FR2968674A1 - IN VITRO INTER-TISSUE DIAGNOSIS METHOD FOR DIAGNOSING BRAIN TUMORS - Google Patents

Abstract

The present invention relates to an in vitro diagnosis method of a brain tumor belonging to the group consisting of 2 types of tumors: ODG, GBM, and tumor type identification, comprising the measurement of the expression levels of the tumor. at least one first and second miRNAs respectively belonging to two different groups of miRNAs, in a sample from a patient suspected of having one of the above brain tumors.

Description

The present invention relates to an in vitro inter-tissue diagnostic method for diagnosing brain tumors using miRNAs as biomarkers. Tumors of the central nervous system (CNS) are mostly gliomas (50%), including glioblastoma (GBM) and oligodendroglioma (ODG). These tumors are a major cause of morbidity and mortality and represent a major public health problem. In fact, CNS tumors are the second leading cause of cancer death in children and the third leading cause in adult men (15-34 years). The overall incidence of CNS tumors is close to 7000 new cases detected each year in France. Finally, of the 6 million annual deaths worldwide due to some form of cancer, 1-2% are attributable to CNS tumors (World Health Organization data).

Gliomas or glial tumors are classified by the World Health Organization (WHO) in four histological grades, the grade indicating mainly the degree of malignancy. Oligodendrogliomas (ODG) grade II, developed from oligodendrocytes, are low-grade gliomas. On the other hand, grade IV glioblastomas (GBM), developed from astrocytes, are high-grade gliomas. For oligodendrogliomas, the median survival is about 7 years whereas it is only about 1 year for glioblastomas after treatment; accurately diagnosing the nature of the tumor is therefore of decisive importance. Excision of the tumor is a means, a priori radical, to eradicate a tumor but in clinical practice, this strategy remains imperfect. The removal of the tumor must be exhaustive, which is far from being the case either because infiltrating tumors have "irradiated" pre-tumor cells in the brain regions adjacent to the primary tumor, or because the boundaries of the tumor are poorly evaluated at diagnosis. At present, apart from the histological analysis performed by the pathologist, there are only a few diagnostic tests based on molecular approaches. Microscopic observations of cell morphology are completed in a few laboratories by the search for certain protein markers using specific antibodies. These immunohistochemical tests nevertheless have many disadvantages for the moment. They have only a low rate of productivity (they allow detection of only one antigen at a time), do not allow to distinguish unambiguously the different types of tumor cells and offer only poor possibilities of quantitative detection of markers. The diagnostics performed on the detection of genetic markers (such as lp and 19q heterozygosity losses in oligodendrogliomas) are currently little used. In recent years, scientists have discovered that a class of RNAs, designated miRNAs or microRNAs, can regulate gene expression either by degradation of target messenger RNAs or by repression of their translation depending on the degree of complementarity between the RNAs. miRNA and its target mRNA. The microRNAs (miRNAs) represent a relatively recent identification class of single-stranded (21 to 25nt), endogenous, non-coding RNAs. The genes responsible for the expression of these miRNAs are previously transcribed in the form of long precursors, themselves cleaved into pre-miRNAs by RNAse III Drosha. The processing of these pre-miRNAs is performed by another RNAse, Dicer, which gives rise to an RNA duplex noted [miRNA: miRNA *]. Only one of the two strands, the mature strand, participates in the RISC (RNA-induced silencing complex) ribonucleoprotein complex to function as a post-transcriptional regulator (Bartel et al., Cell, 2004. 116 (2): 281-97). . Since these RNAs play an important role in translational regulation, they are therefore strongly involved in many cellular processes such as development, differentiation, proliferation, apoptosis and stress response, processes often deregulated in tumors.

Numerous scientific studies have been devoted to the role of miRNAs in oncogenesis processes (Benard, J. and S. Douc-Rasy, Bull Cancer, 2005. 92 (9): 757-62; Hammond Curr Opin Genet Dev , 2006. 16 (1): 4-9). Now, it is recognized that miRNAs are actively involved in the development of cancers. In humans, the number of genes encoding miRNA precursors currently identified is 1048 (Sanger miRBase version 16, September 2010). Some of these miRNAs have been detected as tumor markers in the context of breast and prostate cancer and are therefore considered to be oncogenic or tumor suppressor miRNAs depending on their expression in tumors and their post-transcriptional role. In recent years, the possible alteration of miRNA expression levels in glial tumors has already been the subject of several scientific publications. A publication by Ciafre et al. in 2005 (Biochem Biophys Res Commun, 2005. Sep 9; 334 (4): 1351-8) compares expression levels of 245 miRNAs in glioblastomas and normal tissues, and highlights a distinct expression pattern. of these miRNAs in glioblastomas relative to the expression pattern in normal tissues. This publication discloses that miR-221 is overexpressed in glioblastomas, whereas miR-128, miR-181a, miR18b and miR181c are under expressed in glioblastomas. At the same time, Chen (N Engl J Med, 2005. 353 (17): 1768-71) describes that miR-21 is highly overexpressed in glioblastomas compared to normal tissues.

Another scan of the expression levels of 192 miRNAs in glial tumor tissues and normal tissues was performed by Silber et al. in 2008 (BMC Med, 2008. Jun 24, 6: 14). This study aims to analyze a possible modification of the expression profile of miRNAs in anaplastic astrocytomas (grade III) or glioblastomas (grade IV), tumors of different grades with the same cell origins. This study shows a modified expression profile of miRNAs in anaplastic astrocytomas and glioblastomas, compared to normal tissues. The miRNAs mentioned in this publication, the expression of which is modified, are not identical to those already mentioned in previous publications. However, to date, no previous study has done an exhaustive scan, as all microRNAs expressed in human cells are never explored. Moreover, in most cases, these studies only allow to diagnose a glioma vis-à-vis healthy tissue or peritumoral tissue, but do not distinguish a glioblastoma oligodendroglioma, two tumors whose cell origins and prognoses are very different, and also require different treatments.

Although the study by Silber et al. (BMC Med., 2008. Jun 24, 6: 14.) Showed that the expression patterns of miRNAs measured in anaplastic astrocytomas and those measured in glioblastomas are different, these tumors are indeed tumors of the same kind, but of different grade because they are both developed from astrocytes. Indeed, none of these previous studies can accurately and quickly diagnose the presence of glioblastoma or oligodendroglioma from the analysis of a group of biomarkers. There is a great need to develop a diagnostic method capable of distinguishing between an oligodendroglioma and a glioblastoma, allowing a patient to receive care corresponding to his physical state and to increase his chances of survival.

The present invention is based on the unexpected finding made by the inventors during a scan to measure the expression levels of 847 human microRNAs.

The inventors have succeeded in identifying 28 microRNAs whose expression levels in one type of glial tumors are different from those measured in another type of glial tumors and / or in healthy tissue. These 28 microRNAs can be divided into the following groups (see Table 2): Group A in this group consisting of hsa-miR-200c, hsa-miR-199a-5p, hsa-miR-21-star, hsa-miR-146b -5p and hsa-miR-31, whose expression levels measured in glioblastomas are significantly different from those measured in healthy tissues and in oligodendrogliomas. Group B comprising hsa-miR-135a-star, hsa-miR-99a-star, hsa-miR-382, hsa- miR-409-3p and hsa-miR-191-star, whose expression levels measured in oligodendrogliomas are significantly different from those measured in healthy tissues. Group C consisting of hsa-miR-424-star, hsa-miR-503, hsa-miR-132, hsa-miR-1301, hsa-miR-1231, hsa-miR-328, hsa-miR-1180, hsa mR-149, hsa-miR-491-5p, hsa-miR-1280, hsa-miR-490-5p, hsa-miR-431-star, hsa-miR-770-5p, hsa-miR-769-3p , hsa-miR-129-5p, hsa-miR-139-3p and hsa-miR-139-5p, whose expression levels measured respectively in glioblastomas or in oligodendrogliomas are significantly different from those measured in healthy tissues . Group D consisting of hsa-miR-199a-3p, whose expression levels measured respectively in glioblastomas or in oligodendrogliomas are significantly different from those measured in healthy tissues. The level of expression of this miRNA measured in glioblastomas is also significantly different from that measured in oligodendrogliomas, respectively.

The miRNAs used in the present invention are referenced in the miRBase database (http: /% i w.mirbaseorg /) (miRBase: tools for microRNA genomic, Griffiths-Jones et al., NAR 2008 36 (Database Issue): D154 -D158) where the nucleic sequence of a miRNA can be found by a MIMAT accession number or a uniform annotation. An annotation system has been put in place to name the different miRNAs (A uniform system for microRNA annotation, Ambros et al., RNA 2003 9 (3): 277-279). In this system, microRNAs are designated by a number. Previous this identification number, is the abbreviation "miR" or "mir", which allows a distinction between the mature microRNA (miR) and the precursor loop (hairpin) of the microRNA (mir), respectively corresponding to a number of MIMAT accession and MI. A prefix of three or four letters is used to distinguish the genomic origins of this miRNA. For example, "hsa-miR-126" means that this mature miRNA is from the human genome. Sometimes mature microRNAs can be very close (only one difference basis). In this case, the microRNAs bearing the same number are distinguished from each other by a lowercase letter such as a, b, c ... for example hsa- miR-26b. Sometimes a precursor loop can generate, on its side 5 'and its side 3', two mature microRNAs which are distinguished from each other by the annotation "5p" or "3p". For example, "hsa-miR-151-3p" means a mature miRNA from the 3 'side of its precursor. Sometimes a microRNA precursor loop can derive two mature miRNAs, namely a major product and a minor product. Such a minor miRNA is distinguished from the major miRNA derived from the same precursor by a star followed by the identification number, for example "hsa-miR-424 *" or hsa-miR-424-star. The nucleic acid sequences of the miRNAs mentioned above and used in the present invention as well as their accession numbers are presented below in Table 1. entitled Sequence No. MiRNA Accession No. miRNAase sequence Sanger hsa-miR-199a-3p SEQ ID NO .: 1 ACAGUAGUCUGACACAUUGGUUA MIMAT0000232 hsa-miR-139-3p SEQ ID NO: 2 GGAGACGCGGCCCUGUUGGAGU MIMAT0004552 hsa-miR-424-star SEQ ID NO: 3 CAAAACGUGAGGCGCUGCUAU MIMAT0001341 hsa-miR-503 SEQ ID NO: 4 UAGCAGCGGGAACAGUUCUGCAG MIMAT0002874 hsa-miR-132 SEQ ID NO: 5 UAACAGUCUACAGCCAUGGUCG MIMAT0000426 hsa-miR-1301 SEQ ID NO: 6 UUGCAGCUGCCUGGGAGUGACUUC MIMAT0005797 hsa-miR-1231 SEQ ID NO: 7 GUGUCUGGGCGGACAGCUGC MIMAT0005586 hsa-miR-328 SEQ ID NO: 8 CUGGCCCUCUCUGCCCUUCCGU MIMAT0000752 hSA miR-1180 SEQ ID NO: 9 UUUCCGGCUCGCGUGGGUGUGU MIMAT0005825 hsa-miR-149 SEQ ID NO: 10 UCUGGCUCCGUGUCUUCACUCCC MIMAT0000450 hsa-mi R-491-5p SEQ ID NO: 11 AGUGGGGAACCCUUCCAUGAGG MIMAT0002807 hsa-miR-1280 SEQ ID NO: 12 UCCCACC GCUGCCACCC MIMAT0005946 hsa-miR-490-5p SEQ ID NO: 13 CCAUGGAUCUCCAGGUGGGU MIMAT0004764 hsa-miR-431-star SEQ ID NO: 14 CAGGUCGUCUUGCAGGGCUUCU MIMAT0001625 hsa-miR-770-5p SEQ ID NO: 15 UCCAGUACCACGUGUCAGGGCCA MIMAT0003948 hsa-miR-769- 3p SEQ ID NO: 16 CUGGGAUCUCCGGGGUCUUGGUU MIMAT0003887 hsa-mi R-129-5p SEQ ID NO: 17 CUUUUUGCGGUCUGGGCUUGC MIMAT0000242 hsa-miR-139-5p SEQ ID NO: 18 UCUACAGUGCACGUGUCUCCAG MIMAT0000250 hsa-mi R-135a-star SEQ ID NO: 19 UAUAGGGAUUGGAGCCGUGGCG MIMAT0000428 hsa-miR-99a-star SEQ ID NO: 20 CAAGCUCGCUUCUAUGGGUCUG MIMAT0000097 hsa-miR-382 SEQ ID NO: 21 GAAGUUGUUCGUGGUGGAUUCG MIMAT0000737 hsa-miR-409-3p SEQ ID NO: 22 GAAUGUUGCUCGGUGAACCCCU MIMAT0001639 hsa-miR-191-star SEQ ID NO: 23 GCUGCGCUUGGAUUUCGUCCCC MIMAT0000440 hsa-miR-200c SEQ ID NO: 24 UAAUACUGCCGGGUAAUGAUGGA MIMAT0000617 hsa-miR-199a-5p SEQ ID NO: 25 CCCAGUGUUCAGACUACCUGUUC MIMAT0000231 hsa-miR-21-star SEQ ID NO: 26 CAACACCAGUCGAUGGGCUGU MIMAT0000076 2968674 6 hsa- miR-146b-5p SEQ ID NO: 27 UGA GAACUGAAUUCCAUAGGCU MIMAT0002809 hsa-miR-31 SEQ ID NO: 28 AGGCAAGAUGCUGGCAUAGCU MIMAT0000089 Table 1

The difference in expression levels of a miRNA between two tissues of different character is considered significant, when the level of expression of said miRNA measured in one of the two tissues is 5 times greater than that measured in the other. .

Measurement of miRNA expression levels can be achieved by any conventional method, such as DNA microarray hybridization, high throughput sequencing methods of a large number of individualized miRNAs, Real-time PCR, - Northern blot, or any other specific method of miRNAs. The level of expression of miRNAs can be measured by the "microarray" technique. The technique of the "DNA chip" is well known to those skilled in the art. This is the hybridization of miRNAs extracted on a solid support composed of a nylon membrane, a surface of silicon or glass, optionally nano-beads or particles, comprising oligonucleotides of known sequences fixed on the support or adherents to it. The complementarity of the oligonucleotides fixed with the sequences of microRNAs or their conversion products (amplification products, cDNA, RNA or cRNA) makes it possible to generate a signal (fluorescence, luminescence, radioactivity, electrical signal, etc.) according to the techniques of labeling used at the level of immobilized oligonucleotides (DNA chips). This signal is detected by a specific device and a value of intensity of this own signal for each miRNA is thus recorded. Several types of chips for the detection of miRNAs are already on the market, such as GeneChip® miRNA marketed by Affymetrix, miRcury arrays by Exiqon, miRXplore microarrays by Miltenyi.

In the case of high throughput sequencing, the miRNAs are extracted and purified from a sample, isolated from each other by methods provided by sequencing equipment suppliers such as Roche, Invitrogen. This kind of analysis consists in individualizing the molecules of the various microRNAs, performing an amplification step and sequencing the products ("nucleic acid clones") thus generated. The realization of many sequences to identify each of these "clones" (several thousand) makes it possible to generate a listing of the microRNAs present in a sample and to quantify each of these miRNAs simply by counting how many times each sequence is found in the listing. detailed.

The implementation of different sets of miRNAs from these groups makes it possible to diagnose and distinguish directly and precisely the nature of a sample from a patient suspected of having a glioblastoma, or an oligodendroglioma, or possibly to diagnose and distinguish directly and precisely the nature of a sample from a patient suspected of having a glioma.

In one embodiment of the invention, the measurement of at least 1 miRNA selected from the 28 miRNAs analyzed in the present invention, described above, makes it possible to diagnose a cerebral tumor belonging to the group consisting of 2 types of tumors: ODG, GBM, and tumor type identification. Said in vitro diagnostic method for a tumor comprises (i) measuring expression levels of at least 1 miRNA extracted from a biological sample from a patient suspected of having one of the above brain tumors, said miRNA being selected from the groups described above, (ii) comparing the level of expression of the above miRNA measured in the sample from the above patient with that measured in at least one type of the reference tissue selected from the group consisting of at least one reference healthy tissue, a reference ODG tissue and a reference GBM tissue.

In another embodiment, the present invention relates to a method for in vitro diagnosis of a brain tumor belonging to the group consisting of 2 types of tumors: ODG, GBM, and tumor type identification, comprising: i) measuring the expression levels of at least a first and a second miRNAs respectively belonging to two different miRNAs groups belonging to a set of 3 miRNAs groups, in a sample from a patient suspected of presenting one of the aforementioned brain tumors: the group 1 consisting of miRNAs belonging to the group A mentioned above, namely hsa-miR-200c, hsa-miR-199a-5p, hsa-miR-21-star, hsa-miR -146b-5p and hsa-miR-31, - group 2 consisting of miRNAs belonging to group B mentioned above, namely: hsa-miR-135a-star, hsa-miR-99a-star, hsa-miR -382, hsa-miR-409-3p and hsa-miR-191-star, - group 3 consisting of miRNAs belonging to groups C and D mentioned above, namely: hsa-miR-424-star, hsa-miR-503, hsa-miR-132, hsa-miR-1301, hsa-miR-1231, hsa-miR-328, hsa-miR- 1180, hsa-miR-149, hsa-miR-491-5p, hsa-miR-1280, hsa-miR-490-5p, hsa-miR-431-star, hsa-miR-770-5p, hsa-miR- 769-3p, hsa-miR-129-5p, hsa-miR-139- 3p, hsa-miR-139-5p and hsa-miR-199a-3p, - the two aforesaid miRNAs not belonging to the same group, ( ii) comparing the levels of expression of the above-mentioned miRNAs measured in the sample from the above-mentioned patient with those of the above-mentioned miRNAs measured in at least one type of the reference tissue selected from the group consisting of at least one reference healthy tissue , a reference ODG tissue and a reference GBM tissue (N, ODG, GBM).

By "biological sample" is meant a tissue sample, in particular a brain tissue obtained for example by biopsy or excision, or a sample of biological fluids, in particular a blood sample. A tissue sample corresponds to a fragment of fresh tissue, frozen or fixed and embedded in paraffin according to conventional pathology analysis techniques or which has been preserved by any other method of preservation and treatment. A brain tissue sample may be central nervous system tissue from the cerebral cortex, cerebellar cortex, basal ganglia, or brainstem nuclei. A biological fluid sample may be blood serum or blood plasma. When "a biological sample from a patient suspected of having one of the above brain tumors" is a brain tissue sample, it is tissue that has been removed, biopsied or excised from the operating room or any other intratumoral sampling method adapted from the tumoral seat suspected of a patient. The suspected tumor site is previously identified by a conventional method, such as MRI (Magnetic Resonance Imaging), a Pet Scan (gamma ray image scanner), or a conventional scanner.

When "a biological sample from a patient suspected of having one of the above brain tumors" is a blood sample, this sample is obtained from a patient by blood sampling according to conventional methods. "A healthy reference tissue" can be a brain tissue devoid of any tumor character after histological analysis by anatomopathologists. The reference healthy tissue may be central nervous system tissue from the cerebral cortex, cerebellar cortex, basal ganglia, or brainstem nuclei. The reference healthy tissue is preferably taken from the same patient (healthy tissue peripheral zone to the tumor). Alternatively it may consist of encephalic fragments obtained after surgery called cortectomy performed on individuals without brain tumors but in the context of intervention for the treatment of epilepsy or following traumatic brain injury. "Reference healthy tissue" may also be a sample of biological fluids, including blood serum or blood plasma taken from a healthy person, and especially from a person with no cancer. "Reference ODG tissue" is tissue from a patient in which the presence of an oligodendroglioma has been certified by pathological analysis. "A reference GBM tissue" is a tissue from a patient in which the presence of glioblastoma has been diagnosed by pathological analysis. "Reference ODG tissue" or "reference GBM tissue" is brain tissue, the aforementioned tissue may be a tumor fragment (glioma) obtained by excision in a patient and whose tumor type has been certified by pathological analysis. Ideally, the diagnosis of oligodendrogliomas or glioblastomas can also be confirmed by molecular analyzes such as for example the analysis of the gene expression profiles of these tumor tissues. Indeed, a classification method, based on the use of expression levels of 54 genes obtained by hybridization on a chip, can be used to classify tumors (Li A, Walling J, Ahn S, Kotliarov Y, Su Q, Quezado M, Oberholtzer JC, Park J, Zenklusen JC, Fine HA Cancer Res 2009 Mar 1; 69 (5): 2091-9). Glioblastomas or oligodendrogliomas are classified respectively in groups G and O of the above-mentioned publication.

The expression levels of miRNAs measured in the sample from the above patient can be compared only with those measured in a reference healthy tissue. This is the first method to compare miRNA expression levels.

In a second comparison method, miRNA expression levels measured in the above sample can be compared with reference healthy tissue, reference ODG tissue, and reference GBM tissue, respectively.

In a particular embodiment, the method consists in using a set of miRNAs comprising at least two specific miRNAs. The level of expression of a miRNA measured in the sample from a patient suspected of having an ODG or GBM is compared with that measured in a healthy reference tissue.

The result of this comparison can be expressed as a ratio of levels of expression between that measured in the sample from said patient and that measured in the reference healthy tissue. When the ratio is greater than 1, it means that said miRNA is overexpressed in the sample from said patient relative to its level of expression in the reference healthy tissue. In contrast, when this ratio is less than 1, said miRNA is under-expressed in the sample from said patient with respect to his level of expression in the reference healthy tissue. When the above ratio is greater than 5, overexpression of said miRNA in the sample from said patient relative to the level of expression of said miRNA in healthy tissue is significant. When the above ratio is less than 0.2, the subexpression of said miRNA in the sample from said patient relative to the level of expression of said miRNA in healthy tissue is significant. On the other hand, when the value of the aforesaid ratio is between 0.2 and 5, the level of expression of said miRNA measured in the sample from said patient is not considered to be significantly different from that measured in the reference healthy tissue. . More particularly, this in vitro diagnostic method according to the invention comprises: (i) measurement in a sample from a patient suspected of having one of the above-mentioned brain tumors, expression levels of two miRNAs, - a first miRNA selected from one of three miRNA groups, * group 1 consisting of miRNAs belonging to group A, * group 2 consisting of miRNAs belonging to group B, * group 3 consisting of miRNAs belonging to groups C or D, - a second miRNA chosen from one of the three above-mentioned groups, - the two above-mentioned miRNAs that do not belong to the same group, (ii) the comparison of the expression levels of the above-mentioned miRNAs measured in the sample from of the above-mentioned patient with those of the above-mentioned miRNAs measured in a reference healthy tissue.

The level of expression of a group A miRNA in GBM tissue is significantly different from that in healthy tissue. The level of expression of a Group B miRNA in an ODG tissue is significantly different from that in healthy tissue. The level of expression of a miRNA belonging to group C or D in glial tissue, i.e., glioblastoma or oligodendroglioma, is significantly different from that in healthy tissue.

In a particular embodiment, the method according to the invention comprises: (i) measuring in a sample from a patient suspected of having one of the above brain tumors, expression levels of two miRNAs, - a first miRNAs selected from one of the three groups of miRNAs, * group 1 consisting of miRNAs belonging to group A, 20 * group 2 consisting of miRNAs belonging to group B, * group 3 consisting of miRNAs belonging to groups C or D, - a second miRNA selected from one of the three aforesaid groups, - the two aforesaid miRNAs not belonging to the same group, (ii) comparing the levels of expression of the above miRNAs measured in the sample from of the above-mentioned patient with those of the above-mentioned miRNAs measured in a reference healthy tissue.

In a particular embodiment, the method according to the invention consists in using two miRNAs, one of which, selected from group A, makes it possible to signal the presence of a glioblastoma; the other, selected from group B, makes it possible to indicate the presence of an oligodendroglioma. This in vitro diagnostic method according to the invention, comprising: (i) measurement in a sample from a patient suspected of having one of the above brain tumors, expression levels of two miRNAs, - a first miRNA selected from group A, and - from a second miRNA selected from group B, (ii) comparing the levels of expression of the above miRNAs measured in the sample from the above patient with those of the above miRNAs measured in a tissue healthy reference.

In this diagnostic method according to the invention, the deduction of the presence of ODG in the sample from a patient suspected of having one of the above-mentioned tumors is made * when the level of expression of the second miRNA (chosen in FIG. group B) measured in said sample is at least 5 times greater or at least 5-fold lower than that of said miRNA measured in reference healthy tissue, and * when the level of expression of the first miRNA (selected in group A) measured in said sample is not at least 5 times greater or at least 5 times lower than that of said miRNA measured in a reference healthy tissue,

On the other hand, the deduction of the presence of GBM in the sample from a patient suspected of having one of the above-mentioned tumors is made when the level of expression of the second miRNA (selected in group B) measured in said sample. is not at least 5 times greater or at least 5 times lower than that of the above miRNA measured in reference healthy tissue, and * when the level of expression of the first miRNA (selected in group A) measured in said sample is at least 5 times higher than that of the above miRNA measured in a reference healthy tissue. In another particular embodiment, the method according to the invention consists in using two miRNAs, one of which, selected from group C or D, makes it possible to signal the presence of a glioma; the other, selected from group A, confirms the presence of a glioblastoma. More particularly, this in vitro diagnostic method according to the invention, comprising: (i) measuring in a sample from a patient suspected of having one of the above brain tumors, expression levels of two miRNAs; first miRNA being selected from group C or D, - the second miRNA being selected from group A, (ii) comparing the levels of expression of the above-mentioned miRNAs measured in the sample from the aforementioned patient suspected of having one of the above tumors with those of the above miRNAs measured in a healthy reference tissue.

In this method, the deduction of the presence of ODG in the sample from a patient suspected of having one of the above-mentioned tumors is made * when the level of expression of the first miRNA measured in said sample is at least 5 times greater or at least 5 times lower than that of the above-mentioned first miRNA measured in reference healthy tissue, and * when the level of expression of the second miRNA measured in said sample is not at least 5 times greater or at least 5 times lower to that of the aforementioned second miRNA measured in a healthy reference tissue.

In this method, the deduction of the presence of GBM in the sample from a patient suspected of having one of the above-mentioned tumors is made * when the level of expression of the first miRNA measured in said sample is at least 5-fold higher or at least 5 times lower than that of the above-mentioned first miRNA measured in a reference healthy tissue, and * when the level of expression of the second miRNA measured in said sample is at least 5 times greater than that of the aforementioned second miRNA measured in a healthy tissue reference.

In another particular embodiment, the method according to the invention consists in using two miRNAs, one of which, selected from group C or D, makes it possible to signal the presence of a glioma; the other, selected from group B, confirms the presence of an oligodendroglioma. More particularly, this in vitro diagnostic method according to the invention, comprising: (i) measuring in a sample from a patient suspected of having one of the above-mentioned brain tumors, expression levels of two miRNAs, - the first miRNA being selected from group C or D, and - the second miRNA being selected from group B, (ii) comparing the levels of expression of the above miRNAs measured in the sample from the above-mentioned patient to present one of the said method, the deduction of the presence of ODG in the sample from a patient suspected of having one of the above-mentioned tumors is made * when the level of expression of the first miRNA measured in said sample is at least 5 times greater or at least 5 times lower than that of the above-mentioned first miRNA measured in a reference healthy tissue, and * lor squeezing the level of expression of the second miRNA measured in said sample is also at least 5 times greater or at least 5 times lower than that of the above-mentioned 2nd miRNA measured in a reference healthy tissue. On the other hand, the deduction of the presence of GBM in the sample from a patient suspected of having one of the above-mentioned tumors is made * when the level of expression of the first miRNA measured in said sample is at least 5-fold higher or at least 5 times lower than that of the above-mentioned first miRNA measured in reference healthy tissue, and * when the level of expression of the second miRNA measured in said sample is not at least 5 times greater or at least 5 times less than that of the aforementioned second miRNA measured in a reference healthy tissue. In one advantageous embodiment, the invention consists in using a set of miRNAs comprising at least three specific miRNAs: a first miRNA whose level of expression in a glioblastoma is significantly different from that measured in a healthy tissue, a second miRNA whose level of expression in an oligodendroglioma is significantly different from that measured in healthy tissue; a third miRNA whose respective level of expression in a glioblastoma and an oligodendroglioma is significantly different from that measured in a tissue; healthy. Expression levels of miRNAs measured in a sample from a patient suspected of having ODG or GBM are compared only with reference healthy tissue. The results of comparisons can be expressed as ratios of levels of expression between that measured in the sample from said patient and that measured in the reference healthy tissue.

In a particular embodiment of the invention, the method comprises measuring the levels of expression - of a first miRNA chosen in group A, - a second miRNA chosen from group B, - and measuring the level of expression of a third miRNA selected from group C consisting of hsa-miR-424-star, hsa-miR-503, hsa-miR-132, hsa-miR-1301, hsa-miR-1231, hsa- mi miR-328, hsa-miR-1180, hsa-miR-149, hsa-miR-491-5p, hsa-miR-1280, hsa-miR-490-5p, hsa-miR-431-star, hsa-miR- 770-5p, hsa-miR-769-3p, hsa-miR-129-5p, hsa-miR-139-3p, hsamiR-139-5p, or in group D consisting of hsa-miR-199a-3p, in a sample from a patient suspected of having one of the above brain tumors.

The above method comprises: (i) measurement in a sample from a patient suspected of having one of the above brain tumors, expression levels of at least three miRNAs, - at least one first miRNA selected from group A consisting of hsa-miR-200c, hsa-miR-199a-5p, hsa-miR-2 1 -star, hsa-miR-146b-5p and hsa-miR-3 1 - at least one second miRNA selected from group B consisting of hsa-miR-135astar, hsa-miR-99a-star, hsa-miR-382, hsa-miR-409-3p and hsa-miR-191-star, and - at least a third miRNA selected from groups C + D, consisting of hsa-miR-424-star, hsa-miR-503, hsa-miR-132, hsa-miR-1301, hsa-miR-1231, hsa-miR-328, hsa-miR-1180, hsa mR-149, hsa-miR-491-5p, hsa-miR-1280, hsa-miR-490-5p, hsa-miR-43 1-star, hsamiR-770-5p, hsa-miR-769-3p, hsa-miR-129-5p, hsa-miR-139-3p, hsa-miR-139-5p and hsamiR-199a-3p, (ii) comparison of expression levels of the above miRNAs measured in the sample from of the aforesaid patient with those of the aforesaid miRNAs measured in a healthy reference tissue.

The expression level of a miRNA belonging to group C or D in ODG tissue or GBM tissue is significantly different from that in healthy tissue. In this method according to the invention, the deduction of the presence of ODG in the sample from a patient suspected of having one of the above-mentioned tumors is made, when the level of expression of the second miRNA measured in said sample is at least 5 times greater or 5 times lower than that measured in reference healthy tissue, and - when the level of expression of the first miRNA measured in said sample 5 is not at least 5 times greater or 5 times lower than that measured in a reference healthy tissue, and - when the level of expression of the third miRNA measured in said sample is at least 5 times greater or 5 times lower than that measured in a reference healthy tissue. In this method according to the invention, the deduction of the presence of GBM in the sample from a patient suspected of having one of the above-mentioned tumors is made, when the level of expression of the first miRNA measured in said sample is at least 5 times greater than that measured in reference healthy tissue, and - when the level of expression of the second miRNA measured in said sample is not at least 5 times greater or 5 times lower than that measured in healthy tissue reference number, and - when the level of expression of the third miRNA measured in said sample is 5 times greater or 5 times lower than that measured in a reference healthy tissue.

In another particular embodiment, the method consists in using a set of 20 miRNAs comprising at least two specific miRNAs. The levels of expression of the above miRNAs measured in a sample from a patient suspected of having an ODG or GBM are compared with those measured in reference healthy tissue, reference GBM tissue and tissue respectively. 'ODG reference. This in vitro diagnostic method according to the invention comprises: (i) measurement in a sample from a patient suspected of having one of the above brain tumors, expression levels of two miRNAs, - a first miRNA selected in group A, a second miRNA selected from group B, (ii) comparing the levels of expression of the above miRNAs measured in the sample from the above patient with those of the above miRNAs measured in a reference healthy tissue. , a reference ODG tissue, and a reference GBM tissue. The level of expression of a group A miRNA in a GBM tissue is significantly different from that in an ODG tissue. In this method, the deduction of the presence of GBM in the sample from a suspected patient to present one of the above-mentioned tumors is made, - when the level of expression of the first miRNA measured in said sample is at least 5 times greater than that measured in a reference healthy tissue, and - when the level of expression of the second miRNA measured in said sample is not at least 5 times greater or at least 5 times lower than that measured in reference healthy tissue, and - when the level of expression of the first miRNA measured in said sample is at least 5 times greater than to that measured in a reference ODG tissue, and - when the expression levels of the first and second miRNAs measured in said sample are not 5 times greater or 5 times lower to those measured in a reference GBM tissue. More particularly, the deduction of the presence of GBM in the sample from a patient suspected of having one of the above-mentioned tumors is made, - when the level of expression of the first miRNA measured in said sample is at least 5 times greater than that measured in a reference healthy tissue, and - when the expression level of the first miRNA measured in said sample is at least 5 times greater than that measured in a reference ODG tissue, and - when the levels of expression the first and second miRNAs measured in said sample have only a difference of less than 20%, respectively, with respect to those measured in a reference GBM tissue.

In this method, the deduction of the presence of ODG in the sample from a patient suspected of having one of the above-mentioned tumors is made, when the level of expression of the second miRNA measured in said sample is at least 5. 5 times less than that measured in a reference healthy tissue, and - when the level of expression of the first miRNA measured in said sample is not at least 5 times greater or at least 5 times lower than that measured in a reference healthy tissue, and - when the level of expression of the first miRNA measured in said sample is at least 5 times lower than that measured in a reference GBM tissue, and - when the levels of expression of the first and of the second miRNAs measured in said sample are not 5 times greater or 5 times lower than those measured in a reference ODG tissue. More particularly, the deduction of the presence of ODG in the sample from a patient suspected of having one of the above-mentioned tumors is made, - when the level of expression of the second miRNA measured in said sample is at least 5 times greater or 5 times lower than that measured in a reference healthy tissue, and - when the level of expression of the first miRNA measured in said sample is at least 5 times lower than that measured in a reference GBM tissue, and - when the The expression levels of the first and second miRNAs measured in said sample respectively show only a difference of less than 20% compared to those measured in a reference ODG tissue.

In an advantageous embodiment of the invention, step (i) of the aforesaid method further comprises measuring the level of expression of a third miRNA selected from group C or D, consisting of hsa-miR- 424-star, hsa-miR-503, hsa-miR-132, hsa-miR-1301, hsa-miR-1231, hsa-miR-328, hsa-miR-1180, hsa-miR-149, hsa-miR- 491-5p, hsa-miR-1280, hsa-miR-490-5p, hsa-miR-431-star, hsa-miR-770-5p, hsa-miR-769-3p, hsa-miR-129-5p, hsa-miR-139-3p, hsa-miR-139-5p and hsa-miR-199a-3p, in a sample from a patient suspected of having one of the above brain tumors. This group of miRNAs, whose level of expression in an ODG tissue or in a GBM is significantly different from that in healthy tissue, can indicate the presence of a glioma in a sample from a suspected patient to present a glioma.

More particularly, this in vitro diagnostic method according to the invention, comprising: (i) measuring in a sample from a patient suspected of having one of the above brain tumors, expression levels of at least three miRNAs, at least one first miRNA selected from group A, at least one second miRNA selected from group B, and at least one third miRNA selected from group C or D; (ii) comparing the levels of expression of the aforesaid miRNAs measured in the sample from the above patient with those of the above miRNAs measured in a reference healthy tissue, a reference ODG tissue and a reference GBM tissue.

In a particular embodiment of the invention, the third miRNA used in the method according to the invention is chosen from group C, namely from hsa-miR-424-star, hsa-miR-503, hsa-miR- 132, hrs-miR-1301, hrs-miR-1231, hsa-miR-328, hsa-miR-1180, hsa-miR-149, hsa-miR-491-5p, hsa-miR-1280, hsa-miR- 490-5p, hsa-miR-43 1-star, hsa-miR-770-5p, hsa-miR-769-3p, hsa-miR-129-5p, hsa-miR-139-3p, hsa-miR-139 -5p.

In this method, the deduction of the presence of ODG in the sample from a patient suspected of having one of the above-mentioned tumors is made, - when the level of expression of the second miRNA measured in said sample is at least 5 times greater than 5 times less than that measured in reference healthy tissue, and - when the level of expression of the first miRNA measured in said sample is not at least 5 times greater or 5 times lower than that measured in healthy tissue reference level, when the level of expression of the first miRNA measured in said sample is at least 5 times lower than that measured in a reference GBM tissue, when the levels of expression of the first and second miRNAs measured in said sample are not at least 5 times greater or 5 times lower than those measured in a reference ODG tissue, and - when the level of expression of the third miRNA measured in This sample is at least 5 times greater or 5 times smaller than that measured in a reference healthy tissue. More particularly, the deduction of the presence of ODG in the sample from a patient suspected of having one of the above-mentioned tumors is made, - when the level of expression of the second miRNA measured in said sample is at least 5 times greater or 5 times lower than that measured in a reference healthy tissue, and - when the level of expression of the first miRNA measured in said sample is at least 5 times lower than that measured in a reference GBM tissue, - when the expression levels of the first and second miRNAs measured in said sample show only a difference of less than 20% compared to those measured in a reference ODG tissue, and - when the level of expression of the third miRNA measured in said sample is at least 5 times greater or 5 times lower than that measured in a reference healthy tissue.

On the other hand, the deduction of the presence of GBM in the sample from a patient suspected of having one of the above-mentioned tumors is made, when the level of expression of the first miRNA measured in said sample is respectively 5 times greater than that measured in a reference healthy tissue, and - when the level of expression of the second miRNA measured in said sample is not at least 5 times greater or 5 times lower than that measured in a reference healthy tissue, and - when the level of expression of the first miRNA measured in said sample is at least 5 times greater than that measured in a reference ODG tissue, and - when the expression levels of the first, second and third miRNAs measured in said sample are not not less than 5 times or 5 times lower than those measured in reference GBM tissue, and - when the level of expression of the third miRNA measured in sample is at least 5 times or 5 times lower than that measured in a healthy reference tissue. More particularly, the deduction of the presence of GBM in the sample from a patient suspected of having one of the above-mentioned tumors is made, - when the level of expression of the first miRNA measured in said sample is respectively 5 times greater than that measured in a reference healthy tissue, and - when the level of expression of the first miRNA measured in said sample is at least 5 times greater than that measured in a reference ODG tissue, and - when the levels of expression of the first, second and third miRNAs measured in said sample have a difference of less than 20% compared to those measured in a reference GBM tissue, and - when the level of expression of the third miRNA measured in said sample is at less than 5 times or 5 times less than that measured in a reference healthy tissue.

In a particular embodiment of the invention, the third miRNA used in the method according to the invention above is selected from group D, namely hsa-miR-199a-3p. In this method, the deduction of the presence of ODG in the sample from a patient suspected of having one of the above-mentioned tumors is made, - when the level of expression of the second miRNA measured in said sample is at least 5 times greater than 5 times less than that measured in reference healthy tissue, and - when the level of expression of the first miRNA measured in said sample is not at least 5 times greater or 5 times lower than that measured in healthy tissue reference level, - when the level of expression of the first miRNA measured in said sample is at least 5 times lower than that measured in a reference GBM tissue, - when the expression levels of the first, second and third miRNAs measured in said sample does not present at least 5 times greater or 5 times lower than those measured in a reference ODG tissue, and - when the level of expression of the third miRNA measured in said sample is at least 5 times greater than that measured in a reference healthy tissue, and at least 5 times lower than that measured in a reference GBM tissue. More particularly, the deduction of the presence of ODG in the sample from a patient suspected of having one of the above-mentioned tumors is made, - when the level of expression of the second miRNA measured in said sample is at least 5 times greater or 5 times lower than that measured in a reference healthy tissue, and - when the expression level of the first miRNA measured in said sample is at least 5 times lower than that measured in a reference GBM tissue, - when the levels of expression of the first, second and third miRNAs measured in said sample have a difference of less than 20% compared to those measured in a reference ODG tissue, and - when the level of expression of the third miRNA measured in said sample is at least 5 times greater than that measured in a reference healthy tissue, and at least 5 times lower than that measured in a GBM tissue of eference. On the other hand, the deduction of the presence of GBM in the sample from a patient suspected of having one of the above-mentioned tumors is made, when the level of expression of the first miRNA measured in said sample is respectively 5 times greater than that measured in a reference healthy tissue, and - when the expression level of the second miRNA measured in said sample is not at least 5 times greater or 5 times lower than that measured in a reference healthy tissue, and - when the level of expression of the first miRNA measured in said sample is at least 5 times greater than that measured in a reference ODG tissue, and - when the expression levels of the first, second and third miRNAs measured in said sample do not are not at least 5 times greater or 5 times lower than those measured in reference GBM tissue, and - when the level of expression of the third miRNA measured in said The sample is at least 5-fold higher than those measured in a reference healthy tissue and a standard ODG tissue. More particularly, the deduction of the presence of GBM in the sample from a patient suspected of having one of the above-mentioned tumors is made, - when the level of expression of the first miRNA measured in said sample is respectively 5 times greater than that measured in a reference healthy tissue, and when the expression level of the first miRNA measured in said sample is at least 5 times greater than that measured in a reference ODG tissue, and when the levels of expression the first and third miRNAs measured in said sample have a difference of less than 20% compared to those measured in reference GBM tissue, and when the level of expression of the third miRNA measured in said sample is at least 5 times higher than those measured in a reference healthy tissue and a reference ODG tissue.

More particularly, since expression levels of hsa-miR-199a-3p in ODG tissue, GBM tissue and healthy tissue are significantly different from each other, assaying this single miRNA would confirm whether the tissue is tumorous or not and would further specify that the glioma is either an ODG or a GBM. A particular diagnostic method of a brain tumor belonging to the group consisting of 2 types of tumors: ODG, GBM, and tumor type identification is to use miRNA hsa-miR-199a-3p alone. This method comprises: (i) measuring the level of expression of hsa-miR-199a-3p, in a sample from a patient suspected of having one of the above brain tumors, (ii) comparing the level of expression of the above miRNA measured in the sample from the above patient with that of the above miRNA measured in a reference healthy tissue, a reference ODG tissue, and a reference GBM tissue.

In this method, the deduction of the presence of ODG in the sample from said patient is made, * when the level of expression of said miRNA in said sample is at least 5 times greater than that measured in a reference healthy tissue, and * when the level of expression of said miRNA in said sample is at least 10-fold lower than that measured in a reference GBM tissue, and * when the level of expression of said miRNA in said sample is not at least 5 times greater or 5 times lower than that measured in a reference ODG tissue. More particularly, the deduction of the presence of ODG in the sample from said patient is made, when the level of expression of said miRNA in said sample is at least 5 times greater than that measured in a reference healthy tissue, and * when the level of expression of said miRNA in said sample is at least 5 times less than that measured in a reference GBM tissue, and * when the level of expression of said miRNA in said sample only shows a difference less than 20% of that measured in a standard ODG tissue.

In this method, the deduction of the presence of GBM in the sample from said patient is made, when the level of expression of said miRNA in said sample is at least 5 times greater than that measured in a reference healthy tissue, and * when the level of expression of said miRNA in said sample is at least 5 times greater than that measured in a reference ODG tissue, and * when the level of expression of said miRNA in said sample is not at 30 less than 5 times or 5 times less than that measured in a reference GBM tissue. More particularly, the deduction of the presence of GBM in the sample from said patient is made, * when the level of expression of said miRNA in said sample is at least 5 times greater than that measured in a reference healthy tissue, and * when the level of expression of said miRNA in said sample is at least 5 times greater than that measured in a reference ODG tissue, and * when the level of expression of said miRNA in said sample shows only a difference less than 20% of that measured in a reference GBM tissue.

The invention is further illustrated by the figures and examples given below. The embodiment of the present invention is in no way limited to these figures and examples. FIG. 1 shows, respectively, the profiles of the expression levels of hsa-miR-21-star and hsa-miR-135a-star in a reference healthy tissue (N) represented by a black dot, in a Reference ODG tissue (ODG) represented by black triangle and in a reference GBM fabric (GBM) represented by black square. The y-axis represents the absolute value of miRNA measured in a tissue. Figure 2: Figure 2 illustrates respectively the profiles of the expression levels of hsa-miR-21-star and hsa-miR-135a-star in a sample number 1 represented by black triangle, in a sample number 2 represented by point black and in a sample number 3 represented by black square. The y-axis represents the absolute value of miRNA measured in a tissue. Figure 3: Figure 3 shows respectively the expression levels of hsa-miR-146b-5p, hsa-miR-99a-star and hsa-miR-328 in a healthy tissue reference (N) represented by black dot in a reference ODG tissue (ODG) represented by black triangle and in a reference GBM tissue (GBM) represented by black square. The y-axis represents the absolute value of miRNA measured in a tissue. Figure 4: Figure 4 shows respectively the profiles of expression levels of hsa-miR-146b-5p, hsa-miR-99a-star and hsa-miR-328 in a sample number 4 represented by black triangle, in a sample number 5 represented by black square and in a sample 30 number 6 represented by black dot. The y-axis represents the absolute value of miRNA measured in a tissue. Figure 5: Figure 5 shows respectively the expression levels of hsa-miR-424-star, hsa-miR-1301, hsa-miR-199a-5p and hsa-miR-99a-star in a healthy tissue. reference (N) represented by black dot, in a reference ODG fabric (ODG) represented by black triangle and in a reference GBM fabric (GBM) represented by black square. The y-axis represents the absolute value of miRNA measured in a tissue. Figure 6: Figure 6 illustrates respectively the profiles of expression levels of hsa-miR-424-star, hsa-miR-1301, hsa-miR-199a-5p and hsa-miR-99a-star a sample number 7 shown by black triangle, in a sample number 8 represented by black square and in a sample number 9 represented by black dot. The y-axis represents the absolute value of miRNA measured in a tissue.

Examples Example 1: Materials and Methods This example illustrates the preferred methods of the inventors but does not constitute an exhaustive list of the methods that can be used to carry out the invention.

1.1 Tumor specimens Tumor samples of glioblastoma, oligodendrogliomas and meningiomas as well as samples of healthy tissue (cortectomies) are obtained after excision by neurosurgeons in the operating theater of Grenoble University Hospital and are immediately frozen at -80 ° C. Tissue sections of about 40 μm thickness are then made using a cryotome in sufficient number to obtain about 80 mg of tissue and stored at -80 ° C until RNA extraction.

1.2 Biological Liquids For the purification of circulating microRNAs in the blood, blood samples are taken from patients on PAXGene Blood RNA sampling tubes (PreAnalytix-Qiagen-BD Company). The total lysis of the circulating cells is carried out and the RNAs are collected by centrifugation and purified according to the indications of the supplier. With regard to the microRNA fractions contained in microvesicles produced by tumors and present in the blood, the method used is directly based on that described by Skog et al (Skog J, Würdinger T, van Rijn S, Meijer DH, Gainche L, Sena-Esteves M, Curry WT Jr, BS Carter, Krichevsky AM, Breakefield XO Glioblastoma microvesicles transport RNA and proteins that promote tumor growth and provide diagnostic biomarkers (Skog et al., Nat Cell Biot 2008 Dec; (12): 1470-6, Epub 2008 Nov 16) .10 The microvesicles are purified from the sera by centrifugation and microfiltration.The sera are centrifuged a first time for 10 min at 300 g, then the supernatants are then centrifuged for 20 min. at 17000 g and filtered on a 0.22 micron filter The microvesicles are obtained by ultracentrifugation of the filtrate at 110000 g for 70 min The pellet is finally resuspended in phosphate buffer (PBS) and the RNA are extracted salt the protocol described below.

1.3 RNA extraction The RNAs are extracted using the hsa-miRVanaTM kit (Ambion, ABI) to separate the long RNAs (size> 250 nt) from the short RNAs (size <250 nt) according to the supplier's recommendations. Briefly, the tissue is first lyzed, the RNA is then precipitated after addition of sodium acetate and ethanol, extracted in the presence of a phenol / chloroform mixture, separated according to their size on chromatographic columns and then eluted. The eluted RNAs are then quantified by measuring the OD at 260 nm using the Nanodrop ND-1000 spectrophotometer and a quality control of these RNAs is carried out by electrophoretic migration in a polymer gel on the BioAnalyser 2100 using the RNA 6000 nano kit. LabChip® (Agilent).

1.4 miRNA Assay by DNA Hybridization The short (less than 250 bases) RNAs obtained in the previous step are used for the GeneChip miRNA Affymetrix DNA Hybrid Analysis. The first step is to add a poly-A end at the 3 'position of the RNAs. The second step is to carry out the labeling of the RNAs. For this, a ligation reaction will be made to add to the RNA biotinylated DNA (for example with the labeling and detection reagents of the HSR Flash Tag kit from Genisphere, Hatfield, USA). Once this step is completed, hybridization can take place with the probes on the chip. After the hybridization, there is a step of amplification of the marking and washing that are done before the chip is scanned. Finally the chip will be scanned and we get an image of each chip that must be processed to have an intensity value corresponding to the RNA / probe hybridization for each microRNA. The data are then processed and standardized with QC Tools software according to the methods proposed by Irizarry et al (RA Irizarry, Hobbs B, Collin F, Beazer-Barclay Y, KJ Antonellis, U Scherf and P. Speed. Exploration, Normalization, and Summaries of High Density Oligonucleotide Array Probe Level Data, Biostatistics, April 2003; Vol 4; Number 2: 249-264).

Alternatively, the results can also be generated by assaying with RT-Q-PCR, any other type of DNA chip from any vendor or any other assay method. The analyzes can be performed on biological fluids (blood or subfraction for example). 1.5 Real-time PCR miRNA assay The expression of miRNAs is quantified by the quantitative PCR technique using the Applied Biosystems distributed kits, which are specific for mature miRNAs. In a first step, 80 ng of short RNAs are inversely transcribed (in single-stranded cDNA) in the presence of loop primers, which confer the specificity for the quantification of the expression of mature miRNAs. Real-time PCR is then performed using the primers provided in the kits. One of the primers comprises fluorescent groups (so-called Taqman® probe) which makes it possible to perform a quantitative measurement using a suitable fluorimeter such as the Stratagene Mx3005 station. The detection threshold is determined initially by the user at the beginning of the exponential phase. The value of Ct corresponds to the number of cycles from which the fluorescence exceeds this detection threshold. This Ct value is proportional to the amount of cDNA initially present in the sample. In the absence of a specific standard range for each cDNA, only relative quantification between samples is possible. The assay values for each miRNA are normalized with the data obtained for a non-coding RNA, RNU24.

Example 2 A scan on 847 human miRNAs makes it possible to identify 28 miRNAs whose expression levels are modified in at least one type of tumor belonging to the group consisting of ODG, and GBM. Table 2 below shows the levels of expression of these 28 miRNAs measured respectively in a reference healthy tissue (N), a reference oligodendroglioma tissue (ODG), and a reference glioblastoma tissue (GBM), as well as ratios of GBM / N, OGD / N and GBM / ODG expression levels. TABLE 2 ODG GBM N ODGIN GBM / N GBM / ODG hsa-miR-200c 13 1831 8 1.6 227.8 139.8 hsa-miR-199a-5p 36 711 17 2.1 42.1 20.0 hsa -miR-21-star 9 152 8 1.1 18.6 16.9 hsa-miR-146b-5p 69 536 53 1.3 10.2 7.8 hsa-miR-31 34 862 168 0.2 5, 1 25.4 hsa-miR-135a-star 62 7 10 6.0 0.6 0.1 hsa-miR-99a-star 78 17 9 8.6 1.9 0.2 hsa-miR-382 98 231 801 0.1 0.3 2.4 hrs-miR-409-3p 80 271 559 0.1 0.5 3.4 hsa-miR-191-star 7 23 56 0.1 0.4 3.2 hsa-miR -424-star 58 54 5 11.0 10.4 0.9 hsa-miR-503 52 88 10 5.2 8.7 1.7 hsa-miR-132 574 598 3269 0.18 0.18 1.0 hsa-miR-1301 119 119 757 0.16 0.16 1.0 hrs-miR-1231 113 116 792 0.14 0.15 1.0 hrs-miR-328 15 8 117 0.13 0.07 0, Hrs-miR-1180 151 91 1233 0.12 0.07 0.6 hrs-miR-149 253 184 2112 0.12 0.09 0.7 hrs-miR-491-5p 88 61 953 0.09 0, 06 0.7 hsa-miR-1280 127 146 2340 0.05 0.06 1.1 hsa-miR-490-5p 5 3 97 0.05 0.03 0.7 hsa-miR-431-star 7 6 180 0.04 0.03 0.8 hsa-miR-770-5p 6 8 159 0.03 0.05 1.4 hsa-miR-769-3p 5 5 260 0.02 0.02 1.0 hsa-miR -129-5p 17 6 1075 0.02 0.01 0.4 hsa-miR-139- 5p 503 115 2780 0.18 0.04 0.2 hsa-miR-139-3p 36 5 811 0.04 0.006 0.14 hsa-miR-199a-3p 62 1097 11 5.8 102.6 17.8 specific of the

group A GBM group A group A group A group A

group B ODG group B group B group B group B

group C gliomas group C group C group C group C group C group C group C group C group C group C group C group C group C group C group C group C

group D gliomas Example 3

The expression levels of 2 miRNAs, namely hsa-miR-21-star and hsa-miR-135a-star, are measured in a reference healthy tissue, a reference ODG tissue and a GBM tissue respectively. reference according to the method described in Examples 1.3, 1.4 and 1.5 above. Expression levels of these two miRNAs are also measured in three samples from patients suspected of having oligodendroglioma or glioblastoma. The reference tissues as well as the samples from the patients are taken according to example 1.1 above. The tumor character of the reference ODG tissue and the reference GBM tissue is confirmed by other diagnostic methods known to those skilled in the art. The hsa-miR-21-star miRNA belonging to group A, is overexpressed in a glioblastoma tissue, whereas its level of expression in oligodendroglioma tissue is not significantly different from that in healthy tissue. A high level of expression of this miRNA in tissue indicates the presence of glioblastoma in this tissue. The hsa-miR-135a-star miRNA belonging to group B is overexpressed in an oligodendroglioma tissue, whereas its level of expression in glioblastoma tissue is not significantly different from that in healthy tissue. A high level of expression of this miRNA in a tissue makes it possible to indicate the presence of an oligodendroglioma in this tissue. The profiles of the expression levels of these two miRNAs in the three reference tissues are established from the absolute values of the expression levels of these two miRNAs measured in the three reference tissues (FIG. 1). The profiles of the expression levels of these two miRNAs in three patient samples are derived from the absolute values of the expression levels of these two miRNAs measured in these three samples (Figure 2).

Diagnosis of Sample No. 1 The level of expression of hsa-miR-21-star measured in Sample No. 1 was not significantly different from those measured in reference healthy tissue and in ODG tissue. reference, but is significantly different from that measured in the 29 GBM reference tissue. These results mean that sample number 1 is not a glioblastoma. The expression level of hsa-miR-135a-star measured in sample number 1 is significantly higher than those measured in the reference healthy tissue and in the reference GBM tissue. This means the presence of an oligodendroglioma in sample number 1. The combination of all these results makes it possible to diagnose the presence of oligodendroglioma in sample 1.

Diagnosis of Sample Number 2 The expression level of hsa-miR-21-star measured in sample number 2 is not significantly different from those measured in the reference healthy tissue and in the ODG tissue of reference, but is significantly different from that measured in the reference GBM tissue. These results mean that sample number 2 is not a glioblastoma. The expression level of hsa-miR-135a-star measured in sample number 2 is not significantly different from those measured in the reference healthy tissue or in reference GBM tissue, but is significantly different from that of measured in the standard ODG tissue. This means that sample number 2 is not an oligodendroglioma. The combination of all these results makes it possible to diagnose that sample number 2 is a normal tissue.

Diagnosis of Sample Number 3 The expression level of hsa-miR-21-star measured in Sample # 3 is significantly higher than that measured in the reference healthy tissue or reference ODG tissue, but is not significantly different from that measured in the reference GBM tissue. These results show that sample number 3 is probably a glioblastoma.

The expression level of hsa-miR-135a-star measured in sample number 3 is not significantly different from those measured in the reference healthy tissue, but significantly different from that measured in the reference oligodentroglioma tissue. . This shows that sample number 1 is not an oligodendroglioma.

The combination of all these results makes it possible to diagnose the presence of glioblastoma in sample number 3.

EXAMPLE 4 The expression levels of three miRNAs, namely hsa-miR-146b-5p, hsa-miR-99astar, and hsa-miR-328, are measured respectively in a reference healthy tissue, an ODG tissue of reference and a reference GBM tissue according to the method described in Examples 1.3, 1.4 and 1.5 above. Expression levels of these two miRNAs are also measured in three samples from patients suspected of having oligodendroglioma or glioblastoma. The reference tissues as well as the samples from the patients are taken according to example 1.1 above. The tumor character of the reference ODG tissue and reference GBM tissue is confirmed by other diagnostic methods known to those skilled in the art. The hsa-miR-146b-5p miRNA belonging to group A, is overexpressed in glioblastoma tissue, while its level of expression in oligodendroglioma tissue is not significantly different from that in healthy tissue. A high level of expression of this miRNA in tissue indicates the presence of glioblastoma in this tissue. Hsa-miR-99a-star miRNA belonging to group B is overexpressed in oligodendroglioma tissue, whereas its level of expression in glioblastoma tissue is not significantly different from that in healthy tissue. A high level of expression of this miRNA in a tissue makes it possible to indicate the presence of an oligodendroglioma in this tissue. Hsa-miR-328 miRNA belonging to group C is under-expressed both in glioblastoma tissue and in oligodendroglioma tissue relative to healthy tissue. A very low level of expression of this miRNAs in a tissue makes it possible to indicate the presence of a glioma in this tissue. The profiles of the expression levels of these three miRNAs in the three reference tissues are established from the absolute values of the expression levels of these three miRNAs measured in the three reference tissues (FIG. 3). The profiles of the expression levels of these three miRNAs in three patient samples are based on the absolute values of the expression levels of these three miRNAs measured in these three samples (Figure 4).

Diagnosis of Sample Number 4 The level of expression of hsa-miR-146b-5p measured in sample number 4 is not significantly different from those measured in the reference healthy tissue and in the ODG tissue of reference, but is significantly different from that measured in the reference GBM tissue. These results mean that sample number 4 is not a glioblastoma. The expression level of hsa-miR-99a-star measured in sample number 4 is significantly higher than those measured in the reference healthy tissue and in the reference GBM tissue. This means the presence of an oligodendroglioma in sample number 4. The expression level of hsa-miR-328 measured in sample number 4 is significantly lower than that measured in the reference healthy tissue, but does not is not significantly different from those measured in the reference ODG tissue or in the reference GBM tissue. These results indicate that sample number 4 is not normal tissue, but most likely has a glial type tumor. The combination of all these results makes it possible to diagnose the presence of an oligodendroglioma in the sample 4.

Diagnosis of Sample No. 5 The expression level of hsa-miR-146b-5p measured in Sample No. 5 is significantly higher than that measured in reference healthy tissue or reference ODG tissue, but is not significantly different from that measured in the reference GBM tissue. These results show that sample number 5 is probably a glioblastoma.

The expression level of hsa-miR-99a-star measured in sample number 5 is not significantly different from that measured in the reference healthy tissue, but is significantly different from that measured in the ODG tissue of reference. This shows that sample number 5 is not an oligodendroglioma. The expression level of hsa-miR-328 measured in sample number 5 is significantly lower than that measured in the reference healthy tissue, but is not significantly different from those measured in the reference ODG tissue. or in the reference GBM fabric. These results indicate that sample number 5 is not normal tissue, but most likely has a glial type tumor.

The combination of all these results makes it possible to diagnose the presence of glioblastoma in sample number 5.

Diagnosis of Sample 6 The level of expression of hsa-miR-146b-5p measured in Sample 6 is not significantly different from that measured in the standard healthy tissue and in the ODG tissue of reference, but is significantly different from that measured in the reference GBM tissue. These results mean that sample number 6 is not a glioblastoma.

The expression level of hsa-miR-99a-star measured in sample number 6 is not significantly different from those measured in the reference healthy tissue or in a reference GBM tissue, but is significantly different from that of measured in the standard ODG tissue. This means that sample number 6 is not an oligodendroglioma. The expression level of hsa-miR-328 measured in sample number 6 is significantly higher than those measured in the reference ODG tissue or in the reference GBM tissue, but is not significantly different from that measured in the reference healthy tissue. These results indicate that sample number 6 is normal tissue, and does not exhibit glial type tumor. The combination of all these results makes it possible to diagnose that sample 6 is a normal tissue.

EXAMPLE 5 Expression levels of four miRNAs, namely hsa-miR-424-star, hsa-miR-1301, hsa-miRl99a-5p and hsa-miR-99a-star, are measured in healthy tissue respectively. reference, a reference ODG tissue and a reference GBM tissue according to the method described in Examples 1.3, 1.4 and 1.5 above. The expression levels of these two miRNAs are also measured in three samples from patients suspected of having an oligodendroglioma or glioblastoma. The reference tissues as well as the samples from the patients are taken according to Example 1.1 above. The tumor character of the reference ODG tissue and the reference GBM tissue is confirmed by other diagnostic methods known to those skilled in the art.

Hsa-miRl99a-5p miRNA belonging to group A, is overexpressed in glioblastoma tissue, whereas its level of expression in oligodendroglioma tissue is not significantly different from that in healthy tissue. A high level of expression of this miRNA in tissue indicates the presence of glioblastoma in this tissue.

The hsa-miR-99a-star miRNA belonging to group B, is overexpressed in oligodendroglioma tissue, whereas its level of expression in glioblastoma tissue is not significantly different from that in healthy tissue. A high level of expression of this miRNA in a tissue makes it possible to indicate the presence of an oligodendroglioma in this tissue. Hsa-miR-424-star miRNA belonging to group C is overexpressed in both glioblastoma tissue and oligodendroglioma tissue. A high expression level of this miRNAs in a tissue indicates the presence of a glioma in this tissue. Hsa-miR-1301 miRNA, belonging to group C, is under-expressed in both glioblastoma tissue and oligodendroglioma tissue. A very low level of expression of this miRNAs in a tissue means the presence of a glioma in this tissue.

The profiles of the expression levels of these four miRNAs in the three reference tissues are established from the absolute values of the expression levels of these two miRNAs measured in the three reference tissues (FIG. 5). The profiles of the expression levels of these four miRNAs in the three samples from the patients are established from the absolute values of the expression levels of these two miRNAs measured in these three samples (FIG. 6).

Diagnosis of Sample No. 7 The expression level of hsa-miRl99a-5p measured in Sample No. 7 is not significantly different from those measured in the reference healthy tissue and in the reference ODG tissue. but is significantly different from that measured in the reference GBM tissue. These results mean that sample number 7 is not a glioblastoma. The expression level of hsa-miR-99a-star measured in sample number 7 is significantly higher than those measured in the reference healthy tissue and in the reference GBM tissue. This means the presence of an oligodendroglioma in sample number 7. The hsa-miR-1301 expression level measured in sample number 7 is significantly lower than that measured in the reference healthy tissue, but is not not significantly different from those measured in the reference ODG tissue or in the reference GBM tissue. These results indicate that sample number 7 is not normal tissue, but most likely has a glial type tumor. The expression level hsa-miR-424-star measured in sample number 7 is significantly higher than that measured in the reference healthy tissue, but is not significantly different from those measured in the ODG tissue of reference or in the reference GBM fabric. These results indicate that sample number 7 is not normal tissue, but most likely has a glial type tumor. The combination of all these results makes it possible to diagnose the presence of an oligodendroglioma in the sample 7.

Diagnosis of Sample 8 The level of expression of hsa-miRl99a-5p measured in Sample 8 is significantly higher than that measured in the reference healthy tissue or the reference ODG tissue, but is not is not significantly different from that measured in the reference GBM tissue. These results show that sample number 8 is probably a glioblastoma. The expression level of hsa-miR-99a-star measured in sample number 8 is not significantly different from those measured in the reference healthy tissue and the reference GBM tissue, but is significantly different from that measured in the reference ODG tissue. This shows that sample number 8 is not an oligodendroglioma. The expression level of hsa-miR-1301 measured in sample number 8 is significantly lower than that measured in the reference healthy tissue, but is not significantly different from those measured in the reference ODG tissue. or in the reference GBM fabric. These results indicate that sample number 8 is not normal tissue, but most likely has a glial type tumor. The expression level hsa-miR-424-star measured in sample number 8 is significantly higher than that measured in the reference healthy tissue, but is not significantly different from those measured in the ODG tissue of reference or in the reference GBM fabric. These results indicate that sample number 8 is not normal tissue, but most likely has a glial type tumor. The combination of all these results makes it possible to diagnose the presence of glioblastoma in sample number 8.

Diagnosis of Sample Number 9 The level of expression of hsa-miRl99a-5p measured in sample number 9 is not significantly different from those measured in the reference healthy tissue and in the reference ODG tissue, but is significantly different from that measured in the reference GBM tissue. These results mean that sample number 9 is not a glioblastoma. The expression level of hsa-miR-99a-star measured in sample number 9 is not significantly different from those measured in the reference healthy tissue or in reference GBM tissue, but is significantly different from that of measured in the standard ODG tissue. This means that sample number 9 is not an oligodendroglioma.

The expression level of hsa-miR-1301 measured in sample number 9 is significantly higher than those measured in the reference ODG tissue or in the reference GBM tissue, but is not significantly different from that measured in the reference healthy tissue. These results indicate that sample number 9 is normal tissue, and does not show glial type tumor.

The expression level of hsa-miR-424-star measured in sample number 9 is significantly lower than those measured in the reference ODG tissue or in the reference GBM tissue, but is not significantly different from that measured in the reference healthy tissue. These results indicate that sample number 9 is normal tissue, and does not show glial type tumor.

The combination of all these results makes it possible to diagnose that the sample 9 is a normal tissue.

Claims (18)

REVENDICATIONS1. A method of in vitro diagnosis of a brain tumor belonging to the group consisting of 2 types of tumors: ODG, GBM, and tumor type identification, comprising: (i) measuring expression levels of at least first and second miRNAs belonging respectively to two different groups of miRNAs belonging to a set of 3 groups of miRNAs, in a sample from a patient suspected of having one of the above-mentioned brain tumors: the group 1 consisting of hsa-miR-200c, hsa-miR-199a-5p, hsa-miR-21-star, hsa-miR-146b-5p and hsa-miR-31, - group 2 consisting of among hsa-miR-135a -star, hsa-miR-99a-star, hsa-miR-382, hsa-miR-409-3p and hsa-miR-191-star, - group 3 consisting of hsa-miR-424-star, hsa-miR -503, hsa-miR-132, hsa-miR-1301, hsa-miR-1231, hsa-miR-328, hsa-miR-1180, hsa-miR-149, hsa-miR-491-5p, hsa-miR 1280, hsa-miR-490-5p, hsa-miR-431-star, hsa-miR-770-5p, hsa-miR-769-3p, hsa-miR-129-5p, hsa-miR -139-3p, hsa-miR-139-5p and hsa-miR-199a-3p, - the two above-mentioned miRNAs not belonging to the same group, (ii) the comparison of the expression levels of the above-mentioned miRNAs measured in the sample from the above patient with those of the above miRNAs measured in at least one type of the reference tissue selected from the group consisting of at least one reference healthy tissue, a reference ODG tissue and a GBM tissue of reference. 2. In vitro diagnostic method according to claim 1, comprising: (i) measurement in a sample from a patient suspected of having one of the above-mentioned brain tumors, expression levels of two miRNAs, - a first miRNA selected from one of three groups of miRNAs, * group 1 consisting of hsa-miR-200c, hsa-miR-199a-5p, hsa-miR-21-star, hsa-miR-146b-5p and hsa- miR- miR-31, * group 2 consisting of hsa-miR-135a-star, hsa-miR-99a-star, hsa-miR-382, 30 hsa-miR-409-3p and hsa-miR-191-star, the group 3 consisting of hsa-miR-424-star, hsa-miR-503, hsa-miR-132, hsamiR-1301, hsa-miR-1231, hsa-miR-328, hsa-miR-1180, hsa-miR-149, hsa-miR-491-5p, hsamiR-1280, hsa-miR-490-5p, hsa-miR-431-star, hsa-miR-770-5p, hsa-miR-769-3p, hsa-miR-129-5p, hsa-miR-139-3p, hsa-miR-139-5p and hsa-miR-199a-3p, - a second miRNA selected from one of the three aforesaid groups, - the two aforesaid miRNAs not belonging to the same group, (ii) the comparison of levels of expression of the above miRNAs measured in the sample from the above patient with those of the above-mentioned miRNAs measured in a reference healthy tissue. An in vitro diagnostic method according to claim 2, comprising: (i) measuring in a sample from a patient suspected of having one of the above brain tumors, expression levels of two miRNAs, - a first miRNA selected from group 1, and - a second miRNA selected from group 2, (ii) comparing the levels of expression of the above miRNAs measured in the sample from the above patient with those of the above miRNAs measured in a healthy tissue reference. An in vitro diagnostic method according to claim 3, comprising: (i) measuring in a sample from a patient suspected of having one of the above brain tumors, expression levels of two miRNAs, - the first miRNA being selected in group 1, - the second miRNA being selected from group 2, (ii) comparing the levels of expression of the above miRNAs measured in the sample from the above-mentioned patient suspected of having one of the above-mentioned tumors with those of the above-mentioned miRNAs measured in a healthy reference tissue, (iii) - the deduction of the presence of ODG in the sample from a patient suspected of having one of the above-mentioned tumors being made * when the level of expression of the second miRNA measured in said sample is at least 5 times greater or at least 5 times lower than that of the above miRNA measured in a reference healthy tissue, and * when the level of expression of the first miRNA in said sample is not at least 5 times greater or at least 5 times less than that of the above miRNA measured in a reference healthy tissue, - the deduction of the presence of GBM in the sample from a patient suspected to have one of the above-mentioned tumors being made when the level of expression of the second miRNA measured in said sample is not at least 5 times greater or at least 5-fold lower than that of said miRNA measured in a reference healthy tissue and * when the expression level of the first miRNA measured in said sample is at least 5 times greater than that of the above miRNA measured in a reference healthy tissue. An in vitro diagnostic method according to claim 2 comprising: (i) measuring in a sample from a patient suspected of having one of the above brain tumors, expression levels of two miRNAs, 10 - the first miRNA being selected from group 3, - the second miRNA being selected from group 1, (ii) comparing the levels of expression of the above miRNAs measured in the sample from the above-mentioned patient suspected of having one of the above-mentioned tumors with those of said miRNAs measured in a reference healthy tissue, (iii) - the deduction of the presence of ODG in the sample from a patient suspected of having one of the above-mentioned tumors being made * when the level of expression of the first miRNA measured in said sample is at least 5 times greater or at least 5 times lower than that of the above-mentioned first miRNA measured in a reference healthy tissue, and 20 * when the level of expression of the miRNA is the second miRNA measured in said sample is not at least 5 times greater or at least 5 times lower than that of said second miRNA measured in a reference healthy tissue, - the deduction of the presence of GBM in the sample from a patient suspected of having one of the above-mentioned tumors being made 25 * when the level of expression of the first miRNA measured in said sample is at least 5 times greater or at least 5-fold lower than that of the above-mentioned first miRNA measured in a healthy tissue. reference, and * when the level of expression of the second miRNA measured in said sample is at least 5 times greater than that of the aforementioned second miRNA measured in a healthy reference tissue. An in vitro diagnostic method according to claim 2, comprising: (i) measuring in a sample from a patient suspected of having one of the above brain tumors, expression levels of two miRNAs, - the first miRNA being selected in group 3, and - the second miRNA being selected from group 2, (ii) comparing the levels of expression of the above miRNAs measured in the sample from the above-mentioned patient suspected of having one of the above-mentioned tumors with those of The above-mentioned miRNAs measured in a reference healthy tissue, (iii) the deduction of the presence of ODG in the sample from a patient suspected of having one of the above-mentioned tumors being made * when the level of expression of the first miRNA measured in said sample is at least 5 times greater or at least 5 times lower than that of the above-mentioned first miRNA 10 measured in a reference healthy tissue, and * when the level of expression of the second miRNA measured in said sample is also at least 5 times greater or at least 5-fold lower than that of the above-mentioned second miRNA measured in a reference healthy tissue, - deduction of the presence of GBM in the sample from a patient suspected to have one of the above-mentioned tumors being made when the level of expression of the first miRNA measured in said sample is at least 5 times greater or at least 5-fold lower than that of the above-mentioned first miRNA measured in a reference healthy tissue, and * when the level of expression of the second miRNA measured in said sample is not at least 5 times greater or at least 5 times lower than that of said second miRNA measured in a reference healthy tissue. An in vitro diagnostic method according to claim 1, comprising: (i) measuring in a sample from a patient suspected of having one of the above-mentioned brain tumors, expression levels of three miRNAs, - a first miRNA selected from group 1, - a second miRNA selected from group 2, and - a third miRNA selected from group 3, (ii) comparing the levels of expression of the above miRNAs measured in the sample 30 from the above patient with those of the above miRNAs measured in a reference healthy tissue. The method according to claim 7, wherein the deduction of the presence of ODG in the sample from a patient suspected of having one of the above-mentioned tumors is made, when the level of expression of the second miRNA measured in said sample is at least 5 times greater or 5 times lower than that measured in a reference healthy tissue, and - when the level of expression of the first miRNA measured in said sample is not at least 5 times greater or 5 times lower than that measured in a reference healthy tissue, and - when the level of expression of the third miRNA measured in said sample is at least 5 times greater or 5 times lower than that measured in a reference healthy tissue. The method according to claim 7, wherein the deduction of the presence of GBM in the sample from a patient suspected of having one of the above-mentioned tumors is made, when the level of expression of the first miRNA measured in said sample. is at least 5 times greater than that measured in reference healthy tissue, and - when the level of expression of the second miRNA measured in said sample is not at least 5 times greater or 5 times lower than that measured in a tissue healthy reference, and - when the level of expression of the third miRNA measured in said sample is 5 times greater or 5 times lower than that measured in a reference healthy tissue. An in vitro diagnostic method according to claim 1, comprising: (i) measuring in a sample from a patient suspected of having one of the above brain tumors, expression levels of at least two miRNAs, 20 - a first miRNA selected from group 1; - a second miRNA selected from group 2; and (ii) comparing the levels of expression of the above miRNAs measured in the sample from the above patient with those of the above miRNAs measured in a tissue. Reference healthy tissue, a reference ODG tissue, and a reference GBM tissue. 25 11. In vitro diagnostic method according to claim 10, wherein the deduction of the presence of GBM in the sample from a patient suspected of having one of the above-mentioned tumors is made, when the level of expression of the first miRNA measured in said sample is at least 5 times greater than that measured in a reference healthy tissue, and - when the level of expression of the second miRNA measured in said sample is not at least 5 times greater or at least 5 times less than that measured in a reference healthy tissue, and- when the level of expression of the first miRNA measured in said sample is at least 5 times greater than that measured in a reference ODG tissue, and - when the levels of Expression of the first and second miRNAs measured in said sample are not at least 5 times greater or 5 times lower than those measured in a reference GBM tissue. An in vitro diagnostic method according to claim 10, wherein the deduction of the presence of ODG in the sample from a patient suspected of having one of the above-mentioned tumors is made, when the level of expression of the second miRNA measured in said sample is at least 5 times greater or 5 times lower than that measured in reference healthy tissue, and - when the level of expression of the first miRNA measured in said sample is not at least 5 times greater than or at least 5 times lower than that measured in a reference healthy tissue, and when the level of expression of the first miRNA measured in said sample is at least 5 times lower than that measured in a reference GBM tissue, and when the levels of expression of the first and second miRNAs measured in said sample are not at least 5 times greater or 5 times lower than those measured in a reference ODG tissue this. 20 The in vitro diagnostic method of claim 10, wherein step (i) further comprises measuring the level of expression of a miRNA selected from group 3. 14. The in vitro diagnostic method of claim 13, comprising: (i) measuring in a sample from a patient suspected of having one of the above brain tumors, expression levels of at least three miRNAs, at least one first miRNA selected from group 1, at least one second miRNA selected from group 2, and at least one third miRNA selected from group 3, and (ii) comparing expression levels of the above miRNAs. measured in the sample from the above patient with those of the above miRNAs measured in a reference healthy tissue, a reference ODG tissue and a reference GBM tissue. The in vitro diagnostic method of claim 14 comprising: (i) measuring in a sample from a patient suspected of having one of the above brain tumors, expression levels of at least three miRNAs, minus one first miRNA selected from group 1, - at least one second miRNA selected from group 2, and - at least one third miRNA selected from group 4, a subgroup from group 3, group 4 consisting of hsa- miR-424-star, hsa-miR-503, hsa-miR-132, hsa-miR-1301, hsa-miR-1231, hsa-miR-328, hsa-miR-1 180, hsa-miR-149, hsa mR-491-5p, hsa-miR-1280, hsa-miR-490-5p, hsa-miR-431-star, hsa-miR-770-5p, hsa-miR-769-3p, hsa-miR-129 -5p, hsamiR-139-3p, hsa-miR-139-5p, (ii) comparison of the levels of expression of the above miRNAs measured in the sample from the above patient with those of the above-mentioned miRNAs measured in a healthy tissue of reference, a reference ODG tissue and a reference GBM tissue. The method according to claim 15, wherein: (i) the deduction of the presence of ODG in the sample from a patient suspected of having one of the above-mentioned tumors is made, - when the level of expression of the second miRNA measured in said sample is at least 5 times greater or 5 times lower than that measured in a reference healthy tissue, and - when the level of expression of the first miRNA measured in said sample is not at least 5 times greater or 5 times lower than that measured in a reference healthy tissue, - when the expression level of the first miRNA measured in said sample is at least 5 times lower than that measured in a reference GBM tissue, - when the levels of expression of the first and second miRNAs measured in said sample are not at least 5 times greater or 5 times lower than those measured in a reference ODG tissue, and - when the level of expressi the third miRNA measured in said sample is at least 5 times greater or 5 times lower than that measured in a reference healthy tissue; or (ii) the deduction of the presence of GBM in the sample from a patient suspected of having one of the above-mentioned tumors is made, when the level of expression of the first miRNA measured in said sample is 5 times higher respectively to that measured in a reference healthy tissue, and - when the level of expression of the second miRNA measured in said sample is not at least 5 times greater or 5 times lower than that measured in a reference healthy tissue, and- when the level of expression of the first miRNA measured in said sample is at least 5 times greater than that measured in a reference ODG tissue, and - when the expression levels of the first and third miRNAs measured in said sample do not are not at least 5-fold greater or 5-fold lower than those measured in reference GBM tissue, and - when the level of expression of the third miRNA measured in said sample is at least 5 times greater or 5 times lower than that measured in a reference healthy tissue. The method of claim 14 comprising: (i) measuring in a sample from a patient suspected of having one of the above brain tumors, expression levels of at least three miRNAs, - at least a first miRNA selected from group 1, - at least one second miRNA selected from group 2, and - at least one third miRNA selected from group 5, a subgroup from group 3, group 5 consisting of hsa-miRN- 199a-3p, (ii) comparison of the expression levels of the above-mentioned miRNAs measured in the sample from the above patient with those of the above-mentioned miRNAs measured in a reference healthy tissue, a reference ODG tissue and a tissue of GBM reference. 20 The method of claim 17, wherein: (i) the deduction of the presence of ODG in the sample from a patient suspected of having one of the above-mentioned tumors is made, - when the level of expression of the second miRNA measured in said sample is at least 5-fold greater or 5-fold lower than that measured in reference healthy tissue, and when the level of expression of the first miRNA measured in said sample is not at least 5-fold higher or 5 times lower than that measured in a reference healthy tissue, - when the level of expression of the first miRNA measured in said sample is at least 5 times lower than that measured in a reference GBM tissue, - when the levels of expression of the first and second miRNAs measured in said sample are not at least 5 times greater or 5 times lower than those measured in a reference ODG tissue, and - when the level of expre ssion of the third miRNA measured in said sample is at least 5 times greater than that measured in a reference healthy tissue, and at least 5 times lower than that measured in a reference GBM tissue; (ii) the deduction of the presence of GBM in the sample from a patient suspected of having one of the above-mentioned tumors is made, - when the level of expression of the first miRNA measured in said sample is respectively 5 times greater than that measured in a reference healthy tissue, and when the level of expression of the second miRNA measured in said sample is not at least 5 times greater or 5 times lower than that measured in a reference healthy tissue, and when the level of expression of the first miRNA measured in said sample is at least 5 times greater than that measured in a reference ODG tissue, and - when the levels of expression of the first and third miRNAs measured in said 10 sample are not at least 5 times greater or 5 times lower than those measured in a reference GBM tissue, and - when the level of expression of the third miRNA measured in said sample is at least 5 times greater than that measured in a reference healthy tissue and in a standard ODG tissue.