JP2002369639A - Conditional knockout mammal having inactivated sphingolipid synthetic activity - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a conditional knockout mammal having inactivated sphingolipid synthetic activity. SOLUTION: The conditional knockout mammal is prepared by partially or totally inactivating the synthetic activity of sphingolipid in time-specific and/or tissue-specific state by modifying a part or total of the DNA region of serine palmitoyl transferase gene in the genom.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a conditional knockout mammal for sphingolipid synthesis and a method for producing the same.

[0002]

2. Description of the Related Art Sphingolipids Sphingolipids are also referred to as sphingolipids and are a general term for lipids having long-chain bases such as sphingosine, and are used broadly as lipids containing glycerol, that is, glycerolipids. It is a lipid that consists of glycosphingolipids and phosphosphingolipids and is widely distributed from lower animals to higher animals. It is characteristic that the fatty acid has an acid amide bond with the amino group at the C-2 position of the long-chain base of sphingosine sugar. Unlike glycerolipid, it is extremely stable to lipase and the like, and is particularly soluble in a mixed solution of chloroform and methanol.

[0003] Glycosphingolipids are a group (glycolipids) of sphingolipids containing a sugar in the molecule. Glycosphingolipids include sphingosine or phytosphingosine, which are long-chain bases, in addition to sugars and long-chain fatty acids. Relatively simple glycosphingolipids are cerebrosides found in the brain and kidneys. Furthermore, sulfatide with a sulfate group, ceramide oligohexoside with several molecules of neutral sugar, globoside with amino sugar, and ganglioside with sialic acid are also included in the category of glycosphingolipids.

[0004] Sphingolipids are a group of sphingolipids, and in particular, those containing phosphorus (phosphoric acid, phosphonic acid, etc.). It is mainly divided into ceramide 1-phosphate derivatives and ceramide 1-phosphonic acid derivatives. For example, the former includes sphingomyelin, and the latter includes ceramide siratin (ceramide aminoethylphosphonic acid). In a narrow sense, there are cases where only the former is distinguished as sphingolipid and the latter is identified as sphingphosphonolipid.

[0005] The biosynthetic pathway for the biosynthesis sphingolipid a sphingolipid is well studied (Figure 1). First, ceramide (N-acylsphingosine) is synthesized through four steps using serine and palmitoyl-CoA as starting materials. Next, glucose is transferred from UDP glucose to ceramide by glugosyltransferase (GlcT-1) first.
Glucosylceramide is synthesized. Glycosphingolipid biosynthesis begins with glucosylceramide as a starting material,
In response to the action of various glycosyltransferases typified by galactosyltransferase (Gal-T), the ganglio series (Gangliosides) and the globo series (G
lobosides), lactosid (Lactosid)
es) and the like. Also, instead of glucose initially with ceramide, UDP galactose: ceramide galactosyltransferase (GC
When galactose is transferred by T), galactosylceramide is obtained. On the other hand, sphingophospholipids also use ceramide as a starting material and, for example, choline phosphate (eg,
Phosphatidylcholine) (derived from phosphatidylcholine) forms a phosphodiester bond with sphingomyelin synthase to give sphingomyelin.

Functions of sphingolipids Currently known functions of sphingolipids mainly include 1) a function as a component of a cell membrane, and 2) a function as a signal transmitter.

1) Function as Cell Membrane Constituent Sphingolipid has a function as a cell membrane constituent, particularly as a cell membrane constituent for providing a place for information transmission.

Cells can be regarded as units isolated from the outside world by cell membranes. Although the cell membrane varies from cell to cell, it is composed of about 50% of lipids and about 50% of proteins. The lipid constituting the cell membrane includes phospholipids, glycolipids, and sterols. Phospholipids include sphingolipids having a glycerol skeleton such as phosphatidylcholine and sphingolipids according to the present invention. Glycolipids also include glycosphingolipids containing sphingosine as a skeleton and containing sugars such as glucose and galactose, or modified with sialic acid. Phospholipids, glycolipids,
Lipids such as sterols form a double membrane structure with non-polar groups attached to one another with the polar groups facing out.

[0009] It is known that the lipid composition of the cell membrane is not constant and heterogeneity exists. For example, there is a difference in the lipid composition of the cell membrane between the apical part and the basolateral part of the epithelial cells, and glycolipids are widely distributed at the apical part. In particular, in recent years, the existence of a domain of a cell membrane having a more localized lipid composition has become known. Representative examples of such localized domains include caveolae and rafts.

[0010] "Caveolae" is an intracellular construct present immediately below the cell membrane of various cells such as epithelial cells. 50-1
It has a flask-like structure of about 00 nm or an indentation-like structure opened to the cell membrane. Unlike secretory granules and phagocytic granules, they always remain below the cell membrane and are considered important for the formation of microdomains on the cell membrane. Purified biochemically as an insoluble fraction of Triton X-100, which is a surfactant, has a characteristic substance composition different from that of the cell membrane. : Gly
cosyl phosphatidyl inosit
ol) Rich in anchor type proteins. It has been suggested that the function of caveolae is involved in the incorporation of small molecules such as folate transporters and cAMP-binding proteins (pottocytosis), signal transduction and transmission on the cell surface, and intracellular control transport.

"Rafts" have been proposed as membrane domains rich in sphingolipids and cholesterol and involved in protein selection. Sphingolipids often have a saturated fatty acid portion (acyl chain) and are considered to be tightly packed in a lipid bilayer. On the other hand, the phospholipid has a cis-type unsaturated acyl chain, and since this portion is twisted, the phospholipids are hardly packed with each other, forming a highly fluid phase. In addition, because the steroid ring of cholesterol readily interacts with saturated acyl chains, cholesterol is more likely to bind to sphingolipids with saturated acyl chains than to phospholipids with unsaturated acyl chains. Sphingolipids are bound between the sugar chains of each other and between the sphingosine skeletons by van der Waals force and hydrogen bonding force. The space between sphingolipids is filled with cholesterol, which interacts non-covalently with saturated fatty acids. That is, it is thought that sphingolipids and cholesterol form tightly packed microdomains in a phospholipid-rich environment.

Raft, due to its structure, exhibits a property that it is hardly soluble in nonionic surfactants and has a low specific gravity. Therefore, if cells are solubilized with a detergent and centrifuged using a sucrose density gradient method, the raft floats to a low specific gravity fraction, and this domain can be fractionated from other soluble cell membrane components. it can. Raft lipids and proteins present therein have been analyzed by fractionation using the sucrose density gradient method. Src, a cytoplasmic protein present on the membrane, including GPI-anchored proteins
It has been shown that characteristic molecules such as tyrosine kinases are localized. The nature of this raft suggests that it has the function of collecting specific molecules in the microdomain on the cell membrane and excluding other molecules. That is, it is considered that various proteins such as a signal transmitting substance are localized in the raft, and function as a place for movement of a substance in a cell or information transmission.

Caveolae and rafts have structures with similar properties, such as their lipid composition and insolubility in solubilizers. Also, in purification using density gradient centrifugation,
Since caveolae and raft behave similarly, it is unlikely that they are completely separated. Therefore, the relationship between the functions considered to be exhibited by both parties has not been sufficiently elucidated. However, lymphocytes do not have caveolin protein essential for maintaining caveolae structure, and caveolae is not recognized. Rafts are also found on lymphocytes. Therefore, it is considered that rafts exist both in caveolae and in cell membranes outside caveolae.

"Caveola and Raft", Fujimoto et al., Cell Engineering
Vol. 18, No. 8, 1999, p. 1155-1
161; "The role of rafts in T cell antigen receptor signaling", Yasuda et al., Protein Nucleic Acid Enzyme Vol. 4
5, No. 11 (2000), p. 1812-182
2.

2) Functions as Signaling Substances Metabolites of sphingolipids (ceramide and sphingosine 1-phosphate) have attracted much attention as intercellular or cell signal molecules in survival, cell death and differentiation.

Specifically, ceramides play an important role as lipid mediators in apoptosis by various stresses or drugs (eg, anticancer drugs).
Sphingosine 1-phosphate has a specific receptor (vascular endothelial cell differentiation gene (end) on its surface.
other differential
ene) (Edg family)) is known to play an important role in angiogenesis and the like.

Knockout of sphingolipid synthesizing function As described above, sphingolipids are considered to play an important biological function as a component of cell membrane or as a signal transmitting substance. However, little is known about the function at the actual individual level.

[0018] Hanada et al. (Journal of
Biological Chemistry, Vol.
267, 1992, p. 23527-23533) is C
Using a temperature-sensitive mutant SPB-1 derived from HO cells,
It describes the role of whole sphingolipid synthesis in cells. Specifically, in FIG. 1 of the present specification, as the first step in the synthesis of sphingolipids, palmitoyl-CoA and the non-essential amino acid L-serine are polycondensed by serine palmitoyltransferase enzyme (SPT), and 3
-Ketosphinganine is synthesized. SPT is Lcb
It is a heterodimer consisting of two subunits, 1 and Lcb2. Established a mutant strain in which the subunit Lcb1 subunit failed to function at non-permissive temperatures. The temperature mutant SPB-1 having the Lcb1 mutant gene caused cell death when kept at a non-permissive temperature.

In order to analyze the function of sphingolipids at the individual level, it is conceivable to create a so-called knockout animal in which the gene of an enzyme that controls the synthesis of sphingolipids is artificially disrupted. However, as suggested by the above-mentioned article by Hanada et al., Since sphingolipids are membrane components essential for cell survival, the SPT gene (Lcb1 or 2 ) Is inferred to be embryonic lethal. Therefore, it is necessary to create a knockout animal capable of controlling sphingolipid synthesis in a time-specific or tissue-specific manner (conditionally).

[0020]

An object of the present invention is to provide a conditional knockout mammal for sphingolipid synthesis. The conditional knockout mammal of the present invention can modify a part or all of sphingolipid synthesis in a stage-specific and / or tissue-specific manner by modifying a part or all of a DNA region of a serine palmitoyltransferase gene in a genome. It is characterized by being inactivated.

[0021] The conditional knockout mammal of the present invention is preferably constructed by utilizing a recombinant protein / recombinase target sequence system, wherein one of the DNA regions of the serine palmitoyltransferase gene in the genome is responsive to the expression of the recombinant protein. It is produced by modifying part or all.

[0022] The conditional knockout mammal of the present invention is preferably a mouse. Another object of the present invention is to provide a method for producing a non-human conditional knockout mammal in which part or all of sphingolipid synthesis is inactivated in a time-specific and / or tissue-specific manner. The production method of the present invention comprises: 1) a sequence in which a part or all of a genomic DNA region of a serine palmitoyltransferase gene is sandwiched between recombination target sequences, and a part or all of a genomic DNA region of a serine palmitoyl transferase gene in the sequence. 2) transducing the said targeting vector into embryonic stem cells to cause homologous recombination of a part or all of the genomic DNA region of the serine palmitoyltransferase gene. 3) using the embryonic stem cells in which the homologous recombination has occurred, to prepare a genetically modified animal having a modified serine palmitoyltransferase gene containing a recombinase target sequence; and Or tissue specific Breeding with a recombinantly-expressing gene-modified animal that expresses a melamine protein to obtain a non-human mammal in which the expression of serine palmitoyltransferase protein is suppressed in a time-specific and / or tissue-specific manner. .

It is a further object of the present invention to provide a genetically modified animal having a modified serine palmitoyltransferase gene containing a recombinant target sequence for use in the method for producing a conditional knockout mammal.

Still another object of the present invention is to provide a targeting vector for use in the above-mentioned method for producing a non-human conditional knockout mammal. The targeting vector of the present invention comprises a sequence in which a part or all of the genomic DNA region of the serine palmitoyltransferase gene is sandwiched between recombination target sequences, and a part or all of the genomic DNA region of the serine palmitoyltransferase gene is homologous to the sequence. It is characterized by changing.

[0025]

Means for Solving the Problems The present inventors have made intensive studies to solve the above-mentioned problems, and as a result, have produced knockout mice that stop tissue-specific or time-specific sphingolipid biosynthesis. We succeeded, and corresponded to the present invention.

Conditioning of sphingolipid synthesis
Kkuauto mammals present invention provides a conditional knockout mammals sphingolipid synthesis. The conditional knockout mammal of the present invention can modify a part or all of sphingolipid synthesis in a stage-specific and / or tissue-specific manner by modifying a part or all of a DNA region of a serine palmitoyltransferase gene in a genome. It is inactivated.

As used herein, "serine palmitoyltransferase" is an enzyme that synthesizes 3-ketosphinganine by condensation polymerization of palmitoyl-CoA and a non-essential amino acid L-serine in the first step of sphingolipid synthesis. It is. Serine palmitoyltransferase is a heterodimer composed of two subunits, SPT, Lcb1 and Lcb2. For Lcb1, for example, see Hanada, K et al. ,
Journal of BiologicalChem
istry, Vol. 272 (51), 1997,
p. 32108-32114 cDN of mouse Lcb1
A sequence is Gene bank accession N
o. AF003823, and discloses a deduced amino acid sequence. Lcb2
Are described, for example, in Nagiec, M .; M. et al. ,
Gene 1996 Oct 24; 177 (1-
2): 237-41 shows that the cDNA sequence of mouse Lcb2 contains Gene bank accession No.
It has been described as deposited as U27455,
A deduced amino acid sequence is disclosed. In the sequence listing described later in this specification, the amino acid sequence of Lcb2 is described as SEQ ID NO: 1, and the nucleotide sequence of cDNA is described as SEQ ID NO: 2. In addition, the aforementioned Nagiec, M.A. M. e
t al. Gene 1996 describes the amino acid sequences of human Lcb2 and mouse Lcb2 as K. lactis,
S. cerevisiae, S .; The results are also compared with Lcb2 derived from yeast such as pombe. Sphingolipids are lipids widely distributed from lower animals to higher animals, and the SPT subunit Lcb2 also exists from yeast to humans and shows high homology.

Lcb2 is responsible for the enzymatic activity of SPT, that is, a subunit containing the active site,
Lcb1 is thought to be a subunit that regulates activity. Therefore, in order to inactivate SPT in the present invention, it is preferable to mutate a part or all of the gene encoding Lcb2, but it is not limited thereto. In the above-mentioned paper by Hanada et al. (1992), L
Cell death was also induced in the temperature mutant strain in which the gene encoding the cb1 subunit was mutated.
It is also possible to inactivate SPT by mutating b1.

If serine palmitoyltransferase is substantially inactivated, the modification in the present invention may be all or part of the DNA region of the serine palmitoyltransferase gene in the genome. The part where the mutation is introduced is Lcb1 gene or Lc
3 'of the b2 gene, the Lcb1 gene or L
When the 5 ′ side of the cb2 gene is normally transcribed and translated, the N-terminal side of Lcb1 or Lcb2 is operably expressed, that is, there is a possibility that a part of serine palmitoyltransferase activity remains. Therefore, although not limited, the part where the mutation is introduced is Lc
The 5 ′ side of the b1 gene or Lcb2 gene is preferred.

On the other hand, a 5 'upstream portion including an initiation codon, ie, a site containing a nucleic acid sequence for controlling transcription or translation in the genome, for example, a transcription promoter, operator, or enhancer, an mRNA ribosome binding site, And, when a mutation is made in a region containing a site that regulates the initiation of transcription and translation, Lcb1 or Lcb
The two genes may be completely inactivated, but not conditionally, and not expressed at all. This aims to obtain a conditionally knocked-out non-human mammal in which part or all of sphingolipid synthesis is inactivated only under certain conditions, that is, only in a time-specific and / or tissue-specific manner. Cannot be achieved. Therefore, it is not preferable, but not limited, to introduce a mutation into such a region.

As described above, in the genome of the Lcb1 gene or the Lcb2 gene, mutation is performed downstream of the start site, preferably 5 ′ upstream from half, more preferably 1/3 upstream. For example, the Lcb2 genome is presumed to consist of exon 1 to exon 12, but preferably introduce mutations within exon 1 to exon 6 and more preferably within exon 3 to exon 5. In the examples described later in this specification, mutations are introduced so as to modify exon 3 of the mouse Lcb2 genome to inactivate part or all of sphingolipid synthesis only in a time-specific and / or tissue-specific manner. Successfully obtained a conditional knockout mouse.

In this specification, palmitoyl-CoA is used in the first step of sphingolipid synthesis.
And a non-essential amino acid L-serine were polycondensed to mutate a serine palmitoyltransferase enzyme, an enzyme that synthesizes 3-ketosphinganine, to inactivate part or all of sphingolipid synthesis. The pathway from 3-ketosphinganine to the subsequent synthesis of ceramide is a pathway common to all sphingolipid synthesis (FIG. 1).
Therefore, in FIG. 1, a step in which sphinganine is synthesized from 3-ketosphinganine,
Similarly, a part of the synthesis of sphingolipids can be achieved by modifying the genes encoding the enzymes involved in the steps of synthesizing acylsphinganine and synthesizing ceramide from N-acylsphinganine. Alternatively, all can be inactivated.

In the present invention, "altering part or all of the DNA region of the serine palmitoyltransferase gene in the genome" refers to causing a change, deletion or substitution of a part of the genomic DNA of the serine palmitoyltransferase gene. , Or inversion of a specific area. In order to render the serine palmitoyltransferase gene inoperable, two or more methods of altering, deleting, inserting or replacing the serine palmitoyltransferase gene may be used simultaneously. Further, the serine palmitoyltransferase gene that causes the modification is not limited to only one gene, and two or more genes, for example, Lcb
Alterations may occur simultaneously for both the 1 and Lcb2 genes.

In the present invention, "change" of genomic DNA
The expression means that one or more base substitutions are introduced into the genomic DNA sequence of the serine palmitoyltransferase gene so that the altered expression product of the serine palmitoyltransferase gene does not function as serine palmitoyltransferase. In the present invention, `` deletion '' of genomic DNA means that the expression product of the serine palmitoyltransferase gene does not function or does not exist as a serine palmitoyltransferase by deleting a part or all of the genome of the serine palmitoyltransferase gene. To do. In the present invention, the genomic DN
The term "insertion" with respect to A refers to the expression of a serine palmitoyltransferase gene into which a DNA other than the serine palmitoyltransferase gene is inserted by inserting a DNA having a sequence other than the serine palmitoyltransferase gene into the serine palmitoyltransferase gene. Refers to preventing the product from functioning as a serine palmitoyltransferase. In the present invention, “substitution” of genomic DNA means
Refers to replacing part or all of the genome of the serine palmitoyltransferase gene with a separate sequence unrelated to the serine palmitoyltransferase gene so that the expression product of serine palmitoyltransferase does not function or is not present as serine palmitoyltransferase. .

The knockout mouse of the present invention is particularly characterized in that part or all of sphingolipid synthesis is inactivated in a time-specific and / or tissue-specific manner, that is, conditionally. As a general method of controlling gene expression in a time-specific and / or tissue-specific manner,
For example, A) a method for inducing gene recombination using a recombinant protein / recombinase target sequence system, B) a method for controlling gene expression using a tetracycline activator, etc., and a method combining A) and B). (For example, a separate volume Experimental Medicine The Protocol Series "The Latest Technology of Gene Targeting" (2000, Yodosha) Conditional Targeting Method p.115-120; Bio Manual Series 8 "Gene Targeting" -Production of mutant mice using ES cells (1995, Yodosha)
p. 71-77); Sambrook et al., Molecu.
lar Cloning: A LABORATORY
MANUAL, 3rd edition, COLD SPRING HA
RBOR LABORATORY PRESS, 200
1 year, 4.82-4.85).

The method of the type of gene recombination induction utilizing the recombinant protein / recombinase target sequence system of A) is a method in which a specific recombinase protein recognizes a recombinase target sequence and DNA recombination is performed at that portion. It uses what happens. The recombinase target sequence does not recombine unless a particular recombinase is present. Therefore, a non-human genetically modified mammal in which the recombinant protein is expressed in a stage-specific and / or tissue-specific manner and a non-human genetically modified mammal of the same species into which the recombinant target sequence has been introduced are cross-linked to form a combination by the recombinant. The recombination occurs in a time- and / or tissue-specific manner, allowing the desired gene to be controlled in a time- and / or tissue-specific manner. Without limitation, Cre from bacteriophage P1
Cre using a 34 base pair loxP sequence recognized by the recombinant protein and the Cre protein
The / loxP system is preferred. In addition, yeast-derived F
LP / FRT system (Jung, S. et al.,
Science, 265, p. 103-, 1994)
(Mammalian cells, Drosophila (Drosophili)
la) also causes homologous recombination), Zygosachch
pSR1 recombinase of aromyces rouxii (which can function in yeast S. cerevisiae) and the like are also known. For a method for producing a conditional knockout non-human mammal using a recombinant protein / recombinase target sequence system,
This will be described in more detail in the section of the manufacturing method.

The B) gene expression control method utilizes a method in which a mammal deficient in a specific gene is rescued by introducing a modified gene into the deficient gene. When rescuing the gene expression system, the deleted gene itself is expressed under the control of a transactivator such as a tetracycline activator (TET-A). At that time, since the TET-A gene needs to have the same expression pattern as the defective gene, the TET-A gene is introduced by knock-in during gene targeting. This knocked-in TET-A gene is expressed by using a gene-deficient gene expression system,
It acts on the transgenic tet promoter and expresses the defective gene. That is, the specific gene expression
The mouse | mouth made to carry out via ET-A and a tet promoter is produced. TET-A cannot act on the tet promoter by adding tetracycline from the outside, and thus can delete a specific gene at the tissue and time when tetracycline is added. This method can regulate gene deficiency by devising artificial introduction of tetracycline, and can restore gene expression by stopping addition of tetracycline. Becomes possible.

In particular, the present invention provides a conditional knockout mammal in which part or all of sphingolipid synthesis is inactivated specifically in epidermal cells, and a part or whole of sphingolipid synthesis inactivated specifically in T cells. Including conditional knockout mammals. These can be obtained, for example, by using a recombinant protein / recombinase target sequence system and using a genetically modified animal that expresses recombinase in an epidermal cell-specific manner or in a T cell-specific manner.

[0039] The conditional knockout mammal of the present invention is a non-human mammal, preferably a mouse,
Rats, goats, cows, pigs, rabbits, sheep and the like.
Mice that are easy to handle and have established experimental systems are most preferred. The knock-out mammals of the present invention include not only adults but also ES cells, fertilized eggs, embryos from the 8-cell stage to blastocyst formation and immediately before birth, embryos, eggs, sperm, tissue / organ cultures, chimeric animals, etc. Includes all aspects. These may be frozen as needed for storage.

Non-human conditional knockout mammal
Animal production method The present invention further comprises a time-specific and / or tissue-specific
Provided is a method for producing a non-human conditional knockout mammal in which part or all of sphingolipid synthesis is inactivated. The production method of the present invention comprises: 1) a sequence in which a part or all of a genomic DNA region of a serine palmitoyltransferase gene is sandwiched between recombination target sequences, and a part or all of a genomic DNA region of a serine palmitoyl transferase gene in the sequence. 2) transducing the said targeting vector into embryonic stem cells to cause homologous recombination of a part or all of the genomic DNA region of the serine palmitoyltransferase gene. 3) using the embryonic stem cells in which the homologous recombination has occurred, to prepare a genetically modified animal having a modified serine palmitoyltransferase gene containing a recombinase target sequence; and Or tissue specific Breeding with a recombinantly-expressed gene-modified animal that expresses a recombinant protein, and obtaining a non-human mammal in which the expression of serine palmitoyltransferase protein is suppressed in a time-specific and / or tissue-specific manner. .

The non-human conditional knockout mammal of the present invention described above is not limited,
Preferably, it is produced by the production method of the present invention using a recombinant protein / recombinase target sequence system. For the purpose of illustrating, but not limited to, the present invention, a conceptual diagram of an example of a conditional knockout utilizing the recombinant protein / recombinase target sequence system of the present invention is shown in FIG.

1. Serine palmitoyl transferer
Genomic DNA of Ze Gene Genomic DNA is used to construct a targeting vector for homologous recombination of embryonic stem cells (ES cells). Therefore, the genomic DNA is desirably isolated and used from the same animal species as the animal species from which the ES cells to be prepared are derived, so that recombination occurs more efficiently when performing homologous recombination. More preferably, in order to further increase the efficiency of homologous recombination, genomic DNA from animals of the same strain among animals of the same species from which ES cells are derived
Is used. This is because even if the strains are the same, if the strains are different, DNA sequence variations are scattered throughout the genome, and these variations may lower the probability of homologous recombination.

For example, when collecting a genomic clone of the mouse serine palmitoyltransferase gene (Lcb1 or Lcb2), a mouse-derived cDNA
Screening from a mouse genomic library can be performed using probes or genomic DNA probes. When a cDNA probe is used, the full-length cDNA for the target serine palmitoyltransferase gene or a part thereof may be used. Alternatively, a synthetic oligonucleotide prepared based on the sequence of a known mouse serine palmitoyltransferase gene may be used as a probe.

Specifically, Lcb1 is described in, for example, Hanada, K et al. , Journa
l of Biological Chemistr
y, Vol. 272 (51), 1997, p. 32
No. 108-32114, the cDNA sequence of mouse Lcb1 was stored in Gene bank accession no. AF
003823, and discloses a deduced amino acid sequence. Lcb2 is, for example, Gene bank accession No.
U27455 discloses the amino acid sequence of mouse Lcb2 and the nucleotide sequence of cDNA. In the sequence listing described later in this specification, the amino acid sequence of mouse Lcb2 is described as SEQ ID NO: 1, and the nucleotide sequence of cDNA is described as SEQ ID NO: 2. Also, see Nagiec, M .; M.
et al. , Gene 1996 Oct 24; 1
77 (1-2): 237-41 describes the amino acid sequences of human Lcb2 and mouse Lcb2 in K. lactis, S .;
cerevisiae, S .; The results are also compared with Lcb2 derived from yeast such as pombe. Based on these sequences, a cDNA probe using the full length or a part of the cDNA or a synthetic oligonucleotide probe can be prepared, and a genomic library can be screened.

A serine palmitoyltransferase gene genomic DNA fragment exhibiting probe binding is excised with a restriction enzyme and inserted into a commercially available cloning vector. As a cloning vector, commercially available pBluescript (Stratagene) is used.
Any plasmid such as pBR322, pUC, etc. may be used. By determining the partial sequence of the genomic clone isolated in this way, it can be confirmed that the isolated genomic clone is a genomic clone for the target serine palmitoyltransferase gene.

2. Construction of the targeting vector The targeting vector has a sequence in which a part or all of the genomic DNA region of the serine palmitoyltransferase gene is sandwiched by recombination target sequences, and the sequence includes a part or all of the genomic DNA region of the serine palmitoyltransferase gene. It is used for homologous recombination. Therefore, the targeting vector for the serine palmitoyltransferase gene according to the present invention is characterized in that it contains a sequence in which a part or the whole of the genomic DNA region of the serine palmitoyltransferase gene is sandwiched between recombination target sequences. When the sequence flanked by the recombinase target sequences is inserted into the genome by homologous recombination, the sequence flanked by the recombinase target sequences is deleted from the genome by the enzymatic activity of the corresponding recombinase protein that recognizes the target sequence, Subject to modification such as inversion. When the recombinase activity does not exist, deletion of the sequence does not occur, and the transcription and translation of the genomic DNA of the serine palmitoyltransferase gene are performed in the same manner as the wild type regardless of the presence of the recombinase target sequence, and a functional serine palmitoyltransferase is obtained. The protein is obtained and sphingolipid synthesis is performed normally. Therefore, by controlling the expression of the recombinase protein in a time-specific and / or tissue-specific manner, it is possible to inactivate part or all of sphingolipid synthesis in a time-specific and / or tissue-specific manner. Become.

The recombinase protein / recombinase target sequence system that can be utilized according to the present invention utilizes the Cre recombinase protein from bacteriophage P1 and the recombinant hotspot loxP sequence in P1 that is recognized by the Cre protein. Cre
-LoxP system, FLP / FRT system derived from yeast (Jung, S. et al., Science, 2
65, p. 103-, 1994) (Homologous recombination also occurs in mammalian cells, Drosophila), Zygosaccharomyces r
oxii pSR1 recombination (yeast S. cer)
Evisiae).

Although not limited, Cre / lo
An xP system is preferred. loxP has the following 34 base pairs, one separated by an 8 base pair spacer.
3 bp inverted repeat (inverted repeat)
at sequence).

[0049]

5′-ataacttcgtata atgt | atgc tatacgaagttat- 3 ′ 3′- tattgaagcatat taca | tacg atatgcttcaata- 5 ′ inverted repeat sequence spacer inverted repeat sequence (SEQ ID NO: 3) Recombination at the loxP site is at P1 cre Catalyzed by Cre, a 343 amino acid recombinant protein encoded by the gene. Each loxP site consists of two Cre binding sites consisting of a 13 base pair repeat and an adjacent 4 base pair spacer. The two most distal base pairs of each repeat can be modified without altering the recombination frequency. A total of two Cre molecules bind, one to each loxP site. Then C
The re-loxP complex is composed of the same nucleic acid molecule (such as DNA)
Pairs with the second loxP site present above. Following asymmetric cleavage of the DNA in the spacer region, strand exchange between the paired loxP partners is induced. Due to the asymmetric nature of the spacer region, recombination between loxPs located on the same nucleic acid molecule is polar. That is, recombination between loxPs in the same direction causes excision (deletion) of DNA between two sites, while recombination between loxPs in the opposite direction results in inversion of intervening DNA between the two sites. Bring.

The Cre protein catalyzes the recombination phenomenon not only in bacteria (such as Escherichia coli) but also in yeast and mammalian cells. Therefore, Cre recombinase protein is
In yeast and mammalian cells, it is possible to cause the site-specific insertion of the plasmid into the chromosome or to delete the DNA region flanked by multiple (preferably two) loxP sites. Genomes in yeast and mammalian cells are not believed to have loxP sites. Furthermore, Cre protein expression is not toxic to mammalian cells unless particularly highly expressed, and a genetically modified mouse having a cre gene under the control of a promoter such as a mouse metallothionein I promoter or cytomegalovirus promoter. Is unaffected during development, growth, and reproduction.

The sequence recognized by the Cre protein is not limited to SEQ ID NO: 3 described above. Even if there is a slight mutation in the nucleotide sequence, the sequence can be recognized by the Cre protein and similarly cause recombination. For example, but not limited to, the two most distal base pairs of each repeat
It can be modified without changing the recombination frequency. In addition, there is also a report that when the t base at the 5 'end in the spacer sequence 5'-atgtatgc-3' is mutated to g, the recombination frequency in the transformed mammalian cells is substantially increased. . Therefore, herein, the sequence recognized by the Cre protein containing such a mutation is also included in the “loxP” sequence that can be used in the present invention.

Deletion of a DNA region flanked by a plurality (preferably two) of loxP sites can occur more frequently than site-specific insertion of a loxP plasmid into a loxP site on a chromosome. Using a Cre-loxP system, a genetically engineered mammalian (eg, mouse) system containing a loxP site at a specific position on the chromosome is bred to a genetically modified animal expressing Cre. ,
It is possible to generate null alleles (null alleles) of the desired gene. Therefore, preferably, the targeting vector of the present invention sandwiches a part or all of the genomic DNA region of the serine palmitoyltransferase gene with a plurality (preferably two) of loxP sequences in the same direction. When the sequence is integrated into the genome by homologous recombination, multiple lo
Part or all of the genomic DNA region of the serine palmitoyltransferase gene flanked by xP sequences is deleted (cut out). When the serine palmitoyltransferase gene is contained in a plurality of loxP sequences in opposite directions, a specific chromosomal site may be inverted or deleted. Therefore, such an embodiment can be included in the present invention because a part or all of the genomic DNA region of the serine palmitoyltransferase gene can be modified (Sa
mbrook et al., Molecular Clonin
g: A LABORATORY MANUAL, 3rd
Edition, COLD SPRING HARBORLABOR
ATORY PRESS, 2001, 4.82-4.
85).

In general, but not exclusively, in order for homologous recombination of genomic DNA to occur efficiently with a targeting vector, the longer the homologous region, the better.
On the other hand, depending on the type of the targeting vector, a preferable length of DNA that can be inserted and handled is limited to a certain length.
Therefore, in the serine palmitoyltransferase gene genomic DNA obtained as described above, preferably 1 kb to 20 kb, more preferably 5 kb to 20 kb,
Most preferably, 10 kb-20 kb is included in the targeting vector. Among them, a sequence having a length that easily causes modification such as deletion (exclusion) is designed to be sandwiched by two or more recombinase target sequences, depending on the recombinase protein / recombinase target sequence system to be applied. Although not limited, Cre-l
When applying the oxP system, preferably 1 kb-1
A sequence having a length of 00 kb, more preferably 1 kb-10 kb, most preferably 1.2 kb-3.5 kb is flanked by two or more loxP sequences. In the targeting vectors of Examples described later in the present specification, mouse Lcb
Genomic sequence flanking exon 3 of two genomes (length about 1.2
kb) was sandwiched between two loxPs.

The vector serving as the basic skeleton of the targeting vector of the present invention into which the modified serine palmitoyltransferase gene incorporating the recombinase target sequence is introduced is not particularly limited, and is self-replicating in a cell to be transformed (eg, Escherichia coli). Whatever is possible is possible.
For example, commercially available pBluescript (Stratag
ene), pZErO 1.1 (Invitrog)
en), pGEM-1 (Promega) and the like can be used.

The method of the present invention transforms embryonic stem cells (ES cells) with a targeting vector containing a modified serine palmitoyltransferase gene into which a recombinant target sequence has been incorporated, and causes homologous recombination.
When designing for the construction of a targeting vector, it is desirable to consider so that screening of homologous recombinants that must be performed in a later step can be performed more easily. For example, screening of homologous recombinants includes (1) first-stage screening at the cell level performed in culture using a gene for selection such as positive selection or negative selection introduced into the recombinant by a targeting vector, And (2) for the recombinant selected by the first stage screening,
Furthermore, it is preferable to carry out by two steps of the second-stage screening at the DNA level, which comprises performing a PCR method, a Southern blot hybridization method and the like. Therefore, it is preferable to design a targeting vector so that one or both of the two-step screening can be performed more easily.

[0056] Positive selection is a targeting vector.
To select only embryonic stem cells whose chromosome has been introduced.
Means Electrode commonly used for transformation
By the poration method, the introduced gene DNA
Is 10 ^Three-10^FourAbout one per cell
The frequency of the cells,
First consider the sequence (positive selection) to select
There must be.

As marker genes for positive selection, neomycin resistance gene (selection by G418), hygromycin B phosphotransferase (BPH) gene (selection by hygromycin-B), blasticidin S deaminase gene (selection by blasticidin S) , Puromycin resistance gene (selected by puromycin) and the like can be used. The neomycin resistance gene is most preferred.

Negative selection means that embryonic stem cells that have undergone heterologous recombination are selectively removed. this is,
In particular, whether the gene of interest is not expressed in ES cells,
It can be used when the expression level is low. Homologous recombination occurs in the homologous region, but non-homologous recombination is largely linear
It occurs at both ends of A. Negative selection is performed by adding to one end of the introduced DNA a gene which, when integrated, is toxic to cells. As a negative selection,
The herpes simplex virus (HSV) thymidine kinase (tk) gene, diphtheria toxin A fragment (DT
-A) Methods using genes and the like are known. Compared to endogenous thymidine kinase (TK), T cells derived from HSV
K phosphorylates nucleic acid analogs such as FIAU and gancyclobia at a higher rate. The tk selection utilizes the fact that when the HSVtk gene is introduced by non-homologous recombination and FIAU or the like is added, this is phosphorylated and incorporated into chromosomal DNA to inhibit DNA synthesis.
DT-A inhibits protein synthesis by polyADP-ribosylating elongation factor II in cells. If a DT-A gene linked to a promoter having high expression activity in ES cells is used, it is expected that cells in which the DT-A gene has been integrated into the chromosome by non-homologous recombination will die. It has the advantage that no selection agent is required for sorting at the translation level. Conventionally, before integration into chromosomal DNA, DT-A was expressed episomally (in a state outside the chromosome), and there was a fear that cells might be randomly killed.
In particular, it is becoming clear that cell death hardly occurs in ES cells due to transient expression. If necessary, a vector may be prepared in combination with polyA selection described below, that is, without adding a polyA addition signal.

As a promoter having strong expression activity in ES cells, phosphoglycerate kinase-1 (PG
K-1) promoter, elongation factor 2 (EF-2) promoter, MC-1 promoter and the like can be used. Targeting locus and its DN
Since the promoter activity is greatly affected by the A region, generally, the stronger the promoter, the better. Therefore, more preferably, the PGK-1 promoter is used.
However, when DT-A is used for negative selection,
Since random cell death before integration into chromosomal DNA is feared, it is preferable to use a promoter with slightly lower expression activity, for example, the MC-1 promoter.

The selectable marker gene linked to the promoter is, for example, a neomycin resistance gene cassette (ne
o cassette, provided as pKJ2), hygromycin B phosphotransferase gene cassette (hph cassette), thymidine kinase gene cassette (tk cassette, provided as pMCtk), diphtheria toxin A gene fragment cassette (DT-A cassette, pMCDT-A or pMC1DTApA) And a lacZ gene cassette (for example, provided as pBSlacZ), and a commercially available selection marker gene inserted in a plasmid may be used. The targeting vector may be constructed using any of the selectable markers linked to these promoters.
In the examples described below, Nakano et al. , Eu
r J Neurosci 1999 Jul; 11
(7): Plasmid loxP- described in 2577-81
p-gK-neo (available from the present inventor, Junji Takeda, Osaka University School of Medicine)
GK-neo fragment and plasmid pMC1DTA
pA (Yagi et al., 1993; Anal.
Biochem. 214; 77-86) (available from Prof. Takeshi Yagi, Center for Cellular Biotechnology, Osaka University).

Preferably, the sequences for positive selection and negative selection (along with their promoters, if present) are inserted into the targeting vector in the same direction (forward direction) as the serine palmitoyltransferase gene.

When the targeting vector contains a sequence for selecting only embryonic stem cells into which the targeting vector has been introduced, that is, a positive selection sequence, the chromosome into which the targeting vector has been introduced has a positive selection sequence. Has been inserted. If the positive selection sequence remains, the conditional knockout animal finally obtained may have adverse effects such as disrupting the expression of the Lcb2 gene itself and causing developmental disorders not only in the early developmental stage. Preferably, the method includes a step of deleting the positive selection sequence from the chromosomal DNA. To facilitate the deletion of sequences for negative selection, the recombinase protein / recombinase target sequence system described above for the serine palmitoyltransferase gene can be utilized. Therefore, it is preferable, but not limited to, that the positive selection sequence be sandwiched between two recombination target sequences in the same direction and included in the targeting vector. The method for deleting the sequence for positive selection will be described in detail in the section “6.

As further usable selections, there are known a promoter selection, a polyA selection and the like. Promoter selection can be used when the gene of interest is expressed in cells that undergo recombination. in this case,
If a promoter is not attached to the positive selection sequence and homologous recombination occurs, a vector is designed so that the positive selection sequence is expressed from the expression control region of the target gene,
By performing promoter selection, it is possible to reduce the number of non-homologous recombinants that are positive in positive selection. In addition, in the polyA selection, a vector is designed so that the polyA addition signal of the target gene can be used only when homologous recombination occurs without adding the polyA addition signal to the positive selection gene, thereby removing the non-homologous recombinant. Is what you do. This is particularly useful when combined with negative selection or the like.

A part or all of sphingolipid synthesis was inactivated in a time-specific and / or tissue-specific manner as described above.
The targeting vector itself for use in the method for producing a non-human conditional knockout mammal is also newly obtained by the present invention and is included. The targeting vector of the present invention comprises a sequence in which a part or all of the genomic DNA region of the serine palmitoyltransferase gene is sandwiched between recombination target sequences,
The above sequence is characterized by homologous recombination of part or all of the genomic DNA region of the serine palmitoyltransferase gene.

[0065] 3. Homologous set by targeting vector
Recombinant then used targeting vector prepared by the above method, performing homologous recombination. In the present invention, “homologous recombination of serine palmitoyltransferase gene” means artificially recombining the modified serine palmitoyltransferase gene on the corresponding genome.

In general, it is known that the frequency of homologous recombination of a desired gene is about 10 ^-6 . Therefore, in order to obtain the target homologous recombinant, theoretically, 1
0 ⁶ or more cells must perform the recombination operation, it is necessary to screen at least tens to hundreds of specimens recombinants. However, since it is practically impossible to use 10 ⁶ fertilized eggs, instead of fertilized eggs, they have the same pluripotency as fertilized eggs, and i.
It is necessary to use cells that can be cultured in vitro. As a method that can achieve such an object, a method using embryonic stem cells (ES cells), a method using a cloned animal production technique, and the like can be used, but are not limited thereto.

In the currently established gene targeting method, it is desirable to use ES cells. At present, ES cells have been established in a plurality of mammals such as humans, mink, hamsters, pigs, cows, marmosets, and rhesus monkeys. If similar ES cells are established in more kinds of animals in the future, a genetically modified animal can be produced using a similar method.

An ES cell line for producing a genetically modified mouse is as follows:
You may make it yourself using a known manual,
Existing established ES cell lines are available and preferred. Currently available mouse-derived ES cells include TT2 cells, AB-1 cells, J1 cells, R1 cells,
E14.1 cells, RW-4 cells and the like. Which of the ES cells to use to produce a genetically modified animal can be arbitrarily determined according to the purpose and method of the experiment, such as the mouse strain from which the collected genomic DNA is derived and the method for selecting chimeric animals. it can. The desired ES cell line can be obtained from a specific research institution as needed.
For example, the R1 cells used in the examples herein are derived from the mouse strain 129SVJ and are described, for example, in Andras
Nagy, Samuel Lunenfeld Re
search Institute, Mount S
inai Hospital, (600 Unive
rity Avenue, Toronto M5G 1X
5 Ontario, Canada).

The targeting vector prepared in the above section 2 and containing a sequence in which a part or all of the genomic DNA region of the serine palmitoyltransferase gene is sandwiched between recombinase target sequences is introduced into ES cells. Then, the genomic DNA sequence of the desired serine palmitoyltransferase gene in the ES cells is replaced by homologous recombination with the serine palmitoyltransferase gene sequence sandwiched between the recombination target sequences in the targeting vector. Homologous recombination can be generated stochastically by utilizing the homology between the genomic DNA sequence of the serine palmitoyltransferase gene and the sequence of the unmodified portion in the targeting vector.

As a method for introducing a targeting vector into ES cells, known methods such as an electroporation method, a calcium phosphate method, and a DEAE-dextran method can be used. It is preferable to use the electroporation method in consideration of efficiency, ease of operation, and the like. The method of electroporation is, for example,
(Nakano et al., Eur J Neu.
rosci 1999 Jul; 11 (7): 2577-
81 can be used.

[0071] 4. Screening of homologous recombinants The resulting recombinant ES cells are plated on a plate for selection of mitomycin C-treated NHL7 cells or the like on a feeder cell layer composed of neomycin-resistant primary cultured cells. Then, in the ES culture solution, selective culture, which is the first-stage screening, is performed using the positive selection marker and / or the negative selection marker introduced into the ES cells by homologous recombination. In the first-stage selection step, a plurality of selection marker genes can be used among the selection markers described above.
The culture medium for culturing ES cells may be changed daily. Depending on the type of selectable marker gene, for example, neomycin (G418, GIBCO)
BRL) and hygromycin B (Calbioche)
m) is included. Surviving colonies are collected as resistant clones on day 6-8 of the selective culture.

The resistant clone is picked up and expanded. Then, whether the target serine palmitoyltransferase gene is targeted,
That is, the second-stage screening can be performed in order to surely select a transformant that has undergone homologous recombination.
The second stage of screening is a step of confirming whether the target serine palmitoyltransferase gene has been targeted at the DNA level. As such a method, there are a PCR method, a Southern blot hybridization method and the like, and any of them may be used, or two or more methods may be used in combination.

In the present invention, first, genomic DNA is prepared from each of the pools of ES cell clones selected by the first-stage screening, and this genomic DN is prepared.
The second stage screening is performed on ES cells by performing a PCR method using A as a template. A clone in which recombination has occurred is isolated by screening using this PCR method.

It is desirable to design the PCR primer so that it can be more efficiently confirmed whether or not the target genomic DNA region can be replaced with a foreign gene by targeting. For this purpose, it is preferable that the target vector is set on the genomic DNA region outside the gene of interest and on the selectable marker gene cassette region, and designed so that the insertion site can be amplified. In Example 3 in the present specification, the 5′-side primer U3 / 105 was synthesized as the former, and the 3′-side primer pGK-1 was synthesized as the latter and used as PCR primers.

In the second stage screening, ES
In order to confirm that the cell is a homologous recombinant, an ES cell clone can be analyzed by Southern blot hybridization. The Southern blot hybridization analysis is desirably performed using a probe that recognizes a genomic region not contained in the targeting vector and a probe that recognizes a region present in the targeting vector. By using two types of probes, it is possible to know whether there is non-homologous recombination in addition to homologous recombination, and to more accurately confirm that homologous recombination has occurred in the target genomic region. Because it can be. Alternatively, a probe may be prepared such that bands having different lengths are recognized in a Southern blot between a mutant genome into which a targeting vector has been introduced and a wild-type genome.

How to design these probes depends on which selection marker is used in constructing a targeting vector. In the Southern blot hybridization analysis of the serine palmitoyltransferase gene of the present invention, a genomic DNA fragment obtained by appropriately treating a genomic clone with a restriction enzyme and a probe for a positive selection gene used as a selection marker are used as probes. May be used. Thus, the conditions of Southern blot hybridization can be appropriately modified by those skilled in the art. You can also. Southern blot hybridization can be performed using a known method such as a method using a radioactive isotope such as ³² P or a method using a non-radioactive label such as digoxigenin. From the viewpoints of sensitivity and simplicity, a method using digoxigenin is preferred.

After transforming ES cells with the targeting vector and selecting homologous recombinants, it is preferable to carry out karyotyping to confirm that there is no chromosomal abnormality. Karyotyping is described, for example, by Robertson E. et al.
J. (1987) in Teratocarcino
mas and embryonic stemcel
ls -a practical approach,
ed. Robertson, E.A. J. (IR
L Press, Oxford) pp. 108-
112 and the like. For example, the normal karyotype of a mouse is 2n = 40.
Preferably, the karyotype of the ES cell to be used is confirmed even before the transformation with the targeting vector.

[0078] 5. Modified serine palmitoyl transfer
Preparation of Genetically Modified Animal Having Rase Gene Next, the recombinant ES cells obtained as a result of homologous recombination were
Transfer into the 8-cell stage or blastocyst embryo. A chimeric animal can be prepared by transplanting the ES cell-transplanted embryo into the uterus of a pseudopregnant foster mother and giving birth. Knockout (KO) animals are currently mainly produced for mice. However, in the future, when the technology for genetic recombination of fertilized eggs or embryos can be used for various animals, each animal can also be produced.

The method for transplanting ES cells into embryos is as follows.
For example, a micromanipulation method, an aggregation method (eg, Kondoh et a
l. , 1999, J.A. Biochem. Biop
hys. Methods, 39, 137-142) and the like, but any of them may be used. The method of transplantation can be appropriately modified by those skilled in the art.
In the case of mice, first, female mice superovulated with a hormonal agent (for example, PMSG having FSH-like action and hCG having LH action) are mated with male mice. Thereafter, early embryos are collected from the uterus 2.5 days after fertilization when using 8-cell stage embryos and 3.5 days after fertilization when using blastocysts. The embryos thus recovered were subjected to homologous recombination using a targeting vector, followed by in vivo
Inject in vitro to produce chimeric embryos.

On the other hand, a pseudopregnant female mouse to be used as a foster parent can be obtained by mating a female mouse in a normal cycle with a male mouse castrated by vasectomy or the like.
A chimeric animal can be produced by implanting the chimeric embryo produced by the above-mentioned method into the uterus of the pseudopregnant mouse thus produced and causing the mouse to become pregnant and give birth. In order to ensure that the implantation of the chimeric embryo and pregnancy occur, it is desirable to create a female mouse that collects a fertilized egg and a pseudopregnant mouse that becomes a foster mother from a group of female mice in the same estrous cycle .

From such chimeric mice, male mice derived from ES cell-transplanted embryos are selected. After the selected male chimeric mouse derived from the ES cell-transplanted embryo matures, the mouse is bred to a female mouse of a pure mouse strain, and the coat color derived from the ES cell appears in the next generation of offspring.
It can be confirmed that the ES cells were introduced into the germ line of the chimeric mouse. In order to confirm that the ES cells have been introduced into the germ line, various traits can be used as indices. However, it is preferable to use the coat color in consideration of ease of confirmation. In mice, wild mice (agouti), black (black), ocher (cinnamon), chocolate (chocol)
ate) and white (albino) coat color are known, and the mouse strain to be bred with the chimeric mouse can be appropriately selected in consideration of the ES cell origin used. For example, in the present invention, E-derived from a gray mouse strain (agouti) strain (129 mice) is used.
Male chimeric mice created using S cells are crossed with black C57BL / 6 female mice. The coat color of the offspring of the next generation is a gray mouse color, indicating that the ES cells have been introduced into the germ line of the chimeric mouse. As described above, an animal in which a recombinant ES cell implanted in an embryo has been introduced into the germ line is selected, and an individual deficient in the gene of interest can be obtained by breeding the chimeric animal. By mating the obtained serine palmitoyltransferase gene-deficient heterozygous mice with each other, a target gene-deficient homozygous mouse can be obtained.

Generally, in order to conduct research using experimental animals, it is desirable to use animals that have been established as strains, that is, animals that are genetically homozygous. This is because the genetic background of such an animal has been examined in detail, and only the effect of the treatment applied to the animal can be specified under such a known genetic background. On the other hand, since various genes are present in a heterozygous state in a hybrid animal, it is necessary to determine whether the effect resulting from the treatment on the animal is derived only from the treatment or the genetic background. Is difficult.

In the process of preparing a genetically modified mouse including a KO mouse, crossing is carried out to prepare hybrid progeny in order to confirm whether or not ES cells have been introduced into the germ line using the difference in coat color as an index. It is necessary to carry out the process. Therefore, since many genes exist in a heterogeneous state, it becomes difficult to examine the specific effects solely due to deletion of the serine palmitoyltransferase gene. Therefore, in order to extract only the specific effects of gene deficiency, the resulting gene deficient mice were backcrossed with a pure mouse strain, and all genes including the targeted gene were genetically homozygous as much as possible. Preferably, it is in a state. In order to obtain an animal having a desired genetic constitution, it is preferable to perform backcrossing with about 5 to 8 generations of the same strain. Those skilled in the art can appropriately select a mouse used for backcrossing.
As a mouse that can be used, for example, BALB
/ C, C57BL / 6, DBA11, ICR, etc., but are not limited thereto. In addition, if backcrossing is performed only by natural crossing, it may take a long time. Therefore, if it is desired to change generations quickly, an in vitro fertilization technique can be appropriately used.

Genetically modified animals having the modified serine palmitoyltransferase gene containing the recombinase target sequence thus obtained can be obtained by using a known or prepared recombinase protein that expresses a recombinase protein in a time-specific and / or tissue-specific manner. By breeding with an expressed gene-modified animal, it becomes possible to produce a conditional knockout animal of the serine palmitoyltransferase gene (7, etc., described below). Thus, such genetically modified animals (including their eggs, sperm, fertilized eggs, embryonic tissue / organ cultures, etc.) are useful and are included in the scope of the present invention.

[0085] 6. Deletion of positive selection sequence When the targeting vector contains a sequence for selecting only embryonic stem cells into which the targeting vector has been introduced, that is, when the targeting vector contains a sequence for positive selection, the chromosome into which the targeting vector has been introduced is subjected to positive selection. Sequence has been inserted. If the positive selection sequence remains, the conditional knockout animal finally obtained may have adverse effects such as disrupting the expression of the Lcb2 gene itself and causing developmental disorders not only in the early developmental stage. Therefore, the method of the present invention preferably includes a step of deleting a positive selection sequence from chromosomal DNA.

To facilitate deletion of sequences for positive selection, the recombinase protein / recombinase target sequence system described above for the serine palmitoyltransferase gene can be utilized. Therefore, although not limited, a positive selection sequence is included between two recombinase target sequences in the same direction in a targeting vector, and this is introduced into a chromosomal genome. Then, by crossing the genetically modified animal having the modified serine palmitoyltransferase gene obtained in the above item 5 with a homologous animal expressing the recombinant protein, the positive selection sequence can be deleted by the recombinant activity. At this time, the recombinase protein does not need to delete (all or part of) the serine palmitoyltransferase gene flanked by the recombinase target sequences, and need to selectively delete only the positive selection sequence.

A specific methodology is described, for example, in Dynek.
i, S. M. Et al. (2000, Gene Target)
ing -a practical aproac
h, 2nd edition, ed. Joyn
er, A .; L. (Oxford Univ. Pr
ess), pp. 68-73).

As one of the most efficient methods, the recombination target sequence flanking the positive selection sequence should be derived from a recombination target different from the recombination target sequence used for the modified serine palmitoyltransferase gene, and It is conceivable to breed with genetically modified animals that express different recombinases depending on the situation. Specifically, the positive selection sequence was FRT derived from yeast, and the modified serine palmitoyltransferase gene was replaced with loxP derived from bacteriophage.
I put it between. This is expressed in mouse or ES cells by FR.
By acting on the recombination flp targeting T, only the positive selection sequence can be deleted. At this time, fl
Since p cannot act on loxP, the modified serine palmitoyltransferase gene is not deleted.

On the other hand, the second embodiment described later in this specification
The targeting vector created in step 3) has a positive selection sequence sandwiched between two recombinase target sequences, and a part of the serine palmitoyltransferase gene (third exon) sandwiched between another recombinase target sequence of the same species as “3 recombinases”. Target sequence type. "
In this case, the above-described method utilizing the difference in the types of recombinations cannot be used. However, there is an advantage that the construction of a targeting vector is simpler than the above-mentioned method using two types of recombinant target sequences. In this case, it is possible to express the corresponding recombinase in a mammalian individual or ES cells in a limited manner, and to select one from which only the positive selection sequence has been deleted.

For example, in Example 6 of the present specification, Lak
so, M.S. et al. , 1996, Proc. N
atl. Acad. Sci. USA, 93, 58
EIIaCre transgenic mice described in Nos. 60-5865 (for example, National Institutes of Health (NIH)
(Available from Dr. Heimer Westphal, USA). EIIaCre transgenic mice can be obtained by deleting only the positive selection sequence by the following mechanism.

EIIaCre transgenic mice have been reported to express Cre recombinase also in germ cells and their fertilized eggs (Lakso, M. et al., Mol.
et al. , 1996, Proc. Natl.
Acad. Sci. USA, supra). However, in a child (F1) obtained as a result of crossing with mice actually containing two loxP (flox), two loxP (flox) were obtained.
The deleted version of the inter-xP sequence is mosaic throughout the body. In addition, E1aCre obtained by crossing F1 with a wild type is obtained.
Since F2 containing no gene becomes a single deleted type, its expression level / state is considered to differ greatly between individuals or between cells in the same tissue (unpublished data). "3 recombination target sequence type (3lox
In the case of “P type)”, for example, utilizing this property, EII
By breeding with aCre transgenic mouse, a mouse from which only the positive selection sequence has been deleted can be obtained.

Furthermore, in order to delete the positive selection sequence, recombinase activity is required.
In order to use a conditional knockout animal for serine palmitoyltransferase gene,
Preferably, the recombinant gene is not on the same genome as the serine palmitoyltransferase gene. Therefore, preferably, the genetically modified mouse of the first generation (F1) obtained by performing the cross is backcrossed with a wild-type mouse, and the sequence for positive selection is deleted in the second generation (F2). Heterozygotes that are absent and do not have a recombinant gene are selected. Selection of a preferable heterozygote can be carried out by using the PCR method, Southern blotting method or the like used in the screening described in the above item 4.

After obtaining a heterozygote from which the positive selection sequence has been deleted, mating is performed as necessary to obtain a genetically homogenous animal as described in detail in section 5. You may.

Alternatively, deletion of the positive selection sequence can be performed at the ES cell level before transforming the homologously recombined ES cell obtained in 4 above into a mammal. For example, it can be performed as follows.

The concept is described, for example, in Dynecki, S .;
M. Et al. (2000, Gene Targeting-
a practical approach, 2nd
edition, ed. Joyner, A .;
L. (Oxford Univ. Press),
pp. 68-73). The following are, by way of example, Taniguchi, M et al. (Nucleic
Acids Res. 1998 Jan 15; 26
(2): 679-80. )It is described in.

Specifically, first, a Cre expression vector (pCre-pac) having puromycin N-acetyltransferase (puromycin resistance gene) as a selectable marker was added to the modified ES cells of the 3 recombination target sequence type (3loxP type). ) Is transduced by the method described in Example 3 below. After the introduction, for example, puromycin is only positively selected for Cre expression for 2 days. Then, it is possible to select a clone from which only the positive selection sequence has been deleted by using a PCR method, a Southern blotting method, or the like.

[0097] 7. Serine palmitoyl transferer
Preparation of Conditional Knockout Animal of Zy Gene Next, the genetically modified animal is bred with a recombinantly-expressed gene-modified animal that expresses a recombinant protein in a stage-specific and / or tissue-specific manner, and the conditional expression of the serine palmitoyltransferase gene Get knockout animals.

Since the recombinant protein itself does not show any toxicity to individuals, a recombinant-expressing gene-modified animal that expresses the recombinant protein in a time-specific and / or tissue-specific manner is prepared, for example, as follows. Can be done.

The concept is described, for example, in Dynecki, S .;
M. Et al. (2000, Gene Targeting
-A practical approach, 2n
edition, ed. Joyner, A .;
L. (Oxford Univ. Press),
pp. 75-81).

In general, a genetically modified animal having a gene in which a recombinase expression sequence is linked to a promoter sequence enabling expression in a stage-specific and / or tissue-specific manner is prepared. As a method for producing this genetically modified animal, there are a transgenic method and a knock-in method. The transgenic method is a method in which the above-described gene is introduced from the outside, and is obtained by directly injecting the gene into a fertilized egg. The knock-in method is a method of introducing a recombinant expression sequence by homologous recombination behind an endogenous promoter, constructing a targeting vector for the promoter, transforming the cells into ES cells, selecting an appropriate modified ES cell, and then transducing a genetically modified animal. Make it.

Although the transgenic method has fewer experimental steps than the knock-in method and can obtain a genetically modified animal more quickly, the promoter introduced from the outside is targeted because the specificity is lower than that of the endogenous promoter. Recobinase protein may not be expressed in stage and / or tissue. Further, as a phenomenon peculiar to the transgenic method, a gene introduced from the outside may not be well expressed, and the knock-in method has recently become mainstream.

Alternatively, recombinase-expressing gene-modified animals that express the recombinase protein in a stage-specific and / or tissue-specific manner can be obtained from a research institution or commercially available. . In particular, research is progressing on the Cre-loxP system. Many are Samuel Lunen
felt Research Institute (M
out SinaiHospital, Toron
Andra, Ontario, Canada)
s Nagy's homepage (http: // www
w. mshri. on. ca / nagy /).

For example, the Cr used in the examples of this specification
A K5-CreTg transgenic mouse that specifically expresses e only in the epidermis and a lck-Cre transgenic mouse that specifically expresses only T cells are available from the present inventor, Junji Takeda, Osaka University School of Medicine.
Furthermore, nestin-Cre transgenic mice that express Cre in a nerve cell-specific manner,
CD19-Cre transgenic mice that specifically express B cells are also known. In the genetically modified animal, the recombinant gene may be present in a homologous state or a heterologous state.

As an alternative to the recombinantly-expressed gene-modified animal, a particle gun, ointment, or the like, in which a virus or a gold particle is directly injected into cells of the intended genetically-modified animal into which the recombinant-expression vector or lycobinase protein has been incorporated the target recombinant sequence. A method of restricting introduction by a method via the above-mentioned method can also be used in the present invention.

The recombinant-expressing gene-modified animal expressing the recombinant protein in a time-specific and / or tissue-specific manner is obtained by modifying the modified serine palmitoyl containing the target sequence for recombinase obtained in the above 5 (or 6). By mating with a homozygous or heterozygous animal of a genetically modified animal having a transferase gene, a conditional knockout animal of the serine palmitoyltransferase gene is obtained.

Specifically, first, when a wild-type serine palmitoyltransferase gene is present in a homozygous state in a recombinant expression gene-modified animal,
A step of deleting this in a heterologous state is required. As described above, when the serine palmitoyltransferase gene is homozygously deleted and completely inactivated, it is highly possible that the embryo is lethal. Therefore, it is first necessary to obtain a recombinantly-expressed gene-modified animal in which the serine palmitoyltransferase gene is deleted in a heterologous state. This is because of genetically modified animals that express the recombinant in germ cells (eg, EIIa-Cre).
Transgenic mouse, CAG-Cre transgenic mouse), the homozygote of the genetically modified animal having the modified serine palmitoyltransferase gene containing the recombinase target sequence of the present invention obtained in the above section 5 (or section 6) or Crosses with heterozygotes (preferably homozygotes). Then, as in the previous section, P
A preferred heterozygote in which the serine palmitoyltransferase gene has been deleted in a heterologous state can be selected using the CR method, Southern blotting method, or the like. The heterozygote has a heterozygous deletion of the serine palmitoyltransferase gene at a specific time and / or in the tissue in which the recombinant is expressed.

Alternatively, the purpose of deleting the serine palmitoyltransferase gene in a heterologous state is not limited to the method of breeding with a genetically modified animal having the modified serine palmitoyltransferase gene containing the recombinant target sequence of the present invention. Using a known technique for producing a knockout gene-modified animal, it is possible to obtain a knockout gene-modified animal in which the serine palmitoyltransferase gene has been deleted in a heterologous state.

Next, the knockout gene-modified animal in which the serine palmitoyltransferase gene has been deleted in a heterologous state further has the modified serine palmitoyltransferase gene containing the target sequence for recombination obtained in the above section 5 (or section 6). It is crossed with homozygotes or heterozygotes (preferably homozygotes) of the genetically modified animal. Then, a certain percentage of progeny having a chromosome lacking the serine palmitoyltransferase gene derived from the former and a chromosome having the modified serine palmitoyltransferase gene containing the recombinase target sequence derived from the latter are obtained. this is,
Non-human mammals in which the expression of the serine palmitoyltransferase protein is suppressed in a time-specific and / or tissue-specific manner by the expression of the recombinant in a time-specific and / or tissue-specific manner, ie, a conditional expression of the serine palmitoyltransferase gene Provide knockout animals.

The experiments in the present invention are performed based on in-house ethical guidelines for animal experiments and safety guidelines for gene manipulation experiments.

[0110]

The conditional knockout mammal of the present invention provides a very powerful tool for studying the physiological functions of sphingolipids in mammals, including biological membrane functions. In the conditional knockout mammal of the present invention, the expression of serine palmitoyltransferase protein is regulated in a time-specific and / or tissue-specific manner. Thus, the sphingolipids are developed and grown at various times, at various places in the body, and at what kind of physiological functions, by determining the expression of serine palmitoyltransferase protein and / or at various tissues. For example, it became possible for the first time to investigate by systematic control.

For example, it was shown that when the sphingolipid biosynthesis function is deleted from the whole individual, that is, from the level of a fertilized egg, a mouse individual cannot survive the early development (Example 7).

It was also observed that mice lacking sphingolipid biosynthesis function specifically in the epidermis had no hair growth, and even when they did, they had fewer hairs than the wild type (Example 8). By the age of four weeks, they had all died.
In addition, some mice seemed to be inflamed. The knockout mouse in which the sphingolipid biosynthesis function is specifically deleted in the epidermis is particularly useful for studying the function of sphingolipid as a cell membrane constituent. In addition, from the nature that the body hair is less or hardly compared to the wild type, research on skin transplantation, study the effect on skin of compositions or compounds such as pharmaceutical compositions, cosmetics, dietary supplements, life improvement products, etc. It is useful as a model animal.

[0113] Furthermore, it was observed that the mice lacking sphingolipid biosynthesis function specifically in T cells have reduced T cell differentiation and maturity (Example 9). This mouse is particularly useful for studying the immune system associated with T cells, for example, analyzing the mechanism of genetic diseases and allergies accompanied by disruption of immune function, establishing therapeutic methods, and developing immunosuppressants.

[0114] Sphingolipids, particularly gangliosides (glycosphingolipids), are classified as lipids abundant in nervous system tissues such as the brain. Since the composition varies greatly depending on each nerve tissue, a relationship with each function has been suggested for a long time. Therefore, the genetically modified mammal obtained by the present invention, which specifically lacks sphingolipid biosynthesis function in each nerve tissue, is expected to be useful in brain function research, which has been remarkably advanced in recent years. Reference 1. "Caveola and Raft" Fujimoto et al., Cell Engineering Vo
l. 18, No. 8, 1999, p. 1155-116
1; "The role of rafts in T cell antigen receptor signaling," Yasuda et al., Protein Nucleic Acid Enzyme Vol. 45,
No. 11 (2000), p. 1812-1822.

3. Journal of Biolo
medical Chemistry, Vol. 267,1
992, p. 23527-23533 4. Hanada, K et al. , Journ
al of Biological Chemistr
y, Vol. 272 (51), 1997, p. 321
08-32114 5. Nagiec, M .; M. et al. , Gen
e 1996 Oct24; 177 (1-2): 237
-41 6. Separate volume experimental medicine The protocol series
"The Latest Technology of Gene Targeting" (2000, Yodosha) Conditional Targeting Method p. 115-
120 7. Bio Manual Series 8 “Gene Targeting” —Generation of Mutant Mice Using ES Cells (199
5 years, Yodosha) p. 71-77) 8. Sambrook et al., Molecular Cl.
oning: A LABORATORY MANUA
L, 3rd edition, COLD SPRING HARBOR
3. LABORATORY PRESS, 2001, 4.
82-4.85 9. Nakano et al. , Eur J Ne
urosci 1999 Jul; 11 (7): 257
7-81 10. Yagi et al. , 1993; Ana
l. Biochem. 214; 77-86 11. Robertson E. J. (198
7) in Teratocarcinomas an
de embryonic stem cells-a
Practical approach, ed. R
obertson, E .; J. (IRL Pres
s, Oxford), pp. 108-112 12. Kondoh et al. , 1999,
J. Biochem. Biophys. Meth
ods, 39, 137-142 13. Dynecki, S.M. M. et al. , 2
000, Gene Targeting -a pr
physical approach, 2ndediti
on, ed. Joyner, A .; L. (Oxf
ord Univ. Press), pp. 68-7
3 14. Lakso, M .; et al. , 199
6, Proc. Natl. Acad. Sci. US
A, 93, 5860-5865 15. Taniguchi, M et al., Nuclei
c Acids Res. 1998 Jan 15;
26 (2): 679-80 Dynecki, S.M. M. et al. , 2
000, GeneTargeting -a pr
physical approach, 2ndediti
on, ed. Joyner, A .; L. (Oxf
ordUniv. Press), pp. 75-81 17. Osuka, S .; et al. , Cytog
enet CellGenet 1998; 82 (3-
4): 222-3 Nagy et al. Pro, 1993;
c. Natl. Acad. Sci. USA, 90; 84
24-8428 19. Taniuchi et al. , EMBO
J. 1995 14: 3663-3678 20. Yumi Matsuzaki et al. (1999) Flow cytometry freely, supervised by Keimitsu Nakauchi (Shujunsha) pp3-13

[0116]

Hereinafter, the present invention will be described with reference to Examples.
The examples are for illustration and do not limit the invention. The scope of the present invention is determined based on the description in the claims. Furthermore, those skilled in the art can easily make modifications and changes based on the description in this specification.

Example 1 Exo of mouse Lcb2 gene
Screening of genomic DNA containing motif 3 First, the full length amino acid sequence of the mouse Lcb2 protein (N
agiec, M .; M. et al. , Gene 199
6 Oct 24; 177 (1-2): 237-41).
(SEQ ID NO: 2) was labeled in the presence of ³² P-dCTP by a random prime labeling method. Using this as a probe, a 129 SVJ mouse genomic library was screened.

When the restriction enzyme cleavage site and the nucleotide sequence of the positive phage clone were examined, two independent chromosomal DNA fragments of the Lcb2 gene (Lcb2-A,
A phage clone (A, B) having Lcb2-B) was obtained. The restriction maps of Lcb2-A and Lcb2-B are described in FIG.

[0119] The nucleotide sequence of the cDNA encoding the mouse Lcb2 protein is known, for example, Gene.
bank accession No. U27455 (SEQ ID NO: 2). Lcb2-A corresponds to exon 2 (bases 148 to 34 of the cDNA of SEQ ID NO: 2).
2c), a fragment of about 12.6 kb in length, Lc
b2-B is exon 3 (bases 343 to 4 of cDNA)
97, 4) (bases 498 to 64 of cDNA)
6), 5 (bases 647 to 771 of cDNA), 6
It was a fragment of about 13 kb in total length up to (bases 772 to 865 of cDNA).

Among them, a chromosomal DNA fragment Lcb2-B was used as a probe and FISH (fluorescence) was used.
In situ hybridization) was performed. As a result, it was confirmed that the mouse Lcb2 gene is a gene of one copy per chromosome located in the E region of chromosome 12 (Osuka, S. et a).
l. , Cytogenet Cell Genet 1
998; 82 (3-4): 222-3).

Example 2 Preparation of Targeting Vector A targeting vector was prepared according to the strategy shown in FIG. 1) pBS-Lcb2B (1) floxed pGK-
Preparation of neo DNA was extracted from the phage clone B, and NotI was extracted.
, And 1% agarose gel electrophoresis was performed.
2-B (about 13 kb) was recovered, and this was cut with NotI plasmid pBluescript II KS +
(Stratagene) and ligated with T4 ligase to transform Escherichia coli DH5α (available from TOYOBO, etc.) and to transform the plasmid “pBS-Lcb2B”
I got

The plasmid pBS-Lcb2B was
After digestion with tI and XhoI, 1% agarose gel electrophoresis was performed. A DNA fragment corresponding to about 5 kb was recovered, and N
Plasmid pBluesc cut with otI and XhoI
Ript II KS + (Stratagene)
And T4 ligase. Next, Escherichia coli DH5α was transformed using this, and the plasmid “pBS
-Lcb2B (1) "was obtained.

On the other hand, plasmid loxP-flanke
d-pGK-neo (Nakano et al., Eu
r J Neurosci 1999 Jul; 11
(7): 2577-81) (available from the present inventor, Junji Takeda, Osaka University School of Medicine), cut with NotI, and T4D
The ends were blunt-ended using NA polymerase. Then 1
% Agarose gel electrophoresis, and the pGK-neo expression unit corresponds to a portion sandwiched by loxP.
A 3 kb DNA fragment was recovered. The plasmid pBS-Lcb2B (1) was digested with EcoO109I, blunt-ended using T4 DNA polymerase, and ligated using T4 ligase. Next, Escherichia coli DH5α was transformed using this, and the plasmid “pBS
-Lcb2B (1) floxed pGK-neo "was obtained.

However, in this method, the pGK-neo expression unit is pBS-Lcb2B (1) floxed pG
There is a possibility to enter both directions with respect to K-neo. The one inserted in the forward direction was 4.3 when cut with EcoRI.
A DNA fragment corresponding to kb is obtained. Therefore, the plasmid obtained in the previous section was digested with Eco RI and 1%
After agarose gel electrophoresis, a 4.3 kb band was obtained.
Hereinafter, it was used as pGK-neo.

2) Preparation of pBS-Lcb2B (2) loxP pBluescript II KS + was converted to HindII.
I and blunt-ended using T4 DNA polymerase. Then, 1% agarose gel electrophoresis was performed,
Ligation was performed using T4 ligase. Next, Escherichia coli DH5α was transformed using this, and plasmid pBKS (H
indIII (-)) was obtained.

The plasmid pBS obtained in step 1)
-Lcb2B (1) was cut with EcoRV and XhoI. The cleavage reaction product was subjected to 1% agarose gel electrophoresis, and a DNA fragment corresponding to about 1.9 kb was recovered. The DN
The A fragment was ligated with the plasmid pBKS (HindIII (-)) cut with EcoRV and XhoI using T4 ligase. Next, Escherichia coli was transformed using the resultant to obtain a plasmid “pBS-Lcb2B (2)”.

First, the following two synthetic primers were prepared and their 5 ′ ends were phosphorylated by T4 DNA kinase:

[0128]

[ Image Omitted] Upstream of loxP (SEQ ID NO: 4): HindIII (EcoT22I) 5′- ataacttcgtataatgtatgctatacgaagttat aagcttgca-3 ′ 3′-acgt tattgaagcatattacatacgatatgcttcaata ttcga-5 ′ (EcoT22I) and both downstream sequences: Was mixed at 5 μM, and the mixture was mixed at
After boiling for 10 minutes and cooling to room temperature overnight, the synthetic double-stranded DNA “loxP-
HindIII (EcoT22I) ". lo
xP-HindIII (EcoT22I) has 3
It has a loxP sequence (underlined) consisting of 4 bases,
At the 3 'end, a HindIII cleavage site (aagct
t), and both ends have protruding ends consisting of 4 bases (tgca) corresponding to the EcoT22I (NsiI) cleavage site.

Next, the plasmid pBS-Lcb2B
(2) was cut with EcoT22I and subjected to 1% agarose gel electrophoresis. After collecting the 5 kb bunt,
The double-stranded synthetic DNA "loxP-HindII"
I (EcoT22I) "was ligated using T4 ligase. Next, Escherichia coli DH5α was transformed with the plasmid, and the plasmid “pBS-Lcb2B (2) loxP” was used.
I got

However, in this method, loxP-HindI
II (EcoT22I) is multiplexed and inserted in forward and reverse directions. By determining the base sequence of pBS-Lcb2B (2) loxP, loxP-HindIII (Eco
T22I) was selected in which only one was inserted in the forward direction (that is, HindIII was located downstream of the Lcb2 gene in pBS-Lcb2B (2)).

3) Plasmid Lcb2TV3DTApA
Preparation of (Targeting Vector) Plasmid pBS-Lcb2B (1) f prepared in 1)
Loxed pGK-neo was digested with XbaI and NdeI, and subjected to 1% agarose gel electrophoresis to obtain about 4.8 k
The DNA fragment of b was recovered. The same operation was performed, and the plasmid pBS-Lcb2B (2) loxP prepared in 2) was used.
Was digested with NdeI and XhoI to obtain a DNA fragment of about 1.7 kb. In addition, the plasmid p obtained in the step 1)
BS-Lcb2B (1) was cut with XhoI and Asp718I to obtain a DNA fragment of about 5 kb, and plasmid p.
Bluescript II KS + was transferred to Asp718I
And XbaI, a DNA fragment of about 3 kb was recovered. Next, these four DNA fragments were ligated using T4 ligase, E. coli DH5α was transformed, and the plasmid “Lcb
2TV3 "was obtained.

On the other hand, plasmid pMC1DTApA (Y
agi et al. , 1993; Anal. Bioc
hem. 214; 77-86) (obtained from Professor Yagi Takeshi, Osaka University Cell Biotechnology Center) was cut with NotI and blunt-ended using T4 DNA polymerase.
Next, it was cut with XhoI. Further, 1% agarose gel electrophoresis was performed to collect a DNA fragment corresponding to about 1.3 kb, which was designated as "MC1DTApA".

Next, the plasmid pBluescript was separately prepared.
ptII KS + is cut with Asp718I and then T4DN
The ends were blunted using A polymerase. Next, Xho
The DNA fragment was cleaved with I and subjected to 1% agarose gel electrophoresis to recover a DNA fragment corresponding to about 3.0 kb. This was combined with the MC1DTApA using T4 ligase,
E. coli was transformed and the plasmid "pBS / MC1DT" was transformed.
ApA "was obtained.

The plasmid Lcb2TV3 and the plasmid pBS / MC1DTApA were each cut with Asp718I, blunt-ended with T4 DNA polymerase, and then cut with NotI. Further, 1% agarose gel electrophoresis was performed, and about 4.2 kb and about 11.5 kb were respectively obtained.
Was recovered. Both were ligated using T4 ligase, and Escherichia coli DH5α was transformed to obtain a plasmid “Lcb2TV3DTApA”. Hereinafter, the plasmid “Lcb2TV3DTApA” was used as a targeting vector for preparing Lcb2 knockout (KO).

Example 3 Targeting System for ES Cells
Introduced ES cells of the vector are described in Nagy et al. , 1993; Pr
oc. Natl. Acad. Sci. USA, 90; 8
424-8428, the R1 cells (Antras N
agy, Samuel Lunenfeld Rese
arch Institute, Mount Sin
ai Hospital, (600Universi
ty Avenue, available from Toronto M5G 1X5). In the following examples, the cells were all cultured in a 5% CO ₂ incubator at 37 ° C.

20% FBS (Fetal Bovine)
Serum: fetal bovine serum, Life Tech, etc. and 1000 units / ml mLIF (leukoc)
DMEM medium (Dulbecco's modified Eagle medium) supplemented with Yteinhibitory factor (trade name: ESGRO (trademark)) (Chemicon)
(Hereinafter referred to as “ES medium”) with respect to R1 cells maintained in Lcb2KO targeting vector (“Lcb2
TV3DTApA ") was cut with NotI to give 20
μg and electroporation method (Nakano
et al. , Eur J Neurosci 1
999 Jul; 11 (7): 2577-81).

Specifically, the day before the electroporation was performed, R1 cells exchanged with a fresh ES medium were collected, and an electroporation solution (20 mM HE) was used.
PES, pH 7.05, 137 mM NaCl, 5 m
MKCl, 0.7 mM Na ₂ HPO ₄ , 6 mM dextrose). 10 ⁷ R1 cells were transferred to N
20 μg of the targeting vector “Lcb2TV3DTApA” linearized with otI and 0.8 ml of an electroporation solution were mixed in an electroporation cuvette. Then mBio-Ra
d GenePulser (manufactured by Bio-Rad) was used to give an electric pulse under the conditions of 240 V and 500 μF.

After suspending in 10 ml of ES medium, ES cells were collected by centrifugation, suspended in 6 ml of ES medium, and per 10 ml dish previously seeded with feeder cells in 8 ml of ES medium. , 2 ml of this ES cell suspension was added, and after 12-18 hours, the titer was 150 μl.
g / ml of G418 (manufactured by Gibco BRL) was added and cultured for one week.

As feeder cells, the present inventors have used HS1 knockout mice (Taniuchi et al.).
al. , EMBO J .; 1995 14: 3664
-3678) and a female of a wild type ICR line,
Fibroblast cells established from the embryos on days 12 and 13 were used.

Example 4 ES cells having undergone homologous recombination
In Example 3, ES cell colonies generated by culturing for 7 days after the addition of G418 were collected. LCB2CK
Because of the integration of the diphtheria toxin A (DTA) subunit expression cassette into the O targeting vector for negative selection, many of the heterologous recombinants are eliminated before colony formation.

Each colony was divided into two, and the culture was continued on one of them. The other was washed with PBS- to select clones that had undergone the desired homologous recombination.
After the Nase K treatment, chromosomal DNA was recovered and clones were selected by PCR.

The base sequences of the synthetic primers used in the PCR are as follows:

[0143]

Embedded image Primer U3 / 105 (SEQ ID NO: 6): 5′-gtgctgcttagggttttccattttc
agccacat-3 '(base sequence outside the constructed targeting vector) Primer pGK-1 (SEQ ID NO: 7): 5'-tagtgagacgtgctacttccat
ttgtcacg-3 ′ (base sequence outside the neo gene expression unit) The PCR conditions were 94 ° C. for 1 minute, 60 ° C. for 1 minute, 68 ° C.
The PCR product is subjected to 1 cycle of 1% agarose gel electrophoresis, and the expected PCR product (approximately 2.2 kb) when homologous recombination is performed correctly.
Clones that produced a band at a position corresponding to were determined to be positive. Of the 224 clones collected by this method, 16 were positive.

To more accurately confirm homologous recombination,
Culture was continued for each of the 16 clones positive in the preceding paragraph, and chromosomal DN
A was extracted and subjected to Southern blotting as follows.

After cutting 20 μg of the chromosomal DNA with HindIII, 1% agarose gel electrophoresis was carried out and transferred to a nylon membrane Hybond-N + (Amsham Pharmacia Biotech) using a 10 × SSC solution by the capillary method. XbaI and HindI immediately 5 'outside of the constructed targeting vector
The chromosomal DNA fragment (433 bp, “5 ′
Using the “probe”) as a probe, the chromosomal DNA transfer membrane was subjected to Southern blotting using a d-digoxigenin (DIG) hybridization system (Roche Diagnostics).

The wild type in which the mutation was not introduced was about 5.9.
When the homologous recombination of the kb band is performed correctly, a band of about 2.5 kb is expected. About 5.9 kb and about 2.5 kb bands were observed at a ratio of 1: 1 in all 16 clones (heterozygotes).

After cutting 20 μg of the chromosomal DNA with SacI, the mixture was subjected to 0.8% agarose gel electrophoresis, and transferred to a nylon membrane Hybond-N + by a capillary method using a 10 × SSC solution. Using the 5 ′ probe, the transfer membrane was subjected to Southern blotting using a DIG hybridization system.

Approximately 10.
A wild-type in which a 5 kb band is shown, but the mutation is not introduced, shows a band of about 8.5 kb, and a band having a different size when a heterologous recombinant is contained. 16 above
Among the clones, a band having a size suggesting a heterologous recombinant was found in 4 clones.

After cutting 20 μg of the chromosomal DNA with HindIII, 1% agarose gel electrophoresis was carried out and transferred to a nylon membrane Hybond-N + by a capillary method using a 10 × SSC solution. The transfer membrane was subjected to Southern blotting with a probe corresponding to the full length of the neomycin resistance gene using a DIG hybridization system.

If homologous recombination in which the loxP sequence on the 3 'side of exon 3 was correctly inserted was performed, about 3.4 kb
Is confirmed. On the other hand, 3 'side loxP
When the sequence is not inserted, a band of about 5.9 kb is observed.

Homologous recombinant 1 not containing non-homologous recombinant 1
It was confirmed that the 3 'loxP sequence was correctly inserted into 7 clones with respect to 2 clones. Karyotype analysis was performed on these 7 clones to confirm that there was no chromosomal abnormality (Robertson EJ.
(1987) in Teratocarcinoma
s and embryonic stem cell
s-a practical approach,
ed. Robertson, E .; J. (IRL
Press, Oxford), pp. 108-11
2). Of these, the normal karyotype (2n =
40) was observed.

Example 5 Modified serine palmitoyl tolan
Preparation of Genetically Modified Animal Having Spherase Gene Production of a mouse having the same chromosomal DNA as the homologous recombinant ES clone obtained from the above steps was performed by an aggregation method (Kondoh et al., 1999, J. Am.
Biochem. Biophys. Method
s, 39, 137-142).

After culturing ES cells in which homologous recombination was confirmed to have occurred, the cells were subcultured about every 24 hours and continued for 4 days, the cells were dispersed by trypsin treatment. An 8-cell stage embryo was extracted from a female of the same strain, which was mated with a male of the mouse BDF1 strain. After removing the zona pellucida from the embryos, the above-mentioned ES cells separated were adhered (20E).
S cell / one 8-cell stage embryo). This was transferred to the uterus of a female mouse that had been subjected to pseudopregnancy treatment, and the development of a fetus was continued to obtain a chimeric mouse.

The male of this chimeric mouse was black
BL / 6 females were bred and a mouse of the mouse gray color (agouti) was selected from the offspring born, and chromosomal DNA was extracted from a sample in which a part of the tail was cut off. Example 4
The mouse in which the gene mutation was introduced into the whole body was confirmed by the Southern blotting method (HindIII cleavage / “5 ′ probe” detection) described in (1).

According to the method described above, a total of 26 chimeric mice were first produced from the five homologous recombinant ES clones. Ten of them were bred to obtain 74 pups. Southern blot analysis confirmed that 27 of them had the gene mutation introduced into the whole body, and a "hetero" zygote was obtained for the mutant Lcb2 gene. Further, the “hetero” zygotes are crossed to each other to obtain a mutant Lcb2 gene “L
A "homo" conjugate for "cb2target" was obtained.

Example 6 Deletion of Neo gene At this stage, the neomycin gene expression cassette was inserted into the mutation introduced into the mouse Lcb2 gene on the mouse chromosome. To delete this expression cassette, E
IIaCre transgenic mice (Lakso,
M. et al. , 1996, Proc. Natl.
Acad. Sci. USA, 93, 5860-5
865) (obtained from Dr. Heimer Westphal of the National Institutes of Health (NIH) (USA)). The activity of the Cre recombinase expressed by the EIIaCre gene expression cassette excises the neo gene expression cassette flanked by loxP.

Specifically, the mutant Lc obtained in Example 5
A mouse (male) (homozygote) having the b2 gene and a homozygous EIIaCre transgenic mouse (female) were bred to obtain a first generation (F1) mouse in which the neo gene expression cassette had been deleted. In the resulting mouse, ne
o The mouse in which deletion of the gene expression cassette was recognized was screened by Southern blotting (HindIII cleavage / detection of “5 ′ probe”) described in Example 4.
Specifically, when only the neo gene expression cassette is deleted (“Lcb2flox”), a band of about 3.6 kb is confirmed. On the other hand, for the detection of the EIIaCre gene expression cassette, chromosomal DNA extracted from a part of the tail was used.
Was subjected to Southern blotting. Chromosomal DNA
After cutting 20 μg with BamHII, 1% agarose gel electrophoresis was performed, and the resultant was transferred to a nylon membrane Hybond-N + by a capillary method using a 10 × SSC solution. A DNA fragment corresponding to a part of the Cre gene (Eco
The Southern blotting was performed on the transfer membrane by a DIG hybridization system using as a probe 1.1 kbp of RI cut (Cre probe). EII
Mice carrying the aCre gene are approximately 5.5, 4.5,
A 2.5 kb band is observed.

A mouse (male) having a mutant Lcb2 gene (homozygote) and a homozygous EIIaCr
A total of 10 chimeric mice F1 (3 males and 7 females) were obtained from one set of e-transgenic mice (female). Among them, deletion of the neo gene expression cassette was strongly observed in one male, and the EIIaCre gene was heterozygously present.

Next, the chimeric mouse (male) was bred to a wild-type C57BL / 6 mouse (female), and the second generation (F)
2) 9 ("hetero" conjugates) were obtained (4 males, 5 females). Among them, those showing the Lcb2flox band (about 3.6 kb) and the wild type band (about 5.9 kb) in a one-to-one correspondence were selected by Southern blotting with HindIII digestion and 5 ′ probe detection. L by Southern blot
A close ratio of cb2flox and wild-type band of 1: 1 was observed in 2 males, but all had heterologous EIIaCre gene.

Preferably, the EIIaCre gene expression cassette is not integrated into the genome. So male 1
The animals were bred again with wild-type C57BL / 6 (female) and
3 (4 males, 6 females) were obtained. Among them, mice not having the EIIaCre gene expression cassette were selected as intended heterozygotes by the Cre gene detection method using the Southern blot. As a result, L
Three females were obtained in which the cb2flox and wild-type bands were completely one-to-one and did not have the EIIaCre gene.

Further, the selected heterozygotes were bred with each other to obtain “homo” zygotes for the mutant Lcb2 gene “Lcb2flox” from which the neo gene had been deleted. FIG. 5 shows the flow of the strategy for producing the conditional knockout mouse of the present invention described in Example 2-6.

Example 7 CAG-Cre transgenic
Level of fertilized egg for sphingolipid biosynthesis using sucking mouse
In the present example, the sphingolipid biosynthesis function was
That is, the effect of deletion from the fertilized egg level was examined. Specifically, the strategy shown in FIG. 6 was followed.

The C protein expressing Cre protein in the whole individual
AG-Cre transgenic mice were purchased from Osaka University.
Obtained from Professor Junichi Miyazaki, School of Medicine. From this, first, a knockout mouse having the Lcb2 gene heterozygously deleted and also having the Cre gene heterozygously by the following cross was obtained.

Specifically, the mutant Lc obtained in Example 5
A mouse (female) (homozygote) having the b2 gene and a heterozygous CAG-Cre transgenic mouse (male) were bred. A part of the tail was collected from these children, and genomic DNA was extracted. To confirm the Lcb2 gene, Southern blotting using a 5 ′ probe by SacI digestion described in Example 4 was used, and to confirm the CAG-Cre gene, Crn by BamHI digestion described in Example 6 was used.
Southern blotting was performed using the e-probe. The Lcb2 gene was confirmed to be 8.5 kb in the case of the wild type ("+") and 7.5 kb in the case of the deletion type ("-").
And the bands of 3.0 and 1.5 kb are confirmed in the CAG-Cre gene confirmation. As a result, 16 offspring (8 males, 8 females) from one set of crosses
), Of which 2 males and 3 females have the genotype “+”.
/-, CAG-Cre / 0 ".

The above “+/−, CAG-Cre / 0” knockout mouse was bred with the “homo” zygote of the mutant Lcb2 gene “Lcb2target” containing the Neo gene prepared in Example 5, and obtained therefrom. Offspring were genotyped. FIG. 6 shows the result. In FIG. 6, “target” is a mutant Lcb2 gene “Lcb2
target "," + "indicates wild-type Lcb
Two genes, "-" means that the Lcb2 gene has been deleted, and "Cre" means that the Cre gene is present. As shown in FIG. 6, (+ / targ
et, 0/0) were 28 individuals, (− / target, 0 /
(0) was obtained in 34 individuals, and (+/-, Cre / 0) was obtained in 20 individuals. However, according to Mendel's law, the above 3
None of the individuals had a genotype of (− / −, Cre / 0) that should have been obtained at the same level as the species.

Thus, it was shown that when the sphingolipid biosynthesis function is deleted from the whole individual, that is, from the level of a fertilized egg, it is impossible to overcome the early development. Example 8 Using K5-Cre transgenic mouse
Investigation of epidermis-specific deficiency of sphingolipid biosynthesis In this example, the effect of sphingolipid biosynthesis in the epidermis-specific deficiency was examined. Preparation of a conditional knockout mouse was performed in the same manner as in Example 7. However, instead of the CAG-Cre transgenic mouse, a K5-Cre transgenic mouse that expresses Cre protein specifically in the epidermis was used. The K5-Cre transgenic mouse is available from Junji Takeda, Osaka University School of Medicine.
Further, the mutation L containing the Neo gene prepared in Example 5 was used.
A "homo" zygote of the cb2 gene "Lcb2target" was used.

FIG. 7 shows a photograph of the obtained knockout mouse of the present invention at 12 hours after birth. As shown in FIG. 7, the conditional knockout mouse of the present invention did not have a wet feeling on the epidermis as compared with the control wild type mouse, and was in a rough state overall.

FIG. 8 shows a photograph of the obtained knockout mouse of the present invention at the age of 3 weeks. As can be seen from FIG.
The hair was thinner as compared to the wild-type control, especially at the back of the ear. In addition, the cycle of hair regrowth was generally slower than that of the wild type, and some hairs hardly grew.

FIG. 9 is a photomicrograph (magnification: 100) of a section of an epidermal section of a 3-week-old knockout mouse of the present invention and a wild-type control. As shown in FIG. 9, the knockout mouse of the present invention formed a follicle. Further, what looks like black dots in FIG. 9 are lymphocytes, and the presence of a large number of them may indicate that inflammation may have occurred.

[0170] All the knockout mice of this example, which specifically lack the sphingolipid biosynthesis function in the epidermis, died by 4 weeks of age. Example 9 Lck-Cre transgenic mice
Investigation of T cell-specific deficiency of sphingolipid biosynthesis used In this example, the effect of a sphingolipid biosynthesis function specifically deficient in T cells was examined.
Production of a conditional knockout mouse was performed in Example 7
The same was done. However, instead of the CAG-Cre transgenic mouse, an Lck-Cre transgenic mouse expressing Cre protein specifically in T cells was used. The Lck-Cre transgenic mouse is available from Junji Takeda, Osaka University School of Medicine. In addition, a “homo” zygote of the mutant Lcb2 gene “Lcb2target” containing the Neo gene prepared in Example 5 was used.

The effect of the obtained knockout mouse of the present invention on T cells was examined. The method is described in detail in, for example, Yumi Matsuzaki et al. (1999), Flow Cytometry Freedom, and edited by Keimitsu Nakauchi (Shujunsha) pp3-13. Specifically, the thymus and spleen were excised from a 6-week-old male knockout mouse, and stained with a PE-labeled anti-CD4 antibody and an APC-labeled anti-CD8 antibody, respectively. Next, FACS Vantage (Becton, Di)
The cell sorting was performed by two-dimensional analysis on CD4 and CD8 using a quinson and Company company. For the fluorescent dyes PE and APC, the detector FL2 (excitation / detection wavelength, 488 nm / 575) was used.
nm) and FL4 (598 nm / 660 nm),
The intensity and cell number were quantified. As a control, cell selection was similarly performed for wild-type mice.

FIG. 10 shows the results. In FIG. 10, CD
Cells positive only 4 correspond to helper T cells, and cells positive only to CD8 correspond to killer T cells. In an undifferentiated state, T cells become negative for both CD4 and CD8, then both become positive, and when further differentiation proceeds, only CD4 becomes positive (helper T cells) or only CD8 becomes positive (killer T cells).
Cells). In FIG. 10, in the thymus, the knockout mouse of the present invention showed a marked decrease in CD8 only positive (killer T cell) from 4.6% to 2.3% as compared with the wild type. A more remarkable effect was observed in the spleen, and as in the thymus, the number of CD8-only positive (killer T cells) decreased from 12.4% to 3.0%, which was 1/4 or less.

Further, the maturity of T cells differentiated to killer cells was examined. Specifically, for the thymus-derived T cells shown in FIG. 10, cells that showed only CD8 positive (killer T cells) (2.3% of the total), anti-CD
Using the 3e antibody 145-2C11 (available from Pharmigen), the amount of CD3e expression on the cell surface was examined. The CD3e expression level on the cell surface is observed when T cells are educated, and serves as a measure of maturity. The results are shown in FIG. FIG. 11 shows that, in the killer T cells derived from the thymus of the knockout mouse of the present invention, there are cells in which the expression level of CD3e on the cell surface is smaller than that in the wild type, that is, cells with lower maturity (Killer T (About 43% of cells).

Therefore, the knockout mouse of the present example, in which the sphingolipid biosynthesis function is specifically deleted from T cells, has a reduced T cell differentiation, particularly the differentiation to killer T cells, Among the differentiated cells,
It was shown that those with low maturity existed with low maturity.

[0175]

[Sequence List] SEQUENCE LISTING <110> The Institute of Physical and Chemical Research <120> Conditionally knocked-out mammals of sphingolipids synthesis <130> 003248 <160> 7 <210> 1 <211> 560 <212> PRT <213> Mouse <400> 1 Met Arg Pro Glu Pro Gly Gly Cys Cys Cys Arg Arg Pro Met Arg Ala 1 5 10 15 Asn Gly Cys Val Lys Asn Gly Glu Val Arg Asn Gly Tyr Leu Arg Ser 20 25 30 Ser Thr Ala Thr Val Ala Ala Ala Gly Gln Ile His His Val Thr Glu 35 40 45 Asn Gly Gly Leu Tyr Lys Arg Pro Phe Asn Glu Ala Phe Glu Glu Thr 50 55 60 Pro Met Leu Val Ala Val Leu Thr Tyr Val Gly Tyr Gly Val Leu Thr 65 70 75 80 Leu Phe Gly Tyr Leu Arg Asp Phe Leu Arg His Trp Arg Ile Glu Lys 85 90 95 Cys His His Ala Thr Glu Arg Glu Glu Gln Lys Asp Phe Val Ser Leu 100 105 110 Tyr Gln Asp Phe Glu Asn Phe Tyr Thr Arg Asn Leu Tyr Met Arg Ile 115 120 125 Arg Asp Asn Trp Asn Arg Pro Ile Cys Ser Val Pro Gly Ala Lys Val 130 135 140 Asp Ile Met Glu Arg Lys Ser His Asp Tyr Asn Trp Ser Phe Lys Tyr 145 150 155 160 Thr Gly Asn Ile Ile Lys Gly Val Ile Asn Met Gly Ser Tyr Asn Tyr 165 170 175 Leu Gly Phe Ala Arg Asn Thr Gly Ser Cys Gln Glu Ala Ala Ala Glu 180 185 190 Val Leu Lys Glu Tyr Gly Ala Gly Val Cys Ser Thr Arg Gln Glu Ile 195 200 205 Gly Asn Leu Asp Lys His Glu Glu Leu Glu Lys Leu Val Ala Arg Phe 210 215 220 Leu Gly Val Glu Ala Ala Met Thr Tyr Gly Met Gly Phe Ala Thr Asn 225 230 235 240 Ser Met Asn Ile Pro Ala Leu Val Gly Lys Gly Cys Leu Ile Leu Ser 245 250 255 Asp Glu Leu Asn His Ala Ser Leu Val Leu Gly Ala Arg Leu Ser Gly 260 265 270 Ala Thr Ile Arg Ile Phe Lys His Asn Asn Met Gln Ser Leu Glu Lys 275 280 285 Leu Leu Lys Asp Ala Ile Val Tyr Gly Gln Pro Arg Thr Arg Arg Pro 290 295 300 Trp Lys Lys Ile Leu Ile Leu Val Glu Gly Ile Tyr Ser Met Glu Gly 305 310 315 320 Ser Ile Val Arg Leu Pro Glu Val Ile Ala Leu Lys Lys Lys Tyr Lys 325 330 335 Ala Tyr Leu Tyr Leu Asp Glu Ala His Ser Ile Gly Ala Leu Gly Pro 340 345 350 Ser Gly Arg Gly Val Val Asp Tyr Phe Gly Leu Asp Pro Glu Asp Val 355 360 365 Asp Val Met Met Gly Thr Phe Thr Lys Ser Phe Gly Ala Ser Gly Gly 370 375 380 Tyr Ile Gly Gly Lys Lys Glu Leu Ile Asp Tyr Leu Arg Thr His Ser 385 390 395 400 His Ser Ala Val Tyr Ala Thr Ser Met Ser Pro Pro Val Met Glu Gln 405 410 415 Ile Ile Thr Ser Met Lys Cys Ile Met Gly Gln Asp Gly Thr Ser Leu 420 425 430 Gly Lys Glu Cys Ile Gln Gln Leu Ala Glu Asn Thr Arg Tyr Phe Arg 435 440 445 Arg Arg Leu Lys Glu Met Gly Phe Ile Ile Tyr Gly Asn Glu Asp Ser 450 455 460 Pro Val Val Pro Leu Met Leu Tyr Met Pro Ala Lys Ile Gly Ala Phe 465 470 475 480 Gly Arg Glu Met Leu Lys Arg Asn Ile Gly Val Val Val Val Gly Phe 485 490 495 Pro Ala Thr Pro Ile Ile Glu Ser Arg Ala Arg Phe Cys Leu Ser Ala 500 505 510 Ala His Thr Lys Glu Ile Leu Asp Thr Ala Leu Lys Glu Ile Asp Glu 515 520 525 Val Gly Asp Leu Leu Gln Leu Lys Tyr Ser Arg His Arg Leu Val Pro 530 535 540 Leu Leu Asp Arg Pro Phe Asp Glu Thr Thr Tyr Glu Glu Thr Glu Asp 545 550 555 560 <210> 2 <211> 1893 <212> DNA <213> Mouse <400> 2 gtcctgctgc cgggtgctgc cgggaggatg cggccggag c ccggagg tgctgccgc 60 cgcccgatgc gggcgaacgg ctgcgtcaag aacggggaag tgaggaacgg gtacttgagg 120 agcagcaccg ccaccgtcgc ggctgccggc cagattcatc atgtaacaga aaatggagga 180 ctgtacaaaa gaccgttcaa tgaagctttt gaagaaacac ccatgctggt tgctgtgctc 240 acatatgtgg gctatggcgt actcaccctc tttggatatc ttcgagattt cttgaggcat 300 tggagaattg aaaagtgcca ccatgcaaca gaaagagaag aacaaaagga ctttgtgtcc 360 ttgtatcagg attttgaaaa cttctataca aggaacctct acatgagaat cagagacaac 420 tggaatcggc ctatctgtag tgtgcctgga gccaaggtgg atatcatgga gagaaaatct 480 catgactata actggtcatt caagtacaca gggaatataa ttaaaggtgt aataaacatg 540 ggttcctaca actatcttgg atttgcgagg aacactggat catgtcagga agcagctgct 600 gaagtcctca aggagtatgg agcaggggtg tgcagcactc gtcaggaaat tggaaacctg 660 gacaagcatg aagaactaga gaaattggta gcaaggttct taggtgtgga agctgctatg 720 acctatggca tgggatttgc aacaaattca atgaacattc ctgctcttgt tggcaaaggt 780 tgcctgattc tgagtgatga gctgaaccat gcgtcactgg ttctaggagc cagactgtca 840 ggagcaacca ttcgaatctt caaacacaac aatatgcaaa gcttagagaa gcttttaaaa 900 gatgcca ttg tttatggtca gcctcggaca agaagaccct ggaagaaaat cttaatcctt 960 gtggaaggca tatatagtat ggaggggtct attgttcgcc ttcctgaagt gattgctctc 1020 aagaagaaat acaaggcata cttgtatctg gatgaggctc acagcattgg ggctcttggc 1080 ccttcagggc gaggcgtggt agattacttt ggcctggatc ctgaggatgt agatgttatg 1140 atgggaacat tcacaaagag cttcggtgct tcaggaggat acatcggagg caagaaggag 1200 ctgatagact acctgcgcac acattctcac agtgctgtgt atgccacgtc gatgtcaccg 1260 cctgtgatgg aacagattat cacctccatg aagtgcatca tggggcagga tggcaccagt 1320 cttggcaaag aatgtataca gcagttggct gagaacacca ggtatttcag gagacgcctg 1380 aaggaaatgg ggttcatcat ctatggcaat gaagactccc cggtggtgcc tttgatgctc 1440 tacatgccgg ccaaaattgg cgcctttgga agagagatgc tgaagcggaa cattggtgta 1500 gttgtggtgg gatttcctgc taccccgatc attgagtcca gagccagatt ttgcctgtca 1560 gcagctcata ccaaagaaat acttgacact gctttgaagg agatagatga agttggggat 1620 ctgctgcagc taaagtactc tcgccaccgg ctggtgcctc tactggacag gccctttgat 1680 gagactacct atgaagagac agaagactga gcctttctgg tgctccctag agggggataa 1740 ttcctcccag gac agtgtgt ggcctttctg agccaattcc aggaaccaca cttcagtgac 1800 cacttcatgt gaaagacatt tctgaagcta ctgaaggtgg ccaccttcac tccaaatggc 1860 attttgtaaa tagtaaaaaa accaaactgc ttc 1893 <210> 3 <211> a <g> at <311> a <g> actually ttat <210> 4 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Designed cDNA for producing the plasmid pBS-Lcb2B (2) loxP <400> 4 ataacttcgt ataatgtatg ctatacgaag ttataagctt gca <210> 5 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Designed cDNA for producing the plasmid pBS-Lcb2B (2) loxP <400> 5 agcttataac ttcgtatagc atacattata cgaagttatt gca <210> 6 <211> 30 < 212> DNA <213> Artificial sequence <220> <223> Designed cDNA for PCR <400> 6 gtgctgctag ggtttccatt tcagccacat <210> 7 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Designed cDNA for PCR <400> 7 tagtgagacg tgctacttcc atttgtcacg

[Brief description of the drawings]

FIG. 1 shows the biosynthetic pathway of sphingolipids.

FIG. 2 illustrates the concept of an example of a conditional knockout utilizing a recombinase protein / recombinase target sequence system.

FIG. 3 shows a restriction map of Lcb2-A and Lcb2-B.

FIG. 4 shows a strategy for making the targeting vector of the present invention.

FIG. 5 is a flow chart of a strategy for producing a conditional knockout mouse of the present invention.

FIG. 6 shows the strategy and results of studying sphingolipid biosynthesis at the fertilized egg level using CAG-Cre transgenic mice.

FIG. 7 shows a 12-hour-old photograph of an epidermis-specific deficient knockout mouse of sphingolipid biosynthesis using a K5-Cre transgenic mouse.

FIG. 8 shows a 3-week-old photograph of an epidermis-specific deficient knockout mouse of sphingolipid biosynthesis using a K5-Cre transgenic mouse.

FIG. 9 is a photomicrograph of a cross section of a 3-week-old epidermal slice of a skin-specific deficient knockout mouse of sphingolipid biosynthesis using a K5-Cre transgenic mouse.

FIG. 11 shows the results of cell sorting of T cells using CD4 and CD8 as markers in T cell-specific deficient knockout mice of sphingolipid biosynthesis using Lck-Cre transgenic mice.

FIG. 11 shows the results of examining the expression level of CD3e on the cell surface of killer T cells of T cell-specific deficient knockout mice of sphingolipid biosynthesis using Lck-Cre transgenic mice.

 ────────────────────────────────────────────────── ─── Continued on the front page (72) Inventor Junji Takeda 3-38-9 Yamada Nishi, Suita-shi, Osaka F-term (reference) 4B024 AA11 AA20 BA10 BA80 CA01 CA02 CA09 CA20 DA02 EA04 FA02 GA14 GA18 GA27 HA08 HA20

Claims (15)

[Claims] The present invention provides a method for inactivating a part or all of sphingolipid synthesis in a time-specific and / or tissue-specific manner by modifying a part or all of a DNA region of a serine palmitoyltransferase gene in a genome. Human
Conditional knockout mammal. 2. Use of the recombinant protein / recombinase target sequence system to modify a part or all of the DNA region of the serine palmitoyltransferase gene in the genome in response to the expression of the recombinant protein, thereby making the stage specific. The conditional knockout mammal according to claim 1, wherein part or all of sphingolipid synthesis is inactivated specifically and / or tissue-specifically. 3. The conditional knockout mouse mammal according to claim 1, wherein the recombinant protein is a Cre protein and the recombinant target sequence is loxP. 4. The method according to claim 1, wherein part or all of the gene Lcb2 encoding a subunit of serine palmitoyltransferase is modified.
14. The conditional knockout mammal according to the above item. 5. Exon 3 of gene Lcb2 encoding a subunit of serine palmitoyltransferase
5. The method according to claim 1, wherein part or all of the
The conditional knockout mammal according to any one of the above. 6. The conditional knockout mammal according to any one of claims 1 to 5, wherein part or all of sphingolipid synthesis is inactivated specifically in epidermal cells. 7. The method according to claim 1, wherein part or all of sphingolipid synthesis is inactivated in a T cell-specific manner.
14. The conditional knockout mammal according to the above item. 8. The conditional knockout mammal according to any one of claims 1 to 7, which is a mouse. 9. A non-human, wherein part or all of sphingolipid synthesis is inactivated in a time-specific and / or tissue-specific manner.
A method for producing a conditional knockout mammal, comprising: (1) a sequence in which a part or all of a genomic DNA region of a serine palmitoyltransferase gene is sandwiched between recombinase target sequences; 2) transducing the targeting vector into embryonic stem cells, and homologously or partially homologous to the genomic DNA region of the serine palmitoyltransferase gene. 3) using the embryonic stem cells having undergone the homologous recombination to prepare a genetically modified animal having a modified serine palmitoyltransferase gene containing a recombinant target sequence; and 4) preparing the genetically modified animal Time Non-human mammals in which the expression of serine palmitoyltransferase protein is suppressed in a stage-specific and / or tissue-specific manner by crossing with a recombinant-expressing gene-modified animal that expresses the recombinant protein in a stage-specific and / or tissue-specific manner The above method for producing, comprising obtaining an animal. 10. The method according to claim 9, wherein the recombinant protein is Cre protein and the recombinant target sequence is loxP. 11. A targeting vector, which further comprises a sequence for selecting only embryonic stem cells into which the targeting vector has been introduced into a chromosome, and / or a sequence for selectively removing embryonic stem cells in which heterologous recombination has occurred. 11. The method according to claim 9 or 10, comprising a sequence. 12. The method according to claim 1, wherein the step 3) comprises a step of deleting, from the chromosomal DNA, a sequence for selecting only embryonic stem cells from the chromosome into which the targeting vector has been introduced.
2. The method according to 1. 13. A genetically modified animal having a modified serine palmitoyltransferase gene containing a recombinant target sequence for use in the method of any one of claims 9 to 12. 14. A targeting vector for use in a method for producing a non-human conditional knockout mammal, wherein part or all of sphingolipid synthesis is inactivated in a time-specific and / or tissue-specific manner, Genomic DNA of serine palmitoyltransferase gene
The above-mentioned targeting vector comprising a sequence in which a part or the whole of a region is sandwiched between recombination target sequences, and a part or all of a genomic DNA region of a serine palmitoyltransferase gene is homologously recombined with the sequence. 15. The targeting vector further comprises a sequence for selecting only embryonic stem cells introduced into the chromosome and / or a sequence for selecting for removing embryonic stem cells that have undergone heterologous recombination. A targeting vector according to claim 14.