GB2594084A - Medical methods and medical uses - Google Patents

Abstract

The inhibitor of DNMT3A for treating brain cancer may comprise a small molecule compound, an antibody, a polypeptide, a polynucleotide or an antisense oligonucleotide. The brain cancer may comprise one or more myeloid cell having pro-tumoral activity. The inhibitor may inhibit or decrease the expression and/or biological activity of DNMT3A. The brain cancer may comprise a brain tumour, high-grade glioma, glioblastoma or a tumour of the central nervous system. Also claimed is: a pharmaceutical composition comprising an effective amount of an inhibitor of DNMT3A and a pharmaceutically acceptable excipient, diluent or carrier; the in vitro use of an inhibitor of DNMT3A for reducing or inhibiting the pro- or anti-tumoral activity of myeloid cells; a kit comprising a composition; a method of identifying a test agent for use in treating brain cancer; and a method of determining the susceptibility of a brain cancer to treatment using an inhibitor of DNMT3A.

Description

MEDICAL METHODS AND MEDICAL USES

The present invention relates to inhibitors of the DNA methyl transferase, DNMT3A, and the use of such inhibitors in the treatment of brain cancer.

Cancers are characterised by abnormal cell growth absent the proper signals, continuous growth and division in the presence of contrary signals, avoidance of programmed cell death, a limitless number of cell divisions, promotion of angiogenesis, and the invasion of tissue and formation of metastases (Hanahan & Weinberg (2000).

Gliomas are a form of primary intra-axial brain cancer as they originate from, and grow within, the normal tissue of the brain. Gliomas arise from glial cells, including astrocytes, oligodendrocytes, ependymal cells and optic pathway cells (Mamelak & Jacoby (2007); Weller et al. (2015)). Cancers formed predominantly from such cells may also be known as astrocytomas, oligodendromas, ependymomas and optic pathway gliomas, respectively, and comprise approximately 30% of all brain and central nervous system (CNS) tumors, and 80% of all malignant brain cancers (Goodenberger & Jenkins (2012)). The five-year survival rate of subjects with glioma depends upon the type of originating cell (i.e. the form of glioma) and the grade of tumor prior to treatment. In aggressive forms of glioma, such as glioblastoma, survival is particularly poor; fewer than 5% of patients survive 5 years post-diagnosis, and median survival is restricted to approximately 15 months.

According to the revised 2016 World Health Organisation (WHO) classification of CNS tumors, gliomas may be graded as Grade I-IV based upon histological features that are known to correlate with the natural course of disease (Louis et al. (2016)). These tumors may be further classified based upon the presence or absence of particular molecular markers, including mutations in the isocitrate dehydrogenase [NADP] cytoplasmic (IDH1) or isocitrate dehydrogenase [NADP] mitochondria! (IDH2) genes, the presence or absence of 1 p and 19q (1p/19q) chromosomal co-deletion, the degree of 06-methylguanine-DNA methyltransferase (MGMT) activity, the presence or absence of telomerase reverse transcriptase (TERT) promotor mutations, the presence or absence of the alphathalassaemia/mental retardation syndrome X-linked (ATRX) chromatin remodelling protein, the levels of the tumor suppressor protein p53, the presence or absence of a lysine-to-methionine amino acid substitution at position 27 in the Histone H3 gene, H3F3A, and the presence or absence of chromosome 11 open reading frame 95-p65 (C11orf95-RELA) fusions (Louis et al. (2016); Reifenberger et al. (2017)).

Gliomas are heterogeneously composed of bona fide tumor cells and a range of intermingling, non-neoplastic cells that play a role in controlling the course of the pathology. Based on bulk tumor tissue gene expression profiles analysis, The Cancer Genome Atlas (TCGA) proposed the classification of glioblastoma into four distinct transcriptional subtypes: proneural, neural, classical and mesenchymal (Verhaak et al. (2010); Brennan et a/. (2013)). Single cell gene expression profile analysis recently challenged the existence of the neural subtype (Wang et al. (2017)). From the remaining three transcriptional glioma subtypes, the mesenchymal subtype is associated with a significantly lower median survival and characterised by an increase presence of intermingling immune cells, as compared to the proneural, and classical subtypes (Wang et a/. (2017)). The incidence of a brain tumor induces the accumulation of myeloid cells, especially at the tumor periphery, which, for some glioma (likely of the mesenchymal subtype), can constitute a major part of the tumor mass (Charles et al. (2012); Bowman et a/. (2016)). These tumor-associated myeloid (TAM) cells are composed of microglia, the resident immune cells of the CNS, and additionally bone marrow-derived macrophages. Only under conditions of blood-brain barrier disruption, do bone marrow-derived macrophages appear to contribute significantly to the pool of brain myeloid cells.

Increased disruption of the blood-brain barrier accompanies glioma disease progression (Dubois et al. (2014)). Studies in mice have demonstrated in glioma models that resident microglia represent the main and early source of myeloid cells within glioma. Peripheral macrophages were only found to infiltrate at the late stage of tumor growth and represent -35% of all myeloid cells (Muller et a/. (2015); Brandenburg et al. (2016); Bowmann et al. (2016)). As further evidence of the role in glioma progression, removal of microglia, both in brain organotypic slices (Markovic et al. (2005)) and genetic mouse models (Markovic et al. (2009)), inhibits glioma invasiveness and impacts tumor angiogenesis.

During the course of glioma progression, microglia are recruited by the glioma cells as immune competent cells (i.e. as potentially anti-tumoral immune cells), but are reprogrammed into tumor-supporting cells by the tumor (Hambardzumyan (2016)). Tumor cells prevent the pro-inflammatory properties of microglia and instead modulate them to exert tumor-trophic functions. However, the molecular mechanisms that control the microglial reprogramming from the anti-tumoral to pro-tumoral phenotype, while of significant therapeutic interest, remain unclear.

Malignant primary gliomas, such as glioblastoma, are highly aggressive brain tumors with limited therapeutic options. The intrinsic capacity of these high-grade gliomas to infiltrate the surrounding brain tissue, which impedes surgical resection, contributes significantly to the failure of current therapeutic treatments and predictably results in high rates of early recurrence. Despite multimodal therapy with the concomitant use of radiation and adjuvant treatment (e.g. temozolomide, bevacizumab), survival for patients with glioblastoma is extremely poor. Thus, high-grade gliomas with their significant mortality and morbidity remain a substantial challenge in oncology.

o Against this background, the present inventors have surprisingly and unexpectedly found that activity of DNMT3A in myeloid immune cells (e.g. microglial cells) determines whether a pro-or anti-tumoral phenotype is prevalent in such cells. As described above, microglia are co-opted by brain cancer cells, aiding their expansion and ability to invade surrounding healthy brain tissue. The inventors have found that a particular DNA methylase in microglia -DNMT3A -regulates microglia pro-inflammatory gene expression, and that inhibition of DNMT3A in microglia decreases tumor growth, causing microglia to demonstrate an anti-tumoral rather than pro-tumoral phenotype.

Accordingly, an aspect of the invention provides an inhibitor of DNMT3A for use in the treatment of brain cancer in a subject.

In a further aspect, the invention provides the use of an inhibitor of DNMT3A in the manufacture of a medicament for the treatment of brain cancer in a subject.

In yet a further aspect, the invention provides a method for the treatment of brain cancer in a subject, the method comprising the step of administering an inhibitor of DNMT3A.

DNMT3A -an abbreviation of DNA (cytosine-5)-methyltransferase 3A -is a protein involved in the methylafion of DNA. The sequence of the DNMT3A gene is known in the art and is available from a variety of databases, such as that provided by the National Centre for Biotechnology Information (NCBI; Homo sapiens DNA methyltransferase 3 alpha (DNMT3A), RefSegGene (LRG_459) on chromosome 2; RefSeq ID NG_029465.2). The nucleotide sequences of DNMT3A messenger ribonucleic acids (mRNAs) and amino acid sequences of DNMT3A polypeptides are also available from at least the NCB! database. For example, the DNMT3A mRNA may comprise or consist of the nucleotide sequence of SEQ ID NO: 1 (Figure 1). In a further example, the DNMT3A polypeptide may comprise or consist of the amino acid sequence of SEQ ID NO: 2 (Figure 2). Further DNMT3A mRNA and polypeptide sequences, and corresponding NCB! RefSeq IDs are provided in Table 1, below. Accordingly, by "DNMT3A", we include the meaning of the DNMT3A gene, the mRNA (including the "pre-spliced" and "spliced" or "mature" DNMT3A mRNA), and the protein (also referred to as the "DNMT3A polypeptide" or the "DNMT3A protein"), including post-translational modifications.

Table 1. DNMT3A mRNA and polypeptide sequences, and corresponding NCBI RefSeq IDs DNMT3A mRNA nucleotide NCB! RefSeq ID sequences Transcript variant 1 NM _175629.2 Transcript variant 2 NM _153759.3 Transcript variant 3 NM _022552.4 Transcript variant 4 NM 175630.1 Transcript variant 6 NM _001320893.1 Transcript variant 7, non-coding NR 135490.2 -

RNA

Transcript variant 8 NM _001375819.1 Transcript variant X1 XM 017003526.1 Transcript variant X2 XM_ 005264175.5 Transcript variant X3 XM_ 011532662.2 Transcript variant X4 XM_ 011532663.2 Transcript variant X5, XR 001738657.1 -miscellaneous RNA Transcript variant X6 XM_ 011532664.2 Transcript variant X7 XM_ 011532666.2 Transcript variant X9 XM_ 011532667.3 Transcript variant X10 XM_ 017003527.1 DNMT3A mRNA nucleotide NCB! RefSeq ID sequences lsoform a NP_783328.1 lsoform b NP_715640.2 lsoform c NP_783329.1 Isoform c NP_001307821.1 lsoform d NP_001307822.1 lsoform e NP_001362748.1 lsoform X1 XP 005264232.1 lsoform X1 XP_016859015.1 lsoform X2 XP_011530964.1 lsoform X3 XP_011530965.1 lsoform X4 XP_011530966.1 lsoform X5 XP_011530968.1 lsoform X6 XP_011530969.1 lsoform X6 XP_016859016.1 By "an inhibitor of DNMT3A" we include any agent which inhibits (e.g., downregulates, antagonises, suppresses, reduces, prevents, decreases, blocks, and/or reverses) the expression and/or biological activity and/or effect of DNMT3A, as defined herein. More particularly, an inhibitor can act such that the biological activity of DNMT3A is decreased in a manner that is antagonistic (e.g., against, a reversal of, contrary) to the normal, wild type, action of DNMT3A. In the context of the present invention, we include the meaning that inhibition may prevent the main recognised activity of DNMT3A, de novo DNA methylation.

For example, an inhibitor of DNMT3A may act by preventing or inhibiting primary RNA transcription of DNMT3A, by preventing or inhibiting RNA processing prior to translation (e.g. during splicing) of DNMT3A, by preventing or inhibiting mRNA translation of DNMT3A, and/or by preventing or inhibiting one or more function of the DNMT3A protein.

It will be appreciated by those skilled in the art that transcriptional activation and repression are influenced by, and associated with, changes in chromatin structure, including histone modification and DNA methylation. DNA methyl transferases catalyse the transfer of methyl groups from S-adenosyl-L-methionine to specific CpG sites in DNA, resulting in "methylation" of the DNA. A CpG site is a region of DNA wherein a cytosine nucleotide is followed by a guanine nucleotide in the linear sequence of bases (Le. direction).

CpG sites occur with high frequency in genomic regions called CpG islands and can be methylated to form 5-methylcytosine. In mammals, around 70-80% of CpG cytosines are methylated (Jabbari & Bernardi (2004)), which typically prevents expression of the gene whose CpG sites are methylated. "Maintenance" DNA methylation ensures the fidelity of replication of inherited epigenetic patterns. "De novo" DNA methylation, the main recognised activity of DNMT3A, modifies information passed to progeny, and enables key epigenetic modifications essential for processes such a cellular differentiation, embryonic development, transcriptional regulation, heterochromatin formation, X-inactivation, imprinting and genome stability (Jia at a/. (2016)).

The brain consists of a plurality of cell types. Neurons, or nerve cells, typically consist of a compact cell body, called a soma, a single axon, and one or more dendrites. Neurons are the electrically-excitable cell of the brain, capable of communicating with other cells via a specialised synapse and comprise the primary component of the nervous system. Neurons are responsible for effecting transmission of excitatory, inhibitory or modulatory signals to other, postsynaptic neurons via the release of neurotransmitters, such as glutamate, gamma-aminobutyric acid (GABA) or acetylcholine.

Glia, or glial cells, are non-neuronal cells in the central and peripheral nervous systems that do not produce electrical impulses. Nevertheless, glia are capable of communicating with surrounding cells via chemical signals and play important roles in brain homeostasis, including providing physical support, nutrients and oxygen to neurons, insulating neurons from each other, destruction of pathogens and removal of dead cells. Glial cells of the CNS are immune cells, and include macroglia (such as astrocytes, oligodendrocytes, ependymal cells, radial and enteric glial cells, Schwann cells and satellite cells) and microglia.

The term "cancer" as used herein includes the meaning of: abnormal cell growth absent the proper signals; continuous growth and division even given contrary signals; avoidance of programmed cell death; a limitless number of cell divisions; promotion of blood vessel construction (angiogenesis); and the invasion of tissue and formation of metastases (Hanahan & Weinberg (2000)). Accordingly, it will be appreciated that the term "brain cancer" relates to one or more cell within the brain that displays the foregoing hallmarks.

The above cancer-associated processes may be controlled by oncoproteins and/or tumor suppressor proteins, which are expressed by oncogenes and tumor suppressor genes, respectively. An oncogene may arise from a relatively small modification of a proto-oncogene, which typically encodes a protein that is involved in the regulation of one or more of cell growth, differentiation and/or signal transduction. Modifications include, for example, one or more mutations within the proto-oncogene and/or a regulatory region (such as a promoter), giving rise to an increase in enzyme activity and/or loss of regulation.

Additionally or alternatively, a proto-oncogene may become an oncogene through an increase in protein expression (e.g. through misregulation), an increase in mRNA stability, and/or one or more gene duplication events. Tumor suppressor genes act to ensure stability of the genome via DNA repair mechanisms, regulate cell growth by inhibiting cell cycle progression and/or induce cell death via apoptosis. Thus, modifications to tumor suppressor genes that result in their decreased activity and/or expression may dysregulate these processes, and give rise to cancer. It will be appreciated that modifications to protooncogenes or tumor suppressor genes may occur in isolation or in combination.

Accordingly, in an embodiment, the brain cancer is caused by one or more mutations in a proto-oncogene and/or tumor suppressor gene. In a further embodiment, the brain cancer is caused by over-expression of one or more proto-oncogene and/or the under-expression of one or more tumor suppressor gene. In yet a further embodiment, the brain cancer is caused by a gain-of-function modification to a proto-oncogene and/or a loss-of-function modification to a tumor suppressor gene. It will be appreciated that the genes mentioned above, such as those encoding IDH1, I DH2, MGMT, ATRX and p53, are examples of proto-oncogenes or tumor suppressor genes, depending on the action of the resulting protein(s).

By "treating" or "treatment" we include administering therapy to reverse, reduce, alleviate, arrest or cure the symptoms, clinical signs, and/or underlying pathology of a specific disorder, disease, injury or condition in a manner to improve or stabilise a subject's disease. We also include the meaning of palliative use. Thus, treatment refers to administration of the inhibitor to a patient in need thereof, with the expectation that they will obtain a therapeutic benefit.

"Treating" or "treatment" of brain cancer includes one or more of a stabilisation or decrease in tumor mass, a reduction in the symptoms of the tumor, or the prevention of secondary tumor formation, prior to, or following, resection of the primary tumor. In the context of the present invention, the effect of treatment may include a reduction in the incidence of one or more of headaches, nausea, emesis, numbness, weakness, difficulty with balance, personality changes, visual problems including blurred vision, double vision or loss of peripheral vision, confusion, seizures, speech difficulties, and/or memory loss. As such, a therapeutic benefit can be achieved without curing a particular disease or condition, but rather, preferably encompasses a result which includes one or more of alleviation of the disease or condition, reduction of a symptom associated with the disease or condition, elimination of the disease or condition, prevention or alleviation of a secondary disease or condition resulting from the occurrence of a primary disease or condition and/or prevention of the disease or condition. A therapeutic benefit can be assessed by one of ordinary skill in the art and/or by a trained clinician who is treating the subject.

By "a subject" we include the meaning of a patient, or individual in need of treatment for a brain cancer as described herein.

The subject may be a mammal, such as a vertebrate mammal and/or a non-human mammal. In an embodiment, the subject is a mammal selected from the group comprising: a primate (e.g. a human; a monkey; an ape); a rodent (e.g. a mouse, a rat, a hamster, a guinea pig, a gerbil, a rabbit); a canine (e.g. a dog); a feline (e.g. a cat); an equine (e.g. a horse); a bovine (e.g. a cow); and/or a porcine (e.g. a pig). Preferably the subject is a human.

In an embodiment, the inhibitor is administered in a therapeutically effective amount to the subject having or suspected of having, a brain cancer.

The inhibitor may be administered by any method known to those in the art suitable for delivery to the brain, such as nanoparticle delivery mechanisms described in Kreuter & Jorg (2001), Masserini (2013), Min et a/. (2020) and Wohlfart et al. (2012), viral delivery mechanisms described in Maes et al. (2019), Perez-Martinez et a/. (2012) and Gray et al. (2010), exosome delivery mechanisms described in Haqqani et a/. (2013) and Yang et al. (2017), non-invasive techniques to enhance brain drug uptake such as those described in Zhang et a/. (2017), Sheikov et a/. (2008) and Park et a/. (2017), and/or by injection, including intravenous injection and intratumoral injection. It will also be appreciated that the present invention includes a cell therapy. For example, myeloid cells may be removed from a subject and modified ex vivo (e.g. by repression of the normal function of DNMT3A), before being reintroduced to the, or a different, subject. A cell therapy may be administered by any suitable method known in the art, such as by injection, including intratumoral injection.

"Therapeutically effective amount" refers to an amount that can provide therapeutic or palliative relief to a subject, including a human, having or suspected of having a brain cancer. It will be appreciated that the therapeutically effective amount of the inhibitor will be an amount that is capable of inhibiting the expression and/or biological activity of DNMT3A in a subject.

The term "having or suspected of having" indicates that the subject has been determined to have developed, or is suspected of having developed, a brain cancer as herein defined.

For example, a subject may have a personal/family history which leads to a predisposition to brain cancer -for example, exposure to ionising radiation (such as from previous treatments to the brain or head with ionising radiation) and/or a family medical history of occurrences of a particular disease (such as Li-Fraumeni syndrome, neurofibromatosis, nevoid basal cell carcinoma syndrome, tuberous sclerosis, Turcot syndrome or von HippelLindau disease), which may be a contributory factor in the development of a brain cancer as defined herein. A subject may have had such a susceptibility determined by aspects of the invention described herein.

In an embodiment, the invention provides an inhibitor for use according to the aspects of the invention, wherein the inhibitor of DNMT3A comprises: a small molecule compound (such as a small synthetic organic molecule); an antibody; a polypepfide; a polynucleofide (such as an inhibitory RNA, an miRNA, an shRNA and/or an siRNA); an antisense oligonucleotide.

In an embodiment, the inhibitor comprises a small molecule, including but not limited to small synthetic organic molecules which can directly bind to the DNMT3A gene, mRNA and/or protein. Such compounds are typically less than 800 Daltons (Da) and possess advantageous properties such as good solubility, bioavailability, and/or favourable pharmacokinetic and pharmacodynamic properties. A small molecule inhibitor can be designed to target DNMT3A at one of at least four different stages: by preventing or inhibiting primary RNA transcription, by preventing or inhibiting RNA processing prior to translation (e.g. during splicing), by preventing or inhibiting mRNA translation, and/or by preventing or inhibiting one or more function of the DNMT3A protein.

The term "small molecule" includes small organic molecules, drugs, prodrugs and/or compounds. Suitable small molecules may be identified by methods such as: screening large libraries of compounds (Beck-Sickinger & Weber (2001)); by structure-activity relationship by nuclear magnetic resonance (Shuker et a/. (1996); encoded self-assembling chemical libraries (Melkko et a/. (2004)); DNA-templated chemistry (Gartner et al. (2004)); dynamic combinatorial chemistry (Ramstrom & Lehn (2002)); tethering (Arkin & Wells (2004)); and speed screen (Muckenschnabel etal. (2004)). Typically, small organic molecules will have a dissociation constant for the polypepfide in the nanomolar range, particularly for antigens with cavities. The benefits of most small organic molecule binders include their ease of manufacture, lack of immunogenicity, tissue distribution properties, chemical modification strategies and/or oral bioavailability. Small molecules with molecular weights of less than 5 kilodaltons (kDa) are preferred, for example less than 4, 3, 2, or 1 kDa, or less than.5 kDa.

By small molecule, we also include prodrugs thereof. For example, the inhibitor may be administered as a prodrug which is metabolised or otherwise converted into its active form once inside the body of a subject. The term "prodrug" as used herein refers to a precursor or derivative form of a pharmaceutically active substance that is less active compared to the parent drug and is capable of being enzymatically activated or converted into the more active parent form (see, for example, W!man (1986) and Stella & Himmelstein (1985)). As such, the less-active prodrug may be less cytotoxic than the parent form and it will be appreciated that this may help to decrease off-target toxicity by, for example, the target cell having the required means of converting the prodrug to the parent drug to a greater extent than other, non-target cells. The enzymatic activation of prodrugs may result in a large number of drug molecules generated per conjugate precursor molecule which can then diffuse to, for example tumor regions, previously accessible to the conjugated prodrug. Accordingly, not all target cells in a given population need to bind to the prodrug in order to be affected by the parent drug.

As used herein the term "antibody" refers to an immunoglobulin and any antigen-binding portion of an immunoglobulin, e.g., IgG, IgD, IgA, IgM and IgE, or a polypeptide that contains an antigen binding site, which specifically binds to or interacts with, an immunogen, antigen, substrate, and the like. Antibodies can comprise at least one heavy (H) chain and at least one light (L) chain inter-connected by at least one disulphide bond. The term "VH" refers to a heavy chain variable region of an antibody. The term "W" refers to a light chain variable region of an antibody. In some embodiments, the term 'antibody' specifically covers monoclonal and polyclonal antibodies.

A "monoclonal antibody" refers to an antibody obtained from a population of substantially homogenous antibodies, produced by a single clone of hybridoma cells. The individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Nevertheless, the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method previously described by KOhler & Milstein (1975) or may be made by recombinant DNA methods (U.S. Pat. No. 4,816,567). The monoclonal antibodies may also be isolated from phage antibody libraries using the techniques described in Clackson et a/. (1991) and Marks et al. (1991).

A "polyclonal antibody" refers to an antibody which has been derived from the sera of animals immunised with an antigen or antigens. As used herein, the term polyclonal antibody means a preparation of antibodies derived from at least two different antibody-producing cell lines. The use of this term includes preparations of at least two antibodies that contain antibodies that specifically bind to different epitopes or regions of an antigen.

As used herein, the term "epitope" means a protein determinant capable of specific binding to an antibody. Epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three-dimensional structural characteristics, as well as specific charge characteristics.

Conformational and non-conformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents. Typically, an epitope will be a determinant region from a target, which can be recognised by one or more targeting domains.

The term "amino acid" includes naturally-occurring amino acids, L-amino acids, D-amino acids, and synthetic amino acids, as well as amino acid analogues and amino acid mimetics that function in a manner similar to the naturally-occurring amino acids. Naturally-occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, y-carboxyglutamate, and 0-phosphoserine. "Amino acid analogues" refers to compounds that have the same basic chemical structure as a naturally-occurring amino acid, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally-occurring amino acid. Amino acids can be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the I UPAC-I UB Biochemical Nomenclature Commission.

In a further embodiment, the invention provides an inhibitor for use, or a use, or a method according to the first, second or third aspects of the invention, wherein the inhibitor of DNMT3A comprises a polynucleotide.

In yet a further embodiment, the invention provides an inhibitor for use, or a use, or a method according to the first, second or third aspects of the invention, wherein the inhibitor of DNMT3A comprises an antisense oligonucleotide. In a preferred embodiment, the antisense oligonucleotide is partially, substantially or completely identical to any one of SEQ ID NOs: 3-10 (Table 2). In an alternative embodiment, the antisense oligonucleotide is partially, substantially or completely identical to any one of SEQ ID NOs: 11-14 (Table 3).

Table 2. Exemplary siRNA and shRNA sequences targeting human DNMT3A siRNA sequences 5'-.3' Manufacturer SEQ ID NO: GCAUUCAGGUGGACCGCUA Dharmacon 3 (L-006672-01) GCACUGAAAUGGAAAGGGU 4 CUCAGGCGCCUCAGAGCUA 5 GGGACUUGGAGAAGCGGAG 6 shRNA sequences 5'-3' Manufacturer SEQ ID NO: CCGGCCCAAGGTCAAGGAGAT Sig ma Aldrich 7

TATTCTCGAGAATAATCTCCTT

GACCTTGGGTTTTTG

CCGGCCGGCTCTTCTTTGAGT 8

TCTACTCGAGTAGAACTCAAAG

AAGAGCCGGTTTTTG

CCGGCCACCAGAAGAAGAGAA 9

GAATCTCGAGATTCTTCTCTTC

TTCTGGTGGTTTTTG

CCGGGCCTCAGAGCTATTACC 10

CAATCTCGAGATTGGGTAATA

GCTCTGAGGCTTTTTG

Table 3. Exemplary siRNA sequences targeting mouse DNMT3A siRNA sequences 5'-.3' Manufacturer SEQ ID NO: CCGUGAUGAUUGACGCCAA Dharma con 11 (L-065433) GGUCCUAGGAGGCGAACUU 12 CCGCAAAGCCAUCUACGAA 13 CCAAAGCAGCCGACGAU GA 14 By an "oligonucleotide", used interchangeably with "nucleic acid", "nucleic acid sequence," "nucleic acid molecule," and "polynucleofide", we include a DNA molecule or analogue thereof, or an RNA molecule or analogue thereof. Nucleic acids are formed from nucleotides. By "nucleotide" we include a glycosamine comprising a nucleobase and a sugar having a phosphate group covalently linked to the sugar. Nucleotides may be modified with any of a variety of substituents.

In some embodiments, the oligonucleotide is modified, for example, to further stabilise against nucleolytic degradation. Exemplary modifications include a nucleotide base or modification of a sugar moiety. The oligonucleotide can include modified linker agent such as a phosphorothioate in at least the first, second, or third internucleofide linkage at the 5' or 3' terminus of the nucleotide sequence. In one embodiment, the oligonucleotide includes a 2-modified nucleotide, e.g., a Z-deoxy, 2'-deoxy-2'-fluoro, 21-0-methyl, 21-0-methoxyethyl (21-0-M0E), 21-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2-0-dimethylaminopropyl (2'-0-DMAP), 7-0-dimethylaminoethyloxyethyl (T-0-DMAEOE), or 2'-0-N-methylacetamido (2'-0-NMA). In a particularly preferred embodiment, the oligonucleotide includes at least one 21-0-methyl-modified nucleotide, and in some embodiments, all of the nucleotides of the oligonucleotide include a 2-0-methyl modification. In some embodiments, the sugar moiety of the nucleic acid can be replaced, for example, with a non-sugar moiety such as a PNA. Teachings regarding the synthesis of particular modified oligonucleotides may be found in, for example Beaucage (2005) and Wen et a/. (2015).

In an embodiment, the oligonucleotide may be an aptamer. Aptamers may be considered chemical antibodies having the properties of nucleotide-based therapies. Aptamers are small oligonucleotides that bind specifically to molecular targets such as proteins. Unlike oligonucleotide therapeutics that act by hybridising to another nucleic acid target, aptamers form three-dimensional shapes that allow for specific binding to enzymes, growth factors, receptors, viral proteins, and immunoglobulins. An oligonucleotide aptamer generally includes a primary nucleotide sequence that allows the aptamer to form a secondary structure (e.g., by forming stem loop structures) that allows the aptamer to bind to its target.

In the context of the present invention, aptamers can include DNA, RNA, oligonucleotide analogues (e.g., peptide nucleic acids), locked nucleic acids, chemically modified nucleic acids, or combinations thereof Aptamers can be designed for a given ligand by various procedures known in the art. Aptamers can also be used to deliver the inhibitor of the invention (Zhou & Rossi (2010)).

Preferably, the inhibitor is a nucleic acid molecule selected from the group comprising: an antisense oligonucleotide and an inhibitory RNA molecule.

By "RNA", we include the meaning of a polymeric ribonucleotide molecule comprising a hydroxyl group at the 2' position of a p-D-ribofuranose moiety. The terms encompass double stranded RNA, single stranded RNA, RNAs with both double stranded and single stranded regions, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as altered RNA, or analogue RNA that differs from naturally occurring RNA by the addition, deletion, substitution, and/or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of an siRNA or internally, for example at one or more nucleotides of the RNA. Nucleotides in the RNA molecules of the inhibitor of the invention can also comprise non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesised nucleotides or deoxynucleotides. These altered RNAs may be referred to as analogues or analogues of a naturally occurring RNA.

Examples of antisense oligonucleotides include, but are not limited to, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a synthetic peptide nucleic acids (PNA), a LNA/DNA copolymer, and a gapmeR.

Inhibition of DNMT3A expression and/or biological function may be achieved by administering antisense oligonucleotides targeting the DNMT3A mRNA sequence. An antisense oligonucleotide acts through the formation of a mRNA-antisense oligonucleotide duplex through Watson-Crick interactions, leading to inactivation of the mRNA either through inhibition of splicing or translation, or through degradation via recruitment of a ribonuclease, such as RNase H. An antisense oligonucleotide with higher affinity to DNMT3A mRNA may prevent the functional effect of DNMT3A, for example by decreasing or preventing translation of the DNMT3A protein.

In many eukaryotes, the RNA-induced silencing complex, or RISC, is a multiprotein complex which incorporates a single-stranded RNA fragment (such as a microRNA; miRNA), or one strand of a double-stranded siRNA, which is complementary to a target mRNA. Once recognised by RISC, the target mRNA is cleaved in a sequence-specific process known as RNA interference (RNAi), leading to degradation of the target mRNA, thereby preventing its translation. Accordingly, by siRNA we include the meaning of long double-stranded RNA (dsRNA) or short duplexes of approximately 21 base pairs, amenable to processing by the endonuclease "Dicer" into the RISC. Upon introduction into a target cell, both long dsRNA and short duplex RNA form a complex with Dicer, also known as "helicase with RNase motif', which, as a member of the RNase III family, cleaves dsRNA and short duplex RNA into short siRNA with characteristic two-nucleotide 3' overhangs. These cleaved products are incorporated into RISC, which is typically composed of the polypeptides Argonaute-2 (Ago-2), Dicer and TAR-RNA-binding protein (TRBP). The siRNA duplex is separated, and the strand with the lowest duplex stability at the 5' terminus is selected for stable incorporation into the RISC. In contrast, shRNA precursors are synthesised in the nucleus, and form hairpin structures that consist of a stem region of paired sense and antisense strands, connected by an unpaired region of nucleotides known as a "loop". These shRNA precursors are processed by "Drosha" and its double-stranded binding partner DGCR8, resulting in pre-shRNA which may subsequently be processed by Dicer (resulting in the loss of the loop region) and incorporated into the RISC. Once loaded onto the RISC, the siRNA-or shRNA-derived nucleotides bind to the target mRNA in a sequence-specific manner mediated by complementary base pairing, leading to cleavage of the target mRNA via the RNase H-like activity of Ago-2 Methods of producing antisense oligonucleotides are well-known in the art and can be readily adapted to produce an antisense oligonucleofide that targets any polynucleotide sequence, see for example Lima etal. (2018). The selection of antisense oligonucleotide sequences specific for a given target sequence (e.g. DNMT3A) is based upon analysis of the chosen target sequence and determination of secondary structure, T., binding energy, and/or relative stability. Antisense oligonucleotides may be selected based upon their relative inability to form dimers, hairpins, or other secondary structures that would reduce or prohibit specific binding to the target mRNA in a host cell. Highly preferred target regions of the mRNA include those regions at or near the AUG translation initiation codon and those sequences that are substantially complementary to 5' regions of the mRNA. These secondary structure analyses and target site selection considerations can be performed, for example, using v.4 of the OLIGO primer analysis software (Molecular Biology Insights) and/or the BLASTN 2.0.5 algorithm software (Altschul etal. (1997)).

Accordingly, in a preferred embodiment, the inhibitor is an antagonistic antisense oligonucleofide. The antisense oligonucleotides may comprise ribonucleofides or deoxyribonucleotides. In some embodiments, the antisense molecule could be a single or a double stranded sequence. It will be appreciated that single-stranded antisense oligonucleotides can be applied to intercept and degrade mature mRNAs, for example that of DNMT3A.

Both cholesterol conjugation and modification of the phosphate backbone with phosphorothioate (PS) linkages have been utilised to enhance in vivo delivery of antisense oligonucleotides. The 3' cholesterol-conjugated, 2.-0-Me-modified antagomirs have become a well-validated experimental tool for in vivo inhibition of miRNAs (van Rooij & Kauppinen (2014)).

Preferably, the antisense oligonucleotides have at least one chemical modification.

Standard chemical modifications are known to the skilled person and include 2'-0-methyl or methoxyethyl nucleotides, 2'-F nucleotides and phosphorothioate backbone modified oligonucleotides.

Exemplary modifications to antisense oligonucleotides include a nucleotide base or modification of a sugar moiety. Antisense oligonucleotides may be comprised of one or more "locked nucleic acids". A locked nucleic acid (LNA), also termed "inaccessible RNA", is a modified RNA nucleotide. ribose moiety of an LNA nucleotide is modified with an extra bridge connecting the 2' and 4' carbons. The bridge "locks" the ribose in the 3'-endo structural conformation, which is often found in the A-form of DNA or RNA. LNA nucleotides can be mixed with DNA or RNA bases in the oligonucleofide whenever desired. The locked ribose conformation enhances base stacking and backbone pre-organization significantly increasing the Tm of oligonucleotides. LNA bases may be comprised in a DNA backbone, but they can also be comprised in a backbone of LNA, 2'0-methyl RNA, 2'-methoxyethyl RNA, or 2'-fluoro RNA. These molecules may comprise either a phosphodiester or phosphorothioate backbone.

The antisense oligonucleotides may comprise peptide nucleic acids (PNAs), which contain a peptide-based backbone rather than a sugar-phosphate backbone. Peptide nucleic acids (PNA) are synthetic analogues of DNA with a repeating N-(2-aminoethyl)-glycine peptide backbone connected to purine and pyrimidine nucleobases via a linker. In some embodiments, the sugar moiety of the nucleotide can be replaced, for example, with a non-sugar moiety such as a PNA.

Other chemical modifications that the antisense oligonucleotides may contain include, but are not limited to, sugar modifications, such as 2'-0-alkyl (e.g. 21-0-methyl, 21-0-methoxyethyl), 2'-fluoro, and 4'-thio modifications, and backbone modifications, such as one or more phosphorothioate, phosphorodiamidate Morpholino oligomers (PM0s) or phosphonocarboxylate linkages. It is known in the art that a methylene bridge between the 2.-oxygen and the 4'-carbon atoms provide higher structural rigidity and increased selective affinity to the RNA counter strand. It will also be appreciated that phosphorothioate backbone modifications adequately stabilize the oligonucleotides against degradation and result in a high degree of binding to plasma proteins, which reduces rapid elimination. The antisense oligonucleotide can include a phosphorothioate in at least the first, second, or third internucleotide linkage at the 5' or 3' terminus of the nucleotide sequence (Baumann & Winkler (2014)).

Other modifications of antisense oligonucleotides to enhance stability and improve efficacy such as those described by Urban (2003), which is herein incorporated by reference in its entirety, are suitable for use in the methods of the invention. It will be appreciated that modifiers of blood-brain barrier permeability per se, such as angubindin-1, may also allow for increased delivery of an inhibitor of the invention to target myeloid immune cells of the brain. It is envisaged that an inhibitor of the invention may be administered (concurrently or sequentially) with any such a modifier.

In an embodiment, the antisense oligonucleotide is an antisense Morpholino. A Morpholino (MO), also known as a Morpholino oligomer and as a phosphorodiamidate Morpholino oligomer (PM0), is a type of oligomer molecule. Its molecular structure has subunits that are similar to DNA and RNA oligonucleotides, except that they have a backbone of methylenemorpholine rings linked through phosphorodiamidate groups. This feature still allows MOs to undergo Watson-Crick base pairing but offers significant advantages over conventional oligonucleotides. MOs do not act through an RNaseH mechanism but instead specifically binds to its selected target site to block access of cell components to that target site. This property can be exploited to block the translational start site of mRNA molecules, interfere with mRNA splicing, and block ribozyme activity.

By sterically blocking the translation initiation complex, Morpholinos can translationally reduce and/or block (La "knock down") expression of many target sequences completely enough that after waiting for existing protein to degrade, the target protein band disappears from Western blots. Morpholinos generally do not cause degradation of their RNA targets; instead, they block the biological activity of the target RNA until that RNA is degraded naturally, which releases the Morpholino. By blocking sites involved in splicing pre-mRNA, Morpholinos block mRNA splicing, thereby modifying and controlling normal splicing events. This activity can be conveniently assayed by RT-qPCR, with successful splice-modification appearing as changes in the RT-qPCR product band on an electrophorefic gel. The band might shift to a new mass or, if splice-modification triggers nonsense-mediated decay (NMD) of the transcript, the wild-type, normally spliced band will lose intensity or disappear.

In an embodiment, the antisense oligonucleotide is a gapmer. "Gapmers" utilise the intracellular enzyme RNase H, which degrades the RNA strand in an RNA-DNA heteroduplex. To prevent rapid catalysis, such antisense oligonucleotides are generally synthesised with a phosphorothioate backbone. To increase affinity and protect the oligonucleotides from exonucleases, a number of chemically modified nucleic acid analogues have been inserted at each terminus of the oligonucleotide to create what is called a gapmer. A gap with six to eight unmodified DNA nucleotides in the middle mediates efficient induction of RNase H degradation. Very few base modifications are allowed within this DNA gap, in order not to disturb the catalysis. Thus, it will be appreciated that in some embodiments, a suitable antisense molecule is a "gapmer". In a further embodiment, the gapmer is a 2'O-methoxyethyl gapmer which contains 2-0-methoxyethyl-modified ribonucleotides on both 5' and 3' termini with at least ten deoxyribonucleofides in the centre.

Preferably, the antisense oligonucleotide comprises a nucleotide sequence which is complementary to at least part of a nucleotide sequence present in SEQ ID NO: 1.

Antisense oligonucleotides may comprise a nucleotide sequence that is partially, substantially or completely complementary to a target mRNA sequence. By "target mRNA sequence", we include the meaning of a pre-mRNA (Le. an mRNA which has not been spliced and/or processed into a mature mRNA) and a mature mRNA (Le. an mRNA that has been spliced and/or processed from a pre-mRNA). In one embodiment, an inhibitor of the invention is an antisense oligonucleotide comprising a sequence that is partially complementary to DNMT3A mRNA of SEQ ID NO: 1. In one embodiment, an inhibitor of the invention is an antisense oligonucleotide having a sequence that is substantially complementary to a mature mRNA sequence of DNMT3A.

In certain embodiments, an antisense oligonucleotide and a target mRNA are complementary to one another. In certain such embodiments, an antisense compound is perfectly complementary to a target mRNA. In certain embodiments, an antisense compound includes one mismatch. In certain embodiments, an antisense compound includes two mismatches. In certain embodiments, an antisense compound includes three or more mismatches.

As used herein, "complementary" and "complementarity" are interchangeable and refer to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands or regions. Complementary polynucleotide strands or regions can base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G). "Perfect" or "complete" complementarity, or 100% complementarity refers to the situation in which each nucleotide of one polynucleotide strand or region can hydrogen bond with each nucleotide of a second polynucleotide strand or region. Less than perfect complementarity refers to the situation in which some, but not all, nucleotides of two strands or two regions can hydrogen bond with each other.

"Partially complementary" refers to a sequence that is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% complementary to a target mRNA sequence.

"Substantially complementary" refers to a sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary to a target mRNA sequence. Also included is a sequence with 100% complementarity to the target mRNA sequence. We include that if two sequences are substantially complementary a duplex can be formed between them. The duplex may have one or more mismatches, but the region of duplex formation is sufficient to down-regulate expression of the mRNA.

Methods exist for determining an appropriate number of mismatches between oligonucleotides, or between an oligonucleotide and a target nucleic acid, such as by determining melting temperature (Tm). Tm can be calculated by techniques known in the art, such as those described in Freier & Altmann (1997).

Preferably, the antisense oligonucleotide comprises a nucleotide sequence which is complementary to at least part of a nucleotide sequence present in SEQ ID NO: 1.

Antisense oligonucleotides may comprise a sequence that is at least partially 20 complementary to a mature DNMT3A mRNA sequence, for example, at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% complementary to a mature DNMT3A mRNA sequence.

In some embodiments, the antisense oligonucleotide may be substantially complementary to a mature DNMT3A mRNA sequence, that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary to a mature DNMT3A mRNA sequence. In one embodiment, the antisense oligonucleotide comprises a sequence that is 100% complementary to a mature DNMT3A mRNA sequence. In one embodiment, an inhibitor of the invention is an antisense oligonucleotide comprising a sequence that is complementary to SEQ ID NO: 1.

By "mature DNMT3A mRNA sequence" we include the strand of a fully processed mRNA, Le. one which has undergone splicing and processing, and may be translated into a polypeptide.

Preferably, the nucleotide sequence which is complementary to at least part of a nucleotide sequence present in a mature DNMT3A mRNA sequence is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length In some embodiments, the antisense oligonucleotide is from about 15 to about 50 nucleotides in length, more preferably about 18 to about 30 nucleotides in length, more preferably about 19 to about 30 nucleotides in length and most preferably about 19 to about 25 nucleotides in length. In some embodiments, the antisense oligonucleotide has a length of at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides or more. In some embodiments, the antisense oligonucleotide has a length of at least 19 nucleotides.

In certain embodiments, the antisense oligonucleotide is 8 nucleotides in length. In certain embodiments, the antisense oligonucleotide is 9 nucleotides in length. In certain embodiments, the antisense oligonucleotide is 10 nucleotides in length. In certain embodiments, the antisense oligonucleotide is 11 nucleotides in length. In certain embodiments, the antisense oligonucleotide is 12 nucleotides in length. In certain embodiments, the antisense oligonucleotide is 13 nucleotides in length. In certain embodiments, the antisense oligonucleotide is 14 nucleotides in length. In certain embodiments, the antisense oligonucleotide is 15 nucleotides in length. In certain embodiments, the antisense oligonucleotide is 16 nucleotides in length In certain embodiments, the antisense oligonucleotide is 17 nucleotides in length In certain embodiments, the antisense oligonucleotide is 18 nucleotides in length. In certain embodiments, the antisense oligonucleotide is 19 nucleotides in length. In certain embodiments, the antisense oligonucleotide is 20 nucleotides in length In an embodiment, the antisense oligonucleotide is substantially single-stranded and comprises a sequence that is substantially complementary to 19 contiguous nucleotides of a nucleotide sequence of the pre-mRNA sequence of DNMT3A or the mature mRNA sequence of DNMT3A and/or substantially complementary to 6 contiguous nucleotides in the regions at or near the AUG translation initiation codon of a nucleotide sequence of the pre-mRNA sequence of DNMT3A or the mature mRNA sequence of DNMT3A. Preferably, the antisense oligonucleotide comprises a nucleotide sequence which differs by no more than 1, 2, 3, 4 or 5 nucleotides from a DNMT3A pre-mRNA nucleotide sequence.

Preferably, the antisense oligonucleotide comprises a nucleotide sequence which differs by no more than 1, 2, 3, 4 or 5 nucleotides from a mature DNMT3A mRNA nucleotide sequence.

In an embodiment, the antisense oligonucleotide targets a sequence near the AUG translation initiation codon of, for example, SEQ ID NO: 1.

Antisense oligonucleofides, or a part thereof, may have a defined percentage identity to a target sequence disclosed herein (e.g. SEQ ID NO: 1). As used herein, a sequence is identical to the sequence disclosed herein if it has the same nucleotide pairing ability. For example, an RNA which contains uracil in place of thymidine would be considered identical as they both pair with adenine. This identity may be over the entire length of the oligomeric compound, or in a part of the antisense oligonucleotide (e.g., nucleotides 1-20 of a 27-mer may be compared to a 20-mer to determine percent identity of the oligomeric compound to the SEQ ID NO). It is understood by those skilled in the art that an antisense oligonucleotide need not have an identical sequence to those described herein in order to function similarly to an antisense oligonucleotide described herein. Accordingly, an antisense oligonucleotide may be considered partially, substantially or completely identical to a sequence disclosed herein.

"Partially identical" refers to a sequence that is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% identical to an antisense oligonucleotide sequence disclosed herein. "Substantially identical" refers to a sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to an antisense oligonucleotide sequence disclosed herein. "Completely identical" refers to a sequence with 100% identity to an antisense oligonucleotide sequence disclosed herein.

Percent identity is calculated according to the number of bases that have identical base pairing corresponding to the SEQ ID NO or antisense oligonucleotide to which it is being compared. The non-identical bases may be adjacent to each other, dispersed throughout the oligonucleotide, or both. For example, a 15-mer having the same sequence as nucleotides 3-18 of a 25-mer is 60% identical to the 25-mer. Alternatively, a 20-mer containing 15 nucleotides identical to the 25-mer is also 60% identical to the 25-mer. Such calculations are known to the skilled person. The percent sequence identity between two nucleic acid molecules may also be determined using suitable computer programs, for example the Needle (EMBOSS) alignment tool (Madeira et al. (2019)).

In a further example, a 25-nucleotide antisense oligonucleotide comprising the full sequence of the complement of a 15-nucleotide target sequence would comprise a portion of 100% identity with the complement of the 15-nucleotide target sequence, while further comprising an additional 10-nucleotide portion. In preferred embodiments, the antisense oligonucleotides provided herein are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to at least a portion of the complement of the target sequence (e.g. a DNMT3A mRNA) disclosed herein. It will be appreciated that in the latter case, the antisense oligonucleotide would be identical to at least a portion of a DNMT3A mRNA.

In certain embodiments, antisense oligonucleotides may comprise a sequence that is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% complementary to a part the sequence set out in SEQ ID NO: 1. In some embodiments, the antisense oligonucleotide may be at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary to the sequence set out in SEQ ID NO: 1. For example, the antisense oligonucleotide may comprise a sequence set out in SEQ ID NOs: 3-10 or 1114. In an embodiment, the antisense oligonucleotide comprises a sequence set out in SEQ ID NOs: 3-10. In an alternative embodiment, the antisense oligonucleotide comprises a sequence set out in SEQ ID NOs: 11-14.

It will be appreciated that antisense oligonucleotides may be administered as a pool of antisense oligonucleotides. By "pool" we include the meaning of two or more antisense oligonucleotides administered concurrently. The two or more antisense oligonucleotides may target different sequences of the DNMT3A mRNA, and/or may incorporate one or more of the chemical modifications described herein.

In an embodiment, the brain cancer comprises one or more myeloid cell having pro-tumoral activity.

By "myeloid cell", herein used interchangeably with "myeloid immune cell", we include a microglial cell, monocyte, macrophage, neutrophil, basophil, eosinophil, erythrocyte, megakaryocyte and/or platelet. In a preferred embodiment, the myeloid cell is a microglial cell or a macrophage.

By "pro-tumoral activity", we include the meaning of a tumor-supporting phenotype. For example, pro-tumoral activity may include any biological function which supports one or more of abnormal cell growth absent the proper signals; continuous growth and division even given contrary signals; avoidance of programmed cell death; a limitless number of cell divisions; promotion of blood vessel construction (angiogenesis); the invasion of tissue and formation of metastases; cancer cell mobility and migration; and/or resistance to treatment. It will be appreciated that the pro-tumoral phenotype may be brought about by initiating and maintaining inflammation within the brain, which may be mediated by secretion of factors, including proteins, by cells. Secreted factors which may be considered pro-tumoral include, but are not limited to, interleukin (IL)-113, IL-4, IL-6, colony stimulating factor (CSF)-1, granulocyte-macrophage CSF, interferon-y; secreted proteins include matrix metalloproteinases (MMPs). Accordingly, in an embodiment, the pro-tumoral phenotype may be characterised by unresolved inflammation and/or secretion of MM Ps.

In a further embodiment, inhibition of DNMT3A occurs preferentially in a myeloid immune cell of the brain. Preferably, the inhibitor is delivered to a myeloid immune cell of the brain.

By "delivered to a myeloid immune cell of the brain", we include the meaning that the inhibitor of DNMT3A is targeted to a myeloid immune cell of the brain as defined herein and will be active in a myeloid immune cell of the brain. Preferably, the inhibitor is selectively delivered to a myeloid immune cell of the brain. For example, if the inhibitor is selectively delivered to a myeloid immune cell of the brain, a myeloid immune cell of the brain will selectively contain the inhibitor to a greater extent than cells of a different organ, for example, the liver, or the kidney. Additionally or alternatively, the myeloid immune cell of the brain will selectively contain the inhibitor to a greater extent than non-targeted cells of the brain, such as, for example, astrocytes or neurons. Accordingly, following delivery of the inhibitor to a myeloid immune cell of the brain, DNMT3A will be inhibited in a myeloid immune cell of the brain without affecting DNMT3A expression and/or activity in cells of other organs, such as the liver, or the kidney. Additionally or alternatively, following delivery of the inhibitor to a myeloid immune cell of the brain, DNMT3A will be inhibited in the myeloid immune cell of the brain without affecting DNMT3A expression and/or activity in non-targeted cells of the brain, such as, for example, astrocytes or neurons.

Accordingly, delivery of the inhibitor may be by local delivery. By "local delivery" we include the meaning that the inhibitor is delivered directly to a target site within an organism. For example, an agent can be locally delivered by intracerebral injection.

In another embodiment, the inhibitor of the invention is delivered by intravenous or intratumoral injection, and/or orally.

In a further embodiment, the inhibitor of the invention is for use in inhibiting DNMT3A expression and/or biological activity.

Preferably, the inhibitor is able to permeate the cell containing DNMT3A, cannot be rapidly excreted or metabolised, is stable in vitro, in vivo, and ex vivo and, if the inhibitor directly interacts with DNMT3A mRNA or protein, binds to DNMT3A mRNA or protein with high specificity and affinity.

By "DNMT3A expression" we include the level, amount, concentration, and/or abundance of DNMT3A, as defined above. The term "expression" may also refer to the rate of change of the amount or concentration of DNMT3A. Expression can be represented, for example, by the amount or synthesis rate of DNMT3A mRNA or protein. The term can be used to refer to an absolute amount of a DNMT3A mRNA or protein in a sample or to a relative amount of DNMT3A mRNA or protein, including the amount or concentration determined under steady-state or non-steady-state conditions. Expression may also refer to an assay signal that correlates with the amount, concentration, or rate of change of DNMT3A mRNA or protein. The expression of DNMT3A can be determined relative to the level of DNMT3A mRNA or protein in a control sample.

A decrease of the expression level of a nucleotide sequence (or steady-state level of the encoded messenger RNA molecule, e.g. DNMT3A mRNA) is preferably a detectable decrease in the expression level of a nucleotide (or steady state level of an mRNA molecule or any detectable change in a biological activity of DNMT3A) using a method as described herein as compared to the expression level of a corresponding nucleotide sequence (or steady-state level of a corresponding encoded m RNA molecule or equivalent or source thereof) in a control, such as a healthy subject.

In an embodiment, the inhibitor may be one that selectively inhibits DNMT3A. For example, the inhibitor may be one that is capable of inhibiting and/or decreasing the expression and/or biological activity of DNMT3A to a greater extent than it inhibits a non-targeted DNA methyltransferase, such as DNMT3B or DNMT1.

Preferably, the inhibitor is capable of inhibiting and/or decreasing the expression and/or biological activity of DNMT3A at least 5, or at least 10, or at least 20, or at least 40, or at least 50 times more than it inhibits a non-targeted DNA methyltransferase, such as DNMT3B or DNMT1. More preferably, the inhibitor is capable of inhibiting or decreasing the expression and/or biological activity of DNMT3A at least 100, or at least 1,000, or at least 10,000 times more than it inhibits a non-targeted DNA methyltransferase such as DNMT3A or DNMT1.

Preferably, a decrease of the expression of DNMT3A in a myeloid immune cell of the brain includes a decrease of at least 10% of the expression of DNMT3A in a myeloid immune cell of the brain compared to the expression of DNMT3A in a myeloid immune cell of the brain in the absence of an inhibitor of the invention. More preferably, a decrease of the expression of DNMT3A in a myeloid immune cell of the brain means a decrease of at least 15%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% compared to the expression of DNMT3A in a myeloid immune cell of the brain in the absence of an inhibitor. In this latter case, it will be understood that there is no detectable expression of DNMT3A in a myeloid immune cell of the brain.

In an embodiment, an inhibitor of the invention decreases the expression of DNMT3A in a myeloid immune cell of the brain by at least 2-, or at least 5-, or at least 10-, or at least 50-fold compared to the expression of DNMT3A in a myeloid immune cell of the brain in the absence of the inhibitor. More preferably, the inhibitor decreases the expression of DNMT3A in a myeloid immune cell of the brain by at least 100-fold, or at least 1,000-fold, or at least 10,000-fold compared to the expression of DNMT3A in a myeloid immune cell of the brain in the absence of the inhibitor.

By "decreases the expression of DNMT3A", we also include the meaning that DNMT3A is degraded within the myeloid immune cell of the brain by virtue of its inhibition. The amount of DNMT3A may be decreased when in the presence of an inhibitor of the invention compared to the amount of DNMT3A when in the absence of an inhibitor of the invention.

For example, in the presence of an inhibitor of the invention, the amount of DNMT3A may be decreased by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% compared to the amount of DNMT3A in the absence of the molecule of the invention. In the latter case, it will be appreciated that there is no detectable DNMT3A in the myeloid immune cell of the brain. Similarly, it will be appreciated that when a myeloid immune cell of the brain contains an inhibitor of the invention, the inhibitor of the invention may decrease the amount of DNMT3A in the myeloid immune cell of the brain, for example, by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% compared to the level of DNMT3A in the myeloid immune cell of the brain in the absence of an inhibitor of the invention. Preferably the amount of DNMT3A is decreased to an undetectable level. In an embodiment, an inhibitor of the invention results in the degradation of 30-100% of the amount of DNMT3A in the absence of an inhibitor of the invention, such as 40-100%, 50-100%, 60-100%, 70-100%, 80-100%, 90-100%, 95-100%, or 99-100%. It is understood that DNMT3A may be degraded in the absence of an inhibitor of the invention at a background level, for example as part of normal protein turnover. In this case, an inhibitor of the invention may act to cause degradation of DNMT3A to a greater extent than the background degradation rate.

The extent of degradation can be assessed by measuring the level of DNMT3A in a myeloid immune cell of the brain that contains an inhibitor of the invention and measuring the level of DNMT3A in a myeloid immune cell of the brain that is otherwise substantially the same but does not contain an inhibitor of the invention. By "substantially the same", we include the meaning that the myeloid immune cell is of the same type (e.g. expresses substantially the same cell surface markers), and/or are from the same tissue, and/or are in the same stage of the cell cycle. Alternatively, one may measure the starting amount of DNMT3A in a myeloid immune cell of the brain in the absence of an inhibitor of the invention, and subsequently measure the amount of DNMT3A following addition of an inhibitor of the invention. As yet another alternative, the amount of DNMT3A in a myeloid immune cell of the brain in which an inhibitor of the invention is present may also be compared to a negative control.

By "negative control" we include the meaning of a myeloid immune cell of the brain in which an inactive version of an inhibitor of the invention is present, for example a scrambled anfisense oligonucleotide. The skilled person is aware that such negative control scrambled oligonucleotides may be prepared by "scrambling" or changing the order in which the nucleotides of an antisense oligonucleotide of the invention are found, ensuring that the scrambled oligonucleotide is not complementary, or is largely uncomplimentary, to the target (Le. DNMT3A), and to other non-targeted mRNAs. Methods of determining complementarity are described herein. Again, it is preferred that the negative control myeloid immune cell of the brain is substantially the same as the myeloid immune cell of the brain containing an inhibitor of the invention. Alternatively, a negative control may comprise the vehicle in which an inhibitor of the invention would typically be dissolved and/or diluted, except that the inhibitor is absent. It will be appreciated, therefore, that references to at least 10%, 20%, or 30% etc. degradation compared to the amount of DNMT3A in the absence of an inhibitor of the invention includes the meaning of compared to the amount of DNMT3A in a myeloid immune cell of the brain that is otherwise substantially the same but which does not contain an inhibitor of the invention, or compared to the amount of DNMT3A in a myeloid immune cell of the brain prior to the addition of an inhibitor of the invention, or compared to the amount of DNMT3A in a cell containing an inactive version of an inhibitor of the invention, or compared to the amount of DNMT3A in a cell containing the vehicle but absent an inhibitor of the invention.

By "biological activity of DNMT3A" we include one or more biological activity and/or biological action of DNMT3A, and this refers to any function(s) exhibited or performed by a naturally occurring, and/or wild type form of DNMT3A, for example, as measured or observed in vivo (Le. in the natural physiological environment of the protein) or in vitro (i.e. under laboratory conditions).

In an embodiment, the inhibitor may decrease the biological activity of DNMT3A in a myeloid immune cell of the brain by at least 2-, or at least 5-, or at least 10-, or at least 50-fold compared to the biological activity of DNMT3A in the absence of an inhibitor. More preferably, the inhibitor decreases the biological activity of DNMT3A in a myeloid immune cell of the brain by at least 100-fold, or at least 1,000-fold, or at least 10,000-fold compared to the biological activity of DNMT3A in a myeloid immune cell of the brain in the absence of an inhibitor. As noted above, references to a 10-fold, 20-fold, or 30-fold etc decrease in biological activity of DNMT3A includes the meaning of compared to the biological activity of DNMT3A in a myeloid immune cell of the brain that is substantially the same but which does not contain an inhibitor of the invention, or compared to the biological activity of DNMT3A in a myeloid immune cell of the brain prior to addition of an inhibitor of the invention, or compared to the biological activity of DNMT3A in a cell containing an inactive version of an inhibitor of the invention.

In a further embodiment, the inhibitor of DNMT3A reduces and/or inhibits the pro-tumoral activity of the one or more myeloid cell.

Accordingly, it will be appreciated that the inhibitor of DNMT3A prevents, inhibits, or reduces any biological activity associated with the myeloid cell which promotes cancer, as defined herein.

In yet a further embodiment, the inhibitor of DNMT3A increases and/or induces anti-tumoral activity of the one or more myeloid cell.

By "anti-tumoral activity", we include the meaning of a phenotype contrary to a tumor-supporting phenotype. For example, anti-tumoral activity may include any biological function which prevents, decreases, inhibits and/or counters: abnormal cell growth absent the proper signals and/or tumor growth; continuous growth and division even given contrary signals; avoidance of programmed cell death; a limitless number of cell divisions; promotion of blood vessel construction (angiogenesis); and/or the invasion of tissue and formation of metastases.

In a further embodiment, the invention provides an inhibitor for use, or a use, or a method wherein the expression and/or biological activity of DNMT3A is decreased by at least 10%, or at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95%, or at least 99%, or 100%.

Assessing the degradation, expression, and/or biological activity of DNMT3A in the presence and absence of an inhibitor of the invention can be performed using techniques well-known in the art. For example, assessing the level of expression of protein is standard practice in the art and any suitable method may be used. For example, immunoassays such as enzyme-linked immunosorbent assay (ELISA) or radio-immunoassay, immunofluorescence, high-performance liquid chromatography (H PLC), gel electrophoresis and capillary electrophoresis (followed by, for example, ultraviolet or fluorescent detection), may be used to detect and quantify DNMT3A. Methods of measuring levels of a target by mass spectrometry are also well-known in the art, and any suitable form of mass spectrometry may be used. Western blotting, immunoprecipitation, immunohistochemistry (INC) on paraffin, immunofluorescence, fluorescence in situ hybridisation (FISH) and flow cytometry may also be used. The assessment of the expression level of or the presence of DNMT3A mRNA is preferably performed using a suitable assay such as real time (RT) quantitative polymerase chain reaction (PCR; RTqPCR), microarrays, bead arrays, FISH and/or northern blot analysis. The assessment of DNMT3A activity may be performed using a specific assay for DNMT3A activity.

In an embodiment, a preferred assay for DNMT3A degradation and/or expression is western blotting. Western blotting methods are well-known in the art. In yet a further embodiment, a preferred assay for DNMT3A biological activity is a DNA methylation assay.

DNA methylation assays are well-known in the art.

In an embodiment, the inhibitor is one that binds to DNMT3A mRNA in order to inhibit the biological activity of DNMT3A. More preferably the inhibitor is one that selectively binds to DNMT3A mRNA.

By an inhibitor that "selectively binds" to DNMT3A mRNA, we include the meaning that the inhibitor binds to DNMT3A mRNA with a greater affinity than to an unrelated mRNA such as MGMT. Preferably, the inhibitor binds to DNMT3A mRNA with at least 5, or at least 10 or at least 50 times greater affinity than to the unrelated mRNA. More preferably, the inhibitor binds to DNMT3A mRNA with at least 100, or at least 1,000, or at least 10,000 times greater affinity than to an unrelated mRNA. Such binding may be determined by methods well known in the art, including FISH, RNA fluorescence in vivo hybridization (FIVH), surface plasmon resonance (SPR), electrophoretic mobility shift assay (EMSA) and cross-linking, ligation, and sequencing of hybrids (CLASH).

It will be appreciated that inhibition of DNMT3A which follows binding of the inhibitor to DNMT3A may be termed "direct inhibition". An example for a direct inhibition is the interaction of an mRNA molecule with an antisense oligonucleotide (La with an RNA that has a reverse-complementary sequence to the DNMT3A mRNA molecule), thereby forming a duplex, which leads to the degradation of the mRNA molecule.

In an embodiment, the inhibitor does not bind to DNMT3A in order to inhibit the biological activity of DNMT3A. It will be appreciated that this may be termed "indirect inhibition". An example of indirect inhibition is the inhibition of a protein that is involved in the transcription and/or processing of the DNMT3A mRNA molecule, leading to a decrease in its expression. Alternatively, indirect inhibition may involve an inhibitor of the molecule binding to an intermediary that is involved in degrading or otherwise downregulating the expression and/or biological activity of DNMT3A.

In a further embodiment, the one or more myeloid cell of the brain comprises one or more microglial cell and/or one or more macrophage.

In an embodiment, the brain cancer comprises: a brain tumor; high grade glioma; glioblastoma; or a tumor of the central nervous system.

In an embodiment, the inhibitor of the invention is administered to the subject intratumorally, intracerebrally, intravenously and/or orally.

In an embodiment, the inhibitor of DNMT3A is co-administered with a further agent. In a preferred embodiment, the further agent is a chemotherapeutic agent (such as temozolomide), an immunotherapy and/or irradiation.

In an embodiment, the inhibitor of DNMT3A is administered ex vivo to one or more myeloid cell from the subject.

In a further embodiment, the inhibitor is delivered to cells of the brain using any of: (a) a physical method, such as parenteral administration, direct injection or electroporation; and/or (b) a delivery vehicle such as a glucan-containing particle, a lipid containing vehicle, a viral containing vehicle, a polymer containing vehicle, a peptide containing vehicle, a nanoparticle, a microvesicle or an exosome.

In a fourth aspect, the invention provides an inhibitor of DNMT3A wherein the inhibitor is an antisense oligonucleotide with a sequence partially, substantially or completely complementary to SEQ ID NO: 1.

In a fifth aspect, the invention provides an inhibitor of DNMT3A for use in medicine.

In a sixth aspect, the invention provides a pharmaceutical composition comprising an effective amount of an inhibitor of DNMT3A, and a pharmaceutically acceptable excipient, diluent or carrier.

Preferably in relation to the aspects of the invention, the inhibitor of DNMT3A is as defined herein.

By "carrier, we include the meaning of any solvent, dispersion medium, vehicle, coating, diluent, antibacterial, and/or antifungal agent, isotonic agent, absorption delaying agent, buffer, carrier solution, suspension, colloid, and the like. The use of such media and/or agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional medium or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions. Typically, the carriers will be water or saline which will be sterile and pyrogen free; however, other acceptable carriers may be used.

As used herein, "pharmaceutically acceptable" refers to a material that is not biologically or otherwise undesirable, La, the material may be administered to an individual along with a molecule of the invention without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.

Where appropriate, the formulations may be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. Such methods include the step of bringing into association the active ingredient (e.g. the inhibitor for use, or a use, or a method of the invention) with the carrier which constitutes one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

In some embodiments, the unit dosage formulations are those containing a daily dose or unit, daily sub-dose or an appropriate fraction thereof, of an active ingredient. It should be understood that in addition to the ingredients particularly mentioned above the pharmaceutical compositions of the invention may include other agents conventional in the art having regard to the type of formulation in question, for example those suitable for oral administration may include flavouring agents.

The amount of the inhibitor of the invention which is administered to the individual is an amount effective to combat the particular individual's condition. The amount may be determined by the physician.

In an embodiment, the pharmaceutical compositions or formulations of the invention are for parenteral administration, for example intravenous, intratumoral or intracerebral administration. In a further embodiment, the pharmaceutical composition or formulation is suitable for intravenous, intratumoral or intracerebral injection. Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.

In an alternative embodiment, the pharmaceutical compositions or formulations of the invention are for oral administration. Formulations in accordance with the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets, each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution or a suspension in an aqueous liquid or a non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion. The active ingredient may also be presented as a bolus, electuary or paste.

In a seventh aspect, the invention provides the in vitro use of an inhibitor of DNMT3A for reducing and/or inhibiting the pro-tumoral activity of one or more myeloid cell, and/or for increasing and/or inducing the anti-tumoral activity of one or more myeloid cell.

In an eight aspect, the invention provides an inhibitor of DNMT3A for use in reducing and/or inhibiting the pro-tumoral activity of one or more myeloid cell, and/or for increasing and/or inducing the anti-tumoral activity in one or more myeloid cell, in a subject in need thereof In a ninth aspect, the invention provides an in vitro or ex vivo method for reducing and/or inhibiting the pro-tumoral activity of one or more myeloid cell, and/or for increasing and/or inducing the anti-tumoral activity of one or more myeloid cell, the method comprising the step of contacting the one or more myeloid cell with an inhibitor of DNMT3A.

In an embodiment, the invention provides a composition comprising one or more myeloid cell obtained or obtainable by a method as defined in the ninth aspect of the invention.

In a tenth aspect, the invention provides a kit comprising a composition as defined herein.

In some embodiments, the kits comprise one or more inhibitor, formulation and/or composition as defined herein. The kit can also contain instructions for use.

In a further embodiment, in addition to comprising at least one inhibitor, formulation and/or composition as described herein, the kit can further comprise one or more necessary components. In some embodiments, an inhibitor of DNMT3A can be present in a pre-filled syringe, or pre-filled vials. A plurality of pre-filled syringes or vials, such as 10, can be present in, for example, dispensing packs. The kit can also contain instructions for administering an inhibitor, formulation or composition as described herein.

In an eleventh aspect, the invention provides an inhibitor for use, a use, or a method substantially as described herein with reference to the accompanying description, claims and/or figures.

In a twelfth aspect, the invention provides a pharmaceutical composition, or a composition, substantially as described herein with reference to the accompanying description, claims and/or figures.

In a thirteenth aspect, the invention provides a method of identifying a test agent that may be useful in treating a brain cancer in a subject, the method comprising: providing a myeloid cell comprising DNMT3A; providing a test agent; contacting the myeloid cell comprising DNMT3A with the test agent under conditions effective for the test agent to facilitate inhibition of DNMT3A; and determining whether the test agent inhibits DNMT3A, optionally wherein the method further comprises the steps of synthesising, purifying and/or formulating the test agent.

It will be appreciated that the test agent may be an inhibitor according to the first, second or third aspects of the invention. Thus, the method may be used to assess the efficacy of a candidate inhibitor of the first, second or third aspects of the invention to inhibit DNMT3A, to and thereby identify the inhibitor as one that may be useful in combating a brain cancer in a subject.

It will be appreciated that the method may be performed in vivo, ex vivo and/or in vitro. For example, the method may be carried out on a tissue or organ sample ex vivo, in a cell culture system in vitro, or on a cell, tissue or organ when residing in their natural environment in vivo.

By "conditions effective for the test agent to facilitate inhibition of DNMT3A", we include the meaning that the myeloid cell comprising DNMT3A is contacted with the test agent under conditions that allow the test agent to facilitate inhibition of the expression and/or biological activity of DNMT3A as defined herein. It is preferred that the method is carried out within a cell such that the cellular conditions are effective for the test agent to facilitate inhibition of the expression and/or biological activity of DNMT3A. However, in vitro inhibition assays are known, and so the method may be carried out in vitro.

In a preferred embodiment, the test agent is one that results in the inhibition of expression and/or biological activity of DNMT3A. It will be appreciated that in some instances, high-throughput screening of test agents is preferred, and that the method may be used as a "library screening" method, a term well-known to those skilled in the art. Thus, the test agent may be a library of test agents. Methodologies for preparing and screening such libraries are known in the art.

The invention includes screening methods to identify drugs or lead compounds for use in treating a brain cancer in a subject. It is appreciated that screening assays which are capable of high-throughput operation are particularly preferred. It is appreciated that the identification of a test agent that inhibits the expression and/or biological activity of DNMT3A may be an initial step in a drug screening pathway, and the agent may be further selected, for example, based on its efficacy in an assay of the brain cancer in question, and/or further modified. Thus, the method may further comprise the step of testing the test agent in an assay of the brain cancer in question.

The method may comprise the further step of synthesising and/or purifying the identified test agent or the modified test agent. The invention may further comprise the step of synthesising, purifying and/or formulating the identified test agent. Agents may also be subjected to other tests, for example toxicology, pharmacokinetic/pharmacodynamic and/or metabolism tests, as is well known to those skilled in the art. The invention includes the use of an inhibitor of the first, second or third aspects of the disclosure in drug target validation or in drug discovery.

In a fourteenth aspect, the invention provides a method for determining the susceptibility of a brain cancer to treatment using an inhibitor of DNMT3A, the method comprising: providing a myeloid cell from a brain cancer; contacting the myeloid cell with the inhibitor of DNMT3A as defined herein; assessing the effect of the inhibitor on the expression and/or biological activity of DNMT3A; and determining the susceptibility of the brain cancer to treatment on the basis of the assessment of the effect of the inhibitor.

By "susceptibility" we include the meaning that the provision of an inhibitor of DNMT3A to a subject with a brain cancer is sufficient to treat the brain cancer, i.e. to reverse, reduce, alleviate, arrest or cure the symptoms, clinical signs, and/or underlying pathology of the brain cancer, in such a manner as to improve or stabilise a subject. In such conditions, a brain cancer may be considered susceptible to treatment with an inhibitor of the invention.

Assessment of the effect of the inhibitor may be performed by any method known in the art. For example, mRNA levels of DNMT3A may be assessed by any appropriate method in the art, including immunoblotting, such as by northern blotting. Protein levels of DNMT3A may be also assessed by any appropriate technique, including immunoblotting, such as western blotting. The activity of DNMT3A may be assessed by any appropriate protein activity assay, such as a DNA methylation assay. It will be appreciated that an inhibitor which, for example, decreases the mRNA of DNMT3A and/or protein level of DNMT3A and/or biological activity of DNMT3A in a myeloid immune cell of the brain may be considered to render the brain cancer susceptible to treatment using that inhibitor. Conversely, an inhibitor which does not decrease, or increases one or more of DNMT3A mRNA, protein or activity, may be considered not to render the brain cancer susceptible to treatment using that inhibitor.

In the preceding description, particular embodiments may be described in isolation for clarity. Unless otherwise expressly specified that the features of a particular embodiment are incompatible with the features of another embodiment, certain embodiments can include a combination of compatible features described herein in connection with one or more embodiments.

In the preceding description and following claims, the term "and/or" means one or all of the listed elements or a combination of any two or more of the listed elements; the terms "comprises," "comprising," and variations thereof are to be construed as open ended, Le., additional elements or steps are optional and may or may not be present; unless otherwise specified, "a," "an," "the," and "at least one" are used interchangeably and mean one or more than one; and the recitations of numerical ranges by endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).

For any method herein that includes discrete steps, the steps may be conducted in any feasible order, and as appropriate, any combination of two or more steps may be conducted simultaneously.

All of the documents referred to herein are incorporated herein, in their entirety, by reference. The listing or discussion of an apparently prior-published document in this specification should not necessarily be taken as an acknowledgement that the document is part of the state of the art or is common general knowledge.

Preferred, non-limiting examples which embody certain aspects of the invention will now be described, with reference to the following Figures and Examples.

Figure 1. Nucleotide sequence of an exemplary DNMT3A mRNA. Further DNMT3A mRNA sequences are known to the skilled person, for example those referenced in Table 1 above.

Figure 2. Amino acid sequence of an exemplary DNMT3A polypeptide. Further DNMT3A polypeptide sequences are known to the skilled person, for example those referenced in Table 1 above.

Figure 3. Microglia-glioma short-term coculture induces an immune response phenotype associated with a reduction of global DNA methylation in microglia. (A) RNA-seq Clustering analysis of the top 100 most significant Gene Ontology pathways (GO) found upregulated in BV2 cocultured with C6 compare to monoculture using the weight01 algorithm. The color shows the degree of similarity and the dendrograms the clusters formed based on their similarity. As can be seen the majority of GOs are associated with the immune system and forms one well defined cluster with two major sub-clusters, were one is involved in inflammatory response/chemotaxis and the other in immune response; (B) High-throughput profiling of DNA methylation status of CpG islands was performed in BV2 cells after 6h monoculture versus 6h coculture. Average methylation levels (Beta values) in the CpG islands for each sample obtained from the IIlumina® lnfinium HumanMethylation450 BeadChip array analysis are shown on box plot; (C-D) Dot Blot analysis of 5-methylcytosine content (5-mC) in BV2 cells after different time points in monoculture or coculture (C) and quantified by using the monoculture condition as reference set as 1 and representative of 4 independent experiments (D).

Figure 4. Microglia-glioma coculture induces a pro-tumoral phenotype associated with a pro-inflammatory phenotype through IL-113 stress response activation in microglia. (A) Analysis of migration ability of C6 cells by transwell migration assay. C6 cells seeded in inserts in 5% medium were placed in plates containing 10% FBS medium (-control condition) or BV2 cells in 10% FBS medium (+ BV2 condition); (B) mRNA level expression analysis by qPCR of genes involved in microglia activation after 2h/4h/6h of monoculture or coculture conditions (average of three independent experiments); (C) Study of IL-1p protein secretion by ELISA from supernatant of C6 cells or BV2 cells as control conditions and from BV2 cells after 4h of monoculture or coculture conditions.

Figure 5. The microglial short-term immune response is regulated by DNMT3A. (A) Immunoblot of DNMTs proteins (DNMT1, DNMT3A and DNMT3B) show a temporary decrease of DNMT3A protein after short time (2 to 6h) coculture (right panel) compared to the monoculture condition (left panel); (B) The average quantification of the DNMTs protein expression levels is represented in the graphs for each different analyzed protein (from three independent experiments); (C) Graphic representation of the DNMTs mRNA levels in BV2 cells after monoculture or coculture experiments (average of three independent experiments); (D) Box plot of DNMT3A expression levels in gene bodies of the genes that are upregulated at 4 hours in coculture vs monoculture obtained from the ChIP-seq DNMT3A. In genes upregulated in coculture there is less DNMT3A compared to the monoculture condition at 2h and 4h; (E) Chl Pseq analysis of DNMT3A occupancy in BV2 cells in monoculture or coculture with C6 cells for 4h. The x-axis shows the DNMT3A log fold-change which has been ranked from the most downregulated gene (0) to the most upregulated gene (-10000) in co vs monoculture at 2 hours. Genes were then grouped according to their regulation in coculture versus monoculture at 4 hours and the density curves show how those gene groups are distributed in the DNMT3A logFC. As can be seen genes that are upregulated at 4 hours in coculture seem to mostly have lower DNMT3A at 2 hours in coculture; (F) ChIP analysis of the occupancy of DNMT3A on IL-1,6, IL-6 and MMP14 gene promoters at 2 and 4h of monoculture or coculture with 06 cells.

Figure 6. DNMT3A regulates microglia pro-tumoral activation. (A) Immunoblot of DNMT3A protein level in BV2 cells control (Ct: non transfected BV2 cells) or transfected with siRNA Scramble (SCR: negative control) or 5iRNA-DNMT3A (siD3a). 13-actin is used as loading control; (B) mRNA level expression analysis by qPCR of MMP14, IL-1f3 and IL-6 in BV2 control cells (Ct) or transfected with siRNA scramble (SCR: negative control) or siRNA DNMT3A (siD3a). Each graph represents the average Relative Quantification (RQ) to actin of the analyzed gene from three independent experiments; (C-D) Cell migration assay. Analysis of BV2 cell migration ability either transfected with siScramble or siDNMT3A (C) and of 06 migration ability towards BV2 cells transfected with siScramble or siDNMT3A (D); (E) Graph representing the phagocytosis ability of BV2 cells either transfected with siScramble as control or with 5iDNMT3A. Each panel is the average of three independent experiments except for the phagocytosis assay (n=5).

Figure 7. DNMT3A extinction in microglia reduces glioma tumor growth in vivo. (A) Representative pictures of GL261 tumors after injection of GFP-GL261 cells mixed with 8V2 shControl (shCt) (upper panel) or with 8V2 5hDNMT3A (lower panel) in 056/8I6 mice sacrificed 2 weeks after injection; (B) Graph representing the average tumor size of the tumors generated by the injection of GL261+BV2 shCt cells or by the injection of GL261-F3V2 5hDNMT3A cells.

Figure 8. Classical activation of microglia cells by [PS or IL-4 treatments does not affect the DNMT3A protein expression level. (A) Immunoblot analysis of DNMT3A protein expression in BV2 cells after treatment with LPS or IL-4 at different time points. Arginase-1 and iNOS are used as control or treatment effectiveness of [PS (iNOS) and IL-4 (Arginase1). Actin is used as loading control; (B) Quantification of DNMT3A protein expression level from immunoblot with BV2 treated with [PS or IL-4. Graphs represent the average quantification of three independent experiments; (C) mRNA expression level analysis by qPCR of DNMT1, DNMT3A and DNMT3B BV2 treated with [PS (upper panel) or IL-4 (bottom panel). Each graph represents the average Relative Quantification (RQ) to actin mRNA level of the analyzed gene from three independent experiments; (D) mRNA expression level analysis by qPCR of IL-6, IL-1p, CCL22 and Ym1 in BV2 treated with LPS (upper panel) or IL-4 (bottom panel). Each graph represents the average Relative Quantification (RQ) to actin mRNA level of the analyzed gene from three independent experiments.

Figure 9. DNMT3A reduction and immune response activation are observed in a human coculture setup. (A) Immunoblot analysis of DNMT3A protein expression level in human CHM E3 cell line after 2h/4h and 6h of monoculture or coculture with U87 cells; (B) graphic representation of the average quantification of DNMT3A protein level expression in CHM E3 cells after monoculture or coculture (average of three independent experiments); (C) mRNA expression levels analysis by qPCR of DNMT1, DNMT3A and DNMT3B in CHME3 after short time point monoculture or coculture; (D) mRNA expression level analysis by qPCR of IL-113 and IL-6 in CHM E3 cells after 2h/4h or 6h of monoculture or coculture (average representation of three independent experiments).

Figure 10. Extinction of DNMT1 or DNMT3B by siRNA in BV2 cells does not affect C6 or BV2 migration or IL113 mRNA expression level. (A) I mmunoblot of DNMT1 (left panel) or DNMT3B (right panel) proteins in BV2 cells transfected with siRNA DNMT1 (left panel) or siRNA DNMT3B (right panel). Ct condition corresponds to normal BV2 cells and SCR to BV2 cells transfected with siRNA Scramble (negative control). Actin is used as a loading control for each immunoblot; (B) 06 and BV2 transwell migration assay. Each graph corresponds to the average of three independent experiments; (C) mRNA expression level analysis of DNMT1, DNMT3A, DNMT3B and IL-1f3 by qPCR in BV2 cells control (Ct), transfected with siRNA Scramble (SCR: negative control) or with siRNA DNMT1 (siD1) or siRNA DNMT3B (siD3B). Each graph represents the average Relative Quantification (RQ) to actin mRNA level of the analyzed gene from three independent experiments.

Figure 11. Mono and coculture conditions result in no major differences in DNMT3A expression levels in gene bodies of upregulated genes. (A) Box plot of DNMT3A expression levels in gene bodies of the genes that are upregulated at 4h in coculture versus monoculture obtained from the DNMT3A ChIP-seq input samples showing no major differences between mono and coculture conditions; (B) Volcano plot of the results obtained from the RNA-seq experiment comparing gene regulation in coculture versus monoculture at 4h time point.

Figure 12. Validation of the specificity of the DNMT3A siRNA, validation of the phagocytosis assay, mRNA levels of MMPs and expression of DNMT3A in generated BV2 cell lines. (A) Analysis of the mRNA level of DNMT1, DNMT3A and DNMT3B in control (Ct), Transfected Scramble (SCR) and transfected s1DNMT3A (s1D3A) BV2 cells; (B) Analysis of the amount of lysosomes using the lysosensor compound in control (Ct), Transfected Scramble (SCR) and transfected 5iDNMT3A (siD3A) BV2 cells (C) mRNA levels of MMP2 and MMP9 in control (Ct), Transfected Scramble (SCR) and transfected siDNMT3A (siD3A) BV2 cells; (D) Western blot validation of the generated BV2 shRNA DNMT3A cells used for the in vivo experiment by analysis of the DNMT3A protein expression level in Control (BV2 shControl) or in two different clones (BV2 shD3A #1 and shD3A #2).

Examples

Glioblastoma, the most aggressive brain tumor, uses the immune resident cells of the brain, microglia, to expand and migrate within healthy tissue. Microglia, under the influence of cancer cells, are activated and reprogrammed into a pro-tumoral phenotype. Against this background, the present inventors have surprisingly and unexpectedly found that activity of DNMT3A in microglial cells determines whether a pro-or anti-tumoral phenotype is prevalent in such cells. The inventors have found that DNMT3A regulates microglia pro-inflammatory gene expression, and that inhibition of DNMT3A in microglia decreases tumor growth, causing microglia to demonstrate an anti-tumoral rather than pro-tumoral phenotype.

The following Examples reveal that i) the expression of DNMT3A can be selectively and robustly reduced in microglia using RNA-based antisense approaches, transiently using small interfering RNA and even in a stable manner using small hairpin RNA, ii) that reduced DNMT3A expression is associated with a microglial phenotype holding anti-tumoral properties, and finally iii) that cell transfer of DNMT3A deficient microglia impacted negatively on the growth of glioma tumors in an animal model of the disease. Thus, taking advantage of a glioma-induced microglial signaling pathway that control the acquisition of a transient microglial phenotype with inflammatory and immune responses characteristic we can combat the neoplastic cells. Furthermore, the modulation of microglia DNMT3A expression provides an option to override the immune inhibitory and tumor-supportive functions exerted by these cells in the context of the glioma tumor microenvironment.

Example I -Microglia are initially activated as immune reactive cells in response to glioma stimulation inducing a transient reduction in global DNA methylation.

In response to glioma stimuli, microglia cells may transit via different state of activation(s) before acquiring a tumor-supportive phenotype. To assess this, BV2 microglia cells exposed to 06 glioma cells for 2 or 4 hours in a segregated co-culture transwell set-up, were collected and RNA sequencing (RNA-seq) performed on those samples. The genome wide analysis of the microglial transcriptome by RNA-seq showed genes differentially regulated between microglia issue from monoculture and microglia collected from segregated co-culture with glioma cells. More genes were found to be differentially regulated after 4 hours than 2 hours co-culture with glioma cells and most genes regulated at the 2 hours-time point were also found to be affected after 4 hours. When the genes up-regulated in microglia cells after 4 hours exposure to glioma cells were analysed for clustering of Gene Ontology (GO) pathways, two particular clusters were found to be significantly enriched. These early activated gene clusters, i.e. "inflammatory response" (cluster 1) and "immune response" (cluster 3) are associated with the immune system, and particularly with the microglial pro-inflammatory phenotype (Fig. 3A). Examples of genes regulated after this short time point (4h) are represented in a volcano plot (Fig. 11B). Further analysis of the first 50 significantly over expressed GO pathways in co-culture condition as compare to monoculture condition, showed that 20 of these GO pathways are directly associated with an immune response of the cells (Table 4).

Table 4. Top 50 Gene Ontology (GO) pathways overexpressed in BV2 cells cocultured with C6 at 4h compared to monoculture condition (The GO pathways highlighted in grey are related to a pro-inflammatory cell phenotype). G0110

3 7E-06 regulation of macrophage °Perna:taxi's positive regulation of cholesterol efflux 3.7E-06 GO:0010875 000 607 0E-06 Pon establishment of epithelial cell polarity 1 5E-05 GO:0090162 eYtinklue-rueelated signalling Pathway 2 4E-05 positive regulation of MAPK cascade 4.0E-05 GO: 0043410 GO: 0042632 5.8E-05 cholesterol homeostasis 6.9E-05 GO: 0006691 leukotriene metabolic process GO:001 tutor res arise to interfero Coculture vs monoculture (upregulated at 4 hours) p-value coculture vs monoculture ttOph itottpoiatpipi:: *,*:*,,* , * ,, , ,,,*,,*,*.,,,,,*,, GO:0007186 G-protein coupled receptor signaling pathway 8.8E-08 GO:00 immune response 4:9E405 GO: 0051246 negative regulation of protein metabolic process 6.1E-05 Gene Ontology ID GO:0030593 GO: 0043277 1.7E-04 apoptolic cell clearance E-04 GO:007167 regulation of inoi[onucle integrin-mediated signalling pathway 3.1E-04 GO: 0007229 natural killer cell differentiation 0:0001770 ellularresPuns o GO: 0008360 5.6E-04 regulation of cell shape E-04 GO: 0032940 7.0E-04 secretion by cell regulation of ossification 1.1E-03 GO: 0030276 E-03 cheinotaxis regulation of cell migration 1.1E-03 GO: 0030334 regulation of sodium ion transport 1.6E-03 GO: 0002026 regulation of bone resorption 1.6E-03 GO:0045124 GO: 0006837 1.6E-03 seroton in transport intracellular cholesterol transport 1.6E-03 GO: 0032367 GO: 0034205 1.6E-03 beta-amyloid formation 6E-OS 0'0055094 response to lipoprotein particle regulation of chemotaxis 1.6E-03 GO: 0050920 lipoprotein biosynthetic process 1.6E-03 GO:0042158 T-helper 1 cell differentiation 2.1E-03 GO: 0045063 GO0006954 GO: 0048260 positive regulation of receptor-mediated endocytosis 5.2E-04 Ort.itlY.OH.rogrtiatiOrt:.O.frtiOnonnolOarertifb.ro.hfehation.:E.E.:HE GO: 0034249 negative regulation of cellular amide metabolic process 7.7E-04 GO: 0070374 positive regulation of ERK1 and ERK2 cascade 7.9E-04 GO: 0045597 positive regulation of cell differentiation 9.9E-04 maccontiago activation GO:0060122 inner ear receptor stereocilium organization 1 3E-03 Positive ulaflon of tumor necrosis factorproduction GO:0033137 negative regulation of peptidyl-serine phosphorylation 1.6E-03 0.0002283 neiffroPhil activation involved in immune resPon o-oot 743* lation of M diff 500:005072 oaitive regulation of innanim toty raspons 1 6E-Q3 GO: 0034363 low-density lipoprotein particle clearance 2.1E-03 GO: 0060396 growth hormone receptor signalling pathway 2 1E-03 GO:1902991 regulation of amyloid precursor protein catabolic process 2.1E-03 Gene expression is regulated by different mechanisms, including epigenetic regulation. To determine whether the short-term immune response observed could be due to changes in DNA methylafion, a segregated co-culture transwell set-up was used. DNA methylafion level was examined in mouse BV2 microglia cells stimulated by soluble factors originating from C6 glioma cells. In this in vitro setup, glioma cells have been reported to transform 0-0032760 microglia towards a tumor-supporting phenotype (Shen et al. (2016)), as illustrated for example by their ability to promote glioma cell invasion (Fig. 4A).

Using the Illumina® Infinium Methylation 450 BeadChip array, the methylation status of over 450,000 methylation sites per sample at single nucleotide resolution was determined.

Remarkably, global DNA methylation level was found to be reduced in the BV2 microglia cells after 6 hours segregated co-culture with the 06 glioma cells (Fig. 3B). DNA Dot Blot analysis of 5-methylcytosine (5-mC) content in BV2 microglia further revealed that the glioma cell-induced reduction in global DNA methylation was transient in these cells.

Indeed, whereas significant reduction in microglial global DNA methylation level was observed after 4 hours segregated coculture with glioma cells, the 5-mC levels were found to rise back to the level observed in microglia monoculture at 24 hours (Figs. 30 and D).

Example 2 -Early response of microglia to glioma leads to the expression of genes associated with pro-inflammatory and motile cell phenotypes The expression of genes which are commonly used for the characterisation of the different microglial phenotypes was investigated by qPCR in a time dependent manner (2, 4 and 6 hours) upon exposure to glioma cells. Early and sustained mRNA expression for two markers associated with the microglial tumor-supportive phenotype, Le. the chemokine (C-C Motif) ligand 22 (CcI22), and the chitinase-like molecule (Ch113, also known as Ym1), was observed in BV2 microglia upon co-culture with 06 glioma cells (Shen et a/. (2016)) (Fig. 4B). Early induction of matrix metalloproteinase-14 (membrane-inserted) (Mmp14, also known as Mtl-mmp) microglial mRNA expression was also observed in microglia but its expression appears to be transient (Fig. 4B). The expression of MMP14 in microglia is significantly associated with the recruitment of microglia into glioma tumors (Markovic et a/. (2009); Held-Feindt et al. (2010)).

Gene expression of the cytokines, interleukin-13 (11-13) and interleukin-6 (IL-6) was examined in BV2 microglia upon the segregated co-culture with 06 glioma conditions. IL- 13 is a prototypic pro-inflammatory cytokine that play key roles in both acute and chronic inflammatory responses. IL-6 expression was also studied since this gene is relevant in a clinical context; elevated IL-6 expression is associated with poor survival of patients with glioma (Wang et a/. (2009)). IL-6 is an interleukin reported to act as both a pro-and anti-inflammatory cytokine. IL-6 signaling seems to contribute to glioma malignancy through the promotion of glioma stem-cell growth and survival (Wang et al., 2009). Moreover, IL-6 participates in the maintenance of microglial tumor-supportive functions (Zhang et a/., 2012). Early induction of microglial mRNA expression for both cytokines was observed (Fig. 4B). However, the messenger expression for the prototypic pro-inflammatory cytokine, IL-113, was shown to be strictly limited in time and could only be observed in BV2 microglia at the 2 hours-time point upon co-culture with C6 glioma cells, in contrast to IL-6 mRNA which was found to be expressed up to 6 hours (Fig. 4B).

In order to determine whether the strong increase in IL-1p gene expression translated into an increase of the protein expression level! IL-lp protein amount in the supernatant of the cells was monitored by ELISA. By comparing the IL-113 expression level secreted by the C6 cells, the BV2 cells and the BV2 cells in mono or coculture conditions, an increase of the protein amount in the supernatant of the coculture condition was detected (Fig. 40). Early induction of IL-10, but not IL-6 gene expression was observed also using the human microglial cell line CHME3 upon segregated co-culture with human U87-MG glioma cells (Fig. 9D). Of note, LPS or IL-4 treatments of BV2 microglia show a different pattern of expression for the IL-113 gene as compared to microglia-glioma coculture conditions, confirming a specific regulation of microglial IL-1p upon exposure to glioma cells (Fig. 8D).

Example 3 -Decrease in microglial DNA methylation is associated with the transient downregulation of DNMT3A.

DNA methylation is regulated by DNA methyltransferases (DNMTs), enzymes involved in the covalent transfer of a methyl group to the 0-5 position of the cytosine ring of DNA. Therefore, the protein expression level of the main DNMTs, i.e. DNMT1, DNMT3A and DNMT3B, was investigated in rodent BV2 microglia upon exposure to 06 glioma cells.

Immunoblot analysis revealed a reduction in the expression level of microglial DNMT3A protein upon 2 to 6 hours segregated co-culture with glioma cells. The decrease in global DNA methylation and the reduction in DNMT3A protein expression were also transient, and microglial DNMT3A expression levels at 24 hours were undistinguishable between microglia in monocultures and microglia in segregated glioma co-cultures (Figs. 5A and 59). In those conditions, no significant reduction in the protein expression levels was observed for DNMT1 or DNMT3B (Figs. 5A and 5B).

A significant increase in DNMT3A mRNA expression level after 6 hours co-culture was observed that may result from a compensatory mechanism activated by the microglia cells to recover from the reduction in protein expression (Fig. 50). Decreased microglial DNMT3A protein expression upon exposure to glioma derived soluble factors was further confirmed with additional segregated co-culture combined with the human CHM E3 microglia cell line and the human U87-MG glioma cell line (Fig. 9A-C).

It was then determined whether the observed transient DNMT3A down-regulation in microglia cells was a distinctive characteristic of their activation by glioma cells, or a general mark for reactive microglia. To address this question, BV2 microglia were treated with lipopolysaccharide (LPS), a toll-like receptor 4 (TLR4) ligand and potent activator of the microglial pro-inflammatory phenotype (sometime referred in the literature as the "Ml" classical phenotype) (Burguillos et a/. (2011)) or interleukin-4 (IL-4), a cytokine with anti-inflammatory property and the reported ability to promote a microglial phenotype resembling the tumor-supportive one (sometime referred in the literature as the "M2" alternative phenotype). Induction of nitric oxide synthase-2 (NOS2, also known as inducible NOS; iNOS) protein expression and arginase-1 (ARG1) protein expression, were used respectively as control for LPS and IL-4 treatment efficiencies (Fig. 8A). Neither LPS treatment, nor IL-4 treatment that is expected to mimic some of the effect of glioma exposure, impacted on DNMT3A protein expression (Figs. 8A and 8B). However, these treatments appear to affect microglial DNMTs mRNA expression levels (Fig. 80).

Collectively, these data demonstrate that the transient reduction in DNMT3A expression level and associated decrease in global DNA methylation are distinctive characteristics of the activation of microglia cells by gliomas cells.

DNMT3A chromatin immunoprecipitation sequencing (ChIP-seq) was performed to identify the genome-wide DNA binding of this enzyme upon glioma-induced microglia activation.

This analysis revealed a reduction in DNMT3A DNA occupancy in microglia stimulated for 2 hours by glioma cells. This reduction in DNMT3A DNA binding was sustained at 4 hours while at a lower level (Fig. 5D). No difference was observed in the input samples at both time points (Fig. 11A). Remarkably, combined analysis of the RNA-seq and DNMT3A ChIP-seq microglial data sets exposed that reduced DNMT3A DNA binding was observed (at 2 hours) at genes whose expression was found to be up-regulated (at 4 hours) upon stimulation by glioma cells (Fig. 5E). Thus, it appears that glioma-induced microglia activation is associated with an initial regulation of microglial DNMT3A, with its displacement from chromatin sites that regulate the expression of genes that confer a unique transcriptome profile reflecting an immune reactive phenotype for these cells.

The DNMT3A protein occupancy on IL-113, IL-6 and MMP14 gene promoter regions was analysed by ChIP in BV2 microglia cells collected monocultures or segregated co-cultures with C6 glioma cells from 2 and 4 hours (Fig. 5F), since those genes were found to be regulated at early time points (Fig. 4F). A robust decrease in DNMT3A protein occupancy at these three gene promoters was observed at the 2-hour time point in microglia collected from the co-culture, as compared to the monoculture conditions (Fig. 5F). Remarkably, this difference in DNMT3A protein occupancy between these two conditions was lost at the 4-hour time point, indicating a short and transient mechanism for the regulation of these microglial genes by DNMT3A (Fig. 5F). Thus, these experiments, together with the above described genome-wide analyses, infer that glioma-induced loss of DNMT3A-mediated DNA methylation at specific gene loci promotes their expression in microglia and contributes to the acquisition of a pro-inflammatory and motile microglial cell phenotype.

Example 4 -DNMT3A silencing in microglia promotes a pro-inflammatory/antitumoral phenotype.

It is plausible that the observed down-regulation of microglial DNMT3A and associated transcriptional effects, in response to a glioma stimulus, contributes to the polarisation of the microglia cells toward a phenotype that could exert anti-tumoral functions. Therefore, the role of DNMT3A in the activation of BV2 microglia was assessed by knocking down the expression of endogenous DNMT3A using a pool of siRNAs, thereby mimicking the effect glioma cells have on microglial DNMT3A expression, but in a lasting manner. This DNMT3A-targeting siRNA pool led to robust downregulation of expression of the DNMT3A mRNA (but did not affect DNMT1 and DNMT3B mRNA expression; Fig. 12A), as well as the expression of DNMT3A protein in BV2 microglia (Fig. 6A). Identical observations were made in these microglia cells with a small hairpin RNA (shRNA) targeting DNMT3A expression (Fig. 12D). qPCR analysis revealed that DNMT3A gene silencing in BV2 microglia is also associated with a 2-fold increase in IL-113 mRNA expression level while IL-6 mRNA expression level was left unaffected (Fig. 6B).

Using a transwell system, the effects of microglial DNMT3A gene silencing on the capability of microglia cells to migrate, and the ability of these reactive cells to promote the migration of glioma cells was studied. Whereas inhibition of microglial DNMT3A expression appears to stimulate the migration capability of BV2 microglia cells (Fig. 6C), it reduces their aptitude to encourage the migration of C6 glioma cells (Fig. 6D). Furthermore, in accordance with their increased migration capability, the expression of two MMPs, MMP14 and MMP2 were found to be increased upon repression of DNMT3A expression in the BV2 microglia (Figs. 6B and 12C). Knockdown of DNMT3A gene expression in BV2 microglia also promoted their phagocyfic capacity (Fig. 6E). Collectively these observation advocate that sustained repression of DNMT3A expression in microglia is sufficient to promote an immune and inflammatory phenotype but repress the tumor-supporting phenotype, which is induced in response to glioma cell stimuli.

Example 5-DNMT3A-deficient microglia reduce glioma tumor growth Based on the novel finding that DNMT3A is involved in the regulation of a gene expression profile in microglia associated with inflammatory and immune responses, which can potentially exert anti-tumoral functions, it is plausible that repressing its expression in microglia could provide cells which exert beneficial, anti-tumoral effects in the context of glioma tumors. Viral delivery of shRNA targeting DNMT3A was used for establishment of BV2 microglia-derivatives with stable knockdown of DNMT3A (Fig. 12D). A Dnmt3a shRNA expressing microglial clone (Le. BV2 shD3A#2) that exhibited a 90% reduction in DNMT3A protein expression compared to a microglial clone infected with the lentiviral vector carrying a scramble control shRNA, was selected for further experimentation.

To examine the physiological relevance of these findings, in vivo experiments and co-injected GFP-expressing GL261 glioblastoma cells together with BV2 microglia expressing a control shRNA or a Dnmt3a shRNA into the brain of young C57/BL6/J mice, were performed. Importantly, this syngeneic transplant tumor model in immunocompetent mice has been shown, at the time points used, to exhibit limited infiltration by peripheral monocytes or macrophages (M011er et all (2015)). Immunohistochemical analysis of brain tissue 2 weeks post-transplantation revealed a significant reduction in GFP-3L261 glioma tumor sizes in mice co-injected with the BV2 microglia expressing DNMT3A shRNA compared to those co-injected with the microglial cells expressing the scrambled shRNA control (Fig. 7A and 7B), suggesting that repression of DNMT3A expression in microglia is able to induce an effective anti-tumoral phenotype in these myeloid cells. In summary, specific ablation of microglial DNMT3A negatively affects their tumor-supporting function in favor of anti-tumoral properties and thereby reduces glioma expansion in vivo.

Material and methods Cell culture BV2 mouse microglia cell line, CHME3 human microglia cell line, GL261-eGFP mouse glioblastoma cell line and C6 rat glioblastoma cell line were cultivated in DMEM + glutamax medium (Gibco) supplemented with 10% FBS (fetal bovine serum) and 1% P/S (Penicillin/Streptomycin). U87 human glioblastoma cell line was cultivated in MEM medium supplemented with 10% FBS and 1% P/S. All the different cell lines were grown in an incubator at 37°C and 5% CO2. For coculture experiments, microglia cells were seeded in 5% FBS medium on coverslips in 12 well plates while glioblastoma cells were seeded in Petri dishes. 24 hours after seeding, the coculture experiments were started by placing the coverslips into inserts in the petri dishes containing the glioblastoma cells. The microglia cells were then harvested at specified time points.

DNA extraction and DNA methylation analysis DNA extraction was performed using the QIAamp DNA Mini Kit (Qiagen). DNA concentration was quantified using NanoDrop® spectrophotometer (Thermo Fisher Scientific). Whole genome DNA methylafion analysis was performed using the IIlumina® Infinium HumanMethylation450 BeadChip array. Experiments were performed according to protocol at the Bioinformatics and Expression Analysis (BEA) Core facility at Novum, Immunoblottinq Total protein extracts were made directly in Laemmli buffer by scraping off the cells. For immunoblot analysis, protein extracts were resolved on 8% SDS-polyacrylamide gel electrophoresis and then blotted onto 0.45 pm pore-size nitrocellulose membranes. Membranes were blocked with 0.1% Tween/5% milk in PBS and incubated with indicated primary antibodies, overnight at 4°C, followed by incubation with the appropriate horseradish peroxidase secondary antibody (Pierce, 1:10,000) for 1 hour at room temperature. Immunoblot with anti--actin antibodies were used for standardisation of protein loading. Details about antibodies used herein may be found in Table 5. Bands were visualized by enhanced chemiluminescence (ECL-Plus, Pierce) following the manufacturer's protocol. Densitometry was performed using the ImageJ software package.

Table 5. Antibodies

Primary Antibodies Manufacturer Dilution 5-methylcytosine (C15200081; Mouse Diagenode 1/250 mAb) Dnmtl (D63A6; Rabbit mAb) Cell Signaling (#5032) 1/1000 1013-001-0000809108 Dnmt3a (ChIP grade; rabbit pAb) 108- Abcam (a b2850) 1/500 001-0000101480 Dnmt3a (H-295; rabbit pAb) Santa Cruz Biotech 1/500 108-001-0001405397 (sc-20703) Dnmt3b (52A1018 ChIP grade mouse Abcam (abl 3604) 1/500 mAb) 108-001-0000101122 13-Actin (AC40; mouse mAb) Sigma Aldrich (A-3853) 1/2000 108-001-0000310966 Arginase 1 (V-20; goat pAb) Santa Cruz Biotech 1/1000 (sc-18354) NOS2 (M19; rabbit pAB) Santa Cruz Biotech 1/1000 citations in PubMed (sc-650) "When available, reference number to 1DegreeBio antibody validation profile is indicated under the named antibody RNA isolation, cDNA synthesis, and qPCR Total RNA was extracted using the RNeasy Mini Kit (Qiagen). RNA concentrations were quantified using a NanoDrope spectrophotometer (Thermo Fisher Scientific). cDNA was synthesized from 1 pg RNA using Oligo dl, dNTPs, and Superscript Ill Reverse Tanscriptase (Invitrogen). qPCR was run on a StepOnePlus (Applied Biosystems) using the SYBRTM Green master mix (life technologies) and primers listed in Table 6 below.

Actin was used as a housekeeping gene for normalisation. Results were calculated using delta Ct method and represented as a fold change over control cells (monoculture condition).

Table 6. Primer sequences for qPCR cDNA Forward primer SEQ ID NO: Reverse primer SEQ ID NO: (organism) (5'-4') (5'-/3') Dnmt1 GTGAACAGGAAG ATGACAAC 15 CTGGATCCTCCT TTGATTTC 16 (mouse) Dnmt3a ACCAGAAGAAGA GAAGAATCC 17 CAATGATCTCCT 18 (mouse) TGACCTTAG Dnmt3b GACTTCATGGAA GAAGTGAC 19 TATCATCCTGAT 20 (mouse) ACTCTGTGC iNOS TTTTGCATGACA 21 ACTGGTTGATGA ACTCAATG 22 (mouse) CTCTTCAC Arginase-1 TGGCTTTAACCT TGGCTTGC 23 TTCATGTGGCGC ATTCACAG 24 (mouse) 11_113 (mouse) GCTGCTTCCAAA CCTTTGAC 25 TTCTCCACAGCC ACAATGAG 26 11_6 (mouse) GGACCAAGACCA TCCAATTC 27 GGCATAACGCAC TAGGTTTG 28 CCL22 CTGATGCAGGTC CCTATGGT 29 GCAGGATTTTGA GGTCCAGA 30 (mouse) Yml (mouse) CAGGGTAATGAG TGGGTTGG 31 CACGGCACCTCC TAAATTGT 32 Actb (mouse) TTGCTGACAGGA TGCAGAAG 33 TGATCCACATCT 34

GCTGGAAG

Dnmtl CGTAAAGAAGAA TTATCCGAGG 35 GTTTTCTAGACG 36 (human) TCCATTCAC Dnmt3a GAAGAGAAGAAT CCCTACAAAG 37 CAATAATCTCCTT GACCTTGG 38 (human) Dnmt3b CTTACCTTACCA 39 ATCCTGATACTC TGAACTGTC 40 (human) TCGACCTC IL113 (human) CTAAACAGATGA AGTGCTCC 41 GGTCATTCTCCT 42

GGAAGG

IL6 (human) GCAGAAAAAGGC AAAGAATC 43 CTACATTTGCCG AAGAGC 44 Actb (human) GACGACATGGAG AAAATCTG 45 ATGATCTGGGTC ATCTTCTC 46 Dot Blot Total DNA from BV2 cells was extracted using the QIAmp DNA mini kit (Qiagen) following the manufacturer's instructions. DNA concentrations were quantified using a NanoDrop® spectrophotometer (Thermo Fisher Scientific). After dilution of 500 pg of DNA in 0.1M NaOH (or positive 5mC DNA used as control, Diagenode), the samples were denatured for 5 mins at 99°C. The samples were then neutralised with 0.1 volume of 6.6M ammonium acetate and spotted on a Hybond-N+ membrane (Amersham). The membrane was air dried before cross-linking 2 hours at 80°C. The membrane was then blocked in 10% milk, 1% BSA diluted in PBS-tween (0.1%) for 1 hour at room temperature before incubation overnight at 4°C with the primary antibody directed against 5-methylcytosine (Diagenode) diluted 1/250 in blocking solution. After 3 washes in PBS-tween the appropriate horseradish peroxidase secondary antibody (Pierce, 1:10,000) was incubated for 1 hour at room temperature. Spots were visualized by enhanced chemiluminescence (ECL-Plus, Pierce) following the manufacturer's protocol. Densitometry was performed using the ImageJ software package. siRNA

Transfection of BV2 cells was carried out with Lipofectamine 3000 (Invitrogen). Non-targeting control, DNMT1, DNMT3A and DNMT3B ON-TARGET plus SMARTpools siRNAs (Table 7) were obtained from Dharmacon.

Table 7. ON-TARGETplus SMART pool small interfering RNAs siRNA pools Manufacturer SEQ ID NO: Dnintl (mouse, DNMT1 NM 010066) Dharmacon 47 (L-056796) 48

GGUAGAGAGUUACGACGAA

AAGCAAUUCAUGACGAGAA

GGUCGUGAGUGUUCGGGAA

GCUGGGAGAUGGCGUCAUA

Dnmt3a (mouse, DNMT3A NM_001271753) Dharmacon 11 (L-065433) 12

CCGUGAUGAUUGACGCCAA

GGUCCUAGGAGGCGAACUU

CCGCAAAGCCAUCUACGAA

CCAAAGCAGCCGACGAUGA

Dnmt3b (mouse, DNMT3B NM_001271745) Dharmacon 51 (L-044164) 52

GAGGAGUGCAUUAUCGUUA

UCAGGAUGAUAAAGAGUUU

GCAAUGAUCUCUCUAACGU

GGAAUGCGCUGGGUACAGU

Non-targeting siRNA pool Dharmacon 55 (D-001810) 56

UGGUUUACAUGUCGACUAA

UGGUUUACAUGUUGUGUGA

UGGUUUACAUGUUUUCUGA

UGGUUUACAUGUUUUCCUA

DNMT3A gene silencing by shRNA lentiviral infection in BV2 cells ShRNA for DNMT3A in pLKO-PURO lentiviral particles were purchased from Sigma Aldrich. Two clones were tested by lentiviral infection (M01 2) of the BV2 cells overnight in the presence of polybrene (Sigma-Aldrich). After 2 days, cells were selected using fresh medium containing 5 pg/mL of puromycin (Sigma-Aldrich) and shRNA efficiency was monitored by western blotting analysis over the time following the infection and after several cell passages.

Transwell migration assay 8 pm-pore width transparent PET membrane inserts (Transwell, Corning) were used to measure cell migration capability. 06 glioma cells were seeded on top of the insert and BV2 microglia were seeded in the lower compartment. For BV2 migration assay, BV2 cells were seeded in the insert in 5% FBS medium and 10% FBS medium was placed in the bottom as attractant. Once the experiment was finalized (after 24 hours migration for 06 cells or 4 hours migration for BV2 cells), the membranes from the inserts were washed with PBS and carefully cut out with a blade. Subsequently, the membranes were mounted with ProLong Gold antifade reagent with DAPI (Life technologies) and the nuclei of the migrated cells were counted under fluorescent microscopy.

ChIP assay DNMT3A ChIP experiments were performed using the HighCell# ChIP kit from Diagenode (kch-mahigh-G48) according to the manufacturer's instructions. After cell cross-linking in 1% formaldehyde and cell lysis, chromatin was sheared using a Bioruptor® Pico sonicator (Diagenode). Each chromatin immunoprecipitation was performed using 6.3pg of antibody. Purified DNA and 1% input were then analysed by qPCR (Table 8). Data was interpreted from qPCR by calculation of the percentage to input and then normalised to the control condition. DNMT3A ChIP-seq experiments were performed using the iDeal ChIP-seq kit from Diagenode according to the manufacturer's instructions. Purified DNA was sent for library preparation and sequencing at the Bioinformatics and Expression Analysis core facility (BEA, Novum, Karolinska Institute).

Table 8. Primers for ChIP analysis cDNA (organism) Forward primer Reverse primer 1L/13 ChIP (mouse) EpiTect ChIP qPCR Primer (NM_008361.3 (+) 01 kb) (Qiagen) 11_6 ChIP (mouse) EpiTect ChIP qPCR Primer (NM_031168.1 (+) 01 kb) (Qiagen) MMP14 ChIP (mouse) EpiTect ChIP qPCR Primer (NM_008608.2 (+) 01 kb) (Qiagen) Transcriptome data processing The top 100 most significant GO found in the upregulated genes between co and monocultured cells using the weight01 algorithm were taken and the semantic similarity was calculated pairwise between the GOs using the relevance method. The GOs were then clustered using hierarchical correlation clustering. As can be seen the majority of GOs are associated with the immune system and forms one well defined cluster with two major sub-clusters, were one is involved in chemotaxis/signaling and the other in immune cell differentiation.

Syncieneic transplant cilioma mouse model Experiments were performed in accordance with the Guidelines of the European Union Council, following Swedish regulations for the use of laboratory animals and approved by the Regional Animal Research Ethical Board, Stockholm, Sweden (Ethical permits N248/13, and 17283-2018). Male C57/BL6/J mice (Charles River) were housed in a 12/12-hour light/dark cycle with access to food and water ad libitum. Postnatal day 16-17 male pups were anesthetized with isoflurane (5% for induction and 1.5% for maintenance). An incision was made on the scalp and the skin flaps were retracted to expose the skull.

Animals received an intrastriatal injection of either a mix of GL261 and BV2 shControl (35000 + 15000 cells respectively) or a mix of GL261 and BV2 5hDNMT3A (35000 + 15000 cells respectively) suspended in 1 pL culture medium in the left hemisphere using the following coordinates relative to bregma anterior/posterior: +0.7 mm, lateral: ± 2.5 mm, ventral: -3 mm, using a 5 pL ILS microsyringe. The injection was performed over 1 min and the syringe remained in the injection site for 5 min to reduce back flow, and slowly retracted over 1 min thereafter. The skin was sutured, and animals were allowed to recover before they were returned to their dams. Animals were sacrificed 2 weeks after transplantation. Animals were deeply anesthetized with sodium pentobarbital and transcardially perfused with 0.9% sodium chloride followed by fixation with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4). Brains were then transferred to 30% sucrose in 0.1 M phosphate buffer and left until they sank. 25-pm-thick horizontal free-floating sections were prepared using a microtome (Leica SM2010R) and stored in cryoprotection solution at 4°C (25% glycerol, 25% ethylene glycol in 0.1 M phosphate zo buffer) for further histological analysis. The experiment was performed on 4 animals per condition and repeated twice (n=8 animals per condition final).

References 1 Altschul, Madden, Schaffer, Zhang, Zhang, Miller & Lipman (1997). "Gapped BLAST and PSI-BLAST: A new generation of protein database search programs".

Nucleic Acids Res 25(17):3389-402.

2 Arkin & Wells (2004). "Small-molecule inhibitors of protein-protein interactions: progressing towards the dream". Nat Rev Drug Discov 3(4):301-17.

3 Baumann & Winkler (2014). "miRNA-based therapies: strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents". Future Med Chem 6(17):1967-84.

4 Beaucage (2005). "Synthesis of modified oligonucleotides and conjugates". Curr Protoc Nucleic Acid Chem 20(31):4.0.1-4.

Beck-Sickinger & Weber (2001). "Combinational strategies in biology and chemistry". John Wiley & Sons, Chichester, Sussex.

6 Bowman, Klemm, Akkari, Pyonteck, Sevenich, Quail, Dhara, Simpson, Gardner, lacobuzio-Donahue, Brennan, Tabar, Gutin & Joyce (2016). "Macrophage ontogeny underlies differences in tumour-specific education in brain malignancies". Cell Rep 17(9):2446-69.

7 Brandenburg, Muller, Turkowski, Radev, Rot, Schmidt, Bungert, Acker, Schorr, Hippe, Miller, Heppner, Homey & Vajkoczy (2016). "Resident microglia rather than peripheral macrophages promote vascularization in brain tumours and are a source of alternative pro-angiogenic factors". Acta Neuropathol 131(3):365-78.

8 Brennan, Verhaak, McKenna, Campos, Noushmehr, Salama, Zheng, Chakravarty, Sanborn, Berman, Beroukhim, Bernard, Wu, Genovese, Schmulevich, Barnholtz-Sloan, Zou, Vegesna, Shukla, Ciriello, Yung,Zhang, Sougnez, Mikkelsen, Aldape, Bigner, van Meir, Prados, Sloan, Black, Eschbacher, Finocchiaro, Friedman, Andrews, Guha, Iacocca, O'Neill, Foltz, Weinstein, Meyerson, Gabriel, Laird, Naussler, Getz, Chin, TCGA Research Network (2013). "The somatic genomic landscape of glioblastoma". Cell 155(2):462-77.

9 Burguillos, Deierborg, Kavanagh, Persson, Hajji, Garcia-Quintanilla, Cano, Brundin, Englund, Venero & Joseph (2011). "Caspase signalling controls microglia activation and neurotoxicity". Nature 472(7343):319-24.

10. Charles, Holland, Gilbertson, Glass & Kettenmann (2012). "The brain tumor microenvironment". Glia 60(3):502-14.

11. Clackson, Hoogenboom, Griffiths & Winter (1991). "Making antibody fragments using phage display libraries". Nature 352:624-8.

12. Dubois, Campanati, Righy, D'Andrea-Meira, Spohr, Porto-Carreiro, Pereira, BalgaSilva, Kahn, DosSantos, Oliveira, Ximenes-da-Silva, Lopes, Faveret, Gasparetto & Moura-Neto (2014). "Gliomas and the vascular fragility of the blood brain barrier".

Front Cell Neurosci 8(418):1-13.

13. Freier & Altmann (1997). "The ups and downs of nucleic acid duplex stability: Structure-stability studies on chemically-modified DNA:RNA duplexes". Nucleic Acids Res 25(22):4429-43.

14. Gartner, Tse, Grubina, Doyon, Snyder & Liu (2004). "DNA-templated organic synthesis and selection of a library of macrocycles". Science 305(5690):1601-05.

15. Goodenberger & Jenkins (2012). "Genetics of adult glioma". Cancer Genet 205(12):613-21.

16 Gray, Woodard & Samulski (2010). "Viral vectors and delivery strategies for CNS therapy". Ther Deliv 1(4).517-34.

17 Hambardzumyan, Gutmann & Kettenmann (2016). "The role of microglia and macrophages in glioma maintenance and progression". Nat Neurosci 19(1):20-7.

18. Hanahan & Weinberg (2000). "The hallmarks of cancer". Cell 100(1):57-70.

19. Haqqani, Delaney, Tremblay Sodja, Sandhu & Stanimirovic (2013). "Method for isolation and molecular characterization of extracellular microvesicles released from brain endothelial cells". Fluids Barriers CNS 10(1):4.

20. Held-Feindt, Hattermann, MOerkOster, Wedderkopp, Knerlich-Lukoschus, Ungefroren, Mehdorn & Mentlein (2010). "CX3CR1 promotes recruitment of human glioma-infiltrating microglia/macrophages (GIMs). Exp Cell Res 316(9):1553-66.

21 Jabbari & Bernardi (2004). "Cytosine methylation and CpG, TpG (CpA) and TpA frequencies". Gene 333:143-9.

22 Jia, Li, Fang, Zhu, Xu, Cheng, Zhang, Li, Feng, Li, Li, Wang, Du, Li, Chen, Ji, Han, Yu, Wu & Wong (2016). "Negative regulation of DNMT3A de novo DNA methylation by frequently overexpressed UHRF family proteins as a mechanism for widespread DNA hypomethylation in cancer". Cell Discov 2:16007.

23. Kohler & Milstein (1975). "Continuous cultures of fused cells secreting antibody of predefined specificity". Nature 256:495-7.

24 Krueter & Jeirg (2001). "Nanoparticulate systems for brain delivery of drugs". Advanced Drug Delivery Reviews 47(1):65-81.

Lima, Cerqueira, Figueiredo, Oliveira & Azrvado (2018). "Anti-miRNA oligonucleotides: A comprehensive guide for design". RNA Biol 15(3):338-52.

26 Louis, Miguel, Mosses, Bernier & Di Stefano (2016). "The 2016 World Health Organization classification of tumors of the central nervous system: a summary". Acta Neuropathol 131(6).803-20.

27 Madeira, Park, Lee, Buso, Gur, Madhusoodanan, Basutkar, Tivey, Potter, Finn & Lopez (2019). "The EMBL-EBI search and sequence analysis tools APIs in 2019".

Nucleic Acids Res 47(W1):VV636-41.

28 Maes, Colombo, Schulz & Siegert (2019). "Targeting microglia with lentivirus and MV: Recent advances and remaining challenges". Neurosci Lett (Epub ahead of print).

29 Mamelak & Jacoby (2007). "Targeted delivery of antitumoral therapy to glioma and other malignancies with synthetic chlorotoxin (TM-601)". Expert Opin Drug Deliv 4(2):175-86.

Markovic, Glass, Synowitz, van Rooijen & Kettenmann (2005). "Microglia stimulate the invasiveness of glioma cells by increasing the activity of metalloprotease-2". J Neuropathol Exp Neurol 64(9):752-62.

31. Markovic, Vinnakota, CHirasani, Synowitz, Raguet, Stock, Sliwa, Lehmann, Kahn, van Rooijen, Holmbeck, Heppner, Kiwit, Matyash, Lehnardt, Kaminska, Glass & Kettenmann (2009). "Gliomas induce and exploit microglial MT1-MMP expression for tumor expansion". Proc Natl Acad Sci USA 106(30):12530-5.

32. Marks, Hoogenboom, Bonner( McCafferty, Griffiths & Winter (1991). "By-passing immunization. Human antibodies from V-gene libraries displayed on phage". J Mol Biol 222(3):581-97.

33 Masserini (2009). "Nanoparticles for brain drug delivery". ISRN Biochem 2013:238428.

34 Melkko, Scheuermann, Dumelin & Neri (2004). "Encoded self-assembling chemical libraries". Nat Biotechnol 22(5):568-74.

35 Min, Kim, Naito, Ogura, Toh, Hayashi, Kim, Fukushima, Anraku, Miyata & Kataoka (2020). "Systemic brin delivery of antisense oligonucleotides across the blood-brain barrier with a glucose-coated polymeric nanocarrier". Angew Chem Int Ed Engl (Epub ahead of print).

36. Muckenschnabel, Falchetto, Mayr & Filipuzzi (2004). "SpeedScreen: label-free liquid chromatography-mass spectrometry-based high-throughput screening for the discovery of orphan protein ligands". Anal Biochem 324(2):241-49.

37. Willer, Branderburg, Turkowski, Muller & Vajkoczy (2015). "Resident microglia, and not peripheral macrophages, are the main source of brain tumor mononuclear cells". Int J Cancer 137(2):278-88.

38 Park, Aryal, Vykhodtseva, Zhang & McDannold (2017). "Evaluation of permeability, doxorubicin delivery, and drug retention in a rat brain tumor model after ultrasound-induced blood-tumor barrier disruption". J Control Release 250(1):77-85.

39 Perez-Martinez, Carrion & Cena (2013). "The use of nanoparticles for gene therapy in the nervous system". J Alzheimers Dis 31(4):697-710.

Ramstrom & Lehn (2002). "Drug discovery by dynamic combinatorial libraries". Nat Rev Drug Discov 1(1):26-36.

41 Reifenberger, Wirsching, Knobbe-Thomsen & Weller (2017). "Advances in the molecular genetics of gliomas -implications for classification and therapy". Nat Rev Clin Oncol 14(7):434-52.

42 Robertson, Uzvolgyi, Liang, Talmadge, Sumegi, Gonzales & Jones (1999). "The human DNA methyltransferases (DNMTs) 1, 3a and 3b: coordinate mRNA expression in normal tissues and overexpression in tumors". Nucleic Acids Res 27(11):2291-8.

43 Sheikov, McDannold, Sharma & Hynynen (2008). "Effect of focused ultrasound applied with an ultrasound contrast agent on the tight junctional integrity of the brain microvascular endothelium". Ultrasound Med Biol 34(7):1093-104.

44. Shen, Burguillos, Osman, Frijhoff, Carillo-Jimenez, Kanatani, Augsten, Saidi, Rodhe, Kavanagh, Rongvaux, Rraklli, Nyman, Holmberg, Ostman, Flavell, Barragan, Venero, Blomgren, & Joseph (2006). "Glioma-induced inhibition of caspase-3 in microglia promotes a tumor-supportive phenotype". Nat Immunol 17(11):1282-1290.

45. Shuker, Hajduk, Meadows & Fesik (1996). "Discovering high-affinity ligands for proteins: SAR by NM R. Science 274(5192):1531-34.

46 Stella & Himmelstein (1985). "Prodrugs: A chemical approach to targeted drug delivery". Directed Drug Delivery R. Borchardt et al. (ed.) 247-67 (Humana Press).

47 Urban & Noe (2003). "Structural modifications of antisense oligonucleotides".

Farmaco 58(3):243-58 48 van Rooij & Kauppinen (2014). "Development of microRNA therapeutics is coming of age. EMBO Mol Med 6(7):851-64.

49. Verhaak, Hoadley, Purdom, Wang, Qi, Wilkerson, Miller, Ding, Golub, Mesirov, Alexe, Lawrence, O'Kelly, Tamayo, Weird, Gabriel, Winckler, Gupta, Jakkula, Feiler, Hodgson, James, Sarkaria, Brennan, Kahn, Spellman, Wilson, Speed, Gray, Meyerson, Getz, Perou, Hayes & TCGA Research Network (2010). "Integrated genomic analysis identifies relevant subtypes of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR and NF1". Cancer Cell 17(1):98-110.

50 Wang, Lathia, Wu, Wang, Li, Heddleston, Eyler, Elderbroom, Gallagher, Schuschu, MacSwords, Cao, McLendon, Wang, Hjelmeland & Rich (2000). "Targeting interleukin 6 signaling supresses glioma stem cell survival and tumor growth. Stem Cells 27(10):2393-404.

51 Wang, Hu, Hu, Kim, Squatrito, Scarpace, deCarvalho, Lyu, Li, Li, Barthel, Cho, Lin, Satani, Martinez-Ledesma, Zheng, Chang, Sauve, Olar, Lan, Finocchiaro, Philips, Berger, Gabrusiewicz, Wang, Eskilsson, Hu, Mikkelsen, DePinho, Muller, Heimberger, Sulman, Nam, Verhaak (2017). "Tumor evolution of glioma-intrinsic gene expression subtypes associates with immunological changes in the microenvironment". Cancer Cell 32(1):42-56.

52 Ward, Gussow, Griffiths, Jones & Winter (1989). "Binding activities of a repertoire of single immunoglobulin variable domains secreted from Escherichia coli". Nature 341:544-6.

53 Weller, Wick, Aldape, Brada, Berger, Pfister, Mishikawa, Rosenthal, Wen, Stupp & Reifenberger (2015). "Glioma". Nat Rev Dis Primers 1:15017.

54 Wen (2015). "Small molecules targeting microRNA for cancer therapy: Promises and obstacles". J Control Release 219:237-47.

55 Wlman (1986). "Prodrugs in cancer chemotherapy". Biochem Soc Trans 14(2):375-82.

56 Wohlfart, Gelperina & Krueter (2012). "Transport of drugs across the blood-brain barrier by nanoparticles". J Control Release 161(2):264-73.

57. Yang, Fogarty, LaForge, Aziz, Pham, Lai & Bai (2017). "Delivery of small interfering RNA to inhibit endothelial growth factor in zebrafish using natural brain endothelia cell-secreted exosome nanovesicles for the treatment of brain cancer'. AAPS J 19(2):475-86.

58 Zhang, Sarkar, Cau, Zhou, Hadxer & Yong (2017). "A dialog between glioma and microglia that promotes tumor invasion through the CCL2/CCR2/interleukin-6 axis". Carcinogenesis 33(2):312-9.

59 Zhang, Liu, Du, Guo, Chen, Wang, Fang, Cao, Zhang, Liu & Zhang (2017). "increasing blood-brain tumor barrier permeability through transcellular and paracellular pathways by microbubble-enhanced diagnostic ultrasound in a C6 glioma model". Front Neurosci 11(86):1-9.

60 Zhou & Rossi (2010). "Aptamer-targeted cell-specific RNA interference" Silence 1(1):4.

Claims (29)

1. CLAIMS1. An inhibitor of DNMT3A for use in the treatment of brain cancer in a subject.
2. 2. Use of an inhibitor of DNMT3A in the manufacture of a medicament for the treatment of brain cancer in a subject.
3. 3. A method for the treatment of brain cancer in a subject, the method comprising the step of administering an inhibitor of DNMT3A.
4. 4. An inhibitor for use according to Claim 1, or a use according to Claim 2, or a method according to Claim 3, wherein the inhibitor of DNMT3A comprises: a small molecule compound (such as a small synthetic organic molecule); an antibody; a polypeptide; a polynucleotide (such as an inhibitory RNA, a miRNA, an shRNA or an siRNA); an antisense oligonucleotide.
5. An inhibitor for use, or a use, or a method, according to Claim 4, wherein the inhibitor of DNMT3A comprises a polynucleotide.
6. 6. An inhibitor for use, or a use, or a method, according to Claim 4, wherein the inhibitor of DNMT3A comprises an antisense oligonucleotide, optionally wherein the antisense oligonucleotide is partially, substantially or completely identical to any one of SEQ ID NOs: 3-14, further optionally wherein the antisense oligonucleotide is partially, substantially or completely identical to any one of SEQ ID NOs: 3-10.
7. 7. An inhibitor for use, or a use, or a method, according to any preceding claim, wherein the brain cancer comprises one or more myeloid cell having pro-tumoral activity.
8. 8. An inhibitor for use, or a use, or a method, according to any preceding claim, wherein the use is for inhibiting and/or decreasing the expression and/or biological activity of DNMT3A.
9. 9. An inhibitor for use, or a use, or a method, according to Claim 7 or 8, wherein the inhibitor of DNMT3A reduces and/or inhibits the pro-tumoral activity of the one or more myeloid cell.
10. 10. An inhibitor for use, or a use, or a method, according to any one of Claims 7-9, wherein the inhibitor of DNMT3A increases and/or induces anti-tumoral activity of the one or more myeloid cell.
11. 11. An inhibitor for use, or a use, or a method, according to any one of Claims 7-10, wherein the expression and/or biological activity of DNMT3A is decreased by at least 10%, or at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95%, or at least 99%, or 100%.
12. An inhibitor for use, or a use, or a method, according to any of Claims 7-11, wherein the one or more myeloid cell comprises one or more microglial cell and/or one or more macrophage.
13. An inhibitor for use, or a use, or a method, according to any preceding claim, wherein the brain cancer comprises: a brain tumor; high grade glioma; glioblastoma; or a tumor of the central nervous system.
14. An inhibitor for use, or a use, or a method, according to any preceding claim, wherein the inhibitor of DNMT3A is administered to the subject intra-tumorally, intra-cerebrally, intra-venously and/or orally.
15. An inhibitor for use, or a use, or a method, according to any preceding claim, wherein the inhibitor of DNMT3A is co-administered with a chemotherapeutic agent (such as temozolomide), an immunotherapy and/or irradiation.
16. An inhibitor for use, or a use, or a method, according to any preceding claim, wherein the inhibitor of DNMT3A is administered ex vivo to one or more myeloid cell from the subject.
17. An inhibitor for use, or a use, or a method, according to any preceding claim wherein the inhibitor is delivered to cells of the brain using any of: (a) a physical method, such as: parenteral administration, direct injection or electroporation; and/or (b) a delivery vehicle such as: a glucan-containing particle, a lipid containing vehicle, a viral containing vehicle, a polymer containing vehicle, a peptide containing vehicle, a nanoparticle, a microvesicle, or an exosome. 12. 13. 14. 15. 16. 17.
18. 18. An inhibitor of DNMT3A, wherein the inhibitor is an antisense oligonucleotide comprising a sequence, partially, substantially or completely complementary to SEQ ID NO: 1.
19. 19. An inhibitor of DNMT3A as defined in any one of Claims 1-18 for use in medicine.
20. 20. A pharmaceutical composition comprising an effective amount of an inhibitor of DNMT3A as defined in any one of Claims 1-18 and a pharmaceutically acceptable excipient, diluent or carrier.
21. 21. The in vitro use of an inhibitor of DNMT3A for reducing and/or inhibiting the pro-tumoral activity of one or more myeloid cell, and/or for increasing and/or inducing the anti-tumoral activity of one or more myeloid cell.
22. 22. An inhibitor of DNMT3A for use in reducing and/or inhibiting the pro-tumoral activity of one or more myeloid cell, and/or for increasing and/or inducing the anti-tumoral activity of one or more myeloid cell, in a subject in need thereof.
23. 23. An in vitro or ex vivo method for reducing and/or inhibiting the pro-tumoral activity of one or more myeloid cell, and/or for increasing and/or inducing the anti-tumoral activity of one or more myeloid cell, the method comprising the step of contacting the one or more myeloid cell with an inhibitor of DNMT3A.
24. 24. A composition comprising one or more myeloid cell obtained or obtainable by a method as defined in Claim 23
25. 25. A kit comprising a composition as defined in Claim 20 or 24.
26. 26. An inhibitor for use, a use, or a method substantially as described herein with reference to the accompanying description, claims and/or figures.
27. 27. A pharmaceutical composition, or a composition, substantially as described herein with reference to the accompanying description, claims and/or figures.
28. 28. A method of identifying a test agent that may be useful in treating a brain cancer in a subject, the method comprising: providing a myeloid cell comprising DNMT3A; providing a test agent; contacting the myeloid cell comprising DNMT3A with the test agent under conditions effective for the test agent to facilitate inhibition of DNMT3A; and determining whether the test agent is capable of decreasing and/or inhibiting the biological activity and/or expression of DNMT3A, optionally wherein the method further comprises the steps of synthesising, purifying and/or formulating the test agent.
29. 29. A method of determining the susceptibility of a brain cancer to treatment using an inhibitor of DNMT3A, the method comprising: providing a myeloid cell comprising DNMT3A from a brain cancer; contacting the myeloid cell with the inhibitor DNMT3A according to any preceding claim; assessing the effect of the inhibitor on the expression and/or biological activity of DNMT3A; and determining the susceptibility of the brain cancer to treatment on the basis of the assessment of the effect of the inhibitor.