KR20200069185A - nc886 and/or PKR inhibitors as ancillary agents for anti-cancer drugs and methods to provide improved regimens for them - Google Patents

Abstract

The present invention relates to an anti-cancer adjuvant containing nc886 and/or a PKR inhibitor, and a method for providing information of drugs for treating cancer. The present invention has an effect of alleviating cytotoxicity of an anticancer agent in normal cells and has an effect of treating cancer more effectively.

Description

nc886 and/or PKR inhibitors as ancillary agents for anti-cancer drugs and methods to provide improved regimens for them}

The present invention relates to an anti-cancer adjuvant comprising nc886 and/or a PKR inhibitor, and a method for providing information on drugs for the treatment of cancer.

Cancers are largely classified as blood cancers and solid cancers. Lung cancer, gastric cancer, breast cancer, oral cancer, liver cancer, uterine cancer, esophageal cancer, skin cancer, etc. occur almost anywhere in the body. Targeted therapies are used in the treatment of certain cancers, but to date, chemotherapy agents that suppress surgery or radiation therapy and cell proliferation are the main methods. For example, Korean Patent Publication No. 10-2014-0090500 discloses a 2-(phenylethynyl)thieno[3,4-b]pyrazine derivative and a pharmaceutical composition for preventing or treating cancer comprising the same, Korean Patent Publication No. 10-2017-0143457 discloses a novel imidazopyridine derivative, a method for manufacturing the same, and a pharmaceutical composition for preventing or treating cancer containing the same as an active ingredient.

Chemotherapy using cytotoxic drugs has traditionally been used as an important treatment for cancer patients. Doxorubicin, an anthracycline antibiotic-based compound, is one of the most effective anticancer drugs and has been the first choice to treat a wide variety of malignant tumors for almost half a century. In general, doxorubicin induces apoptosis as a result of genetic toxic effects such as DNA adduct formation, DNA intercalation, interference with topoisomerase II action and formation of free radicals. It was thought to be. Although doxorubicin has been used extensively and clinically for a long time, the exact mechanism of its cytotoxicity remains controversial. Doxorubicin has different therapeutic effects depending on the treatment dose, duration of treatment, and tumor type.

PKR (Protein Kinase R) is an interferon-inducing serine/threonine kinase. PKR is present in most mammalian cells in a latent state and is activated by the viral genome itself or by double-stranded RNA (dsRNA) produced during viral replication and transcription. When PKR binds to dsRNA, PKR is dimerized and phosphorylated. Phosphorylated PKR is an active kinase that phosphorylates elF2α, the most well-known substrate, thereby stopping precursor synthesis and consequently apoptosis. The above action is a PKR-mediated antiviral response to block virus-infected cells. However, the PKR route is much more complicated than the above. In addition to dsRNA, PKR is controlled by cellular and external factors that play an important role in various signal transduction pathways such as NF-κB, p53, STAT1, and protein. Because these cell pathways are important in determining cell death and cell proliferation, PKR is an important gene in cancer pathology. When there is a problem in controlling cell death due to abnormal PKR, it is not only important in tumor development itself, but also a decisive factor in the resistance of cancer cells to cancer treatment. There are many studies showing that PKR is activated during doxorubicin treatment and promotes cell death. Therefore, PKR plays an important role in cell death not only in viral infection but also in doxorubicin treatment. Given that doxorubicin induces genetic toxicity to the nucleus, the mechanism by which doxorubicin activates PKR is unknown.

The present inventors identified non-coding RNA that binds to PKR and inhibits the activity of PKR. nc886 is transcribed by RNA polymerase III (Pol III) and expressed in normal human tissue. The expression level of nc886 is generally increased in cancer cells, but in some malignant tumors, it is completely silenced by CpG DNA and methylation. The present inventors completed the present invention, confirming that nc886 is an important signal molecule that links PKR and doxorubicin in therapeutic cell suicide.

Basically, it was known that doxorubicin induces apoptosis by targeting only cancer cells that DNA divides by damaging DNA. The present inventors studied the action of nc886 and PKR when treating doxorubicin on cells. As a result, treatment with doxorubicin inhibited Pol III transcription and thereby decreased expression of nc886, resulting in increased phosphorylation of PKR, resulting in cell death. It was confirmed that such apoptosis is another aspect of the therapeutic cell death activity of doxorubicin. Since normal cells express nc886 and PKR, they may die due to the above-described activity of doxorubicin, and therefore, the PKR inhibitor should be treated with doxorubicin to prevent the death of the normal cells.

Alternatively, by applying doxorubicin to target nc886/PKR, cancer cells can be killed. Since nc886 is generally increased in cancer cells, it is estimated that nc886 reduction and apoptosis due to PKR activity are more likely to occur than normal cells. In this case, doxorubicin treatment at a high concentration/short-term treatment minimizes DNA damage and reduces nc886/PKR. Induced apoptosis. The advantage of this method is that it can minimize damage to normal cells (hair cells or blood cells) that divide. The above facts were confirmed and the present invention was completed.

It is an object of the present invention to provide a composition for alleviating or reducing side effects of a cancer therapeutic agent comprising nc886 and/or PKR inhibitors.

Another object of the present invention is to provide a cancer treatment adjuvant of a DNA-damaging agent comprising nc886 and/or a PKR inhibitor.

The present invention provides the expression level of the gene of nc886 comprising the following steps; And it provides a method for providing information on drugs for cancer treatment according to the expression level of the gene of PKR or the activity level of the protein thereof.

(a) the level of gene or protein expression thereof of nc886 from a biological sample isolated from a cancer patient pathologically judged to be cancer; And measuring the gene expression level of PKR or the activity level of the protein thereof. And

(b) DNA-damaging agent to the cancer patient when the measured expression level of the nc886 gene is lower than the normal control sample, and the expression level of the gene of PKR or the activity level of the protein thereof is higher than the normal control sample. And providing a drug selection information, to administer the PKR inhibitor.

Another object of the present invention is the expression level of the gene of nc886; And it provides a kit for providing information of a drug or its administration for the treatment of cancer, comprising an agent capable of measuring the expression level of the gene of PKR or the protein's activity level.

The present invention is a composition for alleviating or reducing side effects of a cancer therapeutic agent comprising nc886 and/or PKR inhibitors; And it can provide a method for providing information on drugs for the treatment of cancer.

The PKR inhibitor may be an imidazolo-oxindole compound, 2-aminopurine (2-AP), the entire gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 1, or some gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2.

The cancer treatment agent may be a DNA-damaging agent (damaging agnet).

The DNA-damaged agent is an anthracycline-based drug, a platinum-based anti-cancer drug, nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis-chloroethylnitrosourea, streptozosin, and laying Plate or thiotepine.

The anthracycline-based drug may be daunorubicin, doxorubicin, epirubicin, idarubicin, or mitoxantrone.

The cancer is lung cancer, colorectal cancer, colon cancer, rectal cancer, breast cancer, prostate cancer, bladder cancer, blood cancer, leukemia, myelogenous leukemia, lymphoma, cervical carcinoma, osteosarcoma, glioblastoma, melanoma ( melanoma), pancreatic cancer, stomach cancer, liver cancer, kidney cancer, gallbladder cancer, biliary cancer, esophageal cancer, ovarian cancer or neuroblastoma.

The present invention can also provide a cancer treatment adjuvant of a DNA-damaging agent comprising a PKR inhibitor.

The PKR inhibitor may be an imidazolo-oxindole compound, 2-aminopurine (2-AP), the entire gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 1, or some gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2.

The DNA-damaging agent is an anthracycline-based drug, a platinum-based anti-cancer drug, a nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis-chloroethylnitrosourea, It can be streptozosin, busulfan or thiotepine.

The present invention provides the expression level of the gene of nc886 comprising the following steps; And it provides a method for providing information on drugs for cancer treatment according to the expression level of the gene of PKR or the activity level of the protein thereof.

(a) the level of gene or protein expression thereof of nc886 from a biological sample isolated from a cancer patient pathologically judged to be cancer; And measuring the gene expression level of PKR or the activity level of the protein thereof. And

(b) DNA-damaging agent to the cancer patient when the measured expression level of the nc886 gene is lower than the normal control sample, and the expression level of the gene of PKR or the activity level of the protein thereof is higher than the normal control sample. And providing a drug selection information, to administer the PKR inhibitor.

The PKR inhibitor may be an imidazolo-oxindole compound, 2-aminopurine (2-AP), the entire nc886 gene consisting of the nucleotide sequence of SEQ ID NO: 1, or a partial gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2.

The DNA-damaging agent is an anthracycline-based drug, a platinum-based anti-cancer drug, a nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis-chloroethylnitrosourea , Streptozosin, busulfan or thiotefil.

The PKR inhibitor may alleviate or reduce side effects caused by DNA-damaging agents.

the expression level of the gene of nc886; And an agent capable of measuring the expression level of the gene of PKR or the activity level of the protein thereof, or a kit for providing information or a drug for the treatment of cancer.

The agent measuring the expression of the gene may be an antisense oligonucleotide, primer pair or probe.

The agent measuring the activity of the protein may be an antibody that specifically binds to the phosphorylation of PKR.

In the present invention, when treating cancer using a DNA-inhibiting agent-based anticancer agent such as doxorubicin, nc886 and/or PKR inhibitors are administered in combination to reduce the cytotoxicity of the anticancer agent in normal cells. In addition, by measuring the expression and/or activity of nc886 and/or PKR to provide information on drugs for cancer treatment, there is an effect that can more effectively treat cancer.

1 is a result of confirming the expression of nc886 when treating doxorubicin, A is H ₂ O ₂ (0.5 mM), doxorubicin (Doxo; 6 μM), desperioxamine (Dferferoxamine) (DFX; 100 μM) and actinomycin D (actinomycin D) (ActD; 2 μg / ml) is the result of confirming the expression of nc886 by the Northern blot method after 8 hours treatment on the cell line (lanes 1 and 6 are untreated group ("_) "), B to E are the results of staining Northern Blot and EtBr of nc886, and the administration conditions are shown in FIG.
2 is a result showing the cytotoxic effect of doxorubicin in the presence or absence of PKR, A is the result of Western blot of the protein after doxorubicin administration, B is the MTT result for measuring cell survival, C and D are Western blot result and MTT result after administration of doxorubicin after transfection with siRNA.
Figure 3 is a result showing the activation of PKR after doxorubicin treatment, A is the result of the phosphorylation activity analysis of PKR in vitro, B is the result of Western blot of the indicated protein, C is the luciferase analysis result of measuring NF-κB activity (24 hours after transfection of the luciferase-expressing plasmid, cells were pre-treated with 2-AP (2 mM) for 1 hour, and then replaced with a medium containing doxorubicin (6 μM) for 8 hours), D Is the result of the luciferase assay described in panel C, except for the treatment of 2-AP.
Figure 4 is a result showing the role of nc886 for PKR-mediated cytotoxicity in the treatment with doxorubicin, A is the result of various assay methods that appear when transfected with anti-oligos (control and nc886-targeting) for 24 hours And B and C are Western results after experiments combining doxorubicin treatment and transfection of nc886 RNA (in vitro transcript) (12 hours (HCT116) or 6 hours (Nthy-ori 3-1 for Western blot) ), the transfection and administration were performed simultaneously before the cells were harvested), D is the same experimental result as panel BC, except that the mutant nc886 was used, and E to F are Western blots from HCT116 wt and p53 null cells and It is the result of Northern Blot.
Figure 5 shows the results of nc886/PKR-mediated apoptosis independent of vtRNAs or Vault complex, A is the result of Northern and Western blot of the same portion of each fraction after cell fractionation, and B is the same standard Northern blot of vtRNA, Northern and Western blot results 24 hours after transformation of indicated anti-oligos, D is Western blot after transfection of yeast tRNA ("-") and results of in vitro transcripts of vtRNA1-1 and nc886 And E and F are the results of performing MTT analysis (Panel F) for 24 hours by transfection of siRNA for MVP for 48 hours, followed by Western blot (Panel E) or doxorubicin treatment.
6 is a result showing the removal of Pol III and inhibition by doxorubicin, A and B are the results of Northern blot of the indicated Pol III gene, C is qRT-PCR of the indicated Pol III gene, and D is aclarubicin (Acla, 6 μM), Etoposide (Etopo; 30 μM) and doxorubicin (Doxo; 6 μM) after treatment 8 hours after Northern and Western blot results, E is circular plasmid DNA or linear DNA expressing nc886 Is the result of confirming the expression of nc886 24 hours after transfection with Northern blot, and F is the qPCR result of the indicated genomic region bound to POLR3A after treatment with 6 μM doxorubicin for 2 hours.
7 is a short pulse treatment of doxorubicin at a concentration of μM: As a result of application in a 3D culture system and irradiation in various cancer cells, A is a schematic diagram of a pulse treatment experiment, B and C are performed as a schematic diagram on A Afterwards are Northern Blot and Western Blot results, D is a brief summary and schematic showing how to create a three-dimensional culture system, E and F are Northern and Western Blot results described in Panel C, and G is a 791 cell line. IC ₅₀ values are shown as rank distribution in ascending order, and H is a dot plot result of IC ₅₀ values of parent cells (left circle) and doxorubicin endocrine (right triangle) from which 6 species were collected.
8 is a result of summarizing the nc886/PKR pathway in doxorubicin treatment.

Hereinafter, the present invention will be described in detail.

The present inventors studied the effect of doxorubicin, a DNA-damaging agent-based anticancer agent, on cancer cells/normal cells and the relationship between nc886/PKR. When doxorubicin was treated with cells, the expression of nc886 decreased and the activity of PKR increased to kill the cells, and the cause of this cell death was that pkr was activated through inhibition of nc886, not p53 induction (FIG. 1). To 4). nc886 is classified as a paralog of vault RNA (vtRNA), one of its nicknames is vtRNA2-1, and canonical vtRNA (vtRNA1-1, 1-2 and 1-3) are giant ribos called volt complexes that are associated with drug resistance in cancer cells. It is one of the components of the nucleic acid protein complex. As a result of investigating the role of the vault complex in the possible relationship between doxorubicin sensitivity and the nc886/PKR pathway, the vault complex did not play a role in doxorubicin under the dosing conditions despite the inhibition of standard vtRNA by doxorubicin ( Fig. 5). nc886 is transcribed by Pol III, and a mechanism for inhibiting nc886 by doxorubicin is used to confirm that doxorubicin inhibits Pol III transcription (FIG. 6 ). Even when the above experiment was performed in 3D cell culture, doxorubicin inhibited nc886 and induced apoptosis, and thus it is estimated that the nc886/PKR pathway would also work on tumor cells in vivo (FIG. 7 ). As a result, as shown in FIG. 8, it was confirmed that doxorubicin inhibits Pol III transcription, thereby suppressing the expression of nc886 and increasing the activity of PKR, resulting in apoptosis (FIG. 8 ).

As such, the present invention can alleviate or reduce side effects of cancer therapeutics by administering inhibitors of nc886 and/or PKR.

The PKR inhibitor may be an imidazolo-oxindole compound, 2-aminopurine (2-AP), the entire gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 1, or some gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2.

The imidazolo-oxindole compound may be represented by Formula 1 below.

[Formula 1]

The 2-aminopurine (2-AP) may be represented by Formula 2.

[Formula 2]

The nucleotide sequence of nc886 consisting of the nucleotide sequence of SEQ ID NO: 1 may be “5-AGCGUUACCUCCUCAUGCCGGACUUUCUAUCUGUCCAUCUCUGUGCUGGGGUUCGAGACCCGCGGGUGCUUACUGACCCUUUU-3-3. Although some sequencing has been modified by deletion, substitution, or insertion, it is a concept that includes variants that can function functionally the same as the nc886 nucleic acid molecule.

The nucleotide sequence of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2 may be “5'-CAUGCCGGACUUUCUAUCUGUCCAUCUCUGUG-3".

The ncRNA of the present invention may exist in single-stranded or partially double-stranded form. In addition, the nucleic acid molecule of the present invention may be composed of RNA, DNA, peptide nucleic acids (PNA) or locked nucleic acid (LNA).

The nucleic acid molecule of the present invention may be separated or prepared using standard molecular biology techniques, for example, chemical synthesis methods or recombinant methods, or commercially available ones. In addition, the composition of the present invention may include not only the ncRNA nucleic acid molecule itself, but also other substances capable of increasing the expression rate of the ncRNA of the present invention in cells, for example, compounds, natural products, new proteins, and the like.

The cancer treatment may be a DNA-damaging agent (damaging agnet), the DNA-damaging agent (damaging agent) anthracycline-based drugs, platinum-based anti-cancer drugs, nitrogen mustard (nitrogen mustard), cyclophosphamide, melphalan (melphalan), chlorambucil, bis-chloroethylnitrosourea, streptozocin, busulfan or thiotepine.

The anthracycline-based drug may be daunorubicin, doxorubicin, epirubicin, idarubicin, or mitoxantrone.

The cancer is lung cancer, colorectal cancer, colon cancer, rectal cancer, breast cancer, prostate cancer, bladder cancer, blood cancer, leukemia, myelogenous leukemia, lymphoma, cervical carcinoma, osteosarcoma, glioblastoma, melanoma ( melanoma), pancreatic cancer, stomach cancer, liver cancer, kidney cancer, gallbladder cancer, biliary cancer, esophageal cancer, ovarian cancer or neuroblastoma.

In the cancer, the expression level of the nc886 gene is lower than that of the normal control sample, and the expression of the gene of PKR or the activity of its protein may be increased than that of the normal control sample.

The present invention can provide a cancer treatment adjuvant of a DNA-damaging agent comprising a PKR inhibitor.

The PKR inhibitor may be an imidazolo-oxindole compound, 2-aminopurine (2-AP), nc886 whole gene consisting of the nucleotide sequence of SEQ ID NO: 1, or some gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2.

The cancer treatment may be a DNA-damaging agent (damaging agnet), the DNA-damaging agent (damaging agent) anthracycline-based drugs, platinum-based anti-cancer drugs, nitrogen mustard (nitrogen mustard), cyclophosphamide, melphalan (melphalan), chlorambucil, bis-chloroethylnitrosourea, streptozocin, busulfan or thiotepine.

The anthracycline-based drug may be daunorubicin, doxorubicin, epirubicin, idarubicin, or mitoxantrone.

The present invention also includes the following steps, the expression level of the gene of nc886; And it can provide a method for providing information on drugs for the treatment of cancer according to the expression level of the gene of PKR or the activity level of its protein:

(a) the level of gene or protein expression thereof of nc886 from a biological sample isolated from a cancer patient pathologically judged to be cancer; And measuring the gene expression level of PKR or the activity level of the protein thereof. And

(b) DNA-damaging agent to the cancer patient when the measured expression level of the nc886 gene is lower than the normal control sample, and the expression level of the gene of PKR or the activity level of the protein thereof is higher than the normal control sample. And providing drug selection information to continue administering the PKR inhibitor.

The pathologically determined to be cancer may be cancer classified from stage 1 to stage 4 according to a tumor or node metasis (TNM) system.

The biological sample includes, but is not limited to, a sample such as tissue, cell, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine.

The PKR inhibitor may be an imidazolo-oxindole compound, 2-aminopurine (2-AP), the entire gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 1, or some gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2.

The DNA-damaging agent is an anthracycline-based drug, a platinum-based anti-cancer drug, a nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis-chloroethylnitrosourea, It can be streptozosin, busulfan or thiotepine.

The anthracycline-based drug may be daunorubicin, doxorubicin, epirubicin, idarubicin, or mitoxantrone.

The continuous administration may be to continuously administer the DNA-damaging agent at a concentration of 1 to 50 micromolar, preferably at a concentration of 1 to 25 micromolar, and more preferably at a concentration of 6 micromolar.

In the present invention, "measurement of expression level" refers to a process of confirming the presence and expression level of RNA of the gene in cancer tissue cells to confirm the type of cancer, and is made by measuring the amount of RNA. As an analysis method for this, for example, reverse transcriptase reaction (RT-PCR), competitive reverse transcriptase reaction (Competitive RT-PCR), real-time reverse transcriptase reaction (Realtime RT-PCR), RNase protection assay (RPA) ; RNase protection assay), Northern blotting, DNA chip, etc., but are not limited thereto.

The agent for measuring the level of a gene in the present invention is preferably an antisense oligonucleotide, primer pair or probe. In the present invention, “antisense” is an oligomer consisting of nucleotides in which an antisense oligomer is hybridized with a target sequence in RNA by Watson-Crick base pairing, allowing formation of mRNA and RNA:oligomeric heterodimers within the target sequence, typically. Refers to. Oligomers can have accurate sequence complementarity or approximate complementarity to the target sequence. This antisense oligomer can block or inhibit the translation of mRNA and alter the processing of mRNA to produce splice variants of mRNA.

In the present invention, "measurement of protein expression level and its activity" is a process of confirming the presence and expression level of a protein expressed from a gene of the present invention in a cancer tissue cell in order to confirm the progression of liver cancer. It is made by measuring. For this, Western blot, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis , Tissue immunostaining, immunoprecipitation assay, complement fixation assay, flow cytometry (FACS), protein chip, etc., but are not limited thereto. In the present invention, the agent for measuring the protein expression level is preferably an antibody.

The PKR inhibitor may alleviate or reduce side effects caused by DNA-damaging agents in normal cells. Doxorubicin is originally a DNA-damaging agent, and thus it is known to kill only dividing cancer cells, but according to the present invention, it is possible to explain why undesired side effects occur in which normal cells die by the nc886/PKR pathway. .

The present invention provides the expression level of the gene of nc886 comprising the following steps; And it can provide a method for providing information of drugs for cancer treatment according to the expression level of the gene of PKR or the activity level of its protein.

(a) gene expression levels of nc886 from biological samples isolated from cancer patients pathologically judged to be cancer; And measuring the gene expression level of PKR or the activity level of the protein thereof. And

(b) When the expression level of the gene of nc886 is higher than the normal control sample, and the expression level of the gene of PKR or the activity level of the protein thereof is lower than the normal control sample, a short-term administration of a DNA-damaging agent to the patient To provide drug selection information.

The short period may be, for example, 1 minute to 24 hours, preferably 10 minutes to 12 hours, more preferably 10 minutes to 2 hours, particularly preferably 20 minutes to 40 minutes, and most preferably It can be 30 minutes.

The cancer is lung cancer, colorectal cancer, colon cancer, rectal cancer, breast cancer, prostate cancer, bladder cancer, blood cancer, leukemia, myelogenous leukemia, lymphoma, cervical carcinoma, osteosarcoma, glioblastoma, melanoma ( melanoma), pancreatic cancer, stomach cancer, liver cancer, kidney cancer, gallbladder cancer, biliary cancer, esophageal cancer, ovarian cancer or neuroblastoma. When targeting nc886/PKR, treatment with high concentrations of doxorubicin in a short period of time can minimize DNA damage, thus minimizing the genotoxic effects of proliferating normal cells such as hematopoietic cells, hair follicle cells and intestinal epithelial cells. It may be sufficient to induce cell death.

The DNA-damaging agent is a platinum-based anti-cancer drug, nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis-chloroethylnitrosourea, streptozosin, busulfan , Doxorubicin or thiotepine.

The present invention also provides the expression level of the gene of nc886; And an agent capable of measuring the expression level of the gene of PKR or the activity level of the protein thereof.

The drug information is information on a method of administering a DNA damage agent and a PKR inhibitor in combination.

The information on the administration of the drug refers to the frequency of administration, the concentration of administration, etc., where the expression of the nc886 gene is lower than the normal control sample, and the expression of the gene of PKR or the activity of its protein is increased than the normal control sample, in general It is lower than the dose concentration of doxorubicin, and it is said to increase the frequency and duration of administration.

The agent measuring the expression of the gene may be an antisense oligonucleotide, primer pair or probe.

The agent measuring the activity of the protein may be an agent that specifically binds to the phosphorylation of PKR.

Hereinafter, the present invention will be described in more detail through examples. These examples are only intended to illustrate the present invention more specifically, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example 1. Cell lines, antibodies and other reagents

All cell lines, antibodies and other reagents are described in Jeon SH et al., FEBS Lett 586: 3477-348 (2012b) and Lee K et al., RNA 17: 1076-1089 (2011), unless otherwise specified. It is described. Doxorubicin, etoposide and aclarubicin were purchased from EMD Millipore, Sigma-Aldrich and Santa Cruz Biotechnology, respectively. H ₂ O ₂ and deferoxamine mesylate were purchased from Fisher Chemical and Sigma-Aldrich, respectively. Antibodies to total p53 and Chk2 were purchased from Santa Cruz Biotechnology, and phosphorylated antibodies to these antibodies were purchased from Cell Signaling Technology.

Example 2. Primer, plasmid DNA, RNA and transfection

Sequences for the PCR primers and Northern probes are summarized in Table 1 below. The DNA expressing nc886 was a PCR amplified 649nt PCR fragment containing 101 nt nc886 transcript and flanking sequences [271nt and 277nt on the 5'and 3'sides, respectively]. This fragment was inserted into the pCR4-TOPO vector (Invitrogen, Carlsbad, CA). The resulting plasmid and PCR fragments were used in the transfection experiment of Figure 6E. In NF-κB luciferase analysis using pNF-κB-Luc (Stratagene, La Jolla, CA), pRL-SV40 was infected together for standardization. As the siRNA for PKR and MVP, Stealth RNAi™siRNA (Invitrogen), target sequences of nt 343-367, 1054-1078 and 1228-1252 of PKR and nt 1067-1091 and 1908-1932 of MVP were used. These siRNAs targeting different regions of the gene were equally mixed and transfected at a concentration of 40 nM. Anti-oligos against nc886 and standard vtRNA (vtRNA1-1, 1-2, 1-3) used DNA-RNA mixmers with modified sugars (2') and phosphorothioate backbones , Target sequences thereof are 5'-aucucugugcugggguucga-3' (nt 56-75 corresponding to nc886) and 5'-ggcuggcuuuagcucagcgg-3' (corresponding nt 2-21 vtRNA). These anti-oligos were transfected with 200 nM. For structural experiments (FIGS. 4B-D and 6C), in vitro transcribed nc886 and vtRNA were prepared as described in (non-patent document 015) and yeast tRNA was purchased from Applied Biosystems/Ambion (Carlsbad, CA). Short RNAs (siRNAs, antioligos and in vitro transcripts) were transfected with Lipofectamine™ RNAiMAX reagent (Invitrogen), and DNA was transfected with Lipofectamine™ 2000 reagent (Invitrogen).

Sequence listing for PCR primers and Northern probes Primer sequence nc886 for PCR Forward CGGGTCGGAGTTAGCTCAAGCGG Backward AAGGGTCAGTAAGCACCCGCG nc886 for northern blot probe AAGGGTCAGTAAGCACCCGCG

Example 3. Luciferase assay, cell proliferation assay and in vitro kinase assay

All these analyzes were performed as described in Kunkeaw N et al., Oncogene 32: 3722-3731 (2013) and Lee K et al., RNA 17: 1076-1089 (2011). All quantitative assays (MTT assay, luciferase assay, qRT-PCR and ChIP-PCR) were repeated 3 times to calculate the mean, standard deviation and p-value (bilateral t-test).

Example 4. Intracellular fractionation

Subcelluar fractionation was performed as described in Kickhoefer VA et al., J Biol Chem 273: 8971-8974 (1998) and Lee K et al., RNA 17: 1076-1089 (2011). Harvested cells (~5*?* ⁷ ) 1.2 ml of buffer A (50 mM Tris-Cl (pH 7.4), 1.5 mM MgCl ₂ , 75 mM NaCl, 0.5% Nonidet P-40) containing 1 mM PMSF (phenylmethylsulfonyl fluoride) And resuspended in 10 mM ribonucleoside-vanadyl complex (New England Biolabs, Ipswich, MA) and 0.1 ml of 200 unit/ml RNase inhibitor (New England Biolabs) from human placenta Did. All subsequent steps were performed at 4°C. The resuspended cells were lysed for 10 minutes and centrifuged for 10 minutes at 6,000 xg in a TLA-55 rotor using an Optima TLX ultracentrifuge. The pellet was the nuclear fraction (labeled "P10" in Figure 6A). The supernatant was bulk cytoplasmic and fractionated by centrifugation at 100,000× for 1 hour to separate the resulting supernatant (labeled “S100”) from the pellet (labeled “P100”). The P10 and P100 fractions were resuspended with RIzol buffer for subsequent RNA preparation or Western blotting with Trizol reagent. The same amount of isopropanol was added to concentrate the S100 fraction, followed by centrifugation (at a rate of 12 krpm for 10 minutes). RNA was extracted from the obtained pellet with Trizol reagent. An aliquot of the S100 fraction was loaded directly for Western blotting.

Example 5. CHIP assays

ChIP analysis was performed as described previously [Park K et al., J Leukoc Biol 91: 245-257 (2012)]. Briefly, cells were crosslinked with 1% formaldehyde and expansion buffer [5 mM PIPES (pH 8.0), 85 mM KCl, 0.5% Nonidet P-40] and buffer A [10 mM Tris-HCl, 2 mM EDTA, 0.2 % Sonic dodecyl sulfate was sonicated using Bioruptor. Chromatin samples were diluted with Buffer B [10 mM Tris-HCl (pH 8.0), 2% Triton X-100, 280 mM NaCl, 0.2% deoxycholate] and immunoprecipitated with antibodies against POLR3A. Chromatin-antibody complex was removed with ProteinA/G Dynabeads. After treating with proteinase K and reversing crosslinking, the amount of immunoprecipitated DNA was measured by real-time PCR. Chip primers are shown in Table 2 below.

Sequence Listing for Chip Primers gene Base sequence nc886 Left CCAGCACAGAGATGGACAGA nc886 PCR primer for POLR3A ChIP Right GTCCCTCTCCACATCGTCAC nc886 PCR primer for POLR3A ChIP Vtrna1 Left AGTCTGGAAGCGAAGGAGGT vtRNA1-1 PCR primer for POLR3A ChIP Right ATGACTCAGCGACCAGGACT vtRNA1-1 PCR primer for POLR3A ChIP GAPDH Left CGGCTACTAGCGGTTTTACG GAPDH PCR primer for POLR3A ChIP Right GCTGCGGGCTCAATTTATAG GAPDH PCR primer for POLR3A ChIP

Example 6. 3-D cell culture

For 3-D cell culture, the BiO AssayTM kit from n3D Biosciences was treated according to the manufacturer's instructions. Briefly, monolayer cultured 3.3 x 10 ⁶ cells were treated with NanoShuttleTM-PL for 200 hours for 16 hours, followed by trypsin treatment, followed by magnetic injury in 6-well for 24 hours. Suspended cells were suspended in 2 ml of culture (per 6-well), resuspended by pipetting, bioprinted in 96-wells (2.0 x 10 ⁵ cells per 96-well), and ring-driven for 30 minutes. Then, doxorubicin was treated. A schematic diagram of the 3-D cell culture is disclosed in FIG. 7D.

Example 7. nc886 expression decreases upon doxorubicin treatment

As a first step to confirm the role of nc886, the biological situation in which nc886 expression was altered was investigated. For this, HBE135-E6E7 (partially modified lung epithelial cell line) and HCT116 (colon cancer cell line) were treated with H ₂ O ₂ (oxidative stress inducer), desperioxamine (hypoxia-like compound) and doxorubicin, resulting in several Eggplant stress conditions were tested. Actinomycin D, a transcription inhibitor treated for comparison, inhibited nc886 expression as expected (FIG. 1A ). Doxorubicin was as effective in inhibiting nc886 expression as actinomycin D, but H ₂ O ₂ and desperioxamine had little effect (FIG. 1A ). Dose titration experiments of the present invention showed that doxorubicin was required at a high concentration (at least 3 μM or more) to reduce nc886 (FIG. 1B ). It should be noted that this concentration is similar to the clinically relevant concentration. The maximum plasma concentration ranged from 5 to 25 μM after bolus injection of doxorubicin into the patient. nc886 was noticeably reduced after 2 hours treatment and barely observed after 4-8 hours (FIG. 1C ). After the expression of nc886 disappeared at 8 hours, it was observed that even after replacing the medium containing doxorubicin with fresh medium, nc886 expression did not recover after 36 hours (FIG. 1C ). The time-lapse data show that doxorubicin blocks almost nc886 transcription immediately after treatment, given that the half-life of nc886 is 1-2 hours.

Example 8. PKR contributes to doxorubicin-induced cell death.

Doxorubicin has been found to induce the PKR pathway and ultimately apoptosis. For human-derived cells, the experimental evidence for the contribution of PKR to the apoptosis pathway was based mainly on experiments inducing knockdown (KD) using small interfering (or hairpin) RNA (siRNA or shRNA). This role of PKR was supported by experiments on PKR KO cells generated from original Nthy-ori 3-1 cells (PKR wt) by CRISPR-Cas technology (Western blot of PKR in FIG. 2A). Doxorubicin treatment induces proteins related to apoptosis, such as caspase-3 and cleaved poly (ADP-ribose) polymerase (PARP), in PKR wt cells, Expression of this protein was significantly attenuated in PKR KO cells (FIG. 2A ). Similar induction of p53 and Chk2 (represented in its phosphate form in FIG. 2A) in PKR wt and KO cells, doxorubicin was equally effective in these two cell lines. Cell death data showed that it may not be due to a difference in the damage response of the DNA. In addition, when the amount of doxorubicin was treated with an appropriate amount, MTT assays were performed to measure cell survival (FIG. 2B ). PKR KO cells were more resistant to doxorubicin than PKR wt (IC ₅₀ value = 22.83 vs 6.49 μM, respectively), but these two cell lines proliferated similarly under normal growth conditions. Since PKR KO cells have been clonally selected and maintained for a long time, it is possible that these cells have acquired a genetic or epigenetic mutation that may accidentally cause doxorubicin resistance. To rule out this possibility, we measured doxorubicin sensitivity after acute PKR KD by siRNA in HCT116 cells. SiRNA against PKR effectively inhibited PKR expression (FIG. 2C ). Importantly, PKR KD increased IC ₅₀ values by about 3.5 fold, similar to PKR KO data (Figure 2D). The data clearly showed that PKR plays an important role in cell death induced by doxorubicin.

Example 9. Doxorubicin activates PKR.

PKR automatic phosphorylation, characteristic of PKR activation, was measured by in vitro kinase analysis. In this assay, PKR immunoprecipitation (IP) active PKR molecules were radiolabeled and digested on SDS-polyacrylamide gels (Figure 3A). The asterisk band is PKR because it moves to the correct position and is not detected in PKR KO Nthy-ori 3-1 cells (two lanes on the right in FIG. 3A). PKR was phosphorylated in HCT116 and Nthy-ori 3-1 (PKR wt) cells compared to doxorubicin treatment. PKR activation was confirmed by phosphorylation of eIF2α (Figure 3B) and activation of the NF-κB pathway ((Figure 3C-D)) as assessed in the Lucifer raise reporter assay using the NF-κB reactive promoter. (phosphorylation of eIF2α and activation of the NF-κB pathway) are downstream pathways of PKR Induction of NF-κB by doxorubicin treatment was nullified by the PKR inhibitor 2-aminopurine (2-AP) (Figure 4). 3C) PKR KO It was thought to be due to PKR activation because it was hardly seen in Nthy-ori 3-1 cells (Fig. 3D) Doxorubicin activates PKR and its downstream pathway, as shown in the above data.

Example 10. Doxorubicin activates PKR through nc886 inhibition rather than through p53 induction

The data showed that nc886 expression was inhibited upon doxorubicin treatment. Since nc886 is a PKR inhibitor, it was assumed that nc886 inhibition is the basic mechanism of doxorubicin-mediated PKR activation. Several experiments were conducted to prove the hypothesis. First, the nc886 KD experiment was performed using modified antisense oligonucleotides (anti-oligo) to confirm that the deficiency of nc886 induces the same cellular response as doxorubicin treatment. nc886 targeting anti-oligo (anti-nc886) inhibits nc886 compared to anti-control (Northern blot; top panel in FIG. 4A) and as confirmed by in vitro kinase analysis (middle panel in FIG. 4A). PKR activation was induced. nc886 KD was sufficient to induce cell death in PKR wt cells and inhibit cell proliferation (bottom panel in FIG. 4A). This phenotype of nc886 KD occurred through PKR activation because it did not occur in PKR KO cells (compare lanes 2 and 4 in the left panel of Figure 4A). Similar results were confirmed in HCT116 (right panel in Figure 4A). nc886 KD showed the same effect as doxorubicin treatment in PKR activation and thus induction of cell death. Doxorubicin elicits a multifaceted expression effect. The contribution of nc886 was fractionated and it was investigated whether doxorubicin-mediated cytotoxicity was mitigated by ectopic expression of nc886. As the Pol III transcript, nc886 expression was induced by the gene promoter element, so expression from exogenous DNA was also inhibited by doxorubicin (FIG. 6E ). Therefore, the strategy for nc886 expression in the presence of doxorubicin was to deliver it in a form of in vitro transcript. Cell death induced by doxorubicin was attenuated when the nc886 transcript was transfected with HCT116 and Nthy-ori 3-1 (PKR wt) cells, but not in Nthy-ori 3-1 (PKR KO) cells (Figure 4B-C). ). The role of nc886 in the PKR pathway was confirmed by testing two versions of nc886 (testing wt and other mutations with mutations at 46-56 where PKR came into contact with nc886 ("mut_46-56") (Figure 4D) ). This mutant lacked PKR binding. Doxorubicin induced apoptosis was induced by caspase-3 induction and was alleviated by wt nc886 but not at mut_46-56 (FIG. 4D ). All the above data clearly show that PKR activation by nc886 inhibition plays an important role in the cellular response to doxorubicin. In a previous report [Yoon CH et al., Proc Natl Acad Sci U S A 106: 7852-7857 (2009)], the expression and activity of PKR was p53 dependently induced by doxorubicin. Thus, p53 wt and null HCT116 cells (p53 +/+ and p53 −/− in the same cell line pair disclosed in a previous report [Yoon CH et al., Proc Natl Acad Sci USA 106: 7852-7857 (2009)] of FIG. p53 western blot). These two cell lines showed expression levels similar to nc886, which were inhibited by doxorubicin in the almost same time course (Fig. 4F). As a result, PKR was activated as indicated by eIF2α phosphorylation, leading to cell suicide (Figure 4E). These events occurred to a similar degree in both cell lines. The overall PKR level being the same in all lanes indicates that PKR was neither a transcription target of p53 nor was it induced by doxorubicin. The above results contradicted the Yoon paper ([Yoon CH et al., Proc Natl Acad Sci USA 106: 7852-7857 (2009)]), but repeated the experiment in the same HCT 116 cell line, and another paper compared with the Yoon paper ( Rahman M et al., Cell Cycle 8: 3606-3607 (2009). 4, it was confirmed that nc886 inhibition during doxorubicin treatment is a major cause of cytotoxicity due to PKR activation and its results regardless of the p53 state. Nevertheless, there is a possibility that p53 may play an important role in this pathway since phosphorylation of eIF2α was slightly weakened in p53 −/− cells in all studies (FIG. 4E ).

Example 11. The vault complex does not play a role in doxorubicin sensitivity.

nc886 is classified as a paralog of vault RNA (vtRNA) and one of its nicknames is vtRNA2-1. Canonical vtRNA (vtRNA1-1, 1-2 and 1-3) is a component of the giant ribonucleic acid protein complex called the vault complex, which is associated with drug resistance in cancer cells. Therefore, the role of the vault complex in the possible relationship between doxorubicin sensitivity and the nc886/PKR pathway was investigated. Subcellular fractionation separated the nuclear fraction (“P10” in FIG. 5A) and soluble cytoplasmic fraction (“S100”) from insoluble cytoplasmic pellets (“P100”) containing large complexes such as ribosomes and vault particles. The major component of the Bolt Vault Protein (MVP) was only in the P100 (Figure 5A). vtRNA1-1, not nc886, was found in P100. nc886 was exclusively present in S100 of HBE135-E6E7 cells, and in the case of HeLa cells, little was detected due to RNA degradation during fractionation (see EtBr staining in FIG. 5A). However, in this case, vtRNA1-1 was detected in P100. Probably because it was stably assembled in the Vault Complex and protected from RNA degradation. According to the above data, nc886 was consistent with the previous report, and was not physically related to the bolt complex. As with nc886, three standard vtRNAs inhibited by doxorubicin were found (compared to Figure 5B and Figure 1A). Although nc886 has been shown to be independent of the vault complex, there is still the possibility that a standard vtRNA (and Bolt complex) could play a role in doxorubicin sensitivity independent of nc886. This possibility was tested by KD and ectopic expression of vDRNA1-1 (Figure 5C-D). VtRNA1-1 KD by anti-oligo did not activate PKR (it appears to be devoid of phospho-eIF2α) and was not induced cell suicide (Figure 5C). Introduction of in vitro transcribed vtRNA1-1 did not alleviate cell death induced by doxorubicin (FIG. 5D ). By comparing the results with nc886 in the same experiment, the positive effect of nc886 was reproducibly observed, confirming that the lack of this effect of vtRNA1-1 in these two experiments was true. In addition, siRNA-mediated KD of MVP did not affect the IC ₅₀ value of doxorubicin in Nthy-ori 3-1 cells (Figure 5E-F). Overall, we concluded that the vault complex does not play a role in doxorubicin in our dosing conditions despite the inhibition of standard vtRNA by doxorubicin.

Example 12. Doxorubicin inhibits Pol III transcription

The mechanism for inhibition of nc886 by doxorubicin was investigated. nc886 is transcribed by Pol III. Previous studies have concluded that when doxorubicin inhibits the transcription of Pol III when introduced into an in vitro transcription assay. However, this observation has not been pursued in any further studies so far, and thus its biological significance has not been revealed. So, doxorubicin was treated, and Pol nc transcribed ncRNA (labeled "Pol III gene") was measured in addition to nc886. Steady state 5S rRNA and tRNA were not affected by doxorubicin (FIG. 6A ), probably because they are very rich and stable RNA. So, we turned to other Pol III genes and decided to measure standard vtRNAs with a half-life similar to nc886. Upon treatment with doxorubicin, the three vtRNAs and nc886 decreased with almost identical kinetics (Figures 6A-C). Precursor-tRNAs (Pre-RNAs) are considered the most sensitive indicators of assessing Pol III transcription rates. This is because the intermediates are processed and the half-life is very short. The expression levels of the two pre-tRNAs decreased almost completely within 1 hour (purple line in FIG. 6C). All of these data strongly suggested that the worldwide Pol III warriors were discontinued immediately after doxorubicin treatment. PolII transcribed ncRNA of essential cellular function (5S rRNA and tRNA in FIG. 6A) did not decrease within hours of doxorubicin treatment, and therefore could not account for the acute cytotoxic effects observed in the study. Then, I was wondering how doxorubicin inhibits Pol III gene expression extensively. Doxorubicin imposes stress on the DNA/chromatin in several ways. It intercalates to DNA to create topological tension. Another well-known effect of doxorubicin is topoisomerase II (topo II) poisoning. It captures topo II in double stranded cleavage and prevents linkage. The cellular results of this effect are DNA stand breakage, histone removal from chromatin, DNA damage response and cell death. Three different compounds were compared to identify which of the above causes the inhibition of Pol III transcription. One of the anthracycline-based drugs composed of planar aromatics, Aclarubicin is a DNA intercalator. However, unlike doxorubicin, it is not a topo II toxic substance. Therefore, when DNA breakage occurs, it cannot be attributed to the topo II poisoning mechanism. Controversy has been raised as to whether Aclarubicin causes DNA destruction because contradictory data have been obtained in several studies. The non-anthracycline compound, etoposide, does not intercalate with DNA and acts as topo II toxicity. The properties of these three drugs are summarized in Figure 6D. When the drug was treated with a treatment dose [6 μM aclarubicin, 30 μM etoposide and 6 μM doxorubicin], doxorubicin and aclarubicin inhibited nc886 expression, but not etoposide (FIG. 6D ). Left panel). Phosphorylation of p53 and Chk2 was observed in all three drugs (right panel in FIG. 6D), indicating that all treatments were effective and that nc886 inhibition was not due to the aftermath of the DNA damage response. Etoposide data demonstrated that Pol III transcription inhibition was not due to topo II poisoning or DNA breakage. Intercalation of tracycline drugs (including doxorubicin and aclarubicin) to DNA results in DNA twisting that can interfere with the action of Pol III (e.g., renal polymerization). To test this possibility, circular plasmid DNA and linear DNA for nc886 expression were compared. When topological tension is the cause, circular DNA is more affected than linear DNA. Transcription of nc886 from two DNA templates was similarly inhibited by doxorubicin (Figure 6E), suggesting that topological interference is an unlikely mechanism. Another result of intercalation of an anthracycline drug to DNA is the dissociation of the DNA binding protein. In fact, doxorubicin and aclarubicin are known to expel histones from DNA, and etoposide is not. Therefore, it was speculated that these two drugs would remove Pol III as in the case of histones. According to chromatin immunoprecipitation (ChIP) results using the Pol III subunit (POLR3A), Pol III did not bind to the position of the GAPDH gene, which is the Pol II gene, but was bound to the positions of nc886 and vtRNA1-1, which are the Pol III genes. And this binding was reduced by doxorubicin (Figure 6F).

Example 13. Optimization of doxorubicin treatment for the nc886/PKR pathway and application in a three-dimensional (3-D) cell culture system

Overall, in the above data (FIG. 6 ), transcription of nc886 was stopped immediately after doxorubicin treatment. That is, a short pulse treatment is sufficient to activate the nc886/PKR pathway and cell death. This possibility was tested by treating the cells with doxorubicin and replacing with doxorubicin-free medium at 15, 30, and 60 minutes (see FIG. 7A for experimental design). 30 minutes was sufficient time for doxorubicin to inhibit nc886 and induce cell death in a PKR-dependent manner (Figure 7B-C). The DNA damage response measured by phospho-Chk2 was not so significantly induced until 30 minutes, but slightly induced at 60 minutes in PKR wt cells (lanes 1 to 3 for lane 7 and lane 4 for FIG. 7C). For comparison, in PKR KO cells, phospho-Chk2 was observed and cell suicide was induced at night at 30 and 60 minutes (lanes 7-8 in FIG. 7C). It was not known why the DNA damage response was more proficient in PKR KO than PKR wt cells. Nevertheless, in the presence of PKR, the nc886/PKR pathway was dominant in inducing cell death, but the effect of the DNA damage response was minimal in 30 min pulse treatment.

So far, experiments have been carried out in two-dimensional monolayer cell cultures that differ significantly from the in vivo tumor environment in many respects, including drug sensitivity. Cells cultured in 3D are closer to physiology in vivo. So, an attempt was made to investigate the nc886/PKR pathway in 3D culture. It uses a recently developed protocol that is more convenient and superior to other methods. In this technique, the cells are coated with magnetic nanoparticles and floated by applying a magnetic field. The levitated cells form a 3-D structure with the extracellular matrix and are printed in vivo on a plate (see Figure 7D for schematic and real images). Doxorubicin inhibits nc886 in continuous and pulsed treatment of 3D cultures (lanes 1 and 3-4, respectively, in Figures 7E-F) and induces cell death, indicating that the nc886/PKR pathway works in 3-D cultured cells. Suggests, and may also be possible in tumor cells in vivo.

Example 14. Treatment with doxorubicin at a concentration of μM is widely applicable to a subset of cells, particularly tumor cells except silent nc886.

6 μM doxorubicin is expected to be effective in most cancer cells based on available data. Doxorubicin was retrieved from the cancer drug database (http://www.cancerrxgene.org/) and IC ₅₀ values of the 931 cell line were downloaded. In addition, CpG methylation data was obtained from the 957 cell line in a published study. The comparison of the two data sets showed IC ₅₀ values and methylation values in 791 cell lines. When IC ₅₀ values were sorted in ascending order (FIG. 7G ), there were 27 cell lines with IC ₅₀ >6 μM. Even slightly lowering the IC ₅₀ cutoff (1.5 μM), only 83 cells (10.5%) met the criteria. The main problem with chemotherapy is the emergence of drug-resistant cells, and consequently the recurrence of malignant tumors. In a number of reports, these resistant cells were developed after chemotherapy, with increasing drug concentrations or isolated from repeat tumors in patients. IC ₅₀ values were collected from original cells and doxorubicin resistance-inducing cell lines through literature review and displayed in dot plots (FIG. 7H and Table 3). All parent cells (38 out of 38) and most cells (84.5 out of 60) of the doxorubicin-resistant group had an IC ₅₀ of less than 6 μM and treatment conditions (30 minutes at 6 μM) were also seen in recurrent tumors. It is very effective. The doxorubicin concentration effective for apoptosis by nc886/PKR was around 6 μM, and a small number of doxorubicin resistant cell lines with IC ₅₀ values higher than this concentration (eg, 83 cell lines in FIG. 7G) exist. Although nc886 and PKR are mostly expressed in normal human tissue, previous studies have shown that the nc886/PKR pathway does not work in all tumors. The characteristic of nc886 is the silence by CpG DNA and methylation in some malignant cells. This feature is interesting and unique among Pol III genes. Theoretically and based on the above data, this silence would have caused cell death as PKR was activated. However, there are nc886-silenced in vitro and nc886-silenced tumor cells. Previous studies have demonstrated this by the tumor surveillance model. In this model, this cell death would have occurred to ensure elimination of precancerous cells that would have contributed to a reduction in cancer incidence. However, certain cells acquire a genetic/epigenetic modification, for example, overexpression of eIF2B, which neutralizes the apoptotic effect of phospho-eIF2α, may bypass the PKR cell death pathway. Only those cells were able to survive nc886 silencing and developed into clinically detectable and in vitro detachable malignant cells. It has been assumed that these cells have lost the PKR pathway for cell death and therefore tend to be resistant to doxorubicin, especially μM concentration. Since nc886 is not a micro RNA or mRNA, it is difficult to estimate the expression level from public sequence or sequencing data. Therefore, the CpG methylation value was investigated as a proxy indicator for nc886 silencing. nc886 has a CpG island (-189 to +82, the 5'end of the nc886 copy is a +1 reference point) and 10CpG sites in or near this island were analyzed. The average of 10 sites was calculated and >90% was considered hypermethylation. In this analysis (pie chart in FIG. 7G), only nc886- and methylation (12.0%) of 632 doxorubicin sensitive (IC ₅₀ <0.6) cell lines were 86. As a result of the same analysis in doxorubicin resistant (IC ₅₀ > 1.5) cell lines, the concentration of hypermethylated cells was statistically significant (p = 0.041) and 20 out of 83 (19.4%) were observed. These data supported that the PKR cell death pathway was defective in nc886-silenced cells, which would be a factor contributing to resistance to doxorubicin.

Claims (16)

A composition for alleviating or reducing side effects of a cancer treatment, comprising nc886 and/or a PKR inhibitor. According to claim 1, wherein the PKR inhibitor is an imidazolo-oxindole compound, 2-aminopurine (2-AP), the nc886 whole gene consisting of the nucleotide sequence of SEQ ID NO: 1, or of SEQ ID NO: 2 A composition for alleviating or reducing side effects of a cancer therapeutic agent, which is a part of the gene of nc886 comprising a base sequence. The composition for alleviating or reducing side effects of a cancer treatment according to claim 1, wherein the cancer treatment is a DNA-damaging agent (DNA damaging agnet). The method of claim 3, wherein the DNA-damaging agent is an anthracycline-based drug, a platinum-based anticancer drug, a nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis-chloroethylnitroso. Urea, streptozocin, busulfan or thiotepine, a composition for alleviating or reducing side effects of cancer treatment. The composition of claim 4, wherein the anthracycline-based drug is daunorubicin, doxorubicin, epirubicin, idarubicin, or mitoxantrone. The method of claim 1, wherein the cancer is lung cancer, colon cancer, colon cancer, rectal cancer, breast cancer, prostate cancer, bladder cancer, blood cancer, leukemia, myeloid leukemia, lymphoma, cervical carcinoma, osteosarcoma, gliomas ( glioblastoma), melanoma (melanoma), pancreatic cancer, stomach cancer, liver cancer, kidney cancer, gallbladder cancer, biliary cancer, esophageal cancer, ovarian cancer or neuroblastoma, a composition for alleviating or reducing side effects of cancer treatment. A cancer treatment adjuvant of a DNA-damaging agent, including nc886 and/or a PKR inhibitor. The method of claim 7, wherein the PKR inhibitor is an imidazolo-oxindole compound, 2-aminopurine (2-AP), the nc886 whole gene consisting of the nucleotide sequence of SEQ ID NO: 1, or of SEQ ID NO: 2 DNA-damaging agent, a gene for nc886 consisting of a base sequence, is a cancer treatment adjuvant. The method of claim 7, wherein the DNA-damaging agent (damaging agent) is an anthracycline-based drug, a platinum-based anticancer drug, nitrogen mustard (nitrogen mustard), cyclophosphamide, melphalan, chlorambucil, bis- Chloroethyl nitrosourea, streptozocin, busulfan or thiotepine, a cancer treatment adjuvant of DNA-damaging agents. (a) the level of gene or protein expression thereof of nc886 from a biological sample isolated from a cancer patient pathologically judged to be cancer; And measuring the gene expression level of PKR or the activity level of the protein thereof. And
(b) When the expression level of the measured nc886 gene is lower than the normal control sample, and the expression level of the gene of PKR or the activity level of the protein thereof is higher than the normal control sample, a DNA-damaging agent (damaging agent) to the cancer patient ) And PKR inhibitor, providing drug selection information;
The expression level of the gene of nc886, including; And a method for providing information of drugs for the treatment of cancer according to the expression level of the gene of PKR or the activity level of its protein. The method according to claim 10, wherein the PKR inhibitor is an imidazolo-oxindole compound, 2-aminopurine (2-AP), the entire nc886 gene consisting of the nucleotide sequence of SEQ ID NO: 1, or a partial gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2, the expression level of the gene of nnc886; And a method for providing information of drugs for the treatment of cancer according to the expression level of the gene of PKR or the activity level of its protein. The method of claim 10, wherein the DNA-damaging agent is a white anthracycline-based drug, a platinum-based anti-cancer drug, a nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis. -The expression level of the gene of chloroethylnitrosourea, streptozosin, busulfan or thiotepine, nc886; And a method for providing information of drugs for the treatment of cancer according to the expression level of the gene of PKR or the activity level of its protein. 11. The method of claim 10, wherein the PKR inhibitor is a DNA-damaging agent (damaging agent) to reduce or reduce the side effects, the expression level of the gene of nc886; And a method for providing information of drugs for the treatment of cancer according to the expression level of the gene of PKR or the activity level of its protein. the expression level of the gene of nc886; And/or an agent capable of measuring the expression level of a gene of PKR or the activity level of a protein thereof, a kit for providing information of a drug for the treatment of cancer or administration thereof. 15. The method of claim 14, The agent for measuring the expression of the gene is an antisense oligonucleotide, primer pair or probe, kit for providing information of the drug for cancer treatment. 15. The method of claim 14, The agent for measuring the activity of the protein is an antibody that specifically binds to the phosphorylation of PKR, a kit for providing information of drugs for the treatment of cancer.

Images