FR2992659A1 - MICROARN SIGNATURE OF THE ACTIVATION STATUS OF THE INNOVATIVE IMMUNE RESPONSE AND EPIDERMAL INFLAMMATORY AND USES THEREOF - Google Patents

Abstract

The present invention relates to a microRNA signature of the innate immune response and various uses of this signature, in particular for evaluating or qualifying an activation state of the innate immune response and epidermal inflammation, as a new diagnostic tool for the disorder of the immune system. inflammation or physiologic or pathological immune response, as a target to correct a defect in epidermal immune response or as a biomarker and screening tool for testing agents modulating epidermal inflammation. The present invention also relates to the use of microRNAs of this signature, or modulators of these microRNAs, in therapeutic and cosmetic applications, especially in the form of compositions.

Description

MicroRNA SIGNATURE OF THE ACTIVATION STATUS OF THE INFLUENZED IMMUNE RESPONSE AND EPIDERMAL INFLAMMATORY AND USES The present invention is in the cosmetic field, it relates to the skin. It is more generally part of the characterization of the activation state of the innate and inflammatory epidermal immune response of a cultured skin or epithelium and the treatment of disorders, affections or related pathologies. to epidermal inflammation.

The epidermis is a pluristratified epithelium that exerts a protective barrier function against its environment and its aggressions. Among its many physiological functions, the epidermis has the ability to provide a barrier at the same time biological, physical and chemical against the invasion of the body by microorganisms.

The physical barrier properties of the epidermis are, in particular, related to its structural organization. Thus, the epidermis is conventionally divided into a basal layer of keratinocytes constituting the germinal layer of the epidermis, a so-called spinous layer consisting of several layers of polyhedral cells and finally, a set of upper layers called horny layers (or stratum corneum), consisting of end-stage keratinocytes of their differentiation called corneocytes. The chemical barrier properties of the epidermis depend, in particular, on the release on the surface of the latter of numerous antimicrobial proteins such as cathelicidines, dermcidin or proteins of the [beta] defensin family. A dysfunction of the epidermal cell structural organization, or a defect in the chemical barrier function of the epidermis, may result in an inflammatory skin condition. Inflammation is one of the first responses of the immune system to infection, irritation, burning or injury. Inflammation is induced by chemical factors released by damaged cells and provides an effective barrier against the spread of possible infectious agents, and initiate tissue repair processes after the elimination of pathogens. Inflammation is induced by cells initially present in most tissues, such as macrophages, dendritic cells, histiocytes, Kupffer cells or mast cells. These cells express on their surface molecular pattern recognition receptors. These receptors recognize molecules, called molecular patterns associated with pathogens, which are expressed by microbial organisms, but distinct from the molecules of the body. At the onset of infection, burns, or tissue damage, the recognition of molecular patterns associated with pathogens by the molecular pattern recognition receptors expressed by these cells leads to their activation and secretion of different mediators responsible for the clinical signs of inflammation (pain, redness, warmth and swelling). The chemical factors produced during inflammation (histamine, bradykinin, serotonin, leukotrienes and prostaglandins) increase the sensation of pain, locally induce vasodilatation of the blood vessels and the recruitment of phagocytes, especially neutrophils. Neutrophils can also produce soluble factors that contribute to the mobilization of other leukocyte populations. The cytokines produced by macrophages and other cells of the innate immune system are a relay of the immune response. These cytokines include TNFa, HMGB1, and interleukin-1. In order to better characterize the state of activation of the innate and inflammatory epidermal immune response of a "reconstructed skin" skin or cultured epithelium, and to be able to evaluate molecules that can modulate the dyeing process. Epidermal inflammation, the technical tools available to date are as follows: - Morphological analysis and biochemical markers of epidermal inflammation stages. It is a technique that allows to analyze, either very globally (topographic histology), or marker by marker (immunohistochemistry), the known protein actors of inflammation. It does not allow to have a signature of the state of the skin. It is cumbersome and requires the use of certain tools such as antibodies that are specific to desired markers, which is not always the case. On the other hand, it is a technique that is difficult to quantify. -Transcriptomic analysis: it is a method very used to obtain molecular signatures of a healthy or pathological tissue. This technique is based on analyzing the expression of mRNA transcripts of a sample. It can be very global, with the use of microarrays that can hold up to 12,000 genes. However, it has certain drawbacks, in particular it requires expensive equipment (Affymetrix (TM) system type) but above all it generates a very large amount of data that is often difficult to exploit that needs to be handled by an efficient bioinformatics service. - Proteomic analysis: it allows to make a global inventory of all the proteins present in a tissue. It still uses many techniques of two-dimensional electrophoresis gels and is therefore very heavy to implement. In addition, the precise identification of proteins requires additional steps and very expensive devices requiring special expertise. There is therefore a need for a method that allows easy and rapid characterization of the activation state of the innate and inflammatory epidermal immune response of cultured skin or epithelium.

To date, few biological markers are available to effectively and accurately determine the activation state of the innate and inflammatory epidermal immune response of the skin, and in particular to connect a skin disorder or scalp to a skin. such inflammatory condition of the epidermis.

Thus, there is a need for biological markers that can precisely characterize an activation state of the innate and inflammatory epidermal immune response of the skin. There is also a need for a biological marker that can be used in a controlled manner. reliable in a diagnostic process of a skin disorder or scalp related to the activation of the innate immune response and epidermal inflammation state. In addition, an inflammatory skin condition can cause many disorders or pathologies of the skin or the scalp, in connection with a microbial infection such as atopic dermatitis, or seborrheic dermatitis, or without a microbial infection such as psoriasis, eczema or sensitivity and / or exaggerated reactivity of the skin. In mild cases, emollients and keratolytics are recommended.

These treatments are intended to make the lesions tolerable for the patient and they often have a suspensive effect. For more severe conditions, they are anti-inflammatories or corticoids likely to regulate the inflammation of keratinocytes, which have been used for several years. All these treatments have important side effects, very heavy for the patients. Because of the significant side effects of the above-mentioned existing treatments for skin or scalp disorders resulting from the activation state of the innate and inflammatory epidermal immune response of the skin, there is also a need for new cosmetic active ingredients or therapeutic and novel cosmetic or therapeutic compositions useful for the treatment of said skin disorders or scalp. There is also a need for new tools for screening molecules capable of exerting a cosmetic or therapeutic action on the epidermis or keratin materials in general. For the purposes of the invention, the term "epidermis" is intended to mean both the skin and the scalp. The present invention aims to satisfy all of these needs.

The present inventors have demonstrated, in a perfectly unexpected manner, the existence of a microRNA signature of the innate and inflammatory epidermal immune response, allowing not only to characterize the inflammatory state of the skin, but also to consider various treatments. disorders related to the disturbance of this inflammatory state. The microRNAs (miRNAs) discovered since 1993 are small endogenous RNAs that are involved in RNA interference: they can target messenger RNAs (mRNAs) and generate their degradation or prevent their translation. These miRNAs therefore play very important regulatory roles in the cell. In addition, they constitute one of the most abundant classes of regulatory molecules. They have an endogenous origin, derived from pri-miRNA coded by the genome. To date, more than 1000 human microRNAs have been identified. Their functions and targets have not all been elucidated or demonstrated. They play a crucial role in the regulation of various cellular pathways and can be involved in human pathologies. MiRNAs play an important role in the regulation of development, differentiation, proliferation and apoptosis. For example in humans, miR-17-5p and miR-20 are proliferation regulators, miR-223 is involved in granulopoiesis. Deregulation of miRNA expression can contribute to human pathologies. Some miRNAs work as tumor suppressors or others as oncogenes. At present, there are very few studies on microRNAs in the skin, especially in human skin. Since, for each microRNA, there are several dozen target genes, the present inventors propose: - to use microRNAs as markers of the innate immune and epidermal inflammatory response. They allow by their number much less important than the messenger RNAs to make microRNA profiles of a situation, of a tissue, in a simpler, faster and less expensive way than the conventional global methods of transcriptomics; - to use the microRNA molecular signature of the innate and inflammatory epidermal immune response to identify modulators for the treatment of benign or more serious conditions associated with disorders of the innate and epidermal inflammatory immune response.

By modulators are meant chemical entities or extracts of natural extracts, complex formulations, siRNAs, miRNA inhibitors such as antagomirs, but also instrumental systems using light, mechanical effects on the skin, injections; to use the miRNAs or modulators of these miRNAs for cosmetic or therapeutic treatments in the affections of epidermal inflammation; use this signature miRNAs to evaluate the efficacy of a cosmetic or therapeutic treatment of the activation of the innate and inflammatory epidermal immune response; - to use the microRNA molecular signature of the innate and inflammatory epidermal immune response to make a diagnosis of a normal or pathological epidermis; For this purpose, it is proposed to use the expression assay of certain identified microRNAs. In fact, surprisingly, the inventors have shown that during the recognition process of a microorganism by specific molecular signs recognized by receptors of the TLR family, the human microRNAs miR-146, miR-203, miR-155 , miR-886-3p were overexpressed in epidermal keratinocytes stimulated by TLR2, TLR3 and TLR5 receptor-specific ligands, whereas miR-221, miR-365, miR-590-5p, miR-26b, and microRNAs let7 were under-expressed in these same keratinocytes, as compared to keratinocytes that had not been stimulated.

These nine microRNAs therefore represent a molecular signature of the innate immune response. The present invention thus relates to this microRNA signature of the innate immune response and various uses of this signature, in particular for evaluating or qualifying an activation state of the innate immune response and epidermal inflammation, as a new diagnostic tool for inflammation or physiological or pathological immune response, as a target for correcting a defect in epidermal immune response or as a biomarker and screening tool for testing agents modulating epidermal inflammation. The present invention also relates to the use of microRNAs of this signature, or modulators of these microRNAs, in therapeutic and cosmetic applications, especially in the form of compositions. By MicroRNA (or microRNA or miRNA) is meant according to the present invention single-stranded RNAs, about 20 to 25 nucleotides long, more generally 21 to 24 nucleotides. The miRNAs are repressors that act after the transcription of a gene into mRNA: indeed, by pairing with messenger RNAs, they guide their degradation, or the repression of their translation into protein. The production of miRNAs is under tight control of transcriptional and post-transcriptional regulation.

The miRNA genes are transcribed by RNA polymerase II in the form of long primary transcripts or precursors called "pri-miRNA". The precursor miRNAs are enzymatically cleaved into the cell nucleus by Class II RNase III (Drosha) to form the "pre-miRNAs". The "pre-miRNA" is a long RNA of about 70 nucleotides, folded imperfect stem-loop by complementarity of bases between the first half and the second half of its sequence. The pre-miRNAs are then exported to the cytoplasm where they bind to another nuclease (Dicer) and the RISC complex (RNA-induced silencing complex) which contains the transactivation-responsive RNA binding protein (TRBP) and Ago2 (Argonaute 2) proteins. ). Because of the binding, the Ago2 protein cleaves the 3 'ends of the miRNA precursor, thereby generating the mature miRNA duplex. Only the specific strand of the miRNA target mRNA is kept (thermodynamic reaction) within the complex, the other strand is removed and degraded.

The target mRNA is then loaded into the RISC complex and degraded. Although translational repression is the most observed silencing pathway in animal cells, recent studies show that miRNAs can also affect target mRNA levels.

By Hsa-miRxx is meant according to the present invention the name of microRNAs identified in humans (hsa meaning homo sapiens). The sequences of all known microRNAs are listed in databases such as miRBase or microRNAdb, where they are uniquely identified by their accession number (xx). In the following, the hsa-miRxx number is used to refer to the mature miRNA sequence. In particular, the microRNAs below have the following sequence: hsa-miR-146: mature miRNA: CCUCUGAAAUUCAGUUCUUCAG (SEQ ID NO: 1) hsa-miR-886-3p: mature miRNA: CGGGUCGGAGUUAGCUCAAGCGG (SEQ ID NO: 2) hsa -miR-155: mature miRNA: UUAAUGCUAAUCGUGAUAGGGGU (SEQ ID NO: 3) hsa-miR-203: mature miRNA: GUGAAAUGUUUAGGACCACUAG (SEQ ID NO: 4) hsa-let-7: mature miRNA: UGAGGUAGUAGGUUGUAUGGUU (SEQ ID NO: 5) hsa-miR-221: mature miRNA: ACCUGGCAUACAAUGUAGAUUU (SEQ ID NO: 6) hsa-miR-26b: mature miRNA: UUCAAGUAAUUCAGGAUAGGU (SEQ ID NO: 7) hsa-miR-365a: mature miRNA: AGGGACUUUUGGGGGCAGAUGUG (SEQ ID NO: 8) hsa-miR-590-5p: mature miRNA: GAGCUUAUUCAUAAAAGUGCAG (SEQ ID NO: 9) The suffix 'hsa' has sometimes been omitted in the context of this description, however, it is necessary to designate these same 9 microRNAs, described herein. -above. By innate immune system is meant a system comprising cells and mechanisms for the defense of the body against infectious agents immediately, in contrast to the adaptive immune system that provides protection later but more durable. While the adaptive immune system exists only in gnathostomes, the innate immune system exists in all organisms of the plant and animal kingdom. The main functions of the innate immune system of vertebrates are: to constitute a physical and chemical barrier against infectious agents; detect infectious agents and induce the recruitment of immune cells at the site of the infection; to activate the complement cascade allowing the activation of the cells and the elimination of dead cells or immune complexes; the identification and elimination of foreign bodies present in the body, tissues, blood and lymph, by white blood cells; activation of adaptive immunity through antigen presentation. Toll receptors (or Toll-like receptors or TLRs) belong to the family of molecular pattern recognition receptors. As such, they intervene in the mechanisms of innate immunity by recognizing "conserved molecular motifs" in many pathogens. These molecular patterns associated with pathogens are of very different origins (bacterium, virus, parasite) and of various natures (protein, ose, nucleic acid). By Antagomir is meant according to the present invention a new class of oligonucleotides synthesized chemically. They are used to quench ("silencing") the action of endogenous microRNAs. An antagomir is a small synthetic RNA that is perfectly complementary to a targeted microRNA, with one or more basic modifications to inhibit cleavage by Ago2 (other modifications are also often introduced in addition for the antagomir to be more resistant to degradation). Antagomirs are frequently used to constitutively inhibit the activity of specific microRNAs. Numerous antagomirs have been published. All miRNAs are likely to be specifically inhibited by an antagomir.

Only the information of the targeted microRNA sequence is necessary for the development of an antagomir capable of inhibiting the activity of said targeted microRNA.

Other miRNA inhibitors are, for example, miRCURY LNA (TM) microRNA Knockdown Probes (Exiqon) or miScript miRNA inhibitors from Qiagen. The present invention relates to a microRNA signature of the epidermal innate immune response, and therefore a signature representative of the epidermal inflammatory state. According to a first aspect, the present invention more specifically relates to a method for determining the activation state of the innate and inflammatory immune response of a human keratinocyte within a human epithelium sample. Such a method preferably comprises a step of determining the level of expression of at least one microRNA within said keratinocyte. According to the present invention, the selected microRNA is from hsa-miR-146, hsa-miR886-3p, hsa-miR-155, hsa-miR-203, hsa-let-7, hsa-miR-221, hsa- miR886-3p, hsa-miR-155, hsa-miR-203, hsa-let-7, hsa-miR-221, hsa- miR-26b, hsa-miR365, and hsa-miR-590-5p. These 9 miRNAs are called microRNAs or miRNAs or miRNAs of the invention.

The level of expression of the microRNA (s) chosen is compared with the average level of expression of the microRNA (s) selected in unstimulated keratinocytes, preferably from the same strain or population. Methods for detection and quantification of miRNAs are numerous and well known to those skilled in the art. Example 3 details the most used techniques.

Preferably, the method comprises determining the level of at least two distinct microRNAs selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsamiR-203, hsa-let-7, hsa -miR-221, hsa-miR-26b, hsa-miR-365, and hsa-miR-590-5p, and comparing these two levels to the corresponding average levels of the two microRNAs selected from unstimulated keratinocytes, particularly in Alternatively, the method may comprise determining the level of expression of a plurality of microRNAs among the 9 microRNAs of the invention, for example at least 3 at least 4, at least 5, at least 6, at least 7. , at least 8 or the 9 microRNAs of the invention and the comparison of the levels thus determined with the average expression levels of the corresponding microRNAs in unstimulated keratinocytes. By mean level of expression of a microRNA within unstimulated keratinocytes, is meant the level of expression generally observed in this type of cells, preferably corresponding to the average of the level of expression determined within at least 5 different keratinocytes, representative of the population of keratinocytes in unstimulated culture. Preferably, it is the average of at least 10 measurements, or even 20 or 100 different measurements. Preferably, the unstimulated cultured keratinocytes are keratinocytes originating from the same strain or from the same population as the keratinocyte under study.

In the context of the implementation of the method as mentioned above, the keratinocyte under study is considered to be in a state of activation of the innate or stimulated immune response or in a state of inflammation, if the level of expression of at least one of the microRNAs selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203, is statistically higher than the average level of expression of said microRNA in keratinocytes not stimulated. By statistically higher level is meant that the difference observed is statistically significant, especially that it is greater than the standard deviation. One value is said to be statistically superior to another if the difference between the two values is greater than the uncertainty existing on the measurements.

Preferably, the upper level is at least 10% higher than the average level, preferably at least 30% higher. According to particularly preferred embodiments, the level of expression of the microRNA (s) chosen is at least equal to one and a half times the average level of said microRNA (s), preferably it is greater than or equal to twice the average level of the microRNA (s). selected microRNAs.

Preferably, the level of expression of at least one of the microRNAs selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203, is statistically superior to all expression levels of said microRNA in all unstimulated cultured keratinocytes which have made it possible to obtain the average level of expression of said microRNA. According to a preferred embodiment of the method of the invention, the average level of at least two microRNAs selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203 is higher or lower than the average expression level of said miRNAs in unstimulated keratinocytes.

According to a still preferred embodiment of the method of the invention, the average level of at least three microRNAs selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR155, hsa-miR-203 is greater than the average expression level of said miRNAs in unstimulated keratinocytes. According to a still preferred embodiment of the method of the invention, the average level of hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203 is greater than the level of mean expression of said miRNAs in unstimulated keratinocytes. Alternatively, it can also be concluded that the keratinocyte under study is as in a state of activation of the innate or stimulated immune response or in a state of inflammation, if the level of expression of at least one of the microRNAs chosen from hsa mR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203, preferably hsa-miR-146, is substantially identical to the level of expression of said microRNA in epidermal keratinocytes stimulated with specific ligands of TLR receptors. By substantially identical level is meant that the difference in level observed is statistically insignificant, for example it is lower than the existing uncertainty on the level measurement of expression of said microRNA. Conversely, in the context of the implementation of the method of the invention, it will be considered that the keratinocyte under study is as in a state of activation of the innate or stimulated immune response or in a state of inflammation, if the level of expression of at least one of the microRNAs selected from hsa-let-7, hsa-miR-221, hsa-miR-26b, hsamiR-365, and hsa-miR-590-5p, is statistically greater than the level of expression of said microRNA in epidermal keratinocytes stimulated with specific TLR receptor ligands. According to a preferred embodiment of the invention, the average level of at least two microRNAs chosen from hsa-let-7, hsa-miR-221, hsa-miR-26b, hsa-miR-365, and hsamiR-590 -5p, is greater than the average expression level of said miRNAs in stimulated epidermal keratinocytes. Preferably, this is the case of at least 3, at least 4, even all the microRNAs in the list consisting of hsa-let-7, hsa-miR-221, hsa-miR-26b, hsa -miR-365, and hsa-miR-590-5p. Alternatively, it can also be concluded that the keratinocyte under study is as in a state of activation of the innate or stimulated immune response or in a state of inflammation, if the level of expression of at least one of the microRNAs chosen from hsa -let-7, hsa-miR-221, hsa-miR-26b, hsa-miR-365, and hsa-miR-590-5p, is substantially identical to the level of expression of said microRNA in epidermal keratinocytes stimulated with ligands specific TLR receptors. Preferably, this is the case of at least 2, at least 3, at least 4 or all the microRNAs chosen from hsa-let-7, hsa-miR-221, hsa-miR-26b , hsa-miR-365, and hsa-miR-590-5p. By substantially identical level is meant that the difference in level observed is statistically insignificant, for example it is lower than the existing uncertainty on the level measurement of expression of said microRNA. In the context of the present invention, the epithelium, skin or epidermis sample in question may be from different sources, it may be a cultured epithelium, for example a reconstituted epithelium. type "reconstructed skin" or a sample obtained from an individual, for example from a biopsy. Said sample can therefore come from human skin. The comparison of the level of expression of at least one of the microRNAs of the invention may be carried out between any two layers of the epithelium sample under study. If it is a sample of human skin, the comparison is preferably made between two layers of opposite keratinocytes, for example between the keratinocytes of the basal layer and those of the stratum corneum of the epithelium. It should be noted in this connection that recent studies indicate that corneocytes produce or contain microRNAs. The comparison of the level of expression can also be carried out between two layers quite close to the sample, for example in order to highlight different activation states of the innate and inflammatory immune response of one layer compared to the other. layer of keratinocytes of the epithelium under study.

The present invention also relates to various applications of the characterization methods described above, and therefore various uses of the signature microRNAs demonstrated by the inventors, particularly as a tool for diagnosing inflammatory disorders, physiological or pathological, as a target for to correct an epidermal immune defect or as a biomarker and screening tool to test agents that modulate the epidermal immune response. According to a second aspect, the invention therefore relates to a method for determining the effectiveness of a treatment carried out on an epithelium. Such a method includes comparing, before and after treatment, the microRNA signature of the immune response and the level of inflammation of the epithelium. The method therefore comprises comparing the level of expression of at least one microRNA selected from hsamiR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203, hsa-let-7, hsa -miR-221, hsamiR-26b, hsa-miR-365, hsa-miR-590-5p within keratinocytes of this epithelium, before and after treatment.

Indeed, the inventors have demonstrated the variation of the level of expression of these 9 microRNAs during the process of innate immune response taking place in the epidermis. The modification of the level of expression of at least one of these microRNAs is therefore representative of a change in the state of inflammation in response to the treatment under test. Once again, the modification of the level of expression means a significant modification from a statistical point of view, therefore of sufficient and reproducible intensity, observable on a significant number of keratinocytes representative of the epithelium under study. Alternatively, the method for determining the effectiveness of a treatment applied to an epithelium within the meaning of the present invention may also comprise the comparison, before and after the test treatment, of the epidermal inflammation differential of this epithelium. According to this variant of the method, the difference in epidermal inflammation existing between two samples is thus determined before treatment, and the result obtained is compared with the differential activation of epidermal immune response existing between these two same samples after treatment. It is thus determined whether or not the tested treatment has modified the existing difference in terms of inflammation between these two samples, for example by reducing the difference in the state of inflammation between the two samples, that is to say by reducing the differences in expression levels of the microRNAs of the invention between the two samples, or by increasing the epidermal immune response differential.

The treatment tested by this method may consist of any treatment. Preferably, it is the topical application of a molecule, by coating or by injection, preferably subcutaneously. The applied molecule may be a single chemical entity or the combination or combination of different entities, it may be active ingredients, natural molecules, proteins, RNA, DNA, essential oil, d chemical entity derived from natural extracts, a complex formulation, a DNA molecule, a microRNA, a siRNA, a miRNA inhibitor, in particular an antagomir, etc. Particularly preferred molecules in the context of the test treatment according to the invention are in particular RNAs, in particular microRNAs, or molecules modifying the expression of natural microRNAs, such as miRNA inhibitors and in particular antagomirs. It may also be the application of electromagnetic radiation, regardless of the wavelength, for example of visible wavelength, UV, IR or X. The treatment in the sense of the present invention also includes the application of different mechanical effects. The method of the invention is considered effective if it causes a change in the level of expression of at least one of the microRNAs of the invention within the epithelium under study. Preferably, said treatment is considered effective if it causes the modification of the level of expression of at least two, preferably at least three, preferably at least four, preferably at least five, preferably at least six, preferably at least seven, preferably at least 8, preferably all of said microRNAs within the epithelium. The modifications generated on the level of expression of the microRNAs of the invention are not necessarily of identical amplitude for all microRNAs. Preferably, within the meaning of the present invention, a test treatment will be considered effective if it causes a modification of the level of expression of at least one microRNA selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203, concomitantly with a modification of the level of expression in the opposite direction to the preceding one of at least one microRNA selected from hsa-let-7, hsa-miR-221, hsa- miR26b, hsa-miR-365, and hsa-miR-590-5p. Thus, an effective treatment within the meaning of the invention will for example result in an increase in the level of expression of at least one microRNA selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa- miR-203, and, simultaneously, also decreasing the level of expression of at least one microRNA selected from hsa-let-7, hsamiR-221, hsa-miR-26b, hsa-miR-365, and hsa-miR -590-5p. It is also possible, by the methods for determining the effectiveness of a treatment of the present application, to objectify the beneficial action of an agent, in particular a cosmetic product, for example a cosmetic composition, as for its action on the inflammatory state of the skin. The methods of determination described above in vitro can indeed be used in a test protocol making it possible to determine the products that may be qualified as agents having an effect on the inflammatory state and on the activation of the innate immune response of keratinocytes of the skin. Moreover, by means of this test, it is possible to promote the product to consumers, by highlighting the results obtained with this product in the determination methods described in the present invention. The evaluation of the effect on the activation state of the innate or epidermal inflammation immune response will be based on the study of the expression of the microRNAs of the invention.

The present invention therefore also provides a method for recommending a product by signaling its effect in a test protocol consisting of a determination method as described above. The invention therefore also relates to a method for the promotion of a cosmetic product consisting in reporting an efficacy, action or property of said product demonstrated by at least one test operated as described above. Such promotion of the product can be done by any communication channel. It may be made by the seller, directly on the point of sale, by radio and television, particularly in the context of commercials. It may also be done through the press, or through any other document, especially for advertising purposes (prospectus). It can also be done via the Internet, or any other appropriate computer network. It may also be made directly on the product, in particular on its packaging or on any explanatory note that may be associated with it.

The present invention, according to a third aspect, also relates to various methods of screening molecules for their action on the process of activating the innate immune response and epidermal inflammation. In particular, the invention relates to a method for screening modulators of the process of the innate and inflammatory immune response in an epithelium comprising the evaluation of the epidermal inflammation state of keratinocytes in this epithelium, before and after application of the modulator to be screened. Such screening methods may be carried out in vivo, or ex-vivo, or in vitro, for example on cultured epithelia or epithelium samples. The evaluation of the epidermal inflammation state of keratinocytes in this epithelium is carried out by one of the methods according to the first aspect of the invention. As specified above, the epithelium referred to may be a cultured epithelium, for example a reconstituted epithelium, "reconstructed skin" type or a sample obtained from a human being, for example during a biopsy. Alternatively, the invention also relates to a method for screening modulators of the process of the innate and inflammatory immune response in an epithelium, comprising the evaluation of the epidermal inflammation differential of this epithelium, before and after application of the modulator to screened. The evaluation of the epidermal inflammation differential of keratinocytes in this epithelium is carried out by one of the methods according to the first aspect of the invention. The modulator in question may be any chemical entity, for example derived from natural or synthetic extracts, it may be a complex formulation, a DNA molecule, a microRNA, a an siRNA or a miRNA inhibitor such as an antagomir for example. This list is of course not exhaustive. Alternatively, the modulator may be an instrumental system using electromagnetic radiation, preferably visible, UV, IR or X-ray radiation, or a system using mechanical effects.

According to a fourth aspect, the present invention also relates to a method for diagnosing the condition of an epidermis, through the use of the microRNA signature demonstrated by the inventors. Such a diagnostic method comprises the determination of the epidermal inflammation differential existing within this epidermis between the basal layer and the stratum corneum, and the comparison with the average epidermal inflammation differential existing within a normal epidermis of the same type. between the basal layer and the stratum corneum.

The determination of the epidermal inflammation differential is preferably carried out using the different methods according to the first aspect of the invention. It is preferably performed on a skin epidermis sample to be diagnosed. The average epidermal inflammation differential existing in a normal epidermis of the same type, between the basal layer and the stratum corneum, corresponds to an average value of several measurements made on several epidermes from subjects whose skin is healthy and same type as that of the epidermis to be diagnosed. By the same type, we mean comparable age, ethnicity and identical colors. It is an average value that corresponds to a "normal" or "healthy" state, free from any pathology or damage to the epidermis. By this method of diagnosis, it is thus established microRNA profile of the skin to be diagnosed and by comparison, it can be diagnosed possibly premature aging, photoaging or damage caused by solar radiation, aging or damage caused by the stress, acne, or any other physiological or pathological disorder. According to yet another aspect, the present application also relates to the use of the expression assay of at least one microRNA selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203, hsa-let-7, hsa-miR-221, hsa-miR-26b, hsa-miR-365, and hsa-miR-590-5p, in keratinocytes within a sample of human epithelium for determining the activation state of the innate immune response and epidermal inflammation of said keratinocytes.

Indeed, the present inventors have shown that this assay gives access to the microRNA signature of the inflammation and the activation state of the epidermal innate immune response. According to a particularly preferred use, it is carried out the assay of at least 2 distinct microRNAs among the 9 microRNAs of the invention, preferably at least 2, 3, 4, 5, 6, 7, 8. For example, it can the assay of the 9 microRNAs of the invention for the determination of the activation state of the epidermal innate immune response and the inflammation of the keratinocytes under study is used. According to yet another aspect, the subject of the application is various uses, in cosmetics and in therapy, of at least one microRNA selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR -203, hsa-let-7, hsa-miR-221, hsa-miR-26b, hsa-miR-365, and hsamiR-590-5p and / or at least one modulator of the expression of said microRNAs. Indeed, because of the importance of these microRNAs in the process of activating the innate immune response and epidermal inflammation of the skin, the modulation of their level within keratinocytes is likely to influence epidermal inflammation. for example to slow down or accelerate it to slow down or accelerate the inflammatory process. The level modulation of the microRNAs of the invention within keratinocytes is most preferably carried out by introducing one or other of the microRNAs of the invention, in order to increase its level within the keratinocytes, in particular, the use of microRNAs to correct endogenous dysregulations of microRNAs. The modulation can also be carried out by introducing a modulator of said microRNAs, preferably it is the introduction of at least one miRNA inhibitor, for example an antagomir, targeting one of the microRNAs of the invention in order to reduce its level within keratinocytes. Other miRNA inhibitors that are particularly contemplated in the context of this invention include the miRCURY LNATM microRNA Knockdown Probes (Exiqon) and miScript miRNA inhibitors from Qiagen.

According to a preferred embodiment, the invention relates to a microRNA selected from the 9 microRNAs of the invention, or a modulator of this microRNA for a therapeutic use to treat cutaneous pathologies associated with the epidermal inflammatory state. Preferably, the invention relates to a microRNA selected from hsa-miR-146, hsa-miR886-3p, hsa-miR-155, hsa-miR-203 or modulators of this microRNA resulting in an increase in their expression or an inhibitor of miRNAs, such as antagomirs, targeting at least one microRNA selected from hsa-let-7, hsa-miR-221, hsa-miR-26b, hsamiR-365, and hsa-miR-590-5p or modulators of a microRNA selected from hsa-let-7, hsa-miR-221, hsa-miR-26b, hsa-miR-365, and hsa-miR-590-5p resulting in repression of their expression.

Pathologies that are particularly considered in the context of this invention are atopic dermatitis, seboreal dermatitis, acne, ichthyoses, Netherton syndrome, pityriasis rubra pilaire, keratosis pilaris, Darier's disease, palmoplantar keratoderma, psoriasis and porokeratosis. Pathologies that are particularly considered in the context of this invention are pathologies presenting an inflammatory state associated with a microbial condition, preferably atopic dermatitis and seborrheic dermatitis. Preferably, the invention relates to compositions comprising at least one microRNA selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203 and / or at least one modulator thereof. microRNA resulting in an increase in their expression and / or at least one miRNA inhibitor, such as antagomirs, targeting at least one microRNA selected from hsa-let-7, hsa-miR-221, hsa-miR-26b, hsa-miR -365, and hsa-miR-590-5p and / or at least one modulator of a microRNA selected from hsa-let7, hsa-miR-221, hsa-miR-26b, hsa-miR-365, and hsa-miR -590-5p leading to a repression of their expression, for the therapeutic applications mentioned above. More preferably, the compositions according to the invention comprise at least two, preferably at least 3, preferably 4 microRNAs selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa- miR-203 and / or at least one modulator of at least two, preferably at least 3, preferably 4, of said microRNAs resulting in an increase in their expression and / or at least one miRNA inhibitor, such as antagomirs, targeting at least at least two, preferably at least 3, preferably at least 4, preferably 5 microRNAs selected from hsa-let-7, hsa-miR-221, hsa-miR-26b, hsa- miR-365, and hsa-miR- 590-5p and / or at least one modulator of at least two, preferably at least 3, preferably at least 4, preferably 5 microRNAs selected from hsa-let-7, hsa-miR-221, hsa-miR- 26b, hsa-miR-365, and hsa-miR-590-5p resulting in repression of their expression, for the therapeutic applications mentioned above.

With regard to the therapeutic applications of the invention, if the desired therapeutic effect consists in reducing the activation state of the innate and inflammatory immune response of the skin to be treated, according to a preferred embodiment, the invention relates to compositions comprising at least one microRNA selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203, for use in therapy, preferably for treating cutaneous pathologies associated with the activation state of the innate and inflammatory immune response of the skin, especially to treat psoriasis, atopic dermatitis, acne, ichthyoses, Netherton's syndrome, pityriasis rubra pilaris, keratosis pilaris, the disease of Darier, palmoplantar keratoderma and porokeratosis. The invention also relates to compositions comprising, in addition to or instead of, the hsA-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203 microRNA (s), at least one miRNA inhibitor. , such as an antagomir, targeting a microRNA selected from hsalet-7, hsa-miR-221, hsa-miR-26b, hsa-miR-365, and hsa-miR-590-5p, for use in the treatment of said pathologies. Other miRNA inhibitors particularly contemplated in the context of this invention include miRNA (TM) microRNA Knockdown Probes (Exiqon) and miScript miRNA inhibitors from Qiagen.

It is possible to select at least two microRNA inhibitors, preferably 3, preferably 4, preferably 5 microRNAs from the list consisting of hsa-let-7, hsa-miR221, hsa-miR-26b, hsa-miR-365, and hsa-miR-590-5p.

For situations requiring a decrease in the activation state of the innate and inflammatory immune response of the skin to be treated, a composition or product for the mentioned therapeutic application therefore comprises: at least one, and preferably at least minus 2, 3, or all of the microRNAs hsa-miR146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203; and / or one or more modulators of at least one, and preferably at least 2, 3, or all of said hs-miR-146, hsa-miR-886-3p, hsa-miR-155 microRNAs; hsa-miR203 causing an increase in their expression; and / or one or more miRNA inhibitors, such as antagomirs, targeting at least one, and preferably at least 2, 3, 4 or all hsa-let-7, hsa-miR-221 microRNAs, hsa-miR-26b, hsa-miR-365, and hsa-miR-590-5p; and / or one or more modulators of at least one, and preferably at least 2, 3, 4, or all of said hs-let-7 microRNAs, hsa-miR-221, hsa-miR-26b , hsa-miR-365, and hsa-miR-590-5p resulting in a repression of their expression.

Particularly contemplated miRNA inhibitors within the scope of this invention include antagomirs, miRCURY LNA (TM) microRNA Knockdown Probes (Exiqon) and miScript miRNA inhibitors from Qiagen. If it is preferable according to the present invention to reduce the innate immune response and epidermal inflammation, in some cases it is advantageous, conversely, to increase the activation of the innate immune response and the episermic inflammation. In fact, this makes it possible to increase the innate defenses of the host (in particular via the production of antimicrobial peptides), which may be the objective sought when, for example, it is sought to combat a microbial attack. Thus, for situations requiring an increase in the activation state of the innate and inflammatory immune response of the skin to be treated, a composition or product for the mentioned therapeutic or cosmetic application therefore comprises: one or more modulators of at least one, and preferably at least 2, 3, or all of the hs-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203 microRNAs resulting in a decrease in their expression; and / or one or more miRNA inhibitors, such as antagomirs, targeting at least one, and preferably at least 2, 3, or all of said microRNAs resulting in repression of their expression; at least one, and preferably at least 2, 3, 4, or all the microRNAs hsa-let7, hsa-miR-221, hsa-miR-26b, hsa-miR-365, and hsa-miR- 590-5p.

Preferably, the compositions according to the invention for use in therapy are formulated with pharmaceutically acceptable excipients, for topical application or by ingestion. The present invention also relates to the use of a microRNA chosen from hsamiR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203, hsa-let-7, hsa-miR-221, hsa- miR-26b, hsa-miR-365, and hsa-miR-590-5p, or a modulator of said microRNAs, targeting one of said microRNAs, for cosmetic applications on non-pathological human skin. The various uses mentioned in therapy or in cosmetics preferably involve the topical, local application of microRNAs or compositions comprising said microRNAs, or modulators of said miRNAs, for example antagomirs. Because of their small size, microRNAs and their modulators are in fact capable of crossing the keratinocyte membrane and modifying the level of said microRNAs within the treated keratinocytes.

Moreover, because of their physico-chemical nature, it is unlikely that they reach the deep layers of the skin, thus limiting their action on the epidermis. The stability of microRNAs and their modulators, in particular antagomirs, suggests that their action is transient, and the present invention therefore aims for uses in therapy or in cosmetics involving renewed applications on the skin to be treated. Therefore, the invention aims in particular at a method for treating disorders related to the activation of the innate immune response and epidermal inflammation in physiological, non-pathological cosmetic situations, including topical application to the skin of the skin. an individual of a microRNA selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203 or modulators of this microRNA resulting in an increase in their expression or an inhibitor of miRNAs, such as antagomirs, targeting at least one microRNA selected from hsa-let-7, hsa-miR-221, hsamiR-26b, hsa-miR-365, and hsa-miR-590-5p or modulators of a microRNA selected from hsa-let-7, hsa-miR-221, hsa-miR-26b, hsa-miR-365, and hsa-miR-590-5p resulting in repression of their expression. According to a preferred embodiment of said method, the microRNA is selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203, in order to decrease the state of the immune response. innate and inflammatory state of the keratinocytes of the treated skin. It can be chosen at least two microRNAs, preferably at least 3, preferably the 4 microRNAs from the list consisting of hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203. . Alternatively or in addition, at least one or more miRNA modulators targeting one or more microRNAs selected from hsa-let-7, hsa-miR-221, hsa-miR-26b, hsa-miR-365, and hsa-miR-590-5p, resulting in a repression of their expression. Particularly contemplated miRNA inhibitors within the scope of this invention include antagomirs, miRCURY LNA (TM) microRNA Knockdown Probes (Exiqon) and miScript miRNA inhibitors from Qiagen.

Epidermal inflammation disorders in cosmetic situations are linked in particular to dermatoheliosis, scarring, cutaneous dryness of the elderly (senile xerosis), or chemical aggressions, especially by exfoliants, desquamating, delipidants, or mechanical aggression. These disorders are not pathological and their treatment is not to be considered as a therapeutic treatment, but only a cosmetic treatment, the treatment of these disorders having the essential purpose of improving the appearance of the skin and the comfort of the person.

Problems related to dermatoheliosis, or "photo-aging", mean changes in epidermal differentiation with chronic exposure to sunlight. The skin called "photoaged" is characterized in particular by the appearance of tanned leather, and the presence of more pronounced wrinkles, this skin is also modified at the epidermal level, with overexpression of keratin K6, K16, K17 and a decrease in filaggrin and transglutaminase. These alterations have been associated with the formation of wrinkles. The SPRR proteins involved in the formation of the horny layers are also impaired by UV. It is also known that acute exposure to the sun leads to epidermal changes affecting the barrier function and epidermal homeostasis. Healing disorders are defined as changes in epidermal differentiation with the process of healing and repair. Indeed, during the process of reepithelialization occurring after an injury, the entire repertoire of expression of epidermal proteins is modified. The complete repair is done in three phases, first a migration phase, then a proliferation phase and finally a differentiation phase. The proliferation phase allows the recovery of the wound, it is followed by a process of epidermal neo-morphogenesis involving the actors of stratification and keratinocyte differentiation, which, in a healthy situation allows to reform a functional stratum corneum . The disorders related to drought or xerosis are mainly due to the fact that dry skin is essentially characterized by a decrease in the lipid content of the epidermis and an alteration of the stratum corneum. Keratin 1 and 10 are decreased and keratin K5 and K14 increased. The level of expression of filaggrin is disturbed, as is that of involucrine. Chemical aggressions, in particular by exfoliants, desquamating, delipidants, and mechanical aggression are responsible for modifications of the epidermal homeostasis and induce an alteration of the barrier function ensured by the stratum corneum, and an epidermal inflammation. By the application, preferably topical, of at least one of the microRNAs of the invention, and preferably at least 2, or of a specific inhibitor of these miRNAs, it is possible to treat the various non-pathological disorders. mentioned above, in cometic applications. The present invention is therefore also directed to cosmetic compositions or products comprising at least one of the microRNAs of the invention or comprising at least one modulator of the expression of one of the microRNAs of the invention. These compositions or cosmetic products make it possible to correct or improve the appearance of the skin, its grain, its brightness, its imperfections or its microrelief, to improve skin tolerance, to reduce the sensitivity and reactivity of the skin. A modulator of the expression of one of the microRNAs of the invention is an active agent causing the increase or the repression of the expression of one of said microRNAs. Such an active modulator of the expression of one of the microRNAs is for example identified by the screening methods described above, or it may for example be an antagomir of a microRNA of the invention. Preferably, the cosmetic compositions or products according to the invention comprise at least one microRNA selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsamiR-203 and / or at least one modulator of this microRNA resulting in an increase in their expression and / or at least one miRNA inhibitor, such as antagomirs, targeting at least one microRNA selected from hsa-let-7, hsa-miR-221, hsa-miR-26b, hsamiR- 365, and hsa-miR-590-5p and / or at least one modulator of a microRNA selected from hsa-let-7, hsa-miR-221, hsa-miR-26b, hsa-miR-365, and hsa- miR-590-5p. miR-590-5p resulting in a repression of their expression, for the aforementioned cosmetic applications.

More preferably, the compositions according to the invention comprise at least two, preferably at least 3, preferably 4 microRNAs selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa- miR-203 and / or at least one modulator of at least two, preferably at least 3, preferably 4, of said microRNAs resulting in an increase in their expression and / or at least one miRNA inhibitor, such as antagomirs, targeting at least at least two, preferably at least 3, preferably at least 4, preferably 5 microRNAs selected from hsa-let-7, hsa-miR-221, hsa-miR-26b, hsamiR-365, and hsa-miR-590- 5p and / or at least one modulator of at least two, preferably at least 3, preferably at least 4, preferably 5 microRNAs selected from hsa-let-7, hsa-miR-221, hsa-miR-26b, hsa-miR-365, and hsa-miR-590-5p resulting in a repression of their expression, for the aforementioned cosmetic applications. The cosmetic product or composition in question may be in any galenical form, for example formulated in the form of milk, cream, gel, spray or soap, to be administered topically, or in an ingestible form for the oral route. It may in particular be a combination of different actives, for example a combination of at least two microRNAs of the invention, or a microRNA of the invention and a microRNA modulator of the invention, or two modulators microRNAs of the invention. It can also be the combination of an asset and an instrument, in particular an instrument of the mechanical, light, electrical or electromagnetic treatment type. In a preferred manner according to the invention, the microRNAs and / or modulators of the microRNAs of the invention are used to reduce the inflammatory or aeration-like side effects of the skin barrier function of cosmetic active ingredients used in cosmetic compositions and products. such as coloring, straightening, shampoo, hydro-alcoholic lotion. Thus, such compositions or cosmetic products having inflammatory or aeration-like side effects of the skin barrier function, such as compositions or products for coloring, straightening, shampooing, or even hydroalcoholic lotion may comprise one or more microRNAs and / or modulators of microRNAs of the invention. In particular, these compositions and cosmetic products may comprise at least one microRNA selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203 and / or at least one modulator of this microRNA causing an increase in their expression and / or at least one miRNA inhibitor, such as antagomirs, targeting at least one microRNA selected from hsa-let-7, hsamiR-221, hsa-miR-26b, hsa-miR-365 and hsa-miR-590-5p and / or at least one modulator of a microRNA selected from hsa-let-7, hsa-miR-221, hsa-miR-26b, hsa- miR-365, and hsa-miR. -590-5p resulting in a repression of their expression. In the context of the present invention, it is in particular envisaged cosmetic products to reduce surface imperfections related to disorders of epidermal inflammation.

It is also envisaged specific cosmetic products for sensitive and / or reactive skin, by restoring a better quality, and this by reducing the epidermal inflammation and the innate immune response, thanks to microRNAs of the invention or modulators of said microRNAs .

Repairing products to improve the skin repair process during healing are also contemplated within the scope of this invention. It is also possible to formulate products for damaged skin, either in the context of specific procedures (post-peelings, post-lasers, ...) or in everyday situations, such as pollution, household, etc ...

For situations requiring a decrease in the activation state of the innate and inflammatory immune response of the skin to be treated, a composition or product for the cosmetic application mentioned, therefore comprises: at least one, and preferably at least minus 2, 3, or all of the microRNAs hsa-miR146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203; and / or one or more modulators of at least one, and preferably at least 2, 3, or all of said microRNAs causing an increase in their expression; and / or one or more miRNA inhibitors, such as antagomirs, targeting at least one, and preferably at least 2, 3, 4, or all hsa-let-7 microRNAs, hsa-miR221, hsa- miR-26b, hsa-miR-365, and hsa-miR-590-5p; and / or one or more modulators of at least one, and preferably at least 2, 3, 4, or all of said hs-let-7 microRNAs, hsa-miR-221, hsa-miR-26b , hsa-miR-365, and hsa-miR-590-5p resulting in a repression of their expression. Particularly contemplated miRNA inhibitors within the scope of this invention include antagomirs, miRCURY LNATM microRNA Knockdown Probes (Exiqon) and miScript miRNA inhibitors from Qiagen.

The present invention also relates to a kit for determining the activation state of the innate and inflammatory immune response of a human keratinocyte, comprising a means for assaying the expression of at least one microRNA selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203, hsa-let-7, hsa-miR-221, hsa-miR-26b, hsa-miR-365, and hsa-miR-590-5p and the mention of a reference level for the expression of said microRNA (s). A particularly preferred kit in the context of the present invention is a kit such that the reference level is the average level of expression of said microRNA or microRNAs in keratinocytes in non-stimulated culture.

The different preferred implementations described more specifically for one or the other aspects of the invention are also applicable to the other aspects of the invention. In particular, it is always preferred, according to the methods, methods, kits, compositions and uses of the invention to determine the level of expression of at least two microRNAs chosen from the list of 9 microRNAs of the invention, preferably from minus 3, 4, 5, 6, 7, 8, or even the 9 microRNAs of the invention, namely hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR- 203, hsa-let-7, hsa-miR-221, hsa-miR-26b, hsa-miR-365, and hsa-miR-590-5p. FIGURE LEGEND: FIG. 1: Expression level of miRNAs in keratinocytes treated or not with ligands specific for different TLR receptors (TLR2Zymosan, TLR3PolyI: C, TLR5Flagellin) for 6 or 24h under conditions of low or high calcium FIG. Level of expression of mRNA of genes related to the inflammatory response (IL-8, CCL20, TNFα and HBD2) in keratinocytes overexpressing a miRNA control (pre-) or miR146 (pre146a), treated for 6h or 24h with medium control (med) or zymosan (Zym). The units in ordinates are Arbitrary Units (AU).

EXAMPLES: MATERIAL AND METHODS Culture of human keratinocytes in monolayer Normal human epidermal keratinocytes are derived from mammary plasty and are classically cultured according to the method of Rheinwald and Green, on a feeder layer of previously mitomycinated Swiss 3T3 fibroblasts. Reconstructed Skin In vitro reconstructed skin comprising a stratified and differentiated epidermis with corneal layers and a living equivalent dermis are made with normal human keratinocytes and normal human dermis fibroblasts.

Briefly, equivalent dermas are made with bovine collagen I and one million human dermis fibroblasts. Normal keratinocytes are inoculated after contraction of the lattices at 500,000 keratinocytes and cultured in the conventional medium for 7 days.

The culture is then mounted on a grid for the emergence phase (air-liquid interface, 7 days). At the end of this period, the skins have a morphology very close to normal human skin. They can then be used for different experiments by maintaining the culture medium under the skin that is nourished by capillarity.

Extraction of total RNA from keratinocytes Cell lysis: The keratinocytes in monolayer culture are lysed on a culture dish in the Tri Reagent buffer. The reconstructed epidermis of the reconstructed skin is separated from the equivalent dermis using forceps. These skins are manually ground in glass pots, in lysis buffer Tri Reagent. Extraction of total RNAs The total RNAs are extracted by the conventional lysis technique in solution of guanidium isothiocyanate and extraction with a phenol / chloroform mixture.

Hybridization of microRNAs on uParaflo (TM) "MiRHuman 10.0" chips. The small RNAs are extracted from the total RNAs (Microcon filter, Millipore) and are extended in 3 'with a polyA tail. A fluorescently labeled oligonucleotide is ligated to the polyA tail. The labeled small RNAs are then hybridized to [mu] [Rho] 3 [Gamma] 8 [iota] [Iota] [omicron] (TM) "MiRHuman 10.0" chips (Atactic Technologies, LC Sciences). They contain the complementary sequences of all the human microRNAs listed in miRBase 10.0 (71 1 mature microRNAs). The sequences were deposited 5 times on the chip. The fluorescence is quantized and the signals are normalized. The fluorescence level reflects the level of expression of each microRNA in the sample. Statistical analysis The expression of each microRNA is compared statistically between the "keratinocytes in culture" sample and the "reconstructed epidermal keratinocyte" sample using the student's t test (p <0.05). EXAMPLE 1 Level of Expression of miRNA in Keratinocytes Which are or are not Treated with Ligands Specific to Different TLR Receptors The Expression Levels of miRNA in Keratinocytes Which are or are not Treated with Ligands Specific to Different TLR Receptors (TLR2Zymosan, TLR3PolyI: C , TLR5Flagellin) for 6 or 24h were measured per chip. Of the 754 miRNAs analyzed, ie the set of human miRNA present on a complete array designated for this purpose, 9 were significantly over- or under-expressed in keratinocytes stimulated with TLR receptor ligands. : hsa-miR-146, hsa- miR-886-3p, hsa-miR-155, hsa-miR-203, hsa-let-7, hsa-miR-221, hsa-miR-26b, hsamiR-365, and hsa-miR-590-5p. The values obtained from the array were normalized in comparison with a housekiping RNA U6, U44 and U48 and were retained miRNAs for which a difference of expression> 1.8 was observed. Expression levels of miRNA in keratinocytes treated or not with ligands specific for different TLR receptors (TLR2Zymosan, TLR3PolyI: C, TLR5Flagellin) for 6 or 24h under low or high calcium conditions were confirmed by PCR (FIG. EXAMPLE 2: Effect of miR146 on the inflammatory response The level of expression of mRNA of the IL-8, CCL20, TNFα and HBD2 immune response markers were quantified by qPCR in keratinocytes overexpressing a miRNA control (pre-) or the miR146 (pre146a), treated for 6h or 24h with a control medium (med) or zymosan (Zym). It is observed in FIG. 2 that the induction of the genes linked to the inflammatory response induced by zymosan is inhibited by the overexpression of miR146. The units on the ordinates are arbitrary units, as in Figure 1.

EXAMPLE 3 Methods for Detecting miRNAs Northern Blot: This classic technique is qualitative and quantitative. It allows the analysis of some miRNAs during an experiment. This method requires the use of 5 to 50 μg of total RNA. RT Q-PCR: This method allows the study of miRNA precursors and has been adapted for the study of mature miRNAs. It is marketed (Applied Biosystems TaqMan MicroRNA Assays) and is described in several articles. miRNA Microarray This method, like that of conventional mRNA microarrays, is based on the fluorescent labeling of miRNA complementary cDNAs of a sample, and the hybridization of these labeled ANDc on a slide on which miRNA sequences are previously deposited. known.

According to some authors, this miRNA microarray technology, if it regularly integrates miRBase-derived miRNA sequences, would be the method of choice for miRNAs global expression profile analysis. In addition, in certain situations such as the present invention, the miRNA expression profile is more informative than the expression profile of the messenger RNAs.

In situ Hybridization of MicroRNAs This technique is more delicate than conventional in situ hybridization of mRNAs, because by the classical binding method, small RNAs diffuse more than long RNAs and are lost during hybridization and washing steps. . Techniques have been developed to overcome this disadvantage; in addition, miRNA probes are commercially available (Exiqon, Denmark). In this technique, a reporter gene GFP or LacZ is placed under the control of a promoter including the complementary 3'UTR part of a miRNA.

Claims (22)

REVENDICATIONS1. A method of determining the activation state of the innate and inflammatory immune response on a human keratinocyte within a human epithelial sample, comprising determining the level of expression of at least one microRNA selected from hsa- miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203, hsa-let-7, hsa-miR-221, hsa-miR-26b, hsa-miR-365, and hsa -miR-590-5p within said keratinocyte and comparing the level of expression of the microRNA or microRNAs selected at the mean expression level of the microRNA or microRNAs selected from unstimulated keratinocytes, preferably from the same strain or from the same population. The method according to claim 1, wherein said keratinocyte is considered to have an activated innate immune response and an inflammatory state if the level of expression of at least one of the microRNAs selected from hsa-miR-146, hsa-miR -886-3p, hsa-miR-155, and hsamiR-203, is statistically higher than the mean expression level of said microRNA in unstimulated cultured keratinocytes. The method according to claim 1 or 2, wherein said keratinocyte is considered to have an activated innate immune response and an inflammatory state if the level of expression of hsa-miR-146 is statistically higher than the average level of expression of said microRNA in keratinocytes in culture unstimulated. 4. The method according to claim 1, wherein said keratinocyte is considered to have an activated innate immune response and an inflammatory state if the level of expression of at least one of the microRNAs selected from hsa-let-7, hsa-miR- 221, hsa-miR-26b, hsa-miR-365, and hsa-miR-590-5p is statistically lower than the average level of expression of said microRNA in unstimulated cultured keratinocytes. The method according to any one of claims 1 to 4 wherein the expression level of at least one of the microRNAs selected from hsa-miR-886-3p, hsa-miR-590-5p is determined and compared, and hsa-miR-221. 6. A method according to any one of claims 1 to 5 wherein the expression level of hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR203 is determined and compared. , hsa-let-7, hsa-miR-221, hsa-miR-26b, hsa-miR-365, and hsa-miR-590-5p within said keratinocyte. 7. A method according to any one of claims 1 to 6 wherein said sample is derived from human skin or cultured skin type epithelium. 8. A method for determining the efficacy of a cosmetic treatment of an epithelium, comprising comparing, before and after treatment, the level of expression of at least one microRNA selected from hsa-miR-146, hsa-miR -886-3p, hsa-miR-155, hsa-miR-203, hsa-let-7, 20 hrs-miR-221, hsa-miR-26b, hsa-miR-365, and hsa-miR-590-5p within keratinocytes of this epithelium. The method of claim 8, wherein said microRNA is hsa-miR-146. 25 10. The method of claim 8 or 9, wherein said treatment consists of the topical application or injection of a molecule, the application of radiation or the application of mechanical effects, said method being a method in vitro if the treatment consists of the injection of a molecule. 11. Method according to one of claims 8 to 10, wherein said treatment is considered effective if it causes a change in the level of expression of at least one, preferably at least two of said microRNAs within the body. 'epithelium. 12. A method for screening modulators of the process of the innate and inflammatory immune response within an epithelium, comprising evaluating the state of inflammation of 10 keratinocytes in this epithelium by a method according to one of the Claims 1 to 7, before and after application of the modulator to be screened. The method of claim 12, wherein said modulator is a chemical entity, derived from natural extracts, a complex formulation, a DNA molecule, a microRNA, a siRNA, a microRNA inhibitor, an antagomir, or an instrumental system. using radiation, preferably visible, UV, IR or X radiation. 14. Method according to one of claims 12 to 13, wherein a modulator is identified if it generates a modification of the expression level of at least one, preferably at least two, preferably at least three of said microRNAs within the epithelium. 15. A method of diagnosing the condition of an epidermis, comprising: determining the differential activation of the innate immune response and epidermal inflammation existing within this epidermis between the basal layer and the stratum corneum, and comparison with the differential activation of the innate immune response and average epidermal inflammation existing within a normal epidermis of the same type, between the basal layer and the stratum corneum. 16. Use of the assay for expression of at least one microRNA selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203, hsa-let-7, hsa -miR-221, hsa-miR-26b, hsamiR-365, and hsa-miR-590-5p, in keratinocytes in a human epithelium sample for determining the activation state of the response Innate and inflammatory immune system of said keratinocytes. 17. MicroRNA selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203, hsa-let-7, hsa-miR-221, hsa-miR-26b, hsa mR-365, and hsa-miR-590-5p, or modulator of one of these microRNAs, said modulator being chosen from the group comprising chemical entities or from natural extracts, complex formulations, siRNAs, inhibitors of miRNAs such as antagomirs, light-based instrumental systems, mechanical effects on the skin, and / or injections, for therapeutic use to treat skin pathologies associated with the epidermal differentiation program such as atopic dermatitis, seborrheic dermatitis, acne, ichthyoses, Netherton's syndrome, pityriasis rubra pilaris, keratosis pilaris, Darier's disease, palmoplantar keratoderma, psoriasis and porokeratosis. 18. Use of a microRNA selected from hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203, hsa-let-7, hsa-miR-221, hsa-miR -26b, hsa-miR-365, and hsa-miR-590-5p, or a modulator of one of these microRNAs, for cosmetic applications on non-pathological human skin. 19. A method of treating inflammation-related disorders and activating the epidermal innate immune response in non-pathological cosmetic situations, comprising topically applying to the skin of an individual a microRNA selected hsa-miR- 146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203, hsa-let-7, hsa-miR-221, hsa-miR-26b, hsamiR-365, and hsa-miR-590 -5p, or a modulator of one of these microRNAs. 20. The method of claim 19, wherein said disorders related to inflammation and activation of the epidermal innate immune response in cosmetic situations are related to physiological conditions, including dermatoheliosis, scarring, dry skin or xerosis, or chemical aggressions, in particular by exfoliants, desquamating, delipidating agents, or mechanical aggression. 21. Kit for determining the state of inflammation and activation of the epidermal innate immune response of a human keratinocyte, comprising means for assaying the expression of at least one microRNA selected from hsa-miR -146, hsa-miR-886-3p, hsa-miR-155, hsa-miR-203, hsa-let-7, hsa-miR-221, hsa-miR-26b, hsa-miR-365, and hsa- miR-590-5p, and the mention of a reference level for the expression of said microRNA (s). 22. Set of microRNAs consisting of hsa-miR-146, hsa-miR-886-3p, hsa-miR-155, hsa- miR-203, hsa-let-7, hsa-miR-221, hsa-miR-26b , hsa-miR-365, and hsa-miR-590-5p for the determination of the state of inflammation and activation of the epidermal innate immune response of a human keratinocyte.