HUT68066A - Transgenic wheat - Google Patents

Abstract

A novel method for producing transgenic wheat plants, vectors for use in the method and novel transgenic wheat plants.

Description

The present invention further relates to transgenic odoriferous plants.

Since the advent of recombinant DNA technology and its successful application in the transformation of various organisms, one of the main goals has been to do this. the technology is generally used to transform crops or crops of agricultural importance (eg wheat). This type of transformation allows the production of transgenic plants with novel features that provide developmental benefits (e.g., increased root system, herbicide and insect pest resistance).

Because of the steady growth of humanity. It has long been recognized that there is an urgent need to increase the yield of important crops such as cereals (especially wheat), which can be achieved by developing new varieties that have the development benefits mentioned above.

Several different methods have been developed for transforming plants. One such method is the production of protoplasts from plant tissue and their transformation in vitro.

••••••••••••············································ ·

And includes regeneration of transformed protoplasts into whole plants.

Other methods employ an Agrobacterium tumefaciens system to insert recombinant T-DNA from Ti or Ri plasmids into the seed DNA of plant cells. A further method of transforming plant tissue with foreign DNA involves bombarding plant cells with DNA-coated carrier particle bullets, in which some of the projectiles penetrate the plant cells and insert foreign DNA.

Various methods of microinjecting foreign DNA into plant tissues, especially reproductive or regenerative organs, have been used to produce transgenic plants.

All of the above methods have been developed primarily for the transformation of dicotyledonous plants and can be successfully applied to transform these plants. However, they were less useful for the transformation of monocotyledonous plants, especially wheat.

One of the reasons why these methods are not applicable to many monocot plants is that their tissue cultured cells are very difficult to regenerate into whole plants.

• 4 «· 4 • 44 • • 44

One method of transforming wheat plants, involving the uptake of pyramidal DNA at the time of pollen emergence, is described by Picard et al. (Proceedings of the Seventh International Wheat Genetics Symposium, Vol. 1, pp. 779-781; Ed. Miller and Koebner, Cambridge, England, July 13-19, 1988). Plasmids containing aminoglycoside phosphotransferase II gene (NPTII) (expressed to confer kanamycin resistance) and wheat chromosomes up to putative chromosomes to enhance integration of foreign DNA have been used. The plasmids were introduced into the exposed pollen hose, which first removed the tips of the pollinated stigmas (in which the poenene hoses evolved) to open the solution containing the pollen hoses and then the plasmid.

DNA on the emerging pollen tubing apparently migrated downward with the male nucleus, and at the same time as fertilization reached the embryo.

As a result, about% of the obtained seeds were resistant to kanamycin, which was shown to be able to germinate and develop on kanamycin-containing medium and to develop into mature wheat plants in soil irrigated with water containing 100 mg / L kanamycin. Southern biot analysis with the NPTII gene probe also proved that DNA extracted from kanamycin-resistant plants containing the NPTII sequence together with the above-mentioned wheat replication origin plasmids is the most abundant.

Moreover, when these plants were crossed by self-fertilization, each member of the resulting second crop generation (Fs) was kanamycin resistant. which proves that NPTII sequences have entered the second generation. There was no distinction between true integration into the wheat genome and the apparent endophytes carrying NPTII.

It should be noted that, since the publication above, there have been no other descriptions that have confirmed the efficacy of this transformation crop in wheat.

It should also be noted that other publications and conferences following this publication testified that practitioners in this field could not repeat the above procedure and returned to the other wheat transformation techniques mentioned earlier. The above-mentioned techniques of cereal crops - including wheat. Current Transformation Procedures have been described in a review article (Potrykus, Bio / Technology, £ 535-542, 1990) in which it was found that further investigation of the pollen tube process was unsuccessful. promise; in the author's words: pollen tube road: no transgenic wheat was produced; probably does not hide many opportunities ..

We have to note that. Also, the above procedure has since been successfully performed only in rice plants (Luo and Wu, Plant. Biology Reporter, 7, 69-77, 1989), which, although monocotyledonous, has many physiological aspects.

It should also be noted that for all described wheat plants transformed by any of the above methods, none of the wheat strains were commercially available.

different from wheat.

crop variant, ie agricultural version for large quantities of crop wheat. Most of the putative transformed wheat plants are of minor agricultural importance and better. be n as starting points for the experimentation and production of transformed commercial wheat strain, e.g.

will return Estonian by crossing with this and other variants.

The invention provides a transgenic wheat plant process, especially commercial transgenic crop wheat variety (e.g. wheat crop used worldwide for variants of any of ^-.) Thereof.

Another aspect of the invention is a commercial variant of a transgenic wheat plant.

One consequence of the invention. the subject of said transgenic wheat plants':

recombinant DNA molecules.

All other aspects of the invention are described in the following description and in the claims.

According to the above-mentioned objects of the invention, there is described a process for producing transgenic wheat plants comprising (a) male sterilizing the flowers of wheat plants by removing them before ripening and then pollinating the stems of these flowers with ripe pollinators of the same or different varieties of wheat plants;

(b) applying one drop of aqueous DNA solution to one or more of the pollinated pupae within a period of time after pollination, during which time pollen tubes in the pollinated pupae begin to grow into the stalk but have not reached the nucleus.

comprising at least one suitable DNA vector carrying a gene which is foreign to the plant and capable of inducing expression of a desired trait in the plant, and optionally an additional marker gene;

(c) maintaining a drop of said DNA solution in a humid environment for a period of time sufficient to ensure that said DNA vector reaches and enters the nucleus;

(d) protecting the treated plants of step (c) from further pollination by other nearby plants, raising the treated plants, and igniting the seeds formed in the flowers; and (e) cultivating said seeds under conditions adapted for the selection of transformed wheat plants.

In one embodiment of the method of the invention, hereinafter referred to as a truncation method, the stigmas are truncated after pollination and a drop of the aqueous DNA solution is applied to the truncated stigma. In other embodiments of the invention, hereinafter referred to as the intact pup, a drop of the aqueous DNA solution is applied to the intact (intact) pup after some time after pollination.

Said truncation is preferably carried out by cutting off the stigma, preferably 1-2 hours after pollination. For cultivated varieties of spring wheat (Tri ticiun aestiviun) such as ATIR (CNO)

S / PJ62 / 4 / GLL / 3 / T0B // JAR S / CRESPO, Hasera Seed Co., Israel), BAGULA S (CM 59123, CIMMYT. Mexico), CIANO 79 (CM31678, CIMMYT, Mexico), Genaro 81 (VEERY # 3S, CIMMYT, Mexico), KAUZ S (CM67458, CIMMYT, Mexico), KEA S (CM21335, CIMMYT, Mexico), MILAN (23IBWSN37, 'CIMMYT, Mexico) and 85 M 85 (CM40038, CIMMYT, Mexico), Papago M86 (CM52359, CIMMYT, Mexico) and PAVON 76 (CM8399, CIMMYT,

Mexico), Seri 82 (VEERY # 5S ”, CIMMYT, Mexico) and Shafir (SON64A / TZPP // NAI60 / 3 / FA, Hazera Seed Co., Israel), all tested according to the invention, for truncation. , preferably approx. lVz hour. It is believed that the preferred time between pollination and trimming can be applied to other wheat species and varieties.

s. '

Generally, if the truncation method according to the invention.

is performed, the time interval between pollination and stubble cutting should be selected according to the type of wheat used and the environmental conditions. If, for example, the type of wheat variant and environmental conditions favor relatively rapid adherence of pollen to the pup, subsequent rapid development of the pollen tube and growth in the stamen and stalk, said interval may be 1-1 ^ - / 2 hours. If the wheat variant type and environmental conditions favor slower pollen adhesion and slower development of the pollen tube, the interval may be 1 ^x / 2-2 hours.

The timing between pollination and DNA application can also be followed by the intact stigma procedure, the wheat genotype and environmental conditions used, etc. Depending on.

The DNA solution applied in step (b) of the process described is dropped. in both embodiments, preferably, the pollinated stigma (step (c)) is held for a period sufficient to ensure that it is transported by the growing pollen tube. DNA vector reach the egg. It has been found that the appropriate duration is at least 12 hours, for example 12-14 hours.

The present invention further provides a recombinant DNA vector for use in the above method.

s.

The DNA vector of the present invention contains a gene which induces expression of a trait in a plant.

which trait is desired in the plant.

Such a gene may be, for example, a nitrogen-binding protein which confers herbicide resistance to a plant.

may also contain a reporter gene such as, F.

coli 13g1curonone gas encoding uidA gene. which serves as an indicator of successful transformation: this gene when expressed. substrates of the enzyme

together, they are capable of converting the substrate into a detectable product.

Preferably, the DNA vector may further comprise a plant selectable marker gene, such as antibiotic resistance, e.g. kanamycin resistance gene. An example of such a gene is, but is not limited to, the APH (3 ') II (NPTII) gene used in experiments performed within the scope of the invention, which is linked to the nopaline synthase (NOS) promoter and the polyadenylation signal sequence of Tu-DNA (gene 4). connects.

(Gielen, J., et al.

1984; Koncz et al.

1989). The APH (3 ^R) II (NPTII) gene encoding an enzyme to the aminoglikozidfoszfotranszferáz, thus kanamycin resistance to transformed plants.

The large amount required to prepare said DNA solution

s. _

For the production of DNA vector in bacteria a

The vector may also contain another bacterial selectable marker gene, such as the Amp ^K gene.

Non-limiting examples of such DNA vectors used in experiments within the scope of the invention are plasmids pPCV702nIfD and pPCV702GUS, each containing the aforementioned APH (3 ') II gene, and the Klebsiella nifV and NOS terminator, and the coding region for β-glucuronidase in pPCV702GUS also binds to the CaMV 35S promoter and NOS terminator. Accordingly, wheat plants transformed with any of these plasmids according to the invention are kanamycin resistant and / or capable of expressing the GUS enzyme.

Another object of the present invention is to provide crop varieties of agricultural, commercial wheat.

Various commercial wheat plant variants created for the first time as a result of the invention fill a long-standing shortage. Prepared according to the invention. Transgenic wheat plants were grown for five generations without loss of the foreign gene with which the original plants were transformed.

Brief Description of the Drawings

1. Figure pPCV702nf1D plasmid is schematic representation visible. THE 2. Figure a pPCV702GUS plasmid is schematic representation visible. 3a figure the wild type wheat variants, the invention

The results of the hybridization of the NPTII gene Southern probe to the BamHI and HindIII restriction endonuclease digested DNA samples derived from the plants transformed according to the method of SEQ ID NO: 1 and pPCV702niiD (see Example 4).

Figure 3b shows a schematic restriction map integrated into the wheat genome of transformant TAU89107-1. The corresponding restriction endonuclease sites of plasmid pPCV702ni2D, which were determined from the Southern biot (Figures 3a, 4a and 5) (see Example 4).

Figure 4a is a view of wild-type wheat varieties and the invention. shows the results of hybridization of NPT II Southern, a probe for PstI restriction endonuclease digested plants from plants transformed with plasmid pPCV702nffD (Example 4).

Figure 4b shows a schematic restriction map depicting the appropriate restriction endonuclease sites of the plasmid pPCV702nifD integrated into the wheat genome as shown in Figure 4b.

Southern biot results (3 / a, 4 / et e 5. figure) we have determined (see Example 4).

Figure 5 is a fragment of the NPT II fragment and vector 702nil) from wild-type wheat variants and (transcribed with plasmid pPCV702njfD).

(self-fertilization) of transformed wheat plants using second generation (Fa) DNA samples digested with BamHI and PstI restriction endonuclei

Shows the results of Southern biot hybridization (Fig. 4).

example).

Figure 6 shows the results of Southern biot hybridization of a BamHI and HindIII restriction endonuclease DNA sample derived from self-insemination of NPT II fragment with transformant TAU89107-1 transformed wheat (Example 4).

Figure 7 shows the results of Southern biot hybridization of BamHI and HindIII endonuclease DNA samples derived from self-insemination of NPT fragment II and TAU89107 Fa families from transformed wheat plants (Examples 4 and 6).

Figure 8a shows the transformed version of Shafir • · · ·

- shows the results of agarose gel electrophoresis of DNA samples obtained by PCR amplification of the APH (3 ') II gene present in 14 plants. DNA samples were extracted from Fz, Fs and F4 plants obtained by self-insemination of TAU89107-1 transformant (Example 7).

Figure 8b shows the results of agarose gel electrophoresis of DNA samples obtained by PCR amplification of the APH (3 ') II gene and the terminator of gene 4 using total DNA extracted from F4 progeny of transformed TAU89-107-1 plants (Fig. 7). example).

Figure 9 shows the results of Southern biot hybridization of BamHI and HindIII endonuclease DNA samples from the gene terminator fragment 4 and wild-type Shafir wheat plant and TA489107-1 transgenic F4 progeny. All four generations. obtained by self-fertilization (Examples 4 and 8).

Fig. 10a shows the progeny of the TAU89107-1 transformerant Fs generation CC44 (TAU89107-1-J18-9-1B-4A), which when grown on kanamycin-containing medium produced normal shoots while the wild-type Shafir plant grew white under similar conditions. Example 9).

Figure 10b shows a gel separation analysis of PCR amplification products of the NPTII tail (51 bp) and its gene 4 terminator using CC44 transformant.

Or DNA extracts from the Shafir wheat variant were used (Example 9). '

Figure 11 shows the results of hybridization of the first generation wheat plants of the commercial wheat variants Pavon 76 and Seri 82 transformed with the plasmid pPCV702GUS as a probe using a plasmid used for transformation as a probe. DNA samples were digested with EcoRI and HindIII endonucleases (Example 10).

Figure 12 shows the results of agarose gel electrophoresis of DNA samples obtained by PCR amplification of the APH (3 ') II and GUS genes from DNA transformants from the Seri 82 Fi transformants (Figure 10).

Figure 13 shows the results of agarose gel electrophoresis of a 0.6 kb PCR product obtained from F1 transformants transformed with the Streptomyces hygroscopicus bar gene carrying plasmid pPAT-NPTII 100.1-28 (Example 12).

The invention will now be described in more detail by the following examples and the accompanying drawings. The examples are described by way of illustration and not limitation of the invention.

Example 1: Plasmids

Two plasmids (pPCV702ziffD and pPC'V702GUS), which are shown in Figures 1 and 2 respectively, were constructed from the vector pPCV702 (Koncz and Schell, 1986; Konc3 et al., 1989). The két (3 ') ΙΙ v coding for the aminoglycoside (kanamycin) phosphotransferase is present in both plasmids. The NPT II gene, which was linked to the MOS (nopaline synthasease) promoter and the polyadenylation signal (PoliA, terminator) of the TL - DNA ipt gene (gene 4), served as a selective marker gene. This gene, when expressed in plants, conferred kanamycin resistance.

Plasmid pPCV702nifD contains the coding region of Klebslella pneuinonlae ηΐίΐ) between the CaMV 35S promoter and the NOS terminator.

Plasmid pPCV702GUS contains a coding region for the reporter gene, β-glucuronidase (GUS), linked to the CaMV 35S promoter and the NOS terminator.

A mixture of twisted and stretched forms of said plasmid DNAs was dissolved in a mixture of 10 mM Tris and 1 mM EDTA (pH = 8) to prepare DNA solutions, which were transferred to the stigmas in the following transformation procedures.

Example 2: Preparation of wheat plants and use of DNA

Wheat plants selected from commercial wild-type spring wheat varieties were grown in controlled-temperature greenhouses (21 ± 2 ° C) with additional lighting in pots. In addition, another group of wheat plants of the above variants was grown in mesh culture on sandy soil. Groups of these wheat plants were sown at the beginning of the experiments, and were repeatedly seeded every ten days to provide continuous pollen for pollination. provide. When the wheat plants reached developmental stage 57 (3/4 of the ears appeared), the test plant ears were treated as follows: each ear was cut at half its height, the middle flower was removed, leaving the two outer flowers in place. removed from the remaining flower (in each cornea). Each of the ears on one side of the ear axis was labeled with a waterproof marker at the base and then wrapped in a transparent parchment pouch.

When both ears of the middle ears began to become fluffy and spread outward (about 4-5 days after male sterilization), i.e., the sign of maturity of the wasp, the transparent parchment pouch was cut through the tip and the same or different variant, which was cut in half at the cornea (to help the mature stamens protrude from the glum), was placed in it. The dusty corn. We left it in the bag for 20-30 minutes to allow its ports to pop open. and the pollen release .. The dusty earrings were rotated several times to allow each pollen to reach each flower and then removed to make the transparent pollen. ···· · · · · · ··· · ♦ ··· * ·

- 18 parchment bags closed with one clip.

^{1 /} 2-2 ^1/2 hours, usually 1 ^ - / 2 to 2 ^3/2 hours the flaky pistils peak - at the stage when the pollen tubes have been formed and started to grow on the stigma beporaott (but have not yet been through on the stalk to reach the nucleus) - cut with sharp pointed needle scissors to expose the pollen tubes and place a 10 µl DNA solution droplet (2-3 µg plasmid DNA - Example 1) on the tip of the ears of the ears of the previously marked half-flower. . The flowers of the unlabeled half of the ears, which served as controls, were treated with 10 μl of water. It should be noted that the pollination procedure described above initiates the formation of pollen tubes within the stigma at the same time. In addition, the length of time between pollination and harvesting of pollinated stigmas will vary depending on the environmental conditions and the strain of wheat crop employed; the optimum time between pollination and truncation is favorable in cases of relatively rapid adhesion of pollens and subsequent rapid development and growth of pollen hoses. ll ^ -Zh hours, while for pollen slower adhesion and slower development of pollen hoses it takes approx. l ¹ Zz-2 hours.

The treated plants · with their ears fully exposed and the transparent parchment pouches removed - were placed in a high-humidity chamber in a controlled-temperature greenhouse, where they were humidified with a water vaporizer for 12-14 hours. A · · · «« «· 4 4 4 4 4 4 4 4 · · * 4 4

- 19 plants grown in nets were treated in the afternoon when the temperature dropped below 20 ° C. Following the introduction of the DNA, the plants were encapsulated (or treated with dew) in a moisture-proof plastic bag overnight to allow the pollen tubes to grow to the nuclei and then to fertilize the seed bud. After treatment with the drizzle or dew, the transparent parchment pouches were pulled over the treated ears to cover them and the pouches were closed with paper clips. For each treated corn, the operations performed are described in detail.

Experiments similar to the above procedure were performed in which the stigmas were not cleaved and the DNA solution was applied to the pollinated, uncut peak stigma. The results of both sets of experiments are shown in Table 1 for Example 3.

Example 3: Biological Assays (a) APH (3 ') 1I Expression

Example 2. Seeds obtained by the transformation process using pPCV702? iRT.> vector were soaked in hypochlorite for 5 minutes and washed with distilled water. followed by 150 µg / ml. kanamycin was placed in water-agar petri dishes and placed in a 25 ° C growth chamber. Ten days later all the seeds. Transferred to MS medium and then · ·

- Observed the bleaching of the shoot and recorded the number and length of roots. In some experiments, the seedlings were kept on kanamycin-containing medium for 4 days, then transferred to MS medium for another four days and evaluated as above.

Seeds of the F1 generation obtained by the transformation process described above were treated with hypochlorite and placed in 150 µg / ml kanamycin-containing aqueous agar p roducts, together with parental controls without kanamycin. The germinator with normal root and non-white primary leaves seeds were placed in pots and kept at 18 ° C (14 hours illumination / 10 dark cycles ·). These Fi seedlings were grown to maturity and the seeds of the Fa generation represented by them were sown to increase the number of seeds. The seeds obtained from them represent

F.3 generation.

APTII activity, i.e., vectors used to transform native parent plants. To study the expression of the NPTII gene, seeds of the Fs generation were germinated on aqueous agar containing 150 µg / ml kanamycin. Compared to the white leaves of untransformed controls, the development of green leaves indicated the presence and expression of the APTII gene. The green seedlings were taken to the greenhouse and their leaf DNA was Southern biota. analysis and PCR amplification of specific sequences (see Examples 4 and 11).

»· · * 4 · · 44 ♦ ♦ 4 · ·· 4 4 · • ·» · ·· ···· 4

The above kanamycin selection was performed on all successive generations of the transformed plant line TAU89107-1 up to the Fe · generation (including the latter), food also proving that the above transformation is stable.

(b) GUS expression

Axially transformed expression of seedlings was confirmed.

detectable gene expressing in appearing roots (uidA exemplified and containing Fi generation linseed giblets, giblets group (14.6%, prior art, flowing direct, physical). -Glucuronidase due to X-glucose utilization breaks (GUS activity is indicated by 1987). As shown in Figure 2.

comparative) stigma, plasmid derived dο n, injured as cut

%). which is in contrast to the need for developing polar links in the DNA solution).

as substrate cut from pPCV702GU plants

X-glucose βΐ, 4 blue colors were introduced into the genome (Jefferson et al., GUS integrated in 40% of the plants) (see Example 10 and Figure 11).

we noted that during the GUS examination, the pPCV702GUS was applied to the cut (ie without the tip of the stigma)

From plants transformed with DNA solution between seedlings. Surprisingly better results or 5.8 according to

TABLE I

Evaluation of GUS activity at the root of germinating Fi transformants

Seeds number Number of germinated seeds GUS test % examined sample Positive Intact pistil 113 112 39 13 14.6 Cut pistil 926 599 364 21 5.8

The appearance of the blue color of the X-glucose cleavage product is described by Jefferson et al. (1987).

Example 4: Integration of the NPTII [APH (3 ') II] gene into wheat germ; Southern biot hybridization

The presence of foreign DNA in the transgenic wheat, i.e. the previously mentioned kanamycin-resistant plants, was confirmed by Southern imprinting (see Figs.

Figure 9). Total DNA (15 µg) extracted from leaves of putative transformants and wild-type plants was digested with various restriction enzymes (standard methods), separated on a 0.8% agarose gel, and imprinted on a nylon filter. . ³² P-labeled Apa isolated from plasmid pPCV702GUS containing total NPT (Figure 2)

The I / Hind III fragment was used as a probe to detect foreign DNA integrated in the wheat genome. Probe hybridization was performed under stringent conditions (namely, x5 Denhardts' solution, x4 SSC, 0.1% SDS, followed by four rinses in x4 SSC, 0.1% SDS, at the same temperature).

As shown in Fig. 3a, the complete DNA is Genaro 81 (VEERY # 3S, CIMMYT, Mexico) and Seri 82 (VEERY # 5S, CIMMYT,

Mexico) and

Shafir (S0N64A / TZPP // NAI60 / 3 / FA, Hazera Seed

Israel) from wheat varieties and kanamycin resistance (Km ^R ) or NPTII activity

And TAU89104-3

Extracted from putative transformants TAU89107-1 (transformed with plasmid pPCV702nf). All extracted DNAs were separated on BamHI and HindIII restriction agarose gels, digested with endonuclease, and loaded onto a nylon filter by the above standard procedure. As a positive control, two DNA samples were prepared from plasmid pPCV702GUS; one was digested with BamHI and HindIII and the other with ApaI and HindIII and these samples were also separated on said agarose gel and loaded onto a nylon filter. The DNA samples on the nylon filter were subjected to the hybridization procedure mentioned above. was hybridized with the NPTII Apal / HindIII fragment probe. The hybridization results shown in Figure 3 / a

X. »show that the TAU89107-1 transformant exhibits an approx. 10.5 kb * · ·

- It contains foreign DNA on a 24 high molecular weight BamHI / Hindi DNA fragment that hybridizes to the NPTII probe. None of the wild-type DNA fragments can hybridize to the NPTII probe, which means that this gene is not present in wild-type genomes. Figure 3 / b is a schematic restriction map illustrating a possible route for insertion of a portion of plasmid pPCV702nffD (Figure 1) into the wheat plant genome; the word genome refers to genomic DNA. This map was constructed based on the hybridization results shown in Figures 3a and 4a, and the known restriction enzyme cleavage sites of plasmid pPCV702 / JifD (Figure 1) and the lack of the nlID sequence in the transformant DNA of TAU89107-1. .

As shown in Figure 4a, total DNA was extracted from wild-type variants and transformant wheat plants identical to those shown in Figure 3a, but these DNA samples were digested only with PstI restriction endonucleases, which are both plasmid vectors NPTII and cleavage at the ainpK gene. The digested DNA samples were separated on an agarose gel and transferred to a nylon filter and hybridized with the NPTII Apal / HindIII DNA fragment probe as before. The results of the hybridization show that the TAU89107-1 transformant has two PstI DNA fragments (approximately 6.9 and 0.8 kb) which are capable of hybridizing with the probe. The schematic restriction map shown in Figure 4b is identical to Figure 3b

S. 'te as shown, and hybridization shown in Figures 3a and 4a

and the known restriction enzyme cleavage sites of plasmid pPCV702zuilD (Figure 1).

As shown in Figure 5, the wild-type Shafir variant and nine Fz transformants (1, 2, 3, 4, 5, 6, 7, 8 and 9) of the TAU89107-1 Fi plants (see Figures 3a and 4a). a) total DNA was extracted. These DNA samples were digested with PstI and BamHI as described previously, separated on an agarose gel, and transferred to a nylon filter. The DNA samples on the nylon filter were hybridized to the NPTII Apal / HindIII DNA fragment + pPCV702zjffD probe under the hybridization conditions mentioned above. The results show that Fz generation 4, 5, 6, 8 and 9 transformants carry Pst.I / BamHI DNA fragments (about 2.5 and 3.5 kb) capable of hybridizing. that are missing from wild-type genomic DNA.

Example 5: Southern hybridization of F2 DNA

The presence of the 10.5 kb fragment digested with the restriction enzymes BamHI and HindIII in the Fz generation plants of TAU89107-1 transformants is shown in Figure 6. Lanes 1 and 2 represent the Fz generation TAU89107-1-J18 transformant; column 4, Fz. from self-fertilization of TAU89-107-1 Fi plants. generation TAU89-107-1-K10 transformant; lanes 3 and 5 represent control DNA from EcoRI digested plasmid pPCV702nfD. A Southern • «·«

26 biotypes were performed as described in Example 4. The probe used for this assay is the HindIII-Apai NPTII fragment and the PCR-terminated gene terminator 4 (see Figure 8).

which resulted in identical hybridization samples.

Example 6: Southern hybridization of F3 DNA

The presence of 9.8 kb and 10.5 kb fragments digested with BamHI and HindIII in F3 generation TAU89107-1 transformants is shown in Figure 7. Column 1 contains DNA from the wild-type Shafir variant, columns 2, 3, and 4 contain TAU89107-1-H29-21, TAU89107-1-CJ17-14, and TAU89107-1-J18-9 Represents Fs family. Southern biotech was performed as described in Example 4. The probe used for this assay is the HindIII-Apal NPTII fragment and was synthesized by PCR. Gene terminator 4 (see Example 8) was used to produce identical hybridization patterns.

Example 7: PCR amplification

Figure 8a shows the DNA fragments obtained after the PCR procedure under standard conditions, agarose results, viz.

Shafir

TAU89107-lKm ^K

t. ransf o r man s subfamilies Fs,

Results of PCR amplification of the inserted NPTII coding sequence in F4 generation plants (PCR procedure)

see also Example 11). The templates used for PCR were as follows:

Lane 1: control sample without DNA template;

Lane 2: Shafir DNA control sample;

Column 3: Transformant

TAU89107-1-B19 DNA;

Column 4: Transformant

TAU89107-1-J20 DNA;

Column 5: Transformant

TAU89107-1-J18-X DNA;

Lane 6: Transformant

TAU89107-1-J18-9 DNA;

Lane 7: Transformant

TAU89107-1-J18-9-1B DNA;

Lane 8: Transformant

TAU89107-1-J18-9-1K DNA; and untransformed wild type

sample, wood generation Shafir sample, F2 generation Shafir sample, f ₃ generation Shafir sample, f ₃ generation Shafir sample, F " generation Shafir sample, F ₄ generation Shafir

Lane 9: Size markers for DNA fragments cleaved by bacteriophage 0X174 cleaved with HaelII restriction endonuclease.

Thus, the foreign DNA is confirmed F2, F3 and _F4 generations of Shafir TAU89107 ^LKM-R transformants subfamilies direct PCR amplification (see Fig. 8 / figure). Each of the transformant harboring the NPTII coding sequence was synthesized with a 790 bp fragment of the templates, regardless of generation (F2, F3 or _F4).

• · ·

Figure 8b shows the results of PCR amplification of the APH (3 ') II gene and its adjacent gene 4 t.minerator using total DNA extracted from F4 progeny obtained by self-fertilization of the TAU89107-1Km ^R transformant. The following primers were used for PCR:

Primer 1 is the NPTII coding region 21-47. nucleotide (26 nucleotides): 5'-GCACGCAGGTTCTCCGGCCGCTTGGG-3 ';

Primer 2 is the NPTII coding region 744-775. nucleotide (31 nucleotides): 5'-CCCGATTCGCAGCGCATCGCCTTCTATCGCC -3 ';

Primer 3 is a reverse primer and represents the 3 'end of gene 4: 5'-ATTATACATAACACGCACA-3' (19 nucleotides).

The following DNA templates and primers were used for PCR amplification:

Lane 1: BstII-digested lambda bacteriophage DNA size markers;

Column 2: Control Template, Transformation.lan wild

Shafir DNA with primers 1 and 3;

Column 3: transformant sample, generation F4, type

Shafir

TAU89107-1-H29-21-1A2 with primers 1 and 3;

Column 4: transformant sample, F4 generation,

Shafir

TAU89107-1-J18-9-1B is 1 and

3. with a primer;

Column 5: transformant sample, F4 generation,

Shafir

TAU89107-1-J18-9-1B with primers 2 and 3;

Column 6 :. transf ormant sample, F4 generation,

Shafir

TAU89107-1-J18-X-1B is shown in Figs

3. with a primer;

Lane 7: transformant sample, F4 generation,

Shafir

TAU89107-1-J18-X-1B with primers 2 and 3;

Lane 8: HaelII digested bacterial 0X 174 DNA.

The relationship between the NPTII coding region and the adjacent gene terminator 4 was maintained through four generations of the TAU89107-lKm ^R family generated by self-insertion.

Example 8: Stability of NPTII sequence

The stability of the NPTII sequence in various plant organs was determined in various TAU89107-1 F4 transformants.

In F4 plants, plants from the 10.5 kb family were confirmed as shown in Figure 9 to digest total DNA with BamHI endonuclease and the presence of the fragment in three

It can be seen by analyzing Southern biot. Restriction was obtained from F4 plants and HindIII by PCR amplification

Gene 4 (poly A) terminator fragment (Figures 1 and 2) was probed. The DNA templates were:

Lane 1: control template, untransformed wild-type Shafir DNA;

Column 2: Transformant sample, F4 generation Shafir

TAU89107-1-H29-21-1A1C (C refers to the middle fold from which the DNA was extracted);

Lane 3: Transformant sample, F4 generation Shafir

TAU89107-1-H29-21-1A2C (from F.a. same as column 2) · · · ·

- middle shoot of 30 other plants);

Lane 4: Transformant sample, F4 generation Shafir TAU89107-1-J18-9-1BC (C - middle fold from which DNA was extracted);

Lane 5: Transformant sample, Shafir TAU89107-1-J18-9-1BR F-4 generation (R refers to the root of the plant from which the DNA was extracted);

Lane 6: Transformant sample, F4 generation Shafir TAU89107-1-J18-X-1BC (C - middle fold from which DNA was extracted);

Lane 7: Transformant sample, Shafir TAU89107-1-J18-X-1BR F4 generation (R refers to the root of the plant from which the DNA was extracted).

Presence of the 10.5 kb fragment in F4 plants (as shown by the

8 / b verifiable results) may linked to the NPTII coding region terminator. (Gene 4 poly A sequence). As such, a

Southern biot analysis with a terminator sequence confirmed that it was delivered. sequence was stably maintained over 4 generations of self-fertilization. In the Fs and F4 generations, two adjacent bands of about 10 kb were detected.

Example 9: Kanamycin-resistant Fb generation plants

Germinated in seedlings containing 150 / 7g / ml kanamycin on culture medium. Fb generation kanamycin resistance

- 31 expressed.

In Fig. 10a, kanamycin is sensitive

Fb Generation Plant TAU89107-1-J18-9 Fs at the level of kanamycin-resistant pine type) are similar to plants. In the characteristic seedling state k, while by Fs and Fa self-fertilization we show family type seedlings

Fb Shafir (plant untransformed, Fb plant Fi, anamycin-resin generations

Shafir version, along with a distinctive, introduced. The Fb plant (CC44) is the offspring. The height of the mature, transformant plants, leaf and ears of wild type Shafir

Fs and Fb generation strains were tested in the absence of kanamycin.

The presence of the NPTII coding tail (51 bp) and gene 4 (poly

Its attachment to terminator A was confirmed by PCR amplification with primers 2 and 3 (Figure 8 / b, Example 7).

CC44 is a kanamycin-resistant transformant kanamycin-sensitive

On a% agarose gel digested with HaelII

Shafir version $ xl74 bacteriophage was electrophoresed

PCR product a

1.2 with DNA (Figure 10 / b). THE

The DNA templates and primers used for PCR amplification were as follows:

Lane 1: Ha xIII digested bacteriophage DNA xl74;

Column 2: Control template, untransformed, wild type

Shafir DNA with primers 2 and 3;

Column 3: Kanamycin-resistant Fb Shafir TAU89107-1-

Transformant template extracted from J18-9-1B-4A plants (CC44) with primers 2 and 3 (about 0.5 kb).

Example 10: Integration of the GUS reporter gene

Another alien introduced in Fi plants using the vector pPCV702GUS

Presence of a DNA sequence

Southern hybridization.

The results are shown in Figure 11, which shows the total DNA extracted from F1 wheat plants transformed with pPCV702GUS. In this Southern biot analysis, the Shafir DNA sample (lane 1) and the transformant DNA samples (lane 2 and 3) contained approx. 5 zig. . Samples were digested with EcoRI and HindIII restriction endonucleases.

To confirm the presence of the 2.9 kb fragment (containing the 35S promoter-GUS coding region-NOS terminator) in integrated DNA, approximately 10 ng of the vector pPCV702GUS was digested with the previous enzymes and used as a control sample. Southern biot analysis (702GUS).

Lane 1: wild type Shafir control;

Lane 2: Fi generation Seri 82 TAU90-56-13 transformant wheat;

Lane 3: Fi generation Pavon 76 TAU90-84-7 transformant.

The results obtained confirm the presence of the introduced 2.9 kb GUS fragment in the F1 transformants of the high yield Pavon 76 and Seri 82 commercial wheat variants.

Similarly, the F1 subfamilies of TAU90 GUS / NPTII Seri 82 transformants (see Table 2, Example 11; transformants TAU9055-9 and TAU9056-13 transformed with vector pPCV702GUS) were tested for the presence of GUS, NPTII, or both (12). . figure). Figure 12 shows the results of agarose gel electrophoresis under standard conditions of the above DNA fragments obtained after the PCR procedure, namely, PCR amplification of the NPTII or GUS coding sequences inserted into various Fi generation subfamilies of Seri 82 TAU90 GUS / NPTII transformants. DNA templates used for PCR and their amount. are listed as follows:

Column 1: Control sample, GUS primers for the reaction mixture

(Primers 3 and 4, cf. Example 11 or table), but no DNA template; Column 2: Control sample, the for the reaction mixture NPTII primers. (Figures 1 and 2) primary, ld. 11th example, or Second

Table 1) but no DNA template;

Lane 3: control sample, GUS primers were added to the reaction mixture and Seri 82 wild-type DNA (500 ng DNA) was added as a template;

Lane 4: Control sample, NPTII primers were added to the reaction mixture and Seri 82 wild-type DNA (500 ng DNA) was added as a template;

Lane 5: Transformant sample for which GUS primers and

As template S, TAU9055-9 DNA (50 ng) was added;

Lane 6: Transformant sample supplemented with NPTII primers and TAU9055-9 DNA (50 ng) as template;

Lane 7: Transformant sample supplemented with GUS primers and TAU9054-10 DNA (50 ng) as template;

Lane 8: Transformant sample supplemented with GUS primers and TAU9054-11 DNA (50 ng) as template (no synthesis observed);

Lane 9: Transformant sample supplemented with NPTII primers and TAU9056-13 DNA (200 ng) as template;

Lane 10: HaelII cleaved by restriction endonuclease. $ xl74 DNA size markers for DNA fragments.

It should be noted that the above transformants are a group of transformants shown in Table 2 (Example 11).

As shown in Figure 12, the 1170 bp long GUS and 790 bp NPTII fragments were synthesized by the TAU9055-9 transformant (columns 5 and 6). The presence of the GUS fragment was also detected in transformant TAU9054-10 (column 7) but not in transformant TAU9054-11 (column 8). Insertion of the NPTII coding sequence was also detected in transformant TAU9056-13 (column 9). This transformant is also shown in Figure 11, where the 2.9 kb GUS fragment was found.

Southern biot was analyzed by analysis and PCR amplification.

S. 'all transformants showed positive GUS expression in the root phloem (Table 1).

Example 11: Transformation of different wheat variants with two plasmid vectors

Genaro 81 (VEERY # 3S, CIMMYT, Mexico), KEA S (CM21335, CIMMYT, Mexico), Papago M86 (CM52359, CIMMYT, Mexico), Pavon 76 (CM8399, CIMMYT, Mexico), Seri 82 ( VEERY # 5 ”S, CIMMYT, Mexico) and Shafir (S0N64A / TZPP // NAI60 / 3 / FA, Hazera Seed Co., Israel) including high-yield, mid-dwarf spring wheat (T. aestivwn L.) grown alien) We tested their transformation ability by introducing DNA. The above wheat strains were transformed using the procedure described in Example 2, in which

DNA was introduced into the plant as described in Example 1. Following the transformation procedure, the treated plants were subjected to the biological assays described in Example 3 and as described in the following paragraph.

PCR was used to test the success and frequency of transformation.

In transformants containing the NPTII coding sequence, the

The NPTII fragment was synthesized by PCR using complete transformant DNA as template and the following primers:

Primer 1 (5 'region of the NPTII coding sequence):

s.

5 ”-GCACGCAGGTTCTCCGGCCGCTTGGG-3 ^J

Primer 2 (reverse primer of the 3 'region of the NPTII coding sequence): 5'-GAAGGCGAGCGCTGCGAATCGGG-3' ''

Transformants containing the GUS coding sequence contain the GUS fragment. - was synthesized by PCR using complete transformant DNA as template and the following primers:

Primer 3 (5'-region of GUS): 5'-GTGGAATTGATCAGCGTTGGTGGG-3 '

Primer 4 (reverse primer of the 3 'region of GUS):

GCCAGTGGCGAAATATTCCCGTGC 5'-3 '

Table 2 summarizes the transformation events that occurred during the two cycles of the experiments in the different cultivated wheat varieties.

TABLE 2

Transformation events after introduction of plasmids carrying the NPTII or GUS / NPTII genes.

spring wheat termite versions (cf. Example 1) Transformant Wheat input Expression Transformation wheat genotype gene The presence frequency* TAU89104-8 Series 82 NPT II KmR, NPTIIRcr 3 , 2% KmR (1/31) TAU89107-1 Shafir NPT II KmR, NPTIIRCR 4 , 3% KmR (1/23) TAU89147-3 Genaro 81 GUS / KmR, NPTIIRCR 4.5% KmR NPT II (22.1) TAU89173-1 KEA S / GUS / GUS ^PCR 4.3% Km ^R Series 82 NPT II KmR, NPTIIRcr (3/69) TAU9055-9 Series 82 GUS / GUS *, NPTIIpcr 15.5% GUS * NPT II GUSRCR (20/129) TAU9056-13 Series 82 GUS / GUS *, NPTIIPcr 15.5% GUS * NPT II GUS ^pc R (20/129) TAU9085-5 Pavon 76 GUS / GUS · * ·, NPTIIpcr 2.2% GUS * NPT II GUSPCR (4/178) TAU90115-9 Papago M86 GUS / GUS +, NPTIIPCR 4.7% GUS * NPT II (6/128)

In Table 2, the various notations below the presence of Expression are as follows:

Km ^R : The transformant is capable of expressing the NPTII gene, i.e., kanamycin-resistant, as evidenced by green seedlings of 150 µg / ml kanamycin. (Km) containing aqueous agar (see Example 3). ''

NPTII ^PCR : Presence of the NPTII fragment, which was directly detected in the transformant by PCR (see PCR procedure below).

GUS +: The transformant exhibits GUS activity in the roots, as demonstrated by a biological assay using X-glucose as a substrate (see Example 3).

GUS ^PCR : Presence of a GUS fragment detected directly in the transformant by PCR (see PCR procedure below).

*: Kanamycin resistance (NPTII) in seedlings, GUSexpression in roots.

Example 12: Integration of the bar gene into two different wheat varieties

Seri 82 (VEERY # 5S, CIMMYT, Mexico) and Shafir (SON64A / TZPP // NAI60 / 3 / FA, Hazera Seed Co., Israel) produced high-yield, mid-dwarf spring wheat varieties of the Streptomyces hygroscopicus bar gene (DeBlock and mtsi, 1987;

White et al., 1990) carrying pPAT-NPTII 100.1-28. Said gene encodes acetyl-CoA transferase, which is capable of inactivating bialaphos and glufosinate herbicides by acetylation. The gene was linked to the CaMV35S promoter and PoliA (terminator) sequences to serve as a marker gene for plants. Plasmid pPAT-NPTII 100.1-28 is a pUC derivative (Topfer et al.

- 39 personal communication), which also carries the NPTII gene, along with the first intron of the maize Shrunken gene (shl) (Werr and 'mtsi, 1985) (inserted downstream of the NPTII translation start site) (Christoph, Maas, and J Schell, personal communication).

In the Fi generation transformants, the bar sequence was detected by PCR amplification (see Figure 13, which shows the results of electrophoresis of a 0.6 kb PCR product obtained using specific bar primers under standard conditions on an agarose gel). The first primer corresponds to nucleotides 8 to 19 of the bar coding region (White et al., 1990):

** ψψ **

CCGATCCCATATGAGCCCAGAACGACGCC

The translation start point is underlined.

Asterisks denote nucleotide substitutions forming the NdeI and BamHI sites, as well as two further deoxycytidines added at the 5 'end.

The second primer consists of a complementary reverse primer from nucleotide 533 to nucleotide 548 of the coding region, two stop signals and 16 nucleotides in the 3 'direction (White et al., 1990), and two additional deoxycytidines:

5'-CCGGATCCCCCGGGTCATCAGATCTCGGTGACGGGC (37 mer)

As shown in Figure 13, it was used for PCR. Your DNA templates were: '

Lane 1: Transformant sample, Re-amplified F1 generation TAU92P4SHF9-2 fragment after gel purification of the 0.6 kb fragment synthesized by PCR;

Lane 2: transformant sample, Fi generation TAU92P4SER141;

Lane 3: Transformant sample, re-amplified TAU92P4SER14-1 fragment obtained after gel purification of the 0.6 kb fragment obtained during the first PCR synthesis (shown in Lane 2);

Lane 4: Control sample, untransformed, wild type

Shafir DNA;

Lane 5: Control sample, untransformed, wild type

Serial 82 DNA;

Lane 6: control sample, no template;

Lane 7: control sample, template with plasmid pPAT-NPTII 101.1-28 (30 ng);

Lane 8: bacteriophage DNA size markers of restriction endonuclease cleaved by HaelII for DNA fragments.

The NPTII, GUS and bar gene fragments in transformants are 7-12. The direct detection as described in Example 1A was performed using standard PCR procedures (Cetus Corp./Hoffmann-La Roche AG).

3-12. and in the accompanying figures. . ·::: ·. ·. ···· *. ,,,

- 41 results support the integration of foreign DNA into the wheat fungus by the method of the invention. The frequency of insertion was quite high; two different years for the NPTII and GUS / NPTII genes for the DNA probe

2.6% to 4.3%, and up to 15.5% for GUS tests. Integration and expression were shown in relation to wheat variants with two different promoters and terminators, three different genes, and different wheat variants with different genetic backgrounds. The cultivated wheat varieties used for the tests were all high-yield, modern commercial spring wheat, some of which are produced in large areas in developed and developing countries. Most of the transgenic plants have a phenology and productivity that is independent of generations (F1-F5) compared to the original variants.

In conclusion, the process of the present invention provides transgenic wheat plants, in particular commercial, agricultural variants that integrate foreign DNA stably and are capable of passing this DNA to the next generation.

REFERENCES

1. DeBlock, M.Y. , Botterman, J., Vanderwiele, M.Dockz, Y., Thoen, 0., Gossele, V., Movva, C., Thompson, M., Van Montagu, M., and Leemans, J., Engineering herbicide. resistance in planes by expression of a detoxification enzyme, The EMBO J., 25, 2513-2518 (1987).

2. Gielen, J., De Beuckeleer, M., Seurinck, J., Deboeck, F., De Greeve, H., Lemmers, M., Von Montagu, M. and Schell, J.: The Complete Nucleotide Sequence of the TL-DNA of the Agrobacterium tumefaciens plasmid pTiAch5, The EMBO J., 2, 835-846 (1984).

3. Jefferson, R.A., Kavanagh, T.A., and Bevan, M.W., Gus Fusions: B-glucuronidase as a sensitive and versatile gene fusion marker in higher plants, EMBO J., β, 3901-3907 (1987).

4. Koncz, 0-, Martini N., Mayerhofer R., Koncz-Kalman Z., Körber H., Redei G., and Schell J., High frequency T-DNAmediated gene tagging in plants, Proc. Natl. Acad. Sci. (USA), pp. 8467-8471 (1989).

5. Koncz C. and Schell J .: The promotion of Tz-DNA gene 5 controls the tissue-specific expression of a chimeric gene carried by an Agrobacterium binary vector, Mol. Gene. Genet. 204: 386-396 (1986).

6. Lu, Zhong-Xun, and R. Wu, A Simple Method for Pathways of the Transformation of Rice through the Pollen Needle, Plant Molecular Biology Reporter, Z, 69-77 (1989).

7. Picard E., J.M. Jacquemin, F. Granier, M. Bobin, and P.

Forgeois. Genetic trans form ion of wheat (Triticim aestivwn) of plasmid DNA uptake drtring pollen needle germination. " Proc. III International Wheat Genetics Symposium, 1, 779-781, Cambridge, U.K., July 10-12, 1988.

8. Potrykus, I., Gene Transfer to Cereals: An Assessment, Bio / Technology, 8, 535-542 (1990).

9. Topfer, R., Mass, C., Horicke-Grandpierre, Schell and Steinbiss, H.H., Improved sets of expression vectors for high level gene expression in dicotyledonous and monocotyledonous plants (unpublished, personal communication).

10. Werr, W., Frommer, W.B., Mass, C., and Starlinger, P., Structure of the sucrose synthase gene on chromosome 9 of Zea mays L., EMBO J., A, 1373-1380 (1985).

11. White J., Chang, S.Y., Bibb Μ., The casette containing the bar gene of Streptomyces hygroscopics: a selectable marker for plank transformation, Nucleic Acids Research,

18, 1062.

- 44 Patent claims

Claims (32)

Patent claims \ s A process for the production of transgenic wheat plants, comprising (a) male sterilizing the flowers of the wheat plants prior to maturation of the anthers, and then pollinating the stems of these flowers with ripe stamens of the same or other varieties of wheat plants; (b) one or more pollinated stigmas, after a period of time after pollination, during which the pollen hoses in the pollinated germs begin to grow in the stalk but have not reached the nucleus, are provided with a drop of an aqueous DNA solution which provides at least one a suitable DNA vector carrying a foreign gene capable of inducing expression of a desired trait in the plant and optionally containing an additional marker gene; (c) maintaining a drop of said DNA solution in a humid environment for a period of time sufficient to ensure that said DNA vector reaches and enters the nucleus; (d) protecting the treated plants of step (c) from further pollination by other nearby plants, raising the treated plants, and igniting the seeds formed in the flowers; and (e) growing said seeds under conditions adapted for the selection of transformed wheat plants. • 4 2. The method of claim 1, wherein said aqueous DNA solution is applied to a drop of intact pollen. 3. The method of claim 2, wherein said DNA solution is applied to said stigma and said DNA solution approximately one hour after pollination. about 12 to 14 hours in contact with said baby. Method according to claim 1, characterized in that the apex of the pollinated stigmas is cut off after a suitable period of time which ensures that the developing pollen hoses are in the stern but not yet reaching the nucleus and said DNA solution. we carry it to the mutilated stigma. Method according to claim 4, characterized in that the apical point of the pollinated stigmas is cut off at about ^ - / 2-2 ^ - / 2 hours after pollination, as mentioned. A drop of DNA solution is maintained in contact with said cut staple for about 12 to 14 hours. 6. The method of claim 5, wherein the stigma is trimmed about 1-2 hours after pollination. 7. A method according to any one of claims 1 to 3, characterized in that a DNA vector is used which is · Contains a nitrogen-binding structural gene. 8. The method of claim 7, wherein said gene is a Klebsiella pneumoniae nifb gene. 9. The method of any one of claims 1 to 3, wherein the DNA vector comprises a reporter gene as an indicator of successful transformation. The method of claim 9, wherein the reporter gene encoding β-glucuronidase is used. 11. characterized by a process according to any one of the claims. using a DNA sequence encoding a herbicide resistance gene sequence expressed in a transformed plant. 12. The method of claim 11, wherein the bar gene encodes a gene sequence. 13. A process according to any one of claims 1 to 3, characterized in that said. Also used as DNA vectors is a vector which contains a selectable marker gene. 14. The method of claim 13, wherein the marker gene is capable of conferring antibiotic resistance. '' 15. The method of claim 14, wherein said marker gene is an APH (3 ') II (NPTII) gene which, when expressed, encodes an aminoglycoside phosphotransferase conferring kanamycin resistance and which is nopaline synthase (NOS). ) promoter and the polyadenylation signaling sequence of the TL DNA DNA ipt gene (gene 4) as a terminator. 16. The method of any one of claims 1 to 3, wherein said vector is a DNA as defined in claim 1. The plasmid pPCV702níAD, which is the plasmid pPCV702nIAD, was used It was linked to CaMV 35S promoter and NOS terminator Klebsíella pneumoniae nítD coding region, respectively NOS promoter and TL-DNA Terminator with said APH (3 ^R) II (NPTII) gene includes 4 genes. 17. A method according to any one of claims 1 to 4, wherein said vector is a plasmid pPCV702GUS, which is linked to the CaMV 35S promoter and the NOS terminator by β-glucuronidase and NOS-promoter and TL-DNA 4-5, as a vector DNA. es gene gene terminator. Contains the APH (3 ') II (NPTII) gene. ·· < 18. A DNA vector for use in the production of a transgenic wheat plant according to any one of claims 1 to 3, characterized in that it contains a nitrogen-binding structural gene encoding the A subunit of nitrogenase. 19. The DNA vector of claim 18, wherein said gene is the Klebsiella pneunioniae nfD gene. 20. The DNA vector of claim 18 or 19, further comprising a reporter gene. 21. The DNA vector of claim 1, wherein said reporter gene encodes β-glucuronidase. DNA vector for use in the production of a transgenic wheat plant according to any one of claims 1-17, characterized in that it is capable of conferring herbicide resistance when expressed in transformed plants. Contains a DNA sequence. 23. The DNA vector of claim 22, wherein said DNA sequence encodes the bar gene. 24. A 18-23. The DNA vector of claims 1 to 4, further comprising a marker gene. 25. The method of claim 24 DNA vector, with characterized by that mentioned '' marker gene antibiotic resistance biz the it can work product encode. 26. The method of claim 25. DNA vector, with characterized in that said marker gene comprises the APH (3 ') (NPTII) gene which, when expressed, is an aminoglycoside phospho-transferase conferring kanamycin resistance. which is linked to the nopaline synthase (NOS) promoter and the polyadenylation signaling sequence which acts as a terminator of the TL-DNA ipt gene (gene 4). 27. The plasmid pPCV702n_ifD is depicted by the restriction map shown in Figure 1. 28. The plasmid pPCV702GUS is depicted by the restriction map shown in Figure 2. 29. A 1-17. A transgenic wheat plant produced by the process of any one of claims 1 to 3. 30. A 18-26. A transgenic wheat plant transformed with a DNA vector according to any one of claims 1 to 3. 31. Transgenic wheat plants transformed with the plasmid pPCV702n2 / D as shown in Figure 1. ♦♦ ·· ♦ · · · * · * ··· ·· ···· · 32. Transgenic wheat plant transcribed with the restriction map shown in Figure 1 with pPCV702GUS. 33. Commercial transgenic wheat crop. 34. Transgenic wheat plants of the species T. aestivum according to claim 33. 35. Transgenic wheat plants according to claim 33, characterized in that: ATIR (CNO S / PJ62 / 4 / GLL / 3 / SSC // JAR S / Crespo, Hazera Seed Co., Israel), a BAGULA S {CM 59123, CIMMYT, Mexico), CIANO 79 (CM31678, CIMMYT, Mexico), Genaro 81 (VEERY # 3S, CIMMYT, Mexico) a KAUZ '· Q' kJ (CM67458, CIMMYT, Mexico), a KEA S (CM21335, CIMMYT, Mexico), THE MILAN (23IBWSN37, CIMMYT, Mexico) for ΟΡΑΤΑ M 85 (CM40038, CIMMYT, Mexico), Papago M86 (CM52359, CIMMYT, Mexico) to PAVON 76 (CM8399, CIMMYT, Mexico), Seri 82 (VEERY # 5S “, CIMMYT, Mexico) and Shafir (S0N64A / TZPP // NAI60 / 3 / FA, Hazera Seed Co., Israel).