IE940005L - Pichia pastoris alcohol oxidase II regulatory region - Google Patents

Description

sJ vJ 4PPL3CATSOW No........ . •w a a 0 S O u m o«yi) wwm «Dffi®OH«1tB»flu(ih#.^#JB f 3. 1 PICHIA PASTORIS ALCOHOL OXIDASE II REGULATORY REGION This invention relates to the field of recombinant DNA biotechnology. In one of its aspects the invention relates to DNA sequences which regulate the transcription of DMA. In another aspect the invention relates to vectors which incorporate the above-described DNA 5 sequences. In yet another aspect, the invention relates to aovel cells transformed with the above-described vectors.

The present invention relates generally to the manipulation of genetic material, particularly to the regulation of the frequency of transcription of RNA from DNA. This invention specifically relates to a 10 regulatory region of the Pichia pastoris alcohol oxidase II gene.

Background of the Invention As recombinant DNA biotechnology has developed in recent years, the controlled production by cells of an enormous variety of useful polypeptides has become possible. Many eukarvotic polypeptides, for 15 example human growth hormone, leukocyte interferons, human insulin and human proinsulin have been produced by various microorganisms. The continued application of techniques already in hand is expected in the future to permit recombinant production of a variety of other useful polypeptide products.

The basic techniques employed in the field of recombinant technology are known by those of skill in the art. The elements desirably present for the practice of recombinant DNA biotechnology include, but are not limited to: (1) a gene encoding one or more desired polypeptide(s), operably linked (operably linked refers to 2 juxtaposition wherein the components are configured so as to perform their usual function) with adequate control sequences required for expression in the host cell; (2) a vector, usually a plasmid into which a nucleotide sequence can be inserted; a vector is any nucleotide sequence-containing construct capable of transforming a host; (3) a suitable host into which the desired nucleotide sequence can be transferred, where the host also has the cellular apparatus to 10 allow expression of the information coded for by the transferred nucleotide sequence.

A basic element employed in recombinant technology is the plasmid, which is circular extrachromosomal double-stranded DNA first found in microorganisms. Plasmids have been found to occur in multiple 15 copies per cell. In addition to naturally occurring plasmids, a variety of man-made plasmids have been prepared. Included in the plasmid is information required for plasmid reproduction, i.e., an autonomous replicating sequence and/or an origin of replication. One or more means of phenotypically selecting the plasmid in transformed cells may also be 20 included in the information encoded in the plasmid. The phenotypic or marker selection characteristics, such as resistance to antibiotics, permit clones of the host cell containing the plasmid of interest to be recognized and selected for by preferential growth of the cells in selective media. Vectors or plasmids may be specifically cleaved by one 25 or more restriction eadoaucleases or restriction enzymes «, each of which recognizes a specific nucleotide sequence. Thereafterp a regulatory region operably linked to a heterologous gene, i.e.s a gene not naturally occurring in combination with the regulatory region,, or other nucleotide sequences may be inserted by operably linking the desired genetic 30 material at the cleavage site or at reconstructed ends adjacent to the cleavage site.

The vector is then introduced into a host cell, where its nucleotide sequence may direct the host to perform various processes or functions. A few examples include expressing heterologous polypeptides 35 or over-expressing homologous or heterologous polypeptides. The process of nucleotide introduction into the host cell is generally termed transformation. Large quantities of the vector may be obtained by introducing the vector into a suitable host to increase its copy number.

A host cell commonly used to increase the copy number of the vector is L •» coli. The vectors &xe then isolated from the first host and introduced into a second host cell isx which the desired vector-directed activities * will occur, for example the production of a polypeptide. The production of an end product from DMA in this fashion is referred to as ejcpressioa.

When the geae is properly inserted in the vector with reference to the 10 portions of the vector which govern transcription and translation of the encoded nucleotide sequence, the resulting vector can be used to direct the production of the polypeptide sequence for which the inserted gene codes.

Expression is controlled by a regulatory region. Regulatory 15 regions are heterogeneous nucleotide sequences which respond to various stimuli and affect the frequency of MA transcription. Expression may be switched on or off in response to stimuli. Expression being switched on in response to a stimuli is commonly referred to as derepression or induction. A few examples of inducible expression systems are the A0X1 20 system in Pichia pastoris, the estrogen systems in Xenopus laevis, and the raetallothioaein systems in monkeys, humans, hamsters, mice and rats.

Inducible expression systems are usually under more stringent control than constitutive systems. These systems are well suited for genetic engineering purposes. la practice, the use of recombinant DNA biotechnology may create cells capable of expressing heterologous nucleotide sequences. Heterologous nucleotide sequences are nucleotide sequences which do not naturally occur in the host. Examples of which would be new combinations of regulatory regions naturally occurring within the host with structural 30 genes not naturally associated with this regulatory region. Another example would be the combination of a regulatory region with a gene not naturally occurring in the host. The heterologous polypeptide may be produced as a fusion polypeptide, i.e., a heterologous polypeptide fused > to a portion of the amino acid sequence of a homologous or heterologous 35 polypeptide. The initially obtained fusion polypeptide product is 4 sometimes produced in an inactive form until the fused polypeptide is cleaved ia an extracellular environment.

As was previously disclosed in. European patent application 86114700.7 (incorporated herein by reference) the Pichia pastoris genome 5 encodes two functional alcohol oxidase genes AOXl and &0X2.

We have now dis,covered a 5' regulatory region associated with the AOX2 structural gene. This regulatory region is inducible by methanol or by carbon source starvation. However, the maximum level of expression from the A0X2 regulatory region is only about S%-11% of that 10 of the AQX1 regulatory region (A0X1 gene was disclosed in European patent application 85201235.0 incorporated herein by reference).

The A0X2 regulatory region can be employed to express heterologous genes and is particularly useful in those situations where high level expression of a protein. is disadvantageous.

Summary of the Invention In accordance with the present invention, we have discovered, isolated and characterized a DM sequence which regulates the frequency of the transcription of DN& into RMA. The novel DNA sequences of this invention are useful for the production of polypeptide products by 20 methylotrophic yeasts such as Pichia pastoris.

Brief Description of the Figures Figure 1 provides the restriction map of the AOXi (a) and £0X2 (b) genes.

Figure 2 provides a restriction sap of the pBR322.

Figure 3 provides a restriction map of pYJS.

Figure 4 provides a restriction map of plasmid pYM5.

Figure provides a restriction map of plasmid pHR4.

Figure 6 provides a flow chart of the construction of Figure 7 provides a restriction map of plasmid pBPfl. »> 30 Figure 8 provides a restriction map of plasmid pYJ55. pYJ55.

Figure 9 provides a flow chart of the construction of plasmid Figure 20 provides s restriction map of plasmid pSA0H5. Detailed Description of the Invention In accordance with the present invention, there is provided a novel DM sequence containing a regulatory region responsive to at least one of the following conditions: the presence of methanol in the host environment or carbon source starvation when the host cell is grown on substrates other than methanol. The regulatory region of this invention is capable of controlling the frequency of transcription of RNA when operably linked at the 5' end of a DNA sequence which codes for the production of mRM.

In accordance with still another embodiment of the present invention, plasmids and transformed organisms containing the above-described DNA sequences and methods for producing the same are provided.

These and other objects of the invention will become apparent from the disclosure and claims herein provided.

I. Characterization of the Alcohol Oxidase Regulatory Region The complete A0X2 gene is contained within the restriction map provided in Figure 1(b). The A0X2 regulatory region is contained between the first EcoRI site from the 5' end and the start codoo, of the A0X2 structural gene as shown by the restriction map of Figure 1(b). The portion of the DM sequence encoding the alcohol oxidase II protein is indicated by the heavy bar under the restriction map. A restriction map of the alcohol oxidase I gene is provided for comparison of the two genes, Figure 1(a). No significant sequence homology was observed outside the protein-coding portion of the genes.

The A0X2 regulatory region has been further characterized by a lacZ fusion construct, to require no more than from about base pair -1500 to about base pair -1 for regulatory activity (as shown in Table 1). The 6 nucleotide sequence for a DMA fragment containing the A0X2 regulatory region is provided in Table 1.

Table 1 A0X2 Regulatory Region and 5' Untranslated Region -1750 -1730 -1710 ggatctcammcctmgtacttcatttgaatataactctgcacctaaatttacacctaa -1690 -1670 -1650 ctctciatctaggctctagatttgatagattctatagcctttggtttgttatagtgttca -1630 -1610 -1590 ccaactggatgtcctaacgaaatggttctgtggtctagttggttatggcatatgcttaac -1570 -1550 -1530 acgcataacgtccccagttcgatcctgggcagaatcattattttttgaccgaattctttt -1510 -1490 -1470 tttcagaccatatgaccggtccatcttctacggggggattatctatgctttgacctctat -1450 -1430 -1410 cttgattcttttatgattcaaatcacttttacgttatttattacttactggttatttact -1390 -1370 -1350 tagcgccttttctgaaaaacatttactaaaaatcatacatcggcactctcaaacacgaca -1330 -1310 -1290 gattgtgatcaaga&gcagagacaatcaccactaaggttgcacatttgagccagtaggct -1270 -1250 -1230 cctmtagaggttcgatacttattttgataatacgacatattgtcttacctctgaatgtg -1210 -1190 -1170 tcmtactctctcgttcttcgtctcgtcagctaaaaatatmcacttcgagtaagatacg -1150 -1130 -1110 cccaattgmggctacgagataccagactatcactagtagaactttgacatctgctamg -1090 -1070 -1050 cagatcaaatatccatttatccagaatcaattaccttcctttagcttgtcgaaggcatga -1030 -1010 -990 3 o aaaagctacatgaamtccccatccttgaagttttgtcagcttaaaggactccatttcct -970 -950 -930 aaaatttcaagcagtcctctcaactamtttttttccattcctctgcacccagccctctt -910 -890 -870 catcaaccgtccagccttctcaaaagtccaatgtaagtagcctgcaaattcaggttacaa 7 -850 -830 -810 CCCCTCAATTTTCCATCCAAGGGCGATCCTTACAAAGTTAATATCGAACAGCAGAGACTA -790 -770 -750 AGCGAGTCATCATCACCACCCAACGATGGTGAAAAACTTTAAGCATAGATTGATGGAGGG -730 -710 -690 tgtatggcacttggcggctgcattagagtttgaaactatggggtaatacatcacatccgg -670 -650 -630 aactgatccgactccgagatcatatgcaaagcacgtgatgtaccccgtaaactgctcgga -610 -590 -570 ttatcgttgcaattcatcgtcttaaacagtacaagaaactttattcatgggtcattggac -550 -530 -510 tctgatgaggggcacatttccccaatgattttttgggaaagaaagccgtaagaggacagt -490 -470 -450 taagcgaaagagacaagacaacgaacagcaaaagtgacagctgtcagctacctagtggac -430 -410 -390 agttgggagtttccaattggttggttttgaatttttacccatgttgagttgtccttgctt -370 -350 -330 ctccttgcaaacaatgcaagttgataagacatcaccttccaagataggctatttttgtcg -310 -290 -270 cataaatttttgtctcggagtgaaaaccccttttatgtgaacagattacagaagcgtcct -250 -230 -210 acccttcaccggttgagatggggagaaaattaagcgatgaggagacgattattggtataa -190 -170 -150 aagaagcaac c aaaat c c cttatt gt c ctttt ct g atc agc at caaagaatatt gt ctt a -130 -110 -90 aaacgggcttttaactacattgttcttacacattgcaaacctcttccttctatttcggat -70 -50 -30 caactgtattgactacattgatcttttttaacgaagtttacgacttactaaatccccaca -10 aacaaatcaactgagaaaa The aox2 regulatory region is responsive to at least oae of the following conditions: the presence of methanol as the sole carbon source for methylotrophic yeast hosts, such as Pichia pastoris, or carbon source starvation of said host cells. Additionally the aqx2 regulatory region stimulates approximately 5%— 11% of the protein, production of fj-galactosidase as the A0X1 regulatory region.

II. Isolation of Alcohol Oxidase II Regulatory Region from Pichia pastoris The A0X2 regulatory region was isolated by transforming Pichia straia MC100-3 (arg4 his4 aoxl&::SARG4 aox2£,:: p his4). This strain contains a mutant copy of the Pichia HIS4 gene inserted into the A0X2 gene. MC100-3 was transformed with pYM55 a plasmid composed of a 2.7 kb Bglll fragment containing the Pichia HIS4 gene inserted at the BamHI site of pBR322. DNAs from several MC100-3 (pYM5) His* transformants were screened by Southern filter hybridization for transformants which contained pYM5 integrated with the HIS4 fragment located in the A0X2 locus of MC100-3. The DNA from one of these strains was then digested with HindiIIs which resulted in the release of a genomic fragment of about 12 kb containing 5.3 kb of the sequence 5' of the A0X2 Kpn I site, 2.7 kb of the Pichia HIS4 gene, and 4.0 fcb of pBR322. The Hindlll-cut DNA was ligated and transformed into E_^ coli. Transformants were selected by resistance to ampicillin. A plassid, pMR4, was recovered and a restriction map of this plasmid is shown in Figure 5.

III. Properties of the A0X2 Regulatory Region To compare expression of the A0X2 regulatory region to that of A0X1, &n A0X2~IacZ eirptession. vector was constructed which was as similar as possible to pSAOHS (shown in Figure 10)s an AOXl-lacZ fusion vector. The flow chart for construction of the A0X2-lac2 vector, pYJ55, is shown in Figure 9. Preliminary DNA sequence data from the 5' end of A0X2 revealed that A0X2 contains two BamHI sites in positions in the structural gene identical to those found in A0X1 structural gene. Therefore, the first step in the construction of pYJ55 was to insert a 1.8 kb Bglll-BamHI fragment which contains the A0X2 regulatory region and 45 base pairs of the amino-terminal protein-encoding sequence, into the BamHI site of pBPfl to create pYJ38. The second step was to cut pYJ38 9 with BamHI and insert the same adaptor oligonucleotide which was inserted for the construction of the AOXl-lacZ vector (5'-GATCACCCGGGT-3*) . The insertion of this adaptor destroyed the BamHI site of pYJ38 and created a new SmaX site at the point of insertion. This plasmid, pYJ45s was 5 digested with Smal, and the 1.8 kb Smal fragment containing the modified A0X2 promoter was inserted into pBPfl to create plasmid pYJ46. Plasmid pYJ46 was digested with EcoRI to remove a 0. 3kb fragment from the 5' end of the A0X2 fragment in pYJ46. The plasmid was re 11 gated to create plasmid pYJ55. A restriction map of plasmid pYJ55 is provided ia Figure 10 8.

Plasmid pYJ55 was transformed into GS115 (his£), and His+ transformants were screened for a stable His+ phenotype, indicating the presence of an integrated plasmid. Genomic DNAs from several stable His* strains were analyzed by Southern filter hybridization to confirm the 15 presence and determine the location of the plasmid.

To estimate the relative strengths of the A0X1 and A0X2 promoters, f3-galactosidase production by pYJ55 and pSA0H5 was compared by transforming these plasmids into GS115- The transformed GS115 strains were designated GS115(pYJ55) and GS115(pSA0H5) respectively. Each strain 20 contains plasmid integrated at the HIS4 locus. Cells of each strain were grown in glycerol medium, shifted to a medium without carbon source for 24 hours, and then shifted to a medium with methanol for a further 50 hours. Samples of each culture were removed at the end of each growth phase? and extracts were prepared and assayed for p-galactosidase. The 25 results of these assays are shown in Table 2.

Table 2 Comparison of p-Galactosidase Expression from A0X1- and A0X2~lacZ Fusions Strain Promoter $-Ga.lactosidase Activity (U/pg) in Carbon Source Glycerol No Carbon1 Methanol3 GS115(pSA0H5) GS115(pYJ55) A0X1 A0X2 <10 <10 955 109 6,205 739 Hy,\J3 KUc'Jiu/Vl Significant levels of p-galactosidase were not seen in glycerol-grown cells of either the AOXl-lacZ or A0X2-lacZ strains. In the medium with no carboa source, the level of activity in the AOX2-lacZ strain was 5 approximately one-tenth of that observed in the A0X1-lacZ strain. The addition of methanol to the A0X2-lacZ-containing cells resulted in levels of p-gal®ctosidase which reached about one ninth of those of the AOXl-lacZ cells. Thus, the A0X1, and A0X2 genes are regulated in a similar Manser. The one distinguishing feature is a significantly lower 10 response to methanol and carbon source starvation by the A0X2 regulatory region.

Although the introduction of the AOX2 regulatory region.-p-galactosidase gene fusion into a host yeast cell was described herein, those skilled in the art recognize it is not necessary for the practice 15 of this invention to utilize circular plasmids or the p-galactosidase structural gene. Thus, other vectors capable of being maintained in yeasts can be employed ia the utilization of this regulatory region, with other heterologous genes. Alternatively, this regulatory region operably linked to other heterologous genes can be integrated into the chroraosome 20 of the host yeast cell using integrative vectors. Additionally, functional mutants of the A0X2 regulatory region described herein, consisting of shorter DNA sequence from the 5' end, can also be used to regulate heterologous gene expression.

Examples General information pertinent to the Examples Strains Pichia pastoris Pichia pastoris Pichia pastoris NRRL Y-1H30 GS115 (his4) NRJRI Y-15851 PPF1 (arg4 his4) NRRL Y-18017 11 Pichia pastoris KM7121 (arg4 his4 aoxlA::SARG4 aox2A:;PHIS4) MRRL Y-18019 E. coli MC1061 [M^raD139 &(ara ABDIC-leu) 7679&lacX74 galU galK rpsL hsdRj Media. Buffers, and Solutions 1 M Tris buffer 121.1 g Tris base in 800 mL of Hz0; adjust pH to the desired value by adding concentrated (35%) aqueous HC1; allow solution to cool to room temperature before final pH adjustment, dilute to a final volume of 1 L.

TE buffer 1.0 mM EDTA ia 0.01 M (pH 7.4) Tris buffes ssc 0.15 M NaCl mM sodium citrate adjusted to pH 7.0 with NaOH TAE 40 acetic acid mM EDTA in 0.02 M (pH 8.3) Tris buffer •of) 12 Denhardt's solution 5 g Ficoll (5Ox) 5 g polyvinylpyrrolidone g bovine serum alburain (BSA; Pentax Fraction V) brought to a total volume to 500 mL with water 20X SSPE 20 mM EDTA 0.16 M NaOH 0.2 M NaH%P04-H20 3.6 M NaCl adjusted to pH 7.0 with NaOH LB (Lurxa-Bert&ai) 5 g Bacto-trypcoae Hum 5 g Bacto-yaast extract 2.5 g NaCl ia 1 L of water, adjusted to pH 7.5 with NaOH YPD medium 1% Bacto-yeast extract 2% Bacto-peptone 2% Dextrose YM3 medium 6.75 g yeast nitrogen base without amino acids (DIFC0) ia 1 L of water SED I M sorbitol mM EDTA 50 mM DTT 13 SCE buffer 9.1 g sorbitol 1.47 g sodium citrate 0.168 g EDTA 50 fill H20 —pH co 5.8 with HCl CaS 1 M sorbitol mM CaClg —-filter sterilize PEG solution 20% polyethylene glycol-3350 10 mM CaCl2 mM Tris-HCl (pH 7.4) —filter sterilize SOS 1 M sorbitol 0.3x YPS medium 15 10 mM CaCl2 Formamide dye mix 0.1% xyleae cylenol FF 0.2% bromophenol blue 10 mM EDTA 95% deionized formamide Top gel 76.8 g urea 24 mL acrylamide stock 8 mL 10k T3E bring to final volume of 160 mL 14 Acrylamide stock 38 g acrylamide 2 g bis(N,M-methylenebisacrylamide) add water to total volume of 100 raL Bottom gel .14.4 g urea 3.0 g sucrose 7.5 raL 10k THE 4.5 mL acrylsmide stock 0.3 0)X bromphenol blue solution (0.01 g/mL) add water to give total volume of 30 raL dideoxy: dd ATP 0.125 mM dd CTP 0.10 uM dd GT'P 0.10 mM dd TTP 0.80 mil DNTP stocks 0.5 raM dGTP 0.5 mM dCTP 0.5 mM TTP 0.5 mM dAT? IPX Kleaow Dilution Buffer 70mM Tris-HCl, pH 7.5 200mM NaCl 70mH I1gCl2 IroM EDTA IPX IMP, pH 7.5 P.1M Tris-HCl, pH 7.5 P.P5M MgClo P.075M DTT Unless otherwise specified, the above solutioas represent the basic (Ik) concentration employed. Throughout the examples, where different concentration levels are employed, that fact is indicated by referring to the solution as a multiple of the basic (Ix) concentration.

Regeneration Agar 1) Agar-KCl : 9 g Bacto-agar, 13.4 g potassium chloride, 24P raL HgP, autoclave. 2) IPs glucose: 20 g dextrose, 10P mL H20s autoclave. 3) lPx YWB: 6.75 g Yeast Nitrogen Base without amino acids, 1PP mL H2P, autoclave. (Add any desired amino acid or nucleic acid up to a concentration of 200 pg/taL before or after autoclaving.) 4) Add 30 mL of 10x glucose and 30 mL of 10:i YNB to 240 mL of the melted Agar-KCl solution. Add 0.6 mL of 0.2 mg/ml biotin and any other desired amino acid or nucleic acid to a concentration of 20 |jg/mL. Hold melted Regeneration Agar at 55~o0°C.

Growth of Pichia pastoris P. pastoris was grown ia YPD (rich) or YM3 (minimal) medium. As required, YHB medium was supplemented with carbon source (2% dextrose, 1% glycerol, or 0.5% methanol) and with 50 pg/ml of amino acid.

Sequencing 16 DNA. sequencing was by the dideoxvaucleotide chain-termination method of Sanger at al.

, PNAS 74, 5463 (1977).

The following abbreviations are used throughout the Examples EDTA ethylenediaciiae tetrsacetic acid TEMED M,N,N',N*-tecramethylenediamxae DTT dithiothreitol BSA bovine serum albumin EtBr ethidium bromide Ci Curie dATP deoxyadenosiae triphosphate dGTP deoxyguanosine triphosphate TTP thymidine triphosphate dCTP deoxycvtidine triphosphate dXTP "generic" deoxy triphosphate nucleotide oligo(dT) 8 Source: Collaborative Research, Inc.

Zymolyase 60,000 Source: Miles Laboratories Isolation of the Alcohol Oxidase II Regulatory Region Examplfe I Mating of PPF1 X KM7121. and Development of KC100-3 Pichia pastoris PPF1 (arg4 his4) (NRRL Y-18017) and KM7121 (arg4 his4 aojtlA: :SARG4 aox2A: ;PHIS4 (NRRL Y-18019) wsre each inoculated from a fresh YPD plate into a tube of sterile water. About 5 X 10' cells of each strain were mixed, sonicated briefly to break up cell clumps, and 25 spread on a GNAP agar plate (5% dextrose, 2% peptone, 1% yeast extract. 0.5% agar, 2.3% nutrient agar). An unmixed control sample of each strain 17 (approximately I X 108 cells) was treated in the same manner. The GNAJP plates were incubated at 30°C for about 24 hours and then replica-plated onto sporulation medium agar plates (0.5% Na acetate, 1% KC1, 2% agar). These plates were incubated for about 20 hours at 30°C and then 5 replica-plated onto minimal medium agar plates with ao carbon source. Methanol was fed to the cells on the minimal plates in the vapor phase.

After 5 days, about 200 colonies appeared on the minimal plate which received the mixed cells. No colonies ever developed on the *t* "¥ "T unmixed control plates, a result which suggests that the Arg His Mut 10 colonies on the mixed plate were diploid resulting from macings of PPF1 and KM7121 cells (Mut* = methanol utilization) The diploid nature of these Arg^ His' Mut' strains was confirmed by examining the AOX loci of four of these strains by Southern filter hybridization. Specific probes utilized were: pPG3.0 (NRRL B-18022)s an A0X2 specific probe; pYJ30 15 (NRRL B-15890), a HIS4 specific probe; and pPG4.0 (NRRL B-15868), an A0X1 specific probe.

To sporulate the PPF1 X KM7121 diploids, a colony (MCI00) was first recovered from the methanol medium diploid selection plate. About 1 X 106 of these cells were spread on GNAP plates and treated as 20 described for the mating procedure, except that the spoliation plate was incubated for four days at 30°C to allow the cells to complete sporulation. Spores were recovered from the plates by rinsing each plate with 5 ml of sterile water. The suspension was washed twice with 3 ml of phosphate buffer (0.1M Na^PO,*» pH 7.5). A mixture of the yeast lytic 25 ensyiaes Glusulase (Endo Laboratories9 NY) and Zymolyase (60,000 units/g; Miles Laboratories) end p-mercaptoeth.an.ol was added to final concentrations of 2% (v/v)9 0.5 rag/ml, and 0.1%, respectively, to destroy vegetative cells- The mixture was incubated for 5 hours at 30°C.

The spore preparation was then washed twice in sterile water 30 containing 0.2% Twees 80 (v/v) and resuspended ia phosphate buffer. The preparation was then treated to three 20-second cycles of sonicatioa. to break up clumps of spores. A sample of the spore preparation was then diluted and spread on non-selective master plates of minimal medium with 2.0% glucose and 50 |Jg/ml each of arginine and histidine. These were 35 incubated for 48 hours at 30°C. Each master plate was then 18 replica-plated onto the following series of minimal places: 1) glucose, -arg, -his 2) glucose, -arg, +his 3) glucose, +arg, -his and 4) glucose, *arg, +his.

After incubation for 24 hours at 30°C, the colonies were 5 e&araiaed for Arg aad His pheaotypes- Colonies which were Arg His were then tested for growth on methanol by streaking onto YNB methanol agar plates. After about one week at room temperature the plates were examined for Hut pheaotype. One Arg"*" Kis Mut strain was designated HC100-3.

Example II Transformation of Pichia pastoris Yeast cells were inoculated into about 10 ml of YPD medium and shake cultured at 30°C for 12-20 hours. The cells were then diluted to an Agoo °f about 0.01 to 0.1 and maintained in log phase in YPD medium at 15 30°C for about 6-8 hours. 100 ml of YPD medium was inoculated with 0.5 ml of the seed culture at an Agoo about 0.1 and shake cultured at 30°C for about 12-20 hours. The culture was thea harvested when ASqo was about 0.2 to 0.3 (after approximately 16-20 hours) by centrifugation using a DAMON IEC DPR-6000 centrifuge at 1500 g for 5 minutes. 20 To prepare spheroplasts„ the cells were washed once in 10 ml of sterile waiter (centrifugation was performed after each wash as described above), oace in 10 ml of freshly prepared SED, once in 10 ml of sterile 1M sorbitol, end resuspeaded ia 5 ml of SCE buffer. 5 pi of 4 mg/ml Zymolyase 60,000 (Miles Laboratories) wes added and the cells incubated 25 at 30°C for about 30 minutes.

Spheroplast formation was monitored as follows. 100 (j1 aliquots of cells were added to 900 [Jl of 5% SDS sad 900 Ml of 1H sorbitol before or just after the addition of Zymolayse, and at various times during the incubation period. The incubation was stopped at the 30 point where cells would lyse in SDS but not sorbitol. Once formed, spheroplasts were washed once ia 10 ml of sterile XM sorbitol by 19 centrifugation as: 1„000 g for 5-10 minutes, washed once in 10 ml of sterile CaS by centrifugations resuspeaded in 0.6 ml of CaS.

For the actual transformation, DNA samples in water or TE buffer were added (up to 20 [Jl total volume) to 12 X 75 mm sterile 5 polypropylene tubes. (For sma11 amounts of DMA, maximum transformation occurs using about 1 pi of 5 mg/ml sonicated E. coli DNA in each sample). 100 |Jl of spheroplasts were added to each DNA sample and incubated at room temperature for about 20 minutes. 1 ml of PEG solution was added to each sample and incubated ex room temperature for about 15 minutes. The 10 samples were centrifuged at 1,000 g for 5-10 minutes and the supernatant was discarded. The pellets were resuspended in 150 pi of SOS and incubated at room temperature fox- 30 minutes. 850 pi of sterile 1H sorbitol was added to each, and the samples were plated as described below. 10 ml of Regeneration Agar was poured per plate at least 30 minutes before transformation samples were ready. 10 ml aliquots of Regeneration Agar were also distributed to tubes in a 45~50°C bath during the period that transformation samples were in SOS. Samples were then added to the tubes, poured onto plates containing the solid bottom agar 20 layerj and incubated at 30°C for 3-5 days.

Spheroplast quality at various points was determined as follows. 10 [Jl of sample was removed and diluted 100 X by addition to 990 pi of 1M sorbitol. 10 pi of the dilution was removed, and an additional 990 [Jl aliquot of 1M sorbitol was added. 100 pi of both 25 dilutions were spread-plated on YPD agar medium to determine the concentration of uaspheroplasted whole cells remaining in the preparation. 100 (Jl of each dilution was added to 10ml of Regeneration Agar which had been supplemented with 40 pg/ral of all amino acids required by the host to determine the total regeneratable spheroplasts. 30 Good values for a transformation experiment were 1-3 X 10™ total regenerable spheroplasts/ml and about 1 X 103 whole cells/ml.

Bxaraple III Construction of HC10Q-3 (p¥H5) About 10 fig of pBR322 was digested with BamHI and dephosphoryiatec!. About 50[Jg of pYJ8 (NRRL B™ 15389) , which contains the Pichia HIS4 gene, was digested with 8gj.II. A 2.7 Kb Bglll fragment was isolated from ® 0.8% preparative agarose gel. 300 ng of the fragment and 300 ng of BamHI-digested pBH322 were ligated using 0.5 units of T& DNA ligase ia 10 Ml total volume of 66 mM Tris*C1, pH 7.4, 6.6 mM MgCIg9 10 mM DTTS and 0.4 oH ATP, for 24 hours at 4°C.

The ligation reaction was used to transform E. coli MG1061 to arnpicillia resistance as described in Example V. Traasformants were characterized by restriction digestions, and the correct insert size and orientation was verified by agarose gel electrophoresis. This plasmid was called pYM5s and was recovered from £. coli using the alkaline lysis plasmid preparation technique described in Maniatis et al (1982) (Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N„Y„).

About 10 MS of pYHS was digested with StuI prior to transformation of MC100-3. This step directed the plasmid to integrate at one of the HIS4 gene sequences present in iiC100-3 s either the native HIS4 locus or the modified A0X2 locus. Transformation was conducted according to procedures outlined in Example II.

«§* DMAs f rota several MC100-3(pYM5) His trans formants were isolated according to Example IV and screened by Southern filter hybridisation for transformants which contained p¥M5 integrated at the HIS4 fragment located at A0X2. Specific probes utilised were: pPG 3.0 (NRRL 3-18022)„ an A0X2 specific probe; pYJ30 (NRRL 3-15890), a HIS4 specific probe. 21 Properties of che Alcohol Oxidase II Regulatory Region Example IV Yeast DNA Preparation Yeast cells were grown ia 100 ml of YNB medium plus 2% dextrose 5 at 30°C until Aqoo equaled 1-2 and then pelleted using a Damon IEC DPR-6000 centrifuge at 2,000 g for 5 minutes. The pellet was washed once in dH20, once in SED, once ia 1M sorbitol and then resuspended in 5 ml of a solution of 0.1M. Tris.HCl, pH 7.0, and 1M sorbitol. The cells were then mixed with 50-100 pi of a 4 mg/ml solution of Zvmolyase 60,000 (Miles 10 Laboratories) and incubated at 30°C for 1 hour. The resulting spheroplasts were then centrifuged at 1,000 g for 5-10 minutes and suspended in 5 ml Lysis Buffer [0.1% SDS, lOmM Tris*HCl (pH 7.4), 5mM EDTA and 50mM NaCl]. Proteinase K (Boehringer Mannheim) and RNase A (Sigma) were each added to 100 pg/ml and the solution incubated at 37°C for 30 15 minutes. DNA was deproteinised by gently mixing the preparation with an equal volume of chloroform containing isoamyl alcohol (24:1, v/v), and the phases were separated by centrifugation at 12,000 g for 20 minutes. The upper (aqueous) phase was drawn off into a fresh tube and extracted with an equal volume of phenol/chloroform/isoamyl alcohol. The phases 20 were separated &s before aad the top phase placed ia a tube containing 2-3 volumes of cold 100% ethaaol. The sample was gently mixed sad DNA was collected by spooling onto a plastic.rod. The DNA was immediately dissolved in I ml of TE buffer and dialyzed overnight at 4°C against 100 volumes TE buffer.

Example V Construction of pMR4 DNA was isolated according to the method of Example IV from a MC100-3(pYM5) His transformant generated in Example III. 10 pg of this genomic DNA was digested with Hindlll and ligated. The ligation reaction 22 was carried out at 4°C for 24 hours in 66 mil Tris.HCl, pH 7.4 6.6 rr^I MgClj;, 10 rail DTTS 0.4 mM ATP, and 0.5 units of T4 DMA ligase.

The Ligation mix was transformed directly into E. coli MCI061 cells, which had been made competent for transformation and transformed 5 as described by Maniatis et al. (1982). Selection for ampicillin resistance was performed by culturing the cells in either LB medium or 2B medium (0.2% MH4P04, 1.2% Na2HP04, 0.013% MgS04-7H209 0.074% CaCl2-2H20, 1 |jg/ml thiamine, 0.4% dextrose) supplemented with 50 pg/ml amoicillia.

A 12.0 Kb plasmid designated pMR4 was recovered according to 10 Maniatis et al. (1982). This plasmid contained 5.3 Kb of DNA 5s of the A0X2 Kpnl sites 2.7 Kb of the Pichia HIS4 gene and 4.0 Kb of pBR322.

Example VI Construction of pYJ55 In order to determine the regulation aad expression of the A0X2 15 promoter, a vector containing the A0X2 5' sequence fused to the E. coli lacZ gene was constructed. 50 pg of pMR4 (Example V) was digested with Bglll and BamHI according to the manufacturer's directions. A 1.8 Kb Bglll - BamHI fragment containing the AOX2 promoter was isolated from a 0.8% preparative agarose gel. 10 pg of pBPfl (NRRL B-15892) was digested 20 with BaaHI and dephosphorylated using alkaline phosphatase in a 50 pi reaction volume (1 U easyme at 3/°C for 1 hour in 50mM Tris.HCl, pH 9.0, ImM MgClg, 100 pM ZxxClo s ls»M spermidine). 300 ng of the 1.8 Kb fragment and 300 ng of pBPf1 were ligated with T4 ligase as follows. The ligation reaction was performed at 23°C 25 for 1 hour in a 10 pi reaction volume containing 66ciM Tris.HCl, pH 7.6, 5mM MgClo» SraM dithiotreitol, lr.iM ATP and 1 Weiss unit of T4 ligase. The resulting vector was designated pYJ38.

A new Smal restriction site was created in pYJ38 as follows. An adaptor oligonucleotide was synthesized using an Applied Biosysteras 30 DNA Synthesizesp Model 380 As using cyanoethylphosphoramidite chemistry: ' - GATCACCCGGGT - 3' 23 pg of pYJ38 was digested with BamHI and treated with alkaline phosphatase as above. 1 pg of the above adaptor and 0.1 pg of BamHI-digested pYJ38 were ligated using T4 ligase as described above. The modified vector was designated pYJ45. A 1.8 Kb Smal fragment 5 containing the modified A0X2 promoter was obtained by digesting 50 pg of pYJ45 with Smal. The fragment was isolated from a 0.8% preparative agarose gel. 0.3 pg of the fragment and 0.3 pg of Smal-digested pBPf 1 were ligated as above to create the vector plJ46. h 0.3 Kb EcoRl fragment was deleted from the 5' end of the A0X2 segment ia pYJ46 as 10 follows. 10 pg of pYJ46 was digested with EcoRl and treated with alkaline phosphatase as described above. A separate 50 pg aliquot of pYJ46 was also digested with EcoRl and a 1.5 Kb fragment was isolated from a 0.8% preparative agarose gel. About 0.3 pg each of phosphatased pYJ46 and the isolated fragment were ligated and transformed into E. coli as described 15 above. One plasmid which had the correct structure was isolated and designated pYJ55.

Example VII Development of Strain GS115 (pYJ55) Pichia pastoris GS115 5 a histidine autotroph (NRRL Y-15851; 20 his4) was transformed with plasmid pYJ55 (Example VI) as described in ■4» Example 11. Genomic DMAs from stable His strains were analysed by Southern filter hybridisation to determine the location of the plasssid. One traasforsnaat containing pYJ55 integrated at the HIS4 locus was designated GS115(pYJ55).

Example VHx Comparison of the A0X1 and A0X2 Promoters Regulation and expression of the A0X1 and A0X2 promoters has been compared by determining the (3-galactosidase activity of strains GSll5(pSA0H5) and GSU5(pYJ55). 100 ml cultures of each strain were grows ia YNB plus 1% glycerol medium for 24 hr. at 30°C, shifted to YN3 medium without a carbon source for 24 fer at 30°C? then shifted to a YNB medium with 0.5% methanol for 50 hr at 30°C. Samples of each culture were removed at the following tiroes: 1) after 24 hr in glycerol medium, 2) after 24 hr in no carbon medium, and 3) after 24 and 50 hr in. methanol medium. Extracts were prepared aad assayed for p-galactosidase activity as described below. The results of these assays are shown in Table 2. 3-Galactosidase Assay 1) Solution Required: Z-buffer: Final Concentration Na2HP04-7H20 NaH2P04 KC1 MgS0«-7H20 2-mercaptoethanol 16.1 0.06 M .5 S 0.04 M 0.75 g 0.246 g 2.7 mL 0.01 M 0.001 M 0.05 M fill up to 1 L; pH should be 7 O-Hitropheayl-S-D-galactoside (OHPG): Dissolve 400 ag OKfPG (Sigma M-1127) in 100 mL of distilled water to make a 4 mg/raL 0NPG solution 2) Cell-free Protein Extract Preparation: Each sample was washed once in dHoO, once in lysis buffer, and resuspended in lysis buffer at a concentration of 150 Agoo/ml- 0.5 g of glass beads were added to a 350 pjl aliquot of sample, and the mixture was 5 vortexed four times for 60 seconds each with 1 minute intervals on ice. The cell slurry was removed from the glass beads, aad the suspension, was centrifuged for 5 minutes in a microfuge. The supernatant was transferred to a polypropylene microfuge tube for assaying. The amount of total protein ia each extract was determined by the Bradford assay 10 method (3io-Rad). BSA served as the protein standard. 3) Assay Procedure: 1-50 pi of cell-free protein extract was added to 1 ml of Z buffer. The mixture was then vortexed and incubated for 5 minutes at 30°C. The reaction was iaitiated by the addition of 0.2 ml of ONPG 15 (4mg/ial). 0.5 ml of a XM Wa2C03 solution was added to stop the reaction at an appropriate time (A42o<1)- The absorbance at 420 nm was then read. 4) Calculation of [3-galactosidase Activity Units 1 U = 1 nmole of orthonitrophenol (ONP) formed per minute at 30°C and pH 7. 1 nmole of ONP has an absorbance at 420 am (A420) 20 0.0045 with a 1 cm path length. Therefore, an absorbance of 1 at 420 nm represents 222 nmoles ONP/ral, or 378 nmoles ONP/1.7 ml (the total volume of supernatant being analyzed was 1./ ml). Units expressed in Table 2 were calculated as follows: U = —X 378 t (mm)

Claims (3)

CLAIMS:

1. Essentially pure strains of Pichia pastoris which are prototrophic for arginine, auxotrophic for histidine and unable to utilize methanol as a carbon source.

2. The strain of Claim 1 wherein said strain is MC100-3.

3. A strain of Pichia pastoris according to Claim 1, substantially as hereinbefore described and exemplified. F. R. KELLY & CO., AGENTS FOR THE APPLICANTS.