FR2953529A1 - Use of at least one micro(mi)RNA e.g. hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, and hsa-let7a, for the implementation of in vitro diagnosis method of gliomas - Google Patents
Use of at least one micro(mi)RNA e.g. hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, and hsa-let7a, for the implementation of in vitro diagnosis method of gliomas Download PDFInfo
- Publication number
- FR2953529A1 FR2953529A1 FR0958737A FR0958737A FR2953529A1 FR 2953529 A1 FR2953529 A1 FR 2953529A1 FR 0958737 A FR0958737 A FR 0958737A FR 0958737 A FR0958737 A FR 0958737A FR 2953529 A1 FR2953529 A1 FR 2953529A1
- Authority
- FR
- France
- Prior art keywords
- hsa
- mir
- expression
- mirna
- level
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
Abstract
Description
Utilisation de miARNs comme biomarqueurs dans le diagnostic de gliomes La présente invention concerne l'utilisation de miARNs comme biomarqueurs dans le diagnostic de gliomes. Elle concerne en plus l'utilisation des miARNs comme biomarqueurs dans le diagnostic de glioblastomes et oligodendrogliomes. Les tumeurs du système nerveux central (SNC) sont pour la plupart des gliomes (50%) regroupant les astrocytomes et les oligodendrogliomes. Ces tumeurs constituent une cause importante de morbidité et de mortalité et représentent un problème important de santé publique. En effet, les tumeurs du SNC constituent la deuxième cause de décès par cancer chez les enfants et la troisième cause chez l'homme adulte (15-34 ans). L'incidence globale des tumeurs du SNC est voisine de 7000 nouveaux cas dépistés chaque année en France. Enfin, sur 6 millions de décès annuels dans le monde à cause d'une forme quelconque de cancer, 1 à 2 % sont imputables aux tumeurs du SNC (Données de l'OMS). L'exérèse de la tumeur constitue un moyen, a priori radical, pour éradiquer une tumeur. Mais dans la pratique clinique, l'efficacité de ce traitement est souvent compromise, car l'ablation de la tumeur souvent ne peut pas être exhaustive. En effet, à cause de l'imprécision des méthodes de diagnostic actuelles, les limites de la tumeur sont parfois mal évaluées lors du diagnostic. La radiothérapie largement utilisée en complément de la chirurgie ne permet pas de supprimer définitivement les tumeurs. La chimiothérapie, utilisant divers composés pharmaceutiques d'intérêt anti-cancéreux, tels que le cisplatine, ou le temodal, est un autre traitement souvent utilisé dans la lutte contre des tumeurs. Cependant, la chimiothérapie n'est pas efficace pour tous les gliomes, soit parce que certains gliomes, par exemple les glioblastomes, sont peu chimio-sensibles, soit parce que certains composés pharmaceutiques sont incapables de passer la barrière hémato-encéphalique. A l'heure actuelle, en dehors de l'analyse histologique réalisée par l'anatomopathologiste, il n'existe que quelques rares tests-diagnostics basés sur des approches moléculaires. Les observations microscopiques de la morphologie des cellules sont complétées dans quelques laboratoires par la recherche de certains marqueurs protéiques à l'aide d'anticorps spécifiques. Ces tests immunohistochimiques présentent néanmoins de nombreux inconvénients pour l'instant. Ils n'ont qu'un faible débit de productivité (ils ne permettent la détection que d'un seul antigène à la fois), ne permettent pas de distinguer sans ambiguïté les différents types de cellules tumorales et n'offrent que de médiocres possibilités de détection quantitative des marqueurs. Les diagnostics réalisés sur la détection de marqueurs génétiques (tels que les pertes d'hétérozygotie lp et 19q dans les oligodendrogliomes) sont actuellement peu usités. Les microARNs (miARN) représentent une classe d'ARN simple brin de petite taille (21 à 25nt), endogènes, non codants, d'identification relativement récente. Les gènes responsables de l'expression de ces miARNs sont préalablement transcrits sous formes de longs précurseurs, eux-mêmes clivés en pré-miARN par la RNAse III Drosha. La maturation de ces pré-miARN est effectuée par une autre RNAse, Dicer, qui donne lieu à un duplex d'ARN noté [miARN : miARN*]. Seul l'un des 2 brins, le brin mature, participe au complexe ribonucléoprotéique RISC (RNA-induced silencing complex) pour fonctionner comme régulateur post-transcriptionnel (Bartel et al., Cell, 2004. 116(2) : 281-97). Les miARNs peuvent réguler l'expression des gènes soit par dégradation d'ARN messagers cibles, soit par répression de leur traduction suivant le degré de complémentarité entre le miARN et son ARNm cible. Ces ARNs jouant un rôle important dans la régulation traductionnelle, ils sont donc fortement impliqués dans de nombreux processus cellulaires tels que le développement, la différenciation, la prolifération, l'apoptose et la réponse aux stress, processus souvent dérégulés dans les tumeurs. De nombreux travaux scientifiques ont été consacrés au rôle des miARN dans les processus d'oncogenèse (Benard, J. and S. Douc-Rasy, Bull Cancer, 2005. 92(9) : p. 757-62; Hammond Curr Opin Genet Dev, 2006. 16(1) : p. 4-9). Maintenant, il est reconnu que des miARNs sont activement impliqués dans le développement des cancers. Chez l'Homme, le nombre de gènes codant les précurseurs de miARNs actuellement identifiés est de 721 (Sanger miRBase version 14, sept 2009). Certains de ces miARNs ont été détectés comme marqueurs tumoraux dans le contexte des cancers du sein et de la prostate et sont donc considérés comme des miARN oncogènes ou suppresseurs de tumeur suivant leur expression dans les tumeurs et leur rôle post-transcriptionnel. Dans les dernières années, l'altération éventuelle des niveaux d'expression des miARNs dans les tumeurs gliales a déjà fait l'objet de plusieurs publications scientifiques. Une publication de Ciafre et al. en 2005 (Biochem Biophys Res Commun. 2005. Sep 9 ; 334(4) : 1351-8) compare les niveaux d'expression de 245 miARNs dans les glioblastomes et dans les tissus normaux, et met en évidence un profil d'expression distinct de ces miARNs dans les glioblastomes par rapport au profil d'expression dans les tissus normaux. Cette publication décrit que miR-221 est surexprimé dans les glioblastomes, alors que miR-128, miR-181a, miRl8lb et miRl8lc sont sous exprimés dans les glioblastomes. The present invention relates to the use of miRNAs as biomarkers in the diagnosis of gliomas. It also relates to the use of miRNAs as biomarkers in the diagnosis of glioblastomas and oligodendrogliomas. Tumors of the central nervous system (CNS) are mostly gliomas (50%) grouping together astrocytomas and oligodendrogliomas. These tumors are a major cause of morbidity and mortality and represent a major public health problem. In fact, CNS tumors are the second leading cause of cancer death in children and the third leading cause in adult men (15-34 years). The overall incidence of CNS tumors is close to 7000 new cases detected each year in France. Finally, of the 6 million annual deaths worldwide due to some form of cancer, 1-2% are attributable to CNS tumors (WHO data). Excision of the tumor is a means, a priori radical, to eradicate a tumor. But in clinical practice, the effectiveness of this treatment is often compromised because the removal of the tumor often can not be exhaustive. Indeed, because of the imprecision of current diagnostic methods, the limits of the tumor are sometimes poorly evaluated at the time of diagnosis. Radiation therapy, which is widely used in addition to surgery, does not completely eliminate tumors. Chemotherapy, using various pharmaceutical compounds of anti-cancer interest, such as cisplatin, or temodal, is another treatment often used in the fight against tumors. However, chemotherapy is not effective for all gliomas, either because some gliomas, for example glioblastomas, are not chemo-sensitive, or because some pharmaceutical compounds are unable to pass the blood-brain barrier. At present, apart from the histological analysis performed by the pathologist, there are only a few diagnostic tests based on molecular approaches. Microscopic observations of cell morphology are completed in a few laboratories by the search for certain protein markers using specific antibodies. These immunohistochemical tests nevertheless have many disadvantages for the moment. They have only a low rate of productivity (they allow detection of only one antigen at a time), do not allow to distinguish unambiguously the different types of tumor cells and offer only poor possibilities of quantitative detection of markers. The diagnostics performed on the detection of genetic markers (such as lp and 19q heterozygosity losses in oligodendrogliomas) are currently little used. The microRNAs (miRNAs) represent a relatively recent identification class of single-stranded (21 to 25nt), endogenous, non-coding RNAs. The genes responsible for the expression of these miRNAs are previously transcribed in the form of long precursors, themselves cleaved into pre-miRNAs by RNAse III Drosha. The processing of these pre-miRNAs is performed by another RNAse, Dicer, which gives rise to an RNA duplex noted [miRNA: miRNA *]. Only one of the two strands, the mature strand, participates in the RISC (RNA-induced silencing complex) ribonucleoprotein complex to function as a post-transcriptional regulator (Bartel et al., Cell, 2004. 116 (2): 281-97). . The miRNAs can regulate gene expression either by degradation of target messenger RNAs or by repression of their translation according to the degree of complementarity between the miRNA and its target mRNA. Since these RNAs play an important role in translational regulation, they are therefore strongly involved in many cellular processes such as development, differentiation, proliferation, apoptosis and stress response, processes often deregulated in tumors. Numerous scientific studies have been devoted to the role of miRNAs in oncogenesis processes (Benard, J. and S. Douc-Rasy, Bull Cancer, 2005. 92 (9): 757-62; Hammond Curr Opin Genet Dev , 2006. 16 (1): 4-9). Now, it is recognized that miRNAs are actively involved in the development of cancers. In humans, the number of genes encoding the precursors of miRNAs currently identified is 721 (Sanger miRBase version 14, Sep 2009). Some of these miRNAs have been detected as tumor markers in the context of breast and prostate cancers and are therefore considered to be oncogenic or tumor suppressor miRNAs depending on their expression in tumors and their post-transcriptional role. In recent years, the possible alteration of miRNA expression levels in glial tumors has already been the subject of several scientific publications. A publication by Ciafre et al. in 2005 (Biochem Biophys Res Commun, 2005. Sep 9; 334 (4): 1351-8) compares expression levels of 245 miRNAs in glioblastomas and normal tissues, and highlights a distinct expression pattern. of these miRNAs in glioblastomas relative to the expression pattern in normal tissues. This publication discloses that miR-221 is overexpressed in glioblastomas, whereas miR-128, miR-181a, miR18b and miR181c are under expressed in glioblastomas.
Au même moment, Chen (N Engl J Med, 2005. 353 (17) : 1768-71) décrit que miR-21 est fortement surexprimé dans les glioblastomes par rapport aux tissus normaux. Un autre balayage des niveaux d'expression de 192 miARNs, dans les tissus de tumeurs gliales et des tissus normaux, a été effectué par Silber et al. en 2008 (BMC Med. 2008. Jun 24 ; 6 :14.). Cette étude vise à analyser une modification éventuelle du profil d'expression des miARNs dans les astrocytomes anaplasiques (grade III) ou les glioblastomes (grade IV), de tumeurs de différents grades d'un même type de tumeur. Cette étude montre un profil d'expression modifié des miARNs dans les astrocytomes anaplasiques et les glioblastomes, par rapport aux tissus normaux. Les miARNs mentionnés dans cette publication, dont l'expression est modifiée, ne sont pas identiques à ceux déjà mentionnés dans les publications antérieures. Cependant, jusqu'à présent, aucune étude antérieure n'a fait un balayage exhaustif, car l'ensemble des microARNs exprimés dans les cellules humaines n'est jamais exploré. Afin de lutter efficacement contre les tumeurs gliales, la mise en place d'une méthode de diagnostic de gliomes, fiable, permettant de distinguer précisément un tissu de tumeur gliale d'un tissu normal, est donc d'une importance décisive. At the same time, Chen (N Engl J Med, 2005. 353 (17): 1768-71) describes that miR-21 is highly overexpressed in glioblastomas compared to normal tissues. Another scan of the expression levels of 192 miRNAs in glial tumor tissues and normal tissues was performed by Silber et al. in 2008 (BMC Med, 2008. Jun 24, 6: 14). This study aims to analyze a possible modification of the expression profile of miRNAs in anaplastic astrocytomas (grade III) or glioblastomas (grade IV), tumors of different grades of the same type of tumor. This study shows a modified expression profile of miRNAs in anaplastic astrocytomas and glioblastomas, compared to normal tissues. The miRNAs mentioned in this publication, the expression of which is modified, are not identical to those already mentioned in previous publications. However, to date, no previous study has done an exhaustive scan, as all microRNAs expressed in human cells are never explored. In order to effectively fight against glial tumors, the establishment of a reliable method of diagnosing gliomas, which makes it possible to precisely distinguish a glial tumor tissue from a normal tissue, is therefore of decisive importance.
Les gliomes ou tumeurs gliales sont classés par l'Organisation Mondiale de la Santé (OMS) en 4 grades histologiques, le grade indiquant principalement le degré de malignité (voir le tableau 1). Tableau 1 Grade I Astrocytome pilocytique curable par chirurgie G Grade II Oligoastrocytomes deux types de cellules : astrocytes et oligodendrogliales Oligodendrogliomes, Astrocytomes diffus Grade III Oligodendrogliomes anaplasiques Oligoastrocytomes anaplasiques Astrocytomes anaplasiques Grade IV Glioblastome multiforme Les oligodendrogliomes, classés en grade II par OMS, sont des gliomes de bas grade, développés à partir des oligodendrocytes. Ce gliome a été jusqu'à ce jour très souvent sous-diagnostiqué, à cause de défauts de méthode de diagnostic efficace. Néanmoins, contrairement aux autres tumeurs gliales, les oligodendrogliomes sont remarquablement chimio-sensibles. La médiane de survie, pour les oligodendrogliomes, est d'environ 7 ans. En revanche, les glioblastomes, classés en grade IV selon la classification de l'OMS, sont développés à partir des astrocytes, qui sont des passerelles entre le sang et les neurones, assurent la nutrition des neurones, gèrent les connections interneuronales, et régulent les neurotransmetteurs. Les glioblastomes sont des tumeurs astrocytaires malignes. En l'absence d'exérèse chirurgicale satisfaisante et de chimio-sensibilité vis-à-vis de la plupart des médicaments anticancéreux actuellement mis sur le marché, le pronostic de ces tumeurs est très pessimiste La survie moyenne n'est que d'environ 1 an pour les glioblastomes après traitement. Par conséquent, une méthode de diagnostic capable de distinguer rapidement et correctement un oligodendrogliome d'un glioblastome permet à un patient de recevoir des soins correspondant à son état physique et d'augmenter ses chances de survie. Cependant, dans les publications antérieures mentionnées ci-dessus, le matériel biologique de départ est constitué de glioblastomes comparés à du tissu péritumoral ou du tissu sain ; ou des cellules de glioblastomes en culture comparées à du tissu cérébral sain ; ou des glioblastomes, correspondant à des astrocytomes de haut grade, comparées à des tumeurs astrocytaires de bas grades, telles que des astrocytomes anaplastiques. En revanche, les comparaisons entre glioblastomes et oligodendrogliomes n'ont jamais été abordées dans l'art antérieur. Donc, un autre aspect de l'invention a pour objectif de mettre en place une méthode de diagnostic permettant de distinguer précisément un glioblastome d'un oligodendrogliome. Gliomas or glial tumors are classified by the World Health Organization (WHO) in four histological grades, the grade indicating mainly the degree of malignancy (see Table 1). Table 1 Grade I Surgical pilocytic astrocytoma G Grade II Oligoastrocytomas two types of cells: astrocytes and oligodendrogliales Oligodendrogliomas, diffuse Astrocytomas Grade III Anaplastic Oligodendrogliomas Anaplastic Oligoastrocytomas Anaplastic Astrocytomas Grade IV Glioblastoma multiforme Oligodendrogliomas classified as Grade II by WHO are gliomas low grade, developed from oligodendrocytes. This glioma has so far been very often underdiagnosed, because of defects in effective diagnostic method. Nevertheless, unlike other glial tumors, oligodendrogliomas are remarkably chemo-sensitive. The median survival for oligodendrogliomas is about 7 years. On the other hand, glioblastomas, classified in grade IV according to the WHO classification, are developed from astrocytes, which are bridges between the blood and the neurons, ensure the nutrition of the neurons, manage the interneuronal connections, and regulate the neurons. neurotransmitters. Glioblastomas are astrocytic malignant tumors. In the absence of satisfactory surgical excision and chemosensitivity to most of the anticancer drugs currently on the market, the prognosis of these tumors is very pessimistic. Mean survival is only about 1 year for glioblastoma after treatment. Therefore, a diagnostic method capable of quickly and correctly distinguishing an oligodendroglioma from a glioblastoma allows a patient to receive care corresponding to his physical condition and to increase his chances of survival. However, in the previous publications mentioned above, the starting biological material consists of glioblastomas compared to peritumoral tissue or healthy tissue; or cultured glioblastoma cells compared to healthy brain tissue; or glioblastomas, corresponding to high grade astrocytomas, compared to low grade astrocytic tumors, such as anaplastic astrocytomas. On the other hand, comparisons between glioblastomas and oligodendrogliomas have never been discussed in the prior art. Thus, another aspect of the invention aims to provide a diagnostic method for precisely distinguishing a glioblastoma from an oligodendroglioma.
L'invention repose sur une constatation inattendue faite par les Inventeurs lors d'un balayage des niveaux d'expression de 282 microARNs dans les tissus normaux, et les tissus provenant de deux types de tumeurs de nature et d'origine différents, dont les glioblastomes (GBM) et les oligodendrogliomes (ODG). En effet, les Inventeurs ont constaté que le profil d'expression de ces miARNs est nettement différent dans les tissus de tumeur gliale par rapport à celui présent dans les tissus normaux. Basée sur la comparaison faite entre le profil d'expression de 282 miARNs dans les tumeurs gliales (glioblastomes ou oligodendrogliomes) et des tissus cérébraux sains, la présente invention a repéré 19 miARNs dont l'expression est soit systématiquement surexprimée, soit systématiquement sous-exprimée, dans les tumeurs gliales par rapport aux tissus cérébraux sains. Ainsi, le premier aspect de l'invention a pour objet l'utilisation d'au moins un miARN choisi parmi hsa-miR-126, hsa-miR-15b, hsa- miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let7f, hsa-let7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 ou hsa-miR-10a pour la mise en oeuvre d'une méthode de diagnostic in vitro de gliomes. La séquence nucléique et le numéro d'accession pour chaque miARN mentionné dans la présente invention sont présentés ci-dessous dans le tableau 2. Tableau 2 miARNs exprimés Numéro de Accession séquence différemment dans séquence MIMAT les tumeurs gliales par rapport à du tissu cérébral sain hsa-miR-126 SEQ ID NO : 1 MIMAT0000445 ucguaccgugaguaauaaugcg hsa-miR-16 SEQ ID NO : 2 MIMAT0000069 uagcagcacguaaauauuggcg hsa-miR-20a SEQ ID NO : 3 MIMAT0000075 uaaagugcuuauagugcagguag hsa-let 7a SEQ ID NO : 4 MIMAT0000062 ugagguaguagguuguauaguu hsa-let 7f SEQ ID NO : 5 MIMAT0000067 ugagguaguagauuguauaguu hsa-let 7d SEQ ID NO : 6 MIMAT0000065 agagguaguagguugcauaguu hsa-miR-374a SEQ ID NO : 7 MIMAT0000727 uuauaauacaaccugauaagug hsa-miR-15b SEQ ID NO : 8 MIMAT0000417 uagcagcacaucaugguuuaca hsa-miR-127-3p SEQ ID NO : 9 MIMAT 0000446 ucggauccgucugagcuuggcu hsa-miR-339-5p SEQ ID NO : 10 MIMAT0000764 ucccuguccuccaggagcucacg hsa-miR-409-5p SEQ ID NO : 11 MIMAT0001638 agguuacccgagcaacuuugca hsa-miR-134 SEQ ID NO : 12 MIMAT0000447 ugugacugguugaccagagggg hsa-miR-155 SEQ ID NO : 13 MIMAT0000646 uuaaugcuaaucgugauaggggu hsa-miR-210 SEQ ID NO : 14 MIMAT0000267 cugugcgugugacagcggcuga hsa-miR-l0a SEQ ID NO : 15 MIMAT0000253 uacccuguagauccgaauuugug hsa-miR-26b SEQ ID NO : 16 MIMAT0000083 uucaaguaauucaggauaggu hsa-miR-34b SEQ ID NO : 17 MIMAT0004676 caaucacuaacuccacugccau hsa-miR-17 SEQ ID NO : 18 MIMAT0000070 caaagugcuuacagugcagguag hsa-miR-151-3p SEQ ID NO : 19 MIMAT0000757 cuagacugaagcuccuugagg Les miARNs mentionnés ci-dessus sont référencés dans la base de données miRBase ( klr' , t__tgl) (miRBase : tools for microRNA genomic, Griffiths-Jones et al., NAR 2008 36(Database Issue):D154-D158) où la séquence nucléique d'un miARN peut être retrouvée par un numéro d'accession MIMAT ou une annotation uniforme. Un système d'annotation a été mis en place pour nommer les différents miARNs (A uniform system for microRNA annotation, Ambros et al., RNA 2003 9(3):277-279). Dans ce système, les microARNs sont désignés par un numéro. Précédent ce numéro d'identification, se trouve l'abréviation « miR » ou « mir », qui permet une distinction entre le microARN mature (miR) et la boucle précurseur (hairpin) du microARN (mir), correspondant respectivement à un numéro d'accession MIMAT et MI. Un préfixe de trois ou quatre lettres est utilisé pour distinguer les origines génomiques de ce miARN. Par exemple « hsa-miR-126» signifie que ce miARN mature provient du génome humain. Parfois, les microARN matures peuvent être très proches (une seule base de différence). Dans ce cas, les microARNs portant un même numéro sont distingués entre eux par une lettre minuscule comme a, b, c...par exemple hsamiR-26b. Parfois une boucle précurseur peut générer, de son côté 5' et son coté 3', deux microARNs matures qui sont distingués l'un de l'autre par l'annotation « 5p » ou « 3p ». Par exemple « hsa-miR-151-3p » signifie un miARN mature provenant du côté 3' de son précurseur. Les miARNs utilisés dans la présente invention sont les miARNs matures provenant du génome humain, qui peuvent être produits naturellement par des cellules, ou synthétisés par des méthodes chimiques conventionnelles, ou des méthodes biologiques, telles qu'un vecteur recombinant. Dans la présente invention, les expressions « miARN » et « microARN » peuvent être remplacées l'une par l'autre. Les expressions tumeurs gliales ou gliomes sont équivalentes. Glioblastomes et oligodendrogliomes sont deux types de gliomes. Tissu sain ou échantilllon sain signifient tissu non tumoral ou échantillon non tumoral. Ces expressions au singulier peuvent s'entendre au pluriel et réciproquement. Dans un mode de réalisation avantageux, l'invention concerne l'utilisation d'au moins un miARN choisi parmi hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsamiR-127, hsa-miR-151, hsa-miR-26b ou hsa-miR-34b, pour la mise en oeuvre d'une méthode de diagnostic in vitro de gliomes. The invention is based on an unexpected finding made by the inventors during a scan of expression levels of 282 microRNAs in normal tissues, and tissues from two types of tumors of different natures and origin, including glioblastomas. (GBM) and oligodendrogliomas (ODG). Indeed, the inventors have found that the expression profile of these miRNAs is significantly different in glial tumor tissues compared to that present in normal tissues. Based on the comparison between the expression pattern of 282 miRNAs in glial tumors (glioblastomas or oligodendrogliomas) and healthy brain tissue, the present invention identified 19 miRNAs whose expression is either systematically overexpressed or systematically under-expressed. , in glial tumors compared to healthy brain tissue. Thus, the first aspect of the invention relates to the use of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa- miR-16, hsa-miR-17, hsa-miR -20a, hsa-let7a, hsa-let7f, hsa-let7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151 , hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a for the implementation of an in vitro diagnostic method of glioma. The nucleic acid sequence and accession number for each miRNAs mentioned in the present invention are presented below in Table 2. Table 2 miRNAs expressed Sequence Accession number differently in sequence MIMAT glial tumors compared to healthy brain tissue hsa -miR-126 SEQ ID NO: 1 MIMAT0000445 ucguaccgugaguaauaaugcg hsa-miR-16 SEQ ID NO: 2 MIMAT0000069 uagcagcacguaaauauuggcg hsa-miR-20a SEQ ID NO: 3 MIMAT0000075 uaaagugcuuauagugcagguag hsa-let 7a SEQ ID NO: 4 MIMAT0000062 ugagguaguagguuguauaguu hsa-let 7f SEQ ID NO: 5 MIMAT0000067 ugagguaguagauuguauaguu hsa-let 7d SEQ ID NO: 6 MIMAT0000065 agagguaguagguugcauaguu hsa-miR-374a SEQ ID NO: 7 MIMAT0000727 uuauaauacaaccugauaagug hsa-miR-15b SEQ ID NO: 8 MIMAT0000417 uagcagcacaucaugguuuaca hsa-miR-127-3p SEQ ID NO: 9 MIMAT 0000446 ucggauccgucugagcuuggcu hsa-miR-339-5p SEQ ID NO: 10 MIMAT0000764 ucccuguccuccaggagcucacg hsa-miR-409-5p SEQ ID NO: 11 MIMAT0001638 agguuacccgagcaacuuugca hsa-miR-134 SEQ ID NO: 12 MIMAT0000447 ugugacugguugaccagagggg hsa-miR-155 SEQ ID NO: 13 MIMAT0000646 uuaaugcuaaucgugauaggggu hsa-miR-210 SEQ ID NO: 14 MIMAT0000267 cugugcgugugacagcggcuga hsa-miR-l0a SEQ ID NO: 15 MIMAT0000253 uacccuguagauccgaauuugug hsa- miR-26b SEQ ID NO: 16 MIMAT0000083 uucaaguaauucaggauaggu hsa-miR-34b SEQ ID NO: 17 MIMAT0004676 caaucacuaacuccacugccau hsa-miR-17 SEQ ID NO: 18 MIMAT0000070 caaagugcuuacagugcagguag hsa-miR-151-3p SEQ ID NO: 19 MIMAT0000757 cuagacugaagcuccuugagg miRNAs mentioned above are referenced in the miRBase database (klr ', t__tgl) (miRBase: tools for microRNA genomic, Griffiths-Jones et al., NAR 2008 36 (Database Issue): D154-D158) where the nucleic acid sequence a miRNA can be traced by a MIMAT accession number or a uniform annotation. An annotation system has been put in place to name the different miRNAs (A uniform system for microRNA annotation, Ambros et al., RNA 2003 9 (3): 277-279). In this system, microRNAs are designated by a number. Previous this identification number, is the abbreviation "miR" or "mir", which allows a distinction between the mature microRNA (miR) and the precursor loop (hairpin) of the microRNA (mir), respectively corresponding to a number of MIMAT accession and MI. A prefix of three or four letters is used to distinguish the genomic origins of this miRNA. For example, "hsa-miR-126" means that this mature miRNA comes from the human genome. Sometimes mature microRNAs can be very close (only one difference basis). In this case, microRNAs bearing the same number are distinguished from each other by a lowercase letter such as a, b, c ... for example hsamiR-26b. Sometimes a precursor loop can generate, on its side 5 'and its side 3', two mature microRNAs which are distinguished from each other by the annotation "5p" or "3p". For example, "hsa-miR-151-3p" means a mature miRNA from the 3 'side of its precursor. The miRNAs used in the present invention are mature miRNAs from the human genome that can be produced naturally by cells, or synthesized by conventional chemical methods, or biological methods, such as a recombinant vector. In the present invention, the expressions "miRNA" and "microRNA" may be replaced by each other. The terms glial tumors or gliomas are equivalent. Glioblastomas and oligodendrogliomas are two types of gliomas. Healthy tissue or healthy sampling means non-tumor tissue or non-tumor sample. These singular expressions may be understood in the plural and vice versa. In an advantageous embodiment, the invention relates to the use of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miRN 20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsamiR-127, hsa-miR-151, hsa-miR-26b or hsa-miR-34b, for the implementation of an in vitro diagnostic method of glioma.
L'expression aberrante de ces 16 miARNs dans une tumeur gliale n'a jamais été mentionnée par les publications antérieures, soit parce que le balayage des miARNs effectué dans les travaux antérieurs n'est pas exhaustif, (par exemple l'étude de Silber et al. en 2008 ne concerne que 192 miARNs), soit parce que la technique employée auparavant ne permet pas de donner une plus haute résolution par rapport à la technique adoptée dans l'invention. En effet, l'étude de Ciafrè et al. en 2005, utilisant la technique de la « puce à ADN » pour quantifier l'expression des miARNs, ne montre pas une différence significative entre le niveau d'expression de miR-16 dans les tissus de glioblastomes et le niveau d'expression du susdit miARN dans les tissus normaux, alors que la présente invention illustre que miR-16 est surexprimé dans les glioblastomes, grâce à la technique de la PCR quantitative, qui permet de distinguer de manière plus précise une différence de quantité d'ARN entre deux échantillons. Parmi l'ensemble des 19 miARNs repérés dans l'invention, il y a 5 miARNs, à savoir hsa-miR-155, hsa-miR-210 ou hsa-miR-10a, hsa-miR-409 et hsa-miR-134, dont le profil d'expression est très particulier. Le profil d'expression de ces 5 miARNs, qui est différent dans les tumeurs par rapport à celui dans les tissus normaux, est également différencié entre les glioblastomes et les oligodendrogliomes. Les niveaux d'expression de ces 5 miARNs sont systématiquement plus élevés dans les glioblastomes par rapport à ceux dans les oligodendrogliomes (voir le tableau 3 dans l'exemple 2). Dans un mode de réalisation avantageux, l'invention concerne l'utilisation d'au moins un miARN choisi parmi hsa-miR-155, hsa-miR-210 ou hsa-miR-10a, hsa-miR-409 ou hsamiR-134 pour la mise en oeuvre d'une méthode de diagnostic spécifique in vitro de gliomes, ladite méthode permettant de distinguer le glioblastome de l'oligodendrogliome. Un autre aspect de l'invention a pour objet une méthode de diagnostic in vitro de gliomes. Cette méthode permet de diagnostiquer si un patient est atteint d'un gliome. Cette méthode comprend les étapes suivantes : - la mesure du niveau d'expression d'au moins un miARN choisi parmi hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsalet 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsamiR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 ou hsa-miR-10a, dans un échantillon biologique provenant d'un patient suspecté de présenter un gliome, - la comparaison : - entre le niveau d'expression d'au moins un susdit miARN dans le susdit échantillon et le niveau d'expression du susdit miARN dans un échantillon sain de référence, ou - entre le niveau d'expression d'au moins un premier susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome et le niveau d'expression d'au moins un deuxième susdit miARN dans l'échantillon provenant dudit patient suspecté de présenter un gliome. The aberrant expression of these 16 miRNAs in a glial tumor has never been mentioned by previous publications, either because the scanning of miRNAs performed in previous work is not exhaustive, (eg the study of Silber and in 2008 only 192 miRNA), or because the technique used previously does not give a higher resolution compared to the technique adopted in the invention. Indeed, the study of Ciafrè et al. in 2005, using the "microarray" technique to quantify the expression of miRNAs, does not show a significant difference between the level of expression of miR-16 in glioblastoma tissues and the level of expression of the above miRNA in normal tissues, while the present invention illustrates that miR-16 is overexpressed in glioblastomas, thanks to the quantitative PCR technique, which makes it possible to more accurately distinguish a difference in the amount of RNA between two samples. Of the 19 miRNAs identified in the invention, there are 5 miRNAs, ie, hsa-miR-155, hsa-miR-210 or hsa-miR-10a, hsa-miR-409 and hsa-miR-134. , whose expression profile is very particular. The expression pattern of these 5 miRNAs, which is different in tumors compared to that in normal tissues, is also differentiated between glioblastomas and oligodendrogliomas. Expression levels of these miRNAs are consistently higher in glioblastomas than in oligodendrogliomas (see Table 3 in Example 2). In an advantageous embodiment, the invention relates to the use of at least one miRNA selected from hsa-miR-155, hsa-miR-210 or hsa-miR-10a, hsa-miR-409 or hsamiR-134 for the implementation of a method for specific in vitro diagnosis of glioma, said method for distinguishing glioblastoma from oligodendroglioma. Another aspect of the invention is a method for in vitro diagnosis of glioma. This method can diagnose if a patient has a glioma. This method comprises the following steps: measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR -20a, hsa-let7a, hsa-let 7f, hsalet 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsamiR-151, hsa mR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a, in a biological sample from a patient suspected of having a glioma, - the comparison: - between the level of expression of at least one of said miRNA in said sample and the level of expression of said miRNA in a reference healthy sample, or - between the level of expression of at least a first miRNA in the reference sample sample from a patient suspected of having a glioma and the level of expression of at least a second said miRNA in the sample from said patient suspected of having a glioma.
La comparaison des niveaux d'expressions des miARNs peut être réalisée entre un échantillon provenant d'un patient suspecté de présenter un gliome et un échantillon sain de référence, ou un échantillon de référence provenant d'un patient présentant un glioblastome ou d'un patient présentant un oligodendrogliome. Par « échantillon biologique », on entend un échantillon tissulaire, notamment un tissu cérébral obtenu par exérèse, ou un échantillon de liquides biologiques, notamment un échantillon sanguin. Un échantillon tissulaire cérébral peut être un tissu du système nerveux central provenant du cortex cérébral, du cortex cérébelleux, des noyaux gris centraux ou des noyaux du tronc cérébral. Un échantillon de liquide biologique peut être un sérum sanguin ou un plasma sanguin. Lorsqu'il s'agit d'un échantillon tissulaire cérébral, «Un échantillon sain de référence» est un tissu cérébral dépourvu de tout caractère tumoral d'après une analyse histologique réalisée par les anatomopathologistes. Le tissu sain de référence peut être un tissu du système nerveux central provenant du cortex cérébral, du cortex cérébelleux, des noyaux gris centraux ou des noyaux du tronc cérébral. Le tissu sain de référence est préférentiellement prélevé à partir d'un même patient (tissu sain de zone périphérique à la tumeur). Alternativement il peut être constitué de fragments encéphaliques obtenus après chirurgie dite de cortectomie réalisée sur des individus ne présentant pas de tumeurs du cerveau mais dans le cadre d'intervention pour traitement de l'épilepsie ou suite à des traumatismes crâniens. Lorsqu'il s'agit d'un échantillon de liquides biologiques, «un échantillon sain de référence » est prelevé d'une personne saine, et notamment d'une personne ne présentant aucun cancer. The comparison of expression levels of miRNAs can be performed between a sample from a patient suspected of having a glioma and a reference healthy sample, or a reference sample from a patient with glioblastoma or a patient presenting an oligodendroglioma. The term "biological sample" is intended to mean a tissue sample, in particular brain tissue obtained by excision, or a sample of body fluids, in particular a blood sample. A brain tissue sample may be central nervous system tissue from the cerebral cortex, cerebellar cortex, basal ganglia, or brainstem nuclei. A biological fluid sample may be a blood serum or a blood plasma. In the case of a cerebral tissue specimen, "A healthy reference sample" is brain tissue devoid of any tumor character after histological analysis by pathologists. The reference healthy tissue may be central nervous system tissue from the cerebral cortex, cerebellar cortex, basal ganglia, or brainstem nuclei. The reference healthy tissue is preferably taken from the same patient (healthy tissue peripheral zone to the tumor). Alternatively it may consist of encephalic fragments obtained after surgery called cortectomy performed on individuals without brain tumors but in the context of intervention for the treatment of epilepsy or following traumatic brain injury. In the case of a sample of body fluids, "a healthy reference sample" is taken from a healthy person, including a person who is not cancer-free.
Lorsque « un échantillon biologique provenant d'un patient suspecté de présenter un gliome » est un échantillon tissulaire cérébral, il s'agit d'un tissu prélevé, par biopsie ou par exérèse au bloc opératoire ou toute autre méthode de prélèvement intratumoral adapté, du siège tumoral soupçonné d'un patient. Le siège tumoral soupçonné est repéré préalablement par une méthode classique, telle qu'une IRM, un Pet Scan (Scanner par image de rayons gamma), ou un scanner classique. Lorsque « un échantillon biologique provenant d'un patient suspecté de présenter un gliome » est un échantillon sanguin, cet échantillon est obtenu d'un patient par prélèvement du sang selon les méthodes conventionnelles, When "a biological sample from a patient suspected of having a glioma" is a cerebral tissue sample, it is a tissue taken by biopsy or excision from the operating room or any other suitable intratumoral specimen collection method. tumoral seat suspected of a patient. The suspected tumor site is previously identified by a conventional method, such as an MRI, a Pet Scan, or a conventional CT scanner. When "a biological sample from a patient suspected of having a glioma" is a blood sample, this sample is obtained from a patient by blood sampling according to conventional methods,
« Un échantillon de référence provenant d'un patient présentant un glioblastome ou d'un patient présentant un oligodendrogliome» est un échantillon provenant d'un patient dont la présence de l'une des deux tumeurs a été certifiée par l'analyse anatomo-pathologique. Idéalement, le diagnostic peut également être confirmé par des analyses moléculaires telles que par exemple l'analyse des profils d'expression de gènes de ces tissus tumoraux. Les tumeurs sont ensuite caractérisées en utilisant la méthode de classification de Li et al (Li A, Walling J, Ahn S, Kotliarov Y, Su Q, Quezado M, Oberholtzer JC, Park J, Zenklusen JC, Fine HA. Cancer Res. 2009 Mar 1;69(5):2091-9) qui repose sur l'utilisation des niveaux d'expression d'un jeu de 54 gènes. Les glioblastomes ou oligodendrogliomes sont classés respectivement dans les groupes G et O de la publication suscitée. « Un échantillon de référence provenant d'un patient présentant un glioblastome ou d'un patient présentant un oligodendrogliome » est un échantillon tissulaire cérébral, le susdit tissu peut être un fragment de tumeur gliale obtenu par exérèse chez un patient et dont le type de tumeur a été certifié par l'analyse anatomo-pathologique. "A reference sample from a patient with glioblastoma or a patient presenting with an oligodendroglioma" is a sample from a patient whose presence of one of the two tumors has been certified by pathological analysis. . Ideally, the diagnosis can also be confirmed by molecular analyzes such as, for example, the analysis of the gene expression profiles of these tumor tissues. The tumors are then characterized using the Li et al classification method (Li A, Walling J, Ahn S, Kotliarov Y, Su Q, Quezado M, Oberholtzer JC, Park J, Zenklusen JC, Fine HA, Cancer Res. Mar 1; 69 (5): 2091-9) which relies on the use of the expression levels of a set of 54 genes. Glioblastomas or oligodendrogliomas are classified respectively in groups G and O of the resulting publication. "A reference sample from a patient with a glioblastoma or from a patient with an oligodendroglioma" is a brain tissue sample, the aforementioned tissue may be a glial tumor fragment obtained by excision in a patient and whose tumor type has been certified by pathological analysis.
Les miARNs mesurés dans cette méthode sont contenus dans des fractions de purification d'ARNs obtenus soit à partir d'extraits ou lysats provenant de tissus cérébraux obtenus par biopsie ou par exérèse au bloc opératoire ou toute autre méthode de prélèvement intratumoral adapté, lorsqu'il s'agit d'un échantillon tissulaire ; soit à partir d'extraits ou lysats des différentes fractions des liquides biologiques en utilisant des méthodes adaptées, lorsqu'il s'agit d'un échantillon de liquides biologiques. Les extraits de tissus utilisés pour les dosages correspondent à des fractions obtenues après lyse des tissus et purification plus ou moins poussée des ARNs selon des méthodes conventionnelles (par exemple la méthode mirVana commercialisée par Ambion, ou RNeasy par Qiagen, ou méthodes de purification par électrophorèse). Selon les méthodes, les fractions contiennent des ARN totaux, ou des ARNs de tailles inférieures à 200 bases, ou des fractions enrichies en microARN. Les miARNs mesurés dans un échantillon sanguin peuvent être la totalité des miARNs circulants dans le plasma ou le sérum, ou les miARNs localisés dans les microvésicules présentes dans le sérum. La totalité des miARNs circulants dans le sang est purifiée directement à partir de prélèvements de sang selon les méthodes conventionelles, telles que ce qui est décrit par Mitchell PS et al. (Mitchell PS et al., Proc Natl Acad Sci U S A. 2008 Jul 29;105(30):10513-8) ou par Lodes MJ (Lodes MJ et al., PLoS One. 2009 Jul 14;4(7):e6229). Les miARNs localisés dans les microvésicules présentes dans le sérum sont purifiés selon une approche décrite par exemple par Skog et al (Skog et al., Nat Cell Biol. 2008 Dec;10(12):1470-6). Le terme « niveau d'expression » d'un miARN dans un échantillon correspond à une valeur de mesure propre à un miARN, mais exprimé soit en unité arbitraire, soit en unité de masse, de molécules ou de concentration, ou en valeur normalisée par rapport à une autre mesure, en particulier en valeur normalisée par rapport aux quantités du même miARN dans un tissu de référence (sain ou tumoral) Le niveau d'expression des miARNs peut être mesuré par toute méthode conventionnelle, telle que - l'hybridation sur « puces à ADN », - des méthodes de séquençage à haut débit d'un grand nombre de miARN individualisés, - la PCR en temps réel, - le Northern blot, ou encore par toute autre méthode spécifique des miARNs. Le niveau d'expression des miARNs peut être mesuré par la technique de la «puce à ADN ». La technique de la «puce à ADN » est bien connue de l'homme du métier. Il s'agit de l'hybridation de miARNs extraits sur un support solide composé d'une membrane nylon, d'une surface de silicium ou de verre, éventuellement de nano-billes ou particules, comportant des oligonucléotides de séquences connues fixés sur le support ou adhérents à celui-ci. La complémentarité des oligonucléotides fixés avec les séquences des microARNs ou de leurs produits de conversion (produits d'amplification, cDNA, ARN ou cARN) permet de générer un signal (fluorescence, luminescence, radioactivité, signal électrique...) selon les techniques de marquage employées, au niveau des oligonucléotides immobilisés sur les supports (puces à ADN). Ce signal est détecté par un équipement spécifique et une valeur d'intensité de ce signal propre pour chaque miARN est ainsi enregistrée. Plusieurs types de puces destinées à la détection des miARNs sont déjà mis sur le marché, comme par exemple les GeneChip® miRNA commercialisés par Affymetrix, miRcury arrays par Exiqon, miRXplore microarrays par Miltenyi. Dans le cas de l'analyse haut débit par séquençage, les miARNs sont extraits et purifiés d'un échantillon, isolés les uns des autres par des méthodes proposées par les fournisseurs d'équipements de séquençage tels que Roche, Invitrogen. Ce genre d'analyse consiste à individualiser les molécules des différents microARNs, de procéder à une étape d'amplification et de séquencer les produits (« clones d'acides nucléiques ») ainsi générés. La réalisation de très nombreuses séquences pour identifier chacun de ces « clones » (plusieurs milliers) permet de générer un listing des microARNs présents dans un échantillon et de quantifier chacun de ces miARNs en comptant tout simplement combien de fois chaque séquence est retrouvée dans le listing détaillé. Dans un mode de réalisation préférée de l'invention, les dosages de miARN sont réalisés par PCR quantitative (PCR en temps réel). La PCR en temps réel permet d'obtenir des valeurs, appelées Ct, correspondant au nombre de cycles à partir duquel la fluorescence émise dépasse un certain seuil, le seuil étant fixé par l'utilisateur en début de phase exponentielle. Cette valeur de Ct est proportionnelle à la quantité de cDNA (provenant de la transcription inverse des miARN en cDNA par la Reverse Transcriptase) présent initialement dans l'échantillon. En l'absence de gamme-étalon spécifique pour chaque cDNA, seule une quantification relative entre échantillons est possible. Dans un premier temps, afin de pouvoir comparer le contingent de chaque miARN pris individuellement et présent dans les glioblastomes, les oligodendrogliomes et les tissus sains, les valeurs de dosage pour chaque miARN sont normalisées avec les données obtenues pour un ARN non-codant (de la catégorie des snoRNA) appelé RNU24 (SEQ ID NO : 20). Le choix de RNU24 est dicté par une analyse des mesures de plusieurs snoRNA effectuées sur de nombreux échantillons et réalisé à l'aide du logiciel Normfinder. Cette analyse a permis de conclure que RNU24 est le normalisateur le plus fiable dans la présente étude (son taux d'expression varie en fait très peu entre tous les échantillons tissulaires utilisés dans l'invention). La quantification relative d'un miARN entre 2 types d'échantillons est obtenue ensuite grâce par exemple au logiciel REST qui prend en compte le paramètre d'efficacité de la PCR et les valeurs de Ct du miARN d'intérêt et de RNU24 pour tous les échantillons analysés. Cependant, la présente invention peut être mise en oeuvre avec d'autres normalisateurs connus de l'homme de métier. Lorsque les niveaux d'expression des miARNs sont analysés par hybridation sur « puces à ADN », ou par Northern blot, ou par séquençage, ils peuvent être exprimés par la formule I : Quantité de miARNx = intensité du signal de détection pour miARNx Où « intensité de signal » signifie quantité de fluorescence, de radioactité ou de luminescence enregistrée sur les « puces à ADN » par le détecteur adapté, ou nombre de séquences identiques détectées par l'analyse à haut débit par séquençage. Les quantités sont exprimées en unités arbitraires. Les quantités de miARN peuvent être normalisées par rapport à un autre dosage, notamment un ARN dont la concentration ne varie pas dans les différents types d'échantillons analysés. En particulier, la quantité tissulaire d'un ARN non-codant appelé RNU24 a été montrée par les inventeurs comme très stable entre les échantillons tumoraux et les échantillons de tissus sains. Cette normalisation permet de garantir que l'on compare les niveaux d'expression des miARNs détectables dans des extraits dont les concentrations en ARN sont similaires entre ces différents extraits purifiés. Dans ce cas, le niveau d'expresssion normalisé pour un miARN dans un échantillon de tissu est exprimé par la formule II : Quantité de miARNx normalisée = intensité du signal de détection pour miARNx / intensité du signal pour RNU24. The miRNAs measured in this method are contained in fractions of purification of RNAs obtained either from extracts or lysates from brain tissue obtained by biopsy or by excision in the operating room or any other suitable intratumoral sampling method, when is a tissue sample; either from extracts or lysates of the different fractions of biological fluids using adapted methods, when it is a sample of biological fluids. The tissue extracts used for the assays correspond to fractions obtained after lysis of the tissues and more or less thorough purification of the RNAs according to conventional methods (for example the mirVana method marketed by Ambion, or RNeasy by Qiagen, or electrophoresis purification methods ). Depending on the methods, the fractions contain total RNAs, or RNAs less than 200 bases in size, or fractions enriched in microRNAs. The miRNAs measured in a blood sample may be all circulating miRNAs in plasma or serum, or miRNAs located in the microvesicles present in the serum. All circulating miRNAs in the blood are purified directly from blood samples according to conventional methods, such as described by Mitchell PS et al. (Mitchell PS et al., Proc Natl Acad Sci US A 2008 Jul 29; 105 (30): 10513-8) or by Lodes MJ (Lodes MJ et al., PLoS One 2009 Jul 14; 4 (7): e6229). The miRNAs localized in the microvesicles present in the serum are purified according to an approach described for example by Skog et al (Skog et al., Nat Cell Biol., 2008 Dec; 10 (12): 1470-6). The term "level of expression" of a miRNA in a sample corresponds to a measurement value specific to a miRNA, but expressed either in arbitrary units, in units of mass, in molecules or in concentrations, or in values normalized by compared to another measurement, especially in standardized value relative to the amounts of the same miRNA in a reference tissue (healthy or tumor) The level of expression of miRNAs can be measured by any conventional method, such as - hybridization on "DNA microarrays", - high throughput sequencing methods for a large number of individualized miRNAs, - real-time PCR, - Northern blot, or any other specific miRNA method. The level of expression of miRNAs can be measured by the "microarray" technique. The technique of the "DNA chip" is well known to those skilled in the art. This is the hybridization of miRNAs extracted on a solid support composed of a nylon membrane, a surface of silicon or glass, optionally nano-beads or particles, comprising oligonucleotides of known sequences fixed on the support or adherents to it. The complementarity of the oligonucleotides fixed with the sequences of microRNAs or their conversion products (amplification products, cDNA, RNA or cRNA) makes it possible to generate a signal (fluorescence, luminescence, radioactivity, electrical signal, etc.) according to the techniques of labeling used at the level of immobilized oligonucleotides (DNA chips). This signal is detected by a specific device and a value of intensity of this own signal for each miRNA is thus recorded. Several types of chips for the detection of miRNAs are already on the market, such as GeneChip® miRNA marketed by Affymetrix, miRcury arrays by Exiqon, miRXplore microarrays by Miltenyi. In the case of high throughput sequencing, the miRNAs are extracted and purified from a sample, isolated from each other by methods provided by sequencing equipment suppliers such as Roche, Invitrogen. This kind of analysis consists in individualizing the molecules of the various microRNAs, performing an amplification step and sequencing the products ("nucleic acid clones") thus generated. The realization of many sequences to identify each of these "clones" (several thousand) makes it possible to generate a listing of the microRNAs present in a sample and to quantify each of these miRNAs simply by counting how many times each sequence is found in the listing. detailed. In a preferred embodiment of the invention, the miRNA assays are performed by quantitative PCR (real-time PCR). The real-time PCR makes it possible to obtain values, called Ct, corresponding to the number of cycles from which the emitted fluorescence exceeds a certain threshold, the threshold being fixed by the user at the beginning of the exponential phase. This Ct value is proportional to the amount of cDNA (derived from reverse transcription of miRNAs to cDNA by Reverse Transcriptase) initially present in the sample. In the absence of a specific standard range for each cDNA, only relative quantification between samples is possible. First, in order to be able to compare the quota of each miRNA taken individually and present in glioblastomas, oligodendrogliomas and healthy tissues, the assay values for each miRNA are normalized with the data obtained for a non-coding RNA (from the category of snoRNAs) called RNU24 (SEQ ID NO: 20). The choice of RNU24 is dictated by an analysis of the measurements of several snoRNA performed on many samples and realized using the Normfinder software. This analysis concluded that RNU24 is the most reliable normalizer in this study (its expression rate varies in fact very little between all the tissue samples used in the invention). The relative quantification of a miRNA between 2 types of samples is then obtained thanks for example to the REST software which takes into account the PCR efficiency parameter and the Ct values of the miRNA of interest and RNU24 for all analyzed samples. However, the present invention can be implemented with other standardizers known to those skilled in the art. When the expression levels of miRNAs are analyzed by hybridization on "microarrays", or by Northern blot, or by sequencing, they can be expressed by formula I: Amount of miRNAx = intensity of the detection signal for miRNAx Where " signal strength "means the amount of fluorescence, radioactivity or luminescence recorded on the" DNA chips "by the matched detector, or number of identical sequences detected by high throughput sequencing analysis. The quantities are expressed in arbitrary units. The amounts of miRNA can be normalized with respect to another assay, in particular an RNA whose concentration does not vary in the different types of samples analyzed. In particular, the tissue amount of a non-coding RNA called RNU24 has been shown by the inventors to be very stable between tumor samples and healthy tissue samples. This normalization makes it possible to ensure that the expression levels of the detectable miRNAs are compared in extracts whose RNA concentrations are similar between these different purified extracts. In this case, the standard expression level for a miRNA in a tissue sample is expressed as formula II: Normalized miRNAx quantity = detection signal intensity for miRNAx / signal strength for RNU24.
Lorsque les niveaux d'expression des miARNs sont analysés par la PCR en temps réel, ils peuvent être exprimés par la formule III, qui définit la quantité de miARN présente dans le mileu réactionnel de dosage lorsque le nombre de cycles d'amplification est égal à Ct (Quantité de miARNx à Ct) : Quantité de miARNx à Ct = Quantité de miARN à to x Efficacité cc Où « Quantité de miARN à to » désigne la quantité de miARN, ou son équivalent en cDNA, au moment où la réaction de dosage par amplification PCR est initiée. L'expression « efficacité » dans la formule (III) signifie la valeur de l'efficacité de PCR (de valeur comprise entre 1 et 2). Cette valeur dépend de divers paramètres expérimentaux, et notamment de l'appareil effectuant la PCR en temps réel mis en oeuvre. Une fois que cette valeur est mesurée pour un protocole particulier et une machine de PCR configurée, il n'est plus nécessaire de mesurer cette valeur chaque fois avant le calcul, sauf si le protocole expérimental et/ou la condition de fonctionnement de la machine ont été modifiés pour l'expérience donnée. When miRNA expression levels are analyzed by real-time PCR, they can be expressed by formula III, which defines the amount of miRNA present in the assay reaction medium when the number of amplification cycles is equal to Ct (Quantity of miRNAx to Ct): Quantity of miRNAx to Ct = Quantity of miRNA to to x Efficiency cc Where "Quantity of miRNA to" refers to the amount of miRNA, or its equivalent in cDNA, at the time of the assay reaction by PCR amplification is initiated. The expression "efficacy" in formula (III) means the value of PCR efficiency (of value between 1 and 2). This value depends on various experimental parameters, and in particular on the apparatus performing the real-time PCR implemented. Once this value is measured for a particular protocol and a configured PCR machine, it is no longer necessary to measure this value each time before the calculation, unless the experimental protocol and / or the operating condition of the machine have been measured. have been modified for the given experience.
Dans un mode de réalisation particulier de l'invention, l'échantillon biologique provenant d'un patient suspecté de présenter un gliome est un tissu cérébral obtenu par exérèse, ou par biopsie. Cette méthode comprend : - la mesure du niveau d'expression d'au moins un miARN choisi parmi hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsalet 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsamiR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 ou hsa-miR-10a, dans un tissu biologique provenant d'un tissu suspecté de présenter un caractère tumoral, - la comparaison : - entre le niveau d'expression d'au moins un susdit miARN dans le tissu suspecté et le niveau d'expression du susdit miARN dans un tissu sain de référence, ou - entre le niveau d'expression d'au moins un premier susdit miARN dans le tissu suspecté et le niveau d'expression d'au moins un deuxième susdit miARN dans le tissu suspecté. In a particular embodiment of the invention, the biological sample from a patient suspected of having a glioma is brain tissue obtained by excision, or by biopsy. This method comprises: measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsalet 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsamiR-151, hsa-miR- 26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a, in a biological tissue from a tissue suspected of having a tumor character, - the comparison: - between the level expressing at least one of said miRNAs in the suspected tissue and the level of expression of said miRNA in a reference healthy tissue, or - between the level of expression of at least a first of said miRNAs in the suspected tissue and the level of expression of at least a second aforementioned miRNA in the suspected tissue.
Les comparaisons des niveaux d'expression des miARNs peuvent être faites entre un échantillon suspecté et un échantillon sain de référence. Il s'agit d'une comparaison inter-échantillon. Comparisons of miRNA expression levels can be made between a suspected sample and a reference healthy sample. This is an inter-sample comparison.
Dans un premier mode de réalisation, la méthode de diagnostic in vitro de gliomes comprend : - la mesure du niveau d'expression d'au moins un miARN choisi parmi hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsalet 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsamiR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 ou hsa-miR-10a, dans un échantillon biologique provenant d'un patient suspecté de présenter un gliome, - la comparaison entre le niveau d'expression d'au moins un susdit miARN dans le susdit échantillon et le niveau d'expression du susdit miARN dans un échantillon sain de référence, et - la déduction que le patient suspecté présente un gliome lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome est différent du niveau d'expression du susdit miARN dans un échantillon sain de référence. Dans un mode de réalisation avantageux de l'invention, cette méthode comprend la mesure du niveau d'expression d'au moins un miARN choisi parmi hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b ou hsamiR-34b. Parmi les 16 miARNs repérés dans l'invention, il y a 10 miARNs dont le niveau d'expression est systématiquement plus élevé dans les échantillons provenant d'un patient présentant un gliome par rapport à celui dans les échantillons sains de référence, alors que le niveau d'expression de 6 autres miARNs est plus faible dans les échantillons provenant d'un patient présentant un gliome par rapport à celui dans les échantillons sains de référence. Ainsi, un mode de réalisation particulier de la méthode de diagnostic in vitro de gliomes comprend: - la mesure du niveau d'expression est effectuée pour l'un au moins des miARNs suivants : hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsalet7a, hsa-let 7f, hsa-let 7d, hsa-miR-374 ou hsa-miR-26b, et - la déduction que le patient suspecté présente un gliome est faite lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome est supérieur au niveau d'expression du susdit miARN dans un échantillon sain de référence. Un autre mode de réalisation particulier de la méthode de diagnostic in vitro de gliomes comprend: - la mesure du niveau d'expression est effectuée pour l'un au moins des miARNs suivants : hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151 ou hsa-miR-34b, et - la déduction que le patient suspecté présente un gliome est faite lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome est inférieur au niveau d'expression du susdit miARN dans l'échantillon sain de référence. In a first embodiment, the in vitro diagnostic method for glioma comprises: measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16 , hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsalet 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa mR-127, hsamiR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a, in a biological sample from a patient suspected of present a glioma; - the comparison between the level of expression of at least one of the above-mentioned miRNAs in the above sample and the level of expression of the above-mentioned miRNA in a reference healthy sample, and - the deduction that the suspected patient presents a glioma when the expression level of the above-mentioned miRNA in the sample from a patient suspected of having a glioma is different from the level of expression of the above-mentioned miRNA in a reference healthy sample. In an advantageous embodiment of the invention, this method comprises measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR -17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR -127, hsa-miR-151, hsa-miR-26b or hsamiR-34b. Of the 16 miRNAs identified in the invention, there are 10 miRNAs whose level of expression is consistently higher in samples from a patient with glioma compared to that in healthy reference samples, while Expression level of 6 other miRNAs is lower in samples from a patient with glioma compared to that in healthy reference samples. Thus, a particular embodiment of the in vitro diagnostic method of glioma comprises: the measurement of the level of expression is carried out for at least one of the following miRNAs: hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsalet7a, hsa-let 7f, hsa-let 7d, hsa-miR-374 or hsa-miR-26b, and - the deduction that the suspected patient presents a glioma is made when the level of expression of the above miRNA in the sample from a patient suspected of having a glioma is greater than the level of expression of the above miRNA in a reference healthy sample. Another particular embodiment of the in vitro diagnostic method of glioma comprises: the measurement of the level of expression is carried out for at least one of the following miRNAs: hsa-miR-409, hsa-miR-134, hsa mR-339, hsa-miR-127, hsa-miR-151 or hsa-miR-34b, and the inference that the suspected patient has a glioma is made when the level of expression of the above miRNA in the sample a patient suspected of having a glioma is below the level of expression of the above-mentioned miRNA in the reference healthy sample.
Lorsque les niveaux d'expression des miARNs sont obtenus par hybridation sur «puces à ADN» ou par séquençage, la comparaison des niveaux d'expression d'un même miARN dans deux échantillons différents destinée à mettre en évidence les modifications d'expression d'un miARN entre ces échantillons (surexpression ou sous-expression) est évaluée grâce à la formule IV : Quantité de miARNx normalisée (échantillon A) / Quantité de miARNx normalisée (échantillon B), où A représente l'échantillon suspecté et B représente l'échantillon sain de référence. Lorsque les niveaux d'expression des miARNs sont obtenus par la PCR en temps réel, la comparaison des niveaux d'expression d'un même miARN dans deux échantillons différents peut être exprimée par un rapport obtenu par la formule (V) suivante: Rapport (échantillon A/échantillon B) = Efficacité «ct hsa-miARN X - Ct RNU24)échantillon A-(Ct hsa-miARNX - Ct RNU24)échantillon B) En l'occurrence, l'échantillon A est l'échantillon suspecté; l'échantillon B est l'échantillon sain de référence. miARN X représente le miARN dont le niveau d'expression est mesuré respectivement dans l'échantillon sain de référence et l'échantillon suspecté. Les valeurs de Ct pour hsa-miARN X et pour RNU24, respectivement pour l'échantillon suspecté et l'échantillon sain de référence, sont obtenues directement par la PCR en temps réel. Les variations des niveaux d'expression entre le niveau d'expression d'un miARN dans un échantillon provenant d'un patient suspecté de présenter un gliome et celui du susdit miRNA dans un échantillon sain de référence peuvent être déduites des formules IV ou V, selon la méthode d'analyse employée. Dans un mode de réalisation particulier de l'invention, la déduction que le patient suspecté présente un gliome est faite, lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome et le niveau d'expression du susdit miARN dans l'échantillon sain de référence sont différents, le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome étant au moins 3 fois supérieur ou inférieur au niveau d'expression du susdit miARN dans l'échantillon sain de référence. Respectivement, le résultat des formules IV ou V est supérieur à 3 ou inférieur à 0,33. When the expression levels of the miRNAs are obtained by hybridization on "DNA chips" or by sequencing, the comparison of the expression levels of the same miRNA in two different samples is intended to highlight the expression modifications of a miRNA between these samples (overexpression or subexpression) is evaluated using formula IV: Normalized miRNAx (sample A) / normalized miRNAx (sample B), where A represents the suspected sample and B represents the sample. healthy reference sample. When miRNA expression levels are obtained by real-time PCR, the comparison of the expression levels of the same miRNA in two different samples can be expressed by a ratio obtained by the following formula (V): sample A / sample B) = Efficacy "ct hsa-miRNA X - Ct RNU24" sample A- (Ct hsa-miRNAX - Ct RNU24) sample B) In this case, sample A is the suspected sample; sample B is the reference healthy sample. miRNA X represents the miRNA whose level of expression is measured respectively in the reference healthy sample and the suspected sample. The Ct values for hsa-miRNA X and RNU24, respectively for the suspected sample and the reference healthy sample, are obtained directly by the real-time PCR. Variations of the levels of expression between the level of expression of a miRNA in a sample from a patient suspected of having a glioma and that of the above miRNA in a reference healthy sample can be deduced from formulas IV or V, according to the method of analysis used. In a particular embodiment of the invention, the inference that the suspected patient has a glioma is made, when the level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioma and the level of expression of the above miRNA in the reference healthy sample are different, the level of expression of the above miRNA in the sample from a patient suspected of having a glioma being at least 3 times higher or lower than the level of expression of the above miRNA in the reference healthy sample. Respectively, the result of formulas IV or V is greater than 3 or less than 0.33.
Selon un mode de réalisation avantageux, le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome est au moins 3 fois supérieur au niveau d'expression du susdit miARN dans l'échantillon sain de référence. Par l'expression «niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome est au moins 3 fois supérieur au niveau d'expression du susdit miARN dans l'échantillon sain de référence », on entend que le rapport obtenu d'après les formules (IV ou V) est supérieur à une valeur de 3. Cette valeur signifie une surexpression dudit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome par rapport à l'échantillon sain de référence. En l'occurrence, dans ces formules, l'échantillon A est l'échantillon provenant d'un patient suspecté; l'échantillon B est l'échantillon sain de référence. Selon un autre mode de réalisation avantageux, le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome est au moins 3 fois inférieur au niveau d'expression du susdit miARN dans l'échantillon sain de référence. Par l'expression «niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome est au moins 3 fois inférieur au niveau d'expression du susdit miARN dans l'échantillon sain de référence », on entend que le rapport calculé d'après la formule (IV ou V) est inférieur à une valeur de 0, 33. Cette valeur signifie une sous-expression dudit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome vis-à-vis de l'échantillon sain de référence. En l'occurrence, dans ces formules, l'échantillon A est l'échantillon provenant d'un patient suspecté; l'échantillon B est l'échantillon sain de référence. Selon un mode de réalisation particulièrement avantageux, la méthode de diagnostic in vitro de gliomes comprend : - la mesure du niveau d'expression d'au moins un miARN choisi parmi hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsamiR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b, dans un échantillon biologique provenant d'un patient suspecté de présenter un gliome, - la comparaison entre le niveau d'expression du susdit miARN dans le susdit échantillon, et le niveau d'expression du susdit miARN dans un échantillon sain de référence, et, - la déduction que le patient suspecté présente un gliome, lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome et le niveau d'expression du susdit miARN dans l'échantillon sain de référence sont différents, le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome étant 3 fois, notamment 4 fois, plus particulièrement 5 fois, supérieur ou inférieur au niveau d'expression du susdit miARN dans l'échantillon sain de référence. According to an advantageous embodiment, the level of expression of the above miRNA in the sample from a patient suspected of having a glioma is at least 3 times greater than the level of expression of the above miRNA in the reference healthy sample. . By the expression expression level of the above-mentioned miRNA in the sample from a patient suspected of having a glioma is at least 3 times greater than the level of expression of the above-mentioned miRNA in the reference healthy sample. means that the ratio obtained from the formulas (IV or V) is greater than a value of 3. This value means overexpression of said miRNA in the sample from a patient suspected of having a glioma relative to the sample healthy reference. In this case, in these formulas, sample A is the sample from a suspected patient; sample B is the reference healthy sample. According to another advantageous embodiment, the level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioma is at least 3 times lower than the level of expression of the above-mentioned miRNA in the healthy sample. reference. By the expression expression level of the above-mentioned miRNA in the sample from a patient suspected of having a glioma is at least 3 times lower than the level of expression of the above-mentioned miRNA in the reference healthy sample. means that the ratio calculated according to the formula (IV or V) is less than a value of 0, 33. This value means a subexpression of said miRNA in the sample from a patient suspected of presenting a glioma vis- the reference healthy sample. In this case, in these formulas, sample A is the sample from a suspected patient; sample B is the reference healthy sample. According to a particularly advantageous embodiment, the in vitro diagnosis method of glioma comprises: measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR- 16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsamiR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b, in a biological sample from a patient suspected of having a glioma, - a comparison of the level of expression of the above-mentioned miRNA in the above sample, and the level of expression of the above miRNA in a healthy reference sample, and, - the inference that the suspected patient has a glioma, when the level of expression of the above miRNA in the sample from 'a patient suspected of having a glioma and the level of expression of the above miRNA in the reference healthy sample are different, the level of expression of the above miRNA in the sample from a patient suspected of having a glioma being 3 times, notably 4 times, more particularly 5 times, higher or lower than the level of expression of the above miRNA in the reference healthy sample.
Dans un mode de réalisation particulier, l'échantillon biologique provenant d'un patient suspecté de présenter un gliome est un tissu cérébral obtenu par exérèse, ou par biopsie. Ladite méthode comprend : - la mesure du niveau d'expression d'au moins un miARN choisi parmi hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsamiR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b, dans un tissu biologique provenant d'un tissu suspecté d'avoir un caractère tumoral, - la comparaison entre le niveau d'expression du susdit miARN dans le tissu suspecté, et le niveau d'expression du susdit miARN dans un tissu sain de référence, et, - la déduction du caractère tumoral du tissu suspecté, lorsque le niveau d'expression du susdit miARN dans le tissu suspecté et le niveau d'expression du susdit miARN dans le tissu sain de référence sont différents, le niveau d'expression du susdit miARN dans le tissu suspecté étant 3 fois, notamment 4 fois, plus particulièrement 5 fois, supérieur ou inférieur au niveau d'expression du susdit miARN dans le tissu sain de référence. In a particular embodiment, the biological sample from a patient suspected of having a glioma is brain tissue obtained by excision, or biopsy. Said method comprises: measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsamiR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa- miR-26b, hsa-miR-34b, in a biological tissue from a tissue suspected of having a tumor character, - the comparison between the level of expression of the above-mentioned miRNA in the suspected tissue, and the level of expression of the above-mentioned miRNA in a reference healthy tissue, and, - deduction of the tumor characteristic of the suspected tissue, when the level of expression of the above-mentioned miRNA in the suspected tissue and the level of expression of the above miRNA in the reference healthy tissue. are different, the level of expression of the above miRNA in the suspected tissue being 3 times, especially 4 times, more particularly 5 times, higher or lower than the level of expression of the above miRNA in the reference healthy tissue.
Les comparaisons peuvent aussi être réalisées entre les niveaux d'expression de deux miARNs provenant d'un même échantillon provenant d'un patient suspecté présenter un gliome. Il s'agit d'une comparaison intra-échantillon, qui repose sur l'identification de signatures propres à chaque type tumoral. Ainsi, un deuxième mode de réalisation d'une méthode de diagnostic in vitro de gliomes comprend: (i) la mesure du niveau d'expression d'au moins un miARN choisi parmi hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa- miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 ou hsa-miR-10a, dans un échantillon biologique provenant d'un patient suspecté de présenter un gliome, (ii) la comparaison entre le niveau d'expression d'au moins un premier susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome et le niveau d'expression d'au moins un deuxième susdit miARN dans le susdit échantillon, et (iii) la déduction que le patient suspecté présente un gliome, lorsque le rapport entre le niveau d'expression du susdit premier miARN et le niveau d'expression du susdit deuxième miARN est différent de celui dans un abaque préétabli pour un échantillon sain de référence, les susdits premier miARN et deuxième miARN formant un couple de miARNs. Comparisons can also be made between the expression levels of two miRNAs from the same sample from a patient suspected of having a glioma. This is an intra-sample comparison, which relies on the identification of signatures specific to each tumor type. Thus, a second embodiment of an in vitro diagnostic method of glioma comprises: (i) measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa mR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa mR-339, hsa-miR-127, hsa-miR-151, hsa- miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a, in a sample from a patient suspected of having a glioma, (ii) comparing the level of expression of at least a first-mentioned miRNA in the sample from a patient suspected of having a glioma and the level of expressing at least one second aforementioned miRNA in the above sample, and (iii) the inference that the suspected patient has a glioma, when the ratio between the level of expression of the above-mentioned first miRNA and the level of expression of the aforementioned second miRNA is different from that in a pre-established abacus for a healthy reference sample, the aforementioned first miRNA and miRNA second miRNAs forming a pair.
« Le rapport entre le niveau d'expression du susdit premier miARN et le niveau d'expression du susdit deuxième miARN » est un rapport obtenu d'après la formule (VI) ci-dessous dans le cas du dosage par PCR en temps réel: ) = Efficacité (Ct hsa-miARN X - Ct hsa-miARN Y) Rapport (hsa-miARN X/ hsa-miARN Y) l'occurrence, le premier miARN et le deuxième miARN, dont les niveaux d'expression sont comparés, sont représentés respectivement par miARN X et miARN Y. Les valeurs de Ct pour hsa-miARN X et Ct pour hsa-miARN Y, pour l'échantillon provenant d'un patient suspecté et pour l'échantillon sain de référence, sont obtenues directement par la PCR en temps réel. La valeur de l'efficacité est établie préalablement. "The relationship between the level of expression of the above-mentioned first miRNA and the level of expression of the aforementioned second miRNA" is a ratio obtained from formula (VI) below in the case of the real-time PCR assay: ) = Efficacy (Ct hsa-miRNA X - Ct hsa-miRNA Y) Ratio (hsa-miRNA X / hsa-miRNA Y) the occurrence, the first miRNA and the second miRNA, whose expression levels are compared, are respectively represented by miRNA X and miRNA Y. The Ct values for hsa-miRNA X and Ct for hsa-miRNA Y, for the sample from a suspected patient and for the reference healthy sample, are obtained directly by the Real-time PCR. The value of effectiveness is established beforehand.
Dans le cas d'un dosage réalisé par une méthode autre que la PCR en temps réel, le rapport entre le niveau d'expression du susdit premier miARN et le niveau d'expression du susdit deuxième miARN » est un rapport obtenu d'après la formule VII : Rapport (hsa-miARN X/ hsa-miARN Y) = intensité de signal de détection de miARN X / intensité de signal de détection de miARN Y En l'occurrence, le premier miARN et le deuxième miARN, dont les niveaux d'expression sont comparés, sont représentés respectivement par miARN X et miARN Y. Par l'expression « abaque », on entend un tableau ou un graphique établi préalablement, constitué par une série de valeurs de référence. Par « un abaque préétabli pour un échantillon sain de référence», on entend un tableau ou un graphique constitué par une série de valeurs de référence obtenues dans un échantillon sain de référence. Plus particulièrement, une telle valeur de référence, qui sert à établir un abaque, est un rapport(hsa-miARN X/ hsa-miARN Y) obtenu dans un échantillon sain de référence. In the case of an assay performed by a method other than real-time PCR, the ratio between the level of expression of the above-mentioned first miRNA and the level of expression of the aforementioned second miRNA "is a ratio obtained according to the Formula VII: Ratio (hsa-miRNA X / hsa-miRNA Y) = detection signal intensity of miRNA X / detection signal intensity of miRNA Y In this case, the first miRNA and the second miRNA, whose levels of are represented respectively by miRNA X and miRNA Y. By the expression "abacus" is meant a previously established table or graph constituted by a series of reference values. "A pre-established abacus for a reference healthy sample" means a table or graph consisting of a series of reference values obtained in a reference healthy sample. More particularly, such a reference value, which serves to establish an abacus, is a ratio (hsa-miRNA X / hsa-miRNA Y) obtained in a reference healthy sample.
L'expression « le susdit premier miARN et deuxième miARN formant un couple de miARNs » signifie que la comparaison des niveaux d'expression des miARNs est réalisée entre ces deux miARNs. En fonction du nombre de couples de miARNs, un abaque sous forme d'un graphique peut être un graphique bidimensionnel, lorsqu'il s'agit de deux couples de miARNs, ou un graphique tridimensionnel, lorsqu'il s'agit de trois couples de miARNs. En effet, un abaque sous forme d'un graphique bidimensionnel ou tridimensionnel réalise une double ou triple séparation basée sur deux ou trois rapports pour un échantillon à tester, ce qui permet d'éviter une confusion de l'interprétation éventuellement apportée à un échantillon suspecté, lorsque cette interprétation est basée sur un seul rapport(hsa-miARN xi hsa-miARN Y) obtenu d'un échantillon suspecté. Cependant, il est possible d'adopter toute autre façon de l'établissement d'un abaque pour interpréter un rapport(hsa-miARN xi hsa-miARN Y) obtenu pour un échantillon provenant d'un patient suspecté. Après la mise en place d'un abaque, le recours à des échantillons sains n'est plus requis et tout nouvel échantillon peut être typé par le dosage d'un minimum de 2 miARNs seulement. Dans un mode de réalisation avantageux de l'invention, les couples de miARNs utilisés sont les suivants : hsa-let 7a/hsa-miRl27, hsa-let 7a/hsa-miRl Sb, hsa-let 7a/hsamiR34b, hsa-miRl26/hsa-let 7a, hsa-miRl26/hsa-miR34b, hsa-miRl27/hsa-let 7d, hsamiR127/hsa-miRl5b, hsa-miR134/hsa-let 7a, hsa-miRl34/hsa-miRlOa, hsa-miRl51/hsa-let 7a, hsa-miR l51/hsa-let 7d, hsa-miR l51/hsa-let 7f, hsa-miR l51/hsa-miRl5b, hsamiR15b/hsa-miR409, hsa-miR16/hsa-miRl51, hsa-miRl6/hsa-miR339, hsa-miR16/hsamiR34b, hsa-miR17/hsa-miR339, hsa-miRl7/hsa-miR34b, hsa-miR17/hsa-miR409, hsamiR20a/hsa-miR339, hsa-miR26b/hsa-miR134, hsa-miR26b/hsa-miR34b, hsa-miR26b/hsamiR409, hsa-miR339/hsa-let 7f, hsa-miR34b/hsa-let 7f, hsa-miR374/hsa-let 7f, hsamiR374/hsa-miR127, hsa-miR374/hsa-miR134, hsa-miR374/hsa-miR339, hsa-miR374/hsamiR34b, hsa-miR374/hsa-miR409, hsa-miR409/hsa-miRlOa, hsa-miRl55/hsa-miRl34, hsamiR155/hsa-miRl27, hsa-miRl26/hsa-miR409, hsa-miRl27/hsa-let 7f, hsa-miR151/hsamiR20a, hsa-miR 16/hsa-miRl34, hsa-miRl26/hsa-miR339, hsa-miR151/hsa-miRlOa, hsamiR16/hsa-miRl27, hsa-miR20a/hsa-let 7f, hsa-miR20a/hsa-miR409, hsa-miRl55/hsamiR409, hsa-miR339/hsa-let 7d, hsa-miRl51/hsa-miR374, hsa-miRl27/hsa-miRlOa, hsamiR15b/hsa-let 7f, hsa-miR20 a/hs a-let 7a, hsa-miR210/hsa-miRl55, hsa-miR210/hsa-let 7a, hsa-miR26b/hsa-miR-3 39, hsa-miR26b/hsa-miR-127, hsa-miR 16/hsa-miR-409, hsamiR127/hsa-miR-17, hsa-miR151/hsa-miRl26, hsa-miR26b/hsa-miRl51, hsa-miR20a/hsa- miRl27, hsa-miR339/hsa-let 7a, hsa-miR26b/hsa-let 7f, hsa-miRl26/hsa-miRl34, hsamiR20a/hsa-miR34b, hsa-let 7d/hsa-miR34b, hsa-miRlSb/hsa-miR339, hsa-let 7d/hsa let 7f, hsa-miRlOa/hsa let 7d, hsa-miRl26/hsa let 7f, hsa-miRl26/hsa-miRlOa, hsa-miRl26/hsamiR155, hsa-miRl27/hsa-miRl26, hsa-miR134/hsa-miRl7, hsa-miR134/hsa-miR409, hsamiR151/hsa-miRl7, hsa-miRl55/hsa-miR339, hsa-miR15b/hsa-miRlOa, hsa-miR15b/hsamiR155, hsa-miRl5b/hsa-miR34b, hsa-miRl6/hsa-miRlOa, hsa-miR16/hsa-miRl26, hsamiR16/hsa-miRl55, hsa-miR16/hsa-miR15b, hsa-miRl6/hsa-miR20a, hsa-miRl7/hsa let 7d, hsa-miR20a/hsa-miRlOa, hsa-miR210/hsa-miRl27, hsa-miR210/hsa-miRl34, hsamiR2l0/hsa-miR339, hsa-miR2l0/hsa-miR409, hsa-miR26b/hsa let 7a, hsa-miR26b/hsamiRlOa, hsa-miR26b/hsa-miRl55, hsa-miR26b/hsa-miRl5b, hsa-miR374/hsa-miRlOa, hsamiRlOa/hsa-miR210, hsa-miR 1 0 a/hsa-miR3 39, hsa-miR10a/hsa-miR34b, hsa-miRl55/hsa let 7f, hsa-miRl6/hsa let 7a, hsa-miRl6/hsa-miR2l0, hsa-miR2l0/hsa let 7d, hsa-miR2l0/hsamiR126, hsa-miR210/hsa-miRl5b, hsa-miR210/hsa-miRl7, hsa-miR2 10/hs a-miR20 a, hsamiR2l0/hsa-miR374, hsa-miR26b/hsa-miR2l0, hsa-miRl6/hsa let 7f, hsa-miRl6/hsamiR374. Les ratios inverses de ceux cités dans la liste ci-dessus gardent la même signification pour le diagnostic, c'est-à-dire que l'on peut utiliser ces ratios ou leurs inverses. Une déduction que le patient présente au moins une tumeur gliale est faite, lorsque le rapport du niveau d'expression de deux miARNs d'un couple est différent par rapport au susdit rapport établi dans un échantillon sain de référence. A titre d'exemple, la colonne 2 du tableau 4 illustre un abaque préétabli sous forme d'un tableau, dans un tissu sain de référence, pour chaque couple de miARNs. Selon l'invention, il est aussi possible d'établir un graphique bidimensionnel ou tridimensionnel, utilisant deux ou plusieurs couples de miARNs choisis parmi les couples de miARNs mentionnés dans la partie ci-dessus. A titre d'exemple, les figures 2-6 sont des abaques sous forme de graphique bidimensionnel, dans lesquels les points losanges représentant des tissus normaux constituent une zone encadrée par le rectangle tracé en tiret-pointés. Après le dosage de miARNs concernés et le calcul des rapports tels que ceux qui sont utilisés pour l'établissement de l'abaque, la nature du tissu suspecté peut être facilement repérée sur cet abaque, et on peut déduire que le tissu suspecté est un tissu tumoral, lorsque le point, représentant le tissu suspecté, n'entre pas dans la zone encadrée par le rectangle tracé en tiret-pointés. A titre d'exemple également, la figure 7 basée sur l'utilisation de 3 couples différents de miARNs dont les valeurs respectives sont exprimées en pourcentage de la somme des valeurs de ces 3 couples, permet de repérer aisément les tissus sains par rapport aux tissus tumoraux puisqu'ils se caractérisent - à la différences des tissus tumoraux - par des valeurs élevées du couple hsa-miRl34/hsa-miR20a (barres en gris pâle) par rapport aux valeurs des deux autres couples dans un tissu donné. Dans un mode de réalisation avantageux de l'invention, la déduction que le patient suspecté présente un gliome est faite lorsque le rapport entre le niveau d'expression du susdit premier miARN et le niveau d'expression du susdit deuxième miARN est 2 fois, notamment 3 fois, plus particulièrement 4 fois, supérieur à la valeur dudit rapport dans un abaque préétabli pour un échantillon sain de référence. Dans un autre mode de réalisation avantageux de l'invention, la déduction que le patient suspecté présente un gliome est faite lorsque le rapport entre le niveau d'expression du susdit premier miARN et le niveau d'expression du susdit deuxième miARN est 2 fois, notamment 3 fois, plus particulièrement 4 fois, inférieur à la valeur dudit rapport dans un abaque préétabli pour un échantillon sain de référence. Un mode de réalisation avantageux d'une méthode de diagnostic in vitro de gliomes selon l'invention comprend : (i) la mesure du rapport du niveau d'expression d'au moins un couple de miARNs choisi parmi hsa-let 7a/hsa-miRl27, hsa-let 7a/hsa-miRl Sb, hsa-let 7a/hsamiR34b, hsa-miRl26/hsa-let 7a, hsa-miR126/hsa-miR34b, hsa-miRl27/hsa-let 7d, hsa-miR127/hsa-miRl5b, hsa-miR134/hsa-let 7a, hsa-miR134/hsa-miRlOa, hsa- hsa-miRl51/hsa-let 7f, hsa- hsa-miRl 6/hsa-miRl 51, hsa- hsa-miR 17/hsa-miR3 3 9, hsa- hsa- hsa-miR26b/hsa-miR409, hsa- hsa-miR374/hsa-let 7f, hsa- hsa-miR3 74/hsa-miR3 3 9, hsa- hsa-miR409/hsa-miRlOa, hsa- hsa-miRl26/hsa-miR409, hsa- hsa-miRl6/hsa-miRl34, hsa- hsa-miRl 6/hsa-miRl 27, hsa- hsa-miRl55/hsa-miR409, hsa- hsa-miRl27/hsa-miRlOa, hsa- hsa-miR210/hsa-miRl 55, hsa- miRl51/hsa-let 7a, hsa-miRl51/hsa-let 7d, miR 1 51/hsa-miR 1 5b, hsa-miR 1 5b/hsa-miR409, miR16/hsa-miR339, hsa-miRl6/hsa-miR34b, miR17/hsa-miR34b, hsa-miR17/hsa-miR409, hsa-miR20a/hsa-miR339, miR26b/hsa-miRl34, hsa-miR26b/hsa-miR34b, miR339/hsa-let 7f, hsa-miR34b/hsa-let 7f, miR374/hsa-miRl27, hsa-miR374/hsa-miRl34, miR374/hsa-miR34b, hsa-miR374/hsa-miR409, miRl 55/hsa-miRl 34, hsa-miRl 55/hsa-miRl27, miR127/hsa-let 7f, hsa-miR15 1/hsa-miR20 a, miR126/hsa-miR339, hsa-miR151/hsa-miRl Oa, hsa-miR20a/hsa-miR409, hsa-miRl51/hsa-miR374, hsa-miR20a/hsa-let 7a, miR20a/hsa-let 7f, miR3 3 9/hsa- let 7d, miR15b/hsa-let 7f, miR2 10/hsa- let 7a, hsa-miR26b/hsa-miR-3 39, hsa-miR26b/hsa-miR-127, hsamiR16/hsa-miR-409, hsa-miR127/hsa-miR-17, hsa-miR151/hsa-miR126, hsamiR26b/hsa-miRl 5 1, hsa-miR20a/hsa-miR127, hsa-miR3 3 9/hsa- let 7a, hsamiR26b/hsa-let 7f, hsa-miR126/hsa-miR134, hsa-miR20a/hsa-miR34b, hsa-let 7d/hsa-miR34b, hsa-miR15b/hsa-miR339, hsa-let 7d/hsa let 7f, hsa-miRlOa/hsa let 7d, hsa-miR126/hsa let 7f, hsa-miR126/hsa-miRlOa, hsa-miR126/hsa-miR155, hsa-miR127/hsa-miR126, hsa-miR134/hsa-miR17, hsa-miR134/hsa-miR409, hsa- miRl51/hsa-miRl7, miR15b/hsa-miRl 55, miR16/hsa-miRl26, miR16/hsa-miR20a, miR210/hsa-miRl27, miR2 10/hsa-miR4 09, miR26b/hsa-miRl 55, miR 1 0 a/hsa-miR2 10, hsa-miR155/hsa-miR339, hsa-miR 15b/hsa-miRlOa, hsa- hsa-miRl 5b/hsa-miR34b, hsa-miRl 6/hsa-miRl Oa, hsa- hsa-miRl 6/hsa-miRl 55, hsa-miR16/hsa-miRl 5b, hsa- hsa-miRl7/hsa let 7d, hsa-miR20a/hsa-miRlOa, hsa- hsa-miR2 10/hsa-miRl 34, hsa-miR2 10/hsa-miR3 39, hsa- hsa-miR26b/hsa let 7a, hsa-miR26b/hsa-miRlOa, hsahsa-miR26b/hsa-miR15b, hsa-miR374/hsa-miRlOa, hsahsa-miR 1 0 a/hsa-miR3 39, hsa-miR10a/hsa-miR34b, hsa- miRl55/hsa let 7f, hsa-miRl6/hsa let 7a, hsa-miRl6/hsa-miR210, hsa-miR210/hsa let 7d, hsa-miR210/hsa-miRl26, hsa-miR210/hsa-miRl5b, hsa-miR2 10/hsamiR 17, hsa-miR210/hsa-miR20a, hsa-miR2 10/hsa-miR3 74 , hsa-miR26b/hsamiR210, hsa-miRl6/hsa let 7f, hsa-miRl6/hsa-miR374, dans un échantillon biologique provenant d'un patient suspecté de présenter un gliome, (ii) la déduction que le patient suspecté présente un gliome, lorsque le susdit rapport entre le niveau d'expression du susdit premier miARN et le niveau d'expression du susdit deuxième miARN est 2 fois, notamment 3 fois, plus particulièrement 4 fois, supérieur ou inférieur à la valeur dudit rapport dans un abaque préétabli dans un échantillon sain de référence. The expression "the aforementioned first miRNA and miRNA pair miRNAs" means that the comparison of miRNA expression levels is performed between these two miRNAs. Depending on the number of pairs of miRNAs, a graph chart may be a two-dimensional graph, in the case of two pairs of miRNAs, or a three-dimensional graph, in the case of three pairs of miRNAs. miRNAs. Indeed, an abacus in the form of a two-dimensional or three-dimensional graph performs a double or triple separation based on two or three ratios for a sample to be tested, which makes it possible to avoid any confusion of the interpretation that may be given to a suspected sample. when this interpretation is based on a single ratio (hsa-miRNA xi hsa-miRNA Y) obtained from a suspected sample. However, any other way of establishing an abacus can be used to interpret a ratio (hsa-miRNA × hsa-miRNA Y) obtained for a sample from a suspected patient. After the establishment of an abacus, the use of healthy samples is no longer required and any new sample may be typed by the assay of a minimum of 2 miRNAs only. In an advantageous embodiment of the invention, the miRNA pairs used are as follows: hsa-let 7a / hsa-miRl27, hsa-let 7a / hsa-miR1 Sb, hsa-let 7a / hsamiR34b, hsa-miRl26 / hsa-let 7a, hsa-miRl26 / hsa-miR34b, hsa-miRl27 / hsa-let 7d, hsamiR127 / hsa-miRl5b, hsa-miR134 / hsa-let 7a, hsa-miRl34 / hsa-miRlOa, hsa-miRl51 / hsa -let 7a, hrs-miR151 / hsa-7d 7d, hsa-miR151 / hsa-let 7f, hsa-miR151 / hsa-miR15b, hsamiR15b / hsa-miR409, hsa-miR16 / hsa-miRl51, hsa-miR16 / hsa-miR339, hsa-miR16 / hsamiR34b, hsa-miR17 / hsa-miR339, hsa-miR17 / hsa-miR34b, hsa-miR17 / hsa-miR409, hsamiR20a / hsa-miR339, hsa-miR26b / hsa-miR134, hsa -mR26b / hsa-miR34b, hsa-miR26b / hsamiR409, hsa-miR339 / hsa-let 7f, hsa-miR34b / hsa-let 7f, hsa-miR374 / hsa-let 7f, hsamiR374 / hsa-miR127, hsa-miR374 / hsa-miR134, hsa-miR374 / hsa-miR339, hsa-miR374 / hsamiR34b, hsa-miR374 / hsa-miR409, hsa-miR409 / hsa-miR10a, hsa-miR155 / hsa-miR1334, hsamiR155 / hsa-miR127, hsa- miRl26 / hsa-miR409, hsa-miRl27 / hsa-let 7f, hsa-miR151 / hsamiR20a, hsa-miR 16 / hsa-miRl34, hsa-miR 1226 hrs-miR339, hsa-miR151 / hsa-miR10a, hsamiR16 / hsa-miR127, hsa-miR20a / hsa-let 7f, hsa-miR20a / hsa-miR409, hsa-miR155 / hsamiR409, hsa-miR339 / hsa-let 7d, hsa-miRl51 / hsa-miR374, hsa-miRl27 / hsa-miRlOa, hsamiR15b / hsa-let 7f, hsa-miR20 a / hs-let 7a, hsa-miR210 / hsa-miR155, hsa-miR210 / hsa- let 7a, hsa-miR26b / hsa-miR-3 39, hsa-miR26b / hsa-miR-127, hsa-miR 16 / hsa-miR-409, hsamiR127 / hsa-miR-17, hsa-miR151 / hsa-miRl26 , hsa-miR26b / hsa-miR151, hsa-miR20a / hsa- miRl27, hsa-miR339 / hsa-let 7a, hsa-miR26b / hsa-let 7f, hsa-miRl26 / hsa-miRl34, hsamiR20a / hsa-miR34b, hsa -let 7d / hsa-miR34b, hsa-miRlSb / hsa-miR339, hsa-let 7d / hsa let 7f, hsa-miRlOa / hsa let 7d, hsa-miRl26 / hsa let 7f, hsa-miRl26 / hsa-miRlOa, hsa mR1426 / hsamiR155, hsa-miR127 / hsa-miR16, hsa-miR134 / hsa-miR17, hsa-miR134 / hsa-miR409, hsamiR151 / hsa-miR17, hsa-miR155 / hsa-miR339, hsa-miR15b / hsa-miR10a , hsa-miR15b / hsamiR155, hsa-miR15b / hsa-miR34b, hsa-miR16 / hsa-miR10a, hsa-miR16 / hsa-miR16, hsamiR16 / hsa-miR155, hsa-miR16 / hsa-miR15b, hsa-miR16 / hsa -miR20a, hsa-m 1H17 / hsa let 7d, hsa-miR20a / hsa-miR10a, hsa-miR210 / hsa-miR127, hsa-miR210 / hsa-miR134, hsamiR210 / hsa-miR339, hsa-miR210 / hsa-miR409, hsa-miR26b / hsa let 7a, hsa-miR26b / hsamiR10a, hsa-miR26b / hsa-miR155, hsa-miR26b / hsa-miR15b, hsa-miR374 / hsa-miR10a, hsamiR10a / hsa-miR210, hsa-miR10a / hsa-miR3 39, hsa-miR10a / hsa-miR34b, hsa-miRl55 / hsa let 7f, hsa-miRl6 / hsa let 7a, hsa-miRl6 / hsa-miR210, hsa-miR210 / hsa let 7d, hsa-miR210 / hsamiR126, hsa-miR210 / hsa-miRl5b, hsa-miR210 / hsa-miR17, hsa-miR2 10 / hs a-miR20a, hsamiR210 / hsa-miR374, hsa-miR26b / hsa-miR210, hsa-miR16 / hsa let 7f, hsa-miR16 / hsamiR374 . The inverse ratios of those mentioned in the above list have the same meaning for the diagnosis, that is to say that we can use these ratios or their inverses. A deduction that the patient has at least one glial tumor is made, when the ratio of the expression level of two miRNAs of a couple is different from the aforesaid ratio established in a reference healthy sample. By way of example, column 2 of Table 4 illustrates a tabulated pre-established chart in reference healthy tissue for each pair of miRNAs. According to the invention, it is also possible to establish a two-dimensional or three-dimensional graph, using two or more pairs of miRNAs chosen from the miRNA pairs mentioned in the above part. By way of example, FIGS. 2-6 are graphs in the form of a two-dimensional graph, in which the diamond points representing normal tissues constitute a zone framed by the dashed-dotted rectangle. After the assay of miRNAs involved and the calculation of ratios such as those used for the establishment of the abacus, the nature of the suspected tissue can be easily spotted on this abacus, and it can be inferred that the suspected tissue is a tissue. tumor, when the point, representing the suspected tissue, does not enter the area framed by the rectangle drawn dash-dotted. By way of example also, FIG. 7 based on the use of 3 different pairs of miRNAs, the respective values of which are expressed as a percentage of the sum of the values of these 3 pairs, makes it possible to easily identify the healthy tissues with respect to the tissues. tumoral since they are characterized - in contrast to tumor tissue - by high values of the hsa-miRl34 / hsa-miR20a pair (bars in light gray) compared to the values of the other two couples in a given tissue. In an advantageous embodiment of the invention, the deduction that the suspected patient has a glioma is made when the ratio between the level of expression of the aforementioned first miRNA and the level of expression of the aforementioned second miRNA is twice, especially 3 times, more particularly 4 times, greater than the value of said ratio in a pre-established chart for a reference healthy sample. In another advantageous embodiment of the invention, the deduction that the suspected patient has a glioma is made when the ratio between the level of expression of the above-mentioned first miRNA and the level of expression of the aforementioned second miRNA is twice, in particular 3 times, more particularly 4 times, less than the value of said ratio in a pre-established chart for a reference healthy sample. An advantageous embodiment of a method for in vitro diagnosis of gliomas according to the invention comprises: (i) measuring the ratio of the level of expression of at least one pair of miRNAs chosen from hsa-let 7a / hsa- miRl27, hsa-let 7a / hsa-miRl Sb, hsa-let 7a / hsamiR34b, hsa-miRl26 / hsa-let 7a, hsa-miR126 / hsa-miR34b, hsa-miRl27 / hsa-let 7d, hsa-miR127 / hsa -mR15b, hsa-miR134 / hsa-let 7a, hsa-miR134 / hsa-miR10a, hsa-hsa-miR151 / hsa-let 7f, hsa-hsa-miRl 6 / hsa-miRl 51, hsa-hsa-miR 17 / hsa-miR3 3 9, hsa-hsa-hsa-miR26b / hsa-miR409, hsa-hsa-miR374 / hsa-let 7f, hsa-hsa-miR3 74 / hsa-miR3 3 9, hsa-hsa-miR409 / hsa- miRlOa, hsa-hsa-miRl26 / hsa-miR409, hsa-hsa-miRl6 / hsa-miRl34, hsa-hsa-miRl 6 / hsa-miRl 27, hsa-hsa-miRl55 / hsa-miR409, hsa-hsa-miRl27 / hsa-miRlOa, hsa-hsa-miR210 / hsa-miRl 55, hsa- miRl51 / hsa-let 7a, hsa-miRl51 / hsa-let 7d, miR 1 51 / hsa-miR 1 5b, hsa-miR 1 5b / hsa -MR409, miR16 / hsa-miR339, hsa-miR16 / hsa-miR34b, miR17 / hsa-miR34b, hsa-miR17 / hsa-miR409, hsa-miR20a / hsa-miR339, miR26b / hsa-miR 134, hsa-miR26b / hsa-miR34b, miR339 / hsa-let 7f, hsa-miR34b / hsa-let 7f, miR374 / hsa-miR127, hsa-miR374 / hsa-miR134, miR374 / hsa-miR34b, hsa-miR374 / hsa-miR409, miRl 55 / hsa-miRl 34, hsa-miRl 55 / hsa-miRl27, miR127 / hsa-let 7f, hsa-miR15 1 / hsa-miR20a, miR126 / hsa-miR339, hsa-miR151 / hsa- miRl Oa, hsa-miR20a / hsa-miR409, hsa-miRl51 / hsa-miR374, hsa-miR20a / hsa-let 7a, miR20a / hsa-let 7f, miR3 3 9 / hsa-7d, miR15b / hsa-let 7f , miR2 10 / hsa- let 7a, hsa-miR26b / hsa-miR-399, hsa-miR26b / hsa-miR-127, hsamiR16 / hsa-miR-409, hsa-miR127 / hsa-miR-17, hsa- miR151 / hsa-miR126, hsamiR26b / hsa-miR1 5 1, hsa-miR20a / hsa-miR127, hsa-miR3 3 9 / hsa- let 7a, hsamiR26b / hsa-let 7f, hsa-miR126 / hsa-miR134, hsa- miR20a / hsa-miR34b, hsa-let 7d / hsa-miR34b, hsa-miR15b / hsa-miR339, hsa-let 7d / hsa let 7f, hsa-miRlOa / hsa let 7d, hsa-miR126 / hsa let 7f, hs-mi miR126 / hsa-miR10a, hsa-miR126 / hsa-miR155, hsa-miR127 / hsa-miR126, hsa-miR134 / hsa-miR17, hsa-miR134 / hsa-miR409, hsa- miR151 / hsa-miR17, miR15b / hsa- miRl 55, miR16 / hsa-miRl26, miR16 / hsa-miR20a , miR210 / hsa-miRl27, miR2 10 / hsa-miR4 09, miR26b / hsa-miR1 55, miR10a / hsa-miR210, hsa-miR155 / hsa-miR339, hsa-miR15b / hsa-miR10a, hsa hsa-miRl 5b / hsa-miR34b, hsa-miRl 6 / hsa-miRl Oa, hsa-hsa-miRl 6 / hsa-miRl 55, hsa-miR16 / hsa-miRl 5b, hsa-hsa-miRl7 / hsa let 7d , hsa-miR20a / hsa-miR10a, hsa-hsa-miR2 10 / hsa-miRl 34, hsa-miR2 10 / hsa-miR3 39, hsa-hsa-miR26b / hsa let 7a, hsa-miR26b / hsa-miRlOa, hsahsa -mR26b / hsa-miR15b, hsa-miR374 / hsa-miR10a, hsahsa-miR 1 0a / hsa-miR3 39, hsa-miR10a / hsa-miR34b, hsa- miRl55 / hsa let 7f, hsa-miRl6 / hsa let 7a , hsa-miRl6 / hsa-miR210, hsa-miR210 / hsa let 7d, hsa-miR210 / hsa-miRl26, hsa-miR210 / hsa-miR15b, hsa-miR2O / hsamiR17, hsa-miR210 / hsa-miR20a, hsa mR26 / hsamiR210, hsa-miR16 / hsa17f, hsa-miR16 / hsa-miR374, in a biological sample from a patient suspected of having a glioma, (ii) deduction that the suspected patient has a glioma, when the aforementioned ratio between the level of expression of the aforementioned first mi RNA and the level of expression of the aforementioned second miRNA is 2 times, in particular 3 times, more particularly 4 times, greater or less than the value of said ratio in a pre-established abacus in a reference healthy sample.
Dans un mode de réalisation particulier de l'invention, l'échantillon biologique provenant d'un patient suspecté de présenter un gliome est un tissu cérébral obtenu par exérèse, ou par biopsie. Ladite méthode comprend : (i) la mesure du rapport du niveau d'expression d'au moins un couple de miARNs choisi parmi hsa-let 7a/hsa-miRl27, hsa-let 7a/hsa-miRl Sb, hsa-let 7a/hsa-miR34b, hsamiR126/hsa-let 7a, hsa-miR126/hsa-miR34b, hsa-miRl27/hsa-let 7d, hsa-miR127/hsamiR15b, hsa-miR134/hsa-let 7a, hsa-miRl34/hsa-miRlOa, hsa-miR151/hsa-let 7a, hsamiR151/hsa-let 7d, hsa-miR151/hsa-let 7f, hsa-miRl51/hsa-miRl5b, hsa-miRl5b/hsa- miR409, hsa-miR16/hsa-miRl51, hsa-miRl6/hsa-miR339, hsa-miRl6/hsa-miR34b, hsamiR17/hsa-miR3 3 9, hsa-miR17/hsa-miR34b, hsa-miR17/hsa-miR409, hsa-miR20a/hsamiR3 3 9, hsa-miR26b/hsa-miR134, hsa-miR26b/hsa-miR34b, hsa-miR26b/hsa-miR409, hsamiR339/hsa-let 7f, hsa-miR34b/hsa-let 7f, hsa-miR374/hsa-let 7f, hsa-miR374/hsa-miRl27, hsa-miR374/hsa-miR134, hsa-miR3 74/hsa-miR33 9, hsa-miR374/hsa-miR34b, hsamiR374/hsa-miR409, hsa-miR409/hsa-miRlOa, hsa-miR155/hsa-miRl34, hsa-miRl55/hsamiR127, hsa-miR126/hsa-miR409, hsa-miRl27/hsa-let 7f, hsa-miR151/hsa-miR20a, hsamiR16/hsa-miRl34, hsa-miR126/hsa-miR339, hsa-miR151/hsa-miRlOa, hsa-miRl6/hsamiR127, hsa-miR20a/hsa-let 7f, hsa-miR20a/hsa-miR409, hsa-miR155/hsa-miR409, hsamiR339/hsa-let 7d, hsa-miRl51/hsa-miR374, hsa-miRl27/hsa-miRlOa, hsa-miR15b/hsa-let 7f, hsa-miR20a/hsa-let 7a, hsa-miR2l0/hsa-miRl55, hsa-miR2l0/hsa-let 7a, hsa-miR26b/hsamiR-339, hsa-miR26b/hsa-miR-127, hsa-miRl6/hsa-miR-409, hsa-miR127/hsa-miR-17, hsamiR151/hsa-miRl26, hsa-miR26b/hsa-miRl51, hsa-miR20a/hsa-miRl27, hsa-miR339/hsa-let 7a, hsa-miR26b/hsa-let 7f, hsa-miRl26/hsa-miRl34, hsa-miR20a/hsa-miR34b, hsa-let 7d/hsamiR34b, hsa-miRlSb/hsa-miR339, hsa-let 7d/hsa let 7f, hsa-miRlOa/hsa let 7d, hsamiR126/hsa let 7f, hsa-miRl26/hsa-miRlOa, hsa-miR126/hsa-miRl55, hsa-miR127/hsamiR126, hsa-miR134/hsa-miRl7, hsa-miRl34/hsa-miR409, hsa-miR151/hsa-miRl7, hsamiR155/hsa-miR339, hsa-miR15b/hsa-miRlOa, hsa-miR15b/hsa-miRl55, hsa-miRl5b/hsamiR34b, hsa-miR16/hsa-miRlOa, hsa-miRl6/hsa-miRl26, hsa-miRl6/hsa-miRl55, hsamiR16/hsa-miRl5b, hsa-miRl6/hsa-miR20a, hsa-miRl7/hsa let 7d, hsa-miR20a/hsa-miRlOa, hsa-miR210/hsa-miRl27, hsa-miR210/hsa-miRl34, hsa-miR210/hsa-miR339, hsamiR2l0/hsa-miR409, hsa-miR26b/hsa let 7a, hsa-miR26b/hsa-miRlOa, hsa-miR26b/hsamiR155, hsa-miR26b/hsa-miRl5b, hsa-miR374/hsa-miRlOa, hsa-miRlOa/hsa-miR210, hsamiRlOa/hsa-miR339, hsa-miRlOa/hsa-miR34b, hsa-miRl55/hsa let 7f, hsa-miRl6/hsa let 7a, hsa-miR16/hsa-miR210, hsa-miR210/hsa let 7d, hsa-miR210/hsa-miRl26, hsa-miR210/hsamiR15b, hsa-miR210/hsa-miRl7, hsa-miR210/hsa-miR20a, hsa-miR210/hsa-miR374, hsamiR26b/hsa-miR2l0, hsa-miRl6/hsa let 7f, hsa-miRl6/hsa-miR374, dans un tissu biologique provenant d'un tissu suspecté de présenter un caractère tumoral, (ii) la déduction du caractère tumoral du tissu suspecté, lorsque le susdit rapport entre le niveau d'expression du susdit premier miARN et le niveau d'expression du susdit deuxième miARN est 2 fois, notamment 3 fois, plus particulièrement 4 fois, supérieur ou inférieur à la valeur dudit rapport dans un abaque préétabli dans un tissu sain de référence. In a particular embodiment of the invention, the biological sample from a patient suspected of having a glioma is brain tissue obtained by excision, or by biopsy. Said method comprises: (i) measuring the ratio of the level of expression of at least one pair of miRNAs chosen from hsa-let 7a / hsa-miRl27, hsa-let 7a / hsa-miRl Sb, hsa-let 7a / hsa-miR34b, hsamiR126 / hsa-let 7a, hsa-miR126 / hsa-miR34b, hsa-miRl27 / hsa-let 7d, hsa-miR127 / hsamiR15b, hsa-miR134 / hsa-let 7a, hsa-miRl34 / hsa-miRlOa , hsa-miR151 / hsa-let 7a, hsamiR151 / hsa-let 7d, hsa-miR151 / hsa-let 7f, hsa-miR151 / hsa-miR15b, hsa-miR15b / hsa- miR409, hsa-miR16 / hsa-miR151, hsa-miRl6 / hsa-miR339, hsa-miRl6 / hsa-miR34b, hsamiR17 / hsa-miR3 3 9, hsa-miR17 / hsa-miR34b, hsa-miR17 / hsa-miR409, hsa-miR20a / hsamiR3 3 9, hs-miR349 miR26b / hsa-miR134, hsa-miR26b / hsa-miR34b, hsa-miR26b / hsa-miR409, hsamiR339 / hsa-let 7f, hsa-miR34b / hsa-let 7f, hsa-miR374 / hsa-let 7f, hsa-miR374 / hsa-miRl27, hsa-miR374 / hsa-miR134, hsa-miR3 74 / hsa-miR339, hsa-miR374 / hsa-miR34b, hsamiR374 / hsa-miR409, hsa-miR409 / hsa-miR10a, hsa-miR155 / hsa mR134, hsa-miR155 / hsamiR127, hsa-miR126 / hsa-miR409, hsa-miRl27 / hsa-let 7f, hsa-miR151 / hsa-miR20a, hsamiR16 / hsa- miRl34, hsa-miR126 / hsa-miR339, hsa-miR151 / hsa-miR10a, hsa-miR16 / hsamiR127, hsa-miR20a / hsa-let 7f, hsa-miR20a / hsa-miR409, hsa-miR155 / hsa-miR409, hsamiR339 hrs-miRl51 / hsa-miR374, hsa-miRl27 / hsa-miRlOa, hsa-miR15b / hsa-let 7f, hsa-miR20a / hsa-let 7a, hsa-miR2l0 / hsa-miRl55, hs-miR154 miR210 / hsa-let 7a, hsa-miR26b / hsamiR-339, hsa-miR26b / hsa-miR-127, hsa-miR16 / hsa-miR-409, hsa-miR127 / hsa-miR-17, hsamiR151 / hsa-miRl26 , hsa-miR26b / hsa-miR151, hsa-miR20a / hsa-miRl27, hsa-miR339 / hsa-let 7a, hsa-miR26b / hsa-let 7f, hsa-miRl26 / hsa-miRl34, hsa-miR20a / hsa-miR34b , hsa-let 7d / hsamiR34b, hsa-miRlSb / hsa-miR339, hsa-let 7d / hsa let 7f, hsa-miRlOa / hsa let 7d, hsamiR126 / hsa let 7f, hsa-miRl26 / hsa-miRlOa, hsa-miR126 / hsa-miR135, hsa-miR127 / hsamiR126, hsa-miR134 / hsa-miR17, hsa-miR1334 / hsa-miR409, hsa-miR151 / hsa-miR17, hsamiR155 / hsa-miR339, hsa-miR15b / hsa-miR10a, hsa mR15b / hsa-miR155, hsa-miR15b / hsamiR34b, hsa-miR16 / hsa-miR10a, hsa-miR16 / hsa-miR16, hsa-miR16 / hsa-miR155, hsamiR16 / hsa-miR15b, hsa-miR16 / hsa-miR2 0a, hsa-miR17 / hsa let 7d, hsa-miR20a / hsa-miR10a, hsa-miR210 / hsa-miRl27, hsa-miR210 / hsa-miR134, hsa-miR210 / hsa-miR339, hsamiR210 / hsa-miR409, hsa- mR26b / hsa let 7a, hsa-miR26b / hsa-miR10a, hsa-miR26b / hsamiR155, hsa-miR26b / hsa-miR15b, hsa-miR374 / hsa-miR10a, hsa-miR10a / hsa-miR210, hsamiR10a / hsa-miR339, hsa-miRlOa / hsa-miR34b, hsa-miRl55 / hsa let 7f, hsa-miRl6 / hsa let 7a, hsa-miR16 / hsa-miR210, hsa-miR210 / hsa let 7d, hsa-miR210 / hsa-miRl26, hsa- mi miR210 / hsamiR15b, hsa-miR210 / hsa-miR17, hsa-miR210 / hsa-miR20a, hsa-miR210 / hsa-miR374, hsamiR26b / hsa-miR210, hsa-miR16 / hsa17f, hsa-miR16 / hsa-miR374, in a biological tissue from a tissue suspected of having a tumoral character, (ii) the deduction of the tumor character of the suspected tissue, when the aforesaid ratio between the level of expression of the above-mentioned first miRNA and the level of expression of the aforesaid second miRNA is 2 times, in particular 3 times, more particularly 4 times, higher or lower than the value of said ratio in an aba than pre-established in a healthy reference tissue.
L'invention a également pour objet une méthode de diagnostic in vitro de gliomes, permettant de distinguer un glioblastome d'un oligodendrogliome. Dans un premier mode de réalisation, cette méthode repose uniquement sur la mise en oeuvre de 5 miARNs repérés par les Inventeurs, à savoir hsa-miR-155, hsa-miR-210 ou hsamiR-10a, hsa-miR-409 ou hsa-miR-134, dont les niveaux d'expression sont systématiquement plus élevés dans les glioblastomes par rapport à ceux dans les oligodendrogliomes. Dans ce mode d'analyse, il s'agit de réaliser des comparaisons inter-échantillon. Cette méthode comprend : - la mesure du niveau d'expression d'au moins un miARN choisi parmi hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409 ou hsa-miR-134, dans un échantillon biologique provenant d'un patient suspecté de présenter un glioblastome ou un oligodendrogliome, - la comparaison entre : - le niveau d'expression du susdit miARN dans ledit échantillon biologique et * respectivement le niveau d'expression du susdit miARN dans un échantillon biologique de référence provenant d'un patient présentant un glioblastome, et * respectivement le niveau d'expression du susdit miARN dans un échantillon biologique de référence provenant d'un patient présentant un oligodendrogliome, et - la déduction : - soit que le patient suspecté présente un glioblastome, lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un glioblastome ou un oligodendrogliome est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un glioblastome, - soit que le patient suspecté présente un oligodendrogliome, lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un glioblastome ou un oligodendrogliome est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un oligodendrogliome. « Un échantillon biologique de référence provenant d'un patient suspecté de présenter un glioblastome ou un oligodendrogliome » est un échantillon prévelé d'un patient dont la présence d'une tumeur gliale est déjà confirmé par une méthode décrite dans la partie susmentionnée ou par toute autre méthode conventionnelle connue de l'homme du métier, telle qu'une analyse histologique, ou un scanner. Néanmoins, la nature ou la classification exacte de la tumeur gliale est encore inconnue. Un échantillon de référence provenant d'un patient présentant un glioblastome ou un oligodendrogliome peut être un tissu de glioblastome ou un oligodendrogliome obtenu par exérèse chez un patient et dont le type de tumeur a été certifié par l'analyse anatomopathologique, ou un échantillon sanguin prélevé d'un patient dont la présence d'un glioblastome ou un oligodendrogliome est confirmée. Idéalement, le diagnostic peut également être confirmé par des analyses moléculaires telles que par exemple l'analyse des profils d'expression de gènes de ces tissus tumoraux. Les tumeurs sont ensuite caractérisées en utilisant la méthode de classification de Li et al (Li A, Walling J, Ahn S, Kotliarov Y, Su Q, Quezado M, Oberholtzer JC, Park J, Zenklusen JC, Fine HA. Cancer Res. 2009 Mar 1;69(5):2091-9) qui repose sur l'utilisation des niveaux d'expression d'un jeu de 54 gènes. Les glioblastomes ou oligodendrogliomes sont classés respectivement dans les groupes G et O de la publication sus-mentionnée. The invention also relates to a method for in vitro diagnosis of glioma, for distinguishing a glioblastoma from an oligodendroglioma. In a first embodiment, this method relies solely on the implementation of 5 miRNAs identified by the inventors, namely hsa-miR-155, hsa-miR-210 or hsamiR-10a, hsa-miR-409 or hsa- miR-134, whose expression levels are consistently higher in glioblastomas compared to those in oligodendrogliomas. In this analysis mode, it is necessary to make inter-sample comparisons. This method comprises: measuring the level of expression of at least one miRNA selected from hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409 or hsa-miR-134, in a biological sample from a patient suspected of having a glioblastoma or an oligodendroglioma, - the comparison between: - the level of expression of the above miRNA in said biological sample and * respectively the level of expression of the above miRNA in a sample biological reference from a patient with glioblastoma, and * respectively the level of expression of the above miRNA in a reference biological sample from a patient having an oligodendroglioma, and - the deduction: - that the suspected patient presents a glioblastoma, when the level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is equal, within the limit of 20% more or 20% less, to the calf expression of the above miRNA in the reference sample from a patient with glioblastoma, or that the suspected patient has an oligodendroglioma, when the level of expression of the above miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is equal, within 20% plus or minus 20%, to the level of expression of the above miRNA in the reference sample from a patient with an oligodendroglioma. "A reference biological sample from a patient suspected of having a glioblastoma or oligodendroglioma" is a prevelated sample of a patient whose presence of a glial tumor is already confirmed by a method described in the above-mentioned part or by any another conventional method known to those skilled in the art, such as a histological analysis, or a scanner. Nevertheless, the exact nature or classification of the glial tumor is still unknown. A reference sample from a patient with a glioblastoma or oligodendroglioma may be a glioblastoma tissue or an oligodendroglioma obtained by excision in a patient and whose tumor type has been certified by pathological analysis, or a blood sample taken of a patient whose presence of glioblastoma or oligodendroglioma is confirmed. Ideally, the diagnosis can also be confirmed by molecular analyzes such as, for example, the analysis of the gene expression profiles of these tumor tissues. The tumors are then characterized using the Li et al classification method (Li A, Walling J, Ahn S, Kotliarov Y, Su Q, Quezado M, Oberholtzer JC, Park J, Zenklusen JC, Fine HA, Cancer Res. Mar 1; 69 (5): 2091-9) which relies on the use of the expression levels of a set of 54 genes. Glioblastomas or oligodendrogliomas are classified respectively in groups G and O of the aforementioned publication.
Etant donné que les niveaux d'expression de 5 miARNs mis en oeuvre dans cette méthode de détermination de la nature d'une tumeur gliale sont systématiquement plus élevés dans les glioblastomes par rapport aux oligodendrogliomes, lorsque l'échantillon suspecté provient d'un patient atteint d'un glioblastome, le niveau d'expression de l'un susdit miARN dans l'échantillon suspecté est supérieur au niveau d'expression dudit miARN dans l'échantillon de référence provenant d'un patient présentant un oligodendrogliome, et proche du niveau d'expression dudit miARN dans l'échantillon de référence provenant d'un patient présentant un glioblastome. En revanche, lorsque l'échantillon suspecté provient d'un patient atteint d'un oligodendrogliome, le niveau d'expression de l'un susdit miARN dans l'échantillon suspecté est inférieur au niveau d'expression dudit miARN dans l'échantillon de référence provenant d'un patient présentant un glioblastome, et proche du niveau d'expression dudit miARN dans l'échantillon de référence provenant d'un patient présentant un oligodendrogliome. Les niveaux d'expression des miARNs peuvent être mesurés par hybridation sur « puces à ADN », par séquençage, ou par PCR en temps réel. Since the miRNA expression levels used in this method of determining the nature of a glial tumor are consistently higher in glioblastomas than in oligodendrogliomas, when the suspected sample is from a patient with of a glioblastoma, the level of expression of one of the above-mentioned miRNA in the suspected sample is greater than the expression level of said miRNA in the reference sample from a patient presenting with an oligodendroglioma, and close to the level of expression of said miRNA in the reference sample from a patient with glioblastoma. On the other hand, when the suspected sample comes from an oligodendroglioma patient, the level of expression of one of the above-mentioned miRNAs in the suspected sample is lower than the level of expression of said miRNA in the reference sample. from a patient with glioblastoma, and close to the level of expression of said miRNA in the reference sample from a patient with an oligodendroglioma. Expression levels of miRNAs can be measured by "microarray" hybridization, sequencing, or real-time PCR.
Lorsque le dosage des niveaux d'expression des miARNs est effectué par hybridation sur «puces à ADN » ou par séquençage, la comparaison entre le niveau d'expression d'un miARN dans l'échantillon suspecté et celui dans un échantillon de référence (glioblastomes ou oligodendrogliomes) est évaluée d'après la formule IV: Quantité de miARNx normalisée (échantillon A) / Quantité de miARNx normalisée (échantillon B) En l'occurrence, A représente l'échantillon suspecté et B représente un échantillon de référence provenant d'un patient présentant un glioblastome ou un oligodendrogliome. When the assay of miRNA expression levels is performed by "microarray" hybridization or by sequencing, the comparison between the level of expression of a miRNA in the suspected sample and that in a reference sample (glioblastoma or oligodendrogliomas) is evaluated from Formula IV: Normalized miRNAx (Sample A) / Normalized miRNAx (Sample B) In this case, A represents the suspected sample and B represents a reference sample from a patient with glioblastoma or oligodendroglioma.
Lorsque le dosage des niveaux d'expression est obtenu par PCR en temps réel, la comparaison entre le niveau d'expression d'un miARN dans l'échantillon suspecté et celui dans un échantillon de référence provenant d'un patient présentant un glioblastome ou un oligodendrogliome est évaluée selon la formule V ci-après Rapport (échantillon A/échantillon B) = Efficacité «ct hsa-miARN X - Ct RNU24)échantillon A (Ct hsa-miARNX - Ct RNU24)échantillon B) où l'échantillon A est l'échantillon suspecté et l'échantillon B est l'échantillon de référence provenant d'un patient présentant un glioblastome ou un oligodendrogliome. When assaying expression levels is obtained by real-time PCR, the comparison between the level of expression of a miRNA in the suspected sample and that in a reference sample from a patient with glioblastoma or oligodendroglioma is evaluated according to formula V below Ratio (sample A / sample B) = Efficacy "ct hsa-miRNA X - Ct RNU24) sample A (Ct hsa-miRNAX - Ct RNU24) sample B) where sample A is the suspected sample and sample B is the reference sample from a patient with glioblastoma or oligodendroglioma.
Ainsi, la déduction que le patient présente un glioblastome est faite lorsque : - le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un glioblastome ou un oligodendrogliome est au moins 3 fois supérieur au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un oligodendrogliome, et - le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un glioblastome ou un oligodendrogliome est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un glioblastome. L'expression « le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un glioblastome ou un oligodendrogliome est au moins 3 fois supérieur au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un oligodendrogliome » signifie que le rapport entre le niveau d'expression d'un miARN dans l'échantillon provenant d'un patient suspecté et le niveau d'expression du susdit miARN dans un échantillon de référence provenant d'un patient présentant un oligodendrogliome, obtenu d'après la formule IV ou V, a une valeur égale ou supérieure à 3. En l'occurrence, dans ces formules, l'échantillon A est l'échantillon suspecté ; l'échantillon B est l'échantillon de référence provenant d'un patient présentant un oligodendrogliome. L'expression « le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un glioblastome ou un oligodendrogliome est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un glioblastome» signifie que le rapport entre le niveau d'expression d'un miARN dans l'échantillon suspecté et le niveau d'expression du susdit miARN dans échantillon de référence provenant d'un patient présentant un glioblastome, obtenu d'après la formule IV ou V, a une valeur égale à 1 ou comprise entre 0,8 et 1,2. En l'occurrence, dans ces formules, l'échantillon A est l'échantillon suspecté ; l'échantillon B est l'échantillon de référence provenant d'un patient présentant un glioblastome. Thus, the deduction that the patient has a glioblastoma is made when: the level of expression of the above miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is at least 3 times higher than the level of expressing the above miRNA in the reference sample from a patient with an oligodendroglioma, and - the level of expression of the above miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is equal, in the limit of 20% plus or minus 20%, at the level of expression of the above miRNA in the reference sample from a patient with glioblastoma. "The level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is at least 3 times greater than the level of expression of the above-mentioned miRNA in the reference sample from of a patient presenting with an oligodendroglioma "means that the ratio between the level of expression of a miRNA in the sample from a suspected patient and the level of expression of the above miRNA in a reference sample from a Patient with an oligodendroglioma, obtained from formula IV or V, has a value equal to or greater than 3. In this case, in these formulas, sample A is the suspected sample; Sample B is the reference sample from a patient with oligodendroglioma. The expression "level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is equal, within the limit of 20% more or 20% less, at the level of expression of the above-mentioned miRNA in the reference sample from a patient with glioblastoma "means that the ratio between the level of expression of a miRNA in the suspected sample and the level of expression of the said miRNA in the sample of reference from a patient with glioblastoma, obtained from formula IV or V, has a value of 1 or between 0.8 and 1.2. In these cases, in these formulas, sample A is the suspected sample; Sample B is the reference sample from a patient with glioblastoma.
La déduction que le patient présente un oligodendrogliome est faite lorsque : - le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un glioblastome ou un oligodendrogliome est au moins 3 fois inférieur au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un glioblastome, et - le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un glioblastome ou un oligodendrogliome est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un oligodendrogliome. L'expression « le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un glioblastome ou un oligodendrogliome est au moins 3 fois inférieur au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un glioblastome » signifie que le rapport entre le niveau d'expression d'un miARN dans l'échantillon suspecté et le niveau d'expression du susdit miARN dans un échantillon de référence provenant d'un patient présentant un glioblastome, obtenu d'après la formule IV ou V, a une valeur égale ou inférieure à 0,33. The deduction that the patient presents an oligodendroglioma is made when: - the level of expression of the above miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is at least 3 times lower than the level of expression of the said miRNA in the reference sample from a patient with glioblastoma, and - the level of expression of the above miRNA in the sample from a patient suspected of having glioblastoma or oligodendroglioma is, within 20% more or 20% less at the level of expression of the above miRNA in the reference sample from a patient having an oligodendroglioma. "The level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is at least 3-fold lower than the level of expression of the above miRNA in the reference sample from of a patient with glioblastoma "means that the ratio between the level of expression of a miRNA in the suspected sample and the level of expression of the above miRNA in a reference sample from a patient with glioblastoma, obtained from formula IV or V, has a value equal to or less than 0.33.
En l'occurrence, dans ces formules, l'échantillon A est l'échantillon suspecté ; l'échantillon B est l'échantillon de référence provenant d'un patient présentant un glioblastome. L'expression « le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un glioblastome ou un oligodendrogliome est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un oligodendrogliome» signifie que le rapport entre le niveau d'expression d'un miARN dans l'échantillon suspecté et le niveau d'expression du susdit miARN dans un échantillon de référence provenant d'un patient présentant un oligodendrogliome, obtenu d'après la formule IV ou V, a une valeur égale à 1 ou comprise entre 0,8 et 1,2. En l'occurrence, dans ces formules, l'échantillon A est l'échantillon suspecté ; l'échantillon B est l'échantillon de référence provenant d'un patient présentant un oligodendrogliome. En résumé de R19 et R20, lorsque l'échantillon suspecté provient d'un patient atteint d'un glioblastome, le rapport entre le niveau d'expression d'un miARN dans l'échantillon suspecté et le niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un glioblastome est proche de la valeur de 1, et le rapport entre le niveau d'expression d'un miARN dans l'échantillon suspecté et le niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un oligodendrogliome est supérieur à 3. En revanche, lorsque l'échantillon suspecté provient d'un patient atteint d'un oligodendrogliome, le rapport entre le niveau d'expression d'un miARN dans le tissu suspecté et le niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un oligodendrogliome est proche de la valeur de 1, et le rapport entre le niveau d'expression d'un miARN dans l'échantillon suspecté et le niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un glioblastome est inférieur à 0,33. Plus particulièrement, cette méthode comprend donc les étapes suivantes : (i) la mesure du niveau d'expression d'au moins un miARN choisi parmi hsa-miR-155, hsa-miR-210 ou hsa-miR-10a, hsa-miR-409 ou hsa-miR-134, dans un échantillon biologique provenant d'un patient suspecté de présenter un glioblastome ou un oligodendrogliome, (ii) la comparaison entre : - le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un glioblastome ou un oligodendrogliome et * respectivement le niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un glioblastome, et * respectivement le niveau d'expression du susdit miARN l'échantillon de référence provenant d'un patient présentant un oligodendrogliome, (iii) la déduction : - soit que le susdit patient présente un glioblastome, * lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un glioblastome ou un oligodendrogliome est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un glioblastome, et * lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un glioblastome ou un oligodendrogliome est au moins 3 fois supérieur au niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient présentant un oligodendrogliome, - soit que le patient présente un oligodendrogliome, * lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un glioblastome ou un oligodendrogliome est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un oligodendrogliome, et * lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un glioblastome ou un oligodendrogliome est au moins 3 fois inférieur au niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient présentant un glioblastome. In these cases, in these formulas, sample A is the suspected sample; Sample B is the reference sample from a patient with glioblastoma. The expression "level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is equal, within the limit of 20% more or 20% less, at the level of expression of the above miRNA in the reference sample from a patient with an oligodendroglioma "means that the ratio between the level of expression of a miRNA in the suspected sample and the level of expression of the above miRNA in a sample reference number from a patient having an oligodendroglioma, obtained from formula IV or V, has a value of 1 or between 0.8 and 1.2. In these cases, in these formulas, sample A is the suspected sample; Sample B is the reference sample from a patient with oligodendroglioma. In summary of R19 and R20, when the suspected sample comes from a patient with glioblastoma, the ratio between the level of expression of a miRNA in the suspected sample and the level of expression of the said miRNA in the reference sample from a patient with glioblastoma is close to the value of 1, and the ratio between the level of expression of a miRNA in the suspected sample and the level of expression of the above-mentioned miRNA in the reference sample from a patient with an oligodendroglioma is greater than 3. On the other hand, when the suspected sample is from a patient with an oligodendroglioma, the ratio of the level of expression of a miRNA in the suspected tissue and the level of expression of the above miRNA in the reference sample from a patient with an oligodendroglioma is close to the value of 1, and the ratio between the level of expression of a miRNA in the sample knew and the level of expression of the above miRNA in the reference sample from a patient with glioblastoma is less than 0.33. More particularly, this method therefore comprises the following steps: (i) measuring the level of expression of at least one miRNA selected from hsa-miR-155, hsa-miR-210 or hsa-miR-10a, hsa-miR -409 or hsa-miR-134, in a biological sample from a patient suspected of having glioblastoma or oligodendroglioma, (ii) the comparison between: - the level of expression of the above miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma and * respectively the level of expression of the above miRNA in the reference sample from a patient with a glioblastoma, and * respectively the level of expression of the said miRNA the sample reference material from a patient presenting with an oligodendroglioma, (iii) the deduction: - that the aforementioned patient has a glioblastoma, * when the level of expression of the above miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is equal, within a limit of 20% plus or minus 20%, to the level of expression of the above miRNA in the reference sample from a patient with glioblastoma, and * when the level of expression of the above miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is at least 3 times greater than the level of expression of the above miRNA in the sample from a patient with an oligodendroglioma, - the patient presents with an oligodendroglioma, * when the level of expression of the above miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is equal, up to a limit of 20% more or 20% by least, at the level of expression of the above miRNA in the reference sample from a patient presenting with an oligodendroglioma, and * when the level of expression of the above miRNA in the sample p from a patient suspected of having a glioblastoma or oligodendroglioma is at least 3-fold lower than the level of expression of the above-mentioned miRNA in the sample from a patient with glioblastoma.
Dans un mode de réalisation particulier de l'invention, l'échantillon biologique provenant d'un patient suspecté de présenter un gliome est un tissu cérébral obtenu par exérèse, ou par biopsie. Ladite méthode comprend : (i) la mesure du niveau d'expression d'au moins un miARN choisi parmi hsa-miR-155, hsa-miR-210 ou hsa-miR-10a, hsa-miR-409 ou hsa-miR-134, dans un tissu biologique provenant d'un tissu tumoral suspecté d'être un tissu de glioblastome ou un tissu d'oligodendrogliome, (ii) la comparaison entre : - le niveau d'expression du susdit miARN dans le tissu suspecté et * respectivement le niveau d'expression du susdit miARN dans un tissu de glioblastome de référence, et * respectivement le niveau d'expression du susdit miARN dans un tissu d'oligodendrogliome de référence, et (iii) la déduction : - soit que le tissu suspecté est un glioblastome, * lorsque le niveau d'expression du susdit miARN dans le tissu suspecté est égal, dans la limite de 20% en plus ou en moins, notamment 15%, plus particulièrement 10%, au niveau d'expression du susdit miARN dans le tissu de glioblastome de référence, et * lorsque le niveau d'expression du susdit miARN dans le tissu suspecté est au moins 3 fois supérieur au niveau d'expression du susdit miARN dans le tissu d'oligodendrogliome de référence, - soit que le tissu suspecté est un oligodendrogliome, * lorsque le niveau d'expression du susdit miARN dans le tissu suspecté est égal, dans la limite de 20% en plus ou en moins, notamment 15%, plus particulièrement 10%, au niveau d'expression du susdit miARN dans le tissu d'oligodendrogliome de référence, et * lorsque le niveau d'expression du susdit miARN dans le tissu suspecté est au moins 3 fois inférieur au niveau d'expression du susdit miARN dans le tissu de glioblastome de référence. Un deuxième mode de réalisation d'une méthode de diagnostic in vitro de gliomes, permettant de distinguer un glioblastome d'un oligodendrogliome, consiste en des comparaisons infra-échantillons. Cette méthode est basée sur une comparaison intraéchantillon du niveau d'expression de deux miARNs, dont l'un fait partie des 5 miARNs spécifiques dont les niveaux d'expression sont plus élevés dans les glioblastomes par rapport à ceux dans les oligodendrogliomes, l'autre est choisi parmi les 14 autres miARN restant de l'ensemble de 19 miARNs définis précédemment. Cette méthode comprend: (i) la mesure du niveau d'expression des miARNs dans au moins un couple de miARNs constitué par: * un miARN choisi parmi hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409 ou hsa-miR-134, et * un miARN choisi parmi hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsamiR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, , hsa-miR-339, hsa-miR-127, hsamiR-151, hsa-miR-26b , hsa-miR-34b, pour un échantillon biologique provenant d'un patient suspecté de présenter un glioblastome ou un oligodendrogliome, ladite mesure permettant d'établir le rapport du niveau d'expression pour un susdit couple de miARNs, (ii) la comparaison entre : - le susdit rapport du niveau d'expression pour un couple de miARNs et, - celui représenté dans un abaque préétabli pour un échantillon sain de référence, un échantillon de référence provenant d'un patient présentant un glioblastome, et un échantillon de référence provenant d'un patient présentant un oligodendrogliome, (iii) la déduction : * soit que le patient présente un glioblastome, lorsque la différence entre le rapport obtenu dans l'étape (i) et le rapport dans un abaque préétabli dans un échantillon de référence provenant d'un patient présentant un glioblastome est inférieure à 20%, notamment 15%, plus particulièrement 10%, vis-à-vis du rapport dans un abaque préétabli, * soit que le patient présente un oligodendrogliome, lorsque la différence entre le rapport obtenu dans l'étape (i) et le rapport dans un abaque préétabli dans un échantillon de référence provenant d'un patient présentant un oligodendrogliome est inférieure à 20%, notamment 15%, plus particulièrement 10%, vis-à-vis du rapport dans un abaque préétabli. Dans cette méthode, la comparaison intra-échantillon du niveau d'expression de deux miARNs est exprimée par un rapport(hsa-miARN xi hsa-miARN Y), calculé selon les formules (VI ou VII). miARN X est choisi parmi hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409 ou hsa-miR-134, et miARN Y est choisi parmi l'ensemble des 14 miARNs définis précédemment. Dans cette méthode l'utilisation de l'inverse des ratios sus-mentionnés garde toute sa valeur pour l'identification des échantillons. La différence entre ce rapport et un abaque préétabli est exprimée par une valeur donnée en pourcentage, calculée selon la formule (VIII) : 1Rapport(hsa-miARN X/hsa-miARN Y) - RapportabaquelX1OO/RappOrtabaque• RappOrtabaque, qui se trouve dans un abaque préétabli, est un rapport(hsa-miARN X/ hsa-miARN Y) obtenu dans un échantillon de référence provenant d'un patient présentant un glioblastome ou un oligodendrogliome. Cette méthode utilisant un abaque préétabli permet d'éviter le recours à des échantillons sains ou tumoraux de référence. Tout nouvel échantillon peut être analysé par le dosage de seulement quelques miARNs. A titre d'exemple, les colonnes 3 et 4 du tableau 4 donnent un abaque préétabli respectivement dans l'échantillon de référence provenant d'un patient présentant un glioblastome ou un oligodendrogliome, pour chaque couple de miARNs. Un abaque peut également être présenté sous forme d'un graphique bidimensionnel ou tridimensionnel. Dans un abaque à la forme d'un graphique bidimensionnel, tel que l'abaque illustré aux figures 2-6, à titre d'exemple, deux séries de rapport obtenus dans le tissu de glioblastome de référence donnent une zone encadrée par un rectangle en tracé pointillé; deux séries de rapport obtenus dans le tissu d'oligodendrogliome référence donnent une zone encadrée par un rectangle tracé avec des tirets. On peut déduire qu'un tissu suspecté est un tissu de glioblastomes, lorsque la position fixée par deux rapports obtenus respectivement de ce tissu suspecté est incluse dans le rectangle en tracé pointillé couvrant les carrés représentant les glioblastomes de référence. En revanche, un tissu suspecté est un tissu d'oligodendrogliomes, lorsque la position fixée par deux rapports obtenus respectivement de ce tissu suspecté entre dans le rectangle tracé avec des tirets couvrant les triangles représentant les oligodendrogliomes de référence. Dans un mode de réalisation avantageux, les couples de miARNs utilisés sont les suivants : hsa-miRl27/hsa-miR409, hsa-miR2l0/hsa-miR34b, hsa-let 7f/hsa-miRlOa, hsamiR155/hsa-miRl7, hsa-miR155/hsa-miR374, hsa-let 7a/hsa-miR 409, hsa-let 7d/hsamiR409, hsa-miRl34/hsa-let 7f, hsa-let 7f/hsa-miR409, hsa-miRl34/hsa-let 7d, hsamiR151/hsa-miRl55, hsa-miRl55/hsa-miR34b, hsa-miR15b/hsa-miRl34, hsa-miRl34/hsamiR20a, hsa-miR210/hsa-let 7f, hsa-miR20/hsa-miRl55. Dans un mode de réalisation particulier de l'invention, l'échantillon biologique provenant d'un patient suspecté de présenter un gliome est un tissu cérébral obtenu par exérèse, ou par biopsie. Ladite méthode comprend : (i) la mesure du niveau d'expression des miARNs d'un couple choisi parmi hsamiR127/hsa-miR409, hsa-miR210/hsa-miR34b, hsa-let 7f/hsa-miRlOa, hsa-miR155/hsa- miRl7, hsa-miRl55/hsa-miR374, hsa-let 7a/hsa-miR 409, hsa-let 7d/hsa-miR409, hsamiRl 34/hsa- let 7f, hsa-let 7f/hsa-miR409, hsa-miR134/hsa-let 7d, hsa-miR15 1/hsa-miRl 55 , hsa-miR155/hsa-miR34b, hsa-miR15b/hsa-miRl34, hsa-miRl34/hsa-miR20a, hsamiR2l0/hsa-let 7f, hsa-miR20/hsa-miRl55, pour un tissu biologique provenant d'un tissu tumoral suspecté d'être un tissu de glioblastome ou un tissu d'oligodendrogliome, (ii) la comparaison entre : - le susdit rapport du niveau d'expression pour un couple de miARNs et, * celui représenté dans un abaque préétabli pour un tissu sain de référence, un tissu glioblastome de référence, et un tissu oligodendrogliome de référence, (iii) la déduction : * soit que le tissu suspecté est un glioblastome, lorsque la différence entre le rapport obtenu dans l'étape (i) et le rapport dans un abaque préétabli dans un tissu de glioblastome de référence est inférieure à 20%, notamment 15%, plus particulièrement 10%, vis-à-vis du rapport dans un abaque préétabli, * soit que le tissu suspecté est un oligodendrogliome, lorsque la différence entre le rapport obtenu dans l'étape (i) et le rapport dans un abaque préétabli dans un tissu d'oligodendrogliome de référence est inférieure à 20%, notamment 15%, plus particulièrement 10%, vis-à-vis du rapport dans un abaque préétabli. In a particular embodiment of the invention, the biological sample from a patient suspected of having a glioma is brain tissue obtained by excision, or by biopsy. The method comprises: (i) measuring the level of expression of at least one miRNA selected from hsa-miR-155, hsa-miR-210 or hsa-miR-10a, hsa-miR-409 or hsa-miRN 134, in biological tissue from tumor tissue suspected to be glioblastoma tissue or oligodendroglioma tissue, (ii) comparison between: - the level of expression of the above miRNA in the suspected tissue and * respectively the level of expression of the above miRNA in a reference glioblastoma tissue, and * respectively the level of expression of the above miRNA in a reference oligodendroglioma tissue, and (iii) the deduction: - that the suspected tissue is a glioblastoma, * when the level of expression of the above miRNA in the suspected tissue is equal, within the limit of 20% more or less, in particular 15%, more particularly 10%, at the level of expression of the above miRNA in the reference glioblastoma tissue, and * when the level of expression of the above miRNA in the tissue suspected is at least 3 times higher than the level of expression of the above miRNA in the reference oligodendroglioma tissue, or that the suspected tissue is an oligodendroglioma, * when the level of expression of the above miRNA in the suspected tissue is equal , in the limit of 20% more or less, in particular 15%, more particularly 10%, at the level of expression of the above miRNA in the reference oligodendroglioma tissue, and * when the level of expression of the above miRNA in the suspected tissue is at least 3 times lower than the level of expression of the above-mentioned miRNA in the reference glioblastoma tissue. A second embodiment of a method for in vitro diagnosis of gliomas, which makes it possible to distinguish a glioblastoma from an oligodendroglioma, consists of sub-sample comparisons. This method is based on an intra-sample comparison of the level of expression of two miRNAs, one of which is one of the 5 specific miRNAs with higher levels of expression in glioblastomas compared to those in oligodendrogliomas, the other is selected from the remaining 14 miRNAs remaining from the set of 19 miRNAs defined above. This method comprises: (i) measuring the expression level of the miRNAs in at least one pair of miRNAs consisting of: * a miRNA selected from hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa -mR-409 or hsa-miR-134, and * a miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsamiR-20a, hsa-let7a, hsa 7f, hsa-let 7d, hsa-miR-374, hsa-miR-339, hsa-miR-127, hsamiR-151, hsa-miR-26b, hsa-miR-34b, for a biological sample from a patient suspected of presenting a glioblastoma or oligodendroglioma, said measurement making it possible to establish the ratio of the level of expression for a said pair of miRNAs, (ii) the comparison between: the aforementioned ratio of the level of expression for a pair of miRNAs and, - that represented in a pre-established abacus for a reference healthy sample, a reference sample from a patient with a glioblastoma, and a reference sample from a patient presenting with an oligodendrogli ome, (iii) the deduction: * that the patient has a glioblastoma, when the difference between the ratio obtained in step (i) and the ratio in a pre-established chart in a reference sample from a patient with a glioblastoma is less than 20%, especially 15%, more particularly 10%, vis-à-vis the ratio in a pre-established abacus, * is that the patient has an oligodendroglioma, when the difference between the ratio obtained in step (i ) and the ratio in a pre-established abacus in a reference sample from a patient having an oligodendroglioma is less than 20%, especially 15%, more particularly 10%, vis-à-vis the ratio in a pre-established abacus. In this method, the intra-sample comparison of the level of expression of two miRNAs is expressed by a ratio (hsa-miRNA xi hsa-miRNA Y), calculated according to the formulas (VI or VII). miRNA X is selected from hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409 or hsa-miR-134, and miRNA Y is selected from all 14 miRNAs defined above. In this method the use of the inverse of the ratios mentioned above retains all its value for the identification of the samples. The difference between this ratio and a pre-established abacus is expressed by a given percentage value, calculated according to formula (VIII): 1Report (hsa-miRNA X / hsa-miRNA Y) - RapportabaquelX1OO / RappOrtabaque • RappOrtabaque, which is in a pre-established abacus, is a ratio (hsa-miRNA X / hsa-miRNA Y) obtained in a reference sample from a patient with glioblastoma or oligodendroglioma. This method using a pre-established abacus avoids the use of healthy samples or tumor reference. Any new sample can be analyzed by assaying only a few miRNAs. For example, columns 3 and 4 of Table 4 give a pre-established chart respectively in the reference sample from a patient with glioblastoma or oligodendroglioma, for each pair of miRNAs. An abacus can also be presented as a two-dimensional or three-dimensional graph. In an abacus in the form of a two-dimensional graph, such as the abacus illustrated in FIGS. 2-6, by way of example, two sets of ratios obtained in the reference glioblastoma tissue give a zone framed by a rectangle in FIG. dotted line; two series of ratios obtained in the reference oligodendroglioma tissue give a zone framed by a rectangle drawn with dashes. It can be deduced that a suspected tissue is a tissue of glioblastoma, when the position fixed by two respectively obtained reports of this suspected tissue is included in the dotted rectangle covering the squares representing the reference glioblastomas. In contrast, a suspected tissue is an oligodendroglioma tissue, when the position fixed by two respectively obtained reports of this suspected tissue enters the rectangle drawn with dashes covering the triangles representing the reference oligodendrogliomas. In an advantageous embodiment, the miRNA pairs used are the following: hsa-miRl27 / hsa-miR409, hsa-miR210 / hsa-miR34b, hsa-let 7f / hsa-miR10a, hsamiR155 / hsa-miR17, hsa-miR155 / hsa-miR374, hsa-let 7a / hrs-miR 409, hsa-let 7d / hsamiR409, hsa-miRl34 / hsa-let 7f, hsa-let 7f / hsa-miR409, hsa-miRl34 / hsa-let 7d, hsamiR151 / hsa-miR155, hsa-miR155 / hsa-miR34b, hsa-miR15b / hsa-miR134, hsa-miR1334 / hsamiR20a, hsa-miR210 / hsa-let 7f, hsa-miR20 / hsa-miR15. In a particular embodiment of the invention, the biological sample from a patient suspected of having a glioma is brain tissue obtained by excision, or by biopsy. The method comprises: (i) measuring the expression level of the miRNAs of a pair selected from hsamiR127 / hsa-miR409, hsa-miR210 / hsa-miR34b, hsa-let 7f / hsa-miR10a, hsa-miR155 / hsa - miRl7, hsa-miRl55 / hsa-miR374, hsa-let 7a / hsa-miR 409, hsa-let 7d / hsa-miR409, hsamiRl 34 / hsa- let 7f, hsa-let 7f / hsa-miR409, hsa-miR134 hrs-miR15 1 / hsa-miRl5, hsa-miR155 / hsa-miR34b, hsa-miR15b / hsa-miR134, hsa-miR134 / hsa-miR20a, hsamiR210 / hsa-let 7f, hsa-miR20 / hsa-miRl55, for a biological tissue originating from a tumor tissue suspected of being a glioblastoma tissue or an oligodendroglioma tissue, (ii) the comparison between: - the aforementioned ratio of the level of expression for a pair of miRNAs and, * the one shown in a pre-established abacus for a reference healthy tissue, a reference glioblastoma tissue, and a reference oligodendroglioma tissue, (iii) the deduction: * that the suspected tissue is a glioblastoma, when the difference between the report obtained in step (i) and the ratio in a pre-established abacus in a reference glioblastoma tissue is less than 20%, especially 15%, more particularly 10%, vis-à-vis the ratio in a pre-established abacus, * or that the suspected tissue is an oligodendroglioma, when the difference between the ratio obtained in step (i) and the ratio in a pre-established abacus in a reference oligodendroglioma tissue is less than 20%, especially 15%, more particularly 10%, the report in a pre-established abacus.
L'invention a particulièrement pour objet une méthode de diagnostic in vitro de gliomes, permettant de préciser si un patient suspecté de présenter un gliome est atteint d'un glioblastome ou d'un oligodendrogliome. Cette méthode comprend : - i) la détermination, selon l'une des revendications 4 à 17, de la présence de gliome dans un patient suspecté de présenter un gliome, - ii) la déduction, selon l'une des revendications 18 à 22, que ledit patient présente un glioblastome ou le patient suspecté présente un oligodendrogliome. Le premier mode de réalisation de cette méthode consiste en des comparaisons des niveaux d'expression des miARNs entre l'échantillon suspecté et les échantillons de référence. Plus précisément, cette méthode comprend: - i) la mesure du niveau d'expression d'au moins un miARN choisi parmi hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa- miR-26b ou hsa-miR-34b, dans un échantillon biologique provenant d'un patient suspecté de présenter un gliome, - ii) la comparaison des niveaux d'expression du susdit miARN dans le susdit échantillon et dans un échantillon sain de référence, - iii) la déduction que le patient présente un gliome, lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant du susdit patient et le niveau d'expression du susdit miARN dans l'échantillon sain de référence sont différents, le niveau d'expression du susdit miARN dans l'échantillon provenant du susdit patient étant 3 fois, notamment 4 fois, plus particulièrement 5 fois, supérieur ou inférieur au niveau d'expression du susdit miARN dans l'échantillon sain de référence, - iv) la mesure du niveau d'expression d'au moins un miARN choisi parmi hsa-miR-155, hsa-miR-210 ou hsa-miR-10a, hsa-miR-409 ou hsa-miR-134, dans ledit échantillon biologique provenant d'un patient présentant un gliome, - v) la comparaison entre : - le niveau d'expression du susdit miARN dans le susdit échantillon et * respectivement le niveau d'expression du susdit miARN dans un échantillon de référence provenant d'un patient présentant un glioblastome, et * respectivement le niveau d'expression du susdit miARN dans un échantillon de référence provenant d'un patient présentant un oligodendrogliome, et - vi) la déduction : - soit que le patient présente un glioblastome, lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant du susdit patient est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un glioblastome, - soit que le patient présente un oligodendrogliome, lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant du susdit patient est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un oligodendrogliome. Dans un mode de réalisation particulier de l'invention, l'échantillon biologique provenant d'un patient suspecté de présenter un gliome est un tissu cérébral obtenu par exérèse, ou par biopsie. Ladite méthode comprend : - (i) la mesure du niveau d'expression d'au moins un miARN choisi parmi hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-3 74, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsamiR-26b ou hsa-miR-34b, - ii) la comparaison des niveaux d'expression du susdit miARN dans le tissu suspecté et dans un tissu sain de référence, - iii) la déduction du caractère tumoral du tissu suspecté, lorsque le niveau d'expression du susdit miARN dans le tissu suspecté et le niveau d'expression du susdit miARN dans le tissu sain de référence sont différents, le niveau d'expression du susdit miARN dans le tissu suspecté étant 3 fois, notamment 4 fois, plus particulièrement 5 fois, supérieur ou inférieur au niveau d'expression du susdit miARN dans le tissu sain de référence, - iv) la mesure du niveau d'expression d'au moins un miARN choisi parmi hsa-miR-155, hsa-miR-210 ou hsa-miR-10a, hsa-miR-409 ou hsa-miR-134, dans ledit tissu biologique déterminé à l'étape précédente comme ayant un caractère tumoral, - v) la comparaison entre : - le niveau d'expression du susdit miARN dans le susdit tissu et * respectivement le niveau d'expression du susdit miARN dans un tissu de glioblastome de référence, et * respectivement le niveau d'expression du susdit miARN dans un tissu d'oligodendrogliome de référence, et - vi) la déduction : - soit que le susdit tissu est un glioblastome, lorsque le niveau d'expression du susdit miARN dans le tissu suspecté est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans le tissu de glioblastome de référence, - soit que le susdit tissu est un oligodendrogliome, lorsque le niveau d'expression du susdit miARN dans le tissu suspecté est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans le tissu d'oligodendrogliome de référence. The invention particularly relates to a method for in vitro diagnosis of glioma, to clarify whether a patient suspected of having a glioma is affected by a glioblastoma or an oligodendroglioma. This method comprises: - i) the determination, according to one of claims 4 to 17, of the presence of glioma in a patient suspected of having a glioma, - ii) the deduction, according to one of claims 18 to 22, said patient has a glioblastoma or the suspected patient has an oligodendroglioma. The first embodiment of this method consists of comparisons of miRNA expression levels between the suspected sample and the reference samples. More specifically, this method comprises: i) measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa -MR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa mR-151, hsa- miR-26b or hsa-miR-34b, in a biological sample from a patient suspected of having a glioma, ii) comparing the levels of expression of the above miRNA in the above sample and in a reference healthy sample, - iii) the deduction that the patient has a glioma, when the level of expression of the above miRNA in the sample from the above patient and the level of expression of the above miRNA in the healthy sample are different, the level of expression of the above-mentioned miRNA in the sample from the above-mentioned patient being 3 times, in particular 4 times, more particularly 5 times, higher or lower than the level of expression of the said miRNA in the reference healthy sample; iv) measuring the level of expression of at least one miRNA selected from hsa-miR-155, hsa-miR-210 or hsa-miR-10a, hsa-miRN; 409 or hsa-miR-134, in said biological sample from a patient presenting with a glioma; v) the comparison between: the level of expression of the above miRNA in the above sample and the level of expression of the said miRNA in a reference sample from a patient with glioblastoma, and * respectively the level of expression of the above miRNA in a reference sample from a patient having an oligodendroglioma, and - vi) the deduction: - either that the patient has a glioblastoma, when the level of expression of the above miRNA in the sample from the above patient is equal, within the limit of 20% more or 20% less, to the level of expression of the above miRNA in the reference sample from a pre-patient feeling glioblastoma, or that the patient has an oligodendroglioma, when the level of expression of the above miRNA in the sample from the above patient is equal, within the limit of 20% more or 20% less, at the level of expression of the above miRNA in the reference sample from a patient having an oligodendroglioma. In a particular embodiment of the invention, the biological sample from a patient suspected of having a glioma is brain tissue obtained by excision, or by biopsy. The method comprises: - (i) measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR -20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-3 74, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa- miR-151, hsamiR-26b or hsa-miR-34b, - ii) comparison of the levels of expression of the above miRNA in the suspected tissue and in a reference healthy tissue, - iii) deduction of the tumor characteristic of the suspected tissue when the level of expression of the above miRNA in the suspected tissue and the level of expression of the above miRNA in the reference healthy tissue are different, the level of expression of the above miRNA in the suspected tissue being 3 times, especially 4 time, more particularly 5 times, greater or less than the level of expression of the above miRNA in the reference healthy tissue, - iv) measuring the level of expression of at least one miRNA selected from hsa-miR-155, hsa -miR-210 or hsa-miR-10a, hsa-mi R-409 or hsa-miR-134, in said biological tissue determined in the previous step to have a tumor character, - v) the comparison between: - the level of expression of the above miRNA in the aforesaid tissue and * respectively the level of expression of the above miRNA in a reference glioblastoma tissue, and * respectively the level of expression of the above miRNA in a reference oligodendroglioma tissue, and - vi) the deduction: - either that the aforesaid tissue is a glioblastoma, when the expression level of the above-mentioned miRNA in the suspected tissue is equal, within the limit of 20% plus or minus 20%, to the level of expression of the above-mentioned miRNA in the reference glioblastoma tissue, - either that the above-mentioned tissue is an oligodendroglioma, when the level of expression of the above-mentioned miRNA in the suspected tissue is equal, within a limit of 20% more or 20% less, to the level of expression of the above-mentioned miRNA in the tissue of the reference oligodendroglioma.
Dans un mode avantageux, cette méthode permet de déterminer directement si un glioblastome ou un oligodendrogliome est présent dans un patient suspecté d'être atteint d'un gliome. Il n'est plus nécessaire d'effectuer une première étape relative à la détermination de la présence de gliomes dans le susdit patient. La réalisation de cette méthode fait appel à 5 miARNs spécifiques repérés dans l'invention, à savoir hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409, et hsa-miR-134, dont les niveaux d'expression sont à la fois bien différents entre les échantillons provenant des patients présentant un gliome et les échantillons provenant d'une personne saine, et systématiquement plus élevés dans les échantillons provenant des patients présentant un glioblastome par rapport à ceux provenant des patients présentant un oligodendrogliome. Cette méthode est réalisée selon les étapes suivantes : (i) la mesure du niveau d'expression d'au moins un miARNs choisi parmi hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409 ou hsa-miR-134, dans un échantillon biologique provenant d'un patient suspecté de présenter un gliome, (ii) la comparaison entre le niveau d'expression du susdit miARN dans le susdit échantillon et * respectivement le niveau d'expression du susdit miARN dans un échantillon sain de référence, et * respectivement le niveau d'expression du susdit miARN dans un échantillon de référence provenant d'un patient présentant un glioblastome, et * respectivement le niveau d'expression du susdit miARN dans un échantillon de référence provenant d'un patient présentant un oligodendrogliome, (iii) la déduction : * soit que le patient ne présente pas un gliome, lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans l'échantillon sain de référence, * soit que le patient présente un glioblastome, - lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un glioblastome, et - lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome est au moins 3 fois supérieur au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un oligodendrogliome, * soit que le patient présente un oligodendrogliome, - lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un oligodendrogliome, et - lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome est au moins 3 fois inférieur au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un glioblastome. In an advantageous mode, this method makes it possible to determine directly whether a glioblastoma or an oligodendroglioma is present in a patient suspected of having a glioma. It is no longer necessary to perform a first step relating to the determination of the presence of gliomas in the aforesaid patient. The realization of this method makes use of 5 specific miRNAs identified in the invention, namely hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409, and hsa-miR-134, whose expression levels are significantly different between samples from patients with glioma and samples from a healthy person, and consistently higher in samples from patients with glioblastoma compared to those from patients with oligodendroglioma. This method is carried out according to the following steps: (i) measuring the level of expression of at least one miRNAs chosen from hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409 or hsa-miR-134, in a biological sample from a patient suspected of having a glioma, (ii) a comparison between the level of expression of the above-mentioned miRNA in the above sample and * the level of expression of the aforesaid miRNA in a reference healthy sample, and * respectively the level of expression of the above miRNA in a reference sample from a patient with a glioblastoma, and * respectively the level of expression of the above miRNA in a reference sample from of a patient presenting with an oligodendroglioma, (iii) the deduction: * that the patient does not present a glioma, when the level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioma is equal , in the limi 20% more or 20% less, at the level of expression of the above miRNA in the reference healthy sample, * either the patient has a glioblastoma, - when the level of expression of the above miRNA in the sample from a patient suspected of presenting with glioma is equal, within 20% plus or minus 20%, to the level of expression of the above-mentioned miRNA in the reference sample from a patient with glioblastoma and when the level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioma is at least 3 times greater than the level of expression of the above-mentioned miRNA in the reference sample from a patient presenting with an oligodendroglioma, * that the patient presents an oligodendroglioma, - when the level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioma is equal, within the limit of 20% more or 20% less s, at the level of expression of the above miRNA in the reference sample from a patient with an oligodendroglioma, and - when the level of expression of the above miRNA in the sample from a patient suspected of having a glioma is at least 3 times lower than the level of expression of the above miRNA in the reference sample from a patient with glioblastoma.
Dans un mode de réalisation particulier de l'invention, l'échantillon biologique provenant d'un patient suspecté de présenter un gliome est un tissu cérébral obtenu par exérèse, ou par biopsie. Ladite méthode comprend : (i) la mesure du niveau d'expression d'au moins un miARNs choisi parmi hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409 ou hsa-miR-134, dans un tissu biologique provenant d'un tissu suspecté de présenter un caractère tumoral, (ii) la comparaison entre le niveau d'expression du susdit miARN dans le susdit tissu suspecté et * respectivement le niveau d'expression du susdit miARN dans un tissu sain de référence, et * respectivement le niveau d'expression du susdit miARN dans un tissu de glioblastome de référence, et * respectivement le niveau d'expression du susdit miARN dans un tissu d'oligodendrogliome de référence, (iii) la déduction : * soit que le susdit tissu est un tissu sain, lorsque le niveau d'expression du susdit miARN dans le tissu suspecté est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans le tissu sain de référence, * soit que le susdit tissu est un glioblastome, - lorsque le niveau d'expression du susdit miARN dans le tissu suspecté est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans le tissu de glioblastome de référence, et - lorsque le niveau d'expression du susdit miARN dans le tissu suspecté est au moins 3 fois supérieur au niveau d'expression du susdit miARN dans le tissu d'oligodendrogliome de référence, * soit que le susdit tissu est un oligodendrogliome, - lorsque le niveau d'expression du susdit miARN dans le tissu suspecté est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans le tissu d'oligodendrogliome de référence, et - lorsque le niveau d'expression du susdit miARN dans le tissu suspecté est au moins 3 fois inférieur au niveau d'expression du susdit miARN dans le tissu de glioblastome de référence. In a particular embodiment of the invention, the biological sample from a patient suspected of having a glioma is brain tissue obtained by excision, or by biopsy. The method comprises: (i) measuring the level of expression of at least one miRNAs selected from hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409 or hsa-miRNs; 134, in a biological tissue from a tissue suspected of having a tumor character, (ii) the comparison between the level of expression of the above-mentioned miRNA in the above-mentioned suspected tissue and * the level of expression of the above-mentioned miRNA in a reference healthy tissue, and * respectively the level of expression of the above miRNA in a reference glioblastoma tissue, and * respectively the level of expression of the above miRNA in a reference oligodendroglioma tissue, (iii) the deduction: * that the aforesaid tissue is a healthy tissue, when the level of expression of the above miRNA in the suspected tissue is equal, within the limit of 20% more or 20% less, to the level of expression of the above miRNA in the reference healthy tissue, * that the above-mentioned tissue is a glioblastoma, - when the level of expression of the above miRNA in the suspected tissue is equal, within 20% plus or minus 20%, to the level of expression of the above miRNA in the reference glioblastoma tissue, and - when the level of expression of the above-mentioned miRNA in the suspected tissue is at least 3 times greater than the level of expression of the above miRNA in the reference oligodendroglioma tissue, * that the above-mentioned tissue is an oligodendroglioma, - when the level of expression of the aforesaid miRNA in the suspected tissue is equal, within 20% plus or minus 20%, to the level of expression of the above miRNA in the reference oligodendroglioma tissue, and - when the level of expression of the above miRNA in the suspected tissue is at least 3 times lower than the level of expression of the above-mentioned miRNA in the reference glioblastoma tissue.
Avantageusement, la détermination de la nature précise d'une tumeur gliale suspectée d'être présente chez un patient est réalisée selon les étapes suivantes : (i) la mesure du niveau d'expression d'au moins un miARNs choisi parmi hsamiR-409 ou hsa-miR-134, dans un échantillon biologique provenant d'un patient suspecté de présenter un gliome, (ii) la comparaison entre le niveau d'expression du susdit miARN dans le susdit échantillon et * respectivement le niveau d'expression du susdit miARN dans un échantillon sain de référence, et * respectivement le niveau d'expression du susdit miARN dans un échantillon de référence provenant d'un patient présentant un glioblastome, et * respectivement le niveau d'expression du susdit miARN dans un échantillon de référence provenant d'un patient présentant un oligodendrogliome, (iii) la déduction : * soit que le patient ne présente pas un gliome, lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant du susdit patient est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans l'échantillon sain de référence, * soit que le patient présente un glioblastome, - lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un glioblastome, et - lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome est au moins 3 fois supérieur au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un oligodendrogliome, * soit que le patient présente un oligodendrogliome, - lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome est égal, dans la limite de 20% en plus ou 20% en moins, au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un oligodendrogliome, et - lorsque le niveau d'expression du susdit miARN dans l'échantillon provenant d'un patient suspecté de présenter un gliome est au moins 3 fois inférieur au niveau d'expression du susdit miARN dans l'échantillon de référence provenant d'un patient présentant un glioblastome. Advantageously, the determination of the precise nature of a glial tumor suspected of being present in a patient is carried out according to the following steps: (i) measuring the level of expression of at least one miRNAs chosen from hsamiR-409 or hsa-miR-134, in a biological sample from a patient suspected of having a glioma, (ii) the comparison between the level of expression of the above-mentioned miRNA in the above sample and * the level of expression of the said miRNA respectively in a reference healthy sample, and * respectively the level of expression of the above miRNA in a reference sample from a patient with glioblastoma, and * respectively the level of expression of the above miRNA in a reference sample from a patient presenting with an oligodendroglioma, (iii) the deduction: * that the patient does not present a glioma, when the level of expression of the above miRNA in the sample from the the said patient is equal, within a limit of 20% more or 20% less, to the level of expression of the above miRNA in the reference healthy sample, * that the patient has a glioblastoma, - when the level of Expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioma is equal, within the limit of 20% plus or minus 20%, to the level of expression of the above-mentioned miRNA in the reference sample from of a patient with glioblastoma, and - when the level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioma is at least 3 times greater than the level of expression of the above-mentioned miRNA in the reference sample from a patient presenting with an oligodendroglioma, * that the patient presents an oligodendroglioma, - when the level of expression of the above miRNA in the sample from a patient suspected of having a glioma is equal, in the a limit of 20% plus or minus 20%, at the level of expression of the above miRNA in the reference sample from a patient with an oligodendroglioma, and - when the level of expression of the above miRNA in the sample from a patient suspected of having a glioma is at least 3-fold lower than the level of expression of the above-mentioned miRNA in the reference sample from a patient with glioblastoma.
Le deuxième mode de réalisation de la méthode de diagnostic in vitro de gliomes, permettant de déterminer qu'un patient présente un gliome et de déterminer la nature précise du gliome, consiste en des comparaisons de niveaux d'expression des miARNs intraéchantillons. Cette méthode comprend (i) la mesure d'au moins un miARN choisi parmi hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsamiR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 ou hsa-miR-10a, dans un échantillon biologique provenant d'un patient suspecté de présenter un gliome, (ii) la comparaison entre le niveau d'expression d'au moins un premier susdit miARN dans l'échantillon biologique du patient suspecté de présenter un gliome et le niveau d'expression d'au moins un deuxième susdit miARN dans l'échantillon biologique du patient suspecté, les susdits premier miARN et deuxième miARN formant un couple de miARNs, et (iii) la déduction que le patient présente un gliome, lorsque le rapport entre le niveau d'expression du susdit premier miARN et le niveau d'expression du susdit deuxième miARN est 2 fois, notamment 3 fois, plus particulièrement 4 fois, supérieur ou inférieur à celui d'un abaque préétabli dans un échantillon sain de référence, (iv) la mesure du rapport du niveau d'expression d'au moins un couple de miARNs constitué par : * un miARN choisi parmi hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409 ou hsa-miR-134, et * un miARN choisi parmi hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsamiR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b pour un échantillon provenant du susdit patient, ladite mesure permettant d'établir le rapport du niveau d'expression pour un susdit couple de miARNs, (v) la comparaison entre : - le susdit rapport du niveau d'expression pour un couple de miARNs et, - le rapport dans un abaque préétabli dans un échantillon sain de référence, l'échantillon de référence provenant d'un patient présentant un glioblastome, et l'échantillon de référence provenant d'un patient présentant un oligodendrogliome, (vi) la déduction : * soit que le patient présente un glioblastome, lorsque la différence entre le rapport obtenu dans l'étape (iv) et le rapport dans un abaque préétabli dans un échantillon de référence provenant d'un patient présentant un glioblastome est inférieure à 20%, notamment 15%, plus particulièrement 10%, vis-à-vis du rapport dans un abaque préétabli dans un échantillon de référence provenant d'un patient présentant un glioblastome, * soit que le patient présente un oligodendrogliome, lorsque la différence entre le rapport obtenu dans l'étape (iv) et le rapport dans un abaque préétabli dans un échantillon de référence provenant d'un patient présentant un oligodendrogliome est inférieure à 20%, notamment 15%, plus particulièrement 10%, vis-à-vis du rapport dans un abaque préétabli dans un échantillon de référence provenant d'un patient présentant un oligodendrogliome. The second embodiment of the in vitro diagnostic method of glioma, to determine that a patient has a glioma and to determine the precise nature of the glioma, consists of comparisons of intra-sample miRNA expression levels. This method comprises (i) measuring at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsamiR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a, in a biological sample from a patient suspected of having a glioma, (ii) a comparison of the level of expression of at least a first aforesaid miRNA in the biological sample of the patient suspected of having a glioma and the level of expression of at least a second aforesaid miRNA in the biological sample of the suspected patient, the aforementioned first miRNA and second miRNA forming a pair of miRNAs, and (iii) the deduction that the patient has a glioma, when the ratio between the level of expression of the above-mentioned first miRNA and the level of expression of the aforementioned second miRNA is 2 times, in particular 3 times, more particularly 4 times, sup less than that of a pre-established abacus in a reference healthy sample, (iv) measuring the ratio of the level of expression of at least one pair of miRNAs consisting of: * a miRNA selected from hsa-miR-155 , hsa-miR-210, hsa-miR-10a, hsa-miR-409 or hsa-miR-134, and * a miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa mR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsamiR-339, hsa-miR-127, hsa-miR-151, hsa-miR -26b, hsa-miR-34b for a sample from the aforesaid patient, said measurement making it possible to establish the ratio of the level of expression for a said pair of miRNAs, (v) the comparison between: - the aforesaid ratio of the level of expression for a pair of miRNAs and, - the ratio in a pre-established abacus in a reference healthy sample, the reference sample from a patient with glioblastoma, and the reference sample from a patient with a oligodendroglioma, (vi) the deduction: * that the patient has a glioblastoma, when the difference between the ratio obtained in step (iv) and the ratio in a pre-established abacus in a reference sample from a patient with a glioblastoma is less than 20% , especially 15%, more particularly 10%, vis-à-vis the ratio in a pre-established abacus in a reference sample from a patient with a glioblastoma, * that the patient has an oligodendroglioma, when the difference between the report obtained in step (iv) and the ratio in a pre-established abacus in a reference sample from a patient having an oligodendroglioma is less than 20%, especially 15%, more particularly 10%, with respect to the ratio in a pre-established abacus in a reference sample from a patient presenting with an oligodendroglioma.
Dans un mode de réalisation particulier de l'invention, l'échantillon biologique provenant d'un patient suspecté de présenter un gliome est un tissu cérébral obtenu par exérèse, ou par biopsie. Ladite méthode comprend : (i) la mesure d'au moins un miARN choisi parmi hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsamiR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 ou hsa-miR-10a, dans un tissu biologique provenant d'un tissu suspecté d'avoir un caractère tumoral, (ii) la comparaison entre le niveau d'expression d'au moins un premier susdit miARN dans le tissu suspecté et le niveau d'expression d'au moins un deuxième susdit miARN dans le tissu suspecté, les susdits premier miARN et deuxième miARN formant un couple de miARNs, et (iii) la déduction du caractère tumoral du tissu suspecté, lorsque le rapport entre le niveau d'expression du susdit premier miARN et le niveau d'expression du susdit deuxième miARN est 2 fois, notamment 3 fois, plus particulièrement 4 fois, supérieur ou inférieur à celui d'un abaque préétabli dans un tissu sain de référence, (iv) la mesure du rapport du niveau d'expression d'au moins un couple de miARNs constitué par : * un miARN choisi parmi hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409 ou hsa-miR-134, et * un miARN choisi parmi hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsamiR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b pour un tissu biologique provenant d'un tissu tumoral suspecté d'être un tissu de glioblastome ou un tissu d'oligodendrogliome, ladite mesure permettant d'établir le rapport du niveau d'expression pour un susdit couple de miARNs, (v) la comparaison entre : * le susdit rapport du niveau d'expression pour un couple de miARNs et, * le rapport dans un abaque préétabli dans un tissu sain de référence, un tissu glioblastome de référence, et un tissu oligodendrogliome de référence, (vi) la déduction : * soit que le tissu suspecté est un glioblastome, lorsque la différence entre le rapport obtenu dans l'étape (iv) et le rapport dans un abaque préétabli dans un tissu de glioblastome de référence est inférieure à 20%, notamment 15%, plus particulièrement 10%, vis-à-vis du rapport dans un abaque préétabli dans un tissu de glioblastome de référence. * soit que le tissu suspecté est un oligodendrogliome, lorsque la différence entre le rapport obtenu dans l'étape (iv) et le rapport dans un abaque préétabli dans un tissu d'oligodendrogliome de référence est inférieure à 20%, notamment 15%, plus particulièrement 10%, vis-à-vis du rapport dans un abaque préétabli dans un tissu d'oligodendrogliome de référence. In a particular embodiment of the invention, the biological sample from a patient suspected of having a glioma is brain tissue obtained by excision, or by biopsy. The method comprises: (i) measuring at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a , hsa-let 7f, hsa-let 7d, hsamiR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b , hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a, in a biological tissue from a tissue suspected of having a tumor character, (ii) the comparison between the level expressing at least a first of the above-mentioned miRNAs in the suspected tissue and the level of expression of at least a second aforesaid miRNA in the suspected tissue, the aforementioned first miRNAs and miRNAs forming a pair of miRNAs, and (iii ) the deduction of the tumor characteristic of the suspected tissue, when the ratio between the level of expression of the above-mentioned first miRNA and the level of expression of the aforementioned second miRNA is 2 times, in particular 3 times, more particularly 4 times, greater or less than that of a pre-established abacus in a healthy tissue reference, (iv) measuring the ratio of the expression level of at least one pair of miRNAs consisting of: * a miRNA selected from hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa -mR-409 or hsa-miR-134, and * a miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a , hsa-let 7f, hsa-let 7d, hsa-miR-374, hsamiR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b for a biological tissue derived from a tumor tissue suspected to be a glioblastoma tissue or oligodendroglioma tissue, said measurement making it possible to establish the ratio of the level of expression for a said pair of miRNAs, (v) the comparison between: * the aforesaid report the level of expression for a pair of miRNAs and, * the ratio in a pre-established abacus in a reference healthy tissue, a reference glioblastoma tissue, and a reference oligodendroglioma tissue, (vi) the deduction: * that the tissue suspected is a glioblastoma, when the difference between the ratio obtained in step (iv) and the ratio in a pre-established abacus in a reference glioblastoma tissue is less than 20%, especially 15%, more particularly 10%, vis-à-vis the ratio in a pre-established chart in a reference glioblastoma tissue. or that the suspected tissue is an oligodendroglioma, when the difference between the ratio obtained in step (iv) and the ratio in a pre-established abacus in a reference oligodendroglioma tissue is less than 20%, especially 15%, more particularly 10%, vis-à-vis the ratio in a pre-established abacus in a reference oligodendrogliome tissue.
Dans un mode avantageux, cette méthode permet de déterminer directement la nature précise d'un tissu suspecté de présenter un caractère tumoral, sans besoin d'effectuer une étape de la détermination de la présence de gliomes dans un tissu suspecté. Cette méthode est réalisée selon les étapes suivantes : (i) la mesure du rapport du niveau d'expression d'au moins un couple de miARNs miR409, choisi parmi hsa-let 7a/hsa-miR 409, hsa-let 7d/hsahsa-miRl34/hsa-let 7f, hsa-let 7f/hsa-miR409, hsa- miR134/hsa-let 7d, hsa-miR151/hsa-miRl55, hsa-miRl55/hsamiR34b, hsa-miR15b/hsa-miRl34, hsa-miRl34/hsa-miR20a, hsamiR2l0/hsa-let 7f, (tableau 7) dans un échantillon biologique provenant d'un patient suspecté de présenter un gliome, (ii) la comparaison entre : , le susdit rapport du niveau d'expression pour un couple de miARNs, et - le rapport dans un abaque préétabli respectivement dans un échantillon sain de référence, l'échantillon de référence provenant d'un patient présentant un glioblastome, et l'échantillon de référence provenant d'un patient présentant un oligodendrogliome, (iii) la déduction : * soit que le patient ne présente pas un gliome, lorsque la différence entre le rapport obtenu dans l'étape (i) et le rapport dans un abaque préétabli dans un échantillon sain de référence est inférieure à 20%, notamment 15%, plus particulièrement 10%, vis-à-vis du rapport dans un abaque préétabli dans un échantillon sain de référence. * soit que le patient présente un glioblastome, lorsque la différence entre le rapport obtenu dans l'étape (i) et le rapport dans un abaque préétabli dans un échantillon de référence provenant d'un patient présentant un glioblastome est inférieure à 20%, notamment 15%, plus particulièrement 10%, vis-à-vis du rapport dans un abaque préétabli dans un échantillon de référence provenant d'un patient présentant un glioblastome, * soit que le patient présente un oligodendrogliome, lorsque la différence entre le rapport obtenu dans l'étape (i) est le rapport dans un abaque préétabli dans un échantillon de référence provenant d'un patient présentant un oligodendrogliome est inférieure à 20%, notamment 15%, plus particulièrement 10%, vis-à-vis du rapport dans un abaque préétabli dans un échantillon de référence provenant d'un patient présentant un oligodendrogliome. In an advantageous mode, this method makes it possible to directly determine the precise nature of a tissue suspected of having a tumor character, without the need to perform a step of determining the presence of gliomas in a suspected tissue. This method is carried out according to the following steps: (i) the measurement of the ratio of the level of expression of at least one pair of miRNAs miR409, chosen from hsa-let 7a / hsa-miR 409, hsa-let 7d / hsahsa- miRl34 / hsa-let 7f, hsa-let 7f / hsa-miR409, hsa- miR134 / hsa-let 7d, hsa-miR151 / hsa-miR155, hsa-miR155 / hsamiR34b, hsa-miR15b / hsa-miR1334, hsa-miR13 / hsa-miR20a, hsamiR210 / hsa-let 7f, (Table 7) in a biological sample from a patient suspected of presenting a glioma, (ii) the comparison between:, the above-mentioned level of expression ratio for a couple of miRNAs, and - the ratio in a pre-established abacus respectively in a reference healthy sample, the reference sample from a patient with glioblastoma, and the reference sample from a patient presenting with an oligodendroglioma, (iii ) the deduction: * that the patient does not present a glioma, when the difference between the ratio obtained in step (i) and the report in a pre-established abacus in a reference healthy sample is less than 20%, in particular 15%, more particularly 10%, with respect to the ratio in a pre-established abacus in a reference healthy sample. * that the patient has a glioblastoma, when the difference between the ratio obtained in step (i) and the ratio in a predefined abacus in a reference sample from a patient with a glioblastoma is less than 20%, especially 15%, more particularly 10%, with respect to the ratio in a pre-established abacus in a reference sample from a patient presenting with a glioblastoma, * that the patient presents an oligodendroglioma, when the difference between the ratio obtained in step (i) is the ratio in a pre-established abacus in a reference sample from a patient having an oligodendroglioma is less than 20%, especially 15%, more particularly 10%, vis-à-vis the ratio in a pre-established abacus in a reference sample from a patient presenting with an oligodendroglioma.
Dans un mode de réalisaiton particulier de l'invention, l'échantillon biologique provenant d'un patient suspecté de présenter un gliome est un tissu cérébral obtenu par exérèse, ou par biopsie. Ladite méthode comprend : (i) la mesure du rapport du niveau d'expression d'au moins un couple de miARNs choisi parmi hsa-let 7a/hsa-miR 409, hsa-let 7d/hsa-miR409, hsa-miRl34/hsa-let 7f, hsa-let 7f/hsa-miR409, hsa-miR 134/hsa-let 7d, hsa-miR l51/hsa-miRl55, hsa-miR155/hsa-miR34b, hsa-miRlSb/hsa-miRl34, hsa-miRl34/hsa-miR20a, hsa-miR2l0/hsa-let 7f, (tableau 7) dans un tissu biologique provenant d'un tissu suspecté d'avoir un caractère tumoral, (ii) la comparaison entre : - le susdit rapport du niveau d'expression pour un couple de miARNs, et - le rapport dans un abaque préétabli respectivement dans un tissu sain de référence, un tissu glioblastome de référence, et un tissu oligodendrogliome de référence (iii) la déduction : * soit que le susdit tissu est un tissu sain, lorsque la différence entre le rapport obtenu dans l'étape (i) et le rapport dans un abaque préétabli dans un tissu sain de référence est inférieure à 20%, notamment 15%, plus particulièrement 10%, vis-à-vis du rapport dans un abaque préétabli dans un tissu sain de référence. * soit que le susdit tissu est un tissu de glioblastome, lorsque la différence entre le rapport obtenu dans l'étape (i) et le rapport dans un abaque préétabli dans un tissu de glioblastome de référence est inférieure à 20%, notamment 15%, plus particulièrement 10%, vis-à-vis du rapport dans un abaque préétabli dans un tissu glioblastome de référence. * soit que le susdit tissu est un tissu d'oligodendrogliome, lorsque la différence entre le rapport obtenu dans l'étape (i) est le rapport dans un abaque préétabli dans un tissu d'oligodendrogliome de référence est inférieure à 20%, notamment 15%, plus particulièrement 10%, vis-à-vis du rapport dans un abaque préétabli dans un tissu d'oligodendrogliome de référence. In a particular embodiment of the invention, the biological sample from a patient suspected of having a glioma is brain tissue obtained by excision, or biopsy. The method comprises: (i) measuring the ratio of the level of expression of at least one pair of miRNAs selected from hsa-let 7a / hsa-miR 409, hsa-let 7d / hsa-miR409, hsa-miRl34 / hsa -let 7f, hsa-let 7f / hsa-miR409, hsa-miR 134 / hsa-let 7d, hsa-miR151 / hsa-miR155, hsa-miR155 / hsa-miR34b, hsa-miRlSb / hsa-miRl34, hs-miR409 miRl34 / hsa-miR20a, hsa-miR2l0 / hsa-let 7f, (Table 7) in a biological tissue from a tissue suspected of having a tumor character, (ii) the comparison between: - the aforesaid ratio of the level of expression for a pair of miRNAs, and - the ratio in a pre-established abacus respectively in a reference healthy tissue, a reference glioblastoma tissue, and a reference oligodendroglioma tissue (iii) the deduction: * that the aforesaid tissue is a healthy tissue, when the difference between the ratio obtained in step (i) and the ratio in a pre-established abacus in a reference healthy tissue is less than 20%, in particular 15%, more particularly 10%, v in relation to the ratio in a pre-established abacus in a reference healthy tissue. that the above-mentioned tissue is a glioblastoma tissue, when the difference between the ratio obtained in step (i) and the ratio in a pre-established abacus in a reference glioblastoma tissue is less than 20%, especially 15%, more particularly 10%, vis-à-vis the ratio in a pre-established abacus in a reference glioblastoma tissue. or that the aforesaid tissue is an oligodendroglioma tissue, when the difference between the ratio obtained in step (i) is the ratio in a pre-established abacus in a reference oligodendroglioma tissue is less than 20%, especially %, more particularly 10%, vis-à-vis the ratio in a pre-established abacus in a reference oligodendrogliome tissue.
Dans un mode de réalisation selon l'invention, le niveau d'expression des miARNs est dosé par PCR en temps réel. Dans un autre mode de réalisation, le niveau d'expression des miARNs est dosé par hybridation sur « puces à ADN » ou par séquençage à haut débit, ou par Northern blot. Dans un mode de réalisation selon l'invention, un échantillon biologique est choisi parmi un échantillon tissulaire, notamment un tissu cérébral obtenu par exérèse, ou un échantillon de liquide biologique, notamment un échantillon sanguin. L'invention concerne également une trousse de diagnostic in vitro de gliomes, cette trousse comprenant les moyens de dosage d'au moins un miARN choisi parmi hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsamiR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 ou hsa-miR-10a. Dans un mode particulier selon l'invention, cette trousse comprend les moyens de dosage d'au moins un miARN choisi parmi hsa-miR-155, hsa-miR-210 ou hsa-miR-10a, hsamiR-134 ou hsa-miR-409. Cette trousse de diagnostic in vitro de gliomes peut comprendre à titre d'exemple, la Reverse Transcriptase, la DNA polymérase, telle que Hot start, le tampon, un inhibiteur de RNase, des dNTPs, les oligonucléotides amorces d'amplification, les sondes spécifiques, telles que la sonde de Taqman@, ou les marqueurs aspécifiques comme le SYBR Green. L'invention a également pour objet une méthode d'évaluation d'efficacité d'une méthode de traitement de gliomes. Cette méthode comprend : - la mesure du niveau d'expression d'au moins un miARN choisi parmi hsamiR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa- let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsamiR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 ou hsa-miR-l0a dans un échantillon biologique provenant d'un patient soumis à un traitement du gliome, et éventuellement - la comparaison entre - le niveau d'expression du susdit miARN dans l'échantillon biologique provenant dudit patient, et - respectivement le niveau d'expression du susdit miARN un échantillon de référence provenant d'un patient présentant un glioblastome, - et respectivement le niveau d'expression du susdit miARN dans un échantillon de référence provenant d'un patient présentant un oligodendrogliome. Dans un mode de réalisation avantageux, cette méthode permet d'évaluer l'efficacité d'une méthode de traitement de gliomes, par exemple, une intervention chirurgicale, une chimiothérapie ou une radiothérapie. In one embodiment of the invention, the expression level of the miRNAs is assayed by real-time PCR. In another embodiment, the expression level of the miRNAs is assayed by hybridization on "DNA chips" or by high throughput sequencing, or Northern blot. In one embodiment according to the invention, a biological sample is selected from a tissue sample, in particular brain tissue obtained by excision, or a sample of biological fluid, in particular a blood sample. The invention also relates to an in vitro diagnostic kit for glioma, this kit comprising the means for assaying at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR -17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsamiR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127 , hsa-miR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a. In a particular embodiment according to the invention, this kit comprises the means for assaying at least one miRNA selected from hsa-miR-155, hsa-miR-210 or hsa-miR-10a, hsamiR-134 or hsa-miRN. 409. This in vitro diagnostic glioma kit may include, by way of example, reverse transcriptase, DNA polymerase, such as Hot start, buffer, an RNase inhibitor, dNTPs, oligonucleotides amplification primers, specific probes such as the Taqman @ probe, or aspecific markers such as SYBR Green. The invention also relates to a method for evaluating the effectiveness of a glioma treatment method. This method comprises: measuring the level of expression of at least one miRNA selected from hsamiR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa- let7a, hsa- let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsamiR-127, hsa-miR-151, hsa-miR- 26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a in a biological sample from a patient undergoing glioma treatment, and possibly - the comparison between - the level expressing said miRNA in the biological sample from said patient, and - respectively, the level of expression of said miRNA a reference sample from a patient presenting with a glioblastoma, and respectively the level of expression of said miRNA. in a reference sample from a patient with an oligodendroglioma. In one advantageous embodiment, this method makes it possible to evaluate the effectiveness of a method of treating glioma, for example, a surgical procedure, a chemotherapy or a radiotherapy.
La présente invention est illustrée par les figures et les exemples suivants. Figure 1 : La figurel illustre les catégories de microARN surexprimés dans les gliomes par rapport au tissu sain (points losanges) ; les microARN sous-exprimés dans les gliomes par rapport au tissu sain (carrés) ; et les microARN surexprimés dans les glioblastomes (GBM) par rapport aux oligodendrogliomes (ODG) (triangles). L'axe des ordonnées représente les valeurs des ratios des quantités de chaque miARN dans les oligodendrogliomes par rapport à la quantité de ces miARN dans le tissu sain (ODG/N). L'axe des abscisses représente les valeurs des ratios des quantités de chaque miARN dans les glioblastomes par rapport à la quantité de ces miARN dans le tissu sain (GBM/N). Figure 2 : La figure 2 illustre un clustering permettant de distinguer GBM, ODG, tissus sains sur la base des 12 ratios présents respectivement dans les tableaux 4, 5, 6, 7. Les valeurs des ratios pour 4 échantillons de tissu sain, 3 oligodendrogliomes et 4 glioblastomes permettent de construire un tri des tissus en trois groupes bien distincts et cohérents en termed'identité tissulaire (dendrogramme en haut du cluster-logiciel MeV-Multiexperiment viewer v4.4-TM4 software suite MeV team- l s_r 1 _T1 M4,00rg). Figure 3 : La figure 3 illustre l'identification de tissus normaux (points losanges dans le rectangle tracé en tiret-pointés), glioblastomes (points carrés dans le rectangle en tracé pointillé) et des oligodendrogliomes (points triangles dans le rectangle tracé avec des tirets), par dosage de 4 miARNs (let 7a, miR409, miRl55 et miR34b), et sur la base des valeurs des ratios let7a/miR409 et miR155/miR34b. Figure 4 : La figure 4 illustre l'identification de tissus normaux (points losanges dans le rectangle tracé en tiret-pointés), des glioblastomes (points carrés dans le rectangle en tracé pointillé) et des oligodendrogliomes (points triangles dans le rectangle tracé avec des tirets), par dosage de 3 miARNs (miRl55, miR34b et miRl5l), et sur la base des valeurs des ratios miRl55/miR34b et miRl5l/miRl55. Figure 5 : La figure 5 illustre l'identification de tissus normaux (points losanges dans le rectangle tracé en tiret-pointés), des glioblastomes (points carrés dans le rectangle en tracé pointillé) et des oligodendrogliomes (points triangles dans le rectangle tracé avec des tirets), par dosage de 4 miARNs (let 7d, miR409, miRl34 et miR20), et sur la base des valeurs des ratios let7d/miR409 et miR134/miR20. Figure 6 : La figure 6 illustre l'identification de tissus normaux (points losanges dans le rectangle tracé en tiret-pointés), glioblastomes (points carrés dans le rectangle en tracé pointillé) et des oligodendrogliomes (points triangles dans le rectangle tracé avec des tirets), par dosage de 4 miARNs (let 7a, miR409, miRl34 et let-7f), et sur la base des valeurs des ratios let7a/miR409 et miR134/let-7f Figure 7 : La figure 7 illustre les valeurs des ratios miRl55/miR34b (série 1), miRl34/miR20 (série 2) et miR26b/miRl34 (série 3), exprimées en pourcentage (barres empilées 100%). Ces valeurs permettent de distinguer visuellement les oligodendrogliomes (lignes 9-11), les tissus normaux (lignes 5-8), et les glioblastomes (lignes 1-4). The present invention is illustrated by the following figures and examples. Figure 1: The figure illustrates the categories of microRNAs overexpressed in gliomas compared to healthy tissue (diamond points); microRNAs under-expressed in gliomas relative to healthy tissue (squares); and microRNA overexpressed in glioblastoma (GBM) compared to oligodendrogliomas (ODG) (triangles). The y-axis represents the values of the ratios of the amounts of each miRNA in oligodendrogliomas to the amount of these miRNAs in healthy tissue (ODG / N). The x-axis represents the values of the ratios of the amounts of each miRNA in glioblastomas to the amount of these miRNAs in healthy tissue (GBM / N). Figure 2: Figure 2 illustrates clustering to distinguish GBM, ODG, healthy tissue based on the 12 ratios present respectively in Tables 4, 5, 6, 7. Ratio values for 4 samples of healthy tissue, 3 oligodendrogliomas and 4 glioblastomas make it possible to construct tissue sorting into three distinct and coherent groups in terms of tissue identity (dendrogram at the top of the MeV-Multiexperiment viewer software cluster v4.4-TM4 software suite MeV team-1, T4 M4, 00rg). Figure 3: Figure 3 illustrates the identification of normal tissues (diamond points in dashed-dotted rectangle), glioblastomas (square dots in dashed rectangle) and oligodendrogliomas (triangular dots in rectangle drawn with dashes). ), by assaying 4 miRNAs (let 7a, miR409, miRl55 and miR34b), and based on the values of the let7a / miR409 and miR155 / miR34b ratios. Figure 4: Figure 4 illustrates the identification of normal tissues (diamond points in the dotted-dotted rectangle), glioblastomas (square dots in the dashed rectangle) and oligodendrogliomas (triangular dots in the rectangle drawn with dashes), by assay of 3 miRNAs (miRl55, miR34b and miRl5l), and based on the ratio values miRl55 / miR34b and miRl5l / miRl55. Figure 5: Figure 5 illustrates the identification of normal tissues (diamond points in dashed-dotted rectangle), glioblastomas (square dots in the dashed rectangle) and oligodendrogliomas (triangular dots in the rectangle drawn with dashes), by assaying 4 miRNAs (let 7d, miR409, miRl34 and miR20), and based on the values of the let7d / miR409 and miR134 / miR20 ratios. Figure 6: Figure 6 illustrates the identification of normal tissues (diamond points in dashed-dotted rectangle), glioblastomas (square dots in the dashed rectangle) and oligodendrogliomas (triangular dots in the rectangle drawn with dashes). ), by assaying 4 miRNAs (let 7a, miR409, miRl34 and let-7f), and on the basis of the values of the let7a / miR409 and miR134 / let-7f ratios Figure 7: Figure 7 illustrates the values of the ratios miRl55 / miR34b (series 1), miRl34 / miR20 (series 2) and miR26b / miRl34 (series 3), expressed as a percentage (stacked bars 100%). These values distinguish visually oligodendrogliomas (lines 9-11), normal tissues (lines 5-8), and glioblastomas (lines 1-4).
Exemple 1 : Matériels et Méthodes Example 1: Materials and Methods
Les échantillons tissulaires Les échantillons tumoraux (8 glioblastomes et 4 oligodendrogliomes) ainsi que les échantillons de tissu sain (cortectomies) sont obtenus après exérèse par les neurochirurgiens au bloc opératoire et sont immédiatement congelés à -80°C. Des coupes de tissu d'environ 40µm d'épaisseur sont ensuite réalisées à l'aide d'un cryotome en nombre suffisant afin d'obtenir environ 80mg de tissu et conservées à -80°C jusqu'à extraction des ARN. Tissue samples The tumor samples (8 glioblastomas and 4 oligodendrogliomas) as well as the healthy tissue samples (cortectomies) are obtained after neurosurgeons excision in the operating room and are immediately frozen at -80 ° C. Tissue sections of approximately 40 μm thickness are then made using a cryotome in sufficient number to obtain about 80 mg of tissue and stored at -80 ° C until RNA extraction.
Les liquides biologiques Pour la purification des microARNs circulants dans le sang, des échantillons sanguins sont prélevés chez les patients sur des tubes de prélèvement de type PAXGene Blood RNA (PreAnalytix- Qiagen û BD Company). La lyse totale des cellules circulantes est réalisée et les ARN sont collectés par centrifugation et purifiés selon les indications du fournisseur. En ce qui concerne les fractions de microARN contenus dans les microvésicules produites par les tumeurs et présentes dans le sang, la méthode utilisée est directement basée sur celle décrite par Skog et coll (2008). Les microvésicules sont purifiées à partir des sérums par centrifugations et microfiltration. Les sérums sont centrifugés une première fois pendant 10 min à 300g, puis les surnageants sont ensuite centrifugés pendant 20 min à 17000g et filtrés sur filtre de 0,22 microns. Les microvésicules sont obtenues par ultracentrifugation du filtrat à 110000g pendant 70 min. Le culot est enfin resuspendu en tampon phosphate (PBS) et les ARN sont extraits selon le protocole décrit ci-après. Biological Fluids For the purification of circulating microRNAs in the blood, blood samples are taken from patients on PAXGene Blood RNA sampling tubes (PreAnalytix-Qiagen - BD Company). The total lysis of the circulating cells is carried out and the RNAs are collected by centrifugation and purified according to the indications of the supplier. With regard to the microRNA fractions contained in microvesicles produced by tumors and present in the blood, the method used is directly based on that described by Skog et al (2008). The microvesicles are purified from the sera by centrifugation and microfiltration. The sera are centrifuged a first time for 10 min at 300 g, then the supernatants are then centrifuged for 20 min at 17000 g and filtered through a 0.22 micron filter. Microvesicles are obtained by ultracentrifugation of the filtrate at 110000g for 70 min. The pellet is finally resuspended in phosphate buffer (PBS) and the RNAs are extracted according to the protocol described below.
L'extraction des ARN Les ARNs sont extraits à l'aide du kit hsa-miRVanaTM (Ambion, ABI) permettant de séparer les ARNs longs (taille> 250nt) des ARNs courts (taille < 250nt) en suivant les recommandations du fournisseur. Le tissu est tout d'abord lysé, les ARNs sont ensuite précipités après ajout d'acétate de sodium et d'éthanol, extraits en présence d'un mélange phénol/chloroforme, séparés selon leur taille sur colonne chromatographique, puis élués. Les ARNs élués sont ensuite quantifiés par mesure de la DO à 260nm à l'aide du spectrophotomètre Nanodrop ND-1000 et un contrôle qualité de ces ARN est réalisé par migration électrophorétique dans un gel de polymère sur le BioAnalyser 2100 grâce au kit RNA 6000 nano LabChip@(Agilent). RNA extraction The RNAs are extracted using the hsa-miRVanaTM kit (Ambion, ABI) to separate the long RNAs (size> 250 nt) from the short RNAs (size <250 nt) according to the supplier's recommendations. The tissue is first lyzed, the RNAs are then precipitated after addition of sodium acetate and ethanol, extracted in the presence of a phenol / chloroform mixture, separated according to their size on a chromatographic column, and then eluted. The eluted RNAs are then quantified by measuring the OD at 260 nm using the Nanodrop ND-1000 spectrophotometer and a quality control of these RNAs is performed by electrophoretic migration in a polymer gel on the BioAnalyser 2100 using the RNA 6000 nano kit. @ LabChip (Agilent).
Le dosa e des miARNs . ar PCR en tem. s réel L'expression de miARNs est quantifiée par la technique de PCR quantitative à l'aide des kits distribués par Applied Biosystems, spécifiques des miARNs matures. Dans un premier temps, 80ng d'ARNs courts sont inversement transcrits (en cDNA monobrin) en présence d'amorces en boucle, qui confèrent la spécificité pour la quantification de l'expression des miARNs matures. La PCR en temps réel est ensuite réalisée à l'aide des amorces fournies dans les kits. Une des amorces comporte des groupements fluorescents (sonde dite Taqman@) ce qui permet de réaliser une mesure quantitative en utilisant un fluorimètre adapté tel que la station Stratagene Mx3005.Le seuil de détection est déterminé dans un premier temps par l'utilisateur en début de phase exponentielle. La valeur de Ct correspond au nombre de cycles à partir duquel la fluorescence dépasse ce seuil de détection. Cette valeur de Ct est proportionnelle à la quantité de cDNA présent initialement dans l'échantillon. En l'absence de gamme-étalon spécifique pour chaque cDNA, seule une quantification relative entre échantillons est possible. Les valeurs de dosage pour chaque miARN sont normalisées avec les données obtenues pour un ARN non-codant, RNU24. Interprétation des résultats Un niveau d'expression aberrant d'un miARN dans un tissu testé peut être un indicateur du caractère tumoral dudit tissu. Afin de déterminer si un niveau d'expression d'un miARN testé est normal, la comparaison peut être faite soit entre le tissu suspecté et les tissus de référence (la comparaison inter-tissus), soit entre le niveau d'expression du susdit miARN et le niveau d'expression d'un autre miARN dans le même tissu (la comparaison intra-tissu). La comparaison inter-tissulaire du niveau d'expression d'un miARN X dans le tissu A et le tissu B est exprimée par le rapport(échantillon A/échantillon B), calculé d'après la formule (V) : Rapport(' = Efficacité « Ct hsa-miARNX - Ct RNU24)échantillon A-(Ct hsa-miARNX - Ct echantillon A/échantillon B) RNU24)échantillon B) La comparaison intra-tissulaire entre le niveau d'expression d'un miARN X et celui d'un miARN Y est exprimée par le rapport(hsa-miARN X/ hsa-miARN Y), calculé d'après la formule (VI) : Rapport(hsa-miARN X/ hsa-miARN Y)= Efficacité - (Ct hsa-miARN X - Ct hsa-miARN Y) Exemple 2 : Comparaison des niveaux d'expression des miARNs dans les tissus de tumeurs gliales et dans les tissus normaux de référence La nature des tissus utilisés dans le présent exemple est préalablement confirmée par l'analyse histologique. Les niveaux d'expression de 282 miARNs dans les tissus de glioblastomes, les tissus d'oligodendrogliome, les tissus sains de référence sont quantifiés respectivement par la PCR en temps réel selon la méthode décrite dans l'exemple 1. Parmi 282 miARNs testés, l'expression de 19 miARNs est modifiée dans les glioblastomes et dans les oligodendrogliomes, par rapport à celle dans du tissu sain. The dose of miRNAs. ar PCR in tem. Real miRNA expression is quantified by the quantitative PCR technique using the Applied Biosystems distributed kits specific for mature miRNAs. In a first step, 80 ng of short RNAs are inversely transcribed (in single-stranded cDNA) in the presence of loop primers, which confer the specificity for the quantification of the expression of mature miRNAs. Real-time PCR is then performed using the primers provided in the kits. One of the primers comprises fluorescent groups (so-called Taqman® probe) which makes it possible to perform a quantitative measurement using a suitable fluorimeter such as the Stratagene Mx3005 station. The detection threshold is determined initially by the user at the beginning of exponential phase. The value of Ct corresponds to the number of cycles from which the fluorescence exceeds this detection threshold. This Ct value is proportional to the amount of cDNA initially present in the sample. In the absence of a specific standard range for each cDNA, only relative quantification between samples is possible. The assay values for each miRNA are normalized with the data obtained for a non-coding RNA, RNU24. Interpretation of Results An aberrant expression level of a miRNA in a test tissue may be an indicator of the tumor character of the tissue. In order to determine whether a level of expression of a miRNA tested is normal, the comparison can be made either between the suspected tissue and the reference tissues (inter-tissue comparison), or between the level of expression of the above miRNA. and the level of expression of another miRNA in the same tissue (intra-tissue comparison). The inter-tissue comparison of the expression level of a miRNA X in tissue A and tissue B is expressed by the ratio (sample A / sample B), calculated from formula (V): Ratio ('= Efficacy "Ct hsa-miRNAX - Ct RNU24" sample A- (Ct hsa-miRNAX - Ct sample A / sample B) RNU24) sample B) The intra-tissue comparison between the level of expression of a miRNA X and that of miRNA Y is expressed by the ratio (hsa-miRNA X / hsa-miRNA Y), calculated from formula (VI): Ratio (hsa-miRNA X / hsa-miRNA Y) = Efficacy - (Ct hsa- EXAMPLE 2 Comparison of Expression Levels of miRNAs in Glial Tumor Tissues and in Normal Reference Tissues The nature of the tissues used in the present example is previously confirmed by histological analysis. . Expression levels of 282 miRNAs in glioblastoma tissues, oligodendroglioma tissues, reference healthy tissues are quantified respectively by real-time PCR according to the method described in Example 1. Among 282 miRNAs tested, The expression of 19 miRNAs is modified in glioblastomas and in oligodendrogliomas, compared to that in healthy tissue.
Le tableau 3 ci-dessous présente respectivement : les comparaisons inter-tissulaires pour les 19 miARN réalisées entre les glioblastomes de référence (GBM) et les tissus sains de référence (N), exprimées par le rapport(GMB/N) ; les comparaisons entre les oligodendrogliomes de référence (ODG) et les tissus sains de référence (N), exprimées par le rapport(oDGN) ; et les comparaisons entre les glioblastomes de référence (GBM) et les oligodendrogliomes de référence (ODG), exprimées par le rapport(GBM/0DG). Tableau 3 GBM/N ODG/N GBM/ODG 34,46 4,27 8,07 hsa-miR-210 2,35 0,29 8,1 47,00 9,20 5,1 hsa-miR-134 0,20 0,06 3,63 hsa-miR-409 0,321 0,065 4,94 7,76 7,35 1,06 4,84 3,90 1,24 3,31 4,16 0,80 11,43 6,31 1,81 12,87 20,32 0,63 3,63 5,73 0,63 8,95 7,86 1,14 19,25 24,92 0,77 4,19 4,57 0,92 23,18 32,46 0,71 hsa-miR-34b 0,21 0,32 0,67 hsa-miR-127 0,06 0,05 1,21 hsa-miR-151 0,23 0,26 0,89 hsa-miR-339 0,07 0,18 0,39 12 miARNs, marqués en gris dans le tableau 3, sont surexprimés dans les GBM et les ODG. 6 autres miARNs, sans aucun marquage dans le tableau 3, sont sous-exprimés dans les GBM et les ODG. Table 3 below shows respectively: inter-tissue comparisons for the 19 miRNAs performed between the reference glioblastomas (GBM) and the healthy reference tissues (N), expressed by the ratio (GMB / N); comparisons between reference oligodendrogliomas (ODG) and healthy reference tissues (N), expressed by the ratio (oDGN); and comparisons between reference glioblastomas (GBM) and reference oligodendrogliomas (ODG), expressed by the ratio (GBM / 0DG). Table 3 GBM / N ODG / N GBM / ODG 34.46 4.27 8.07 hrs-miR-210 2.35 0.29 8.1 47.00 9.20 5.1 hrs-miR-134 0, 0.06 3.63 hrs-miR-409 0.321 0.065 4.94 7.76 7.35 1.06 4.84 3.90 1.24 3.31 4.16 0.80 11.43 6.31 1.81 12.87 20.32 0.63 3.63 5.73 0.63 8.95 7.86 1.14 19.25 24.92 0.77 4.19 4.57 0.92 23, 18 32.46 0.71 hsa-miR-34b 0.21 0.32 0.67 hsa-miR-127 0.06 0.05 1.21 hsa-miR-151 0.23 0.26 0.89 hsa -miR-339 0.07 0.18 0.39 12 miRNAs, marked gray in Table 3, are overexpressed in GBMs and ODGs. Another 6 miRNAs, without any labeling in Table 3, are under-expressed in GBMs and ODGs.
Une exception est hsa-miR-210, marqué en gras dans le tableau 3, qui est surexprimé dans les GBM, mais sous-exprimé dans les ODG. Parmi ces 19 miARNs repérés dans l'invention en raison de leur profil d'expression modifié dans les tissus de gliomes par rapport aux tissus normaux, 5 miARNs, dont hsa-miR-155, hsa-miR-210, hsa-miR-l0a, hsa-miR-134, hsa-miR-409, montrent également un profil d'expression distinct entre les glioblastomes et les oligodendrogliomes. Ces 5 miARNs sont soulignés dans le tableau 3. An exception is hsa-miR-210, marked in bold in Table 3, which is overexpressed in the GBMs, but under-expressed in the ODGs. Of these 19 miRNAs identified in the invention because of their modified expression profile in glioma tissues compared to normal tissues, 5 miRNAs, including hsa-miR-155, hsa-miR-210, hsa-miR-10a , hsa-miR-134, hsa-miR-409, also show a distinct expression pattern between glioblastomas and oligodendrogliomas. These 5 miRNAs are underlined in Table 3.
Exemple 3 : Comparaisons intra-tissulaires des niveaux d'expression des miARNs La nature des tissus utilisés dans le présent exemple est préalablement confirmée par l'analyse histologique. La comparaison est réalisée entre les niveaux d'expression de 2 miARNs (miARN X et miARN Y) issus d'un même tissu. Le résultat de cette comparaison est exprimé sous forme d'un rapport, qui est calculé selon la formule (VI). Les tableaux 4, 5, 6, 7 ci-dessous représentent le rapport (hsa-miARN xi hsa-miARN Y) obtenu respectivement dans un tissu de glioblastome de référence (GBM), un tissu d'oligodendrogliome de référence (ODG), ou un tissu sain de référence (N). Les couples de miARNs sont sélectionnés sur la base de p-values inférieures à 0,05. (La p-value indique la significativité de chaque couple de miARNs (miARN X et miARN Y) pour les distinctions entre catégories de tissus. Une p-value inférieure à 0,05 est significative). Example 3: Intra-Tissue Comparisons of the Expression Levels of the miRNAs The nature of the tissues used in the present example is previously confirmed by histological analysis. The comparison is made between the expression levels of 2 miRNAs (miRNA X and miRNA Y) from the same tissue. The result of this comparison is expressed as a ratio, which is calculated according to formula (VI). Tables 4, 5, 6, 7 below represent the ratio (hsa-miRNA × hsa-miRNA Y) obtained respectively in a reference glioblastoma tissue (GBM), a reference oligodendroglioma tissue (ODG), or a healthy reference tissue (N). The miRNA pairs are selected on the basis of p-values less than 0.05. (The p-value indicates the significance of each pair of miRNAs (miRNA X and miRNA Y) for distinctions between tissue categories, a p-value of less than 0.05 is significant).
Tableau 4 Couple de miARNs Rapport dans Rapport dans GBM Rapport dans N ODG hsa-let 7a/hsa-miRl27 0,04 13,39 26,93 hsa-let 7a/hsa-miRlSb 1,00 6,57 5,58 hsa-let 7a/hsa-miR34b 11,77 1108,71 5664,24 hsa-let 7d/hsa-miR34b 8,32 137,03 341,47 hsa-miRl26/hsa-let 7a 7,02 2,30 2,08 hsa-miRl26/hsa-miRl34 0,32 8,48 39,09 hsa-miRl26/hsa-miR339 2,37 948,81 283,44 hsa-miRl26/hsa-miR34b 92,64 2446,73 1047,16 hsa-miR126/hsa-miR409 38,66 699,88 6908,75 hsa-miRl27/hsa-let 7d 68,45 1,09 0,99 hsa-miRl27/hsa-let 7f 2065,79 9,19 6,29 hsa-miRl27/hsa-miRlOa 10839,87 28,13 72,27 hsa-miRl27/hsa-miRl5b 30,35 1,04 1,31 hsa-miRl27/hsa-miR-17 405,56 2,82 2,95 hsa-miRl34/hsa-let 7a 21,26 0,21 0,08 hsa-miRl34/hsa-miRlOa 9255,37 31,37 31,47 hsa-miRl5l/hsa-let 7a 35,92 0,56 0,53 hsa-miRl5l/hsa-let 7d 181,76 5,35 4,57 hsa-miRl5l/hsa-let 7f 2941,11 25,08 14,37 hsa-miRl5l/hsa-miRlOa 21981,20 78,57 333,08 hsa-miRl51/hsa-miRl26 6,28 0,30 0,39 hsa-miRl51/hsa-miRl5b 42,05 2,42 2,62 hsa-miRl51/hsa-miR20a 19,14 1,94 0,75 hsa-miRl51/hsa-miR374 73,06 2,11 1,72 hsa-miRl55/hsa-miRl27 0,02 21,72 9,02 hsa-miRl55/hsa-miRl34 0,03 4,95 4,62 has-miR155/has-miR409 3,68 412,41 798,39 hsa-miRlSb/hsa-let 7f 78,80 9,77 8,62 hsa-miRl5b/hsa-miR339 0,38 94,27 16,51 hsa-miR15b/hsa-miR409 6,94 74,86 638,97 hsa-miRl6/hsa-miRl27 1,24 409,04 529,94 hsa-miRl6/hsa-miRl34 1,76 111,42 327,36 hsa-miRl6/hsa-miRl51 1,31 67,29 33,17 hsa-miRl6/hsa-miR339 12,38 16977,61 1904,10 hsa-miR16/hsa-miR34b 489,53 34822,63 20260,67 hsa-miRl6/hsa-miR-409 211,30 9357,42 50575,30 hsa-miR17/hsa-miR339 0,04 47,85 8,30 hsa-miRl7/hsa-miR34b 1,40 106,08 185,81 hsa-miRl7/hsa-miR409 0,76 27,18 250,77 hsa-miR20a/hsa-let 7a 2,53 0,59 0,60 hsa-miR20a/hsa-let 7f 141,24 28,07 21,61 hsa-miR20a/hsa-miRl27 0,08 6,21 16,98 hsa-miR20a/hsa-miR339 0,78 308,04 58,84 hsa-miR20a/hsa-miR34b 32,41 783,28 1528,75 hsa-miR20a/hsa-miR409 13,92 188,77 1844,61 hsa-miR2l0/hsa-let 7a 14,30 2,24 0,31 hsa-miR210/hsa-miRl55 27,01 2,90 3,84 hsa-miR26b/hsa-let 7f 379,42 148,58 83,66 hsa-miR26b/hsa-miR-127 0,20 54,39 103,49 hsa-miR26b/hsa-miRl34 0,31 13,96 59,85 hsa-miR26b/hsa-miRl 51 0,23 8,54 5,76 hsa-miR26b/hsa-miR-339 2,01 1777,46 375,39 hsa-miR26b/hsa-miR34b 73,80 3751,16 2921,07 hsa-miR26b/hsa-miR409 36,68 1151,30 9627,57 hsa-miR339/hsa-let 7a 3,44 0,06 0,05 hsa-miR339/hsa-let 7d 8,08 0,41 0,25 hsa-miR339/hsa-let 7f 225,84 2,49 1,56 hsa-miR34b/hsa-let 7f 6,74 0,06 0,08 hsa-miR374/hsa-let 7f 41,18 15,54 8,72 hsa-miR374/hsa-miRl27 0,02 5,64 10,35 hsa-miR374/hsa-miRl34 0,04 1,37 6,35 hsa-miR374/hsa-miR339 0,24 227,47 37,20 hsa-miR374/hsa-miR34b 9,42 374,55 387,50 hsa-miR374/hsa-miR409 4,57 114,05 985,51 hsa-miR409/hsa-miRl Oa 78,10 0,48 0,40 Les couples de miARNs du tableau 4 permettent d'indiquer que le tissu suspecté est un tissu tumoral, lorsque le rapport du niveau d'expression entre les deux miARNs d'un couple est différent du susdit rapport établi dans un tissu sain de référence. Table 4 Couple of miRNAs Report in Ratio in GBM Ratio in N ODG hsa-let 7a / hsa-miRl27 0.04 13.39 26.93 hsa-let 7a / hsa-miRlSb 1.00 6.57 5.58 hsa- let 7a / hsa-miR34b 11.77 1108.71 5664.24 hsa-let 7d / hsa-miR34b 8.32 137.03 341.47 hsa-miRl26 / hsa-let 7a 7.02 2.30 2.08 hsa mRl26 / hsa-miRl34 0.32 8.48 39.09 hsa-miRl26 / hsa-miR339 2.37 948.81 283.44 hsa-miRl26 / hsa-miR34b 92.64 2446.73 1047.16 hsa-miR126 / hsa-miR409 38.66 699.88 6908.75 hsa-miRl27 / hsa-let 7d 68.45 1.09 0.99 hsa-miRl27 / hsa-let 7f 2065.79 9.19 6.29 hsa-miRl27 hrs-miRlOa 10839.87 28.13 72.27 hrs-miRl27 / hrs-miRl5b 30.35 1.04 1.31 hrs-miRl27 / hrs-miR-17 405.56 2.82 2.95 hsa-miRl34 hsa-let 7a 21.26 0.21 0.08 hsa-miRl34 / hsa-miRlOa 9255.37 31.37 31.47 hsa-miRl5l / hsa-let 7a 35.92 0.56 0.53 hsa-miRl5l Yield: 181.76 5.35 4.57 hrs-miRl5l / hsa-let 7f 2941.11 25.08 14.37 hsa-miRl5l / hsa-miRlOa 21981.20 78.57 333.08 hsa-miRl51 / hrs-miRl26 6.28 0.30 0.39 hrs-miRl51 / hrs-miRl5b 42.05 2.42 2.62 hrs-miRl51 / hrs-miR20a 19.14 1.94 0.75 hsa-mi Rl51 / hsa-miR374 73.06 2.11 1.72 hsa-miRl55 / hsa-miRl27 0.02 21.72 9.02 hsa-miRl55 / hsa-miRl34 0.03 4.95 4.62 has-miR155 / has-miR409 3.68 412.41 798.39 hsa-miRlSb / hsa-let 7f 78.80 9.77 8.62 hsa-miRl5b / hsa-miR339 0.38 94.27 16.51 hsa-miR15b / hsa -mR409 6.94 74.86 638.97 hrs-miRl6 / hrs-miRl27 1.24 409.04 529.94 hrs-miRl6 / hrs-miRl34 1.76 111.42 327.36 hrs-miRl6 / hrs-miRl51 1.31 67.29 33.17 hsa-miRl6 / hsa-miR339 12.38 16977.61 1904.10 hsa-miR16 / hsa-miR34b 489.53 34822.63 20260.67 hsa-miRl6 / hsa-miR-409 211.30 9357.42 50575.30 hrs-miR17 / hrs-miR339 0.04 47.85 8.30 hrs-miR17 / hrs-miR34b 1.40 106.08 185.81 hrs-miR17 / hs-miR409 0, 76 27.18 250.77 hsa-miR20a / hsa-let 7a 2.53 0.59 0.60 hsa-miR20a / hsa-let 7f 141.24 28.07 21.61 hsa-miR20a / hsa-miRl27 0, 08 6.21 16.98 hsa-miR20a / hsa-miR339 0.78 308.04 58.84 hsa-miR20a / hsa-miR34b 32.41 783.28 1528.75 hsa-miR20a / hsa-miR409 13.92 188 , 77 1844.61 hrs-miR2l0 / hsa-let 7a 14.30 2.24 0.31 hsa-miR210 / hsa-miRl55 27.01 2.90 3.84 hsa-miR26b / hsa-let 7f 379.42 148 , 58 83.66 hsa-m iR26b / hsa-miR-127 0.20 54.39 103.49 hsa-miR26b / hsa-miRl34 0.31 13.96 59.85 hsa-miR26b / hsa-miRl 51 0.23 8.54 5.76 hsa -miR26b / hsa-miR-339 2.01 1777.46 375.39 hsa-miR26b / hsa-miR34b 73.80 3751.16 2921.07 hsa-miR26b / hsa-miR409 36.68 1151.30 9627.57 hsa -miR339 / hsa-let 7a 3.44 0.06 0.05 hsa-miR339 / hsa-let 7d 8.08 0.41 0.25 hsa-miR339 / hsa-let 7f 225.84 2.49 1.56 hsa-miR34b / hsa-let 7f 6.74 0.06 0.08 hsa-miR374 / hsa-let 7f 41.18 15.54 8.72 hsa-miR374 / hsa-miRl27 0.02 5.64 10.35 hsa-miR374 / hsa-miRl34 0.04 1.37 6.35 hsa-miR374 / hsa-miR339 0.24 227.47 37.20 hrs-miR374 / hrs-miR34b 9.42 374.55 387.50 hsa- miR374 / hsa-miR409 4.57 114.05 985.51 hsa-miR409 / hsa-miRl Oa 78.10 0.48 0.40 The pairs of miRNAs in Table 4 indicate that the suspected tissue is a tumor tissue. when the ratio of the level of expression between the two miRNAs of a pair is different from the aforesaid ratio established in a reference healthy tissue.
Tableau 5 Couple de miARNs Rapport dans Rapport dans GBM Rapport dans N ODG hsa-let 7d/hsa let 7f 39,38 7,44 5,17 hsa-miRlOa/hsa let 7d 0,01 0,19 0,02 hsa-miRl26/hsa let 7f 409,60 86,77 52,65 hsa-miRl26/hsa-miRlOa 3309,62 212,01 1322,35 hsa-miRl26/hsa-miRl55 11,23 2,56 14,01 hsa-miRl27/hsa-miRl26 6,28 0,18 0,25 hsa-miRl34/hsa-miRl7 308,44 5,14 0,92 hsa-miR134/hsa-miR409 117,50 76,90 105,39 hsa-miRl51/hsa-miRl7 786,64 12,17 5,49 hsa-miR155/hsa-miR339 0,23 658,78 33,40 hsa-miRl5b/hsa-miRlOa 480,59 28,27 216,27 hsa-miRl5b/hsa-miRl55 2,49 0,26 12,60 hsa-miRlSb/hsa-miR34b 17,58 237,79 813,26 hsa-miRl6/hsa-miRlOa 16307,76 2830,58 11326,64 hsa-miRl6/hsa-miRl26 5,72 13,65 14,07 hsa-miRl6/hsa-miRl55 63,55 27,68 301,21 hsa-miRl6/hsa-miRlSb 33,54 118,49 74,32 hsa-miRl6/hsa-miR20a 15,54 66,32 21,88 hsa-miRl6/hsa-let 7f 2208 1195 450 hsa-miRl6/hsa-miR374 54 80 52 hsa-miRl7/hsa let 7d 0,18 0,66 0,74 hsa-miR20a/hsa-miRlOa 973,95 63,63 520,31 hsa-miR210/hsa-miRl27 0,47 41,36 11,83 hsa-miR210/hsa-miRl34 0,76 11,49 6,43 hsa-miR210/hsa-miR339 4,34 577,38 42,97 hsa-miR210/hsa-miR409 85,51 825,50 1082,17 hsa-miR26b/hsa let 7a 6,38 3,46 3,02 hsa-miR26b/hsa-miRl Oa 2395,15 423,06 2043,29 hsa-miR26b/hsa-miRl55 11,10 3,44 42,63 hsa-miR26b/hsa-miRl5b 5,92 14,88 14,85 hsa-miR374/hsa-miRlOa 260,02 47,05 219,75 hsa-miRlOa/hsa-miR210 0,00 0,02 0,01 hsa-miRlOa/hsa-miR339 0,00 4,79 0,11 hsa-miRlOa/hsa-miR34b 0,05 30,18 2,24 hsa-miRl55/hsa let 7f 41,80 53,26 6,99 hsa-miRl6/hsa let 7a 38,15 28,63 14,98 hsa-miRl6/hsa-miR210 3,45 41,60 60,43 hsa-miR2l0/hsa let 7d 40,01 20,29 3,03 hsa-miR210/hsa-miRl26 2,72 2,30 0,21 hsa-miR210/hsa-miRl5b 14,39 13,77 1,53 hsa-miR210/hsa-miRl7 207,54 67,24 3,14 hsa-miR2 10/hsa-miR20 a 6,74 10,76 0,43 hsa-miR2 10/hsa-miR3 74 22,64 13,26 0,92 hsa-miR26b/hsa-miR2 10 0,52 4,13 10,62 Les couples de miARNs du tableau 5 peuvent indiquer que le tissu suspecté est un des deux types de tissu tumoral, lorsque le rapport du niveau d'expression entre les deux miARNs d'un couple est différent du susdit rapport établi dans un tissu sain de référence. Table 5 Couple of miRNAs Report in Report in GBM Report in N ODG hsa-let 7d / hsa let 7f 39.38 7.44 5.17 hsa-miRlOa / hsa let 7d 0.01 0.19 0.02 hsa-miRl26 / hsa let 7f 409.60 86.77 52.65 hsa-miRl26 / hsa-miRlOa 3309.62 212.01 1322.35 hsa-miRl26 / hsa-miRl55 11.23 2.56 14.01 hsa-miRl27 / hsa mRl26 6.28 0.18 0.25 hrs-miRl34 / hrs-miR17 308.44 5.14 0.92 hrs-miR134 / hrs-miR409 117.50 76.90 105.39 hrs-miRl51 / hrs-miR17 786.64 12.17 5.49 hsa-miR155 / hsa-miR339 0.23 658.78 33.40 hsa-miR15b / hsa-miR10a 480.59 28.27 216.27 hsa-miRl5b / hsa-miRl55 2, 49 0.26 12.60 hsa-miRlSb / hsa-miR34b 17.58 237.79 813.26 hsa-miRl6 / hsa-miRlOa 16307.76 2830.58 11326.64 hsa-miRl6 / hsa-miRl26 5.72 13 , 65 14.07 hs-miRl6 / hs-miRl55 63.55 27.68 301.21 hsa-miRl6 / hsa-miRlSb 33.54 118.49 74.32 hsa-miRl6 / hsa-miR20a 15.54 66.32 21.88 hsa-miRl6 / hsa-let 7f 2208 1195 450 hsa-miRl6 / hsa-miR374 54 80 52 hsa-miRl7 / hsa let 7d 0.18 0.66 0.74 hsa-miR20a / hsa-miRlOa 973.95 63.63 520.31 hsa-miR210 / hsa-miRl27 0.47 41.36 11.83 hsa-miR210 / hsa-miRl3 4 0.76 11.49 6.43 hsa-miR210 / hsa-miR339 4.34 577.38 42.97 hsa-miR210 / hsa-miR409 85.51 825.50 1082.17 hsa-miR26b / hsa let 7a 6 , 38 3.46 3.02 hrs-miR26b / hrs-miRl Oa 2395.15 423.06 2043.29 hrs-miR26b / hrs-miR151 11.10 3.44 42.63 hsa-miR26b / hsa-miR15b 5, 92 14.88 14.85 hsa-miR374 / hsa-miRlOa 260.02 47.05 219.75 hsa-miRlOa / hsa-miR210 0.00 0.02 0.01 hsa-miRlOa / hsa-miR339 0.00 4 , 79 0.11 hsa-miRlOa / hsa-miR34b 0.05 30.18 2.24 hsa-miRl55 / hsa let 7f 41.80 53.26 6.99 hsa-miRl6 / hsa let 7a 38.15 28.63 14.98 hrs-miRl6 / hrs-miR210 3.45 41.60 60.43 hrs-miR210 / hrs let 7d 40.01 20.29 3.03 hrs-miR210 / hrs-miRl26 2.72 2.30 0, 21 hrs-miR210 / hrs-miRl5b 14.39 13.77 1.53 hrs-miR210 / hrs-miR17 207.54 67.24 3.14 hrs-miR2 10 / hrs-miR20 a 6.74 10.76 0, 43 hsa-miR2 10 / hsa-miR3 74 22.64 13.26 0.92 hsa-miR26b / hsa-miR2 10 0.52 4.13 10.62 The pairs of miRNAs in Table 5 may indicate that the suspected tissue is one of two types of tumor tissue, when the ratio of the level of expression between the two miRNAs of a couple is different from the aforementioned ratio established in a healthy reference tissue.
Tableau 6 Couple de miARNs Rapport dans Rapport dans GBM Rapport dans N ODG hsa-miRl27/hsa-miR409 205,31 46,96 159,82 hsa-miR2l0/hsa-miR34b 147,47 1752,14 268,48 hsa-let 7f/hsa-miRlOa 6,57 2,81 21,53 hsa-miRl55/hsa-miRl7 10,56 26,58 2,85 hsa-miRl55/hsa-miR374 1,05 4,62 0,83 Hsa-miR20/hsa-miR155 4,34 0,74 23,47 Les couples de miARNs du tableau 6 permettent de distinguer un glioblastome d'un oligodendrogliome, lorsque le caractère tumoral d'un tissu suspecté est déjà confirmé par une méthode décrite dans la présente invention, ou une méthode conventionnelle. Table 6 Couple of miRNAs Ratio in Ratio in GBM Ratio in N ODG hsa-miRl27 / hsa-miR409 205.31 46.96 159.82 hsa-miR2l0 / hsa-miR34b 147.47 1752.14 268.48 hsa-let 7f / hsa-miRlOa 6.57 2.81 21.53 hsa-miRl55 / hrs-miRl7 10.56 26.58 2.85 hsa-miRl55 / hsa-miR374 1.05 4.62 0.83 Hsa-miR20 / hsa The miRNA pairs of Table 6 make it possible to distinguish a glioblastoma from an oligodendroglioma, when the tumor character of a suspected tissue is already confirmed by a method described in the present invention, or a conventional method.
Tableau 7 Couple de miARNs Rapport dans Rapport dans GBM Rapport dans N ODG hsa-let 7a/hsa-miR 409 5,77 356,43 3726,97 hsa-let 7d/hsa-miR409 4,75 41,99 275,42 hsa-miRl34/hsa-let 7f 1067,08 10,55 1,58 hsa-let 7f/hsa-miR409 0,11 7,47 81,66 hsa-miRl34/hsa-let 7d 62,34 2,01 0,43 hsa-miRl51/hsa-miRl55 62,89 0,44 6,93 hsa-miRl55/hsa-miR34b 7,27 1186,37 80,50 hsa-miRl5b/hsa-miRl34 0,06 0,93 5,98 hsa-miRl34/hsa-miR20a 8,61 0,40 0,07 hsa-miR2l0/hsa-let 7f 944,34 129,36 8,61 Les couples de miARNs du tableau 7 ci-dessus permettent de préciser directement la nature d'un tissu suspecté de présenter un caractère tumoral et de distinguer qu'il s'agit d'un glioblastome ou d'un oligodendrogliome, sans besoin d'effectuer une étape de détermination de la présence de gliomes dans ce tissu suspecté. Les figures 3 à 6 illustrent que 3 groupes d'échantillons de nature différente, dont les tissus sains, les tissus de glioblastomes, ou les tissus d'oligodendrogliomes, sont distingués sur un graphique à deux dimensions établi à l'aide de deux couples de miARNs. La figure 7 montre que 3 groupes d'échantillons de nature différente, dont les tissus sains, les tissus de glioblastomes, ou les tissus d'oligodendrogliomes, sont bien différenciés sur un graphique à trois dimensions, établi à l'aide de trois couples de miARNs. Table 7 Couple of miRNAs Report in Report in GBM Report in N ODG hsa-let 7a / hsa-miR 409 5.77 356.43 3726.97 hsa-let 7d / hsa-miR409 4.75 41.99 275.42 hsa -miRl34 / hsa-let 7f 1067.08 10.55 1.58 hsa-let 7f / hsa-miR409 0.17 7.47 81.66 hsa-miRl34 / hsa-let 7d 62.34 2.01 0.43 hsa-miRl51 / hsa-miRl55 62.89 0.44 6.93 hsa-miRl55 / hsa-miR34b 7.27 1186.37 80.50 hsa-miRl5b / hsa-miRl34 0.06 0.93 5.98 hsa- miRl34 / hsa-miR20a 8.61 0.40 0.07 hsa-miR210 / hsa-let 7f 944.34 129.36 8.61 The pairs of miRNAs in Table 7 above make it possible to directly specify the nature of a tissue suspected of having a tumor character and distinguishing between a glioblastoma or an oligodendroglioma, without the need for a step to determine the presence of gliomas in this suspected tissue. Figures 3 to 6 illustrate that 3 groups of different types of samples, including healthy tissues, glioblastoma tissues, or oligodendroglioma tissues, are distinguished on a two-dimensional graph established using two pairs of samples. miRNAs. Figure 7 shows that 3 groups of different types of samples, including healthy tissues, glioblastoma tissues, or oligodendroglioma tissues, are well differentiated on a three-dimensional graph, established using three pairs of miRNAs.
Claims (4)
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR0958737A FR2953529A1 (en) | 2009-12-08 | 2009-12-08 | Use of at least one micro(mi)RNA e.g. hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, and hsa-let7a, for the implementation of in vitro diagnosis method of gliomas |
PCT/FR2010/052650 WO2011070297A2 (en) | 2009-12-08 | 2010-12-08 | Use of mirnas as biomarkers in glioma diagnosis |
US13/514,723 US20120322680A1 (en) | 2009-12-08 | 2010-12-08 | Use of mirnas as biomarkers in glioma diagnosis |
EP10807461.8A EP2510122B1 (en) | 2009-12-08 | 2010-12-08 | Use of mi-rnas as biomarkers for diagnosing gliomas |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR0958737A FR2953529A1 (en) | 2009-12-08 | 2009-12-08 | Use of at least one micro(mi)RNA e.g. hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, and hsa-let7a, for the implementation of in vitro diagnosis method of gliomas |
Publications (1)
Publication Number | Publication Date |
---|---|
FR2953529A1 true FR2953529A1 (en) | 2011-06-10 |
Family
ID=42104553
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
FR0958737A Pending FR2953529A1 (en) | 2009-12-08 | 2009-12-08 | Use of at least one micro(mi)RNA e.g. hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, and hsa-let7a, for the implementation of in vitro diagnosis method of gliomas |
Country Status (1)
Country | Link |
---|---|
FR (1) | FR2953529A1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2015004413A3 (en) * | 2013-07-09 | 2015-05-14 | University Of Central Lancashire | Detection of brain cancer |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20090131354A1 (en) * | 2007-05-22 | 2009-05-21 | Bader Andreas G | miR-126 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION |
-
2009
- 2009-12-08 FR FR0958737A patent/FR2953529A1/en active Pending
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20090131354A1 (en) * | 2007-05-22 | 2009-05-21 | Bader Andreas G | miR-126 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION |
Non-Patent Citations (5)
Title |
---|
CHAN J A ET AL: "MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER REREARCH, US LNKD- DOI:10.1158/0008-5472.CAN-05-0137, vol. 65, no. 14, 15 July 2005 (2005-07-15), pages 6029 - 6033, XP002457479, ISSN: 0008-5472 * |
CIAFRE ET AL: "Extensive modulation of a set of microRNAs in primary glioblastoma", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, ACADEMIC PRESS INC. ORLANDO, FL, US, vol. 334, no. 4, 9 September 2005 (2005-09-09), pages 1351 - 1358, XP005001537, ISSN: 0006-291X * |
NEGRINI M ET AL: "MicroRNAs and cancer-new paradigms in molecular oncology", CURRENT OPINION IN CELL BIOLOGY, CURRENT SCIENCE, LONDON, GB LNKD- DOI:10.1016/J.CEB.2009.03.002, vol. 21, no. 3, 1 June 2009 (2009-06-01), pages 470 - 479, XP026161494, ISSN: 0955-0674, [retrieved on 20090504] * |
SILBER JOACHIM ET AL: "microRNAs in Gliomas: Small Regulators of a Big Problem", NEUROMOLECULAR MEDICINE, vol. 11, no. 3, Sp. Iss. SI, September 2009 (2009-09-01), pages 208 - 222, XP002579555, ISSN: 1535-1084 * |
SILBER JOACHIM ET AL: "miR-124 and miR-137 inhibit proliferation of glioblastoma multiforme cells and induce differentiation of brain tumor stem cells", BMC MEDICINE, BIOMED CENTRAL LTD., LONDON, GB, vol. 6, no. 1, 24 June 2008 (2008-06-24), pages 14, XP021037895, ISSN: 1741-7015 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2015004413A3 (en) * | 2013-07-09 | 2015-05-14 | University Of Central Lancashire | Detection of brain cancer |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP2510122B1 (en) | Use of mi-rnas as biomarkers for diagnosing gliomas | |
JP6807351B2 (en) | MiRNA biogenesis in exosomes for diagnosis and treatment | |
WO2013087907A1 (en) | Methods for diagnosis and therapeutic follow‑up of muscular dystrophies | |
US11136628B2 (en) | Biomarkers useful for detection of types, grades and stages of human breast cancer | |
WO2008042231A2 (en) | Compositions and methods for evaluating and treating heart failure | |
US20130310276A1 (en) | Microrna for diagnosis of pancreatic cancer | |
CN102439169A (en) | Compositions and methods for micro-rna expession profiling of colorectal cancer | |
CN102892898A (en) | Diagnostic kit including micro-rna biomarkers and used for diagnosis of hepatocellular carcinoma, and method | |
WO2016034715A2 (en) | Method for predicting the development of colorectal cancer | |
EP3177735B1 (en) | Micrornas characterising rosacea type ii and the uses thereof | |
CN102443638B (en) | Internal reference for detecting miRNA (micro Ribonucleic Acid) in serum/blood plasma and application of internal reference | |
US20140106985A1 (en) | Microrna biomarkers for prognosis of patients with pancreatic cancer | |
WO2017144642A1 (en) | Mirna combination for predicting the clinical development of colorectal cancer | |
EP3183363A2 (en) | Method for determining the survival prognosis of a patient suffering from pancreatic cancer | |
FR2953529A1 (en) | Use of at least one micro(mi)RNA e.g. hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, and hsa-let7a, for the implementation of in vitro diagnosis method of gliomas | |
EP2649200A1 (en) | Intra-tissue in vitro diagnosis method for diagnosing brain tumours | |
FR2968674A1 (en) | IN VITRO INTER-TISSUE DIAGNOSIS METHOD FOR DIAGNOSING BRAIN TUMORS | |
Morsiani | Circulating microRNAs during human aging and longevity | |
WO2022106795A1 (en) | Method for classifying an individual | |
FR2992659A1 (en) | MICROARN SIGNATURE OF THE ACTIVATION STATUS OF THE INNOVATIVE IMMUNE RESPONSE AND EPIDERMAL INFLAMMATORY AND USES THEREOF |