JP2002209592A - Gene encoding enzyme useful for producing (s)-4-halo-3- hydroxybutyrate, method for obtaining the same, and method for producing optically active alcohol by use of the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a gene encoding a 4-haloacetoacetate reductase useful for producing a (S)-4-halo-3-hydroxybutyrate. SOLUTION: The highly homologous domain of a gene encoding a β- ketoacyl-acyl carrier protein(ACP) reductase for reducing a 4-haloacetoacetate to produce a (S)-4-halo-3-hydroxybutyrate is subjected as a PCR primer to obtain the new 4-haloacetoacetate reductase by PCR or the like. The obtained gene is expressed, and the obtained enzyme is confirmed to have the objective 4-haloacetoacetate reductase activity.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a novel 4-haloacetoacetate reductase useful for the production of optically active alcohols, in particular, (S) -4-halo-3-hydroxybutyrate, and to an enzyme encoding the same. DNA, method for producing the enzyme, alcohol using the enzyme, particularly (S) -4-
The present invention relates to a method for producing a chloro-3-hydroxybutyrate derivative.

[0002]

2. Description of the Related Art Conventionally, optically active (S) -4-halo-3-
The following method is known as a method for producing a hydroxybutyric acid ester. Asymmetric reduction method using microorganisms such as baker's yeast J. Am. Chem. Soc., 105, 5925-5926 (1983) JP-A-61-146191, etc. An asymmetric reduction method using enzymes such as 3α-hydroxysteroid dehydrogenase Simultaneous reduction method Japanese Patent Application Laid-Open No. 1-277494 A gene of an enzyme that reduces 4-haloacetoacetate derived from a microorganism to produce (S) -4-halo-3-hydroxybutyrate is cloned, and is cloned in Escherichia coli. Method for producing (S) -4-halo-3-hydroxybutyrate by reducing 4-haloacetoacetate with recombinant Escherichia coli expressing the gene WO 9835025 JP 2000-236883

Further, the present inventors have proposed Escherichia coli (Escherichi
a) and β-ketoacyl-ACP reductase (hereinafter sometimes abbreviated as KR) derived from Bacillus subtilis to reduce 4-haloacetoacetate, and (S)-
It has been confirmed that 4-halo-3-hydroxybutyrate is synthesized. (S) -4 using the enzyme.
-A method for synthesizing halo-3-hydroxybutyrate was established. Among the fatty acid synthases, KR, which constitutes a type II fatty acid synthase (Nippon Chemistry Experimental Course 4 Lipid I, p34-37), has a subunit molecular weight of about 20,000-40,000 and a small molecular weight. Further, these KRs have a characteristic that they are hardly inhibited by the SH reagent.

Further, the present inventors have proposed Alcaligenes eutrophus and Zoogloea ramiguera.
acetoacetyl-CoA reductase produced by migera)
-Haloacetoacetic acid ester has been confirmed to have the activity of reducing (S) -4-halo-3-hydroxybutyric acid ester (JP-A-2000-189170). The gene encoding acetoacetyl-CoA reductase (hereinafter sometimes abbreviated as AR) is generally abbreviated as phbB or phaB. In general, the gene encoding KR is abbreviated as fabG. phbB or phaB was found by obtaining a poly-β-hydroxy acid synthase (PHS) gene having a high homology to fabG. Alkaligenes eutrophas is currently Ralstonia eutropha (Ral
stonia eutropha). However, all methods using known enzymes have low enzyme stability,
There were problems such as low productivity of the product and low accumulation concentration of the product. (S) -4-halo-3-
In order to carry out the enzymatic synthesis of hydroxybutyrate ester industrially, it is desired to improve these problems.

[0005]

The present invention provides (S) -4
-Useful for the production of halo-3-hydroxybutyrate,
A method for obtaining a DNA encoding a novel 4-haloacetoacetate reductase, a DNA encoding a novel 4-haloacetoacetate reductase, an enzyme encoded by the DNA, and (S) -4 using the enzyme -To provide a method for producing halo-3-hydroxybutyrate.

[0006]

Means for Solving the Problems The present inventors have noticed that KR constituting type II fatty acid synthase is highly likely to be widely distributed in microorganisms, viruses, plants and the like.
Therefore, if it is possible to obtain β-ketoacyl-ACP reductase derived from various organisms, including microorganisms that do not grow by ordinary culture methods, it will be possible to find enzymes with advantageous properties from them. Was. More specifically, it was thought that an enzyme excellent in organic solvent resistance, stability, stereoselectivity, or productivity by a recombinant microorganism could be obtained.

[0007] Based on such a prediction, the present inventors analyzed a known KR-encoding gene (fabG) and found a relatively conserved region. Then, PCR primers corresponding to this portion were synthesized, and PCR was performed using a microorganism genomic DNA, for which the fabG gene was not reported, as a template, thereby obtaining a part of the fabG gene. Using the nucleotide sequence of the obtained gene, the entire region of the fabG gene was cloned and expressed using a host such as E. coli. As a result, it was confirmed that the expressed enzyme reduced 4-haloacetoacetate to produce (S) -4-halo-3-hydroxybutyrate, thereby completing the present invention.

That is, the present invention relates to (S) -4-halo-3
Method for obtaining 4-haloacetoacetate reductase gene useful for producing hydroxybutyrate, obtained gene, 4-haloacetoacetate reductase encoded by the gene, and optically active alcohol using the same It relates to a manufacturing method. [1] a 4-haloacetoacetate ester comprising a combination of oligonucleotides comprising at least 15 consecutive nucleotide sequences complementary to the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4, or their complementary sequences A primer set for synthesizing a gene encoding a protein having an enzymatic activity to act on (S) -4-halo-3-hydroxybutyrate. [2] A method for obtaining a gene encoding a protein having an enzymatic activity that acts on 4-haloacetoacetate to produce (S) -4-halo-3-hydroxybutyrate, comprising the following steps: (A) using the primer set of [1] to perform PCR using a polynucleotide derived from an organism as a template, (b) collecting the amplification product of step (a), (c) generating the amplification (3) the method according to (2), wherein the organism is a thermophilic microorganism; [4] any one of the following (a) to (e):
-A polynucleotide encoding a protein having an enzymatic activity that acts on haloacetoacetate to generate (S) -4-halo-3-hydroxybutyrate. (A) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1; (b) a polynucleotide encoding a protein consisting of the amino acid sequence of SEQ ID NO: 2; (c) an amino acid sequence of SEQ ID NO: 2 Where 1
Or, a plurality of amino acids are substituted, deleted, inserted, and / or
Or (d) a polynucleotide encoding a protein consisting of an added amino acid; (d) a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; A polynucleotide encoding an amino acid sequence having at least 80% homology with the amino acid sequence described in [5]. A protein encoded by the polynucleotide described in [4]. [6] A recombinant vector into which the polynucleotide of [4] has been inserted. [7] a polynucleotide encoding a dehydrogenase capable of catalyzing a redox reaction using β-nicotinamide adenine dinucleotide as a coenzyme,
The recombinant vector according to [6]. [8] A transformant holding the polynucleotide of [4] or the vector of [6] in an expressible manner.

[9] culturing the transformant according to [8], acting on 4-haloacetoacetate, and treating (S) -4-halo-3-
The method for producing a protein according to [5], comprising a step of collecting a protein having an enzymatic activity for producing hydroxybutyrate or a fraction containing the protein. [10] A method for producing an alcohol, comprising reacting the protein according to [5], a microorganism producing the protein, or a processed product of the microorganism with a ketone, and reducing the ketone to produce an alcohol. Method. [11] The method for producing alcohol according to [10], wherein the microorganism is the transformant according to [8]. [12] The method for producing an alcohol according to [10], wherein the ketone is a 4-haloacetoacetate derivative and the alcohol is a (S) -4-halo-3-hydroxybutyrate derivative. [13] The 4-haloacetoacetate ester derivative is 4-chloroacetoacetate ethyl ester, and the alcohol is (S)-
The method for producing an alcohol according to [12], which is ethyl 4-chloro-3-hydroxybutyrate. [14] The method for producing an alcohol according to [10], further comprising a step of additionally converting an oxidized β-nicotinamide adenine dinucleotide to a reduced form.

[0009]

BEST MODE FOR CARRYING OUT THE INVENTION In the present invention, an enzyme having an enzymatic activity which acts on a 4-haloacetoacetic ester to generate (S) -4-halo-3-hydroxybutyrate is
It is called 4-haloacetoacetic ester reductase. The 4-haloacetoacetate reductase according to the present invention reduces the 3-carbonyl group of 4-haloacetoacetate,
It is characterized by producing hydroxyl groups in the (S) configuration. In the present invention, the 4-haloacetoacetate reductase activity is represented by a reduction activity with respect to ethyl 4-chloroacetoacetate, and can be confirmed as follows.

Method for measuring reducing activity against ethyl 4-chloroacetoacetate: 100 mM potassium phosphate buffer (pH 6.5), 0.2 mM
Reduced nicotinamide adenine dinucleotide phosphate (hereinafter abbreviated as NADPH), reacted with 30 mM ethyl 4-chloroacetoacetate and enzyme at 30 ° C.
The decrease in absorbance at 340 nm with the decrease in ADPH is measured. 1 U is the amount of enzyme that catalyzes the reduction of 1 μmol of NADPH per minute. The protein is quantified by a dye binding method using a protein assay kit manufactured by Bio-Rad.

[0011] The present invention relates to a primer set for obtaining a gene encoding 4-haloacetoacetate reductase. The primer set according to the present invention is composed of a combination of oligonucleotides containing the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4 or a continuous nucleotide sequence of at least 15 nucleotides complementary to their complementary sequences. In the present invention, the “complementary sequence” refers to a base sequence constituting one strand of a double-stranded DNA consisting of A: T, G: C base pairs with respect to the other strand. Further, `` complementary '' is not limited to a completely complementary sequence in at least 15 consecutive nucleotide regions, at least 70%, preferably at least 80%, more preferably 90%, even more preferably 95% It is only necessary to have the above homology on the base sequence. A known algorithm such as BLASTN may be used as an algorithm for determining homology.

[0012] The present inventors have developed a known database (SWIS
S-PROT) and the β-ketoacyl ACP reductase gene (fabG) described in FIG.
In the region surrounded by, the amino acid sequence was found to be conserved across species. The nucleotide sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4 are degenerate sequences encoding this conserved amino acid sequence. The present inventors have found that by using a degenerate primer set for this region, it is possible to synthesize a gene encoding 4-haloacetoacetate reductase derived from a wide variety of organisms. I found it.

In the present invention, examples of 4-haloacetoacetate reductase include β-ketoacyl ACP reductase and acetoacetyl-CoA reductase.
On the other hand, the biological species for obtaining genes encoding these enzymes are not particularly limited. In particular, β-ketoacyl
Bacteria, viruses, plants, etc., for which the ACP reductase gene is not known, are useful for obtaining a novel 4-haloacetoacetate reductase. Among them, enzymes derived from thermophilic microorganisms can generally be expected to have high stability, and are therefore suitable as a source of enzymes used industrially. Heat-stable enzyme proteins are also advantageous in enzyme purification. That is, by heating the partially purified enzyme, components contaminating the enzyme protein undergo degradation such as decomposition and formation of aggregates. At this time, the thermostable enzyme protein is not denatured. As a result, the desired enzyme protein can be easily purified.

[0014] The present invention also relates to a method for obtaining a gene encoding 4-haloacetoacetate reductase using the primer set. In the method of the present invention, a part (core region) of the fabG gene can be obtained by performing PCR using a gene derived from an appropriate organism as a template. The gene used as a template is not particularly limited. For example, genes of bacteria, viruses, plants, and the like described above can be used. Genome DN
A, genomic RNA, mRNA, or cDNA can be used. When the gene is interrupted by introns, as in a plant genome, it is advantageous to use cDNA as a template. In PCR, Taq DNA polymerase (Takara Shuzo)
, KOD DNA polymerase (Toyobo), Pfu DNA polymeras
e (Strategene) is available, and the reaction may be performed under standard conditions described in the instructions attached to the product.

If a specific product cannot be obtained by PCR, lower the annealing temperature to 37 ° C. and gradually increase the annealing temperature from the annealing temperature to 60 ° C. by 10 ° C. in one minute. After performing the heat treatment, 5 cycles of heat treatment are performed, and thereafter, the annealing temperature is increased to 45 ° C., the elongation reaction is performed at 70 ° C., and then 25 cycles of heat treatment are performed. Amplification can be performed. When a non-specific PCR product is obtained,
Specific PCR products can be obtained by techniques such as ested PCR (BioTechniques 18, 609-610 (1995)).

The gene synthesized in this manner is usually a fragment (core) of the gene encoding 4-haloacetoacetate reductase that lacks the 5′- and 3′-terminal sequences. Methods for obtaining the full length of a gene of interest based on fragment sequence information of a certain gene are known. For example, inverse PCR (Genetics
120, 621-623 (1988)), it is possible to obtain regions whose base sequences adjacent to both sides of the fragment are unknown. in
In verse PCR, chromosomal DNA is digested with an appropriate restriction enzyme, and then the self-cyclized DNA is used as a template. If PCR is performed using the cyclized DNA as a template and PCR primers for extension to outside the known DNA, a region whose base sequence is unknown can be amplified. The RACE method (Rapid
Amplification of cDNA End, “PCR Experiment Manual” p2
5-33, HBJ Publishing Bureau) can also be used to obtain the full length of the gene. In addition, the above-mentioned primer was used.
A clone containing the target gene can also be selected by hybridizing and screening a genomic library or a cDNA library using the PCR amplification product as a probe.

The present invention acts on the 4-haloacetoacetate described in any one of the following (a) to (e):
The present invention relates to a polynucleotide encoding a protein having an enzymatic activity for producing (S) -4-halo-3-hydroxybutyrate. (A) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1; (b) a polynucleotide encoding a protein consisting of the amino acid sequence of SEQ ID NO: 2; (c) an amino acid sequence of SEQ ID NO: 2 Where 1
Or, a plurality of amino acids are substituted, deleted, inserted, and / or
Or (d) a polynucleotide encoding a protein consisting of an added amino acid; (d) a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; A polynucleotide encoding an amino acid sequence having 80% or more homology with the amino acid sequence described in (a) and (b) with respect to the polynucleotide described in (c) to (e). In the present invention, it is particularly called a homolog. The polynucleotide of the present invention can include DNA, RNA, chimeras of both, or artificial nucleotide derivatives. The polynucleotide having the nucleotide sequence of SEQ ID NO: 1 is the nucleotide sequence of the 4-haloacetoacetate reductase gene obtained from the thermophilic bacterium Bacillus stearothermophilus IFO12550 strain. A polynucleotide containing the nucleotide sequence of SEQ ID NO: 1 can be obtained from the same strain by PCR or hybridization based on the nucleotide sequence information of SEQ ID NO: 1. Alternatively, it can be synthesized completely artificially. The nucleotide sequence described in SEQ ID NO: 1 is
The amino acid sequence described in No. 2 is encoded. The polynucleotide of the present invention includes any polynucleotide that can encode the amino acid sequence set forth in SEQ ID NO: 2. Further, the present invention relates to a homolog of the polynucleotide of the present invention. For those skilled in the art, SEQ ID NO: 1
Site-directed mutagenesis (Nucleic Acid Res.
10, pp.6487 (1982), Methods in Enzymol.100, pp.448
(1983), Molecular Cloning 2ndEdt., Cold Spring Har
bor Laboratory Press (1989), PCR A Practical Appro
Using ach IRL Press pp. 200 (1991)) or the like, a homolog can be obtained by appropriately introducing substitution, deletion, insertion, and / or addition mutation.

Further, the homolog of the present invention has SEQ ID NO: 1.
A polynucleotide that can hybridize under stringent conditions with DNA consisting of the nucleotide sequence shown in, and reducing 4-haloacetoacetate,
It also includes a polynucleotide encoding a protein having an activity of producing (S) -4-halo-3-hydroxybutyrate. The polynucleotide capable of hybridizing under stringent conditions refers to any one or more selected from at least 20, preferably at least 30, for example, 40, 60 or 100 contiguous sequences described in SEQ ID NO: 1. The obtained DNA is used as a probe DNA, for example, ECL direct n
ucleic acid labeling and detection system (Amersha
m Pharmaica Biotech) using the conditions described in the manual (wash: 42 ° C, primary wash b containing 0.5x SSC).
uffer), the polynucleotide that hybridizes.

Furthermore, the homolog of the present invention has the sequence of SEQ ID NO:
2. A polynucleotide encoding a protein having at least 80%, preferably at least 90%, more preferably 95% or more homology with the amino acid sequence shown in 2.
For protein homology search, for example, SWISS-PROT, PIR
Databases and amino acid sequences of proteins such as DD
Targeting databases such as BJ, EMBL, Gene-Bank, etc. on DNA sequences, databases on predicted amino acid sequences based on DNA sequences, etc., using programs such as BLAST, FASTA, etc., for example, over the Internet.

A homology search was performed by using the amino acid sequence of SEQ ID NO: 2 on a protein database such as SWISS-PROT and PIR using the BLAST program, and as a result, the protein showed the highest homology among known proteins. What is Streptomyces coelicolor
ces coelicolor) putative short chain oxi from A3 (2)
It was a doreductase, a predicted ORF derived from genomic analysis of unknown function, with an identity of 58% and a positive of 72%. The homology of 80% or more of the present invention refers to, for example, BLAS
Represents Positive homology values using the T program. The polynucleotide of the present invention is useful for producing a protein having 4-haloacetoacetic ester reductase activity. Alternatively, the polynucleotide of the present invention is useful for producing an optically active alcohol using a protein having 4-haloacetoacetic ester reductase activity.

[0021] The present invention relates to a protein encoded by the polynucleotide. The protein of the present invention containing the amino acid sequence shown in SEQ ID NO: 2 constitutes a preferred embodiment of the protein of the present invention. The amino acid sequence shown in SEQ ID NO: 2 is encoded by the nucleotide sequence shown in SEQ ID NO: 1. On the other hand, in the present invention, the above (c) to (e)
Are referred to as homologues of the protein of the present invention.

The protein of the present invention can be obtained by introducing the polynucleotides described in the above (a) to (e) into a host and expressing them. Further, the homologue of the protein of the present invention includes a protein having at least 80%, preferably at least 90%, more preferably 95% or more homology with the amino acid sequence shown in SEQ ID NO: 2.
For protein homology search, for example, SWISS-PROT, PIR
Databases on amino acid sequences of proteins such as
DBJ, EMBL, Gene-Bank and other databases related to DNA sequences, databases related to predicted amino acid sequences based on DNA sequences, and the like, using programs such as BLAST and FASTA, can be performed, for example, via the Internet .

A homology search was performed by using the amino acid sequence of SEQ ID NO: 2 on a database in which amino acid sequences such as SWISS-PROT and PIR were accumulated using the BLAST program. As a result, the highest protein among known proteins was obtained. The homology was demonstrated by Streptomyces coelicolor (S
treptomyces coelicolor) putative shortch from A3 (2)
ain oxidoreductase. This amino acid sequence is a predicted ORF derived from genomic analysis of unknown function.
y was 58% and positive was 72%. The homology of 80% or more of the present invention means, for example, Pos using the BLAST program.
Represents the homology value of itive.

By inserting the polynucleotide of the present invention into a known expression vector, a 4-haloacetoacetate reductase expression vector is provided. Further, by culturing a transformant transformed with this expression vector, the 4-haloacetoacetate ester reductase of the present invention can be obtained as a recombinant.

In order to express 4-haloacetoacetate reductase in the present invention, the microorganism to be transformed is a recombinant vector containing a polynucleotide encoding a polypeptide having 4-haloacetoacetate reductase activity. There is no particular limitation as long as the organism can be transformed with E. coli and can express 4-haloacetoacetate reductase activity. Examples of usable microorganisms include the following microorganisms. Escherichia genus Bacillus genus Pseudomonas genus Serratia genus Brevibacterium genus Corynebacterium genus Streptococcus genus Lactobacillus etc. Bacteria being developed Rhodococcus (Rhodococcus) genus Streptomyces (Streptomyces) spp. Saccharomyces sp. (Aspergillus) Pharos poly Um (Cephalosporium) genus Trichoderma (Trichoderma) mold that has been developed host vector system such as the genus

The procedure for producing a transformant and the construction of a recombinant vector suitable for a host can be performed according to techniques commonly used in the fields of molecular biology, biotechnology and genetic engineering (for example, , Sambrook et al., Molecular Cloning, ColdSpring Harbor Laboratori.
es). In order to express the 4-haloacetoacetate reductase gene of the present invention in a microorganism or the like, first, the DNA is introduced into a plasmid vector or a phage vector that is stably present in the microorganism, and the genetic information is transcribed. Need to be translated. To do this,
A promoter corresponding to a unit for controlling translation may be incorporated 5'-upstream of the DNA strand of the present invention, more preferably a terminator may be incorporated 3'-downstream. As the promoter and terminator, it is necessary to use a promoter and terminator known to function in a microorganism used as a host. For vectors, promoters, terminators, and the like that can be used in these various microorganisms, see “Basic Lectures on Microbiology 8 Genetic Engineering / Kyoritsu Publishing,” especially for yeast, see Adv. Biochem.
Eng. 43, 75-102 (1990), Yeast 8, 423-488 (1992),
Etc. are described in detail.

For example, in the genus Escherichia, especially Escherichia coli, pBR and pUC plasmids can be used as plasmid vectors.
lac (β-galactosidase), trp (tryptophan operon), tac, trc (lac, fusion of trp), λ phage PL,
Promoters derived from PR and the like can be used. Further, as the terminator, a terminator derived from trpA, phage, rrnB ribosomal RNA, or the like can be used. Among these, commercially available pSE420 (In
A vector pSE420D (described in JP-A-2000-189170) in which a multicloning site (manufactured by vitrogen) is partially modified can be suitably used.

In the genus Bacillus, pU is used as a vector.
B110-series plasmids, pC194-series plasmids and the like can be used, and they can also be integrated into chromosomes. In addition, apr (alkali protease), npr (neutral protease), amy (α-amylase) and the like can be used as the promoter and terminator.

In the genus Pseudomonas, Pseudomonas putida, Pseudomonas putida
Host vector systems have been developed for Pseudomonas cepacia and the like. Plasmid involved in the degradation of toluene compounds Broad host range vector based on TOL plasmid
PKT240 (including a gene required for autonomous replication derived from RSF1010 or the like) can be used, and a lipase (JP-A-5-284973) gene or the like can be used as a promoter or terminator.

The genus Brevibacterium, especially Brevibacterium lactofermentum
ermentum), a plasmid vector such as pAJ43 (Gene 39, 281 (1985)) can be used. As the promoter and terminator, the promoter and terminator used in E. coli can be used as they are.

In the genus Corynebacterium, especially Corynebacterium glutamicum, pCS11 (JP-A-57-183799), pCB101 (Mol. Gen. G.
Plasmid vectors such as enet. 196, 175 (1984) are available.

In the genus Streptococcus, pHV1301 (FEMS Microbiol. Lett. 26, 239 (19)
85), pGK1 (Appl.Environ.Microbiol. 50, 94 (1985))
Can be used as a plasmid vector.

In the genus Lactobacillus, pAMβ1 developed for Streptococcus (J.
Bacteriol. 137, 614 (1979)) are available,
A promoter used in Escherichia coli can be used as the promoter.

In the genus Rhodococcus, Rhodococcus rhodoch
rous) can be used (J. Gen. Microbiol. 138, 1003 (1992)).

In the genus Streptomyces, the Genetic Manipulation of Strepto by Hopwood et al.
myces: A Laboratory Manual Cold Spring Harbor Labo
A plasmid can be constructed according to the method described in ratories (1985). In particular, in Streptomyces lividans, pIJ486
(Mol.Gen.Genet. 203, 468-478, 1986), pKC1064 (Gene
103,97-99 (1991)), pUWL-KS (Gene 165,149-150 (199
5)) can be used. A similar plasmid can also be used in Streptomyces virginiae (Actinomycetol. 11, 4).
6-53 (1997)).

The genus Saccharomyces, especially Saccharomyces cer
evisiae), YRp, YEp, YCp, and YIp plasmids can be used, and integration vectors (such as EP 537456) utilizing homologous recombination with ribosomal DNA present in multiple copies in the chromosome are available. This is extremely useful because the gene can be introduced by copying and the gene can be stably retained. ADH (alcohol dehydrogenase), G
APDH (glyceraldehyde-3-phosphate dehydrogenase), PH
Promoters and terminators such as O (acid phosphatase), GAL (β-galactosidase), PGK (phosphoglycerate kinase), and ENO (enolase) can be used.

In the genus Kleiberomyces, especially Kluyveromyces lactis, a 2 μm-family plasmid derived from Saccharomyces cerevisiae and a pKD1-family plasmid (J. Bacteriol. 145, 382-390)
(1981)), a plasmid derived from pGKl1 involved in killer activity, the autonomous replication gene KARS in the genus Kleiberomyces
Vector plasmids (eg, EP 537456) that can be integrated into the chromosome by homologous recombination with a system plasmid, ribosomal DNA, and the like can be used. ADH,
Promoters and terminators derived from PGK and the like can be used.

[0038] Schizosaccharomyc
In the genus es), a plasmid vector containing an ARS (gene involved in autonomous replication) derived from Schizosaccharomyces pombe and a selection marker complementary to an auxotrophy derived from Saccharomyces cerevisiae is available (Mol.
Cell. Biol. 6, 80 (1986)). An ADH promoter derived from Schizosaccharomyces pombe can be used (EMBO J. 6, 729 (1987)). In particular, pAUR224 is commercially available from Takara Shuzo and can be easily used.

The genus Zygosaccharomyc
es), Zygosaccharomyces roxii (Zygo
saccharomyces rouxii) derived from pSB3 (Nucleic Acids Re
s.13, 4267 (1985)), and a PHO5 promoter derived from Saccharomyces cerevisiae or GAP-Zr (glyceraldehyde-3-phosphate dehydrogenase) derived from S. saccharomyces rouxi. Promoter (Agri. Biol. Chem. 54, 2521)
(1990)).

In the genus Pichia, Pichia anguta (former name: Hansenula polymorpha)
polymorpha)), a host vector system has been developed. Genes involved in autonomous replication from Pichia angusta (HARS1, HARS2) can also be used as vectors, but since they are relatively unstable, multicopy integration into chromosomes is effective (Yeast 7, 431- 443 (199
1)). In addition, AOX (alcohol oxidase), FDH (formate dehydrogenase) promoters and the like, which are induced by methanol or the like, can be used. Also, Pichia Pastoris
(Pichia pastoris) and other host-vector systems using genes involved in Pichia-derived autonomous replication (PARS1, PARS2) and multicopy integration vectors into chromosomes (In
A commercially available Pichia Expression Kit from vitrogen) has been developed (Mol. Cell. Biol. 5, 3376 (1
985)), strong promoters such as AOX which can be induced by high concentration culture and methanol can be used (Nucleic Acids Res.1
5,3859 (1987)).

In the genus Candida, Candida maltosa, Candida albicans, Candida tropicalis, Candida tropicalis,
Host vector systems have been developed for utilus (Candida utilis) and the like. In Candida maltosa, an ARS derived from Candida maltosa has been cloned (Agri. Biol. Chem. 51, 51, 1587 (1987)), and vectors using this have been developed. In Candida utilis, a strong promoter has been developed for a chromosome integration type vector (Japanese Patent Application Laid-Open No. 08-173170).

In the genus Aspergillus, Aspergillus niger, Aspergillus oryzae, etc. have been most studied among molds, and integration into plasmids or chromosomes is available. In addition, promoters derived from extracellular proteases, amylase and amidase can be used (Trends in Biotechnology 7, 283-28
7 (1989)).

In the genus Trichoderma, a host vector system using Trichoderma reesei has been developed, and a promoter derived from an extracellular cellulase gene can be used (Biotechnology).
7, 596-603 (1989)).

In addition to microorganisms, various host / vector systems have been developed for plants and animals, particularly insects using silkworms (Nature 315, 592-594 (1985)), rapeseed, corn, potatoes and the like. A system for expressing a large amount of a heterologous protein in a plant has been developed and can be suitably used.

The present invention also relates to a method for producing an alcohol by reducing a ketone with the 4-haloacetoacetate reductase. As the alcohol, for example, (S) -4
-Halo-3-hydroxybutyrate derivatives. The enzyme reaction of the present invention can be carried out by bringing a transformant such as an enzyme molecule, a processed product thereof, a culture containing the enzyme molecule, or a microorganism producing the enzyme into contact with a reaction solution in a living state. The contact form between the enzyme and the reaction solution is not limited to these specific examples.

In the present invention, the reaction solution is a solution obtained by dissolving, mixing, or suspending a substrate or coenzyme necessary for the enzyme reaction in a suitable solvent that provides an environment suitable for expressing the enzyme activity. As the coenzyme, a coenzyme that can be used by a 4-haloacetoacetic ester reductase that catalyzes the reaction is used. For example, an enzyme consisting of the amino acid sequence of SEQ ID NO: 2 requires reduced nicotinamide adenine dinucleotide phosphate (hereinafter abbreviated as NADPH) as a coenzyme. On the other hand, a substrate compound that is converted into a target compound by an enzymatic reaction is used as the substrate. The relationship between the product alcohol and the substrate compound will be specifically described later.

The treated microorganisms containing 4-haloacetoacetate reductase according to the present invention include microorganisms whose cell membrane permeability has been changed by treatment with a surfactant or an organic solvent such as toluene, or glass beads. And a cell-free extract obtained by crushing cells by enzymatic treatment or a partially purified extract thereof.

As the ketone in the method for producing an alcohol according to the present invention, a 4-haloacetoacetate derivative is preferably used. Halogen includes chlorine, bromine,
Examples thereof include an iodine atom, and a chlorine atom is particularly preferable. Examples of the ester include lower alkyl esters such as methyl ester, ethyl ester, propyl ester, isopropyl ester, and butyl ester, and ethyl ester is particularly desirable. The 4-halogenated acetoacetic acid ester derivatives also include lower alkyl groups which may have a halogen substitution at the β-position, and derivatives having a substitution such as halogen.

The oxidized coenzyme produced accompanying the above reduction reaction can be regenerated as a reduced form again by the enzymatic reaction. For example, oxidized nicotinamide adenine dinucleotide phosphate (hereinafter abbreviated as NADP ⁺ ) generated from NADPH can be enzymatically regenerated to NADPH. Regeneration to NADPH can be performed using the NADP ⁺ reducing ability of the microorganism (glycolysis, C1 compound utilization pathway of methylotroph, etc.). These NADP ⁺ reducing ability can be enhanced by adding glucose, ethanol, formic acid, or the like to the reaction system. Alternatively, the reaction can be carried out by adding a microorganism capable of producing NADPH from NADP ⁺ , a processed product thereof, and an enzyme to the reaction system.

For example, glucose dehydrogenase, formate dehydrogenase, alcohol dehydrogenase, amino acid dehydrogenase, organic acid dehydrogenase (such as malate dehydrogenase), hydrogenase (genus Alcaligenes, genus Clostridium ( Enzyme (Biotech) that performs NADP ⁺ reduction using hydrogen produced by Clostridium, etc. as an electron donor
nol.Bioeng. 27, 1277-1281 (1985), Biocatal.Biotera
nsform. 15, 281-296 (1997)), a co-enzyme can be regenerated using a processed product thereof, and a partially purified or purified enzyme. The components constituting the reaction necessary for such regeneration are added to the reaction system for the production of alcohol according to the present invention, immobilized components are added, or they are contacted via a membrane capable of exchanging coenzymes. Can be done.

When a microorganism transformed with the recombinant vector containing the polynucleotide of the present invention is used as a host in a live cell state for the above-mentioned method for producing alcohol, an additional enzyme for coenzyme regeneration may be used. In some cases, the reaction system can be made unnecessary. In other words, by using a microorganism having a high coenzyme regeneration activity, an efficient reaction can be performed in a reduction reaction using a transformant without adding an enzyme for coenzyme regeneration. Furthermore, by simultaneously introducing a DNA encoding an enzyme usable for coenzyme regeneration and a DNA encoding the NADPH-dependent 4-haloacetoacetate reductase of the present invention into a host, a reduction reaction can be performed more efficiently. It is also possible to do. Enzymes that can be used for coenzyme regeneration include, for example, glucose dehydrogenase, formate dehydrogenase, alcohol dehydrogenase, amino acid dehydrogenase, and organic acid dehydrogenase (such as malate dehydrogenase). Can be. In order to introduce these two or more genes into a host, a method of transforming the host with a recombinant vector in which genes are separately introduced into a plurality of vectors having different replication origins to avoid incompatibility is used. Used. In addition, a method of introducing both genes into a single vector, a method of introducing one or both genes into a chromosome, and the like can also be used.

When a plurality of genes are introduced into a single vector, a method involving ligating regions related to expression control such as a promoter and a terminator to each gene or expression as an operon containing a plurality of cistrons such as a lactose operon. It is also possible to make it.

The reduction reaction using the enzyme of the present invention is carried out in water
It can be performed in a mixed system of water and an organic solvent having compatibility. As a solvent compatible with water, methanol,
Examples include ethanol, isopropanol, acetone, and acetonitrile. In addition, the enzyme reaction for the present invention can be performed in an organic solvent that is hardly soluble in water or in a two-phase system of an organic solvent that is hardly soluble in water and an aqueous medium. Examples of organic solvents that are hardly soluble in water include ethyl acetate, butyl acetate, toluene, chloroform, n-hexane, cyclohexane, octane,
Alternatively, 1-octanol or the like can be used.

The enzymes constituting the enzyme reaction of the present invention can be used after immobilization. The method of immobilizing the enzyme
There is no particular limitation. For example, a method for immobilizing an enzyme using glutaraldehyde, acrylamide, κ-carrageenan, calcium alginate, an ion exchange resin, celite, or the like is known. The reaction of the present invention can be performed using a membrane reactor or the like. Membrane that can constitute a membrane reactor include ultrafiltration membrane, hydrophobic membrane, cationic membrane, nanofiltration membrane (J. Ferme
nt. Bioeng. 83, 54-58 (1997)).

The reaction of the present invention can be carried out at a reaction temperature of 4-70 ° C., preferably 15-50 ° C., pH 3-11, preferably pH 6-8, and a substrate concentration of 0.01-90%, preferably 0.1-30%. it can. In the reaction system, if necessary, the coenzyme NADP ⁺ or NADPH is 0.001 mM-100 mM, preferably 0.01-10 mM.
Can be added. The substrate can be added all at once at the start of the reaction, but it is preferable to add the substrate continuously or discontinuously so that the substrate concentration in the reaction solution does not become too high.

The compound added to the reaction system for the regeneration of NADPH can be added in a molar ratio of 0.1 to 20, preferably 1 to 5 times in excess with respect to the substrate ketone. NAD
As the compound for PH regeneration, for example, glucose when using glucose dehydrogenase, formic acid when using formate dehydrogenase, ethanol or isopropanol when using alcohol dehydrogenase are added. On the other hand, the enzyme constituting the reaction for regenerating NADPH can be added in 0.1 to 100 times, preferably about 0.5 to 20 times in terms of enzyme activity as compared with the NADPH-dependent 4-haloacetoacetate reductase of the present invention. .

The alcohol produced by reduction of the ketone of the present invention can be purified by suitably combining centrifugation of cells and proteins, separation by membrane treatment, solvent extraction, distillation and the like. For example, in the case of ethyl (S) -4-chloro-3-hydroxybutyrate, a reaction solution containing microbial cells is centrifuged to remove the microbial cells, and a solvent such as ethyl acetate or methyl isobutyl ketone is added to the supernatant. To extract ethyl (S) -4-chloro-3-hydroxybutyrate into the solvent layer. After phase separation, this is distilled to obtain highly pure ethyl (S) -4-chloro-3-hydroxybutyrate. The purified ethyl (S) -4-chloro-3-hydroxybutyrate is useful as a raw material for pharmaceuticals. According to the present invention, an optically active alcohol can be efficiently obtained with high purity. Of the optical isomers, there are often compounds having low biological activity and compounds causing side effects.
Therefore, in pharmaceutical raw materials, the optical purity is
It greatly affects the quality of raw materials.

[0058]

EXAMPLES The present invention will be described in more detail with reference to the following Examples, but it should not be construed that the present invention is limited thereto. [Example 1] (Preparation of chromosomal DNA from Bacillus stearothermophilus) Bacillus stearothermophilus IFO 12550 strain was isolated from M-64.
Medium (polypeptone 10g, yeast extract 2.5g, meat extract
2g, glycerol 2g, sodium chloride 2g, K ₂ HPO ₄ 2g,
KH ₂ PO ₄ 2g, MgSO ₄・ 7H ₂ O 0.1g, biotin 0.4μg / L, pH
The cells were cultured at 55 ° C in 7.2), and wet cells were obtained by centrifugation.
Chromosomal DNA was purified from the obtained wet cells using Qiagen Genome-Tip.

Example 2 (Amplification of 4-haloacetoacetate reductase gene core region by PCR) Primer fabG-N (SEQ ID NO: 3) and primer fabG
PCR was performed using -C (SEQ ID NO: 4) and the chromosomal DNA prepared in Example 1 as a template. PCR was performed at 0.2 mM dNTP,
Primer: 50 pmol each, Taq DNA polymerase: 1
U, was performed in a 50 μL reaction solution containing 50 ng or 125 ng of template DNA.

The conditions of PCR were as follows: 5 cycles of step 1 and 25 cycles of step 2 were performed. (Step 1) Denaturation 94 ° C 30 seconds Anneal 37 ° C 30 seconds 1 min at 10 ° C elongation 60 ° C 2 minutes (Step 2) Denaturation 94 ° C 30 seconds Anneal 45 ° C 30 seconds Extension 70 ° C 1 minute

After completion of the PCR, a part was analyzed by agarose gel electrophoresis. As a result, a specific band was detected around 550 bp regardless of the amount of the template DNA. SEQ ID NO: 3: fabG-N ACGGAATTCGTSACRGGMGCSWSSCGCGGMATYGG SEQ ID NO: 4: fabG-C TGCAAGCTTGTCATRGCYGTYKMRATRAAKCCYGGSGC S: G or CR: A or GM: A or CY: T or CK: G or TW: A or T

Example 3 Cloning of Core Region of 4-Haloacetoacetate Ester Reductase Gene The DNA fragment amplified in Example 2 was extracted with phenol-chloroform, and the DNA was recovered by ethanol precipitation. The obtained DNA was double-digested with EcoRI and HindIII, and purified by agarose gel electrophoresis. The obtained DNA fragment was ligated with pUC18 digested with the same restriction enzymes EcoRI and HindIII to obtain a plasmid pBstKR-1 having an objective 550 bp insert.

[Example 4] (Analysis of base sequence of core region of 4-haloacetoacetate ester reductase gene) The base sequence of the inserted fragment of plasmid pBstKR-1 obtained in Example 3 was analyzed. For analysis of DNA base sequence, BigDy
e Terminator Cycle Sequencing ready Reaction Kit
Perform PCR using (Applied Biosystems)
This was performed using RISM 310 GeneticAnalyzer (manufactured by Applied Biosystems). The determined base sequence of the core region is shown as SEQ ID NO: 5.

[Example 5] (Inverse PCR around core region of 4-haloacetoacetate reductase gene) The chromosomal DNA prepared in Example 1 was digested with HindIII, self-cyclized, and digested with SalI. Used as First, 1
As st PCR, BST-N1NE (SEQ ID NO: 6), BST-C1NE
PCR was performed using (SEQ ID NO: 8) as a primer, and the obtained PCR product was purified and further purified by BST-N2NE (SEQ ID NO:
7), 2n using BST-C2NE (SEQ ID NO: 9) as a primer
d PCR was performed. PCR, heat denaturation 94 ° C, 1 minute, annealing 55
30 cycles of 1 minute at 72 ° C and 3 minutes at 72 ° C were performed.

After completion of the PCR, a part of the reaction solution was subjected to agarose electrophoresis. As a result, a specific amplified fragment of about 5 kb was confirmed. SEQ ID NO: 6: BST-N1NE TCCGCGCTCGGAAACCGCGGCCAGGCGAACTATTCGGCGG SEQ ID NO: 7: BST-N2NE ATCGAGCTCGGCAAGTTCGGCATTACGACGAACGCCATCG SEQ ID NO: 8: BST-C1NE ACGCTCGCCACTTTGGCGTACACGTCATACCCTTTCTCCC SEQ ID NO: 9: BST-C2NE CTTCTTCCGCGAAGCGGGTGACAATCGCCTTGCCGATGCC

[Example 6] (Analysis of base sequence around core of 4-haloacetoacetate reductase gene) The base sequence of a DNA fragment obtained by inverse PCR was directly analyzed. As a result, the entire region of β-ketoacyl ACP reductase (fabG gene) is included, and at the same time, a part of acyl CoA dehydrogenase (fabD gene) upstream of fabG gene and a part of acyl carrier protein (ACP) gene downstream of fabG gene. Was found. The resulting 4-haloacetoacetate reductase gene was composed of 762 bp and encoded 254 amino acids. The sequence of the ORF portion is shown in SEQ ID NO: 1.

[Example 7] (Construction of 4-haloacetoacetate reductase gene expression plasmid) Based on the base sequence of ORF of 4-haloacetoacetate reductase obtained in Example 6, an expression plasmid was constructed in Escherichia coli. Primer FABG-E (SEQ ID NO: 10) for
FABG-H (SEQ ID NO: 11) was synthesized. 0.2 mM dNTP, 5%
Dimethyl sulfoxide (DMSO), 10 pmol of each primer,
50μ including chromosomal DNA 50ng, ExTaq buffer, ExTaq 2.5U
Using the L reaction solution, denaturation (94 ° C for 1 minute), annealing (55 ° C
Min) and extension (72 ° C. for 3 min) as one cycle, and 30 cycles were performed. For the reaction, GeneAmp PCR System 2400 (manufactured by PerkinElmer) was used. SEQ ID NO: 10: FABG-E 5′-GGGAATTCAGGAAACAGACCATGAGCCAACGGTTTGCAGGAAGAG-
3 ′ SEQ ID NO: 11: FABG-H 5′-GGAAGCTTAACATTTCGGGCCGCCGGCCACATACAG-3 ′ The obtained PCR product was double-digested with EcoRI and HindIII, and pTrc99
A (Pharmacia) was subcloned between EcoRI and HindIII. The obtained plasmid was designated as pTrc-Bst. pTrc
The plasmid map of -Bst is shown in FIG.

[Example 8] (Production of recombinant 4-haloacetoacetate reductase by Escherichia coli) An LB medium containing 50 mg / L ampicillin of Escherichia coli JM109 strain transformed with pTrc-Bst (Bactotryptone 10 g, Bacto yeast) 5 g of extract, 10 g of sodium chloride / 1 L, pH 7.2), and cultured at 37 ° C. overnight. About 1 day later, the cells were inoculated into 100 mL of LB liquid medium containing 50 mg / L ampicillin and 119 mg / L IPTG (isopropylthiogalactopyranoside), and incubated at 37 ° C for 1 hour.
Cultured for 6-20 hours.

The cultured cells were collected by centrifugation, and
Suspended in 3 mL of 100 mM potassium phosphate buffer (pH 7.4) containing 01% 2-mercaptoethanol, and sonicated (crushed for 30 seconds,
The cells were disrupted by repeating 30 sec intervals 20 times).
After the supernatant was obtained by centrifugation, it was dialyzed against a 10 mM potassium phosphate buffer (pH 7.4) containing 0.01% 2-mercaptoethanol and used as a cell-free extract.

Example 9 (Heat Treatment and Electrophoresis of Recombinant 4-Haloacetoacetate Reductase) The cell-free extract prepared in Example 8 was subjected to (lane 3) heat treatment at 30 ° C. for 10 minutes. Treated (lane 4), treated at 30 ° C for 20 minutes (lane 5), treated at 30 ° C for 40 minutes (lane 4)
6), those treated at 60 ° C. for 10 minutes (lane 7), those treated at 60 ° C. for 20 minutes (lane 8), those treated at 60 ° C. for 40 minutes (lane 9), and those JM109 transformed only with the vector pTrc99A. Cell-free extract (lane 2) and molecular weight marker (lane 1) extracted from the strain
Was subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

As shown in FIG. 3, 27 kD not found in the cell-free extract derived from the bacterium transformed with the vector pTrc99A
The band of a (shown as BstKR1 in FIG. 3) is pTrc-Bs
This was found in cell-free extracts from E. coli transformed with t. This molecular weight was in good agreement with the calculated value of 27 kDa from the amino acid sequence predicted from the DNA sequence. In addition, it was shown that the enzyme can be purified extremely efficiently only by heat treatment, utilizing the heat resistance of 4-haloacetoacetate ester reductase derived from moderately thermophilic bacteria.

Example 10 (Substrate Specificity of Recombinant 4-Haloacetoacetate Ester Reductase) Using the recombinant 4-haloacetoacetate ester reductase prepared in Example 8, the activity for various substrates was measured. As a coenzyme, only reduced nicotinamide adenine dinucleotide phosphate (NADPH) was used as an electron donor, and reduced nicotinamide adenine dinucleotide (NADH) could not be used. Ethyl 4-chloroacetoacetate was efficiently reduced as a substrate for the reduction reaction, but acetoacetyl-CoA, which is a reducing substrate of β-ketoacyl ACP reductase of Escherichia coli and Bacillus subtilis, was not reduced at all. Further, it did not have any oxidation activity of (R) or (S) -4-chloro-3-hydroxybutyric acid ethyl ester using oxidized nicotinamide adenine dinucleotide phosphate (NADP ⁺ ) as an electron acceptor.

[Example 11] (Optimal temperature of recombinant 4-haloacetoacetate ester reductase) Optimum temperature of 4-chloroacetoacetate ethyl reduction reaction using 4-haloacetoacetate ester reductase prepared in Example 8 Was measured. The optimum temperature for the reaction was 45 ° C. Also,
FIG. 4 shows the relative activity of 80% or more of the maximum activity in a wide range from 40 ° C. to 55 ° C. Ethyl 4-chloroacetoacetate used as a substrate for the reaction is an unstable substance at high temperatures. Therefore, when the recombinant 4-haloacetoacetate reductase is allowed to act on another substrate compound that is stable at a high temperature, the optimal temperature of the enzyme reaction may be further increased.

[Example 12] (Production of ethyl (S) -4-chloro-3-hydroxybutyrate by recombinant 4-haloacetoacetate reductase) Using 4-haloacetoacetate reductase prepared in Example 8 Ethyl (S) -4-chloro-3-hydroxybutyrate was synthesized from ethyl 4-chloroacetoacetate. 200 mM potassium phosphate buffer (pH 6.5), 2% ethyl 4-chloroacetoacetate, 2 equivalents glucose to substrate, 1 mM NAD
P ⁺ , 38.4 mU of 4-haloacetoacetate reductase, 4-
The reaction was carried out overnight in a reaction solution containing glucose dehydrogenase (Wako Pure Chemical Industries, Ltd.) twice the amount of haloacetoacetate reductase.

The optical purity of ethyl (S) -4-chloro-3-hydroxybutyrate was measured by the following method using the reaction-terminated liquid. Ethyl 4-chloro-3-hydroxybutyrate was extracted from the reaction solution with ethyl acetate, desolvated, and analyzed by liquid chromatography using an optical resolution column. The chiral cell OD (CHIRALCEL OD. 4.6 mm × 25 cm) manufactured by Daicel Chemical Industries, Ltd. was used as the optical resolution column, and an eluent of n-hexane: 2-propanol = 93: 7, a flow rate of 1 mL / min,
Performed by RI detection. As a result, ethyl 4-chloro-3-hydroxybutyrate produced according to the present invention was (S) -form with 97.8% ee.

The produced ethyl 4-chloro-3-hydroxybutyrate was quantified by gas chromatography, and the yield based on the starting material, ethyl 4-chloroacetoacetate, was determined. The conditions of gas chromatography are as follows. That is, Salmon-3000 5% Chromosolve W 60-80 (AW-DMCS) (Thermon-30005%
Using Chromosorb W 60-80 (AW-DMCS, Shinwa Kako Co., Ltd.), 3.2 mm × 210 cm, the column temperature was 150 ° C., and analysis was performed using a flame ionization detector (FID). As a result, the yield of the reaction was about 48%.

[0077]

The present invention provides a novel β-ketoacyl ACP reductase useful for producing optically active alcohols such as (S) -4-halo-3-hydroxybutyric acid ester derivatives and a method for obtaining homologs thereof. . Furthermore, a β-ketoacyl ACP reductase gene derived from Bacillus stearothermophilus and a protein encoded by the same have been provided based on the method of B. stearothermophilus. By utilizing this enzyme, an efficient method for producing ethyl (S) -4-chloro-3-hydroxybutyrate having high optical purity was provided.

[0078]

[Sequence List] SEQUENCE LISTING <110> DAICEL CHEMICAL INDUSTRIES, LTD. <120> Gene coding a enzyme useful for producing (S) -4-halo-3-hydroxybuty rate ester, method for obtaining the same, and method for producing opti cally active alcohol. <130> D1-A0012 <140> <141> <160> 11 <170> PatentIn Ver. 2.1 <210> 1 <211> 765 <212> DNA <213> Bacillus stearothermophilus <220> <221> CDS <222> (1) .. (765) <400> 1 atg agc caa cgg ttt gca gga aga gtg gcg ttt gtg acc gga gga agc 48 Met Ser Gln Arg Phe Ala Gly Arg Val Ala Phe Val Thr Gly Gly Ser 1 5 10 15 cgc ggc atc ggc aag gcg att gtc acc cgc ttc gcg gaa gaa ggg gcg 96 Arg Gly Ile Gly Lys Ala Ile Val Thr Arg Phe Ala Glu Glu Gly Ala 20 25 30 aaa gtg gca ttc atc gat gaa g ctt gaa gcg acg gct 144 Lys Val Ala Phe Ile Asp Leu Asn Glu Glu Ala Leu Glu Ala Thr Ala 35 40 45 gcc gag ctg cgg gag aaa ggg tat gac gtg tac gcc aaa gtg gcg agc 192 Ala Glu Leu Arg Gyr Lys Asp Val Tyr Ala Lys Val Ala Ser 50 55 60 gtc acc gac cgc gaa caa gtg gaa a cg acg atg caa gag gtc gtc gac 240 Val Thr Asp Arg Glu Gln Val Glu Thr Thr Met Gln Glu Val Val Asp 65 70 75 80 cgg ttc ggc tcg ctt gat att ctt gtc aac aac gcc ggc gtc atc cgc 288 Arg Phe Gly Ser Leu Asp Ile Leu Val Asn Asn Ala Gly Val Ile Arg 85 90 95 gac aac ttg ctc ttt aaa atg acg gac gac gac tgg caa acg gtc atg 336 Asp Asn Leu Leu Phe Lys Met Thr Asp Asp Asp Trp Gln Thr Val Met 100 105 110 gac gtt cat ttg aaa ggg gcg ttt tat tgc gcc cgc gcc gcg caa aaa 384 Asp Val His Leu Lys Gly Ala Phe Tyr Cys Ala Arg Ala Ala Gln Lys 115 120 125 tat atg gtc gaa aaa ggg tac ggg cgc atc atc atc ac tcg tcg acc 432 Tyr Met Val Glu Lys Gly Tyr Gly Arg Ile Ile Asn Ile Ser Ser Thr 130 135 140 tcc gcg ctc gga aac cgc ggc cag gcg aac tat tcg gcg gcg aaa gcc 480 Ser Ala Leu Gly Asn Arg Asn Gln Tyr Ser Ala Ala Lys Ala 145 150 155 160 ggc att caa ggg ttt acg aaa acg ttg gcg atc gag ctc ggc aag ttc 528 Gly Ile Gln Gly Phe Thrhr Lys Thr Leu Ala Ile Glu Leu Gly Lys Phe 165 170 175 gc g att ac aac gcc atc gct cca gga ttc att gaa acc gat atg 576 Gly Ile Thr Thr Asn Ala Ile Ala Pro Gly Phe Ile Glu Thr Asp Met 180 185 190 aca aag gca acc gct gag cgg ctt ggc att tcg ttt gag cag ctc att 624 Thr Lys Ala Thr Ala Glu Arg Leu Gly Ile Ser Phe Glu Gln Leu Ile 195 200 205 cag gcg agc gtc gcc aac atc ccg gtc gga cgc agt ggc cgt ccg gaa 672 Gln Ala Ser Val Ala Asn Ile Pro Val Gly Arg Ser Gly Arg Pro Glu 215 220 gac atc gcc cat gca gtc gcg ttt ttc gcc gac gaa cgg tcg tcg ttt 720 Asp Ile Ala His Ala Val Ala Phe Phe Ala Asp Glu Arg Ser Ser Phe 225 230 235 240 gtc aac ggc caa gtg ctg gg gg gc ccg aaa tgt taa 765 Val Asn Gly Gln Val Leu Tyr Val Ala Gly Gly Gly Pro Lys Cys 245 250 255 <210> 2 <211> 254 <212> PRT <213> Bacillus stearothermophilus <400> 2 Met Ser Gln Arg Phe Ala Gly Arg Val Ala Phe Val Thr Gly Gly Ser 1 5 10 15 Arg Gly Ile Gly Lys Ala Ile Val Thr Arg Phe Ala Glu Glu Gly Ala 20 25 30 Lys Val Ala Phe Ile Asp Leu Asn Glu Glu Ala Leu Glu Ala Thr Ala 35 40 45 Ala Glu Leu Arg Glu L ys Gly Tyr Asp Val Tyr Ala Lys Val Ala Ser 50 55 60 Val Thr Asp Arg Glu Gln Val Glu Thr Thr Met Gln Glu Val Val Asp 65 70 75 80 Arg Phe Gly Ser Leu Asp Ile Leu Val Asn Asn Ala Gly Val Ile Arg 85 90 95 Asp Asn Leu Leu Phe Lys Met Thr Asp Asp Asp Trp Gln Thr Val Met 100 105 110 Asp Val His Leu Lys Gly Ala Phe Tyr Cys Ala Arg Ala Ala Gln Lys 115 120 125 Tyr Met Val Glu Lys Gly Tyr Gly Arg Ile Ile Asn Ile Ser Ser Thr 130 135 140 Ser Ala Leu Gly Asn Arg Gly Gln Ala Asn Tyr Ser Ala Ala Lys Ala 145 150 155 160 Gly Ile Gle Gln Gly Phe Thr Lys Thr Leu Ala Ile Glu Leu Gly Lys Phe 165 170 175 Gly Ile Thr Thr Asn Ala Ile Ala Pro Gly Phe Ile Glu Thr Asp Met 180 185 190 Thr Lys Ala Thr Ala Glu Arg Leu Gly Ile Ser Phe Glu Gln Leu Ile 195 200 205 Gln Ala Ser Val Ala Asn Ile Pro Val Gly Arg Ser Gly Arg Pro Glu 210 215 220 Asp Ile Ala His Ala Val Ala Phe Phe Ala Asp Glu Arg Ser Ser Phe 225 230 235 240 Val Asn Gly Gln Val Leu Tyr Val Ala Gly Gly Pro Lys Cys 245 250 <210> 3 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 3 acggaattcg tsacrggmgc swsscgcggm atygg 35 <210> 4 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 4 tgcaagcttg tcatrgcygt ykmratraak ccyggsgc 38 <210> 5 <211> 557 <212> DNA <213> Bacillus stearothermophilus <400> 5 gaattcgtga cgggcgcag gagcgagcgagcgagcgagcgagcggcagcgagcggcagcgggcgcagggcggagcgggcgcagggcggcagggcggcagggcgggcggagcgggcggcagggcggcagggcggagcgggagcggagcaggagcagggagcgggcggagcggagcggagcagggagcgggagg cgcttgaagc gacggctgcc 120 gagccgcggg agaaagggta tgacgtgtac gccaaagtgg cgagcgtcac cgaccgcgaa 180 caagtggaaa cgacgatgca agaggtcgtc gaccggttcg gctcgcttga tattcttgtc 240 aacaacgccg gcgtcatccg cgacaacttg ctctttaaaa tgacggacga cgactggcaa 300 acggtcatgg acgttcattt gaaaggggcg ttttattgcg cccgcgccgc gcaaaaatat 360 atggtcgaaa aagggtacgg gcgcatcatc aacatttcgt cgacctccgc gctcggaaac 420 cgcggccagg cgaactattc ggcggcgaaa gccggcattc aagggtttac gaaaacgttg 480 gcgatcgagc tcggcaagtt c ggcattacg acgaacgcca tcgcgccggg cttcatcgaa 540 acagctatga caagctt 557 <210> 6 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 6 tccgcgctcg gaaagggcgg cattc <210> 7 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 7 atcgagctcg gcaagttcgg cattacgacg aacgccatcg 40 <210> 8 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 8 acgctcgcca ctttggcgta cacgtcatac cctttctccc 40 <210> 9 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 9 cttcttccgc gaagcgggtg acaatcgcct tgccgatgcc 40 <210> 10 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized prim er sequence <400> 10 gggaattcag gaaacagacc atgagccaac ggtttgcagg aagag 45 <210> 11 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 11 ggaagcttaa catttcgggc cgccggccac atacag 36

[Brief description of the drawings]

FIG. 1 shows an alignment of the fabG amino acid sequence.

FIG. 2 is a plasmid map of pTrc-Bst.

FIG. 3 is a photograph showing the results of SDS-PAGE of recombinant 4-haloacetoacetate reductase and a heat-treated product thereof.

FIG. 4 is a graph showing the optimum temperature of recombinant 4-haloacetoacetate reductase. The vertical axis represents the relative activity, and the horizontal axis represents the reaction temperature.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12N 5/10 C12P 7/04 9/04 21/02 C C12P 7/04 (C12P 7/04 21/02 C12R 1:07) // (C12P 7/04 C12N 15/00 ZNAA C12R 1:07) 5/00 A F term (reference) 4B024 AA03 BA08 CA01 CA09 DA06 EA04 GA11 HA01 4B050 CC03 DD02 FF13E LL05 4B064 AD75 CA02 CA19 CA21 CB18 CB30 CC24 CD05 CD11 DA20 4B065 AA18Y AA26X AB01 AC02 AC14 BA02 BD01 BD30 BD35 CA12 CA28 CA60

Claims (14)

[Claims] 1. A 4-haloacetoacetate comprising a combination of oligonucleotides comprising a base sequence of SEQ ID NO: 3 and SEQ ID NO: 4 or a continuous base sequence of at least 15 bases complementary to a complementary sequence thereof. A primer set for synthesizing a gene encoding a protein having an enzymatic activity that acts on an acetate ester to produce (S) -4-halo-3-hydroxybutyrate ester. 2. A method for obtaining a gene encoding a protein having an enzymatic activity that acts on 4-haloacetoacetate to produce (S) -4-halo-3-hydroxybutyrate, comprising the following steps: (A) using the primer set of claim 1 to perform PCR using a polynucleotide derived from an organism as a template, (b) collecting the amplification product of step (a),
(C) a step of obtaining a gene containing a base sequence of the amplification product and encoding a protein having the desired enzyme activity; 3. The method according to claim 2, wherein the organism is a thermophilic microorganism. 4. The compound according to any one of the following (a) to (e), which acts on 4-haloacetoacetate;
-A polynucleotide encoding a protein having an enzymatic activity to produce halo-3-hydroxybutyrate. (A) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1; (b) a polynucleotide encoding a protein consisting of the amino acid sequence of SEQ ID NO: 2; (c) an amino acid sequence of SEQ ID NO: 2 Where 1
Or, a plurality of amino acids are substituted, deleted, inserted, and / or
Or (d) a polynucleotide encoding a protein consisting of an added amino acid; (d) a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; A polynucleotide encoding an amino acid sequence having 80% or more homology with the described amino acid sequence, 5. A protein encoded by the polynucleotide according to claim 4. 6. A recombinant vector into which the polynucleotide according to claim 4 has been inserted. 7. The recombinant vector according to claim 6, further comprising a polynucleotide encoding a dehydrogenase capable of catalyzing a redox reaction using β-nicotinamide adenine dinucleotide as a coenzyme. 8. A transformant carrying the polynucleotide according to claim 4 or the vector according to claim 6 in an expressible manner. 9. culturing the transformant according to claim 8,
The protein according to claim 5, further comprising a step of recovering a protein having an enzymatic activity that acts on 4-haloacetoacetate to generate (S) -4-halo-3-hydroxybutyrate, or a fraction containing the same. Manufacturing method. 10. An alcohol produced by reacting the protein according to claim 5, a microorganism producing the protein, or a processed product of the microorganism with a ketone, and reducing the ketone to produce an alcohol. Manufacturing method. 11. The method for producing alcohol according to claim 10, wherein the microorganism is the transformant according to claim 8. 12. The method for producing an alcohol according to claim 10, wherein the ketone is a 4-haloacetoacetic acid ester derivative and the alcohol is a (S) -4-halo-3-hydroxybutyric acid ester derivative. 13. The 4-haloacetoacetate derivative is 4
The method for producing an alcohol according to claim 12, wherein the alcohol is ethyl (S) -4-chloro-3-hydroxybutyrate. 14. The method for producing an alcohol according to claim 10, further comprising a step of additionally converting an oxidized β-nicotinamide adenine dinucleotide to a reduced form.