JP2000152792A - New g protein conjugation-type receptor protein, dna and its use - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new G protein conjugation-type receptor protein which consists of a G protein conjugation-type receptor protein that contains a specific amino acid sequence and has lysophosphatidic acid as a ligand and is useful in the development or the like of medicines utilized for diagnosis, treatment and prevention for diseases in prostata. SOLUTION: This protein is a new G protein conjugation-type receptor protein comprising the amino acid sequence represented by the formula or a new G protein conjugation-type receptor protein which comprises the amino acid sequence in which one or plural amino acids are deleted, substituted or added to the formula and has lysophosphatidic acid as a ligand and is useful in the development of medicines capable of being utilized for diagnosis, treatment and prevention for diseases in prostata or the screening out of antagonists or agonists for this G protein conjugation-type receptor protein. This protein is obtained by cloning a cDNA library arising from human tissues and cells by means of using a partial DNA as a probe, integrating the resultant gene into a veotor to introduce into the host cell and transform it and cultivating this transformant.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[Industrial applications]

[0001] The present invention relates to a novel G protein-coupled receptor protein and its DNA. Further, a method for screening for an agonist or antagonist of the G protein-coupled receptor protein, an agonist or antagonist obtained by the screening, an antibody against the G protein-coupled receptor protein and its use, and the G protein-coupled receptor protein DNA
The present invention relates to a method of using fragments as probes and primers.

[0002]

2. Description of the Related Art Many hormones and neurotransmitters regulate the functions of living organisms through specific receptor proteins present on cell membranes. Of these receptors, those having a structure of seven transmembrane domains are involved in signal transduction in cells through activation of G-coupled proteins.
It is collectively called protein-coupled receptor protein. G protein-coupled receptor proteins are present on the surface of various functional cells in living cells and organs, and play an important role as targets for hormones, neurotransmitters and biologically active substances that regulate the functions of these living cells and organs. Is responsible for.

[0003] When stimulation is applied to the cell membrane, phospholipases are activated, the constituent lipids of the cell membrane and the like are degraded, and physiological activities such as arachidonic acid derivatives, platelet activating factor, lysophosphatidic acid, sphingosine-1-phosphate, anandamide and the like. Lipid mediators such as lipids are produced. Lysophosphatidic acid, one of the lipid mediators,
Having a fatty acid at the first or second position of the glycerol skeleton;
It has a structure in which a phosphate group is bonded at the position. Lysophosphatidic acid has a fatty acid at position 1 of the glycerol skeleton.
-Acyl lysophosphatidic acid, 1-alkyl lysophosphatidic acid, 1-alkenyl lysophosphatidic acid, 2-acyl lysophosphatidic acid having a fatty acid at the 2-position, and the like. And there is diversity depending on the type of fatty acid. Lysophosphatidic acid is also sphingosine-1
-Together with phosphoric acid, it is collectively called lysophospholipid. The lysophospholipid binds to a G protein-coupled receptor present on the surface of each functional cell in living cells and organs, and performs intracellular signal transduction, cell differentiation / proliferation, blood pressure regulation, inflammatory immune response, nervous system It is thought to regulate a variety of biological functions including the regulation of functions.

[0004] In recent years, clarifying the relationship between G protein-coupled receptors and their binding ligands has become a very important means for drug development. For this reason, a method of cloning a novel G protein-coupled receptor gene has been performed by utilizing the fact that the G protein-coupled receptor protein shows similarity in amino acid sequence to a part of its structure. Attempts have been made to develop pharmaceuticals by elucidating the ligand for the receptor and elucidating the function of the receptor. G protein-coupled receptors such as Edg-1, Edg-2, Edg-3, Edg-4 and AGR16 have been known as receptors using lysophospholipid as a ligand (Cell Engineering Vol. 1).
7, No. 5 (1998)). These receptors use lysophosphatidic acid or sphingosine-1-phosphate as a ligand. Nature 365, 557-560 (1993), Nature 381 800-
803 (1996) reports that some receptors may use both lysophosphatidic acid and sphingosine-1-phosphate as ligands. However, the relationship between these receptors and lysophospholipids and the functions of the receptors have not yet been fully elucidated.

[0005]

An object of the present invention is to provide a G protein-coupled receptor using lysophosphatidic acid as a ligand, and a novel G protein belonging to a different group from these known G protein-coupled receptors. An object of the present invention is to provide a conjugated receptor and a DNA encoding the receptor protein.
The present invention also provides a method for screening for an agonist that binds to the G protein-coupled receptor, a method for screening for an antagonist of the G protein-coupled receptor, and an agonist or antagonist obtained by the screening.
Further, the present invention provides an antibody useful for detecting the G protein-coupled receptor or regulating the activity of the G protein-coupled receptor. Another object of the present invention is to provide a DNA fragment useful for cloning a G protein-coupled receptor using lysophosphatidic acid as a ligand.

[0006]

Means for Solving the Problems The present inventors focused on the DNA sequence in the known transmembrane region of the lysophospholipid receptor, designed primers, and encoded a human-derived G protein-coupled receptor protein. The cDNA fragment to be isolated was isolated and its nucleotide sequence was determined. Based on the nucleotide sequence of the obtained fragment, a primer was further prepared, and cDNA encoding a human G protein-coupled receptor protein was isolated. CDNA encoding the G protein-coupled receptor protein is
It has seven transmembrane regions characteristic of a G protein-coupled receptor protein, and has homology with the amino acid sequence and DNA sequence of known lysophosphatidic acid receptor and sphingosine-1-phosphate receptor. It was found to be a DNA encoding a human G protein-coupled receptor protein. However, the expression tissue is different from the known G protein-coupled receptor using lysophosphatidic acid as a ligand,
Furthermore, when an evolutionary phylogenetic tree based on the amino acid sequence was prepared, it was found that the gene belongs to a group different from the known G protein-coupled receptor using lysophosphatidic acid as a ligand. From this, it is considered that the protein-coupled receptor protein has a different function in vivo from the known one. As a result of searching for a ligand for DNA encoding the G protein-coupled receptor protein, 1-oleoyl lysophosphatidic acid, one of lysophosphatidic acids, was found to have an agonist activity. Identification of ligands and expressing cells is important information for functional analysis of the receptor and drug development. Based on these findings, the present inventors used a receptor protein in which DNA encoding the human G protein-coupled receptor protein was expressed by an appropriate means, and used any one of the following (1) to (3). It has been found that by using the method, agonists and antagonists of the human G protein-coupled receptor protein can be easily screened from in vivo or natural and unnatural compounds. (1) Binding test between receptor and test substance. (2) A method for detecting intracellular signals (second messengers such as intracellular calcium ion release and intracellular cAMP generation) expressed by binding of a test substance to a receptor. (3) A method of detecting the generation of a second messenger as an appropriate index.

More specifically, a reporter plasmid having a luciferase inserted downstream of a zif268 promoter and a receptor expression vector having a DNA encoding the human G protein-coupled receptor protein inserted downstream of an EF-1α promoter. PC12h cells were co-introduced, a test compound was added, and luciferase activity was measured. It was found that 1-oleoyl lysophosphatidic acid acts as a ligand. In addition, when the expression distribution of the human G protein-coupled receptor protein was examined, the most abundant signal was found in the prostate and trachea, and weak signals were also found in the heart, testis, ovary and pancreas. In the prostate, it is expressed in main secretory cells,
No expression in feeder cells was seen. Furthermore, when 1-oleoyl lysophosphatidic acid was added to the medium of prostate secretory cells, IL-6, endothelin-1 (ET-
1) It was found that the concentration increased. IL-6 and ET-
1 is also known as a growth factor for prostate feeder cells (J. Urol. 151 (5): 1396-1399 (1994), Eur J Pharmacol
349 (1): 123-8 (1998), Prostate 34 (4): 241-250). From the above, it is reasonably expected that the human G protein-coupled receptor protein is expressed in secretory cells and controls cell growth and secretion. In the prostate, it can be expected to be a novel G protein-coupled receptor that not only controls secretory functions but also is involved in diseases such as prostatic hypertrophy, prostate cancer, and prostatitis.

That is, the present invention relates to (1) a G protein-coupled receptor protein consisting of the amino acid sequence represented by SEQ ID NO: 1 or one or more amino acids deleted, substituted or added in SEQ ID NO: 1. G protein-coupled receptor protein comprising lysophosphatidic acid as a ligand comprising a modified amino acid sequence. (2) a protein containing a G protein-coupled receptor protein consisting of the amino acid sequence represented by SEQ ID NO: 1 or a lysozyme comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in SEQ ID NO: 1 A protein comprising a G protein-coupled receptor protein having phosphatidic acid as a ligand. (3) A partial peptide of the G protein-coupled receptor protein according to (1). (4) DNA containing DNA encoding a G protein-coupled receptor protein consisting of the amino acid sequence represented by SEQ ID NO: 1, or amino acid in which one or several amino acids are deleted, substituted or added in SEQ ID NO: 1 A DNA comprising a DNA encoding a G protein-coupled receptor having lysophosphatidic acid as a ligand having a sequence. (5) The above (4)
Containing the DNA of the G protein-coupled receptor protein described in the above.
A. (6) A partial DNA of the G protein-coupled receptor protein DNA according to (4). (7) G represented by SEQ ID NO: 2
Protein-coupled receptor protein DNA. (8) A vector comprising the DNA of (4).
(9) A transformant carrying the vector according to (8). (10) Production of a G protein-coupled receptor protein, which comprises culturing the transformant according to the above (9), producing and isolating a G protein-coupled receptor protein on the cell membrane of the transformant. Method. (11) In a system that expresses the G protein-coupled receptor protein described in (1) or the partial peptide described in (3), a test sample is allowed to act, and the G protein-coupled receptor or the peptide from the peptide is expressed. The method for screening an agonist for a G protein-coupled receptor protein according to the above (1), which comprises detecting a signal.
(12) An agonist selected by the screening method according to (11). (13) An agonist wherein the agonist selected by the screening method according to (11) is a compound selected from lysophosphatidic acid. (14) In a system for expressing the G protein-coupled receptor protein according to (1) or the partial peptide according to (3), (A) the case where only the ligand of the G protein-coupled receptor is acted. (B) The method for screening for an antagonist of a G protein-coupled receptor protein according to the above (1), which comprises comparing the case where a ligand of a G protein-coupled receptor and a test sample are allowed to act on the system.
(15) A method for screening an antagonist of a G protein-coupled receptor protein, wherein the ligand according to (14) is a compound selected from lysophosphatidic acid. (1
6) An antagonist selected by the screening method according to (14) or (15). (17) A probe comprising a DNA fragment having a sequence of at least 15 consecutive nucleotides in a nucleotide sequence encoding the G protein-coupled receptor protein according to (1) or a nucleotide sequence complementary thereto. (18) A G protein-coupled receptor gene cloned by the probe according to (17).
(19) A G protein-coupled receptor protein corresponding to the gene encoding the G protein-coupled receptor protein according to (18). (20) A primer having two regions satisfying the following conditions (a) to (e) from a nucleotide sequence encoding the G protein-coupled receptor protein described in SEQ ID NO: 1 or a nucleotide sequence complementary thereto. (A) The length of the primer is 15 to 40 bases. (B) The ratio of guanine and cytosine in the primer is 40% to 60%. (C) In the primer sequence, adenine, thymine, guanine,
The distribution of cytosine is not partially biased. (D) The distance on the base sequence of the G protein-coupled receptor protein DNA corresponding to the selected primer is 100 to 3000 bases. And (e) no complementary sequence exists between each primer itself or between the two primers. (21) A gene encoding a G protein-coupled receptor protein cloned by the primer according to (20). (2
2) A G protein-coupled receptor protein corresponding to the G protein-coupled receptor protein gene according to (21). (23)
An antibody against the G protein-coupled receptor protein according to (1) or the partial peptide according to (3). (24)
A G protein-coupled receptor protein, characterized in that a substance to be detected is present in a detection system containing the antibody according to the above (23), and the degree of reaction between the substance to be detected and the antibody is measured. Detection method. I will provide a.

[0009] Here, (1) "an amino acid sequence in which one or several amino acids are deleted, substituted or added" includes 1 to 20 amino acids, preferably one or more amino acids.
An amino acid sequence in which 0 or less, more preferably 1 to 5 amino acids are deleted, substituted or added is preferable. (2) As “lysophosphatidic acid”, a compound having a structure in which a fatty acid is bound at the 1- or 2-position of the glycerol skeleton and a phosphate group is bound to the 3-position, and the phosphoric acid at the 3-position is also cyclically located at the 2-position Bound cyclic phosphatidic acid. Compounds having a fatty acid at position 1 of the glycerol skeleton include 1-acyl lysophosphatidic acid, 1-alkyl lysophosphatidic acid, 1-alkenyl lysophosphatidic acid, and compounds having a fatty acid at position 2 are 2-acyl lysophosphatidic acid. Etc. are included. Fatty acids may be straight-chain or branched, and may be saturated or unsaturated. Fatty acids have 12 carbon atoms
From 24 to 24. Preferably, it has 12 to 24 carbon atoms.
Lysophosphatidic acid having an unsaturated fatty acid of
More preferred is 1-acyl lysophosphatidic acid having a linear unsaturated fatty acid having 12 to 24 carbon atoms.
Specifically, it is 1-oleoyl lysophosphatidic acid. (3) “Partial peptide” means a fragment selected from the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence in which one or several amino acids have been deleted, substituted or added, and preferably 10 or more amino acids. Preferred examples include amino acid, more preferably peptide fragments having an amino acid sequence of 16 or more amino acids. These peptide fragments may be selected from a region other than the transmembrane region, that is, a region protruding on the cell surface or a region protruding on the inner surface of the cell. Region or a region where the region protruding into the cell inner surface is continuous. It is preferably a region protruding from the cell surface or a peptide fragment selected from the region. The transmembrane region is a region of about 32 to about 55 from Met (region I), a region of about 68 to about 88 (region II), and a region of about 107 to about 125 from Met. (Region III), a region from about position 146 to position 165 (region IV), a region from position 192 to position 212 (region V),
It is estimated to be a region from about position 241 to about position 261 (region VI) and a region from about position 278 to about position 295 (region VII), with 1 to 20, preferably 1 to 10 regions And more preferably about 1 to 5 pieces. The region protruding from the cell surface is a hydrophilic region, and is a region from the first position Met to the approximately 31st position, a region from about 89 to about 106, a position from about 166 to about 191 and a position from about 262. It is estimated to be a region of about to 277th position, but includes a region of about 1 to 20, preferably 1 to 10, more preferably about 1 to 5. (4) "Partial DNA" means a DNA encoding the amino acid sequence of SEQ ID NO: 1 in addition to a DNA encoding the above-mentioned partial peptide, and a DNA fragment which can be used as a probe or a primer.
Contains NA fragments. (5) "Signal" means not only intracellular signals such as arachidonic acid release, intracellular calcium ion release, and intracellular cAMP generation, which are second messengers expressed through G protein-coupled receptors, but also And an index that can easily detect the expression of these intracellular signals. Examples of this indicator include reporter genes such as luciferase, aequorin, CAT, GUS, and beta-galactosidase. It should be noted that the protein and the partial peptide in the present invention include not only a case where the terminal carboxyl group is a free carboxyl group but also a salt, an ester and an acid thereof. The salts of proteins and partial peptides are particularly preferably physiologically acceptable acid addition salts. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) ,
Salts with tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used. Examples of the ester include ethyl ester as the ethyl ester, and CONH ₂ as the amide.

The present invention will be described below. The present invention provides a novel G protein-coupled receptor protein and a partial peptide thereof, a DNA encoding the G protein-coupled receptor protein, and a partial DNA thereof. G of the present invention
DNA encoding a protein-coupled receptor protein was obtained as follows. First, PCR is performed on human genomic DNA using primers designed based on the DNA sequence in a known lysophospholipid receptor transmembrane region,
Two gene fragments were obtained. Since there was no overlap between the two fragments obtained, primers were designed from these fragments and PCR was performed. As a result, a gene fragment connecting the two gene fragments was obtained. However, when these fragments are spliced, they do not contain a start codon and a stop codon, so that the 5 ′, 3′-
RACE was performed to determine the full-length gene sequence. The obtained full-length gene had a novel nucleotide sequence and had a seven-transmembrane region characteristic of a G protein-coupled receptor (FIG. 2). In addition, it was concluded that the gene belongs to the lysophospholipid receptor subfamily because it has homology to known receptors using lysophosphatidic acid and sphingosine-1-phosphate as ligands. SEQ ID NO: 2 shows the nucleotide sequence of the G protein-coupled receptor protein of the present invention. The amino acid sequence deduced from the nucleotide sequence of the receptor is shown in SEQ ID NO: 1. Furthermore, when an evolutionary phylogenetic tree based on the amino acid sequences of these genes was prepared, it was found that the gene belongs to a group different from the known G protein-coupled receptor having lysophosphatidic acid as a ligand.

[0011] In order to identify the ligand of the G protein-coupled receptor protein of the present invention, screening was performed using a system for detecting the production of a second messenger as luciferase activity. First, a reporter plasmid having luciferase inserted downstream of the zif268 promoter and a human G of the present invention downstream of the EF-1α promoter.
A receptor expression vector into which DNA encoding a protein-coupled receptor protein was inserted was prepared. Next, both a reporter plasmid and a receptor expression plasmid were introduced into PC12h cells, and a test compound was added to the resulting medium containing the transformed cells, and luciferase activity was measured.
As a result, it was found that 1-oleoyl lysophosphatidic acid classified as 1-acyl lysophosphatidic acid acts as a ligand.

When the distribution of expression of the G protein-coupled receptor protein of the present invention was examined, it was confirmed that the G protein-coupled receptor protein was highly expressed in the prostate and the trachea. In the prostate, (a) the G protein-coupled receptor protein of the present invention was expressed in main secretory cells, but was not expressed in supporting cells.
(B) When 1-oleoyl lysophosphatidic acid was added to the medium of prostate secretory cells, it was found that the concentrations of IL-6 and endothelin-1 (ET-1) increased. I
L-6 and ET-1 are also known as growth factors for prostate support cells (J. Urol. 151 (5): 1396-1399 (1994), Eu).
r J Pharmacol 349 (1): 123-8 (1998), Prostate 34 (4): 2
41-250) It is considered that the G protein-coupled receptor protein of the present invention is expressed in secretory cells and controls cell growth or secretion. In the prostate,
It may be related to diseases such as prostatic hypertrophy, prostate cancer, and prostatitis. Therefore, the G protein-coupled receptor protein of the present invention and a DNA encoding the same
Is extremely useful for controlling the normal function of the prostate and investigating the cause of the disease, and for developing a drug effective for controlling the normal function and treating and preventing the disease.
Furthermore, it is also useful for investigating the causes of various diseases in the expressed tissues such as the trachea and developing pharmaceuticals effective for treating and preventing these diseases. In addition, DNA encoding the G protein-coupled receptor protein of the present invention may be, for example, a gene therapy for treating a disease by introducing a cell isolated from a patient not expressing the receptor of the present invention using a retrovirus or an adenovirus. Etc. can also be used.

In general, when the amino acid sequence of a protein having a certain physiological activity is slightly changed, for example, when one or more amino acids in the amino acid sequence are deleted, substituted or added, the physiological activity of the protein is maintained. It is a well-known fact that this may be done. Therefore, in the amino acid sequence shown in SEQ ID NO: 1, even if one or more amino acids are deleted, substituted or added, the G protein-coupled receptor protein using lysophosphatidic acid as a ligand is the present invention. Included in the range. Lysophosphatidic acid is preferably lysophosphatidic acid having an unsaturated fatty acid having 12 to 24 carbon atoms, and more preferably 1-acyl lysophosphatidic acid having a linear unsaturated fatty acid having 12 to 24 carbon atoms. . Specifically, it is 1-oleoyl lysophosphatidic acid.
The number of amino acids to be deleted, substituted or added is 1 or more and 20 or less, preferably 1 or more and 10 or less, more preferably 1 or more and 5 or less. Also,
Since there are a plurality of codons encoding one amino acid, DNA having any nucleotide sequence is included in the scope of the present invention as long as the encoded amino acid sequence is the same. Therefore, the present invention includes any DNA encoding the amino acid sequence represented by SEQ ID NO: 1. Also, as described above, it is a well-known fact that the physiological activity of a protein having a biological activity may be maintained even when the amino acid sequence of the protein is generally slightly changed. Therefore,
In the amino acid sequence shown in SEQ ID NO: 1, even if one or more amino acids are deleted, substituted or added, the G protein-coupled receptor protein has lysophosphatidic acid as a ligand. Is included in the scope of the present invention. The number of amino acids to be deleted, substituted or added is 1 or more and 20 or less, preferably 1 or more and 10 or less, more preferably 1 or more and 5 or less. The most specific example of the sequence of the DNA encoding the G protein-coupled receptor protein of the present invention is shown in SEQ ID NO: 2. It should be noted that G hybridized to the base sequence shown in SEQ ID NO: 2 under the controlled conditions and having lysophosphatidic acid as a ligand.
DNAs encoding protein-coupled receptor proteins are included in the DNA of the present invention. Controlled conditions are described, for example, in Sambrook et al., Molecular Clon.
ing: A Laboratory Manual, 2
nd education, Vol. 1,101-10
4, (1986). More specifically, for example, cleaning conditions at 1 × SSC, 0.5% SDS, and a temperature of 65 ° C. are included. Mutants by deletion, substitution or addition of amino acids can be produced, for example, by site-directed mutagenesis (for example, Nucl. Aid Research, vol.
0, No. 20, 6487-6500, 1992). Site-directed mutagenesis can be performed, for example, using a synthetic oligonucleotide primer that is complementary to the single-stranded phage DNA to be subjected to the particular mutation, which is the desired mutation. In addition, as a method of performing deletion, substitution or addition of an amino acid sequence,
In addition to the above-described site-directed mutagenesis, there is also a method of treating a gene with a mutagen, or a method of cleaving a gene with a restriction enzyme to remove, add or replace a selected gene fragment, and then ligating. A variant may include conservatively substituted sequences, which means that a particular amino acid residue may be replaced by a residue having similar physicochemical characteristics. Non-limiting examples of conservative substitutions include substitutions between aliphatic chain containing amino acid residues, such as substitutions between Ile, Val, Leu or Ala, or polar basic amino acids, such as Lys and Arg. Substitutions between residues are included.

The G protein-coupled receptor protein or its partial peptide of the present invention is chemically synthesized, or encodes the G protein-coupled receptor protein or its partial peptide of the present invention in an expression vector depending on the host. It can be obtained by inserting DNA, transforming a host, culturing, and isolating. The G protein-coupled receptor or partial peptide of the present invention thus obtained can be used as a binding test for agonists and antagonists of the G protein-coupled receptor protein of the present invention, or as an antigen for producing an antibody. it can. When the G protein-coupled receptor protein or its partial peptide of the present invention is produced by a gene recombination technique, it may be performed by a conventional method of the gene recombination technique.
For example, a G protein-coupled G protein of the present invention may be added to an expression vector selected according to a host cell to be used, and a suitable transcription or translation regulatory nucleotide sequence derived from a mammal, a microorganism, a virus, an insect gene or the like may be introduced downstream. A DNA sequence encoding the receptor protein or a fragment thereof is inserted. Examples of regulatory sequences include transcriptional promoters, operators, or enhancers, mRNA ribosome binding sites, and appropriate sequences that control the initiation and termination of transcription and translation. Prokaryotic cells, yeasts or higher eukaryotic cells can be used as host cells. Suitable cloning and expression vectors for use in bacterial, fungal, yeast, and mammalian cell hosts are described, for example, in Pouwels et al., Cloning Vectors: A Laborat
ory Manual, Elsevier, New York, (1985).

Prokaryotes include gram negative or gram positive bacteria, for example, E. coli or Bacillus subtilis. Expression vectors used in prokaryotic host cells generally include one or more phenotypic selectable marker genes. A phenotype selectable marker gene is, for example, a gene that confers antibiotic resistance or auxotrophy. Examples of plasmid vectors suitable for prokaryotic host cells include pBR322
(ATCC37017) or those derived therefrom. pBR322
Contains genes for ampicillin and tetracycline resistance, making it easy to identify transformed cells. Suitable promoter and β-galactoside-
The DNA sequence of the α2,6-sialyltransferase gene is inserted into this pBR322 vector. Other commercially available vectors include, for example, pKK223-3 (Sweden,
Uppsala Pharmacia Fine Chemicals) and pGEM
1 (Promega Bio, Madison, Wisconsin, USA)
tec). Promoter sequences commonly used in expression vectors for prokaryotic host cells include the tac promoter, β-lactamase (penicillinase), the lactose promoter (Chang et al., Nature 275: 615, 1978; and Goeddel et al., Nature 281: 544, 1979). ) Etc. are included.
A particularly useful prokaryotic host cell expression system uses the phage λPL promoter and the cI857ts thermotolerant repressor sequence. Plasmid vectors available from the American Type Culture Collection incorporating derivatives of the λPL promoter include plasmid pHU.
B2 (present in E. coli strain JMB9 (ATCC37092)) and pPLc28 (E. coli RP1 (ATCC53
082).

When the G protein-coupled receptor of the present invention or a partial peptide thereof is expressed using yeast as a host,
For example, Cerevisiae, but other yeast genera such as Schizosaccharomyces pombe, Pichia or Kluyveromyces may be used. Yeast vectors often contain sequences of origin of replication from the 2μ yeast plasmid, autonomously replicating sequences (ARS), promoter regions, sequences for polyadenylation, sequences for transcription termination, and selectable marker genes. . Other leader sequences suitable for promoting secretion of a recombinant polypeptide from a yeast host are also known. Methods for transforming yeast are described, for example, in Hinnen et al., Proc. Natl.
ad. Sci. USA 75: 1929, 1978. When expressing the G protein-coupled receptor protein or its partial peptide of the present invention using a mammalian or insect host cell culture system, a mammalian cell line may be used. Transcription and translation control sequences for mammalian host cell expression vectors can be obtained, for example, from the viral genome. Commonly used promoter and enhancer sequences are derived from polyomavirus, adenovirus 2 and the like. SV40 viral genome, eg, S
DNA sequences derived from the V40 origin, the early and late promoters, enhancers, splice sites, and polyadenylation sites may be used to provide other genetic elements for expression of structural gene sequences in mammalian host cells. Good. Expression vectors for use in mammalian host cells are described, for example, in Okayama and Berg (Mol. Cell. Biol. 3:28
0, 1983).

The partial DNA of the DNA encoding the G protein-coupled receptor protein of the present invention can be used as a probe or primer. In order to use a partial DNA of the G protein-coupled receptor nucleotide sequence of the present invention as a probe, for example, SEQ ID NO: 2 or SEQ ID NO: 19
The probe may be designed based on any of the above sequences. Its length is desirably at least 15 consecutive bases or more. Probes can be used in a conventional manner, for example,
It can be labeled with a detectable enzyme such as a radioisotope or digoxigenin. For example, when radioactive P is used, cD
When using an NA fragment, it is convenient to label it with a random priming label, and when using a synthetic oligoprobe, it is convenient to label it at the 5 ′ end with a phosphorylating enzyme. The probe thus labeled is hybridized with a cDNA library or a genomic library to perform cloning. Hybridization can be performed by a commonly used method and conditions. Generally medium strength, eg, 1 × SSC, 0.5%
Washing at 65 ° C. SDS. CDNA used
The library may be derived from animals including mammals, but is particularly preferably derived from human tissues and cells.

When primers are designed based on the nucleotide sequence of the G protein-coupled receptor of the present invention, for example, two primers are selected from SEQ ID NO: 2 or SEQ ID NO: 19 so as to satisfy the following conditions. do it. 1) The length of the primer is 15 to 40 bases, preferably 20 to 30 bases. 2) The ratio of guanine to cytosine in the primer is 40% to 60%, preferably 45% to 55%, more preferably about 50%. 3) In the primer sequence, adenine, thymine, guanine,
The distribution of cytosine is not partially biased. For example, a region in which guanine and cytosine are repeatedly distributed is considered to have low specificity and is not suitable as a primer. 4) The distance on the base sequence corresponding to the selected primer is 100 to 3000 bases, preferably 150 to 3000 bases.
To 1000 bases, more preferably 150 to 500 bases. And 5) no complementary sequence exists between each primer itself or between the two primers. Once the primer sequence is selected, commercially available DNA
Synthetic equipment, such as DNA from PerkinElmer
May be synthesized.

The present invention also provides a method for screening an agonist and an antagonist for a G protein-coupled receptor protein, and an agonist and an antagonist selected by the screening. Agonist screening is performed by allowing a test sample to act in a system that expresses the G protein-coupled receptor protein of the present invention and detects a signal that mediates the receptor, and detects a signal downstream of the receptor. be able to. More specifically, for example, by using a system that expresses a G protein-coupled receptor protein and a target gene induced downstream of a signal that mediates the G protein-coupled receptor,
Agonists can be screened. This target gene expression system requires cells expressing the G protein-coupled receptor of the present invention on the cell membrane. Such a cell is, for example, a natural cell line expressing the G protein-coupled receptor of the present invention on the cell membrane or a host cell transformed with a DNA encoding the G protein-coupled receptor protein of the present invention. Etc. may be used. The screening operation can be performed, for example, by detecting a target gene or a protein that is a product of the target gene. Also,
A system for detecting another index that can easily detect the presence or absence of the expression of the target protein without directly measuring the target gene or the target protein may be used. When detecting an index, for example, luciferase, aequorin, CAT, G
A reporter gene assay may be performed using a reporter gene such as US and beta-galactosidase. The reporter gene is a plasmid linked behind the promoter region of the target gene, and a cell that expresses the G protein-coupled receptor of the present invention is transformed with the plasmid to construct a system for detecting an indicator.

In the screening of antagonists, the expression of the target gene product when a ligand is allowed to act on the receptor in a system for expressing the G protein-coupled receptor protein and the target gene, and the reaction between the ligand and the test sample This can be done by comparing the expression of the target gene product when the expression is performed. To screen for antagonists, as with screening for agonists,
A cell that expresses the G protein-coupled receptor of the present invention on a cell membrane is required. As described above, a natural cell line that expresses the G protein-coupled receptor of the present invention on a cell membrane, a cell produced by a gene recombination method, or the like may be used.
Screening is performed by detecting a target gene or a protein that is a product of the target gene.If appropriate, when the target protein is produced, the target protein can be screened in the same manner as for the screening of the agonist without directly measuring the target protein. A system for measuring another index which can easily detect the presence or absence of expression may be used. As the ligand, an agonist selected by agonist screening can be used. Specifically, it is 1-oleoyl lysophosphatidic acid. Agonists and antagonists selected by the above screening are prostate diseases, for example,
It is useful as a medicament effective for treating and preventing prostatic hypertrophy, prostate cancer, prostatitis and the like. Agonists and antagonists are formulated into solid preparations (for example, tablets) or liquid preparations (for example, injections) according to known means, and pharmaceutically necessary or sufficient for oral or parenteral (for example, injection) to patients with the disease. Is administered.

The present invention further provides an antibody against the G protein-coupled receptor protein of the present invention or a partial peptide of the protein. An antibody (for example, a polyclonal antibody or a monoclonal antibody) or an antiserum against the G protein-coupled receptor protein or a partial peptide thereof of the present invention comprises:
Using the G protein-coupled receptor protein of the present invention or its partial peptide as an antigen, it can be produced according to a known antibody or antiserum production method. For example, a monoclonal antibody can be produced according to the following method.

(A) Preparation of Monoclonal Antibody Producing Cell The G protein-coupled receptor protein or its partial peptide of the present invention is administered to a warm-blooded animal together with a carrier and a diluent. As the partial peptide, a portion other than the transmembrane region of the receptor protein may be selected as an antigen. The transmembrane region is a region of about 32 to about 55 from Met (region I), a region of about 68 to about 88 (region II), and a region of about 107 to about 125 from Met. (Region III), a region of about position 146 to position 165 (region IV), and a region of position 19
2nd to about 212th region (region V), about 241st to
Region at about position 261 (region VI), from about position 278 to about 2
Since it is estimated to be the 95th region (region VII), other regions or fragments of those regions can be used as antigens. Preferably, the region protruding from the cell surface, that is, the region from the first Met to about the 31st position, the region from the about 89 to about 106, the about 166 to about 19
It is the region of the first position, about 262 to about 277,
It may be about 0, preferably about 1 to 10, more preferably about 1 to 5. FIG. 2 shows the putative structure of the receptor of the present invention. The underlined part in the figure is the estimated transmembrane region. The G protein-coupled receptor protein or its partial peptide of the present invention can be obtained by a protein expression method by chemical synthesis or genetic recombination as described above.

In order to enhance the antibody-producing ability when administering an antigen to an animal, complete Freund's adjuvant or incomplete Freund's adjuvant may be administered. Administration is usually 2-6
It is performed once every week, for a total of about 2 to 10 open. Examples of the warm-blooded animal to be used include monkeys, rabbits, dogs, guinea pigs, mice, rats, sheep, goats and chickens, and mice and rats are preferably used.
When producing monoclonal antibody-producing cells, a warm-blooded animal immunized with an antigen, for example, an individual having an antibody titer is selected from a mouse, and the spleen or lymph node is collected 2 to 5 days after the final immunization and contained therein. By hybridizing the antibody-producing cells to myeloma cells, a monoclonal antibody-producing hybridoma can be prepared. The antibody titer in the antiserum is measured, for example, by reacting the labeled lysophospholipid receptor described below with the antiserum, and then measuring the activity of a labeling agent bound to the antibody. The fusion operation is performed by known methods, for example, the method of Koehler and Milstein (Nature, 256, 495 (1975)).
It can be implemented according to. Examples of the fusion promoter include polyethylene glycol (PEG) and Sendai virus, and PEG is preferably used. Examples of myeloma cells include NS-1, P3U1, SP2 / 0, and AP-1
Although P3Ul is preferably used.
The preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells used is about 1: 1 to 20: 1, and PE
G (preferably PEG1000-PEG6000) is 1
Cell fusion can be carried out efficiently by adding at about 0 to 80% and incubating at 20 to 40 ° C, preferably 30 to 37 ° C for 1 to 10 minutes. Various methods can be used for screening the anti-G protein-coupled receptor antibody-producing hybridoma. For example, a hybridoma culture supernatant is added to a microplate on which a G protein-coupled receptor antigen is adsorbed directly or together with a carrier. A method for detecting an anti-G protein-coupled receptor monoclonal antibody bound to a microplate by adding an anti-immunoglobulin antibody or protein A labeled with a radioactive substance or an enzyme to the microplate; A method in which a hybridoma culture supernatant is added to a plate, a G protein-coupled receptor labeled with a radioactive substance, an enzyme, or the like is added, and an anti-G protein-coupled receptor monoclonal antibody bound to a microplate is detected. The selection of the anti-G protein-coupled receptor monoclonal antibody can be performed according to a known method or a method analogous thereto. It is usually carried out in a medium for animal cells supplemented with HAT (hypoxanthine, aminobuterin, thymidine). As a selection and breeding medium, any medium can be used as long as hybridomas can grow. For example, RPMI 1640 medium containing 1-20%, preferably 10-20% fetal bovine serum, GIT medium containing 1-10% fetal bovine serum (Wako Pure Chemical Industries, Ltd.) or serum-free medium for hybridoma culture ( SFM-10
1, Nissui Pharmaceutical Co., Ltd.) can be used. The culturing temperature is usually 20 to 40 ° C, preferably about 37 ° C. The culturing time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks. The cultivation is usually performed under 5% carbon dioxide. The antibody titer of the hybridoma culture supernatant can be identified in the same manner as the measurement of the anti-G protein-coupled receptor antibody titer in the antiserum described above.

(B) Purification of Monoclonal Antibody Separation and purification of anti-G protein-coupled receptor monoclonal antibody can be carried out in the same manner as ordinary polyclonal antibody separation and purification of immunoglobulin [eg, salting-out method, alcohol precipitation method] , Isoelectric focusing, electrophoresis, adsorption / desorption with ion exchangers (eg, DEAE), ultracentrifugation, gel filtration, antigen-bound solid phase, or antibodies with active adsorbents such as protein A or protein G Is collected and the bond is dissociated to obtain an antibody, followed by a specific purification method. The G protein-coupled receptor antibody of the present invention produced according to the above method is
Since the protein-coupled receptor can be specifically recognized, it can be used for quantification of a G-protein-coupled receptor in a test solution, particularly for quantification by a sandwich immunoassay. As the antibody to be used, the antibody molecule itself may be used, or F (ab ') 2, Fab' or Fab fraction of the antibody molecule may be used.

The measuring method using the antibody of the present invention is not particularly limited, and may be an antibody, an antigen or an antibody-antigen complex corresponding to the amount of an antigen (eg, the amount of a G protein-coupled receptor) in a liquid to be measured. Any measurement method may be used as long as the amount of the body is detected by chemical or physical means, and the amount is calculated from a standard curve prepared using a standard solution containing a known amount of antigen. For example, nephelometry, a competitive method, an immunometric method, and a sandwich method are suitably used, but the sandwich method described below is particularly preferable in terms of sensitivity and specificity. Examples of the labeling agent used in the measurement method using the labeling substance include a radioisotope, an enzyme, a fluorescent substance, and a luminescent substance. As the radioisotope, for example, ¹²⁵ I, ³ H, ¹⁴ C and the like are preferable, and as the above enzyme, those having a stable and high specific activity are preferable. Dehydrogenase, etc., as fluorescent substances, fluorescamine,
Fluorescein isothiocyanate and the like, and luminescent substances include luminol, luminol derivatives, luciferin, lucigenin and the like. Further, a biotin-avidin system can be used for binding the antibody or antigen to the labeling agent. For the insolubilization of the antigen or antibody, physical adsorption may be used, or a method using a chemical bond usually used for insolubilizing and immobilizing proteins or enzymes may be used. Examples of the carrier include insoluble polysaccharides such as agarose, dextran, and cellulose; synthetic resins such as polystyrene, polyacrylamide, and silicon; and glass. In the sandwich method, a test solution is reacted with an insolubilized anti-G protein-coupled receptor antibody (primary reaction), and further reacted with a labeled anti-G protein-coupled receptor antibody (secondary reaction). By measuring the activity of the labeling agent on the carrier, the amount of G protein-coupled receptor in the test solution can be determined. In the immunoassay by the sandwich method, the antibody used as the solid phase antibody or the labeling antibody is not necessarily l.
It does not need to be a type, and a mixture of two or more types of antibodies may be used for the purpose of improving measurement sensitivity and the like. In the method for measuring a G protein-coupled type by the sandwich method of the present invention, it is desirable that the anti-G protein-coupled receptor antibody used in the primary reaction and the secondary reaction is an antibody having a different site to which the G protein-coupled receptor binds. Used. That is, the antibody used in the primary reaction and the secondary reaction is, for example, the antibody used in the primary reaction, if the antibody used in the secondary reaction recognizes the C-terminal of the G protein-coupled receptor, Preferably, an antibody that recognizes other than the C-terminal, for example, the N-terminal, is used. In applying the immunological assay to the assay of the present invention, no special conditions, operations, and the like need to be set. The measurement system for G protein-coupled receptor may be constructed by adding ordinary technical considerations of those skilled in the art to ordinary conditions and operation methods in each method. As described above, the G protein-coupled receptor antibody can be quantified with high sensitivity by using the G protein-coupled receptor antibody of the present invention. Also,
Antibodies can also be used to control prostate function and to treat and prevent disease.

The present invention will be specifically described below.

【Example】

Example 1 Cloning of DNA Encoding Novel G Protein-Coupled Receptor "GLM01" and Determination of Base Sequence (1) Degenerate PCR (a) Setting of Mix Primer 14 genes belonging to lysophospholipid receptor [ human edg-1 (M31210), mo
use edg-1 (U40811), rat edg-1 (U10303), mouse Gp
cr13 (L20334), rat AGR16 (U10699), human edg-2
(Y06479), human vzg-1 (U80811), mouse vzg-1 (U7
0622), mouse rec1.3 (U48235), rat edg-2 (AF1441
8), sheep edg-2 (U18405), cattle rec1.3 (U4823
6), human edg-3 (X83864), human edg-4 (AC00230
6) The numbers in parentheses indicate the Accession No. of the DNA Database. ]
Are aligned using clustal W, and two sets of degenerate mix primers [edg.DF2 (SEQ ID NO: 3) and edg.DR1 (SEQ ID NO: 4)] from the well conserved part in the transmembrane region , [Edg.DF3 (SEQ ID NO: 5) and edg.DR3 (SEQ ID NO: 6)] were designed and synthesized. (B) Using 10 μl of PCR human genomic DNA (0.1 μg / μl: manufactured by CLONTECH) as a template, 23 μl of sterile water, PCR buffer (100 mM Tris-HCl (pH 8.3), 500 mM KCl, 15 mM MgCl
2: Takara Shuzo Co., Ltd. 5 μl, deoxynucleotide (dATP, d
CTP, dGTP, dTTP, 2.5 mM each: Takara Shuzo) 5 μl,
1 μl of Taq DNA polymerase (5 u / μl: manufactured by Takara Shuzo Co., Ltd.) and 3 μl of a sense degenerate mix primer of edg.DF2 (SEQ ID NO: 3) and an antisense degenerate mix primer of edg.DR1 (SEQ ID NO: 4) ( 500 μM)
50 μl of the reaction solution was prepared. [94 ° C5
Min. (94 ° C 1 minute → 38 ° C 1 minute (1 minute 30 seconds) → 72 ° C 2 minutes)
× 3 times (94 ° C 1 minute → 55 ° C 1 minute → 72 ° C 2 minutes) × 32 times 72 ° C 10
Minutes]. PCR equipment is GeneAmp PCR S
ystem 9600 (ABI) was used. Using the same reaction mixture composition, the sense primer of edg.DF3 (SEQ ID NO: 5) and e
PCR was performed with the antisense primer of dg.DR3 (SEQ ID NO: 6) under the same conditions. (C) Cloning & Sequencing The two types of PCR products thus obtained were separated by electrophoresis using a 2% agarose gel, and two bands of approximately 180 bp and 150 bp were cut out from each, and QIA
The PCR product was purified using EX II Agarose Gel Extraction Kit (QIAGEN). 1 μl of this PCR product (approximately 25
ng / μl), 3 μl of sterile water, pGEM T-Vector (50 ng / μl: P
1 μl (manufactured by ROMEGA) was incubated with 5 μl of solution I of Ligation Kit Ver.2 (manufactured by Takara Shuzo) at 16 ° C. for 3 hours and ligated. The thus obtained plasmid was transformed into E. coli JM109 competent cells (manufactured by Toyobo) to obtain clones. The PCR product cloned into pGEM T-Vector is converted to Dye Deoxy terminator Cycle Sequencing K
The reaction was performed using it FS (manufactured by ABI), and the nucleotide sequence was determined using a fluorescent autosequencer (ABI373A: manufactured by ABI). In the obtained nucleotide sequence, two types of novel nucleotide sequences were obtained in addition to the known G protein-coupled receptor nucleotide sequence used in designing the degenerate mix primer. The obtained nucleotide sequence had homology to a known G protein-coupled receptor (SEQ ID NOs: 7 and 8; the nucleotide sequence of the primer portion was not included).

(2) RT-PCR To determine whether these nucleotide sequences (SEQ ID NOS: 7 and 8) are derived from two different transcripts or from the same transcript, Primer F05F1 (SEQ ID NO: 9),
Based on SEQ ID NO: 8, an antisense primer I06R1 (SEQ ID NO: 10) was designed and synthesized. (A) cDNA synthesis Human heart and testis-derived human poly (A) RNA synthesis template (CLO
NTECH), SuperScript Preamplification System f
Using First Strand cDNA Synthesis (GIBCO BRL), cDNA was synthesized as follows. poly (A) RN
A 1 μg (manufactured by CLONTECH) was added to 10 μl of a 10-fold concentrated solution of synthesis buffer (200 mM Tris-HCl (pH 8.4), 500 mM KCl)
5mM MgCl2 10μl, 0.1M DTT 10μl, deoxynucleotide (dATP, dCTP, dGTP, dTTP, 10mM each) 5μl
The reaction was carried out at 42 ° C. for 50 minutes in a reaction solution containing 5 μl of oligo dT12-18 primer (0.5 μg / μl) and 5 μm of reverse transcriptase SuperScript II RT (200 u / μl). Then E.Coli RNa
RNA was degraded by adding 5 μl of se H (2 u / μl). The reaction solution was adjusted to 100 μl at the final stage. (B) PCR Using 4 μl of the thus prepared human cDNA as a template, 10.27 μl of sterilized water, a 10-fold concentrated PCR buffer (100 mM
1.6 µl of Tris-HCl (pH 8.3), 500 mM KCl, 15 mM MgCl2 (Takara Shuzo), deoxynucleotides (dATP, dCTP, dG
TP, dTTP, 2.5 mM each: Takara Shuzo) 2 μl, Taq DNA
0.13 μl of polymerase (5 u / μl: manufactured by Takara Shuzo), and a sense primer of F05F1 (SEQ ID NO: 9) and I06R1
(SEQ ID NO: 10)
1 μl (10 μM) was added to prepare 20 μl of a reaction solution. For this solution, [94 ℃ 2min ・ (94 ℃ 30sec → 55 ℃ 30sec → 72 ℃ 2
Min) × 35 times at 72 ° C. for 10 minutes]. PCR
The device used was GeneAmp PCR System 9600 (ABI).
(C) Sequencing PCR products were separated by electrophoresis using a 2% agarose gel, bands around 480 bp were cut out, and the QIAEX II Agarose Gel Extraction Kit (QIAEX
GEN) and directly purified by Dye Deoxy termina
Reaction was performed using tor Cycle Sequencing Kit FS (ABI), and fluorescence autosequencer (ABI373A: ABI)
The nucleotide sequence was determined. (SEQ ID NO: 11) This fragment of the nucleotide sequence contains the nucleotide sequences of the two PCR products analyzed earlier (SEQ ID NOs: 7 and 8) because it overlaps SEQ ID NO: 7 upstream and SEQ ID NO: 8 downstream, And it was confirmed that it was a bridge between them. Therefore, it became clear that these three base sequences were derived from the same transcript. Further, from homology analysis with a known G protein-coupled receptor, it was inferred that SEQ ID NO: 11 covers the transmembrane regions III to VII of the novel G protein-coupled receptor.

(3) Expression distribution of the novel G protein-coupled receptor gene
(A) Human RNAMaster Blot with RNA dot (CLONTECH
) And the expression distribution of this gene was examined. (B) Probe adjustment degenerate PC
From the plasmid of the clone derived from the R product 180 bp, a PCR product using primers F05F1 and F05R1 (SEQ ID NO: 9 and SEQ ID NO: 12) set so as not to contain the degenerate mix primer region was used as a probe. Plasmid DNA 1μl
(2.5 ng / μl) as a template, into which sterile water 12.75
μl, 10 times concentrated solution of PCR buffer (100 mM Tris-HCl
(PH 8.3), 500 mM KCl, 15 mM MgCl2: manufactured by Takara Shuzo Co., Ltd.)
l, deoxynucleotides (dATP, dCTP, dGTP, dTTP,
2.5 μm each: 2 μl from Takara Shuzo, Taq DNA polymerase (5 u / μl: 0.25 μl from Takara Shuzo), a sense primer of F05F1 (SEQ ID NO: 9) and F05R1 (SEQ ID NO: 1)
2) 1 μl (10 μl) of each antisense primer
M), and 20 μl of a reaction solution was prepared. For this solution, [94 ° C for 2 minutes · (94 ° C for 30 seconds → 55 ° C for 30 seconds → 72 ° C for 2 minutes) × 35
Times at 72 ° C. for 10 minutes]. Gen PCR
eAmp PCR System 9600 (ABI) was used. P obtained
The CR product was separated by electrophoresis using 4% NuSieve 3: 1 Gel (manufactured by FMC), a 118 bp band was cut out, and QIAEX
The PCR product was purified using II Agarose Gel Extraction Kit (QIAGEN). Probe labeling was performed using [anti-sense primer] alone and incorporating [α-32P] dCTP as follows. Using 1 μl (20 ng / μl) of the PCR product as a template, 30 μl of sterile water, a 10-fold concentrated PCR buffer (100 mM Tris-HCl (pH 8.3), 500 mM KCl, 15 mM Mg
Cl2: Takara Shuzo Co., Ltd. 5 μl, dATP, dGTP, dTTP (each 0.2 mM:
Takara Shuzo) 1 μl, [α-32P] dCTP (3.3 mM: Amasham) 5 μl, Taq DNA polymerase (5 u / μl: Takara Shuzo) 1 μl, and F05R1 (SEQ ID NO: 12) antisense primer 5 μl (10 μM) 50 μl of the added reaction solution was prepared. For this solution, [94 ° C for 2 minutes
30 seconds → 72 ° C for 2 minutes) x 10 times]. P
As the CR device, GeneAmp PCR System 9600 (ABI) was used. This probe is used with ProbeQuant G-50 Micro Columns
(Pharmacia) for gel filtration purification. (B)
The hybridization Blot filter contains 1.5 mg of salmon sperm DNA (CLONTECH) heat-denatured at 94 ° C for 5 minutes.
55 in ml ExpressHyb buffer (CLONTECH)
Prehybridization was performed at 1 ° C. for 1 hour. Thereafter, 200 μl of the above probe and 150 μg of salmon sperm DNA (CLONTECH) containing 6 μl of ExpressHyb buffer (CLONTECH) was heat denatured at 94 ° C. for 5 minutes, and hybridized at 55 ° C. overnight. After this, the filter
The plate was washed at 65 ° C. with a washing solution containing 0.1 × SSC (15 mM sodium chloride, 1.5 mM sodium citrate) and 0.1% SDS.
Hybridization signal is obtained from Bio-imaging An
Visualization was performed using an alysis System 2000 (Fujifilm). This resulted in strong signals in the prostate and trachea. In addition, weak signals were also observed in the heart, testis, ovary, and pancreas as compared to the prostate and trachea (FIG. 1).

(4) Determination of full-length nucleotide sequence Next, in order to determine the full-length nucleotide sequence of the novel lysophospholipid receptor gene fragment obtained as described above, 5 ', 3'-RACE (Rapid Amplific
ation of cDNA Ends). Marat as PCR template
hon-Ready Human Prostate (manufactured by CLONTECH) was used. This is obtained by linking an adapter for PCR to Human Prostate cDNA. (B) PCRMarathon-Ready
Put 5 μl of Human Prostate as a template and add sterile water
29.5 μl, 5 μl of 10-fold concentrated solution of LA-Taq PCR buffer (Takara Shuzo), deoxynucleotide (dATP, dCTP,
dGTP, dTTP, 2.5 mM each: Takara Shuzo) 8 μl, LA-Ta
q DNA polymerase (5u / μl: manufactured by Takara Shuzo Co., Ltd.) 0.5μl, and 5'-RACE F05R2 (SEQ ID NO: 13) antisense primer and adapter primer AP1 (CLONTEC
H company) (1 μl, 10 μM) was added, and 50 μl of the reaction system was prepared. With the same reaction mixture composition, I06F3 for 3'-RACE
1 μl (10 μM) of each of the sense primer (SEQ ID NO: 14) and the adapter primer AP1 was added to prepare a 50 μl reaction system. For these solutions,
(94 ° C 30 seconds → 72 ° C 4 minutes) x 5 times ・ (94 ° C 30 seconds → 70 ° C 4 minutes)
× 5 times (94 ° C for 30 seconds → 68 ° C for 4 minutes) × 25 times]
Was given. PCR equipment is GeneAmp PCR System 9600 (ABI
Was used. 100-fold dilutions of these PCR reactions 1
μl as a template, 33.5 μl of sterile water, 5 μl of a 10-fold concentrated solution of Ex-Taq PCR buffer (Takara Shuzo), deoxynucleotide (dATP, dCTP, dGTP, dTTP, 2.5 m each)
M: Takara Shuzo Co., Ltd. 8μl, Ex-Taq DNA polymerase (5u / μ
l: Takara Shuzo) 0.5μl and F05R3 for 5'-RACE
Each of the antisense primer (SEQ ID NO: 15) and the adapter primer AP2 (manufactured by CLONTECH) were added in an amount of 1 μl (1
0 μM) to prepare 50 μl of the reaction system. In the same reaction mixture composition, in the case of 3′-RACE, 1 μl of the sense primer of I06F4 (SEQ ID NO: 16) and 1 μl of the adapter primer AP2 were used.
(10 μM), and 50 μl of the reaction system was prepared. For these solutions, [94 ° C for 2 minutes ・ (94 ° C for 30 seconds → 60 ° C for 30 seconds → 72 ° C for 2 minutes
Minutes) × 30 times at 72 ° C. for 10 minutes]. The PCR device used was GeneAmp PCR System 9600 (ABI). (B) Cloning & Sequencing The two PCR products obtained were separated by electrophoresis using a 0.8% agarose gel, bands of approximately 800 bp and 500 bp were cut out, respectively, and QIAEX II Agarose Gel Extraction Kit
(Manufactured by QIAGEN). 2 μl of this PCR product
l (approx. 16 ng / μl), sterile water 2 μl, pGEM T-Vector
(50 ng / μl: manufactured by PROMEGA) 1 μl of Ligation Kit Ver.2
5 μl of Solution I (Takara Shuzo) was incubated at 16 ° C. for 4 hours and ligated. The thus obtained plasmid is used to transform E. coli DH5α competent cells (manufactured by Toyobo).
To obtain a clone. The two PCR products cloned into the pGEM T-Vector were transferred to Dye Deoxy terminator Cy
Reaction with cle Sequencing Kit FS (ABI)
The nucleotide sequence was determined using a fluorescent auto sequencer (ABI373A: manufactured by ABI). The base sequence obtained by 5′-RACE (SEQ ID NO: 17) and the base sequence obtained by 3′-RACE (SEQ ID NO: 18) are the same as the base sequence obtained previously (SEQ ID NO: 11).
There was an area that matched. Further, by assembling them, one connected base sequence (SEQ ID NO: 1)
9) was obtained. A large open reading frame is found in SEQ ID NO: 19, which has homology to a known G protein-coupled receptor and clearly encodes a novel G protein-coupled receptor. became.

(5) Cloning of Full Length and Confirmation of Base Sequence Primers GLM01.FL, GLM01 containing a restriction enzyme recognition sequence (HpaI, XbaI) and amplifying a fragment containing the full length coding sequence deduced from SEQ ID NO: 19 .RL (SEQ ID NO: 20, SEQ ID NO: 21) was set, RT-PCR was performed,
Further, the obtained PCR product was cloned and sequenced. (B) RT-PCR Marathon-Ready Human
Using 5 μl of Prostate as a template, add 29.5 μl of sterile water, 1
0μ concentrated solution Ex-Taq PCR buffer (Takara Shuzo) 5μ
l, deoxynucleotides (dATP, dCTP, dGTP, dTTP,
2.5 μm each: Takara Shuzo) 8 μl, Ex-Taq DNA polymerase (5 u / μl: Takara Shuzo) 0.5 μl, and GLM01.
FL (SEQ ID NO: 20) sense primer (including HpaI recognition sequence) and GLM01.RL (SEQ ID NO: 21) antisense primer (including XbaI recognition sequence) were each 1 μl (10 μl).
μM) to prepare 50 μl of the reaction solution. For these solutions, [94 ° C for 2 minutes ・ (94 ° C for 30 seconds → 55 ° C for 30 seconds → 72 ° C for 2 minutes)
× 30 times at 72 ° C. for 10 minutes]. The PCR device used was GeneAmp PCR System 9600 (ABI).
(B) Cloning & sequencing
After buffer exchange in croSpin S-200 HR Columns (Pharmacia), treatment with restriction enzymes (Hpa I, Xba I) was performed. This was separated by electrophoresis using 1% agarose gel, one band of about 1200 bp was cut out, and purified using QIAEX II Agarose Gel Extraction Kit (manufactured by QIAGEN). 4 PCR products treated with restriction enzymes
1 μl (approximately 2 ng / μl) and 1 μl of pGEM3zf (50 ng / μl)
ation Kit Ver.2 with solution I (Takara Shuzo)
The mixture was incubated at a temperature of 3 ° C. for 3 hours and ligated. The thus obtained plasmid was transformed into Escherichia coli DH5α competent cells (manufactured by Toyobo) to obtain clones.
Plasmid DNA from this E. coli clone is transferred to QIAGEN Plasmi
d Purified using Mini Kit (manufactured by QIAGEN). pGEM3zf
Plasmid DNA cloned into Dye Deoxy termina
Reaction was performed using tor Cycle Sequencing Kit FS (ABI), and fluorescence autosequencer (ABI373A: ABI)
The nucleotide sequence was determined at SEQ ID NO: 22 (SEQ ID NO: 22)
Was confirmed to be the same as the partial sequence.

(6) Homology analysis of novel G protein-coupled receptor blast (Altschul, S, F., et al., J. Mol. Bi
215, 403-410 (1990)), there was a group of G protein-coupled receptors having high homology to the nucleotide sequence of the novel G protein-coupled receptor "GLM01".
Among these genes, human base sequences are listed (for those whose human base sequence has not been determined, reference is made to the base sequence of rodents), human edg-1 (M31210), rat AGR
16 (U10699), human edg-2 (Y06479), human edg-3
(X83864) and human edg-4 (AC002306). (The Accession No. of the DNA Database is shown in parentheses.) Particularly high homology was human edg-2 and human edg
-4 at the amino acid level, 47.5% and 46.1%, respectively.
% Homology, at the nucleic acid level 57.2%, 56.9%
There was a homology of Next, using an evolutionary phylogenetic tree creation program, SINCA (Fujitsu), an evolutionary phylogenetic tree was created based on the amino acid sequences of these genes. Neighbor J
Bootstrap analysis was also performed using the oining method. as a result,
Edg-1, ed with sphingosine-1-phosphate as ligand
g-3 and rat AGR16 form a group, edg-2 and edg-4, which use lysophosphatidic acid as a ligand, and a novel G protein-coupled receptor "GLM01" cloned this time
(SEQ ID NO: 1) (hereinafter sometimes referred to as “GLM01”) was found to form another group (FIG. 3).

[0032]

Example 2 Identification of Ligands for Novel G Protein-Coupled Receptors Receptor activity was measured by the reporter gene method by activating the zif268 promoter. zif268
A reporter plasmid (pGL2-zif) having luciferase inserted downstream of the promoter and a receptor expression vector (pEF-humanGM01) having the receptor gene represented by SEQ ID NO: 2 inserted downstream of the EF-1a promoter were prepared. . PC1
The receptor expression vector and the reporter plasmid were both introduced into 2h cells, and after adding the compound to be tested, the ligand was identified by measuring the luciferase activity. At this time, cells that did not express the receptor were used as a control. From sequence homology analysis, it was predicted that the novel G protein-coupled receptor "GLM01" would use a lipid mediator as a ligand. Therefore, about 20 lipid-related compounds
As a result of testing 0 types, it was found that 1-oleoyl lysophosphatidic acid acts as a ligand of the G protein-coupled receptor of the present invention.

The operation using 1-oleoyl lysophosphatidic acid as a test compound is specifically described below. A reporter plasmid (pGL2-zif) having luciferase inserted downstream of the zif268 promoter was prepared by the following procedure. Using rat genomic DNA as a template, primer F1 (5′-AGAGAGGGTACCACGC
CTCAGCTCTACGCGCCT-3 ') (SEQ ID NO: 23) and primer R1 (5'-AGAGAGA
AGCTTGAAGCTACTGAGGGCACT
-3 ′) (SEQ ID NO: 24) and PCR was performed.
f268 gene promoter region [-526 to +227 relative to the transcription start site (Proc. Natl. Aca
d. Sci. 86, 377-381, 1989.
Year)]. Restriction enzyme S
After digestion with acII, blunt-end treatment was carried out, followed by further digestion with the restriction enzyme KpnI to obtain a fragment of -526 to +97. An expression vector pGL2-basic vector (PROMEGA) having no promoter sequence and enhancer sequence of eukaryotic cells was replaced with a restriction enzyme HindII.
After digestion with I, blunt-end treatment was performed, followed by restriction enzyme K
After digestion with pnI, the above zif promoter fragment (-
526 to +97) The DNA fragment was cloned into the pGL2-basic vector upstream of the luciferase gene. Similarly, a receptor expression vector (pEF-humanGLM01) in which the receptor gene represented by SEQ ID NO: 2 was inserted downstream of the EF-1α promoter was prepared. PC12h cells (Dev
elemental Brain Research,
6 (3), 243-250 (1983)) was inoculated into a collagen-coated culture flask (IWAKI) so as to become semi-confluent the next day, and cultured at 37 ° C. The medium contains (10% horse serum, 5% fetal calf serum, penicillin 5).
D-MEM containing 0 units / ml and streptomycin 50 μg / ml) was used. The next day, collect the prepared cells and use 2x1
Adjust to 0 ⁵ cells / ml. At this time, the medium contains (0.5% horse serum, 0.25% fetal calf serum, penicillin 50 units / ml, streptomycin 50 μg / ml).
D-MEM was used. Receptor expression vector (pEF-human GLM0
1) 50ng / well, reporter plasmid (pGL2-zif) 2
0 ng / well, 2.5 ng / well of G16 expression vector (pME-G16) and 27.5 ng / well of empty vector (pEF-106r) were added to 6 μl / well of D-MEM medium, and SuperFect reagent (QIAGEN) was added thereto.
Add 0.2 μl / well and mix. This DNA-SuperFec
100 μl / well of the prepared cell solution was added to the t solution, and the cells were seeded on a 96-well plate (IWAKI) that had been treated with collagen. As a control, an expression vector (pEF-106r) containing no receptor gene was co-transfected with the reporter plasmid under the conditions described above. After culturing at 37 ° C. for 2 days, the culture supernatant was discarded, and D-MEM medium was added at 50 μl / well. 4 hours
After culturing at 37 ° C, Monoooleoyl Phosphatidic acid (1-oleo
yl lysophosphatidic acid, hereinafter sometimes referred to as "LPA (C18: 1)". ) (Avanti Polar Lipid) to final concentration
50 μl / well was added to 1.56-100 μM.
After culturing at 37 ° C for 6 hours, the cells are treated with a phosphate buffered saline solution for 1 hour.
After washing twice, 25 μl of a cell lysis buffer (reporter lysis buffer; PROMEGA) was added to each well to lyse the cells, and a part (10 μl) of the lysate was subjected to luciferase activity measurement. Luciferase activity was measured using a luciferase reporter gene assay kit (Boehringer Mannheim) as a substrate and a LUMINOUS CT-9000D (DI
A-IATRON). When GLM01 was introduced, luciferase activity was shown to increase depending on the concentration of LPA (C18: 1) as compared to the control (FIG. 4). The circles in the figure are
The bar represents the standard error of the mean of three measurements.

[0034]

Example 3 Identification of Expression Cells in Human Prostate (1)
Preparation of cryosections of human prostate tissue The human prostate removed by surgery is cut into blocks of about 5 mm square and fixed at 4 ° C (4% paraformaldehyde / 0.1 M phosphate buffer [pH 7.4])
And fixed. Fix the fixed tissue block at 4 ° C.
With 10% sucrose / 0.1 M phosphate buffer [pH 7.
4], 15% sucrose / 0.1 M phosphate buffer [pH7.
4], 20% sucrose / 0.1 M phosphate buffer [pH7.
4], 30% sucrose / 0.1 M phosphate buffer [pH 7.4]
The sucrose was replaced by sucrose replacement sequentially for 30 minutes.
Sucrose-substituted human prostate tissue blocks were
It was embedded in a CT compound (Tissue-Tek, Miles Inc.) and frozen by immersion in isopentane cooled with liquid nitrogen. CRYOCUT frozen human prostate tissue block
Cut into 6 μm-thick sections with 1800 (Leica) and add 3-aminoprop
Placed on glass slide coated with yltriethoxysilane. After air drying for 1 hour, it was dried at 45 ° C for 2 hours.

(2) Preparation of Antisense Probe A part of the gene of the present invention was amplified by a PCR method so that a T7 promoter was added to its end. First, F05-F1 primer (5'-GAGGCACATGTCAATCATGAGG-3 ') (SEQ ID NO: 9) 10 picomoles, T7-AS primer (5'-TAATACGACTCACTATAGGGTT)
CTCCTGAGAGAAGC-3 ′) (SEQ ID NO: 25) 10 pmol, 0.4 μg of plasmid DNA cloned with the gene of the present invention,
Deoxynucleotide triphosphate 4 species (dATP, dCTP, dGTP,
50 μl of a reaction solution containing 6.25 nmol of each (TTP) and 2.5 units of rTaq DNA polymerase (Takara Shuzo) was prepared. The reaction solution was heated at 95 ° C for 2 minutes using GeneAmp 9600 (manufactured by PE Applied Biosystems), and then heated at 95 ° C for 30 seconds.
Perform a cycle of 55 ° C for 30 seconds and 72 ° C for 2 minutes 25 times,
Heated for minutes. The reaction solution was subjected to agarose gel electrophoresis, and a 570 bp amplified DNA fragment was separated and purified using QIAEX II (manufactured by QIAGEN). A digoxigenin-labeled RNA probe was prepared using a purified DNA fragment as a template and a DIG RNA labeling kit (manufactured by Roche Diagnostics). 200 ng of purified DNA fragment, 20 units of RNase inhibitor, 20 nmol of ATP, 20 nmol of CTP, G
TP 20 nmole, UTP 13 nmole, digoxigenin labeled U
20 μl of a reaction solution containing 7 nmoles of TP and 20 units of T7 RNA polymerase was prepared. This reaction solution was kept at 37 ° C. for 2 hours to be reacted. After adding 10 units of DNase I and keeping the temperature at 37 ° C. for 30 minutes to digest the template DNA, the reaction was stopped by adding 2 μl of 0.2 M EDTA. The reaction product was purified by the ethanol precipitation method.

(3) Preparation of Sense Probe A part of the gene of the present invention was amplified by the PCR method so that the SP6 promoter was added to the end. First, F05-R2 primer (5'-
CCCATAAAAATGGCGATGGCCCAGAC-3 ') (SEQ ID NO: 13) 10
Picomolar, SP6-S primer (5'-ATTTAGGTGACACTATAGGA
GCAACACTGATACTGTCG-3 ') (SEQ ID NO: 26) 10 pmol, plasmid DNA from which the gene of the present invention was cloned.
4 μg, deoxynucleotide triphosphate 4 species (dATP, dCTP,
dGTP, TTP), each containing 6.25 nmoles, and 2.5 units of rTaq DNA polymerase (Takara Shuzo), 50 μl
Was prepared. The reaction solution was heated at 95 ° C for 2 minutes using GeneAmp 9600 (manufactured by PE Applied Biosystems),
A cycle of 30 ° C. for 30 seconds, 55 ° C. for 30 seconds and 72 ° C. for 2 minutes was performed 25 times, and further heating was performed at 72 ° C. for 10 minutes. The reaction solution was subjected to agarose gel electrophoresis, and a 433 bp amplified DNA fragment was separated and purified using QIAEX II (manufactured by QIAGEN). Using the purified DNA fragment as a template, digoxigenin-labeled RN using a DIG RNA labeling kit (Roche Diagnostics)
A probe was prepared. 20 μl of a reaction solution containing 160 ng of the purified DNA fragment, 20 units of RNase inhibitor, 20 nmol of ATP, 20 nmol of CTP, 20 nmol of GTP, 13 nmol of UTP, 7 nmol of UTP labeled with digoxigenin, and 20 units of SP6 RNA polymerase was prepared. This reaction solution was kept at 37 ° C. for 2 hours to be reacted. Add 10 units of DNase I, 37
After digesting the template DNA by incubating at 30 ° C for 30 minutes, 0.2 M EDTA 2μ
The reaction with l was stopped. The reaction product was purified by the ethanol precipitation method.

(4) In situ hybridization Frozen sections of human prostate tissue were placed in phosphate buffered saline for 5 hours.
It was immersed and washed three times for each minute. Next, immerse in sterile distilled water
After washing, it was immersed in 0.2 N hydrochloric acid for 20 minutes. Sterile distilled water,
After sequentially immersing and washing in phosphate buffered saline, 2 μg / ml
Place Proteinase K solution on a section of human prostate tissue, 3
It was kept at 7 ° C for 15 minutes. 5 minutes each in phosphate buffered saline
It was immersed three times and washed. It was immersed in phosphate buffered saline containing 4% paraformaldehyde for 5 minutes at room temperature. After immersion and washing in phosphate buffered saline, the cells were immersed twice in phosphate buffered saline containing 2 mg / ml glycine for 15 minutes.
After immersion and washing in sterile distilled water, immersed in 50% ethanol, 70% ethanol, and 95% ethanol sequentially,
Air dried for minutes. 50% deionized formamide / 4xSSC containing 2 μg / ml probe was mounted on sections of human prostate tissue. It was placed in a wet box saturated with 0.6 M sodium chloride / 50% formamide and reacted at 4 ° C. overnight. It was immersed in 50% formamide / 2 × SSC at 50 ° C. for 1 hour for washing. 2xSSC at room temperature
For 15 minutes twice. It was immersed in 2xSSC at 55 ° C for 1 hour. It was immersed in 0.2 × SSC at 55 ° C. for 1 hour. 1x TBK buffer at room temperature (8 g / l NaCl, 0.2 g / l KCl, 3 g / l Tris base [pH
7.4]) for 10 minutes. The blocking solution was placed on a section of human prostate tissue and left at room temperature for 30 minutes. Alkaline phosphatase-labeled anti-digoxigenin antibody (manufactured by Roche Diagnostics) was diluted 500-fold with a blocking solution, placed on a section of human prostate tissue, and reacted at 4 ° C. overnight. It was immersed in 1 × TBK buffer at room temperature three times for 10 minutes each and washed. 0.1 M TrisHCl [pH9.5] /0.1 M NaCl / 50 mM
After immersion in a MgCl ₂ solution for 2 minutes, a color developing solution (manufactured by Roche Diagnostics) containing 5-bromo-4-chloro-3-indolyl phosphoric acid and nitroblue tetrazolium salt is placed on a section of human prostate tissue. The reaction was allowed to proceed for 1 hour at room temperature, protected from light. The reaction was stopped by immersion in phosphate buffered saline. It was immersed in water for washing, and immersed in a 10% formalin solution at room temperature for 1 hour. The cells were sealed, air-dried overnight, and observed under a microscope. As a result, when the antisense probe was used, FIG.
As shown in Fig. 7, color development was observed in glandular epithelial cells of human prostate tissue. However, no coloring was observed in the supporting cells (the whitish portion in the upper right part of FIG. 5). On the other hand, when the sense probe was used, no color development was observed as shown in FIG.

[0038]

Example 4 LPA (C1) against human normal prostate epithelial cells
8: 1) Effect of human normal prostate epithelial cells (PrEC, Clonetics)
With LPA, cell proliferation, basic fibroblast growth factor (bFGF) secretion, interleukin 6 (IL-6) secretion, interleukin 6 soluble receptor (IL-6 sR)
Secretion, endothelin-1 (ET-1) secretion, PSA (prosta
te specific antigen) secretion, TGF (transforming grow)
th factor) -beta1 secretion and vascular endothelial growth factor (VE
GF) Changes in secretion were measured. Of these, cell proliferation,
Interleukin 6 (IL-6) secretion, endothelin-1
(ET-1) A remarkable effect was observed on the secretion amount. PrEC on day 1
Using PrEGM medium (Clonetics; BPE, hydrocortisone, human EGF, epinephrine, transferrin, insulin, retinoic acid, triiodothyronine, GA-100
Was added to each well of a 6-well multiplate and inoculated at a concentration of 5 × 10 ⁴ / ml. On the second day, the medium was removed and fresh PrEGM medium or LPA (1-oleoyl-2-hydroxy-sn-glycero-3-phosphat
e; 2 ml each of a PrEGM medium supplemented with 10 μM (Avanti Polar Lipids). On day 5, the medium was removed and cells were washed with 1 ml of phosphate buffered saline. To this, 0.5 ml of a trypsin EDTA solution was added to release the cells. The removed medium was used to measure bFGF secretion, IL-6 secretion, endothelin-1 secretion, and VEGF secretion. The released cells are suspended in ISOTON II (Beckman Coulter), and Coulter Counter ZM type (formerly Coulter,
(Current Beckman Coulter) was used to count the number of cells. FIG. 7 shows the average value and standard error of three measurements. The cell number was reduced when LPA was added. In addition, the measurement of the amount of IL-6 in the medium was performed using
-6 immunoassay kit (manufactured by R & D Systems) using sandwich ELISA method, IL-6 concentration pg /
Expressed in ml. FIG. 8 shows the average value and standard error of three measurements. The IL-6 concentration increased when LPA was added. The amount of ET-1 in the medium was measured by a sandwich ELISA method using a human ET-1 ELISA system (manufactured by Amersham Pharmacia Biotech), and the ET-1 concentration f in the medium was determined.
Expressed in mole / ml. FIG. 9 shows the average value and standard error of three measurements. The ET-1 concentration increased when LPA was added.

[0039]

INDUSTRIAL APPLICABILITY The present invention is extremely useful for the development of a medicament which can be used for diagnosis, treatment and prevention of prostate diseases. That is, by utilizing the G protein-coupled receptor of the present invention, it has become possible to screen for an antagonist of the G protein-coupled receptor. In addition, by using the G protein-coupled receptor of the present invention and its ligand lysophosphatidic acid, it has become possible to easily screen for an agonist of the G protein-coupled receptor.

[0040]

[Sequence List] SEQUENCE LISTING <110> Japan Tobacco Inc. <120> New G protein couppled receptor, gene and using there <130> J99-0083 <140> <141> <150> JP P1998-174731 <151> 1998- 06-22 <160> 26 <170> PatentIn Ver. 2.0 <210> 1 <211> 353 <212> PRT <213> Homo sapiens <400> 1 Met Asn Glu Cys His Tyr Asp Lys His Met Asp Phe Phe Tyr Asn Arg 1 5 10 15 Ser Asn Thr Asp Thr Val Asp Asp Trp Thr Gly Thr Lys Leu Val Ile 20 25 30 Val Leu Cys Val Gly Thr Phe Phe Cys Leu Phe Ile Phe Phe Ser Asn 35 40 45 Ser Leu Val Ile Ala Ala Val Ile Lys Asn Arg Lys Phe His Phe Pro 50 55 60 Phe Tyr Tyr Leu Leu Ala Asn Leu Ala Ala Ala Asp Phe Phe Ala Gly 65 70 75 80 Ile Ala Tyr Val Phe Leu Met Phe Asn Thr Gly Pro Val Ser Lys Thr 85 90 95 Leu Thr Val Asn Arg Trp Phe Leu Arg Gln Gly Leu Leu Asp Ser Ser 100 105 110 Leu Thr Ala Ser Leu Thr Asn Leu Leu Val Ile Ala Val Glu Arg His 115 120 125 Met Ser Ile Met Arg Met Arg Val His Ser Asn Leu Thr Lys Lys Arg 130 135 140 Val Thr Leu Leu Ile Leu Leu Val Trp Ala Ile Ala Ile Phe Met Gly 145 150 155 160 Ala Val Pro Thr Leu Gly Trp Asn Cys Leu Cys Asn Ile Ser Ala Cys 165 170 175 Ser Ser Leu Ala Pro Ile Tyr Ser Arg Ser Tyr Leu Val Phe Trp Thr 180 185 190 Val Ser Asn Leu Met Ala Phe Leu Ile Met Val Val Val Tyr Leu Arg 195 200 205 Ile Tyr Val Tyr Val Lys Arg Lys Thr Asn Val Leu Ser Pro His Thr 210 215 220 Ser Gly Ser Ile Ser Arg Arg Arg Thr Pro Met Lys Leu Met Lys Thr 225 230 235 240 Val Met Thr Val Leu Gly Ala Phe Val Val Cys Trp Thr Pro Gly Leu 245 250 255 Val Val Leu Leu Leu Asp Gly Leu Asn Cys Arg Gln Cys Gly Val Gln 260 265 270 His Val Lys Arg Trp Phe Leu Leu Leu Ala Leu Leu Asn Ser Val Val 275 280 285 Asn Pro Ile Ile Tyr Ser Tyr Lys Asp Glu Asp Met Tyr Gly Thr Met 290 295 300 Lys Lys Met Ile Cys Cys Phe Ser Gln Glu Asn Pro Glu Arg Arg Pro 305 310 315 320 Ser Arg Ile Pro Ser Thr Val Leu Ser Arg Ser Asp Thr Gly Ser Gln 325 330 335 Tyr Ile Glu Asp Ser Ile Ser Gln Gly Ala Val Cys Asn Lys Ser Thr 340 345 350 Ser <210> 2 <211> 1059 <212> DNA < 213> Homo sapiens <40 0> 2 atgaatgagt gtcactatga caagcacatg gacttttttt ataataggag caacactgat 60 actgtcgatg actggacagg aacaaagctt gtgattgttt tgtgtgttgg gacgtttttc 120 tgcctgttta tttttttttc taattctctg gtcatcgcgg cagtgatcaa aaacagaaaa 180 tttcatttcc ccttctacta cctgttggct aatttagctg ctgccgattt cttcgctgga 240 attgcctatg tattcctgat gtttaacaca ggcccagttt caaaaacttt gactgtcaac 300 cgctggtttc tccgtcaggg gcttctggac agtagcttga ctgcttccct caccaacttg 360 ctggttatcg ccgtggagag gcacatgtca atcatgagga tgcgggtcca tagcaacctg 420 accaaaaaga gggtgacact gctcattttg cttgtctggg ccatcgccat ttttatgggg 480 gcggtcccca cactgggctg gaattgcctc tgcaacatct ctgcctgctc ttccctggcc 540 cccatttaca gcaggagtta ccttgttttc tggacagtgt ccaacctcat ggccttcctc 600 atcatggttg tggtgtacct gcggatctac gtgtacgtca agaggaaaac caacgtcttg 660 tctccgcata caagtgggtc catcagccgc cggaggacac ccatgaagct aatgaagacg 720 gtgatgactg tcttaggggc gtttgtggta tgctggaccc cgggcctggt ggttctgctc 780 ctcgacggcc tgaactgcag gcagtgtggc gtgcagcatg tgaaaaggtg gttcctgctg 840 ctggcgctgc tcaac tccgt cgtgaacccc atcatctact cctacaagga cgaggacatg 900 tatggcacca tgaagaagat gatctgctgc ttctctcagg agaacccaga gaggcgtccc 960 tctcgcatcc cctccacagt cctcagcagg agtgacacag gcagccagta catagaggat 1020 agtattagcc aaggtgcagt ctgcaataaa agcacttcc 1059 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed nucleic acid sequence for primer. <400> 3 arcytvctgg cyatygcmrt bga 23 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed nucleic acid sequence for primer. <220> <221> modified_base <222> (3) .. (8) <223> positions at 3, 5, 8 mean i <400> 4 aknknrynsa krcarttcca gcc 23 <210> 5 <211> 20 < 212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed nucleic acid sequence for primer. <220> <221> modified_base <222> (11) <223> positioned at 11 means i <400> 5 gbgybttyat nryctgctgg 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description o f Artificial Sequence: Designed nucleic acid sequence for primer. <220> <221> modified_base <222> (13) <223> position at 13 means i <400> 6 gayrgsgtts rtnssdgagt t 21 <210> 7 <211> 118 <212 > DNA <213> Homo sapiens <400> 7 gaggcacatg tcaatcatga ggatgcgggt ccatagcaac ctgaccaaaa agagggtgac 60 actgctcatt ttgcttgtct gggccatcgc catttttatg ggggcggtcc ccacactg 118 <210> 8 <g> cc <tg> gcaggcagtg tggcgtgcag 60 catgtgaaaa ggtggttcct gctgctggcg ctgctc 96 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed nucleic acid sequence for primer. <400> 9 gaggcacatg tcaatcatgagg 22 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed nucleic acid sequence for primer. <400> 10 gagcagcgcc agcagcagga ac 22 <210> 11 <211 > 475 <212> DNA <213> Homo sapiens <400> 11 gaggcacatg tcaatcatga ggatgcgggt ccatagcaac ctgaccaaaa agag ggtgac 60 actgctcatt ttgcttgtct gggccatcgc catttttatg ggggcggtcc ccacactggg 120 ctggaattgc ctctgcaaca tctctgcctg ctcttccctg gcccccattt acagcaggag 180 ttaccttgtt ttctggacag tgtccaacct catggccttc ctcatcatgg ttgtggtgta 240 cctgcggatc tacgtgtacg tcaagaggaa aaccaacgtc ttgtctccgc atacaagtgg 300 gtccatcagc cgccggagga cacccatgaa gctaatgaag acggtgatga ctgtcttagg 360 ggcgtttgtg gtatgctgga ccccgggcct ggtggttctg ctcctcgacg gcctgaactg 420 caggcagtgt ggcgtgcagc atgtgaaaag gtggttcctg ctgctggcgc tgctc 475 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed sequence for primer. <400> 12 cagtgtgggg accgccccca ta 22 <210> 13 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed nucleic acid sequence for primer. <400> 13 cccataaaaa tggcgatggc ccagac 26 <210> 14 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed sequence for primer. <400> 14 ggcctggtgg t tctgctcct cgacgg 26 <210> 15 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed sequence for primer. <400> 15 ctttttggtc aggttgctat ggacccgc 28 <210> 16 <211 > 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed sequence for primer. <400> 16 aaggtggttc ctgctgctgg cgctgc 26 <210> 17 <211> 487 <212> DNA <213> Homo sapiens <400> 17 ccgctcccgg gctcggcggc gcgggtgaac gtgagcggat gttcacttct tctccacaat 60 gaatgagtgt cactatgaca agcacatgga ctttttttat aataggagca acactgatac 120 tgtcgatgac tggacaggaa caaagcttgt gattgttttg tgtgttggga cgtttttctg 180 cctgtttatt tttttttcta attctctggt catcgcggca gtgatcaaaa acagaaaatt 240 tcatttcccc ttctactacc tgttggctaa tttagctgct gccgatttct tcgctggaat 300 tgcctatgta ttcctgatgt ttaacacagg cccagtttca aaaactttga ctgtcaaccg 360 ctggtttctc cgtcaggggc ttctggacag tagcttgact gcttccctca ccaacttgct 420 ggttatcgcc gtggagaggc acatgtcaat catgaggatg cgggtccata gcaacctgac 480 caaaaag 487 <210> 18 <211> 680 <212> DNA <213> Homo sapiens <400> 18 aaggtggttc ctgctgctgg cgctgctcaa ctccgtcgtg aaccccatca tctactccta 60 caaggacgag gacatgtatg gcaccatgaa gaagatgatc tgctgcttct ctcaggagaa 120 cccagagagg cgtccctctc gcatcccctc cacagtcctc agcaggagtg acacaggcag 180 ccagtacata gaggatagta ttagccaagg tgcagtctgc aataaaagca cttcctaaac 240 tctggatgcc tctcggccca cccaggcctc ctctgggaaa agagctgtta agaatgatta 300 cctgtctcta acaaagccca tgtacagtgt tatttgaggt ctccattaat cactgctaga 360 tttctttaaa aaattttttt tcatagttta aaagcatggg cagtaaagag aggacctgct 420 gcatttagag aaagcacaga aacgggagag gttcggcggg tccctgcttg tcctatgaac 480 tgctcagagc tcctgtcagt ccagctgggc cttctgggtt ctggcaccat ttcgtagcca 540 ttctctttgt attttaaaag gacgttatga aagggcttag accaaaataa atcataatgt 600 tacttgagcc accttatata gctgcttgga gagtctatgt agttctttct gcatgcatta 660 aaaatgttta gaaatgcttc 680 <210 > 19 <211> 1562 <212> DNA <213> Unknown <220> <223> Description of Unknown Organism: Hypothetical nucleic acid sequence by assembling SEQ ID 17 and 18. <400> 19 ccgctcccgg gctcggcggc gcgggtgaac gtgagcggat gttcacttct tctccacaat 60 gaatgagtgt cactatgaca agcacatgga ctttttttat aataggagca acactgatac 120 tgtcgatgac tggacaggaa caaagcttgt gattgttttg tgtgttggga cgtttttctg 180 cctgtttatt tttttttcta attctctggt catcgcggca gtgatcaaaa acagaaaatt 240 tcatttcccc ttctactacc tgttggctaa tttagctgct gccgatttct tcgctggaat 300 tgcctatgta ttcctgatgt ttaacacagg cccagtttca aaaactttga ctgtcaaccg 360 ctggtttctc cgtcaggggc ttctggacag tagcttgact gcttccctca ccaacttgct 420 ggttatcgcc gtggagaggc acatgtcaat catgaggatg cgggtccata gcaacctgac 480 caaaaagagg gtgacactgc tcattttgct tgtctgggcc atcgccattt ttatgggggc 540 ggtccccaca ctgggctgga attgcctctg caacatctct gcctgctctt ccctggcccc 600 catttacagc aggagttacc ttgttttctg gacagtgtcc aacctcatgg ccttcctcat 660 catggttgtg gtgtacctgc ggatctacgt gtacgtcaag aggaaaacca acgtcttgtc 720 tccgcataca agtgggtcca tcagccgccg gaggacaccc atgaagctaa tgaagacggt 780 gatgactgtc ttaggggcgt ttgtggtatg ctggaccccg ggcctggtgg ttctgctcct 840 cgacggcctg aactgcaggc agtgtggcgt gcagcatgtg aaaaggtggt tcctgctgct 900 ggcgctgctc aactccgtcg tgaaccccat catctactcc tacaaggacg aggacatgta 960 tggcaccatg aagaagatga tctgctgctt ctctcaggag aacccagaga ggcgtccctc 1020 tcgcatcccc tccacagtcc tcagcaggag tgacacaggc agccagtaca tagaggatag 1080 tattagccaa ggtgcagtct gcaataaaag cacttcctaa actctggatg cctctcggcc 1140 cacccaggcc tcctctggga aaagagctgt taagaatgat tacctgtctc taacaaagcc 1200 catgtacagt gttatttgag gtctccatta atcactgcta gatttcttta aaaaattttt 1260 tttcatagtt taaaagcatg ggcagtaaag agaggacctg ctgcatttag agaaagcaca 1320 gaaacgggag aggttcggcg ggtccctgct tgtcctatga actgctcaga gctcctgtca 1380 gtccagctgg gccttctggg ttctggcacc atttcgtagc cattctcttt gtattttaaa 1440 aggacgttat gaaagggctt agaccaaaat aaatcataat gttacttgag ccaccttata 1500 tagctgcttg gagagtctat gtagttcttt ctgcatgcat taaaaatgtt tagaaatgct 1560 tc 1562 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed nucleic acid sequence for primer. <400> 20 cgggttaacg tgagcggatg ttc 23 <210> 21 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed nucleic acid sequence for primer. <400> 21 tttctagagg aggcctgggt ggg 23 <210> 22 <211> 1127 <212> DNA <213> Homo sapiens <400> 22 aacgtgagcg gatgttcact tcttctccac aatgaatgag tgtcactatg acaagcacat 60 ggactttttt tataatagga gcaacactga tactgtcgat gactggacag gaacaaagct 120 tgtgattgtt ttgtgtgttg ggacgttttt ctgcctgttt attttttttt ctaattctct 180 ggtcatcgcg gcagtgatca aaaacagaaa atttcatttc cccttctact acctgttggc 240 taatttagct gctgccgatt tcttcgctgg aattgcctat gtattcctga tgtttaacac 300 aggcccagtt tcaaaaactt tgactgtcaa ccgctggttt ctccgtcagg ggcttctgga 360 cagtagcttg actgcttccc tcaccaactt gctggttatc gccgtggaga ggcacatgtc 420 aatcatgagg atgcgggtcc atagcaacct gaccaaaaag agggtgacac tgctcatttt 480 gcttgtctgg gccatcgcca tttttatggg ggcggtcccc acactgggct ggaattgcct 540 ctgcaacatc tctgcctgct cttccctggc ccccatttac agcaggagtt accttgtttt 600 ctggacagtg tccaacctca tggccttcct catcatggtt gtggtgtacc tgcggatcta 660 cgtgtacgtc aagaggaaaa ccaacgtctt gtctccgcat acaagtgggt ccatcagccg 720 ccggaggaca cccatgaagc taatgaagac ggtgatgact gtcttagggg cgtttgtggt 780 atgctggacc ccgggcctgg tggttctgct cctcgacggc ctgaactgca ggcagtgtgg 840 cgtgcagcat gtgaaaaggt ggttcctgct gctggcgctg ctcaactccg tcgtgaaccc 900 catcatctac tcctacaagg acgaggacat gtatggcacc atgaagaaga tgatctgctg 960 cttctctcag gagaacccag agaggcgtcc ctctcgcatc ccctccacag tcctcagcag 1020 gagtgacaca ggcagccagt acatagagga tagtattagc caaggtgcag tctgcaataa 1080 aagcacttcc taaactctgg atgcctctcg gcccacccag gcctcct 1127 <210> 23 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed nucleic acid sequence for primer <400> 23 agagagggcgcccag ct 32 <210> 24 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed nucleic acid sequence for primer <400> 24 agagagaagc ttgaagctac tgagggcaca ct 32 <210> 25 < 211> 36 <212> DNA <21 3> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed nucleic acid sequence for primer <400> 25 taatacgact cactataggg ttctcctgag agaagc 36 <210> 26 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed nucleic acid sequence for primer <400> 26 atttaggtga cactatagga gcaacactga tactgtcg 38

[Brief description of the drawings]

FIG. 1 is a diagram showing the expression status of mRNA analyzed by dot blotting performed to examine the expression distribution of the receptor of the present invention.

FIG. 2 is a diagram inferring an amino acid sequence and a base sequence of a receptor of the present invention and a seven-transmembrane region.

[FIG. 3] An evolutionary phylogenetic tree based on the amino acid sequence of a gene group highly homologous to GLM01 was created using an evolutionary phylogenetic tree creation program, SINCA (Fujitsu).

FIG. 4 shows that the G protein-coupled receptor of the present invention increases luciferase activity in a concentration-dependent manner by 1-oleoyl lysophosphatidic acid.

FIG. 5 is a diagram showing the expression status of human prostate tissue mRNA by in situ hybridization using an antisense probe.

FIG. 6 is a diagram showing the expression status of mRNA in human prostate tissue by in situ hybridization using a sense probe.

FIG. 7 is a diagram showing the results of examining changes in the number of cells by allowing 1-oleoyl lysophosphatidic acid to act on human prostate epithelial cells.

FIG. 8 is a graph showing the results obtained by reacting 1-oleoyl lysophosphatidic acid on human prostate epithelial cells and examining changes in the concentration of IL-6 in the medium.

FIG. 9 is a diagram showing the results of examining changes in the concentration of ET-1 in the medium by allowing 1-oleoyl lysophosphatidic acid to act on human prostate epithelial cells.

Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat II (Reference) C12Q 1/68 C12Q 1/68 A G01N 33/15 G01N 33/15 Z 33/50 33/50 Z 33/53 33 / 53 D 33/566 33/566 // (C12N 1/21 C12R 1:19)

Claims (24)

[Claims] 1. A G protein-coupled receptor protein comprising the amino acid sequence represented by SEQ ID NO: 1, or a lysophosphatidine comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in SEQ ID NO: 1. A G protein-coupled receptor protein having an acid as a ligand. 2. A protein comprising a G protein-coupled receptor protein consisting of the amino acid sequence represented by SEQ ID NO: 1, or
One or several amino acids are deleted in SEQ ID NO: 1,
A protein comprising a G protein-coupled receptor protein having a lysophosphatidic acid having a substituted or added amino acid sequence as a ligand. 3. A partial peptide of the G protein-coupled receptor protein according to claim 1. 4. A DNA encoding a G protein-coupled receptor protein consisting of the amino acid sequence represented by SEQ ID NO: 1, or an amino acid sequence in which one or several amino acids are deleted, substituted or added in SEQ ID NO: 1. DNA encoding a G protein-coupled receptor comprising lysophosphatidic acid as a ligand. 5. A DNA containing a DNA encoding a G protein-coupled receptor protein consisting of the amino acid sequence represented by SEQ ID NO: 1, or one or several amino acids in SEQ ID NO: 1 are deleted, substituted or added. DNA containing a DNA encoding a G protein-coupled receptor having lysophosphatidic acid as a ligand, the amino acid sequence comprising: 6. A partial DNA of the G protein-coupled receptor protein DNA according to claim 4. 7. A G protein-coupled receptor protein DNA represented by SEQ ID NO: 2. 8. A vector comprising the DNA according to claim 4. 9. A transformant carrying the vector according to claim 8. (10) culturing the transformant according to (9),
A method for producing a G protein-coupled receptor protein, which comprises producing and isolating a G protein-coupled receptor protein on the cell membrane of a transformant. 11. A system for expressing a G protein-coupled receptor protein according to claim 1 or a partial peptide according to claim 3, wherein a test sample is acted on to express the G protein-coupled receptor or the peptide. 2. The method for screening an agonist for a G protein-coupled receptor protein according to claim 1, wherein the signal is detected. An agonist selected by the screening method according to claim 11. 13. An agonist selected by the screening method according to claim 11, which is a compound selected from lysophosphatidic acid. 14. A system for expressing the G protein-coupled receptor protein according to claim 1 or the partial peptide according to claim 3, wherein (A) only the ligand of the G protein-coupled receptor is acted on. (B) The method for screening for an antagonist of a G protein-coupled receptor protein according to claim 1, wherein the system is compared with a case where a ligand of the G protein-coupled receptor and a test sample are allowed to act on the system. 15. A method for screening an antagonist of a G protein-coupled receptor protein, wherein the ligand according to claim 14 is a compound selected from lysophosphatidic acid. 16. An antagonist selected by the screening method according to claim 14 or 15. 17. A probe comprising a DNA fragment having a sequence of at least 15 consecutive nucleotides in a nucleotide sequence encoding the G protein-coupled receptor protein according to claim 1 or a nucleotide sequence complementary thereto. 18. A G protein-coupled receptor gene cloned by the probe according to claim 17. 19. A G protein-coupled receptor protein corresponding to the gene encoding the G protein-coupled receptor protein according to claim 18. 20. A primer having two regions satisfying the following conditions from a nucleotide sequence encoding the G protein-coupled receptor protein of SEQ ID NO: 1 or a nucleotide sequence complementary thereto. 1) The length of the primer is 15 to 40 bases. 2) The ratio of guanine and cytosine in the primer is 40% to 60%. 3) The distribution of adenine, thymine, guanine and cytosine in the primer sequence is not partially biased. 4) The distance on the base sequence of the G protein-coupled receptor protein DNA corresponding to the selected primer is 100 to 3000 bases. And 5) no complementary sequence exists between each primer itself or between the two primers. 21. A gene encoding a G protein-coupled receptor protein cloned by the primer according to claim 20. 22. A G protein-coupled receptor protein corresponding to the G protein-coupled receptor protein gene according to claim 21. 23. An antibody against the G protein-coupled receptor protein according to claim 1 or the partial peptide according to claim 3. 24. A G protein-coupled type wherein a substance to be detected is present in a detection system containing the antibody according to claim 23, and the degree of reaction between the substance to be detected and the antibody is measured. A method for detecting a receptor protein.