JP2001275682A - Gene encoding antimalathion monoclonal antibody - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for producing a gene encoding an antimalathion monoclonal antibody, a vector containing the gene, a host cell obtained by transforming with the vector or a recombinant protein containing the variable region of the antimalathion monoclonal antibody obtained by using the above gene and to obtain the recombinant protein produced by the above method for production. SOLUTION: This gene encoding the antimalathion monoclonal antibody is obtained by including the amino acid sequence represented by either sequence number 2 or 4 in the sequence table (see specification) or the amino acid sequence obtained by deleting, substituting or adding one or plural amino acid residues from, for, to the above amino acid sequence.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a monoclonal antibody against S-1,2-bis (ethoxycarbonyl) ethyl O, O-dimethyl phosphorodithioate (hereinafter referred to as "malathion" in the present specification). And particularly genes encoding the variable regions of antibodies.
The present invention further provides a vector containing the gene, a host cell containing the expression vector, and a method for producing a recombinant protein containing the variable region of an anti-malathion monoclonal antibody by culturing the host cell. Provided is a recombinant protein obtained by the production method.

[0002]

2. Description of the Related Art Malathion has the following formula (1):

[0003]

Embedded image

A dithio-type low-toxic organophosphorus insecticide having a structure represented by the following formula: It is effective against sucking pests such as planthoppers, leafhoppers, aphids, thrips, and thrips. The main insecticidal mechanism of this drug is parathion, EP
It is in the inhibition of cholinesterase in the same way as the N agent. Insecticidal activity is generally weaker than them, but it is strong, selective and fast-acting depending on the type of insect. Although there is considerable osmotic migration, it is considered that the residual effect period is short because it is easily degraded in plant tissues and is also lost by volatilization and decomposition from the plant surface. Therefore, it can be used for fruit trees and vegetables up to several days before harvesting, but it is less effective unless used repeatedly for pests with a long outbreak or short generation.
It has little effect on soil pests and larvae. As for the chemical damage, it is necessary to pay particular attention to the seedlings of cucurbits and tomatoes because they are highly sensitive to malathion agents (Agrochemical Handbook pages 28-32 and 514, 1994 edition, Japan Plant Protection Association; "Recent Analytical Methods for the Latest Pesticides", pp. 384-386, edited by the Research Group for Pesticide Residual Analytical Methods, published by Chuo Hoshin.

[0005] In recent years, there has been great social interest in pesticide residues in the environment such as soil, water, and the atmosphere, and post-harvest pesticides in imported agricultural products, which have recently increased in particular. Regarding malathion, based on the Food Sanitation Law, the residual standard value is rice (0.1 ppm), cereals (2-8 ppm),
Beans, fruits, vegetables (0.5-8 ppm), flour (1.
2 ppm), oil seeds (0.1-8 ppm), nuts (8 ppm), hops (1 ppm), etc. ("Recent Analytical Methods for Pesticides" Same as above). Regarding water quality, the standard value for registration suspension for water pollution is 0.1 m.
g / l (Revised 3rd edition Agricultural Chemical Registration Suspension Standard Handbook pp. 874-876, September 25, 1998 Chemical Daily, Inc.) It is necessary to quickly and accurately determine the amount of malathion contained.

[0006] The immunological measurement method is a method for detecting an antigen based on an antigen-antibody reaction in which the antibody specifically recognizes the antigen. Due to its excellent accuracy, simplicity, rapidity, and economic efficiency, it has recently been used. It's getting attention. In immunoassays, a wide variety of labels have been applied as detection methods, for example enzymes, radiotracers, chemiluminescent or fluorescent substances, metal atoms, sols, latexes and bacteriophages.

[0007] Among immunoassays, enzyme immunoassay (EIA) using an enzyme has been widely used as a particularly excellent one. An excellent review of enzyme immunoassays can be found in Tijssen P, "Practic.
e and theoryof enzyme imm
unoassays "in Laboratory
technologies in biochemistr
y and molecular biology,
Elsevier Amsterdam New Yo
rk, Oxford ISBN 0-7204-42
00-1 (1990).

As for malathion, the applicant of the present invention has proposed, at the 24th Annual Meeting of the Japanese Agricultural Pharmaceutical Association (March 26, 1999), an anti-malathion antibody, a method for producing the same, and a hapten constituting an antigen for producing a malathion antibody. Oral presentations and abstracts were presented for the compounds. For further details, see February 23, 1999.
A patent application was filed as Japanese Patent Application No. 11-44450 on the same day.
The Applicant has specifically filed an anti-malathion monoclonal antibody ML
T2-23, MLT40-4 and MLT45-3 were obtained. Particularly preferred monoclonal antibody MLT2-23
, On January 22, 1999, the deposit number FERM P-
In 17157, the Institute of Biotechnology and Industrial Technology,
05-0046 1-3-1 Higashi, Tsukuba City, Ibaraki Prefecture).

Malathion Hapten Compounds More specifically, but not exclusively, a malathion antibody is obtained by binding a compound obtained by introducing a spacer arm and a functional group available for binding to malathion to a suitable polymer compound as a hapten. It can be obtained by using a substance as an antigen. For example, the following equation (2):

[0010]

Embedded image

[In the formula (2), X is NH or S;
Z is NH or O; k is 0 or 1; m is 0
And n is an integer of 1 to 20], is used as a hapten for the production of an antibody.

Preferably, k is zero. Preferably,
m is 2. Preferably, n is an integer from 5 to 10.

More preferably, X is NH and k is 0
Where m is 2 and n is 5.

The malathion hapten represented by the formula (2) can be produced according to a known method. Although not limited, for example, the following method can be used.

I. When X = S i) When k = 0 and Z = NH First, methanol is reacted with diphosphorus pentasulfide in an organic solvent. The reaction is carried out at 0 ° C. to the boiling point of the solvent, preferably at 40 ° C.
To 70 ° C. for 1 to 24 hours, preferably 2 to 5 hours, with stirring.

Examples of the organic solvent include toluene, acetonitrile, acetone, hexane, pentane, benzene, dichloromethane, chloroform, 1,2-dichloroethane, ethyl acetate, diglyme, N, N-dimethylformamide, hexamethylphosphoric triamide and the like. Or a mixed solvent thereof can be used.

Next, a base is added, and the following formula (Y1):

[0018]

Embedded image

In the formula (Y1), L is a halogen atom selected from F, Cl, Br or I, and is reacted with an ester compound having a structure represented by the following formula (Y
2):

[0020]

Embedded image

A compound having a structure represented by the following formula is obtained. As the base, for example, potassium carbonate, sodium carbonate,
Lithium carbonate, potassium bicarbonate, sodium bicarbonate, sodium hydroxide, potassium hydroxide, sodium methylate, sodium ethylate, triethylamine,
N, N-dimethylaniline, lithium diisopropylamide, and the like can be used.

The reaction is carried out at 0 ° C. to the boiling point of the solvent, preferably at 40 ° C. to 70 ° C., for 1 hour to 24 hours, preferably for 1 hour to 3 hours.

Next, the compound of the formula (Y2) is converted to a compound of the following formula (Y) in an organic solvent in the presence of lithium bis (trimethylsilyl) amide, lithium diisopropylamide or the like.
3):

[0024]

Embedded image

Wherein, in the formula (Y3), P is a protecting group for a carboxyl group; and L and m are as defined above, by reacting an ester compound having a structure represented by the following formula: Formula (Y4):

[0026]

Embedded image

In the formula (Y4), P and m are as defined above, to obtain a compound having a structural formula represented by the following formula:

As the organic solvent, tetrahydrofuran (THF), dioxane, diethyl ether, dimethoxyethane and the like can be used.

The protecting group for the carboxyl group represented by P may be a known one, and specific examples include a methyl group, an ethyl group, a tert-butyl group, a benzyl group, a p-methoxybenzyl group and a 3,4-dimethoxybenzyl group. Group, trichloroethyl group, trimethylsilyl group, tert-butyldimethylsilyl group, tert-butyldiphenylsilyl group,
Examples include a triethylsilyl group, a triisopropylsilyl group, a trimethylsilylethoxymethyl group, and the like. However,
Those which are more easily released from the carboxyl group than the ethyl group in the removal step by hydrolysis described below are preferable. For example, t-butyl group, p-methoxybenzyl group, 3,4-
A dimethoxybenzyl group is preferred.

The reaction is carried out at a temperature of −100 ° C. to the boiling point of the solvent, preferably at −80 ° C. to 30 ° C., for 1 hour to 20 hours, preferably 1 hour to 3 hours.

Next, the protecting group of the carboxyl group represented by P is removed from the compound of the formula (Y4) to give the following formula (Y5):

[0032]

Embedded image

A compound having a structure represented by the formula (Y5), wherein m is as defined above, is obtained.

The removal of the protecting group can be carried out by a known method such as alkali hydrolysis and acid hydrolysis.

That is, in the case of acid hydrolysis, the formula (Y
The compound 4) is preferably dissolved in an organic solvent such as acetic acid, formic acid, benzene, dichloromethane, 1,2-dichloroethane and the like, and then hydrochloric acid, sulfuric acid, boron trifluoride diethyl ether complex, trifluoroacetic acid, trifluoromethanesulfonic acid , P-toluenesulfonic acid and the like, and the mixture is stirred at 0 ° C. to the boiling point of the solvent, preferably at 0 ° C. to 50 ° C. for 5 minutes to 10 hours, preferably 1 hour to 5 hours to give a compound of the formula (Y5) Can be obtained.

In the case of alkali hydrolysis, the formula (Y
The compound of 4) is preferably methanol, ethanol,
Dissolve in an organic solvent such as THF and ethylene glycol, and then add sodium hydrogencarbonate, sodium carbonate, potassium carbonate, lithium hydroxide, sodium hydroxide or potassium hydroxide aqueous solution, etc., and bring the solvent to a boiling point of 0 ° C, preferably 0 ° C. The compound of formula (Y5) can be obtained by stirring and reacting at a temperature of from 0 ° C. to room temperature for 5 minutes to 10 hours, preferably 1 hour to 2 hours.

Further, when P is a benzyl group, the removal can be carried out by hydrogenolysis with hydrogen.

Further, when P is a silyl group, deprotection can also be carried out with a reagent generating a fluorine anion such as tetra-n-butylammonium fluoride or pyridinium fluoride.

Next, the compound represented by the formula (Y) is preferably dissolved in an organic solvent such as THF, methanol, ethanol and ethylene glycol.
The compound of 5) is represented by the following formula (Y6):

[0040]

Embedded image

By reacting a compound having a structure represented by the formula (Y6), P and n are as defined above, the following formula (Y7):

[0042]

Embedded image

A compound having a structure represented by the formula (Y7), wherein P, m and n are as defined above, is obtained.

The reaction is carried out from -20 ° C to the boiling point of the solvent,
Preferably at minus 15 ° C to 30 ° C for 30 minutes to 2
It is carried out for 0 hour, preferably for 1 hour to 2 hours.

It is desirable that a base such as N-methylmorpholine and a haloformate such as isobutyl chloroformate are present in the reaction solution.

Further, the compound of formula (2) (X = S, Z = NH and k = 0) can be obtained by removing the protecting group of the carboxyl group represented by P from the compound of (Y7). it can. The removal of the protecting group for the carboxyl group can be performed by the same method as described above in the synthesis of the compound of the formula (Y5).

Ii) When k = 0 and Z = 0 The compound of the formula (Y2) described above in i) is added to an organic solvent in the presence of lithium bis (trimethylsilyl) amide, lithium diisopropylamide, Y
8):

[0048]

Embedded image

[In the formula (Y8), L, P, m and n
Is as defined above], and a compound having a structure represented by the following formula (Y9):

[0050]

Embedded image

In the formula (Y9), P, m and n are as defined above to obtain a compound having a structure represented by the following formula:

As the organic solvent, those similar to those used for the synthesis of the compound of the formula (Y4) can be used. The reaction is carried out at a temperature of −100 ° C. to the boiling point of the solvent, preferably −80 ° C.
C. to 30.degree. C. for 1 hour to 20 hours, preferably 1 hour to 3 hours.

The compound of the formula (2) (X = S, Z = O and k = 0) can be obtained by removing the protecting group for the carboxyl group of P from the compound of the formula (Y9). Removal of the carboxyl-protecting group can be performed by the same method as described above.

Iii) When k = 1 and Z = NH First, similarly to the synthesis of the compound of the formula (Y1), methanol is reacted with diphosphorus pentasulfide in an organic solvent. Next, a base is added, and further, the following formula (Y10):

[0055]

Embedded image

In the formula (Y10), L, P and m are as defined above, and are reacted with an ester compound having a structure represented by the following formula (Y11):

[0057]

Embedded image

A compound having a structure represented by the formula (Y11), wherein P and m are as defined above, is obtained.
The synthesis of the compound of the formula (Y11) can be carried out in the same manner as the synthesis of the compound of the formula (Y2).

Next, the compound of the formula (Y11) is converted into the following formula (Y12):

[0060]

Embedded image

In the formula (Y12), L is as defined above, and an ester compound having a structure represented by the following formula (Y13) is reacted:

[0062]

Embedded image

A compound having a structural formula represented by the formula (Y13), wherein P and m are as defined above, is obtained. The compound of the formula (Y13) can be synthesized in the same manner as in the synthesis of the compound of the formula (Y4).

Next, the protecting group of the carboxyl group represented by P is removed from the compound of the formula (Y13),
The following formula (Y14):

[0065]

Embedded image

In the formula (Y14), m is as defined above, to obtain a compound having a structure represented by the following formula: Removal of the carboxyl-protecting group can be performed by the same method as described above.

Next, the compound of the above formula (Y6) is reacted with the compound of the formula (Y14) to give the following compound of the following formula (Y1)
5):

[0068]

Embedded image

A compound having a structure represented by the formula (Y15), wherein P, m and n are as defined above is obtained. The compound of the formula (Y15) can be synthesized in the same manner as in the synthesis of the compound of the formula (Y7).

Further, by removing the protecting group for the carboxyl group represented by P from the compound of (Y15), a compound of the formula (2) (X = S, Z = NH and k = 1) can be obtained. it can. Removal of the carboxyl-protecting group can be performed by the same method as described above.

II. When X = NH When Z = O and k <m First, the following formula (Y16):

[0072]

Embedded image

In the compound having the structure represented by the formula (Y16), k and m are as defined above,-(C
H ₂ ) A protecting group is introduced into a carboxyl group near the _m side, and is represented by the following formula (Y17):

[0074]

Embedded image

In the formula (Y17), P is a carboxyl-protecting group; and k and m are as defined above.

A known protecting group for the carboxyl group represented by P can be used, and the protecting group can be introduced by a known method. For example, when a benzyl group is introduced as a protective group, benzyl alcohol is reacted in an organic solvent such as diethyl ether or water in the presence of a condensing agent such as sulfuric acid, and the benzyl group is converted to a compound (Y16) by a condensation reaction.
To the compound.

The reaction is carried out at 0 ° C. to the boiling point of the solvent, preferably at 20 ° C. to 30 ° C., for 1 hour to 40 hours, preferably 20 hours to 30 hours.

Next, a protecting group is introduced into the amino group of the compound of the formula (Y17) to give the following formula (Y18):

[0079]

Embedded image

In the formula (Y18), a compound having a structure represented by the following formula is synthesized: P ′ is a protecting group for an amino group; and P, k and m are as defined above.

As the protecting group for the amino group represented by P ′, known groups can be used, and for example, a benzyloxycarbonyl group, a tert-butoxycarbonyl group and the like can be used. Introduction of a protecting group can also be performed using a known method.

For example, when a benzylcarbonyl group is introduced as a protecting group, benzyloxycarbonyl chloride is reacted in water in the presence of a base to convert the protecting group to (Y1
The compound of 7) is introduced. As the base, sodium hydrogen carbonate, potassium carbonate, sodium carbonate, lithium carbonate, potassium hydrogen carbonate, sodium hydroxide, potassium hydroxide, sodium methylate, sodium ethylate,
Triethylamine, N, N-dimethylaniline and the like can be used. The reaction is carried out at 0 ° C. to the boiling point of the solvent, preferably 0 ° C. to 80 ° C., for 1 hour to 20 hours, preferably 1 hour to 3 hours.

Next, the compound of the formula (Y18) is reacted with a solution of hydrogen chloride in diethyl ether to give the compound of the following formula (Y1)
9):

[0084]

Embedded image

In the formula (Y19), P, P ′, k and m are as defined above, and a compound having a structure represented by the following formula is synthesized.

The reaction is carried out in ethanol at 0 ° C. to the boiling point of the solvent, preferably at 40 ° C. to 60 ° C., for 1 hour to 20 hours, preferably 1 hour to 3 hours.

Next, the protecting group for the carboxyl group represented by P and the protecting group for the amino group represented by P ′ are removed from the compound of the formula (Y19) to give the following formula (Y2)
0):

[0088]

Embedded image

In the formula (Y20), k and m are as defined above, to obtain a compound having a structure represented by the following formula:
The removal of the protecting group can be performed by a known method as described above for the removal of the protecting group of the carboxyl group.

For example, when P and / or P ′ is a benzyl group, the removal can be carried out by hydrogenolysis with hydrogen.

Next, an amino-protecting group is introduced again into the compound of the formula (Y20), and the compound of the following formula (Y21) is obtained.

[0092]

Embedded image

A compound having a structure represented by the formula (Y21), wherein P ′, k and m are as defined above, is obtained.

Next, the compound of the formula (Y21) is added to the compound of the following formula (Y22) in an organic solvent:

[0095]

Embedded image

By reacting a compound having a structure represented by the formula (Y22), P and n are as defined above, the following formula (Y23):

[0097]

Embedded image

A compound having a structure represented by the formula (Y23), wherein P, P ', k, m and n are as defined above, is obtained.

The reaction is performed in tetrahydrofuran (THF),
In organic solvents such as dioxane, diethyl ether, dimethoxyethane, dichloromethane, and 1,2-dichloroethane, the temperature is from 0 ° C to the boiling point of the solvent, preferably from 20 ° C to 30 ° C.
And 1 hour to 40 hours, preferably 20 hours to 30 hours
Do time.

The reaction is preferably carried out using a base catalyst such as N, N-dimethylaminopyridine (DMAP), an acid catalyst such as camphorsulfonic acid, N, N-dicyclohexylcarbodiimide (DCC), N, N-diisopropylcarbodiimide. And the like in the presence of a condensing agent.

Next, the protecting group for the amino group represented by P ′ is removed from the compound of the formula (Y23) to give the following formula (Y24):

[0102]

Embedded image

A compound having a structure represented by the formula (Y24), wherein P, k, m and n are as defined above, is obtained. The removal of the protecting group for the amino group can be carried out by the same method as described above for the synthesis of the compound of the formula (Y20).

Next, the compound of the formula (Y24) is added to the following formula (Y25):

[0105]

Embedded image

In the formula (Y25), L is as defined above, and reacted with a halogenated dimethyl thiophosphate having a structure represented by the following formula in an organic solvent in the presence of a base:
The following formula (Y26):

[0107]

Embedded image

A compound having a structure represented by the formula (Y26), wherein P, k, m and n are as defined above, is obtained.

Examples of the organic solvent for synthesizing the compound of the formula (Y26) include acetonitrile, acetone, hexane, pentane, benzene, toluene, dichloromethane, chloroform, 1,2-dichloroethane, ethyl acetate, diglyme, N, N-dimethylformamide, hexamethylphosphoric triamide, etc., or a mixed solution thereof can be used. As the base, for example, potassium carbonate, sodium carbonate, lithium carbonate, potassium hydrogen carbonate, sodium hydrogen carbonate, sodium hydroxide, potassium hydroxide, sodium methylate, sodium ethylate, triethylamine, N, N-dimethylaniline, lithium diisopropyl Amides and the like can be used.

The reaction is carried out at 0 ° C. to the boiling point of the solvent, preferably at 40 ° C. to 60 ° C., for 1 hour to 10 hours, preferably 1 hour to 2 hours.

Next, the protecting group of the carboxyl group represented by P is removed from the compound of the formula (Y26),
The compound of formula (2) (when X = NH and Z = O) can be obtained.

The removal of the carboxyl-protecting group can be carried out by a known method as described above.

By subjecting the compound obtained by the above-mentioned production method to silica gel chromatography or recrystallization operation as required, a purified product with higher purity can be obtained.

Further, a polyclonal antibody and a monoclonal antibody are prepared according to a tolerized method by using the hapten compound as an antigen for immunization after binding to an appropriate polymer compound.

The binding between the malathion hapten and the polymer compound can be performed, for example, by the activated ester method (AEKARU).
et al. : J. Agric. Food Chem.
42301-309 (1994)) or the mixed acid anhydride method (BF Erlanger et al .: JB).
iol. Chem. 234 1090-1094 (19
54)) and the like.

For example, a polyclonal antibody is prepared by dissolving a malathion hapten-KLH conjugate in a sodium phosphate buffer (hereinafter, referred to as “PBS”) and mixing it with an adjuvant such as Freund's complete adjuvant or incomplete adjuvant, or alum. It can be obtained by immunizing an animal.

In producing a monoclonal antibody,
At least the following work steps are required. (A) Preparation of a conjugate of malathion hapten used as an antigen for immunization and a polymer compound (b) Immunization of animals (c) Collection of blood, assay, and preparation of antibody-producing cells (d) Preparation of myeloma cells (E) Cell fusion between antibody-producing cells and myeloma cells and selective culture of hybridomas (f) Screening and cell cloning of hybridomas producing the desired antibody (g) Monoclones by culturing hybridomas or transplanting hybridomas into animals Preparation of Antibodies (h) Measurement of Reactivity of Prepared Monoclonal Antibodies Conventional methods for producing hybridomas that produce monoclonal antibodies include, for example, Hybridoma Technologies, Cold Spring Harbor Laboratories (Co.)
ld Spring Harbor Laborato
ry, 1980 edition), and Cell Histochemistry (Shuji Yamashita et al., edited by the Japanese Society for Tissue and Cellular Chemistry; Interdisciplinary Planning, 1986).

Applicants specifically recognize the anti-malathion monoclonal antibodies MLT2-23, MLT40-4 and MLT2.
45-3 was obtained. Particularly preferred monoclonal antibody ML
T2-23, on January 22, 1999, the deposit number FE
RM P-17157 at the National Institute of Advanced Industrial Science and Technology (1-1-1 Higashi, Tsukuba, Ibaraki, 305-0046, Japan)
No. 3).

However, before the present invention, the amino acid sequence of the antibody against malathion was not elucidated, and the gene encoding the antibody was not obtained. Therefore, the region important for the binding of the antibody to the antigen is not clear,
In addition, the antibody or a fragment capable of binding to the antigen (eg, _Fab fragment or the like) could not be produced by genetic engineering.

[0120]

An object of the present invention is to provide a gene encoding the heavy chain variable region of an anti-malathion monoclonal antibody.

Another object of the present invention is to provide a gene encoding a light chain variable region of an anti-malathion monoclonal antibody.

The present invention further aims at providing a vector containing a gene encoding the light chain variable region of the anti-malathion monoclonal antibody, and a host cell transformed with the vector.

Another object of the present invention is to provide a method for producing a heavy chain and / or light chain variable region of an anti-malathion monoclonal antibody by genetic engineering by culturing the host cell. I do.

[0124] Another object of the present invention is to provide a recombinant protein obtained by the above production method.

[0125]

Means for Solving the Problems The present inventors have made intensive studies for the purpose of solving the above problems, and as a result, isolated a gene encoding an anti-malathion monoclonal antibody and arrived at the present invention. The details will be described below.

In general, an immunoglobulin constituting an antibody is composed of a heavy chain having a molecular weight of 50,000 to 70,000 (also referred to as an H chain) and a light chain having a molecular weight of 20,000 to 30,000 (also referred to as an L chain). The peptide chain structure of the basic structure of immunoglobulin is 2
One heavy chain and two light chains are linked by disulfide and non-covalent bonds to give a molecular weight of 150,000-19
It is ten thousand. The regions located at the N-terminus of both heavy and light chains are:
Even if a sample is from the same class (subclass) of the same animal, its amino acid sequence is not constant and is called a variable region. On the other hand, the amino acid sequence at the C-terminal side is substantially constant for each class and is called a constant region (or “Fc region”).

The antigen-binding site of an antibody is composed of the variable regions of the heavy and light chains, and the specificity of binding depends on the amino acid sequence of this site. The part of the variable region that has a remarkable difference is called a hypervariable region. The present invention provides heavy chain and light chain genes of an anti-malathion monoclonal antibody, particularly genes of their variable regions.

Specifically, the present invention provides a gene encoding the heavy chain variable region of an anti-malathion monoclonal antibody. In the present invention, the heavy chain variable region of the anti-malathion monoclonal antibody comprises the following i) and ii): i) an amino acid sequence having amino acid residues 1-115 of SEQ ID NO: 2; and ii) an amino acid sequence of the above i). An amino acid sequence in which one or more amino acid residues have been deleted, substituted or added; and an amino acid sequence selected from the group consisting of: is there.

Preferably, the heavy chain variable region of the anti-malathion monoclonal antibody encoded by the gene of the present invention has the following i): i) the amino acid sequence having the amino acid residues 1-115 of SEQ ID NO: 2. Have.

[0130] More preferably, the gene of the present invention has the nucleotide sequence 1-345 of SEQ ID NO: 1.

The present invention also provides a gene encoding the light chain variable region of an anti-malathion monoclonal antibody. In the present invention, the light chain variable region of the anti-malathion monoclonal antibody comprises the following i) and ii): i) an amino acid sequence having amino acid residues 1-113 of SEQ ID NO: 4; and ii) the amino acid sequence of the above i) Has an amino acid sequence selected from the group consisting of: an amino acid sequence in which one or more amino acid residues have been deleted, substituted or added; and capable of forming an antigen binding site and interacting with malathion It is.

Preferably, the light chain variable region of the anti-malathion monoclonal antibody encoded by the gene of the present invention has the following i): i) the amino acid sequence having amino acid residues 1-113 of SEQ ID NO: 4. Have.

[0133] More preferably, the gene of the present invention has the nucleotide sequence 1-339 of SEQ ID NO: 3.

The above-described gene of the present invention can be obtained by a known method based on the disclosure of the present specification. For example, but not by way of limitation, the genes of the present invention can be obtained from hybridomas producing anti-malathion monoclonal antibodies. First, mRNA is prepared from these hybridomas by a known method, and based on the mRNA, a single-stranded cDNA is synthesized by a reverse transcriptase, and then the variable heavy or light chain of the anti-malathion monoclonal antibody disclosed herein is modified. The gene of the present invention can be selectively obtained by using a PCR method, a hybridization method, or the like based on the amino acid sequence or base sequence of the region. Such methods are well known, and those skilled in the art can easily isolate the gene of the present invention based on the disclosure of the present specification.

In the examples described later in this specification,
First, the cD of antimalathion monoclonal antibody-producing cells
A NA library is constructed, and the cDNA library coding for the highly conserved immunoglobulin heavy and light chain constant regions is used as a probe. Was isolated. The hybridoma producing the anti-malathion monoclonal antibody is not limited, and for example, MLT2-23 deposited at the Institute of Biotechnology, National Institute of Advanced Industrial Science and Technology described above can be used. Alternatively, for example, it can also be prepared using a method disclosed in a reference example described later or an oral presentation and a collection of abstracts at the 24th Annual Meeting of the Japanese Society of Pesticides (March 26, 1999).

[0136] The gene of the present invention may also be chemically synthesized using known techniques based on the description in the present specification.

Examples of the sequence of the gene of the present invention are disclosed in the sequence listing described later. SEQ ID Nos. 1 and 2 in the sequence listing correspond to the M
The nucleotide sequence and deduced amino acid sequence of each of the genes encoding the heavy chain variable region of LT2-23 are shown. SEQ ID NOs: 3 and 4 show the nucleotide sequence and deduced amino acid sequence of each of the genes encoding the light chain variable region of MLT2-23.

Amino acid residues 28-32, 47-63 and 95-104 in the heavy chain of MLT2-23 correspond to the hypervariable regions and are called H1, H2 and H3, respectively.
Similarly, amino acid residue 2 in the light chain of MLT2-23
4-39, 55-61 and 94-102 correspond to the hypervariable regions and are called L1, L2 and L3, respectively. Generally, in an immunoglobulin, the hypervariable regions are close to each other on a three-dimensional structure and assemble antibody active groups, and this region determines the specificity for the antigen to be bound.

The variable region of the heavy or light chain of the anti-malathion monoclonal antibody having the amino acid sequence encoded by the gene of the present invention is not limited to those having the amino acid sequences specifically described in the Sequence Listing and the drawings. ,
The sequence has an amino acid sequence in which one or more amino acid residues have been deleted, substituted or added, and is capable of forming an antigen-binding site and interacting with malathion. Also includes those that retain the function as an area. Such genes also include those that have a higher ability to bind to malathion than the amino acid sequences specifically described herein.

More specifically, for example, a reference example described later,
Alternatively, in the oral presentations and abstracts of the 24th Annual Meeting of the Japanese Society of Pesticides (March 26, 1999), MLT40-4 and MLT45-3 as well as MLT2-23 are disclosed as anti-malathion monoclonal antibodies.
Based on the amino acid sequences and base sequences of the variable and / or constant regions of the heavy and light chains of MLT2-24 described herein, or by a method similar to the method described herein, For example, a cDNA fragment encoding the constant region of an immunoglobulin
By screening a DNA library, M
Genes encoding LT40-4 and MLT45-3 can be obtained and are also included in the scope of the present invention.

Alternatively, the MLT2 described herein
DNA prepared based on the base sequence and / or amino acid sequence of -23 by synthesis and ligation of oligonucleotides or by site-directed mutagenesis technique
It may be synthesized from the construct. For example, a gene of the invention can be used under stringent conditions (eg, 2 × SSC
Hybridization at 50 ° C. overnight in medium; 2 × SSC
Medium, washed at 50 ° C.). A gene encoding a peptide capable of hybridizing with a DNA having any one of SEQ ID NOs: 1 and 3 and forming an antigen-binding site and interacting with malathion is also included. Including.

In general, substitutions of amino acid sequences must be made conservatively, ie, the most preferred substituted amino acids form an antigen-binding site in a manner substantially equivalent to MLT2-23 to form malathion. Amino acids that do not affect the ability of the variable region to interact. Examples of conservative substitutions include, for example, amino acid substitutions that do not alter the secondary and / or tertiary structure of MLT2-23. As a further example, substituting one aliphatic residue for another, such as replacing Ile, Val, Leu or Ala with each other, or Ly
s and Arg; Glu and Asp; or Gln and Asn
Substituting one polar residue for another polar residue, such as a substitution between. Other such conservative substitutions are well known, for example, replacement of an entire region with similar hydrophobicity.

As another example, to cause a Cys residue to be deleted or replaced by another amino acid,
The sequence encoding the Cys residue can be altered to prevent the formation of inappropriate intramolecular disulfide bridges during regeneration. The amino acids to be replaced are tryptophan, serine,
Selected from the group consisting of aspartic acid and lysine,
Most preferably, the amino acid is tryptophan.

Similarly, it is possible to delete or add amino acid sequences by considering the potential effects of the deletion or insertion on biological activity. For example, the use of a yeast expression system expresses a homologous carbohydrate-reduced analog, but the N-glycosylation site can be modified to eliminate glucosylation. Glycosylation sites in eukaryotic polypeptides are amino acid triplets, As
n-XY (where X is any amino acid except Pro and Y is Ser or Thr).
Appropriate modifications of the nucleotide sequence encoding this triplet will result in substitutions, additions or deletions that prevent the attachment of carbohydrate residues on the Asn side chain. Alternatively, the sequence encoding the dibasic amino acid residue can be modified to enhance expression in a yeast system where KEX2 protease activity is present.

Variable region of anti-malathion monoclonal antibody
By inserting the gene of the present invention into an appropriate expression vector and culturing a host cell transformed with the expression vector, the variable region of the anti-malathion monoclonal antibody can be expressed by genetic engineering. is there.

The general structure of immunoglobulins is well known, and both the heavy and light chains contain an N-terminal variable region and a C-terminal constant region. When an immunoglobulin gene is obtained and the nucleotide sequence and the encoded amino acid sequence are analyzed, those skilled in the art can easily understand the portion encoding the variable region and the portion encoding the constant region. .

In general, the variable regions of the heavy and light chains of an antibody contain an antigen-binding site, and the DNAs of both regions are connected by a linker to be expressed in a host cell, whereby a single-chain Fv with antigen-binding ability is expressed. It is known that a protein (sFv) can be obtained. Thus, for example, by expressing genes encoding both heavy and light chain variable regions of the present invention in host cells such as E. coli, it is possible to obtain a large amount of a protein capable of binding to malathion. (Figure 1). This is cheaper than maintaining monoclonal antibodies obtained by culturing in a medium requiring serum, and is expected to be applied to enzyme immunoassays. Alternatively, by introducing a vector containing the gene of the present invention into animals and plants, animals and plants resistant to the dithio-type low-toxic organophosphorus insecticide can be produced.

Recombinant expression vectors for expressing the variable region of the anti-malathion monoclonal antibody (hereinafter simply referred to as “variable region” according to the context) by recombinant genetic engineering techniques include mammals, microorganisms, viruses or Operably linked to an appropriate transcriptional or translational regulatory nucleotide sequence, such as derived from an insect gene,
Includes the cDNA sequence encoding the variable region. Examples of regulatory sequences include sequences that have a regulatory role in gene expression (eg, regulated promoters or enhancers), operator sequences to control transcription if desired,
Sequences encoding the RNA ribosome binding site and appropriate sequences that control the initiation and termination of transcription and translation are included.

Nucleotide sequences are operably linked when the regulatory sequence is operatively related to the variable region DNA sequence. For example, if the promoter nucleotide sequence controls the transcription of the variable region DNA sequence, then the promoter nucleotide sequence is operable to
It is linked to the A sequence. Still further, if a ribosome binding site is located in the vector to facilitate translation, the ribosome binding site will be operably linked to the variable region polypeptide sequence. Furthermore, a sequence encoding a signal peptide can be incorporated into an expression vector. For example, the DNA sequence of a signal peptide (secretory leader) can be
It can be linked to an NA sequence.

Suitable host cells for expression of the variable region polypeptides include prokaryotes, yeast or higher eukaryotic cells. Prokaryotes include gram negative or gram positive organisms, such as E. coli or Bacilli. Prokaryotic host cells suitable for transformation include, for example, E. coli, Bacillus subtilis, Salmonella type.
himurium and various other species of the genus Pseudomonas, Streptomyces and Saccharomyces. Higher eukaryotic cells include established cell lines of mammalian origin. Cell-free translation systems can also be used to produce variable region polypeptides using RNA obtained based on the DNA constructs disclosed herein. Cloning and expression vectors suitable for use in bacterial, fungal, yeast and mammalian cell hosts are described, for example, in Pouwels et al.
loaning Vector: A Laborator
yManual, Elsevier, New York
(1985).

The expression vector carrying the recombinant variable region DNA sequence is transfected or transformed into a substantially homogeneous culture of a suitable host microorganism or mammalian cell line. A transformed host cell is a cell that has been transformed or transfected with a nucleotide sequence encoding a variable region polypeptide, and that expresses the variable region polypeptide. The expressed variable region polypeptide will be located within the host cell and / or secreted into the culture supernatant fluid, depending on the nature of the host cell and the genetic construct inserted into the host cell.

[0152] Expression vectors transfected into prokaryotic host cells generally contain one or more selectable phenotypic markers. Selectable phenotypic markers are, for example, genes encoding proteins that confer antibody resistance or supply auxotrophy, and an origin of replication recognized by the host to ensure amplification within the host. . Other useful expression vectors for prokaryotic host cells include selectable markers of bacterial origin derived from commercially available plasmids. This selectable marker can include the genetic elements of the cloning vector pBR322 (ATCC 37017). pBR322 contains genes for ampicillin and tetracycline resistance, and thus provides a simple means to identify transformed cells. pBR322 “backbone (backb
one) "portion is ligated with an appropriate promoter and variable region DNA sequence. Other commercially available vectors include, for example, pKK223-3 (Pharm
Acia Fine Chemicals, Uppsa
la, Sweden) and pGEM1 (Promega)
a Biotec, Madison, WI, USA).

Although not limited, in Example (5) of the present invention, phagemid pCANTAB 5E (Pharmacia Biotech) was used as an expression vector for E. coli.
Was used. pCANTAB 5E contains the lac promoter, gene3 signal sequence,
Anti-E-tag antibody recognition sequence, gene3 protein (g
3p), anti-E-tag antibody recognition sequence, M13 phage intergenic region (IG), ampicillin resistance gene, Col
E1 Has a replication origin and the like. Since it has a ColE1 origin of replication, it can replicate in Escherichia coli, and has an M13 phage intergenic region (IG), so that
7 (Pharmacia Biotech) or the like, it becomes single-stranded DNA by infection with a helper phage, and can form a phage. The gene3 protein is a coat protein of the M13 phage, and the protein and the recombinant protein of the present invention are expressed on the phage surface as a fusion protein and displayed on the phage surface. This enables selection by panning with malathion hapten.

The recognition sequence of the anti-E-Tag antibody was EL
It is useful in immunoassays such as ISA. Specifically, when performing indirect competition ELISA for malathion, a secondary antibody is used to detect an anti-malathion antibody recombinant protein bound to a malathion hapten immobilized on the plate surface. A normal secondary antibody recognizes the constant region and the like of the antibody. For example, in the case of a recombinant protein containing only the variable region and not containing the constant region, the secondary antibody cannot bind. Thus, by fusing and expressing the anti-E-Tag antibody recognition sequence with the recombinant protein, it becomes possible for the anti-E-Tag antibody to recognize the recombinant protein. Anti-E-
The Tag antibody is a mouse monoclonal antibody, and a normal secondary antibody can bind to an anti-E-Tag antibody.

[0155] Promoter sequences are commonly used in recombinant prokaryotic host cell expression vectors. Common promoter sequences include β-lactamase (penicillinase), lactose promoter system (Chang et al., Na
cure, 275: 615, 1978; and Goed.
del et al., Nature, 281: 544, 197.
9), tryptophan (trp) promoter system (Go
eddel et al., Nucl. Acids Res. , 8:
4057, 1980; and EP-A-36776),
And tac promoter (Maniatis, Mol
eco Cloning: A Laborato
ry Manual, Cold Spring Harb
or Laboratory, 412, 1982). Particularly useful prokaryotic host cell expression systems employ the phage λPL promoter and the cI857ts thermotolerant repressor sequence. Plasmid vectors incorporating derivatives of the λ PL promoter available from the American Type Culture Collection (ATCC) include plasmid pHUB2 [resident in E. coli strain JMB9 (ATCC 37092)] and p
PLc28 [resident in E. coli RR1 (ATCC53082)].

The variable region can also be expressed in yeast host cells such as Saccharomyces (eg, S. cerevisiae). Other yeast genera such as Pichia or Kluyveromyces can also be used. Yeast vectors will sometimes include a replication initiation sequence, an autonomously replicating sequence (ARS), a promoter region, a polyadenylation sequence, and a transcription termination sequence from a 2μ yeast plasmid. Desirably, the yeast vector is
Includes a replication initiation sequence and a selectable marker. Suitable yeast vector promoter sequences include metallothionein, 3-phosphoglycerate kinase (Hitzema
n. Biol. Chem. , 255: 2073,
1980) or other glycolytic enzymes (Hess
J. et al. Adv. Enzyme Reg. , 7:14
9, 1968; and Holland et al., Bioche.
m. 17: 4900, 1978), for example, enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, Triose phosphate isomerase, phosphoglucose isomerase, glucokinase and the like are included. Other suitable vectors and promoters used for yeast expression are also available from Hit
zeman, EPA-73,657.

[0157] Mammalian or insect host cell culture systems can also be used to express recombinant variable region polypeptides. Examples of suitable mammalian host cell lines include the COS-7 line of monkey kidney cells (ATCC C
RL1651) (Gluzman et al., Cell, 23:
175, 1981), L cells, C127 cells, 3T3 cells (ATCC CCL163), Chinese hamster ovary (CHO) cells, HeLa cells and BHK (A
TCC CRL10) cell lines are included. Suitable mammalian expression vectors include non-transcribed elements, such as origins of replication, promoter sequences, enhancers, etc., linked to the structural gene; ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, and transcription termination sequences, etc. 5 ′ or 3 ′ contiguous untranslated sequence;

[0158] The transcription and translation control sequences of the mammalian host cell expression vector can be excised from the viral genome. For example, commonly used mammalian cell promoter and enhancer sequences include polyomavirus, adenovirus 2, simian virus 40 (S
V40) and human cytomegalovirus. A DNA sequence derived from the SV40 virus genome,
For example, the SV40 origin, early and late promoters, enhancers, splices, and polyadenylation sites can be used to provide other genetic elements required for expression of structural gene sequences in mammalian host cells.

Mammalian expression vectors include, for example, Oka
yama and Berg (Mol. Cell Bio
l. , 3: 280, 1983). Cosman et al., N
Nature, 312: 768, 1984;
PMLSV N1 / N4, a useful high expression vector
Has been deposited as ATCC 39890. A further useful mammalian expression vector is EP-A-0367.
556, and US patent application Ser. No. 07 / 701,41.
5, filed May 16, 1991, incorporated herein by reference.

Although not limited, the heavy chain and light chain variable regions are preferably expressed in the presence of a DNA encoding a linker sequence and tandem binding. By expressing a plurality of chains including a heavy chain and a light chain in close proximity, the ability to bind to the antibody can be increased. By utilizing the gene of the present invention, it is possible to bind a heavy chain and a light chain in tandem and to express them in large amounts. The linker sequence is not particularly limited, but the length is preferably about 6 to 20 bases. More specifically, a repeating sequence of amino acid residues, for example, a sequence in which (GGGGS) _n is repeated in tandem can be used as a linker. Preferably, n is 3. Alternatively, a commercially available linker sequence can be used, for example, Lithium from Pharmacia Biotech.
nkerPrimer Mix can be used.

The gene encoding the variable region of the present invention may be expressed by binding to the gene encoding the variable region such that the variable region is covalently bound or aggregated with other proteins or polypeptides. Such fusions include, for example, the N-terminal region or the C-terminus of the variable region polypeptide involved in transporting the complex from its synthesis site, either simultaneously or after translation, to a site inside or outside the cell membrane or cell wall. Region signal or leader polypeptide (eg, Saccharomyces alpha factor leader). Alternatively, the variable region polypeptide fusion may be a fusion with a polypeptide (eg, poly-His) added to facilitate purification and identification of the variable region.

[0162] Fusion proteins can be prepared using conventional techniques of enzymatic cleavage and ligation of fragments from the desired sequence. PCR techniques using synthetic oligonucleotides can be used to prepare and / or amplify the desired fragment. Synthetic oligonucleotides exhibiting the desired sequence can also be used to prepare DNA constructs encoding the fusion protein. Also, the fusion protein has a variable region,
As well as leader (or signal peptide) sequences, oligomerization region (eg, leucine zipper moieties or suitable zipper moieties) linker sequences, and highly immunogenic that provide a means for easily purifying or rapidly detecting the fusion protein. Including sequences that code the parts,
One or more additional sequences can be included.

[0163] The signal peptide promotes secretion of the protein from the cell. Flag® octapeptide (Hopp et al., Bio / Technology,
6: 1204, 1988) are reversible by specific monoclonal antibodies that do not alter the biological activity of the fusion protein, have high immunogenicity, and allow for rapid detection and easy purification of the expressed fusion protein. To provide an epitope that is bound to. The Flag® sequence is also activated by bovine mucosal enterokinase.
Fusion proteins cleaved specifically at the residue immediately following the Asp-Lys pair and capped with this peptide are also resistant to intracellular degradation in E. coli. Flag
A murine monoclonal antibody that binds to ® is deposited with the ATCC (accession number HB925).
9); A method for purifying a fusion protein containing a Flag® sequence using an antibody is described in US Pat.
No. 1,912, incorporated herein by reference. Although not limited, in the examples of the present specification, the signal sequence of gene3 which is an outer protein of M13 phage was used as the signal sequence.

The gene encoding the variable region of the present invention
The antibody may be expressed by binding to a gene encoding a constant region (hereinafter, referred to as “Fc region”) of the antibody. The constant region may be the same as the monoclonal antibody from which the variable region is derived, or may be from a different monoclonal antibody. Suitable Fc regions can bind to protein A or protein G, or can be recognized by antibodies that can be used to purify or detect fusion proteins containing the Fc region. As the Fc region, for example, a known human IgG1 or murine IgG1 Fc region can be used. A fragment of an appropriate Fc region, for example, a human IgG, wherein the sequence of amino acids responsive to binding to protein A has been deleted, such that the fragment binds to protein G but does not bind to protein A.
One Fc region can also be used.

[0165] In addition, the immunological assay using an antibody may generally cause problems such as sensitivity, specificity, and resistance to organic solvents. Such a problem can be solved by expressing the gene of the present invention as a fusion protein with another protein or peptide. For example, but not limited to, for performing measurements at elevated temperatures for the purpose of increasing specificity, Tth DNA polymerase
and a fusion protein with a thermostable enzyme such as restriction enzyme Taq I.

It should be noted that pCANTAB of the examples of the present invention was used.
When phagemid is used as an expression vector, as in 5E, the vector and inserted DNA become single-stranded DNA upon infection with a helper phage, and are used not only for polypeptide expression but also for base sequence determination and site-specific mutation. Becomes possible. It is also possible to use a phage containing the single-stranded DNA to select a phage displaying an appropriate polypeptide, re-infect Escherichia coli, and the like. As the phagemid, a commercially available phagemid such as BluescriptII (trademark) phagemid vector (manufactured by TAKARA) other than pCANTAB 5E can be used. Further, as the helper phage, M13 KO7 (Pharmacia Biotech), VSC-M13, R408, or the like can be used depending on the type of phagemid.

Without limitation, when utilizing phage for expression of the recombinant protein of the present invention,
The advantage is obtained that the selection of the target protein and the recovery of the DNA encoding it can be performed simultaneously. Specifically, PCR can be used to obtain a gene encoding the anti-malathion antibody of the present invention. However, when amplifying DNA by PCR, errors such as substitution or omission of bases occur at a certain ratio. there is a possibility. If an error occurs even for one base, it is considered that the amino acid sequence of the recombinant protein also changes, thereby changing the reactivity to malathion. When a cDNA encoding a recombinant protein is introduced into a phage, a large number of phages expressing the recombinant protein are panned at once to select a clone that reacts with malathion, and at the same time, the obtained clone is infected into E. coli. The target DNA can be easily obtained.

Recombinant Variable Region Polypeptides The heavy chain and / or light chain variable regions of anti-malathion monoclonal antibodies can be produced using the genes of the present invention. Specifically, a host cell transformed with the vector containing the gene of the present invention is cultured under conditions that promote the expression of the heavy and / or light chain variable regions of the anti-malathion monoclonal antibody, and The variable region of the heavy and / or light chain of the anti-malathion monoclonal antibody is recovered from the culture.

[0169] The variable region polypeptides can be prepared by culturing the transformed host cells under the culture conditions necessary to express the variable region polypeptide. Next, the resulting expressed polypeptide can be purified from the culture solution or cell extract. If desired, the variable region polypeptide can be converted to a commercially available protein concentration filter, such as Am
icon or Millipore Pellicon
It can be concentrated using an ultrafiltration unit. After the concentration process, the concentrate can be loaded onto a purification matrix, such as a gel filtration medium. Alternatively, an anion exchange resin such as free diethylaminoethyl (D
A matrix or substrate having EAE) groups can be used. The matrix can be acrylamide, agarose, dextran, cellulose or other types commonly used for protein purification. Alternatively, a cation exchanger can be used.
Suitable cation exchangers include various insoluble matrices containing sulfopropyl or carboxymethyl groups. Sulfopropyl groups are preferred.

Finally, to further purify the variable region, one or more reverse steps using a hydrophobic RP-HPLC medium (eg, silica gel with free methyl or other aliphatic groups). Phase high performance liquid chromatography (RP-HPLC) can be used.
Various or any combination of the foregoing purification means can be used in various combinations to provide a substantially homogeneous recombinant protein.

For affinity purification of the expressed variable region polypeptide, it is also possible to use an affinity column to which malathion is bound. The variable region polypeptide can be removed from the affinity column with a high salt elution buffer and then dialyzed against the lower salt buffer used.

The recombinant protein produced in bacterial culture
Usually, first disruption of the host cells, centrifugation, extraction from the cell pellet for insoluble polypeptides or from the supernatant for soluble polypeptides, and one or more steps of concentration, salting Isolated by precipitation, ion exchange, affinity purification or ultrafiltration chromatography. Finally, RP-HPLC can be used for the final purification step. Microbial cells can be disrupted according to any conventional method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents.

The transformed yeast host cells are desirably used to express the variable region as a secreted polypeptide. This simplifies purification. The recombinant polypeptide secreted from the yeast host cell fermentation is Ur
dal et al. (J. Chromatog., 296: 17).
1, 1984). Urdal et al. Describe a two-step reverse-phase HPLC performed sequentially to purify human recombinant IL-2 on a preparative HPLC column.

[0174] The recombinant protein of the anti-malathion monoclonal antibody obtained as described above may be used in the same manner as the natural anti-malathion monoclonal antibody protein obtained by purification from the antibody-producing cells, for example, ELI as described later.
Subclasses, antibody titers, and the like can be determined using known methods such as the SA method. As a method for measuring malathion using the antibody used in the present invention, radioisotope immunoassay (RIA), ELISA (Engval,
E. FIG. , Methods in Enzymol. , 7
0, 419-439 (1980)), fluorescent antibody method, plaque method, spot method, agglutination method, Ouchterony (Ouchon)
terlony), etc. ("Hybridoma Method and Monoclonal Antibody", published by R & D Planning, pp. 30-5)
3 pages, March 5, 1982). The ELISA method is widely used from the viewpoints of sensitivity, simplicity, and the like. Less than,
The present invention will be described specifically with reference to examples, but these are not intended to limit the technical scope of the present invention. Those skilled in the art can easily modify the present invention based on the description in this specification,
Modifications can be made and are within the scope of the invention.

[0175]

EXAMPLES Reference Example Reference Example 1 Synthesis of Malathion Hapten-1

[0176]

Embedded image

Synthesis of (2) 22.2 g (100 mmol) of diphosphorus pentasulfide was dissolved in 100 ml of a toluene solution, and methanol (16 g, 500 g) was dissolved.
mmol) was added dropwise at 50 ° C. and stirred for 3.5 hours. The pH of this solution was adjusted to 6 with a 2N aqueous sodium hydroxide solution while cooling with ice. 34 g (200 mmol) of ethyl bromoacetate was added dropwise at room temperature and stirred at 60 ° C. for 30 minutes and at 70 ° C. for 30 minutes. The toluene layer was collected, dehydrated (anhydrous magnesium sulfate), filtered and concentrated, and then subjected to a silica gel column (n-hexane: ethyl acetate = 49: 1 → 19:
Purification (1 → 9: 1 → 2: 1) afforded 22.4 g (46% yield) of (2) as a clear yellow oil.

[0178]

Table 1 ¹ H-NMR (CDCl ₃ ) 1.21-1.34 (3H, t), 3.53-3.65
(2H, d) 4.13-4.26 (2H, q) Synthesis of (3) 1.0 M lithium bis (trimethylsilyl) amide
(LiHMDS: lithium hexamethyldisilazane)
31 ml was cooled to −70 ° C. or lower with dry ice-acetone, and 7.5 g (30 mmol) of (2) was added dropwise under a nitrogen stream. After stirring for 1 hour, 6.0 g (30 mm
ol) in THF solution of tert-butyl bromoacetate 5m
1 was added dropwise. After dropping, remove the Dewar bath and remove
Stirred for hours. The reaction solution was concentrated under reduced pressure and subjected to silica gel chromatography (n-hexane: ethyl acetate = 19:
1 → 9: 1), 7.1 g as a clear oil
(Yield 66%) (3) was obtained.

[0179]

Table 2 ¹ H-NMR (CDCl ₃ ) 1.21-1.33 (3H, t), 1.37-1.49
(9H, s) 2.75-3.00 (2H, m), 3.70-3.87
(6H, m) 3.99-4.27 (3H, m) Synthesis of (4) 7.0 g (19 mmol) of (3) was dissolved in 100 ml of dichloromethane, and trifluoroacetic acid (TFA) 5
The mixture was stirred at room temperature for 1 hour, and 5 ml of TFA was further added and stirred for 1.5 hours. The reaction solution was concentrated under reduced pressure and purified by silica gel chromatography (n-hexane: ethyl acetate = 4: 1 → 2: 1 → 1: 1). 4) was obtained.

[0180]

Table 3 ¹ H-NMR (CDCl ₃ ) 1.23-1.35 (3H, t), 2.90-3.18
(2H, m) 3.76-3.87 (6H, d), 4.06-4.29
(3H, m) Synthesis of (5) 2.46 g (8.1 mmol) of (4) was dissolved in tetrahydrofuran (THF) 30 ml, the solution salt - while cooling with ice 0.82 g (8.1 mmol) Of N-methylmorpholine (NMM) in THF (10 ml) and then isobutyl formate (1.1 g, 8.1 mmol) in THF
10 ml of the solution was added dropwise. 1.5g after stirring for 10 minutes
(8.1 mmol) of tert- 6-aminohexanoic acid
10 ml of a THF solution of butyl was added dropwise. After stirring under ice-cooling for 5 minutes, the mixture was stirred at 4 ° C. for 20 minutes and further at room temperature for 10 minutes.
After evaporating the solvent, the residue was redissolved with dichloromethane,
After washing with water, dehydration (anhydrous magnesium sulfate), filtration and concentration, the mixture was roughly purified by silica gel chromatography (n-hexane: ethyl acetate = 2: 1 → 1: 1).

The crude product containing the synthesis (5) containing (6) was dissolved in 100 ml of dichloromethane, 10 ml of TFA was added, and the mixture was stirred at room temperature for 2 hours. The reaction solution was concentrated under reduced pressure, and silica gel chromatography (n-hexane: ethyl acetate = 2: 1 → 1: 1 →
(Ethyl acetate) to give 1.94 as a clear oil.
g (57% of the total yield from (4)) was obtained.

[0182]

Table 4 ¹ H-NMR (CDCl ₃ ) 1.14-1.71 (9H, duplicate), 2.25-2.4
1 (2H, t) 2.61-2.94 (2H, m), 3.12-3.3
1 (2H, m) 3.67-3.86 (6H, m), 4.03-4.2
7 (3H, duplication) 5.59-5.65 (1H, br) Reference Example 2 Synthesis of malathion hapten-2

[0183]

Embedded image

Synthesis of (2) 22.2 g (100 mmol) of diphosphorus pentasulfide was dissolved in 100 ml of toluene solution, and methanol (16 g, 500 g) was dissolved.
mmol) was added dropwise at 50 ° C. and stirred for 3.5 hours. The pH of this solution was adjusted to 6 with a 2N aqueous sodium hydroxide solution while cooling with ice. Tert-butyl bromoacetate 35
g (179 mmol) was added dropwise at room temperature, and the mixture was stirred at 60 ° C. for 1 hour. The toluene layer was collected, dehydrated (anhydrous magnesium sulfate), filtered and concentrated, and then purified by a silica gel column (n-hexane: ethyl acetate = 49: 1 → 9: 1).
18.7 g (34% yield) of (2) was obtained as a yellow transparent oil.

[0185]

Table 5 ¹ H-NMR (CDCl ₃ ) 1.48 (9H, s), 3.41-3.57 (2H,
d) 3.68-3.87 (6H, d) Synthesis of (3) 1.0 M lithium bis (trimethylsilyl) amide 1
9 ml of the mixture was cooled to −70 ° C. or less with dry ice-acetone, and 5.0 g (18 mmol) of (2) was added dropwise under a nitrogen stream. After stirring for 1 hour, 3.1 g (18 mm
ol) in 5 ml of a THF solution of ethyl bromoacetate. After completion of the dropping, the Dewar bath was removed and the mixture was stirred for 1 hour. The reaction solution was concentrated under reduced pressure, dissolved in ethyl acetate, and washed with water. The concentrate is subjected to silica gel chromatography (n
-Hexane: ethyl acetate = 19: 1 → 9: 1) gave 3.5 g (yield 53%) of (3) as a clear oil.

[0186]

Table 6 ¹ H-NMR (CDCl ₃ ) 1.20-1.30 (3H, t), 1.48 (9H,
s) 2.79-3.05 (2H, m), 3.73-3.87
(6H, m) 3.97-4.23 (3H, m) Synthesis of (4) 3.4 g (9.5 mmol) of (3) was dissolved in 100 ml of dichloromethane, and trifluoroacetic acid (TFA) was dissolved.
5 ml was added and the mixture was stirred at room temperature for 3 hours.
Was added and stirred for 40 minutes. The reaction solution was concentrated under reduced pressure and purified by silica gel chromatography (n-hexane: ethyl acetate = 4: 1 → 2: 1) to obtain 2.2 g (yield 76%) of (4) as a transparent oil. Was.

[0187]

Table 7 ¹ H-NMR (CDCl ₃ ) 1.20-1.31 (3H, t), 2.84-3.11
(2H, m) 3.72-3.88 (6H, m), 4.06-4.27
(3H, m) Synthesis of (5) 1.5 g (5 mmol) of (4) was dissolved in 30 ml of tetrahydrofuran (THF), and 0.67 g (6.6 mmol) of N was dissolved while cooling the solution with salt-ice. -5 ml of a solution of methylmorpholine (NMM) in THF, then 0.9
g (6.6 mmol) of isobutyl formate in THF 5
ml was added dropwise. After stirring for 20 minutes, 1.1 g (5.9
5 mmol of tert-butyl 6-aminohexanoate in THF was added dropwise. After stirring for 30 minutes under ice-cooling, the mixture was further stirred at room temperature for 15 minutes. After the solvent was distilled off, the residue was redissolved in dichloromethane, washed with water, dehydrated (anhydrous magnesium sulfate), filtered, concentrated and purified by silica gel chromatography (n-hexane: ethyl acetate = 9: 1) to give a transparent oil. 390 mg (16% yield) of (5) were obtained.

[0188]

Table 8 ¹ H-NMR (CDCl ₃ ) 1.20-1.67 (18H, m), 2.16-2.2
7 (2H, t) 2.81-3.15 (2H, m), 3.20-3.3
1 (2H, m) 3.71-3.83 (6H, m), 3.99-4.1
9 (3H, m) 6.49-6.58 (1H, m) Synthesis of (6) 390 mg (830 μmol) of (5) was dissolved in 50 ml of dichloromethane, 5 ml of TFA was added, and the mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure and subjected to silica gel chromatography (n-hexane: ethyl acetate = 2:
Purification by (1 → 1: 1 → ethyl acetate) afforded 260 mg (76% yield) of (6) as a clear oil.

[0189]

Table 9 ¹ H-NMR (CDCl ₃ ) 1.22-1.74 (9H, m), 2.32-2.43
(2H, t) 2.82-3.14 (2H, m), 3.22-3.33
(2H, m) 3.73-3.84 (6H, m), 3.99-4.20
(3H, m) 6.56-6.77 (1H, m), 8.69-9.25
(1H, br) Reference Example 3 Synthesis of malathion hapten-3

[0190]

Embedded image

Synthesis of (2) 22.2 g (100 mmol) of diphosphorus pentasulfide was dissolved in 100 ml of a toluene solution, and 16 g of methanol (500
mmol) was added dropwise at 50 ° C. and stirred for 3.5 hours. The pH of this solution was adjusted to 6 with a 2N aqueous sodium hydroxide solution while cooling with ice. 34 g (200 mmol) of ethyl bromoacetate was added dropwise at room temperature and stirred at 60 ° C. for 30 minutes and at 70 ° C. for 30 minutes. The toluene layer was collected, dehydrated (anhydrous magnesium sulfate), filtered and concentrated, and then subjected to a silica gel column (n-hexane: ethyl acetate = 49: 1 → 19:
Purification (1 → 9: 1 → 2: 1) afforded 22.4 g (46% yield) of (2) as a clear yellow oil.

[0192]

Table 10 ¹ H-NMR (CDCl ₃ ) 1.21-1.34 (3H, t), 3.53-3.65
(2H, d) 4.13-4.26 (2H , q) (3) dry ice lithium bis (trimethylsilyl) amide 5.3ml Synthesis 1.0M of - minus 70 ° C. with acetone
The mixture was cooled to 1.3 g (5.3 mmo) under a nitrogen stream.
1) (2) was added dropwise. After stirring for 1 hour, 2.0 g
2 ml of a THF solution of (5.3 mmol) tert-butyl 11- (bromoacetoxy) undecanoate was added dropwise. After completion of the dropping, the Dewar bath was removed and the mixture was stirred for 1 hour. The reaction solution was concentrated under reduced pressure, dissolved in ethyl acetate, and washed with water. The concentrate is subjected to silica gel chromatography (n
-Hexane: ethyl acetate = 19: 1 → 9: 1) to give 1.3 g (yield 45%) as a yellow transparent oil.
(3) was obtained.

[0193]

Table 11 ¹ H-NMR (CDCl ₃ ) 1.17-1.47 (28H, m), 2.11-2.2
3 (2H, t) 2.82-3.11 (2H, m), 3.71-3.8
6 (6H, m) 4.00-4.27 ( 5H, m) (4) Synthesis 1.3g of (2.4 mmol) of (3) was dissolved in dichloromethane 50 ml, was added trifluoroacetic acid 5ml Stir at room temperature for 1.5 hours. The reaction solution was concentrated under reduced pressure and purified by silica gel chromatography (n-hexane: ethyl acetate = 4: 1 → 1: 1) to give 1.0 g (yield 88%) of (4) as a yellow transparent oil. I got

[0194]

[Table 12] ¹ H-NMR (CDCl ₃ ) 1.17-1.40 (15H, m), 1.50-1.7
0 (4H, m) 2.24-2.40 (2H, t), 2.79-3.1
0 (2H, m) 3.68-3.86 (6H, m), 3.99-4.2
6 (5H, m) Reference Example 4 Synthesis of Malathion Hapten-4

[0195]

Embedded image

Synthesis of (2) 22.2 g (100 mmol) of diphosphorus pentasulfide was dissolved in 100 ml of toluene solution, and methanol (16 g, 500 g) was dissolved.
mmol) was added dropwise at 50 ° C. and stirred for 3.5 hours. The pH of this solution was adjusted to 6 with a 2N aqueous sodium hydroxide solution while cooling with ice. 34 g (200 mmol) of ethyl bromoacetate was added dropwise at room temperature and stirred at 60 ° C. for 30 minutes and at 70 ° C. for 30 minutes. The toluene layer was collected, dehydrated (anhydrous magnesium sulfate), filtered and concentrated, and then subjected to a silica gel column (n-hexane: ethyl acetate = 49: 1 → 19:
Purification (1 → 9: 1 → 2: 1) afforded 22.4 g (46% yield) of (2) as a clear yellow oil.

[0197]

Table 13 ¹ H-NMR (CDCl ₃ ) 1.21-1.34 (3H, t), 3.53-3.65
(2H, d) 4.13-4.26 (2H, q) Synthesis of (3) 1.0 M lithium bis (trimethylsilyl) amide 8
The mixture was cooled to −70 ° C. or less with dry ice-acetone, and 1.96 g (8 mmol) of (2) was added dropwise under a nitrogen stream. After stirring for 1 hour, 5 ml of a THF solution of 2.35 g (8 mmol) of tert-butyl 6- (bromoacetoxy) hexanoate was added dropwise. After completion of the dropping, the Dewar bath was removed and the mixture was stirred for 1 hour. The reaction solution was concentrated under reduced pressure, dissolved in ethyl acetate, and washed with water. The concentrate was roughly purified by silica gel chromatography (n-hexane: ethyl acetate = 19: 1 → 9: 1).

Synthesis of (4) The crude product containing (3) was dissolved in 50 ml of dichloromethane, 5 ml of trifluoroacetic acid was added, and the mixture was stirred at room temperature for 2 hours. The reaction solution is concentrated under reduced pressure and silica gel chromatography (n-hexane: ethyl acetate = 4: 1 →
Purification in 1: 1) yielded 0.54 g as a clear oil.
(4) of (total yield from (2) 20%) was obtained.

[0199]

Table 14 ¹ H-NMR (CDCl ₃ ) 1.20-1.50 (5H, duplicate), 1.58-1.7
6 (4H, m) 2.31-2.43 (2H, t), 2.82-3.1
1 (2H, m) 3.71-3.88 (6H, m), 4.03-4.2
7 (5H, duplication) Reference Example 5 Synthesis of Malathion Hapten-5

[0200]

Embedded image

Synthetic (2) 10 ml of sulfuric acid was added to 100 ml of diethyl ether, and then 100 ml of benzyl alcohol was added with stirring. After distilling off diethyl ether, 13.4 g (100 m
l) L-Aspartic acid was added in small portions. 1 at room temperature
After stirring for 200 days, ethanol 200 ml and pyridine 50 ml
Was added and left in the refrigerator overnight. The precipitated crystals were collected by filtration, washed with ether and water, and then dried, giving 11 g.
(Yield 49%) (2) was obtained.

Synthesis of (3) 11 g (49 mmol) of (2) was added to 600 ml of water and dissolved at 80 ° C. When heating was stopped and cooled to 60 ° C., 10.5 g (125 mmol) of sodium hydrogen carbonate and 12 g (70 mmol) of benzyloxycarbonyl chloride (Z-Cl) were added, and the mixture was stirred for 3 hours. After washing with diethyl ether, the mixture was adjusted to pH 1 with concentrated hydrochloric acid while cooling on ice, and extracted with ethyl acetate. After dehydration (anhydrous sodium sulfate), filtration and concentration, purification by a silica gel column (n-hexane: ethyl acetate = 9: 1 → 1: 2) gave 4.5 g (yield 25%) of (3) as white crystals. Obtained.

[0203]

Table 15 ¹ H-NMR (CDCl ₃ ) 2.80-3.17 (2H, m), 4.54-4.76 (1H, m) 5.11 (4H, s), 5.74- 5.89 (1H, d) 7.31 (10H, s), 9.38-10.02 (1H, br) Synthesis of (4) 4.5 g (12.6 mmol) of (3) was converted to ethanol 1
The mixture was dissolved in 50 ml, and 15 ml of a 1.0 M solution of hydrogen chloride in diethyl ether was added, and the mixture was refluxed for 30 minutes. Further, 15 ml of the solution was added, and the mixture was refluxed for 30 minutes.
Was added and refluxed for 30 minutes. The reaction solution was filtered, concentrated, and then purified by a silica gel column (n-hexane: ethyl acetate = 4: 1 → 2: 1) to obtain 1.8 g (yield 37%) of (4) as a transparent oil. .

[0204]

[Table 16] _{^{1 H-NMR (CDCl 3)}} 1.13-1.27 (3H, t), 2.83-3.14 (2H, m) 4.08-4.22 (2H, m), 4.58-4.69 (1H, m) 5.11 (4H, s), 5.69-5.81 (1H, d) 7.34 (10H, s) Synthesis of 8.6 g of ( 5) 22 mmol) of (4) in ethanol 200
Then, 2.0 g of 5% palladium carbon was added, and the mixture was stirred at room temperature for 1 hour under a hydrogen atmosphere. The reaction solution was filtered and concentrated to obtain (5).

Synthesis of (6) 4.2 g of crude carboxylic acid (5) was added to 300 ml of water and dissolved at 80 ° C. When heating was stopped and cooled to 60 ° C., 0.88 g (10.5 g) of sodium hydrogencarbonate was added.
3.0 g (17.6 mmol) after the addition of
Of Z-Cl was added. 1.3 g (15.5 mmo)
1) Sodium bicarbonate was added and stirred for 3 hours. After washing with diethyl ether, pH was adjusted with concentrated hydrochloric acid while cooling with ice.
Was adjusted to 2 and extracted with ethyl acetate. After dehydration (anhydrous sodium sulfate), filtration and concentration, the silica gel column (n-
Purification with hexane: ethyl acetate = 1: 1 → 1: 2) gave 1.63 g (total yield 50% from (4)) of (6) as white crystals.

[0206]

Table 17 ¹ H-NMR (CDCl ₃ ) 1.11-1.30 (3H, t), 2.74-3.12 (2H, m) 4.06-4.25 (2H, m), 4.55-4.70 (1H, m) 5.10 (2H, s), 5.84-5.99 (1H, d) 7.33 (5H, s), 8.49-9.26 ( 1H, br) Synthesis of (7) 1.63 g (5.5 mmol) of (6), 224 mg
(1.8 mmol) N, N-dimethylaminopyridine (DMAP), 426 mg (1.8 mmol) camphorsulfonic acid (CSA), 1.4 g (7.4 mmol)
l) Tert-butyl 6-hydroxyhexanoate was added to 50 ml of tetrahydrofuran (THF). 1.7
g (8.3 mmol) of N, N-dicyclohexylcarbodiimide (DCC) in 10 ml of THF was added dropwise. After stirring at room temperature for 1 day, the reaction solution was filtered and concentrated, and then silica gel column (n-hexane: ethyl acetate = 4: 1 → 2:
Purification in 1) gave 2.16 g (84% yield) of (7) as a clear oil.

[0207]

[Table 18] _{^{1 H-NMR (CDCl 3)}} 1.20-1.46 (14H, overlapping), 1.51-1.69 (4H, m) 2.15-2.26 (2H, t), 2.77-3.07 (2H, m) 4.02-4.26 (4H, m), 4.57-4.67 (1H, m) 5.12 (2H, s), 5.73- Synthesis of 5.82 (1H, d) 7.37 (5H, s) (8) 2.16 g (4.6 mmol) of (7) in ethanol 2
Dissolve in 00ml and 300mg 5% palladium carbon
Was added and the mixture was stirred at room temperature for 1 hour under a hydrogen atmosphere. The reaction solution was filtered and concentrated to obtain (8). This was used for the next reaction without purification.

Synthesis of (9) Crude amine (8), 0.8 g (5 mmol) of dimethyl chlorothiophosphate and 0.7 g (5 mmol) of potassium carbonate were added to 80 ml of acetonitrile, and the mixture was stirred at 50 ° C. for 1 hour. Filtration and concentration followed by purification on a silica gel column (n-hexane: ethyl acetate = 4: 1) gave 1.71 g.
(9) of (total yield 100% from (7)) was obtained.

[0209]

Table 19 ¹ H-NMR (CDCl ₃ ) 1.23-1.49 (14H, duplication), 1.54-1.71 (4H, m) 2.15-2.27 (2H, t), 2.71-3.00 (2H, m) 3.63-3.75 (6H, m), 4.00-4.11 (5H, t) 4.17-4.34 (3H, duplicate) ( Synthesis of 10) 1.71 g (4.6 mmol) of (9) was dissolved in 100 ml of dichloromethane, and trifluoroacetic acid (TF
A) 5 ml was added and the mixture was stirred at room temperature for 1 hour. Further TFA
5 ml was added and stirred for 1 hour. The reaction solution was concentrated under reduced pressure and subjected to silica gel chromatography (n-hexane:
Purification with ethyl acetate = 4: 1 → 1: 1) gave 1.44 g (99% yield) of (10) as a clear oil.

[0210]

Table 20 ¹ H-NMR (CDCl ₃ ) 1.22-1.33 (3H, t), 1.35-1.49 (2H, m) 1.59-1.75 (4H, m), 2.31-2.42 (2H, t) 2.71-3.00 (2H, m), 3.62-3.36 (6H, m) 4.01-4.34 (5H, duplicate) Reference Example 6 Synthesis of Malathion Hapten-6

[0211]

Embedded image

Synthesis of (2) 58.8 g (400 mmol) of L-glutamic acid and 4
8 g (440 mmol) of benzyl alcohol to 60%
In addition to sulfuric acid (39.2 g of concentrated sulfuric acid + 26 ml of water), 70
Stir at 45 ° C. for 45 minutes. After concentration at 70 ° C. for 3 hours, 67.
The mixture was poured into 200 ml of cold water containing 2 g (800 mmol) of sodium hydrogen carbonate with stirring, 150 ml of cold water was added, and the mixture was allowed to stand. The precipitated crystals were separated by filtration and washed with water. The crystals were recrystallized from water to give 35 as white crystals.
g (37% yield) of (2) was obtained.

Synthesis of (3) 4.74 g (20 mmol) of (2) was added to 300 ml of water and dissolved at 80 ° C. Stop heating and 60 ℃
When cooled down, 4.2 g (50 mmol) of sodium hydrogen carbonate and 4.1 g (24 mmol) of benzyloxycarbonyl chloride (Z-Cl) were added, and the mixture was stirred for 3 hours. After washing with diethyl ether, the mixture was adjusted to pH 1 with concentrated hydrochloric acid while cooling on ice, and extracted with ethyl acetate. After dehydration (anhydrous sodium sulfate), filtration, and concentration, purification was performed using a silica gel column (n-hexane: ethyl acetate = 1: 2).
6.4 g (yield 86%) of (3) was obtained as white crystals.

[0214]

Table 21 ¹ H-NMR (CDCl ₃ ) 1.93-2.37 (2H, m), 2.37-2.61 (2H, m) 4.30-4.50 (1H, m), 5.10 (4H, s) 5.40-5.53 (1H, d), 7.33 (10H, s) Synthesis of (4) 6.0 g (16 mmol) of (3) was added to ethanol 150
Then, 1 ml of a 1.0 M hydrogen chloride diethyl ether solution was added, and the mixture was refluxed for 30 minutes. 3m of the solution
After 1 minute was added and refluxed for 30 minutes, 3 ml of the solution was added three times and refluxed for 1 hour. The reaction solution was filtered and concentrated, and then concentrated on a silica gel column (n-hexane: ethyl acetate = 9: 1 →
4: 1 → 2: 1) to give a clear oil.
2 g (yield 65%) of (4) was obtained.

[0215]

Table 22 ¹ H-NMR (CDCl ₃ ) 1.15-1.33 (3H, q), 1.87-2.32 (2H, m) 2.33-2.58 (2H, m), 4.07-4.25 (2H, m) 4.32-4.48 (1H, m), 5.10 (4H, s) 5.32-5.45 (1H, d), 7.34 ( 10H, s) Synthesis of (5) 16 g (40 mmol) of (4) was treated with 250 ml of ethanol.
Then, 2.5 g of 5% palladium carbon was added, and the mixture was stirred under a hydrogen atmosphere at room temperature for 1 hour. The reaction solution was filtered and concentrated to obtain (5). 8.6 g of crude yield (crude yield 1
22%).

Synthesis of (6) 8.6 g of crude carboxylic acid (5) was added to 300 ml of water and dissolved at 80 ° C. When heating was stopped and the temperature was cooled to 60 ° C., 8.4 g (100 mmol) of sodium hydrogen carbonate and 8.2 g (48 mmol) of Z-Cl were added, and the mixture was stirred for 3 hours. After washing with diethyl ether, the mixture was adjusted to pH 1 with concentrated hydrochloric acid while cooling on ice, and extracted with ethyl acetate. After dehydration (anhydrous sodium sulfate), filtration and concentration, a silica gel column (n-hexane: ethyl acetate = 1: 1 →
1: 2), 5.4 g as white crystals
(6) of (total yield 43% from (4)) was obtained.

[0219]

Table 23 ¹ H-NMR (CDCl ₃ ) 1.17-1.35 (3H, q), 1.88-2.30 (2H, m) 2.33-2.57 (2H, m), 4.06-4.26 (2H, m) 4.34-4.49 (1H, m), 5.11 (2H, s) 5.38-5.51 (1H, d), 7.34 ( 5H, s) Synthesis of (7) 1.0 g (3.2 mmol) of (6), 130 mg
(1.1 mmol) N, N-dimethylaminopyridine (DMAP), 250 mg (1.1 mmol) camphorsulfonic acid (CSA), 600 mg (3.2 mmol)
l) Tert-butyl 6-hydroxyhexanoate was added to 15 ml of tetrahydrofuran (THF). 1.0
g (4.9 mmol) of N, N-dicyclohexylcarbodiimide (DCC) in 15 ml of THF was added dropwise. After stirring at room temperature for 20 hours, the reaction solution was filtered and concentrated, and then silica gel column (n-hexane: ethyl acetate = 4: 1 →
2: 1), 940 mg as a clear oil
(7) of (yield 60%) was obtained.

[0218]

Table 24 ¹ H-NMR (CDCl ₃ ) 1.21-1.47 (14H, overlap), 1.52-1.70 (4H, m) 1.90-2.06 (1H, m), 2.16-2.27 (3H, m) 2.34-2.47 (2H, m), 4.00-4.10 (2H, t) 4.14-4.26 (2H, q), 4.33-4.44 (1H, m) 5.11 (2H, s), 5.37-5.46 (1H, d) 7.36 (5H, s) Synthesis of 5.9 g of ( 8) 12.3 mmol) of (7) in ethanol 1
Dissolve in 50 ml, 5% palladium carbon 600mg
Was added and stirred at room temperature for 30 minutes under a hydrogen atmosphere. The reaction solution was filtered and concentrated to obtain (8). This was used for the next reaction without purification.

Synthesis of (9) Crude amine (8) and 2.0 g (12, 4 mmol) of dimethyl chlorothiophosphate, 1.7 g (12.3 mmol)
Of potassium carbonate in 100 ml of acetonitrile
Stirred at 0 ° C. for 1 hour. After filtration and concentration, the residue was purified by a silica gel column (n-hexane: ethyl acetate = 4: 1) to obtain 4.7 g (total yield 100% from (7)) of (9).

[0220]

[Table 25] _{^{1 H-NMR (CDCl 3)}} 1.21-1.47 (14H, overlapping), 1.54-1.70 (4H, m) 1.83-2.15 (2H, m), 2.18-2.26 (2H, t) 2.37-2.48 (2H, m), 3.60-3.73 (6H, m) 3.93-4.11 (3H, duplication), 4.15-4.27 (2H, q) Synthesis of (10) 4.7 g (12.3 mmol) of (9) is dissolved in 80 ml of dichloromethane, and trifluoroacetic acid (TFA) is dissolved.
5 ml was added and the mixture was stirred at room temperature for 1 hour. 5 ml of TFA was added, and the mixture was further stirred for 1 hour. The reaction solution was concentrated under reduced pressure and purified by silica gel chromatography (n-hexane: ethyl acetate = 4: 1 → 1: 1) to obtain 3.5 g (87% yield) of (10) as a transparent oil. Was.

[0221]

Table 26 ¹ H-NMR (CDCl ₃ ) 1.24 to 1.36 (3H, t), 1.36-1.50 (2H, m) 1.60-1.74 (4H, m), 1.83-2.20 (2H, m) 2.34-2.50 (4H, duplication), 3.61-3.76 (6H, m) 3.94-4.28 (5H, m) Reference Example 7 Preparation of Antigen for Immunization and Antigen for Screening Using malathion haptens-1 to 6 prepared in Reference Examples 1 to 6 as haptens, 3.6 μmol each of DMS was used.
O was dissolved in 100 μl. To these solutions, a solution of N-hydroxysuccinimide (16 μmol) dissolved in 10 μl of DMSO was added. Next, a solution of 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide.hydrochloride (5.6 μmol) dissolved in 20 μl of DMSO was added, and the mixture was reacted at room temperature for 1.5 hours.
A solution prepared by dissolving 10 mg each of BSA or KLH in 500 μl of 85 mM borate buffer (pH 8.0) was added to these reaction solutions, and the reaction was performed again at room temperature for 1.5 hours. After completion of the reaction, Dulbecco's phosphate buffer (hereinafter, referred to as
Dialyzed with “PBS (−)”), conjugated with malathion hapten-1 to 6 and KLH (hereinafter, referred to as “malathion hapten-1 to 6 / KLH”), malathion hapten-1 to 6 and BSA And a conjugate with
"Malathion hapten-1 to 6 / BSA")
Was prepared respectively.

Reference Example 8 Immunization Balb / c mice (7 weeks old, female) were used for immunization. 100 μg of malathion hapten-1 to 6 / KLH prepared in Reference Example 7 were each dissolved in 50 μl of PBS (−). This was emulsified and mixed with an equal volume of Freund's complete adjuvant, and then inoculated intraperitoneally into mice. One month later,
A booster immunization was performed with a quarter of the initial immunization amount, and 5 weeks later, the same immunization as the booster immunization was finally performed.

Reference Example 9 Preparation of Hybridoma Cell fusion for obtaining a hybridoma producing a monoclonal antibody was performed using the spleen cells of the mouse on day 3 after the final immunization in Reference Example 8.

From the excised spleen, spleen cells were taken out in DMEM and washed three times with DMEM. After washing, the cells were mixed with mouse myeloma cells P3-X63-Ag8.653 at a cell number ratio of 5: 1 (spleen cells: myeloma cells) and centrifuged (1,200 rpm, 5 minutes). The cell sediment was collected. To this cell sediment, 50% polyethylene glycol (molecular weight 150
0) 1 ml was added to fuse the cells. DMEM 10m
1 was gradually added, and 1 ml of fetal bovine serum (hereinafter referred to as “FBS”) was further added to stop the cell fusion. The fused cells were obtained by adding 10% FBS, hypoxanthine (100 μM), aminopterin (0.4%) to DMEM.
μM) and thymidine (16 μM) and suspended in a HAT medium, and dispensed at 2 × 10 ⁵ cells / well into each well of a 96-well microplate. After culturing at 37 ° C. in the presence of 5% carbon dioxide for 10 to 14 days, colonies of hybridomas were formed in each well.

Reference Example 10 Preparation of Monoclonal Antibody Among the wells in which colonies were formed in Reference Example 9, those producing a monoclonal antibody reactive with malathion in their culture supernatants were indirectly used as follows. Competition inhibition E
Screening was performed using the LISA method.

First, malathion hapten-1 to 6 / BSA (4 μg / ml) dissolved in PBS (−) was added to 96
100 wells per well of a microtiter plate
The mixture was added at μl / well, and allowed to stand at 4 ° C. overnight to immobilize the solid phase. Next, 300 μl / well of blocking buffer (85% with 1% BSA and 60 mM NaCl) was added.
mM borate buffer (pH 8.0)) and blocked for 1 hour at room temperature. Add diluent A (150m
85 mM borate buffer (pH
The malathion solution serially diluted to an appropriate concentration in 8.0)) was added at 50 μl / well. Then, immediately dilute the culture supernatant to the appropriate concentration with the same diluent, and add 50
The mixture was added at μl / well, mixed, and reacted at room temperature for 1 hour. Appropriate concentration refers to this EL without malathion added.
This is the antibody concentration at which the absorbance of the ISA method can be の of that at the time of antibody saturation.

Washing solution (8 with 60 mM NaCl added)
After washing three times with 5 mM borate buffer (pH 8.0), a diluent B for secondary antibody (0.3% BSA and 60 mM
85 mM borate buffer (pH
8.0)) HRP-conjugated anti-mouse I diluted 1000-fold
A gG antibody (manufactured by Capel) was added at 100 μl / well, and reacted at room temperature for 1 hour. After washing 3 times again, HRP
Color was developed for 10 minutes with a substrate solution (0.1 M sodium acetate buffer (pH 5.5) supplemented with 100 μg / ml 3,3′5,5′-tetramethylbenzidine and 0.006% hydrogen peroxide), After stopping the reaction with 1N sulfuric acid, 450 nm
Was measured for absorbance.

After qualitatively screening the reactivity of each well, the hybridomas in the wells that showed reactivity with malathion were cloned by the limiting dilution method. In this way, three monoclonal antibody-producing cells (MLT2-2) producing antibodies reactive to malathion were obtained.
3, MLT40-4, MLT45-3). All of these three strains are hybridomas obtained using malathion hapten-5 / BSA as an antigen.

Further, these monoclonal antibody-producing cells were cultured in DMEM supplemented with 10% of FBS, and the obtained culture supernatants were used as monoclonal antibodies. Since then
Each monoclonal antibody has the same name as the monoclonal antibody-producing cells that produce them.

The subclasses of the prepared monoclonal antibodies are shown in Table 27 below.

[0231]

Table 27: Subclass of the prepared monoclonal antibody Monoclonal antibody Subclass MLT2-23 IgG2a MLT40-4 IgG1 MLT45-3 IgG1 Of the obtained monoclonal antibodies, MLT2-23 was deposited on January 22, 1999, and the deposit number was FERM. P-171
At 57, the Institute of Bioscience and Biotechnology, Institute of Industrial Science (¥ 305-00
46 1-3-1 Higashi, Tsukuba City, Ibaraki Prefecture).

Reference Example 11 Purification of Monoclonal Antibody Each monoclonal antibody obtained in Reference Example 10 was purified. First, Balb / c mice were inoculated with each monoclonal antibody-producing cell intraperitoneally to obtain ascites. MLT2-
The ascites from the 23-producing cells had 35% saturation, and the MLT40-4 producing cells and the MLT45-3
Ammonium sulfate was added to the ascites derived from the producing cells so as to be 33% saturated, and each was stirred at 4 ° C. and then centrifuged to obtain a precipitate. These precipitates were solubilized with PBS (-), and further dialyzed against PBS (-) for 2 nights to obtain purified antibodies. The purity of these antibodies was at least 90% as measured by SDS-polyacrylamide gel electrophoresis.

Reference Example 12 Malathion Hapten and HRP
Preparation of Conjugate with Malathion Hapten-4 to 1.25 μm Each
was dissolved in 50 μl of DMSO. To these solutions, N
-Hydroxysuccinimide (5.5 μmol).
Solution in 4 μl of DMSO, then 1-ethyl-
3- (3-dimethylaminopropyl) carbodiimide.
A solution of hydrochloride (1.9 μmol) dissolved in 6.8 μl of DMSO was added, and the mixture was reacted at room temperature for 1 hour. 40 μl of 1 M sodium bicarbonate was added to these reaction solutions,
Further, a solution in which HRP (5 mg) was dissolved in 250 μl of distilled water was added, and reacted at room temperature for 3 hours. The low-molecular-weight compound was removed from the obtained reaction solution using a gel filtration column (Sephadex G-25), and malathion hapten-4 was removed.
-6 and HRP (hereinafter referred to as "malathion hapten-4 to 6 / HRP").

Reference Example 13 Direct ELISA for competitive inhibition
Monoclonal Antibody Reactivity to Malathion in Example 1 The reactivity of the obtained monoclonal antibody to malathion was examined using a direct competitive inhibition ELISA method.

MLT2-23, M purified in Reference Example 11
LT40-4 has a concentration of 3 μg / ml, and MLT45-3
Was dissolved in PBS (−) at a concentration of 5 μg / ml. These were added to each well of a 96-well microtiter plate at 100 μl / well, and allowed to stand at 4 ° C. overnight for immobilization. Then, it was replaced with 300 μl / well of a blocking buffer, and blocked at room temperature for 1 hour. On the other hand, diluent C (0.3% BSA and 150 mM
100 mM phosphate buffer containing NaCl (pH
7.0)), a malathion diluted stepwise to an appropriate concentration, and a malathion hapten similarly diluted to an appropriate concentration.
A mixture of 5 / HRP was prepared. The appropriate concentration means that the absorbance of this ELISA method under the condition where malathion is not added is HR
It is the concentration of the HRP-bound hapten that can show half of the P-bound hapten saturation. These were added at 100 μl / well to each of the previously blocked wells, and reacted at room temperature for 1 hour. After washing three times with the washing solution, the color was developed in the same manner as the indirect competitive inhibition ELISA method shown in Reference Example 10,
The absorbance at 450 nm was measured.

The results are shown in FIG. Here, the inhibition rate was calculated by the following equation.

[0237]

Embedded image

As shown in FIG. 4, the monoclonal antibodies MLT2-23 and MLT40-4 were 10 ng / ml.
To 300 ng / ml, monoclonal antibody MLT45
-3 reacted with malathion in a concentration range of 100 ng / ml to 1000 ng / ml. Therefore, it was revealed that the monoclonal antibodies MLT2-23 and MLT40-4 particularly show high reactivity with malathion.

Reference Example 14 Using heterologous hapten
Monoclonal in direct competitive inhibition ELISA
Malathion of MLT2-23 and MLT40-4
For monoclonal antibodies MLT2-23 and MLT40-4 which showed high reactivity to malathion in Reference Example 13, changes in reactivity to malathion were examined by changing the HRP-binding hapten used in the direct competitive inhibition ELISA method. . Specifically, the procedure was performed in the same manner as in Reference Example 13 except that malathion hapten-6 / HRP or malathion hapten-4 / HRP was used instead of malathion hapten-5 / HRP as the HRP-bound hapten.

FIG. 5 shows the results. As shown in FIG. 5, the reactivity of each antibody to malathion varied depending on the type of HRP-binding hapten used. That is, the monoclonal antibody MLT2-23 differs from the result of Reference Example 13 in the concentration range of 4 ng / ml to 100 ng / ml when malathion hapten-6 / HRP is used, and 10 ng when malathion hapten-4 / HRP is used. /
Reacted with malathion in a concentration range from ml to 1000 ng / ml. On the other hand, monoclonal antibody MLT40-4
Is 40 when malathion hapten-6 / HRP is used.
10 ng / m when malathion hapten-4 / HRP is used in a concentration range of ng / ml to 1000 ng / ml.
It reacted with malathion in a concentration range of 1 to 300 ng / ml.

As described above, the monoclonal antibody MLT2-
Both 23 and MLT40-4 showed unique reactivity in combination with the hapten for label competition. In particular, when the monoclonal antibody MLT2-23 was combined with malathion hapten-6 / HRP, it became clear that the reactivity with malathion was highest.

Reference Example 15 Monoclonal Antibody MLT2
Based on the results of Reference Example 14, the combination of the monoclonal antibody MLT2-23 having the highest reactivity with malathion and the combination of malathion hapten-6 / HRP was used to evaluate the cross-reactivity with malathion metabolites and related compounds. Was examined.

The results are shown in Table 28 below.

[0244]

[Table 28]

In Table 28, IC 50 indicates the reaction
% The concentration of the compound that inhibits, and the cross-reactivity is the IC50 value of malathion / IC50 value of each compound x 100. From Table 28, it can be seen that the monoclonal antibody MLT2-23
Is 1.6% with malaoxon, a metabolite of malathion
Despite showing cross-reactivity, all compounds cross-reacted less than 1% with all other compounds, revealing high specificity to malathion. Example (1) cD of anti-malathion monoclonal antibody-producing cells
Construction of NA Library A mouse hybridoma cell (MLT2-23) producing the anti-malathion monoclonal antibody MLT2-23 was used as a starting material. Hybridoma MLT2-23 was deposited on January 22, 1999 under accession number FERM P-1715.
7 at the National Institute of Advanced Industrial Science and Technology (¥ 305-004)
6. Deposited at 1-3 1-3 Higashi, Tsukuba City, Ibaraki Prefecture).

First, 3 × 10 ⁷ MLT2-23 cells cultured in a DMEM medium (purchased from ICN) containing 10% fetal bovine serum (purchased from JRH) were collected from Quick
Prep Micro mRNA Purificat
ion Kit (Amersham Pharmaci)
a Biotech) according to the attached instructions, and about 10 μg of mRNA was extracted. 5μ of this
gAP as a template and ZAP-cDNA Synt
hesis Kit (purchased from Stratagene)
CDNA was synthesized using the anti-malathion monoclonal antibody MLT2 incorporated into λZAPII ™.
A cDNA library of cells of the -23 producing hybridoma was constructed according to the attached instructions. This cDNA library was amplified according to the attached instructions.

(2) immunoglobulin heavy and light chains
Preparation of cDNA Fragment to be Loaded The nucleotide sequence of the immunoglobulin constant region has extremely high conservation. Then, using the cDNAs encoding the constant regions of the heavy and light chains of the immunoglobulin as probes, the anti-malathion monoclonal antibody MLT2-2 prepared in (1) was used.
Screening of a cDNA library of the cells of the three-producing hybridoma cells was carried out, and an attempt was made to isolate cDNAs of immunoglobulin light chain and heavy chain specific to malathion.

C encoding heavy and light chain constant regions
The DNA probe was anti-malathion monoclonal antibody M
-6-451. M-6-451 is a monoclonal antibody newly obtained by the present inventors at the Kobe University Faculty of Agriculture, Department of Agrochemical Biochemistry. Although the nucleotide sequence and amino acid sequence of the anti-malathion monoclonal antibody M-6-451 have not been determined, the subclass is IgG1
Thus, the light chain is revealed by the kappa chain. Since the nucleotide sequence of the immunoglobulin constant region is extremely highly conserved, a cDNA nucleotide sequence encoding another mouse immunoglobulin constant region is searched from a database, primers are synthesized based on the known sequence, and the M- From the 6-451 cDNA library, cDNAs encoding immunoglobulin heavy and light chain constant regions were amplified.

First, 1 × 10 ⁷ M-6-451-producing mouse hybridoma cells (HYB451) were
QuickPrep Micro mRNA Puri
7.8 μg of mRNA was extracted by using a kit according to the attached instructions. 100 of these
ng mRNA to ThermoScript RT-
PCR System (Life Technology
ns) and follow the instructions provided with
A was synthesized.

Using this cDNA as a template, a cDNA fragment encoding the constant region of the immunoglobulin light chain and heavy chain was amplified by PCR, and the cDNA base sequence encoding the other mouse immunoglobulin constant region was searched from a database. Primers for amplifying the heavy and light chain constant regions were synthesized. The nucleotide sequences of the cDNAs encoding the known heavy and light chains of the mouse immunoglobulin used are shown in SEQ ID NOS: 5 and 6. Based on these nucleotide sequences, the following four oligonucleotides were synthesized as primers for PCR amplification.

[0251]

Embedded image KF primer: 5′-TGCTGCACCAACTGTATCCATC-3 ′ (SEQ ID NO: 7) KB primer: 5′-CTGTTTGAAGCTCTTGACAATGGGG-3 ′ (SEQ ID NO: 8) G1F primer 5′-CTGCTGCCCAAACTAACTCCAT-3 ′ G (SEQ ID NO: 9) G 5′-CTCTTCTCAGTATGGTGGTTGTGC-3 ′ (SEQ ID NO: 10) The prepared cDNA solution was dispensed in equal amounts into two PCR tubes, and 50 pmol of the KF primer and 50 pmol of the KB primer were added to one tube, and the other was added. To the tube, 50 pmol of G1F primer and 50 pmol of G1B primer were added. Further 2.
4 μl of 5 mM dNTP, 5 μl of 10 × PCR buffer, Taq DNA polymerase (5 U / μl)
(Purchased from Takara Shuzo) were added in an amount of 0.5 μl, and the total volume was adjusted to 50 μl with sterilized water. PCR was performed at 95 ° C for 1 minute, 58
The reaction was repeated 10 times at 2 ° C. and 2 minutes at 72 ° C.
The reaction was performed at 95 ° C for 1 minute, at 63 ° C for 2 minutes, and at 72 ° C for 2 minutes.
Repeated 0 times.

Both reactions were electrophoresed on a 1.5% agarose gel and the approximately 300 bp cD coding for the light chain constant region.
Approximately 900 bp c encoding NA fragment and heavy chain constant region
The amplification of the DNA fragment was confirmed. These cDNA fragments were extracted from agarose gel using Geneclean II (purchased from Bio101) according to the attached instructions, and the heavy chain constant region cDNA was extracted at 451G and the light chain constant region c.
The DNA was 451 l.

(3) MLT2-23 cell cDNA live
Rally screening The MLT2-23 cell cDNA library prepared and amplified in (1) was replaced with the heavy chain constant region cDNA prepared in (2).
Fragment (451G) and the light chain constant region cDNA fragment (4
Using 511) as a probe, screening by plaque hybridization was performed according to the attached instructions.

Specifically, Hybond-N + nylon membrane (Amersham Pharmacia)
(Purchased from Biotech) was attached to 2.5 × 10 ⁵ plaques two by two and transferred, and two sets of filters were fixed with alkali. On the other hand, cDNA fragment 451G and cDN
The A fragment 451K was used for ECL Direct Nuclei.
c Acid Labeling and Detec
Tion System (Amersham Phar
macia Biotech). One set of filters is labeled cD
Hybridization was performed with the NA fragment 451G and another set of filters with the labeled cDNA fragment 451K. Hybridization is ECL Direct
Nucleic Acid Labeling an
This was performed at 37 ° C. and 0.5 M NaCl for 16 hours using d Detection System according to the attached instructions. Wash these filters according to the attached instructions, and add them to the chemiluminescent substrate solution provided with the kit.
Soaked for minutes. The filter was then wrapped in wrap and exposed to the film for 1 hour in the dark. Plaques that showed a positive reaction were isolated from the developed film and subjected to screening again.

After repeating the screening a total of three times, eight phages were isolated for each of the light chain and the heavy chain. The inserted cDNA in each isolated phage was cloned from λZAPII ™ into the phagemid pBluescript according to the attached instructions. Then, culturing the E. coli colony carrying the phagemid,
After purifying the phagemid, restriction enzymes EcoRI and Xh
Treated with oI. They were subjected to 1.5% agarose gel electrophoresis to measure the chain length of the insert cDNA inserted in each phagemid. The full length cDNA chain encoding the heavy chain is about 1500 bp, and the full length cDNA chain encoding the light chain is about 1000 bp. Therefore,
The insert cDNA chain length is about 1500 bp or about 1
000 bp only, and the cDNA encoding the light chain of the anti-malathion antibody MLT2-23 (K
211) and cDNA (G208) encoding the heavy chain, respectively. The nucleotide sequences of G208 and K211 were determined, and it was confirmed that they contained the full-length cDNA of the heavy chain and light chain of the anti-malathion antibody MLT2-23, respectively.
The nucleotide sequence of G208 and the predicted amino acid sequence to be encoded are described in SEQ ID NOS: 11 and 12, respectively. The nucleotide sequence of K211 and the encoded amino acid sequence are described in SEQ ID NOs: 13 and 14, respectively.

(4) Anti-malathion recombinant antibody gene ML
Construction of T2-23 scFv Using the heavy chain cDNA clone G208 and the light chain cDNA clone K211 obtained in (3), MLT2-
M-consisting of an anti-malathion recombinant antibody gene that encodes a polypeptide linking 23 heavy and light chain variable regions.
An LT2-23scFv cDNA fragment was prepared.

First, based on the nucleotide sequences of G208 and K211, primers 1 and 2 for amplifying heavy chain variable region cDNA and primers 3 for amplifying light chain variable region cDNA have the following sequences. And 4 were synthesized.

[0258]

Embedded image Primer 1: 5'-TT GGCCCAGCCGGCC CTTCAGGAGTCAGGAC CTAGCCT -3 '( SEQ ID NO: 15) Primer 2: 5'- AGAGCCACCTCCGCCTGAACCGCCTCCACC T GCAGAGACAGTGACCAGAGTTC-3 ' ( SEQ ID NO: 16) Primer 3: 5'- GGCGGAGGTGGCTCTGGCGGTGGCGGATCG G ATATTGTGATGACCCAAACTCCAC-3 '(SEQ ID NO: 17) Primer 4 5'-TT GCGGCCGCCCGTTTTTATTCCAGCGGTGT- 3' (SEQ ID NO: 18) Synthetic peptide Includes a nucleotide sequence encoding a linker, are indicated by underlining, respectively. In addition, primers 1 and 2 each contain a sequence identical or homologous to bases 105-127 and 427-449 of SEQ ID NO: 11. Primers 3 and 4 each had SEQ ID NO: 1
3 contains the same or homologous sequence as bases 91 to 115 and bases 409 to 429.

In order to amplify the cDNA fragment encoding the heavy chain variable region, pG208 (c
Recombinant pBlue with DNA clone G208 inserted
script) and primer 1 at 50 pm
ol, primer 2 at 50 pmol, 2.5 mM dN
4 μl of TP and Pfu DNA polymerase (2.5 U
/ Μl), 5 μl of 10 × PCR buffer (purchased from Stratagene, respectively) was added, and the total volume was adjusted to 50 μl with sterile water to prepare a reaction solution. Also,
To amplify the cDNA fragment encoding the light chain variable region, pK211 (recombinant pBluescript into which cDNA clone K211 was inserted) was added to a PCR tube.
t) 100ng, primer 3 50pmol, primer 4 50pmol, 2.5mM dNTP 4μ
1, 0.5 μl of Pfu DNA polymerase (2.5 U / μl), 5 μl of 10 × PCR buffer, and the total volume was adjusted to 50 μl with sterile water to prepare a reaction solution. PCR
The reaction was repeated 30 times at 95 ° C for 1 minute, at 63 ° C for 2 minutes, and at 72 ° C for 2 minutes.

Both reaction solutions were electrophoresed on a 1.5% agarose gel, and the cD of about 400 bp encoding the light chain variable region was analyzed.
About 400 bp c encoding NA fragment and heavy chain variable region
The amplification of the DNA fragment was confirmed. Both cDNA fragments were purified and used for construction of a single-chain variable region (MLT2-23scFv) cDNA in which the heavy and light chain variable regions of MLT2-23 were linked.

First, a heavy chain variable region c was placed in a PCR tube.
50 ng of DNA, 50 ng of light chain variable region cDNA,
4 μl of 2.5 mM dNTP, 0.5 μl of pfu DNA polymerase (2.5 U / μl), 10 × PCR
5 μl of buffer was added, and the total volume was adjusted to 50 μl with sterile water. PCR at 95 ° C for 1 minute, 55 ° C for 2 minutes, 72 ° C for 2 minutes
The reaction was repeated 7 times. As described above, the cDNA encoding the heavy chain variable region was obtained by PCR using primers 1 and 2, and the cDNA encoding the light chain variable region was obtained by PCR using primers 3 and 4. Primers 2 and 3 contain a synthetic linker base sequence, a cDNA encoding a heavy chain variable region and a cDNA encoding a light chain variable region.
The base sequence of NA is complementary in the base sequence portion encoding the synthetic linker. Therefore, the two cDNAs are paired at the complementary nucleotide sequence to form a double strand. Therefore, first, PCR was performed without adding a primer, and the fragments of both cDNAs were ligated via a synthetic linker sequence.

Next, the ligated cDNA fragment (MLT
PCR was performed using primer 1 and primer 4 with a single-chain variable region (MLT2-23scFv) cDNA in which the heavy chain and light chain variable regions of 2-23 were linked as templates, and amplified. Specifically, 50 pmol of primer 1 and 50 pmol of primer 4 were added to the previous reaction solution.
4 μl of 2.5 mM dNTP, 0.5 μl of Pfu DNA polymerase (2.5 U / μl), 10 × PCR
5 μl of buffer was added and the total volume was made up to 100 μl with sterile water. PCR was repeated 30 times at 95 ° C for 1 minute, at 63 ° C for 2 minutes, and at 72 ° C for 2 minutes. 1.5% of this reaction solution
Perform electrophoresis on an agarose gel and obtain an ML of about 750 bp.
The amplification of the T2-23scFv cDNA fragment was confirmed and purified.

(5) MLT2-23scFv presentation fur
MLT2-23scFv cDNA obtained in the preparation (4) above,
Escherichia coli expression vector pCANTAB 5E (Pharmacia Biotech) was ligated to construct Escherichia coli expression plasmid pCANTAB 5E-MLT2-23scFv.

As described in FIG. 1, pCANTAB 5E contains a lac promoter, a gene3 signal sequence, an anti-E-tag antibody recognition sequence, a gene3 protein (g3p), an anti-E-tag antibody recognition sequence, and an M13 phage intergenic region ( IG), ampicillin resistance gene, C
olE1 has a replication origin and the like. Since it has a ColE1 origin of replication, it can replicate in E. coli.
Since it has a phage intergenic region (IG), it becomes a single-stranded DNA upon infection with a helper phage and can form a phage.

First, 5 μl of 10 mM ATP was added to T4
DNA ligase (400 U / μl) (New Eng
1 μl, 150 μl (purchased from Land Biolabs)
ng of MLT2-23scFv cDNA was added to an Eppendorf tube, and Recombinant Pha
Ge Antibody System (Amersh
am Purchased from Pharmacia Biotech)
10xOPA buffer and pCANT attached to
5 μl and 250 ng of AB 5E were added, respectively, and the total volume was adjusted to 50 μl with sterile water. This was incubated at 16 ° C. overnight, and the MLT2-23scFv cDNA was
The plasmid pCANTAB 5E-ML for expression of MLT2-23scFv for E. coli was ligated to NTAB 5E.
A T2-23 scFv was constructed (FIG. 1).

Next, the plasmid pCANTAB 5E-
E. coli was transformed using MLT2-23scFv. Recombinant Page Anti
E. coli TG1 cells attached to the body system
It was prepared in advance in a competent cell according to the attached instructions. Transfer the ligation reaction mixture to 10 Eppendorf tubes containing 50 μl of competent cells.
μl was dispensed into each tube, and pCANTAB 5E-MLT2-23scFv was introduced into Escherichia coli TG1 cells by electroporation according to the conditions of the attached instructions. Then, 16 ml of 2xYT-G medium (1.7
% (W / v) Bacto-trypton, 1% (w / v)
v) Bacto-yeast extract (each purchased from Difco), 0.5% (w / v) NaC
l, 2% (w / v) glucose (each purchased from Nacalai Tesque)), and cultured with shaking at 37 ° C for 1 hour.

Subsequently, rescue of the recombinant Escherichia coli was performed. 1.5 mg of ampicillin and 4
X10 ¹⁰ pfu of helper phage M13 KO7 (Pharmacia Biotech) was added, and the mixture was further cultured with shaking at 37 ° C. for 1 hour to prepare an MLT2-23scFv-displaying phage, which was released outside the cells. MLT2-23
The suspension containing the scFv-displaying phage was
After centrifugation for minutes, the supernatant was collected. Add polyethylene glycol and sodium chloride to the supernatant, and add
Centrifuge at 10000 g for 0 minutes, MLT2-23scF
v-display phage were precipitated. This precipitate is mixed with 16 ml of 2
xYT medium (1.7% (w / v) Bacto-tryp
ton, 1% (w / v) Bacto-yeast ex
After suspending in Tract, 0.5% (w / v) NaCl), PBS (10 mM sodium phosphate (purchased from Nacalai Tesque), 150 mM NaCl, pH 7.2)
5% w / w skim milk (purchased from Difco)
v) A dissolved blocking solution was prepared and 14 ml was added to the phage suspension.

(6) MLT2-23s by panning
Selection of cFv-displaying phage and reinfection into Escherichia coli The malathion hapten-5 / BSA conjugate prepared in Reference Example 5 was used as an antigen, diluted with PBS to 10 μg / ml, and 5 ml was added to a 25 cm ₂ cell culture flask (Sumitomo Bakelite). More purchased). This was incubated overnight at 4 ° C., and the bottom of the flask was solid-phased with this antigen. After the incubation, the inner solution was removed, and the inside of the flask was filled with a blocking solution. After leaving for 1 hour at room temperature,
The blocking solution was removed and used for panning (selection).

20 ml of the phage suspension was added to this flask and allowed to stand at 25 ° C. for 2 hours to allow the phage-displayed MLT2-23scFv to bind to the immobilized antigen. After removing the internal solution, the inside of the flask was
Washing was performed 0 times to remove phage that did not bind to the immobilized antigen. As a result, only the phage displaying MLT2-23scFv were selectively bound to the flask bottom.

Next, E. coli TG1 cells in the logarithmic growth phase were added to the flask, and the mixture was incubated at 37 ° C. for 1 hour to infect Escherichia coli with the phage that showed binding to the immobilized antigen. Then, 1 μl of this suspension was added to SOBAG
(2% (w / v) Bacto-trypton, 0.5
% (W / v) Bacto-yeast extrac
t, 0.05% (w / v) NaCl, 10 mM MgC
l ₂ , 100 μg / ml ampicillin, 2% (w / v)
Glucose) plates and incubated overnight at 30 ° C. 400 μl of 2 × YT-AG medium (100 μg / ml ampicillin, 2% (w / v) glucose added to 2 × YT medium) was added to a 96 tube plate (purchased from Coster). Forty-six colonies were randomly selected from a large number of colonies that appeared on the plate, and were inoculated into each tube of a 96-tube plate. This plate was cultured with shaking at 30 ° C. overnight to obtain a “master plate”.

In each tube of a new 96-tube plate, 400 μl of 2 × YT-AG medium and 2 × 10 ⁸ M1
3 KO7 helper phage was added and 40 μl from each tube on the master plate was transferred to a tube at the same position on this plate. The plate was shake-cultured at 37 ° C. for 2 hours, again producing MLT2-23scFv-displayed phage in the medium, and centrifuged at 1500 g for 20 minutes. After removing the supernatant, 400 μl of 2 × YT-AK was added to each tube.
Medium (100 μg / ml ampicillin in 2 × YT medium,
Medium supplemented with 50 μg / ml kanamycin).
The plate was shake-cultured at 37 ° C. overnight and centrifuged at 1500 g for 20 minutes. 322 μl of supernatant was collected from each tube. 320 μl of the ELISA was used for phage detection
In A, 2 μl was used to infect E. coli HB2151 cells.

(7) Phage detection ELISA 96-well microtiter plate (purchased from Nunc)
Then, 200 μl of 1 μg / ml malathion hapten-5 / BSA was dispensed into each well, and the plate was allowed to stand overnight at 4 ° C. to solidify the plate. After removing the internal solution, 300 μl of the blocking solution was dispensed to each well, and the plate was left standing at 4 ° C. overnight to perform blocking on the plate.

After removing the blocking solution, a mixed solution was prepared by adding 80 μl of the blocking solution to 320 μl of the phage suspension obtained in (6), and 200 μl was added to each well.
The mixture was dispensed in 1 l increments and incubated at 25 ° C. for 2 hours. P
After washing each well 6 times with BS, a peroxidase-labeled anti-M13 antibody (Amersham Pharmacia Biot) was used with a blocking solution diluted 5-fold with PBS.
(purchased from ech) was prepared by diluting 5000-fold, 200 μl was dispensed to each well, and incubated at 25 ° C. for 1 hour. After washing each well six times with PBS, a chromogenic substrate solution (100 mM acetate buffer (pH
5.5) 100 μg / ml TMBZ (purchased from Dojindo Laboratories) and 0.006% (w / v) H ₂ O ₂ (purchased from Nacalai Tesque) were added to each well.
Dispensed in μl. After incubation at room temperature for 10 minutes, the enzyme reaction was stopped by dispensing 50 μl of 4N sulfuric acid, and the absorbance at 450 nm was measured. As a result, the absorbance of 9 of the 46 wells showed a value of 0.3 or more. From the master plate, 9
Transfer the recombinant phage suspension in the tube to E. coli HB2151.
Used to infect cells.

(8) Preparation of soluble MLT2-23scFv
Ltd. in advance 2xYT medium with E. coli HB2151 cells 400μl that had been cultured until the logarithmic growth phase was added to the nine sterile tube. Of the phage suspension prepared in (6), 2 μl of the phage suspension in a tube corresponding to the well that showed a positive reaction in (7) was further added to the E. coli HB21.
The cells were added to each tube containing 51 cells, and cultured with shaking at 37 ° C. for 30 minutes to infect Escherichia coli.

This E. coli suspension was line-cultured on a SOBAG-N plate (a plate obtained by adding 100 μg / ml nalidixic acid to a SOBAG plate) and incubated at 30 ° C. overnight. A single colony that appeared on each plate was inoculated into 5 ml of 2 × YT-AG medium and cultured at 30 ° C. overnight with shaking. This suspension was centrifuged at 1500 g for 20 minutes, and after removing the supernatant, 50 ml of 2xYT-AI was removed.
The cells were suspended in a medium (a medium in which 100 μg / ml ampicillin and 1 mM IPTG were added to 2 × YT medium). After shaking culture at 28 ° C. for 6 hours, the mixture was centrifuged at 1500 g for 20 minutes, and the supernatant was removed.

The precipitated cells were chilled with 1 ml of ice-cooled 1 × TE
S buffer (0.2 M Tris-HCl (pH 8.
0), 0.5 mM EDTA, and 0.5 M sucrose (each purchased from Nacalai Tesque), and further, ice-cooled 1.5 ml of 0.2 × TES buffer (0.04 M Tris-HCl (pH 8.0), 0.
(1 mM EDTA, 0.1 M sucrose) and stirred well. The suspension was cooled on ice for 30 minutes,
Centrifuged at 000 g for 10 minutes. The resulting nine supernatants were used as soluble MLT2-23scFv.

(9) Malathion Indirect Competition ELISA In a 96-well microtiter plate, 100 μl of 1 μg / ml malathion hapten-5 / BSA was dispensed into each well, and left at 4 ° C. overnight. After removing the internal solution, 300 μl of the blocking solution was dispensed to each well and left at 4 ° C. overnight. After removing the internal solution, PBS
Malathion standard solution diluted step by step in 5 wells
0 μl was dispensed, and the 9 soluble scFvs obtained in (8) were
Was dispensed into each well in an amount of 50 μl. After incubating for 1 hour at 25 ° C., wash each well three times with PBS,
1 μg / ml with blocking solution diluted 5 times with PBS
Mouse anti-E tag antibody (Amersham P)
100 μl of the solution (purchased from B. harcia Biotech) was dispensed into each well and incubated at 25 ° C. for 1 hour. Wash each well three times with PBS, add PBS
Peroxidase-labeled goat anti-mouse antibody (Pierce) diluted 1000-fold with a blocking solution diluted 5-fold with
100 μl of the solution was dispensed into each well,
Incubated for 1 hour at 5 ° C. After washing each well three times with PBS, 100 μl of the chromogenic substrate solution was added to each well.
Was dispensed. After incubating at room temperature for 10 minutes,
The enzyme reaction was stopped by dispensing 100 μl each of 1N sulfuric acid,
The absorbance at 450 nm was measured. Nine soluble MLT2
Eight of the -23 scFvs inhibited the binding to the immobilized antigen in a concentration-dependent manner due to the presence of malathion in the reaction solution (FIG. 2).

Of the eight MLT2-23 scFvs, MLT2-23scFv34 showed the highest affinity for malathion (that is, the binding to immobilized antigen was inhibited by the presence of lower concentrations of malathion). ).
The nucleotide sequence of MLT2-23scFv34 was determined, and the nucleotide sequence is shown in FIG. As shown therein, amino acid residues 1-115 of MLT2-23scFv34 correspond to the anti-malathion monoclonal antibody ML
G208 heavy chain variable region of T2-23, amino acid residue 11
6-130 is a synthetic peptide linker region (GGGGS)
_3. Amino acid residues 131-243 were found to be the K211 light chain variable region of anti-malathion monoclonal antibody MLT2-23.

[0279]

According to the present invention, a gene encoding a heavy chain and a light chain of an anti-malathion monoclonal antibody is provided, and the gene provided by the present invention, the amino acid sequence and the base sequence of which are clarified, particularly the heavy chain and the light chain. By expressing the variable region of the light chain in a host cell using the same, it became possible to obtain a large amount of a protein capable of binding to malathion. Recombinant proteins can be produced with high efficiency without using animals.
This is less expensive than maintaining monoclonal antibodies obtained by culturing in a medium that requires serum,
Application to enzyme immunoassays such as ISA is possible.

In particular, a recombinant protein produced using the gene obtained in the present invention has the following advantages. (1) A monoclonal antibody obtained by purification from a hybridoma is composed of two pairs of heavy and light chains including a variable region and a constant region, and has a molecular weight of about 150 kDa.
On the other hand, the recombinant protein can be bound to about 25 kDa by binding only the variable region in tandem if desired.
Can be expressed as a low molecular weight polypeptide. (2) The molecular modeling of the antigen binding site is possible (3) The reaction characteristics of the antibody can be easily improved (4) The fusion protein can be easily produced. In particular, by modification, by fusing with an antibody or a thermostable enzyme having better binding ability, it is possible to overcome sensitivity, specificity, organic solvent resistance, etc., which are common problems in performing enzyme immunoassays possessed by antibodies. Is also possible.

(5) By introducing the gene of the present invention into animals and plants, animals and plants resistant to the insecticide malathion can be produced.

[0282]

[Sequence List] SEQUENCE LISTING <110> Institute for Environmental Immunology <120> Gene encoding anti-malathion monoclonal antibody <130> 000428 <160> 19 <170> JIS <210> 1 <211> 345 <212> DNA < 400> 1 CTT CAG GAG TCA GGA CCT AGC CTC GTG AAA CCT TCT CAG ACT CTG 45 Leu Gln Glu Ser Gly Pro Ser Leu Val Lys Pro Ser Gln Thr Leu 1 5 10 15 TCC CTC ACC TGT TCT GTC ACT GGC GAC TCC ATC ACC AGT GGT TAC 90 Ser Leu Thr Cys Ser Val Thr Gly Asp Ser Ile Thr Ser Gly Tyr 20 25 30 TGG AAC TGG ATC CGG AAA TTC CCA GGG AAT AAA CTT GAG TAT ATG 135 Trp Asn Trp Ile Arg Lys Phe Pro Gly Asn Lys Leu Glu Tyr Met 35 40 45 GGG TAC ATA AGC TAC AGT GGT AGC ACT TAC TAC AAT CCA TCT CTC 180 Gly Tyr Ile Ser Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu 50 55 60 AAA AAT CGG ATC TCC ATC ACT CGA GAC ACA TCC AGG AAC CAG TTC 225 Lys Asn Arg Ile Ser Ile Thr Arg Asp Thr Ser Arg Asn Gln Phe 65 70 75 TCC CTG CAC CTG AAT TCT GTG ATT ACT GAG GAC ACA GCC ACA TAT 270 Ser Leu His Leu Asn Ser Val Ile Thr Glu Asp Thr Ala Thr Ty r 80 85 90 TAC TGT GCA GGA TCC ACT ATG ATT ACG ACG AGG GCC GGT CAC TGG 315 Tyr Cys Ala Gly Ser Thr Met Ile Thr Thr Arg Ala Gly His Trp 95 100 105 GGC CAA GGG ACT CTG GTC ACT GTC TCT GCA 345 Gly Gln Gly Thr Leu Val Thr Val Ser Ala 110 115 <210> 2 <211> 115 <212> PRT <400> 2 Leu Gln Glu Ser Gly Pro Ser Leu Val Lys Pro Ser Gln Thr Leu 1 5 10 15 Ser Leu Thr Cys Ser Val Thr Gly Asp Ser Ile Thr Ser Gly Tyr 20 25 30 Trp Asn Trp Ile Arg Lys Phe Pro Gly Asn Lys Leu Glu Tyr Met 35 40 45 Gly Tyr Ile Ser Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu 50 55 60 Lys Asn Arg Ile Ser Ile Thr Arg Asp Thr Ser Arg Asn Gln Phe 65 70 75 Ser Leu His Leu Asn Ser Val Ile Thr Glu Asp Thr Ala Thr Tyr 80 85 90 Tyr Cys Ala Gly Ser Thr Met Ile Thr Arg Ala Gly His Trp 95 100 105 Gly Gln Gly Thr Leu Val Thr Val Ser Ala 110 115 <210> 3 <211> 339 <212> DNA <400> 3 GAT ATT GTG ATG ACC 15 Asp Ile Val Met Thr 15 CAA ACT CCA CTC TCC CTG CCT GTC AGT CTT GGA GAT CAA GCC TCC 60 Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly As p Gln Ala Ser 10 15 20 ATC TCT TGC AGA TCT AGT CAG AGC CTT GTA CAC AGT AAT GGA AAC 105 Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His Ser Asn Gly Asn 25 30 35 ACC TAT TTA CAT TGG TAC CTG CAG AAG CCA GGC CAG TCT CCA AAG 150 Thr Tyr Leu His Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Lys 40 45 50 CTC CTG ATC TAC AAA GTT TCC AAC CGA TTT TCT GGG GTC CCA GAC 195 Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp 55 60 65 AGG TTC AGT GGC AGT GGA TCA GGG ACA GAT TTC ACA CTC AAG ATC 240 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile 70 75 80 AGC AGA GTA GAG GCT GAG GAT CTG GGA CTT TAT TTC TGC TCT CAA 285 Ser Arg Val Glu Ala Glu Asp Leu Gly Leu Tyr Phe Cys Ser Gln 85 90 95 GCT ACA CAT GTT CCT TTC ACG TTC GGA GGG GGG ACC ACG CTG GAA 330 Ala Thr His Val Pro Phe Thr Phe Gly Gly Gly Thr Thr Leu Glu 100 105 110 ATA AAA CGG 339 Ile Lys Arg 113 <210> 4 <211> 113 <212> PRT <400> 4 Asp Ile Val Met Thr 1 5 Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly Asp Gln Ala Ser 10 15 20 Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His Ser Asn Gly Asn 25 30 35 Thr Tyr Leu His Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Lys 40 45 50 Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp 55 60 65 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile 70 75 80 Ser Arg Val Glu Ala Glu Asp Leu Gly Leu Tyr Phe Cys Ser Gln 85 90 95 Ala Thr His Val Pro Phe Thr Phe Gly Gly Gly Thr Thr Leu Glu 100 105 110 Ile Lys Arg 113 <210> 5 <211> 997 <212> DNA <400> 5 gccaaaacga cacccccatc tgtctatcca ctggcccctg gatctgctgc ccaaactaac 60 tccatggtga ccctgggatg cctggtcaag ggctatttcc ctgagccagt gacagtgacc 120 tggaactctg gatccctgtc cagcggtgtg cacaccttcc cagctgtcct gcagtctgac 180 ctctacactc tgagcagctc agtgactgtc ccctccagca cctggcccag cgagaccgtc 240 acctgcaacg ttgcccaccc ggccagcagc accaaggtgg acaagaaaat tgtgcccagg 300 gattgtggtt gtaagccttg catatgtaca gtcccagaag tatcatctgt cttcatctgc caccctcagtc gccaccattcagtcgt gccccattaggtc gccccattcagtcagtcgtcgtcg atgtggag 480 gtgcacacag ctcagacgca accccgggag gagcagttca acagcacttt ccgctcagtc 540 agtgaacttc ccatcatgca ccaggactgg ctcaatggca aggagttcaa atgcagggtc 600 aacagtgcag ctttccctgc ccccatcgag aaaaccatct ccaaaaccaa aggcagaccg 660 aaggctccac aggtgtacac cattccacct cccaaggagc agatggccaa ggataaagtc 720 agtctgacct gcatgataac agacttcttc cctgaagaca ttactgtgga gtggcagtgg 780 aatgggcagc cagcggagaa ctacaagaac actcagccca tcatggacac agatggctct 840 tacttcgtct acagcaagct caatgtgcag aagagcaact gggaggcagg aaatactttc 900 acctgctctg tgttacatga gggcctgcac aaccaccata ctgagaagag cctctcccac 960 tctcctggta aatgatccca gtgtccttgg agccctc 997 <210> 6 <211> 318 <212> DNA <400> 6 gctgatgctg caccaactgt atccatcttc ccaccatcca gtgagcagtt aacatctgga 60 ggtgcctcag tcgtgtgctt cttgaacaac ttctacccca aagacatcaa tgtcaagtgg 120 aagattgatg gcagtgaacg acaaaatggc gtcctgaaca gttggactga tcaggacagc 180 aaagacagca cctacagcat gagcagcacc ctcacgttga ccaaggacga gtatgaacga 240 cataacagct atacctgtga ggccactcac aagacatcaa cttcacccat tgtcaagagc 3 00 ttcaacagga atgagtgt 318 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PCR Primer <400> 7 tgctgcacca actgtatcca tc 22 <210> 8 <211> 23 <212> DNA < 213> Artificial Sequence <220> <223> PCR Primer <400> 8 ctgttgaagc tcttgacaat ggg 23 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PCR Primer <400> 9 ctgctgccca aactaactcc at 22 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PCR Primer <400> 10 ctcttctcag tatggtggtt gtgc 24 <210> 11 <211> 1570 <212> DNA <400 > 11 ggcacgaggg atttttgaag aaaggggttg tagcctaaaa gatgatggtg ttaagtcttc 60 tgtacctgtt gacagccctt ccgggtatcc tgtcagaggt gcagcttcag gagtcaggac 120 ctagcctcgt gaaaccttct cagactctgt ccctcacctg ttctgtcact ggcgactcca 180 tcaccagtgg ttactggaac tggatccgga aattcccagg gaataaactt gagtatatgg 240 ggtacataag ctacagtggt agcacttact acaatccatc tctcaaaaat cggatctcca 300 tcactcgaga cacatccagg aaccagttct ccctgcacct gaattctgtg attactgagg 360 acacagccac atattactgt gcaggatcca ctatgattac gacgagggcc ggtcact ggg 420 gccaagggac tctggtcact gtctctgcag ccaaaacaac agccccatcg gtctatccac 480 tggcccctgt gtgtggagat acaactggct cctcggtgac tctaggatgc ctggtcaagg 540 gttatttccc tgagccagtg accttgacct ggaactctgg atccctgtcc agtggtgtgc 600 acaccttccc agctgtcctg cagtctgacc tctacaccct cagcagctca gtgactgtaa 660 cctcgagcac ctggcccagc cagtccatca cctgcaatgt ggcccacccg gcaagcagca 720 ccaaggtgga caagaaaatt gagcccagag ggcccacaat caagccctgt cctccatgca 780 aatgcccagc acctaacctc ttgggtggac catccgtctt catcttccct ccaaagatca 840 aggatgtact catgatctcc ctgagcccca tagtcacatg tgtggtggtg gatgtgagcg 900 aggatgaccc agatgtccag atcagctggt ttgtgaacaa cgtggaagta cacacagctc 960 agacacaaac ccatagagag gattacaaca gtactctccg ggtggtcagt gccctcccca 1020 tccagcacca ggactggatg agtggcaagg agttcaaatg caaggtcaac aacaaagacc 1080 tcccagcgcc catcgagaga accatctcaa aacccaaagg gtcagtaaga gctccacagg 1140 tatatgtctt gcctccacca gaagaagaga tgactaagaa acaggtcact ctgacctgca 1200 tggtcacaga cttcatgcct gaagacattt acgtggagtg gaccaacaac gggaaaacag 1260 agctaaa cta caagaacact gaaccagtcc tggactctga tggttcttac ttcatgtaca 1320 gcaagctgag agtggaaaag aagaactggg tggaaagaaa tagctactcc tgttcagtgg 1380 tccacgaggg tctgcacaat caccacacga ctaagagctt ctcccggact ccgggtaaat 1440 gagctcagca cccacaaaac tctcaggtcc aaagagacac ccacactcat ctccatgctt 1500 cccttgtata aataaagcac ccagcaatgc ctgggaccat gtaaaaaaaa aaaaaaaaaa 1560 aaaaaaaaaa 1570 <210> 12 <211> 466 <212> PRT < 400> 12 Met Met Val Leu Ser Leu Leu Tyr Leu Leu Thr Ala Leu Pro Gly 1 5 10 15 Ile Leu Ser Glu Val Gln Leu Gln Glu Ser Gly Pro Ser Leu Val 20 25 30 Lys Pro Ser Gln Thr Leu Ser Leu Thr Cys Ser Val Thr Gly Asp 35 40 45 Ser Ile Thr Ser Gly Tyr Trp Asn Trp Ile Arg Lys Phe Pro Gly 50 55 60 Asn Lys Leu Glu Tyr Met Gly Tyr Ile Ser Tyr Ser Gly Ser Thr 65 70 75 Tyr Tyr Asn Pro Ser Leu Lys Asn Arg Ile Ser Ile Thr Arg Asp 80 85 90 Thr Ser Arg Asn Gln Phe Ser Leu His Leu Asn Ser Val Ile Thr 95 100 105 Glu Asp Thr Ala Thr Tyr Tyr Cys Ala Gly Ser Thr Met Ile Thr 110 115 120 Thr Arg Ala Gly His Trp Gly Gln Gly Thr Leu Val Thr Val Ser 125 130 135 Ala Ala Lys Thr Thr Ala Pro Ser Val Tyr Pro Leu Ala Pro Val 140 145 150 Cys Gly Asp Thr Thr Gly Ser Ser Val Thr Leu Gly Cys Leu Val 155 160 165 Lys Gly Tyr Phe Pro Glu Pro Val Thr Leu Thr Trp Asn Ser Gly 170 175 180 Ser Leu Ser Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser 185 190 195 Asp Leu Tyr Thr Leu Ser Ser Ser Val Thr Val Thr Ser Ser Thr 200 205 210 Trp Pro Ser Gln Ser Ile Thr Cys Asn Val Ala His Pro Ala Ser 215 220 225 Ser Thr Lys Val Asp Lys Lys Ile Glu Pro Arg Gly Pro Thr Ile 230 235 240 Lys Pro Cys Pro Pro Cys Lys Cys Pro Ala Pro Asn Leu Leu Gly 245 250 255 Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Ile Lys Asp Val Leu 260 265 270 Met Ile Ser Leu Ser Pro Ile Val Thr Cys Val Val Val Asp Val 275 280 285 Ser Glu Asp Asp Pro Asp Val Gln Ile Ser Trp Phe Val Asn Asn 290 295 300 Val Glu Val His Thr Ala Gln Thr Gln Thr His Arg Glu Asp Tyr 305 310 315 Asn Ser Thr Leu Arg Val Val Ser Ala Leu Pro Ile Gln His Gln 320 325 330 Asp Trp Met Ser Gly Lys Glu PheLys Cys Lys Val Asn Asn Lys 335 340 345 Asp Leu Pro Ala Pro Ile Glu Arg Thr Ile Ser Lys Pro Lys Gly 350 355 360 Ser Val Arg Ala Pro Gln Val Tyr Val Leu Pro Pro Pro Glu Glu 365 370 375 Glu Met Thr Lys Lys Gln Val Thr Leu Thr Cys Met Val Thr Asp 380 385 390 Phe Met Pro Glu Asp Ile Tyr Val Glu Trp Thr Asn Asn Gly Lys 395 400 405 Thr Glu Leu Asn Tyr Lys Asn Thr Glu Pro Val Leu Asp Ser Asp 410 415 420 Gly Ser Tyr Phe Met Tyr Ser Lys Leu Arg Val Glu Lys Lys Asn 425 430 435 Trp Val Glu Arg Asn Ser Tyr Ser Cys Ser Val Val His Glu Gly 440 445 450 Leu His Asn His His Thr Thr Lys Ser Phe Ser Arg Thr Pro Gly 455 460 465 Lys 466 <210> 13 <211> 986 <212> DNA <400> 13 ggcacgaggg tctcctcagg ttgcctcctc aaaatgaagt tgcctgttag gctgttggtg 60 ctgatgttct ggattcctgt ttccagcagt gatattgtga tgacccaaac tccactctcc 120 ctgcctgtca gtcttggaga tcaagcctcc atctcttgca gatctagtca gagccttgta 180 cacagtaatg gaaacaccta tttacattgg tacctgcaga agccaggcca gtctccaaag 240 ctcctgatct acaaagtttc caaccgattt tctggggtcc cagacaggtt cagt ggcagt 300 ggatcaggga cagatttcac actcaagatc agcagagtag aggctgagga tctgggactt 360 tatttctgct ctcaagctac acatgttcct ttcacgttcg gaggggggac cacgctggaa 420 ataaaacggg ctgatgctgc accaactgta tccatcttcc caccatccag tgagcagtta 480 acatctggag gtgcctcagt cgtgtgcttc ttgaacaact tctaccccaa agacatcaat 540 gtcaagtgga agattgatgg cagtgaacga caaaatggcg tcctgaacag ttggactgat 600 caggacagca aagacagcac ctacagcatg agcagcaccc tcacgttgac caaggacgag 660 tatgaacgac ataacagcta tacctgtgag gccactcaca agacatcaac ttcacccatt 720 gtcaagagct tcaacaggaa tgagtgttag agacaaaggt cctgagacgc caccaccagc 780 tccccagctc catcctatct tcccttctaa ggtcttggag gcttccccac aagcgaccta 840 ccactgttgc ggtgctccaa acctcctccc cacctccttc tcctcctcct ccctttcctt 900 ggcttttatc atgctaatat ttgcagaaaa tattcaataa agtgagtctt tgcacttgaa 960 aaaaaaaaaa aaaaaaaaaa aaaaaa 986 <210> 14 <211> 238 <212> PRT <400> 14 Met Lys Leu Pro Val Arg Leu Leu Val Leu Met Phe Trp Ile Pro 1 5 10 15 Val Ser Ser Ser Asp Ile Val Met Thr Gln Thr Pro Leu Ser Leu 20 25 30 Pro Val S er Leu Gly Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser 35 40 45 Gln Ser Leu Val His Ser Asn Gly Asn Thr Tyr Leu His Trp Tyr 50 55 60 Leu Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr Lys Val 65 70 75 Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly 80 85 90 Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala Glu 95 100 105 Asp Leu Gly Leu Tyr Phe Cys Ser Gln Ala Thr His Val Pro Phe 110 115 120 Thr Phe Gly Gly Gly Thr Thr Leu Glu Ile Lys Arg Ala Asp Ala 125 130 135 Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln Leu Thr 140 145 150 Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr Pro 155 160 165 Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln 170 175 180 Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser 185 190 195 Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr 200 205 210 Glu Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser 215 220 225 Thr Ser Pro Ile Val Lys Ser Phe Asn Arg Asn Glu Cys 230 235 238 <210 > 15 <211> 38 <212 > DNA <213> Artificial Sequence <220> <223> PCR Primer <400> 15 ttggcccagc cggcccttca ggagtcagga cctagcct 38 <210> 16 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> PCR Primer < 400> 16 agagccacct ccgcctgaac cgcctccacc tgcagagaca gtgaccagag ttc 53 <210> 17 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> PCR Primer <400> 17 ggcggaggtg gctctggcgg tggcggatcg gatattgtga tcc <211> 31 <212> DNA <213> Artificial Sequence <220> <223> PCR Primer <400> 18 ttgcggccgc ccgttttatt tccagcgtgg t 31 <210> 19 <211> 729 <212> DNA <400> 19 CTT CAG GAG TCA GGA CCT AGC CTC GTG AAA CCT TCT CAG ACT CTG 45 Leu Gln Glu Ser Gly Pro Ser Leu Val Lys Pro Ser Gln Thr Leu 1 5 10 15 TCC CTC ACC TGT TCT GTC ACT GGC GAC TCC ATC ACC AGT GGT TAC 90 Ser Leu Thr Cys Ser Val Thr Gly Asp Ser Ile Thr Ser Gly Tyr 20 25 30 TGG AAC TGG ATC CGG AAA TTC CCA GGG AAT AAA CTT GAG TAT ATG 135 Trp Asn Trp Ile Arg Lys Phe Pro Gly Asn Lys Leu Glu Tyr Met 35 40 45 GGG TAC ATA AGC TAC AGT GGT AGC A CT TAC TAC AAT CCA TCT CTC 180 Gly Tyr Ile Ser Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu 50 55 60 AAA AAT CGG ATC TCC ATC ACT CGA GAC ACA TCC AGG AAC CAG TTC 225 Lys Asn Arg Ile Ser Ile Thr Arg Asp Thr Ser Arg Asn Gln Phe 65 70 75 TCC CTG CAC CTG AAT TCT GTG ATT ACT GAG GAC ACA GCC ACA TAT 270 Ser Leu His Leu Asn Ser Val Ile Thr Glu Asp Thr Ala Thr Tyr 80 85 90 TAC TGT GCA GGA TCC ACT ATG ATT ACG ACG AGG GCC GGT CAC TGG 315 Tyr Cys Ala Gly Ser Thr Met Ile Thr Thr Arg Ala Gly His Trp 95 100 105 GGC CAA GGG ACT CTG GTC ACT GTC TCT GCA GGT GGA GGC GGT TCA 360 Gly Gln Gly Thr Leu Val Thr Val Ser Ala Gly Gly Gly Gly Ser 110 115 120 GGC GGA GGT GGC TCT GGC GGT GGC GGA TCG GAT ATT GTG ATG ACC 405 Gly Gly Gly Gly Ser Gly Gly Gly Gly Gly Ser Asp Ile Val Met Thr 125 130 135 CAA ACT CCA CTC TCC CTG CCT GTC AGT CTT GGA GAT CAA GCC TCC 450 Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly Asp Gln Ala Ser 140 145 150 ATC TCT TGC AGA TCT AGT CAG AGC CTT GTA CAC AGT AAT GGA AAC 495 Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His Ser Asn Gly Asn 155 160 165 ACC TAT TTA CAT TGG TAC CTG CAG AAG CCA GGC CAG TCT CCA AAG 540 Thr Tyr Leu His Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Lys 170 175 180 CTC CTG ATC TAC AAA GTT TCC AAC CGA TTT TCT GGG GTC CCA GAC 585 Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp 185 190 195 AGG TTC AGT GGC AGT GGA TCA GGG ACA GAT TTC ACA CTC AAG ATC 630 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile 200 205 210 AGC AGA GTA GAG GCT GAG GAT CTG GGA CTT TAT TTC TGC TCT CAA 675 Ser Arg Val Glu Ala Glu Asp Leu Gly Leu Tyr Phe Cys Ser Gln 215 220 225 GCT ACA CAT GTT CCT TTC ACG TTC GGA GGG GGG ACC ACG CTG GAA 720 Ala Thr His Val Pro Phe Thr Phe Gly Gly Gly Thr Thr Leu Glu 230 235 240 ATA AAA CGG 729 Ile Lys Arg 243

[Brief description of the drawings]

FIG. 1 shows an expression plasmid for E. coli, pCANTA.
3 shows the structure of B5E-MLT2-23scFv.

FIG. 2 shows a malathion standard curve by indirect competitive ELISA.

FIG. 3 shows an anti-malathion antibody fragment MLT2-23.
1 shows the cDNA base sequence of scFv34 and the deduced amino acid sequence.

FIG. 4 shows monoclonal antibodies MLT2-23, MLT40-4 and MLT by direct competitive inhibition ELISA.
4 shows the reactivity of LT45-3 to malathion.

FIG. 5 shows heterologous direct competitive inhibition ELISA.
Monoclonal antibodies MLT2-23 and ML by method A
Fig. 4 shows the reactivity of T40-4 with malathion.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12N 5/10 C12P 21/08 C12P 21/02 (C12N 1/21 21/08 C12R 1:19) // (C12N 1/21 (C12P 21/02 C C12R 1:19) C12R 1:19) (C12P 21/02 C12N 15/00 ZNAA C12R 1:19) 5/00 A F term (reference) 4B024 AA11 BA53 CA04 DA06 GA11 HA01 4B064 AG01 AG27 CA02 CA19 CC24 DA13 4B065 AA26X AA92Y AA99Y AB01 BA02 CA25 CA46 4H045 AA11 BA10 CA40 DA76 EA50 FA74

Claims (13)

[Claims] 1. A gene encoding a heavy chain variable region of an anti-malathion monoclonal antibody, wherein the heavy chain variable region of the anti-malathion monoclonal antibody has the following i) and ii): i) the amino acid residue of SEQ ID NO: 2 An amino acid sequence selected from the group consisting of: an amino acid sequence having groups 1-115; ii) an amino acid sequence in which one or more amino acid residues have been deleted, substituted or added in the amino acid sequence of i) above; And the gene capable of forming an antigen-binding site and interacting with malathion. 2. The gene according to claim 1, wherein the heavy chain variable region of the anti-malathion monoclonal antibody has the following amino acid sequence of i): i) an amino acid sequence having amino acid residues 1-115 of SEQ ID NO: 2. . 3. The gene according to claim 1, which has the nucleotide sequence of SEQ ID NO: 1 to 345. 4. A gene encoding a light chain variable region of an anti-malathion monoclonal antibody, wherein the light chain variable region of the anti-malathion monoclonal antibody has the following i) -i
i): i) an amino acid sequence having amino acid residues 1-113 of SEQ ID NO: 4; ii) an amino acid sequence in which one or more amino acid residues are deleted, substituted or added in the amino acid sequence of the above i). The above gene, which has an amino acid sequence selected from the group and is capable of forming an antigen-binding site and interacting with malathion. 5. The gene according to claim 4, wherein the light chain variable region of the anti-malathion monoclonal antibody has the following i): i) an amino acid sequence having amino acid residues 1-113 of SEQ ID NO: 4. . 6. The gene according to claim 4, which has the nucleotide sequence 1-339 of SEQ ID NO: 3. A vector comprising the gene according to any one of claims 1 to 6. 8. The vector according to claim 7, which is a plasmid. 9. The vector according to claim 6, which is capable of self-propagation in a host cell. [10] A host cell transformed with the vector according to any one of [7] to [9]. 11. A method for producing a recombinant protein comprising a heavy chain and / or a light chain variable region of an anti-malathion monoclonal antibody, which is transformed with the vector according to any one of claims 7 to 9. The isolated host cells are cultured under conditions that promote expression of the heavy and / or light chain variable regions of the anti-malathion monoclonal antibody, and the heavy and / or light chains of the anti-malathion monoclonal antibody are isolated from the culture. Recovering a recombinant protein comprising the variable region of 12. Produced by the method of claim 11,
A recombinant protein comprising the heavy and / or light chain variable regions of an anti-malathion monoclonal antibody. 13. The recombinant protein according to claim 12, wherein the variable region of the heavy chain and the variable region of the light chain of the anti-malathion monoclonal antibody are linked by a linker.