EP2791353A1

EP2791353A1 - Methods for diagnosis and therapeutic follow up of muscular dystrophies

Info

Publication number: EP2791353A1
Application number: EP12809235.0A
Authority: EP
Inventors: Laurence JEANSON-LEH; David Israeli; Fatima AMOR; Thomas Voit
Original assignee: Genethon; Association Institut de Myologie
Current assignee: Genethon; Association Institut de Myologie
Priority date: 2011-12-16
Filing date: 2012-12-14
Publication date: 2014-10-22
Also published as: JP2015504655A; CN104271760A; CA2858465A1; US20140342937A1; AU2012351524A1; FR2984358A1; WO2013087907A1

Abstract

The invention relates to the diagnosis, the follow‑up and the evaluation of the efficacy of a treatment of a muscular dystrophy by detection of microRNA in a body fluid, in particular in the urine.

Description

METHODS FOR DIAGNOSING AND THERAPEUTICALLY MONITORING

MUSCULAR DYSTROPHIES

FIELD OF THE INVENTION

The invention relates to the diagnosis, monitoring and evaluation of the efficacy of a treatment of muscular dystrophy by detecting microRNA in a body fluid, especially in the urine.

STATE OF THE ART

Duchenne muscular dystrophy (DMD) or Becker muscular dystrophy (BMD) is caused by mutations or deletions of the gene encoding dystrophin (Muntoni, Torelli et al., 2003). In the first case, where the phenotype is the most severe, dystrophin is completely absent. The DAPC complex (Dystrophin Associated Protein Complex), which links intracellular actin filaments to the extracellular matrix (Rumor, Winder et al.), Is also missing. This complex usually protects the membrane of muscle fibers that are subject to contractions and relaxations. In its absence, the fibers are no longer protected, muscle cells are seen to be degenerating and new cells are showing regeneration tending to counterbalance the phenomenon (Batchelor and Winder 2006). In the long term, the regeneration is insufficient and the fibers are replaced by adipose tissue.

On the therapeutic level, high hopes are currently based on the exon skipping technique (Cirak, Arechavala-Gomeza et al, Lu, Yokota et al.). Indeed, BMD, which leads to a less serious phenotype, is also due to one or more mutations in the gene coding for dystrophin but the fundamental domains of the protein are conserved:

an N-terminal domain of actin filament binding,

a cysteine-rich C-terminal domain which binds to the DAPC complex.

For DMD patients, it is therefore possible to obtain a Becker phenotype by excluding the exons carrying nonsense mutations within the messenger RNAs (mRNAs) and thus restore the open reading frame. The protein produced, which is shorter, is then partially functional. This strategy is currently being tested through several clinical trials. Regular medical surveillance, multidisciplinary, allows to evaluate the evolution of the pathology and to propose a management to improve the life of the patients. It involves the prevention of retractions, the provision of technical aids, physiotherapy, cardiac monitoring, orthopedics and respiratory support. The diagnostic follow-up is carried out, among other things, by the evaluation of motor functions, by muscle biopsies or by the measurement of an enzyme secreted in the circulation, creatine kinase (Bushby, Finkel et al).

The muscle biopsy analysis allows to observe the damaged fibers, smaller fibers testifying to the muscular regeneration, as well as areas of necrosis replaced by adipose tissue. This method has the disadvantage of being very invasive for the patient.

Another method is to dose creatine kinase (CK) in the blood. This enzyme is linked to energy metabolism present in several types of cells. The increase of its concentration in the blood testifies to the state of degradation of the muscular fibers. However, this biomarker is not completely reliable because its level also depends on stress such as physical activity (Nicholson, Morgan et al., 1986). Other enzymes exist, such as aldolase or lactate dehydrogenase, but as with CK, their abundance is not dependent solely on disease status (Lott and Landesman 1984). Therefore, it appears necessary to identify new and more reliable biomarkers for Duchenne muscular dystrophy, which could be measured from non-invasive samples such as urine specimens.

Micro ARs (or miRNAs) are promising bio markers. They are expressed in all tissues of the body and especially in skeletal muscle. It is also known that they exist in the "circulating" state in all biological fluids (Weber, Baxter et al.). Recent work in the literature has shown that there is a specific signature of Duchenne muscle myopathy in muscle (Cacchiarelli, Martone et al., Greco, De Simone et al., 2009) and in serum (Cacchiarelli, Legnini et al. .).

To date, no studies have shown the potential use of miRNAs as markers of muscular dystrophy in urine. The inventors have studied the presence profile of miRNAs in the urine of patients with muscular dystrophy in order to identify a signature that is specific to this type of pathology. In addition, the inventors have also looked for new circulating markers of muscular dystrophy.

SUMMARY OF THE INVENTION

The inventors have in particular studied urine samples from DMD patients in order to determine whether specific miRNAs of this pathology could be identified. This work has highlighted a specific signature relating to the abundance of certain miRNAs in the urine of DMD patients compared to the urine of healthy donors. The finding of such a variation in the expression of one or more miRNAs in a sick individual as compared to a healthy individual finds application in the field of diagnosis. The present invention thus relates to the use of at least one miRNA selected from the miRNAs of Table 1, for the implementation of a method for diagnosing muscular dystrophy. It also relates to the use of one or more of said miRNAs for assessing the risk of developing or presenting muscular dystrophy.

Table 1;

urinary miRNA sequence SEQ ID # hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU 1 hsa-let-7b UGAGGUAGUAGGUUGUGUGGUU 2 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU 3 hsa-let-7d AGAGGUAGUAGGUUGCAUAGUU 4 hsa-let-7e UGAGGUAGGAGGUUGUAUAGUU 5 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU 6 HSA let-7g UGAGGUAGUAGUUUGUACAGUU 7 hsa-miR-1244 AAGUAGUUGGUUUGUAUGAGAUGGUU 8 hsa-miR-139-5p UCUACAGUGCACGUGUCUCCAGU 9 hsa-miR-151-5p UCGAGGAGCUCACAGUCUAGU 10 hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGGU 11 hsa-miR-15a UAGCAGCACAUAAUGGUUUGUG 12 hsa-miR-15b UAGCAGCACAUCAUGGUUUACA 13 hrs-miR-182 UUUGGCAAUGGUAGAACUCACACU 14 hsa-miR-183 UAUGGCACUGGUAGAAUUCACU 15 hrs-miR-192 * CUGCCAAUUCCAUAGGUCACAG 16 s a-miR-193 a-3 p AACUGGCCUACAAAGUCCCAGU 17 hsa-miR-196b UAGGUAGUUUCCUGUUGUUGGG 18 hsa-miR-198 GGUCCAGAGGGGAGAUAGGUUC 19 hsa -miR-200b * CAUCUUACUGGGCAGCAUUGGA 20 hsa-miR-206 UGGAAUGUAAGGAAGUGUGUGG 21 hsa-miR-208 AUAAGACGAGCAAAAAGCUUGU 22 hsa-miR-214 UGCCUGUCUACACUUGCUGUGC 23 hsa-miR-216b AAAUCUCUGCAGGCAAAUGUGA 24 hsa-miR-220 CCACACCGUAUCUGACACUUU 25 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU 26 hsa-miR-23a AUCACAUUGCCAGGGAUUUCC 27 hsa -miR-23b AUCACAUUGCCAGGGAUUACC 28 hsa-miR-26b UUCAAGUAAUUCAGGAUAGGU 29 hsa-miR-28-5p AAGGAGCUCACAGUCUAUUGAG 30 hsa-miR-30d UGUAAACAUCCCCGACUGGAAG 31 hsa-miR-30e-3 UGUAAACAUCCUUGACUGGAAG 32 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU 33 hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU 34 hsa-miR-33a * CAAUGUUUCCACAGUGCAUCAC 35 hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU 36 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC 37 hsa-miR-373 ACUCAAAAUGGGGGCGCUUUCC 38 hsa-miR-376c GGUGGAUAUUCCUUCUAUGUU 39 hsa-miR-381 AGCGAGGUUGCCCUUUGUAUAU 40 hsa-miR -410 AAUAUAACACAGAUGGCCUGU 41 hsa-miR-412 ACUUCACCUGGUCCACUAGCCGU 42 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU 43 hsa-miR-433 AUCAUGAUGGGCUCCUCGGUGU 44 hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAU 45 hsa-miR-487b AAUCGUACAGGGUCAUCCACUU 46 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG 47 hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU 48 hsa-miR-493 UUGUACAUGGUAGGCUUUCAUU 49 hsa-miR-494 UGAAACAUACACGGGAAACCUC 50 hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA 51 hsa-miR-505 * GGGAGCCAGGAAGUAUUGAUGU 52 hsa-miR -511 GUGUCUUUUGCUCUGCAGUCA 53 hsa-miR-517b AUCGUGCAUCCCUUUAGAGUGU 54 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA 55 hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU 56 hsa-miR 18th AAAGCGCUUCCCUUCAGAGUG 57 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG 58 s has miR-520 a-3 p AAAGUGCUUCCCUUUGGACUGU 59 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU 60 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU 61 hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU 62 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC its 63-miR-548c-5p AAAAGUAAUUGCGGUUUUUGCC its 64-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC 65 hsa-miR-590-3p UAAUUUUAUGUAUAAGCUAGU 66 hsa-miR-593 UGUCUCUGCUGGGGUUUCU 67 hsa-miR-597 UGUGUCACUCGAUGACCACUGU 68 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA 69 hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC 70 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG 71 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA 72 hsa-miR-668 UGUCACUCGGCUCGGCCCACUAC 73 hsa-miR-720 UCUCGCUGGGGCCUCCA 74 hsa-miR-874 CUGCCCUGGCCCGAGGGACCGA 75 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU 76 hsa-miR-942 UCUUCUCUGUUUUGGCCAUGUG 77

More specifically, the invention relates to a method for diagnosing muscular dystrophy or assessing the risk of developing or presenting muscular dystrophy in a subject, comprising measuring the level of expression of at least one miRNA in a sample. body fluid (e.g. a urine sample) of said subject. The invention may in particular comprise comparing said level of expression measured in said sample to a level obtained in a healthy reference sample, a difference between the level of expression relative to the reference level being indicative of muscular dystrophy in the subject.

The invention also relates to a method for diagnosing muscular dystrophy or for assessing the risk of developing or presenting muscular dystrophy, comprising determining in a body fluid sample (e.g. a urine sample) of a subject of the presence or level of expression of at least one miRNA selected from the group consisting of the miRNAs listed in Table 1.

The present invention relates in particular to a method for diagnosing muscular dystrophy, in particular Duchenne muscular dystrophy, comprising the comparison of:

a) the level of expression of at least one miRNA in a sample of body fluid (eg urine) of a subject (test sample), the miRNA being selected from the group consisting of the miRNAs of Table 1, and b) the level of expression of said miRNA in a reference healthy sample, a statistically significant difference between the level of expression in the test sample relative to the reference sample being indicative of muscular dystrophy in the subject.

According to a particular aspect, the invention relates to a method for diagnosing muscular dystrophy comprising the following steps:

measuring the level of expression of at least one miRNA selected from the miRNAs of Table 1, in a sample of body fluid (in particular urine) from a subject to be tested (for example a subject suspected of presenting a muscular dystrophy); and

- the comparison:

between the level of expression of at least one of said miRNAs in said sample and the level of expression of said miRNA in a reference healthy sample, or

- between the level of expression of at least a first of said miRNAs in the sample from a patient suspected of having muscular dystrophy and the level of expression of said miRNA in a reference sample from a patient presenting a muscular dystrophy, in particular DMD.

Thus, the comparison of miRNA expression levels can be performed between a sample from a patient suspected of having muscular dystrophy and a reference healthy sample, or a reference sample from a patient with muscular dystrophy.

The existence in the urine of specific miRNAs of muscular dystrophy, and in particular of DMD, has never been reported by previous publications. In addition, the following miRNAs have never been reported as present in body fluid and as indicative of muscular dystrophy: let-7f, let-7a, miR-548d-5p, miR-183, miR-490-3p , miR-520a-3p, miR-590-3p, miR-15a, miR-1244, miR-328, miR-494, miR-668, miR-208, miR-521, miR-597, miR-874, miR -224, miR-182, miR-23b, miR-492, let-7c, let-7e, miR-15b, miR-487b, miR-410, miR-139-5p, miR-216b, miR-423-5p , miR-484, miR-23a, miR-376c, miR-412, miR-433, miR-335, miR-33a *, miR-193a-3p, miR-381, miR-34c-5p, miR-628- 3p, miR-659, miR-505 *, let-7b, let-7d, let-7g, miR-196b, miR-26b, miR-942, miR-200b *, miR-523, miR-346, miR- 155, miR-548b-5p, miR-548c-5p, miR-518f, miR-886-3p, miR-650, miR-720, miR-593, miR-657, miR-502-3p miR-198, miR -214, miR-220, miR-373, miR-511, miR-517b, miR-518a-3p, miR-518b, miR-518e, miR-520g, miR-493, miR-151-5p, miR-192 *, miR-28-5p, miR-30d and miR-30e 3P. Thus, according to a particular embodiment, the method according to the invention comprises measuring the level of at least one miRNA selected from the group consisting of the miRNAs listed in the preceding sentence.

According to another particular embodiment, the method according to the invention comprises measuring the level in a urine sample of a subject of at least one miRNA selected from the group consisting of let-7f, let-7a, miR -548d-5p, miR-183, miR-490-3p, miR-520a-3p, miR-590-3p, miR-15a, miR-1244, miR-328, miR-494, miR-668, miR-208 , miR-521, miR-597, miR-874, miR-224, miR-182, miR-23b, miR-492, let-7c, let-7e, miR-15b, miR-487b, miR-410, miR -139-5p, miR-216b, miR-423-5p, miR-484, miR-23a, miR-376c, miR-412, miR-433, miR-206, miR-335, miR-33a *, miR- 193a-3p, miR-381, miR-34c-5p, miR-628-3p, miR-659, miR-505 *, let-7b, let-7d, let-7g, miR-196b, miR-26b, miR -942, miR-200b *, miR-523, miR-346, miR-155, miR-548b-5p, miR-548c-5p, miR-518f, miR-886-3p, miR-650, miR-720, miR-593, miR-657, miR-502-3p miR-198, miR-214, miR-220, miR-373, miR-511, miR-517b, miR-518a-3p, miR-518b, miR-518e , miR-520g, miR-493, miR-151-5p, miR-192 *, miR-28- 5p, miR-30d and miR-30e-3p, the measure of a difference of n said miRNA in the sample of the subject relative to the healthy reference sample being indicative of possible muscular dystrophy.

The invention also relates to a method for monitoring the course of muscular dystrophy, and a method for evaluating the efficacy of a therapeutic treatment of muscular dystrophy. In this case, the method comprises measuring the level of expression of at least one of the above-mentioned miRNAs in a second sample of body fluid (especially urine) of a subject, that level in the sample of the subject being compared at the level of said miRNA in a first reference sample which corresponds to a sample taken previously on the same subject. In the case of the monitoring of the efficacy of a treatment, the first sample may have been taken before the administration of the therapeutic treatment to the subject, and the second sample will be taken after administration of the therapeutic treatment (for example several days / weeks / month after administration of the therapeutic treatment). Alternatively, the first and second samples can be taken both after administration of the therapeutic treatment (for example, the first sample is taken after treatment, the same day as this treatment, or several days / weeks / months after the treatment, and the second sample is taken several days / weeks / month after the first sample).

The invention further relates to a kit and a multiwell support useful for the diagnosis of muscular dystrophy.

DETAILED DESCRIPTION OF THE INVENTION

"MicroRNAs" (or miRNAs) are non-coding single-stranded RNAs of approximately 17 to 26 nucleotides in length, which regulate gene expression by repressing the translation of their target mRNA. MiRNAs that have been identified are registered in the miRBase database release 14 ^th (http://microarn.saner.ac.uk).

In the context of the invention, a "reference sample", when reference is made to a "healthy sample", corresponds to a sample obtained from one or more subjects, preferably two or more, which do not suffer from muscular dystrophy. The reference sample may also be a sample obtained from one or more patients with muscular dystrophy. Reference expression levels can be determined by measuring the level of expression of miRNAs to explore in one or more subjects. These reference levels can also be adjusted according to specific subject populations. In a preferred embodiment, the reference sample is obtained from a pool of healthy subjects. The expression pattern of the miRNAs in the reference sample may preferably be generated from a population of two or more subjects. For example, the population may include 2, 4, 5, 10, 15, 20, 30, 40, 50 subjects, or more. In the context of methods for monitoring muscular dystrophy or for monitoring the effectiveness of a treatment, the reference sample is a sample taken from the subject that will be followed, but before the follow-up has begun.

By "muscular dystrophy" is meant in particular Duchenne muscular dystrophy, Becker muscular dystrophy, muscular muscular dystrophies such as alpha- and gamma-sarcoglycanopathies. The invention relates more particularly to the study of Duchenne muscular dystrophy or Becker muscular dystrophy, more particularly Duchenne. The term "body fluid" or "biological fluid" refers to the body fluid of a subject, in particular a human subject, that is to say any liquid taken from a subject, such as serum, plasma, whole blood, urine, cerebrospinal fluid or saliva. According to a preferred embodiment, the body fluid used in the present invention is a urine sample.

The term "subject" means a mammal, human or non-human, preferably human. The subject may have a predisposition for muscular dystrophy (revealed for example by genetic analysis, or suspicion that may result from family history) or suffer from a reported muscular dystrophy. The invention can also be applied in screening, the subject having no known symptoms or predisposition. In particular, the method according to the invention can be applied to mass screening in young children before the classical age of declaration of symptoms (0-5 years). The invention can also be applied to the follow-up of model animals of the disease, in particular of dogs or of model mice and more particularly to the dogs GRMD (Golden Retriever Muscular Dystrophy), LMD (Labrador Muscular Dystrophy) or CXMDj (Canine X-linked Muscular Dystrophy in Japan), during the preclinical development of treatments.

The term "level of expression" of a miRNA in a sample corresponds to a measurement value specific to a miRNA, but expressed either in arbitrary units, in units of mass, in molecules or in concentrations, or in values normalized by compared to another measurement, especially in normalized value compared to the amounts of the same miRNA in a reference sample (healthy or a patient with muscular dystrophy). The expression level of miRNAs can be measured by any conventional method, such as

- hybridization on "DNA chips",

- high throughput sequencing methods for a large number of individualized miRNAs,

- the quantitative PCR in real time or digital,

- Northern blot,

- or by any other specific method of miRNAs.

The level of expression of miRNAs can be measured by the "microarray" technique. The technique of the "DNA chip" is well known to those skilled in the art. This is hybridization of miRNAs extracted on a solid support composed of a nylon membrane, a surface of silicon or glass, optionally nano-beads or particles, comprising oligonucleotides of known sequences attached to or adhered to the support. The complementarity of the oligonucleotides fixed with the sequences of the microRNAs or their conversion products (amplification products, cDNA, RNA or cRNA) makes it possible to generate a signal (fluorescence, luminescence, radioactivity, electrical signal, etc.) according to the techniques of labeling used at the level of immobilized oligonucleotides (DNA chips). This signal is detected by a specific device and a value of intensity of this own signal for each miRNA is thus recorded. Several types of chips for the detection of miRNAs are already on the market, for example the GeneChip (R) miRNAs marketed by Affymetrix, miRcury arrays by Exiqon, miRXplore microarrays by Miltenyi.

In the case of high throughput sequencing, miRNAs are extracted and purified from a sample, isolated from each other by methods provided by sequencing equipment suppliers such as Roche, Invitrogen. This kind of analysis consists in individualizing the molecules of the various microRNAs, performing an amplification step and sequencing the products ("nucleic acid clones") thus generated. The realization of a large number of sequences to identify each of these "clones" (several thousand) makes it possible to generate a list of the microRNAs present in a sample and to quantify each of these miRNAs simply by counting how many times each sequence is found in the list. Detailed.

In a preferred embodiment of the invention, the miRNA assays are performed by quantitative PCR (real-time PCR or digital PCR). The real-time PCR makes it possible to obtain values, called Ct, corresponding to the number of cycles from which the emitted fluorescence exceeds a certain threshold, the threshold being fixed by the user at the beginning of the exponential phase. This Ct value is proportional to the amount of cDNA (derived from reverse transcription of miRNAs to cDNA by Reverse Transcriptase) initially present in the sample. In the absence of a specific standard range for each cDNA, only relative quantification between samples is possible. First, in order to be able to compare the quota of each miRNA taken individually and present in the samples, the assay values for each miRNA are normalized with the data obtained for a non-coding RNA. It is also possible to normalize the expression of a miRNA compared to the average Ct of all the miRNAs of a PCR plate (384 well TLDA plates, including a different miRNA detected per well - see the examples for more details). Thus, the results can be normalized with respect to several miRNA references whose abundance varies little in the urine. The digital PCR allows, from a starting sample to determine the exact number of copies of a miRNA it contains, following either a dilution of the PCR reaction in a large number of microwells (PCR technology Life Life Technologies or Roche) or to a dispersion of the PCR reaction in microdroplets (Droplet technology, Bio-Rad). The relative quantification of a miRNA between 2 types of samples is then obtained thanks for example to the SDS2.3 software, RQ manager (Applied Biosystems), and by the Ct delta delta method on Miscrosoft Excel spreadsheet or any other software allowing a complex calculation. When miRNA expression levels are analyzed by "microarray" or Northern blot hybridization, or by sequencing, they can be expressed as Formula I:

(I) Amount of miRNAx = intensity of detection signal for miRNAx Where "signal intensity" means amount of fluorescence, radioactivity or luminescence recorded on "DNA chips" by the matched detector, or number of identical sequences detected by high throughput sequencing analysis. The quantities are expressed in arbitrary units.

The amounts of miRNA can be normalized with respect to another assay, in particular an RNA (RNAnorm) whose concentration does not vary in the different types of samples analyzed. This standardization makes it possible to ensure that the expression levels of the detectable miRNAs are compared in extracts whose RNA concentrations are similar between these different purified extracts. In this case, the normalized expression level for a miRNA in a sample is expressed by formula II:

(II) Normalized miRNAx quantity = detection signal intensity for miRNAx / signal strength for ARNnorm When the expression levels of the miRNAs are analyzed by the real-time PCR, they can be expressed by the formula III, which defines the amount of miRNA present in the assay reaction medium when the number of amplification cycles is equal to Ct (Quantity of miRNAx to Ct):

(III) Quantity of miRNAx at Ct = Quantity of miRNA at tO x Efficiency ^"0 .

Where "Quantity of miRNA at t0" refers to the amount of miRNA, or its equivalent in cDNA, at the time the PCR amplification assay is initiated. The term "efficacy" in formula (III) means the value of the PCR efficiency (arbitrarily set at 2 in the case of delta delta Ct calculations). This value depends on various experimental parameters, and in particular on the apparatus performing the real-time PCR implemented. Once this value is measured for a particular protocol and a configured PCR machine, it is no longer necessary to measure this value each time before the calculation, unless the experimental protocol and / or the operating condition of the machine have been measured. have been modified for the given experience.

In a particular embodiment, the level of miRNA expression is assayed by quantitative PCR in real time.

Tables 2 and 3 below describe the expression pattern of miRNA whose expression is altered in patients with DMD, relative to the expression pattern observed in healthy subjects. The inventors having been able to highlight a difference of expression between the patients according to their age, the information is classified according to this criterion.

Table 2: Expression profile of indicative miRNAs in patients / subjects aged 3-8 years

Expression in patients compared to

urinary miRNA healthy subjects

let-7a Increase

let-7b Increase

let-7c Increase

let-7d Increase

let-7th Increase

let-7f Increase

let-7g Increase miR-151-5p Increase miR-15a Increase miR-15b Increase miR-182 Increase miR-183 Increase miR-192 * Increase miR-196b Increase miR-200b * Increase miR-206 Increase miR-224 Increase miR-23b Increase miR- 26b Increase miR-28-5p Increase miR-30d Increase miR-30e-3p Increase miR-335 Increase miR-33a * Increase miR-487b Increase miR-490-3p Increase miR-492 Increase miR-502-3p Increase miR-505 * Increase miR-520a-3p Increase miR-548d-5p Increase miR-590-3p Increase miR-628-3p Increase miR-659 Increase miR-942 Increase miR-1244 Decrease miR-328 Decrease miR-484 Decrease miR-494 Decrease miR-593 Decrease miR-650 Decrease miR-657 Decrease miR-668 Decrease miR-720 Decrease miR-886-3p Decrease Table 3: Expression profile of indicative miRNAs in patients / subjects aged 13-18

Expression in patients compared to

urinary miRNA healthy subjects

mi -183 Increase

miR-193a-3p Increase

miR-198 Increase

miR-208 Increase

miR-214 Increase

miR-220 Increase

miR-328 Increase

miR-346 Increase

miR-34c-5p Increase

miR-373 Increase

miR-381 Increase

miR-410 Increase

miR-433 Augmentation

miR-490-3p Increase

miR-493 Increase

miR-494 Increase

miR-511 Increase

miR-517b Increase

miR-518a-3p Increase

miR-518b Increase

miR-518e Increase

miR-518f Increase

miR-520a-3p Increase

miR-520g Increase

miR-521 Augmentation

miR-523 Increase

miR-548b-5p Increase

miR-548c-5p Increase

miR-548d-5p Increase

miR-597 Increase

let-7b Decrease

let-7c Decrease

let-7e Decrease

let-7f Decrease

miR-139-5p Decrease

miR-155 Decrease

miR-15a Decrease

miR-216b Decrease mid -23a Decrease

miR-376c Decrease

miR-412 Decrease

miR-423-5p Decrease

miR-492 Decrease

miR-502-3p Decrease

miR-874 Decrease

Legend for Tables 2 and 3 increase: higher expression in patients compared to healthy subjects; decrease: lower expression in patients compared to healthy subjects.

The miRNAs listed above all vary in patient samples compared to healthy subjects. The invention therefore relates to a method (a) for diagnosing muscular dystrophy, (b) monitoring the progression of muscular dystrophy, and (c) evaluating the efficacy of a therapeutic treatment of muscular dystrophy, comprising determining a change in the level of expression of one or more of these miRNAs in a body fluid sample of a subject relative to the level of expression in a reference sample.

In a particular embodiment, a first category of miRNA corresponds to those who are over-represented in the urine of DMD patients, (referred to as the "increase" category in Tables 2 and 3). If one or more miRNAs of this first category are used in a method according to the invention:

a higher expression in the tested subject compared to a reference obtained in a sample of a healthy subject will be indicative of muscular dystrophy (diagnostic method);

an upper expression in a sample of the tested subject taken at a time T2 relative to a sample of the same tested subject taken at a time Tl (Tl preceding T2 chronologically) will be indicative of a progression of the disease (prognostic method, or method for monitoring muscular dystrophy);

in the context of a treatment of muscular dystrophy in a patient, a lower expression in a sample of the test subject taken at a time T2 relative to a sample of the same test subject taken at a time T1 (T1 before T2 chronologically ) will be indicative of an effective treatment of the disease (method of monitoring the effectiveness of a treatment of muscular dystrophy).

A second category of miRNAs are underrepresented in the urine of DMD patients, compared to healthy subjects (designated in the "decrease" category in Tables 2 and 3). If one or more miRNAs of this second category are exploited in a method according to the invention:

- a lower expression in the tested subject compared to a reference obtained in a sample of a healthy subject will be indicative of muscular dystrophy (diagnostic method);

a lower expression in a sample of the tested subject taken at a time T2 relative to a sample of the same test subject taken at a time T1 (T1 before T2 chronologically) will be indicative of a progression of the disease (prognostic method, or method for monitoring muscular dystrophy);

in the context of a treatment of a muscular dystrophy in a patient, an upper expression in a sample of the test subject taken at a time T2 relative to a sample of the same test subject taken at a time Tl (Tl preceding T2 chronologically ) will be indicative of an effective treatment of the disease (method of monitoring the effectiveness of a treatment of muscular dystrophy).

By "higher expression level" or "lower expression level" is meant a level of expression whose variation is statistically significant, according to procedures well known to those skilled in the art. The description made above of the two categories of miRNAs identified and their use in a diagnostic method according to the invention implements a reference sample from a healthy subject. Of course, the desired expression variations will be reversed when the reference sample comes from a patient suffering from muscular dystrophy.

The methods of the invention include the detection of at least one miRNA selected from the group consisting of miRNAs of Tables 2 and 3.

According to a first variant embodiment, the detected miRNAs are chosen from the miRNAs of Table 4. Table 4

According to a second variant embodiment, the detected miRNAs are chosen from the miRNAs of Table 5.

Table 5

let-7f miR-494 let-7c miR-376c

let-7a miR-668 let-7th miR-412

miR-548d-5p miR-208 miR-15b miR-433

miR-183 miR-521 miR-487b miR-206

miR-490-3p miR-597 miR-410 miR-335

miR-520a-3p miR-874 miR-139-5p miR-33a *

miR-590-3p miR-224 miR-216b miR-193a-3p

miR-15a miR-182 miR-423-5p miR-381 miR-1244 miR-23b miR-484 miR-34c-5p |

miR-328 miR-492 miR-23a

According to a third variant embodiment, the detected miRNAs are chosen from the miRNAs of Table 6.

Table 6

In a particular embodiment, the body fluid sample, particularly a urine sample, is from a human subject and the detected one or more miRNAs are selected from the group consisting of the miRNAs of Table 2 and 3, or from the miRNAs in Table 2 or 3 and also appearing in Tables 4, 5 and 6.

The diagnosis (or the evaluation of the risk), the prognosis or the effectiveness of the treatment can moreover be confirmed in procedures according to the methods according to the invention, comprising known stages of evaluation of a muscular dystrophy (for example , determination of the level of creatine kinase, search for specific markers in muscle biopsies, genomic analysis, etc.) Thus, a particular embodiment of the diagnostic method according to the invention as described above also comprises a step confirming the diagnosis using an alternative method of assessing muscular dystrophy.

The invention also relates to a kit for diagnosing muscular dystrophy, this kit comprising means for detecting or assaying at least one miRNA selected from let-7f, let-7a, miR-548d-5p, miR-183 , miR-490-3p, miR-520a-3p, miR-590-3p, miR-15a, miR-1244, miR-328, miR-494, miR-668, miR-208, miR-521, miR-597 , miR-874, miR-224, miR-182, miR-23b, miR-492, let-7c, let-7e, miR-15b, miR-487b, miR-410, miR-139-5p, miR-216b , miR-423-5p, miR-484, miR-23a, miR-376c, miR-412, miR-433, miR-206, miR-335, miR-33a *, miR-193a-3p, miR-381, miR-34c-5p, miR-628-3p, miR-659, miR-505 *, let-7b, let-7d, let-7g, miR-196b, miR-26b, miR-942, miR-200b *, miR-523, miR-346, miR-155, miR-548b-5p, miR-548c-5p, miR-518f, miR-886-3p, miR-650, miR-720, miR-593, miR-657, miR-502-3p miR-198, miR-214, miR-220, miR-373, miR-511, miR-517b, miR-518a-3p, miR-518b, miR-518e, miR-520g, miR-493 , miR-151-5p, miR-192 *, miR-28-5p, miR-30d and miR-30e-3p. According to a particular embodiment, the kit comprises the detection or dosing means of all the miRNAs of this list. According to a particular embodiment, the kit comprises means for detecting or assaying one or more miRNAs (in particular all) chosen from the miRNAs listed in Table 4, Table 5 or Table 6. According to a specific mode embodiment, the detection or dosing means in the kit consist of means for detecting or assaying one or more of the miRNAs of Tables 2 and 3, or of one or more of the miRNAs listed in each of the tables 4, 5 and 6. According to one particular embodiment, the miRNAs detected or assayed using the kit consist of all the miRNAs of Table 4, more particularly the set of miRNAs in Table 5, and even more particularly in the aggregate. Table 6 miRNAs.

By way of illustration, the kit according to the invention may be a kit for performing a real-time PCR and may also contain a reverse transcriptase, a DNA polymerase, one or more buffer (s) adapted to the reactions to be carried out, probes specific for amplified regions (for example Taqman® probes), or markers specific for double-stranded DNA such as SYBR Green. The invention also relates to a set of nucleotide sequences, this set comprising primer pairs that can be used to specifically amplify at least two miRNAs selected from let-7f, let-7a, miR-548d-5p, miR-183, and miR-490. -3p, miR-520a-3p, miR-590-3p, miR-15a, miR-1244, miR-328, miR-494, miR-668, miR-208, miR-521, miR-597, miR-874 , miR-224, miR-182, miR-23b, miR-492, let-7c, let-7e, miR-15b, miR-487b, miR-410, miR-139-5p, miR-216b, miR-423 -5p, miR-484, miR-23a, miR-376c, miR-412, miR-433, miR-206, miR-335, miR-33a *, miR-193a-3p, miR-381, miR-34c- 5p, miR-628-3p, miR-659, miR-505 *, let-7b, let-7d, let-7g, miR-196b, miR-26b, miR-942, miR-200b *, miR-523, miR-346, miR-155, miR-548b-5p, miR-548c-5p, miR-518f, miR-886-3p, miR-650, miR-720, miR-593, miR-657, miR-502- 3p miR-198, miR-214, miR-220, miR-373, miR-511, miR-517b, miR-518a-3p, miR-518b, miR-518e, miR-520g, miR-493, miR-151 -5p, miR-192 *, miR-28- 5p, miR-30d and miR-30e-3 in a PCR experiment. According to one variant, the nucleotide sequences make it possible to amplify one or more miRNAs of each of Tables 4, 5 and 6. According to one particular embodiment, the set of nucleotide sequences comprises pairs of primers allowing amplification. specific to all the miRNAs listed above. According to an alternative embodiment, the set of nucleotide sequences can also comprise a nucleotide sequence that can be used as a labeled probe for the detection and quantification of the amplified fragments (for example a probe that can be used in the TaqMan real-time PCR system).

The invention also relates to a set of nucleotide sequences comprising one or more labeled oligonucleotides usable for the specific detection of at least two miRNAs of Table 1, for example in a Northern blot experiment. In a particular embodiment, the set of sequences contains oligonucleotides specific to each of the miRNAs of Table 1, Table 2, Table 3, 4, Table 5 or Table 6.

The invention also relates to a multiwell support for PCR, comprising at least two pairs of PCR primers each specific for a miRNA different from Table 1, Table 2, Table 3, 4, Table 5 or Table 6, each of the primer pairs being disposed in a different well of the support. According to a specific variant, the support contains pairs of primers consisting of primers specific for at least two miRNAs of Table 1, 2, 3, 4, 5 or 6, each of the pairs of primers being arranged in a different well. of the support. According to a particular embodiment, the multiwell support comprises primer pairs specific for all the miRNAs of Table 1, Table 2, Table 3, 4, Table 5 or Table 6, each of these pairs of primers being arranged in a different well. According to another specific embodiment, the support contains pairs of primers consisting of primers specific for all the miRNAs of Table 1, 2, 3, 4, 5 or 6, each of the pairs of primers being arranged in a well. different from the support.

The present invention is illustrated by the following figures and examples. Legend of figures

Figure 1: (high) number of different miRNAs detected by sample category after TLDA card expression pattern A and B (patients 3-8 years) or TLDA A (patients 13-18 years). (low) Average Ct per sample category. Healthy 3-8years (5 samples), DMD 3-8 years (5 samples), healthy 13-18years (3 samples), DMD 13-18years (2 samples).

Figure 2: heatmaps including the abundances of each miRNA identified for each donor tested, and hierarchical grouping of donors according to miRNA expression candidates, (high) heatmap for 3-8 years. (low) heatmap for 13-18 year olds. The heatmaps and hierarchical grouping calculations are done via the CIMminer software (http://discovcr.nci.nih.gov/cimmincr/) Figure 3: Example of deregulated miRNAs in the urine of DMD patients. The abundance of miRNAs is represented according to the group of patients.

EXAMPLES

Material and methods :

Urine is collected in sterile containers. In the next half hour, it is centrifuged at 2000rpm for 5 min to eliminate the cells present. The supernatant is then recovered, aliquoted and frozen at -80 ° C.

The study on Map A is based on urine samples from 4 DMD patients and 6 healthy subjects aged 3 to 8 years or 2 DMD patients and 3 healthy subjects aged 13 to 18 years.

The study on Map B is based on urine samples from 4 DMD patients and 5 healthy subjects.

10ml of urine are used to extract the total RNAs containing the microRNAs using Norgen Biotek's kit "Urine total RNA maxi kit, slurry format", according to the supplier's protocol. The RNAs are eluted in 2 successive elutions of ΙΟΟμί. They are then precipitated overnight at -20 ° C. in the presence of sodium acetate, absolute ethanol and linear acrylamide (Ambion) according to the Ambion protocol. The RNAs are then resuspended in water without RNAse. A quality control of the RNAs is then carried out in 3 steps: 1) assay by the absorbance at 260nm (Nanodrop 8000, Thermo Scientifc) 2) capillary electrophoresis on a small RNA chip and pico (Agilent Technologies) 3) amplification of 3 small urinary RNAs controls by RT-qPCR (miR-16, miR-377 *, U6). 100 ng of total RNA are then subjected to multiplex reverse transcription (Megaplex pools, Applied biosystems). We perform 2 reverse transcripts from 2 different primer pools: pools A and B. Together they cover the detection of 762 different microRNAs, which is about half of the 1424 known human miRNAs (miRbase, www.mirbase .org, release 17, April 2011). The resulting complementary DNAs undergo then a pre-amplification step (preAmp master mix and preAmp primer pools, Applied Biosystems) before being deposited on TLDA (Taqman Low Density Array) plates. This technology was developed by Applied Biosystems, and consists of the simultaneous detection of 381 miRNAs on a 384-well plate by RT-qPCR. The relative amount of each miRNA is determined by normalizing with the average Ct (cycle threshold) of each sample (Mestdagh, Genome Biol 2009), and using a healthy donor sample as a reference (ddCt method). The ratios of the relative amounts of each miRNA between the healthy donor population and the DMD patient population are then determined. The relative quantities are calculated according to the delta delta method of Ct. With dCt (miR) = Ct miR - Ct calibrator;

ddCt (miR) = dCt (reference) - dCt (miR); and

Relative quantity (miR) = 2 ^A delta delta Ct (miR).

The reference corresponds to the average value obtained for a given miR in healthy donors. The calibrator is the average Ct of the entire TLDA plate.

Results:

We considered only the detected miRNAs with a Ct of less than 35 for a threshold of 0.1, according to the RQ manager software (Applied Biosystems). Among subjects 3-8 years old, considering only panel A TLDA cards used, and for each urinary sample, we detected an average of 172 different miRNAs, the average Ct of each sample being equal to 28.2 (Figure 1 ). Among subjects aged 13-18 years, considering only panel A of the TLDA maps used, and for each urinary sample, we detected an average of 210 different miRNAs, the average Ct of each sample being equal to 27.8 (Figure 1 ). Panel B was only tested for donors 3-8 years of age and detected an average of 160 additional miRNAs (approximately 330 different miRNAs detectable in donor urine 3-8 years old). We therefore observe a rather large abundance and variety of miRNAs in the urine. We finally determined the list of miRNAs differently represented in the urine of DMD patients compared to healthy donors, comparing subjects of equivalent age (1: group 3-8 years, 2: group 13-18 years). The miRNAs are shown in Table 7 and for each miRNA is indicated its level of deregulation in the urine of the 3-8 and 13-18 age groups (difference factor), its category (increased, decreased in DMD relative to healthy), and its potential as biomarkers (score out of 4). Very high potential miRNAs (potential = 4) show significant modification factors and / or deregulation in both age groups. Good potential (potential = 1) miRNAs show low but significant difference factors. High potential or intermediate potential miRNAs have a score of 3 or 2. Figure 2 shows these results as 2 heatmaps, one for each age group. From the abundance data of the different urinary miRNAs selected in Table 7, the hierarchical grouping algorithm used (http://discover.nci.nih.gov/cimminer/) allows donors to be effectively separated according to their healthy status or DMD. Thus, this result shows that the expression of the identified miRNAs can be used as a signature of the DMD pathology. Figure 3 shows examples of deregulated miRNAs in DMD patients.

Table 7

Factor

difference increases / decreases

potential urinary miRNA / 4

(DMD / healthy) at DMD 3-8 years

3-8ans

hsa-let-7f 80000 increases 4

hsa-let-7a 20000 increases 4

hsa-miR-548d-5p 4000 increases 4

hsa-miR-183 2000 increases 4

hsa-miR-490-3p 2000 increases 4

hsa-miR-520a-3p 1000 increases 4

hsa-miR-590-3p 80 increases 4

hsa-miR-15a 9 increases 4

hsa-miR-224 8000 increases 3

hsa-miR-182 25 increases 3

hsa-miR-23b 8 increases 3

hsa-miR-492 6 increases 3

hsa-let-7c 5 increases 3

hsa-let-7e 5 increases 3

hsa-miR-15b 5 increases 3

hsa-miR-206 3 increases 3

hsa-miR-335 3 increases 3

hsa-miR-33a * 3 increases 3

hsa-miR-487b 3 increases 3

hsa-miR-628-3p 12 increases 2

hsa-miR-659 9 increases 2

hsa-miR-505 * 7 increases 2

hsa-let-7b 5 increases 2 hsa-let-7d 5 increase 2 hsa-let-7g 5 increase 2 hsa-mi -196b 5 increase 2 hsa-miR-26b 5 increase 2 hsa-miR-942 5 increase 2 hsa-miR-200b * 3 increase 2 hsa -miR-502-3p 3 increases 2 hsa-miR-151-5p 3 increases 1 hsa-miR-192 * 3 increases 1 hsa-miR-28-5p 3 increases 1 hsa-miR-30d 3 increases 1 hsa-miR- 30e-3p 3 increase 1 hsa-miR-668 -100 decrease 4 hsa-miR-1244 -20 decrease 4 hsa-miR-494 -20 decrease 4 hsa-miR-328 -10 decrease 4 hsa-miR-484 -5 decrease 3 hsa-miR-657 -17 decreases 2 hsa-miR-593 -13 decreases 2 hsa-miR-650 -12 decreases 2 hsa-miR-720 -12 decreases 2 hsa-miR-886-3p -8 decreases 2

Factor

difference increases / decreases in urinary miRNA potential

(DMD / healthy) DMD 13-18years / 4 13-18years

hsa-miR-521 40000 increase 4 hsa-miR-597 30000 increase 4 hsa-miR-520a-3p 67 increase 4 hsa-miR-548d-5p 63 increase 4 hsa-miR-208 54 increase 4 hsa-miR-490- 3p 20 increases 4 hsa-miR-328 7 increases 4 hsa-miR-494 7 increases 4 hsa-miR-193a-3p 35 increases 3 hsa-miR-34c-5p 26 increases 3 hsa-miR-433 20 increases 3 hsa- miR-381 increases 3 hsa-miR-410 14 increases 3 hsa-miR-518a-3p 173 increases 2 hsa-miR-198 84 increases 2 hsa-miR-511 58 increases 2 hsa-miR-373 36 increases 2

hsa-miR-548c-5p 29 increases 2

hsa-miR-220 26 increases 2

hsa-miR-346 24 increases 2

hsa-miR-518b 24 increases 2

hsa-miR-214 22 increases 2

hsa-miR-520g 22 increases 2

hsa-miR-548b-5p 21 increases 2

hsa-miR-517b 17 increases 2

hsa-miR-518e 17 increases 2

hsa-miR-518f 17 increases 2

hsa-miR-493 13 increases 2

hsa-miR-523 12 increases 2

hsa-miR-874 -2000 decreases 4

hsa-let-7f -171 decreases 4

hsa-miR-183 -162 decreases 4

hsa-miR-15a -16 decreases 4

hsa-miR-412 -620 decreases 3

hsa-miR-216b -533 decreases 3

hsa-miR-23a -464 decreases 3

hsa-miR-139-5p -216 decreases 3

hsa-miR-376c -128 decreases 3

hsa-miR-492 -123 decreases 3

hsa-miR-423-5p -120 decreases 3

hsa-let-7e -11 decreases 3

hsa-let-7c -10 decreases 3

has-miR-155 -17 decreases 2

hsa-let-7b -10 decreases 2

REFERENCES Batchelor, C. L. and S. J. Winder (2006). "Sparks, Signals and Shock Absorbers: How Dystrophin Loss Causes Muscular Dystrophy." Trends Cell Biol 16 (4): 198-205.

Bushby, R. Finkel, et al. "Diagnosis and management of Duchenne muscular dystrophy, part 1: diagnosis, and pharmacological and psychosocial management." Lancet Neurol 9 (1): 77-93.

Cacchiarelli, D., I. Legnini, et al. "miRNAs have serum biomarkers for Duchenne muscular dystrophy." EMBO Mol Med 3 (5): 258-65. Cacchiarelli, D., J. Martone, et al. "MicroRNAs involved in molecular circuits falling under the Duchenne muscular dystrophy pathogenesis are controlled by the dystrophin / nNOS pathway." Cell Metab 12 (4): 341-51.

Cirak, S., Arechavala-Gomeza V., et al. "Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study." Lancet.

Gidlof, O., P. Andersson, et al. "Cardiospecific MicroR A Plasma Levels Correlate with Troponin and Cardiac Function in Patients with ST Elevation Myocardial Infarction, Are Selectively Dependent on Renal Elimination, and Can Be Detected in Urine Samples." Cardiologv 118 (4): 217-226.

Greco, S., M. De Simone, et al. (2009). "Common micro-RNA signature in skeletal muscle damage and regeneration induced by Duchenne muscular dystrophy and acute ischemia." Faseb J 23 (10): 3335-46.

Hanke, M., K. Hoeff, et al. "A robust methodology to study microRNA urine as tumor marker: microRNA-126 and microRNA-182 are related to urinary bladder cancer." Urol Oncol 28 (6): 655-61.

Rumor, E., S. J. Winder, et al. "Dystrophin: more than just the sum of its parts." Biochim Biophvs Acta 1804 (9): 1713-22.

Lott, J.A. and P.W. Landesman (1984). "The enzymology of skeletal muscle disorders." Crit Rev Clin Lab Sci 20 (2): 1- 3-90.

Lu, Q. L., T. Yokota, et al. "The status of exon skipping a duchenne muscular dystrophy." Mol Ther 19 (1): 9-15.

Muntoni, F., S. Torelli, et al. (2003). "Dystrophin and mutations: one gene, multiple proteins, multiple phenotypes." Lancet Neurol 2 (12): 731-40.

Nicholson, G.A., G.J. Morgan, et al. (1986). "The effect of aerobic exercise on serum creatine kinase activities." Muscle Nerve 9 (9): 820-4.

Wang, G., L. S. Tarn, et al. "Serum and urinary free microRNA level in patients with systemic lupus erythematosus." Lupus 20 (5): 493-500.

Weber, J.A., D.H.Baxter, et al. "The microRNA spectrum in 12 body fiuids." Clin Chem 56 (11): 1733-41.

Yamada, Y., Enokida, H., et al. "MiR-96 and miR-183 in urine detection as a tumor markers of urothelial carcinoma: correlation with stage and grade, and comparison with urinary cytology." Cancer Sci 102 (3): 522-9.

Claims

A method for diagnosing or assessing the risk of developing or presenting muscular dystrophy in a subject, comprising measuring the level of expression of at least one microRNA in a urine sample of said subject and comparing said level of expression measured in said urine sample at a level obtained in a healthy reference sample, a difference between the level of expression relative to the reference sample being indicative of a dystrophy in the subject.

The method of claim 1, wherein the at least one microRNA is selected from let-7f, let-7a, miR-548d-5p, miR-183, miR-490-3p, miR-520a-3p, miR -590-3p, miR-15a, miR-1244, miR-328, miR-494, miR-668, miR-208, miR-521, miR-597, miR-874, miR-224, miR-182, miR -23b, miR-492, let-7c, let-7e, miR-15b, miR-487b, miR-410, miR-139-5p, miR-216b, miR-423-5p, miR-484, miR-23a , miR-376c, miR-412, miR-433, miR-206, miR-335, miR-33a *, miR-193a-3p, miR-381, miR-34c-5p, miR-628-3p, miR- 659, miR-505 *, let-7b, let-7d, let-7g, miR-196b, miR-26b, miR-942, miR-200b *, miR-523, miR-346, miR-155, miR- 548b-5p, miR-548c-5p, miR-518f, miR-886-3p, miR-650, miR-720, miR-593, miR-657, miR-502-3p miR-198, miR-214, miR -220, miR-373, miR-511, miR-517b, miR-518a-3p, miR-518b, miR-518e, miR-520g, miR-493, miR-151-5p, miR-192 *, miR- 28-5p, miR-30d and miR-30e-3p.

A method for diagnosing or assessing the risk of developing or presenting muscular dystrophy in a subject, comprising measuring the level of expression in a body fluid sample of said subject of at least one microRNA selected from among 7f, let-7a, miR-548d-5p, miR-183, miR-490-3p, miR-520a-3p, miR-590-3p, miR-15a, miR-1244, miR-328, miR-494, miR-668, miR-208, miR-521, miR-597, miR-874, miR-224, miR-182, miR-23b, miR-492, let-7c, let-7e, miR-15b, miR- 487b, miR-410, miR-139-5p, miR-216b, miR-423-5p, miR-484, miR-23a, miR-376c, miR-412, miR-433, miR-335, miR-33a * , miR-193a-3p, miR-381, miR-34c-5p, miR-628-3p, miR-659, miR-505 *, let-7b, let-7d, let-7g, miR-196b, miR- 26b, miR-942, miR-200b *, miR-523, miR-346, miR-155, miR-548b-5p, miR-548c-5p, miR-518f, miR-886-3p, miR-650, miR -720, miR-593, miR-657, miR-502-3p miR- 198, miR-214, miR-220, miR-373, miR-511, miR-517b, miR-518a-3p, miR-518b, miR-518e, miR-520g, miR-493, miR-151-5p, miR-192 *, miR-28-5p, miR-30d and miR-30e-3p.

4. A method of monitoring the course of a muscular dystrophy comprising measuring the level of expression of at least one microRNA selected from let-7f, let-7a, miR-548d-5p, miR-183, miR- 490-3p, miR-520a-3p, miR-590-3p, miR-15a, miR-1244, miR-328, miR-494, miR-668, miR-208, miR-521, miR-597, miR- 874, miR-224, miR-182, miR-23b, miR-492, let-7c, let-7e, miR-15b, miR-487b, miR-410, miR-139-5p, miR-216b, miR- 423-5p, miR-484, miR-23a, miR-376c, miR-412, miR-433, miR-335, miR-33a *, miR-193a-3p, miR-381, miR-34c-5p, miR -628-3p, miR-659, miR-505 *, let-7b, let-7d, let-7g, miR-196b, miR-26b, miR-942, miR-200b *, miR-523, miR-346 , miR-155, miR-548b-5p, miR-548c-5p, miR-518f, miR-886-3p, miR-650, miR-720, miR-593, miR-657, miR-502-3p miR- 198, miR-214, miR-220, miR-373, miR-511, miR-17b, miR-518a-3p, miR-18b, miR-518e, miR-520g, miR-493, miR-1 1-5p , miR-192 *, miR-28-5p, miR-30d and miR-30e-3p in a second body fluid sample of a subject, this level in the sample of the subject being compared at said microRNA in a first reference sample which corresponds to a sample taken previously on the same subject;

the evolution of the expression level of the selected microRNA (s) being indicative of a progression of muscular dystrophy.

A method for determining the efficacy of a therapeutic treatment of muscular dystrophy in a subject, comprising

a) measuring the level of expression in a body fluid of said subject, of one or more microRNAs, whereby a reference level is determined; then

b) measuring the level of expression of said at least one microRNA selected in step a) in a second biological fluid sample taken from the same subject at a given time after administration of the therapeutic treatment, whereby a test level is determined; and

c) the comparison of the control and test levels, the evolution of the level of expression of the selected microRNAs being indicative of an effective treatment of the subject;

said one or more miRNAs being chosen from among let-7f, let-7a, miR-548d-5p, miR-183, miR-490-3p, miR-520a-3p, miR-590-3p, miR-15a, miR-1244, miR-328, miR-494, miR-668, miR-208, miR-521, miR-597, miR-874, miR-224, miR-182, miR-23b, miR-492, let- 7c, let-7th, miR-15b, miR-487b, miR-410, miR-139-5p, miR-216b, miR-423-5p, miR-484, miR-23a, miR-376c, miR-412, miR-433, miR-335, rniR- 33a *, miR-193a-3p, miR-381, miR-34c-5p, miR-628-3p, miR-659, miR-505 *, let-7b, let-7d, let-7g, miR-196b, miR-26b, miR-942, miR-200b *, miR-523, miR-346, miR-155, miR-548b-5p, miR-548c-5p, miR-518f, miR-886-3p, miR-650 , miR-720, miR-593, miR-657, miR-502-3p miR-198, miR-214, miR-220, miR-373, miR-511, miR-517b, miR-518a-3p, miR- 518b, miR-518e, miR-520g, miR-493, miR-151-5p, miR-192 *, miR-28-5p, miR-30d and miR-30e-3p.

6. Method according to any one of claims 3 to 5, the sample being a urine sample.

7. A method for (a) monitoring the course of muscular dystrophy or (b) determining the efficacy of a therapeutic treatment of muscular dystrophy in a subject, including measuring the level of expression in a subject urine sample of said subject of at least one microRNA selected from let-7f, let-7a, miR-548d-5p, miR-183, miR-490-3p, miR-520a-3p, miR-590-3p, miR-15a, miR-1244, miR-328, miR-494, miR-668, miR-208, miR-521, miR-597, miR-874, miR-224, miR-182, miR-23b, miR- 492, let-7c, let-7e, miR-15b, miR-487b, miR-410, miR-139-5p, miR-216b, miR-423-5p, miR-484, miR-23a, miR-376c, miR-412, miR-433, miR-206, miR-335, miR-33a *, miR-193a-3p, miR-381, miR-34c-5p, miR-628-3p, miR-659, miR-505 *, let-7b, let-7d, let-7g, miR-196b, miR-26b, miR-942, miR-200b *, miR-523, miR-346, miR-155, miR-548b-5p, miR -548c-5p, miR-518f, miR-886-3p, miR-650, miR-720, miR-593, miR-657, miR-502-3p miR-198, miR-214, miR-220, miR- 373, miR-51 1, miR-517b, miR-518a-3p, miR-518b, miR-518e, miR-520g, miR-493, miR-151-5p, miR-192 *, miR-28-5p, miR-30d and miR-30e-3p.

8. A method according to any one of claims 1 to 7, wherein said microRNA (s) is selected from among let-7f, let-7a, miR-548d-5p, miR-183, miR-490-3p, miR- 520a-3p, miR-590- 3p, miR-15a, miR-1244, miR-328, miR-494, miR-668, miR-208, miR-521, miR-597, miR-874, miR-224, miR-182, miR-23b, miR-492, let-7c, let-7e, miR-1b, miR-487b, miR-410, miR-139-5p, miR-216b, miR-423-5p, miR -484, miR-23a, miR-376c, miR-412, miR-433, miR-206, miR-335, miR-33a *, miR-193a-3p, miR-381, miR-34c-5p, miR- 628-3p, miR-659, miR-505 *, let-7b, let-7d, let-7g, miR-196b, miR-26b, miR-942, miR-200b *, miR-523, miR-346, miR-155, miR-548b-5p, miR-548c-5p, miR-18f, miR-886-3p, miR-650, miR-720, miR- 593, miR-657, miR-502-3p, miR-198, miR-214, miR-220, miR-373, miR-511, miR-517b, miR-518a-3p, miR-18b, miR-518e, miR-520g and miR-493.

9. A method according to any one of claims 1 to 8, wherein said miRNA (s) being chosen from among let-7f, let-7a, miR-548d-5p, miR-183, miR-490-3p, miRN- 520a-3p, miR-590-

3p, miR-15a, miR-1244, miR-328, miR-494, miR-668, miR-208, miR-521, miR-597, miR-874, miR-224, miR-182, miR-23b, miR-492, let-7c, let-7e, miR-15b, miR-487b, miR-410, miR-139-5p, miR-216b, miR-423-5p, miR-484, miR-23a, miR- 376c, miR-412, miR-433, miR-206, miR-335, miR-33a *, miR-193a-3p, miR-381 and miR-34c-5p.

The method according to any one of claims 1 to 9, wherein said miRNA (s) are selected from among let-7f, let-7a, miR-548d-5p, miR-183, miR-490-3p, miRN- 520a-3p, miR-590-3p, miR-15a, miR-1244, miR-328, miR-494, miR-668, miR-208, miR-521, miR-597 and miR-874.

11. Method according to any one of claims 1 to 10, the method comprising measuring all the miRNAs listed.

12. Method according to any one of claims 1 to 11, for the diagnosis, risk assessment, monitoring of the evolution or the monitoring of the effectiveness of a treatment of Duchenne muscular dystrophy or the Becker muscular dystrophy, especially Duchenne muscular dystrophy.

A kit comprising microRNA detection or assaying means, the detection or assaying means in the kit consisting of means for detecting or assaying one or more miRNAs selected from let-7f, let-7a, miR-548d-5p, miR-183, miR-490-3p, miR-520a-3p, miR-590-3p, miR-15a, miR-1244, miR-328, miR-494, miR-668, miR- 208, miR-521, miR-597, miR-874, miR-224, miR-182, miR-23b, miR-492, let-7c, let-7e, miR-15b, miR-487b, miR-410, miR-139-5p, miR-216b, miR-423-5p, miR-484, miR-23a, miR-376c, miR-412, miR-433, miR-206, miR-335, miR-33a *, miR -193a-3p, miR-381, miR-34c-5p, miR-628-3p, miR-659, miR-505 *, let-7b, let-7d, let-7g, miR-196b, miR-26b, miR-942, miR-200b *, miR-523, miR-346, miR-155, miR-548b-5p, miR-548c-5p, miR-518f, miR-886-3p, miR-650, miR-720 , miR-593, miR-657, miR-502-3p miR-198, miR-214, miR-220, miR-373, miR-511, miR-517b, miR-518a-3p, miR-518b, miR-518e, miR-520g, miR-493, miR-151-5p, miR-192 *, miR-28-5p, miR-30d and miR-30e-3p.

The kit of claim 13, wherein each of the miRNAs is detected or assayed using a specific probe and / or primer pair.

15. Multi-well PCR support comprising PCR primer pairs consisting of primers specific for at least two miRNAs selected from the group consisting of let-7f, let-7a, miR-548d-5p, miR-183, miRN- 490-3p, miR-520a-3p, miR-590-3p, miR-15a, miR-1244, miR-328, miR-494, miR-668, miR-208, miR-521, miR-597, miR- 874, miR-224, miR-182, miR-23b, miR-492, let-7c, let-7e, miR-1b, miR-487b, miR-410, miR-139-5p, miR-216b, miR -423-5p, miR-484, miR-23a, miR-376c, miR-412, miR-433, miR-206, miR-335, miR-33a *, miR-193a-3p, miR-381, miR- 34c-5p, miR-628-3p, miR-659, miR-505 *, let-7b, let-7d, let-7g, miR-196b, miR-26b, miR-942, miR-200b *, miR- 523, miR-346, miR-155, miR-548b-5p, miR-548c-5p, miR-518f, miR-886-3p, miR-650, miR-720, miR-593, miR-657, miR- 502- 3p miR-198, miR-214, miR-220, miR-373, miR-11, miR-517b, miR-518a-3p, miR-518b, miR-518e, miR-520g, miR-493, miR -151-5p, miR-192 *, miR-28-5p, miR-30d and miR-30e-3p, each of the primer pairs being arranged in a different well of u support.