CA2117652A1 - Transgenic wheat - Google Patents

Abstract

A novel method for producing transgenic wheat plants, vectors for use in the method and novel transgenic wheat plants.

Description

wo 93/18168 Pcr/Eps3/oo48s ~A2 i 1 76 52 TRANSGENIC WHEAT

~IELD OF TIIE INVENTION
The present invention provides a method for producing transgenic wheat plants which comprises u-lu.illg foreign DNA via the pollen tubes, thereby obtaining a transgenic embryo which can develop into 5 a mature 1l~ 5~ plant.
The present invention also provides transgenic wheat plants.

BACKGROUND OF TIIE INVENTION AND PRIOR ART
Since the advent of .c.~ DNA I ' -'a6~y and its 10 successful, ~ , in the ~ r~ ;, ... of various organisms, one of the main goals has been to apply this technology for the l,- ~r(ll ~ n of plants in general and agriculturally important crops, e.g. wheat, in particular. Such l,~,.~r( aims at the ~l. h of transgenic plants having new traits which provide certain growth advantages such as improved root svstems, I5 herbicide resistance and pest resistance.

SUBSTITUTE SHEET

WO 93/18168 C A 2 1 1 7 6 5 2 PCI'/EP93/00485 With a steadily increasing world pop~l it has long been realised that there exists an urgent need for increasing the yield of important crops such as grain crops, in particular wheat, and this by d~,h)yil.g new VarjetieS of such plants that have the aforesaid growth ad~ ~ -Various methods for ~ e plants have been developed.
One such method involves the ~ r ~; of lul. rl from plant tissue, the i ' thereof in vitro and ' ~. 'y the ..~ al;~ of the rl".... cl ,u.. , ' into transgenic whole plants.
Other methods employ theA~s")~c~c~ ~ ,r ens system 10 by which l~ ~. h: ~ T-DNA from Ti or Ri plasmids become inserted into the nuclear DNA of plant cells. Yet another method for llal.aru.lllil.& plant tissues with foreign DNA involves the bulllbalrilll~ of plant cells with DNA-coated carrier particle projectiles, whereby some of these ~JIU, "' penetrate the plant cells and insert the foreign DNA therein.
Various other methods of micro ; of foreign DNA into plant organs, in particulam~pl. ' ~ or l~ l aliv~ organs have also been employed for the purposes of producing trarsgenic plants.
All of the aforesaid methods were developed primarily for the of L~i ~led~ ,lJs plants and were r lly applied in 20 such plants. However, they were found to be less applicable for l.allarullllig plants, in particular wheat plants.
One of the reasons that the aforesaid methods were not 7rpiir7hl~ to many M, . ~vledonous plants is the fact that it is very difficult to regenerate their cells grown in tissue culture into whole plants.
A method for i ' ,, wheat plants which involves plasmid DNA uptake during pollen tube d~,lo~,...~..l was reported by Picard et al., 1988 in l'PIu~el;llga of the Seventh 1 ~ I Wheat Genetics S~ . ~ Vol. 1, p.779-781", Miller and Koebner Eds., ~'~mhririee, England, 13-19 July, 1988. These authors reported that they used plasmids SUBSTITUTE SHEET

wo 93/18168 Pcr/En3/00485 g the ali,.oOly~os.dc pl ~y~ .1.,~......................................... A~r Il gene (N~II) which confers kaulalll~ h~ resistance when expressed, and plasmids 3 the NI~II gene and putative wheat uh~u~àsu~dl origins of IC,'- " for g foreign DNA O The plasmids were ~ ~ ' ~ into 5 exposed pollen tubes by first removing the tips of pollinated stigmas in which the pollen tubes were growing to expose these tubes and then adding thereto a solution containing the plasmids. The plasmid DNA a,upa c~ltly migrated down the growing pollen tubes together with the male nuclei and so entered the ovules during fertilization. As a result, about 1% of the seeds 10 which were obtained were resistant to kalla~ hl as ~' I by their ability to germinate and grow on media 3 ha lal.,~;.. and by the ability of such g~ ; g plants to grow into mature wheat plants in soil always soaked with water r ~ g I00 mgll kaulaul~ h~. Southern blot analysis with an NI~II gene probe further revealed that DNA extracted from 15 the kallalll~h~ resistant plants contain the NPTII sequence with plasmids 3 the above-noted wheat origins of llr' ~i being the most frequent. Fu~lh~ u~c, when these plants were self-crossed the resulting second g~ ti,,- of plants (F2) were all ka~a~ .h~ resistant which indicates that the NPTII sequences were i ' ~d to the second v No 20 ~1 between true " into the wheat genome and putative NI~II-carr,ving ~ ' r ' .~ t,_;. was presented.
However, it must be pointed out that since the aforesaid I ' ' there have been no ' ~ ' g the claimed success of this 11 procedure in wheat. It should be 25 noted that various r ' 1' ' and ' I ~ b.~.~ l to the above ~ ' ' revealed that the workers in the field havel in fact, not been able to repeat the above procedure and have reverted to the various other 1~.1 ; ~ c '; ' L~-h~dbu~, for ~ r~ g wheat. rne aforesaid were addressed in a recent review of current l..u~cd...ci, for SUBSTITUTE SHEET

wo 93/18168 Pcr/EPs3/oo48s ,, cereal plants, including wheat (Potrykus, 1990, Bio/Technoiogy ~, 535-542), in which it was concluded that while the pollen tube procedure should be i~ L~t~,d further, it did not hold-much promise for success; in the author's words "Pollen Tube Pathway: No transgenic plants have been recovered; probably not much potential".
It should also be noted that the aforesaid procedure has since been carried out with success only in rice plants (Luo and Wu, 1989, Plant Molecular Biology Reporter ~, 69-77), which although being - .y' ' differ in many physiological respects from wheat.
o ru. ~, it should also be noted that in all of the reported ' wheat plants, by way of any of the above methods, none of the wheat strains were, ~,ial crop cultivars, i.e. agricultural cultivars grown on a large scale in order to obtain wheat crops. Many of the putative ' wheat plants would have little ~g~ AI a~FI ~~' and, at 15 best, could be used as a starting point to try and obtain a IIA~ ~d ~,iàl wheat strain, e.g. by back-crossing and by crossing with other varieties.

SUMMARY OF T~E INVENTION
It is an object of the present invention to provide a method for producing i ~ wheat plants in particular transgenic wheat plants of a ~ l crop variety, i.e. one of many cultivated varieties used ._~' the world for growing wheat crops.
It is a further object of the present invention to provide a ''5 transgenic wheat plant of a ~u~ ,;al variety.
A still further object of the present invention is to provide the -t~Y" . 1~ DNA moiecules for the purposes of producing the aforesaid transgenic wheat plants.

SUBSTITUTE SHEET

wo 93/18168 pcr/Ep93/ooft85 ~A21 1 7652 All other objects of the invention will be revealed in the following dc;,.l;r and claims.
In a.w d~ -~ with the ~,I,u~ r.~,t~d objects of the present invention, there is provided a method for producing transgenic wheat plants 5 ~ ";~; V the steps of:
(a) f m~cr-li g wheat plant florets by removing all pollinator anthers prior to their and then inducing :,y.l.L ~ pnllir.~tif n by pnlli-~tinE the stigmas of said florets with mature male pollinator anthers from the same or a different variety of wheat plant;
lû (b) applying a droplet of an aqueous DNA solution onto one or more pollinated stigmas, following a time period after poilir~tif~ in which the pollen tubes in the pollinated stigmas have started to grow into the style but have not yet reached the ovary, said DNA solution ~ E a DNA
vector carrying at least one gene foreign to the plant and capable of 15 inducing the f_~.pl~ of a desirable trait in the plant and optionally an additional marker gene;
(c) . ~ g said DNA solution droplet on said stigma in a humid ~ ;.u.. ~.. l for a period of time to ensure that said DNA vector reaches and enters the ovule;
(d) protecting the treated plants of step (c) from additional pnll' ~'' by any nearby plants, growing said plants and collecting the seeds developed in said f orets; and (e) growing said seeds under conditions adapted for the selection of l-~ ru~n d wheat plants.
In acco .L .~; with one . .,.ho~ f .a of the invention, to be referred to herein at times as the "~ n ~ 17c ~ "~ the stigmas are truncated after pnil' ~' and the droplet of an aqueous DNA solution is - applied onto the truncated stigmas. In a.. U d~ ~ci with another f mhofiimf nt of the invention, to be referred to herein at times as the "intact stigma SUBSTITUTE SHEET

wo 93/18168 C ~ 7 65~ pcr/Ep93/oo48s ", the droplet of an aqueous DNA solution is applied onto intact stigmas following a time period after ~ "
Preferably, the aforesaid truncation is carried out by truncating the stigma tips, about Ih-2l~2, more preferably about 1-2 hours after S pnll' ~'' In the case of the spring-bread (T aesnvum L.) cultivars such as cultivars ATIR (CNO "S"/PJ62/4/GLL/3/TOB//JAR "S"/CRESPO, Hazera Seed Co., Israel), BAGULA "S" (CM 59123, CIMMYT, Mexico?, CIANO
79 (CM31678, CIMMYT, Mexico), Genaro 81 (VEERY#3"S", CIMMYT, Mexico), KAUZ "S" (CM67458, CIMMYT, Mexico), KEA"S" (CM21335, 10 CIMMYT, Mexico), MILAN (23IBWSN37, CIMMYT, Mexico), OPATA
M 85 (CM40038, CIMMYT, Mexico), Papago M86 (CM52359, CIMMYT, Mexico), PAVON 76 (CM8399, CIMMYT, Mexico), Seri 82 (VEERY#S"S", CIMMYT, Mexico), and Shafir (SON64A/TZPP//NAI60/3/FA, Hazera Seed Co., Israel), all of which were tested in a,,.,u,d~..ce with the invention, the 15 truncation is preferably performed about 1~ hours after ~ ' It is believed that this preferred time period between p~.ll- and truncation would also apply to other wheat species and cultivars.
Generally, when p r~. .; ,~ the truncation e l~o l; ~ l of the invention, the interval between pnll- '' and truncation of the stigma tips 20 should be chosen in a~..' with the wheat genotype used and the c..~i,, I ' Where, for example, the type of wheat cultivar and the .,..~i,, i conditions favour relatively rapid pollen A~
to the stigmas and ~ p, ' pollen tube d~luy~ and growth within the stigmas and into the styles, this interval may be in the range of 1~
25 hours. Where, as another example, the type of wheat cultivar and the c..~i" I conditions favour a slower AllA- l l of the pollen and pollen tube d~lot,l~ , the interval may be in the range of 11~-2 hours SUBSTITUTE SHEET

W O 93/18168 PC~r/EP93/00485 rA21 17652 The above described timing between pn~ til~n and DNA
a~ ; should also be adhered to when u.,,ru. g the intact stigma c,..bo.li,...,..l of the invention, ~ ~ as noted above, with the wheat genotype used, with the c..~ I conditions etc.
S In a~w,.la.,~e with both e l o~ the droplet of DNA
solution applied in step (b) of the method is suitably ' on the pollinated stigma (step (c)) for a time period sufficient to ensure that the DNA vector hal.~pult~d by the growing pollen tube reaches the ovule. A
suitable time period was found to be at least 12 hours, e.g. for about 12-14 10 hours.
Also provided by the invention is a ~U~,U~I~U' ' DNA vector for use in the above method.
The DNA vector of the invention comprises a gene which can induce in the plant the ~ of a trait, the transfer of which into the 15 plant is desired. Such a gene may for example be one ~ ..g a nitrogen fixation structural protein or one ~ h~g a protein that confers herbicide resistance to the plant. Additionally, the vector may also suitably comprise a reporter gene, e.g. the ~idA gene encoding E. coli ~-glu~u~ul~ida ~e~ which serves as an indicator of successful l.. ~r,.. ",~;.. cells ~ hlg this0 gene when provided with the substrate (X-Gluc) for the expressed enzyme are capable of, ~ .g this susbstrate into a detectable product.
The DNA vector preferably comprises also a plant selectable marker gene which may, for example, be one encoding an antibiotic resistance, e.g. kallalllv~hl resistance. A non-limiting example of such a gene, used in the ~1l~.. ;.. ,l~ conducted within the rlalll~Jlh of the present invention, is the APH(3')11 (NPTII) gene linhed to the nopaline synthase (NOS) promoter and to the pOl~ad~vlaliull signal sequence of the TL-DNA
(gene 4) (Gielen, J. et al., 1984, Koncz et al., 1989). The APH(3')11 (NPTII) SUBSTITUTE SHEET

wo 93/18168 Pcr/EPg3/oo485 - a -gene encodes the enzyme a~ û~ uaidc 1' ~' tl ' aae and thus confers kaulalllj~hl resistance to the r " plants.
Another bacterial selectable marker gene e.g. AmpR may also be included in the vector for the purpose of yl" _ ~ the DNA vector in 5 bacteria in order to obtain large quantities thereof needed for the p of said DNA solution.
Non-limiting examples of such DNA vectors, used in the r~ conducted within the fial...,~.~J-I. of the present invention, are the plasmids pPCV702nifD and pPCV702GUS, both of which comprise the afore-.. ~ APH(3')11 gene and, in pPCV702nifD, the Klebsiella p rS nifD coding region linked to a CaMV 35S promoter and a NOS
terminator and, in pPCV702GUS, the coding region of ,~-~lu.u.u..ida,e (GUS) also linked to a CaMV 35S promoter and a NOS terminator.
A~wldil~gly, wheat plants 1.~ ~r.. ~ d with either of these plasmids, by the15 method of the present invention, are kaulalll~hl resistant and/or capable of ~A~ ' g, the GUS enzyme.
The invention also provides transgenic wheat plants of agll wllllll.l~ial crop varieties.
In a~-ul-laul~ with the present invention, a long-felt need is 20 fulfilled whereby transgenic wheat plants of severaM,u~ ial varieties, have been obtained for the first time. Transgenic wheat plants obtained in a wld with the invention were grown through 5 g aliulla without a loss of the foreign gene with which the original plants were Llall:,ro~ d.

The figures in the annexed drawings illustrate the following:
Fig. 1 is a schematic .~ i of the plasmid pPCV702niJD;
Fig. 2 is a schematic .~ of the plasmid pPCV70'7GUS;

SUBSTITUTE SHEET

w o 93/18168 P Cr/Ep93/oo485 Fig. 3a shows results of Southern blot l.~l, ' of a NPTII gene probe to DNA samples, digested with BamHI and HindlII restriction from wild type wheat varieties, plants ll,. r." . - d according to the procedure of the present invention and from the plasmid 5 pPCV702nifD, described in Example 4;
Fig. 3b is a schematic restriction map ill ' g the pertinent restriction ' ' sites of pPCV702nifD integrated into the wheat genome in the i ~ ,.t. Ii TAU89107-1, as ~ d from Southern blot results (Fig. 3a, Fig. 4a and Fig. 5), as described in 10 Example 4;
Fig. 4a shows results of Southern blot-h~ . of a NPT II
probe to DNA samples, digested with Pstl restriction f~ r, from wild type wheat varieties and plants ~ rl~ .- d with pPCV70~nifD
according to the present invention, as described in Example 4;
Fig. 4b is a schematic restriction map illustrating the pertinent restriction; ' ' sites for pPCV702nifD integrated into the wheat genome as ~' ' from the Southern blot results (Figs. 3a, 4a and Fig. 5), as described in Example 4;
Fig. 5 shows results of Southern blot-ll~bl " of a NPT 11 ''O fragment and the rest of the 702nifD vector with DNA samples digested with Bam Hl and Pst I from a wild-type wheat plant and second generation (F~ d wheat plants obtained by selfing of first generation plants I by plasmid pPCV702nifD, as described in Example 4;
Fig. 6 shows the results of Southern blot h~ ' of a NPTII
25 fragment with BamHI and HindlII digested DNA sample of the second (F2) of ll~ ullll~,li wheat plants, obtained by selfing of the ~ TAU89107-1, as described in Examples 4 and 5;
- Fig. 7 shows the results of Southern blot h~bl' 1; ' of a NPIII
fragment with BamHI and Hindlll digested DNA samples of the third SUBSTITUTE SHEET

wo 93/18168 Pcr/Ep93/oo485 CA~l 1 765~

~, (F3) of ~ .8,... d wheat plants obtained by selfing of plants from the TAU89107 F2 families, as described in-Examples 4 and 6;
Fig. 8a shows the results of an agarose gel r~ of DNA
samples obtained by PCR , ' ~ t. of the APH(3')II gene present in the S "~ r~ Fd wheat plants of the Shafir cultivar. DNA samples were extracted from F2, F3 and F4 plants ~ g from the ~
TAU89107-1 and resulting from self pnil ' of each ~ - of plants, as described in Example 7;
Fig. 8b shows the results of an agarose gel clF~.LIl r~ ;> of DNA
10 samples obtained by PCR ~..,pi;r;. A~ of the APH(3~II gene and its gene 4 lr ~ 8 ~ ~ 1~ using total DNA extracted from the F4 progenies of L~ r(l',~. d TAU89-107-1 obtained by selfing, as described in Example 7;
Fig. 9 shows the results of Southern blot L.~ ; 'i of a gene 4 l;llaLul fragment with DNA samples of a wild type Shafir wheat plant and the F4 ~, progenies of the i ' TAU89107-1. The DNA samples were digested with BamHI and HindIII. All four ,, ti resulted from self-~ ~" . as described in Examples 4 and 8;
Fig. 10a shows the F5 progeny CC44 (TAU89107-1-J18-9-lB-4A) of the TAU89107-1 ~ rl,.,..-..~ which produced a normal shoot upon ''O growing on kallal~ hl ~ ~ medium as compared to the wild type Shafr plant which turned white under the same growth, " as described in Example 9;
Fg. lOb d ............ ~I.dt. ' gel separation analysis of the PCR
~mplif - products of the NPTII tail (51bp) and its gene 4 t~llllhlaLol ''5 using DNA templates extracted from CC44 "~ ~rl.,.. ~..~ or from plants of the wheat cultivar Shafir, as described in Example 9;
Fig. 11 shows the results of S~ ' blot l.~l,. ;.1;,~l;.. . of the first g (Fl) of wheat plants of the ~ullllll~l~;al cultivars Pavon 76 and Seri 82 1.,. .. 8... d with pPCV702GUS and probed with the same plasmid, SUBSTITUTE SHEET

wo 93/18l68 pc1r/Ep93/oo485 CA21 l 7652 11 the DNA samples having been digested with EcoRl and HindIII, as described in Example 10;
Fig. 12 shows the results of an agarose gel ele~h, l ' u~is of DNA
samples obtained from PCR A~l~p~ - of the APH(3')II and GUS genes 5 from DNA extracts from F, ~ rUII ~ of Seri 82 cultivar. as described in Example 10; and Fig. 13 shows a l~ of the ele.,ll, rl ~ on an agarose gel of the 0.6 kb PCR product obtained from F~ generation ll ' ll ' ' with the plasmid pPAT-NPTlI 100.1-28 carrying the 10 5~ -r 'L y~,C.~ hy~, V~L~ Cus bar gene, as described in Example 12.

DESCRIPTIO'N OF SPECIFIC EMBODIMENTS
The present invention will now be described in more detail in the following examples and the annexed Figures. These examples should be 15 construed as an ill ' '' of the present invention and should not be ' ud limiting.

Example 1: Plasmids Two plasmids, pPCV70"nifD and pPCV702GUS, were 20 , u~t~d as illustrated in Figs. 1 and 2, ~ , bo~h derived from the vector pPCV702 (Koncz and Schell, 1986; and Koncz et al., 1989). In both plasmids, the APH(3')II or NPT II gene encoding _lllhlogl~uside (k~llall~ hl) I ~ linked to the NOS (nopaline synthase) promoter and to the TL-DNA ipt gene (gene 4) pol~ad~ lAliull signal, or ''' PolyA, (terminator), served as a selective marker. This gene, when expressed in plants, confers hAIl.. v~;.. l~
The plasmid pPCV702nifD contains the coding region of - Klebsiella p~ nifD, situated between the CaMV 35S promoter and NOS terminator.

SUBSTITUTE SHEET

WO93/18168 PCI/k~,31f~ , ~,A21 17652 The plasmid pPCV702GUS includes the coding region of the (GUS) gene, a reporter gene, linked to the CaMV 35S
promoter and to the NOS trrrnirl7tr,r A mixture of supercoiled and relaxed (nicked) forms of the 5 aforesaid plasmid DNA, dissolved in I0 mM Tris, 1 mM EDTA, pH 8, was used for preparing the DNA solutions to be applied onto the stigmas in the l ~ ~r(.~ methods described },~" ' ' .. .

Example 2: Pl~... of Wheat Plants and A~' ~ ' of DNA
Wheat plants selected from several cu,..,.,~.~;al wild spring bread wheat cultivars, were grown in pots in a t~ u.c-controlled ~-- ' (21 _ 2~C) with ~"ppl " l- y lights. In addition, a second group of wheat plants, of the same above variety, were grown in a nethouse 15 in sandy-loam soil. These groups of wheat plants were sown at the start of the ~p. ;~ with additional sowings repeated at 10-day intervals to ensure constant supply of pollen when needed for poll When wheat plants reached growth state 57 (3/4 of ear emerged) the spikes of the 1 plants were treated as follows: each spikelet was cut at half its 20 height, the middle florets removed, leaving the two outer florets. The immature stamens were removed from each of the two remaining florets (per spikelet). All spikelets on one side of the rachis were marked at their base with a water-proof marker. Thereaher, the spike was covered with a glassine paper bag.
''5 When the stigma of each of the two floret pistil of the median spikelets on the aforesaid treated spike started becoming feathery and spread outward (ca. 4-5 days after ~mqcrlll ), i.e. exhibited signs of pistil maturity, the glassine paper bag was cut across the top and a male pollinator spike (of same or different cultivar) with its spikelets cut in half, to allow 30 mature stamens to protrude outward from the glumes, was inserted into the SUBSTITUTE SHEET

W O 93/18168 PC~r/EP93/00485 C:A21 1 7652 bag. The pollinator spike was leh inside the bag for 20-30 min. to ailow its stamens to burst and release their pollen. The pollinator spike was swirled around several times to allow pollen to reach all floreS of the spike.
Thereaher, the pollinator spike was removed and the glassine paper bag 5 sealed with a clip.
Between half an hour to two and a half hrs. Iater, usually one and a half to two and a half hrs. Iater, at the stage when the pollen tubes have formed and have begun growing within the pollinated stigmas (but have not yet traversed the styles to reach the ovary), the tip of the feathery 10 stigmas was clipped with sharp, narrow-tipped scissors to expose the aforesaid pollen tubes and a 10 ul drop of a DNA solution (2-3 ug of plasmid DNA -Example 1) was placed on top of the cut stigmas of florets on the ylc~ marked half spike with the aid of a micro-tip ~prlir~ r.
Florets on the non-marked half spike which served as control, received 10 15 111 of water. It should be noted that the aforesaid poll procedure provides a ~ " ' initiation of pollen tube formation within the stigmas. Further, the aforesaid period between pol1 and clipping of the pollinated stigma tips varies according to e~ I conditions and the strain of wheat plants used, such that a period of about 1-1'h hrs is optimal 20 for situations favouring relatively rapid p-~llir~in~ .a and d~ ylll~,llt of pollen tubes within the stigmas and into the styles, a period of 1Ih-2 hrs being optimal in situations where the aforesaid pollen ~ l and pollen tube d~ llL is slower.
Treated, open-bagged plants with glassine bags pulled down 25 and spikes fully exposed, were placed in a humidity chamber in the t~ ,l"Lulc-controlled E,l~ ~ _ , where a water-mister provided fine mist for between 12 and 14 hr. Plants grown in the nethouse were treated in the - ahernoon when ~ dropped to less than 20~C. Following in-troduction of DNA, plants were covered overnight, to allow growth of pollen SUBSTITUTE SHEET

W O 93/18168 C A 2 1 1 7 6 5 2 P(~r/EP93/00485 tubes to the ovaries and ' , f~,~;' ti of the ova, with a plastic bag to supply condensed moisture, or were subjected to dew when a~ Ul Following exposure to mist or- dew, the glassine bags were pulled upward to cover treated spikes and sealed with paper clips. Detailed S ulJe~ ~dh~ were recorded for each treated spike.
Similar e, were also carried out according to the above noted procedure but wherein the stigma tips were not cut, the DNA
solution being added to the top of pollinated uncut stigmas. The results of both sets of ~ are set forth in Table 1 as referred to in Example 10 3 below.

Example 3: Bioassays (a) APH(3')1I F c Seeds obtained by the Ll ' procedure of Example 2 using the pPCV702nil1) vector were immersed in hypochlorite for 5 minutes, washed in distilled water and then Llall ~ d to water-agar petri dishes with 150 llglml kalla,~ ill and placed in a growth chamber at 25~C. Ten days later, all seeds were llal.~ lcd to MS medium and thereafter scored for the al of bleaching of the shoot and the number and length of roots 20 recorded. In some ~ the seedlings were kept in the growth chamber for 4 days on a kalla...y~;.. containing medium and thereafter L.. ~fc,.cd to MS growth medium for a further 4 days and scored as noted above.
Seeds obtained from the above l,...,~r.~....-,;.." procedure, 25 .~ the Fl " were treated with hypochlorite and placed in water-agar petri dishes ~ g, 150 !lglml kanalll~;ll, along with controls of parents without ka~a~ hl. ~ g seeds with normal roots and, ' I~_a~.h~d primary leaves were L~a~r~ cJ to pots and placed at 18~C
(14 hr lighV10 hr dark). These Fl seedlings were grown to maturity and SUBSTITUTE SHEET

WO 93/18168 C A 2 1 1 7 6 5 2 PCI'/EP93/00485 1 ~ _ seeds obtained therefrom, I~,!JlC~ illg the F2 ~ ; were then sown without selectable pressure for seed increase. Seeds obtained therefrom represent the F3 g~ r~ti~l-To examine APTII activity, i.e. CAIUlC of the NPTII gene 5 carried by the vectors used to transform the original parent plants, seedlingsof the F3 ~ were v ' on water-agar _ ~ 3 150 llg/ml k~ulall.~hl. The d~ ,lu,u~ t of green leaves as compared to the white leaves of the U,~l~A~r".. d controls, indicated that the APTII gene is present and expressed. These green seedlings were lla~.~rcll~d to the 10 greenhouse and their leaf DNA was analyzed by Southern blotting and PCR
. ' of specific sequences (See Examples 4 to 11 below).
The above k~...l..~i.. selection procedure has been performed in all uu--~c~,uli~/e v ~ of the ".. ~r.,............................... d plant line termed TAU89107-1, up to and including the F5 (fifth) g~ .. 8 this further 15 indicating that the above Ll ' is stable.

(b) GUS EALU~
The CAIJ~C of ~-~lu~u-ullhiaae in roots excised from the axenically grown (i.e. isolated) F~ seedlings, from the originally ~ r~,.. ~1 O plants ~ r.,., .I with pPCV702GUS, was ~ ' using X-Gluc as a substrate. The ~.pp~ . of a blue color which resulted from a specific breakage of the 1-4 ~ bond of X-Gluc, indicated the activity of the h~lludu~,J GUS in the roots (Jefferson et al., 1987). In 40% of the plants C,'.~ il.g GUS activity (Table 1) it was possible to detect the 25 uu~e~ foreign gene (uidA so-called GUS) integrated into the genome by Southern analysis (see below in Example 10 and Figure 11). As noted above in Example 2, in this GUS assay a . . was also made ~ between Fl seedlings ." ;~;;. -1; ~g from plants ~ r~" .. . d by a DNA solution " pPCV702GUS applied to cut stigmas (i.e. without the tips of the SUBSTITUTE SHEET

wo 93/18168 C A ~ 1~ 7 ~ 5 ~ Pcr~ f ~ ~ ~

stigmas) or applied to uncut stigmas. S , ' ~ ~ly, the "uncut stigma" group gave better results than the "cut stigma" group (14.6% vs 5.8%), this result being in contrast to the ~ h~ held belief that it is necessary to physically expose the growing pollen tubes to the DNA solution (see S references in the 'Background' section above).

F. ' ' of GUS activity in the roots of ~ F~

No. of ~ ~ No.~'of~ ' GlJS'~~'assav~ s' Seeds~ Ce, ' ~ ' ~ ~ Assayed Positive 'Y o '~
~ =séeds ~ 'fresh ~
Uncut stigma 113 112 89 13 14.6 Cut stigma 926 599 364 21 5.8 The 1.;~assay described by Jefferson et al. (1987) waS used to localize the ~e of the blue color of the X-Gluc cleavage product.

Example 4: 1 ~ of NPTII[APH(3')111 gene into Wheat C -Southern Blot II~L... ' ' The presence of foreign DNA in the transgenic wheat, i.e. the aforesaid kdlla~ .;" resistant plants, was confirrned by Southern blotting as illustrated in Figs. 3-7 and 9. Total DNA (15 llg) extracted from leaves of 30 the putative ha~ [~ ' and wild type plants, was digested by standard procedure with various restriction enzymes, separated on 0.8% agarose gels and then blotted onto nylon filters. The Apa l/Hind 111 fragment containing the entire NPT 1I gene (Fig. 2), isolated from pPCV702GUS and labelled SUBSTITUTE SHEET

wo 93/~8168 P~r/Eps3/oo485 with 32p was used as a probe for detecting the presence of the integrated foreign DNA in the wheat genome. H~l, " with the probe was carried out under stringent " namely x5 Denhardts solution, x4 SSC, 0.1%
SDS at 60~C and followed by four rinses in x4 SSC, 0.1% SDS at the same As illustrated in Fig. 3a, total DNA was extracted from the wild type wheat cultivars Genaro 81 (VEERY #3"S", CIMMYT, Mexico), Seri 82 (VEERY #5"S", CIMMYT, Mexico) and Shafir (SON64A~IZPP//NAi60/3/FA) and from putative ~ r~ a~ expressing h~ hl resistance (Km~), i.e. APTII activity, d~ ci~r7t~d TAU89104-3 and TAU89107-1 which were ~ r~..".. d by plasmid pPCV70~nifD. Ail the extracted DNAs were di~ested with the restriction, ' '- BamHI
and Hindlll and then separated on an agarose gel and L~ rc~cd onto a nylon filter, by the above-noted standard lulu~GJulcs. As a positive control, 15 two DNA samples from plasmid pPCV702GUS were also prepared, one digested with the enzymes BamHI and Hindlll, the other with the enzymes Apal and Hindlll, these samples being separated on same above-noted agarose gel and Ll~ r~..cd onto the nylon filter. The DNA sampies on the nylon filter were hybridized with the aforesaid NPTII ApallHindlll fragment O probe by the aforesaid l.~l, " procedure. The hylll il~ results as shown in Fig. 3a d~ "~t that the LIA..~r(ll l..-.a TAU89107-1 cames, on a high molecular weight BamHI/Hindlll DNA fragment of about 10.5 kb, a foreign DNA which hybridizes with the NPTII probe. None of she wild type DNA fragments are capable of hybridizing to the NPTII probe, 5 indicating that this gene is not present in these genomes. The schematic restriction map shown in Fig. 3b illustrates the possible mode of insertion of a part of the plasmid pPCV702nifD (Fig. 1) into the wheat plant genome, - "genomic" denoting this genomic DNA. This map was co.l~L.u~Lcd on the basis of the hylJIidi~Liùll results shown in Fig. 3a and Fig. 4a and also on SUBSTITUTE SHEET

wo 93/18168 PCI/~l 7Jj~ ' ~
~A21 17652 the basis of the known restriction enzyme sites of the piasmid pPCV702nitD
(Fig. lj, and the absence of niJD sequence in the DNA of the h~ ~r~
TAU89107-1.
As shown in Fig. 4a, total DNA was extracted from the same 5 wild type cultivars and ~ r.,,.-"l wheat plants as described for Fig. 3a, but these DNA samples were digested with the restriction ' ' PstI
only, which cuts each of the two plasmid vectors in the NPTII gene and in the ampR gene. The digested DNA samples were separated on an agarose gel and were ' , '~ d to a nylon filter and hyl,liJi~d as before with the NPTII ApaVHindlll DNA fragment probe. The results of the hylJl ' reveal that ~ rl~ l TAU89107-1 has two Pstl DNA
fragments (approx. 6.9 and 0.8 kb) which are capable of hybridizing said probe. The schematic restriction map shown on Fig. 4b) is the same as that of Fig. 3b) and was, . ~ on the basis of the l,~ '; results shown in Figs. 3a) and 4a) and on the basis of the known restriction sites of pPCV702niJD (Fig. 1).
As shown in Fig. 5, total DNA was extracted from the wild type wheat cultivar Shafir and from nine F2 l~ r~ of TAU89107-1 F~ plants (1, 2, 3, 4, 5, 6, 7, 8 and 9), (see Figs. 3a and 4a). These DNA
samples were digested with the restriction ~ If ''~' Pstl and BamHI, were separated on an agarose gel and lla~fi,~l~J to a nylon filter as before.
The DNA samples on the nylon filter were hybridized with the probe NPTII
ApaVHindlll DNA fragment + pPCV702nifD vector as noted above (Figs.
3a, 4a) under the aforesaid hylJ~hli~aliull I ' - The results indicate that second generation l.~l ~r~." ~ ~ 4,5,6,8, and 9, in particular, carry PstVBamHI DNA fragments (approx. 2.5 and 3.5 kb) which are capable of ll~l,lhli~i..g to the probe and which appears to be absent from the wild type genomic DNA.

SUBSTITUTE SHEET

wo 93/18168 C A 2 1 1 7 6 5 2 Pcr,~, 73t~~ ~

Example 5: Southern II~ ' of F2 DNA
The presence of 10.5 kb fragment in the F2 plants of TAU89107~ r(~ digested with BamHI and HindllI is shown in Fig. 6. Lanes 1 and 2 represent the F2 I~ r I~ TAU89107-1-J18; lane 4 the F2 TAU89107-1-K10 1.~ derived from selfing of F~ plants of TAU89-107-1; and lanes 3 and 5 represent the controls being DNA from the plasmid pPCV702_D digested with EcoRI. The Southern blot were as described above in Example 4. The probes used in these analyses were the following: the HindlII-Apal NPTII fragment or the PCR
~ ' ' gene 4 l (described in Example 8), both of which resulted in identical h~VI;d;~-I;U~ patterns.

Example 6: Southern H~ ' of F3 DNA
The presence of 9.8kb and 10.5kb fragments in the F3 plants of TAU89107-1 ll ' digested with BamHI and Hindlll is shown in Fig. 7. DNA from wild type Shafir is shown in lane 1. Lanes , 3 and 4 represent the following F3 families: TAU89107-1-H29-21, TAU89107-1-J17-14 and TAU89107-1-J18-9, respectively. The Southern blot ~lu~clu,~i~ were as described abve in Example 4. The probes used in these 0 analyses, were those noted above in Example 5, namely, the Hindlll-Apal fragment or the PCR sylllh~ d gene 4 terminator fragment, both of which resulted in identical h~l ''' ' patterns.

Example 7: PCR ~ n ''5 In Fig. 8(a) there is shown a l.tJI~ ,~.. hlioll of the ele~ll, .' ~,;s on an agarose gel, under standard ~ ' , of the DNA
fragments obtained after the PCR procedure, namely, the results of the PCR
~ a .I.P.r t; of the inserted NPTII coding sequence in F2, F3 and F4 generation plants of sub-families of the IIA~ Shafir TAU89107-SUBSTITUTE SHEET

wo 93/18168 C A 2 1 1 7 6 5 2 PCr~

lKmR (for the PCR ~,.. ' ,,~ see also Example 11 below). The DNA
templates used in the PCR procedure were as follows:

Lane No. 1 = control sample, no DNA template in reaction;
5 Lane No. 2 = control sample, non-ll, r", A, wild-type Shafir DNA;
Lane No. 3 = i ' sample, F2 ~ i Shafir TAU89107-1-B19 DNA;
Lane No. 4 = ~ sample, F2 gr~ratinn Shafir TAU89107-1-J20 DNA;
Lane No. 5 = Il., r", sample, F3 g~n~ratinn Shafir TAU89107-1-J18-X DNA;
Lane No. 6 = ll ' sample, F3 grr~ratinn Shafir TAU89107-1-J18-9 DNA;
Lane No. 7 = 1,.'~~1 sample, F4 g~n~ratinn, Shafir TAU89107-1-J18-9-lB DNA;
Lane No. 8 = l. ' sample, F4 g~ r~ti~n, Shafir TAU89107-1-J18-9-lK DNA; and Lane No. 9 = size markers for DNA fragments from 0X 174 b~ t~ f r ~ ~ DNA cleaved with Haelll restriction ~o Thus, the presence of foreign DNA in sub-families of h ~r~ Shafir TAU89107-lKmR (see also Table 2 below, Example 11) in F2, F3 and F4 O was positively confirmed by direct PCR
25 r' as shown in Fig. 8(a). In all such ll~ r,... -. ~ carrying the NPTII coding sequence, a 790 bp fragment was ~yll~h~ d from the templates regardless of generation (F2, F3, F4).
Figure 8(b) shows the results of the PCR ~ ' of the APH(3')11 gene and its adjacent gene 4 terminator using total DNA extracted SUBSTITUTE SHEET

WO 93/18168 C A 2 1 1 7 6 5 2 PCr/Ei~93/00485 from the F4 progenies of l~all~rull~ l TAU89107-lKmR obtained by selfing.
The primers used in the PCR reactions were as follows:
Primer No. 1 ~,Oll~ r I to nl~iPoti iP 21 until the 47th nucleotide of the N~TII coding region (26 ,.,.. i~ ~,t;~i~c) as follows:
= 5'-GCACGCAGGTTCTCCGGCCGCTTGGG-3' Primer No. 2 I,ull~ r ' to m~lP~)tiriP 744 until nucleotide 775 of the NPTII coding region (31 ,~ l~.,l;.i~') as follows:

=5'-CCCGATTCGCAGCGCATCGCCTTCTATCGCC-3' Primer No. 3 is a reverse primer and represents the 3' end of gene 4 tl"lllill~tUl as follows:
= 5'-ATTATACATAACACGCACA-3' (a total of 19 ) --The DNA templates and the primers used in the PCR
~mpljF were as follows:

Lane No. 1 = size markers being b~ ph~L~r i~ DNA digested with BstEII;
Lane No. 2 = control template non~ r(".~f~i wild-type Shafir DNA
with primers 1 and 3;
Lane No. 3 = ll~ rolul~llll sample, F4 generation, Shafir TAU89107-1-H29-21-lA2 with primers 1 and 3 (about 1.15 kb);
Lane No. 4 = ll ~r~.. l sample, F4 gPnPratir~n Shafir TAU89107-1-J18-9-lB with primers l and 3;

SUBSTITUTE SHEET

WO 93/18168 C A 2 ~ ~ 7 6 5 2 PCI~/EP93/00485 Lane No. 5 = ll ' sample, F4 g~ m~r~tinn Shafir TAU89107-1-J18-9-lB with primers 2 and 3 (about 0.5 kb);
Lane No. 6 = m '~ sample, F4 g~'n~'r~ti~ln, Shafir TAU89107-1-J18-X-lB with primers 1 and 3;
Lane No. 7 = ll ' sample, F4 generation Shafir TAU89107-1-J18-X-lB with primers 2 and 3;
Lane No. 8 = R~ p~ ~g~ ~x174 DNA digested with HaelII.

The linkage between the NPTII coding region and the adjacent 10 gene4 i was .~ ; d lluu_g' _ 4 g of selfingûfthe TAU89107-1KmR family.

Example 8: Stabilit~ of the NPIII sequence ~ The stability of the NPTII sequence in different plant organs was evaluated in various F4 ll~ of the TAU89107-1.
The presence of a 10.5 kb fragment was confirmed in F4 plants as shown by Southern blot analysis of l~ t~ ., plants of 3 families (Fig. 9). Total DNA extracted from the F4 plants was digested with BamHI
and HindIII and probed with the gene 4 (Poly A) terminator fragment which was obtained by PCR ll ~ (Figs. 1 and 2). The DNA templates were as follows:

Lane No. 1 = control template, non-l,. ~ wild-type Shafir DNA.
Lane No. 2 = h~ [ullll.~ul sample, F4 generation, Shafir TAU89107-1-H29-21-lAlC (C = refers to the central tiller from which DNA was extracted).
Lane No. 3 = l ' sample, F4 generation Shafir TAU89107-1-H29-21-lA2C (a central tiller form another plant originated from the same F3 spike as in Lane No. 2).

SUBSTITUTE SHEET

wo 93/18168 PC1r/EP93/00485 rA2 1 1 ~b52 23 -Lane No. 4 = IIA'''I''I'II'f''l sample, F4 generation Shafir TAU89107-1-J18-9-lBC (a central tiller from which DNA was extracted).
- Lane No. 5 = IIA~ -r~ sampie, F4 generation Shafir TAU89107-1-J18-9-lBR (R = refers to the roots of the plant from which DNA was extracted).
Lane No. 6 = L~ r,... ,.. , sample, F4 generation Shafir TAU89107-1-J18-X-lBC (a central tiller from which DNA was extracted).
Lane No. 7 = ~ ru.,.. -.. ~ sample, F4 generation Shafir TAU89107-1-J18-X-lBR (roots of the plant from which DNA was extracted).

The presence in F4 plants of the 10.5 kb fragment as shown by 15 the results presented in Fig. 8b, should also contain the t~ l;..alul (the gene 4 poly A sequence) linked to the NPrll coding region. Therefore the Southern blot analysis performed with the terminator sequence confirmed that the i..l.udu~c;i sequence was stably ... A;111A;~ d 1l11. _ g ' . 4 ~
of selfing. The presence of two adjacent bands of about 10 kb was observed ~0 in F3 and F4 g Example 9: ~ ~.;.. Resistant Fs Plants Resistance to hal~a~y~hl was expressed in seedlings of F5 plants ~ on 150 ~lg/ml kallallly~hl. A I~ alive Fs piant is ~5 shown in Fig. 10a together with kallalllyc;ll ~ ivc seedling of the wild-type Shafir. The F5 plant (CC44) is a progeny of the TAU89107-1-J18-9 F3 family. The mature F5 ha..a...y~i..-resistant Shafir IlA ~r1~ plant ~ resembles 1' yl~h,ally (plant height, leaf and spike shape) the non-' ' wild-type Shafir. This l~ .,..lali~,~, F5 plant was examined for SUBSTITUTE SHEET

wo 93/18168 C ~ 7 6 5 2 Pcr/Ep93/oo48s resistance to ka~ /.hl at the seedling stage in Fl, F3 and the F5 whereas seed ', ' via selfing without L-llalll~;ll was performed in the F2 and F4 ~, The presence of the NPTII coding "tail" (51bp) and the linkage S to the gene 4 (poly A) terminator was confirmed by PCR amplif --- using primers 2 and 3 of Fig. 8b (Example 7). The PCR product of the L,llalll~.;ll-resistant i ' CC44 and the k.~ .hl s~ ilive Shafir were cle~ r ~ cd on 1.2% agarose gel along with ba t . ;~ x174 DNA digested with HaeIII (Fig. 10b). The DNA templates and the primers 10 used in the PCR a . ' ~ " were as follows:

Lane No. 1 = b~ x174 DNA digested with HaeIII.
Lane No. 2 = control template, non~ r .. d wild-type Shafir DNA
with primers 2 and 3.
15 Lane No. 3 = ~ r~ templateextractedfromk~ ;ll-resistantF5 Shafir TAU89107-1-J18-9-lB-4A plant (= CC44) primed with primers 2 and 3 (about 0.5 kb).

Example 10: T ' ~ of the GUS Reporter Gene The presence of another foreign DNA sequence ;IIIludU-Cii bv the cp~ of the vector pPCV702GUS was confirmed in Fl plants by Southern ll~b~ ' The results are presented in Fig. 11 which shows total DNA extracted from Fl wheat plants ll~ rullll.d with pPCV702GUS
and probed with the same plasmid. In this Southern blot the Shafr (lane No.
1) and the 1l ~r.. , - -' DNA samples (lanes 2 and 3) were about 5 llg of total genomic DNA. The samples were digested with the restriction ' ' EcoRI and HindllI.
In order to confirm the presence of 2.9 kb which includes: 35S
promotor-GUS coding region -NOS t~rmin~t-lr, in the integrated DNA, SUBSTITUTE SHEET

wo 93/18168 - P~r/EP93/00485 C~71 ~ 7~

about 10 ng of the vector pPCV702GUS were digested with the same enzymes and used as a control sample in the Southern blot analvsis (denoted as 702GUS).

5 Lane No. 1 = represents the wild-type Shafir control, Lane No. 2 = representstheFlwheatl.d ~ Seri82TAU90-56-13, and Lane No~ 3 = represents the Fl I~d ~r~ Pavon 76 TAU90-84-7.

The above observed results are evidence of the presence of the introduced 2.9 kb GUS fragment in F~ hd~ ~r...l~ of the high-vielding cm.l.ll~lc;dl wheat cultivars Pavon 76 and Seri 82.
In a similar fashion, the Fl sub-families of Seri 82 r~ TAU90 GUS/NPTII (see Table '' below, Example 11, listed as ~ r..... ~ TAU9055-9 and TAU9056-13, l~d~.i,ful~ d by the pPCV702GUS vector) were evaluated for the presence of GUS, NPTII or both by direct PCR as shown in Fig. 1~. This figure shows a l~ Cll~dliUII
of the cle~lluyLul~;lis on an agarose gel, under standard cn~ 1itinnc of the above DNA fragments obtained after the PCR procedure, namely, the results 20 of the PCR ~mplif~ of the inserted NPTII or GUS coding sequences in several Fl generation sub-families of Seri 8" TAU90 GUS/NPTII
lld .ru....~ The to DNA templates used in the PCR procedure and the amounts thereof were as follows:

5 Lane No.1 = control sample, GUS primers (primers Nos. 3 and 4, see Example 11, Table '') added to reaction but no DNA
template added;

SUBSTITUTE SHEET

wo 93/18168 pcr/Ep93/oo485 - 2s --Lane No. 2 = control sample, NPIII primers (primers Nos. 1 and 2, see Example 11, Table 2) added to reaction but no DNA
template added;
Lane No. 3 = control sample, GUS pnmers and Seri 82 wild type DNA
as template added (500 ng DNA);
Lane No. 4 = control sample, N~TII primers and wild type Seri 82 DNA
as template added (500 ng DNA);
Lane No. 5 = ll ' sample, GUS primers and TAU9055-9 DNA
as template added (50 ng DNA);
Lane No. 6 = i ' sample, NPTII primers and TAU9055-9 DNA
as template added (50 ng DNA);
Lane No. 7 = IIA- ~r~ sample, GUS primers and TAU9054-10 DNA
as template added (50 ng DNA);
Lane No. 8 = l,~ c,,,, ~ sample, GUS primers and TAU9054-11 DNA
as template added (50 ng DNA) (no synthesis observed);
Lane No. 9 = i ' sample, N~TII primers and TAU9056-13 DNA
as template added (200 ng DNA); and Lane No. 10 = size markers for DNA fragments from ~x174 bA~t~
DNA cleaved with Haelll restriction, ~0 It should be noted that all the above llal.i~rulll-A..l:~ are part of the I~ r~J~ presented in Table 2 (Example 11).
Thus, as shown in Fig. 1'', 1170 bp GUS and 790 bp NPIII
fragments were ~y-llh~ .,d by the IIAI~:~rlllll~AIII TAU9055-9 (lanes 5 and 6, ~ 1y) A GUS fragment was also confirmed in the TAU9054-10 l.. ---~r.. ~ (lane7),butnotintheTAU9054-lll,A- r~"... - l(lane8). An N~TII coding sequence insertion was also confirmed in the TAU9056-13 r......... ---~ (lane 9). This IIA 'r~ was also l~ .. t~d in Fig. 11, where the 2.9 kb GUS fragment was observed.

SUBSTITUTE SHEET

C ~ 2 1 1 7 6 5 2 PCI-/EP93/00485 All IIA r~ that were verified by Southern blot and PCR
a ~' ~ gave a positive GUS GAylG in the root phloem (Table 1).

- Example 11: Tr_ ~ of different wheatvarieties bvtwo plasmid vectors The high-yielding, semi-dwarf, spring bread wheat (T. aestiv~m L.) cultivars Genaro 81 (VEERY#3"S", CIMMYT, Mexico), KEA"S" (CM21335, CIMMYT, Mexico), Papago M86 (CM52359, CIMMYT, Mexico), Pavon 76(CM8399, CIMMYT, Mexico), Seri 82 (VEERY#5"S", CIMMYT, Mexico) and Shafir (SON64AmPP//NAI60/3/FA, Hazera Seed Co., Israel) (see also Exampies 2-4 above) were examined for their ll.. ~r.. A~ I capability by wav of ad,.. illiat~l~d foreign DNA. The above wheat strains were IIA~ ~r .. d using the yll ' Ga described in Example 2 above, the foreign DNA being -' ~ ~ ~J to the plants being that detailed in Example 1 above.
Following the ~ r " procedure, the treated plants were tested to determine the success and frequency of ll ' using the bioassay 20 methods described in Example 3 above and by a PCR assay carried out as follows:
In the llA..~r~ g the NPTII coding sequence, the NPTII fragment was a~ h~ai ~d by PCR using total ll_ll;.rul~llalll DNA as template and the following primers:
Primer No. 1 (5' region of NPTII coding sequence):
5'-GCACGCAGGTTCTCCGGCCGCTTGGG-3' SUBSTITUTE SHEET

C A 2 1 1 7 6 5 2 Pcr/EP93/oo48S

Primer No.2 (a reverse primer of the 3' region of NPIll coding sequence):
5'-GAAGGCGAGCGCTGCGAATCGGG-3' In the 1., r,~ g the GUS coding sequence, the GUS fragment was ~ h~ d by PCR using total l.~ r.. ~ DNA as template and the following primers:

Primer No.3(5' region of GUS):
5'-GTGGAATTGATCAGCGTTGGTGGG-3' Primer No. 4 (a reverse primer of the 3' region of GUS):
5'-GCCAGTGGCGAAATATTCCCGTGC-3' T ' events occurring in different wheat cultivars during 2 cycles of ~ . ;,. d by the above two assays are ~- ;, d in Table 2.

SUBSTITUTE SHEET

X
. ,, ~ ~ ~ ~, C C ;~

E E E E ~ ~ ~ C~
' ~ ~ Y Y Y Y ~ O

~ ~
-- . ~,~ -- -- --E E E E
~: ~ ~ Y Y Y Y
C, L

e ~ Z Z Z

~ ~7 Z Z ~ ~ ~ ~ ~ ~

C . . X 'O

X ',-- O C~ X X
c~

~ O C ~ ~ Ir~ ~~ X
~3,,,, c lo _ o ,,, _ _ SUBSTITUTE SHEET

W O 93/18168 PC~r/EP93/00485 In Table 2 above the various c' _ under "Presence and C;l.lJIC ' Il, denote the following:

Km~ = T.~ ~r~ a is capable of expressing the NPTII gene, i.e. is 1 ~hl resistant, as observed from green seedlings capable of growing on water agar containing 150 ~lg/ml h~ h (Km) (see Example 3 above).
NPTII~CR = Presence of NPTII fragment detected directly in the ~ . r.",....~ by use of PCR methods (see PCR procedure }~ C;I~I~CIU .. ).
GUS; = T,~ r.... ~,1 exhibits GUS activity in the roots, as observed in a bioassay using X-Gluc as substrate (see Example 3 above).
GUSK:R = Presence of GUS fragment detected directly in the h '( by use of PCR methods (see PCR procedure }~
* = Evaluated according to I ~hl resistance (NPTII) in seedlings or GUS C~.IJI~ ' (GUS) in the roots.

Example 12: T ' ~ of the bar gene into two different wheat varieties The high yielding, semi-dwarf, spring bread wheat cultivars Seri 82 (VEERY #5"S", CIMMYT, Mexico) and Shafir (SON64AmPP/tNAI60/3/FA, Hazera Seed Co., Israel) were ~ [u~ d with the plasmid pPAT-NPTII 100.1-28 carrying the Sl.~ u.l.~s h~ E:IU~ UIJ;~U:~ bar gene (DeBlock et al., 1987, White et al., 1990). This geneencodes an acetyl CoA ~ rr."~ capable of hl~l~liv~Lil-g the herbicides bialaphos and ~l..r..~: tl by a~et~l~liu... The gene was linked to the CaMV
30 35S promoter and PolyA (t._llllhldtùl) sequences to serve as a marker gene SUBSTITUTE SHEET

~A~ I l7~r'~

in plants. The plasmid pPAT-NPTII 100.1-28 is a pUC-derivative (Topfer et al., I . ' ' ' i, personal ~ ) which also carries the NPTII
gene with the first intron of the maize Shrunken gene (shl) (Werr et al., - 1985) inserted du~ L.. ,alll to the NPTII ~ ' I start site (Christoph, S MaaS and J. Schell, personal ).
The bar sequence was detected by PCR ~ ' ~ " in of the F~ g t as shown in Figure 13, which is a l~pl~ of the el~,.,h~ ,;s on an agarose gel, under standard conditions of the 0.6 kb PCR product obtained, when specific bar primers were used. The first one COIlc r ' to the ' ' -8 until 19th ' of the bar coding region (White et al., 1990) as follows:

CCGATCCCATATGAGCCCAGAACGACGCC
The h I start site is, ' ' Asterisks denote nucleotide ' to form the Ndel and BamHI sites and additional two dc~,~r~ylhLI.~s that were added to the 5' end.
The second primer is a reverse primer ~ Y to the sequence of ' ' 533 to nucleotide 548 of the coding region, two stop signals and 16 ' ' du..~h~a~.. according to White et al., (1990) and additional two dc~l..y~lid;l.~,~ as follows:

5'-CCGGATCCCCCGGGTCATCAGATCTCGGTGACGGGC (37 mer) With reference to Figure 13, the DNA templates used in the PCR procedure were the following:

SUBSTITUTE SHEET

wo 93/18168 Pcr/EP93/oo485 CA21 1765~
Lane No. 1 = ll ' sample, F~ ,,TAU92P4SHF9-2, ., .' ' fragment after gel l ~~of the 0.6 kb fragment ~ylllL~ d by PCR;
Lane No. 2 = IIA~-~r~ sample, Fl generation TAU92P4SER14-1;
Lane No. 3 = IIA~ sample, F~ g ~ TAU92P4SER14-1, ,.~...pl;r;rA fragment after gel ,._ of the 0.6 kb fragment obtained in the first PCR synthesis, (d in Lane 2);
Lane No. 4 = control sample, non-l.~ ~r~ rA~ wild type Shafir DNA;
10 Lane No. 5 = control sample, non-~ r~ A, wild type Seri 82 DNA;
Lane No. 6 = control sample, no template added in PCR reaction;
Lane No. 7 = control sample, plasmid pPAT-NPTII 101.1-28 as a template (30 ng); and Lane No. 8 = size markers for DNA fragments from ~x174 b..~t~l r~
DNA cleaved with HaellI.

The above-noted direct detection of the NPTII, GUS and bar gene fragments in the hA~-~r~ as set forth in Examples 7-12, was carried out using standard PCR Ul~ ' ~,, (CCtUS Corp./Hoffmann-La 20 Roche AG).
The present findings as set forth h."~ a'-ove in Examples 3-12 and their a~-ull~ L.g Figures, support ;.,1. ~ I events of foreign DNA into the wheat genome by the method of the present invention. The of insertion were rather high ranging from 2.6 to 4.3% according 25 to DNA probing and up to 15.5% according to GUS assays over two different years, for the NPTII and GUS/NPTII genes.
T "U and C;A,UI~ iU.. were shown for three different genes having two different promoters and ~ , and for different wheat cultivars of diverse genetical bd-h~ The wheat cultivars used SUBSTITUTE SHEET

wo 93/18168 PClr/EP93/00485 in the study were all high-yielding, modern ~ ;al spring wheats, some of which are grown over large acreages in developed and d~
countries. The i ' ' ,,y and fertility of most I~ r~ matched that of the original cultivars regardless of generation (F, to F5).
Thus, it may be concluded that bv the method of the present invention it is possible to prepare transgenic wheat plants, in particular, those of w,.~ ;AI ..~, varieties which have stably integrated the foreign DNA and can transmit this DNA to the next ge~

SUBSTITUTE SHEET

C A 2 1 1 7 6 5 ~ PCr/~l ,3, G

REFERENCES
1. DeBlock, M.Y., Bottrnn~n J., Vandewiele M., Dockz, Y, Thoen, C., Gossele, V., Mowa, C., Thompsonj M, Van Montagu, M., and Leemans, J. (1987), r.. ,; ..;..g herbicide resistance in plants by ~p.~ of a d~,tu~yry g enzyme. The EMPO J. ~, 2513-2518.
2. Gielen, J., De B- ~ lf , M.; Seurinck, J.; Deboeck, F.; De Greve, H.; Lemmers, M.; Von Montagu, M., and Schell, J. 1984, The Complete Nl ' ' Sequence of the TL-DNA of theA~, o ~ tH
t. ,' - ~.7s plasmid pTiAchS. The EMBO J. 3:835-846.
3. Jefferson, R.A. Kavanagh T.A., and Bevan M.W., 1987, Gus Fusions:
3-- ' ~ ' as a sensitive and versatile gene fusion marker in higher plants. EMBO Journal, Vol. 6, 3901-3907.

4. Koncz C., Martini N., Mayerhofer R., Koncz-Kalman Z., Korber H., Redei G. and Schell J, 1989. High frequency T-DNA-mediated gene tagging in plants. Proc. Natl. Acad. Sci. (U.S.A.), ~, 8467-8471.

5. Koncz C., and Schell J., 1986. The promotion of T2-DNA gene 5 controls the tissue-specific ~ ~ of chimeric genes carried by a novel type of A~ u~, binary vector. Mol. Gen. Gen. Vol.
204, 386-396.

6. Lu, Zhong-xun and R. Wu, 1989. A simple method for the of rice via the pollen-tube pathway. Plant Molecular Biology Reporter 7: 69-77.

7. Picard E., J.M. Jacquemin, F. Granier, M. Bobin and P. Forgeois, 1988. Genetic t,, ' of wheat (Triticum aestivum) of plasmid DNA uptake during pollen tube g~ Proc. 111 I Wheat Genetics Symposium, Vol. 1: 779-781.
g U.K 10-12 July, 1988.

8. Potrykus, 1., 1990. Gene Transfer to Cereals: An ~t, BiolTechnology ~, 535-542.

SUBSTITUTE SHEET

W O 93/18168 P~r/EP93/00485 ~ A 2 1 1 7 6 5 2 3,~

9. Topfer, R., Maas C., Horicke-G 'l c, Schell and Steinbiss, H.H.
Improved sets of c~yl~ vectors for high level gene C,~JII ~ in d;wly' ~ _ and y' ' plants (" ' ' ' ~, personal )-10. Werr, W., Frommer, W.B., Mass, C., and Starlinger, P. (1985).
Structure of the sucrose synthase gene on ~L~ 9 of Zea mays L. EMBO J. ~,1373-1380.

11. White, J., Chang, S.Y., Bibb M.J. and Bibb M. (1990). A cassette g the bar gene of 5~1 r '~ h.~ . a selectable marker for plant I~ r~ ; Nucleic Acids Research ~, 1062.

SUBSTITUTE SHEET

Claims (18)

CLAIMS:

1. A method for producing transgenic wheat plants comprising:
(a) emasculating wheat plant florets by removing all pollinator anthers prior to their maturation and then inducing synchronized pollination by pollinating the stigmas of said florets with mature male pollinator anthers from the same or a different variety of wheat plant;
(b) applying a droplet of an aqueous DNA solution onto one or more pollinated stigmas, following a time period after pollination in which the pollen tubes in the pollinated stigmas have started to grow into the style but have not yet reached the ovary, said DNA solution comprising a suitable DNA vector carrying at least one gene foreign to the plant and capable of inducing the expression of a desirable trait in the plant and optionally an additional marker gene;
(c) maintaining said DNA solution droplet on said stigma in a humid environment for a period of time to ensure that said DNA vector reaches and enters the ovule;
(d) protecting the treated plants of step (c) from additional pollination by any nearby plants, growing said plants and collecting the seeds developed in said florets; and (e) growing said seeds under conditions adapted for the selection of transformed wheat plants.

2. The method according to Claim 1, wherein said pollinated stigma, to which said droplet of an aqueous DNA solution is added, is an intact stigma.

3. A method for producing transgenic wheat plants comprising:
(a) emasculating wheat plant florets by removing all pollinator anthers prior to their maturation and then inducing synchronized pollination by pollinating the stigmas of said florets with mature male pollinator anthers from the same or a different variety of wheat plant;
(b) 1-2 hours after pollination applying a droplet of an aqueous DNA
solution onto one or more pollinated stigmas, said DNA solution comprising a suitable DNA vector carrying at least one gene foreign to the plant and capable of inducing the expression of a desirable trait in the plant and optionally an additional marker gene;
(c) maintaining said DNA solution droplet on said stigma in a humid environment for a period of 12-14 hours;
(d) protecting the treated plants of step (c) from additional pollination by any nearby plants, growing said plants and collecting the seeds developed in said florets; and (e) growing said seeds under conditions adapted for the selection of transformed wheat plants.

4. A method for producing transgenic wheat plants comprising:
(a) emasculating wheat plant florets by removing all pollinator anthers prior to their maturation and then inducing synchronized pollination by pollinating the stigmas of said florets with mature male pollinator anthers from the same or a different variety of wheat plant;
(b) truncating the tips of the pollen stigmas after a suitable period of time so that the growing pollen tubes are within the styles but before the ovary, and applying a droplet of an aqueous DNA solution onto one or more truncated stigmas, following a time period after pollination in which the pollen tubes in the pollinated stigmas have started to grow into the style but have not vet reached the ovary, said DNA solution comprising a suitable DNA vector carrying at least one gene foreign to the plant and capable of inducing the expression of a desirable trait in the plant and optionally an additional marker gene;

(c) maintaining said DNA solution droplet on said stigma in a humid environment for a period of time to ensure that said DNA vector reaches and enters the ovule;
(d) protecting the treated plants of step (c) from additional pollination by any nearby plants, growing said plants and collecting the seeds developed in said florets; and (e) growing said seeds under conditions adapted for the selection of transformed wheat plants.

5. The method of Claim 4, wherein the truncation of the tips of the pollinated stigmas is carried out about ~-2~ hours after pollination and said droplet of DNA solution is maintained in contact with said cut stigma tips for about 12-14 hours.

6. The method of Claim 5, wherein the truncation of the stigma tips is carried out about 1-2 hours after pollination.

7. The method of any one of Claims 1-6 wherein said DNA vector comprises a reporter gene which serves as an indication of successful transformation.

8. The method of Claim 7 wherein said reporter gene encodes .beta.-glucuronidase.

9. The method of any one of Claims 1-6 wherein said DNA vector comprises a gene capable of conferring herbicide resistance when expressed in transformed plants.

10. The method of Claim 10, wherein said gene sequence is one encoding the bar gene.

11. The method of any one of Claims 1-10 wherein said DNA
vector also comprises a selectable marker gene.

12. The method of Claim 11 wherein said marker gene is one capable of conferring antibiotic resistance.

13. The method of Claim 14 wherein said marker gene is the APH(3')II (NPTII) gene which encodes aminoglycoside phosphotransferase conferring kanamycin resistance when expressed, said gene being linked to the nopaline synthase (NOS) promoter and to the TL-DNA ipt gene gene 4) polyadenylation signal sequence acting as a terminator.

14 Transgenic wheat being stably transformed with a foreign gene.
the foreign gene being sexually transmittable to subsequent generation.

15. Transgenic wheat according to Claim 14, prepared by the method of any one of Claims 1-13.

16. Transgenic wheat plants according to Claim 14 or 15, being of a commercial crop variety.

17. Transgenic wheat plants according to Claim 16, being of the species T aestivum.

18. Transgenic wheat plants according to Claim 16, selected from the group consisting of ATIR (CNO "S"/PJ62/4/GLL/3/TOB// JAR
"S"/CRESPO Hazera Seed Co., Israel), BAGULA "S" (CM 59123, CIMMYT, Mexico), CIANO 79 (CM31678. CIMMYT, Mexico), Genaro 81 (VEERy#3"S", CIMMYT, Mexico), KAUZ "S" (CM67458, CIMMYT, Mexico), KEA"S" (CM21335 CIMMYT, Mexico), MILAN (231BWSN37, CIMMYT, Mexico), OPATA M85 (CM40038, CIMMYT Mexico), Papago M86 (CM52359, CIMMYT, Mexico), PAVON 76 (CM8399, CIMMYT, Mexico), Seri 82, (VEERY#5"S", CIMMYT, Mexico) and Shafir (SON64A/TZPP// NAI60/3/FA, Hazera Seed Co., Israel).