CA2060874A1 - Suppressor trna gene transcription systems - Google Patents
Suppressor trna gene transcription systemsInfo
- Publication number
- CA2060874A1 CA2060874A1 CA002060874A CA2060874A CA2060874A1 CA 2060874 A1 CA2060874 A1 CA 2060874A1 CA 002060874 A CA002060874 A CA 002060874A CA 2060874 A CA2060874 A CA 2060874A CA 2060874 A1 CA2060874 A1 CA 2060874A1
- Authority
- CA
- Canada
- Prior art keywords
- gene
- eukaryotic
- trna
- suppressor
- regulation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/67—General methods for enhancing the expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Saccharide Compounds (AREA)
Abstract
Abstract of the disclosure Suppressor tRNA gene transcription systems The invention relates to a eukaryotic suppressor tRNA
gene transcription system amenable to regulation, to its stable integration into eukaryotic cells and to its use as transcription system.
gene transcription system amenable to regulation, to its stable integration into eukaryotic cells and to its use as transcription system.
Description
BEHRINGWERKE ARTIENGESELLSCHAFT HOE 91/B O~1 - Ma 842 Dr. Lp./Wr.
Suppressor tRNA aene transcriPtiOn sYstems The invention relates to eukaryotic suppressor tRNA gene transcription systems which are amenable to regulation and can be employed as control qystems for the expression of a required polypeptide in eukaryotic cells, and to a process for the preparation of systems of this type.
In a tRNA suppresQor sy~tem, a first mutation which leads to an alteration in a codon in an mRNA with the conse-quence that a functional protein can no longer be ex-pressed is ma~ked by a second mutation in such a way thata functional protein can nevertheless be expressed. This second mutation is a so-called suppressor mutation which takes place in the anticodon of a tRNA. The mutated tRNA
in turn is namely able to recognize the mutated codon of the mRNA as its original target codon or as another sense codon. The suppressor mutations are called nonsense or missense mutations, depending on whether the mutation in the mRNA results in a readable or non-readable codon.
Tha most important example of a nonsense suppressor mutation is the tRNA which is mutated in the anticodon and is able to recognize a UAG (amber) codon. A tRNA
mutated in this way is called amber suppressor tRNA. A
mutation of this type can prevent the UAG codon being recognized as mutation by a releasing factor, and the translation thus being terminated. Instead of this, the amber suppressor tRNA ensures that protein synthesis is continued by attaching either a normal amino acid corres-ponding to the original genetic information or an amino acid not corresponding to the original genetic information.
The transcription of eukaryotic tRNA genes is controlled by promoters within the genes. Although it i~ perfectly possible for there to be differences in transcription efficiency of different tRNA genes in vitro, controlled expression in vivo has not succeeded to date.
Suppressor tRNA aene transcriPtiOn sYstems The invention relates to eukaryotic suppressor tRNA gene transcription systems which are amenable to regulation and can be employed as control qystems for the expression of a required polypeptide in eukaryotic cells, and to a process for the preparation of systems of this type.
In a tRNA suppresQor sy~tem, a first mutation which leads to an alteration in a codon in an mRNA with the conse-quence that a functional protein can no longer be ex-pressed is ma~ked by a second mutation in such a way thata functional protein can nevertheless be expressed. This second mutation is a so-called suppressor mutation which takes place in the anticodon of a tRNA. The mutated tRNA
in turn is namely able to recognize the mutated codon of the mRNA as its original target codon or as another sense codon. The suppressor mutations are called nonsense or missense mutations, depending on whether the mutation in the mRNA results in a readable or non-readable codon.
Tha most important example of a nonsense suppressor mutation is the tRNA which is mutated in the anticodon and is able to recognize a UAG (amber) codon. A tRNA
mutated in this way is called amber suppressor tRNA. A
mutation of this type can prevent the UAG codon being recognized as mutation by a releasing factor, and the translation thus being terminated. Instead of this, the amber suppressor tRNA ensures that protein synthesis is continued by attaching either a normal amino acid corres-ponding to the original genetic information or an amino acid not corresponding to the original genetic information.
The transcription of eukaryotic tRNA genes is controlled by promoters within the genes. Although it i~ perfectly possible for there to be differences in transcription efficiency of different tRNA genes in vitro, controlled expression in vivo has not succeeded to date.
2~g ~)~
Particularly in view of the current vigorous discussion about biological safety, there is a need for a possible way of regulating, in a straightfoward manner but with great safety, the expression of genes from outside.
It would be possible with targeted regulation of tRNA
suppressor genes to carry out controlled expres3ion of structural genes which possess particular nonsense mutations. These mutations in the structural gene could then be regarded as conditionally lethal mutations.
The ob~ect of the present invention i8 to make it pos-sible to control the expression of a foreign gene in a host organism from outside.
The ob~ect has been achieved by a eukaryotic suppressor tRNA gene transcription system which is amenable to regulation and comprises (a) a tRNA suppressor gene (b) a prokaryotic operator (c) a repressor gene which is under the control of a eukaryotic promoter 0 (d) a reporter gene which is under the control of a eukaryotic promoter, (e) a resistance gene.
In a preferred embodiment, the invention relates to a eukaryotic suppressor tRNA gene transcription system which is amenable to regulation and includes a tRNA
suppressor gene which contains an operator or an operator sequence directly at the 5' end, that is to say in front of the actual gene. The tRNA suppressor gene is particu-larly preferably a tRNA (amber) suppressor gene from a eukaryote, preferably from Dictyostelium discoideum.
The operator is preferably a tetracycline operator (tet operator).
The suppressor tRNA gene transcription systemadditionally 2 ~
contains a repressor gene, preferably a prokaryotic tetracycline repressor gene (tet repressor gene).
The gene transcription system likewise includes a report-er gene which iB preferably of prokaryotic ori~in a~d is particularly preferably a ~-galactosidase (lacZ) gene from E. coli. This reporter gene contains a UAG (amber) translation stop codon in the N-terminal region.
Both repres~or gene and reporter gene are under the control of a eukaryotic promoter, preferably an actin 6 promoter from Dictyostelium discoideum.
Finally, the tRNA gene transcription system according to the invention also includes a resistance gene which can preferably be expressed in a eukaryote; a neomycin (neo) resistance gene is particularly preferred.
The transcription system according to the invention can be present inserted on two different plasmids, one plasmid containing the amber suppressor gene immediately in front of which the tet operator has been inserted. The plasmid additionally contains the lacZ gene from E. coli, which is under the control of an actin 6 promoter from D. discoideum. The lacZ gene carries a UAG (amber) translation stop codon in the N-terminal region. This gene can therefore act as so-called reporter system because it is expressed only when an active amber sup-pressor gene is present. Another plaRmid contains the tetrepressor gene which is likewise under the control of an actin 6 promoter, as well as the neo resistance gene which can be expressed in D. discoideum.
The invention likewise embraces a suppres~or tRNA gene transcription system which is amenable to regulation and is stably integrated in a eukaryotic cell. A cell of Dictyostelium discoideum iB preferred.
The invention also relates to eukaryotic cells which _ 4 ~ a~
contain a eukaryotic suppressor tRNA gene transcription system which is amenable to regulation. The transcription system contained in the cells corresponds to the trans~
cription system according to the invention including the preferred embodiments.
A Dictyostelium discoideum cell is particularly preferred in this connection.
The invention further embraces a proce~s for the prepara-tion of a eukaryotic suppressor tRNA gene transcription system which i8 amenable to regulation and is stably integrated in a eukaryotic cell.
The process according to the invention takes place in such a way that a eukaryotic tRNA gene is mutated to a tRNA suppressor gene, for example a tRNA (amber) suppres-sor gene, an operator, for example a prokaryotic tetoperator, is inserted immediately in front of the mutated tRNA suppressor gene, and the tRNA suppressor gene is then cloned onto a plasmid which carries a reporter gene under the control of a eukaryotic promoter, for example the actin 6 promoter from Dictyostelium discoideum, where this reporter gene, for example the lacZ gene from E. coli, contains a translation stop codon in the N-terminal region. A repressor gene, for example the tet repressor gene, which is likewise under the control of a eukaryotic promoter, for example the actin 6 promoter from Dictyostelium discoideum, is cloned onto another plasmid which preferably carries a resistance gene, for example the neo resistance gene, which can be expressed in eukaryotes. Then, in another process step, the two plasmids are stably integrated into the genome of a eukaryotic cell, for example a Dictyostelium discoideum cell, by cotransformation.
The eukaryotic suppressor tRNA gene transcription system which is amenable to regulation according to the invention can be used with a view to biological safety.
2 ~ ~q~3~'~
This is because a system of this type is capable of specific control of the expression of a polypeptide gene containing a UAG (amber) translation stop codon in a eukaryotic cell.
The principle of specific regulation of eukaryotic tRNA
genes is based on positioning the prokaryotic control system, in the present case the tetracycline (tet) operator, in the region of the initiation site of a tRNA
gene. Regulation of a tRNA gene in Dictyostelium dis-coideum i8 preferred according to the invention, but thisregulation may be implemented in any other eukaryotic cell such as, for example, cells of yeast strains or mammalian cells which carry suppressor tRNA genes amen-able to regulation.
For this purpose initially a tRNAGlU( W C) gene from D. discoideum was mutated to an amber suppressor gene.
The construction of the lacZ fusion gene is disclosed in Gene 59, 99-106.
The actin 6 promoter originates from the plasmid pDneo2 (Mol. Cell Biol. 6, 3973).
Under ~normal conditions" the transformants are charac-terized by a lacZ~ phenotype. However, if the cells are cultured in the presence of tetracycline, ~-galactosidase is detectable.
In the transformants there is constitutive expression both of the tet repressor and of the mutated reporter gene under actin 6 promoter control. The repressor now binds with extremely high affinity to the tet operator and thus masks the initiation site of the suppressor tRNA
gene. The expression of this gene is completely prevented by this. Consequently, it is also impossible for func-tional ~-galactosidase to be synthesized because a functional suppressor tRNA is necessary for this. If the 7 ~
cells are now cultured in the presence of tetracycline, sufficient tetracycline enters the cell nucleus to bind the repressor. This means that the repressor loses its affinity for the operator, the tet/operator complex diffuses away or no longer binds, and the transcription initiation site of the suppressor tRNA gene becomes free.
The synthesized suppressor tRNA efficiently reads over the amber stop codon in the lacZ gene and ~-galactosidase can be detected.
Brief description of the figures:
Fig. 1 i6 a diagrammatic representation of the plasmid pDneoA6PTR.
This plasmid contains the tetracycline repressor (tetR) fused to the N-terminal region of the actin 6 gene (A6P) from D. discoideum. Termination of transcription of the act6::tetR fusion gene takes place at the appropriate signal of the actin 8 gene (A8T) from D. discoideum. The plasmid furthermore carries the selection marker for D. discoideum transformation. This marker is the bac-terial neomycin-resistance gene (NeoR) from the transposon Tn903, which is transcribed in D. discoideum under the control of the actin 15 promoter (A15P) and terminator (A15T). The product, neomycin phosphotransferase, confers resistance to the neomycin analog G418 on the transfor-mants.
Fig. 2 is a diagrammatic representation of the plasmidpGTETR+1.
This plasmid carries the reporter gene for suppression and the inducible suppressor tRNA gene.
Fig. 3 is a diagrammatic representation of tRNA gene transcription which can be regulated by prokaryotic control systems in Dictyostelium discoideum (A) and the detection of tRNA function with the aid of a modified --7-- 2 ~
lacZ gene as reporter (B).
Fig. 4 depicts ~-galactosidase detection in cell extracts from D. discoideum.
The Dictyostelium strain contains a tRNAGlU (amber) sup-pressor tRNA gene [Glu(2) + ltetO] which carries the tet operator in its S'-flanking sequence. Furthermore, there is constitutive expression of the tet repressor by the strain, and it contains as reporter a lacZ gene which undergoes constitutive expression and carries in the 5' region an amber stop codon [A6PTlac(UAG)]. Also analyzed as control (3rd lane) was an extract prepared from cells with very high level expression of unmodified ~-galacto-sidase [A6PTlac].
In the lower part the inducibility of tRNA gene expres-sion was measured as a function of the tetracycline concentration in the medium.
The ~-galactosidase was detected with CPRG (chlorophenyl red ~-D-galactopyranoside) which gives a red color after hydrolysis.
The precondition for this is that there is constitutive expression of the tet repressor gene (tet repressor) in the appropriate cell. This is achieved by placing the repressor gene under the control of eukaryotic promoter which can be read in the appropriate eukaryotic cell and thus is able to function. For example, the tRNA trans-cription system according to the invention also functions in yeast cells when the tet repressor gene is placed under the control of a homologous promoter of the yeast, for example the ADH (alcohol dehydrogena~e) promoter.
Another advantage of the system, which results in the tRNA gene transcription system according to the invention functioning in principle in any eukaryotic cell, is that the tRNA genes possess so-called gene-internal promoters s~3 r~J
which are recognized by all eukaryotic organisms. This means that it is also possible, for example, for mutated RNA genes which have been taken from a particular organ-ism to be expressed in all possible other eukaryotic S cells without the need to alter the promoters.
The system can be stably integrated into any desired eukaryote. If there is constitutive expression of the tet repressor in the appropriate cell, regulation of the synthesis of the suppres~or tRNA gene i8 possible because tetracycline penetrateC very well into the cells of a wide variety of eukaryotes, even plants.
A control system of this type has the following advantages:
- The system controls the synthesis of any desired protein as long as the corresponding gene carries a translation stop codon.
- The synthesis of the foreign protein takes place only in the presence of tetracycline. Unwanted synthesis of this protein is therefore virtually ruled out. As such, the system contributes to the biological safety of organisms used in biotechnolog~.
- The tRNA gene transcription regulated by tetra-cycline can also be designed as a conditionally lethal system. If an essential gene is equipped with a translation stop codon, the corresonding organism can survive only in the presence of tetracycline.
2 ~
Examples Exam~le 1 Organisms, media and Dictyostelium discoideum transformation:
Axenic Dictyostelium discoideum strain Ax-2 was cultured in HL-5 medium (Biochem. J. 119, 175-182) at 22~C. Cells which were intended for use for transformation were cultured in HL-5 medium containing morpholineethanesul-fonic acid (Mol. Cell Biol. 4, 2890). Dictyostelium transformation was carried out as published (Gene 59, 99-106; Gene 39, 155-163; Mol. Cell Biol. 4, 2890). ~rans-formants were selected in the presence of 20 ~g/ml G418.
Clones were picked out and recloned in the presence of Klebsiella aerogenes (DNA 8, 193-204; Gene 85, 353-362).
The plasmid DNAs employed for the transformation were stably integrated into the genome, and amplified 10 to 100 times, in the transformants. 15 to 30 ~g of tetra-cycline were added to the medium to induce the tRNA gene amenable to regulation.
Example 2 Enzyme assay for ~-galactosidase:
D. discoideum cells were harvested, washed in phosphate buffer (14.7 mM RH2PO4/2mM Na2HPO4 pH 6) and resuspended at 5 x 106 _ 5 x 107 cells/ml of phosphate buffer. The cell suspension was then frozen and thawed again three times, vigorously mixing the cells for 1 minute between each of these cycles. Cell detritus was then removed by centrifu-gation, and the supernatant was employed for the deter-mination of the protein concentration and for the activ-ity determination (Gene 85, 353-362).
For the activity determination, 100 ~1 of extract were mixed with 300 ~1 of Z buffer (60 mM Na2HPO4/40 mM
NaH2PO4/10 mM ~Cl/l mM MgSO4 pH 7), 50 mM ~-mercapto-ethanol and 200 ~1 of a solution which contained 4 mg/ml ~ f~f~
- -o-nitrophenyl ~-D-galactoside (ONPG) in 100 mM phosphate buffer pH 7. The mixture was incubated at 22C, and $he reaction was stopped by adding 400 ~1 of 1 M Na~CO3. After centrifugation, the clear solution was optically measured at 420 nm. Enzyme activities are reported in kat, where one kat is defined as the enzymatic activity which hydrolyzes 1 mol of ONPG in one second at 22C.
Example 3 The physical map of the plasmid pDneoA6PTR i8 depicted in Fig. 1. The tetracycline repressor gene was isolated from the plasmid pWH305 (EMBO J. 3, 539-543). This entailed initial cutting with XbaI, filling in of protruding ends and subsequent religation in the presence of a BamHI
linker (CGGGATCCCG). After this, a BamHI/EcoRI fragment which contained the complete tetR gene was isolated.
The resulting fragment was ligated into the vector pDNeo2 (Mol. Cell Biol. 6, 3973-3983) which had been modified as follows. The vector was cut with SalI, and protruding ends were filled in with Rlenow polymerase. BamHI linker ligation (CGGGATCCCG) was followed by digestion with the enzymes BamHI and EcoRI.
Exam~le 4 The reporter gene is a variant of the plasmid pAPTlac.1, which was modified by primer-directed in vitro muta~ene-sis in such a way that it carries a UAG translation stopcodon in the reading frame of the act6::1acZ fusion gene.
The HindIII fragment with the fusion gene was isolated and cloned into the plasmid pGTET+l. This plasmid is a pUC19 derivative which carries a tRNAGlU (amber) suppres-sor gene and, in front of this gene, a tetracyclineoperator sequence (tetO).
2 ~
Example 5 The tRNAGlU (amber) suppressor gene is a variant of the tRNAGLUII gene from D. discoideum (DNA 8, 193-204). The gene was modified in the anticodon region by primer-di-rected in vitro mutagenesis so that a UAG translationstop codon is read, instead of a GAA glutamic acid codon, by the product. The entire 5'-flanking region of this tRNA gene was then removed by Bal41 deletion. The following synthetically prepared tetO fragment:
CTAGACTCTATCATTGATAGAGT was ligated into the XbaI cleav-age site located in front of the tRNA gene.
This plasmid was then cut with HindIII and, in this form, acted as recipient for the prepared HindIII fragment with the act6::lacZ fusion reporter gene from pA6PTlac.UAG.
The resulting plasmid pGTETR+1 is about 7.3 kb in size and carries the act6::lacZ fusion reporter gene and the inducible suppressor tRNA gene in the same transcription orientation.
Example 6 tRNA gene transcription amenable to regulation In order to establish stable D. discoideum strains with a suppressor tRNA gene which is amenable to regulation, the plasmids pDneoA6PTR and pGTETR~1 were stably inte-grated into the D. discoideum genome by cotransformation.
The transformants are primarily selected on the basis of the acquired G418 resistance. Resistant clones are then grown in medium which, besides G418 (15 ~g/ml), also contains tetracycline (15 ~g/ml). These clones are then assayed for ~-galactosidase activity. Positive clones are subsequently assayed for inducibility. For this, subpopulations of the positive clones are cultured in tetracycline-free medium. Expression of ~-galactosidase should no longer occur with these.
Particularly in view of the current vigorous discussion about biological safety, there is a need for a possible way of regulating, in a straightfoward manner but with great safety, the expression of genes from outside.
It would be possible with targeted regulation of tRNA
suppressor genes to carry out controlled expres3ion of structural genes which possess particular nonsense mutations. These mutations in the structural gene could then be regarded as conditionally lethal mutations.
The ob~ect of the present invention i8 to make it pos-sible to control the expression of a foreign gene in a host organism from outside.
The ob~ect has been achieved by a eukaryotic suppressor tRNA gene transcription system which is amenable to regulation and comprises (a) a tRNA suppressor gene (b) a prokaryotic operator (c) a repressor gene which is under the control of a eukaryotic promoter 0 (d) a reporter gene which is under the control of a eukaryotic promoter, (e) a resistance gene.
In a preferred embodiment, the invention relates to a eukaryotic suppressor tRNA gene transcription system which is amenable to regulation and includes a tRNA
suppressor gene which contains an operator or an operator sequence directly at the 5' end, that is to say in front of the actual gene. The tRNA suppressor gene is particu-larly preferably a tRNA (amber) suppressor gene from a eukaryote, preferably from Dictyostelium discoideum.
The operator is preferably a tetracycline operator (tet operator).
The suppressor tRNA gene transcription systemadditionally 2 ~
contains a repressor gene, preferably a prokaryotic tetracycline repressor gene (tet repressor gene).
The gene transcription system likewise includes a report-er gene which iB preferably of prokaryotic ori~in a~d is particularly preferably a ~-galactosidase (lacZ) gene from E. coli. This reporter gene contains a UAG (amber) translation stop codon in the N-terminal region.
Both repres~or gene and reporter gene are under the control of a eukaryotic promoter, preferably an actin 6 promoter from Dictyostelium discoideum.
Finally, the tRNA gene transcription system according to the invention also includes a resistance gene which can preferably be expressed in a eukaryote; a neomycin (neo) resistance gene is particularly preferred.
The transcription system according to the invention can be present inserted on two different plasmids, one plasmid containing the amber suppressor gene immediately in front of which the tet operator has been inserted. The plasmid additionally contains the lacZ gene from E. coli, which is under the control of an actin 6 promoter from D. discoideum. The lacZ gene carries a UAG (amber) translation stop codon in the N-terminal region. This gene can therefore act as so-called reporter system because it is expressed only when an active amber sup-pressor gene is present. Another plaRmid contains the tetrepressor gene which is likewise under the control of an actin 6 promoter, as well as the neo resistance gene which can be expressed in D. discoideum.
The invention likewise embraces a suppres~or tRNA gene transcription system which is amenable to regulation and is stably integrated in a eukaryotic cell. A cell of Dictyostelium discoideum iB preferred.
The invention also relates to eukaryotic cells which _ 4 ~ a~
contain a eukaryotic suppressor tRNA gene transcription system which is amenable to regulation. The transcription system contained in the cells corresponds to the trans~
cription system according to the invention including the preferred embodiments.
A Dictyostelium discoideum cell is particularly preferred in this connection.
The invention further embraces a proce~s for the prepara-tion of a eukaryotic suppressor tRNA gene transcription system which i8 amenable to regulation and is stably integrated in a eukaryotic cell.
The process according to the invention takes place in such a way that a eukaryotic tRNA gene is mutated to a tRNA suppressor gene, for example a tRNA (amber) suppres-sor gene, an operator, for example a prokaryotic tetoperator, is inserted immediately in front of the mutated tRNA suppressor gene, and the tRNA suppressor gene is then cloned onto a plasmid which carries a reporter gene under the control of a eukaryotic promoter, for example the actin 6 promoter from Dictyostelium discoideum, where this reporter gene, for example the lacZ gene from E. coli, contains a translation stop codon in the N-terminal region. A repressor gene, for example the tet repressor gene, which is likewise under the control of a eukaryotic promoter, for example the actin 6 promoter from Dictyostelium discoideum, is cloned onto another plasmid which preferably carries a resistance gene, for example the neo resistance gene, which can be expressed in eukaryotes. Then, in another process step, the two plasmids are stably integrated into the genome of a eukaryotic cell, for example a Dictyostelium discoideum cell, by cotransformation.
The eukaryotic suppressor tRNA gene transcription system which is amenable to regulation according to the invention can be used with a view to biological safety.
2 ~ ~q~3~'~
This is because a system of this type is capable of specific control of the expression of a polypeptide gene containing a UAG (amber) translation stop codon in a eukaryotic cell.
The principle of specific regulation of eukaryotic tRNA
genes is based on positioning the prokaryotic control system, in the present case the tetracycline (tet) operator, in the region of the initiation site of a tRNA
gene. Regulation of a tRNA gene in Dictyostelium dis-coideum i8 preferred according to the invention, but thisregulation may be implemented in any other eukaryotic cell such as, for example, cells of yeast strains or mammalian cells which carry suppressor tRNA genes amen-able to regulation.
For this purpose initially a tRNAGlU( W C) gene from D. discoideum was mutated to an amber suppressor gene.
The construction of the lacZ fusion gene is disclosed in Gene 59, 99-106.
The actin 6 promoter originates from the plasmid pDneo2 (Mol. Cell Biol. 6, 3973).
Under ~normal conditions" the transformants are charac-terized by a lacZ~ phenotype. However, if the cells are cultured in the presence of tetracycline, ~-galactosidase is detectable.
In the transformants there is constitutive expression both of the tet repressor and of the mutated reporter gene under actin 6 promoter control. The repressor now binds with extremely high affinity to the tet operator and thus masks the initiation site of the suppressor tRNA
gene. The expression of this gene is completely prevented by this. Consequently, it is also impossible for func-tional ~-galactosidase to be synthesized because a functional suppressor tRNA is necessary for this. If the 7 ~
cells are now cultured in the presence of tetracycline, sufficient tetracycline enters the cell nucleus to bind the repressor. This means that the repressor loses its affinity for the operator, the tet/operator complex diffuses away or no longer binds, and the transcription initiation site of the suppressor tRNA gene becomes free.
The synthesized suppressor tRNA efficiently reads over the amber stop codon in the lacZ gene and ~-galactosidase can be detected.
Brief description of the figures:
Fig. 1 i6 a diagrammatic representation of the plasmid pDneoA6PTR.
This plasmid contains the tetracycline repressor (tetR) fused to the N-terminal region of the actin 6 gene (A6P) from D. discoideum. Termination of transcription of the act6::tetR fusion gene takes place at the appropriate signal of the actin 8 gene (A8T) from D. discoideum. The plasmid furthermore carries the selection marker for D. discoideum transformation. This marker is the bac-terial neomycin-resistance gene (NeoR) from the transposon Tn903, which is transcribed in D. discoideum under the control of the actin 15 promoter (A15P) and terminator (A15T). The product, neomycin phosphotransferase, confers resistance to the neomycin analog G418 on the transfor-mants.
Fig. 2 is a diagrammatic representation of the plasmidpGTETR+1.
This plasmid carries the reporter gene for suppression and the inducible suppressor tRNA gene.
Fig. 3 is a diagrammatic representation of tRNA gene transcription which can be regulated by prokaryotic control systems in Dictyostelium discoideum (A) and the detection of tRNA function with the aid of a modified --7-- 2 ~
lacZ gene as reporter (B).
Fig. 4 depicts ~-galactosidase detection in cell extracts from D. discoideum.
The Dictyostelium strain contains a tRNAGlU (amber) sup-pressor tRNA gene [Glu(2) + ltetO] which carries the tet operator in its S'-flanking sequence. Furthermore, there is constitutive expression of the tet repressor by the strain, and it contains as reporter a lacZ gene which undergoes constitutive expression and carries in the 5' region an amber stop codon [A6PTlac(UAG)]. Also analyzed as control (3rd lane) was an extract prepared from cells with very high level expression of unmodified ~-galacto-sidase [A6PTlac].
In the lower part the inducibility of tRNA gene expres-sion was measured as a function of the tetracycline concentration in the medium.
The ~-galactosidase was detected with CPRG (chlorophenyl red ~-D-galactopyranoside) which gives a red color after hydrolysis.
The precondition for this is that there is constitutive expression of the tet repressor gene (tet repressor) in the appropriate cell. This is achieved by placing the repressor gene under the control of eukaryotic promoter which can be read in the appropriate eukaryotic cell and thus is able to function. For example, the tRNA trans-cription system according to the invention also functions in yeast cells when the tet repressor gene is placed under the control of a homologous promoter of the yeast, for example the ADH (alcohol dehydrogena~e) promoter.
Another advantage of the system, which results in the tRNA gene transcription system according to the invention functioning in principle in any eukaryotic cell, is that the tRNA genes possess so-called gene-internal promoters s~3 r~J
which are recognized by all eukaryotic organisms. This means that it is also possible, for example, for mutated RNA genes which have been taken from a particular organ-ism to be expressed in all possible other eukaryotic S cells without the need to alter the promoters.
The system can be stably integrated into any desired eukaryote. If there is constitutive expression of the tet repressor in the appropriate cell, regulation of the synthesis of the suppres~or tRNA gene i8 possible because tetracycline penetrateC very well into the cells of a wide variety of eukaryotes, even plants.
A control system of this type has the following advantages:
- The system controls the synthesis of any desired protein as long as the corresponding gene carries a translation stop codon.
- The synthesis of the foreign protein takes place only in the presence of tetracycline. Unwanted synthesis of this protein is therefore virtually ruled out. As such, the system contributes to the biological safety of organisms used in biotechnolog~.
- The tRNA gene transcription regulated by tetra-cycline can also be designed as a conditionally lethal system. If an essential gene is equipped with a translation stop codon, the corresonding organism can survive only in the presence of tetracycline.
2 ~
Examples Exam~le 1 Organisms, media and Dictyostelium discoideum transformation:
Axenic Dictyostelium discoideum strain Ax-2 was cultured in HL-5 medium (Biochem. J. 119, 175-182) at 22~C. Cells which were intended for use for transformation were cultured in HL-5 medium containing morpholineethanesul-fonic acid (Mol. Cell Biol. 4, 2890). Dictyostelium transformation was carried out as published (Gene 59, 99-106; Gene 39, 155-163; Mol. Cell Biol. 4, 2890). ~rans-formants were selected in the presence of 20 ~g/ml G418.
Clones were picked out and recloned in the presence of Klebsiella aerogenes (DNA 8, 193-204; Gene 85, 353-362).
The plasmid DNAs employed for the transformation were stably integrated into the genome, and amplified 10 to 100 times, in the transformants. 15 to 30 ~g of tetra-cycline were added to the medium to induce the tRNA gene amenable to regulation.
Example 2 Enzyme assay for ~-galactosidase:
D. discoideum cells were harvested, washed in phosphate buffer (14.7 mM RH2PO4/2mM Na2HPO4 pH 6) and resuspended at 5 x 106 _ 5 x 107 cells/ml of phosphate buffer. The cell suspension was then frozen and thawed again three times, vigorously mixing the cells for 1 minute between each of these cycles. Cell detritus was then removed by centrifu-gation, and the supernatant was employed for the deter-mination of the protein concentration and for the activ-ity determination (Gene 85, 353-362).
For the activity determination, 100 ~1 of extract were mixed with 300 ~1 of Z buffer (60 mM Na2HPO4/40 mM
NaH2PO4/10 mM ~Cl/l mM MgSO4 pH 7), 50 mM ~-mercapto-ethanol and 200 ~1 of a solution which contained 4 mg/ml ~ f~f~
- -o-nitrophenyl ~-D-galactoside (ONPG) in 100 mM phosphate buffer pH 7. The mixture was incubated at 22C, and $he reaction was stopped by adding 400 ~1 of 1 M Na~CO3. After centrifugation, the clear solution was optically measured at 420 nm. Enzyme activities are reported in kat, where one kat is defined as the enzymatic activity which hydrolyzes 1 mol of ONPG in one second at 22C.
Example 3 The physical map of the plasmid pDneoA6PTR i8 depicted in Fig. 1. The tetracycline repressor gene was isolated from the plasmid pWH305 (EMBO J. 3, 539-543). This entailed initial cutting with XbaI, filling in of protruding ends and subsequent religation in the presence of a BamHI
linker (CGGGATCCCG). After this, a BamHI/EcoRI fragment which contained the complete tetR gene was isolated.
The resulting fragment was ligated into the vector pDNeo2 (Mol. Cell Biol. 6, 3973-3983) which had been modified as follows. The vector was cut with SalI, and protruding ends were filled in with Rlenow polymerase. BamHI linker ligation (CGGGATCCCG) was followed by digestion with the enzymes BamHI and EcoRI.
Exam~le 4 The reporter gene is a variant of the plasmid pAPTlac.1, which was modified by primer-directed in vitro muta~ene-sis in such a way that it carries a UAG translation stopcodon in the reading frame of the act6::1acZ fusion gene.
The HindIII fragment with the fusion gene was isolated and cloned into the plasmid pGTET+l. This plasmid is a pUC19 derivative which carries a tRNAGlU (amber) suppres-sor gene and, in front of this gene, a tetracyclineoperator sequence (tetO).
2 ~
Example 5 The tRNAGlU (amber) suppressor gene is a variant of the tRNAGLUII gene from D. discoideum (DNA 8, 193-204). The gene was modified in the anticodon region by primer-di-rected in vitro mutagenesis so that a UAG translationstop codon is read, instead of a GAA glutamic acid codon, by the product. The entire 5'-flanking region of this tRNA gene was then removed by Bal41 deletion. The following synthetically prepared tetO fragment:
CTAGACTCTATCATTGATAGAGT was ligated into the XbaI cleav-age site located in front of the tRNA gene.
This plasmid was then cut with HindIII and, in this form, acted as recipient for the prepared HindIII fragment with the act6::lacZ fusion reporter gene from pA6PTlac.UAG.
The resulting plasmid pGTETR+1 is about 7.3 kb in size and carries the act6::lacZ fusion reporter gene and the inducible suppressor tRNA gene in the same transcription orientation.
Example 6 tRNA gene transcription amenable to regulation In order to establish stable D. discoideum strains with a suppressor tRNA gene which is amenable to regulation, the plasmids pDneoA6PTR and pGTETR~1 were stably inte-grated into the D. discoideum genome by cotransformation.
The transformants are primarily selected on the basis of the acquired G418 resistance. Resistant clones are then grown in medium which, besides G418 (15 ~g/ml), also contains tetracycline (15 ~g/ml). These clones are then assayed for ~-galactosidase activity. Positive clones are subsequently assayed for inducibility. For this, subpopulations of the positive clones are cultured in tetracycline-free medium. Expression of ~-galactosidase should no longer occur with these.
Claims (26)
1. A eukaryotic suppressor tRNA gene transcription system which is amenable to regulation and comprises (a) a tRNA suppressor gene (b) a prokaryotic operator (c) a repressor gene which is under the control of a eukaryotic promoter (d) a reporter gene which is under the control of a eukaryotic promoter, (e) a resistance gene.
2. A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claim 1, wherein the operator is inserted immediately in front of the tRNA
suppressor gene.
suppressor gene.
3. A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claims 1 and 2, wherein the operator which is inserted immediately in front of the tRNA suppressor gene is a tet operator.
4. A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claims 1 to 3, wherein the tRNA suppressor gene is a tRNA amber suppres-sor gene.
5. A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claim 4, wherein the tRNA amber suppressor gene originates from Dictyostelium discoideum.
6. A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claims 1 to 5, wherein the repressor gene is a prokaryotic tet repressor gene.
7. A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claims 1 to 6, wherein the reporter gene is of prokaryotic origin.
8. A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claim 7, wherein the reporter gene is a lacZ gene from E. coli, which carries a UAG (amber) translation stop codon in the N-terminal region.
9. A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claims 1 to 8, wherein the repressor gene and the reporter gene are under the control of the eukaryotic actin 6 promoter from Dictyostelium discoideum.
10. A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claims 1 to 9, wherein the resistance gene is a neomycin (neo) resistance gene which can be expressed in eukaryotes.
11. A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claims 1 to 10, which is stably integrated in a eukaryotic cell.
12. A eukaryotic suppressor tRNA gene transcription system amenable to regulation as claimed in claim 11, which is integrated in cells of Dictyostelium discoideum.
13. The plasmids pDneoA6PTR (Fig. 1) and pGTETR + 1 (Fig. 2).
14. A eukaryotic cell containing a eukaryotic suppressor tRNA gene transcription system which is amenable to regulation and comprises (a) a tRNA suppressor gene (b) a prokaryotic operator (c) a repressor gene which is under the control of a eukaryotic promoter (d) a reporter gene which is under the control of a eukaryotic promoter, (e) a resistance gene.
15. A eukaryotic cell as claimed in claim 14, which is a Dictyostelium discoideum cell.
16. A eukaryotic cell as claimed in claim 14 or 15, which contains a eukaryotic tRNA gene transcription system amenable to regulation as claimed in claims 1 to 10.
17. A process for the preparation of a eukaryotic sup-pressor tRNA gene transcription system which is amenable to regulation and is stably integrated into a eukaryotic cell, which comprises mutating a eukaryotic tRNA gene to a tRNA suppressor gene, inserting an operator immediately in front of the mutated tRNA suppressor gene, and cloning the tRNA suppressor gene onto a plasmid which carries a reporter gene under the control of a eukaryotic promoter, where this reporter gene contains a translation stop codon in the N-terminal region, and cloning a repressor gene which is likewise under the control of a eukaryotic promoter onto another plasmid which carries a resistance gene which can be expressed in eukaryotes, and then stably integrating the two plasmids into the genome of a eukaryotic cell by cotransformation.
18. The process as claimed in claim 17, wherein the tRNA
suppressor gene is a tRNA UAG (amber) suppressor gene.
suppressor gene is a tRNA UAG (amber) suppressor gene.
19. The process as claimed in claim 18, wherein the tRNA
suppressor gene originates from D. discoideum.
suppressor gene originates from D. discoideum.
20. The process as claimed in claims 17 to 19, wherein the operator is a (tet) operator.
21. The process as claimed in claims 17 to 20, wherein the reporter gene is a prokaryotic gene which is under the control of eukaryotic promoter.
22. The process as claimed in claim 21, wherein the prokaryotic reporter gene is a lacZ gene from E. coli, which carries a UAG (amber) translation stop codon in the N-terminal region.
23. The process as claimed in claim 22, wherein the lacZ
gene from E. coli is under the control of an actin 6 promoter from D. discoideum.
gene from E. coli is under the control of an actin 6 promoter from D. discoideum.
24. The process as claimed in claim 23, wherein the resistance gene is a neo resistance gene which can be expressed in D. discoideum.
25. The process as claimed in claims 17 to 24, wherein the eukaryotic cells are cotransformed with the plasmids pDneoA6PTR and pGTETR + 1.
26. The use of a eukaryotic suppressor tRNA gene trans-cription system amenable to regulation as claimed in claims 1 to 14 for the specific control of the expression of a polypeptide gene carrying a UAG (amber) translation stop codon in a eukaryotic cell.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE4103952A DE4103952A1 (en) | 1991-02-09 | 1991-02-09 | SUPPRESSOR-TRNA GENTRAL TRANSFER SYSTEMS |
| DEP4103952.1 | 1991-02-09 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2060874A1 true CA2060874A1 (en) | 1992-08-10 |
Family
ID=6424718
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002060874A Abandoned CA2060874A1 (en) | 1991-02-09 | 1992-02-07 | Suppressor trna gene transcription systems |
Country Status (6)
| Country | Link |
|---|---|
| EP (1) | EP0499059A1 (en) |
| KR (1) | KR920016592A (en) |
| AU (1) | AU1077392A (en) |
| CA (1) | CA2060874A1 (en) |
| DE (1) | DE4103952A1 (en) |
| IE (1) | IE920420A1 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001068835A2 (en) * | 2000-03-13 | 2001-09-20 | Aptagen | Method for modifying a nucleic acid |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4687737A (en) * | 1982-11-12 | 1987-08-18 | Massachusetts Institute Of Technology | Mammalian suppressor genes |
-
1991
- 1991-02-09 DE DE4103952A patent/DE4103952A1/en not_active Withdrawn
-
1992
- 1992-01-22 EP EP92100983A patent/EP0499059A1/en not_active Withdrawn
- 1992-02-07 AU AU10773/92A patent/AU1077392A/en not_active Abandoned
- 1992-02-07 CA CA002060874A patent/CA2060874A1/en not_active Abandoned
- 1992-02-07 IE IE042092A patent/IE920420A1/en unknown
- 1992-02-07 KR KR1019920001738A patent/KR920016592A/en not_active Application Discontinuation
Also Published As
| Publication number | Publication date |
|---|---|
| KR920016592A (en) | 1992-09-25 |
| AU1077392A (en) | 1992-08-13 |
| DE4103952A1 (en) | 1992-08-13 |
| IE920420A1 (en) | 1992-08-12 |
| EP0499059A1 (en) | 1992-08-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Maeser et al. | The Gin recombinase of phage Mu can catalyse site-specific recombination in plant protoplasts | |
| Zock et al. | The Bacillus subtilis pnbA gene encoding p-nitrobenzyl esterase: cloning, sequence and high-level expression in Escherichia coli | |
| US5948622A (en) | System for in vitro transposition | |
| JPH06104065B2 (en) | Production of promoters for expression of foreign genes in yeast, plasmids comprising them, and polypeptides | |
| CA1309675C (en) | Recombinant dna expression vectors and dna compounds that encode isopenicillin n synthetase from penicillium chrysogenum | |
| EP0351585B1 (en) | Vector containing a chicken beta-actin gene promoter for the expression of a desired gene | |
| AU6346900A (en) | Recombinase-based methods for producing expression vectors and compositions for use in practicing the same | |
| PH25990A (en) | Site selective genomic modification of yeast of the genus pichia | |
| GB2136814A (en) | Dna vectors | |
| Ross-Macdonald et al. | [29] Transposon mutagenesis for the analysis of protein production, function, and localization | |
| JP3689920B2 (en) | Multicloning vectors, expression vectors, and production of heterologous proteins | |
| JPS61257189A (en) | Novel plasmid vector | |
| US6368821B1 (en) | Process for infecting eukaryotic cells with a bacterial virus | |
| WO2001079512A2 (en) | Vector and method for targeted replacement and disruption of an integrated dna sequence | |
| CA2060874A1 (en) | Suppressor trna gene transcription systems | |
| CA2080482C (en) | Isolated promoter and terminator of elongation factor ef-1.alpha. | |
| EP1405908A1 (en) | Creation of high yield heterologous expression cell lines | |
| US6596513B2 (en) | Kluyveromyces lactis maltase/maltose permease bi-directional promoter and use thereof | |
| EP0374162B1 (en) | Balanced constitutive inducible transcription system | |
| WO1995009914A1 (en) | Multicloning vector, expression vector, and production of foreign protein with expression vector | |
| Musmanno et al. | Complete hamster CAD protein and the carbamylphosphate synthetase domain of CAD complement mammalian cell mutants defective in de novo pyrimidine biosynthesis | |
| Werneke et al. | Development of broad-host-range vectors for expression of cloned genes in Pseudomonas | |
| US6838239B1 (en) | Chitobiase as a reporter enzyme | |
| JPH05276958A (en) | Recombinant dna compound and expression vector encoding para-nitrobenzyl esterase activity from bacillus | |
| EP0154351B1 (en) | Expression plasmids useful in b. subtilis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FZDE | Dead |