JP2002018270A - Synthetic hydrogel - Google Patents

Abstract

PROBLEM TO BE SOLVED: To prepare a synthetic hydrogel capable of simply and rapidly obtaining the hydrogel having sufficient strength in the vicinity of the bodily temperature (37 deg.C) of a person under a physiological condition without being accompanied by chemical reaction or polymerization reaction in the formation of a crosslinking point. SOLUTION: The synthetic hydrogel has a complementary nucleic acid base pair, which comprises two kinds of water soluble polymers [X(xn), Y(yn)] wherein a plurality of nucleic acid oligomers (x, y) capable of mutually forming a base pair are bonded in one molecule, as a crosslinking point.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a hydrogel used in medical fields, cosmetic fields, agricultural and horticultural fields, and the like.

[0002]

2. Description of the Related Art Most of living tissues are composed of hydrogel, and hydrogel is regarded as a very important soft material in the field relating to living organisms. Its use has become indispensable, for example, as a carrier for culturing cells or bacterial cells, or as a support for electrophoresis or chromatography for separating DNA and proteins. In addition, it has been actively used in medical and hygiene products as a contact lens, wound dressing, biological tissue adhesive, anti-adhesion material, drug carrier, water-absorbing material, and in cosmetics and agricultural and horticultural fields as a water retention agent. Have been.

[0003] The three-dimensional network structure of a hydrogel is constructed by cross-linking between hydrophilic polymers, and the cross-linking points are formed by covalent bonds (chemically cross-linked gels), hydrogen bonds, and va.
It is classified into those based on secondary interaction forces such as n der Waals force and hydrophobic interaction (physical crosslinked gel).

As the chemically crosslinked gel, there is a polyacrylamide gel used for an electrophoresis support and a polyacrylate gel used as a water absorbing material. These are prepared by adding a small amount of a bifunctional monomer such as bisacrylamide when radical polymerization is performed by adding a polymerization initiator such as persulfate to an aqueous solution of a polymerizable monomer such as acrylamide or sodium acrylate under deoxygenation. It is obtained by polymerizing. Other chemically crosslinked gels include gelatin glue and albumin glue. This is a method of chemically cross-linking a large number of primary amino groups in gelatin or albumin molecules with formaldehyde or glutaraldehyde.It is simple to mix aqueous gelatin solution or aqueous albumin solution with aqueous aldehyde solution at room temperature or near body temperature. High strength hydrogel quickly with simple operation (within minutes)
Therefore, it is used as a biological tissue adhesive. However, carcinogenicity and tissue damage of aldehydes used as crosslinking agents have been pointed out.

[0005] Gelatin gels and agarose (agarose) gels are well known as physically crosslinked gels. When an aqueous solution of gelatin or agar is cooled to a temperature below room temperature, a hydrogel is obtained. However, the melting point of gelatin gel is 30 ° C. or less, and it does not become a hydrogel near human body temperature (37 ° C.). Agar gel is a hydrogel that is stable even at 37 ° C,
Heating to 90 ° C or higher is required to obtain an uncrosslinked aqueous agar solution. In addition, the composition and molecular weight of the raw seaweed vary depending on the production place, growth degree, agar recovery method and the like, and quality control is difficult. Although collagen gel, which is a raw material for gelatin, is a hydrogel that is stable even at 37 ° C., it is necessary to maintain the pH at an extremely low pH of 3 or less in order to obtain an uncrosslinked aqueous collagen solution. Since these physically crosslinked hydrogels are natural materials, it is impossible to arbitrarily control the physical properties of the hydrogel by molecular design.

[0006] Synthetic or semi-synthetic physically crosslinked gels are also known. Polyvinyl alcohol, which is a synthetic polymer, is crosslinked by hydrogen bonds between hydroxyl groups and becomes a stable hydrogel even at 37 ° C. Generally, to dissolve polyvinyl alcohol in water, it is necessary to completely decompose hydrogen bonds between hydroxyl groups.
Heating above 0 ° C. is required. On the other hand, for gelation, after cooling to -80 ° C to -10 ° C and freezing,
Thawing must be performed at a temperature between ℃ and room temperature. As a semi-synthetic physically crosslinked gel, there is a gel of a cellulose derivative. An aqueous solution of methylcellulose in which the hydroxyl groups of cellulose are heterogeneously etherified with methyl groups becomes a hydrogel by heating, contrary to gelatin or agar gel,
It is known that cooling returns to an aqueous solution. In general, the higher the degree of methyl group substitution, the lower the gelation temperature of an aqueous solution of methylcellulose, but even when highly methylated, the gelation temperature of the aqueous solution is as high as 45 ° C. or higher.
A stable hydrogel was not obtained at room temperature or 37 ° C.
Furthermore, synthetic hydrogels have been developed that can arbitrarily control the sol-gel transition temperature of such gelled thermoreversible hydrogels at elevated temperatures (H. Yoshioka, et al., J. Macromo
l. Sci., A31 (1), 113-120 (1994)). However,
In this system, the strength of the hydrogel was not always sufficient because the crosslinking points of the hydrogel were formed by a weak secondary force called hydrophobic interaction.

[0007]

In a chemically crosslinked gel, the formation of crosslink points involves a chemical reaction or a polymerization reaction, so that the toxicity of a crosslinking agent, a monomer, a polymerization initiator, etc. becomes a serious problem. Physically crosslinked gels can avoid toxicity problems because they do not involve a chemical reaction in the formation of crosslink points.However, since the formation of crosslink points is due to a secondary interaction force that is relatively weak, the resulting hydrogel has a human body temperature. In order to maintain the state of an aqueous solution with low fluidity at around (37 ° C) or high fluidity as an uncrosslinked water-soluble polymer, maintain a state such as extremely high or low temperature or extremely low pH. I needed to. In addition, as a problem common to both of them, there is a problem that the formation of a hydrogel requires a large change in an environment that is unbearable to living organisms, and it takes time and effort. An object of the present invention is to provide a synthetic hydrogel that solves the above-mentioned problems of the prior art.

[0008]

Means for Solving the Problems As a result of earnest studies, the present inventors have found that a synthetic hydrogel having a nucleic acid base pair as a crosslinking point is extremely effective in solving the above-mentioned problems.

The present invention is based on the above findings, and according to the present invention, there is provided a synthetic hydrogel having complementary nucleic acid base pairs as crosslinking points. According to the present invention, further, a nucleic acid oligomer (x, y) capable of forming a base pair with each other is further provided.
A synthetic hydrogel having a complementary nucleic acid base pair composed of at least two types of water-soluble polymers (X (xn), Y (yn)), each of which is bonded to a plurality of molecules, in a molecule. You. According to the present invention, nucleic acid oligomers (x, y) each capable of forming a base pair with each other are each 1
A synthetic hydrogel having a nucleic acid base pair consisting of at least two types of water-soluble nucleic acid molecules (X (xn), Y (yn)) having a plurality of molecules in the molecule as a crosslinking point is provided. According to the present invention,
Furthermore, a synthetic hydrogel having a nucleic acid base pair consisting of a water-soluble protein or water-soluble polysaccharide in which a plurality of nucleic acid oligomers (x, y) capable of forming base pairs with each other are bound in one molecule is used as a crosslinking point. Is provided.

In the present invention, a hydrogel is defined as a hydrophilic polymer having a three-dimensional network structure swelled in water (edited by the Society of Polymer Science, New Polymer Dictionary, Asakura Shoten, 1988).
Year). That is, for example, a state in which double-stranded DNA is simply dispersed or dissolved in water at a high concentration is different from the hydrogel defined in the present invention. Generally such a DN
A state in which a polymer dispersion or aqueous solution such as A loses fluidity may be referred to as a gel state, but such a dispersion or aqueous solution can be diluted infinitely by adding water, The hydrogel referred to in the present invention is distinguished by having a finite equilibrium swelling volume even in excess water. That is, the synthetic hydrogel of the present invention has extremely low solubility in water, usually 30% or less, preferably 10% or less,
More preferably, it is 5% or less.

[0011] The solubility of the hydrogel in water can be measured specifically as follows. 10 g of a hydrogel having a polymer concentration of 10% (1 g in terms of dry polymer weight) is immersed in 1,000 ml of distilled water at 37 ° C. for 1 hour to swell, and the hydrogel is collected and dried at 40 ° C. for 3 days in a 0.1 torr vacuum dryer. Dried in,
The dry weight (D) g is measured. At this time, the solubility of the hydrogel is calculated as (1−D) × 100%.

[0012] Nucleic acid is an acidic high molecular organic compound containing phosphoric acid which is always present in places where life phenomena are performed, from cells of higher animals and plants to bacteria and viruses. Nucleic acid is a DNA (deoxyribonu
cleic acid (deoxyribonucleic acid) and RNA (ribonucleic
acid, ribonucleic acid). DNA is also RNA
The basic structure is also common, and a unit consisting of a nucleic acid base (usually simply abbreviated as a base) and a pentose pentose are connected one-dimensionally via phosphoric acid. The unit consisting of a base and a sugar is called a nucleoside, and the unit with a phosphate group is called a nucleotide.
In DNA, the sugar moiety is 2-deoxy-D-ribose (2-deox
While it is yD-ribose), that of RNA is D-ribose. Furthermore, the bases of DNA consist of four types: adenine (abbreviated as A), guanine (guanine) (G), cytosine cytosine (C), and thymine (thymine) (T).
(U) is used. Both DNA and RNA are macromolecules in which a large number of these four bases are arranged in various orders. The position to which the phosphate is bonded is alternated between the 5'- and 3'-positions of the pentose. If one end of the polynucleotide chain is at the 5'-end, the other end is at the 3'-end. When both DNA and RNA are synthesized in vivo, synthesis proceeds from the 5 'end to the 3' end.
That is, the nucleic acid molecule has a direction of 5 ′ to 3 ′. The base sequence of a nucleic acid molecule is usually at the 5 'end,
The terminal side is written on the right. That is, AGCT and TCGA are different molecules, and for the purpose of clarifying this point, they may be referred to as 5'AGCT3 'and 5'TCGA3', respectively.

Normally, DNA has a Watson-Crick double helix structure in which two strands are twisted. The directions of the two chains are opposite to each other, and the force linking the chains is a hydrogen bond acting between the bases A and T and G and C. The two strands linked by this pairing rule are called complementary strands, and those strands are expressed as having complementary base sequences. Pairing rules play a central role in gene replication and gene expression.

The present inventors have noticed that the binding between the complementary strands is selective and strong, and the interaction between a pair of nucleic acid oligomers having the complementary base sequence is described as the cross-linking point of the hydrogel. The present inventors have found that the present invention can be used for formation and completed the present invention.

[0015] The nucleic acid used in the present invention is synthesized by an organic chemical synthesis means or a biochemical synthesis means. The organic chemical synthesis of a nucleic acid having an arbitrary base sequence is performed by bonding nucleotides and oligonucleotides having a small number of the nucleotides together using a condensing agent. At this time, if the phosphoric acid group is converted into a triester, the efficiency of the condensation is high (phosphoric acid triester method). The easily reactive group on the base is modified and protected in advance, and is returned to its original state after removal of the protecting group after completion of the nucleic acid chain. Polynucleotides of up to about 20 bases can be synthesized relatively easily by this method.

In the biochemical method, a mixture of a DNA sample and a polymerase or other reagents is repeatedly heated and cooled to replicate the DNA sample by PCR (Polymerase Chain Reactor).
ion) method is used. The PCR reaction proceeds as follows (Medical Technology, 24, No. 3, 1996). 1) The template DNA is heat-denatured at 94 ° C. to be single-stranded (heat denaturation). 2) A primer of about 20 mer (single-stranded DNA in which about 20 nucleotides are linked) having complementary base sequences at the 3 'ends of both ends of the DNA region to be subsequently amplified is used.
Bond at around ° C (annealing). 3) While reading the template DNA from the 3 ′ side to the 5 ′ side, a complementary strand is synthesized at about 72 ° C. from the 5 ′ side to the 3 ′ side by the DNA polymerase using the primer as a starting point.
(DNA chain elongation) The above process is defined as one cycle, and by repeating this process n times, the DNA is theoretically amplified to 2n.

In the present invention, the interaction between a pair of nucleic acid oligomers (x, y) having mutually complementary base sequences obtained by the above-mentioned method is used for forming a crosslinking point of a hydrogel. It is desirable that the base sequence of the nucleic acid used in the above does not have specific genetic information.

The length of the base sequence of the nucleic acid oligomers x and y is closely related to the stability of the hydrogel of the present invention. The melting temperature of the hydrogel decreases as the length (number) of the nucleic acid base pairs forming the crosslink points decreases, and as the length increases, the melting temperature increases. In order to obtain a stable hydrogel at a temperature near body temperature, the length of the nucleobase is preferably 10 bases or more. On the other hand, if the length of the nucleic acid base is 150 bases or more, synthesis becomes difficult. For DNA, it is generally said that the melting temperature increases by about 2 ° C. per AT base pair and about 3 ° C. per GC base pair. That is, for nucleic acid base pairs of the same length, the more GC base pairs, the higher the stability.

As described above, in the synthetic hydrogel of the present invention, the stability (melting temperature) of the hydrogel can be arbitrarily changed by changing the length of the nucleic acid base pairs forming the cross-linking points and the type of the nucleic acid forming the base pairs. It has an excellent feature that it can be controlled. Gelatin gel and agar gel also have the property of melting at high temperatures, but it is impossible to arbitrarily control the melting temperature of these natural polymer materials.

The nucleotide sequences of the nucleic acid oligomers x and y are complementary to each other (for example, 5'ATGC3 'and 5'TACG).
3 ′) is desirable, but it is not always necessary to be a completely complementary strand, and it is sufficient that x and y can form a stable complex at room temperature or near body temperature even if some base sequences are not complementary. More specifically, a paired nucleic acid oligomer x
It is preferable that there are 10 or more complementary base pairs in the base sequences of and y, more preferably 20 or more complementary base pairs are formed.

However, when x oligomers or y oligomers form a complex, they form one complex.
Water-soluble polymers X (xn) and Y (y
n) alone forms a hydrogel and cannot function as an aqueous solution of a water-soluble polymer.Therefore, the base sequence of x and y has a base sequence such as a palindrome that is itself a complementary chain. Desirably not.

The base sequences of the nucleic acid oligomers x and y may all have the same base sequence. That is, the x oligomer is 5'AAAAnAAA3 '(oligo dA) and the y oligomer is 5'TTTTnTTT3' (oligo dT) or x
The oligomer is 5'GGGGnGGG3 '(oligo dG) and y
The oligomer may be a combination of 5′CCCCnCCC3 ′ (oligo dC).

In the present invention, the above complementary nucleic acid oligomers x and y are separately bonded to a water-soluble polymer. Here, the type of the water-soluble polymer that binds x and the type of the water-soluble polymer that binds y may be the same or different. However, it is necessary to introduce a plurality of nucleic acid oligomers into one water-soluble polymer. If only one nucleic acid oligomer is introduced into one molecule of the water-soluble polymer, even if the nucleic acid oligomer forms a complementary base pair, the nucleic acid oligomer ends only with the cross-linking between the two molecules, and the water-soluble polymer becomes infinite. No crosslinked three-dimensional network structure is obtained and no hydrogel is formed.

The kind of the water-soluble polymer of the present invention is not particularly limited, and various synthetic polymers and natural polymers can be used. However, when a polycation is used as the water-soluble polymer since the nucleic acid oligomer is anionic, a polyion complex is formed between the nucleic acid oligomer and the polycation, which is not preferable. Accordingly, a nonionic or anionic polymer is preferably used as the water-soluble polymer of the present invention. When the hydrogel of the present invention is used for biomedical applications, the polymer compound constituting the hydrogel is preferably biodegradable, and nucleic acids, proteins, polysaccharides, and the like are used as the water-soluble polymer of the present invention. This is extremely useful because it is metabolically degraded in vivo. Here, when a nucleic acid is used as the water-soluble polymer, it is necessary to select one that does not form a complementary base pair with the complementary nucleic acid oligomers x and y described above.

As a method for introducing the complementary nucleic acid oligomer (x, y) into the water-soluble polymer, various methods known in the art can be adopted, and examples thereof are as follows. Complementary nucleic acid oligomer (x,
y) is synthesized, and the 5 ′ end or 3 ′ end of each oligomer is activated and separately graft-bonded to the hydrophilic polymer (X, Y). At this time, a design is made so that a plurality of nucleic acid oligomers are introduced into one water-soluble polymer.

Each of the water-soluble polymers X (xn) and Y (yn) obtained by grafting the two kinds of complementary nucleic acid oligomers (x, y) obtained as described above is used as separate aqueous solutions. This 2
When two polymer aqueous solutions are mixed, a cross-link is formed between the two water-soluble polymers X (xn) and Y (yn) by complementary base pairing between xy, and the water-soluble polymer is infinite. A three-dimensional network structure crosslinked to form a hydrogel.

In the above embodiment, the synthesis of a graft copolymer in which a complementary nucleic acid oligomer is introduced as a side chain to a hydrophilic polymer main chain has been exemplified. May be an embodiment of a block copolymer linearly introduced into the polymer.

Hereinafter, the present invention will be described in more detail with reference to Examples, but the present invention is not limited to the following Examples.

[0029]

Example 1 A DNA oligomer consisting of only 20 bases of guanine was synthesized by an automatic nucleic acid synthesizer, and the 5′-terminal aminated oligo dG (20mer) was obtained from Nippon Flour Milling Co., Ltd. This 5 'terminal aminated oligo dG
160mg (20μmol) and carboxymethylcellulose (CM
CNa, degree of etherification 0.9, degree of condensation 400, molecular weight about 100,000) 500
mg of carbodiimide [1- (3-dimethylaminopropyl) -3-ethy] in 100 ml of phosphate buffer (pH 7, 0.15M).
lcarbodiimide hydrochloride, EDC] 50mg, 37 ℃
For 24 hours. It was concentrated to 10 ml using an ultrafiltration membrane having a molecular weight cut off of 30,000, and the concentrated solution was diluted with 90 ml of distilled water. The above concentration and dilution were repeated three times to remove low molecular weight impurities, followed by lyophilization, and oligo dG (20mer) was 5 ′.
600 mg of a water-soluble polymer (I) grafted to the CMC main chain at the terminal via an amide bond was obtained. Elemental analysis results, DNA
Since the ratio of the graft chain to the CMC main chain was the same as the charge ratio, the molecular weight of the DNA chain was about 8,000, and the molecular weight of the CMC chain was about 100,00.
If it is set to 0, it is estimated that about 4 DNA graft chains have been introduced per one CMC main chain.

A DNA oligomer consisting of only 20 bases of cytosine was synthesized by an automatic nucleic acid synthesizer, and the 5′-terminal aminated oligo dC (20mer) was obtained from Nippon Flour Milling Co., Ltd. This 5 'terminal aminated oligo d
C130mg (20μmol) and carboxymethylcellulose (CM
CNa, degree of etherification 0.9, degree of condensation 400, molecular weight about 100,000) 500
mg was dissolved in 100 ml of a phosphate buffer (pH 7, 0.15 M), 50 mg of water-soluble carbodiimide (EDC) was added, and the mixture was reacted at 37 ° C. for 24 hours. It was concentrated to 10 ml using an ultrafiltration membrane having a molecular weight cut off of 30,000, and the concentrated solution was diluted with 90 ml of distilled water. The above concentration and dilution were repeated three times to remove low molecular weight impurities, followed by freeze-drying, and oligo dC (20mer) having CMC at the 5 'end.
580 mg of a water-soluble polymer (II) grafted to the main chain via an amide bond was obtained. As a result of elemental analysis, the ratio of the DNA grafted chain to the CMC main chain was the same as the charging ratio.
If the molecular weight of the chain is about 6,500 and the molecular weight of the CMC chain is about 100,000, C
It is estimated that about four DNA graft chains were introduced per MC main chain.

0.5 g of the water-soluble polymer (I) was dissolved in 4.5 g of distilled water to prepare a 10% aqueous solution. In addition, water-soluble polymer (II) 0.5
g was dissolved in 4.5 g of distilled water to obtain a 10% aqueous solution. When the two aqueous solutions were mixed at room temperature, they rapidly lost their fluidity due to base pairing between complementary DNA graft chains and gelled, resulting in an elastic hydrogel. 10 g of the thus-obtained synthetic hydrogel of the present invention was poured into 1000 ml of distilled water at 37 ° C., and immersed at 37 ° C. for 1 hour.
It was dried in a vacuum drier of 0.1 torr at 0 ° C. for 3 days, and the dry weight was measured to be 0.99 g. That is, the solubility of the synthetic hydrogel of the present invention was calculated to be 1%.

[0032]

Example 2 A DNA oligomer consisting of 20 bases of random sequence (5′CTGCCAGAGTGTTGACACGG3 ′) was synthesized with an automatic nucleic acid synthesizer and the 5′-terminal aminated oligo-DNA was synthesized by Nippon Mills Co., Ltd. Obtained from. 150 mg of this 5′-terminal aminated random oligo DNA (20 μm
ol) and 500 mg of carboxymethylcellulose (CMCNa, degree of etherification 0.9, degree of condensation 400, molecular weight about 100,000) were dissolved in 100 ml of phosphate buffer (pH 7, 0.15 M), and 50 mg of water-soluble carbodiimide (EDC) was added. Reaction was performed at 24 ° C. for 24 hours. It was concentrated to 10 ml using an ultrafiltration membrane having a molecular weight cut off of 30,000, and the concentrated solution was diluted with 90 ml of distilled water. The above concentration and dilution were repeated three times to remove low molecular weight impurities, freeze-dried, and a water-soluble polymer (II) in which random oligo DNA (20mer) was grafted to the CMC main chain at the 5 'end via an amide bond (II)
I) 600 mg were obtained.

A DNA oligomer consisting of 20 bases having a sequence complementary to the above-mentioned random sequence (3′GACGGTCTCA
CAACTGTGCC 5 ′) was synthesized with an automatic nucleic acid synthesizer and the 5 ′ end was aminated at the 5′-terminal aminated oligo DNA (20 me
r) was obtained from Nippon Flour Milling Co., Ltd. 150 mg (20 μmol) of the 5 ′ terminal aminated complementary oligo DNA and carboxymethyl cellulose (CMCNa, degree of etherification 0.9, degree of condensation 40
0, 500,000 molecular weight) 500mg phosphate buffer (pH7, 0.15M)
After dissolving in 100 ml, 50 mg of water-soluble carbodiimide (EDC) was added and reacted at 37 ° C. for 24 hours. It was concentrated to 10 ml using an ultrafiltration membrane having a molecular weight cut off of 30,000, and the concentrated solution was diluted with 90 ml of distilled water. The above concentration and dilution are repeated three times to remove low molecular weight impurities, freeze-dried, and complemented oligo DNA
(20mer) obtained 600 mg of a water-soluble polymer (IV) grafted to the CMC main chain via an amide bond at the 5 'end.

0.5 g of water-soluble polymer (III) is added to 4.5 g of distilled water
Into a 10% aqueous solution. In addition, a water-soluble polymer (I
V) 0.5 g was dissolved in 4.5 g of distilled water to make a 10% aqueous solution. When the two aqueous solutions were mixed at room temperature, they rapidly lost their fluidity and gelled due to base pair formation between complementary DNA graft chains, resulting in an elastic hydrogel. 10 g of the thus-obtained synthetic hydrogel of the present invention was added to distilled water 100
After pouring into 0 ml and immersing at 37 ° C. for 1 hour, the hydrogel was collected and dried in a 0.1 torr vacuum dryer at 40 ° C. for 3 days,
The measured dry weight was 0.99 g. That is,
The solubility of the synthetic hydrogel of the present invention was calculated to be 1%.

[0035]

As described above, the synthetic hydrogel of the present invention uses a complementary nucleic acid base pair as a cross-linking point, so that gelation does not involve a chemical reaction, and there is a problem of toxicity due to a cross-linking agent which is a problem in a chemically cross-linked gel. Absent. In addition, since the cross-linking between hydrophilic polymers is formed by the strong interaction force of complementary nucleic acid base pairs, 37
It is stable even in water at ℃ and does not melt or dissolve.
Furthermore, the stability (melting temperature) of the hydrogel can be arbitrarily set by changing the length and type of the complementary nucleic acid base pairs, so that a hydrogel suitable for various uses can be molecularly designed. Furthermore, by using biodegradable polymers such as nucleic acids, polysaccharides, and proteins as the water-soluble polymers that are the raw materials of the synthetic hydrogel of the present invention, the synthetic hydrogel can be made biodegradable, so that it can be used as a medical material. It can be particularly preferably used.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61L 27/00 A61L 27/00 D 4J002 C B01J 20/26 B01J 20/26 D L C08J 3/075 CFJ C08J 3/075 CFJ C08L 5/00 C08L 5/00 89/00 89/00 F-term (reference) 4C076 AA09 BB24 BB31 EE01A EE30A EE41A FF02 4C081 AA02 AA12 AA14 AB19 AB23 AC04 BA16 CD011 CD111 DA12 4F070 AA6 AB06 AB06 AB06 AB19X AB19Y AB25X BA09 BB03 BB08 CA15 DA02 DA03 4G066 AB26B AC01B AC01C AC03B AC03C AC33B AC33C AC35B AC35C BA28 CA43 CA54 EA01 4J002 AD00W AD00X AD03W AD03X

Claims (6)

[Claims] 1. A synthetic hydrogel comprising a complementary nucleic acid base pair as a crosslinking point. 2. The synthetic hydrogel comprises at least two types of water-soluble polymers (X, Y), wherein X and Y are two types of complementary nucleic acid oligomers (x, y) capable of forming base pairs with each other. 2. The synthetic hydrogel according to claim 1, wherein a plurality of are bonded to one molecule. 3. The synthetic hydrogel according to claim 2, wherein the water-soluble polymer is a nucleic acid. 4. The synthetic hydrogel according to claim 2, wherein the water-soluble polymer is a polysaccharide or a protein having a nucleic acid oligomer bound thereto. 5. The synthetic hydrogel according to claim 2, wherein each of the two kinds of complementary nucleic acid oligomers (x, y) has a sequence of a single kind of base. 6. The two complementary nucleic acid oligomers (x, y) are oligo dA and oligo dT or oligo dG.
6. The synthetic hydrogel according to claim 5, wherein the combination is a combination of and dC.