FI105825B - Pichia pastoris strains - Google Patents

Description

105825

Pichia pastoris This application is a division of 893109 by division.

This invention relates to the field of recombinant DNA biotechnology. The application discloses DNA sequences that regulate DNA transcription as well as vectors containing the DNA sequences described above. The invention relates to novel cells transformed with the vectors described above.

The development of recombinant biotechnology in recent years has enabled the controlled production of a wide variety of useful polypeptides by cells 10. Many eukaryotic polypeptides, such as human growth hormone, leukocyte interferons, human insulin and human proinsulin, have been produced by various microorganisms. The continued application of already available technology is expected in the future to enable the production of a number of other useful polypeptide products based on combination technology.

15 The basic technology employed in the field of composite technology is known to those skilled in the art. From the point of view of the practical application of recombinant biotechnology. Factors that are present include, but are not limited to: (1) a gene encoding one or more polypeptides of interest that is operably linked. fused (functionally linked means juxtaposition where the components of the com · ·, · ". are interchangeable with their normal function) with sufficient control sequences required for expression in the host cell; ; (2) a vector, usually a plasmid to which the nucleotide sequence can be inserted; a vector is any construct containing a nucleotide sequence by which a host can be transformed; (3) a suitable host to which the desired nucleotide sequence can be - IM - - --------------- 25, whereby the host also contains a cellular mechanism, which * .., ϊ allows the expression of the information encoded by the transferred nucleotide sequence.

• · # .... - ......... - _ * • · ·

The basic factor used in recombinant technology is a plasmid consisting of a circle m. . shaped double-stranded DNA first encountered with microorganisms.

• · ·: 30 Plasmids have been found to occur in multiple copies per cell. In addition to the naturally occurring plasmids, a variety of artificial plasmids have been prepared. The plasmid contains the information required for plasmid propagation, i.e.. the autonomous replication sequence and / or the origin of replication. One or more means for selecting a plasmid from phenotypically transformed cells may also be included in the information encoded by the plasmid. A phenotypic or marker-based selection feature, such as antibiotic resistance, enables the identification and selection of host cell clones containing the plasmid of interest by favoring cell growth in selective media. Vectors or plasmids may be cleaved with one or more restriction endonucleases or restriction enzymes, each of which recognizes a specific nucleotide sequence. A regulatory region operably linked to a heterologous gene, i.e.. a gene that does not occur naturally within the regulatory region, or other nucleotide sequences can then be inserted by operably linking the desired genetic material to the 10 cleavage sites or to the reconstructed ends on either side of the cleavage site.

The vector is then transferred to a host cell where its nucleotide sequence can direct the host to perform various processes or functions. Some examples include expression of heterologous polypeptides or overexpression of homologous or heterologous poly-15 peptides. The process of transferring a nucleotide to a host cell is commonly referred to as transformation. Large numbers of vectors can be obtained by transferring the vector to a suitable host to increase the copy number of the vector. A commonly used host cell for increasing the copy number of a vector is E. coli. The vectors are then isolated from the first host and transferred to a second host cell where the desired vector-led activities take place, for example, production of the polypeptide. The production of the end product in this way by DNA is called expression. When the gene is correctly placed in the vector, with respect to those parts of the vector that control: copy and read the coding nucleotide sequence, the resulting vector can be used to produce the polypeptide sequence encoded by the inserted gene.

* · • · · 25 Expression is regulated by the regulatory region. The regulatory regions are heterologous nucleotide sequences that respond to a variety of stimuli and affect the copy frequency of RNA. Expression can be turned on or off in response to the stimulus.

The expression that is activated in response to a stimulus is commonly referred to as derepression or induction. Some examples of inducible expression

• M

• ... * systems include the AOX1 system in Pichia pastoris, the estrogen system in Xenopus · "*: the laurel, and the metallothionein systems in monkeys, humans, hamsters, mice, and rats. Inducible expression systems are usually more tightly controlled. systems are well suited for the purposes of genetic engineering '··. ·'.

· * • * • · ·

* · I

• «« • · • w 3 105825

In practice, the use of recombinant biotechnology can provide cells capable of expressing heterologous nucleotide sequences. Heterologous nucleotide sequences are nucleotide sequences that do not naturally occur in the host. Examples of these could be novel combinations of naturally occurring regulatory regions in the host with structural genes not naturally related to this regulatory region. Another example would be the combination of a regulatory region with a gene that does not naturally occur in the host. The heterologous polypeptide can be produced as a fusion polypeptide, i. a heterologous polypeptide fused to a portion of a homologous or heterologous amino acid sequence. The fusion polypeptide product originally obtained is sometimes produced in an inactive form until the fusion polypeptide is cleaved in an extracellular environment.

As previously disclosed in European Patent Application 86114700.7 (incorporated herein by reference). The genome of Pichia pastoris encodes two functional alcoholic oxidase genes, AOX1 and AOX2.

In accordance with the invention, a 5 'end regulatory region has now been discovered associated with the AOX2 structural gene. Methanol or carbon source scarcity induce this regulatory domain. However, the maximum level of expression from the AOX2 regulatory domain is only about 5-11% of the AOX1 regulatory domain (the AOX1 gene was disclosed in European Patent Application 85201235.0, which is incorporated herein by reference).

The AOX2 regulatory region can be used to express heterologous genes and is particularly useful in situations where a high level of protein expression is disadvantageous.

In accordance with the present invention, isolated, characterized DNA sequences have been found that regulate the copy frequency of DNA to RNA. These DNA sequences m ·: 25 are useful for the production of polypeptide products by methylotrophic yeasts such as Pichia pastoris.

• · ·

Figure 1 provides restriction maps of the AOX1 (a) and AOX2 (b) genes.

• · ·: <t <: Figure 2 shows a non-restriction map of pBR322.

Figure 3 shows a? Y8: no-restriction map.

Figure 4 shows a restriction map of plasmid pYM5.

Figure 5 shows a restriction map of plasmid pMR4.

Figure 6 shows a flow diagram of the construction of pMR4.

: '* *: Figure 7 shows a restriction map of plasmid pBPfl.

Figure 8 shows the restriction map of plasmid pYJ55.

4, 105825

Figure 9 shows a flow diagram of the construction of plasmid pYJ55.

Figure 10 shows a restriction map of plasmid pSAOH5.

The present application provides a novel DNA sequence comprising a regulatory region that responds to at least one of the following conditions: presence of methanol in the host environment or carbon source scarcity when the host cell is grown on substrates other than methanol. The regulatory region of the present invention is capable of directing the copy frequency of RNA when operably linked to the 5 'end of a DNA sequence encoding mRNA production.

In accordance with the present invention, plasmids and transformed organisms containing the DNA sequences described above are provided.

These and other objects of the invention will become apparent in the present disclosure. The essential features of the invention are set forth in the appended claims.

I. Characterization of Alcohol Oxidase Regulatory Region The complete AOX2 gene is included in the restriction map in Figure 1 (b). The AOX2 regulatory region is located between the first EcoRI site of the 5 'end and the start codon of the AOX2 structural gene, as shown in the restriction map in Figure 1 (b). The portion of the DNA sequence encoding the alcohol oxidase II protein is indicated by a thick bar below the restriction map. A restriction map 20 of the alcohol oxidase I gene is given for comparison of the two genes involved, Figure 1 (a). Nothing significant i · a: ·. sequence homology was not observed outside the protein coding portion of the geeme.

• · # *

Based on the additional characterization by means of the lacZ fusion structure, the AOX2 regulatory domain • does not need more than about base pairs for 1500 to about -1 regulatory activity (as i: · shown in Table 1). Table 1 gives the nucleotide sequence of 25 DNA fragments containing the AOX2 regulatory region.

... Table 1 AOX2 Regulatory Range and 5'-End Non-Readable Range «« · -1750 -1730 -1710

; GGATCTCAAAAACCTAAGTACTTCATTTGAATATAACTCTGCACCTAAATTTACACCTAA

-1690 -1670 -1650

'' 30 CTCTCTATCTAGGCTCTAGATTTGATAGATTCTATAGCCTTTGGTTTGTTATAGTGTTCA

-1630 -1610 -1590

CCAACTGGATGTCCTAACGAAATGGTTCTGTGGTCTAGTTGGTTATGGCATATGCTTAAC

5 105825 -1570 -1550 -1530 -1510 -1490 -1470 ACGCATAACGTCCCCAGTTCGATCCTGGGCAGAATCATTATTTTTTGACCGAATTCTTTT TTT CAGAC CATATGAC CGGTC CATCTTCTACGGGGGGATTATCTATGCTTTGACCTCTAT 5 -1450 -1430 -1410 -1390 -1370 -1350 CTTGATTCTTTTATGATTCAAATCACTTTTACGTTATTTATTACTTACTGGTTATTTACT TAGCGCCTTTTCTGAAAAACATTTACTAAAAATCATACATCGGCACTCTCAAACACGACA -1330 -1310 -1290

10 GATTGTGATCAAGAAGCAGAGACAATCACCACTAAGGTTGCACATTTGAGCCAGTAGGCT

-1270 -1250 -1230 -1210 -1190 -1170 cctaatagaggttcgatacttattttgataatacgacatattgtcttacctctgaatgtg tcaatactctctcgttcttcgtctcgtcagctaaaaatataacacttcgagtaagatacg 15 -1150 -1130 -1110 -1090 -1070 -1050 CCCAATTGAAGGCTACGAGATACCAGACTATCACTAGTAGAACTTTGACATCTGCTAAAG CAGATCAAATATCCATTTATCCAGAATCAATTACCTTCCTTTAGCTTGTCGAAGGCATGA -1030 -1010 -990

20 AAAAGCTACATGAAAATCCCCATCCTTGAAGTTTTGTCAGCTTAAAGGACTCCATTTCCT

-970 -950 -930 AAAATTTCAAGCAGTCCTCTCAACTAAATTTTTTTCCATTCCTCTGCACCCAGCCCTCTT -910 -890 -870

;; ·: CATCAACCGTCCAGCCTTCTCAAAAGTCCAATGTAAGTAGCCTGCAAATTCAGGTTACAA

: · 25 -850 -830 -810

:. ί .: CCCCTCAATTTTCCATCCAAGGGCGATCCTTACAAAGTTAATATCGAACAGCAGAGACTA

-790 -770 -750

j; i AGCGAGTCATCATCACCACCCAACGAT GGTGAAAAACTTTAAGCATAGATTGATGGAGGG

: T: -730 -710 -690

3 0 TGTATGGCACTTGGCGGCTGCATTAGÄGTTTGAAACTATGGGGTAATACATCACATCCGG

'. * ··. -670 -650 -630

. '·· *. AACTGATCCGACTCCGAGATCATATGCAAAGCACGTGATGTACCCCGTAAACTGCTCGGA

-610 -590 -570

:.:: TTATCGTTGCAATTCATCGTCTTAAACAGTACAAGAAACTTTATTCATGGGTCATTGGAC

35 -550 -530 -510

. 1 '*'. TCTGATGAGGGGCACATTTCCCCAATGATTTTTTGGGAAAGAAAGCCGTAAGAGGACAGT

-490 -470 -450 6 -430 -410 105 825 TAAGCGAAAGAGACAAGACAACGAACAGCAAAAGTGACAGCTGTCAGCTACCTAGTGGAC AGTTGGGAGTTTCCAATTGGTTGGTTTTGAATTTTTACCCATGTTGAGTTGTCCTTGCTT -390 -370 -350 -330 5 -310 -290 -270 CTCCTTGCAAACAATGCAAGTTGATAAGACATCACCTTCCAAGATAGGCTATTTTTGTCG CATAAATTTTTGTCTCGGAGTGAAAACCCCTTTTATGTGAACAGATTACAGAAGCGTCCT -250 -230 -210 -190 -170 ACCCTTCACCGGTTGAGATGGGGAGAAAATTAAGCGATGAGGAGACGATTATTGGTATAA 10 -150 -130 -110 AAGAAGCAACCAAAATCCCTTATTGTCCTTTTCTGATCAGCATCAAAGAATATTGTCTTA -90 AAACGGGCTTTTAACTACATTGTTCTTACACATTGCAAACCTCTTCCTTCTATTTCGGAT -70 -50 -30

15 CAACTGTATTGACTACATTGATCTTTTTTAACGAAGTTTACGACTTACTAAATCCCCACA

-10

AACAAATCAACTGAGAAAA

The AOX2 regulatory region will respond to at least one of the following conditions: the presence of methanol as the sole carbon source for methylotrophic yeast hosts, such as Pichia 20 pastoris, or carbon source scarcity with said host cells. The AOX2 regulatory region additionally stimulates 5-11% of β-galactosidase protein production, such as the AOX1 regulatory region.

. ·. II. Isolation of Alcohol Oxidase äät Regulatory Region from Pichia Pastoris * · «· ί" The AOX2 regulatory region was isolated by transformation of Pichia strain MC100-3 (arg4 his4 aox1A :: SARG4 aox2A :: Phis4). This strain contains the mutant Pichia HIS4 gene. * ·: 25 copies inserted into the AOX2 gene MC100-3 was transformed with pYM5 with a plasmid, Ι #: *: consisting of a 2.7 kb BglII fragment containing the Pichia HIS4 gene: T: linked to pBR322 DNA of several MClOO-3 (pYM5) His + transformants was screened by Southem filter hybridization for transformants containing pYM5 fused to the HIS4 fragment located in MC 100-3. / ···, 30 AOX2 locus, DNA from one of these strains was then hydrolyzed

HindIII, resulting in the release of a genomic fragment containing about 12 kb containing 5.3 kb sequence on the 5 side of the AOX2 Kpn1 site, 2.7 kb

Pichia from the HIS4 gene, and 4.0 from pBR322. HindIII-cleaved DNA was ligated and. was transformed into E. coli. Transformants were selected for ampicillin resistance by 7 105825 teas. One plasmid, pMR4, was recovered and the restriction map of this plasmid is shown in Figure 5.

m. Properties of the AOX2 Regulatory Region To compare the expression of the AOX2 regulatory region with the expression of AOX1, an AOX2-lacZ expression vector was constructed as similar as possible to pSAOH5 (shown in Figure 10), an AOX1-lacZ fusion vector. The flow diagram for the construction of the AOX2-lacZ vector, pYJ55, is shown in Figure 9. Preliminary DNA sequence results at the 5 'end of AOX2 indicated that AOX2 contains two BamHI sites at positions identical to those of the AOX1 structural gene. Therefore, in the first step of constructing pYJ55, a 1.8 kb BglII-BamHI fragment containing the AOX2 regulatory region and 45 bp of the amino-terminal protein coding sequence was inserted into the BamHI site of pBPfl to form pYJ38. In a second step, pYJ38 was cleaved with BamHI and the same adapter oligonucleotide was inserted as used in the construction of the AOX1-lacZ vector (5- '15 GATCACCCGGGT-3'). The insertion of this adapter destroyed the BamHI site of pYJ38 and created a new Smal site at the insertion site. This plasmid, pYJ45, was hydrolyzed with Smal and a 1.6 kb Smal fragment containing the modified AOX2 promoter was ligated into pBPflie to generate plasmid pYJ46. Plasmid pYJ460 was hydrolyzed with EcoRI to remove the 0.3 boiled fragment at the 5 'end of the AOX2 fragment in pYJ46. The plasmid was ligated again to form plasmid pYJ55. A restriction map of plasmid pYJ55 is provided in Figure 8.

The plasmid pYJ55 was transformed into strain GS115 (his4), and the His + transformants were screened for a permanent His + phenotype showing the presence of an associated plasmid. The genomic DNA of several of the 25 permanent His + strains was analyzed by Southem filter hybridization: \ to confirm the presence and location of the plasmid.

To estimate the relative potencies of the AOX1 and AOX2 promoters, β-galactosidase production by pYJ55 and p $ AOH5 was compared by transforming these plasmids into strain GS115. Transformed GS115 strains were designated 30 GS115 (pYJ55) and GS115 (pSA0H5), respectively. Each strain contains a plasmid: fixed at the HIS4 locus. Cells from both strains were grown in glycerol medium, transferred to medium without nitrogen source for 24 hours, and then transferred to methanol-containing medium for an additional 50 hours. Samples were taken at the end of each growth phase of each culture, and extracts were prepared, of which: ß-galactosidase was determined. The results of these assays are shown in Table 2.

8 105825

Table 2 Comparison of β-galactosidase activity from the AOX1 and AOX2 fusion vectors (U g) at carbon source Strain Promoter Glycerol Non-carbon YNB Media

No significant amounts of β-galactosidase were detected in glycerol-grown cells in either strain AOX1-lacZ or AOX2-lacZ. In the medium lacking the legal carbon source, the level of activity on the AOX2-lacZ strain was approximately one-tenth of that found on the AOX1-lacZ strain. Addition of methanol to AOX2-lacZ-containing cells resulted in β-galactosidase levels reaching about one-ninth the levels of AOX1-lacZ cells. The AOX1 and AOX2 genes are thus regulated in the same way. One distinguishing feature is the significantly lower response to methanol and carbon source scarcity associated with the AOX2 regulatory region.

Although the introduction of the AOX2 regulatory region-3-galactosidase gene fusion into a host yeast cell is described herein, those skilled in the art will appreciate that it is not necessary for the practice of this invention to use ring-shaped plasmids or the β-galactosidase structural gene. Other vectors that can be conserved in HI-20 butter can thus be used to utilize this regulatory region with other heterologous genes. Alternatively, this regulatory region operably linked to other heterologous genes may be attached to the host yeast cell chromosome by using linking vectors. In addition, functional mutants of the AOX2 regulatory region described herein that comprise a shorter DNA sequence at the 5 'end can also be used to regulate expression of a heterologous gene.

• ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• '** ** **' ** K ** K 'K ) NRRL Y-15851

Pichia pastoris PPF1 (arg4 his4) NRRL Y-18017 '··. · * Pichia pastoris KM7121 (arg4 his4 aoxlA :: SARG4 aox2A:: PHIS4) NRRL Y-18019 * «· j *; E. coli MC 1061 [FaraD139 (ara ABDIC-Leu) 7679 lacX74 galU galK rpsL hsdR] • «9 105825

Trays, Buffers and Solutions 1 M Tris Buffer 121.1 g Tris base in 800 mL H 2 O; the pH is adjusted to the desired value by the addition of concentrated (35%) aqueous HCl; the solution is allowed to cool to room temperature before final pH adjustment, diluted to a final volume of 1 L.

TE buffer 1.0 mM EDTA 0.01 M (pH 7.4) in Tris buffer SSC 0.15 MNaCl 15 mM sodium citrate pH adjusted to 7.0 with NaOH 10 TAE 40 mM acetic acid

5 mM EDTA

0.02 M (pH 8.3) in Tris buffer

Denhardt's solution 5 g Ficoll (50x) 5 g polyvinylpyrrolidone 15 5 g bovine serum albumin (BSA; Pentax Fraction V) final volume adjusted to 500 ml with water

20X SSPE 20 mM EDTA

0.16 MNaOH

0,2MNaH2PO4.H2O

3.6 MNaCl pH adjusted to 7.0 with NaOH LB (Luria-Bertani) - 5 g Bacto-trypton. : ': start with 5 g Bacto yeast extract 2.5 g NaCl in 1 liter water, pH adjusted to 7.5. 25 NaOH «·: YPD Medium 1% Bacto Yeast Extract • ·· · · 2% Bacto Peptone **. * .. * 2% Dextrose YNB Medium 6.75 g Yeast Nitrogen Medium Without Amino Acids 30 (DIFCO ) In 1 L of water SED 1M sorbitol

.O 25 mM EDTA

50 mM DTT

• I I

. · · ·. SCE buffer 9.1 g sorbitol 35 1.47 g sodium citrate O 0.168 gEDTA 50 ml H2O 10 105825 -pH 5.8 HCl CaS 1 M sorbitol 10 mM CaCl2 is sterilized by filtration. PEG solution 20% polyethylene glycol-3350 in 10mM CaCl2 in 10mM Tris.HCl (pH 7.4) - sterilized by filtration with SOS 1M Sorbitol 10 0.3x YPD in 10mM CaCl2

Formamide dye mixture 0.1% xylene xylene FF

0.2% bromophenol blue in 10 mM EDTA

95% deionized formamide

Pineapple gel 76.8 g urea in 24 ml acrylamide stock solution 8 ml 10x TBE is adjusted to a final volume of 160 ml 20 acrylamide stock 38 g acrylamide solution in 2 g bis (N, N-methylenebisacrylamide), water is added to a total volume of 100 ml Bottom gel 14, 4 g of urea: 390 g of sucrose "25 7.5 ml of 10x TBE 4.5 ml of acrylamide stock solution 0.3 ml of bromophenol blue solution (0.01 g / ml) are added with water: to make a total volume of 30 ml

IM

dideoxy:

30 ddATP 0.125 mM

ddCTP 0.10 mM

ddGTP 0.10 mM

ddTTP 0.80 mM

i. i: DNTP stock solutions 0.5 mM dGTP

35 0.5 mM dCTP

. · '··. 0,5mMTTP

0.5 mM dATP

105825 10X Klenow Dilution - 70 mM Tris.HCl, pH 7.5 Buffer 200 mM NaCl

70 mM MgCl2 1 mM EDTA

5 10X TMD, pH 795 0.1 M Tris.HCl, pH 7.5

0.05MMgCl2 0.075 MDTT

Unless otherwise stated, the above solutions refer to the base concentration (Ix) used. Throughout the examples using different concentration levels, this fact 10 is demonstrated by reference to a multiple of the basic (1x) concentration in the solution.

Regeneration Agar 1) Agar-KCl: 9 g Bacto agar, 13.4 g potassium chloride, 240 mL H2O are autoclaved.

2) 10x glucose: 20 g dextrose, 100 ml H 2 O, autoclaved.

3) 10x YNB: 6.75 g of Yeast Nitrogen Base (Yeast Nitrogen Base) without amino acids, 100 mL of H 2 O are autoclaved. (Add any desired amino acid or nucleic acid up to 200 μg / ml before or after autoclaving.) 4) Add 30 mL of 10x glucose and 30 mL of 10x YNB to 240 mL of thawed Agar.

I

j; ' 20 KCl solution. Add 0.6 ml biotin, 0.2 mg / ml, and any desired amino acid or nucleic acid to a concentration of 20 pg / ml. The thawed regeneration agar is maintained at 55-60 ° C.

Pichia pastoris breeding P. pastoris was grown on YPD (rich) or YNB (minimal) medium. As required, a carbon source (2% dextrose, 1% glycerol or: 0.5% methanol) and 50 μg / ml amino acid were added to the YNB medium.

• · · 'Sequencing w f • · ·

• I I

I I «f

. · ·. DNA sequencing was performed according to Sanger et al. chain termination method, PNAS

;;; 74.5463 (1977).

• • • • • • • • • • 12 105825

The following abbreviations are used throughout the Examples: EDTA Ethylenediaminetetraacetic Acid TEMED Ν, Ν, Ν ', Ν'-Tetramethylenediamine DTT Dithiothreitol 5 BSA Bovine Serum Albumin

EtBr ethidium bromide

Ci Curie dATP deoxyadenosine triphosphate dGTP deoxyguanosine triphosphate 10 TTP thymidine triphosphate dCTP deoxycytidine triphosphate dXTP "general" deoxytriphosphate nucleotide oligo (dT) i2-i8 Source: Collaborative Research, Inc.

Zymolyase 60,000 Source: Miles Laboratories 15 Isolation of Alcohol Oxidase Π Regulatory Area

Example 1 PPF1 X KM7121 pairing and MC100-3 development

Pichia pastoris PPF1 (arg4 his4) (NRRL Y-18017), and KM7121 (arg4 his4 aox1A :: SARG4 aox2A :: PHIS4 (NRRL Y-18019)) were each transferred from a freshly grown YPD plate into a sterile water tube. X 107 cells of each strain were mixed, sonicated briefly to disrupt cell clips, and • plated on a GNAP agar plate (5% dextrose, 2% peptone, 1% yeast extract, · · ·); 5% agar, 2.3% nutrient agar). An unmixed control sample from each || l n ·· ”· strain (approximately 1 X 10 cells) was treated in the same manner. GNAP plates were incubated at 30 ° C for about 24 hours and then replated onto sporulation medium II (0.5% Na acetate, 1% KCl, 2% agar). These plates were incubated for about 20 hours at 30 ° C and then replated onto minimal medium agar plates containing no carbon source. Methanol was supplied to the cells mi · · ·. ·· *. in gaseous phases.

• t ·: 30 After five days, approximately 200 colonies appeared on a minimal plate to which the cell mixture was inoculated. No colonies developed on plates containing unmixed controls, a result suggesting that Arg + His + Mut + colonies were mixed diploid, resulting from PPF1 and KM7121 cell pairing. methanol). The diploidy of these Arg + His + Mut + strains was confirmed by examining AQX loci on four of these strains by Southem filter hybridization. The specific probes used were: pPG3.0 (NRRL B-18022), AOX2 specific probe; pYJ30 (NRRL B-15890), HIS4-specific assay; and pPG4.0 (NRRL B-15868), an AOX1-specific probe.

For sporulation of PPF1 X KM7121 diploids, a colony (MC100) was first picked from a diploid selection plate containing methanol medium. About 1 X 10 6 of these cells were plated on GNAP plates and treated as described for the mating procedure, except that the sporulation plate was incubated for 4 days at 30 ° C to allow the sperm to complete sporulation. Spores were harvested from the plates by rinsing each plate with 5 ml of sterile water. The suspension was washed twice with 3 ml of phosphate buffer (0.1 M Na 3 PO 4, pH 7.5). A mixture of yeast degrading enzymes, Glusulase (Endo Laboratories, NY) and Zymolyase (60,000 units / g; Miles Laboratories), and β-mercaptoethanol were added to final concentrations of 2% (v / v), 0.5 mg / ml, and 0.1 %, respectively, to destroy vegetative cells. The mixture was incubated for 5 hours at 30 ° C.

The spore preparation was then washed twice in sterile water containing 0.2% Tween 80 (v / v) and resuspended in phosphate buffer. The preparation was then subjected to three cycles of 20 seconds sonication to disrupt spore lumps. The spore preparation sample was then diluted and applied to non-selective 20-well pre-culture plates containing 2.0% glucose and 50 μg / ml of both arginine and histidine. These were incubated for 48 hours at 30 ° C. Each pre-culture dish was then replayed for the next set of minimal dishes • I ·

Ml I f .. le: • * • · m 1) glucose, -arg, -his 2) glucose, -arg, + his 3) glucose, + arg, -is and 4) glucose,: * ··: 25 + arg, + his.

After incubation for 24 hours at 30 ° C, colonies were examined for Arg and His phenotypes. Colonies which were Arg + His * were then tested for growth with methanol by spreading on YNB-methanol agar plates. * ··· * Plates were examined for mut phenotype after about one week at room temperature in 30 hours. One Arg + His "Mut strain was designated MC 100-3.

m • «t» »• · · • · ·» • a ...

• • • • • * m • aa • * * * ♦ »·» · · * · I4 105825

Example II

Transformation of Pichia pastoris

Yeast cells were inoculated into about 10 ml of YPD medium and cultured by shaking at 30 ° C for 12-20 hours. The cells were then diluted to an A 50 of about 0.01-5.1 and kept in a log phase in YPD medium at 30 for about 6-8 hours.

One hundred wells of YPD medium were inoculated with 0.5 ml of inoculum culture at A010 at about 0.1 and cultured with shaking at 30 ° C for about 12-20 hours. The culture was then harvested by centrifugation at A0,000 of about 0.2-0.3 (after approximately 16-20 hours) using a DAMON IEC DPR6-000 centrifuge at 1500 g for 5 minutes.

To make spheroplasts, cells were washed once with 10 mL of sterile water (centrifugation was performed after each wash as described above), once with 10 mL of freshly prepared SED, once with 10 mL of sterile 1 M sorbitol, and resuspended in 5 mL of SCE. buffer. 5 μΐ of Zymolyase 60,000 (Miles Labo-15 ratories), 4 mg / ml, was added and the cells incubated at 30 ° C for approximately 30 minutes.

Spheroplast formation was monitored as follows. 100 µg aliquots of cells were added to 900 µl of 5% SDS and 900 µl of 1 M sorbitol before or shortly after Zymolyase addition and at different times during the incubation period. The incubation was terminated at the point where the cells disintegrate in SDS but not in sorbitol. The resulting 20 spheroplasts were washed once in 10 mL of sterile 1 M sorbitol by centrifugation at 1000 g for 5-10 minutes, washed once in 10 mL of sterile CaS:. centrifugation and resuspended in 0.6 mL of CaS.

i <

• I

I '. , ·, For the actual transformation, DNA samples in water or TE buffer were added (up to a total volume of 20 μ1: η) into 12 X 75 mm sterile polypropylene tubes. (For small amounts of DNA, maximal transformation occurs when approximately 1 μΐ of E. coli sonicated DNA, 5 mg / ml, is used in each sample). 100 μl of the spheroplasts were added to each DNA sample and incubated at room temperature for approximately 20 minutes. 1 ml of PEG solution was added to each sample and incubated at room temperature for approximately 15 minutes. Samples were centrifuged at 30,000 g for 5-10 minutes and the supernatant discarded. The pellets were resuspended; . ·. 150 of SOS and incubated at room temperature for 30 minutes.

• · · * '· · 1850 μΐ sterile 1 M sorbitol was added to each, and samples were cultured as described in • · * 1 below.

10 ml of regeneration agar was poured into each plate at least 30 minutes before the transformation samples were ready. 10 ml aliquots of regeneration agar were also dispensed into tubes in a 45-50 ° C bath while the transformation samples were in SOS. Samples were then added to tubes, poured into plates containing a solid bottom agar, and incubated at 30 for 3-5 days.

The quality of the spheroplasts at the various sites was determined as follows. A 10 μl sample was removed and diluted to 100 X by adding the sample to 990 μl 1 M sorbitol. 10 µl of dilution was removed and a further 990 µl aliquot of 1 M sorbitol was added. 100 µl of each dilution were plated on YPD agar medium to determine the concentration of non-spheroplastic intact cells remaining in the preparation. 100 µl of each dilution was added to 10 ml of regeneration agar supplemented with 40 µl / ml of all the amino acids required by the host to determine the total spheroplasts that could be regenerated. Good values for the transformation assay were 1-3 X 10 7 total regenerated-15 spheroplasts / ml, and about 1 X 10 3 total cells / ml.

Example III

Construction of MC100-3 (pYM5)

About 10 pg of pBR322 was hydrolyzed with BamHI and dephosphorylated. About 50 pg of pYJ8 (NRRL B-15889) containing the Pichia HIS4 gene was hydrolyzed with 20 BglII. The 2.7 kb BglII fragment was isolated from a 0.8% preparative agarose gel. 300 ng of the piece and 300 ng of BamHI hydrolyzed pBR322 li-. i: was digested using 0.5 units of T4 DNA ligase in a total volume of 10 µl which

; '' Contained 66 mM Tris.HCl, pH 7.4, 6.6 mM MgCl2, 10 mM DTT, and 0.4 mM

ATP over a period of 24 hours at 4 ° C.

The ligation mixture was used to transform E. coli MC1061 to ampicillin resistance as described in Example V. The transformants were characterized by restriction hydrolysis and the correct size of the attachment. and orientation was confirmed by agarose gel electrophoresis. This plasmid was designated pYM5 and was recovered from E. coli using the alkaline digestion plasmid preparation technique described by Maniatis et al. (1982) (Maniatis, T., Fritsch, E.F., and Sambroox, J.).

#: (1982). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, *, ··, Cold Spring Harbor, NY.).

• ·

About 10 pg of pYM5 was hydrolyzed with Stu I before transformation to MC100-3. This step directed the plasmid to attach to another present in MC 100-3

• V

I6 105825 HIS4 gene sequences, either to the native HIS4 locus or to the modified AOX2 locus. Transformation was performed according to the procedures outlined in Example Π.

DNA from several MCI00-3 (pYM5) His + transformants was isolated according to Example IV and screened by Southem filter hybridization for transformants containing pYM5 fused to the HIS4 fragment in AOX2. Specific probes used were: pPG 3.0 (NRRL B-18022), AOX2 specific probe; pYJ30 (NRRL B-15890), a HIS4-specific probe.

Properties of Alcohol Oxidase II Regulatory Area 10 Example IV

Preparation of yeast DNA

Yeast cells were grown in 100 ml of YNB medium containing 2% dextrose. At 30 ° C until the A 50 was 1-2, and then pelleted using a Damon IEC DPR-6000 centrifuge at 2000 g for 5 minutes. The pellet was washed once with 15 distilled water, once with SED, once with 1 M sorbitol, and then resuspended in 5 mL of a solution containing 0.1 M Tris.HCl, pH 7.0 and 1 M sorbitol. The cells were then mixed with 50-100 μl of Zymolyase 60,000, 4 mg / ml (Miles Laboratories) and incubated at 30 ° C for 1 hour. The resulting spheroplasts were then centrifuged at 1000 g for 5-10 minutes and suspended in 5 ml of lysis buffer [0.1% SDS, 10 mM Tris.HCl (pH 7.4), 5 mM EDTA: a and 50 mM NaCl). Proteinase K (Boehringer Mannheim) and RNase Aita: .i: (Sigma) were each added at 100 μg / ml and the solution was incubated at 37 ° C.

I I

! · · 30 minutes. Protein was removed from the DNA by gentle mixing ß, ί, ϊ with an equal volume of chloroform containing isoamyl alcohol (24: 1, v / v), 25 and the phases were separated by centrifugation at 12,000 g for 20 minutes. The upper · · *: (aqueous) phase was aspirated into a new tube and extracted with a corresponding volume of M * · phenol / chloroform / isoamyl alcohol. The phases were separated as above and the surface phase was placed in a tube containing 2-3 volumes of cold 100% ethanol. Sample se-

..... was lightly kneaded and DNA was collected by twisting it on the surface of a plastic rod. DNA

30 µl were immediately dissolved in 1 ml of TE buffer and dialyzed overnight at 4 ° C against 100 volumes of TE buffer.

• I

«I

«I · III ·« I · • «« · <I · • «1 • · •« I t t «·

• · V

• * •> '105825

Example V Construction of pMR4 DNA was isolated from the MCI00-3 (pYM5) His + transformant formed in Example mukaisesti according to the procedure in Example TV. 10 pg of this genomic DNA was hydrolyzed with HindIII and ligated. The ligation reaction was performed at 4 ° C for 24 hours in a solution of 66 µM Tris.HCl, pH 7.4, 6.6 mM MgCl 2, 10 mM DTT, 0.4 mM ATP, and 0. 5 units T4 DNA ligase.

The ligation mixture was directly transformed into E. coli MC 1061 cells made competent for transformation and transformed as described by Maniatis et al. is described in lut (1982). Selection for ampicillin resistance was performed by culturing cells in either LB medium or 2B medium (0.2% NHLtPO 4, 1.2% Na 2 HPO 4, 0.013% MgSO 4 .7H 2 O, 0.074% CaCl 2. 2H 2 O, 1 μg / thiamine, 0.4% dextrose) supplemented with 50 pg / ml ampicillin.

A 12.0 kb plasmid, designated pMR4, was recovered from Mania-15 Tixi et al. (1982). This plasmid contained 5.3 codons of DNA from the 5 'side of the AOX2 Kpn1 site, 2.7 codons of the Pichia HIS4 gene, and 4.0 codons of pBR322.

Example VI Construction of pYJ55 To determine the regulation and expression of the AOX2 promoter, a vector * 20 containing the AOX2 5 'sequence fused to the E. coli lacZ gene was constructed. 50 µg of the plasmid pMR4 (Example V) was hydrolyzed with BglII and BamHI according to the manufacturer's instructions. A 1.8 boiled BglII-BamHI fragment containing the AOX2- * '* *: promoter was isolated from a 0.8% preparative agarose gel. 10 µg · · ·: pBPfl (NRRL B-15892) was hydrolyzed with BamHI and phosphorus was removed using: T: 25 alkaline phosphatase in a 50 µl reaction volume (1 U enzyme at 37 ° C for 1 hour)

solution with 50 mM Tris.HCl, pH 9.0, 1 mM MgCl 2, 100 pM

. ·· *: ZnCl2, 1 mM spermidine).

300 ng of 1.8 boiled pieces and 300 ng of pBPfl were ligated with T4 ligase as follows. The ligation reaction was carried out at 23 ° C for 1 hour in a 10 µl reaction volume containing 66 mM Tris.HCl, pH 7.6, 5 mM MgCl 2, 5 mM dithiothreitol, 1. mM ATP and 1 Weiss unit T4 ligase The resulting vector was designated pYJ3 8.

0 · 18 105825

A new Smal cleavage site was constructed in pYJ38 as follows. The adapter oligonucleotide was synthesized using an Applied Biosystems DNA synthesizer, Model 380 A, using cyanoethyl phosphoramidite chemistry: 5 '- GATCACCCGGGT -3' 5 µg of plasmid pYJ38 were hydrolyzed with BamHI and treated with alkaline phosphatase as above. One pg of the above adapter and 0.1 pg of BamHI-hydrolyzed pYJ38 were ligated using T4 ligase as described above. The modified vector was designated pYJ45. A 1.8 boiled Smal fragment containing the modified AOX2 promoter was obtained by hydrolysis of 50 µg pYJ45 with Smal. Piece-10 was isolated from a 0.8% preparative agarose gel. 0.3 µg of the piece and 0.3 µg of SmaI-hydrolyzed pBPfl were ligated as above to generate the vector pYJ46. The 0.3 kb EcoRI fragment was removed at the 5 'end of the AOX2 segment in pYJ46 as follows. 10 µg of plasmid pYJ46 were hydrolyzed with EcoRI and treated with alkaline phosphatase as described above. A separate aliquot of 50 µg pYJ46 was also hydrolyzed with EcoRI, and the 1.5 kb fragment was isolated from a 0.8% preparative agarose gel. About 0.3 µg of each phosphatase-treated plasmid pYJ46 and the isolated piece were ligated and transformed into E. coli as described above. One plasmid with the correct structure was isolated and designated pYJ55.

Example VII

i Development of strain GS115 (pYJ55). Pichia pastoris GS115, histidine auxotroph (NRRL Y15851; his4) was transformed, **: with plasmid pYJ55 (Example VI) as described in Example II. Genomic DNA from stable His + strains was analyzed by Southem filter hybridization: 1/25 to determine plasmid location. One transformant containing pYJ55 attached at the HIS4 locus was designated GS115 (pYJ55).

♦ / “: Example of Vili ···. 1 1 1; Comparison of AOX1 and AOX2 Promoters The regulation and expression of AOX1 and AOX2 promoters have been compared by determining the β-galactosidase activity of strains GS115 (pSAOH5) and GS115 (pYJ55). 100 ml cultures of each strain were grown in YNB medium supplemented with 1% // '. glycerol, for 24 hours at 30 ° C, were transferred to YNB-free carbon dioxide medium for 24 hours at 30 ° C, then transferred to YNB medium containing 19 105825 0.5% methanol for 50 inches at 30 ° C. Samples were taken from each culture at the following times: 1) 24 hours in glycerol medium, 2) 24 hours in carbon-free medium, and 3) 24 and 50 hours in methanol medium. Extracts were prepared and assayed for β-galactosidase activity as described below. The results of these assays are shown in Table 2.

β-galactosidase assay 1) Solution Required: Z Buffer: Final concentration

Na 2 HPO 4 .7H 2 O 16.1 g 0.06 M

NaH 2 PO 4 5.5 g 0.04 M

KCl 0.75 g 0.01 M

MgSO4 .7H2O 0.246 g 0.001 M

2-mercaptoethanol 2.7 ml 0.05 M

make up to 1 liter; The pH should be 7.

15 O-Nitrophenyl? -D-galactoside! (ONPG):

400 mg ONPG (Sigma N-1127) is dissolved in 100 ml distilled water to make a 4 mg / ml ONPG solution.

2) Preparation of cell-free protein extract:

Each sample was washed once in distilled water, once in lysis buffer, and resuspended in lysis buffer at 150 Ae / ml. 0.5 g of glass beads was added to a 350 μ1: η sample batch and the mixture was vortexed four times for 60 seconds, *. * At 1 minute intervals on ice. The cell slurry was removed from the glass beads, and ;;; the suspension was centrifuged for 5 minutes in a microfuge. The supernatant was transferred to a polypropylene microfuge tube for assay. The total amount of protein in each extract was determined by the Bradford assay (Bio-Rad). BSA served as a protein standard.

* 3) Configuration Procedure: · · ·

4 | I

• · · 1-50 μΐ of cell-free protein extract was added to 1 ml of Z buffer. The mixture was then vortexed and incubated for 5 minutes at 30 ° C. The reaction was initiated by addition of 0.2 ml ONPG (4 mg / ml). 0.5 ml of 1 M Na 2 CO 3 solution was added to stop reaction ψ 4 9 105825 20 at an appropriate time (A420 <1). The absorbance was then read at 420 nm.

4) Calculation of β-galactosidase activity units 1 U = 1 nmole of formed orthonitrophenol (ONP) per minute at 30 ° C and 5 ph 7. 1 nmole of ONP gives absorbance at 420 nm (A420) 0.0045 at 1 cm path length. Therefore, the absorbance value at 1 at 420 nm represents 222 nmoles of ONP / ml, or 378 nmoles of ONP / l, 7 ml (with a total volume of supernatant of 1.7 ml). The units indicated in Table 2 were calculated as follows: 10 A420 U = -x 378 h (min) «« I 1

4 I

4 1 'tl * • · • · c »t · · i · ·. I I »• · ·» * ·> · ·

IM

• * M · • · · m • · · * * • · · • · * «· · •« * *

Claims (3)

21 105825 Claim Essentially pure strain of Pichia pastoris, characterized in that it is arginine prototrophic, histidine auxotrophic and unable to utilize methanol as a carbon source, and strain GS115 deposited under accession number 5, NRRL Y-15851, is deposited under accession number NRRL Y-18017, KM7121, which is deposited under accession number NRRL Y-18019, or MC100-3, the construction of which is set forth in Examples I, II and ja. 10 Enzymatic Renal Pichia Pastoris Stam, Attack Methods for Prototrophic Medication for Arginine, auxotrophic Medium for Treatment with Methanol Som Colk, and Stemmen GS115, Som Deponerates for Deposition Number NRRL Y-15851 nap depositionsnummer NRRL Y-18017, KM7121, som deponerats pä depositionsnummer NRRL Y-18019, eller MC100-3, 15 stem construction beskrivits i exempel I, «<* 1 I 'I · ·· «III« · • • • • • • • • • • • • • • • • • · · · · · · · · · · · · · · · · · · · · · * • · · 1 * * «, · a« · a · a «·« · · *