IE920420A1 - SUPPRESSOR tRNA GENE TRANSCRIPTION SYSTEMS - Google Patents

SUPPRESSOR tRNA GENE TRANSCRIPTION SYSTEMS

Info

Publication number
IE920420A1
IE920420A1 IE042092A IE920420A IE920420A1 IE 920420 A1 IE920420 A1 IE 920420A1 IE 042092 A IE042092 A IE 042092A IE 920420 A IE920420 A IE 920420A IE 920420 A1 IE920420 A1 IE 920420A1
Authority
IE
Ireland
Prior art keywords
gene
eukaryotic
trna
suppressor
regulation
Prior art date
Application number
IE042092A
Inventor
Theo Dingermann
Original Assignee
Behringwerke Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Behringwerke Ag filed Critical Behringwerke Ag
Publication of IE920420A1 publication Critical patent/IE920420A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Saccharide Compounds (AREA)

Abstract

The invention relates to a eucaryotic suppressor tRNA gene transcription system which can be regulated, to its stable integration into eucaryotic cells, and to its use as a transcription system.

Description

BEHRINGWERKE AKTIENGESELLSCHAFT HOE 91/B 001 - Ma 842 Dr. Lp./Wr.
Suppressor tRNA gene transcription systems The invention relates to eukaryotic suppressor tRNA gene transcription systems which are amenable to regulation and can be employed as control systems for the expression of a required polypeptide in eukaryotic cells, and to a process for the preparation of systems of this type.
In a tRNA suppressor system, a first mutation which leads to an alteration in a codon in an mRNA with the consequence that a functional protein can no longer be ex10 pressed is masked by a second mutation in such a way that a functional protein can nevertheless be expressed. This second mutation is a so-called suppressor mutation which takes place in the anticodon of a tRNA. The mutated tRNA in turn is namely able to recognize the mutated codon of the mRNA as its original target codon or as another sense codon. The suppressor mutations are called nonsense or missense mutations, depending on whether the mutation in the mRNA results in a readable or non-readable codon.
The most important example of a nonsense suppressor mutation is the tRNA which is mutated in the anticodon and is able to recognize a UAG (amber) codon. A tRNA mutated in this way is called amber suppressor tRNA. A mutation of this type can prevent the UAG codon being recognized as mutation by a releasing factor, and the translation thus being terminated. Instead of this, the amber suppressor tRNA ensures that protein synthesis is continued by attaching either a normal amino acid corresponding to the original genetic information or an amino acid not corresponding to the original genetic information.
The transcription of eukaryotic tRNA genes is controlled by promoters within the genes. Although it is perfectly possible for there to be differences in transcription efficiency of different tRNA genes in vitro, controlled expression in vivo has not succeeded to date. - 2 Particularly in view of the current vigorous discussion about biological safety, there is a need for a possible way of regulating, in a straightfoward manner but with great safety, the expression of genes from outside.
It would be possible with targeted regulation of tRNA suppressor genes to carry out controlled expression of structural genes which possess particular nonsense mutations. These mutations in the structural gene could then be regarded as conditionally lethal mutations.
The object of the present invention is to make it possible to control the expression of a foreign gene in a host organism from outside.
The object has been achieved by a eukaryotic suppressor tRNA gene transcription system which is amenable to regulation and comprises (a) (b) (c) (d) (θ) a tRNA suppressor gene a prokaryotic operator a repressor gene which eukaryotic promoter a reporter gene which eukaryotic promoter, a resistance gene. is is under the control of of a a under the control In a preferred embodiment, the invention relates to a eukaryotic suppressor tRNA gene transcription system 25 which is amenable to regulation and includes a tRNA suppressor gene which contains an operator or an operator sequence directly at the 5' end, that is to say in front of the actual gene. The tRNA suppressor gene is particularly preferably a tRNA (amber) suppressor gene from a eukaryote, preferably from Dictyostelium discoideum.
The operator is preferably a tetracycline operator (tet operator).
The suppressor tRNA gene transcription systemadditionally contains a repressor gene, preferably a prokaryotic tetracycline repressor gene (tet repressor gene).
The gene transcription system likewise includes a reporter gene which is preferably of prokaryotic origin and is particularly preferably a ^-galactosidase (lacZ) gene from E. coli. This reporter gene contains a UAG (amber) translation stop codon in the N-terminal region.
Both repressor gene and reporter gene are under the control of a eukaryotic promoter, preferably an actin 6 promoter from Dictyostelium discoideum.
Finally, the tRNA gene transcription system according to the invention also includes a resistance gene which can preferably be expressed in a eukaryote; a neomycin (neo) resistance gene is particularly preferred.
The transcription system according to the invention can be present inserted on two different plasmids, one plasmid containing the amber suppressor gene immediately in front of which the tet operator has been inserted. The plasmid additionally contains the lacZ gene from E. coli, which is under the control of an actin 6 promoter from D. discoideum. The lacZ gene carries a UAG (amber) translation stop codon in the N-terminal region. This gene can therefore act as so-called reporter system because it is expressed only when an active amber sup25 pressor gene is present. Another plasmid contains the tet repressor gene which is likewise under the control of an actin 6 promoter, as well as the neo resistance gene which can be expressed in D. discoideum.
The invention likewise embraces a suppressor tRNA gene transcription system which is amenable to regulation and is stably integrated in a eukaryotic cell. A cell of Dictyostelium discoideum is preferred.
The invention also relates to eukaryotic cells which - 4 contain a eukaryotic suppressor tRNA gene transcription system which is amenable to regulation. The transcription system contained in the cells corresponds to the transcription system according to the invention including the preferred embodiments.
A Dictyostelium discoideum cell is particularly preferred in this connection.
The invention further embraces a process for the preparation of a eukaryotic suppressor tRNA gene transcription system which is amenable to regulation and is stably integrated in a eukaryotic cell.
The process according to the invention takes place in such a way that a eukaryotic tRNA gene is mutated to a tRNA suppressor gene, for example a tRNA (amber) suppres15 sor gene, an operator, for example a prokaryotic tet operator, is inserted immediately in front of the mutated tRNA suppressor gene, and the tRNA suppressor gene is then cloned onto a plasmid which carries a reporter gene under the control of a eukaryotic promoter, for example the actin 6 promoter from Dictyostelium discoideum, where this reporter gene, for example the lacZ gene from E. coli, contains a translation stop codon in the Nterminal region. A repressor gene, for example the tet repressor gene, which is likewise under the control of a eukaryotic promoter, for example the actin 6 promoter from Dictyostelium discoideum, is cloned onto another plasmid which preferably carries a resistance gene, for example the neo resistance gene, which can be expressed in eukaryotes. Then, in another process step, the two plasmids are stably integrated into the genome of a eukaryotic cell, for example a Dictyostelium discoideum cell, by cotransformation.
The eukaryotic suppressor tRNA gene transcription system which is amenable to regulation according to the invention can be used with a view to biological safety.
This is because a system of this type is capable of specific control of the expression of a polypeptide gene containing a UAG (amber) translation stop codon in a eukaryotic cell.
The principle of specific regulation of eukaryotic tRNA genes is based on positioning the prokaryotic control system, in the present case the tetracycline (tet) operator, in the region of the initiation site of a tRNA gene. Regulation of a tRNA gene in Dictyostelium dis10 coideum is preferred according to the invention, but this regulation may be implemented in any other eukaryotic cell such as, for example, cells of yeast strains or mammalian cells which carry suppressor tRNA genes amenable to regulation.
For this purpose initially a tRNAGlu(UUC) gene from D. discoideum was mutated to an amber suppressor gene.
The construction of the lacZ fusion gene is disclosed in Gene 59, 99-106.
The actin 6 promoter originates from the plasmid pDneo2 (Mol. Cell Biol. 6, 3973).
Under normal conditions the transformants are characterized by a lacZ phenotype. However, if the cells are cultured in the presence of tetracycline, 0-galactosidase is detectable.
In the transformants there is constitutive expression both of the tet repressor and of the mutated reporter gene under actin 6 promoter control. The repressor now binds with extremely high affinity to the tet operator and thus masks the initiation site of the suppressor tRNA gene. The expression of this gene is completely prevented by this. Consequently, it is also impossible for functional ^-galactosidase to be synthesized because a functional suppressor tRNA is necessary for this. If the - 6 cells are now cultured in the presence of tetracycline, sufficient tetracycline enters the cell nucleus to bind the repressor. This means that the repressor loses its affinity for the operator, the tet/operator complex diffuses away or no longer binds, and the transcription initiation site of the suppressor tRNA gene becomes free. The synthesized suppressor tRNA efficiently reads over the amber stop codon in the lacZ gene and 0-galactosidase can be detected.
Brief description of the figures: Fig. 1 is a diagrammatic representation of the plasmid pDneoA6PTR.
This plasmid contains the tetracycline repressor (tetR) fused to the N-terminal region of the actin 6 gene (A6P) from D. discoideum. Termination of transcription of the act6::tetR fusion gene takes place at the appropriate signal of the actin 8 gene (A8T) from D. discoideum. The plasmid furthermore carries the selection marker for D. discoideum transformation. This marker is the bac20 terial neomycin-resistance gene (NeoR) from the transposon Tn903, which is transcribed in D. discoideum under the control of the actin 15 promoter (A15P) and terminator (A15T) . The product, neomycin phosphotransferase, confers resistance to the neomycin analog G418 on the transfor25 mants.
Fig. 2 is a diagrammatic representation of the plasmid pGTETR+1.
This plasmid carries the reporter gene for suppression and the inducible suppressor tRNA gene.
Fig. 3 is a diagrammatic representation of tRNA gene transcription which can be regulated by prokaryotic control systems in Dictyostelium discoideum (A) and the detection of tRNA function with the aid of a modified lacZ gene as reporter (B).
Fig. 4 depicts 0-galactosidase detection in cell extracts from D. discoideum.
The Dictyostelium strain contains a tRNAGlu (amber) sup5 pressor tRNA gene [Glu(2) + ItetO] which carries the tet operator in its 5'-flanking sequence. Furthermore, there is constitutive expression of the tet repressor by the strain, and it contains as reporter a lacZ gene which undergoes constitutive expression and carries in the 5' region an amber stop codon [A6PTlac(UAG)]. Also analyzed as control (3rd lane) was an extract prepared from cells with very high level expression of unmodified 0-galactosidase [A6PTlac].
In the lower part the inducibility of tRNA gene expres15 sion was measured as a function of the tetracycline concentration in the medium.
The jS-galactosidase was detected with CPRG (chlorophenyl red ^-D-galactopyranoside) which gives a red color after hydrolysis .
The precondition for this is that there is constitutive expression of the tet repressor gene (tet repressor) in the appropriate cell. This is achieved by placing the repressor gene under the control of eukaryotic promoter which can be read in the appropriate eukaryotic cell and thus is able to function. For example, the tRNA transcription system according to the invention also functions in yeast cells when the tet repressor gene is placed under the control of a homologous promoter of the yeast, for example the ADH (alcohol dehydrogenase) promoter.
Another advantage of the system, which results in the tRNA gene transcription system according to the invention functioning in principle in any eukaryotic cell, is that the tRNA genes possess so-called gene-internal promoters - 8 which are recognized by all eukaryotic organisms. This means that it is also possible, for example, for mutated RNA genes which have been taken from a particular organism to be expressed in all possible other eukaryotic cells without the need to alter the promoters.
The system can be stably integrated into any desired eukaryote. If there is constitutive expression of the tet repressor in the appropriate cell, regulation of the synthesis of the suppressor tRNA gene is possible because tetracycline penetrates very well into the cells of a wide variety of eukaryotes, even plants.
A control system of this type has the following advantages : The system controls the synthesis of any desired protein as long as the corresponding gene carries a translation stop codon.
The synthesis of the foreign protein takes place only in the presence of tetracycline. Unwanted synthesis of this protein is therefore virtually ruled out. As such, the system contributes to the biological safety of organisms used in biotechnology.
The tRNA gene transcription regulated by tetracycline can also be designed as a conditionally lethal system. If an essential gene is equipped with a translation stop codon, the corresonding organism can survive only in the presence of tetracycline. - 9 Examples Example 1 Organisms, media and Dictyostelium discoideum transformation: Axenic Dictyostelium discoideum strain Ax-2 was cultured in HL-5 medium (Biochem. J. 119, 175-182) at 22eC. Cells which were intended for use for transformation were cultured in HL-5 medium containing morpholineethanesulfonic acid (Mol. Cell Biol. 4, 2890). Dictyostelium transformation was carried out as published (Gene 59, 99106; Gene 39, 155-163; Mol. Cell Biol. 4, 2890). Transformants were selected in the presence of 20 pg/ml G418. Clones were picked out and recloned in the presence of Klebsiella aerogenes (DNA 8, 193-204; Gene 85, 353-362).
The plasmid DNAs employed for the transformation were stably integrated into the genome, and amplified 10 to 100 times, in the transformants. 15 to 30 pg of tetracycline were added to the medium to induce the tRNA gene amenable to regulation.
Example 2 Enzyme assay for ^-galactosidase: D. discoideum cells were harvested, washed in phosphate buffer (14.7 mM ΚΗ2ΡΟ,/2ιηΜ Na2HPO4 pH 6) and resuspended at 5 x 106 - 5 x 107 cells/ml of phosphate buffer. The cell suspension was then frozen and thawed again three times, vigorously mixing the cells for 1 minute between each of these cycles. Cell detritus was then removed by centrifugation, and the supernatant was employed for the determination of the protein concentration and for the activ30 ity determination (Gene 85, 353-362).
For the activity determination, 100 pi of extract were mixed with 300 pi of Z buffer (60 mM Na2HPO4/40 mM NaH2PO4/10 mM KC1/1 mM MgSO4 pH 7), 50 mM 0-mercaptoethanol and 200 pi of a solution which contained 4 mg/ml ίο o-nitrophenyl 0-D-galactoside (ONPG) in 100 mM phosphate buffer pH 7. The mixture was incubated at 22°C, and the reaction was stopped by adding 400 μΐ of 1 M Na2CO3. After centrifugation, the clear solution was optically measured at 420 nm. Enzyme activities are reported in kat, where one kat is defined as the enzymatic activity which hydrolyzes 1 mol of ONPG in one second at 22C.
Example 3 The physical map of the plasmid pDneoA6PTR is depicted in 10 Fig. 1. The tetracycline repressor gene was isolated from the plasmid pWH305 (EMBO J. 3, 539-543). This entailed initial cutting with Xbal, filling in of protruding ends and subsequent religation in the presence of a BamHI linker (CGGGATCCCG). After this, a BamHI/EcoRI fragment which contained the complete tetR gene was isolated.
The resulting fragment was ligated into the vector pDNeo2 (Mol. Cell Biol. 6, 3973-3983) which had been modified as follows. The vector was cut with Sail, and protruding ends were filled in with Klenow polymerase. BamHI linker ligation (CGGGATCCCG) was followed by digestion with the enzymes BamHI and EcoRI.
Example 4 The reporter gene is a variant of the plasmid pAPTlac.1, which was modified by primer-directed in vitro mutagene25 sis in such a way that it carries a UAG translation stop codon in the reading frame of the act6::lacZ fusion gene.
The Hindi 11 fragment with the fusion gene was isolated and cloned into the plasmid pGTET+1. This plasmid is a pUC19 derivative which carries a tRNAGlu (amber) suppres30 sor gene and, in front of this gene, a tetracycline operator sequence (tetO).
Example 5 The tRNAGlu (amber) suppressor gene is a variant of the tRNAGluII gene from D. discoideum (DNA 8, 193-204). The gene was modified in the anticodon region by primer-di5 rected in vitro mutagenesis so that a UAG translation stop codon is read, instead of a GAA glutamic acid codon, by the product. The entire 5'-flanking region of this tRNA gene was then removed by Bal41 deletion. The following synthetically prepared tetO fragment: CTAGACTCTATCATTGATAGAGT was ligated into the Xbal cleavage site located in front of the tRNA gene.
This plasmid was then cut with Hindlll and, in this form, acted as recipient for the prepared Hindlll fragment with the act6::lacZ fusion reporter gene from pA6PTlac.UAG.
The resulting plasmid pGTETR+1 is about 7.3 kb in size and carries the act6::lacZ fusion reporter gene and the inducible suppressor tRNA gene in the same transcription orientation.
Example 6 tRNA gene transcription amenable to regulation In order to establish stable D. discoideum strains with a suppressor tRNA gene which is amenable to regulation, the plasmids pDneoA6PTR and pGTETR+1 were stably integrated into the D. discoideum genome by cotransformation.
The transformants are primarily selected on the basis of the acquired G418 resistance. Resistant clones are then grown in medium which, besides G418 (15 pg/ml), also contains tetracycline (15 /xg/ml). These clones are then assayed for 0-galactosidase activity. Positive clones are subsequently assayed for inducibility. For this, subpopulations of the positive clones are cultured in tetracycline-free medium. Expression of ^-galactosidase should no longer occur with these.

Claims (29)

1. A eukaryotic suppressor tRNA gene transcription system which is amenable to regulation and comprises (a) a tRNA suppressor gene (b) a prokaryotic operator (c) a repressor gene which is under the control of a eukaryotic promoter (d) a reporter gene which is under the control of a eukaryotic promoter, (e) a resistance gene.
2. . A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claim 1, wherein the operator is inserted immediately in front of the tRNA suppressor gene.
3. 0 gene.
4. . A eukaryotic suppressor tRNA gene transcription system 20 amenable to regulation as claimed in claims 1 to 3, wherein the tRNA suppressor gene is a tRNA amber suppressor gene. 5. Contains a eukaryotic tRNA gene transcription system amenable to regulation as claimed in claims 1 to 10. 5 a UAG (amber) translation stop codon in the N-terminal region.
5. A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claim 4, wherein the
6. . A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claims 1 to 5, wherein the repressor gene is a prokaryotic tet repressor
7. . A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claims 1 to 6, wherein the reporter gene is of prokaryotic origin.
8. A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claim 7, wherein the reporter gene is a lacZ gene from E. coli, which carries
9. A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claims 1 to 8, wherein the repressor gene and the reporter gene are 10. Cell, which comprises mutating a eukaryotic tRNA gene to a tRNA suppressor gene, inserting an operator immediately in front of the mutated tRNA suppressor gene, and cloning the tRNA suppressor gene onto a plasmid which carries a reporter gene under the control of a eukaryotic promoter,
10. A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claims 1 to 9, wherein the resistance gene is a neomycin (neo) 10 under the control of the eukaryotic actin 6 promoter from Dictyostelium discoideum.
11. A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claims 1 to 10, which is stably integrated in a eukaryotic cell.
12. A eukaryotic suppressor tRNA gene transcription
13. The plasmids pDneoA6PTR (Fig. 1) and pGTETR + 1 (Fig. 2). 14. - 14 (e) a resistance gene.
14. A eukaryotic cell containing a eukaryotic suppressor tRNA gene transcription system which is amenable to regulation and comprises (a) a tRNA suppressor gene (b) a prokaryotic operator (c) a repressor gene which is under the control of a eukaryotic promoter (d) a reporter gene which is under the eukaryotic promoter, control of a 15. Where this reporter gene contains a translation stop codon in the N-terminal region, and cloning a repressor gene which is likewise under the control of a eukaryotic promoter onto another plasmid which carries a resistance gene which can be expressed in eukaryotes, and then
15. A eukaryotic cell as claimed in claim 14, which is a Dictyostelium discoideum cell. 15 resistance gene which can be expressed in eukaryotes. 15 3. A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claims 1 and 2, wherein the operator which is inserted immediately in front of the tRNA suppressor gene is a tet operator.
16. A eukaryotic cell as claimed in claim 14 or 15, which
17. A process for the preparation of a eukaryotic suppressor tRNA gene transcription system which is amenable to regulation and is stably integrated into a eukaryotic
18. The process as claimed in claim 17, wherein the tRNA suppressor gene is a tRNA UAG (amber) suppressor gene.
19. The process as claimed in claim 18, wherein the tRNA
20. The process as claimed in claims 17 to 19, wherein the operator is a (tet) operator. 20 stably integrating the two plasmids into the genome of a eukaryotic cell by cotransformation. 20 system amenable to regulation as claimed in claim 11, which is integrated in cells of Dictyostelium discoideum.
21. The process as claimed in claims 17 to 20, wherein the reporter gene is a prokaryotic gene which is under 30 the control of eukaryotic promoter.
22. The process as claimed in claim 21, wherein the prokaryotic reporter gene is a lacZ gene from E. coli, which carries a UAG (amber) translation stop codon in the N-terminal region.
23. The process as claimed in claim 22, wherein the lacZ gene from E. coli is under the control of an actin 6 promoter from D. discoideum.
24. The process as claimed in claim 23, wherein the resistance gene is a neo resistance gene which can be expressed in D. discoideum.
25. The process as claimed in claims 17 to 24, wherein the eukaryotic cells are cotransformed with the plasmids pDneoA6PTR and pGTETR + 1. 25 suppressor gene originates from D. discoideum. 25 tRNA amber suppressor gene originates from Dictyostelium discoideum.
26. The use of a eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claims 1 to 14 for the specific control of the expression of a polypeptide gene carrying a UAG (amber) translation stop codon in a eukaryotic cell.
27. A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claim 1, substantially as hereinbefore described and exemplified.
28. A process as claimed in claim 17, substantially as hereinbefore described and exemplified.
29. A eukaryotic suppressor tRNA gene transcription system which is amenable to regulation and is stably integrated into a eukaryotic cell, whenever prepared by a process claimed in a preceding claim.
IE042092A 1991-02-09 1992-02-07 SUPPRESSOR tRNA GENE TRANSCRIPTION SYSTEMS IE920420A1 (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
DE4103952A DE4103952A1 (en) 1991-02-09 1991-02-09 SUPPRESSOR-TRNA GENTRAL TRANSFER SYSTEMS

Publications (1)

Publication Number Publication Date
IE920420A1 true IE920420A1 (en) 1992-08-12

Family

ID=6424718

Family Applications (1)

Application Number Title Priority Date Filing Date
IE042092A IE920420A1 (en) 1991-02-09 1992-02-07 SUPPRESSOR tRNA GENE TRANSCRIPTION SYSTEMS

Country Status (6)

Country Link
EP (1) EP0499059A1 (en)
KR (1) KR920016592A (en)
AU (1) AU1077392A (en)
CA (1) CA2060874A1 (en)
DE (1) DE4103952A1 (en)
IE (1) IE920420A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001068835A2 (en) * 2000-03-13 2001-09-20 Aptagen Method for modifying a nucleic acid

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4687737A (en) * 1982-11-12 1987-08-18 Massachusetts Institute Of Technology Mammalian suppressor genes

Also Published As

Publication number Publication date
KR920016592A (en) 1992-09-25
AU1077392A (en) 1992-08-13
DE4103952A1 (en) 1992-08-13
CA2060874A1 (en) 1992-08-10
EP0499059A1 (en) 1992-08-19

Similar Documents

Publication Publication Date Title
US5948622A (en) System for in vitro transposition
Guarente [10] Yeast promoters and lacZ fusions designed to study expression of cloned genes in yeast
EP0592597B1 (en) Novel mutagenesis methods and compositions
US6953689B2 (en) Cloning system for construction of recombinant expression vectors
JP2017538425A (en) Fungal genome modification system and method of use
JPH06104065B2 (en) Production of promoters for expression of foreign genes in yeast, plasmids comprising them, and polypeptides
US5770400A (en) Exogenous gene expression vector containing chick β-actin gene promoter
AU6346900A (en) Recombinase-based methods for producing expression vectors and compositions for use in practicing the same
GB2136814A (en) Dna vectors
Heitzer et al. Construction of modular tandem expression vectors for the green alga Chlamydomonas reinhardtii using the Cre/lox-system
JPS61257189A (en) Novel plasmid vector
WO2013111754A1 (en) Expression vector and method for producing protein
JP3689920B2 (en) Multicloning vectors, expression vectors, and production of heterologous proteins
US6368821B1 (en) Process for infecting eukaryotic cells with a bacterial virus
WO2001079512A2 (en) Vector and method for targeted replacement and disruption of an integrated dna sequence
IE920420A1 (en) SUPPRESSOR tRNA GENE TRANSCRIPTION SYSTEMS
EP0281246A2 (en) Method to enhance amplification and expression of foreign genes
EP0374162B1 (en) Balanced constitutive inducible transcription system
WO1995009914A1 (en) Multicloning vector, expression vector, and production of foreign protein with expression vector
US6838239B1 (en) Chitobiase as a reporter enzyme
Musmanno et al. Synthesis of the nonconserved dihydroorotase domain of the multifunctional hamster CAD protein in Escherichia coli
EP0154351B1 (en) Expression plasmids useful in b. subtilis
WO2001027322A2 (en) Chitobiase as a reporter enzyme
KR100278109B1 (en) Method for preparing human plasma albumin using transformed yeast Saccharomyces cerevisiae containing human plasma albumin expression vector
JP2022086783A (en) Promoter for filamentous fungi and use thereof