recombinant virus genomes, chooses wantonly in bacterium (WO-A-96/25506) or yeast (WO-A-95/03400) to make up, and is transfected into described cell.It also can be the recombinant virus that is used for infecting dressing h system.Viral DNA also can be introduced with segmental form, and each fragment is carried part recombinant virus genomes and a homologous region, and described homologous region makes it can rebuild recombinant virus genomes by the homologous recombination between each fragment after introducing the dressing h.

Reproducible adenovirus also can be used for gene therapy.For example the E1a gene can be inserted in the first-generation virus under the tumor-specific promoters adjusting.In theory, after described virus infection was gone into tumour, it can specificity duplicate in tumour and can not duplicate by normal cell around.The carrier of the type can be used for directly by the cracking killing tumor cell or be used for transmitting " suicide gene ", for example can kill and wound the herpes simplex virus thymidine kinase gene (HSK tk) of cells infected and bystander cell line after with the gancyclovir treatment.

Described virogene also can place under the control of low oxygen effect regulatory element.The hybrid carrier system

Also can use hybrid adenovirus/retrovirus system, make the feature and the genomic genetic stability combination of retrovirus of adenovirus thus.These hybrid virus vector utilize adenovirus transduction target cell, and this target cell becomes and can stablize the instant reversal record virus production cell that infects flanking cell then.

Hybrid virus carrier system of the present invention comprises first virus vector that comprises one or more second virus vector of encoding, described first virus vector can infect first target cell, and express wherein described second virus vector, described second carrier second target cell of can transduceing.

So genophore of the present invention comprises external preparation first carrier, produce the essential gene of second carrier in this first vector encoded body.In the application, second carrier carries one or more selected genes for inserting second target cell.Selected gene can be one or more marker gene and/or therapeutic gene (referring to above).

First virus vector can be for example retrovirus (comprising slow virus), adenovirus, simplexvirus or a poxvirus vector of various virus vector, and perhaps under the situation of many first virus vector, they can be the carrier mixtures in different virus source.No matter under which kind of situation, the preferred defective of described first virus vector can not be independently duplicated for them.Therefore, they can enter target cell and transmit the second carrier sequence, but reproducible is not with further target cell infection.

Comprise that at described hybrid virus carrier system all first carriers are used for infecting the first target cell group under the situation of first carrier of coding second carrier more than, be generally simultaneously and infect.First virus vector that preferably has single encoded all second virus vector components.

Preferred single or multiple first virus vector are adenovirus carrier.Adenovirus carrier can obtain to have clear superiority than other virus vector aspect the high titre from the vitro culture thing.Compare with the enveloped virus particle, adenovirus particles is quite stable also, so be easier to purifying and preservation.

The preferred retrovirus vector of described second virus vector, more preferably lentiviral vectors.In first target cell, express the assembling indispensable gene and pack the defective viral vector particle and produce second carrier.Its defective is can not be independently duplicated.Therefore, second target cell in case second retrovirus vector is transduceed just can not be given other target cell by copy propagation.

Be expressed in the essential gene of generation retrovirus vector of encoding in first carrier DNA and can produce second carrier.This genoid comprise retrovirus gag-pol gene, enveloped virus env gene and contain the defective type retrovirus genome of one or more therapeutic genes.In general, defective type retrovirus genome comprises the sequence that reverse transcription can be carried out, to small part 5 ' long terminal repeat (LTR), to small part 3 ' LTR and packaging signal.

Importantly, second carrier that has wherein added one or more security features also is safe to using in the body, and having eliminated recombinates produces the possibility of infective virus that can be independently duplicated.

In order to guarantee that second carrier is a replication defective, it can be by a plurality of transcription units coding that is arranged in single or plural adenovirus or other second carrier.Therefore, can one transcription unit the encode second vector gene group, an encoding gag-pol of transcription unit and the coding env of transcription unit.Perhaps can make up plural transcription unit.For example encoding gag-pol and env or env and genomic nucleotide sequence can be combined in the transcription unit.Its implementation method is known in the art.

Transcription unit as herein described is the nucleic acid segment that contains encoding sequence and be independent of the signal of any other encoding sequence, these encoding sequences of realization expression.So at least one promotor, an enhanser and a polyadenylic acid signal are generally contained in each transcription unit.The promotor of transcription unit and the enhanser of second carrier of encoding is preferably under the condition that produces described second virus vector, in described first target cell strong activity arranged, or can be induced by force.Described promotor and/or enhanser can be that composing type is effective, or its activity can be subjected to tissue limitations or be subjected to time limitation.

The security feature that can join described hybrid virus carrier system is below described.Can there be one or more this category features.

At first, by disappearance homologous region, the sequence homology between the sequence of described second carrier component of can avoiding encoding.Homologous region allows the producer reorganization.In a specific embodiment, make up second retrovirus vector with three kinds of transcription units.The gag-pol gene of the retrovirus under non-retrovirus promotor and enhanser control is contained in first transcription unit.The env gene of the retrovirus under non-retrovirus promotor and enhanser control is contained in second transcription unit.The 3rd transcription unit is included in the defective type retrovirus genome under non-retrovirus promotor and the enhanser control.In natural retrovirus genome, the position of packaging signal makes correctly to work needs part gag sequence.Usually, when therefore making up the retrovirus vector system, the packaging signal that comprises part gag gene is still in described vector gene group.Yet under situation of the present invention, described defective type retrovirus genome contains basic packaging signal, it does not comprise with described first transcription unit in the sequence of gag sequence homology.Equally, in retrovirus, for example in Moloney muroid leukosis virus (MMLV), between pol encoding sequence 3 ' end and env5 ' end, overlay cells is arranged.By the sequence that changes or pol encoding sequence 3 ' is held or env 5 ' holds, with the change codon usage, and do not change coded proteic aminoacid sequence, can remove the corresponding homology zone between described first and second transcription units.

Secondly, by with the envelope protein of another retrovirus or another envelope virus genome pseudotyping with a kind of retrovirus, make and to avoid homologous region between env component and the gag-pol component, can avoid producing the possibility of second virus vector of replication.In a specific embodiments, make up described retrovirus vector by following three kinds of components: the gag-pol gene of the retrovirus under non-retrovirus promotor and the enhanser control is contained in first transcription unit.The env gene of another the optional enveloped virus under non-retrovirus promotor and enhanser control is contained in second transcription unit.The 3rd transcription unit is included in the defective type retrovirus genome under non-retrovirus promotor and the enhanser control.Described defective type retrovirus genome contains basic packaging signal, it does not contain with described first transcription unit in the sequence of gag sequence homology.

Pseudotyping for example relates to based on the retrovirus genome of slow virus such as HIV or equine infectious anemia virus (EIAV), and described envelope protein can be the amphophilic envelope protein that for example is called 4070A.Perhaps, the retrovirus genome can be based on MMLV, and envelope protein can be for example to derive from another viral albumen, for example the G albumen of hemagglutinin of influenza virus or vesicular stomatitis virus with what non-toxicity volume production was given birth in first target cell.In another alternative method, described envelope protein can be the envelope protein modified as sudden change or the engineering envelope protein.Can prepare or select to modify to introduce the target ability or to reduce toxicity or be used for another purpose.

The 3rd, by adopting two kinds of transcription units that make up with ad hoc fashion, can eliminate the possibility of the retrovirus of replication.The gag-pol coding region under promoters active-enhanser in first target cell (such as hCMV promoter-enhancer or tissue limitations promoter-enhancer) control is contained in first transcription unit.Second transcription unit coding can be packed into the retrovirus geneome RNA in the counter-transcription-ing virus particle.The necessary retrovirus sequence of packing, integration and reverse transcription is contained in second transcription unit, also contains the env albumen coded sequence of envelope virus and the encoding sequence of one or more therapeutic genes.

In preferred embodiments, single or multiple adenovirus first carrier that comprises coding retrovirus second carrier according to the hybrid virus carrier system.Being used for adenovirus carrier of the present invention can derived from human adenovirus or the general adenovirus that does not infect the mankind.Described carrier is preferably derived from 2 type adenovirus or 5 type adenovirus (Ad2 or Ad5) or mouse adenovirus or bird adenovirus such as CELO virus.Described carrier can be the adenovirus carrier that replication is arranged, but more preferably defective adenoviral vector.Adenovirus carrier can obtain defective by lacking the necessary component of one or more virus replications.Each adenovirus carrier generally contains at least one disappearance in the E1 district.Be to produce the infectivity adenoviral vector particle, by virus as described in going down to posterity as people's 293 clones in human embryonic fibroblast system, thereby compensate this disappearance, described clone contains the Ad5 left part of the complete copy that comprises the E1 gene.Allogeneic dna sequence DNA inserts the capacity of such carrier can be up to about 7kb.So such carrier can be used for making up system of the present invention, this system comprises three independent recombinant vectorss, and each carrier contains an essential transcription unit that makes up retrovirus second carrier.

The alternative adenovirus carrier that contains other disappearance in other adenoviral gene is known in the art, and such carrier also is applicable to the present invention.Several such s-generation adenoviral vector particles show that (for example E1+E2 lacks Gorziglia etc., 1996 in the immunogenicity reduction; E1+E4 disappearance Yeh etc., 1996).Prolong disappearance and be used to provide extra clone's ability of polygene being introduced carrier.For example to have described 25kb disappearance (Lieber etc., 1996) and to have reported the cloning vector (Fisher etc., 1996) that lacks all virogenes, described carrier will allow to introduce the above allogeneic dna sequence DNA of 35kb.This class carrier can be used for producing according to adenovirus first carrier of the present invention, and its coding is used to make up 2-3 transcription unit of retrovirus second carrier.

Described the preferred embodiments of the invention solve a subject matter relevant with other virus vector with adenovirus carrier, and promptly the genetic expression from this class carrier is instantaneous.The counter-transcription-ing virus particle that is produced by first target cell second target cell of can transduceing, the genetic expression in described second target cell stably keeps, because described retrovirus vector genome conformity is gone in the host cell gene group.Described second target cell is not expressed a large amount of viral protein antigen, so immunogenicity is lower than the cell with the adenovirus carrier transduction.

Is favourable with retrovirus vector as described second carrier, because it is for example by the quick somatoblast of permission guiding, and allows cell to a certain degree to distinguish.In addition, the integration of retrovirus allows stably express therapeutic gene in target tissue, is included in the stably express in the proliferative target cell.

Preferably, described first virus vector preferentially infects certain or some cell type.The more preferably directed carrier of described first carrier that is to say that it compares tissue tropism and change with natural viral, makes the specific cell of described carrier guiding.Term " directed carrier " is not necessarily relevant with term " target cell "." target cell " just is meant that natural or directed carrier can transfection or the cell of transduction.

Be used for comprising: hematopoietic cell (progenitor cell that comprises monocyte, scavenger cell, lymphocyte, granulocyte or any of these cell) according to first target cell of carrier system of the present invention; Endotheliocyte; Tumour cell; Stroma cell; Astroglia cell or neurogliocyte; The myocyte; And epithelial cell.

What therefore, can produce described second virus vector can be any in the above-mentioned cell type according to first target cell of the present invention.In a preferred embodiment, according to first target cell of the present invention is the monocyte or the scavenger cell of transduceing with a kind of defective adenoviral vector, and described defective adenoviral vector contains first transcription unit that is useful on retrovirus gag-pol and can produce can pack genomic second transcription unit of defective type retrovirus.In this case, described second transcription unit preferably is under the control of preferential promoters active-enhanser in the interior ill position of body, the microenvironment of wherein said ill position such as local asphyxia site or solid tumor.In particularly preferred embodiment of this respect of the present invention, make up described second transcription unit, make when inserting described genome in described second target cell, produce an intron, it is used for reducing viral env expression of gene, and allows the efficient expression therapeutic gene.

Described second virus vector also can be directed carrier.For retrovirus vector, this can finish by modifying described envelope protein.The envelope protein of described retrovirus second carrier need be nontoxic coating or the coating that can produce in described first target cell with nontoxic amount, such as the amphophilic coating of MMLV amphophilic coating or modification.In this case, described security feature preferably lacks zone or the sequence homology between the retrovirus component.

Described second targeted cell population can be identical with described first targeted cell population.For example, with first carrier transfer of the present invention to tumour cell, the duplicating and producing of other carrier granule of other tumour cell that causes transduceing.Perhaps, described second targeted cell population can be different from described first targeted cell population.In this case, described first target cell is as by treatment individual machine intravital endogenous factory, can the transduce other carrier granule of described second targeted cell population of generation.For example, described first targeted cell population can be with described first carrier body hematopoietic cell interior or that in vitro transduce.Then, described first target cell is passed to or migrates in the body site such as tumour, and produce described second carrier granule of the tumour cell of mitogen activation in the solid tumor for example of can transduceing.

The present invention allows near required one or more of second target cell of effectively transduceing are subsequently treated proteic action site or its, and the location produces the defective type retroviral vector particles of high titre in the body.This than or adopt defective adenoviral vector or adopt independent defective type retrovirus vector more effective.

The present invention also allows the inherent Unseparated Cell of body or slowly produces in the splitted cell such as the retrovirus vector based on the carrier of MMLV.Previous only might be in quick splitted cell such as the cell that is adapted to tissue culture of in-vitro multiplication, or in the quick splitted tumour cell in vivo, produce retrovirus vector based on MMLV.For the cell that gene is passed to solid tumor (wherein many solid tumor cell divisions slowly), and for using Unseparated Cell (such as endotheliocyte) and various hematopoietic lineage cell as for the endogenous factory of production for treating protein product, the scope that expansion can produce the cell type of retrovirus vector is favourable.Promotor/enhanser

Induce or regulate to be meant and can priority activation to express, for example in the replying of pair cell external signal, can change expression.Constitutive expression is meant with the volume production of constant and gives birth to; Expression is opposite with regulating.For example there is not under the condition of outside stimulus the constitutive expression that recurs.

Nucleic acid preferred operations of the present invention in carrier is connected to and can causes the preferential expression control sequenc of expressing of described fusion rotein in target cell.Expression control sequenc can be for example preferentially to have active promotor or enhanser in comprising some cell type of target cell, preferentially have active promotor or enhanser under some condition such as hypoxia condition.The expression control sequenc that can cause preferential expression under hypoxia condition is called as hypoxia responsive element (Dachs etc., 1997 Nature Medicine 3,515).

Described nucleic acid can be under the promotor control, and described promotor is only activated by the hypoxemia specificity when scavenger cell enters tumour.This helps localized delivery prodrug activation enzyme.This aspect of the present invention is specially adapted to these prodrugs such as Tirapazamine, RSU1069, and E09 and ametycin, this is significantly activated these prodrugs under the hypoxemia situation that for example preferentially is present in tumour.

Described nucleic acid can be under the expression control of expressing regulatory element, usually under the control of promotor or promotor and enhanser.Described enhanser and/or promotor can preferentially have activity in hypoxemia or local asphyxia or low dextrose environment, make described nucleic acid preferentially express in specific purpose tissue, such as expressing in tumor environment, arthritis knuckle or other local asphyxia position.Therefore, can alleviate or eliminate any remarkable biological effect or deleterious effect to individuality to be treated.Enhancer element or give other element of being regulated expression and can exist with multiple copied.Equally, or in addition, described enhanser and/or promotor can preferentially have activity in one or more specific cell types, such as in scavenger cell, endotheliocyte or their combination any or multiple in activity is arranged.Other example comprises the non-replicating cell that end, the end broke up after airway epithelial cell, liver cell, myocyte, myocardial cell, synovial cell (synoviocyte), elementary breast epithelial cell (primary mammary epithelial cess) and the mitotic division, such as scavenger cell, neurone.

Term " promotor " uses with the normal implication in this area, for example is the RNA polymerase binding site in the Jacob-Monod genetic expression theory.

Term " enhanser " comprises that other protein ingredient that is incorporated into the transcription initiation mixture also promotes the dna sequence dna by the transcription initiation of its promoter related guidance thus.

Promotor of the present invention is preferably tissue-specific.That is to say that they can drive nucleic acid and transcribe in a kind of tissue, and in other types of organization, mainly keep " silence ".

Term " tissue-specific " is meant a kind of like this promotor, and its activity is not limited to single organization's type, but they still show selectivity, because they can have activity in a class tissue, and activity is lower or reticent in another kind of tissue.The desirable feature of promotor of the present invention is that they are under the situation that lacks activated hypoxemia adjusting enhancer element, even in target tissue, its activity that has is also low relatively.A kind of method that reaches this point is to use " silencer " element, and they suppress the activity of selected promotor under the situation that does not have hypoxemia.

Many above-mentioned tissue-specific promoters are particularly advantageous in the embodiment of this invention.In most of the cases, these promotors can be used as and are applicable to that easily being cloned into the restrictive diges-tion fragment of selecting in the carrier separates.Perhaps, can separate promoter fragment with the polymerase chain reaction.Add restriction site by 5 ' end in primer, can be so that the clone of amplified fragments.

Be applicable to that the specific heart expression promoter comprises the promotor from muroid heart α-myoglobulin heavy chain (MHC) gene.Suitable blood vessel endothelium specificity promoter comprises Et-1 promotor and von Willebrand factor promotor.

The prostate specific promotor comprises 5 ' flanking region of people's gland kallikrein 1 (hKLK2) gene and prostate specific antigen (hKLK3).

The example of the promotor/enhanser of cell-specific comprises scavenger cell specificity promoter or enhanser, such as the CSF-1 promoter-enhancer or from the element (1994 Exp Cell Res 214:113-119 such as Rouleux) of mannose receptor gene promoter-enhanser.Perhaps, can use preferential promoters active or enhancer element or lymphocyte specific enhanser in neutrophilic granulocyte, such as the IL-2 genetic enhancer.

By there being one or more low oxygen effect enhanser (HRE) elements, induce the expression that therapeutic gene improves under hypoxia condition.The RHE element contains the polynucleotide sequence that can be positioned at described promotor and/or therapeutic gene upstream (5 ') or downstream (3 ').HRE enhancer element (HREE) is generally transacting element, is about 10-300bp usually, and it acts on promotor, to increase the gene transcription under the described promotor control.Preferably, select described promotor and enhancer element, make by the expression of gene of these element regulation minimum under the situation that has regular supply oxygen, and under hypoxemia or anoxia condition to adjusted.

Term " hypoxemia " is meant the under-supply situation of oxygen that certain organs or tissue are accepted.

Hypoxia responsive element also can be selected from for example erythropoietin HRE element (HREE1), muscle pyruvate kinase (PKM), HRE element, B-Hydratase, phosphoenolpyruvate (Hydratase, phosphoenolpyruvate 3; ENO3) HRE element, endothelin-1 (ET-1) HRE element and metallothionein(MT) II (MTII) HRE element.

The example again that hypoxemia is regulated enhanser is binding member (the 1997 Nature Med 5:515 such as Dachs of transcription factor HIF-1; Wang and Sememnza 1993 Proc Natl Acad SciUSA 90:4304; 1994 Proc Natl Acad Sci USA 91:6496 such as Firth).Find that also low oxygen effect enhancer element links to each other with many genes, comprises erythropoietin (EPO) gene (1993 Proc Natl Acad Sci 90:3928 such as Madan; Semenza and Wang 1992Mol Cell Biol 1992 12:5447-5454).From muscle glycolytic ferment pyruvate kinase (PKM) gene (1989 J Biol Chem 264:2363-2367 such as Takenaka), people's muscle specific β-enolase gene (ENO3; Peshavaria and Day 1991 Biochem J 275:427-433) and endothelin-1 (ET-1) gene (1989 J Biol Chem 264:14954-14959 such as Inoue) in all isolate other HREE.

When described enzyme activation domain was expressed by scavenger cell, described promotor and/or enhanser should be that composing type is effective.The example of constitutive promoter such as cytomegalovirus (CMV) is known in the art, can use wherein any.A kind of preferred promoter-enhancer combination is mainly early stage immediately (MIE) promotor of human cytomegalic inclusion disease virus (hCMV)/enhanser combination.We find that composition produces special excellent results in the cancer for example treating for scavenger cell that engineering expresses prodrug activation enzyme such as P450.This is wonderful especially.Host cell and target cell

Polynucleotide construction of the present invention, nucleic acid carrier and virus vector can be introduced various host cells.Host cell comprises prokaryotic cell prokaryocyte such as bacterium and eukaryotic cell such as yeast and senior eukaryotic cell (for example insect cell, mammalian cell such as people's cell).Host cell can be used for breeding non-virus and virus vector, contains the nucleic acid carrier or the preparation infectious titer original seed of polynucleotide of the present invention with for example preparation.

Perhaps, the host cell that contains polynucleotide sequence/NOI of the present invention can be used for treatment, for example scavenger cell discussed below is used for as external treatment.

Usually adopt technology well known to those skilled in the art non-viral nucleic acid and virus vector to be introduced host cell as conversion or transfection.Virus vector also can be introduced host cell by transfection.

Target cell of the present invention is meant the cell of the common organism that need treat or derives from the cell rather than the simple clone of described biology.Can take out target cell from described organism, fail back more after treatment or the interior target of body.Therefore can think that for example intravital tumour cell is a target cell.

The example of target cell comprises tumour cell (the tumour table look-up that vide infra), the especially tumour cell under the hypoxia condition.Described target cell can be the cell that can experience fissional cessation of growth cessation, such as the cell of tumor mass centre portions or such as stem cell or the CD34 of HSC ⁺Cell.Select as another kind, target cell can be the noble cells precursor, such as monocyte precursor, CD33 ⁺Cell or granulocyte precursor.Described target cell also can be a noble cells, such as neurone, astroglia cell, neurogliocyte, microglia, scavenger cell, monocyte, epithelial cell, endotheliocyte or liver cell.Can separate the back from the human individual external commentaries on classics seven or transduction target cell, perhaps can be directly transfection or transduction target cell in vivo.

But preferred host cell/target cell comprises the cell of wherein expressing EPAS, more preferably wherein expresses EPAS the cell of not expressing HIF-1 (or very low-level expression).

In particularly preferred embodiments, hemopoietic stem cell such as scavenger cell are as host cell/target cell.As mentioned above, HSC is the multipotential stem cell that produces all hemocyte pedigrees Mammals.Such as the interaction of cell-cell with exist under the microenvironment factor affecting of the soluble cell factor, HSC is divided into various cell lineages.Produce four kinds of main cell lineages by HSC.These pedigrees comprise: red corpuscle class pedigree (red corpuscle); Megalokaryocyte pedigree (thrombocyte); Marrow pedigree (granulocyte and monocyte); With lymph pedigree (lymphocyte).Particularly, marrow pedigree and lymph pedigree are critical for functions of immune system.Under the influence of tissue specificity albumen instrumentality network, the maturation of these cells takes place, wherein provided the many titles of described instrumentality, comprise somatomedin, cytokine and interleukin.

The cell that will derive from the monocytic scavenger cell of blood flow is as transmitting carrier, with medicine and therapeutic gene guiding solid tumor.Verified, scavenger cell continues to enter solid tumor, and forms poor local asphyxia position at the mammary cancer medium vessels and gather.In addition, the degree positive correlation of macrophages infiltration in local asphyxia inductive degree of necrosis and the tumour in these tumours.

Monocyte and scavenger cell also soak into the local asphyxia infringement, and this is the feature that comprises other morbid state of following disease: cerebral malaria, coronary heart disease and rheumatoid arthritis.Therefore monocyte and scavenger cell are to be applicable to host cell of the present invention.Especially containing the monocyte of polynucleotide of the present invention and/or carrier such as virus vector and/or scavenger cell is applicable to external and intracorporal method treatment and hypoxemia diseases associated.

Separate HSC and in culture, keep and the method for breaking up in this area (Santiago-Schwartz etc., 1992; Charbord etc., 1996; Dao etc., 1997; Piacibello etc., 1997) and among the WO-A-91/09938 as can be known.Reported that also the retrovirus gene is transmitted into (Duphar and Emmons, 1994) among the HSC in general sense.Dunbar etc., 1996 have also described the HSC transduction of retrovirus mediation and have passed to patient's method.

Muroid research shows in the body, and with 5 FU 5 fluorouracil pre-treatment donor mice, circulation that can be by inducing initiating cell also improves susceptibility to retroviral infection and integration, the raising transduction efficiency before results marrow.Target cell and retrovirus produce the collaborative cultivation of clone and utilize and can produce at least 10 by every ml ⁵The clone of virion has also improved efficient (Bodine etc., 1991).In fact, with 1-50% or more carry the genomic cell of provirus and rebuild in all acceptor mouse of a plurality of hematopoietic lineages, (Fraser etc., 1990) in the long-term repopulation cell gene successfully have been transferred to.

When in the present invention uses body, transmitting nucleotide sequence to the carrier of HSC, the described carrier CD34 that preferably can lead ⁺The directed carrier of HSC.

Term " directed carrier " is meant that infection/transfectional cell or the ability of expressing are limited to the carrier of some cell type in the host living beings in target cell, described cell type normally has the cell of common phenotype or similar phenotype.An example of directed carrier is the directed retrovirus vector with genetic modification envelope protein, and described envelope protein only is incorporated into the cell surface molecule of finding in the limited cell type of host living beings number.Another example of directed carrier is to contain the carrier that only allows one or more retrovirus transcripts expression promoter/enhancer element in host living beings part cell type.Therefore, can provide CD34 specific part, such as antibody or the immunoglobulin-like molecule of guiding CD34 for described carrier.In the time of in introducing by the treatment individuality, this carrier is transfection CD34+HSC specifically.Described carrier can system give to peripheral circulation.Therepic use

Believe that the present invention has one or more NOI, prodrug activation structural domain and/or prodrug that wide range of therapeutic suitability-depend on is particularly selected.In addition, or in alternative method, the present invention can be used for the treatment of disease listed among the WO-A-98/09985.In order to be easy to reference, provide part this table now: scavenger cell suppresses activity and/or T cell inhibitory activity and anti-inflammatory activity thus; Anti-immunocompetence, promptly the retarding effect of cellular immune responses and/or humoral immunoresponse(HI) comprises with inflammation is incoherent and replying; Suppress scavenger cell and T cell attachment in the ability of extracellular matrix components and fibronectin, and in adjusted T cell the fas receptor expression; Suppress undesired immune response and inflammation, comprise sacroiliitis, comprise rheumatoid arthritis, the inflammation relevant with supersensitivity, transformation reactions, asthma, systemic lupus erythematous, collagen diseases and other autoimmune disease, the inflammation relevant with atherosclerosis, atherosclerosis, atherosclerotic heart disease, reperfusion injury, heartbeat stops, myocardial infarction, the vascular inflammation disease, respiratory distress syndrome or other heart and lung diseases, with peptide ulceration, the inflammation that ulcerative colitis is relevant with other gastrointestinal tract disease, hepatic fibrosis, liver cirrhosis or other hepatopathy, thyroiditis or other body of gland disease, glomerulonephritis or other ephrosis and urology disease, otitis or other ear naso-pharynageal disease, dermatitis or other tetter, periodontopathy or other odontopathy, testitis or epididymitis (epididimo-orchitis), infertility, testis wound or other Ia testis disease, disorder of placental function, placenta insufficiency, habitual abortion, eclampsia, preeclampsia and other immunity and/or the relevant gynaecopathia of inflammation, posterior uveitis, middle uveitis, anterior uveitis, conjunctivitis, choroidoretinitis, the uvea retinitis (uveoretinitis), optic neuritis, intraocular inflammation is the retinitis or capsule spot shape oedema (cystoid macular oedema) for example, sympathetic ophthalmia, scleritis, retinitis pigmentosa, the immunity of degeneration fondus disease and inflammatory component, the inflammatory component of ocular injury, the ophthalmia that causes by infection, hyperplastic vitreous-retinopathy (vitreo-retinopathy), the acute ischemic optic neuropathy, the for example excessive cicatrization after glaucoma filtration surgery, immunity and/or Inflammatory response and other immunity illness in eye relevant at ocular implant with inflammation, the inflammation relevant with autoimmune disease or in central nervous system (CNS) or any other organ immunity and/or inflammation suppress to be useful illness or obstacle, the Parkinson disease, the complication that causes by treatment Parkinson disease/or side effect, the relevant encephalopathic of chronic brain syndrome HIV that AIDS is relevant, the Devic disease, the Sydenham tarantism, other degenerative disease of presenile dementia and CNS, illness or obstacle, the inflammatory component of apoplexy, syndrome after the poliomyelitis, the immunity of mental disorder and inflammatory component, myelitis, encephalitis, subacute sclerosing panencephalitis, encephalomyelitis, acute neuropathy, subacute neuropathy, chronic neuropathic, Guillaim-Barre syndrome, the Sydenham tarantism, myasthenia gravis, the false tumour of brain, Down syndrome, the Huntington disease, amyotrophic lateral sclerosis, the inflammatory component that CNS compressing or CNS wound or CNS infect, amyotrophy and underfed inflammatory component, and the unify immunity disease relevant of peripheral nervous system of central nervous system with inflammation, illness or obstacle, inflammation after the wound, septic shock, transmissible disease, the inflammation complication or the side effect of operation, bone marrow transplantation or other complication of transplant and/or side effect, for example because inflammation and/or the immunologic complication and the side effect of the gene therapy that the infective virus carrier causes, the inflammation relevant with AIDS, in order to check or suppress body fluid and/or cellullar immunologic response, in order to treat or to alleviate for example leukemia of monocyte or leukemia proliferative disease by reducing monocyte or lymphocytic amount, transplanting natural or artificial cell, tissue or organ are (such as cornea, marrow, organ, lens, pacemaker, natural or artificial skin tissue) is used to prevent and/or treat transplant rejection under the situation.

Especially polynucleotide of the present invention, nucleic acid carrier, virus vector and host cell can be used for treating tumour.Can include but not limited to the tumour example of the present invention's treatment: the sarcoma that comprises osteogenic sarcoma and soft tissue sarcoma; Cancer such as mammary cancer, lung cancer, bladder cancer, thyroid carcinoma, prostate cancer, colorectal carcinoma, the rectum cancer, carcinoma of the pancreas, cancer of the stomach, liver cancer, uterus carcinoma and ovarian cancer; The lymphoma that comprises Hodgkin and non-Hodgkin lymphoma; Neuroblastoma; Melanoma; Myelomatosis; The Wilms tumour; And leukemia, comprise acute lymphocytoblast type leukemia and acute myeloblast type leukemia; Neurospongioma and retinoblastoma.

Particularly advantageous characteristics nucleotide sequence of the present invention can be expressed in hypoxic cell, and does not express in the cell under normal oxygen condition.Therefore nucleotide sequence of the present invention, nucleic acid carrier, virus vector and host cell can be used for the various illnesss that are characterized as hypoxemia of clinical treatment.The example that is characterized as the illness of hypoxemia symptom comprises apoplexy, dvt formation, pulmonary embolisms and renal failure.The necrocytosis that is called the heart tissue of myocardial infarction mainly is because by pouring into the tissue injury that causes after local asphyxia and/or the local asphyxia again.Other example comprises cerebral malaria and rheumatoid arthritis.

Especially preferably nucleotide sequence of the present invention, nucleic acid carrier, virus vector and host cell are used for clinical treatment solid tumor such as ovarian tumor, especially comprise the tumour of the tumour cell of hypoxia.Treatment can reach that tumor growth rate reduces, the stagnation of tumor growth rate or real dwindling of tumor mass and not necessarily cause complete apoptosis/gangrenosum acne death of all malignant cells of patient.

Nucleotide sequence of the present invention, nucleic acid carrier, virus vector and host cell also can be used for treating preventive medicine.Therefore, be used for prodrug of the present invention and can realize the treatment effect by prevention.For example, when the risk of diagnosing out the generation cancer increased, the present invention can be used for carrying out vaccine inoculation for the risk individuality.

The suitability that is used to prevent can be foundation with the genetic factor to cancer, for example mammary cancer or the ovarian cancer that takes place because of the one or more sudden changes in BRCA-1 gene, BRAC-2 gene (Cornelisse etc., 1996) or another genes involved.Medication

So nucleotide sequence of the present invention, nucleic acid carrier, virus vector and host cell can be used for therapeutic gene is passed to the human or animal who needs treatment.

Nucleotide sequence of the present invention can directly give with the naked nucleic acid construction, also preferably contains and host cell gene group homologous flanking sequence.Comprise that biological emission transforms and several known technologies of lipofection can strengthen mammalian cell picked-up naked nucleic acid construction.Perhaps, the described nucleotide sequence part that can be used as the nucleic acid carrier that comprises plasmid vector or virus vector, preferred lentiviral vectors gives.

Preferred described carrier (being naked nucleic acid construction or the virus vector that for example comprises described polynucleotide) makes up to produce medicinal compositions with pharmaceutically acceptable carrier or thinner.So, the present invention also provides by the individual medicinal compositions of gene therapy treatment, wherein said composition comprises nucleotide sequence of the present invention, carrier or virus vector and pharmaceutically acceptable carrier, thinner, vehicle or the auxiliary for the treatment of significant quantity, and described sequence or carrier comprise one or more transferable therapeutic and/or diagnostic NOI or by its generation or derive from its virion.Described medicinal compositions can be used for the mankind or animal purposes.

The selection of pharmaceutical carrier, vehicle or thinner can planned route of administration and standard pharmaceutical put into practice and select.Suitable carriers and thinner comprise isotonicity salts solution, for example phosphate buffered saline buffer.Described medicinal compositions can comprise as any suitable binder carrier, vehicle or thinner or in addition, lubricant, suspension agent, Drug coating, solubilizing agent and can assist or increase other carrier agent (such as the lipid transfer system) that virus enters target site.

Can prepare the pharmaceutical composition of parenteral, intramuscular, intravenously, encephalic, subcutaneous, intraocular or transdermal administration.

Described medicinal compositions can suitably give by following any or multiple mode: suck; Suppository or vaginal suppository form; External-use lotion, solution, emulsifiable paste, ointment or spreading pulvis (dusting powder) form; By using skin patch; Oral, be the tablet form that contains vehicle (such as starch or lactose) or independent or in conjunction with the capsule or the ovule form of vehicle or contain seasonings or the elixir of tinting material, solution or form of suspension; Or they can parenteral injection, for example in the corpus cavernosum penis, intravenously, intramuscular or subcutaneous injection.For parenteral admin, described composition preferably uses with the aseptic aqueous solution form, and the described aqueous solution can contain other material, and for example enough salt or monose are so that solution and blood etc. ooze.For cheek or sublingual administration, described composition can give with tablet or the lozenge with the ordinary method preparation.

Described medicinal compositions gives in the mode that the nucleotide sequence/carrier that contains the therapeutic gene that is useful on gene therapy can mix the cell of appropriate area.

Active component content in said composition is about 0.1%-99% (weight) of described preparation." pharmaceutically acceptable " is meant that described composition must mate with other composition of composition and is acceptable on the patient physiological.

Pharmacy that employing is easy to obtain or veterinary equipment are prepared the medicinal compositions of purposes of the present invention in a usual manner.Therefore, described activeconstituents or separately or optional mixing with the conventional carrier of other active substance and one or more, thinner and/or vehicle produce conventional Green (galenic) preparation such as tablet, pill, powder, lozenge, little wafer, cachet, elixir, suspension agent, emulsion, solution, syrup, aerosol, Gelseal and hard-gelatin capsules, suppository, aseptic parenteral solution, sterile packed powder etc.

Suitable carrier, the example of vehicle and thinner has lactose, glucose, sucrose, sorbyl alcohol, N.F,USP MANNITOL, starch, gum arabic, calcium phosphate, aglinates, tragacanth, gelatin, Calucium Silicate powder, Microcrystalline Cellulose, polyvinylpyrrolidone, Mierocrystalline cellulose, the molasses sugar pulp-water, water/ethanol, water/ethylene glycol, water/polyethylene, ethylene glycol, propylene glycol, methylcellulose gum, methyl hydroxybenzoate, nipasol, talcum powder, Magnesium Stearate, mineral oil or fatty substance are as tristearin or their suitable mixture.Described composition can also contain lubricant, wetting agent, emulsifying agent, suspension agent, sanitas, sweeting agent, seasonings etc.Adopt method well known in the art to prepare described preparation with snap-out release after giving the patient, slowly discharge or delayed release of active elements.

Preferably with the unit dosage preparation, for example the per unit formulation contains the 0.1-500mg activeconstituents of having an appointment to described composition.

The course of treatment is depended on many factors in the accurate dosage of activeconstituents and treatment, comprises patient's age and body weight, concrete illness and its severity to be treated and gives approach.In general, the about 0.01-20mg of effective dose per kilogram of body weight every day, for example every day about 0.05-10mg/kg, give one or many every day.So adult's suitable dose is 10-100mg every day, for example every day 20-50mg.

Medication can be any appropriate method known in the art, comprises for example oral, parenteral (for example intramuscular, subcutaneous, intraperitoneal or intravenously), rectum or topical.

When with virus vector of the present invention nucleotide sequence of the present invention being passed to cell, the virus quantity that is given is 10 ³-10 ¹⁰Pfu, be preferably 10 ⁵-10 ⁸Pfu, more preferably 10 ⁶-10 ⁷Pfu.When injection, give 1-10ml the virus in pharmaceutically acceptable suitable carrier or thinner usually.

When described nucleotide sequence/carrier gave with naked nucleic acid, the nucleic acid amount that is given was generally 1 μ g-10mg, preferred 100 μ g-1mg.

Control following time when NOI is in induction type adjusting sequence, only need its inducible gene expression during treating.In case treatment is finished, remove inductor, stop to express NOI.This has tangible clinical advantage.This system for example can relate to and for example gives antibiotic tetracycline, to express by its effect activated gene to tet repressor/VP16 fusion rotein.Another system comprises that using desferrioxamines and induces HRE.

When adopting polynucleotide of the present invention/carrier, the application organizes specificity promoter helps to treat disease.For example several nervous system diseases are that the specific gene product causes at a unique little cell subset unconventionality expression.Can only in relevant influenced cell type, the expression treatment gene be favourable, when especially when this genoid is expressed, having toxicity in other cell type.

Give patient or risky individuality with modification HSC of the present invention with appropriate formulation.Described preparation can comprise normal isotonic saline solution, buffer salt solution or tissue culture medium (TCM).Give described cell by large bolus injection or by intravenous infusion, or described cell is directly given tumor locus or gives marrow, its concentration for example is about 10 ⁶To about 10 ¹²Cell/agent preferably is at least 10 ⁸Or 10 ¹⁰Cell/agent.

At first handle described individuality, exhausting bone marrow stem cell, or handle, move in the peripheral blood to increase stem cell, or use one or more cytokine therapies, with the repopulation of enhancing marrow with one or more cytokines such as G-CSF.Also imagined the combination that this class is handled.Therapy of the present invention can be united with present available anti-cancer therapies.

Under the situation of the vector encoded prodrug activation enzyme that is used for Stem Cell Engineering, the cancer patients uses corresponding prodrugs therapy in addition, according to principle known in the art, adopts suitable scheme administration.

When from individuality to be treated, taking out HSC, before or after introducing one or more described NOI, described cell is generally increased in culture also with described carrier in-vitro transfection or transduction.When external cultivation under appropriate condition, or when accepting appropriate signal in vivo, HSC has other cell type that ability is divided into endotheliocyte, marrow like cell, dendritic cell and immune effector cell, wherein said immunological effect such as neutrophilic granulocyte, lymphocyte, mononuclear macrophage and NK cell.

This relates to the application organizes culture method, and described method is known in the art, comprises being exposed to cytokine and/or somatomedin to keep HSC (Santiago-Schwartz etc., 1992; Charbord etc. 1996; Dao etc., 1997; Piacibello etc., 1997).Also can add the medicine of inducing the HSC differentiation.

Except that hypoxemia was replied, known described HRE element was replied hypoxia-mimicking chemical inducer.Wherein two kinds of these inductors are known, and they are cobalt chloride and desferrioxamine (Meliillo etc., 1996; Wang and Semenza 1993b).Therefore, wherein adopt the goods of the present invention of HRE can be used for treating to the disease of hypoxia-mimicking compound, for example use the chemokinesis thing to desferrioxamine or similar chemical substance) treatment neuroblastoma (Blatt, 1994), beta Thalassemia (Giardina and Grady, 1995), presenile dementia (Crapper etc., 1991, VEGF lacks (Beerrepoot etc., 1996), erythropoietin lacks (Wang and Semenza1993b) and in order to strengthen chemotherapy of tumors (Voest etc., 1993).Goods of the present invention can with hypoxia-mimicking compound simultaneously, sequential or independently give.

Skilled medical practitioner describedly gives approach and dosage is only for reference, because can determine easily that the best of any concrete patient and the state of an illness gives approach and dosage.

The suitability that is used to prevent can be foundation with the genetic factor to cancer, mammary cancer or the ovarian cancer that takes place because of the one or more sudden changes in BRCA-1 gene, BRAC-2 gene (Cornelisse etc., 1996 Pathol Res Pract 192:684-693) or another genes involved for example.

Think at present and may determine importantly that wherein concrete goods are safety and effective patient.This heritable variation that is based on Different Individual may cause the understanding of the variation of drug effect.

So, the invention provides the polymorphism of the individual DNA of test in drug metabolism enzyme, if the suitable method that gives prodrug activation agent of the present invention then.

According to the present invention, can use the standard molecular biological technique in those skilled in the art's level.This class technology has carried out describing all sidedly in the literature.Referring to (1989) Molecular Cloning:a laboratory manual such as for example Sambrook; Hames and Glover (1985-1997) DNA Cloning:a practical approach, 1-IV rolls up (the 2nd edition); In (1996) such as McCafferty " Antibody Engineering:A Practical Approach ", provided the engineering method of immunoglobulin gene.

The feature that it should be understood that above-described various piece of the present invention, aspect and embodiment generally is equally applicable to other parts, aspect and embodiment mutatis mutandis.

Referring now to following limiting examples the present invention is described in further detail:

Although in gene therapy to adopt people NADPH: Cytochrome c reductase is example explanation the present invention, but it is applicable to any P450 reductase enzyme that derives from any species and can improves to improve enzymic activity with the protein engineering method, and be applicable to that any other is natural, genetic engineering or synthetic prodrug activation enzyme, for example DT-diphosphatase, thymidine kinase, intestinal bacteria nitroreductase and carboxypeptidase G 2.Embodiment 1 will examine the target peptide and add P450R.[Fig. 7 .1]

Prepare hybrid DNA by the standard method of adopting recombinant DNA technology field those skilled in the art to understand, thus preparation peptide or protein fusions.For example press method described in the document, for example (1989) Molecular Cloning:a laboratory Approach such as Sambrook; Hames and Glover (1985-1997) DNA Cloning:a practical approach, 1-IV rolls up (the 2nd edition).Heterozygous genes is inserted suitable carrier to be passed to mammalian cell.Can use the carrier of many types, they have been carried out describing in detail (Number 1, gene therapy for for example Lever and Goodfellow 1995, Brit.Med.Bull.51) and are known to the those skilled in the art.For example in order to produce the retrovirus vector of the prodrug activation enzyme that can be expressed in described in this embodiment and following examples, relevant coding region is inserted in the retrovirus vector, wherein produce the transcript that contains the P450 encoding sequence from strong promoter such as hCMV-MIE promotor.Suitable plasmid is that (Soneoka etc. 1995, Nucl.AcidsRes.23 for pHIT111; 628-633), adopt standard molecular biological technique to insert required gene then to replace the LacZ gene.Then, the gained plasmid transfection is gone into FLYRD18 or FLYA13 package cell line (1995 J.Virol.69 such as Cosset; 7430-7436), and in 1mg/ml G418 select cells transfected.G418 resistance packing cell produces the recombinant Retroviruses that high titre can the infected person cell.Use this virus formulation infected person cancer cells then, and can be injected into in-vivo tumour.Then by described tumor cells expression prodrug activation enzyme.

In pHIT111, adopt MoMLV LTR promoter-enhancer expression treatment gene in target cell.Also can modify this carrier and make therapeutic gene transcribe, for example main internal promoter-enhanser that in tumour cell, has activity or contain the hypoxemia regulatory element by internal promoter-enhanser.A kind of suitable HRE enhanser that contains is made up of the HSV TK promotor of brachymemma and the mouse PGK HRE of three copies (1994 Proc Natl Acad Sci USA91:6496-6500 such as Firth).Insert between NheI among the pHIT1113 ' LTR and the XbaI site (Soneoka etc., the same) being described in synthetic oligonucleotide among the WO95/21927 for example, produce the wherein genetic expression in target cell and be in retrovirus vector under the hypoxemia control.A kind of alternate retrovirus vector of Gou Jianing is the pKAHRE that is shown in Fig. 6 a in the same manner.Other available support main chain is shown in Fig. 6 b.

In order to operate and analyze the encoding sequence of P450R gene, its following subclone is gone into mammalian cell expression vector :-

Serial ID NO:1 be people P450R cDNA (Shephard etc. 1992, Arch.Biochem.Biophy.294:168, GenBank registration number: S90469, referring to Fig. 1 a).

Obtaining from people's placenta cDNA with conventional pcr amplification method is the segmental P450 reductase enzyme of EcoRI cDNA, connects into pBlueScript II carrier and forms P450R.1.

In order to make up the nuclear target derivative of P450 reductase enzyme, remove the ER anchor and structural domain, produces non-anchor P450 reductase enzyme (alP450), and the adding nuclear localization signal.

The functional structure territory of P450 reductase enzyme is shown in Fig. 1 b.

SEQ ID NO:alP450R sequence is shown in Fig. 2 A.

Adopt the pcr amplification of following primer to obtain any P450 reductase enzyme derivative (alP450R is referring to the SEQ ID NO:3 sequence of Fig. 2 a) that SV40NLS substitutes the ER structural domain from plasmid pP450R.1.

NLS-alP450 5 '-primer: SEQ ID NO:7.

cccgccgcca?ccatgCCAAA?AAAGAAGAGA?AAGGTA TCCT?CTGTCAGAGA

GACGCTTTG(61mer)

It contains following component:

1.Kozak leader sequence (Peakman etc. 1992, patent publication No. EP0486170-A/2, GenBank registration number A18727).Underscore.

2.SV40 large T antigen be transported into the nuclear signal sequence (Fiers etc., 1978, Nature 273:113, also referring to Nigg 1997, Nature 386:779, GenBank registration number: V01380).

3.alP450R 5 ' district (Smith etc. 1994, PNAS 91:8710 Fig. 3 A).

AlP450 3 '-primer: SEQ ID NO:8.3 ' of alP450R-district

CTAGCTCCAC?ACGTCCAGGG?AGTAG(25mer)

The PCR fragment subclone of gained is gone into the SmaI site in pCIneo carrier (deriving from Promega) polyclone district.

SEQ?ID?NO：9。The multiple clone site of pCINeo

gctagctcga?gaattcacgcg?tggtacctct?agagtcgaCC?CGGGcggccg?c

(NheI-XhoI-EcoRI-MluI-XbaI-AccI/SalI-SmaI-NotI)

Final fusions structure is shown in Fig. 7 .1.Embodiment 2 will examine the functional structure territory (FN) that the target peptide adds P450R.[Fig. 7 .2]

The functional fragment of P450 reductase enzyme (FN fragment) (Smith etc. 1994, PNAS 91:8710) is shown in Fig. 2 B.Following structure nuclear target FN:-

Produce the PCR fragment of the dna sequence dna of the following fusion rotein of coding :-

SEQ ID NO:10 and 11.SV40NLS (Fig. 3)

SEQ ID NO:5 and 5.The FN fragment of P450 reductase enzyme.P450 reductase enzyme FN fragments sequence is shown in Fig. 2 B.

Adopt following primer by pP450R.1 (embodiment 1) amplification PCR fragment :-

FN 5 '-primer: SEQ ID NO:12.This sequence contains the segmental 5 '-district of Kozak translation initiation sequence (lowercase), SV40NLS (capitalization) and FN (underscore black matrix): Ccgccgcca CcatgC CAAAAAAGAA GAGAAAGGTA C GCCAGTACGA GCTTGTGGTC CACA(60mer)

FN 3 '-primer: SEQ ID NO:13.The segmental 3 '-coding region of FN

CTAGCTCCAC?ACGTCCAGGG?AGTAG(24mer)

PCR fragment subclone is gone into the SmaI site of pCIneo carrier, produce SV40NLS-FN (Fig. 7 .2).Embodiment 3 makes up bFGF-alP450R virus vector [Fig. 7 .3]

Press embodiment 1 described preparation fusions.

(Prats etc. 1989, and PNAS 86:1836 is referring to Fig. 4 B for the 18kD isotype of bFGF; GenBank registration number: J04513).

Be structured in the terminal and C-end of the N-of 18kD isotype of bFGF and contain non-anchor the hybrid albumen of P450 reductase enzyme (Fig. 2 A).Adopt two PCR reactions, (derive from R﹠amp from the bFGF-pUC18 plasmid; D system) removes the bFGF sequence and produce the bFGF fragment, and remove the alP450R sequence from p450R.1.Digest this two kinds of fragments with SalI then, link together.Use following primer :-

BFGF 5 '-primer: SEQ ID NO:14.Its guiding has 5 '-coding region of the 18kD isotype of Kozak leader sequence (underscore). cccgccgcca?ccatggcagc?cgggagcatc?accacg(36mer)

BFGF 3 '-primer: SEQ ID NO:15.Its guiding has 3 '-coding region of the bFGF of SalI agretope ggcgGTCGACgct cttagcagac attggaaga (32mer) point (representing with capitalization) the preceding

AlP450R 5 '-primer: SEQ ID NO:16.Its guiding has 5 '-coding region ggcgGTCGAC tcc tctgtcagag agagcagctt tg (35mer) of SAlI restriction site (capitalization is represented) alP450R the preceding

AlP450R 3 '-primer: SEQ ID NO:17.It guides 3 '-coding region ctagctccac acgtccaggg agtag (24mer) of alP450R

With two PCR fragment bFGF of SalI digestion and alP450R, purifying is interconnected with one another then then.Then the DNA subclone that connects is gone into the SalI site (Fig. 7 .3) of mammalian expression vector pCIneo.

In some cases, preferably separate protein structure domain with flexible joint.Such as but not limited to sequence (Gly-Gly-Gly-Gly-Ser) ₃(1993 PNAS 90,7889 such as Somia).This is the method that recombinant DNA technology and protein expression field those skilled in the art know.

For example, can use one group of alternative primer and prepare following fragment in order to make flexible joint (flexlink) between TTS and alP450 or FN protein structure domain contact:

Primer SalI-flexlink-alP450R:SEQ ID NO:18.The rare codon (1996 Curr.Biol.s such as Haas, 6,315) of black matrix sequence representative in the gene of high expression level.The underscore sequence is the 5 ' district of alP450R.5 '-ggcgGTCGAC gga ggt gga ggt tcg GGC GGG GGC GGC AGT GGG GGC GGCGGG AGT Tcc tctgtcagag agagcagctt tgEmbodiment 4 makes up bFGF-FN expression vector [Fig. 7 .4]

By pcr amplification from bFGF/PUC18 plasmid (R﹠amp; D system) the cDNA fragment of the fusion protein product of acquisition coding 18kDbFGF albumen (seeing Fig. 3 B) and FN structural domain (Fig. 2 B), described FN fragment adopts following primer to obtain from plasmid pP450R.1:

The bFGF primer: for bFGF 5 '-and 3 '-primer referring to embodiment 3.

FN 5 '-primer: SEQ ID NO:21.Its guiding has 5 '-coding region ggcgGTCGAC cgc cagtacgagc ttgtggtcca ca (35mer) of SalI restriction site the preceding

FN 3 '-primer: SEQ ID NO:13.The segmental 3 '-coding region of FN

CTAGCTCCAC?ACGTCCAGGG?AGTAG(24mer)

With two PCR fragment bFGF of SalI digestion and FN, purifying is interconnected with one another then then.Then the DNA subclone that connects is gone into the SalI site (Fig. 7 .4) of mammalian expression vector pCIneo.

In order to make flexible joint between bFGF and FN structural domain, can use one to substitute 5 ' primer:

Primer SalI-flexlink-alP450R:SEQ ID NO:22.

5’-ggcgGTCGAC?gga?ggt?gga?ggt?tcg?GGC?GGG?GGC?GGC?AGT?GGG?GGC?GGC

GGG?AGT?cgc? cagtacgagc?ttgtggtcca?ca

The rare codon (1996 CurrBiol.s such as Haas, 6,315) of black matrix sequence representative in the gene of high expression level.The underscore sequence is the 5 ' district of FN.Embodiment 5 makes up pAntp-alP450R expression vector [Fig. 7 .5]

SEQ ID NO:53 and 54.Fruit bat rqikiwfqnrrmkwkk homology frame peptide (pAntp, 1986 Mol.Cell.Biol.6:4676 such as Laughon).

Adopt following primer, from p903G plasmid pcr amplification pAntp and from plasmid pP450R.1 amplification non-anchor P450R obtain the cDNA fragment of the fusion protein product of coding pAntp and alP450RD:

PAntp 5 '-primer: SEQ ID NO:23.Its guiding has 5 '-coding region of the pAntp of Kozak leader sequence (underscore) Cccgccgcca ccatgGaacg caaacgcgga aggcagacat (40mer)

PAntp 3 '-primer: SEQ ID NO:24.Its guiding has 3 '-coding region ggcgGTCGACgtt ctccttcttc cacttcatgc gccga (38mer) of SalI restriction site

AlP450R 5 '-primer: SEQ ID NO:16.Its guiding has 5 '-coding region ggcgGTCGACtcc tctgtcagag agagcagctt tg (35mer) of SalI restriction site the preceding

AlP450R 3 '-primer: SEQ ID NO:17.It guides 3 '-coding region

ctagctccac?acgtccaggg?agtag

With two PCR fragment pAntp of SalI digestion and alP450R, it is interconnected with one another then.Again the DNA subclone that connects is gone into the SmaI site (Fig. 8 .5) of mammalian expression vector pCIneo.

Described by above embodiment, available alternative primer inserts flexible joint.

In order to strengthen the pAntp fusions, secretion signal is added the N-end from emiocytosis.Appropriate signals can be derived from 5T4 single-chain antibody sequence (Fig. 3 F).

PAntp secretes 5 ' primer: SEQ ID NO:28.It makes Kozak translation initiation site and secretion signal place 5 ' end of pAntp peptide.Capitalization represents to be equivalent to the sequence of pAntp, and underscore is the Kozak homing sequence. CcaccatgggAtggagctgtatcatcctcttcttggtagcaacagctacaggtgtccactccaaac gcggaaggcagacaGAACGCAAACGCGGAAGGCAGACAT (105mer) embodiment 6 makes up pAntp-FN expression vector [Fig. 7 .6]

It is described to press embodiment 5, by pcr amplification from the plasmid that contains pAntp for example p903G obtain the cDNA fragment of the fusion protein product of coding pAntp.Adopt following primer, obtain FN fragment (seeing Fig. 2 B) from plasmid pP450R.1:

5 ' of pAntp-primer and 3 '-primer is seen embodiment 5

5 ' of FN-primer and 3 '-primer is seen embodiment 4.

With two PCR fragment pAntp of SalI digestion and FN, it is interconnected with one another then.Again the DNA subclone that connects is gone into the SmaI site (Fig. 7 .6) of mammalian expression vector pCIneo.Maybe can use pAntp secretion 5 ' primer, SEQ ID NO:28.Embodiment 7 makes up VP-alP450R expression vector [Fig. 7 .7]

SEQ ID NO:55 and 56.Herpes simplex types 1 virus tegument protein VP22 (Elliott and O ' Hare 1997 Cell 88:223, GenBank registration number: X14112).

Adopt following primer, by pcr amplification from the plasmid pGE109 that contains VP-22 with obtain VP22 by pcr amplification from plasmid pP450R.1 and merge fusion protein product to alP450R:

VP22 5 ' primer: SEQ ID NO:29.Its guiding has 5 '-encoding sequence of Kozak leader sequence (underscore). cccgccgcca?ccatgacctc?tcgccgctcc?gtgaag(36mer)

VP22 3 ' primer: SEQ ID NO:30.It guides 3 '-coding region, and contains the SalI restriction site.ggcgGTCGACctc?gacgggccgt?ctggggcgag?a(34mer)

5 ' of alP450R-and 3 '-primer referring to embodiment 3.

With two PCR fragment VP-22 of SalI digestion and alP450R, it is interconnected with one another then.Again the DNA subclone that connects is gone into the SmaI site (Fig. 7 .7) of mammalian expression vector pCIneo.Embodiment 8 makes up VP-FN expression vector [Fig. 7 .8]

It is described to press embodiment 7, adopts following primer to obtain coding VP-22 fusion protein product cDNA fragment (referring to 3D) and obtain FN fragment (seeing Fig. 2 B) from plasmid pP450R.1 from pGE109 by pcr amplification:

VP22 5 '-primer and VP22 3-' primer are seen embodiment 7

FN 5 '-primer and VP22 3 '-primer is seen embodiment 4.

With two PCR fragment pAntp of SalI digestion and FN, it is interconnected with one another then.Again the DNA subclone that connects is gone into the SmaI site (Fig. 7 .8) of mammalian expression vector pCIneo.Embodiment 9A makes up 5T4scFv-PEA-alP450R expression vector [Fig. 7 .9]

Make up this fusion rotein and relate to pcr amplification, connect three kinds of dna fragmentations then and form complete inset.The protein product of the variable antibody fragment of strand of first fragment coding tumor-resistant antigen 5T4.

SEQ?ID?NO：26。Fig. 3 F is the encoding sequence of 5T4 scFv.Adopt following primer to obtain this sequence from the common plasmid pPs-5T4 that contains this sequence by pcr amplification:

Fragment 1:5T4 scFv

5T4 scFv 5 '-primer: SEQ ID NO:31.This primer provides translation initiation signal and secretion signal district (Fig. 3 F) of 5T4 scFv sequence.ccaccatggg?atggagctgt?atca(24mer)

5T4 scFv 3 '-primer: SEQ ID NO:32.Its guiding has the segmental 3 '-district of 5T4 scFv of HindIII restriction site.ggccAAGCTTccg?tttgatttcca?gcttggag(32mer)

Fragment 2:PEA fragment

SEQ ID NO:33 and 34.The albumen of Pseudomonas aeruginosa exotoxin A domain II (PEA, GenBank registration number K01397 and M23348) (Fig. 3 E).Adopt following primer can obtain segmental this albumen as PCR:

PEA 5 '-primer: SEQ ID NO:35.Its guiding has 5 '-coding region of HindIII restriction site.ggcgAAGCTTggc?agcctggccg?cgctgaccgcg?ca(35mer)

PEA 3 '-primer: SEQ ID NO:36.Its guiding has 3 '-coding region of EcoRI restriction site.ggcgGAATTCgtt?ggccgcgccc?cggtcgtcgt?t(34mer)

Fragment 3:alP450R fragment

Adopt following primer to obtain the 3rd the cDNA fragment (seeing Fig. 2 A) of coding alP450R from plasmid pP450R.1 by pcr amplification:

AlP450R 5 '-primer: SEQ ID NO:37.Its guiding has 5 '-coding region of EcoRI restriction site.ggcgGAATTCtca?gctcttagca?gacattggaa?g(34mer)

AlP450R3 '-primer: the SEQ ID NO:17 that sees embodiment 3.

After digesting first and second PCR fragment with HindIII then it is linked together.Be connected to form the total length inset after digesting described connector and the 3rd PCR fragment with EcoRI again.Total length inset subclone is gone into the SmaI site (Fig. 7 .9) of pCIneo expression vector.Embodiment 9B makes up 5T4scFv-alP450R-MTS expression vector [Fig. 7 .13]

Make up this fusion rotein and need carry out pcr amplification, then three kinds of dna fragmentations are connected to form complete inset.As embodiment 9A, the protein product of the variable antibody fragment of strand of first fragment coding tumor-resistant antigen 5T4.

SEQ?ID?NO：26。Fig. 3 F is the encoding sequence of 5T4 scFv.Adopt following primer to obtain this sequence from the common plasmid pPs-5T4 that contains this sequence by pcr amplification:

Fragment 1:5T4scFv

5T4scFv 5 '-primer: SEQ ID NO:31.This primer provides translation initiation signal and secretion signal district (Fig. 3 F) of 5T4scFv sequence.ccaccatggg?atggagctgt?atca(24mer)

5T4scFv 3 '-primer: SEQ ID NO:32.Its guiding has 3 ' of HindIII restriction site-district.ggccAAGCTTccg?tttgatttcca?gcttggag(32mer)

Fragment 2:alP450R

Adopt following primer to obtain second cDNA fragment (seeing Fig. 2 A) of coding alP450R from plasmid pP450R.1 by pcr amplification:

AlP450R 5 '-primer: SEQ ID NO:38.Its guiding has 5 '-coding region of HindIII restriction site.ggccAAGCTTtca?gctcttagca?gacattggaa?g(34mer)

AlP450R 3 '-primer: SEQ ID NO:39.Its guiding has the alP450R 3 '-coding region of EcoRI restriction site.gccgGAATTCgct?ccacacgtcc?agggagtag(32mer)

Fragment 3:MTS

Adopt following primer to obtain the 3rd fragment of coding film transposition sequence (MTS) by pcr amplification:

MTS 5 '-primer: SEQ ID NO:40.Guiding has 5 '-coding region of EcoRI restriction site.gccgGAATTCgca?gccgttcttc?tccctgttct?tcttgccgca?ccc(46mer)

MTS 3 '-primer: SEQ ID NO:41.It guides 3 '-coding region.

ttagggtgcg?gcaagaagaa?cagggagaag?aacggctgc(39mer)

After digesting first and second PCR fragment with HmdIII then it is linked together.Be connected to form the total length inset after digesting described connector and the 3rd PCR fragment with EcoRI again.Total length inset subclone is gone into the SmaI site (Fig. 7 .13) of pCIneo expression vector.Embodiment 10A makes up 5T4scFv-PEA-FN expression vector [Fig. 7 .10]

Make up this carrier and relate to pcr amplification, connect three kinds of dna fragmentations then and form inset.First fragment as the protein product of the variable antibody fragment of strand of acquisition coding tumor-resistant antigen 5T4 as described in the embodiment 9A.

Second cDNA fragment as the albumen (PEA, GenBank registration number K01397 and M23348) of acquisition coding Pseudomonas aeruginosa exotoxin A domain II as described in the embodiment 9A.

PEA 5 '-and 3 '-primer with embodiment 9A.

Adopt following primer, obtain the 3rd the cDNA fragment (seeing Fig. 2 B) of coding FN by PCR from plasmid pP450R.1:

FN 5 '-primer: SEQ ID NO:32.Its guiding has 5 '-coding region of EcoRI restriction site.ggcgGAATTCcge?cagtacgagc?ttgtggtcca?ca(35mer)

FN 3 '-primer: with embodiment 4.

After digesting first and second PCR fragment with HindIII then it is linked together.Be connected to form the total length inset after digesting described connection product and the 3rd PCR fragment with EcoRI again.Total length inset subclone is gone into the SmaI site (Fig. 7 .10) of pCIneo expression vector.Embodiment 10B makes up the 5T4scFv-FN-MTS expression vector

Make up this carrier and relate to and carry out pcr amplification, then three kinds of dna fragmentations are connected to form inset.Obtain first fragment of protein product of the variable antibody fragment of strand of coding tumor-resistant antigen 5T4 as embodiment 9A.

Adopt following primer, obtain second fragment (seeing Fig. 2 B) of coding FN by pcr amplification from plasmid pP450R.1:

FN 5 '-primer: SEQ ID NO:43.Its guiding has 5 '-coding region of HindIII restriction site.ggccAGGTTCcgc?cagtacgagc?ttgtggtcca?ca(35mer)

FN 3 '-primer: SEQ ID NO:44.Its guiding has 3 '-coding region of EcoRI restriction site.gccgGAATTCcta?gctccacacg?tccagggagt?ag(35mer)

Obtain the 3rd fragment of coding MTS by pcr amplification as embodiment 9B.

After digesting first and second PCR fragment with HindIII then it is linked together.Be connected to form the total length inset after digesting described connection product and the 3rd PCR fragment with EcoRI again.SmaI site (Fig. 7 .14) embodiment 11 that total length inset subclone is gone into the pCIneo expression vector makes up P4502B6/FN fusion rotein [Fig. 7 .11]

SEQ?ID?NO：33。The coding region of P4502B6 (1989 Biochemistry such as Yamano, 28,7340; GenBank registration number JO2864) (Fig. 4).Adopt following primer that it is gone among the pCI-Neo as NheI to XhoI fragment subclone.

2B6 Nhe 5 ' primer: SEQ ID NO:34ggcgGCTAGC cagaccatggaactcagcg (29mer)

2B6 Nhe 3 ' primer: SEQ ID NO:35.This primer is modified described proteic C-end, to remove terminator codon and to replace it with the XhoI site.Digest described PCR fragment with NheI and XhoI, and subclone is gone into the pCI-Neo that the pCINeo generation contains brachymemma P450.ggcgCTCGAG?gcggggcaggaagcggatctgg(32mer)

Make up flexi-link FN fragment with following primer:

Flexi-FN 5 ' primer: SEQ ID NO:36.This primer is positioned at before the flexible joint of the segmental N-end of FN the SalI restriction site.The small letter boldface type is the rare codon in the joint; Following setting-out is the sequence among the FN; Capitalization is the SalI site.-ggcgGTCGAC?gga?ggt?gga?ggt?tcg?GGC?GGG?GGC?GGC?AGT?GGG?GGC?GGCGGG?AGT?cgc?cagtacgagc?ttgtggtcca?ca(80mer)

FN 3 ' primer: with embodiment 4.CTAGCTCCAC?ACGTCCAGGG?AGTAG(24mer)

With NheI and XhaI digestion 2B6 PCR, be connected to the FN fragment of SalI digestion, after the described fragment of purifying, connect pCIneo[Fig. 7 .11] into XhoI/SmaI digestion.Embodiment 12 makes up the double expression boxes [Fig. 7 .12] of P450 and P450R

Adopt following primer that P450 2B6 is gone among the pCINeo as NheI/XhoI fragment subclone:

2B6 Nhe 5 ' primer: SEQ ID NO:37

ggcgGCTAGC?cagaccatggaactcagcg

2B6 end 3 ' primer: SEQ ID NO:38.This primer keeps real translation termination signal 5 ' ggcgCTCGAG tcagcggggcaggaagcggatctgg

SEQ?ID?NO：39。Internal ribosome site (IRES, Fig. 5,1992 Virus Res.26 such as Escarmis, 113) derived from FMDV R100.

Be inserted in the XhoI site of the plasmid pCI-Neo that contains above-mentioned 2B6 sequence.Use derived from relevant 5 ' of sequence shown in Figure 6 and separate segmental IRES with 3 ' primer as XhoI/SalI.The plasmid that is produced digests with SalI, inserts the XhoI/SalI fragment that derives from P450R.1.Final structure is shown in Fig. 7 .12.Embodiment 13 makes up the double expression boxes of P450/FN and VP-FN

Structure contains the composition of the coding region of active P450 and P450R entity.An example is coexpression VP-FN and P450FN.

The fusions (Fig. 8 .8) of embodiment 8 described structures is inserted the HpaI site (Fig. 6 b) of retrovirus COI and the XhoI site of embodiment 11 described fusion construct (Fig. 7 .11) being inserted COI.This produces the carrier (Fig. 8) of the maximum susceptibility of endoxan, Tirapazamine and ametycin.The retrovirus vector of the prodrug activation enzyme that embodiment 14 construction expressions are modified

Use package cell line system to produce RRV such as FLYRD18 (Cosset etc.).The plamid vector transfection that will contain vector gene group to be packaged is gone into above-mentioned package cell line (Cosset FL etc. 1995, J Virol 69 7430-7436), with the production clone of deriving.The suitable plasmid that contains the vector gene group be pHIT111 (Soneoka etc. 1995, Nucl Acids Res 23,628-633).Adopt standard molecular biological technique, insert required therapeutic gene to replace the LacZ gene among the pHIT111.Regulatory element and/or enhancer element such as HRE similarly can be introduced among the LTR of retrovirus among the pHIT111, to replace the retrovirus enhanser, to guarantee to regulate the expression therapeutic gene.Then, with this plasmid with the common transfection of the selective marker that is applicable to the FLYRD18 cell (for example pSV2neo), and among 1mg/ml G418 (Sigma) the selection cells transfected.A kind of alternative carrier is PKAHER, and it is based on the single transcription unit carrier (Fig. 6) of MLV.The expression of therapeutic gene is subjected to the control (3 * PGK, Dachs etc. are in the book of being quoted) of hypoxemia effect promoter.The nlsLAcZ of gene shown in replacing with the described prodrug activation enzyme of coding.The alternative carrier that is specially adapted to express many transcription units is COI (Fig. 6).This is the carrier based on MLV that substitutes MLV enhanser (dash box) with cmv enhancer.The gene of the described prodrug activation enzyme of coding is inserted in Bam/Sal/Hpa polylinker or the Stu/Xho polylinker.Modify with suitable joint in case of necessity and be inserted into the fragment end, produce suitable coupling restriction site.Perhaps different genes is inserted each joint area (Fig. 8).

Can use slow virus on the other hand, this will describe in embodiment 14B in more detail.Embodiment 14B produces the EIAV vector gene group construction of expressing P450 and describes in detail

Peg HRElacZ is described in patent application No. 9901906.9, is repeated below.PEGASUS4 (pEGASUS1 just), pONY4.0, pONY4.1, pONY3.1, pHORSE3.1 are described in PCT/GB98/03876, also are described below.OBhrel

Triplet (trimer) comprises the mouse PGK's that is connected to SV40 promotor (italic) natural orientation-307/-290 (Firth etc., 1995).GCTAGA GTCGTGCAGGACGTGACATCTAGT GTCGTGCAGGACGTGACANhel HRE HRETCTAGT GTCGTGCAGGACGTGACAGCTAGCCCGGGCTCGAGATCTGCG

HRE XbalATCTGCATCTCAATTAGTCAGCAACCATAG TCCCGCCCCTAACTCCGCC CATCCCGCCCCTAACTCCGCCCA GTTCCGCCCATTCTCCGCCCCATCGCTGACTAATTTTTTT ATTTATGCAGAGGCCGAGGCCGCCTC GGCC TCTG

Initial

This promoter sequence is defined as OBhrel.The plasmid called after plasmid OB37 that is produced.PEGASUS-4 (pEGASUS-1 just)

The hypoxemia effect promoter has been building up among lentiviral vectors pEGASUS-1 (pEGASUS-4 (+) just) and the relevant carrier pONY2.1.All (Payne etc. 1998 derived from infectious provirus EIAV clone pSPEIAV19 for these two kinds of carriers; Registration number U01866).The structure (taking from UK Patent Application the 9727135.7th) of these plasmids is below described.pONY2.1

EIAV 5 ' LTR is inserted pBluescript II KS ⁺(Stratagene) make up plasmid pONY1.With pfu polysaccharase and following primer-5 ' GCATGGACCTGTGGGGTTTTTATGAGG and 3 ' GCATGAGCTCTGTAGGATCTCGAACAGAC by PCR from pSPEIAV19 amplification EIAV 5 ' LTR.The product that is increased is put down and flush endization by the benefit of 5 ' overhang, and inserts the pBluescript II KS that removes 3 ' overhang flush endization with the BssHII cutting, with the T4 archaeal dna polymerase ⁺In.This construction is called pONY1, and its orientation is and pBluescript II KS ⁺Beta-galactosidase enzymes relevant 5 ' to 3 '.The PONY order-checking shows not sudden change.

By removing the env district disappearance that Hind III/Hind III fragment makes pSPEIAV19, produce pSPEIAV19 Δ H.Then MluI/MluI (216/8124) fragment of pSPEIAV19 Δ H is inserted among the pONY1 with the MluI cutting, produced pBluescript II KS ⁺In wild-type provirus clone (pONY2 Δ H).Carry out pBluescript II KS then ⁺BssHII digestion (619/792), obtain multiple clone site.Mend by 5 ' overhang and flatly to make its flush endization, and be connected to BglII and NcoI cutting (1901/4949-is in pol) and also mend the pONY2 Δ H of average endization by 5 ' overhang.It is oriented to relevant with the EIAV sequence 3 ' to 5 '.This clone is called pONY2.1.

(the Genbank registration number: M28246) (PstI/HindIII) inserts pSP72 (Promega with pLNCX; Genbank registration number X65332) produces pSPCMV in.PTIN414 (Cannon etc., 1996) beta-galactosidase gene is inserted pSPCMV (XhoI/SphI), preparation pSPlacZ.SV40 T antigen nuclear localization signal with pAD.RSVbgal (Stratford-Perricaudet etc., 1992) substitutes 5 ' end to beta-galactosidase gene, produces pSPnlslacZ (XhoI/ClaI).The CMV of pSPlacZ and pSPnlslacZ appraises and decides the position and the localized beta-galactosidase enzymes of non-nuclear excises with PstI, inserts the PstI site of the pONY2.1 of EIAV 5 ' to 3 ' direction.These constructions are called pONY2.1nlslacZ and pONY2.1lacZ.pEGASUS-1

This is the carrier based on EIAV that only contains the 759nt of EIAV sequence (268nt-675nt and 7942nt-8292nt).Adopt primer PPTEIAV+ (Y8198): GACTACGACTAGTGTATGTTTAGAAAAACAAGG and 3 ' NEGSpeI (Y8199): CTAGGCTACTAGTACTGTAGGATCTCGAACAG, obtain to comprise EIAV polypurine tract (polypurine tract) (PPT) and the sequence of 3 ' LTR from pONY2.1 by PCR.Purified product is with SpeI digestion and connect into SpeI digestion with the pBS II KS of alkaline phosphatase treatment preparation ⁺Being transformed into screening behind the intestinal bacteria XL-1Blue obtains to exist the U5 district of 3 ' TLR wherein in abutting connection with pBS II KS ⁺The bacterium colony of 3 ' LTR of the orientation in the NotI site of joint.Measure the sequence of the inset cloned, prove that it only contains the variation of an EIAV clone pSPEIAV19.This is to insert in the base 3 of Zone R and ' C ' between the base 4.Identical change sees used template in the PCR reaction.This clone's called after pBS.3 ' LTR.

Then reporter gene box CMV promotor/LacZ is introduced the Pstl site of pBS.3 ' LTR.Obtain as the segmental CMV/LacZ box of PstI from pONY2.1.To connect above-mentioned segmental ligation thing and be transformed into intestinal bacteria XLlBlue.Adopt standard method that it is transfected among the clone 293T, estimate wherein CMV/LacZ inset orientation and make the CMV/LacZ box activity of LacZ gene in abutting connection with many clones of 3 ' LTR.Selected after the transfection 48 hours to produce the clone of large cortical cells for follow-up use with the X-gal colour developing.This clone's called after pBSCMVLacZ.3 ' LTR.

Make up 5 ' district of EIAV carrier in expression vector pCI-ENeo, the pCI-ENeo carrier is pCI-Neo (Promega; Genbank registration number U47120) derivative, it is modified by 5 ' terminal about 400 base pairs that contain the total length CMV promotor that derives from above definition.Adopt primer VSAT1 (GGGCTATATGAGATCTTGAATAATAAAATGTGT) and VSAT2 (TATTAATAAC TAGT) and make template, obtain described 400 base pair fragments by pcr amplification with pHIT60 (Soneoka etc., 1995).Digest described product with BglII and SpeI, and connect among the pCI-Neo of same digestion.

Make template DNA with pSPEIAV19, adopt the increase genomic fragment of EIAV of Zone R nt 150 of (nt 268-675) of primer CMV5 ' EIAV2 (GCTACGCAGAGCTCGTTTAGTGAACCGGGCACTCAGATTCTG:[underscore sequence is annealed to EIAVR district]) and 3 ' PSI.NEG (GCTGAGCTCTAGAGTCCTTTTCTTT TACAAAGTTGG) to the gag coding region.The sequence that is right after CMV promoter transcription initiation site upstream is contained in the 5 ' district of primer CMV5 ' EIAV2, available SacI (black matrix) cutting.3 ' PSI.NEG is in conjunction with according to 3 ' of the EIAV packaging sequence of deletion analysis definition, and contains the XbaI site.

With SacI and XbaI finishing PCR product, and connect into the pCI-Eneo that is used for connecting with same enzyme digestion preparation.This operation makes the EIAV Zone R originate in the transcripting start point of CMV promotor, and consequent transcription product is initial and extend to 3 ' of packaging signal-side from the used real zero position of EIAV.Evaluation is considered as correct clone and checks order to restriction analysis.Selection is called the clone of pCI-Eneo.5 ' EIAV to be used for follow-up work.

In next step, will introduce among the pCI-Eneo.5 ' EIAV at CMVLacZ among the pBS.CMVLacZ.3 ' LTR and 3 ' LTR box.Digest pBS.CMVLacZ.3 ' LTR with ApaI, remove 3 ' overhang, digest with NotI then with the T4 archaeal dna polymerase.The fragment that contains CMVLacZ.3 ' LTR with the standard molecular biological technique purifying.With SalI digestion, it is flat to use the T4 archaeal dna polymerase that 5 ' overhang is mended then, thereby is used for the carrier that is connected with described fragment by pCIEneo.5 ' EIAV preparation.Digest described DNA with NotI then, before being used for ligation, carry out purifying.After being transformed into intestinal bacteria XL-1bLUE, the bacterium colony that has inset by the restriction analysis screening, need clone's (noting its real expression pEGASUS-4 (+), is that a kind of pEGASUS-1-that contains near the EIAV RR3 in downstream, EIAV R-U5-psi district sees for details hereinafter) with what evaluation was called pEGASUS-1.pEGASUS-4(+)

Can improve EIAV carrier pEGASUS-1 by introducing other element, to improve titre.The suitable site of introducing this class component is the SalI site that is positioned between the CMV/LacZ upstream of the XbaI of packaging signal 3 ' and pEGASUS-1.For example the RRE of EIAV can insert this site.

The following EIAV RRE that obtains above definition by pcr amplification.Make template with pONY2.10LacZ, carry out twice amplification and obtain two parts of EIAV RRE.Adopt primer ERRE1 (TTCTGTCGACGAATCCCAGGGGGAATCTCAAC) and HRRE2 (GTCACCTTCCAG AGGGCCCTGGCTAAGCATAACAG) to obtain 5 '-element, obtain 3 '-element with ERRE3 (CTGTTATGCTTAGCCAGGGCCCTCTGGAAGGTGAC) and ERRE4 (AATTGCTGACCCCCAAA ATAGCCATAAG).These products can be annealed mutually, thus can be used for second PCR reaction, to obtain the DNA of ' coding ' EIAVRRE.At first second pcr amplification carried out 10 circulations, then these primers are added in the reaction, carry out 10 round-robin amplifications again without primer ERR1 and ERRE4.With PCR product and the pEGASUS-1 that SalI digestion produces, connect and be transformed among the intestinal bacteria XL-1Blue.Selecting wherein, EIAV RRE is in the clone of forward or negative sense for further handling.These vector plasmids are called pEGASURS-4 (+) (seeing Figure 20) and pEGASUS-4 (-).pONY?HRE?luc/lac

Excision substitutes with the oligonucleotide that contains the MluI/XbaI site as the CMV promotor among the segmental pONY2.1 of XbaI/AscI.Thereby this makes and can insert the fragment from OB37 isolated M luI/XbaI, produces pONY HRE luc/lac.Removal connects main chain and produces pONY HRElac as the segmental luciferase encoding sequence of Ncol.Equally, behind the lacZ of removal as XbaI/SalI, connect main chain, produce pONY HREluc.pEGHRELacZ/luc

, substitute from EIAV vector plasmid pEGASUS-1 excision CMV promotor lacZ box with EcoRI with the synthetic oligonucleotide that contains SacI and Bsu36 site.This make can be respectively from as SacI/Bsu36 and SacI/EcoRI segmental pONY HRE luc and pONYHRE lac clone HRE luc/HRE lac box.Final carrier is called pEG-HRE-lacZ and pEG-HRE-luc.

Use Same Way, make up the pEGHRE carrier, to express the therapeutic gene that replaces lacZ or Luc gene, for example above listed arbitrary therapeutic gene.Excise the lacZ/luc fragment and be connected the suitable fragments that contains encoding sequence from pEG-HRE-lacZ or pEG-HRE-luc with SacI/EcoRI with SacI/Bsu36 respectively, thereby these fragment clonings are gone into the pEGHRE carrier.Available therapeutic gene example is the gene (Genbank registration number X04665) of coding anti-angiogenesis thrombospondin-1.

Do not have the EIAV of replication carrier system in order to make up, we have adopted the infectious provirus clone pSPEIAV19 (registration number of being described by (1994, J Gen Virol.75:425-9) such as Payne: U01866) as starting point.According to the number system of (the same) such as Payne, the Hind III/Hind III fragment that is equivalent to coordination 5835/6571 by removal lacks part env simply, thereby makes up the initial carrier based on EIAV.The puromycin resistance gene that is used under the SV40 early promoter control of pTIN500 is replaced this fragment (1996 J.Virol.70:8234-8240 such as Cannon), produces pESP.

So, make up a carrier system again that comprises three transcription units, to produce down array structure: 1) vector gene group RNA; 2) gag-pol env and 3).In order to guarantee to produce each enough component, described env and gag-pol transcription unit transcribe from have active promoter-enhancer selected people's package cell line.Like this, produce enough gag-pol and most probable tat, to guarantee effectively to produce transducible carrier granule.

The following vector gene group that has reporter gene in the genomic pol district that is structured in.By making up the plasmid that is called pONY1 with the EIAV LTR insertion pBluescript II KS+ (Stratagene) of PCR from the pSPEIAV19 amplification.Use following primer, adopt the 5 ' LTR:5 ' GCATGGACCTGTGGGGTTTTTATGAGG3 ' GCATGAGCTCTGTAGGATCTCGAACAGAC of pfu polysaccharase through pcr amplification EIAV clone pSPEIAV19

Mend the described amplicon of average endization by 5 ' overhang, and be inserted among the pBluescript II KS+ that uses Bss HII to cut, use T4 archaeal dna polymerase removal 3 ' overhang flush endization.This construction is called pONY1, is oriented to relevant with pBluescript II KS+ beta-glucosidase 5 ' to 3 '.The order-checking of pONY1 shows not sudden change.

Env district at HindIII/HindIII site disappearance pSEIAV19 produces pSPEIAV19DH.With Mlu I (216/8124) cut vector genome pSPEIAV19DH, insert among the pONY1 of Mlu I (216) cutting preparation pONY2.Carry out the Bss HII digestion (619/792) of pBluescript IIKS+, obtain multiple clone site.Mend average endization by 5 ' overhang, be connected to Bgl II and Nco I (1901/4949) and cut and mend the pONY2 of average endization by 5 ' overhang.Its orientation is relevant with the EIAV sequence 3 ' to 5 '.This is called as pONY2.1.(registration number: M28246) (Pst I/Hind III) inserts and produces pSPCMV among the pSP72 (Promega) with pLNCX.(J.Virol.70 such as Cannon PM, beta-glucosidase gene 8234-8240) inserts among the pSP72 (Xho I/Sph I), makes pSPlacZ will to derive from pTIN414.Replace 5 ' end of beta-glucosidase gene with the SV40 T antigen nuclear localization signal that derives from pAD.RSVbgal (J.Clin.Invet.90:626-630,1992).With Xho I/Cla I cutting pAD.RSVbgal, be inserted among the Xho I/Cla I pSPlacZ, make pSPnlslacZ.The CMV that derives from pSPlacZ and pSPnlslacZ appraises and decides position and the Pst I excision of the localized beta-glucosidase of non-nuclear, the Pst I site of inserting the pONY2.1 of 5 ' to 3 ' orientation among the EIAV.These constructions are called pONY2.1nlslacZ and pONY2.1lacZ.

Express the gag-pol gene from the hCMV-MIE promoter-enhancer.Specifically, with Mlu I (216/8124) cutting gagpol pSPEIAV19DH, and insert the middle preparation of pCI-Neo (Promega) pONY3 of Mlu I cutting (216).

Vector gene group pONY2.1lacZ contains 1377 nt of gag.Differentiate at the leader sequence of gag and the possible stem-ring structure in the 5 ' end with RNA secondary structure prediction (" http://www.ibc.wustl.edu/～zuker/rna/ ").According to these predictions, 4 disappearances in the gag district of pONY2.1lacZ, have been prepared.Adopt standard technique to reach disappearance through PCR mutagenesis.pONY2.11lacZ

PONY2.1lacZ contains the 1377nt (from 1901nt position disappearance) of gag

PONY2.1lacZ contains 354nt (from 878 disappearances) pONY3.1 of gag

5 ' the non-translational region that in pONY3, has the prolongation of gagpol encoding sequence before initial.The expression that this unusual long sequence may jeopardize the gagpol box.Express in order to improve gagpol, modify pONY3, the 5 ' LTR that stays with removal.Can realize this purpose with NarI and Eco RV cutting pONY3.The 2.4kb fragment is inserted pBluescriptKS+ (Stratagene) at Cla I and Eco RV site, make construction pBSpONY3.0.With Xho I and Eco RV cutting pBSpONY3.0.The 2.4kb fragment is inserted pONY3 at XhoI and Eco RV site, make pONY3.1.

This operation is removed 5 ' LTR until the Nar I site in PBR (386nt).This construction titre increases by 2 times, and improves protein expression (Fig. 9).

The same with pONY3, pONY3.1 encoding gag, gagpol, Tat, S2 and Rev.Because showing S2, the S2 mutant test in production system or EIAV vector gene group, all do not need, so can design the gagpol expression constructs that does not contain S2.Two such construction pHORSE and pHORSE3.1 have been produced.pHORSE

Adopt pONY3 to make template DNA, use EGAGP5 ' OUTER/EGAGPINNER3 and EGAGP3 ' OUTER/EGAGPINNER5 to prepare pHORSE through pcr amplification.Two kinds of PCR products of purifying merge product, use primer EGAGP5 ' OUTER/EGAGP3 ' OUTER to increase again.With Xho I and the Sal I site that this product inserts pSP72, preparation pSP72EIAVgagpolO ' lap.With Pvu II and Nco I cutting pONY3, the 4.3kb fragment is inserted among the pSP72EIAVgagpolO ' lap that cuts with Pvu II and Nco I, make pSPEGP.With Xho I and Sal I (4.7kb) cutting, insert among the pCI-Neo at Xho I and Sal I site.This construction is called pCIEGP., insert the pCIEGP construction in Sal I site and make pHORSE from pEGASUS excision RRE with Sal I (0.7kb).

When the protein expression of analyzing under the situation that there be or do not exist pCI-Rev (express the construction of EIAV Rev open reading-frame (ORF), see above) in this construction, find it equally is that Rev is dependent as expected.Yet protein expression is much lower than pONY3.1.In addition, when being used for virus production, its virus titer is low 100 times than pONY3.1.pHORSE3.1

Beyond thoughtly be that when the leader sequence of pONY3.1 (comprising the sequence from the end of the U5 of 5 ' LTR to the ATG initiator codon of gag 383-524nt) being inserted pHORSE make pHORSE3.1, protein expression and virus produce and improves.The 1.5kb Xho I/Xba I that replaces pHORSE with the 1.6kbXho I/Xba I of pONY3.1 makes pHORSE3.1.Similar with the titre that pHORSE3.1 obtains to pONY3.1.Compare with pONY3.1, the reason that the virus titer of pHORSE3.1 reduces slightly may be because pHORSE3.1 needs four plasmid co-transfections (because this system is that Rev is dependent).So our conclusion is that basic EIAV carrier system should contain this leader sequence, so that gagpol expresses maximization.PONY4 and pONY4.1

PONY2.1llacZ has a disappearance in gag, the feasible 373bp that only stays gag ORF.CMV LTR replacement 5 ' LTR with pEGASUS-1 makes pONY4.With BglII/Xho I cutting pEGASUS-1, discharge 3.2kb fragment (containing CMV LTR), be inserted among the pSP72 with Bgl II/Xho I cutting.This construction called after pSPPEG213.Cut it with Hpa I/Nar I, 1.3kb fragment (comprising CMV LTR) is inserted among the pONY2.11lacZ of Nae I/Nar I cutting.PONY4.1 contains a disappearance (2.1kb) in the downstream (between Sfu I and the Sal I site) of lacZ gene, makes tat, S2, env, rev and RRE lose or serious brachymemma.By it being used Sfu I/Sal I cutting, Klenow polysaccharase flush endization and reclosing, make pONY4.1.Be used as GFP gene (the Bam HI/Xba I digestion that blunt-ended fragment derives from pEGFP-Nl (Clontech), use Klenow polysaccharase flush endization then) replace lacZ gene (Klenow polysaccharase flush endization is used in Sac II/Kpn I digestion then) the preparation pONY4G of pONY4.Induction type-HREpEGHREP450

With Not I cutting pegHRElacZ (purifying contains the 3.9kb fragment of HRE enhanser/SV40 promotor and lac Z gene).To make pBHRElacZ among the pBluesctiptKS+ (Stratagene) of this fragment insertion with Not I cutting.Its orientation makes that lac Z and Amp gene are equidirectional.This plasmid is used for inserting any purpose nucleotide sequence through Nco I/Sph I site now and replaces the lac Z that is under the HRE control.Through Not I site this box inserted EIAV vector gene group plasmid pegHRElacZ then.

With (registration number M29874 is also referred to as CYP2B) primer 5 ' P450 and 3 ' P450 through pcr amplification P450.The target of described PCR can be liver cDNA or the plasmid that contains P450.5 ' P450 SEQ ID NO:59TTTTCAGACCATGGAACTCAGCGTCC (underscore=Nco I), 3 ' P450 SEQ ID NO:60ATCGCATGCTCAGCGGGGCAGGAAGCGGATC (underscore=Sph I)

This is P450, with Nco I cutting PCR fragment, purifying 0.3kb fragment, and inserts the pBHRElacZ that cuts with Nco I.Obtain plasmid pBHREP450del.Cut described PCR fragment with Aat II/Sph I, the 1.3kb fragment is inserted among the plasmid pBHREP450del (3.9kb of purifying) that cuts with Aat II/Sph I.Obtain plasmid pBHREP450.Cut it with Not I, insert pegHRElacZ then, obtain pegHREP450 with Not I cutting.pONY4HREP450

With Not I/Sph I cutting pBHREP450, discharge 1.8kb HRE P450, with its terminal flush endization, insert among the pONY4.0 with Pst I cutting terminal flush end acquisition pONY4HREP450 with the T4DNA polysaccharase then.pONY4.1HREP450

With Not I/Sph I cutting pBHREP450, discharge 1.8kb HRE P450, with its terminal flush endization, insert among the pONY4.1 with Pst I cutting terminal flush end acquisition pONY4.1HREP450 with the T4DNA polysaccharase then.Composing type-CMVpEGASUS4P450

PBHREP450 obtains the 1.5kb fragment with Bsm I/Sph I cutting,, inserts then among the pEGASUS4 with Xho I/Spl I cutting, T4 archaeal dna polymerase flush endization its terminal flush endization with the T4 archaeal dna polymerase, obtains pEGASUS4P450.pONY4.0P450

PBHREP450 obtains the 1.5kb fragment with Bsm I/Sph I cutting,, inserts then among the pONY4.0 with Xho I cutting, the terminal flush endization of T4 archaeal dna polymerase its terminal flush endization with the T4 archaeal dna polymerase, obtains pONY4.0P450.pONY4.1P450

PBHREP450 obtains the 1.5kb fragment with Bsm I/Sph I cutting,, inserts then among the pONY4.0 with Xho I cutting, the terminal flush endization of T4 archaeal dna polymerase its terminal flush endization with the T4 archaeal dna polymerase, obtains pONY4.1P450.Preparation VSV-G pseudotyping EIAV

Above-mentioned vector gene group is used for producing the EIAV virus vector with three plasmid co-transfections of EIAVgagpol expression plasmid pONY3.1 and VSV-G coating.

Because the toxicity of VSV-G, so the figurate adjusting of essential tool is expressed.Temperature sensitive type VSV-G clone has been described in TE671.

In addition tet inducible system (J Virol 1999 Jan have been described; 73 (1): 576-84 is used for the package cell line of lentiviral vectors.Kafri?T，van?Praag?H，Ouyang?L，GageFH，Verma?IM)。Rabies-G pseudotyping EIAV

Above-mentioned vector gene group is used for producing the EIAV virus vector with three plasmid co-transfections of EIAVgagpol expression plasmid pONY3.1 and Rabies-G coating.Embodiment 15 usefulness monocyte/macrophages or stem cell are transmitted enhanced prodrug activation enzyme

(Sandlie and Michaelsen 1996 are set forth in Antibody engineering:a practical approach with standard technique in laboratory scale.Editors such as McCafferty, the 9th chapter) and when extensive through elutriation (for example deriving from the Ceprate of CellPro) from the human peripheral separating periphery blood monocytic cell.Spend the night through adhering to plastics, enrichment attached cell (being essentially monocyte) is cultivated 1-3 week to attached cell then, makes cell along the differentiation of scavenger cell differentiation path.Perhaps can pass through the enrichment of CD14 immune magnetic cell sorting.CD14:LPS and LBP acceptor ((1990) Science 249:1431 such as Wright SD).The separation yield that can obtain from peripheral blood with this method be the rate of recovery 95-99% purity and 90% more than and debility is lost.Various infection protocols can be used to carrier is introduced in monocyte and the scavenger cell, comprise that the DNA that particle mediates transmits the transfection (for example using Superfect, Qiagen) of (biological emission), electroporation, cationics mediation.Guide according to the manufacturer is implemented wherein each method, and describes consideration change parameter in detail to reach optimum according to concrete manufacturer.On the other hand, available virus vector, for example defective adenoviral vector (Microbix Inc or QuantumBiotechnologies Inc) or retrovirus are as being described in the virus vector among Fig. 6.

Gather in the crops stem cell (1993 Exp Hematol.21 such as Cassel, 585) with G-CSF and/or endoxan activation back from peripheral blood.With 10g/kg/ days subcutaneous G-CSF (Amgen) 7 days that give of dosage.Carry out the enrichment (Cassel etc. are in the book of being quoted) of single blood sampling composition art (apheresis) and stem cell with CellPro stem cell separation system.In the presence of 4g/ml protamine sulfate and 20ng/ml IL-3 (Sandoz), 50ng/ml IL-6 (Sandoz), 100ng/ml SCF (Amgen), with 10 ⁵Cell/ml produces in cell (embodiment 1) the exhausted substratum culturing stem cells enrichment colony at RRV, and (Santiago-Schwartz etc. 1992, JLeuk Biol 52,274; Charbord etc. 1996, Br J Haematol 94,449; Dao etc. 1997, and Blood 89,446; Piacibello etc. 1997, Blood, 89,2644).Self stroma cell that also can add other cytokine and/or described (Dunbar etc. 1996, Hum Gene Ther, 7,231) preparation.After 24 hours, with cell centrifugation, and resuspending has somatomedin and fresh containing in the RRV substratum of protamine sulfate in above-mentioned.After 24 hours, repeat this step, cell cultures is reached 48 hours again.After this, use the trypsin treatment cell, wash for several times in fresh culture by centrifugal, resuspending is used for infusion again in Plasma-Lyte A.The cumulative volume of infusion is about 25-50ml again.Be patient's infusion as many as 2 hours.The cell number of infusion is at least 105 cells, can be up to about 1012 cells.

Before infusion again, also can (Haylock etc. (1992) Blood80:1405-1412) make cell along medullary cell differentiation pathway maturation according to disclosed method.

With expression vector transfection monocyte, scavenger cell or the stem cell that can in people's cell, express enhanced prodrug activation enzyme.The retrovirus vector that comprises above-mentioned lentiviral vectors is suitable.For the high level expression of composing type, enhanced prodrug activation enzyme in the carrier that utilizes hCMV-MIE promoter-enhancer pCI (Promega).Express for the hypoxia inducible type, replace the hCMV promotor with the promotor that contains at least one HRE.Embodiment 16 contains the susceptibility of the tumour cell of improved prodrug activation enzyme to endoxan, Tirapazamien and ametycin

(Houlbrook etc. 1994 for human tumor cell line, Oncol (Life Sci.Adv.) 13,69) derive from U.S. typical case's culture collecting center, grow in RPMI 1640 substratum that are supplemented with 2mM glutamine and 10% (v/v) foetal calf serum as monolayer cell.

As described in (the same) such as Patterson, with electroporation technology plasmid is introduced the human carcinoma cell line, especially mammary cancer MCF-7, MDA468, T47D and NSCLC clone.In brief, with cell scraper harvest index grown cell, wash and be suspended in ' cytomix ' damping fluid (Van den Hoff etc. 1992, Nucl.Acid Res.20,2902).5 * 10 ⁶Cell mixes with the 10ug linear plasmid, and at 4 ℃, 960 μ F, 280V, BioRad carries out electroporation.With low density plating cell, in microbiotic G418, select the cell of survival.Choose each G418 resistance colony, enlarge to produce independently and clone.As described below or press proteic distribution of P450R and enzymic activity in the described analysis clone cell such as Patterson.Or by Soneoka etc. (in the book of being quoted) is described transmits gene with the retrovirus transfectional cell.

In order to detect the P450 reductase enzyme, at first in the damping fluid that contains 10mM HEPES (pH7.4), 1mMEDTA, 0.5mM benzamide, 0.5mM PMSF, 1ug/ml trypsin inhibitor through frozen-thawed cell preparation cell pyrolysis liquid.At 4 ℃ with the centrifugal removal cell debris of 1600g.The supernatant liquor that is obtained is divided into halves.Portion stores as the intact cell lysate after adding glycerine to 10%.Another equal portions are with 105, and 000g is centrifugal 45 minutes in 2 ℃.The film precipitation of dry gained, and resuspending is in TRIS buffer salt solution (pH7.4).

By detecting the reduction of NADPH dependent cell pigment c, thereby with spectrophotometry P450 reductase activity.Reactant contains 400 μ l cytochrome cs (final concentration 50uM), 100ul 10mM potassium cyanide (final concentration 1mM) and 10-300ug protein cleavage thing, and this lysate can be complete cell lysate or membrane portions (10-100ul volume).With 100mM phosphoric acid buffer pH7.6 the reactant volume is made 100 μ l.With after the reactant balance to 37 ℃, add 20ul 20mM NADPH (final concentration 200ul) and begin reaction.In 550nm monitoring cytochrome c with respect to the barren rate of reduction that does not have NADPH 3 minutes.Calculate the speed of reaction of beginning, it is expressed as every mg crack protein per minute reductive cytochrome c nmol, suppose that optical extinction coefficient is 21mM ^-1According to CO (carbon monoxide) in conjunction with spectral detection P450 concentration (Omura and Sato, 1964, J.Biol.Chem.239,2370).

In order to measure the position of enzyme in cell, (confocal microscope) analyzes it with focusing microscope.For assembling microscopical analysis, cell is grown on the cover glass.The washing monolayer cell was at 1: 1 acetone: fixing in the ethanol, seal with 1%BSA, then with the anti-people P450 of 1/100 dilution rabbit reductase enzyme polyclonal antibody (Smith GCM, Tew DG and Wolf CR 1994 PNAS USA 918710-8714) hatch, then the second antibody (Becton Dickinson) of puting together with anti-rabbit igg FITC is handled.Detect cell with BioRad MRC1000 or MRC1004.The distribution of wild-type P450R, alP450R and FN is similar to the distribution of NLS derivative.

Following analysis of cells is to the susceptibility of prodrug;-i) Tirapazamine IC ₅₀

As Seng and Ley, 1972, Angew., Chem., Int.XI.1009 and Adams etc. 1984, Br.J.Cancer, 49,571 is described, with the synthetic Tiapazamine of standard chemical process.

Determine dose response curve with the MTT proliferation assay.Its basis is that can to transform solubility tetrazolium salts MTT be purple first  crystalline ability (Mossma 1983 J.Immunol.Methods.65,55) to viable cell.To contain with 10 ³The 96 parallel orifice plates of/hole density inoculating cell are hatched and are grown to 8 days.Detect the first  generation of described plate every day, obtain cell count according to optical density(OD) to the typical curve of the cell that produced every day.IC ₅₀Value is to compare with untreated contrast, and optical density(OD) reduces by 50% needed drug level, and it is used for measuring cellular sensitivity to particular procedure.Cell contacts 3 hours with Tirapazamin under hypoxia condition, makes its growth carry out MTT after 96 hours and measures.When the hypoxemia of catalyst inducement is used in combination nitrogen purging plastics and reagent, generally keep hypoxemia by 1997 (in the book of being quoted) improved methods such as 1995 (in books of being quoted) such as Patterson and Patterson.Ii) endoxan IC ₅₀

Endoxan is available from Sigma chemical company.For testing drug susceptibility, with 4 * 10 ⁴Cells/well is inoculated in 6 well culture plates.Inoculate back 20 hours and add CP.Cell grows to 7 days.Determine final viable count with the above MTT detection method or by Chen etc. 1996 at the Trypan Blue dye exclusion method dyeing viable cell that passes through described in the book of being quoted.Iii) ametycin (MMC) IC ₅₀

Ametycin derives from Sigma chemical company.For testing drug susceptibility, will be with 5 * 10 ³Cell inoculation is in 96 hole microtiter plates.Inoculate back 16 hours MMC and handled cell 3 hours with dilution.Cell growth 7 days detects cell survival rate (Bligh etc. 1990 are in the book of being quoted) with the above MTT detection method then.Embodiment 17 is by collaborative culture assays bystander effect

The cell of engineering being expressed the TTS-P450R fusion rotein mixes with various ratios with non-engineering cell (control cells).Cell viability after evaluation is handled with prodrug.More described IC ₅₀IC with the homogeneous phase culture of engineering cell and non-engineering cell ₅₀When necrocytosis percentage during, show to have bystander effect greater than the original percentage of the engineering cell in the mixture.In order need to determine whether contacting of cell and cell, control cells being inoculated on the culture plate, and engineering cell is added in the COSTAR inset.Add medicine, but the indication of the survival rate of control cells produces the spreading factor from engineering cell.Chen etc. have described the method for measuring the bystander effect of ep in the book of being quoted.Embodiment 18 analyzes interior effectiveness of body of enhanced prodrug activation enzyme

Produce the tumor cell line heterograft that engineering is expressed various enhanced prodrug activation enzymes or composition nude mice.Handle described mouse with the cumulative related drugs of concentration, with growth of contrast heterograft comparison of tumor and cell survival rate at the offside flank.

Use the female (nu that isozygotys ⁺/ nu ⁺), 20-30g athymia Swiss nude mice.Tumour cell such as MCF-7 or MDA231 (2 * 10 with exponential phase of growth ⁷/ 0.2ml/ injection site) is subcutaneously injected into flank.Every mouse is accepted twice implant and implants, and is control tumor on the side flank, and opposite side is a prodrug activation expression of enzymes tumour.In some cases, need carry out other processing,, 17-β estradiol ball be implanted mouse (Chen etc. 1996 are in the book of being quoted) in advance in preceding 1 day of implantation tumour cell if for example use the MCF-7 cell.As the about 50-100mm of described tumour ²During size, usually 5-6 week after implantation, begin drug treating.Through intraperitoneal or tumour inner injecting and administering, be generally 24 hours at interval with suitable dose, be administered twice.

For some animal, when appropriate between, be generally after the drug treating 4-48 hour, put to death described animal, analyze the expression of tumour and the effect of prodrug.Separate tumour with standard method, comprise chopping, freeze thawing, supersound process and handle with collagenase (500 μ g/ml) according to tumor cell type.Enzyme analysis activity and cell survival rate as mentioned above.Keep some animals and measure the tumour size with outer vernier scale.Embodiment 19 analyzes the effect of transmitting in the tumour of the carrier of expressing enhanced prodrug activation enzyme

Prepare people's tumor xenogeneic graft as mentioned above.In case during the about 50mm of described tumour, with No. 22 pins injection carrier formulations.Each tumour is injected 5 times at least, so that described carrier is distributed in the whole tumour.Handle described animal with prodrug in 48 hours behind the injection carrier, analyze tumour as mentioned above.Embodiment 20 expresses the scavenger cell of prodrug activation enzyme

Separate the primary human scavenger cell with standard method from peripheral blood.Analyze the expression of its P450 and P450 reductase gene.It is shocking that they are expressed the P450 reductase enzyme and do not have P450 and express.

Structure contains the adenovirus carrier of CMV promotor (Ad.CMV) or low oxygen effect HRE promotor (ad.ObHRE).Human-cytochrome P4502B6 gene is inserted in these carriers.Can detect P450 in the engineering scavenger cell expresses.Handle described scavenger cell with endoxan, other cell of handling with same engineering such as tumour cell is different is that they are not are not killed and wounded.Yet, when the P450 engineering cell being added to tumour cell or three-dimensional tumour spheroid, can kill and wound them existing under the situation of endoxan.If during with labelled protein (being GFP in the case) the described scavenger cell of engineering, then tumour cell is all survived.Infer because of constitutive expression, so the effect of Ad.CMV-P450 is the most remarkable.Yet Ad.HRE-P450 causes significantly also and kills and wounds that explanation can put on tumor-selective described system.The scavenger cell of embodiment 21 usefulness engineering expressing human P450 kills and wounds people's tumour spheroid

This test-results is shown in Fig. 9.Above three figure show with the engineering scavenger cell and handle but the tumour spheroids of not handling with endoxan.All borderline tumors all are discontinuous, and outward appearance is an entity.Below three figure show to add the situations of endoxan.When adopting the Ad.CMV-P450 scavenger cell, the tumour spheroid is destroyed fully, can not be used for the processing of subsequent analysis.Littler, the more disperse of tumour spheroid with Ad.HRE-P450, very frangible during processing.Tumour spheroid with Ad.CMV-GFP is normal.Special is that the tumour target is by the Ad.CMV-P450 completely destroy to what the people stayed deep printing.

Claims (30)

1. prodrug activation agent, it comprises:

A) locating structure territory; With

B) be used for prodrug activation agent structural domain at target cell activation prodrug; And wherein said locating structure territory is not the antibody of tumor-selective.

2. the prodrug activation agent of claim 1, wherein said locating structure territory comprise in the cell or stride the cellular localization structural domain.

3. the prodrug activation agent of claim 1, wherein said locating structure territory comprises biochemical binding domains.

4. the prodrug activation agent of claim 1, wherein said locating structure territory comprises the Chemical bond structural domain.

5. the prodrug activation agent of claim 1, wherein said locating structure territory comprises plastosome input structure territory.

6. the prodrug activation agent of arbitrary aforementioned claim, wherein said prodrug activation structural domain is for being the prodrug activation enzyme.

7. the prodrug activation agent of claim 6, wherein said prodrug activation enzyme is Cytochrome P450 or cytochrome P450 reductase.

8. the prodrug activation agent of claim 7, wherein said Cytochrome P450 is Cytochrome P450 2B6.

9. the prodrug activation agent of arbitrary aforementioned claim, it is the fusion rotein form.

10. any one prodrug activation agent among the claim 1-8, it is the form of the nucleotide sequence of coding described locating structure territory and prodrug activation structural domain.

11. prodrug activation agent, it comprises the expressible nucleic acid sequence of at least a Codocyte cytochrome p 450, and wherein said nucleotide sequence or every kind of nucleotide sequence operability are connected to one or more constitutive expression regulating and controlling elements or one or more inducible expression regulating and controlling elements.

12. prodrug activation agent, it comprises the modified version hemopoietic stem cell (MHSC) of the expressible nucleic acid sequence that contains at least a coding prodrug activation agent structural domain, and wherein said nucleotide sequence or every kind of nucleotide sequence operability are connected to one or more constitutive expression regulating and controlling elements or one or more inducible expression regulating and controlling elements.

13. the prodrug activation agent of claim 12, wherein said MHSC is a scavenger cell.

14. the prodrug activation agent of claim 12 or 13, wherein said nucleic acid sequence encoding prodrug activation enzyme.

15. the prodrug activation agent of claim 14, wherein said prodrug activation enzyme is Cytochrome P450 or cytochrome P450 reductase.

16. the prodrug activation agent of claim 15, wherein said Cytochrome P450 are Cytochrome P450 2B6.

17. any one the prodrug activation agent among the claim 11-16, wherein said constitutive expression controlling elements is a cytomegalovirus promoter.

18. a nucleic acid carrier, it comprises defined nucleotide sequence among among the claim 10-17 any one.

19. a virus vector, it comprises defined nucleotide sequence among among the claim 10-17 any one.

20. the virus vector of claim 19, wherein said virus vector are retrovirus vector, adenovirus carrier, adeno-associated virus vector, poxvirus vector or acne accompanying virus carriers.

21. the virus vector of claim 20, wherein said virus vector is a lentiviral vectors.

22. be used for any one prodrug activation agent of the claim 1-17 of medicine, the nucleic acid carrier that is used for medical claim 18 or any one virus vector of claim 19-21.

23. medicinal compositions, it comprises any one prodrug activation agent, the nucleic acid carrier of claim 18 or virus vector of claim 19-21 among optional and pharmaceutically acceptable thinner, vehicle or the carrier blended claim 1-17.

24. any one prodrug activation agent, the nucleic acid carrier of claim 18 or any one purposes of virus vector in the medicine of the following disease of production for treating of claim 19-21 among the claim 1-17, described disease is: tumour, inflammation, atherosclerotic blood vessel and dystrophic myofiber end.

25. cell with the virus vector transduction of prodrug activation agent any among the claim 1-17,18 nucleic acid carrier or claim 19-21.

26. be used for any one the activator transfer system of claim 1-11, wherein said transfer system comprises the non-virus expression carrier of one or more retroviruss, adenovirus or plasmid.

27. the method for activation prodrug comprises under the condition that makes target cell and prodrug can absorb prodrug target cell contacting, and makes described prodrug be activated when any one prodrug activation agent is located in claim 1-17.

28. produce the method for virus strain, this method comprises introduces viral genome with defined nucleotide sequence among the claim 10-16.

29. the method for claim 28, this method comprise by homologous recombination between viral genome and the 18 defined carriers described nucleotide sequence is introduced viral genome.

30. produce the method for MHSC any among the claim 12-16, this method comprises introduces hemopoietic stem cell with any one virus vector among the claim 19-21.

Images