KR102143701B1 - nc886 and/or PKR inhibitors as ancillary agents for anti-cancer drugs and methods to provide improved regimens for them - Google Patents

Abstract

The present invention relates to an anticancer adjuvant comprising nc886 and/or a PKR inhibitor, and a method of providing information on a drug for cancer treatment.

Description

[nc886 and/or PKR inhibitors as ancillary agents for anti-cancer drugs and methods to provide improved regimens for them}

The present invention relates to an anticancer adjuvant comprising nc886 and/or a PKR inhibitor, and a method of providing information on a drug for cancer treatment.

Cancer is largely classified into blood cancer and solid cancer, and it occurs in almost all parts of the body, such as lung cancer, stomach cancer, breast cancer, oral cancer, liver cancer, uterine cancer, esophageal cancer, and skin cancer, and these treatment methods include a small number of recent treatments such as Gleevec or Herceptin. Targeted therapies have been used for the treatment of specific cancers, but until now, surgery or radiation therapy and chemotherapy to suppress cell proliferation are the main methods of treatment with anticancer drugs. For example, Korean Patent Application Publication No. 10-2014-0090500 discloses a 2-(phenylethynyl)thieno[3,4-b]pyrazine derivative and a pharmaceutical composition for preventing or treating cancer comprising the same, Korean Patent Publication No. 10-2017-0143457 discloses a novel imidazopyridine derivative, a preparation method thereof, and a pharmaceutical composition for preventing or treating cancer containing the same as an active ingredient.

Chemotherapy with cytotoxic drugs has traditionally been used as an important treatment for cancer patients. Doxorubicin, a compound of the anthracycline antibiotic family, is one of the most effective anticancer drugs, and for nearly half a century it was first chosen to treat a variety of malignancies. In general, doxorubicin induces apoptosis as a result of genotoxic effects such as DNA adduct formation, DNA intercalation, interference with topoisomerase II action, and formation of free radicals. Was thought to be. Although doxorubicin has been used extensively and clinically for a long time, the precise mechanism for its cytotoxicity remains controversial. Doxorubicin has different therapeutic effects depending on the therapeutic dose, duration of treatment, and tumor type.

PKR (Protein Kinase R) is an interferon-induced serine/threonine kinase. PKR is dormant in most mammalian cells and is activated by the viral genome itself or by double-stranded RNA (dsRNA) produced during viral replication and transcription. When PKR binds to dsRNA, PKR dimers and phosphorylates. Phosphorylated PKR is an active kinase that phosphorylates elF2α, the most well-known substrate, and this causes precursor synthesis to be stopped, resulting in apoptosis. The above action is a PKR-mediated antiviral response to block virus-infected cells. However, the PKR path is much more complicated than the above description. In addition to dsRNA, PKR is controlled by cellular and external factors that play an important role in various signaling pathways such as NF-κB, p53, STAT1, and protein. Because these cellular pathways are important in determining cell death and cell proliferation, PKR is an important gene in cancer pathology. When there is a problem in the regulation of apoptosis by abnormal PKR, it is important not only in tumor development itself, but also a decisive factor in the resistance of cancer cells to cancer treatment. There are many studies showing that PKR is activated during doxorubicin treatment and promotes cell death. Therefore, PKR plays an important role in apoptosis not only in viral infection but also in doxorubicin treatment. Given that doxorubicin induces genotoxicity in the nucleus, the mechanism by which doxorubicin activates PKR is unknown.

The present inventors identified a non-coding RNA that binds to PKR and inhibits the activity of PKR. nc886 is transcribed by RNA polymerase III (Pol III) and expressed in normal human tissues. The expression level of nc886 is generally increased in cancer cells, but in some malignant tumors it is completely silenced by CpG DNA and methylation. The present inventors completed the present invention, confirming that nc886 is an important signaling molecule linking PKR and doxorubicin in therapeutic cell suicide.

Basically, doxorubicin is known to induce apoptosis by targeting only cancer cells in which DNA is dividing by damaging DNA. The present inventors studied the action of nc886 and PKR when doxorubicin was treated on cells. As a result, when doxorubicin was treated, Pol III transcription was inhibited and the expression of nc886 decreased, resulting in increased phosphorylation of PKR, resulting in cell death. And it was confirmed that such apoptosis is another aspect of the therapeutic apoptosis activity of doxorubicin. Since normal cells express nc886 and PKR, they can be killed due to the above activity of doxorubicin. Therefore, in order to prevent the death of normal cells, a PKR inhibitor must be treated with doxorubicin.

Or by applying doxorubicin targeting nc886/PKR, cancer cells can be killed. In general, since nc886 is increased in cancer cells, it is estimated that apoptosis due to nc886 reduction and PKR activity will occur more than normal cells. In this case, high concentration/short-term treatment of doxorubicin minimizes DNA damage while minimizing damage to nc886/PKR. Can induce apoptosis by The advantage of this method is that it can minimize damage to dividing normal cells (hair cells or blood cells). After confirming the above facts, the present invention was completed.

It is an object of the present invention to provide a composition for alleviating or reducing side effects of cancer therapeutics comprising nc886 and/or a PKR inhibitor.

Another object of the present invention is to provide a cancer treatment adjuvant of a DNA-damaging agent comprising nc886 and/or a PKR inhibitor.

The present invention relates to the expression level of the gene of nc886 comprising the following steps; And it is to provide a method of providing information on a drug for the treatment of cancer according to the expression level of the gene of PKR or the activity level of the protein thereof.

(a) the expression level of the gene or protein thereof of nc886 from a biological sample isolated from a cancer patient that is pathologically determined to be cancer; And measuring a gene expression level of PKR or an activity level of a protein thereof. And

(b) When the measured expression level of the nc886 gene is lower than that of the normal control sample, and the expression level of the PKR gene or the activity level of its protein is higher than that of the normal control sample, a DNA-damaging agent for the cancer patient And providing drug selection information to administer the PKR inhibitor.

Another object of the present invention is the expression level of the gene of nc886; And an agent capable of measuring the expression level of a gene of PKR or the activity level of a protein thereof, and a drug for cancer treatment or a kit for providing information on administration thereof.

The present invention is a composition for alleviating or reducing the side effects of cancer treatment comprising nc886 and/or a PKR inhibitor; And it is possible to provide a method of providing information on drugs for cancer treatment.

The PKR inhibitor may be an imidazolo-oxindole compound, 2-aminopurine (2-AP), the entire nc886 gene consisting of the nucleotide sequence of SEQ ID NO: 1, or a partial gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2.

The cancer therapeutic agent may be a DNA-damaging agent.

The DNA-damaging agents include anthracycline drugs, platinum anticancer drugs, nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis-chloroethylnitrosourea, streptozosine, and It may be pan or thiotepine.

The anthracycline drug may be daunorubicin, doxorubicin, epirubicin, idarubicin, or mitoxantrone.

The cancers include lung cancer, colon cancer, colon cancer, rectal cancer, breast cancer, prostate cancer, bladder cancer, blood cancer, leukemia, myeloid leukemia, lymphoma, cervical carcinoma, osteosarcoma, glioblastoma, melanoma ( melanoma), pancreatic cancer, gastric cancer, liver cancer, kidney cancer, gallbladder cancer, biliary tract cancer, esophageal cancer, ovarian cancer or neuroblastoma.

The present invention can also provide a cancer treatment adjuvant of a DNA-damaging agent comprising a PKR inhibitor.

The PKR inhibitor may be an imidazolo-oxindole compound, 2-aminopurine (2-AP), the entire gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 1, or a partial gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2.

The DNA-damaging agent is an anthracycline drug, platinum anticancer drug, nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis-chloroethylnitrosourea, It may be streptozosine, busulfan or thiotepine.

The present invention relates to the expression level of the gene of nc886 comprising the following steps; And it is to provide a method of providing information on a drug for the treatment of cancer according to the expression level of the gene of PKR or the activity level of the protein thereof.

(a) the expression level of the gene or protein thereof of nc886 from a biological sample isolated from a cancer patient that is pathologically determined to be cancer; And measuring a gene expression level of PKR or an activity level of a protein thereof. And

(b) When the measured expression level of the nc886 gene is lower than that of the normal control sample, and the expression level of the PKR gene or the activity level of its protein is higher than that of the normal control sample, a DNA-damaging agent for the cancer patient And providing drug selection information to administer the PKR inhibitor.

The PKR inhibitor may be an imidazolo-oxindole compound, 2-aminopurine (2-AP), the entire nc886 gene consisting of the nucleotide sequence of SEQ ID NO: 1, or a partial gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2.

The DNA-damaging agent is an anthracycline drug, platinum anticancer drug, nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis-chloroethylnitrosourea , Streptozosine, busulfan or thiotepyl.

The PKR inhibitor may alleviate or reduce side effects caused by a DNA-damaging agent.

the expression level of the gene of nc886; And it is possible to provide a drug for cancer treatment or a kit for providing administration information thereof, including an agent capable of measuring the expression level of the gene of PKR or the activity level of the protein thereof.

The agent for measuring the expression of the gene may be an antisense oligonucleotide, a primer pair, or a probe.

The agent for measuring the activity of the protein may be an antibody that specifically binds to phosphorylation of PKR.

The present invention has the effect of reducing the cytotoxicity of the anticancer agent in general cells by co-administering nc886 and/or an inhibitor of PKR when treating cancer using a DNA-inhibiting agent-based anticancer agent such as doxorubicin. In addition, by measuring the expression and/or activity of nc886 and/or PKR, information on drugs for cancer treatment is provided, and thus there is an effect of more effectively treating cancer.

1 is a result of confirming the expression of nc886 during doxorubicin treatment, where A is H ₂ O ₂ (0.5 mM), doxorubicin (Doxo; 6 μM), desferrioxamine (DFX; 100 μM) and actinomycin D (actinomycin D) (ActD; 2 μg / ml) is the result of confirming the expression of nc886 by the Northern blot method after 8 hours treatment of the cell line (lanes 1 and 6 are untreated groups ("_ "), B to E are the results of Northern blot and EtBr staining of nc886, and the administration conditions are indicated in the figure.
Figure 2 is a result showing the cytotoxic effect of doxorubicin in the presence or absence of PKR, where A is the result of Western blot of the protein shown after doxorubicin administration, B is the MTT result for measuring the survival of cells, C and D are The results are Western blot results and MTT results after administration of doxorubicin after transfection with siRNA.
3 is a result showing the activation of PKR after doxorubicin treatment, where A is the result of the phosphorylation activity assay of PKR in vitro, B is the result of western blot of the indicated protein, and C is the result of luciferase assay measuring NF-κB activity. (24 hours after transfection with luciferase-expressing plasmid, cells were pretreated with 2-AP (2 mM) for 1 hour, and then replaced with medium containing doxorubicin (6 μM) for 8 hours), D Are the results of the luciferase assay described in panel C, excluding the treatment of 2-AP.
4 is a result showing the role of nc886 on PKR-mediated cytotoxicity during doxorubicin treatment, where A is the result of various assay methods that appear when transfected with anti-oligos (control and nc886-targeting) for 24 hours And B and C are Western results after a combination of doxorubicin treatment and transfection of nc886 RNA (in vitro transcript) (12 hours (HCT116) or 6 hours (Nthy-ori 3-1 for Western blot)). ), transfection and administration were performed simultaneously before harvesting cells in), D is the same experimental result as panel BC, except that the mutant nc886 was used, and E to F are Western blot and p53 null cells in HCT116 wt and p53 null cells. This is the result of Northern Blot.
5 is a result showing nc886/PKR-mediated apoptosis independent of vtRNAs or Vault complex, where A is a result of performing Northern and Western blots on the same part of each fraction after cell fractionation, and B is a standard performed in the same manner. Northern blot of vtRNA, Northern and Western blot results 24 hours after transformation of the indicated antioligo, D is Western blot after transfection of yeast tRNA ("-") and results of in vitro transcripts of vtRNA1-1 and nc886 E and F are the results of transfection of siRNA for MVP for 48 hours, and then MTT analysis (Panel F) for 24 hours by Western blot (panel E) or doxorubicin treatment.
6 is a result showing the removal of Pol III and inhibition by doxorubicin, where A and B are the results of Northern blot of the indicated Pol III gene, C is the qRT-PCR of the indicated Pol III gene, and D is aclarubicin (Acla, 6 μM), etoposide (Etopo; 30 μM) and doxorubicin (Doxo; 6 μM) 8 hours after treatment, and the result of Northern and Western blot, E is circular plasmid DNA or linear DNA expressing nc886 The expression of nc886 after 24 hours of transfection is a result of confirming the expression of nc886 by Northern blot, F is the qPCR result of the indicated genomic region bound to POLR3A after 2 hours treatment with 6 μM doxorubicin.
7 is a short pulse treatment of μM concentration of doxorubicin: as a result of application in a three-dimensional culture system and investigation in various cancer cells, A is a schematic diagram of a pulse treatment experiment, and B and C are performed as a schematic diagram in A Northern Blot and Western Blot results after performing, D is a brief summary and schematic diagram explaining how to create a three-dimensional culture system, E and F are the Northern and Western blot results described in Panel C, and G is the 791 cell line. IC ₅₀ values are plotted as a rank distribution plot in ascending order, and H is the dot plot result of the IC ₅₀ values of the parental cells (left circle) and doxorubicin endogenous agent (right triangle) collected from 6 species.
8 is a summary of the nc886/PKR pathway when treated with doxorubicin.

Hereinafter, the present invention will be described in detail.

The present inventors studied the effect of doxorubicin, a DNA-damaging agent family anticancer agent, on cancer cells/normal cells and the relationship between nc886/PKR. When doxorubicin was treated with cells, the expression of nc886 decreased and the activity of PKR increased, resulting in cell death, and it was found that the cause of this apoptosis is that PKR is activated through inhibition of nc886 rather than p53 induction (Fig. 1 To 4). nc886 is classified as a paralog of vault RNA (vtRNA), one of its aliases is vtRNA2-1, and Canonical vtRNA (vtRNA1-1, 1-2 and 1-3) is a huge ribotype called the bolt complex, which is associated with drug resistance in cancer cells. It is one of the components of the nucleic acid protein complex. Accordingly, the role of the vault complex in the possible relationship between doxorubicin sensitivity and the nc886/PKR pathway was investigated. As a result, the vault complex did not play a role in doxorubicin under administration conditions, despite the inhibition of standard vtRNA by doxorubicin ( Fig. 5). nc886 is transcribed by Pol III, and as a result of examining the mechanism for nc886 inhibition by doxorubicin using this, it was confirmed that doxorubicin inhibits Pol III transcription (FIG. 6). Even when the above experiment was performed in 3D cell culture, doxorubicin inhibited nc886 and induced apoptosis, and therefore, it is estimated that the nc886/PKR pathway will actually work in tumor cells in vivo (FIG. 7 ). As a result, it was confirmed that doxorubicin inhibits Pol III transcription, thereby inhibiting the expression of nc886, and increasing the activity of PKR, resulting in apoptosis (FIG. 8).

As described above, the present invention can alleviate or reduce the side effects of cancer treatment by administering an inhibitor of nc886 and/or PKR.

The PKR inhibitor may be an imidazolo-oxindole compound, 2-aminopurine (2-AP), the entire nc886 gene consisting of the nucleotide sequence of SEQ ID NO: 1, or a partial gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2.

The imidazolo-oxindole compound may be represented by Formula 1 below.

[Formula 1]

The 2-aminopurine (2-AP) may be represented by Chemical Formula 2.

[Formula 2]

The nucleotide sequence of nc886 consisting of the nucleotide sequence of SEQ ID NO: 1 may be "5-AGCGUUACCUCCUCAUGCCGGACUUUCUAUCUGUCCAUCUGUGCUGGGGUUCGAGACCCGCGGGUGCUUACUGACCCUUUU-3". nc896 used in the present invention is a functional equivalent of a nucleic acid molecule constituting the same, for example, nc886 Although some nucleotide sequences have been modified by deletion, substitution, or insertion, the concept includes a variant capable of functionally equivalent to the nc886 nucleic acid molecule.

The nucleotide sequence of some genes of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2 may be “5'-CAUGCCGGACUUUCUAUCUGUCCAUCUCUGUG-3”.

The ncRNA of the present invention may exist in a single-stranded or partially double-stranded form. In addition, the nucleic acid molecule of the present invention may be composed of RNA, DNA, peptide nucleic acids (PNA), or locked nucleic acid (LNA).

The nucleic acid molecule of the present invention may be isolated or prepared using standard molecular biology techniques, such as chemical synthesis or recombinant methods, or commercially available ones may be used. In addition, the composition of the present invention may contain not only the ncRNA nucleic acid molecule itself, but also other substances capable of increasing the expression rate of the ncRNA of the present invention in cells, such as compounds, natural products, novel proteins, and the like.

The cancer treatment may be a DNA-damaging agent, and the DNA-damaging agent may be an anthracycline drug, a platinum-based anticancer drug, a nitrogen mustard, cyclophosphamide, or melphalan. (melphalan), chlorambucil, bis-chloroethylnitrosourea, streptozosine, busulfan or thiotepine.

The anthracycline drug may be daunorubicin, doxorubicin, epirubicin, idarubicin, or mitoxantrone.

The cancers include lung cancer, colon cancer, colon cancer, rectal cancer, breast cancer, prostate cancer, bladder cancer, blood cancer, leukemia, myeloid leukemia, lymphoma, cervical carcinoma, osteosarcoma, glioblastoma, melanoma ( melanoma), pancreatic cancer, gastric cancer, liver cancer, kidney cancer, gallbladder cancer, biliary tract cancer, esophageal cancer, ovarian cancer or neuroblastoma.

In the cancer, the expression level of the nc886 gene is lower than that of the normal control sample, and the expression of the PKR gene or the activity of the protein thereof may be increased than that of the normal control sample.

The present invention can provide a cancer treatment adjuvant of a DNA-damaging agent comprising a PKR inhibitor.

The PKR inhibitor may be an imidazolo-oxindole compound, 2-aminopurine (2-AP), and a partial gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 1, and the entire nc886 gene or the nucleotide sequence of SEQ ID NO: 2.

The cancer treatment may be a DNA-damaging agent, and the DNA-damaging agent may be an anthracycline drug, a platinum-based anticancer drug, a nitrogen mustard, cyclophosphamide, or melphalan. (melphalan), chlorambucil, bis-chloroethylnitrosourea, streptozosine, busulfan or thiotepine.

The anthracycline drug may be daunorubicin, doxorubicin, epirubicin, idarubicin, or mitoxantrone.

The present invention also provides an expression level of the gene of nc886 comprising the following steps; And according to the expression level of the gene of PKR or the activity level of the protein thereof, a method of providing information on a drug for the treatment of cancer can be provided:

(a) the expression level of the gene or protein thereof of nc886 from a biological sample isolated from a cancer patient that is pathologically determined to be cancer; And measuring a gene expression level of PKR or an activity level of a protein thereof. And

(b) When the measured expression level of the nc886 gene is lower than that of the normal control sample, and the expression level of the PKR gene or the activity level of its protein is higher than that of the normal control sample, a DNA-damaging agent for the cancer patient And providing drug selection information to continue administration of the PKR inhibitor.

The pathologically determined cancer may be a cancer classified from stage 1 to stage 4 according to a tumor or node metasis (TNM) system.

The biological sample includes, but is not limited to, a sample such as tissue, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine.

The PKR inhibitor may be an imidazolo-oxindole compound, 2-aminopurine (2-AP), the entire nc886 gene consisting of the nucleotide sequence of SEQ ID NO: 1, or a partial gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2.

The DNA-damaging agent is an anthracycline drug, platinum anticancer drug, nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis-chloroethylnitrosourea, It may be streptozosine, busulfan or thiotepine.

The anthracycline drug may be daunorubicin, doxorubicin, epirubicin, idarubicin, or mitoxantrone.

The continued administration may be to continuously administer the DNA-damaging agent at a concentration of 1 to 50 micromolar, preferably at a concentration of 1 to 25 micromolar, and more preferably at a concentration of 6 micromolar.

In the present invention, "expression level measurement" is a process of checking the presence and expression of the gene in cancer tissue cells in order to determine the type of cancer, and is performed by measuring the amount of RNA. Analysis methods for this include, for example, reverse transcription polymerase reaction (RT-PCR), competitive reverse transcription polymerase reaction (Competitive RT-PCR), realtime reverse transcription polymerase reaction (Realtime RT-PCR), and RNase protection assay (RPA). ; RNase protection assay), Northern blotting, DNA chips, and the like, but are not limited thereto.

The agent for measuring the level of a gene in the present invention is preferably an antisense oligonucleotide, a primer pair or a probe. In the present invention, "antisense" refers to an oligomer consisting of nucleotides in which the antisense oligomer is hybridized with the target sequence in RNA by Watson-Crick base pairing, allowing the formation of typically mRNA and RNA: oligomer heterodimer within the target sequence. Refers to. Oligomers may have exact sequence complementarity or approximate complementarity to the target sequence. These antisense oligomers can block or inhibit the translation of mRNA and alter the processing of mRNA to produce splice variants of the mRNA.

In the present invention, the term "measurement of protein expression and activity thereof" refers to a process of confirming the presence and degree of expression of a protein expressed from the gene of the present invention in cancer tissue cells in order to confirm the progression of liver cancer. It is achieved by measuring. Analysis methods for this include Western blot, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, and rocket immunoelectrophoresis. , Tissue immunostaining, immunoprecipitation assay (Immunoprecipitation Assay), complement fixation assay (Complement Fixation Assay), flow cytometry (Fluorescence Activated Cell Sorter, FACS), protein chip, etc., but are not limited thereto. The agent for measuring the protein expression level in the present invention is preferably an antibody.

The PKR inhibitor may alleviate or reduce side effects caused by a DNA-damaging agent to normal cells. Doxorubicin is originally a DNA-damaging agent, and is therefore known to kill only dividing cancer cells, but according to the present invention, it is possible to explain the reason why unwanted side effects occur, in which normal cells are also killed by the nc886/PKR pathway. .

The present invention relates to the expression level of the gene of nc886 comprising the following steps; And a method of providing drug information for cancer treatment according to the expression level of the gene of PKR or the activity level of the protein thereof.

(a) the gene expression level of nc886 from a biological sample isolated from a cancer patient that is pathologically determined to be cancer; And measuring a gene expression level of PKR or an activity level of a protein thereof. And

(b) When the expression level of the gene of nc886 is higher than that of the normal control sample, and the expression level of the gene of PKR or the activity level of its protein is lower than that of the normal control sample, a DNA-damaging agent is administered to the patient for a short period of time. Providing drug selection information to be performed.

The short period may be, for example, 1 minute to 24 hours, preferably 10 minutes to 12 hours, more preferably 10 minutes to 2 hours, particularly preferably 20 minutes to 40 minutes, and most preferably It could be 30 minutes.

The cancers include lung cancer, colon cancer, colon cancer, rectal cancer, breast cancer, prostate cancer, bladder cancer, blood cancer, leukemia, myeloid leukemia, lymphoma, cervical carcinoma, osteosarcoma, glioblastoma, melanoma ( melanoma), pancreatic cancer, gastric cancer, liver cancer, kidney cancer, gallbladder cancer, biliary tract cancer, esophageal cancer, ovarian cancer or neuroblastoma. When targeting nc886/PKR, DNA damage can be minimized by treatment with a high concentration of doxorubicin in a short time, and thus minimal genotoxic effect of proliferating normal cells such as hematopoietic cells, hair follicle cells and intestinal epithelial cells. It may be sufficient to induce cell death while having

The DNA-damaging agent is a platinum-based anticancer drug, nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis-chloroethylnitrosourea, streptozosine, busulfan , Doxorubicin or thiotepine.

The present invention also relates to the expression level of the gene of nc886; And it is possible to provide a drug for cancer treatment or a kit for providing information on administration thereof, including an agent capable of measuring the expression level of the gene of PKR or the activity level of the protein thereof.

The drug information is information on a method of administering a DNA damaging agent and a PKR inhibitor in combination.

The information on the administration of the drug refers to the number of administrations, concentrations, etc., and when the expression of the nc886 gene is lower than that of the normal control sample, and the expression of the PKR gene or its protein activity is increased than that of the normal control sample, general It is lower than the dose of doxorubicin and refers to increasing the number and duration of administration.

The agent for measuring the expression of the gene may be an antisense oligonucleotide, a primer pair, or a probe.

The agent for measuring the activity of the protein may be an anti-agent that specifically binds to the phosphorylation of PKR.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example 1. Cell lines, antibodies and other reagents

All cell lines, antibodies and other reagents are described in Jeon SH et al., FEBS Lett 586: 3477-348 (2012b) and Lee K et al., RNA 17: 1076-1089 (2011) unless otherwise specified. It is described. Doxorubicin (doxorubicin), etoposide (etoposide) and aclarubicin (aclarubicin) were purchased from EMD Millipore, Sigma-Aldrich and Santa Cruz Biotechnology, respectively. H ₂ O ₂ and deferoxamine mesylate were purchased from Fisher Chemical and Sigma-Aldrich, respectively. Antibodies against total p53 and Chk2 were purchased from Santa Cruz Biotechnology, and phosphorylated antibodies against these antibodies were purchased from Cell Signaling Technology.

Example 2. Primers, Plasmid DNA, RNA and Transfection

The sequences for the PCR primers and Northern probes are summarized in Table 1 below. DNA expressing nc886 was a PCR amplified 649 nt PCR fragment containing a 101 nt nc886 transcript and a flanking sequence [271 nt and 277 nt on the 5'and 3'sides, respectively]. This fragment was inserted into the pCR4-TOPO vector (Invitrogen, Carlsbad, CA). The generated plasmid and PCR fragment were used in the transfection experiment of Fig. 6E. In the analysis of NF-κB luciferase using pNF-κB-Luc (Stratagene, La Jolla, CA), pRL-SV40 was infected together for standardization. As siRNAs for PKR and MVP, Stealth RNAi™ siRNA (Invitrogen), which is a target sequence of nt 343-367, 1054-1078 and 1228-1252 of PKR and nt 1067-1091 and 1908-1932 of MVP, was used. These siRNAs targeting different regions of the gene were equally mixed and transfected at a concentration of 40 nM. Anti-oligos against nc886 and standard vtRNA (vtRNA1-1, 1-2, 1-3) were used as a DNA-RNA mixmer with a modified sugar (2') and a phosphorothioate backbone. , Its target sequences are 5'-aucucugugcugggguucga-3' (nt 56-75 corresponding to nc886) and 5'-ggcuggcuuuagcucagcgg-3' (corresponding vtRNA of nt 2-21). These anti-oligos were transfected with 200 nM. For structural experiments (Figures 4B-D and 6C), in vitro transcribed nc886 and vtRNA were prepared as described in (Non-Patent Document 015), and yeast tRNA was purchased from Applied Biosystems / Ambion (Carlsbad, CA). Short RNAs (siRNAs, antioligos and in vitro transcripts) were transfected with Lipofectamine™ RNAiMAX reagent (Invitrogen), and DNA was transfected with Lipofectamine™2000 reagent (Invitrogen).

Sequence listing for PCR primers and Northern probes Primer sequence nc886 for PCR Forward CGGGTCGGAGTTAGCTCAAGCGG Backward AAGGGTCAGTAAGCACCCGCG nc886 for northern blot probe AAGGGTCAGTAAGCACCCGCG

Example 3. Luciferase assay, cell proliferation assay and in vitro kinase assay

All these analyzes were performed as described in Kunkeeaw N et al., Oncogene 32: 3722-3731 (2013) and Lee K et al., RNA 17: 1076-1089 (2011). All quantitative assays (MTT assay, luciferase assay, qRT-PCR and ChIP-PCR) were repeated 3 times to calculate the mean, standard deviation and p-value (both t-test).

Example 4. Intracellular fractionation

Subcelluar fractionation was performed as disclosed in Kickhoefer VA et al., J Biol Chem 273: 8971-8974 (1998) and Lee K et al., RNA 17: 1076-1089 (2011). The harvested cells (~5*?* ⁷ ) are 1mM PMSF (phenylmethylsulfonyl fluoride) containing buffer A (50mM Tris-Cl (pH 7.4), 1.5mM MgCl ₂ , 75mM NaCl, 0.5% Nonidet P-40) 1.2ml And 0.1 ml of 10 mM ribonucleoside-vanadyl complex (New England Biolabs, Ipswich, MA) and 200 unit/ml RNase inhibitor from human placenta (New England Biolabs) I did. All subsequent steps were carried out at 4°C. The resuspended cells were lysed for 10 minutes and centrifuged for 10 minutes at 6,000 xg in a TLA-55 rotor using an Optima TLX ultracentrifuge. The pellet was the nuclear fraction (indicated as "P10" in Figure 6A). The supernatant was bulk cytoplasm, and fractionated by centrifugation at 100,000× for 1 hour, and the resulting supernatant (designated “S100”) was separated from the pellet (designated “P100”). The P10 and P100 fractions were resuspended in RIPA buffer for subsequent RNA preparation or western blotting with Trizol reagent. The same amount of isopropanol was added to concentrate the S100 fraction, followed by centrifugation (at a rate of 12 krpm for 10 minutes). RNA was extracted from the obtained pellet with Trizol reagent. Aliquots of the S100 fraction were loaded directly for western blotting.

Example 5. CHIP assays

ChIP analysis was performed as previously described [Park K et al., J Leukoc Biol 91: 245-257 (2012)]. Briefly, cells are crosslinked with 1% formaldehyde and expansion buffer [5 mM PIPES (pH 8.0), 85 mM KCl, 0.5% Nonidet P-40] and buffer A [10 mM Tris-HCl, 2 mM EDTA, 0.2 % Sodium dodecyl sulfate was sonicated using Bioruptor. Chromatin samples were diluted with Buffer B [10 mM Tris-HCl (pH 8.0), 2% Triton X-100, 280 mM NaCl, 0.2% deoxycholate], and immunoprecipitated with an antibody against POLR3A. Chromatin-antibody complexes were removed with ProteinA/G Dynabeads. After treatment with proteinase K and reversing crosslinking, the amount of immunoprecipitated DNA was measured by real-time PCR. Chip primers are shown in Table 2 below.

Sequence listing for chip primers gene Base sequence nc886 Left CCAGCACAGAGATGGACAGA nc886 PCR primer for POLR3A ChIP Right GTCCCTCTCCACATCGTCAC nc886 PCR primer for POLR3A ChIP Vtrna1 Left AGTCTGGAAGCGAAGGAGGT vtRNA1-1 PCR primer for POLR3A ChIP Right ATGACTCAGCGACCAGGACT vtRNA1-1 PCR primer for POLR3A ChIP GAPDH Left CGGCTACTAGCGGTTTTACG GAPDH PCR primer for POLR3A ChIP Right GCTGCGGGCTCAATTTATAG GAPDH PCR primer for POLR3A ChIP

Example 6. 3-D cell culture

For 3-D cell culture, n3D Biosciences' BiO AssayTM kit was processed according to the manufacturer's instructions. Briefly, monolayer cultured 3.3 × 10 ⁶ cells were treated with NanoShuttleTM-PL for 200 hours for 16 hours, trypsinized, and then magnetically levated in 6-wells for 24 hours. The suspended cells were suspended in 2 ml of culture solution (per 6-well), resuspended by pipetting, and bioprinted in 96-wells (2.0 x 10 ⁵ cells per 96-well) and ring driven for 30 minutes. And doxorubicin was treated. A schematic diagram of the 3-D cell culture is disclosed in FIG. 7D.

Example 7. nc886 expression decreases upon treatment with doxorubicin

As a first step in determining the role of nc886, we investigated the biological situation in which nc886 expression was altered. To this end, HBE135-E6E7 (partially modified lung epithelial cell line) and HCT116 (colorectal cancer cell line) were treated with H ₂ O ₂ (oxidative stress inducer), desferrioxamine (hypoxia-like compound) and doxorubicin. Different stress conditions were tested. For comparison, the treated transcription inhibitor Actinomycin D inhibited nc886 expression as expected (Fig. 1A). Doxorubicin was as effective as actinomycin D in inhibiting nc886 expression, but H ₂ O ₂ and desferrioxamine had little effect (FIG. 1A). Dose titration experiments of the present invention showed that high concentrations (at least 3 μM or more) of doxorubicin were required to reduce nc886 (FIG. 1B ). It should be noted that this concentration is similar to the clinically relevant concentration. After bolus injection of doxorubicin to the patient, the maximum plasma concentration ranged from 5 to 25 μM. nc886 was noticeably reduced after 2 hours treatment and was barely observed after 4-8 hours (Fig. 1C). After the expression of nc886 disappeared at 8 hours, it was observed that even when the medium containing doxorubicin was replaced with a fresh medium, the expression of nc886 did not recover after 36 hours (FIG. 1C). The above time course data show that doxorubicin blocks nc886 transcription almost immediately upon treatment, given that the half-life of nc886 is 1-2 hours.

Example 8. PKR contributes to doxorubicin-induced cell death.

Doxorubicin has been shown to induce the PKR pathway and ultimately apotosis. In the case of human-derived cells, experimental evidence for the contribution of PKR to the apoptosis pathway was mainly based on experiments inducing knockdown (KD) using small interfering (or hairpin) RNA (siRNA or shRNA). This role of PKR was supported by experiments on PKR KO cells generated from original Nthy-ori 3-1 cells (PKR wt) by CRISPR-Cas technology (Western blot of PKR in Fig. 2A). Doxorubicin treatment induces apoptosis-related proteins such as caspase-3 and cleaved poly (ADP-ribose) polymerase (PARP) in PKR wt cells, Expression of this protein was significantly attenuated in PKR KO cells (Fig. 2A). Similar induction of p53 and Chk2 (indicated in its phosphate form in Figure 2A) in PKR wt and KO cells was that doxorubicin was equally effective in these two cell lines. It has been shown that apoptosis data may not be due to differences in DNA damage response. In addition, when the amount of doxorubicin was treated in an appropriate amount, MTT assays were performed to measure cell survival (FIG. 2B). PKR KO cells were more resistant to doxorubicin than PKR wt (IC ₅₀ value = 22.83 vs 6.49 μM, respectively), but these two cell lines proliferated similarly under normal growth conditions. Since PKR KO cells were clonally selected and maintained for a long time, it is likely that these cells acquired a genetic or epigenetic mutation that could inadvertently cause doxorubicin resistance. To rule out this possibility, we measured doxorubicin sensitivity after acute PKR KD by siRNA in HCT116 cells. SiRNA against PKR effectively inhibited PKR expression (Fig. 2C). Importantly, PKR KD increased the IC ₅₀ value by about 3.5 times similar to the PKR KO data (FIG. 2D ). The data clearly showed that PKR plays an important role in doxorubicin-induced cell death.

Example 9. Doxorubicin activates PKR.

PKR autophosphorylation, a characteristic of PKR activation, was determined by in vitro kinase assay. In this assay, PKR immunoprecipitation (IP) active PKR molecules were radiolabeled and digested on an SDS-polyacrylamide gel (Fig. 3A). The band with an asterisk is PKR because it moves to the correct position and is not detected in PKR KO Nthy-ori 3-1 cells (the right two lanes in Fig. 3A). PKR was phosphorylated in HCT116 and Nthy-ori 3-1 (PKR wt) cells than when treated with doxorubicin. PKR activation was confirmed by phosphorylation of eIF2α (Figure 3B) and activation of the NF-κB pathway (Figure 3C-D) as assessed in a luciferase reporter assay using an NF-κB responsive promoter. (phosphorylation of eIF2α and activation of the NF-κB pathway) are downstream pathways of PKR. Induction of NF-κB by doxorubicin treatment was negated by 2-aminopurine (2-AP), a PKR inhibitor (Fig. 3C) PKR KO Nthy-ori 3-1 cells were almost invisible, so it was thought to be due to PKR activation (Fig. 3D) As shown in the above data, doxorubicin activates PKR and its downstream pathways.

Example 10. Doxorubicin activates PKR not through p53 induction but through nc886 inhibition

The data showed that doxorubicin treatment inhibited nc886 expression. Since nc886 is a PKR inhibitor, it was hypothesized that nc886 inhibition is the underlying mechanism of doxorubicin-mediated PKR activation. Several experiments were performed to prove the hypothesis. First, the nc886 KD experiment was performed using a modified antisense oligonucleotide (anti-oligo) to confirm that the deficiency of nc886 induces the same cellular response as doxorubicin treatment. nc886 targeting anti-oligo (anti-nc886) inhibited nc886 compared to anti-control (Northern blot; top panel in Fig. 4A) and as confirmed by in vitro kinase assay (middle panel in Fig. 4A). PKR activation was induced. nc886 KD was sufficient to induce apoptosis and inhibit cell proliferation in PKR wt cells (bottom panel of FIG. 4A). This phenotype of nc886 KD occurred through PKR activation as it did not occur in PKR KO cells (compare lanes 2 and 4 in the left panel of Figure 4A). Similar results were confirmed in HCT116 (right panel in Figure 4A). nc886 KD showed the same effect as doxorubicin treatment in PKR activation and thus induction of cell death. Doxorubicin elicits a pleiotropic effect. The contribution of nc886 was discriminated, and whether doxorubicin-mediated cytotoxicity was alleviated by ectopic expression of nc886 was investigated. Since nc886 expression as a Pol III transcript is induced by a promoter element inside the gene, expression from exogenous DNA was also suppressed by doxorubicin (Fig. 6E). Therefore, the strategy for nc886 expression in the presence of doxorubicin was to deliver it as a form of in vitro transcript. Apoptosis induced by doxorubicin was attenuated when the nc886 transcript was transfected with HCT116 and Nthy-ori 3-1 (PKR wt) cells, but not in Nthy-ori 3-1 (PKR KO) cells (Fig. 4B-C). ). The role of nc886 in the PKR pathway was confirmed by testing two versions of nc886 (PKR testing wt and other mutations with mutations at 46-56 in contact with nc886 ("mut_46-56")) (Figure 4D ). This mutant did not have PKR binding. Doxorubicin-induced apoptosis was shown by caspase-3 induction and was relieved by wt nc886, but not mut_46-56 (Fig. 4D). All of the above data clearly show that PKR activation by nc886 inhibition plays an important role in the cellular response to doxorubicin. In a previous report [Yoon CH et al., Proc Natl Acad Sci U S A 106: 7852-7857 (2009)], the expression and activity of PKR was induced p53-dependently by doxorubicin. Therefore, p53 wt and null HCT116 cells (p53 +/+ and p53 -/-), the same pair of cell lines disclosed in previous reports [Yoon CH et al., Proc Natl Acad Sci USA 106: 7852-7857 (2009)]. p53 Western blot) to investigate this possibility. These two cell lines showed similar expression levels to nc886, which were inhibited by doxorubicin in the course of almost the same time (Fig. 4F). As a result, PKR was activated as indicated by eIF2α phosphorylation, inducing apoptosis (Fig. 4E). These events occurred to a similar extent in both cell lines. The fact that the overall PKR levels are the same in all lanes indicates that PKR is neither a transcriptional target of p53 nor induced by doxorubicin. The above results contradicted the Yoon paper ([Yoon CH et al., Proc Natl Acad Sci USA 106: 7852-7857 (2009)]), but as a result of repeating the experiment in the same HCT 116 cell line, another paper compared with the Yoon paper ( It is consistent with the literature [Rahman M et al., Cell Cycle 8: 3606-3607 (2009)]. Summarizing the results of FIG. 4, it was confirmed that inhibition of nc886 during doxorubicin treatment was a major cause of PKR activation and cytotoxicity resulting from the p53 state, regardless of p53 state. Nevertheless, since phosphorylation of eIF2α was slightly attenuated in p53 -/- cells in all studies, there is a possibility that p53 may play an important role in this pathway (Fig. 4E).

Example 11. The vault complex does not play a role in doxorubicin sensitivity.

nc886 is classified as a paralog of vault RNA (vtRNA) and one of its aliases is vtRNA2-1. Canonical vtRNA (vtRNA1-1, 1-2 and 1-3) is a component of a large ribonucleic protein complex called the vault complex, which is associated with drug resistance in cancer cells. Therefore, the role of the vault complex in the possible relationship between doxorubicin sensitivity and the nc886/PKR pathway was investigated. Subcellular fractionation separated the nuclear fraction ("P10" in Fig. 5A) and the soluble cytoplasmic fraction ("S100") from an insoluble cytoplasmic pellet ("P100") containing large complexes such as ribosomes and vault particles. The major component of the Vault Complex (Major Vault Protein, MVP) was only in P100 (Figure 5A). vtRNA1-1, not nc886, was found in P100. nc886 was present exclusively in S100 of HBE135-E6E7 cells, and in the case of HeLa cells, it was hardly detected due to RNA degradation during fractionation (see EtBr staining in Fig. 5A). However, in this case, vtRNA1-1 could be detected in P100. Perhaps because it was stably assembled in the Vault Complex and protected from RNA degradation. According to the above data, the nc886 was found to be physically unrelated to the bolt complex, consistent with previous reports. Like nc886, three standard vtRNAs were found that were inhibited by doxorubicin (Fig. 5B, compared with Fig. 1A). Although nc886 has been shown to be independent of the vault complex, the possibility still exists that the standard vtRNA (and vault complex) could play a role in doxorubicin sensitivity independent of nc886. This possibility was tested by KD and ectopic expression of vDRNA1-1 (Figs. 5C-D). The vtRNA1-1 KD by the anti-oligo did not activate PKR (appeared to be lack of phospho-eIF2α) and neither induced apoptosis (FIG. 5C ). Introduction of transcribed vtRNA1-1 in vitro did not alleviate cell death induced by doxorubicin (FIG. 5D ). By comparing the results with nc886 in the same experiment and reproducibly observing the positive effect of nc886, it was confirmed that the lack of this effect of vtRNA1-1 in the two experiments was true. In addition, siRNA-mediated KD of MVP did not affect the IC ₅₀ value of doxorubicin in Nthy-ori 3-1 cells (Fig. 5E-F). Collectively, we conclude that the vault complex does not play a role in doxorubicin in our administration conditions despite the inhibition of standard vtRNA by doxorubicin.

Example 12. Doxorubicin Inhibits Pol III Transcription

The mechanism for nc886 inhibition by doxorubicin was investigated. nc886 is transcribed by Pol III. Previous studies have concluded that when doxorubicin is introduced into an in vitro transcription assay, doxorubicin inhibits the transcription of Pol III. However, this observation has so far not been pursued in any further studies and thus the biological significance has not yet been elucidated. So, doxorubicin was treated and Pol III transcribed ncRNA (indicated as "Pol III gene") in addition to nc886 was measured. The steady state 5S rRNA and tRNA were not affected by doxorubicin (Fig. 6A), probably because they are very rich and stable RNAs. So we turned our attention to other Pol III genes and decided to measure a standard vtRNA with a half-life similar to that of nc886. Upon treatment with doxorubicin, the three vtRNAs and nc886 were reduced with almost the same kinetics (Figs. 6A-C). Precursor-tRNAs (Pre-RNAs) are considered the most sensitive indicators of Pol III transcription rates. This is because intermediates are processed and the half-life is very short. The expression levels of the two pre-tRNAs decreased almost completely within 1 hour (purple line in Fig. 6C). All of these data strongly suggested that Pol III transcripts on a global scale were stopped immediately after doxorubicin treatment. PolII transcribed ncRNA of essential cellular functions (5S rRNA and tRNA in Fig. 6A) did not decrease within several hours of doxorubicin treatment, and thus cannot explain the acute cytotoxic effects observed in this study. The question was then how doxorubicin broadly suppresses the expression of the Pol III gene. Doxorubicin stresses DNA/chromatin in several ways. It intercalates into the DNA to create a topological tension. Another well-known effect of doxorubicin is topoisomerase II (topo II) poisoning. Captures topo II and prevents ligation in the double-stranded form. Cellular consequences of this effect are DNA stand breakage, histone removal from chromatin, DNA damage response, and cell death. To identify which of the above causes is responsible for inhibition of Pol III transcription, three different compounds were compared. Aclarubicin, one of the anthracycline drugs composed of planar aromatic moieties, is a DNA intercalator. However, unlike doxorubicin, it is not a topo II toxic substance. Therefore, if DNA breakage occurs, it cannot be attributed to the topo II poisoning mechanism. Controversy has been raised as to whether Aclarubicin causes DNA destruction, because contradictory data have been obtained from several studies. The non-anthracycline compound etoposide does not intercalate in DNA and acts as topo II toxicity. The properties of these three drugs are summarized in Figure 6D. When the drug was treated with the treatment dose [6 μM aclarubicin, 30 μM etoposide, and 6 μM doxorubicin], doxorubicin and aclarubicin inhibited nc886 expression, whereas etoposide did not (Fig. 6D In the left panel). Phosphorylation of p53 and Chk2 was observed in all three drugs (right panel in Fig. 6D), indicating that all treatments were effective and that nc886 inhibition was not due to the aftermath of the DNA damage response. Etoposide data demonstrated that inhibition of Pol III transcription was not due to topo II poisoning or DNA breakage. Intercalation of tracycline drugs (including doxorubicin and aclarubicin) into DNA results in DNA distortion that can interfere with the action of Pol III (e.g., renal polymerization stage). To test this possibility, circular plasmid DNA and linear DNA for nc886 expression were compared. When topological tension is the cause, circular DNA is more affected than linear DNA. The transcription of nc886 from the two DNA templates was similarly suppressed by doxorubicin (Figure 6E), suggesting that topological interference is an unlikely mechanism. Another result of intercalation of anthracycline drugs into DNA is the dissociation of the DNA-binding protein. In fact, doxorubicin and aclarubicin are known to evict histones from DNA, and etoposides are known to not. Therefore, it was speculated that these two drugs would eliminate Pol III, as in the case of histones. According to the results of chromatin immunoprecipitation (ChIP) using the Pol III subunit (POLR3A), Pol III did not bind to the Pol II gene, GAPDH, but to the Pol III gene, nc886 and vtRNA1-1. And this binding was reduced by doxorubicin (Fig. 6F).

Example 13. Optimization of doxorubicin treatment for the nc886 / PKR pathway and application in a three-dimensional (3-D) cell culture system

Overall from the above data (Figure 6), transcription of nc886 was stopped immediately after doxorubicin treatment. That is, a short pulse treatment is sufficient to activate the nc886 / PKR pathway and apoptosis. This possibility was tested by treating the cells with doxorubicin and replacing them with doxorubicin-free medium at 15, 30 and 60 minutes (see Fig. 7A for experimental design). 30 minutes was sufficient time for doxorubicin to inhibit nc886 and induce cell death in a PKR-dependent manner (Figs. 7B-C). The DNA damage response measured by phospho-Chk2 was not significantly induced until 30 minutes, but was slightly induced at 60 minutes in PKR wt cells (lanes 1 to 3 in lane 7 and lanes 4 in FIG. 7C). For comparison, in PKR KO cells, phospho-Chk2 was observed and apoptosis was induced at night at 30 and 60 minutes (lanes 7-8 in FIG. 7C). It was not known why the DNA damage response was more proficient in PKR KO than in PKR wt cells. Nevertheless, in the presence of PKR, the nc886/PKR pathway was dominant in inducing apoptosis, but the effect of the DNA damage response was minimal at 30 min pulse treatment.

To date, experiments have been performed on two-dimensional monolayer cell cultures that differ significantly from the in vivo tumor environment in many aspects, including drug sensitivity. Cells cultured in three dimensions are closer to physiology in vivo. So, we tried to investigate the nc886/PKR pathway in 3D culture. A recently developed protocol that is more convenient and superior to other methods was used. In this technique, cells are coated with magnetic nanoparticles and floated by applying a magnetic field. Levitated cells form a 3-D structure with the extracellular matrix and are printed in vivo on a plate (see Fig. 7D for schematic and actual images). Doxorubicin inhibits nc886 and induces apoptosis in continuous and pulsed treatments (lanes 1 and 3-4 of FIGS. 7E-F, respectively) for three-dimensional cultures, indicating that the nc886/PKR pathway works in 3-D cultured cells Suggests, and may also be possible in tumor cells in vivo.

Example 14. Treatment with μM concentration of doxorubicin can be widely applied to tumor cells except for a subset of cells, especially the silent nc886.

6 μM doxorubicin is expected to be effective in most cancer cells based on available data. Doxorubicin was searched for in the cancer drug database (http://www.cancerrxgene.org/) and the IC ₅₀ value of the 931 cell line was downloaded. In addition, CpG methylation data were obtained in the 957 cell line in a published study. Comparison of the two data sets showed IC ₅₀ values and methylation values in 791 cell lines. When the IC ₅₀ values were sorted in ascending order (FIG. 7G ), there were 27 cell lines with IC ₅₀ > 6 μM. Even slightly lowering the IC ₅₀ cutoff (1.5 μM), only 83 cells (10.5%) met this criterion. The main problem with chemotherapy is the emergence of drug resistant cells, and consequently the recurrence of malignant tumors. In several reports, these resistant cells have been developed either by gradually increasing drug concentrations after chemotherapy or by isolation from recurrent tumors in patients. IC ₅₀ values were collected from the original cells and doxorubicin resistance induced cell lines through literature investigation and displayed in dot plots (Fig. 7H and Table 3). All parental cells (38 of 38) and most of the cells (60 of 71 84.5%) in the doxorubicin-resistant group had an IC ₅₀ of less than 6 μM, and treatment conditions (30 min at 6 μM) were also applied to recurrent tumors. It is very effective. The effective doxorubicin concentration for apoptosis by nc886/PKR was about 6 μM, and there are a few doxorubicin-resistant cell lines (eg, 83 cell lines in FIG. 7G) with an IC ₅₀ value higher than this concentration. Although nc886 and PKR are mostly expressed in normal human tissues, previous studies have shown that the nc886/PKR pathway does not work in all tumors. The characteristic of nc886 is the silencing of CpG DNA and methylation in some malignant cells. This feature is interesting and unique among Pol III genes. In theory and based on the above data, this silencing would have caused cell death since PKR was activated. However, nc886-silenced in vitro and nc886-silenced tumor cells exist. Previous work has explained this by a tumor surveillance model. In this model, this cell death would have occurred to ensure the elimination of precancerous cells that would have contributed to a reduction in the incidence of cancer. However, certain cells acquire genetic/epigenetic modifications, such as overexpression of eIF2B, which counteracts the apoptotic effects of phospho-eIF2α, can bypass the PKR cell death pathway. Only those cells survived nc886 silencing and developed into malignant cells that are clinically detectable and can be isolated in vitro. It was assumed that these cells had lost the PKR pathway for cell death and therefore tended to be resistant to doxorubicin, especially at μM concentrations. Since nc886 is neither microRNA nor mRNA, it is difficult to estimate its expression level from public sequence or sequencing data. Therefore, the CpG methylation value was investigated as a proxy indicator of nc886 silencing. nc886 contains a CpG island (-189 to +82, the 5'end of the nc886 manuscript is the +1 reference point), and 10CpG sites within or near this island were analyzed. The average of 10 sites was calculated and considered >90% to be hypermethylated. In this analysis (pie chart of Fig. 7G), only 86 of the 632 doxorubicin sensitive (IC ₅₀ <0.6) cell lines were nc886- and methylated (12.0%). As a result of performing the same analysis in the doxorubicin-resistant (IC ₅₀ > 1.5) cell line, enrichment of hypermethylated cells was observed at a statistically significant level (p = 0.041), 20 times (19.4%) of 83 times. These data supported that the PKR cell death pathway was defective in nc886-silenced cells, which would contribute to resistance to doxorubicin.

Claims (16)

As a composition for alleviating or reducing the side effects of cancer treatment, which is a DNA damaging agent, comprising nc886,
The DNA-damaging agents include anthracycline drugs, platinum anticancer drugs, nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis-chloroethylnitrosourea, streptozosin, and Pan or thiotepine DNA-damaging agent (DNA damaging agent) a composition for alleviating or reducing the side effects of cancer treatment. delete delete delete The method of claim 1, wherein the anthracycline drug is daunorubicin, doxorubicin, epirubicin, idarubicin, or mitoxantrone, for alleviating or reducing side effects of cancer treatments, which are DNA damaging agents. Composition. The method of claim 1, wherein the cancer is lung cancer, colon cancer, colon cancer, rectal cancer, breast cancer, prostate cancer, bladder cancer, blood cancer, leukemia, myeloid leukemia, lymphoma, cervical carcinoma, osteosarcoma, glioblastoma ( glioblastoma), melanoma, pancreatic cancer, gastric cancer, liver cancer, kidney cancer, gallbladder cancer, biliary tract cancer, esophageal cancer, ovarian cancer, or neuroblastoma, a DNA damaging agent. Composition for alleviating or reducing. As an adjuvant composition for cancer treatment, which is a DNA damaging agent, comprising nc886,
The DNA-damaging agents include anthracycline drugs, platinum anticancer drugs, nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis-chloroethylnitrosourea, streptozosin, and Pan or thiotepine DNA-damaging agent (DNA damaging agent) cancer treatment adjuvant composition. delete delete (a) the expression level of the gene or protein thereof of nc886 from a biological sample isolated from a cancer patient that is pathologically determined to be cancer; And measuring a gene expression level of PKR or an activity level of a protein thereof. And
(b) When the measured expression level of the nc886 gene is lower than that of the normal control sample, and the expression level of the PKR gene or the activity level of its protein is higher than that of the normal control sample, a DNA-damaging agent ) Providing drug selection information to administer a cancer therapeutic agent and a PKR inhibitor;
Including, the expression level of the gene of nc886; And a method of providing drug information for cancer treatment according to the expression level of the gene of PKR or the activity level of the protein thereof. delete The method of claim 10, wherein the DNA-damaging agent is an anthracycline-based drug, a platinum-based anticancer drug, a nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis- The expression level of the gene of chloroethylnitrosourea, streptozosine, busulfan or thiotepine, nc886; And a method of providing drug information for cancer treatment according to the expression level of the gene of PKR or the activity level of the protein thereof. delete the expression level of the gene of nc886; And an agent capable of measuring the expression level of the gene of PKR or the activity level of the protein thereof, a DNA-damaging agent, a cancer therapeutic agent Or a kit for providing information on its administration. The cancer therapeutic agent according to claim 14, wherein the agent measuring the expression of the gene is an antisense oligonucleotide, a primer pair or a probe, a DNA damaging agent. Or a kit for providing information on its administration. The cancer treatment according to claim 14, wherein the agent measuring the activity of the protein is an antibody that specifically binds to phosphorylation of PKR, a DNA damaging agent. Or a kit for providing information on its administration.

Images