FR2953529A1 - Use of at least one micro(mi)RNA e.g. hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, and hsa-let7a, for the implementation of in vitro diagnosis method of gliomas - Google Patents

Abstract

Use of at least one micro (mi)RNA comprising hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a, for the implementation of in vitro diagnosis method of gliomas, is claimed. Independent claims are included for: (1) a method for in vitro diagnosis of gliomas comprising: measuring the level of expression of (I) in a biological sample from a patient suspected of having glioma, comparing: between the level of expression of at least one the miRNA in the sample and the level of expression of the miRNAs in a healthy sample of reference or between the level of expression of at least one first of the miRNA in the sample obtained from a patient suspected of having a glioma and the level of expression of at least one second of the miRNAs in the same sample obtained from the patient suspected of having a glioma; (2) a kit for in vitro diagnosis of gliomas, comprising metering means of at least one miRNA comprising HSA-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR- 155, hsa-miR-210 or hsa-miR-10a; and (3) a method of evaluating effectiveness of a method for treating gliomas, comprising: measuring the level of expression of at least one miRNA comprising hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa miR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a in a biological sample from a patient subjected to glioma treatment, and optionally comparing the level of expression of the miRNAs in the biological sample from the patient, and respectively the level of expression of the miRNAs in a reference sample from a patient having glioblastoma and respectively the level of expression of the miRNA in a reference sample from a patient having oligodendroglioma.

Description

The present invention relates to the use of miRNAs as biomarkers in the diagnosis of gliomas. It also relates to the use of miRNAs as biomarkers in the diagnosis of glioblastomas and oligodendrogliomas. Tumors of the central nervous system (CNS) are mostly gliomas (50%) grouping together astrocytomas and oligodendrogliomas. These tumors are a major cause of morbidity and mortality and represent a major public health problem. In fact, CNS tumors are the second leading cause of cancer death in children and the third leading cause in adult men (15-34 years). The overall incidence of CNS tumors is close to 7000 new cases detected each year in France. Finally, of the 6 million annual deaths worldwide due to some form of cancer, 1-2% are attributable to CNS tumors (WHO data). Excision of the tumor is a means, a priori radical, to eradicate a tumor. But in clinical practice, the effectiveness of this treatment is often compromised because the removal of the tumor often can not be exhaustive. Indeed, because of the imprecision of current diagnostic methods, the limits of the tumor are sometimes poorly evaluated at the time of diagnosis. Radiation therapy, which is widely used in addition to surgery, does not completely eliminate tumors. Chemotherapy, using various pharmaceutical compounds of anti-cancer interest, such as cisplatin, or temodal, is another treatment often used in the fight against tumors. However, chemotherapy is not effective for all gliomas, either because some gliomas, for example glioblastomas, are not chemo-sensitive, or because some pharmaceutical compounds are unable to pass the blood-brain barrier. At present, apart from the histological analysis performed by the pathologist, there are only a few diagnostic tests based on molecular approaches. Microscopic observations of cell morphology are completed in a few laboratories by the search for certain protein markers using specific antibodies. These immunohistochemical tests nevertheless have many disadvantages for the moment. They have only a low rate of productivity (they allow detection of only one antigen at a time), do not allow to distinguish unambiguously the different types of tumor cells and offer only poor possibilities of quantitative detection of markers. The diagnostics performed on the detection of genetic markers (such as lp and 19q heterozygosity losses in oligodendrogliomas) are currently little used. The microRNAs (miRNAs) represent a relatively recent identification class of single-stranded (21 to 25nt), endogenous, non-coding RNAs. The genes responsible for the expression of these miRNAs are previously transcribed in the form of long precursors, themselves cleaved into pre-miRNAs by RNAse III Drosha. The processing of these pre-miRNAs is performed by another RNAse, Dicer, which gives rise to an RNA duplex noted [miRNA: miRNA *]. Only one of the two strands, the mature strand, participates in the RISC (RNA-induced silencing complex) ribonucleoprotein complex to function as a post-transcriptional regulator (Bartel et al., Cell, 2004. 116 (2): 281-97). . The miRNAs can regulate gene expression either by degradation of target messenger RNAs or by repression of their translation according to the degree of complementarity between the miRNA and its target mRNA. Since these RNAs play an important role in translational regulation, they are therefore strongly involved in many cellular processes such as development, differentiation, proliferation, apoptosis and stress response, processes often deregulated in tumors. Numerous scientific studies have been devoted to the role of miRNAs in oncogenesis processes (Benard, J. and S. Douc-Rasy, Bull Cancer, 2005. 92 (9): 757-62; Hammond Curr Opin Genet Dev , 2006. 16 (1): 4-9). Now, it is recognized that miRNAs are actively involved in the development of cancers. In humans, the number of genes encoding the precursors of miRNAs currently identified is 721 (Sanger miRBase version 14, Sep 2009). Some of these miRNAs have been detected as tumor markers in the context of breast and prostate cancers and are therefore considered to be oncogenic or tumor suppressor miRNAs depending on their expression in tumors and their post-transcriptional role. In recent years, the possible alteration of miRNA expression levels in glial tumors has already been the subject of several scientific publications. A publication by Ciafre et al. in 2005 (Biochem Biophys Res Commun, 2005. Sep 9; 334 (4): 1351-8) compares expression levels of 245 miRNAs in glioblastomas and normal tissues, and highlights a distinct expression pattern. of these miRNAs in glioblastomas relative to the expression pattern in normal tissues. This publication discloses that miR-221 is overexpressed in glioblastomas, whereas miR-128, miR-181a, miR18b and miR181c are under expressed in glioblastomas.

At the same time, Chen (N Engl J Med, 2005. 353 (17): 1768-71) describes that miR-21 is highly overexpressed in glioblastomas compared to normal tissues. Another scan of the expression levels of 192 miRNAs in glial tumor tissues and normal tissues was performed by Silber et al. in 2008 (BMC Med, 2008. Jun 24, 6: 14). This study aims to analyze a possible modification of the expression profile of miRNAs in anaplastic astrocytomas (grade III) or glioblastomas (grade IV), tumors of different grades of the same type of tumor. This study shows a modified expression profile of miRNAs in anaplastic astrocytomas and glioblastomas, compared to normal tissues. The miRNAs mentioned in this publication, the expression of which is modified, are not identical to those already mentioned in previous publications. However, to date, no previous study has done an exhaustive scan, as all microRNAs expressed in human cells are never explored. In order to effectively fight against glial tumors, the establishment of a reliable method of diagnosing gliomas, which makes it possible to precisely distinguish a glial tumor tissue from a normal tissue, is therefore of decisive importance.

Gliomas or glial tumors are classified by the World Health Organization (WHO) in four histological grades, the grade indicating mainly the degree of malignancy (see Table 1). Table 1 Grade I Surgical pilocytic astrocytoma G Grade II Oligoastrocytomas two types of cells: astrocytes and oligodendrogliales Oligodendrogliomas, diffuse Astrocytomas Grade III Anaplastic Oligodendrogliomas Anaplastic Oligoastrocytomas Anaplastic Astrocytomas Grade IV Glioblastoma multiforme Oligodendrogliomas classified as Grade II by WHO are gliomas low grade, developed from oligodendrocytes. This glioma has so far been very often underdiagnosed, because of defects in effective diagnostic method. Nevertheless, unlike other glial tumors, oligodendrogliomas are remarkably chemo-sensitive. The median survival for oligodendrogliomas is about 7 years. On the other hand, glioblastomas, classified in grade IV according to the WHO classification, are developed from astrocytes, which are bridges between the blood and the neurons, ensure the nutrition of the neurons, manage the interneuronal connections, and regulate the neurons. neurotransmitters. Glioblastomas are astrocytic malignant tumors. In the absence of satisfactory surgical excision and chemosensitivity to most of the anticancer drugs currently on the market, the prognosis of these tumors is very pessimistic. Mean survival is only about 1 year for glioblastoma after treatment. Therefore, a diagnostic method capable of quickly and correctly distinguishing an oligodendroglioma from a glioblastoma allows a patient to receive care corresponding to his physical condition and to increase his chances of survival. However, in the previous publications mentioned above, the starting biological material consists of glioblastomas compared to peritumoral tissue or healthy tissue; or cultured glioblastoma cells compared to healthy brain tissue; or glioblastomas, corresponding to high grade astrocytomas, compared to low grade astrocytic tumors, such as anaplastic astrocytomas. On the other hand, comparisons between glioblastomas and oligodendrogliomas have never been discussed in the prior art. Thus, another aspect of the invention aims to provide a diagnostic method for precisely distinguishing a glioblastoma from an oligodendroglioma.

The invention is based on an unexpected finding made by the inventors during a scan of expression levels of 282 microRNAs in normal tissues, and tissues from two types of tumors of different natures and origin, including glioblastomas. (GBM) and oligodendrogliomas (ODG). Indeed, the inventors have found that the expression profile of these miRNAs is significantly different in glial tumor tissues compared to that present in normal tissues. Based on the comparison between the expression pattern of 282 miRNAs in glial tumors (glioblastomas or oligodendrogliomas) and healthy brain tissue, the present invention identified 19 miRNAs whose expression is either systematically overexpressed or systematically under-expressed. , in glial tumors compared to healthy brain tissue. Thus, the first aspect of the invention relates to the use of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa- miR-16, hsa-miR-17, hsa-miR -20a, hsa-let7a, hsa-let7f, hsa-let7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151 , hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a for the implementation of an in vitro diagnostic method of glioma. The nucleic acid sequence and accession number for each miRNAs mentioned in the present invention are presented below in Table 2. Table 2 miRNAs expressed Sequence Accession number differently in sequence MIMAT glial tumors compared to healthy brain tissue hsa -miR-126 SEQ ID NO: 1 MIMAT0000445 ucguaccgugaguaauaaugcg hsa-miR-16 SEQ ID NO: 2 MIMAT0000069 uagcagcacguaaauauuggcg hsa-miR-20a SEQ ID NO: 3 MIMAT0000075 uaaagugcuuauagugcagguag hsa-let 7a SEQ ID NO: 4 MIMAT0000062 ugagguaguagguuguauaguu hsa-let 7f SEQ ID NO: 5 MIMAT0000067 ugagguaguagauuguauaguu hsa-let 7d SEQ ID NO: 6 MIMAT0000065 agagguaguagguugcauaguu hsa-miR-374a SEQ ID NO: 7 MIMAT0000727 uuauaauacaaccugauaagug hsa-miR-15b SEQ ID NO: 8 MIMAT0000417 uagcagcacaucaugguuuaca hsa-miR-127-3p SEQ ID NO: 9 MIMAT 0000446 ucggauccgucugagcuuggcu hsa-miR-339-5p SEQ ID NO: 10 MIMAT0000764 ucccuguccuccaggagcucacg hsa-miR-409-5p SEQ ID NO: 11 MIMAT0001638 agguuacccgagcaacuuugca hsa-miR-134 SEQ ID NO: 12 MIMAT0000447 ugugacugguugaccagagggg hsa-miR-155 SEQ ID NO: 13 MIMAT0000646 uuaaugcuaaucgugauaggggu hsa-miR-210 SEQ ID NO: 14 MIMAT0000267 cugugcgugugacagcggcuga hsa-miR-l0a SEQ ID NO: 15 MIMAT0000253 uacccuguagauccgaauuugug hsa- miR-26b SEQ ID NO: 16 MIMAT0000083 uucaaguaauucaggauaggu hsa-miR-34b SEQ ID NO: 17 MIMAT0004676 caaucacuaacuccacugccau hsa-miR-17 SEQ ID NO: 18 MIMAT0000070 caaagugcuuacagugcagguag hsa-miR-151-3p SEQ ID NO: 19 MIMAT0000757 cuagacugaagcuccuugagg miRNAs mentioned above are referenced in the miRBase database (klr ', t__tgl) (miRBase: tools for microRNA genomic, Griffiths-Jones et al., NAR 2008 36 (Database Issue): D154-D158) where the nucleic acid sequence a miRNA can be traced by a MIMAT accession number or a uniform annotation. An annotation system has been put in place to name the different miRNAs (A uniform system for microRNA annotation, Ambros et al., RNA 2003 9 (3): 277-279). In this system, microRNAs are designated by a number. Previous this identification number, is the abbreviation "miR" or "mir", which allows a distinction between the mature microRNA (miR) and the precursor loop (hairpin) of the microRNA (mir), respectively corresponding to a number of MIMAT accession and MI. A prefix of three or four letters is used to distinguish the genomic origins of this miRNA. For example, "hsa-miR-126" means that this mature miRNA comes from the human genome. Sometimes mature microRNAs can be very close (only one difference basis). In this case, microRNAs bearing the same number are distinguished from each other by a lowercase letter such as a, b, c ... for example hsamiR-26b. Sometimes a precursor loop can generate, on its side 5 'and its side 3', two mature microRNAs which are distinguished from each other by the annotation "5p" or "3p". For example, "hsa-miR-151-3p" means a mature miRNA from the 3 'side of its precursor. The miRNAs used in the present invention are mature miRNAs from the human genome that can be produced naturally by cells, or synthesized by conventional chemical methods, or biological methods, such as a recombinant vector. In the present invention, the expressions "miRNA" and "microRNA" may be replaced by each other. The terms glial tumors or gliomas are equivalent. Glioblastomas and oligodendrogliomas are two types of gliomas. Healthy tissue or healthy sampling means non-tumor tissue or non-tumor sample. These singular expressions may be understood in the plural and vice versa. In an advantageous embodiment, the invention relates to the use of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miRN 20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsamiR-127, hsa-miR-151, hsa-miR-26b or hsa-miR-34b, for the implementation of an in vitro diagnostic method of glioma.

The aberrant expression of these 16 miRNAs in a glial tumor has never been mentioned by previous publications, either because the scanning of miRNAs performed in previous work is not exhaustive, (eg the study of Silber and in 2008 only 192 miRNA), or because the technique used previously does not give a higher resolution compared to the technique adopted in the invention. Indeed, the study of Ciafrè et al. in 2005, using the "microarray" technique to quantify the expression of miRNAs, does not show a significant difference between the level of expression of miR-16 in glioblastoma tissues and the level of expression of the above miRNA in normal tissues, while the present invention illustrates that miR-16 is overexpressed in glioblastomas, thanks to the quantitative PCR technique, which makes it possible to more accurately distinguish a difference in the amount of RNA between two samples. Of the 19 miRNAs identified in the invention, there are 5 miRNAs, ie, hsa-miR-155, hsa-miR-210 or hsa-miR-10a, hsa-miR-409 and hsa-miR-134. , whose expression profile is very particular. The expression pattern of these 5 miRNAs, which is different in tumors compared to that in normal tissues, is also differentiated between glioblastomas and oligodendrogliomas. Expression levels of these miRNAs are consistently higher in glioblastomas than in oligodendrogliomas (see Table 3 in Example 2). In an advantageous embodiment, the invention relates to the use of at least one miRNA selected from hsa-miR-155, hsa-miR-210 or hsa-miR-10a, hsa-miR-409 or hsamiR-134 for the implementation of a method for specific in vitro diagnosis of glioma, said method for distinguishing glioblastoma from oligodendroglioma. Another aspect of the invention is a method for in vitro diagnosis of glioma. This method can diagnose if a patient has a glioma. This method comprises the following steps: measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR -20a, hsa-let7a, hsa-let 7f, hsalet 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsamiR-151, hsa mR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a, in a biological sample from a patient suspected of having a glioma, - the comparison: - between the level of expression of at least one of said miRNA in said sample and the level of expression of said miRNA in a reference healthy sample, or - between the level of expression of at least a first miRNA in the reference sample sample from a patient suspected of having a glioma and the level of expression of at least a second said miRNA in the sample from said patient suspected of having a glioma.

The comparison of expression levels of miRNAs can be performed between a sample from a patient suspected of having a glioma and a reference healthy sample, or a reference sample from a patient with glioblastoma or a patient presenting an oligodendroglioma. The term "biological sample" is intended to mean a tissue sample, in particular brain tissue obtained by excision, or a sample of body fluids, in particular a blood sample. A brain tissue sample may be central nervous system tissue from the cerebral cortex, cerebellar cortex, basal ganglia, or brainstem nuclei. A biological fluid sample may be a blood serum or a blood plasma. In the case of a cerebral tissue specimen, "A healthy reference sample" is brain tissue devoid of any tumor character after histological analysis by pathologists. The reference healthy tissue may be central nervous system tissue from the cerebral cortex, cerebellar cortex, basal ganglia, or brainstem nuclei. The reference healthy tissue is preferably taken from the same patient (healthy tissue peripheral zone to the tumor). Alternatively it may consist of encephalic fragments obtained after surgery called cortectomy performed on individuals without brain tumors but in the context of intervention for the treatment of epilepsy or following traumatic brain injury. In the case of a sample of body fluids, "a healthy reference sample" is taken from a healthy person, including a person who is not cancer-free.

When "a biological sample from a patient suspected of having a glioma" is a cerebral tissue sample, it is a tissue taken by biopsy or excision from the operating room or any other suitable intratumoral specimen collection method. tumoral seat suspected of a patient. The suspected tumor site is previously identified by a conventional method, such as an MRI, a Pet Scan, or a conventional CT scanner. When "a biological sample from a patient suspected of having a glioma" is a blood sample, this sample is obtained from a patient by blood sampling according to conventional methods,

"A reference sample from a patient with glioblastoma or a patient presenting with an oligodendroglioma" is a sample from a patient whose presence of one of the two tumors has been certified by pathological analysis. . Ideally, the diagnosis can also be confirmed by molecular analyzes such as, for example, the analysis of the gene expression profiles of these tumor tissues. The tumors are then characterized using the Li et al classification method (Li A, Walling J, Ahn S, Kotliarov Y, Su Q, Quezado M, Oberholtzer JC, Park J, Zenklusen JC, Fine HA, Cancer Res. Mar 1; 69 (5): 2091-9) which relies on the use of the expression levels of a set of 54 genes. Glioblastomas or oligodendrogliomas are classified respectively in groups G and O of the resulting publication. "A reference sample from a patient with a glioblastoma or from a patient with an oligodendroglioma" is a brain tissue sample, the aforementioned tissue may be a glial tumor fragment obtained by excision in a patient and whose tumor type has been certified by pathological analysis.

The miRNAs measured in this method are contained in fractions of purification of RNAs obtained either from extracts or lysates from brain tissue obtained by biopsy or by excision in the operating room or any other suitable intratumoral sampling method, when is a tissue sample; either from extracts or lysates of the different fractions of biological fluids using adapted methods, when it is a sample of biological fluids. The tissue extracts used for the assays correspond to fractions obtained after lysis of the tissues and more or less thorough purification of the RNAs according to conventional methods (for example the mirVana method marketed by Ambion, or RNeasy by Qiagen, or electrophoresis purification methods ). Depending on the methods, the fractions contain total RNAs, or RNAs less than 200 bases in size, or fractions enriched in microRNAs. The miRNAs measured in a blood sample may be all circulating miRNAs in plasma or serum, or miRNAs located in the microvesicles present in the serum. All circulating miRNAs in the blood are purified directly from blood samples according to conventional methods, such as described by Mitchell PS et al. (Mitchell PS et al., Proc Natl Acad Sci US A 2008 Jul 29; 105 (30): 10513-8) or by Lodes MJ (Lodes MJ et al., PLoS One 2009 Jul 14; 4 (7): e6229). The miRNAs localized in the microvesicles present in the serum are purified according to an approach described for example by Skog et al (Skog et al., Nat Cell Biol., 2008 Dec; 10 (12): 1470-6). The term "level of expression" of a miRNA in a sample corresponds to a measurement value specific to a miRNA, but expressed either in arbitrary units, in units of mass, in molecules or in concentrations, or in values normalized by compared to another measurement, especially in standardized value relative to the amounts of the same miRNA in a reference tissue (healthy or tumor) The level of expression of miRNAs can be measured by any conventional method, such as - hybridization on "DNA microarrays", - high throughput sequencing methods for a large number of individualized miRNAs, - real-time PCR, - Northern blot, or any other specific miRNA method. The level of expression of miRNAs can be measured by the "microarray" technique. The technique of the "DNA chip" is well known to those skilled in the art. This is the hybridization of miRNAs extracted on a solid support composed of a nylon membrane, a surface of silicon or glass, optionally nano-beads or particles, comprising oligonucleotides of known sequences fixed on the support or adherents to it. The complementarity of the oligonucleotides fixed with the sequences of microRNAs or their conversion products (amplification products, cDNA, RNA or cRNA) makes it possible to generate a signal (fluorescence, luminescence, radioactivity, electrical signal, etc.) according to the techniques of labeling used at the level of immobilized oligonucleotides (DNA chips). This signal is detected by a specific device and a value of intensity of this own signal for each miRNA is thus recorded. Several types of chips for the detection of miRNAs are already on the market, such as GeneChip® miRNA marketed by Affymetrix, miRcury arrays by Exiqon, miRXplore microarrays by Miltenyi. In the case of high throughput sequencing, the miRNAs are extracted and purified from a sample, isolated from each other by methods provided by sequencing equipment suppliers such as Roche, Invitrogen. This kind of analysis consists in individualizing the molecules of the various microRNAs, performing an amplification step and sequencing the products ("nucleic acid clones") thus generated. The realization of many sequences to identify each of these "clones" (several thousand) makes it possible to generate a listing of the microRNAs present in a sample and to quantify each of these miRNAs simply by counting how many times each sequence is found in the listing. detailed. In a preferred embodiment of the invention, the miRNA assays are performed by quantitative PCR (real-time PCR). The real-time PCR makes it possible to obtain values, called Ct, corresponding to the number of cycles from which the emitted fluorescence exceeds a certain threshold, the threshold being fixed by the user at the beginning of the exponential phase. This Ct value is proportional to the amount of cDNA (derived from reverse transcription of miRNAs to cDNA by Reverse Transcriptase) initially present in the sample. In the absence of a specific standard range for each cDNA, only relative quantification between samples is possible. First, in order to be able to compare the quota of each miRNA taken individually and present in glioblastomas, oligodendrogliomas and healthy tissues, the assay values for each miRNA are normalized with the data obtained for a non-coding RNA (from the category of snoRNAs) called RNU24 (SEQ ID NO: 20). The choice of RNU24 is dictated by an analysis of the measurements of several snoRNA performed on many samples and realized using the Normfinder software. This analysis concluded that RNU24 is the most reliable normalizer in this study (its expression rate varies in fact very little between all the tissue samples used in the invention). The relative quantification of a miRNA between 2 types of samples is then obtained thanks for example to the REST software which takes into account the PCR efficiency parameter and the Ct values of the miRNA of interest and RNU24 for all analyzed samples. However, the present invention can be implemented with other standardizers known to those skilled in the art. When the expression levels of miRNAs are analyzed by hybridization on "microarrays", or by Northern blot, or by sequencing, they can be expressed by formula I: Amount of miRNAx = intensity of the detection signal for miRNAx Where " signal strength "means the amount of fluorescence, radioactivity or luminescence recorded on the" DNA chips "by the matched detector, or number of identical sequences detected by high throughput sequencing analysis. The quantities are expressed in arbitrary units. The amounts of miRNA can be normalized with respect to another assay, in particular an RNA whose concentration does not vary in the different types of samples analyzed. In particular, the tissue amount of a non-coding RNA called RNU24 has been shown by the inventors to be very stable between tumor samples and healthy tissue samples. This normalization makes it possible to ensure that the expression levels of the detectable miRNAs are compared in extracts whose RNA concentrations are similar between these different purified extracts. In this case, the standard expression level for a miRNA in a tissue sample is expressed as formula II: Normalized miRNAx quantity = detection signal intensity for miRNAx / signal strength for RNU24.

When miRNA expression levels are analyzed by real-time PCR, they can be expressed by formula III, which defines the amount of miRNA present in the assay reaction medium when the number of amplification cycles is equal to Ct (Quantity of miRNAx to Ct): Quantity of miRNAx to Ct = Quantity of miRNA to to x Efficiency cc Where "Quantity of miRNA to" refers to the amount of miRNA, or its equivalent in cDNA, at the time of the assay reaction by PCR amplification is initiated. The expression "efficacy" in formula (III) means the value of PCR efficiency (of value between 1 and 2). This value depends on various experimental parameters, and in particular on the apparatus performing the real-time PCR implemented. Once this value is measured for a particular protocol and a configured PCR machine, it is no longer necessary to measure this value each time before the calculation, unless the experimental protocol and / or the operating condition of the machine have been measured. have been modified for the given experience.

In a particular embodiment of the invention, the biological sample from a patient suspected of having a glioma is brain tissue obtained by excision, or by biopsy. This method comprises: measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsalet 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsamiR-151, hsa-miR- 26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a, in a biological tissue from a tissue suspected of having a tumor character, - the comparison: - between the level expressing at least one of said miRNAs in the suspected tissue and the level of expression of said miRNA in a reference healthy tissue, or - between the level of expression of at least a first of said miRNAs in the suspected tissue and the level of expression of at least a second aforementioned miRNA in the suspected tissue.

Comparisons of miRNA expression levels can be made between a suspected sample and a reference healthy sample. This is an inter-sample comparison.

In a first embodiment, the in vitro diagnostic method for glioma comprises: measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16 , hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsalet 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa mR-127, hsamiR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a, in a biological sample from a patient suspected of present a glioma; - the comparison between the level of expression of at least one of the above-mentioned miRNAs in the above sample and the level of expression of the above-mentioned miRNA in a reference healthy sample, and - the deduction that the suspected patient presents a glioma when the expression level of the above-mentioned miRNA in the sample from a patient suspected of having a glioma is different from the level of expression of the above-mentioned miRNA in a reference healthy sample. In an advantageous embodiment of the invention, this method comprises measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR -17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR -127, hsa-miR-151, hsa-miR-26b or hsamiR-34b. Of the 16 miRNAs identified in the invention, there are 10 miRNAs whose level of expression is consistently higher in samples from a patient with glioma compared to that in healthy reference samples, while Expression level of 6 other miRNAs is lower in samples from a patient with glioma compared to that in healthy reference samples. Thus, a particular embodiment of the in vitro diagnostic method of glioma comprises: the measurement of the level of expression is carried out for at least one of the following miRNAs: hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsalet7a, hsa-let 7f, hsa-let 7d, hsa-miR-374 or hsa-miR-26b, and - the deduction that the suspected patient presents a glioma is made when the level of expression of the above miRNA in the sample from a patient suspected of having a glioma is greater than the level of expression of the above miRNA in a reference healthy sample. Another particular embodiment of the in vitro diagnostic method of glioma comprises: the measurement of the level of expression is carried out for at least one of the following miRNAs: hsa-miR-409, hsa-miR-134, hsa mR-339, hsa-miR-127, hsa-miR-151 or hsa-miR-34b, and the inference that the suspected patient has a glioma is made when the level of expression of the above miRNA in the sample a patient suspected of having a glioma is below the level of expression of the above-mentioned miRNA in the reference healthy sample.

When the expression levels of the miRNAs are obtained by hybridization on "DNA chips" or by sequencing, the comparison of the expression levels of the same miRNA in two different samples is intended to highlight the expression modifications of a miRNA between these samples (overexpression or subexpression) is evaluated using formula IV: Normalized miRNAx (sample A) / normalized miRNAx (sample B), where A represents the suspected sample and B represents the sample. healthy reference sample. When miRNA expression levels are obtained by real-time PCR, the comparison of the expression levels of the same miRNA in two different samples can be expressed by a ratio obtained by the following formula (V): sample A / sample B) = Efficacy "ct hsa-miRNA X - Ct RNU24" sample A- (Ct hsa-miRNAX - Ct RNU24) sample B) In this case, sample A is the suspected sample; sample B is the reference healthy sample. miRNA X represents the miRNA whose level of expression is measured respectively in the reference healthy sample and the suspected sample. The Ct values for hsa-miRNA X and RNU24, respectively for the suspected sample and the reference healthy sample, are obtained directly by the real-time PCR. Variations of the levels of expression between the level of expression of a miRNA in a sample from a patient suspected of having a glioma and that of the above miRNA in a reference healthy sample can be deduced from formulas IV or V, according to the method of analysis used. In a particular embodiment of the invention, the inference that the suspected patient has a glioma is made, when the level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioma and the level of expression of the above miRNA in the reference healthy sample are different, the level of expression of the above miRNA in the sample from a patient suspected of having a glioma being at least 3 times higher or lower than the level of expression of the above miRNA in the reference healthy sample. Respectively, the result of formulas IV or V is greater than 3 or less than 0.33.

According to an advantageous embodiment, the level of expression of the above miRNA in the sample from a patient suspected of having a glioma is at least 3 times greater than the level of expression of the above miRNA in the reference healthy sample. . By the expression expression level of the above-mentioned miRNA in the sample from a patient suspected of having a glioma is at least 3 times greater than the level of expression of the above-mentioned miRNA in the reference healthy sample. means that the ratio obtained from the formulas (IV or V) is greater than a value of 3. This value means overexpression of said miRNA in the sample from a patient suspected of having a glioma relative to the sample healthy reference. In this case, in these formulas, sample A is the sample from a suspected patient; sample B is the reference healthy sample. According to another advantageous embodiment, the level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioma is at least 3 times lower than the level of expression of the above-mentioned miRNA in the healthy sample. reference. By the expression expression level of the above-mentioned miRNA in the sample from a patient suspected of having a glioma is at least 3 times lower than the level of expression of the above-mentioned miRNA in the reference healthy sample. means that the ratio calculated according to the formula (IV or V) is less than a value of 0, 33. This value means a subexpression of said miRNA in the sample from a patient suspected of presenting a glioma vis- the reference healthy sample. In this case, in these formulas, sample A is the sample from a suspected patient; sample B is the reference healthy sample. According to a particularly advantageous embodiment, the in vitro diagnosis method of glioma comprises: measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR- 16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsamiR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b, in a biological sample from a patient suspected of having a glioma, - a comparison of the level of expression of the above-mentioned miRNA in the above sample, and the level of expression of the above miRNA in a healthy reference sample, and, - the inference that the suspected patient has a glioma, when the level of expression of the above miRNA in the sample from 'a patient suspected of having a glioma and the level of expression of the above miRNA in the reference healthy sample are different, the level of expression of the above miRNA in the sample from a patient suspected of having a glioma being 3 times, notably 4 times, more particularly 5 times, higher or lower than the level of expression of the above miRNA in the reference healthy sample.

In a particular embodiment, the biological sample from a patient suspected of having a glioma is brain tissue obtained by excision, or biopsy. Said method comprises: measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsamiR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa- miR-26b, hsa-miR-34b, in a biological tissue from a tissue suspected of having a tumor character, - the comparison between the level of expression of the above-mentioned miRNA in the suspected tissue, and the level of expression of the above-mentioned miRNA in a reference healthy tissue, and, - deduction of the tumor characteristic of the suspected tissue, when the level of expression of the above-mentioned miRNA in the suspected tissue and the level of expression of the above miRNA in the reference healthy tissue. are different, the level of expression of the above miRNA in the suspected tissue being 3 times, especially 4 times, more particularly 5 times, higher or lower than the level of expression of the above miRNA in the reference healthy tissue.

Comparisons can also be made between the expression levels of two miRNAs from the same sample from a patient suspected of having a glioma. This is an intra-sample comparison, which relies on the identification of signatures specific to each tumor type. Thus, a second embodiment of an in vitro diagnostic method of glioma comprises: (i) measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa mR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa mR-339, hsa-miR-127, hsa-miR-151, hsa- miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a, in a sample from a patient suspected of having a glioma, (ii) comparing the level of expression of at least a first-mentioned miRNA in the sample from a patient suspected of having a glioma and the level of expressing at least one second aforementioned miRNA in the above sample, and (iii) the inference that the suspected patient has a glioma, when the ratio between the level of expression of the above-mentioned first miRNA and the level of expression of the aforementioned second miRNA is different from that in a pre-established abacus for a healthy reference sample, the aforementioned first miRNA and miRNA second miRNAs forming a pair.

"The relationship between the level of expression of the above-mentioned first miRNA and the level of expression of the aforementioned second miRNA" is a ratio obtained from formula (VI) below in the case of the real-time PCR assay: ) = Efficacy (Ct hsa-miRNA X - Ct hsa-miRNA Y) Ratio (hsa-miRNA X / hsa-miRNA Y) the occurrence, the first miRNA and the second miRNA, whose expression levels are compared, are respectively represented by miRNA X and miRNA Y. The Ct values for hsa-miRNA X and Ct for hsa-miRNA Y, for the sample from a suspected patient and for the reference healthy sample, are obtained directly by the Real-time PCR. The value of effectiveness is established beforehand.

In the case of an assay performed by a method other than real-time PCR, the ratio between the level of expression of the above-mentioned first miRNA and the level of expression of the aforementioned second miRNA "is a ratio obtained according to the Formula VII: Ratio (hsa-miRNA X / hsa-miRNA Y) = detection signal intensity of miRNA X / detection signal intensity of miRNA Y In this case, the first miRNA and the second miRNA, whose levels of are represented respectively by miRNA X and miRNA Y. By the expression "abacus" is meant a previously established table or graph constituted by a series of reference values. "A pre-established abacus for a reference healthy sample" means a table or graph consisting of a series of reference values obtained in a reference healthy sample. More particularly, such a reference value, which serves to establish an abacus, is a ratio (hsa-miRNA X / hsa-miRNA Y) obtained in a reference healthy sample.

The expression "the aforementioned first miRNA and miRNA pair miRNAs" means that the comparison of miRNA expression levels is performed between these two miRNAs. Depending on the number of pairs of miRNAs, a graph chart may be a two-dimensional graph, in the case of two pairs of miRNAs, or a three-dimensional graph, in the case of three pairs of miRNAs. miRNAs. Indeed, an abacus in the form of a two-dimensional or three-dimensional graph performs a double or triple separation based on two or three ratios for a sample to be tested, which makes it possible to avoid any confusion of the interpretation that may be given to a suspected sample. when this interpretation is based on a single ratio (hsa-miRNA xi hsa-miRNA Y) obtained from a suspected sample. However, any other way of establishing an abacus can be used to interpret a ratio (hsa-miRNA × hsa-miRNA Y) obtained for a sample from a suspected patient. After the establishment of an abacus, the use of healthy samples is no longer required and any new sample may be typed by the assay of a minimum of 2 miRNAs only. In an advantageous embodiment of the invention, the miRNA pairs used are as follows: hsa-let 7a / hsa-miRl27, hsa-let 7a / hsa-miR1 Sb, hsa-let 7a / hsamiR34b, hsa-miRl26 / hsa-let 7a, hsa-miRl26 / hsa-miR34b, hsa-miRl27 / hsa-let 7d, hsamiR127 / hsa-miRl5b, hsa-miR134 / hsa-let 7a, hsa-miRl34 / hsa-miRlOa, hsa-miRl51 / hsa -let 7a, hrs-miR151 / hsa-7d 7d, hsa-miR151 / hsa-let 7f, hsa-miR151 / hsa-miR15b, hsamiR15b / hsa-miR409, hsa-miR16 / hsa-miRl51, hsa-miR16 / hsa-miR339, hsa-miR16 / hsamiR34b, hsa-miR17 / hsa-miR339, hsa-miR17 / hsa-miR34b, hsa-miR17 / hsa-miR409, hsamiR20a / hsa-miR339, hsa-miR26b / hsa-miR134, hsa -mR26b / hsa-miR34b, hsa-miR26b / hsamiR409, hsa-miR339 / hsa-let 7f, hsa-miR34b / hsa-let 7f, hsa-miR374 / hsa-let 7f, hsamiR374 / hsa-miR127, hsa-miR374 / hsa-miR134, hsa-miR374 / hsa-miR339, hsa-miR374 / hsamiR34b, hsa-miR374 / hsa-miR409, hsa-miR409 / hsa-miR10a, hsa-miR155 / hsa-miR1334, hsamiR155 / hsa-miR127, hsa- miRl26 / hsa-miR409, hsa-miRl27 / hsa-let 7f, hsa-miR151 / hsamiR20a, hsa-miR 16 / hsa-miRl34, hsa-miR 1226 hrs-miR339, hsa-miR151 / hsa-miR10a, hsamiR16 / hsa-miR127, hsa-miR20a / hsa-let 7f, hsa-miR20a / hsa-miR409, hsa-miR155 / hsamiR409, hsa-miR339 / hsa-let 7d, hsa-miRl51 / hsa-miR374, hsa-miRl27 / hsa-miRlOa, hsamiR15b / hsa-let 7f, hsa-miR20 a / hs-let 7a, hsa-miR210 / hsa-miR155, hsa-miR210 / hsa- let 7a, hsa-miR26b / hsa-miR-3 39, hsa-miR26b / hsa-miR-127, hsa-miR 16 / hsa-miR-409, hsamiR127 / hsa-miR-17, hsa-miR151 / hsa-miRl26 , hsa-miR26b / hsa-miR151, hsa-miR20a / hsa- miRl27, hsa-miR339 / hsa-let 7a, hsa-miR26b / hsa-let 7f, hsa-miRl26 / hsa-miRl34, hsamiR20a / hsa-miR34b, hsa -let 7d / hsa-miR34b, hsa-miRlSb / hsa-miR339, hsa-let 7d / hsa let 7f, hsa-miRlOa / hsa let 7d, hsa-miRl26 / hsa let 7f, hsa-miRl26 / hsa-miRlOa, hsa mR1426 / hsamiR155, hsa-miR127 / hsa-miR16, hsa-miR134 / hsa-miR17, hsa-miR134 / hsa-miR409, hsamiR151 / hsa-miR17, hsa-miR155 / hsa-miR339, hsa-miR15b / hsa-miR10a , hsa-miR15b / hsamiR155, hsa-miR15b / hsa-miR34b, hsa-miR16 / hsa-miR10a, hsa-miR16 / hsa-miR16, hsamiR16 / hsa-miR155, hsa-miR16 / hsa-miR15b, hsa-miR16 / hsa -miR20a, hsa-m 1H17 / hsa let 7d, hsa-miR20a / hsa-miR10a, hsa-miR210 / hsa-miR127, hsa-miR210 / hsa-miR134, hsamiR210 / hsa-miR339, hsa-miR210 / hsa-miR409, hsa-miR26b / hsa let 7a, hsa-miR26b / hsamiR10a, hsa-miR26b / hsa-miR155, hsa-miR26b / hsa-miR15b, hsa-miR374 / hsa-miR10a, hsamiR10a / hsa-miR210, hsa-miR10a / hsa-miR3 39, hsa-miR10a / hsa-miR34b, hsa-miRl55 / hsa let 7f, hsa-miRl6 / hsa let 7a, hsa-miRl6 / hsa-miR210, hsa-miR210 / hsa let 7d, hsa-miR210 / hsamiR126, hsa-miR210 / hsa-miRl5b, hsa-miR210 / hsa-miR17, hsa-miR2 10 / hs a-miR20a, hsamiR210 / hsa-miR374, hsa-miR26b / hsa-miR210, hsa-miR16 / hsa let 7f, hsa-miR16 / hsamiR374 . The inverse ratios of those mentioned in the above list have the same meaning for the diagnosis, that is to say that we can use these ratios or their inverses. A deduction that the patient has at least one glial tumor is made, when the ratio of the expression level of two miRNAs of a couple is different from the aforesaid ratio established in a reference healthy sample. By way of example, column 2 of Table 4 illustrates a tabulated pre-established chart in reference healthy tissue for each pair of miRNAs. According to the invention, it is also possible to establish a two-dimensional or three-dimensional graph, using two or more pairs of miRNAs chosen from the miRNA pairs mentioned in the above part. By way of example, FIGS. 2-6 are graphs in the form of a two-dimensional graph, in which the diamond points representing normal tissues constitute a zone framed by the dashed-dotted rectangle. After the assay of miRNAs involved and the calculation of ratios such as those used for the establishment of the abacus, the nature of the suspected tissue can be easily spotted on this abacus, and it can be inferred that the suspected tissue is a tissue. tumor, when the point, representing the suspected tissue, does not enter the area framed by the rectangle drawn dash-dotted. By way of example also, FIG. 7 based on the use of 3 different pairs of miRNAs, the respective values of which are expressed as a percentage of the sum of the values of these 3 pairs, makes it possible to easily identify the healthy tissues with respect to the tissues. tumoral since they are characterized - in contrast to tumor tissue - by high values of the hsa-miRl34 / hsa-miR20a pair (bars in light gray) compared to the values of the other two couples in a given tissue. In an advantageous embodiment of the invention, the deduction that the suspected patient has a glioma is made when the ratio between the level of expression of the aforementioned first miRNA and the level of expression of the aforementioned second miRNA is twice, especially 3 times, more particularly 4 times, greater than the value of said ratio in a pre-established chart for a reference healthy sample. In another advantageous embodiment of the invention, the deduction that the suspected patient has a glioma is made when the ratio between the level of expression of the above-mentioned first miRNA and the level of expression of the aforementioned second miRNA is twice, in particular 3 times, more particularly 4 times, less than the value of said ratio in a pre-established chart for a reference healthy sample. An advantageous embodiment of a method for in vitro diagnosis of gliomas according to the invention comprises: (i) measuring the ratio of the level of expression of at least one pair of miRNAs chosen from hsa-let 7a / hsa- miRl27, hsa-let 7a / hsa-miRl Sb, hsa-let 7a / hsamiR34b, hsa-miRl26 / hsa-let 7a, hsa-miR126 / hsa-miR34b, hsa-miRl27 / hsa-let 7d, hsa-miR127 / hsa -mR15b, hsa-miR134 / hsa-let 7a, hsa-miR134 / hsa-miR10a, hsa-hsa-miR151 / hsa-let 7f, hsa-hsa-miRl 6 / hsa-miRl 51, hsa-hsa-miR 17 / hsa-miR3 3 9, hsa-hsa-hsa-miR26b / hsa-miR409, hsa-hsa-miR374 / hsa-let 7f, hsa-hsa-miR3 74 / hsa-miR3 3 9, hsa-hsa-miR409 / hsa- miRlOa, hsa-hsa-miRl26 / hsa-miR409, hsa-hsa-miRl6 / hsa-miRl34, hsa-hsa-miRl 6 / hsa-miRl 27, hsa-hsa-miRl55 / hsa-miR409, hsa-hsa-miRl27 / hsa-miRlOa, hsa-hsa-miR210 / hsa-miRl 55, hsa- miRl51 / hsa-let 7a, hsa-miRl51 / hsa-let 7d, miR 1 51 / hsa-miR 1 5b, hsa-miR 1 5b / hsa -MR409, miR16 / hsa-miR339, hsa-miR16 / hsa-miR34b, miR17 / hsa-miR34b, hsa-miR17 / hsa-miR409, hsa-miR20a / hsa-miR339, miR26b / hsa-miR 134, hsa-miR26b / hsa-miR34b, miR339 / hsa-let 7f, hsa-miR34b / hsa-let 7f, miR374 / hsa-miR127, hsa-miR374 / hsa-miR134, miR374 / hsa-miR34b, hsa-miR374 / hsa-miR409, miRl 55 / hsa-miRl 34, hsa-miRl 55 / hsa-miRl27, miR127 / hsa-let 7f, hsa-miR15 1 / hsa-miR20a, miR126 / hsa-miR339, hsa-miR151 / hsa- miRl Oa, hsa-miR20a / hsa-miR409, hsa-miRl51 / hsa-miR374, hsa-miR20a / hsa-let 7a, miR20a / hsa-let 7f, miR3 3 9 / hsa-7d, miR15b / hsa-let 7f , miR2 10 / hsa- let 7a, hsa-miR26b / hsa-miR-399, hsa-miR26b / hsa-miR-127, hsamiR16 / hsa-miR-409, hsa-miR127 / hsa-miR-17, hsa- miR151 / hsa-miR126, hsamiR26b / hsa-miR1 5 1, hsa-miR20a / hsa-miR127, hsa-miR3 3 9 / hsa- let 7a, hsamiR26b / hsa-let 7f, hsa-miR126 / hsa-miR134, hsa- miR20a / hsa-miR34b, hsa-let 7d / hsa-miR34b, hsa-miR15b / hsa-miR339, hsa-let 7d / hsa let 7f, hsa-miRlOa / hsa let 7d, hsa-miR126 / hsa let 7f, hs-mi miR126 / hsa-miR10a, hsa-miR126 / hsa-miR155, hsa-miR127 / hsa-miR126, hsa-miR134 / hsa-miR17, hsa-miR134 / hsa-miR409, hsa- miR151 / hsa-miR17, miR15b / hsa- miRl 55, miR16 / hsa-miRl26, miR16 / hsa-miR20a , miR210 / hsa-miRl27, miR2 10 / hsa-miR4 09, miR26b / hsa-miR1 55, miR10a / hsa-miR210, hsa-miR155 / hsa-miR339, hsa-miR15b / hsa-miR10a, hsa hsa-miRl 5b / hsa-miR34b, hsa-miRl 6 / hsa-miRl Oa, hsa-hsa-miRl 6 / hsa-miRl 55, hsa-miR16 / hsa-miRl 5b, hsa-hsa-miRl7 / hsa let 7d , hsa-miR20a / hsa-miR10a, hsa-hsa-miR2 10 / hsa-miRl 34, hsa-miR2 10 / hsa-miR3 39, hsa-hsa-miR26b / hsa let 7a, hsa-miR26b / hsa-miRlOa, hsahsa -mR26b / hsa-miR15b, hsa-miR374 / hsa-miR10a, hsahsa-miR 1 0a / hsa-miR3 39, hsa-miR10a / hsa-miR34b, hsa- miRl55 / hsa let 7f, hsa-miRl6 / hsa let 7a , hsa-miRl6 / hsa-miR210, hsa-miR210 / hsa let 7d, hsa-miR210 / hsa-miRl26, hsa-miR210 / hsa-miR15b, hsa-miR2O / hsamiR17, hsa-miR210 / hsa-miR20a, hsa mR26 / hsamiR210, hsa-miR16 / hsa17f, hsa-miR16 / hsa-miR374, in a biological sample from a patient suspected of having a glioma, (ii) deduction that the suspected patient has a glioma, when the aforementioned ratio between the level of expression of the aforementioned first mi RNA and the level of expression of the aforementioned second miRNA is 2 times, in particular 3 times, more particularly 4 times, greater or less than the value of said ratio in a pre-established abacus in a reference healthy sample.

In a particular embodiment of the invention, the biological sample from a patient suspected of having a glioma is brain tissue obtained by excision, or by biopsy. Said method comprises: (i) measuring the ratio of the level of expression of at least one pair of miRNAs chosen from hsa-let 7a / hsa-miRl27, hsa-let 7a / hsa-miRl Sb, hsa-let 7a / hsa-miR34b, hsamiR126 / hsa-let 7a, hsa-miR126 / hsa-miR34b, hsa-miRl27 / hsa-let 7d, hsa-miR127 / hsamiR15b, hsa-miR134 / hsa-let 7a, hsa-miRl34 / hsa-miRlOa , hsa-miR151 / hsa-let 7a, hsamiR151 / hsa-let 7d, hsa-miR151 / hsa-let 7f, hsa-miR151 / hsa-miR15b, hsa-miR15b / hsa- miR409, hsa-miR16 / hsa-miR151, hsa-miRl6 / hsa-miR339, hsa-miRl6 / hsa-miR34b, hsamiR17 / hsa-miR3 3 9, hsa-miR17 / hsa-miR34b, hsa-miR17 / hsa-miR409, hsa-miR20a / hsamiR3 3 9, hs-miR349 miR26b / hsa-miR134, hsa-miR26b / hsa-miR34b, hsa-miR26b / hsa-miR409, hsamiR339 / hsa-let 7f, hsa-miR34b / hsa-let 7f, hsa-miR374 / hsa-let 7f, hsa-miR374 / hsa-miRl27, hsa-miR374 / hsa-miR134, hsa-miR3 74 / hsa-miR339, hsa-miR374 / hsa-miR34b, hsamiR374 / hsa-miR409, hsa-miR409 / hsa-miR10a, hsa-miR155 / hsa mR134, hsa-miR155 / hsamiR127, hsa-miR126 / hsa-miR409, hsa-miRl27 / hsa-let 7f, hsa-miR151 / hsa-miR20a, hsamiR16 / hsa- miRl34, hsa-miR126 / hsa-miR339, hsa-miR151 / hsa-miR10a, hsa-miR16 / hsamiR127, hsa-miR20a / hsa-let 7f, hsa-miR20a / hsa-miR409, hsa-miR155 / hsa-miR409, hsamiR339 hrs-miRl51 / hsa-miR374, hsa-miRl27 / hsa-miRlOa, hsa-miR15b / hsa-let 7f, hsa-miR20a / hsa-let 7a, hsa-miR2l0 / hsa-miRl55, hs-miR154 miR210 / hsa-let 7a, hsa-miR26b / hsamiR-339, hsa-miR26b / hsa-miR-127, hsa-miR16 / hsa-miR-409, hsa-miR127 / hsa-miR-17, hsamiR151 / hsa-miRl26 , hsa-miR26b / hsa-miR151, hsa-miR20a / hsa-miRl27, hsa-miR339 / hsa-let 7a, hsa-miR26b / hsa-let 7f, hsa-miRl26 / hsa-miRl34, hsa-miR20a / hsa-miR34b , hsa-let 7d / hsamiR34b, hsa-miRlSb / hsa-miR339, hsa-let 7d / hsa let 7f, hsa-miRlOa / hsa let 7d, hsamiR126 / hsa let 7f, hsa-miRl26 / hsa-miRlOa, hsa-miR126 / hsa-miR135, hsa-miR127 / hsamiR126, hsa-miR134 / hsa-miR17, hsa-miR1334 / hsa-miR409, hsa-miR151 / hsa-miR17, hsamiR155 / hsa-miR339, hsa-miR15b / hsa-miR10a, hsa mR15b / hsa-miR155, hsa-miR15b / hsamiR34b, hsa-miR16 / hsa-miR10a, hsa-miR16 / hsa-miR16, hsa-miR16 / hsa-miR155, hsamiR16 / hsa-miR15b, hsa-miR16 / hsa-miR2 0a, hsa-miR17 / hsa let 7d, hsa-miR20a / hsa-miR10a, hsa-miR210 / hsa-miRl27, hsa-miR210 / hsa-miR134, hsa-miR210 / hsa-miR339, hsamiR210 / hsa-miR409, hsa- mR26b / hsa let 7a, hsa-miR26b / hsa-miR10a, hsa-miR26b / hsamiR155, hsa-miR26b / hsa-miR15b, hsa-miR374 / hsa-miR10a, hsa-miR10a / hsa-miR210, hsamiR10a / hsa-miR339, hsa-miRlOa / hsa-miR34b, hsa-miRl55 / hsa let 7f, hsa-miRl6 / hsa let 7a, hsa-miR16 / hsa-miR210, hsa-miR210 / hsa let 7d, hsa-miR210 / hsa-miRl26, hsa- mi miR210 / hsamiR15b, hsa-miR210 / hsa-miR17, hsa-miR210 / hsa-miR20a, hsa-miR210 / hsa-miR374, hsamiR26b / hsa-miR210, hsa-miR16 / hsa17f, hsa-miR16 / hsa-miR374, in a biological tissue from a tissue suspected of having a tumoral character, (ii) the deduction of the tumor character of the suspected tissue, when the aforesaid ratio between the level of expression of the above-mentioned first miRNA and the level of expression of the aforesaid second miRNA is 2 times, in particular 3 times, more particularly 4 times, higher or lower than the value of said ratio in an aba than pre-established in a healthy reference tissue.

The invention also relates to a method for in vitro diagnosis of glioma, for distinguishing a glioblastoma from an oligodendroglioma. In a first embodiment, this method relies solely on the implementation of 5 miRNAs identified by the inventors, namely hsa-miR-155, hsa-miR-210 or hsamiR-10a, hsa-miR-409 or hsa- miR-134, whose expression levels are consistently higher in glioblastomas compared to those in oligodendrogliomas. In this analysis mode, it is necessary to make inter-sample comparisons. This method comprises: measuring the level of expression of at least one miRNA selected from hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409 or hsa-miR-134, in a biological sample from a patient suspected of having a glioblastoma or an oligodendroglioma, - the comparison between: - the level of expression of the above miRNA in said biological sample and * respectively the level of expression of the above miRNA in a sample biological reference from a patient with glioblastoma, and * respectively the level of expression of the above miRNA in a reference biological sample from a patient having an oligodendroglioma, and - the deduction: - that the suspected patient presents a glioblastoma, when the level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is equal, within the limit of 20% more or 20% less, to the calf expression of the above miRNA in the reference sample from a patient with glioblastoma, or that the suspected patient has an oligodendroglioma, when the level of expression of the above miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is equal, within 20% plus or minus 20%, to the level of expression of the above miRNA in the reference sample from a patient with an oligodendroglioma. "A reference biological sample from a patient suspected of having a glioblastoma or oligodendroglioma" is a prevelated sample of a patient whose presence of a glial tumor is already confirmed by a method described in the above-mentioned part or by any another conventional method known to those skilled in the art, such as a histological analysis, or a scanner. Nevertheless, the exact nature or classification of the glial tumor is still unknown. A reference sample from a patient with a glioblastoma or oligodendroglioma may be a glioblastoma tissue or an oligodendroglioma obtained by excision in a patient and whose tumor type has been certified by pathological analysis, or a blood sample taken of a patient whose presence of glioblastoma or oligodendroglioma is confirmed. Ideally, the diagnosis can also be confirmed by molecular analyzes such as, for example, the analysis of the gene expression profiles of these tumor tissues. The tumors are then characterized using the Li et al classification method (Li A, Walling J, Ahn S, Kotliarov Y, Su Q, Quezado M, Oberholtzer JC, Park J, Zenklusen JC, Fine HA, Cancer Res. Mar 1; 69 (5): 2091-9) which relies on the use of the expression levels of a set of 54 genes. Glioblastomas or oligodendrogliomas are classified respectively in groups G and O of the aforementioned publication.

Since the miRNA expression levels used in this method of determining the nature of a glial tumor are consistently higher in glioblastomas than in oligodendrogliomas, when the suspected sample is from a patient with of a glioblastoma, the level of expression of one of the above-mentioned miRNA in the suspected sample is greater than the expression level of said miRNA in the reference sample from a patient presenting with an oligodendroglioma, and close to the level of expression of said miRNA in the reference sample from a patient with glioblastoma. On the other hand, when the suspected sample comes from an oligodendroglioma patient, the level of expression of one of the above-mentioned miRNAs in the suspected sample is lower than the level of expression of said miRNA in the reference sample. from a patient with glioblastoma, and close to the level of expression of said miRNA in the reference sample from a patient with an oligodendroglioma. Expression levels of miRNAs can be measured by "microarray" hybridization, sequencing, or real-time PCR.

When the assay of miRNA expression levels is performed by "microarray" hybridization or by sequencing, the comparison between the level of expression of a miRNA in the suspected sample and that in a reference sample (glioblastoma or oligodendrogliomas) is evaluated from Formula IV: Normalized miRNAx (Sample A) / Normalized miRNAx (Sample B) In this case, A represents the suspected sample and B represents a reference sample from a patient with glioblastoma or oligodendroglioma.

When assaying expression levels is obtained by real-time PCR, the comparison between the level of expression of a miRNA in the suspected sample and that in a reference sample from a patient with glioblastoma or oligodendroglioma is evaluated according to formula V below Ratio (sample A / sample B) = Efficacy "ct hsa-miRNA X - Ct RNU24) sample A (Ct hsa-miRNAX - Ct RNU24) sample B) where sample A is the suspected sample and sample B is the reference sample from a patient with glioblastoma or oligodendroglioma.

Thus, the deduction that the patient has a glioblastoma is made when: the level of expression of the above miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is at least 3 times higher than the level of expressing the above miRNA in the reference sample from a patient with an oligodendroglioma, and - the level of expression of the above miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is equal, in the limit of 20% plus or minus 20%, at the level of expression of the above miRNA in the reference sample from a patient with glioblastoma. "The level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is at least 3 times greater than the level of expression of the above-mentioned miRNA in the reference sample from of a patient presenting with an oligodendroglioma "means that the ratio between the level of expression of a miRNA in the sample from a suspected patient and the level of expression of the above miRNA in a reference sample from a Patient with an oligodendroglioma, obtained from formula IV or V, has a value equal to or greater than 3. In this case, in these formulas, sample A is the suspected sample; Sample B is the reference sample from a patient with oligodendroglioma. The expression "level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is equal, within the limit of 20% more or 20% less, at the level of expression of the above-mentioned miRNA in the reference sample from a patient with glioblastoma "means that the ratio between the level of expression of a miRNA in the suspected sample and the level of expression of the said miRNA in the sample of reference from a patient with glioblastoma, obtained from formula IV or V, has a value of 1 or between 0.8 and 1.2. In these cases, in these formulas, sample A is the suspected sample; Sample B is the reference sample from a patient with glioblastoma.

The deduction that the patient presents an oligodendroglioma is made when: - the level of expression of the above miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is at least 3 times lower than the level of expression of the said miRNA in the reference sample from a patient with glioblastoma, and - the level of expression of the above miRNA in the sample from a patient suspected of having glioblastoma or oligodendroglioma is, within 20% more or 20% less at the level of expression of the above miRNA in the reference sample from a patient having an oligodendroglioma. "The level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is at least 3-fold lower than the level of expression of the above miRNA in the reference sample from of a patient with glioblastoma "means that the ratio between the level of expression of a miRNA in the suspected sample and the level of expression of the above miRNA in a reference sample from a patient with glioblastoma, obtained from formula IV or V, has a value equal to or less than 0.33.

In these cases, in these formulas, sample A is the suspected sample; Sample B is the reference sample from a patient with glioblastoma. The expression "level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is equal, within the limit of 20% more or 20% less, at the level of expression of the above miRNA in the reference sample from a patient with an oligodendroglioma "means that the ratio between the level of expression of a miRNA in the suspected sample and the level of expression of the above miRNA in a sample reference number from a patient having an oligodendroglioma, obtained from formula IV or V, has a value of 1 or between 0.8 and 1.2. In these cases, in these formulas, sample A is the suspected sample; Sample B is the reference sample from a patient with oligodendroglioma. In summary of R19 and R20, when the suspected sample comes from a patient with glioblastoma, the ratio between the level of expression of a miRNA in the suspected sample and the level of expression of the said miRNA in the reference sample from a patient with glioblastoma is close to the value of 1, and the ratio between the level of expression of a miRNA in the suspected sample and the level of expression of the above-mentioned miRNA in the reference sample from a patient with an oligodendroglioma is greater than 3. On the other hand, when the suspected sample is from a patient with an oligodendroglioma, the ratio of the level of expression of a miRNA in the suspected tissue and the level of expression of the above miRNA in the reference sample from a patient with an oligodendroglioma is close to the value of 1, and the ratio between the level of expression of a miRNA in the sample knew and the level of expression of the above miRNA in the reference sample from a patient with glioblastoma is less than 0.33. More particularly, this method therefore comprises the following steps: (i) measuring the level of expression of at least one miRNA selected from hsa-miR-155, hsa-miR-210 or hsa-miR-10a, hsa-miR -409 or hsa-miR-134, in a biological sample from a patient suspected of having glioblastoma or oligodendroglioma, (ii) the comparison between: - the level of expression of the above miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma and * respectively the level of expression of the above miRNA in the reference sample from a patient with a glioblastoma, and * respectively the level of expression of the said miRNA the sample reference material from a patient presenting with an oligodendroglioma, (iii) the deduction: - that the aforementioned patient has a glioblastoma, * when the level of expression of the above miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is equal, within a limit of 20% plus or minus 20%, to the level of expression of the above miRNA in the reference sample from a patient with glioblastoma, and * when the level of expression of the above miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is at least 3 times greater than the level of expression of the above miRNA in the sample from a patient with an oligodendroglioma, - the patient presents with an oligodendroglioma, * when the level of expression of the above miRNA in the sample from a patient suspected of having a glioblastoma or oligodendroglioma is equal, up to a limit of 20% more or 20% by least, at the level of expression of the above miRNA in the reference sample from a patient presenting with an oligodendroglioma, and * when the level of expression of the above miRNA in the sample p from a patient suspected of having a glioblastoma or oligodendroglioma is at least 3-fold lower than the level of expression of the above-mentioned miRNA in the sample from a patient with glioblastoma.

In a particular embodiment of the invention, the biological sample from a patient suspected of having a glioma is brain tissue obtained by excision, or by biopsy. The method comprises: (i) measuring the level of expression of at least one miRNA selected from hsa-miR-155, hsa-miR-210 or hsa-miR-10a, hsa-miR-409 or hsa-miRN 134, in biological tissue from tumor tissue suspected to be glioblastoma tissue or oligodendroglioma tissue, (ii) comparison between: - the level of expression of the above miRNA in the suspected tissue and * respectively the level of expression of the above miRNA in a reference glioblastoma tissue, and * respectively the level of expression of the above miRNA in a reference oligodendroglioma tissue, and (iii) the deduction: - that the suspected tissue is a glioblastoma, * when the level of expression of the above miRNA in the suspected tissue is equal, within the limit of 20% more or less, in particular 15%, more particularly 10%, at the level of expression of the above miRNA in the reference glioblastoma tissue, and * when the level of expression of the above miRNA in the tissue suspected is at least 3 times higher than the level of expression of the above miRNA in the reference oligodendroglioma tissue, or that the suspected tissue is an oligodendroglioma, * when the level of expression of the above miRNA in the suspected tissue is equal , in the limit of 20% more or less, in particular 15%, more particularly 10%, at the level of expression of the above miRNA in the reference oligodendroglioma tissue, and * when the level of expression of the above miRNA in the suspected tissue is at least 3 times lower than the level of expression of the above-mentioned miRNA in the reference glioblastoma tissue. A second embodiment of a method for in vitro diagnosis of gliomas, which makes it possible to distinguish a glioblastoma from an oligodendroglioma, consists of sub-sample comparisons. This method is based on an intra-sample comparison of the level of expression of two miRNAs, one of which is one of the 5 specific miRNAs with higher levels of expression in glioblastomas compared to those in oligodendrogliomas, the other is selected from the remaining 14 miRNAs remaining from the set of 19 miRNAs defined above. This method comprises: (i) measuring the expression level of the miRNAs in at least one pair of miRNAs consisting of: * a miRNA selected from hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa -mR-409 or hsa-miR-134, and * a miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsamiR-20a, hsa-let7a, hsa 7f, hsa-let 7d, hsa-miR-374, hsa-miR-339, hsa-miR-127, hsamiR-151, hsa-miR-26b, hsa-miR-34b, for a biological sample from a patient suspected of presenting a glioblastoma or oligodendroglioma, said measurement making it possible to establish the ratio of the level of expression for a said pair of miRNAs, (ii) the comparison between: the aforementioned ratio of the level of expression for a pair of miRNAs and, - that represented in a pre-established abacus for a reference healthy sample, a reference sample from a patient with a glioblastoma, and a reference sample from a patient presenting with an oligodendrogli ome, (iii) the deduction: * that the patient has a glioblastoma, when the difference between the ratio obtained in step (i) and the ratio in a pre-established chart in a reference sample from a patient with a glioblastoma is less than 20%, especially 15%, more particularly 10%, vis-à-vis the ratio in a pre-established abacus, * is that the patient has an oligodendroglioma, when the difference between the ratio obtained in step (i ) and the ratio in a pre-established abacus in a reference sample from a patient having an oligodendroglioma is less than 20%, especially 15%, more particularly 10%, vis-à-vis the ratio in a pre-established abacus. In this method, the intra-sample comparison of the level of expression of two miRNAs is expressed by a ratio (hsa-miRNA xi hsa-miRNA Y), calculated according to the formulas (VI or VII). miRNA X is selected from hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409 or hsa-miR-134, and miRNA Y is selected from all 14 miRNAs defined above. In this method the use of the inverse of the ratios mentioned above retains all its value for the identification of the samples. The difference between this ratio and a pre-established abacus is expressed by a given percentage value, calculated according to formula (VIII): 1Report (hsa-miRNA X / hsa-miRNA Y) - RapportabaquelX1OO / RappOrtabaque • RappOrtabaque, which is in a pre-established abacus, is a ratio (hsa-miRNA X / hsa-miRNA Y) obtained in a reference sample from a patient with glioblastoma or oligodendroglioma. This method using a pre-established abacus avoids the use of healthy samples or tumor reference. Any new sample can be analyzed by assaying only a few miRNAs. For example, columns 3 and 4 of Table 4 give a pre-established chart respectively in the reference sample from a patient with glioblastoma or oligodendroglioma, for each pair of miRNAs. An abacus can also be presented as a two-dimensional or three-dimensional graph. In an abacus in the form of a two-dimensional graph, such as the abacus illustrated in FIGS. 2-6, by way of example, two sets of ratios obtained in the reference glioblastoma tissue give a zone framed by a rectangle in FIG. dotted line; two series of ratios obtained in the reference oligodendroglioma tissue give a zone framed by a rectangle drawn with dashes. It can be deduced that a suspected tissue is a tissue of glioblastoma, when the position fixed by two respectively obtained reports of this suspected tissue is included in the dotted rectangle covering the squares representing the reference glioblastomas. In contrast, a suspected tissue is an oligodendroglioma tissue, when the position fixed by two respectively obtained reports of this suspected tissue enters the rectangle drawn with dashes covering the triangles representing the reference oligodendrogliomas. In an advantageous embodiment, the miRNA pairs used are the following: hsa-miRl27 / hsa-miR409, hsa-miR210 / hsa-miR34b, hsa-let 7f / hsa-miR10a, hsamiR155 / hsa-miR17, hsa-miR155 / hsa-miR374, hsa-let 7a / hrs-miR 409, hsa-let 7d / hsamiR409, hsa-miRl34 / hsa-let 7f, hsa-let 7f / hsa-miR409, hsa-miRl34 / hsa-let 7d, hsamiR151 / hsa-miR155, hsa-miR155 / hsa-miR34b, hsa-miR15b / hsa-miR134, hsa-miR1334 / hsamiR20a, hsa-miR210 / hsa-let 7f, hsa-miR20 / hsa-miR15. In a particular embodiment of the invention, the biological sample from a patient suspected of having a glioma is brain tissue obtained by excision, or by biopsy. The method comprises: (i) measuring the expression level of the miRNAs of a pair selected from hsamiR127 / hsa-miR409, hsa-miR210 / hsa-miR34b, hsa-let 7f / hsa-miR10a, hsa-miR155 / hsa - miRl7, hsa-miRl55 / hsa-miR374, hsa-let 7a / hsa-miR 409, hsa-let 7d / hsa-miR409, hsamiRl 34 / hsa- let 7f, hsa-let 7f / hsa-miR409, hsa-miR134 hrs-miR15 1 / hsa-miRl5, hsa-miR155 / hsa-miR34b, hsa-miR15b / hsa-miR134, hsa-miR134 / hsa-miR20a, hsamiR210 / hsa-let 7f, hsa-miR20 / hsa-miRl55, for a biological tissue originating from a tumor tissue suspected of being a glioblastoma tissue or an oligodendroglioma tissue, (ii) the comparison between: - the aforementioned ratio of the level of expression for a pair of miRNAs and, * the one shown in a pre-established abacus for a reference healthy tissue, a reference glioblastoma tissue, and a reference oligodendroglioma tissue, (iii) the deduction: * that the suspected tissue is a glioblastoma, when the difference between the report obtained in step (i) and the ratio in a pre-established abacus in a reference glioblastoma tissue is less than 20%, especially 15%, more particularly 10%, vis-à-vis the ratio in a pre-established abacus, * or that the suspected tissue is an oligodendroglioma, when the difference between the ratio obtained in step (i) and the ratio in a pre-established abacus in a reference oligodendroglioma tissue is less than 20%, especially 15%, more particularly 10%, the report in a pre-established abacus.

The invention particularly relates to a method for in vitro diagnosis of glioma, to clarify whether a patient suspected of having a glioma is affected by a glioblastoma or an oligodendroglioma. This method comprises: - i) the determination, according to one of claims 4 to 17, of the presence of glioma in a patient suspected of having a glioma, - ii) the deduction, according to one of claims 18 to 22, said patient has a glioblastoma or the suspected patient has an oligodendroglioma. The first embodiment of this method consists of comparisons of miRNA expression levels between the suspected sample and the reference samples. More specifically, this method comprises: i) measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa -MR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa mR-151, hsa- miR-26b or hsa-miR-34b, in a biological sample from a patient suspected of having a glioma, ii) comparing the levels of expression of the above miRNA in the above sample and in a reference healthy sample, - iii) the deduction that the patient has a glioma, when the level of expression of the above miRNA in the sample from the above patient and the level of expression of the above miRNA in the healthy sample are different, the level of expression of the above-mentioned miRNA in the sample from the above-mentioned patient being 3 times, in particular 4 times, more particularly 5 times, higher or lower than the level of expression of the said miRNA in the reference healthy sample; iv) measuring the level of expression of at least one miRNA selected from hsa-miR-155, hsa-miR-210 or hsa-miR-10a, hsa-miRN; 409 or hsa-miR-134, in said biological sample from a patient presenting with a glioma; v) the comparison between: the level of expression of the above miRNA in the above sample and the level of expression of the said miRNA in a reference sample from a patient with glioblastoma, and * respectively the level of expression of the above miRNA in a reference sample from a patient having an oligodendroglioma, and - vi) the deduction: - either that the patient has a glioblastoma, when the level of expression of the above miRNA in the sample from the above patient is equal, within the limit of 20% more or 20% less, to the level of expression of the above miRNA in the reference sample from a pre-patient feeling glioblastoma, or that the patient has an oligodendroglioma, when the level of expression of the above miRNA in the sample from the above patient is equal, within the limit of 20% more or 20% less, at the level of expression of the above miRNA in the reference sample from a patient having an oligodendroglioma. In a particular embodiment of the invention, the biological sample from a patient suspected of having a glioma is brain tissue obtained by excision, or by biopsy. The method comprises: - (i) measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR -20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-3 74, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa- miR-151, hsamiR-26b or hsa-miR-34b, - ii) comparison of the levels of expression of the above miRNA in the suspected tissue and in a reference healthy tissue, - iii) deduction of the tumor characteristic of the suspected tissue when the level of expression of the above miRNA in the suspected tissue and the level of expression of the above miRNA in the reference healthy tissue are different, the level of expression of the above miRNA in the suspected tissue being 3 times, especially 4 time, more particularly 5 times, greater or less than the level of expression of the above miRNA in the reference healthy tissue, - iv) measuring the level of expression of at least one miRNA selected from hsa-miR-155, hsa -miR-210 or hsa-miR-10a, hsa-mi R-409 or hsa-miR-134, in said biological tissue determined in the previous step to have a tumor character, - v) the comparison between: - the level of expression of the above miRNA in the aforesaid tissue and * respectively the level of expression of the above miRNA in a reference glioblastoma tissue, and * respectively the level of expression of the above miRNA in a reference oligodendroglioma tissue, and - vi) the deduction: - either that the aforesaid tissue is a glioblastoma, when the expression level of the above-mentioned miRNA in the suspected tissue is equal, within the limit of 20% plus or minus 20%, to the level of expression of the above-mentioned miRNA in the reference glioblastoma tissue, - either that the above-mentioned tissue is an oligodendroglioma, when the level of expression of the above-mentioned miRNA in the suspected tissue is equal, within a limit of 20% more or 20% less, to the level of expression of the above-mentioned miRNA in the tissue of the reference oligodendroglioma.

In an advantageous mode, this method makes it possible to determine directly whether a glioblastoma or an oligodendroglioma is present in a patient suspected of having a glioma. It is no longer necessary to perform a first step relating to the determination of the presence of gliomas in the aforesaid patient. The realization of this method makes use of 5 specific miRNAs identified in the invention, namely hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409, and hsa-miR-134, whose expression levels are significantly different between samples from patients with glioma and samples from a healthy person, and consistently higher in samples from patients with glioblastoma compared to those from patients with oligodendroglioma. This method is carried out according to the following steps: (i) measuring the level of expression of at least one miRNAs chosen from hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409 or hsa-miR-134, in a biological sample from a patient suspected of having a glioma, (ii) a comparison between the level of expression of the above-mentioned miRNA in the above sample and * the level of expression of the aforesaid miRNA in a reference healthy sample, and * respectively the level of expression of the above miRNA in a reference sample from a patient with a glioblastoma, and * respectively the level of expression of the above miRNA in a reference sample from of a patient presenting with an oligodendroglioma, (iii) the deduction: * that the patient does not present a glioma, when the level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioma is equal , in the limi 20% more or 20% less, at the level of expression of the above miRNA in the reference healthy sample, * either the patient has a glioblastoma, - when the level of expression of the above miRNA in the sample from a patient suspected of presenting with glioma is equal, within 20% plus or minus 20%, to the level of expression of the above-mentioned miRNA in the reference sample from a patient with glioblastoma and when the level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioma is at least 3 times greater than the level of expression of the above-mentioned miRNA in the reference sample from a patient presenting with an oligodendroglioma, * that the patient presents an oligodendroglioma, - when the level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioma is equal, within the limit of 20% more or 20% less s, at the level of expression of the above miRNA in the reference sample from a patient with an oligodendroglioma, and - when the level of expression of the above miRNA in the sample from a patient suspected of having a glioma is at least 3 times lower than the level of expression of the above miRNA in the reference sample from a patient with glioblastoma.

In a particular embodiment of the invention, the biological sample from a patient suspected of having a glioma is brain tissue obtained by excision, or by biopsy. The method comprises: (i) measuring the level of expression of at least one miRNAs selected from hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409 or hsa-miRNs; 134, in a biological tissue from a tissue suspected of having a tumor character, (ii) the comparison between the level of expression of the above-mentioned miRNA in the above-mentioned suspected tissue and * the level of expression of the above-mentioned miRNA in a reference healthy tissue, and * respectively the level of expression of the above miRNA in a reference glioblastoma tissue, and * respectively the level of expression of the above miRNA in a reference oligodendroglioma tissue, (iii) the deduction: * that the aforesaid tissue is a healthy tissue, when the level of expression of the above miRNA in the suspected tissue is equal, within the limit of 20% more or 20% less, to the level of expression of the above miRNA in the reference healthy tissue, * that the above-mentioned tissue is a glioblastoma, - when the level of expression of the above miRNA in the suspected tissue is equal, within 20% plus or minus 20%, to the level of expression of the above miRNA in the reference glioblastoma tissue, and - when the level of expression of the above-mentioned miRNA in the suspected tissue is at least 3 times greater than the level of expression of the above miRNA in the reference oligodendroglioma tissue, * that the above-mentioned tissue is an oligodendroglioma, - when the level of expression of the aforesaid miRNA in the suspected tissue is equal, within 20% plus or minus 20%, to the level of expression of the above miRNA in the reference oligodendroglioma tissue, and - when the level of expression of the above miRNA in the suspected tissue is at least 3 times lower than the level of expression of the above-mentioned miRNA in the reference glioblastoma tissue.

Advantageously, the determination of the precise nature of a glial tumor suspected of being present in a patient is carried out according to the following steps: (i) measuring the level of expression of at least one miRNAs chosen from hsamiR-409 or hsa-miR-134, in a biological sample from a patient suspected of having a glioma, (ii) the comparison between the level of expression of the above-mentioned miRNA in the above sample and * the level of expression of the said miRNA respectively in a reference healthy sample, and * respectively the level of expression of the above miRNA in a reference sample from a patient with glioblastoma, and * respectively the level of expression of the above miRNA in a reference sample from a patient presenting with an oligodendroglioma, (iii) the deduction: * that the patient does not present a glioma, when the level of expression of the above miRNA in the sample from the the said patient is equal, within a limit of 20% more or 20% less, to the level of expression of the above miRNA in the reference healthy sample, * that the patient has a glioblastoma, - when the level of Expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioma is equal, within the limit of 20% plus or minus 20%, to the level of expression of the above-mentioned miRNA in the reference sample from of a patient with glioblastoma, and - when the level of expression of the above-mentioned miRNA in the sample from a patient suspected of having a glioma is at least 3 times greater than the level of expression of the above-mentioned miRNA in the reference sample from a patient presenting with an oligodendroglioma, * that the patient presents an oligodendroglioma, - when the level of expression of the above miRNA in the sample from a patient suspected of having a glioma is equal, in the a limit of 20% plus or minus 20%, at the level of expression of the above miRNA in the reference sample from a patient with an oligodendroglioma, and - when the level of expression of the above miRNA in the sample from a patient suspected of having a glioma is at least 3-fold lower than the level of expression of the above-mentioned miRNA in the reference sample from a patient with glioblastoma.

The second embodiment of the in vitro diagnostic method of glioma, to determine that a patient has a glioma and to determine the precise nature of the glioma, consists of comparisons of intra-sample miRNA expression levels. This method comprises (i) measuring at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsamiR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a, in a biological sample from a patient suspected of having a glioma, (ii) a comparison of the level of expression of at least a first aforesaid miRNA in the biological sample of the patient suspected of having a glioma and the level of expression of at least a second aforesaid miRNA in the biological sample of the suspected patient, the aforementioned first miRNA and second miRNA forming a pair of miRNAs, and (iii) the deduction that the patient has a glioma, when the ratio between the level of expression of the above-mentioned first miRNA and the level of expression of the aforementioned second miRNA is 2 times, in particular 3 times, more particularly 4 times, sup less than that of a pre-established abacus in a reference healthy sample, (iv) measuring the ratio of the level of expression of at least one pair of miRNAs consisting of: * a miRNA selected from hsa-miR-155 , hsa-miR-210, hsa-miR-10a, hsa-miR-409 or hsa-miR-134, and * a miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa mR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsamiR-339, hsa-miR-127, hsa-miR-151, hsa-miR -26b, hsa-miR-34b for a sample from the aforesaid patient, said measurement making it possible to establish the ratio of the level of expression for a said pair of miRNAs, (v) the comparison between: - the aforesaid ratio of the level of expression for a pair of miRNAs and, - the ratio in a pre-established abacus in a reference healthy sample, the reference sample from a patient with glioblastoma, and the reference sample from a patient with a oligodendroglioma, (vi) the deduction: * that the patient has a glioblastoma, when the difference between the ratio obtained in step (iv) and the ratio in a pre-established abacus in a reference sample from a patient with a glioblastoma is less than 20% , especially 15%, more particularly 10%, vis-à-vis the ratio in a pre-established abacus in a reference sample from a patient with a glioblastoma, * that the patient has an oligodendroglioma, when the difference between the report obtained in step (iv) and the ratio in a pre-established abacus in a reference sample from a patient having an oligodendroglioma is less than 20%, especially 15%, more particularly 10%, with respect to the ratio in a pre-established abacus in a reference sample from a patient presenting with an oligodendroglioma.

In a particular embodiment of the invention, the biological sample from a patient suspected of having a glioma is brain tissue obtained by excision, or by biopsy. The method comprises: (i) measuring at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a , hsa-let 7f, hsa-let 7d, hsamiR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b , hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a, in a biological tissue from a tissue suspected of having a tumor character, (ii) the comparison between the level expressing at least a first of the above-mentioned miRNAs in the suspected tissue and the level of expression of at least a second aforesaid miRNA in the suspected tissue, the aforementioned first miRNAs and miRNAs forming a pair of miRNAs, and (iii ) the deduction of the tumor characteristic of the suspected tissue, when the ratio between the level of expression of the above-mentioned first miRNA and the level of expression of the aforementioned second miRNA is 2 times, in particular 3 times, more particularly 4 times, greater or less than that of a pre-established abacus in a healthy tissue reference, (iv) measuring the ratio of the expression level of at least one pair of miRNAs consisting of: * a miRNA selected from hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa -mR-409 or hsa-miR-134, and * a miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a , hsa-let 7f, hsa-let 7d, hsa-miR-374, hsamiR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b for a biological tissue derived from a tumor tissue suspected to be a glioblastoma tissue or oligodendroglioma tissue, said measurement making it possible to establish the ratio of the level of expression for a said pair of miRNAs, (v) the comparison between: * the aforesaid report the level of expression for a pair of miRNAs and, * the ratio in a pre-established abacus in a reference healthy tissue, a reference glioblastoma tissue, and a reference oligodendroglioma tissue, (vi) the deduction: * that the tissue suspected is a glioblastoma, when the difference between the ratio obtained in step (iv) and the ratio in a pre-established abacus in a reference glioblastoma tissue is less than 20%, especially 15%, more particularly 10%, vis-à-vis the ratio in a pre-established chart in a reference glioblastoma tissue. or that the suspected tissue is an oligodendroglioma, when the difference between the ratio obtained in step (iv) and the ratio in a pre-established abacus in a reference oligodendroglioma tissue is less than 20%, especially 15%, more particularly 10%, vis-à-vis the ratio in a pre-established abacus in a reference oligodendrogliome tissue.

In an advantageous mode, this method makes it possible to directly determine the precise nature of a tissue suspected of having a tumor character, without the need to perform a step of determining the presence of gliomas in a suspected tissue. This method is carried out according to the following steps: (i) the measurement of the ratio of the level of expression of at least one pair of miRNAs miR409, chosen from hsa-let 7a / hsa-miR 409, hsa-let 7d / hsahsa- miRl34 / hsa-let 7f, hsa-let 7f / hsa-miR409, hsa- miR134 / hsa-let 7d, hsa-miR151 / hsa-miR155, hsa-miR155 / hsamiR34b, hsa-miR15b / hsa-miR1334, hsa-miR13 / hsa-miR20a, hsamiR210 / hsa-let 7f, (Table 7) in a biological sample from a patient suspected of presenting a glioma, (ii) the comparison between:, the above-mentioned level of expression ratio for a couple of miRNAs, and - the ratio in a pre-established abacus respectively in a reference healthy sample, the reference sample from a patient with glioblastoma, and the reference sample from a patient presenting with an oligodendroglioma, (iii ) the deduction: * that the patient does not present a glioma, when the difference between the ratio obtained in step (i) and the report in a pre-established abacus in a reference healthy sample is less than 20%, in particular 15%, more particularly 10%, with respect to the ratio in a pre-established abacus in a reference healthy sample. * that the patient has a glioblastoma, when the difference between the ratio obtained in step (i) and the ratio in a predefined abacus in a reference sample from a patient with a glioblastoma is less than 20%, especially 15%, more particularly 10%, with respect to the ratio in a pre-established abacus in a reference sample from a patient presenting with a glioblastoma, * that the patient presents an oligodendroglioma, when the difference between the ratio obtained in step (i) is the ratio in a pre-established abacus in a reference sample from a patient having an oligodendroglioma is less than 20%, especially 15%, more particularly 10%, vis-à-vis the ratio in a pre-established abacus in a reference sample from a patient presenting with an oligodendroglioma.

In a particular embodiment of the invention, the biological sample from a patient suspected of having a glioma is brain tissue obtained by excision, or biopsy. The method comprises: (i) measuring the ratio of the level of expression of at least one pair of miRNAs selected from hsa-let 7a / hsa-miR 409, hsa-let 7d / hsa-miR409, hsa-miRl34 / hsa -let 7f, hsa-let 7f / hsa-miR409, hsa-miR 134 / hsa-let 7d, hsa-miR151 / hsa-miR155, hsa-miR155 / hsa-miR34b, hsa-miRlSb / hsa-miRl34, hs-miR409 miRl34 / hsa-miR20a, hsa-miR2l0 / hsa-let 7f, (Table 7) in a biological tissue from a tissue suspected of having a tumor character, (ii) the comparison between: - the aforesaid ratio of the level of expression for a pair of miRNAs, and - the ratio in a pre-established abacus respectively in a reference healthy tissue, a reference glioblastoma tissue, and a reference oligodendroglioma tissue (iii) the deduction: * that the aforesaid tissue is a healthy tissue, when the difference between the ratio obtained in step (i) and the ratio in a pre-established abacus in a reference healthy tissue is less than 20%, in particular 15%, more particularly 10%, v in relation to the ratio in a pre-established abacus in a reference healthy tissue. that the above-mentioned tissue is a glioblastoma tissue, when the difference between the ratio obtained in step (i) and the ratio in a pre-established abacus in a reference glioblastoma tissue is less than 20%, especially 15%, more particularly 10%, vis-à-vis the ratio in a pre-established abacus in a reference glioblastoma tissue. or that the aforesaid tissue is an oligodendroglioma tissue, when the difference between the ratio obtained in step (i) is the ratio in a pre-established abacus in a reference oligodendroglioma tissue is less than 20%, especially %, more particularly 10%, vis-à-vis the ratio in a pre-established abacus in a reference oligodendrogliome tissue.

In one embodiment of the invention, the expression level of the miRNAs is assayed by real-time PCR. In another embodiment, the expression level of the miRNAs is assayed by hybridization on "DNA chips" or by high throughput sequencing, or Northern blot. In one embodiment according to the invention, a biological sample is selected from a tissue sample, in particular brain tissue obtained by excision, or a sample of biological fluid, in particular a blood sample. The invention also relates to an in vitro diagnostic kit for glioma, this kit comprising the means for assaying at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR -17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsamiR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127 , hsa-miR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a. In a particular embodiment according to the invention, this kit comprises the means for assaying at least one miRNA selected from hsa-miR-155, hsa-miR-210 or hsa-miR-10a, hsamiR-134 or hsa-miRN. 409. This in vitro diagnostic glioma kit may include, by way of example, reverse transcriptase, DNA polymerase, such as Hot start, buffer, an RNase inhibitor, dNTPs, oligonucleotides amplification primers, specific probes such as the Taqman @ probe, or aspecific markers such as SYBR Green. The invention also relates to a method for evaluating the effectiveness of a glioma treatment method. This method comprises: measuring the level of expression of at least one miRNA selected from hsamiR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa- let7a, hsa- let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsamiR-127, hsa-miR-151, hsa-miR- 26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a in a biological sample from a patient undergoing glioma treatment, and possibly - the comparison between - the level expressing said miRNA in the biological sample from said patient, and - respectively, the level of expression of said miRNA a reference sample from a patient presenting with a glioblastoma, and respectively the level of expression of said miRNA. in a reference sample from a patient with an oligodendroglioma. In one advantageous embodiment, this method makes it possible to evaluate the effectiveness of a method of treating glioma, for example, a surgical procedure, a chemotherapy or a radiotherapy.

The present invention is illustrated by the following figures and examples. Figure 1: The figure illustrates the categories of microRNAs overexpressed in gliomas compared to healthy tissue (diamond points); microRNAs under-expressed in gliomas relative to healthy tissue (squares); and microRNA overexpressed in glioblastoma (GBM) compared to oligodendrogliomas (ODG) (triangles). The y-axis represents the values of the ratios of the amounts of each miRNA in oligodendrogliomas to the amount of these miRNAs in healthy tissue (ODG / N). The x-axis represents the values of the ratios of the amounts of each miRNA in glioblastomas to the amount of these miRNAs in healthy tissue (GBM / N). Figure 2: Figure 2 illustrates clustering to distinguish GBM, ODG, healthy tissue based on the 12 ratios present respectively in Tables 4, 5, 6, 7. Ratio values for 4 samples of healthy tissue, 3 oligodendrogliomas and 4 glioblastomas make it possible to construct tissue sorting into three distinct and coherent groups in terms of tissue identity (dendrogram at the top of the MeV-Multiexperiment viewer software cluster v4.4-TM4 software suite MeV team-1, T4 M4, 00rg). Figure 3: Figure 3 illustrates the identification of normal tissues (diamond points in dashed-dotted rectangle), glioblastomas (square dots in dashed rectangle) and oligodendrogliomas (triangular dots in rectangle drawn with dashes). ), by assaying 4 miRNAs (let 7a, miR409, miRl55 and miR34b), and based on the values of the let7a / miR409 and miR155 / miR34b ratios. Figure 4: Figure 4 illustrates the identification of normal tissues (diamond points in the dotted-dotted rectangle), glioblastomas (square dots in the dashed rectangle) and oligodendrogliomas (triangular dots in the rectangle drawn with dashes), by assay of 3 miRNAs (miRl55, miR34b and miRl5l), and based on the ratio values miRl55 / miR34b and miRl5l / miRl55. Figure 5: Figure 5 illustrates the identification of normal tissues (diamond points in dashed-dotted rectangle), glioblastomas (square dots in the dashed rectangle) and oligodendrogliomas (triangular dots in the rectangle drawn with dashes), by assaying 4 miRNAs (let 7d, miR409, miRl34 and miR20), and based on the values of the let7d / miR409 and miR134 / miR20 ratios. Figure 6: Figure 6 illustrates the identification of normal tissues (diamond points in dashed-dotted rectangle), glioblastomas (square dots in the dashed rectangle) and oligodendrogliomas (triangular dots in the rectangle drawn with dashes). ), by assaying 4 miRNAs (let 7a, miR409, miRl34 and let-7f), and on the basis of the values of the let7a / miR409 and miR134 / let-7f ratios Figure 7: Figure 7 illustrates the values of the ratios miRl55 / miR34b (series 1), miRl34 / miR20 (series 2) and miR26b / miRl34 (series 3), expressed as a percentage (stacked bars 100%). These values distinguish visually oligodendrogliomas (lines 9-11), normal tissues (lines 5-8), and glioblastomas (lines 1-4).

Examples

Example 1: Materials and Methods

Tissue samples The tumor samples (8 glioblastomas and 4 oligodendrogliomas) as well as the healthy tissue samples (cortectomies) are obtained after neurosurgeons excision in the operating room and are immediately frozen at -80 ° C. Tissue sections of approximately 40 μm thickness are then made using a cryotome in sufficient number to obtain about 80 mg of tissue and stored at -80 ° C until RNA extraction.

Biological Fluids For the purification of circulating microRNAs in the blood, blood samples are taken from patients on PAXGene Blood RNA sampling tubes (PreAnalytix-Qiagen - BD Company). The total lysis of the circulating cells is carried out and the RNAs are collected by centrifugation and purified according to the indications of the supplier. With regard to the microRNA fractions contained in microvesicles produced by tumors and present in the blood, the method used is directly based on that described by Skog et al (2008). The microvesicles are purified from the sera by centrifugation and microfiltration. The sera are centrifuged a first time for 10 min at 300 g, then the supernatants are then centrifuged for 20 min at 17000 g and filtered through a 0.22 micron filter. Microvesicles are obtained by ultracentrifugation of the filtrate at 110000g for 70 min. The pellet is finally resuspended in phosphate buffer (PBS) and the RNAs are extracted according to the protocol described below.

RNA extraction The RNAs are extracted using the hsa-miRVanaTM kit (Ambion, ABI) to separate the long RNAs (size> 250 nt) from the short RNAs (size <250 nt) according to the supplier's recommendations. The tissue is first lyzed, the RNAs are then precipitated after addition of sodium acetate and ethanol, extracted in the presence of a phenol / chloroform mixture, separated according to their size on a chromatographic column, and then eluted. The eluted RNAs are then quantified by measuring the OD at 260 nm using the Nanodrop ND-1000 spectrophotometer and a quality control of these RNAs is performed by electrophoretic migration in a polymer gel on the BioAnalyser 2100 using the RNA 6000 nano kit. @ LabChip (Agilent).

The dose of miRNAs. ar PCR in tem. Real miRNA expression is quantified by the quantitative PCR technique using the Applied Biosystems distributed kits specific for mature miRNAs. In a first step, 80 ng of short RNAs are inversely transcribed (in single-stranded cDNA) in the presence of loop primers, which confer the specificity for the quantification of the expression of mature miRNAs. Real-time PCR is then performed using the primers provided in the kits. One of the primers comprises fluorescent groups (so-called Taqman® probe) which makes it possible to perform a quantitative measurement using a suitable fluorimeter such as the Stratagene Mx3005 station. The detection threshold is determined initially by the user at the beginning of exponential phase. The value of Ct corresponds to the number of cycles from which the fluorescence exceeds this detection threshold. This Ct value is proportional to the amount of cDNA initially present in the sample. In the absence of a specific standard range for each cDNA, only relative quantification between samples is possible. The assay values for each miRNA are normalized with the data obtained for a non-coding RNA, RNU24. Interpretation of Results An aberrant expression level of a miRNA in a test tissue may be an indicator of the tumor character of the tissue. In order to determine whether a level of expression of a miRNA tested is normal, the comparison can be made either between the suspected tissue and the reference tissues (inter-tissue comparison), or between the level of expression of the above miRNA. and the level of expression of another miRNA in the same tissue (intra-tissue comparison). The inter-tissue comparison of the expression level of a miRNA X in tissue A and tissue B is expressed by the ratio (sample A / sample B), calculated from formula (V): Ratio ('= Efficacy "Ct hsa-miRNAX - Ct RNU24" sample A- (Ct hsa-miRNAX - Ct sample A / sample B) RNU24) sample B) The intra-tissue comparison between the level of expression of a miRNA X and that of miRNA Y is expressed by the ratio (hsa-miRNA X / hsa-miRNA Y), calculated from formula (VI): Ratio (hsa-miRNA X / hsa-miRNA Y) = Efficacy - (Ct hsa- EXAMPLE 2 Comparison of Expression Levels of miRNAs in Glial Tumor Tissues and in Normal Reference Tissues The nature of the tissues used in the present example is previously confirmed by histological analysis. . Expression levels of 282 miRNAs in glioblastoma tissues, oligodendroglioma tissues, reference healthy tissues are quantified respectively by real-time PCR according to the method described in Example 1. Among 282 miRNAs tested, The expression of 19 miRNAs is modified in glioblastomas and in oligodendrogliomas, compared to that in healthy tissue.

Table 3 below shows respectively: inter-tissue comparisons for the 19 miRNAs performed between the reference glioblastomas (GBM) and the healthy reference tissues (N), expressed by the ratio (GMB / N); comparisons between reference oligodendrogliomas (ODG) and healthy reference tissues (N), expressed by the ratio (oDGN); and comparisons between reference glioblastomas (GBM) and reference oligodendrogliomas (ODG), expressed by the ratio (GBM / 0DG). Table 3 GBM / N ODG / N GBM / ODG 34.46 4.27 8.07 hrs-miR-210 2.35 0.29 8.1 47.00 9.20 5.1 hrs-miR-134 0, 0.06 3.63 hrs-miR-409 0.321 0.065 4.94 7.76 7.35 1.06 4.84 3.90 1.24 3.31 4.16 0.80 11.43 6.31 1.81 12.87 20.32 0.63 3.63 5.73 0.63 8.95 7.86 1.14 19.25 24.92 0.77 4.19 4.57 0.92 23, 18 32.46 0.71 hsa-miR-34b 0.21 0.32 0.67 hsa-miR-127 0.06 0.05 1.21 hsa-miR-151 0.23 0.26 0.89 hsa -miR-339 0.07 0.18 0.39 12 miRNAs, marked gray in Table 3, are overexpressed in GBMs and ODGs. Another 6 miRNAs, without any labeling in Table 3, are under-expressed in GBMs and ODGs.

An exception is hsa-miR-210, marked in bold in Table 3, which is overexpressed in the GBMs, but under-expressed in the ODGs. Of these 19 miRNAs identified in the invention because of their modified expression profile in glioma tissues compared to normal tissues, 5 miRNAs, including hsa-miR-155, hsa-miR-210, hsa-miR-10a , hsa-miR-134, hsa-miR-409, also show a distinct expression pattern between glioblastomas and oligodendrogliomas. These 5 miRNAs are underlined in Table 3.

Example 3: Intra-Tissue Comparisons of the Expression Levels of the miRNAs The nature of the tissues used in the present example is previously confirmed by histological analysis. The comparison is made between the expression levels of 2 miRNAs (miRNA X and miRNA Y) from the same tissue. The result of this comparison is expressed as a ratio, which is calculated according to formula (VI). Tables 4, 5, 6, 7 below represent the ratio (hsa-miRNA × hsa-miRNA Y) obtained respectively in a reference glioblastoma tissue (GBM), a reference oligodendroglioma tissue (ODG), or a healthy reference tissue (N). The miRNA pairs are selected on the basis of p-values less than 0.05. (The p-value indicates the significance of each pair of miRNAs (miRNA X and miRNA Y) for distinctions between tissue categories, a p-value of less than 0.05 is significant).

Table 4 Couple of miRNAs Report in Ratio in GBM Ratio in N ODG hsa-let 7a / hsa-miRl27 0.04 13.39 26.93 hsa-let 7a / hsa-miRlSb 1.00 6.57 5.58 hsa- let 7a / hsa-miR34b 11.77 1108.71 5664.24 hsa-let 7d / hsa-miR34b 8.32 137.03 341.47 hsa-miRl26 / hsa-let 7a 7.02 2.30 2.08 hsa mRl26 / hsa-miRl34 0.32 8.48 39.09 hsa-miRl26 / hsa-miR339 2.37 948.81 283.44 hsa-miRl26 / hsa-miR34b 92.64 2446.73 1047.16 hsa-miR126 / hsa-miR409 38.66 699.88 6908.75 hsa-miRl27 / hsa-let 7d 68.45 1.09 0.99 hsa-miRl27 / hsa-let 7f 2065.79 9.19 6.29 hsa-miRl27 hrs-miRlOa 10839.87 28.13 72.27 hrs-miRl27 / hrs-miRl5b 30.35 1.04 1.31 hrs-miRl27 / hrs-miR-17 405.56 2.82 2.95 hsa-miRl34 hsa-let 7a 21.26 0.21 0.08 hsa-miRl34 / hsa-miRlOa 9255.37 31.37 31.47 hsa-miRl5l / hsa-let 7a 35.92 0.56 0.53 hsa-miRl5l Yield: 181.76 5.35 4.57 hrs-miRl5l / hsa-let 7f 2941.11 25.08 14.37 hsa-miRl5l / hsa-miRlOa 21981.20 78.57 333.08 hsa-miRl51 / hrs-miRl26 6.28 0.30 0.39 hrs-miRl51 / hrs-miRl5b 42.05 2.42 2.62 hrs-miRl51 / hrs-miR20a 19.14 1.94 0.75 hsa-mi Rl51 / hsa-miR374 73.06 2.11 1.72 hsa-miRl55 / hsa-miRl27 0.02 21.72 9.02 hsa-miRl55 / hsa-miRl34 0.03 4.95 4.62 has-miR155 / has-miR409 3.68 412.41 798.39 hsa-miRlSb / hsa-let 7f 78.80 9.77 8.62 hsa-miRl5b / hsa-miR339 0.38 94.27 16.51 hsa-miR15b / hsa -mR409 6.94 74.86 638.97 hrs-miRl6 / hrs-miRl27 1.24 409.04 529.94 hrs-miRl6 / hrs-miRl34 1.76 111.42 327.36 hrs-miRl6 / hrs-miRl51 1.31 67.29 33.17 hsa-miRl6 / hsa-miR339 12.38 16977.61 1904.10 hsa-miR16 / hsa-miR34b 489.53 34822.63 20260.67 hsa-miRl6 / hsa-miR-409 211.30 9357.42 50575.30 hrs-miR17 / hrs-miR339 0.04 47.85 8.30 hrs-miR17 / hrs-miR34b 1.40 106.08 185.81 hrs-miR17 / hs-miR409 0, 76 27.18 250.77 hsa-miR20a / hsa-let 7a 2.53 0.59 0.60 hsa-miR20a / hsa-let 7f 141.24 28.07 21.61 hsa-miR20a / hsa-miRl27 0, 08 6.21 16.98 hsa-miR20a / hsa-miR339 0.78 308.04 58.84 hsa-miR20a / hsa-miR34b 32.41 783.28 1528.75 hsa-miR20a / hsa-miR409 13.92 188 , 77 1844.61 hrs-miR2l0 / hsa-let 7a 14.30 2.24 0.31 hsa-miR210 / hsa-miRl55 27.01 2.90 3.84 hsa-miR26b / hsa-let 7f 379.42 148 , 58 83.66 hsa-m iR26b / hsa-miR-127 0.20 54.39 103.49 hsa-miR26b / hsa-miRl34 0.31 13.96 59.85 hsa-miR26b / hsa-miRl 51 0.23 8.54 5.76 hsa -miR26b / hsa-miR-339 2.01 1777.46 375.39 hsa-miR26b / hsa-miR34b 73.80 3751.16 2921.07 hsa-miR26b / hsa-miR409 36.68 1151.30 9627.57 hsa -miR339 / hsa-let 7a 3.44 0.06 0.05 hsa-miR339 / hsa-let 7d 8.08 0.41 0.25 hsa-miR339 / hsa-let 7f 225.84 2.49 1.56 hsa-miR34b / hsa-let 7f 6.74 0.06 0.08 hsa-miR374 / hsa-let 7f 41.18 15.54 8.72 hsa-miR374 / hsa-miRl27 0.02 5.64 10.35 hsa-miR374 / hsa-miRl34 0.04 1.37 6.35 hsa-miR374 / hsa-miR339 0.24 227.47 37.20 hrs-miR374 / hrs-miR34b 9.42 374.55 387.50 hsa- miR374 / hsa-miR409 4.57 114.05 985.51 hsa-miR409 / hsa-miRl Oa 78.10 0.48 0.40 The pairs of miRNAs in Table 4 indicate that the suspected tissue is a tumor tissue. when the ratio of the level of expression between the two miRNAs of a pair is different from the aforesaid ratio established in a reference healthy tissue.

Table 5 Couple of miRNAs Report in Report in GBM Report in N ODG hsa-let 7d / hsa let 7f 39.38 7.44 5.17 hsa-miRlOa / hsa let 7d 0.01 0.19 0.02 hsa-miRl26 / hsa let 7f 409.60 86.77 52.65 hsa-miRl26 / hsa-miRlOa 3309.62 212.01 1322.35 hsa-miRl26 / hsa-miRl55 11.23 2.56 14.01 hsa-miRl27 / hsa mRl26 6.28 0.18 0.25 hrs-miRl34 / hrs-miR17 308.44 5.14 0.92 hrs-miR134 / hrs-miR409 117.50 76.90 105.39 hrs-miRl51 / hrs-miR17 786.64 12.17 5.49 hsa-miR155 / hsa-miR339 0.23 658.78 33.40 hsa-miR15b / hsa-miR10a 480.59 28.27 216.27 hsa-miRl5b / hsa-miRl55 2, 49 0.26 12.60 hsa-miRlSb / hsa-miR34b 17.58 237.79 813.26 hsa-miRl6 / hsa-miRlOa 16307.76 2830.58 11326.64 hsa-miRl6 / hsa-miRl26 5.72 13 , 65 14.07 hs-miRl6 / hs-miRl55 63.55 27.68 301.21 hsa-miRl6 / hsa-miRlSb 33.54 118.49 74.32 hsa-miRl6 / hsa-miR20a 15.54 66.32 21.88 hsa-miRl6 / hsa-let 7f 2208 1195 450 hsa-miRl6 / hsa-miR374 54 80 52 hsa-miRl7 / hsa let 7d 0.18 0.66 0.74 hsa-miR20a / hsa-miRlOa 973.95 63.63 520.31 hsa-miR210 / hsa-miRl27 0.47 41.36 11.83 hsa-miR210 / hsa-miRl3 4 0.76 11.49 6.43 hsa-miR210 / hsa-miR339 4.34 577.38 42.97 hsa-miR210 / hsa-miR409 85.51 825.50 1082.17 hsa-miR26b / hsa let 7a 6 , 38 3.46 3.02 hrs-miR26b / hrs-miRl Oa 2395.15 423.06 2043.29 hrs-miR26b / hrs-miR151 11.10 3.44 42.63 hsa-miR26b / hsa-miR15b 5, 92 14.88 14.85 hsa-miR374 / hsa-miRlOa 260.02 47.05 219.75 hsa-miRlOa / hsa-miR210 0.00 0.02 0.01 hsa-miRlOa / hsa-miR339 0.00 4 , 79 0.11 hsa-miRlOa / hsa-miR34b 0.05 30.18 2.24 hsa-miRl55 / hsa let 7f 41.80 53.26 6.99 hsa-miRl6 / hsa let 7a 38.15 28.63 14.98 hrs-miRl6 / hrs-miR210 3.45 41.60 60.43 hrs-miR210 / hrs let 7d 40.01 20.29 3.03 hrs-miR210 / hrs-miRl26 2.72 2.30 0, 21 hrs-miR210 / hrs-miRl5b 14.39 13.77 1.53 hrs-miR210 / hrs-miR17 207.54 67.24 3.14 hrs-miR2 10 / hrs-miR20 a 6.74 10.76 0, 43 hsa-miR2 10 / hsa-miR3 74 22.64 13.26 0.92 hsa-miR26b / hsa-miR2 10 0.52 4.13 10.62 The pairs of miRNAs in Table 5 may indicate that the suspected tissue is one of two types of tumor tissue, when the ratio of the level of expression between the two miRNAs of a couple is different from the aforementioned ratio established in a healthy reference tissue.

Table 6 Couple of miRNAs Ratio in Ratio in GBM Ratio in N ODG hsa-miRl27 / hsa-miR409 205.31 46.96 159.82 hsa-miR2l0 / hsa-miR34b 147.47 1752.14 268.48 hsa-let 7f / hsa-miRlOa 6.57 2.81 21.53 hsa-miRl55 / hrs-miRl7 10.56 26.58 2.85 hsa-miRl55 / hsa-miR374 1.05 4.62 0.83 Hsa-miR20 / hsa The miRNA pairs of Table 6 make it possible to distinguish a glioblastoma from an oligodendroglioma, when the tumor character of a suspected tissue is already confirmed by a method described in the present invention, or a conventional method.

Table 7 Couple of miRNAs Report in Report in GBM Report in N ODG hsa-let 7a / hsa-miR 409 5.77 356.43 3726.97 hsa-let 7d / hsa-miR409 4.75 41.99 275.42 hsa -miRl34 / hsa-let 7f 1067.08 10.55 1.58 hsa-let 7f / hsa-miR409 0.17 7.47 81.66 hsa-miRl34 / hsa-let 7d 62.34 2.01 0.43 hsa-miRl51 / hsa-miRl55 62.89 0.44 6.93 hsa-miRl55 / hsa-miR34b 7.27 1186.37 80.50 hsa-miRl5b / hsa-miRl34 0.06 0.93 5.98 hsa- miRl34 / hsa-miR20a 8.61 0.40 0.07 hsa-miR210 / hsa-let 7f 944.34 129.36 8.61 The pairs of miRNAs in Table 7 above make it possible to directly specify the nature of a tissue suspected of having a tumor character and distinguishing between a glioblastoma or an oligodendroglioma, without the need for a step to determine the presence of gliomas in this suspected tissue. Figures 3 to 6 illustrate that 3 groups of different types of samples, including healthy tissues, glioblastoma tissues, or oligodendroglioma tissues, are distinguished on a two-dimensional graph established using two pairs of samples. miRNAs. Figure 7 shows that 3 groups of different types of samples, including healthy tissues, glioblastoma tissues, or oligodendroglioma tissues, are well differentiated on a three-dimensional graph, established using three pairs of miRNAs.

Claims (4)

REVENDICATIONS1. Use of at least one miRNA selected from hsamR-126, hsa-miR-15b, hsamR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa- mi let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b , hsa-miR-155, hsa-miR-210 or hsa-miR-10a for the implementation of an in vitro diagnostic method for glioma. 2. Use according to claim 1 of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-3 74, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa-miR -26b or hsa-miR-34b, for the implementation of a method of in vitro diagnosis of glioma. 3. Use according to claim 1 or 2, of a miRNA selected from hsa-miR-155, hsamiR-210, hsa-miR-10a, hsa-miR-409 or hsa-miR-134 for the implementation of a method for the specific in vitro diagnosis of glioma, said method for distinguishing glioblastoma from oligodendroglioma. 4.  In vitro diagnostic method of glioma comprising: - measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa -mR-20a, hsa-let7a, hsa-let 7f, hsalet 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsamiR-151 , hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a, in a biological sample from a patient suspected of having a glioma, - the comparison: between the expression level of at least one of the above-mentioned miRNAs in the above-mentioned sample and the expression level of the above-mentioned miRNA in a reference healthy sample, or between the level of expression of at least one of the above-mentioned miRNAs. in the sample from a patient suspected of having a glioma and the level of expression of at least a second said miRNA in the same sample from the patient suspected of having a glioma.  .  An in vitro diagnostic method of glioma according to claim 4 comprising: - measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa- miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsalet 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR- 127, hsamiR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a, in a biological sample from a patient suspected of having a glioma comparing the level of expression of at least one of the above-mentioned miRNA in the above sample with the level of expression of the above-mentioned miRNA in a reference healthy sample, and the deduction that the suspected patient has a glioma when the Expression level of the above miRNA in the sample from the patient suspected of having a glioma is different from the level of expression of the above miRNA in a healthy reference sample.  6.  A method according to claim 5 comprising measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miRN 20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR- 151, hsa-miR-26b or hsa-miR-34b.  7.  A method according to claim 5 wherein: - the expression level is measured for at least one of the following miRNAs: hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR -17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374 or hsa-miR-26b, and - the deduction that the suspected patient has a glioma is made when the Expression level of the above miRNA in the sample from the patient suspected of having a glioma is greater than the level of expression of the above miRNA in a reference healthy sample.  8.  A method according to claim 5 wherein: - the expression level is measured for at least one of the following miRNAs: hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR -127, hsa-miR-151 or hsa-miR-34b, and - the inference that the suspected patient has a glioma is made when the level of expression of the above-mentioned miRNA in the sample from the patient suspected of having a glioma is lower than the level of expression of the above miRNA in the reference healthy sample.  9.  In vitro diagnostic method of glioma according to one of claims 4 to 8, wherein the deduction that the suspected patient has a glioma is made, when the level of expression of the above miRNA in the sample from the patient suspected to present a glioma and the level of expression of the above miRNA in the reference healthy sample are different, the level of expression of the above miRNA in the sample from the patient suspected of having a glioma being at least 3 times higher or lower than the level of expression of the above miRNA in the reference healthy sample.  10.  A method according to claim 9, wherein the level of expression of the above miRNA in the sample from a patient suspected of having a glioma is at least 3 times greater than the level of expression of the above miRNA in the healthy sample. reference.  11.  The method of claim 9, wherein the level of expression of the above miRNA in the sample from a patient suspected of having a glioma is at least 3 times lower than the level of expression of the above miRNA in the healthy sample. reference.  12.  Method according to one of claims 4 to 11, comprising: - measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR -17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR -127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b, in a biological sample from a patient suspected of presenting a glioma, - the comparison between the level of expression of the above-mentioned miRNA in the sample, and the level of expression of the above-mentioned miRNA in a healthy reference sample, and, - the deduction that the suspected patient has a glioma, when the level of expression of the above-mentioned miRNA in the sample from the patient suspected of having present a glioma and the level of expression of the above miRNA in the healthy reference sample are different, the level of expression of the above miRNA in the sample from the patient suspected of having a glioma 3 times, especially 4 times, more particularly 5 times, higher or lower than the level of expression of the above miRNA in the reference healthy sample.  13.  An in vitro diagnostic method of glioma according to claim 4 comprising: - measuring the level of expression of at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa- miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsalet 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR- 127, hsamiR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a, in a biological sample from a patient suspected of having a glioma comparing the level of expression of at least a first aforesaid miRNA in the sample from the patient suspected of having a glioma and the level of expression of at least a second said miRNA in the above sample, and the deduction that the suspected patient has a glioma, when the ratio between the level of expression of the above-mentioned first miRNA and the level of expression of the aforementioned second miRNA is different from that in a pre-established abacus for a healthy sample of ri ference, the aforesaid first and second miRNA miRNAs pairing of miRNAs.  14.  A method according to claim 13, wherein the miRNA pairs used are: hsa-let 7a / hsa-miRl27, hsa-let 7a / hsa-miR1 Sb, hsa-let 7a / hsa-miR34b, hsa-miRl26 / hsa -let 7a, hsa-miRl26 / hsa-miR34b, hsa-miRl27 / hsa-let 7d, hsamiRl27 / hsa-miR15b, hsa-miR134 / hsa-let 7a, hsa-miR134 / hsa-miR10a, hsamiR1 51 / hsa- let 7a, hsa-miRl51 / hsa-let 7d, hsa-miRl51 / hsa-let 7f, hsa-miRl51 / hsamiR15b, hsa-miR15b / hsa-miR409, hsa-miR16 / hsa-miR151, hsa-miR16 / hsa -mR339, hsa-miR16 / hsa-miR34b, hsa-miR17b / hsa-miR339, hsa-miR17b / hsa-miR34b, hsamiR17 / hsa-miR409, hsa-miR20a / hsa-miR339, hsa-miR26b / hsa-miR134, hsamiR26b / hsa-miR34b, hsa-miR26b / hsa-miR409, hsa-miR339 / hsa-let 7f, hsamiR34b / hsa-let 7f, hsa-miR374 / hsa-let 7f, hsa-miR374 / hsa-miR127, hsa-miR374 / hsamiR134, hsa-miR374 / hsa-miR339, hsa-miR374 / hsa-miR34b, hsa-miR374 / hsamiR409, hsa-miR409 / hsa-miR10a, hsa-miR155 / hsa-miR134, hsa-miR155 / hsamiR127, hsa-miR126 / hsa-miR409, hsa-miR127 / hsa-let 7f, hsa-miR151 / hsa-miR20a, hsa-miR16 / hsa-miR134, hsa-miR126 / h Sa-miR339, hsa-miR151 / hsa-miR10a, hsa- miR16 / hsa-miR127, hsa-miR20a / hsa-let 7f, hsa-miR20a / hsa-miR409, hsa- miR155 / hsa-miR409, hsa-miR3 3 9 7, hsa-miRlOa, hsa-miR15b / hsa-let 7f, hsa-miR20a / hsa-let 7a, hsa-miR210 / hsamiR155, hsa -mR2 10 / hsa- let 7a, hsa-miR26b / hsa-miR-399, hsa-miR26b / hsa-miR-127, hsa-miR16 / hsa-miR-409, hsa-miR127 / hsa-miR-17, hsa-miR151 / hsa-miR126, hsamiR26b / hsa-miR1 5 1, hsa-miR20a / hsa-miR127, hsa-miR3 39 / hsa- let 7a, hsamiR26b / hsa-let 7f, hsa-miR126 / hsa-miR134, hsa -miR20a / hsa-miR34b, hsa-let 7d / hsamiR34b, hsa-miR15b / hsa-miR339, hsa-let 7d / hsa let 7f, hsa-miRlOa / hsa let 7d, hsa- miR126 / hsa let 7f, hsa-miR126 / hsa-miR10a, hsa-miR126 / hsa-miR155, hsa- miR127 / hsa-miR126, hsa-miR134 / hsa-miR17, hsa-miR134 / hsa-miR409, hsa- miR151 / hsa-miR17, hsa-miR155 / hsa mR159, hsa-miR15b / hsa-miR10a, hsa- miR15b / hsa-miR155, hsa-miR15b / hsa-miR34b, hsa-miR16 / hsa-miR10a, hsamR16 / hsa-miR126, hsa-miR16 / hsa -miR155, hsa-miR16 / hsa-miR15b, hsa- mi R16 / hsa-miR20a, hsa-miR17 / hsa let 7d, hsa-miR20a / hsa-miR10a, hsa-miR210 / hsamiR127, hsa-miR2 10 / hsa-miR1 34, hsa-miR2 10 / hs a-miR3 39, hsa mR26b / hsa let 7a, hsa-miR26b / hsa-miR10a, hsa-miR26b / hsa-miR155, hsa-miR26b / hsa-miR15b, hsa-miR374 / hsa-miR10a, hsa-miR10a / hsa -mR210, hsamiR10a / hsa-miR339, hsa-miR10a / hsa-miR34b, hsa-miR155 / hsa let 7f, hsa-miR16 / hsa let 7a, hsa-miR16 / hsa-miR210, hsa-miR210 / hsa let 7d, hsa -mR210 / hsa-miR126, hsamiR2 10 / hsa-miR15b, hsa-miR210 / hsa-miR17, hsa-miR210 / hsa-miR20a, hsamiR210 / hsa-miR374, hsa-miR26b / hsa-miR210, hsa-miR16 / hsa let 7f, hsa-miR16 / hsamiR374.  15.  The method according to claim 13 or 14, wherein the deduction that the suspected patient has a glioma is made when the ratio between the level of expression of the aforesaid first miRNA and the level of expression of the aforesaid second miRNA is 2 times, in particular 3 times , more particularly 4 times, greater than the value of said ratio in a pre-established abacus for a reference healthy sample.  16.  The method of claim 13 or 14, wherein the inference that the suspected patient has a glioma is made when the ratio between the level of expression of the above-mentioned first miRNA and the level of expression of the aforesaid second miRNA is 2 times, in particular 3 time, more particularly 4 times, less than the value of said ratio in a pre-established abacus for a reference healthy sample.  17.  The method according to one of claims 13 to 16, comprising: (i) measuring the ratio of the level of expression of at least one pair of miRNAs selected from hsa-let 7a / hsa-miRl27, hsa-let 7a / hsa -MR1 Sb, hsa-let 7a / hsa-miR34b, hsa-miRl26 / hsa-let 7a, hsa-miRl26 / hsa-miR34b, hsamiR127 / hsa-let 7d, hsa-miR127 / hsa-miR15b, hsa-miR134 / hsa -let 7a, hsamiR134 / hsa-miR10a, hsa-miR151 / hsa-let 7a, hsa-miR151 / hsa-let 7d, hsamiR151 / hsa-let 7f, hsa-miR151 / hsa-miR15b, hsa-miR15b / hsa-miR409 , hsamiR16 / hsa-miR151, hsa-miR16b / hsa-miR339, hsa-miR169 / hsa-miR34b, hsamiR17 / hsa-miR339, hsa-miR17 / hsa-miR34b, hsa-miR17 / hsa-miR409, hsamiR20a / hsa-miR339 , hsa-miR26b / hsa-miR134, hsa-miR26b / hsa-miR34b, hsamiR26b / hsa-miR409, hsa-miR339 / hsa-let 7f, hsa-miR34b / hsa-let 7f, hsamiR374 / hsa-let 7f, hsa- miR374 / hsa-miRl27, hsa-miR374 / hsa-miR134, hsamiR374 / hsa-miR339, hsa-miR374 / hsa-miR34b, hsa-miR374 / hsa-miR409, hsamiR409 / hsa-miR10a, hsa-miR155 / hsa-miR134, hsa-miRl55 / hsa-miRl27, hsamiR126 / hsa-miR409, hsa-miR127 / hsa-let 7f, hsa-miRl51 / hsa-miR20a, hsamiR16 / hsa-miR134, hsa-miR126 / hsa-miR339, hsa-miR151 / hsa-miR10Oa, hsamiR16 / hsa-miR127, hsa-miR20a / hsa-let 7f, hsa-miR20a / hsa-miR409, hsamiR155 / hsa-miR409, hsa-miR339 / hsa-let 7d, hsa-miR151 / hsa-miR374, hsamiR127 / hsa-miR10a, hsa-miRlSb / hsa-let 7f, hsa-miR20a / hsa-let 7a, hsamiR210 / hsa -MR155, hsa-miR210 / hsa-7a, hsa-miR26b / hsa-miR-339, hsamiR26b / hsa-miR-127, hsa-miR16 / hsa-miR-409, hsa-miR127 / hsa-miR-17, hsamiR151 / hsa-miRl26, hsa-miR26b / hsa-miR151, hsa-miR20a / hsa-miR137, hsamiR339 / hsa-let 7a, hsa-miR26b / hsa-let 7f, hsa-miRl26 / hsa-miR1334, hsamiR20a / hsa- miR34b, hsa-let 7d / hsa-miR34b, hsa-miRl5b / hsa-miR339, hsa-let 7d / hsa let 7f, hsa-miRlOa / hsa let 7d, hsa-miRl26 / hsa let 7f, hsa-miRl26 / hsa- miRlOa, hsa-miR126 / hsa-miRl55, hsa-miRl27 / hsa-miRl26, hsa-miRl34 / hsamiR17, hsa-miRl34 / hsa-miR409, hsa-miR151 / hsa-miR17, hsa-miR155 / hsamiR339, hsa-miR15b / hsa-miRlOa, hsa-miRl5b / hsa-miRl55, hsa-miRl5b / hsamiR34b, hsa-miR16 / hsa-miRlOa, hsa-miRl6 / hsa-miRl26, hsa-miRl6 / hsamiR155, hsa-miR16 / hsa-mi R15b, hsa-miR16 / hsa-miR20a, hsa-miR17 / hsa let 7d, hsa-miR20a / hsa-miR10a, hsa-miR210 / hsa-miR127, hsa-miR210 / hsamiR1 34, hsa-miR2 10 / hsa-miR3 39 , hsa-miR210 / hsa-miR409, hsa-miR26b / hsa let 7a, hsa-miR26b / hsa-miR10a, hsa-miR26b / hsa-miR155, hsa-miR26b / hsamiR15b, hsa-miR374 / hsa-miR10a, hsa-miRlOa / hsa-miR210, hsa-miR10a / hsamiR339, hsa-miR10a / hsa-miR34b, hsa-miR155 / hsa let 7f, hsa-miR16 / hsa let 7a, hsa-miR16 / hsa-miR210, hsa-miR210 / hsa let 7d , hsa-miR210 / hsa-miRl26, hsa-miR210 / hsa-miR15b, hsa-miR210 / hsa-miR17, hsa-miR2 10 / hs a-miR20a, hsa-miR210 / hsa-miR374, hsa-miR26b / hsa- miR210, hsa-miRl6 / hsa let 7f, hsamiR16 / hsa-miR374, in a biological sample from a patient suspected of having a glioma, (ii) the inference that the suspected patient has a glioma, when the aforesaid ratio of level of expression of the above-mentioned first miRNA and the level of expression of the aforementioned second miRNA is 2 times, in particular 3 times, more particularly 4 times, higher or lower than the value of said ratio in a pre-established chart in a reference healthy sample.  18.  A method for in vitro specific diagnosis of gliomas according to claims 4 to 17, said method for distinguishing glioblastoma from oligodendroglioma, comprising: - measuring the level of expression of at least one miRNA selected from hsa-miR-155 , hsa-miR-210, hsa-miR-10a, hsa-miR-409 or hsa-miR-134, in a biological sample from a patient suspected of having glioblastoma or oligodendroglioma, - the comparison between: - the level of expression of the above miRNA in said biological sample and * respectively the level of expression of the above miRNA in a reference biological sample from a patient with a glioblastoma, and * respectively the level of expression of the said miRNA in a biological reference sample from a patient presenting with an oligodendroglioma, and - the deduction: - that the suspected patient has a glioblastoma, when the level of expression of the above miRNA in the sample ilon from said patient suspected of having glioblastoma or oligodendroglioma is equal, within 20% plus or minus 20%, to the level of expression of the above miRNA in the reference sample from a patient with glioblastoma, - either the suspected patient has an oligodendroglioma, when the level of expression of the above miRNA in the sample from said patient suspected of having a glioblastoma or oligodendroglioma is equal, within the limit of 20% more or 20% in less, at the level of expression of the above miRNA in the reference sample from a patient having an oligodendroglioma.  19.  A method according to claim 18, wherein the deduction that the patient has a glioblastoma is made when: - the level of expression of the above miRNA in the sample from the patient suspected of having a glioblastoma or oligodendroglioma is at least 3 times higher at the level of expression of the above miRNA in the reference sample from a patient presenting with an oligodendroglioma, and the level of expression of the above miRNA in the sample from the patient suspected of having a glioblastoma or oligodendroglioma is equal up to 20% more or 20% less at the level of expression of the above miRNA in the reference sample from a patient with glioblastoma.  20.  The method of claim 18, wherein the inference that the patient has an oligodendroglioma is made when: - the level of expression of the above miRNA in the sample from the patient suspected of having glioblastoma or oligodendroglioma is at least 3 times lower at the level of expression of the above miRNA in the reference sample from a patient with glioblastoma, and the level of expression of the above miRNA in the sample from the patient suspected of having glioblastoma or oligodendroglioma is equal , within a limit of 20% plus or minus 20%, at the level of expression of the above miRNA in the reference sample from a patient having an oligodendroglioma.  21.  A method according to claims 18 to 20 comprising the steps of: - measuring the level of expression of at least one miRNA selected from hsa-miR-155, hsa-miR-210 or hsa-miR-10a, hsa-miR -409 or hsa-miR-134, in a biological sample from a patient suspected of having a glioblastoma or oligodendroglioma, - the comparison between: - the level of expression of the above miRNA in the sample from a patient suspected to have glioblastoma or oligodendroglioma and * respectively the level of expression of the above miRNA in the reference sample from said patient with glioblastoma, and * respectively the level of expression of the above miRNA the reference sample from a patient presenting with an oligodendroglioma, - the deduction: - that the patient has a glioblastoma, * when the level of expression of the above miRNA in the sample from said patient suspected of having a glioblastoma or an oligodendroglioma is equal, within a limit of 20% plus or minus 20%, to the level of expression of the above miRNA in the reference sample from a patient with glioblastoma, and * when the level of expression of the above miRNA in the sample from said patient suspected of having a glioblastoma or oligodendroglioma is at least 3 times higher than the level of expression of the above miRNA in the sample from a patient having an oligodendroglioma, or the patient has an oligodendroglioma, * when the level of expression of the above-mentioned miRNA in the sample from said patient suspected of having a glioblastoma or oligodendroglioma is equal, within the limit of 20% more or 20% less, at the level of expressing the above miRNA in the reference sample from a patient presenting with an oligodendroglioma, and * when the level of expression of the above miRNA in the sample from the said patient suspected of having a glioblastoma or oligodendroglioma is at least 3 times lower than the level of expression of the above miRNA in the sample from a patient with glioblastoma.  22.  A method for in vitro specific diagnosis of gliomas according to one of claims 4 to 17, said method for distinguishing glioblastoma from oligodendroglioma, comprising: (i) measuring the level of expression of miRNAs in at least one pair of miRNAs consisting of: * a miRNA selected from hsa-miR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409 or hsa-miR-134, and * a miRNA selected from hsa-miR-126 , hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsa-miR- 339, hsa-miR-127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b, for a biological sample from a patient suspected of having a glioblastoma or an oligodendroglioma, said measure being used to establish the ratio of the level of expression for a said pair of miRNAs, (ii) the comparison between: the aforementioned ratio of the level of expression for a pair of miRNAs, and that represented in a pre-established abacus for a reference healthy sample. , a reference sample from a patient with glioblastoma, and a reference sample from a patient with an oligodendroglioma, (iii) the deduction: * that the patient has glioblastoma, when the difference between the ratio obtained in the step (i) and the ratio in a pre-established abacus in a reference sample from a patient having a glioblastoma is less than 20%, especially 15%, more particularly 10%, vis-à-vis the ratio in an abacus preestablished, * either the patient has an oligodendroglioma, when the difference between the ratio obtained in step (i) and the ratio in a pre-established abacus in a reference sample from a patient presenting with an oligodendroglioma is less than 20% , especially 15%, more particularly 10%, vis-à-vis the ratio in a preset abacus.  23.  A method according to claim 22, wherein the miRNA pairs used are as follows: hsa-miRl27 / hsa-miR409, hsa-miR210 / hsa-miR34b, hsa-let 7f / hsamiR10a, hsa-miR155 / hsa-miR17, hsa- miR15 miRl55 / hsa-miR374, hsa-let 7a / hsa-miR 409, hsa-let 7d / hsa-miR409, hsa-miRl34 / hsa-let 7f, hsa-let 7f / hsa-miR409, hsamiRl 34 / hsa- 7d , hsa-miR15 1 / hsa-miR1 55, hsa-miR155 / hsa-miR34b, hsamiR15b / hsa-miR134, hsa-miR134 / hsa-miR20a, hsa-miR210 / hsa-let 7f, hsamiR20 / has-miRl 55.  24.  Method according to claims 1 to 23, comprising: - i) the determination, according to one of claims 4 to 17, of the presence of glioma in a patient suspected of having a glioma, - ii) the deduction, according to one Claims 18 to 22, whether said patient has a glioblastoma or the suspected patient has an oligodendroglioma.  25.  A method according to claim 24, comprising: i) measuring the level of expression of at least one miRNA selected from hsamiR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa- mi miR-20a, hsa-let7a, hsalet 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsamiR-127, hsa-miR-151, hsa-miR-26b or hsa-miR-34b, in a biological sample from a patient suspected of having a glioma, - ii) comparing the levels of expression of the above-mentioned miRNA in the above sample and in a healthy sample of reference, - (iii) the inference that the patient has a glioma, when the level of expression of the above-mentioned miRNA in the sample from the above-mentioned patient and the level of expression of the above-mentioned miRNA in the reference healthy sample are different, the level of expression of the above-mentioned miRNA in the sample from the aforementioned patient suspected of having a glioma being 3 times, in particular 4 times, more particularly 5 times, higher or lower at the level of expression of the above miRNA in the reference healthy sample, - iv) measuring the level of expression of at least one miRNA selected from hsamiR-155, hsa-miR-210 or hsa-miR-10a , hsa-miR-409 or hsa-miR-134, in said biological sample from a patient presenting with a glioma, v) the comparison between: the level of expression of the above miRNA in the aforesaid sample and * respectively the level of expression of the above miRNA in a reference sample from a patient with glioblastoma, and * respectively the level of expression of the above miRNA in a reference sample from a patient having an oligodendroglioma, and - vi) the deduction: - that the patient has a glioblastoma, when the level of expression of the above miRNA in the sample from the above patient is equal, within the limit of 20% more or 20% less, at the level of Expression of the above miRNA in the reference sample from a patient with a glioblastoma, or the patient has an oligodendroglioma, when the level of expression of the above miRNA in the sample from the above patient is equal, within the limit of 20% more or 20% in less, at the level of expression of the above miRNA in the reference sample from a patient having an oligodendroglioma.  26.  A method according to claim 24 or 25 comprising: (i) measuring the level of expression of at least one miRNAs selected from hsamiR-155, hsa-miR-210, hsa-miR-10a, hsa-miR-409 or hsa-miR-134, in a biological sample from a patient suspected of having a glioma, (ii) the comparison between the level of expression of the above-mentioned miRNA in the above sample and * the level of expression of the said miRNA respectively in a reference healthy sample, and * respectively the level of expression of the above miRNA in a reference sample from a patient with glioblastoma, and * respectively the level of expression of the above miRNA in a reference sample from a patient presenting with an oligodendroglioma, (iii) the deduction: * that the patient does not present a glioma, when the level of expression of the above miRNA in the sample from the above patient is equal, within the limit of 20% more or 20% less, has u expression level of the above-mentioned miRNA in the reference healthy sample, * that the patient has a glioblastoma, - when the level of expression of the above-mentioned miRNA in the sample from the above-mentioned patient is equal, within the limit of 20% plus or minus 20%, at the level of expression of the above miRNA in the reference sample from a patient with glioblastoma, and - when the level of expression of the above miRNA in the sample from the said patient is at least 3 times greater than the expression level of the above-mentioned miRNA in the reference sample from a patient presenting with an oligodendroglioma, or the patient has an oligodendroglioma, when the level of expression of the said miRNA in the sample from the above patient is equal, within 20% plus or minus 20%, to the level of expression of the above miRNA in the reference sample from a patient with an oligoden drogliome, and - when the level of expression of the above miRNA in the sample from the above patient is at least 3 times lower than the level of expression of the above miRNA in the reference sample from a patient with glioblastoma.  27.  A method according to claim 24 comprising (i) measuring at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsamiR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151, hsa- miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a, in a biological sample from a patient suspected of having a glioma, (ii) the comparison between the expression level of at least a first aforesaid miRNA in the sample from the aforesaid patient suspected of having a glioma and the level of expression of at least a second aforesaid miRNA in the above sample, the aforementioned first miRNA and second miRNA forming a pair of miRNAs, and (iii) the deduction that the patient has a glioma, when the ratio between the level of expression of the above-mentioned first miRNA and the level of expression of the aforementioned second miRNA is 2 times, in particular 3 times , more particularly 4 times, greater than or less than that of a pre-established abacus in a reference healthy sample, (iv) measuring the ratio of the level of expression of at least one pair of miRNAs consisting of: * a miRNA chosen from hsa-miR-155 , hsa-miR-210, hsa-miR-10a, hsa-miR-409 or hsa-miR-134, and * a miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa mR-17, hsa-miR-20a, hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsamiR-339, hsa-miR-127, hsa-miR-151, hsa-miR -26b or hsa-miR-34b, for a sample from said patient presenting a glioma, said measurement making it possible to establish the ratio of the level of expression for a said pair of miRNAs, (v) the comparison between: - the aforesaid report the level of expression for a pair of miRNAs; and - the ratio in a pre-established abacus in a reference healthy sample, the reference sample from a patient with glioblastoma, and the reference sample from a patient presenting an ol igodendroglioma, (vi) the deduction: * that the patient has a glioblastoma, when the difference between the ratio obtained in step (iv) and the ratio in a pre-established abacus in a reference sample from a patient with a glioblastoma is less than 20%, in particular 15%, more particularly 10%, with respect to the ratio in a pre-established abacus in a reference sample originating from a patient presenting with a glioblastoma, * or that the patient presents an oligodendroglioma, when the difference between the ratio obtained in step (iv) and the ratio in a pre-established abacus in a reference sample from a patient having an oligodendroglioma is less than 20%, especially 15%, more particularly 10%, the ratio in a pre-established chart in a reference sample from a patient with an oligodendroglioma.  28.  The method of claim 24 or 27, comprising: (i) measuring the ratio of the expression level of at least one pair of miRNAs selected from hsa-let 7a / hsa-miR 409, hsa-let 7d / hsamiR409, hsa -mR134 / hsa-7f, hsa-let 7f / hsa-miR409, hsa- miRl 34 / hsa-7d 7d, hsa-miR15 1 / hsa-miRl 55, hsa-miRl55 / hsamiR34b, hsa-miR15b / hsa-miRl34 , hsa-miRl34 / hsa-miR20a, hsamiR210 / hsa-let 7f, in a biological sample from a patient suspected of having a glioma, (ii) a comparison between: - the aforementioned ratio of expression level for a couple miRNAs and - the ratio in a pre-established abacus respectively in a reference healthy sample, the reference sample from a patient with glioblastoma, and the reference sample from a patient with oligodendroglioma, (iii) the deduction: * that the patient does not present a glioma, when the difference between the ratio obtained in step (i) and the ratio in an ab Pre-established in a reference healthy sample is less than 20%, especially 15%, more particularly 10%, vis-à-vis the ratio in a pre-established chart in a reference healthy sample.  * that the patient has a glioblastoma, when the difference between the ratio obtained in step (i) and the ratio in a predefined abacus in a reference sample from a patient with a glioblastoma is less than 20%, especially 15%, more particularly 10%, with respect to the ratio in a pre-established chart in a reference sample from a patient with glioblastoma.  or that the patient has an oligodendroglioma, when the difference between the ratio obtained in step (i) is the ratio in a predefined abacus in a reference sample coming from a patient presenting an oligodendroglioma is less than 20%, especially 15%, more particularly 10%, with respect to the ratio in a pre-established abacus in a reference sample from a patient having an oligodendroglioma.  29.  The method according to claims 4 to 28, wherein the level of miRNA expression is assayed by real-time PCR.  30.  A method according to claims 4 to 28, wherein the expression level of the miRNAs is assayed by "DNA chip" hybridization, high throughput sequencing, or Northern blot.  31.  The method of claims 4 to 30, wherein a biological sample is selected from a tissue sample, including brain tissue obtained by resection, or a sample of body fluids, including a blood sample.  32.  In vitro diagnostic kit for glioma, comprising the means for assaying at least one miRNA selected from hsa-miR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a , hsa-let7a, hsa-let 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsa-miR-127, hsa-miR-151 , hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a. 33.  An in vitro specific glioma diagnostic kit according to claim 32, said kit for distinguishing glioblastoma from oligodendroglioma comprising the assay means of at least one miRNA selected from hsa-miR-155, hsa-miR-210 or hsa-miR-10a, hsa-miR-134 or hsa-miR-409.  34.  A method for evaluating the efficacy of a glioma treatment method, comprising: - measuring the level of expression of at least one miRNA selected from hsamiR-126, hsa-miR-15b, hsa-miR-16, hsa-miR-17, hsa-miR-20a, hsa-let7a, hsalet 7f, hsa-let 7d, hsa-miR-374, hsa-miR-409, hsa-miR-134, hsa-miR-339, hsamiR- 127, hsa-miR-151, hsa-miR-26b, hsa-miR-34b, hsa-miR-155, hsa-miR-210 or hsa-miR-10a in a biological sample from a patient undergoing treatment glioma, and optionally - the comparison between - the level of expression of the above miRNA in the biological sample from said patient, and - respectively the level of expression of the above miRNA in a reference sample from a patient with a glioblastoma - and respectively the level of expression of the above miRNA in a reference sample from a patient with an oligodendroglioma.  39.  The method of claim 34, wherein the method of treatment is chemotherapy or radiotherapy.  40.  The method of claims 34 and 35 wherein a biological sample is selected from a tissue sample, including brain tissue obtained by resection, or a sample of body fluids, including a blood sample.