FR2987057A1 - BIO-MARKER GENES FOR SELECTING AND EVALUATING THE PROTECTION EFFICIENCY OF A SOLAR PRODUCT AGAINST LONG UVA - Google Patents

Abstract

The present invention relates to the use of biomarkers of skin exposure to long UVA, the predominant ultraviolet of the solar spectrum and which have a deleterious impact on the skin, to measure the effectiveness of sun protection products against UVA long and screen photoprotective compounds.

Description

The present invention relates to the use of biomarker genes for exposing the skin to long UVAs, the predominant ultraviolet of the solar spectrum. and which have a deleterious impact on the skin, to measure the effectiveness of sun protection products against long UVA and to screen photoprotective compounds. The skin is composed of two major tissues, the epidermis and the dermis. The epidermis is the most superficial. Keratinocytes are the majority cells of the epidermis whose essential function is protection from the outside and which is ensured by the process of epidermal differentiation resulting in the formation of horny layers. The epidermis also includes melanocytes (about 5% of the epidermal cell population) responsible for skin staining and antigen-presenting cells, Langerhans cells. The epidermis is based on the dermis, a supportive connective matrix that also provides vascularity and also allows better protection of underlying tissues and organs. It is the fibroblasts, cells embedded in the dermis, that synthesize the main components of this conjunctive matrix, which are collagens, elastin and proteoglycans. The skin is exposed to many external factors, such as pollution, climatic factors, mechanical aggression, infections, sun etc., which can lead to harmful consequences in the short, medium and long term. In particular, the sun emits a lot of radiation, 10% of which consists of ultraviolet rays. Only ultraviolet B (UVB, 280 to 320 nm) and ultraviolet A (UVA, 320 to 400 nm) reach the earth's surface. The UVA are subdivided into short UVA (320 to 340 nm) and long UVA (340 to 400 nm). Distribution of the received UV and their variations The great majority of the UV received on earth are UVA since they constitute on average 95% at least received UV; the UVB represents only 5% (International Commission on Illumination, 1989, CIE Publication No. 85 http://www.cie.co.at/index.php/Publications/index.php?i ça id = 360. Accessed January 20th, 2011). Among the 95% of UVA received, the long UVAs predominate, representing at least 77% of the UV received on Earth.

These figures are averages and the intensity of solar UV received is variable, depending on many geo-orbital and environmental parameters such as latitude, time of day, season, weather conditions and layer thickness ozone. While UVB levels are very sensitive to these parameters, UVA rates are much less affected and vary less depending on these different parameters. For example, UVA levels are less affected than UVBs by season and decrease less in winter (Sabziparvar, et al., Photochem Photobiol 1999, 69 (2): 193-202). Regarding the time of day, the UVB and UVA increase since the beginning of the day, reach a peak at noon solar and decline at the end of the day. However UVA are more "present" than UVB throughout the day since they have a variation comparable to visible light while the UVB levels are highest between 10 am and 4 pm ( with a strong peak at noon). On the other hand, while UVBs are almost completely absorbed by glass, UVA passes through windows. Finally, during a daily solar exposure, encountered in everyday life, (as opposed to a beach-type exposure), the UVA rate is even higher compared to the UVB rate. Thus, during a beach-type exposure, the UVA / UVB ratio is less than 18 on average; during a daily exposure, this ratio rises to 23 (Christiaens et al., Photochem Photobiol 81: 874-878 (2005)).

Thus, compared to UVB, UVA is more abundant and more permanent throughout the year. However, UVAs are less energetic than UVB and are more penetrating: UVA can cross the epidermis and penetrate deep into the dermis.

Biological effects of UVA It has long been thought that UVB, because of their high energy (they are able to induce direct lesions on DNA, are responsible for sunburn and are involved in cutaneous carcinogenesis) were the only ones responsible for the deleterious effects of solar exposures. However, UVAs generate reactive oxygen species in the cells of the skin, responsible for oxidative stress, which will damage DNA, proteins and cell membranes. By these mechanisms, UVA induce profound alterations in the dermis and it has been clearly demonstrated that they are responsible for signs of photo-aging (age spots, wrinkles, dry skin ...) but are also involved in cutaneous carcinogenesis (Tyrrell et al., Antioxid Redox Signal 6: 835-840 (2004), Wondrak et al., Photochem Photobiol Sci 5: 215-237 (2006), Wondrak et al, Photochem Photobiol Sci 5: 215-237 (2006); Autier P et al Curr Opin Oncol 23: 189-196 (2011)). At the moment, solar formulas very effectively protect short UVAs and cover a part of long UVA: the best solar formulas on the market absorb long UVAs up to 370 nm. Beyond this wavelength (370 nm), for technical reasons, the absorption of solar formulas decreases very clearly in long UVA. Thus, today with good sunscreen, we are protected from short UVA, part of long UVA (between 340 and 370 nm), but long UVA between 370 and 400 nm reach our skin. It is therefore important to be concerned about the impact of long UVA on the skin. The biological and clinical consequences of long UVA exposure are increasingly described: - at the molecular level, long UVAs are responsible for the generation of oxidative stress via the production of reactive oxygen species, giving rise to lipid peroxidations and activation of certain oxidative stress response pathways (Leccia et al., Eur J Dermatol 8: 478-482 (1998), Dissemond J et al., Br J Dermatol 149: 341-349 (2003), Schneider et al. Arch Dermatol Res 297: 324-328 (2006) Gruber et al., FASEB 24: 39-48 (2009)). In addition, long UVAs are capable of generating lesions in the DNA molecule (pyrimidine dimers, oxidized purines). If these long UVA-induced lesions are not repaired, they can give rise to mutations (Besaratinia et al., Proc Natl Acad Sci USA 102: 10058-10063 (2005), Tewari et al J Invest Dermatol (2011 Nov 14). [Epub ahead of print]) Rochette et al., Nucleic Acids Res 31: 2786-2794 (2003), Besaratinia et al., Proc Natl Acad Sci USA 104: 5953-5958 (2007)). Deletions in mitochondrial DNA are also observed after exposure to long UVA (Bernburg et al., J Biol Chem 274: 15345-15349 (1999)); at the cellular level, long UVAs are cytotoxic for cutaneous cells, fibroblasts being more sensitive than keratinocytes (Leccia et al., Eur J Dermatol 8: 478-482 (1998)) and inducing apoptotic phenomena (Nishigaki et al. Photochem Photobiol 70: 228-235 (1999), Breuckmann et al J Eur Acad Dermatol Venereol 17: 418-429 (2003), Godar et al J Invest Dermatol 112: 3-12 (1999)). They also have an impact on cutaneous immune cells, altering the density and morphology of Langerhans cells (Seite et al., Br J Dermatol 148: 291-299 (2003), Dumay et al., Br J Dermatol 144: 1161-1168 (2001)) as well as the morphology and activity of melanocytes (Rosen et al., J Invest Dermatol 88: 774-779 (1987)); at the tissue level, long UVAs induce changes in the dermis, in particular with alterations of the collagen fibers and elastic fibers and the induction of matrix metalloproteinase 1 (MMP-1) (Kligman L et al., Photochem Photobiol 54). 233-237 (1991), Zheng et al., J Invest Dermatol 100: 194-199 (1993), Seite et al J Eur Acad Dermatol Venereol 20: 980-987 (2006), Yin et al., J Dermatol 30: 173-180 (2003)). In addition, long UVAs are responsible for modulating many cytokines (Skov et al., Br J Dermatol 138: 216-220 (1998), Bacharach-Buhles et al., Dermatology 198: 5-10 (1999)); - at the clinical level, long-term UVA are carcinogenic and induce numerous other signs of photoaging, notably with the formation of wrinkles, thickening, dryness and looseness of the skin (Ley et al., Photochem Photobiol 72: 485-487 (2000); van der Leun JC, de Gruijl, FR: Carcinogenesis 18: 1013-1020 (1997)). They are also pigmentogenic (Kollias et al., Photodermatol Photoimmunol Photomed 15: 175-178 (1999)). In high doses they may be erythematous (Harrison et al., Methods 28: 14-19 (2002), Beattie et al., Arch Dermatol 141: 1549-1555 (2005)). Finally, they are immunosuppressive, and because of their high proportion in the solar spectrum, they are the most immunosuppressive ultraviolet, especially at low doses (Matthews et al J Dermatol Sci 59: 192-197 (2010), Damian et al. Br J Dermatol 164: 657-659 (2011), Moyal et al J Invest Dermatol 117: 1186-1192 (2001)). Long UVAs, which are the predominant ultraviolet of the solar spectrum received on Earth (more than 3/4 of the received UV are long UVA) and are not totally filtered by the current sun protection, therefore have a deleterious impact on the skin. Methods available to test the effectiveness of solar products against UV The efficacy tests of a solar product are first based on the value of the "SPF" (Sun Protection Factor) index. By definition, the SPF is a protective measure against erythema (or sunburn) that is largely induced by UVB. The SPF is defined as the ratio "time to obtain an erythema in the presence of formula" divided by "time to obtain an erythema without sunscreen". This SPF value does not give information on UVA photoprotection as the contribution of UVA in the generation of erythema is minimal.

In vivo and in vitro evaluation methods for UVA photoprotection efficacy have been proposed. Currently, there is no consensus for the measurement of UVA protection. Nevertheless, the PPD ("Persistent Pigment Darkening") method is probably the most widely used to determine a UVA protection factor (Moyal et al., Photodermatol Photoimmunol Photomed 16: 250-255 (2000), Japan Cosmetic Industry Association (JCIA). Standard Measurements for UVA Protection Efficiency, Tokyo, Japan: JCIA, 1996). This in vivo method is based on measuring the time required to induce the "persistent pigment darkening", UVA-induced browning. The higher the PPD value, the better the UVA protection. This method has been described to test the efficacy of solar products against global UVA stress (short UVA + long UVA).

Therefore, there is currently no method for evaluating protection efficacy in the long UVA domain. There is also no validated method to measure clinical consequences other than erythema or pigmentation, especially immunosuppression or phenomena related to the development of cancers, as well as dermal alterations associated with photoaging.

The present application therefore aims to provide a method for detecting long UVA stress, and for testing the efficacy of solar products against long UVA in a specific manner. The inventors have identified a set of bio-marker genes for long UVA exposure and whose expression study makes it possible to detect long UVA stress, to select solar products protecting long UVA, and to evaluate protection of a solar product against long UVA. Indeed, the inventors have found, surprisingly and unexpectedly, that long UVAs modulate the expression of 180 genes hitherto not described as being involved in the UV response (whether UVA, UVB or even UVC). These 180 genes belong to different functional families (Tables 1 and 2). This list was restricted to 41 representative genes of functional families (Table 3). Finally, a list "heart" of 11 genes has been established, it signs a long UVA stress (Table 4).

DESCRIPTION OF THE INVENTION According to a first aspect, the invention relates to an in vitro method for identifying a photo-protective compound, the method comprising the steps of: a) measuring the level of expression, in a sample of skin which has been exposed to radiation comprising long UVA in the presence of a candidate compound, of at least one gene selected from the group consisting of the genes listed in Table 1 below Table 1: list of 180 SEQ biomarker genes ID Number Short name GenBank access gene name (updated 27/07/2010) 32 NM 002462 MX1 myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) 1 NM 002463 MX2 myxovirus (influenza virus ) resistance 2 (mouse) 2 NM 004120 GBP2 guanylate binding protein 2, interferon-inducible 33 NM 052942 GBP5 guanylate binding protein 5 34 NM 198460 GBP6 guanylate binding protein family, member 6 35 NM 016816 OAS1 2 ', 5'-oligoadenylate synthetase 1 , 40 / 46kDa 36 N M 002535 OAS2 2'-5'-oligoadenylate synthetase 2, 69 / 71kDa 37 NM 017654 SAMD9 sterile alpha motif containing domain 9 38 NM 152703 SAMD9L sterile alpha motif containing domain 9-like 39 NM 001031683 IFIT3 interferon-induced protein with tetratricopeptide repeats 3 40 NM 006417 IF144 interferon-induced protein 44 41 NM 006820 IF144L interferon-induced protein 44-like 42 NM 001002264 EPSTI1 epithelial stromal interaction 1 (breast) 43 NM 015474 SAMHD1 SAM domain and HD domain 1 44 NM 014439 ILI F7 interleukin 1 family, member 7 (zeta) 45 NM 000640 IL13RA2 interleukin 13 receptor, alpha 2 46 NM 003764 STX11 syntaxin 11 47 NM 007115 TNFAIP6 tumor necrosis factor, alpha-induced protein 6 48 NM 025218 ULBP1 UL16 binding protein 1 3 NM 001130711 CLEC2A C-type lectin domain family 2, member A 49 NM 005127 CLEC2B C-type lectin domain family 2, member B 50 NM 003046 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y + system), member 2 51 NM 006577 B3GNT2 UDP-GIcNAc: betaGal beta -1, 3-N-acetylglucosaminyltransferase 2 52 NM 001712 CEACAM1 carcinoembryonic antigen-related celI adhesion molecule 1 (biliary glycoprotein) 53 NM 003937 KYNU kynureninase (L-kynurenine hydrolase) 54 NM 004529 MLLT3 myeloid / lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila ); PSORS1C2 psoriasis susceptibility 1 candidate 2 56 NM 001085 SERPINA3 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 57 NM 004072 CMKLR1 chemokine-like receptor 1 58 NM 172220 CSF3 colony stimulating factor 3 (granulocyte) 59 NM 001776 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 60 NM 006895 HNMT histamine N-methyltransferase 4 NM 002359 MAFG v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) 61 NM 014375 FETUB fetuin B SEQ ID Number Short Name Gene Name d GenBank access (updated 27/07/2010) 62 NM 153487 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 63 NM 206963 RARRES1 retinoic acid receptor responder (tazarotene induced) 1 64 NM 012449 STEAP1 six transmembrane epithelial antigen of the prostate 1 65 NM 182606 TMPRSS11A transmembrane protease, serine 11A 66 NM 182643 DLC1 deleted in liver cancer 1 67 NM 030915 LBH limb bud and heart development e) 68 NM 175634 RUNX1T1 runt-related transcription factor 1; (NMR) SNAll snail homolog 1 (Drosophila) 70 NM 005098 MSC musculin (activated B-cell factor-1) 71 NM 053001 OSR2 odd-skipped related 2 (Drosophila) 72 NM 002585 PBX1 pre-B-cell leukemia homeobox 1 73 NM 017893 SEMA4G sema domain, immunoglobulin domain (Ig), domain transmembrane (TM) and short cytoplasmic domain, (semaphorin) 4G 74 NM 013259 TAGLN3 transgelin 3 75 NM 017637 BNC2 basonuclin 2 76 NM 018717 MAML3 mastermind-like 3 (Drosophila) 77 NM 153026 PRICKLE1 prickle homolog 1 (Drosophila) 78 NM 003882 WISP1 WNT1 inducible signaling pathway protein 1 NM 001111283 IGF1 insulin-like growth factor 1 (somatomedin C) 79 NM 001037954 DIXDC1 TEN domain containing 1 80 NM 203371 FIBIN end bud initiation factor homolog (zebrafish) 81 NM 005264 GFRA1 GDNF family receptor alpha 1 82 NM 201433 GAS7 growth arrest-specific 7 83 NM 005192 CDKN3 cyclin-dependent kinase inhibitor 3 84 NM 025195 TRIB1 tribible homolog 1 (Drosophila) 85 NM 022073 EGLN3 egl n homolog 3 (C, elegans) 86 NM 133328 DEDD2 death effector domain containing 2 87 NM 006186 NR4A2 nuclear receptor subfamily 4, group A, member 2 88 NM 031458 PARP9 poly (ADP-ribose) family polymerase, member 9 6 NM 002192 INHBA inhibin, beta A 89 NM 001099772 CYP4B1 cytochrome P450, family 4, subfamily B, polypeptide 1 90 NM 002275 KRT15 keratin 15 91 NM 175078 KRT77 keratin 77 7 NM 001343 DAB2 disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) 92 NM 015277 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like 93 NM 000129 F1 3A1 coagulation factor XIII, Al polypeptide 94 NM 004469 FIGF c-fos induced growth factor (vascular SEQ ID Number Short name GenBank access gene name (set to as of 27/07/2010) endothelial growth factor D) 95 NM 007350 PHLDA1 pleckstrin homology-like domain, family A, member 1 96 NM 014822 SEC24D SEC24 family, member D (S, cerevisiae) 97 NM 080474 SERPINB12 serpin peptidase inhibitor, clade B (ovalbumin), member 12 98 NM 014365 HSPB8 heat shock 22kDa protein 8 8 NM 014331 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y + system) member 11 99 NM 001172 ARG2 arginase, type 11 100 NM 007207 DUSP10 dual specificity phosphatase 10 101 NM 000433 NCF2 neutrophil cytosolic factor 2 9 NM 152310 ELOVL3 elongation of very long chain fatty acids (FEN1 / E1o2, SUR4 / E1o3, yeast) -like 3 102 NM 032717 AGPAT9 1-acylglycerol-3-phosphate 0-acyltransferase 9 103 NM 003956 CH25H cholesterol 25 CYP4F11 cytochrome P450, family 4, subfamily F, polypeptide 11 105 NM 007238 PXMP4 peroxisomal membrane protein 4, 24kDa 106 NM 000351 STS steroid sulfatase (microsomal), isozyme S 107 NM 024560 ACSS3 short-chain acyl-CoA synthetase family member 3 108 NM 001277 CHKA cholin kinase alpha 109 NM 001006630 CHRM2 cholinergic receptor, muscarinic 2 110 NM 002612 PDK4 pyruvate dehydrogenase kinase, isozyme 4 111 NM 013261 PPARGC1A peroxisome proliferator-activated receptor gamma, coact ivator 1 alpha 112 NM 001482 GATM glycine amidinotransferase (L-arginine: glycine amidinotransferase) 113 NM 019891 ERO1LB ER01-like beta (S, cerevisiae) 114 NM 014324 AMACR alpha-methylacyl-CoA racemase 115 NM 001460 FMO2 flavin containing monooxygenase 2 (no - functional) 116 NM 001461 FMO5 flavin containing monooxygenase 5 117 NM 152908 SLC47A2 solute carrier family 47, member 2 10 NM 138461 TM4SF19 transmembrane 4 L six family member 19 118 NM 015993 PLLP plasma membrane proteolipid (plasmolipin) 119 NM 013390 TMEM2 transmembrane protein 2 120 NM 017631 DDX60 DEAD (Asp-Glu-Ala-Asp) box polypeptide 60 121 NM 001012967 DDX6OL DEAD (Asp-Glu-Ala-Asp) box polypeptide 60- like 122 NM 005325 HIST1H1A histone cluster 1, H1a 123 NM 004836 EIF2AK3 eukaryotic translation initiation initiation factor 2-alpha kinase 3 124 NM 024524 ATP13A3 ATPase type 13A3 125 NM 000891 KCNJ2 potassium inwardly-rectifying channel, subfamily J, member 2 SEQ ID Number Short name GenBank access gene name (update) of the 27/07/2010) 126 NM 018593 SLC16A10 solute carrier family 16, member 10 (aromatic amino acid transporter) 127 NM 014585 SLC40A1 solute carrier family 40 (iron-regulated transporter), member 1 128 NM 182767 SLC6A15 solute carrier family 6 ATPase, Ca ++ transporting, plasma membrane 1 130 NM 001040624 NCALD neurocalcin delta 131 NM 006996 SLC19A2 solute carrier family 19 (thiamine transporter), member 2 132 NM 001128431 SLC39A14 solute carrier family 39 (Zinc transporter), member 14 133 NM 001012661 SLC3A2 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 134 NM 181785 SLC46A3 solute carrier family 46, member 3 135 NM 001503 GPLD1 glycosylphosphatidylinositol specific phospholipase D1 136 NM 022041 GAN gigaxonin 137 NM 005909 MAP1 B microtubule-associated protein 1B 138 NM 012134 LMOD1 leiomodin 1 (smooth muscle) 139 NM 001010000 ARHGAP28 Rho GTPase activating protein 28 140 NM 004570 PIK3C2G phosphoinositide-3-kinase, class 2, gamma polypeptide 141 NM 053064 GNG2 guanine nucleotide binding protein (G protein), gamma 2 142 NM 000856 GUCY1A3 guanylate cyclase 1, soluble, alpha 3 143 NM 018945 PDE7B phosphodiesterase 7B 144 NM 001098512 PRKG1 protein kinase, cGMP-dependent, type I 145 NM 023940 RASL11B RAS-like, family 11, member B 146 NM 002923 RGS2 regulator of G-protein signaling 2, 24kDa 11 AK303463 USP41 ubiquitin specific peptidase 41 147 NM 014363 SACS spastic ataxia of Charlevoix -Saguenay (sacsin) 148 NM 001038633 RSPO1 R-spondin homolog (Xenopus laevis) 149 NM 005733 KIF20A kinesin family member 20A 150 NM 021724 NR1D1 nuclear receptor subfamily 1, group D, member 1 151 NM 138573 NRG4 neuregulin 4 152 NM 005103 FEZ1 fasciculation and elongation protein zeta 1 (zygin I) 153 NM 024769 ASAM adipocyte-specific adhesion molecule 154 NM 017671 FERMT1 fermitin family homolog 1 (Drosophila) 155 NM 024165 PHF1 PHD finger protein 1 156 NM 181533 ABHD12B abhydro lase domain containing 12B 157 NM 206966 C5orf46 chromosome 5 open reading frame 46 158 NM 183373 C6orf145 chromosome 6 open reading frame 145 159 NM 018325 C9orf72 chromosome 9 open reading frame 72 SEQ ID Number Short Name GenBank Access Gene Name (updated as of 27/07/2010) 160 NM 001215 CA6 carbonic anhydrase VI 161 NM 014157 CCDC113 coiled-coil domain containing 113 162 NM 024519 FAM65A family with sequence similarity 65, member A 163 NM 017938 FAM70A family with sequence similarity 70, member A 164 NM 173815 FLJ37464 hypothetical protein FLJ37464 165 NM 001490 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) 166 NM 015187 KIAA0746 KIAA0746 protein 167 NM 005779 LHFPL2 lipoma HMGIC fusion partner-like 2 168 BC107865 LOC204010 ribosomal protein SA pseudogene 169 NM 006152 LRMP lymphoid-restricted membrane protein 170 NM 024717 Multiple MCTP1 C2 domains, transmembrane 1 171 NM 014033 METTL7A methyltransferase-like 7A 172 BC06630 1 MGC87042 similar to six transmembrane epithelial antigen of prostate 173 NM 144599 NIPA1 not imprinted in Prader-Willi / Angelman syndrome 1 174 NM 001085382 PSAPL1 prosaposin-like 1 175 NM 031469 SH3BGRL2 SH3 domain binding glutamic acid-rich protein like 2 176 NM 020808 SIPA1L2 signal-induced proliferation-associated 1 like 2 177 NM 007000 UPK1A uroplakin 1A 178 NM 152495 CNIH3 gland homolog 3 (Drosophila) 179 NM 024007 EBF1 early B-cell factor 1 180 NM 020354 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7181 NM 017565 FAM20A family with sequence similarity 20, member A 182 NM 153711 FAM26E family with sequence similarity 26, member E 183 NM 153690 FAM43A family with sequence similarity 43, member A 184 NM 016323 HERC5 hect domain and RLD 5 185 NM 017912 HERC6 hect domain and RLD 6 186 NM 001550 IFRD1 interferon-related developmental regulator 1 187 NM 033397 ITPRIP inositol 1,4,5-triphosphate receptor interacting protein 188 NM 014851 KLHL21 kelch-like 21 (Drosophila) 189 AK093957 LOC728264 hypothetical protein LOC728264 190 AF176921 MST131 MSTP131 191 NM 198474 OLFML1 olfactomedin-like 1 192 NM 015886 PI15 peptidase inhibitor 15 193 NM 001003793 RBMS3 RNA binding motif, single stranded interacting protein 194 NM 005068 SIM1 single-minded homolog 1 (Drosophila) 195 NM 175839 SMOX spermine oxidase 196 NM 018266 TMEM39A transmembrane protein 39A 197 NM 198152 UTS2D urotensin 2 domain containing 198 NM 053276 VIT vitrin 199 NM 182491 ZFAND2A zinc finger, AN1-type domain 2A SEQ ID Number Short name GenBank access gene name ( update 27/07/2010) 200 NM 020747 ZNF608 zinc finger protein 608 b) compare the level of expression of said at least one gene measured in the skin sample that has been exposed to said radiation comprising long UVA in the presence of said candidate compound, with the level of expression of said at least one gene measured in a sample of said skin which has been exposed to radiation comprising long UVA in absence of said candidate compound; c) determining that said candidate compound is a photoprotective compound when: cl) a decrease in the level of expression of said at least one gene in the skin sample that has been exposed to said radiation comprising long UVA in the presence of said candidate compound is detected, relative to the level of expression of said at least one gene in the sample of said skin which has been exposed to radiation comprising long UVA in the absence of said candidate compound, when said at least one gene is selected from the group consisting of IL13RA2, STX11, TNFAIP6, ULBP1, SLC7A2, B3GNT2, CEACAM1, KYNU, CSF3, MAFG, MDGA1, STEAP1, MSC, TAGLN3, TRIB1, DEDD2, NR4A2, INHBA, DAB2, NEDD4L, PHLDA1, SEC24D, HSPB8, SLC7A11 genes , ARG2, DUSP10, NCF2, AGPAT9, CH25H, CYP4F11, CHKA, ERO1LB, TM4SF19, TMEM2, EIF2AK3, ATP13A3, SLC6A15, ATP2B1, SLC19A2, SLC39A14, SLC3A2, MAP1B, NR1D1, FEZ1, ASAM, FERMT1, PHF1, C6orf145, C9orf72 , FAM65A, KIAA0746, LHFPL2, LOC204010, MCTP1, MGC870 42, NIPA1, SIPA1L2, CNIH3, ENTPD7, IFRD1, ITPRIP, KLHL21, MST131, SMOX, TMEM39A and ZFAND2A; and / or c2) an increase in the level of expression of said at least one gene in the skin sample which has been exposed to said radiation comprising long UVA is detected in the presence of said candidate compound, relative to the level of expression of said minus one gene in the sample of said skin which has been exposed to radiation comprising long UVA in the absence of said candidate compound, when said at least one gene is selected from the group consisting of MX1, MX2, GBP2, GBP5, GBP6 genes , OAS1, OAS2, SAMD9, SAMD9L, IFIT3, IF144, IF144L, EPSTI1, SAMHD1, ILI F7, CLEC2A, CLEC2B, MLLT3, PSORS1C2, SERPINA3, CMKLR1, ENTPD1, HNMT, FETUB, RARRES1, TMPRSS11A, DLC1, LBH, RUNX1T1, SNAI1, OSR2, PBX1, SEMA4G, BNC2, MAML3, PRICKLE1, WISP1, IGF1, DIXDC1, FIBIN, GFRA1, GAS7, CDKN3, EGLN3, PARP9, CYP4B1, KRT15, KRT77, F1A3A1, FIGF, SERPINB12, ELOVL3, PXMP4, STS , ACSS3, CHRM2, PDK4, PPARGC1A, GATM, AMACR, FMO2, FMO5, SLC47A2, PLLP, DDX60, DDX6OL, HIST1H1A, KCNJ2, SLC16A 10, SLC40A1, NCALD, SLC46A3, GPLD1, GAN, LMOD1, ARHGAP28, PIK3C2G, GNG2, GUCY1A3, PDE7B, PRKG1, RASL11B, RGS2, USP41, SACS, RSPO1, KIF20A, NRG4, ABHD12B, C5orf46, CA6, CCDC113, FAM70A, FLJ37464, GCNT1, LRMP, METTL7A, PSAPL1, SH3BGRL2, UPK1A, EBF1, FAM20A, FAM26E, FAM43A, HERC5, HERC6, LOC728264, OLFML1, P115, RBMS3, SIM1, UTS2D, VIT and ZNF608. According to a second aspect, the invention relates to an in vitro method for determining the protection conferred by a photoprotective composition with respect to long UVA radiation, the method comprising the steps of: a) measuring the level of expression, in a sample of a skin that has been exposed to radiation comprising long UVAs in the presence of a photo-protective composition, of at least one gene selected from the group consisting of the genes listed in the table 1 above; b) comparing the level of expression of said at least one measured gene in the skin sample which has been exposed to radiation comprising long UVA in the presence of the photoprotective composition, with the level of expression of said at least one measured gene in a sample of said skin which has been exposed to radiation comprising long UVA in the absence of photoprotective composition; c) determining that said photoprotective composition confers protection against long UVA radiation when: cl) a decrease in the level of expression of said at least one gene in the skin sample which has been exposed to radiation comprising long UVA in the presence of said photoprotective composition is detected, relative to the level of expression of said at least one gene in the sample of said skin which has been exposed to radiation comprising long UVA in the absence of photo composition -protectrice, when said at least one gene is selected from the group consisting of IL13RA2, STX11, TNFAIP6, ULBP1, SLC7A2, B3GNT2, CEACAM1, KYNU, CSF3, MAFG, MDGA1, STEAP1, MSC, TAGLN3, TRIB1, DEDD2, NR4A2 genes , INHBA, DAB2, NEDD4L, PHLDA1, SEC24D, HSPB8, SLC7A11, ARG2, DUSP10, NCF2, AGPAT9, CH25H, CYP4F11, CHKA, ERO1LB, TM4SF19, TMEM2, EIF2AK3, ATP13A3, SLC6A15, ATP2B1, SLC19A2, SLC39A14, SLC3A2, MAP1B , NR1D1, FEZ1, ASAM, FERMT1, PHF1, C6orf145 , C9orf72, FAM65A, KIAA0746, LHFPL2, LOC204010, MCTP1, MGC87042, NIPA1, SIPA1L2, CNIH3, ENTPD7, IFRD1, ITPRIP, KLHL21, MST131, SMOX, TMEM39A and ZFAND2A; and / or c2) an increase in the level of expression of said at least one gene in the skin sample which has been exposed to radiation comprising long UVA in the presence of said photoprotective composition is detected, relative to the level of expressing said at least one gene in the sample of said skin that has been exposed to radiation comprising long UVAs in the absence of a photoprotective composition, when said at least one gene is selected from the group consisting of MX1, MX2, GBP2 genes , GBP5, GBP6, OAS1, OAS2, SAMD9, SAMD9L, IFIT3, IF144, IF144L, EPSTI1, SAMHD1, ILI F7, CLEC2A, CLEC2B, MLLT3, PSORS1C2, SERPINA3, CMKLR1, ENTPD1, HNMT, FETUB, RARRES1, TMPRSS11A, DLC1, LBH, RUNX1T1, SNA11, OSR2, PBX1, SEMA4G, BNC2, MAML3, PRICKLE1, WISP1, IGF1, DIXDC1, FIBIN, GFRA1, GAS7, CDKN3, EGLN3, PARP9, CYP4B1, KRT15, KRT77, F1-3A1, FIGF, SERPINB12, ELOVL3 , PXMP4, STS, ACSS3, CHRM2, PDK4, PPARGC1A, GATM, AMACR, FMO2, FMO5, SLC47A2, PLLP, DDX60, DDX6OL, HI ST1H1A, KCNJ2, SLC16A10, SLC40A1, NCALD, SLC46A3, GPLD1, GAN, LMOD1, ARHGAP28, PIK3C2G, GNG2, GUCY1A3, PDE7B, PRKG1, RASL11B, RGS2, USP41, SACS, RSPO1, KIF20A, NRG4, ABHD12B, C5orf46, CA6, CCDC113, FAM70A, FLJ37464, GCNT1, LRMP, METTL7A, PSAPL1, SH3BGRL2, UPK1A, EBF1, FAM20A, FAM26E, FAM43A, HERC5, HERC6, LOC728264, OLFML1, P115, RBMS3, SIM1, UTS2D, VIT and ZNF608.

According to a third aspect, the invention relates to an in vitro method for comparing the protective efficacy of at least two photoresponsive compositions with respect to long UVA radiation, the method comprising the steps of: a) measuring the level of expression, in a sample of a skin that has been exposed to radiation comprising long UVAs in the presence of a first photoprotective composition, of at least one gene selected from the group consisting of the genes listed in Table 1 above; b) measuring the level of expression in a sample of said skin that has been exposed to radiation comprising long UVA in the presence of a second photoprotective composition, said at least one gene selected from the group consisting of the genes mentioned in step a); c) identifying as a photoprotective composition having the best protection efficacy against long UVA radiation, the photo-protective composition in the presence of which is detected: cl) a decrease in the level of expression of said at least one gene in the skin sample that has been exposed to radiation comprising long UVAs, relative to the level of expression of said at least one gene in the sample of said skin that has been exposed to radiation comprising long UVAs in the presence of the other photoprotective composition, when said at least one gene is selected from the group consisting of IL13RA2, STX11, TNFAIP6, ULBP1, SLC7A2, B3GNT2, CEACAM1, KYNU, CSF3, MAFG, MDGA1, STEAP1, MSC genes. , TAGLN3, TRIB1, DEDD2, NR4A2, INHBA, DAB2, NEDD4L, PHLDA1, SEC24D, HSPB8, SLC7A11, ARG2, DUSP10, NCF2, AGPAT9, CH25H, CYP4F11, CHKA, ERO1LB, TM4SF19, TMEM2, EIF2AK3, ATP13A3, SLC6A15, ATP2B1 , SLC19A2, SLC39A14, SLC3A2, MAP1B, NR1D1, FEZ1, AS AM, FERMT1, PHF1, C6orf145, C9orf72, FAM65A, KIAA0746, LHFPL2, LOC204010, MCTP1, MGC87042, NIPA1, SIPA1L2, CNIH3, ENTPD7, IFRD1, ITPRIP, KLHL21, MST131, SMOX, TMEM39A and ZFAND2A; ; and / or c2) an increase in the level of expression of said at least one gene in the skin sample that has been exposed to radiation comprising long UVAs, relative to the level of expression of said at least one gene in the sample of said skin which has been exposed to radiation comprising long UVA in the presence of the other photoprotective composition, when said at least one gene is selected from the group consisting of MX1, MX2, GBP2, GBP5, GBP6, OAS1 genes, OAS2, SAMD9, SAMD9L, IFIT3, IF144, IF144L, EPSTI1, SAMHD1, IL1F7, CLEC2A, CLEC2B, MLLT3, PSORS1C2, SERPINA3, CMKLR1, ENTPD1, HNMT, FETUB, RARRES1, TMPRSS11A, DLC1, LBH, RUNX1T1, SNAI1, OSR2, PBX1, SEMA4G, BNC2, MAML3, PRICKLE1, WISP1, IGF1, DIXDC1, FIBIN, GFRA1, GAS7, CDKN3, EGLN3, PARP9, CYP4B1, KRT15, KRT77, F13A1, FIGF, SERPINB12, ELOVL3, PXMP4, STS, ACSS3, CHRM2, PDK4, PPARGC1A, GATM, AMACR, FMO2, FMO5, SLC47A2, PLLP, DDX60, DDX6OL, HIST1H1A, KCNJ2, SLC16A10, SLC40A1, NCALD, SLC46A3, GPLD1, GAN, LMOD1, ARHGAP28, PIK3C2G, GNG2, GUCY1A3, PDE7B, PRKG1, RASL11B, RGS2, USP41, SACS, RSPO1, KIF20A, NRG4, ABHD12B, C5orf46, CA6, CCDC113, FAM70A, FLJ37464, GCNT1, LRMP, METTL7A, PSAPL1, SH3BGRL2, UPK1A, EBF1, FAM20A, FAM26E, FAM43A, HERC5, HERC6, LOC728264, OLFML1, P115, RBMS3, SIM1, UTS2D, VIT and ZNF608.

The invention also relates to the use of a kit comprising: a) means for detecting, in a biological sample, the expression of at least one gene selected from the group consisting of the genes listed in Table 1, 3 or 4; and b) a solid support; for detecting the exposure of a skin to radiation comprising long UVAs. Biomarker Genes and Means for Detecting the Level of Expression of these Genes The inventors have identified 180 biomarkers of stress by long UVA (see Table 1 above and Table 2 of Example 3), and were two more specific subgroups consisting of 41 of these bio-marker genes (see Table 3 of Example 3) and 11 of these bio-marker genes (see Table 4 of Example 3).

The more specific subgroup of 41 bio-marker genes consists of the MX2, GBP2, OAS1, SAMD9L, IFIT3, IF144, IL1F7, IL13RA2, CLEC2A, HNMT, MAFG, RARRES1, SNAI1, WISP1, IGF1, GAS7, CDKN3 genes. INHBA, KRT15, DAB2, NEDD4L, F13A1, SLC7A11, ELOVL3, GATM, ERO1LB, FMO5, TM4SF19, DDX60, SLC16A10, SLC39A14, MAP1B, ARHGAP28, GNG2, RGS2, USP41, KIF20A, NR1D1, NRG4, HERC5 and SMOX. The 11 most preferred bio-marker genes are the MX2, GBP2, CLEC2A, MAFG, IGF1, INHBA, DAB2, SLC7A11, ELOVL3, TM4SF19, and USP41 genes. In the methods or kit according to the invention, the detection of the level of expression, or means of detection of the level of expression of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20 , 30, 40, 50 or more of these genes, and in particular the totality of each of these 11, 41 or 180 genes, can be implemented. In particular, in the methods or kit according to the invention, the detection of the level of expression, or means for detecting the level of expression of at least one gene, for example 1, 2, 3, 4 or 5, selected from the group consisting of CLEC2A, MX2, IGF1, TM4SF19 and SLC7A11 genes may be used. Exposure of the skin to long UVAs, or to radiation comprising long UVAs, modulates the expression of the genes MX1, MX2, GBP2, GBP6, SAMD9L, IFIT3, IF144, IF144L, ILI F7, IL13RA2, STX11, ULBP1, CLEC2A, CLEC2B, SLC7A2, B3GNT2, CEACAM1, KYNU, MLLT3, PSORS1C2, SERPINA3, FETUB, MDGA1, RARRES1, STEAP1, TMPRSS11A, MSC, OSR2, PBX1, SEMA4G, TAGLN3, CDKN3, TRIB1, EGLN3, INHBA, CYP4B1, KRT15, KRT77, DAB2, NEDD4L, PHLDA1, SEC24D, SERPINB12, SLC7A11, ARG2, DUSP10, NCF2, ELOVL3, AGPAT9, CH25H, CYP4F11, PXMP4, STS, GATM, ERO1LB, AMACR, FMO2, FMO5, SLC47A2, TM4SF19, PLLP, TMEM2, DDX60, HIST1H1A, ATP13A3, KCNJ2, SLC16A10, SLC40A1, SLC6A15, GPLD1, GAN, MAP1 B, ARHGAP28, PIK3C2G, USP41, SACS, RSPO1, KIF20A, NR1D1, NRG4, FEZ1, ASAM, FERMT1, PHF1, ABHD12B, C5orf46, C6orf145, C9orf72, CA6, CCDC113, FAM65A, FAM70A, FLJ37464, GCNT1, KIAA0746, LHFPL2, LOC204010, LRMP, MCTP1, METTL7A, MGC87042, NIPA1, PSAPL1, SH3BGRL2, SIPA1L2 and UPK1A in the epidermis of the skin. The skin sample is therefore preferably an epidermis sample when said at least one biomarker gene is one of these genes.

In particular, as the exposure of the skin to long UVA, or to radiation comprising long UVA, modulates the expression of INHBA, DAB2, SLC7A11, TM4SF19, MX2, GBP2, CLEC2A, ELOVL3 and USP41 genes in the epidermis of the skin, the skin sample may be an epidermis sample when said at least one biomarker gene is INHBA, DAB2, SLC7A11, TM4SF19, MX2, GBP2, CLEC2A, ELOVL3 or USP41. Exposure of the skin to long UVA, or to radiation comprising long UVA, modulates the expression of MX1, MX2, GBP2, GBP5, OAS1, OAS2, SAMD9, SAMD9L, IFIT3, EPSTI1, SAMHD1, TNFAIP6, CMKLR1 genes. , CSF3, ENTPD1, HNMT, MAFG, DLC1, LBH, RUNX1T1, SNAI1, BNC2, MAML3, PRICKLE1, WISP1, IGF1, DIXDC1, FIBIN, GFRA1, GAS7, DEDD2, NR4A2, PARP9, F13A1, FIGF, HSPB8, SLC7A11, ELOVL3 , ACSS3, CHKA, CHRM2, PDK4, PPARGC1A, DDX60, DDX6OL, EIF2AK3, ATP2B1, NCALD, SLC19A2, SLC39A14, SLC3A2, SLC46A3, LMOD1, GNG2, GUCY1A3, PDE7B, PRKG1, RASL11B, RGS2, USP41, RSPO1, CNIH3, EBF1 , ENTPD7, FAM20A, FAM26E, FAM43A, HERC5, HERC6, IFRD1, ITPRIP, KLHL21, LOC728264, MST131, OLFML1, P115, RBMS3, SIM1, SMOX, TMEM39A, UTS2D, VIT, ZFAND2A and ZNF608. In particular, as the exposure of the skin to long UVAs, or to radiation comprising long UVA, modulates the expression of the MAFG, SLC7A11, MX2, GBP2, IGF1, ELOVL3 and USP41 genes in the dermis of the skin. The skin sample may be a dermis sample when said at least one biomarker gene is MAFG, SLC7A11, MX2, GBP2, IGF1, ELOVL3 or USP41. The IL13RA2, STX11, TNFAIP6, ULBP1, SLC7A2, B3GNT2, CEACAM1, KYNU, CSF3, MAFG, MDGA1, STEAP1, MSC, TAGLN3, TRIB1, DEDD2, NR4A2, INHBA, DAB2, NEDD4L, PHLDA1, SEC24D, HSPB8, SLC7A11 genes, ARG2, DUSP10, NCF2, AGPAT9, CH25H, CYP4F11, CHKA, ERO1LB, TM4SF19, TMEM2, EIF2AK3, ATP13A3, SLC6A15, ATP2B1, SLC19A2, SLC39A14, SLC3A2, MAP1B, NR1D1, FEZ1, ASAM, FERMT1, PHF1, C6orf145, C9orf72, FAM65A, KIAA0746, LHFPL2, LOC204010, MCTP1, MGC87042, NIPA1, SIPA1L2, CNIH3, ENTPD7, IFRD1, ITPRIP, KLHL21, MST131, SMOX, TMEM39A and ZFAND2A are induced by long UVA radiation, or by radiation comprising long UVA. Their level of expression is thus increased in the skin exposed to long UVA compared with the skin not exposed to long UVA.

In particular, the MAFG, INHBA, DAB2, SLC7A11 and TM4SF19 genes are induced by long UVA radiation, or by radiation comprising long UVA. Their level of expression is thus increased in the skin exposed to long UVA compared with the skin not exposed to long UVA.

Genes MX1, MX2, GBP2, GBP5, GBP6, OAS1, OAS2, SAMD9, SAMD9L, IFIT3, IF144, IF144L, EPSTI1, SAMHD1, ILI F7, CLEC2A, CLEC2B, MLLT3, PSORS1C2, SERPINA3, CMKLR1, ENTPD1, HNMT, FETUB , RARRES1, TMPRSS11A, DLC1, LBH, RUNX1T1, SNAI1, OSR2, PBX1, SEMA4G, BNC2, MAML3, PRICKLE1, WISP1, IGF1, DIXDC1, FIBIN, GFRA1, GAS7, CDKN3, EGLN3, PARP9, CYP4B1, KRT15, KRT77, F13A1 , FIGF, SERPINB12, ELOVL3, PXMP4, STS, ACSS3, CHRM2, PDK4, PPARGC1A, GATM, AMACR, FMO2, FMO5, SLC47A2, PLLP, DDX60, DDX6OL, HIST1H1A, KCNJ2, SLC16A10, SLC40A1, NCALD, SLC46A3, GPLD1, GAN , LMOD1, ARHGAP28, PIK3C2G, GNG2, GUCY1A3, PDE7B, PRKG1, RASL11B, RGS2, USP41, SACS, RSPO1, KIF20A, NRG4, ABHD12B, C5orf46, CA6, CCDC113, FAM70A, FLJ37464, GCNT1, LRMP, METTL7A, PSAPL1, SH3BGRL2 , UPK1A, EBF1, FAM20A, FAM26E, FAM43A, HERC5, HERC6, LOC728264, OLFML1, P115, RBMS3, SIM1, UTS2D, VIT and ZNF608 are suppressed by long UVA radiation, or by radiation comprising long UVA. Their level of expression is therefore decreased in skin exposed to long UVA compared to skin not exposed to long UVA.

In particular, the genes MX2, GBP2, CLEC2A, IGF1, ELOVL3 and USP41 are repressed by long UVA radiation, or by radiation comprising long UVA. Their level of expression is therefore decreased in skin exposed to long UVA compared to skin not exposed to long UVA. The methods of the invention may comprise measuring the level of expression of at least one gene selected from the group consisting of MX2, GBP2, CLEC2A, MAFG, IGF1, INHBA, DAB2, SLC7A11, ELOVL3, TM4SF19, and USP41. and measuring the level of expression of one or more modulated (i.e. induced or repressed) additional genes specifically by long UVAs, and in particular at least one of genes other than MX2, GBP2, CLEC2A, MAFG, IGF1, INHBA, DAB2, SLC7A11, ELOVL3, TM4SF19, and USP41 which are identified in Tables 1 to 3. The methods according to the invention can comprise the measurement of the level of expression of at least one gene selected in the group consisting of CLEC2A, MX2, IGF1, TM4SF19 and SLC7A11, and measuring the level of expression of one or more additional genes modulated (i.e., induced or repressed) specifically by long UVAs, and in particular at least one of the genes other than CLEC2A, MX2, IGF1, TM4SF19 and SLC7A11 that are t identified in Tables 1 to 3.

The gene "MX2" refers to the gene "Homo sapiens myxovirus (influenza virus) resistance 2 (mouse)". A cDNA of this gene is available in the GenBank database under access number NM 002463 and is shown as SEQ ID NO: 1. The "GBP2" gene designates the "guanylate binding protein 2, interferon-inducible" gene. A cDNA of this gene is available in the GenBank database under access number NM 004120 and is shown as SEQ ID NO: 2. The "CLEC2A" gene refers to the "C-type lectin domain family 2, member A" gene. A cDNA of this gene is available in the GenBank database under accession number NM 001130711 and is shown as SEQ ID NO: 3.

The gene "MAFG" refers to the gene "v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian)". A cDNA of this gene is available in the GenBank database under access number NM 002359 and is shown as SEQ ID NO: 4. The gene "IGF1" refers to the gene "insulin-like growth factor 1". A cDNA of this gene is available in the GenBank database under access number NM 001111283 and is shown as SEQ ID NO: 5. The gene "INHBA" refers to the gene "inhibin, beta A". A cDNA of this gene is available in the GenBank database under access number NM 002192 and is shown as SEQ ID NO: 6.

The gene "DAB2" refers to the gene "disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)". A cDNA of this gene is available in the GenBank database under access number NM 001343 and is shown as SEQ ID NO: 7. The gene "SLC7A11" refers to the gene "solute carrier family 7, (cationic amino acid transporter, y + system) member 11". A cDNA of this gene is available in the GenBank database under access number NM 014331 and is shown as SEQ ID NO: 8. The gene "ELOVL3" refers to the gene "elongation of very long chain fatty acids (FEN1 / E102, SUR4 / E103, yeast) -like 3". A cDNA of this gene is available in the GenBank database under access number NM 152310 and is shown as SEQ ID NO: 9. The gene "TM4SF19" refers to the gene "transmembrane 4 L six family member 19". A cDNA of this gene is available in the GenBank database under accession number NM 138461 and is shown as SEQ ID NO: 10.

The gene "USP41" refers to the gene "ubiquitin specific peptidase 41". A cDNA of this gene is available in the GenBank database under accession number AK303463 and is shown as SEQ ID NO: 11. The sequences disclosed by reference to the GenBank database are those available as of July 27, 2010. The above cDNA sequences are given by way of non-limiting reference. In the context of the present application, the term "level of expression of a gene" is intended to mean the level of expression of the gene having for its coding sequence the specified reference cDNA, but also all of any variant or polymorphic form thereof. human gene and which could have a coding sequence differing from this cDNA by substitution, addition, deletion of one or more nucleotides. In particular variants or polymorphs of a given gene will have a coding sequence having at least 90%, preferably 95%, more preferably 97% sequence identity with the reference coding sequence of the gene in question. In particular, the variants or polymorphic forms of a gene have the same biological function as the gene having for its coding sequence the specified reference cDNA. In the context of the present invention, the percentage identity between two nucleotide sequences can be determined by global alignment of the two sequences using the Needleman-Wunsch algorithm, for example using the Needle program using the DNAfull matrix and the gap-open parameterization: 10 and gap-extend: 0.5. "Express" or "expression" means allowing or causing the information contained in a gene or DNA sequence to become manifest, for example by producing a protein by activating the cellular functions involved in the transcription and translation of the gene. genetic sequence or corresponding DNA. The level of expression of a gene can be measured: by detecting the level of mRNA of said gene by any appropriate method of molecular biology as described in particular in Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition ( 1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York ("Sambrook et al., 1989") or in DNA Cloning: A Practical Approach, Volumes I and II (DN Glover, 1985) FM Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994), or by detecting the level of the protein encoded by said gene by any suitable biochemical or immunological method.

For the detection of the level of mRNA of a biomarker gene, the skin sample can be processed to extract the cellular RNAs, and the mRNAs specific for the biomarker gene are then detected and quantified for example by semi-quantitative RT-PCR with labeling ethidium bromide amplified products and separation by electrophoresis, or by quantitative / real-time RT-PCR, using primers and optionally one or more probe (s) specific for the mRNA to be detected.

For the detection of the level of the protein encoded by said biomarker gene, the skin sample may be processed to extract the proteins and the proteins encoded by the gene may be detected for example by an immunoassay, in particular an ELISA or RIA, or by Western blotting, or any other suitable method known to those skilled in the art, using antibodies specific for the protein to be detected.

The primers, probes or antibodies constitute means for detecting the level of expression of at least one of the biomarker genes according to the invention. The primers are oligonucleotides for the amplification of a target sequence, in this case the biomarker gene mRNAs, by extension of the oligonucleotide after hybridization to the target sequence. The probes are oligonucleotides, generally labeled with a detectable label, for the detection of an amplified target sequence by hybridization to the target sequence. The primers and probes have the ability to hybridize to the target sequence under appropriate conditions of temperature and ionic strength (the "stringency conditions"). Conditions of high stringency correspond, for example, to the use of a formamide hybridization solution 50%, 5x or 6x SCC, where SCC is a solution of 0.15 M NaCl, 0.015 M Na-citrate, and can be used for primers or probes having the highest melting temperature (Tm). Preferably, the primers and probes have a sequence complementary to the target mRNA to be detected, even if, depending on the stringency conditions used, mismatches between bases are possible.

For the detection of the expression level of the genes CLEC2A, MX2, IGF1, TM4SF19 and SLC7A11, the sense and antisense primer pairs described in Table 5 below can for example be used. The term "antibodies" refers to conventional monoclonal or polyclonal antibodies, and fragments thereof, as well as single-domain antibodies and fragments thereof, in particular a single domain variable variable heavy chain. For the implementation of methods according to the invention, or in the kit according to the invention, one or more antibodies directed against the protein (s) encoded by the gene (s) biomarker (s) whose level of expression is to be quantified can be used. Probes or antibodies can advantageously be used in solid support bound form, preferably in a format compatible with high throughput analysis such as a microtiter chip or plate.

Exposure of the skin to long UVA In the methods according to the invention, the skin may be for example a skin cell culture, an epidermis culture, a reconstructed complete skin (Bell et al., Science, 1981, 211: 1052 -4, Bernerd and Asselineau, Cell Death Differ., 1998, 5: 792-802, Vioux-Changnoleau et al., J Dermatol Science Supplement, (2006) 2, S1-512, Auxenfans et al Eur J Dermatol (2009) 19. 107-13), an explant of human skin (Del Bino et al., Pigment Cell Research, 19: 606-614 (2006)), or the skin of a human being. The skin sample in which the level of expression of at least one biomarker gene is measured may be some or all of the skin cell culture, some or all of the epidermis culture, the dermis and / or the epidermis of a reconstructed complete skin, an explant of human skin, or the skin of a human being. In the method for identifying a photo-protective compound according to the invention, the level of expression of at least one biomarker gene in a skin sample that has been exposed to radiation comprising long UVA in the presence of a candidate compound, is compared with the level of expression of said at least one biomarker gene in a sample of the same skin or skin type (for example a reconstructed complete skin, if a reconstructed complete skin has been exposed to radiation comprising long UVA in the presence of the candidate compound, or a portion of the skin of a human other than that exposed to radiation comprising long UVA, if the skin in situ of a human being has been exposed to radiation comprising long UVA in the presence of the candidate compound) but which has been exposed to radiation comprising long UVA in the absence of the candidate compound.

In the method for determining the protection conferred by a photoprotective composition against long UVA radiation, the level of expression of at least one biomarker gene in a skin sample that has been exposed to a radiation comprising long UVA in the presence of the photoprotective composition, is compared with the level of expression of said at least one biomarker gene in another sample of the same skin or the same type of skin exposed to radiation comprising long UVAs but in the absence of a photoprotective composition (for example a reconstructed complete skin, if a reconstructed complete skin has been exposed to radiation comprising long UVAs in the presence of the photoprotective composition, or a part of the skin of a human being other than that which has been exposed to radiation comprising long UVAs in the presence of the photoprotective composition).

In the method for comparing the protective efficacy of at least two photoprotective compositions against long UVA radiation, the level of expression of at least one biomarker gene in a skin sample that has been exposed to radiation comprising long UVA in the presence of the photoprotective composition, is compared with the level of expression of said at least one biomarker gene in another sample of the same skin or skin type exposed to a radiation comprising long UVA in the presence of the second photoprotective composition. The photoprotective compositions or the photoprotective candidate compound may be applied topically when the skin is reconstructed complete skin, an explant of human skin, or the skin of a human being, or plated on a quartz plate which is then placed between the skin and the radiation source, or be incorporated in the culture medium when the skin is a skin cell culture or epidermis culture.

A photoprotective composition may contain one or more radiation blocking products, in particular UVs, UVA, short and / or long UVA, UVB, such as organic filters, mineral filters or particles. As examples of radiation blocking products, there may be mentioned organic filters: octocrylene, oxybenzone, Mexoryl SX, Mexoryl XL; avobenzone (parsol 1789), mineral filters: oxide of zinc, titanium dioxide. A photo-protective composition may alternatively or also contain one or more biological protection products, such as active ingredients, natural extracts, food supplements. It may be, for example, vitamin C, vitamin E, natural extracts or other antioxidants, but also activators of endogenous antioxidant protection pathway such as the Nrf2 pathway by an active ingredient or an extract such as broccoli. A "candidate compound" for the screening of photoprotective compounds can be any molecule or active, for example of organic, mineral or particulate nature.

By definition, long UVA refers to wavelength radiation from 340 to 400 nm. "Radiation comprising long UVA" therefore means radiation comprising radiation with wavelengths ranging from 340 to 400 nm. The radiation comprising long UVAs may be radiation consisting of, or essentially comprising, wavelength radiations of 320 nm to 450 nm (total UVA and a radiation portion in the visible range of 400 to 450 nm). This type of radiation can be obtained for example using a solar simulator equipped with a xenon lamp and a WG 335/3 mm filter delivering a spectrum between 320 and 450 nm. The radiation comprising long UVAs may be radiation consisting of, or essentially comprising, wavelength radiations of 340 nm to 450 nm (long UVA and a radiation portion in the visible range of 400 to 450 nm). This type of radiation can be obtained for example using a solar simulator equipped with a xenon lamp and a WG 360/2 mm filter suppressing wavelengths less than 340 nm.

By radiation comprising "substantially" specified wavelength radiation, it is meant that the spectral irradiance (expressed in mW.cm-2.nm-1 as a function of the wavelength in nm) between the wavelengths of Specified waves represent at least 80%, preferably at least 90%, of the total spectral irradiance. Preferably, the radiation comprising long UVA consists mainly of long UVA, that is to say that the spectral irradiance (expressed in mW.cm-2.nm-1 as a function of the wavelength in nm) for wavelengths of 340 to 400 nm represents at least 50%, preferably at least 60%, of the total spectral irradiance.

The invention will be described in more detail with reference to the following figures and examples. FIGURES FIG. 1: IGF1 mRNA level in reconstructed skin fibroblasts exposed or not exposed to 40 J / cm 2 of long UVA, protected or not by a solar formula.

Figure 2: CLEC2A mRNA level in reconstructed skin fibroblasts exposed or not exposed to 40 J / cm2 long UVA, protected or not by a solar formula. FIG. 3: SLC7A11 mRNA level in reconstructed skin keratinocytes exposed or not exposed to 40 J / cm 2 of long UVA, protected or not by a solar formula. FIG. 4: SLC7A11 mRNA level in the keratinocytes of reconstructed skin exposed or not exposed to 35 J / cm2 of total UVA, protected or not by a solar formula. FIG. 5: MX2 mRNA level in reconstructed skin fibroblasts exposed or not exposed to 35 J / cm 2 of total UVA, protected or not by a solar formula. FIG. 6: TM4SF19 mRNA level in keratinocytes of reconstructed skin exposed or not exposed to 35 J / cm 2 of total UVA, protected or not by a solar formula. (Figures 1 to 6: The mRNA levels are expressed in arbitrary units and the unexposed sample rate has been reduced to 1. The error bars represent the standard error to the mean.) Figure 7 : Long UVA emission spectrum used.

Figure 8: Total UVA emission spectrum used. Figure 9: Absorption spectrum of formulas A and B tested. EXAMPLES Example 1 List of 180 genes modulated by long UVA in fibroblasts and / or in reconstructed skin keratinocytes. The expression of all the human genes (full genome) was studied in the reconstructed skin, exposed or not exposed to 40 J / cm2 of long UVA (at the time 6 hours post exposure). 180 genes modulated by long UVA in fibroblasts and / or in reconstructed skin keratinocytes have been identified that have been classified into different functional families such as: - immunity / inflammation with in particular a high modulation of immunity markers innate, represented by strong repression of many genes of the interferon response. - "Development / Cell cycle / apoptosis / oncogene / tumor suppressor / cancer" family, - epidermal differentiation / proliferation / morphogenesis - dermal extracellular matrix (ECM) markers, scarring, mesenchymal transition and dialogue dermis / epidermis - stress and especially oxidative stress - markers of metabolism and in particular the metabolism of cholesterol and lipids - the oxidation-reduction / detoxification (mitochondria / xenobiotics) - transmembrane proteins, - the regulation of gene expression and chromatin remodeling - Transport ions / amino acids / iron - protein trafficking - cytoskeleton - intracellular signal - proteasome - vasoconstriction - migration - circadian rhythm - inter-cellular signaling - "miscellaneous" family including 49 genes that could not be classified in a particular functional family, lack of bibliography provided e or particular function well described. Table 2: The 180 genes modulated by 40 J / cm 2 long UVA in the fibroblasts and / or keratinocytes of the reconstructed skin. Modulation rate dermal epidermis Immunity / inflammation Innate immunity - response to interferon NM_002462 MX1 myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) -2.08 -2.51 NM 002463 MX2 myxovirus (influenza virus) resistance 2 (mouse) -2,53 -3,45 NM_004120 GBP2 guanylate binding protein 2, interferon-inducible -2,12 -2,01 NM_052942 GBP5 guanylate binding protein 5 -2,10 NM 198460 GBP6 guanylate binding protein family, member 6 -2.10 NM: 016816 OAS1 2 ', 5'-oligoadenylate synthetase 1, 40 / 46kDa -2.24 NM_002535 OAS2 2'-5'-oligoadenylate synthetase 2, 69 / 71kDa -2.14 NM_017654 SAMD9 sterile alpha motif domain containing 9 -2.17 NM 152703 SAMD9L sterile alpha motif domain containing 9-like -2.26 -2.95 NM: 001031683 IFIT3 interferon-induced protein with tetratricopeptide repeats 3 -2.31 -2.52 NM_006417 IF144 interferon- induced protein 44 -2,18 NM_006820 IF144L interferon-induced protein 44-like -2.37 NM_001002264 EPSTI1 epithelial stromal interaction 1 ast) -2.14 NM 015474 SAMHD1 SAM domain and HD domain 1 -2.03 Anti-inflammatory markers NM_014439 ILIF7 interleukin 1 family, member 7 (zeta) -3,27 Pro-inflammatory markers NM 000640 IL13RA2 interleukin 13 receptor, alpha 2 4.93 NM: 003764 STX11 syntaxin 11 3.00 NM_007115 TNFAIP6 tumor necrosis factor, alpha-induced protein 6 2.07 NM_025218 ULBP1 UL16 binding protein 1 3.08 Immunity / inflammation - other NM_001130711 CLEC2A C-type lectin domain family 2 , member A -4,18 NM_005127 CLEC2B C-type lectin domain family 2, member B -4.53 NM 003046 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y + system), member 2 2.92 NM_006577 B3GNT2 UDP-GIcNAc betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2.70 NM_001712 CEACAM1 carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) 3.82 NM 003937 KYNU kynureninase (L-kynurenine hydrolase) 2.02 NM: 004529 MLLT3 myeloid / lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); -2,12 translocated to, 3 27 Dermal epidermal modulation rate NM 014069 PSORSIC2 psoriasis susceptibility 1 candidate 2 -2.05 NM 001085 SERPINA3 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 -2.45 NM_004072 CMKLR1 chemokine-like receptor 1 -3.82 NM_172220 CSF3 colony stimulating factor 3 (granulocyte) 2.35 NM_001776 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 -2.48 NM 006895 HNMT histamine N-methyltransferase -2.08 Development / Cell cycle / / apoptoseloncogene / tumor suppressor / cancer Cancer / skin cancer / oncogene / tumor suppressor NM_002359 MAFG v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) 2.21 NM_014375 FETUB fetuin B -2.14 NM_153487 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 2.13 NM 206963 RARRES1 retinoic acid receptor responder (tazarotene induced) 1 -2.52 NM 012449 STEAPI six transmembrane epithelial antigen of the prostate 1 2.02 NM 182606 TMPRSS11A transmembrane protease, serine 11 A -2.02 NM_182643 DLC1 deleted in liver cancer 1 -2.06 NM 030915 LBH limb bud and heart development homolog (mouse) -2.94 N M: 175634 RUNX1T1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) -2.04 NM_005985 SNAI1 snail homolog 1 (Drosophila) -2.01 Development NM 005098 MSC musculin (activated B-cell factor-1) 2.54 NM 053001 OSR2 odd-skipped related 2 (Drosophila) -2.15 NM_002585 PBX1 pre-B-cell leukemia homeobox 1 -2.10 NM_017893 SEMA4G sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G -2, 13 NM 013259 TAGLN3 transgelin 3 2.35 NM_017637 BNC2 basonuclin 2 -2.06 NM_018717 MAML3 mastermind-like 3 (Drosophila) -2.02 NM_153026 PRICKLEI prickle homolog 1 (Drosophila) -2.32 NM_003882 WISP1 WNT1 inducible signaling pathway protein 1 -2,12 Cell cycle / proliferation NM 001111283 IGF1 insulin-like growth factor 1 (somatomedin C) -4.82 NM_001037954 DIXDCI DIX domain containing 1 -2.13 NM 203371 FIBIN end bud initiation factor homolog (zebrafish) -2.61 NM 005264 GFRA1 GDNF family receptor alpha 1 -2.34 NM 201433 GAS7 growth arrest-specific 7 -2.09 28 Epidermal modulation rate NMR 005192 CDKN3 cyclin-dependent kinase inhibitor 3 -2.04 NM_025195 TRIB1 tribble homolog 1 (Drosophila) 2.07 Apoptosis NM_022073 EGLN3 egline homolog 3 (C, elegans) -2.03 NM_133328 DEDD2 death effector domain containing 2 2, 03 NM 006186 NR4A2 nuclear receptor subfamily 4, group A, member 2 2.43 NM_ 031458 PARP9 poly (ADP-ribose) family polymerase, member 9 -2.28 Differentiation / proliferation / epidermal morphogenesis NM_002192 INHBA inhibin, beta A 2.63 NM_001099772 CYP4B1 cytochrome P450, family 4, subfamily B, polypeptide 1 -2.05 NM_002275 KRT15 keratin 15 -2.55 NM 175078 KRT77 keratin 77 -2.37 MEK / Wound repair / Epithelial-mesenchymal transition-cross talk dermal epidermis TGF pathway NM 001343 DAB2 disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) 2.57 NM: 015277 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like 2.12 Wound repair NM_000129 F13A1 coagulation factor XIII, A1 polypeptide -3.16 Growth factors NM_004469 FIGF c-fos induc ed growth factor (vascular endothelial growth factor D) -3,11 Other NM_007350 PHLDA1 pleckstrin homology-like domain, family A, member 1 2.15 NM_014822 SEC24D SEC24 family, member D (S, cerevisiae) 2.43 NM 080474 SERPINB12 serpin peptidase inhibitor, clade B (ovalbumin), member 12 -3,52 Stress / oxidative stress Stress NM_014365 HSPB8 heat shock 22kDa protein 8 2.19 Oxidative stress NM_014331 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y + system) member 11 2,49 7,63 NM_001172 ARG2 arginase, type II 2.00 NM 007207 DUSP10 dual specificity phosphatase 10 2.23 NM_000433 NCF2 neutrophil cytosolic factor 2 2.69 Various metabolism cholesterol and lipid metabolism NM_152310 ELOVL3 elongation of very long chain fatty acids FEN1 / E1o2, SUR4 / E1o3, yeast) -like 3 -2,17 -2,36 29 Dermal epidermal modulation rate NM 032717 AGPAT9 1-acylglycerol-3-phosphate 0-acyltransferase 9 2.06 NM 003956 CH25H cholesterol 25- hydroxylase 2.35 NM 021187 CYP4F11 cytochrome P450, family 4, subfam ily F, polypeptide 2.99 NM_007238 PXMP4 peroxisomal membrane protein 4, 24kDa -2.72 NM 000351 STS steroid sulfatase (microsomal), isozyme S -2.56 NM_024560 ACSS3 acyl-CoA synthase short-chain family member 3 -2, 15 NM 001277 CH KA choline kinase alpha 2.33 NM_001006630 CHRM2 cholinergic receptor, muscarinic 2 -2.24 NM_002612 PDK4 pyruvate dehydrogenase kinase, isozyme 4 -2.14 NM_013261 PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha -2.00 energy metabolism NM 001482 GATM glycine amidinotransferase (L-arginine: glycine amidinotransferase) -2.06 metabolism secreted proteins NM 019891 ERO1LB ERO1-like beta (S, cerevisiae) 2.05 Oxidoreduction / Detoxification (mitochondria / xenobiotics) NM_014324 AMACR alpha-methylacyl -CoA racemase -2.17 NM_001460 FMO2 flavin containing monooxygenase 2 (non-functional) -2.64 NM_001461 FMO5 flavin containing monooxygenase 5 -2.06 NM_152908 SLC47A2 solute carrier family 47, member 2 -3.26 Transme Protein NMN138461 TM4SF19 transmembrane 4 L six family member 19 5.36 NM_015993 PLLP plasma membrane proteolipid (plasmolipin) -2.06 NM_013390 TMEM2 transmembrane protein 2 2.00 Regulation of gene expression / chromatin remodeling NM 017631 DDX60 DEAD (Asp-Glu-Ala -Asp) box polypeptide 60 -2.07-2.23 NM 001012967 DDX6OL DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like -2.07 NM_005325 HIST1H1A histone cluster 1, H1a -2.00 NM_004836 EIF2AK3 eukaryotic translation initiation initiation factor 2-alpha kinase 3 2.26 Transport ions I amino acids I iron NM_024524 ATP13A3 ATPase type 13A3 2.08 NM_000891 KCNJ2 potassium inwardly-rectifying channel, subfamily J, member 2 -2.39 NM_018593 SLC16A10 solute carrier family 16, member 10 (aromatic amino acid transporter) -3.97 NM 014585 SLC40A1 solute carrier family 40 (iron-regulated transporter), member 1 -3.75 NM1182767 SLC6A15 solute carrier family 6 (neutral amino acid transporter), member 2.14 NM_001001323 ATP2B1 ATPase, Ca ++ transporting, plasma membrane ne 1 2,14 30 Modulation rate dermal epidermis NM 001040624 NCALD neurocalcin delta -2.02 NM 006996 SLC19A2 solute carrier family 19 (thiamine transporter), member 2 2.33 NM 001128431 SLC39A14 solute carrier family 39 (zinc transporter), member 14 2.13 NM_001012661 SLC3A2 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 2.11 NM_181785 SLC46A3 solute carrier family 46, member 3 -2.04 Traffic -protein NM_001503 GPLD1 glycosylphosphatidylinositol specific phospholipase D1 -2 , 26 Cytoskeleton NM_022041 GAN gigaxonin -2.02 NM_005909 MAP1B microtubule-associated protein 1B 2.06 NM_012134 LMOD1 leiomodin 1 (smooth muscle) -2.04 Intracellular signaling NM 001010000 ARHGAP28 Rho GTPase activating protein 28 -2.06 NM 004570 PIK3C2G phosphoinositide -3-kinase, class 2, gamma polypeptide -2.02 NM_053064 GNG2 guanine nucleotide binding protein (G protein), gamma 2 -2.54 NM_000856 GUCYIA3 guanylate cyclase 1, soluble, alpha 3 -2.22 NM_018945 PDE7B phospho diesterase 7B -2.43 NM_001098512 PRKG1 protein kinase, cGMP-dependent, type I -2.11 NM_023940 RASL11B RAS-like, family 11, member B -3.03 NM_002923 RGS2 regulator of G-protein signaling 2, 24kDa 2.00 Proteasome AK303463 USP41 ubiquitin specific peptidase 41 -2.40 -2.26 NM 014363 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 2.18 Vasoconstriction NM_001038633 RSPO1 R-spondin homolog (Xenopus laevis) -2.06 Migration NM_005733 KIF20A kinesin family member 20A -2,15 Cycadian rhythm NM_021724 NRID1 nuclear receptor subfamily 1, group D, member 1 2.53 Inter-cell signaling NM_138573 NRG4 neuregulin 4 -2.40 Miscellaneous NM_005103 FEZ1 fasciculation and elongation protein zeta 1 (zygin I) 2.17 NM_024769 ASAM adipocyte-specific adhesion molecule 2.36 NM_017671 FERMT1 fermitin family homolog 1 (Drosophila) 2.02 31 Dermal epidermal modulation rate NM 024165 PHF1 PHD finger protein 1 2.09 NM 181533 ABHD12B abhydrolase domain containing 12B -2.83 NM 206966 C5orf46 chromosome 5 open readi ng frame 46 -2.15 NM_183373 C6orf145 chromosome 6 open reading frame 145 2.05 NM_018325 C9orf72 chromosome 9 open reading frame 72 2.19 NM_001215 CA6 carbonic anhydrase VI -2.08 NM_014157 CCDC113 coiled-coil domain containing 113 -2.29 NM_024519 FAM65A family with sequence similarity 65, member A 2.07 NM_017938 FAM70A family with sequence similarity 70, member A -3.67 NM_173815 FLJ37464 hypothetical protein FLJ37464 -2.64 NM_001490 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 ( beta-1,6-N--2,02 acetylglucosaminyltransferase) NM 015187 KIAA0746 KIAA0746 protein 2.23 NM 005779 LHFPL2 lipoma HMGIC fusion partner-like 2 2.02 BCf 07865 LOC204010 ribosomal protein SA pseudogene 2.07 NM 006152 LRMP lymphoid- restricted membrane protein -2.35 NM: 024717 Multiple MCTP1 C2 domains, transmembrane 1 2.68 NM 014033 METTL7A methyltransferase like 7A -2.41 BC066301 MGC87042 similar to six epithelial transmembrane antigen of prostate 2.02 NM_144599 NIPA1 not imprinted in Prader- Willi / Angelman syn Drome 1 2,11 NM_001085382 PSAPL1 prosaposin-like 1 -2,18 NM_031469 SH3BGRL2 SH3 domain binding glutamic acid-rich protein like 2 -2.02 NM_020808 SIPA1L2 signal-induced proliferation-associated 1 like 2 2.06 NM 007000 UPK1A uroplakin 1A -2.09 NM 152495 CNIH3 gland homolog 3 (Drosophila) 2.01 NM_024007 EBF1 early B-cell factor 1 -2.27 NM_020354 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 2.09 NM_017565 FAM20A family with sequence similarity 20, member A -2, 33 NM_153711 FAM26E family with sequence similarity 26, member E -2,15 NM_153690 FAM43A family with sequence similarity 43, member A -2,03 NM_016323 HERC5 hect domain and RLD 5 -2,36 NM_017912 HERC6 hect domain and RLD 6 -2, 14 NM_001550 IFRD1 interferon-related developmental regulator 1 2.33 NM 033397 ITPRIP inositol 1,4,5-triphosphate receptor interacting protein 2.04 NM 014851 KLHL21 kelch-like 21 (Drosophila) 2.12 32 Dermal epidermal modulation rate AK093957 LOC728264 hypothetical protein LOC728264 -2.49 AF176921 M ST131 MSTP131 2.11 NM_198474 OLFML1 olfactomedin-like 1 -3.26 NM 015886 PI15 peptidase inhibitor 15 -2.31 NM_001003793 RBMS3 RNA binding motif, single stranded interacting protein -2.29 NM 005068 SIM1 single-minded homolog 1 (Drosophila) -3.29 NM: 175839 SMOX spermine oxidase 2.01 NM_018266 TMEM39A transmembrane protein 39A 2.07 NM 198152 UTS2D urotensin 2 domain containing -2.35 NM: 053276 VIT vitrin -2.03 NM_182491 ZFAND2A zinc finger, AN1-type domain 2A 2.70 NM_020747 ZNF608 zinc finger protein 608 -2.12 The first column indicates the accession number of the gene, columns 2 and 3 detail respectively the symbol and the name of the gene. Columns 4 and 5 indicate the level of modulation in keratinocytes and in fibroblasts respectively. Only significant modulation rates are given. The term significant modulation rate means a modulation level greater than 2 ("induction" in bold) or less than -2 ("repression" in normal characters) and having an adjPvalue less than 0.0001. For example MX1 is repressed by long UVAs significantly 2.08 times in keratinocytes and 2.51 times in fibroblasts, compared to unexposed control.

Example 2: A shortlist of 41 genes modulated by long UVA in fibroblasts and / or in reconstructed skin keratinocytes, representative of functional families impacted by long UVA.

From the list of 180 genes modulated by long UVA reconstructed skin (Table 2), we selected 41 genes representative of many functional families that we have discovered impacted by long UVA (Table 3). For the selection of 41 genes, we focused on taking into account: the relevance of this gene in skin biology originality of the marker. the modulation rate (a high absolute value of the modulation rate favors the choice of the gene), assuming that the more the gene is modulated and the more its activity will be impacted. In addition, the detection will be facilitated. the modulation of this gene in the two compartments of the reconstructed skin. If the gene is modulated in the two compartments of the reconstructed skin, its detection may be facilitated in vivo for example, or in simpler biological systems, fibroblasts or keratinocytes in monolayer culture may be used.

Table 3: Short list of 41 genes modulated by 40 J / cm 2 long UVA in reconstructed skin fibroblasts and / or keratinocytes, representative of functional families altered by long UVA. Modulation rate dermal epidermis Immunity / inflammation Innate immunity - response to interferon MX2 -2,53 -3,45 GBP2 -2,12 -2,01 OAS1 -2,24 SAMD9L -2,26 -2,95 IFIT3 - 2,31 -2,52 IF144 -2,18 IL1 F7 -3,27 anti-inflammatory markers Proinflammatory markers IL13RA2 4.93 Immunity / inflammation - others CLEC2A -4,18 HNMT -2,08 Development / Cell cycle / / apoptosis / oncogene / tumor suppressor / cancer Cancer / skin cancer / oncogene / tumor suppressor MAFG 2,21 RARRESI -2,52 SNAI1 -2,01 Development Modulation rate epidermis dermis WISP1 -2,12 Cell cycle / proliferation IGF1 -4 , 82 GAS7 -2.09 CDKN3 -2.04 Differentiation / proliferation / epidermal morphogenesis INHBA 2.63 KRT15 -2.55 MEC / Wound repair / Epithelial-mesenchymal transition-cross talk dermal epidermis TGF DAB2 2.57 NEDD4L 2, 12 Wound repair F13A1 -3,16 Stress / oxidative stress Oxidative stress SLC7A11 2,49 7,63 Various metabolism cholesterol and lipid metabolism ELOVL3 -2,17 -2,36 energy metabolism GATM -2 , 06 metabolism secreted proteins ERO1LB 2.05 Oxidoreduction / Detoxification (mitochondria / xenobiotics) FMO5 -2.06 Transmembrane Proteins TM4SF19 5.36 Regulation of gene expression / chromatin remodeling DDX60 -2.07 -2.23 Transport ions / amino acids / iron SLC16A10 -3.97 SLC39A14 2.13 Cytoskeleton MAP1 B 2.06 Intracellular signaling ARHGAP28 -2.06 GNG2 -2.54 RGS2 2.00 Proteasome USP41 -2.40 -2.26 Migration KI F20A -2.15 Rhythm cyrcadian NR1D1 2.53 Inter-cell signaling NRG4 -2.40 Miscellaneous HERC5 -2.36 SMOX 2.01 The levels of epidermal and dermal modulation indicate the level of modulation in keratinocytes and in fibroblasts, respectively. Only significant modulation rates are given. Significant modulation rate means a modulation rate greater than 2 ("induction" in bold) or less than -2 ("repression" in normal characters) and having an adjPvalue less than 0.0001. Example 3: Minimum list of 11 genes modulated by long UVA in fibroblasts and / or reconstructed skin keratinocytes. From the short list of 41 genes modulated by long UVA, a selection of 11 genes was made taking into account: the relevance of the genes in cutaneous biology the modulation rate (a high absolute value of the modulation rate favors the choice of gene), assuming that the more the gene is modulated and the more its activity will be impacted. In addition, the detection will be facilitated. the modulation of the gene in both compartments of the reconstructed skin. If the gene is modulated in the two compartments of the reconstructed skin, its detection may be facilitated in vivo for example, or in simpler biological systems, fibroblasts or keratinocytes in monolayer culture may be used. Table 4: "Heart" list of 11 genes modulated by 40 J / cm 2 long UVA in the fibroblasts and / or keratinocytes of the reconstructed skin, for the detection of a long UVA stress. Modulation rate epidermis dermis Immunity / inflammation Innate immunity - response to interferon NM 002463 MX2 myxovirus (influenza virus) resistance 2 (mouse) -2.53 -3.45 NM 004120 GBP2 guanylate binding protein 2, interferon-inducible -2 , 12 -2.01 Immunity / inflammation - other NM 001130711 CLEC2A C-type lectin domain family 2, member A -4,18 Development / Cell cycle / / apoptosis / oncogene / tumor suppressor / cancer Cancer / skin cancer / oncogene / tumor suppressor NM 002359 MAFG v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) 2,21 Cell cycle / proliferation NM 001111283 IGF1 insulin-like growth factor 1 (somatomedin C) -4,82 Differentiation / proliferation / epidermal morphogenesis NM 002192 INHBA inhibin, beta A 2.63 MEC / Wound repair / Epithelial-mesenchymal transition-cross talk dermal epidermis TGF NM 001343 pathway DAB2 disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) 2.57 Stress / oxidative stress Oxidative stress NM 014331 SLC7A11 solute carri family 7, (cationic amino acid transporter, y + system) member 11 2.49 7.63 Various metabolism cholesterol and lipid metabolism NM 152310 ELOVL3 elongation of very long chain fatty acids (FEN1 / E1o2, SUR4 / E1o3, yeast) -like 3 -2,17 -2,36 Transmembrane Proteins NM 138461 TM4SF19 transmembrane 4 L six family member 19 5,36 Proteasome AK303463 USP41 ubiquitin specific peptidase 41 -2,40 -2,26 The first column indicates the accession number of the gene columns 2 and 3 detail respectively the symbol and the name of the gene. Columns 4 and 5 indicate the level of modulation in keratinocytes and in fibroblasts respectively. Only significant modulation rates are given. By significant modulation rate is meant a modulation rate greater than 2 ("induction" in bold) or less than -2 ("repression" in normal characters) and having an adjPvalue less than 0.0001. EXAMPLE 4 Modulation of the IGF1 Gene and the CLEC2A Gene by Long UVAs in the Rebuilt Skin Fibroblasts and Protection by These Modulations by 2 Solar Formulas In order to test the protective efficacy of two solar formulas (A and B), the expression of the genes CLEC2A and IGF 1, from the "core" list of 11 genes (Table 3), was tested under long UVA ( Figure 1 and 2). Reconstructed skin was exposed to 40 J / cm 2 of long UVA in the presence or absence of the sun formula (formula A or formula B). Six hours after exposure, the total RNAs were extracted from the dermal fibroblasts and the IGF1 and CLEC2A mRNA levels were assayed under all experimental conditions by the Quantitative PCR method. FIG. 1 shows that in reconstructed skin fibroblasts not previously applied by a solar formula (control), the expression of the IGF1 gene is repressed by the long UVA (x 0.2 relative to the unexposed sample), in agreement with microarray data (Tables 1, 2 and 3). Formula A protects this modulation induced by long UVA since in the presence of formula A the modulation rate rises to 0.6, approaching the value 1 of the unexposed control. Formula B, which filters more long UVA than formula A (see material and methods), protects better from this modulation than formula A (x 1); the level of IGF1 mRNA in the presence of formula A is similar to the level of IGF1 mRNA of the unexposed sample. In the same way, for CLEC2A, FIG. 2 shows that in reconstructed skin fibroblasts not previously applied by a solar formula (control), the expression of the CLEC2A gene is repressed by the long UVA (x 0.5 compared with unexposed sample). Formula A tends to protect slightly from this long UVA modulation (x 0.6). Formula B, which filters more long UVA than formula A (see material and methods), protects better from this modulation than formula A (x 0.8). The level of CLEC2A mRNA in the presence of formula A is very close to the level of CLEC2A mRNA of the unexposed sample. The analysis of the gene modulation of CLEC2A and / or IGF1 in reconstructed skin makes it possible to highlight: - a long UVA stress - the protection of a solar formula against this stress - to classify solar formulas with one another according to their filtration efficiency in the "long UVA" wavelength domain.

EXAMPLE 5 Modulation of the SLC7A11 Gene by Long UVAs and Total UVAs in Reconstructed Skin Keratinocytes and Protection by These Modulations by 2 Solar Formulas In order to test the protective efficacy of two solar formulas (A and B), the expression of the SLC7A11 gene, from the "core" list of 11 genes (Table 3), was tested under long UVA (FIG. 3). . Reconstructed skin was exposed to 40 J / cm 2 of long UVA in the presence or absence of the sun formula (formula A or formula B). Six hours after exposure, the total RNAs were extracted from the epidermal keratinocytes and the mRNA levels of SLC7A11 were assayed under all experimental conditions by the Quantitative PCR method.

FIG. 3 shows that in reconstructed skin keratinocytes not previously applied by a solar formula (control), the expression of the SLC7A11 gene is strongly induced by long UVA (x 11.5 relative to the unexposed sample), in accordance with microarray data (Tables 1, 2 and 3). Formula A protects from this modulation induced by long UVA since in the presence of formula A the modulation rate is only 3, approaching the value 1 of the unexposed control. Formula B, which filters more long UVA than Formula A (see Material and Methods), protects better from this modulation than Formula A (x1.3); the level of SLC7A11 mRNA in the presence of formula A is similar to the level of SLC7A11 mRNA of the unexposed sample.

In order to be closer to an exposure encountered in nature, a total UVA spectrum (short UVA + long UVA) was used (see material and methods, figure 8). The protective efficacy of two solar formulas (A and B) was tested against this total UVA exposure by studying the expression of this same gene SLC7A11 (Figure 4). Reconstructed skin was exposed to 35 J / cm2. Total UVA in the presence or absence of a solar formula (formula A or formula B). Six hours after exposure, the total RNAs were extracted from the epidermal keratinocytes and the mRNA levels of SLC7A11 were assayed by Quantitative PCR. Total UVA, which includes all long UVA, induces the SLC7A11 gene (x4) in the reconstructed skin keratinocytes. The pre-application of formula A before UVA exposure makes it possible to reduce this induction (x 2). The use of Formula B, which better filters long UVA than Formula A, makes it possible to recover a normal SLC7A11 gene expression (x1, similar to unexposed control) (Figure 4). The analysis of the SLC7A11 gene modulation in reconstructed skin makes it possible to highlight: long UVA stress long UVA stress included in the total UVA the protection of a solar formula against these two types of stress to classify solar formulas between them according to their filtration efficiency in the "long UVA" wavelength range.

EXAMPLE 6 Modulation of MX2 gene by total UVA in reconstructed skin fibroblasts and protection by these modulations by 2 solar formulas In order to test the protective efficacy of two solar formulas (A and B), MX2 gene expression was tested under total UVA (Figure 5). Reconstructed skins were exposed to 35 J / cm 2 of total UVA in the presence or absence of the sun formula (formula A or formula B). Six hours after exposure, the total RNAs were extracted from the dermal fibroblasts and the MX2 mRNA levels were assayed by Quantitative PCR. Total UVA, which includes all long UVA, suppresses the MX2 gene (x0.1) in the fibroblasts of the reconstructed skin. The pre-application of formula A before UVA exposure makes it possible to reduce the rate of this suppression (x 0.3). The use of formula B, which better filters long UVA than formula A, further reduces this suppression rate (x 0.6), approaching value 1 of the unexposed control (Figure 4). the MX2 gene modulation in reconstructed skin makes it possible to highlight: a long UVA stress included in the total UVA the protection of a solar formula against this stress to classify solar formulas with each other according to their filtration efficiency in the wavelength domain "long UVA".

EXAMPLE 7 Modulation of the TM4SF19 gene by total UVA in reconstructed skin keratinocytes and protection by these modulations by 2 solar formulas. In order to test the protective efficacy of two solar formulas (A and B), the expression of the TM4SF19 gene was tested under total UVA (FIG. 6). Reconstructed skins were exposed to 35 J / cm 2 of total UVA in the presence or absence of the sun formula (formula A or formula B). Six hours after exposure, the total RNAs were extracted from the epidermal keratinocytes and the TM4SF19 mRNA levels were assayed by Quantitative PCR.

The TM4SF19 gene is highly induced in reconstructed skin keratinocytes exposed to total UVA (x12). This induction rate is greatly reduced by the use of the formula A (x 3). Formula B, which filters more long UVA than formula A, makes it possible to further reduce this induction (x 2) and to thus approach the unexposed control (x 1) (FIG. 6).

The analysis of the gene modulation of TM4SF19 in reconstructed skin makes it possible to highlight: a long UVA stress included in the total UVA the protection of a solar formula against this stress to classify solar formulas with each other according to their effectiveness filtration in the "long UVA" wavelength range. MATERIAL AND METHODS Reconstructed Skin In vitro reconstructed skin comprising a stratified and differentiated epidermis with horny layers and a living equivalent dermis are made with normal human keratinocytes and normal human dermis fibroblasts. Briefly, equivalent dermas are made with bovine collagen I and one million human dermis fibroblasts. Normal keratinocytes are seeded after contraction of lattices at 500 000 keratinocytes and cultured in conventional medium (MEM + 10% FCS + 2 mM L-Glutamine +1 mM Sodium Pyruvate + 1 X Non-essential amino acids + 0.2% Penicillin Streptomycin + 0.1`)% 0 antimycotic antibiotic + 10 ng / ml EGF + 10-10 M Cholera Toxin + 0.4 pg / ml Hydrocortisone) for 7 days. The culture is then mounted on a grid for the emergence phase (air-liquid interface, 7 days). At the end of this period, the skins have a morphology very close to normal human skin. They can then be used for different experiments by maintaining the culture medium under the skin that is nourished by capillarity.

A description of the preparation of reconstructed skins can also be found in the article Bernerd and Asselineau, Cell Death Differ. 1998, 5: 792-802 Long UVA Exposure Long UVAs are delivered with an Oriel Solar Simulator (1000 Watts xenon lamp) equipped with a WG 360 / 2mm filter to cut all wavelengths below 340 nm (Figure 7). To obtain the entire UVA spectrum up to 400 nm, it is not possible to overcome the wavelengths between 400 nm and 450 nm corresponding to visible light. In the examples, this wavelength emission spectrum between 340 and 440 nm is called "long UVA". The reconstructed skin is exposed to long UVA in the absence of culture medium and in the presence of PBS. After exposure, the skins are re-cultured while waiting for their collection (6h post-UVA long to study gene expression by microarray Affimetrix or quantitative PCR). Total UVA Exposure Total UVAs are delivered with an Oriel Solar Simulator (1000 Watts xenon lamp) equipped with a WG 335 / 3mm filter that delivers a spectrum between 320 and 450 nm (Figure 8). To obtain the entire UVA spectrum up to 400 nm, it is not possible to overcome the wavelengths between 400 nm and 450 corresponding to visible light. In the examples, this emission spectrum is named "Total UVA". The reconstructed skin is exposed to total UVA in the absence of culture medium and in the presence of PBS. After exposure, the skins are put back in culture while awaiting their collection (6h post UVA total for the study of gene expression by quantitative PCR). RNA extraction The equivalent dermis and reconstructed epidermis are separated using fine forceps. The epidermal keratinocytes and the dermal fibroblasts are then lysed separately and then the total tRNAs are extracted using the RNeasy kit midi Kit Qiagen.

Transcriptomic study by the method of Microarrav Affimetrix. A "Full Genome" transcriptomic study on a Human Gene 1.0 ST Affimetrix chip was performed to study the effect of reconstructed skin exposure at 40 J / cm2 of long UVA.

Hybridization on Human Gene 1.0 ST Affimetrix chips Three reconstructed skins served as unexposed control and 3 reconstructed skins were exposed to 40 J / cm2 of long UVA. Six hours after exposure, the equivalent dermis and reconstructed epidermis are separated from each reconstructed skin and the total RNAs are extracted separately from each sample. For each condition, the synthesis of the cRNAs was performed from 300 ng of total RNA. Human Gene 1.0 ST microarray hybridization was performed according to the "Whole transccript IVT kit" protocol. 5.5 μg of ssDNA were used for the fragmentation and labeling steps. A total of 12 chips were thus generated, with 3 chips hybridized with each of the 3 dermal control samples, 3 chips with each of the 3 dermal samples exposed to long UVA, 3 chips with each of 3 epidermal control samples, 3 chips with each of 3 epidermal samples exposed to long UVA. Standardization and Statistical Analysis for the Determination of Differentially Expressed Genes The data were standardized using the RMA (Robust Multichip Ave rag e) method. Gene expression was therefore compared in 3 control dermal samples versus 3 dermal samples exposed to long UVA, and in 3 epidermal control versus 3 epidermal samples exposed to long UVA. The "ebayes" method was used to determine the differentially expressed genes between two conditions (Smyth, Stat Appl Gen Gen Mol Biol 3: Article 3, 2004). In order to correct the error associated with the multiple tests, a correction of the p value was performed by the FDR method, generating an adjusted pValue (adj P. Val). A gene was considered differentially expressed between 2 conditions if the modulation rate between the control value and the long UVA value was greater than 2 or less than 0.5 and the adjusted pValue was less than 0.001. Solar formulas Two formulas (A and B) were tested. Their compositions are given in Table 5.

Table 5: Constituents and characteristics of the formulas Formula% in vitro SPF filter in vitro PPD Formula A 1.5% Parsol 1789 12.9 ± 4.0 8.5 ± 2.2 = reference formula 5% Octocrylene 1% Tinosorb S 0.3% MP Mexoryl SX 10% Eldew Formula B = UVA 0.7% Parsol 1789 5.5% Octocrylene 1.1% Mexoryl XL 0.3% Uvinul A + 3% MP Mexoryl SX 0.4% R0068717A 1% R0069475A 10% Eldew 13.6 ± 1.4 Formula shifted 13.8 ± 1.5 long Absorption profiles of the formulas tested (FIG. The absorption spectra of the two filtering formulas clearly show the net absorption gain in long UVA for formula B (blue curve) compared to the reference formula (in red) (Figure 9). Formula A absorbs UVB, short UVA and a portion of long UVA (up to about 370 nm). Formula B absorbs the same wavelengths as Formula A, plus about 30 nm in long UVAs (up to about 400 nm) (Figure 9). Application of the solar formula on reconstructed skin 2 mg / cm2 of product are spread on the surface of the epidermis of the reconstructed skin, using a glass rake.

Assay of mRNA level in keratinocytes and fibroblasts of reconstructed skin by the quantitative PCR method Quantification of mRNAs by quantitative PCR A reverse transcription of 1 μg of total RNA is carried out (Advantge RT for PCR kit, Clontech). The expression of 5 genes is studied in each cell type by real-time quantitative PCR on LigtCycler 480 (Roche), from the retro-transcribed cDNAs. The results are normalized by mRNA levels of 5 reference genes (GAPDH, b2m, RPS9, RPL13A and RPS28), using the Genorm software (Savli H et al J Med Microbiol 52: 403-408 (2003); Vandesompele et al., Genome Biol 3: research0034.1-0034.11 (2002)). The gene names and the sequences of the primers used are given in Table 6.

Table 6: Markers and primers used for gene expression. Gene name Sense primer (3'-5 ') Anti-sense primer (5'-3') Genes of interest CLEC2A GGACTGGCTTGGAGTGAGAG (SEQ ID NO: 12) TTGAATGTGGTGCCATTTGT (SEQ ID NO: 13) MX2 AAGCAGTATCGAGGCAAGGA (SEQ ID NO : 14) TCGTGCTCTGAACAGTTTGG SEQ ID NO: 15) IGF1 TGGATGCTCTTCAGTTCGTG (SEQ ID NO: 16) CCTGCACTCCCTCTACTTGC (SEQ ID NO: 17) TM4SF19 CAGCCTTTCTCCAGGTTCTG (SEQ ID NO: 18) CCCCTCAACAGGTAGGTGAC (SEQ ID NO: 19) SLC7A11 TTTGCACCCTTTGACAATGA (SEQ ID NO : 20) GGGTCCGAATAGAGGGAAAG (SEQ ID NO: 21) Genes used for data normalization GAPDH GGCTCTCCAGAACATCATCCCT GC (SEQ ID NO: 22) GGGTGTCGCTGTTGAAGTCAGAGG (SEQ ID NO: 23) RPS9 GATGAGAAGGACCCACGGCGT CTGTTCG (SEQ ID NO: 24) GAGACAATCCAGCAGCCCAGGAG GGAC (SEQ ID NO: 23) ID NO: 25) B2M TTTCATCCATCCGACATTGA (SEQ ID NO: 26) CCTCCATGATGCTGCTTAAC (SEQ ID NO: 27) RPL13A TAAACAGGTACTGCTGGGCCGG AAGGTG (SEQ ID NO: 28) CACGTTCTTCTCGGCCTGTTTCCGT AGC (SEQ ID NO: 29) RPS28 CCGTGTGCAGCCTATCAAG (SEQ ID NO: 30) CAAGCTCAGCGCAACCTC (SEQ ID NO: 31) Calculation of the average rate of gene modulation For ch For each gene studied and for each condition, the average modulation rate is calculated as follows: mean gene mRNA level in the exposed samples divided by gene mRNA level in the control samples.

Claims (1)

CLAIMS1.- An in vitro method for identifying a photo-protective compound, the method comprising the steps of: a) measuring the level of expression, in a sample of a skin that has been exposed to radiation comprising UVA long in the presence of a candidate compound, of at least one gene selected from the group consisting of the genes: SEQ ID No. Short name Name of GenBank access gene (updated on 27/07/2010) 32 NM 002462 MX1 myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) 1 NM 002463 MX2 myxovirus (influenza virus) resistance 2 (mouse) 2 NM 004120 GBP2 guanylate binding protein 2, interferon-inducible 33 NM 052942 GBP5 guanylate binding protein 5 34 NM 198460 GBP6 guanylate binding protein family, member 6 35 NM 016816 OAS1 2 ', 5'-oligoadenylate synthetase 1, 40 / 46kDa 36 NM 002535 OAS2 2'-5'-oligoadenylate synthetase 2, 69 / 71kDa 37 NM 017654 SAMD9 sterile alpha pattern containing domain 9 38 NM 152703 SAMD9L sterile alpha motif domain containing 9-like 39 NM 001031683 IFIT3 interferon-induced protein with tetratricopeptide repeats 3 40 NM 006417 IF144 interferon-induced protein 44 41 NM 006820 IF144L interferon-induced protein 44-like 42 NM 001002264 EPSTI1 epithelial stromal interaction 1 (breast ) 43 NM 015474 SAMHD1 SAM domain and HD domain 1 44 NM 014439 ILI F7 interleukin 1 family, member 7 (zeta) 45 NM 000640 IL13RA2 interleukin 13 receptor, alpha 2 46 NM 003764 STX11 syntaxin 11 47 NM 007115 TNFAIP6 tumor necrosis factor, alpha -induced protein 6 48 NM 025218 ULBP1 UL16 binding protein 1 3 NM 001130711 CLEC2A C-type lectin domain family 2, member A 49 NM 005127 CLEC2B C-type lectin domain family 2, member B 50 NM 003046 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y + system), member 2 51 NM 006577 B3GNT2 UDP-GIcNAc: betaGal beta-1,3-N-acetylglucosaminyltransferase 2 52 NM 001712 CEACAM1 carcinoembryonic antigen-related celI adhesion molecule 1 (biliary glycoprotein 53 NM 003937 KYNU kynureninase (L-kynurenine hydrolase) 54 NM 004529 MLLT3 myeloid / lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); PSORS1C2 psoriasis susceptibility 1 candidate 2 56 NM 001085 SERPINA3 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 57 NM 004072 CMKLRI Chemokine-like receptor 1 58 NM 172220 CSF3 Colony stimulating factor 3 (granulocyte) 59 NM _001776 ENTPDI Ectonucleoside triphosphate diphosphohydrolase 1 60 NM_006895 HNMT histamine N-methyltransferase 4 NM 002359 MAFG v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) 61 NM 014375 FETUB fetuin B 62 NM 153487 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 63 NM 206963 RARRESI retinoic acid receptor responder (tazarotene induced) 1 64 NM 012449 STEAPI six transmembrane epithelial antigen of the prostate 1 65 NM 182606 TMPRSSI1A transmembrane protease, serine 11A 66 NM 182643 DLC1 deleted in liver cancer 1 67 NM 030915 LBH Iimb bud and heart development homolog (mouse) 68 NM 175634 RUNXITI runt-related transcription factor 1; (NMR) SNAI1 snail homolog 1 (Drosophila) 70 NM 005098 MSC musculin (activated B-cell factor-1) 71 NM 053001 OSR2 odd-skipped related 2 (Drosophila) 72 NM 002585 PBX1 pre-B-cell leukemia homeobox 1 73 NM 017893 SEMA4G sema domain, immunoglobulin domain (Ig), domain transmembrane (TM) and short cytoplasmic domain, (semaphorin) 4G 74 NM 013259 TAGLN3 transgelin 3 75 NM 017637 BNC2 basonuclin 2 76 NM 018717 MAML3 mastermind-like 3 (Drosophila) 77 NM 153026 PRICKLEI prickle homolog 1 (Drosophila) 78 NM 003882 WISP1 WNT1 inducible signaling pathway protein 1 NM 001111283 IGF1 insulin-like growth factor 1 (somatomedin C) 79 NM 001037954 DIXDCI DIX domain containing 1 80 NM 203371 FIBIN end bud initiation factor homolog (zebrafish) 81 NM 005264 GFRA1 GDNF family receptor alpha 1 82 NM 201433 GAS7 growth arrest-specific 7 83 NM 005192 CDKN3 cyclin-dependent kinase inhibitor 3 84 NM 025195 TRIB1 tribible homolog 1 (Drosophila) 85 NM 022073 EGLN3 egl n homolog 3 (C, elegans) 86 NM 133328 DEDD2 death effector domain containing 2 87 NM 006186 NR4A2 nuclear receptor subfamily 4, group A, member 2 88 NM 031458 PARP9 poly (ADP-ribose) family polymerase, member 9 6 NM 002192 INHBA inhibin, beta A 89 NM001099772 CYP4B1 cytochrome P450, family 4, subfamily B, polypeptide 1 90 NM 002275 KRTI 5 keratin 15 91 NM 175078 KRT77 keratin 77 7 NM 001343 DAB2 disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) 92 NM 015277 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like 93 NM 000129 F1 3A1 coagulation factor XIII, A1 polypeptide 94 NM 004469 FIGF c-fos induced growth factor (vascular endothelial growth factor D) 95 NM 007350 PHLDA1 pleckstrin homology-like domain , family A, member 1 96 NM 014822 SEC24D SEC24 family, member D (S, cerevisiae) 97 NM 080474 SERPINB12 serpin peptidase inhibitor, clade B (ovalbumin), member 12 98 NM 014365 HSPB8 heat shock 22kDa protein 8 8 NM 014331 SLC7A11 solute carrier fa mily 7, (cationic amino acid transporter, y + system) member 11 99 NM 001172 ARG2 arginase, type 11 100 NM 007207 DUSP10 dual specificity phosphatase 101 NM 000433 NCF2 neutrophil cytosolic factor 29 NM 152310 ELOVL3 elongation of very long chain fatty acids ( FEN1 / E1o2, SUR4 / E1o3, yeast) -like 3 102 NM 032717 AGPAT9 1-acylglycerol-3-phosphate 0-acyltransferase 9 103 NM 003956 CH25H cholesterol 25-hydroxylase 104 NM 021187 CYP4F11 cytochrome P450, family 4, subfamily F, polypeptide 11 105 NM 007238 PXMP4 peroxisomal membrane protein 4, 24kDa 106 NM 000351 STS steroid sulfatase (microsomal), isozyme S 107 NM 024560 ACSS3 acyl-CoA synthase short-chain family member 3 108 NM 001277 CHKA choline kinase alpha 109 NM 001006630 CHRM2 cholinergic receptor , muscarinic 2 110 NM 002612 PDK4 pyruvate dehydrogenase kinase, isozyme 4 111 NM 013261 PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha 112 NM 001482 GATM glycine amidinotransferase (L-arginine: glycine amidi notransferase) 113 NM 019891 ERO1LB ER01-like beta (S, cerevisiae) 114 NM 014324 AMACR alpha-methylacyl-CoA racemase 115 NM 001460 FMO2 flavin containing monooxygenase 2 (non-functional) 116 NM 001461 FMO5 flavin containing monooxygenase 5 117 NM 152908 SLC47A2 solute carrier family 47, member 2 10 NM 138461 TM4SF19 transmembrane 4 L six family member 19 118 NM 015993 PLLP plasma membrane proteolipid (plasmolipin) 119 NM 013390 TMEM2 transmembrane protein 2 120 NM 017631 DDX60 DEAD (Asp-Glu-Ala-Asp) box polypeptide 60 121 NM 001012967 DDX6OL DEAD (Asp-Glu-Ala-Asp) box polypeptide 60- like 122 NM 005325 HIST1H1A histone cluster 1, Hia 123 NM 004836 ElF2AK3 eukaryotic translation initiation factor 2-alpha kinase 3 124 NM 024524 ATP13A3 ATPase 13A3 125 NM 000891 KCNJ2 potassium inwardly-rectifying channel, subfamily J, member 2 126 NM 018593 SLC16A10 solute carrier family 16, member 10 (aromatic amino acid transporter) 127 NM 014585 SLC40A1 solute carrier family 40 (iron-regulated transporter), member 1 128 NM 182767 SLC6A15 solute carrier family 6 (neutral amino acid transporter), member 15 129 NM 001001323 ATP2B1 ATPase, Ca ++ transporting, plasma membrane 1,130 NM 001040624 NCALD neurocalcin delta 131 NM 006996 SLC19A2 solute carrier family 19 (thiamine transporter), member 2 132 NM 001128431 SLC39A14 solute carrier family 39 (zinc transporter), member 14 133 NM 001012661 SLC3A2 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 134 NM 181785 SLC46A3 solute carrier family 46, member 3 135 NM 001503 GPLD1 glycosylphosphatidylinositol specific phospholipase D1 136 NM 022041 GAN gigaxonin 137 NM 005909 MAP1 B microtubule-associated prot ein 1B 138 NM 012134 LMOD1 leiomodin 1 (smooth muscle) 139 NM 001010000 ARHGAP28 Rho GTPase activating protein 28 140 NM 004570 PIK3C2G phosphoinositide-3-kinase, class 2, gamma polypeptide 141 NM 053064 GNG2 guanine nucleotide binding protein (G protein), gamma 2 142 NM 000856 GUCY1A3 guanylate cyclase 1, soluble, alpha 3 143 NM 018945 PDE7B phosphodiesterase 7B 144 NM 001098512 PRKG1 protein kinase, cGMP-dependent, type I 145 NM 023940 RASL11B RAS-like, family 11, member B 146 NM 002923 RGS2 regulator of G-protein signaling 2, 24kDa 11 AK303463 USP41 ubiquitin specific peptidase 41 147 NM 014363 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 148 NM 001038633 RSPO1 R-spondin homolog (Xenopus laevis) 149 NM 005733 KIF20A kinesin family member 20A 150 NM 021724 NR1D1 nuclear receptor subfamily 1, group D, member 1 151 NM 138573 NRG4 neuregulin 4 152 NM 005103 FEZ1 fasciculation and elongation protein zeta 1 (zygin I) 153 NM 024769 ASAM adipocyte-specific adhesion molecule 154 NM 01 7671 FERMT1 fermitin family homolog 1 (Drosophila) 155 NM 024165 PHF1 PHD finger protein 1 156 NM 181533 ABHD12B abhydrolase domain containing 12B 157 NM 206966 C5orf46 chromosome 5 open reading frame 46 158 NM 183373 C6orf145 chromosome 6 open reading frame 145 159 NM 018325 C9orf72 chromosome 9 open reading frame 72 160 NM 001215 CA6 carbonic anhydrase VI 161 NM 014157 CCDC113 coiled-coil domain containing 113 162 NM 024519 FAM65A family with sequence similarity 65, member A 163 NM 017938 FAM70A family with sequence similarity 70, member A 164 NM 173815 FLJ37464 hypothetical protein FLJ37464 165 NM 001490 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) 166 NM 015187 KIAA0746 KIAA0746 protein 167 NM 005779 LHFPL2 lipoma HMGIC fusion partner-like 2 168 BC107865 LOC204010 ribosomal protein SA pseudogene 169 NM 006152 LRMP lymphoid-restricted membrane protein 170 NM 024717 Multiple MCTP1 C2 domains, transmembrane 1 171 NM 014033 METTL7A meth yltransferase like 7A 172 BC066301 MGC87042 similar to Six epithelial transmembrane antigen of prostate 173 NM 144599 NIPA1 not imprinted in Prader-Willi / Angelman syndrome 1 174 NM 001085382 PSAPL1 prosaposin-like 1 175 NM 031469 SH3BGRL2 SH3 binding domain glutamic acid-rich protein like 2 176 NM 020808 SIPA1L2 signal-induced proliferation-associated 1 like 2 177 NM 007000 UPK1A uroplakin 1A 178 NM 152495 CNIH3 gland homolog 3 (Drosophila) 179 NM 024007 EBF1 early B-cell factor 1 180 NM 020354 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 181 NM 017565 FAM20A family with sequence similarity 20, member A 182 NM 153711 FAM26E family with sequence similarity 26, member E 183 NM 153690 FAM43A family with sequence similarity 43, member A 184 NM 016323 HERC5 hect domain and RLD 5 185 NM 017912 HERC6 hect domain and RLD 6 186 NM 001550 IFRD1 interferon-related developmental regulator 1 187 NM 033397 ITPRIP inositol 1,4,5-triphosphate receptor interacting protein 188 NM 014851 K LHL21 kelch-like 21 (Drosophila) 189 AK093957 LOC728264 hypothetical protein LOC728264 190 AF176921 MST131 MSTP131 191 NM 198474 OLFML1 olfactomedin-like 1 192 NM 015886 PI15 peptidase inhibitor 15 193 NM 001003793 RBMS3 RNA binding motif, single stranded interacting protein 194 NM 005068 SIM1 single -minded homolog 1 (Drosophila) 195 NM 175839 SMOX spermine oxidase 196 NM 018266 TMEM39A transmembrane protein 39A 197 NM 198152 UTS2D urotensin 2 domain containing 198 NM 053276 Vit vitrin 199 NM 182491 ZFAND2A zinc finger, AN1-type domain 2A 200 NM 020747 ZNF608 zinc finger protein 608 b) comparing the level of expression of said at least one measured gene in the skin sample that has been exposed to said radiation comprising long UVA in the presence of said candidate compound, with the level of expression of said at least one gene measured in a sample of said skin that has been exposed to radiation comprising long UVA in the absence of said candidate compound; c) determining that the said candidate compound is a photoprotective compound when: cl) a decrease in the level of expression of said at least one gene in the skin sample which has been exposed to said radiation comprising long UVA in the presence of said candidate compound is detected, by ratio to the level of expression of said at least one gene in the sample of said skin which has been exposed to radiation comprising long UVA in the absence of said candidate compound, when said at least one gene is selected from the group consisting of IL13RA2 genes , STX11, TNFAIP6, ULBP1, SLC7A2, B3GNT2, CEACAM1, KYNU, CSF3, MAFG, MDGA1, STEAP1, MSC, TAGLN3, TRIB1, DEDD2, NR4A2, INHBA, DAB2, NEDD4L, PHLDA1, SEC24D, HSPB8, SLC7A11, ARG2, DUSP10 , NCF2, AGPAT9, CH25H, CYP4F11, CHKA, ERO1LB, TM4SF19, TMEM2, EIF2AK3, ATP13A3, SLC6A15, ATP2B1, SLC19A2, SLC39A14, SLC3A2, MAP1B, NR1D1, FEZ1, ASAM, FERMT1, PHF1, C6orf145, C9orf72, FAM65A, KIAA0746 , LHFPL2, LOC204010, MCTP1, MGC87042, NIPA1, SIPA1L2, C NIH3, ENTPD7, IFRD1, ITPRIP, KLHL21, MST131, SMOX, TMEM39A and ZFAND2A; and / or c2) an increase in the level of expression of said at least one gene in the skin sample which has been exposed to said radiation comprising long UVA in the presence of said candidate compound is detected, relative to the level of expression of said at least one gene in the sample of said skin which has been exposed to radiation comprising long UVA in the absence of said candidate compound, when said at least one gene is selected from the group consisting of the genes MX1, MX2, GBP2, GBP5, GBP6, OAS1, OAS2, SAMD9, SAMD9L, IFIT3, IF144, IF144L, EPSTI1, SAMHD1, ILI F7, CLEC2A, CLEC2B, MLLT3, PSORS1C2, SERPINA3, CMKLR1, ENTPD1, HNMT, FETUB, RARRES1, TMPRSS11A, DLC1, LBH, RUNX1T1, SNAI1 , OSR2, PBX1, SEMA4G, BNC2, MAML3, PRICKLE1, WISP1, IGF1, DIXDC1, FIBIN, GFRA1, GAS7, CDKN3, EGLN3, PARP9, CYP4B1, KRT15, KRT77, F1A3A1, FIGF, SERPINB12, ELOVL3, PXMP4, STS, ACSS3, CHRM2, PDK4, PPARGC1A, GATM, AMACR, FMO2, FMO5, SLC47A2, PLLP, DDX60, DDX6OL, HIST1H1A, KCNJ2, SLC16A1 0, SLC40A1, NCALD, SLC46A3, GPLD1, GAN, LMOD1, ARHGAP28, PIK3C2G, GNG2, GUCY1A3, PDE7B, PRKG1, RASL11B, RGS2, USP41, SACS, RSPO1, KIF20A, NRG4, ABHD12B, C5orf46, CA6, CCDC113, FAM70A, FLJ37464, GCNT1, LRMP, METTL7A, PSAPL1, SH3BGRL2, UPK1A, EBF1, FAM20A, FAM26E, FAM43A, HERC5, HERC6, LOC728264, OLFML1, P115, RBMS3, SIM1, UTS2D, VIT and ZNF608.2. In vitro method of determination of the protection conferred by a photoprotective composition against long UVA radiation, the method comprising the steps of: a) measuring the level of expression, in a sample of a skin that has been exposed to radiation comprising long UVAs in the presence of a photoprotective composition, of at least one gene selected from the group consisting of genes Number Abbreviated name GenBank access gene name (updated on 27/07/2010) NM 002462 MX1 myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) NM 002463 MX2 myxovirus (influenza virus) resistance 2 (mouse) NM 004120 GBP2 guanylate binding protein 2, interferon-inducible NM 052942 GBP5 guanylate binding protein 5 NM 198460 GBP6 guanylate binding protein family, member 6 NM 016816 OAS1 2 ', 5'-oligoadenylate synthetase 1, 40 / 46kDa NM 002535 OAS2 2'-5'-oligoadenylate synthetase 2, 69 / 71kDa NM 017654 SAMD9 sterile alpha motif containing domain 9 NM 152703 SAMD9L sterile alpha motif containing domain 9-like NM 001031683 IFIT3 interferon-induced protein with tetratricopeptide repeats 3 NM 006417 IF144 interferon -induced protein 44 NM 006820 IF144L interferon-induced protein 44-like NM 001002264 EPSTI1 epithelial stromal interaction 1 (breast) NM 015474 SAMHD1 SAM domain and HD domain 1 NM 014439 ILI F7 interleukin 1 family, member 7 (zeta) NM 000640 IL13RA2 interleukin 13 receptor, alpha 2 NM 003764 STX11 syntaxin 11 NM 007115 TNFAIP6 tumor necrosis factor, alpha-induced protein 6 NM 025218 ULBP1 UL16 binding protein 1 NM 001130711 CLEC2A C-type lectin domain family 2, memb C252 CLEC2507 Beta2-C-type lectin domain family 2, member B NM 003046 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y + system), member 2 NM 006577 B3GNT2 UDP-GIcNAc: betaGal beta-1,3-N- acetylglucosaminyltransferase 2 NM 001712 CEACAM1 carcinoembryonic antigen-related celI adhesion molecule 1 (biliary glycoprotein) NM 003937 KYNU kynureninase (L-kynurenine hydrolase) NM 004529 MLLT3 myeloid / lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 NM 014069 PSORS1C2 psoriasis susceptibility 1 candidate 2 NM 001085 SERPINA3 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 NM 004072 CMKLR1 chemokine-like receptor 1 NM 172220 CSF3 colony stimulating factor 3 (granulocyte) NM 001776 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 NM 006895 HNMT histamine N-methyltransferase NM 002359 MAFG v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) NM 014375 FETUB fetuin B NM 153487 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 NM 206963 RARRES1 retinoic acid receptor responder tazarotene induced) 1 NM 012449 STEAP1 six transmembrane epithelial antigen of the prostate 1 NM 182606 TMPRSS11A transmembrane protease, serine 11A NM 182643 DLC1 deleted in liver cancer 1 NM 030915 LBH limb bud and heart development homolog (mouse) NM 175634 RUNX1T1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) NM 005985 SNAll snail homolog 1 (Drosophila) NM 005098 MSC musculin (activated B-cell factor-1) NM 053001 OSR2 odd-skipped related 2 (Drosophila) NM 002585 PBX1 pre-B- cell leukemia homeobox 1 NM 017893 SEMA4G sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G NM 013259 TAGLN3 transgelin 3 NM 017637 BNC2 basonuclin 2 NM 018717 MAML3 mastermind-like 3 (Drosophila) NM 153026 PRICKLE1 prickle homolog 1 (Drosophila) NM 003882 WISP1 WNT1 inducible signaling pathway protein 1 NM 001111283 IGF1 insulin-like growth factor 1 (somatomedin C) NM 001037954 DIXDC1 TEN domain containing 1 NM 203371 FIBIN end bud initiation factor homolog (zebrafish) NM 005264 GFRA1 GDNF family receptor alpha 1 NM 201433 GAS7 growth arrest-specific 7 NM 005192 CDKN3 cyclin-dependent kinase inhibitor 3 NM 025195 TRIB1 tribble homolog 1 (Drosophila) NM 022073 EGLN3 eglin homolog 3 (C, elegans) NM 133328 DEDD2 death ef fector domain containing 2 NM 006186 NR4A2 nuclear receptor subfamily 4, group A, member 2 NM 031458 PARP9 poly (ADP-ribose) family polymerase, member 9 NM 002192 INHBA inhibin, beta A NM 001099772 CYP4B1 cytochrome P450, family 4, subfamily B, polypeptide 1 NM 002275 KRT15 keratin 15 NM 175078 KRT77 keratin 77 NM 001343 DAB2 disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) NM 015277 NEDD4L neural precursor cell expressed, developmentally downregulated 4-like NM 000129 F1 3A1 coagulation factor XIII, A1 polypeptide NM 004469 FIGF c-fos induced growth factor (vascular endothelial growth factor D) NM 007350 PHLDA1 pleckstrin homology-like domain, family A, member 1 NM 014822 SEC24D SEC24 family, member D (S, cerevisiae) NM 080474 SERPINB12 serpin peptidase inhibitor, clade B (ovalbumin), member 12 NM 014365 HSPB8 heat shock 22kDa protein 8 NM 014331 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y + system) member 11 NM 001172 ARG2 arginase, type IINM DUSP10 dual specificity phosphatase 10 NM 000433 NCF2 neutrophil cytosolic factor 2 NM 152310 ELOVL3 elongation of very long chain fatty acids (FEN1 / E1o2, SUR4 / E1o3, yeast) -like 3 NM 032717 AGPAT9 1-acylglycerol-3-phosphate O-acyltransferase 9 NM 003956 CH25H cholesterol 25-hydroxylase NM 021187 CYP4F11 cytochrome P450, family 4, subfamily F, polypeptide 11 NM 007238 PXMP4 peroxisomal membrane protein 4, 24kDa NM 000351 STS steroid sulfatase (microsomal), isozyme S NM 024560 ACSS3 acyl-CoA synthetase short -chain family member 3 NM 001277 CHKA choline kinase alpha NM 001006630 CHRM2 cholinergic receptor, muscarinic 2 NM 002612 PDK4 pyruvate dehydrogenase kinase, isozyme 4 NM 013261 PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha NM 001482 GATM glycine amidinotransferase (L-arginine glycine amidinotransferase) NM 019891 ERO1LB ERO1-like beta (S, cerevisiae) NM 014324 AMACR alpha-methylacyl-CoA racemase NM 001460 FMO2 flavin containing monooxygenase 2 (non-functional) NM 001461 FMO5 flavin containing monooxygenase 5 NM 152908 SLC47A2 solute carrier family 47, member 2 NM 138461 TM4SF19 transmembrane 4 L six family member 19 NM 015993 PLLP plasma membrane proteolipid (plasmolipin) NM 013390 TMEM2 transmembrane protein 2 NM 017631 DDX60 DEAD (Asp-Glu-Ala-Asp) box polypeptide 60 NM 001012967 DDX6OL DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like NM 005325 HIST1H1A histone cluster 1, H1a NM 004836 EIF2AK3 eukaryotic translation initiation factor 2-alpha kinase 3 NM 024524 ATP13A3 ATPase type 13A3 NM 000891 KCNJ2 potassium inwardly-rectifying channel, subfamily J, member 2 NM 018593 SLC16A10 solute carrier family 16, member 10 (aromatic amino acid transporter) NM 014585 SLC40A1 solute carrier family 40 (iron-regulated transporter ), member 1 NM 182767 SLC6A15 solute carrier family 6 (neutral amino acid transporter), member 15 NM 001001323 ATP2B1 ATPase, Ca ++ transporting, plasma membrane 1 NM 001040624 NCALD neurocalcin delta NM 006996 SLC19A2 solute carrier family 19 (thiamine transporter), member 2 NM 001128431 SLC39A14 solute carrier family 39 (zinc transporter), member 14 NM 001012661 SLC3A2 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 NM 181785 SLC46A3 solute carrier family 46, member 3 NM 001503 GPLD1 glycosylphosphatidylinositol specific phospholipase D1 NM 022041 GAN gigaxonin NM 005909 MAP1 B microtubule-associated protein 1B NM 012134 LMOD1 leiomodin 1 (smooth muscle) NM 001010000 ARHGAP28 Rho GTPase activating protein 28 NM 004570 PIK3C2G phosphoinositide-3- kinase, class 2, gamma polypeptide NM 053064 GNG2 guanine nucleotide binding protein (G protein), gamma 2 NM 000856 GUCY1A3 guanylate cyclase 1, soluble, alpha 3NM 018945 PDE7B phosphodiesterase 7B NM 001098512 PRKG1 protein kinase, cGMP-dependent, type I NM 023940 RASL11B RAS-like, family 11, member B NM 002923 RGS2 regulator of G-protein signaling 2, 24kDa AK303463 USP41 ubiquitin specific peptidase 41 NM 014363 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) NM 001038633 RSPO1 R-spondin homolog (Xenopus laevis) NM 005733 KIF20A kinesin family member 20A NM 021724 NR1 D1 nuclear receptor subfamily 1, group D, member 1 NM 138573 NRG4 neuregulin 4 NM 005103 FEZ1 fasciculation and elongation protein zeta 1 (zygin I) NM 024769 ASAM adipocyte-specific adhesion molecule NM 017671 FERMT1 fermitin family homolog 1 (Drosophila) NM 024165 PHF1 PHD finger protein 1 NM 181533 ABHD12B abhydrolase domain containing 12B NM 206966 C5orf46 chromosome 5 open reading frame 46 NM 183373 C6orf145 chromosome 6 open reading frame 145 NM 018325 C9orf72 chromosome 9 open reading frame 72 NM 001215 CA6 carbonic anhydrase VI NM 014157 CCDC113 coiled-coil domain containing 113 NM 024519 FAM65A family with sequence similarity 65, member A NM 017938 FAM70A family with sequence similarity 70, member A NM 173815 FLJ37464 hypothetical protein FLJ37464 NM 001490 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 (b andα-1,6-N-acetylglucosaminyltransferase) NM 015187 KIAA0746 KIAA0746 protein NM 005779 LHFPL2 lipoma HMGIC fusion partner-like 2 BC107865 LOC204010 ribosomal protein SA pseudogene NM 006152 LRMP lymphoid-restricted membrane protein NM 024717 Multiple MCTP1 C2 domains, transmembrane 1 NM 014033 Methyltransferase-like 7A BC066301 MGC87042 similar to six epithelial transmembrane antigen of prostate NM 144599 NIPA1 not imprinted in Prader-Willi / Angelman syndrome 1 NM 001085382 PSAPL1 prosaposin-like 1 NM 031469 SH3BGRL2 SH3 domain binding glutamic acid-rich protein like 2 NM 020808 SIPA1L2 signal-induced proliferation-associated 1 like 2 NM 007000 UPK1A uroplakin 1A NM 152495 CNIH3 gland homolog 3 (Drosophila) NM 024007 EBF1 early B-cell factor 1 NM 020354 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 NM 017565 FAM20A family with sequence similarity 20, member A NM 153711 FAM26E family with sequence similarity 26, member E NM 153690 FAM43A family with sequence similar rity 43, member A NM 016323 HERC5 hect. domain and RLD 5 NM 017912 HERC6 hect. domain and RLD 6 NM 001550 IFRD1 interferon-related developmental regulator 1 NM 033397 ITPRIP inositol 1,4,5-triphosphate receptor interacting protein NM 014851 KLHL21 kelch-like 21 (Drosophila) AK093957 LOC728264 hypothetical protein LOC728264 AF176921 MST131 MSTP131 NM 198474 OLFML1 olfactomedin-like 1 NM 015886 PI15 peptidase inhibitor 15NM 001003793 RBMS3 RNA binding motif, single stranded interacting protein NM 005068 SIM1 single-minded homolog 1 (Drosophila) NM 175839 SMOX spermine oxidase NM 018266 TMEM39A transmembrane protein 39A NM 198152 UTS2D urotensin 2 domain containing NM 053276 VIT vitrin NM 182491 ZFAND2A zinc finger, AN1-type domain 2A NM 020747 ZNF608 zinc finger protein 608 b) compare the level of expression of said at least one measured gene in the skin sample which has been exposed to radiation comprising long UVA in the presence of the photoprotective composition, with the calf expression of said at least one gene measured in a sample of said skin which has been exposed to radiation comprising long UVA in the absence of photoprotective composition; c) determining that said photoprotective composition confers protection against long UVA radiation when: cl) a decrease in the level of expression of said at least one gene in the skin sample which has been exposed to radiation comprising long UVA in the presence of said photoprotective composition is detected, relative to the level of expression of said at least one gene in the sample of said skin which has been exposed to radiation comprising long UVA in the absence of photo composition -protectrice, when said at least one gene is selected from the group consisting of IL13RA2, STX11, TNFAIP6, ULBP1, SLC7A2, B3GNT2, CEACAM1, KYNU, CSF3, MAFG, MDGA1, STEAP1, MSC, TAGLN3, TRIB1, DEDD2, NR4A2 genes , INHBA, DAB2, NEDD4L, PHLDA1, SEC24D, HSPB8, SLC7A11, ARG2, DUSP10, NCF2, AGPAT9, CH25H, CYP4F11, CHKA, ERO1LB, TM4SF19, TMEM2, EIF2AK3, ATP13A3, SLC6A15, ATP2B1, SLC19A2, SLC39A14, SLC3A2, MAP1B , NR1D1, FEZ1, ASAM, FERMT1, PHF1, C6orf145 , C9orf72, FAM65A, KIAA0746, LHFPL2, LOC204010, MCTP1, MGC87042, NIPA1, SIPA1L2, CNIH3, ENTPD7, IFRD1, ITPRIP, KLHL21, MST131, SMOX, TMEM39A and ZFAND2A; and / or c2) an increase in the level of expression of said at least one gene in the skin sample which has been exposed to radiation comprising long UVA in the presence of said photoprotective composition is detected, relative to the level of expressing said at least one gene in the sample of said skin which has been exposed to radiation comprising long UVAs in the absence of a photoprotective composition, when said at least one gene is selected from the group consisting of MX1, MX2, GBP2 genes , GBP5, GBP6, OAS1, OAS2, SAMD9, SAMD9L, IFIT3, IF144, IF144L, EPSTI1, SAMHD1, ILI F7, CLEC2A, CLEC2B, MLLT3, PSORS1C2, SERPINA3, CMKLR1, ENTPD1, HNMT, FETUB, RARRES1, TMPRSS11A, DLC1, LBH, RUNX1T1, SNAI1, OSR2, PBX1, SEMA4G, BNC2, MAML3, PRICKLE1, WISP1, IGF1, DIXDC1, FIBIN, GFRA1, GAS7, CDKN3, EGLN3, PARP9, CYP4B1, KRT15, KRT77, F13A1, FIGF, SERPINB12, ELOVL3, PXMP4, STS, ACSS3, CHRM2, PDK4, PPARGC1A, GATM, AMACR, FMO2, FMO5, SLC47A2, PLLP, DDX60, DDX6OL, HIST1H 1A, KCNJ2, SLC16A10, SLC40A1, NCALD, SLC46A3, GPLD1, GAN, LMOD1, ARHGAP28, PIK3C2G, GNG2, GUCY1A3, PDE7B, PRKG1, RASL11B, RGS2, USP41, SACS, RSPO1, KIF20A, NRG4, ABHD12B, C5orf46, CA6, CCDC113, FAM70A, FLJ37464, GCNT1, LRMP, METTL7A, PSAPL1, SH3BGRL2, UPK1A, EBF1, FAM20A, FAM26E, FAM43A, HERC5, HERC6, LOC728264, OLFML1, P115, RBMS3, SIM1, UTS2D, VIT and ZNF608. 3. In vitro method for comparing the protective efficacy of at least two photoprotective compositions against long UVA radiation, the method comprising the steps of: a) measuring the level of expression in a sample of a skin that has been exposed to radiation comprising long UVA in the presence of a first photoprotective composition, at least one gene selected from the group consisting of genes. GenBank access (updated 27/07/2010) NM 002462 MX1 myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) NM 002463 MX2 myxovirus (influenza virus) resistance 2 (mouse) NM 004120 GBP2 guanylate binding protein 2, interferon-inducible NM 052942 GBP5 guanylate binding protein 5 NM 198460 GBP6 guanylate binding protein family, member 6 NM 016816 OAS1 2 ', 5'-oligoadenylate synthetase 1, 40 / 46kDa NM 002535 OAS2 2'-5'-oligoadenylate synthetase 2, 69 / 71kDa NM 017654 SAMD9 st erile alpha motif domain containing 9 NM 152703 SAMD9L sterile alpha motif domain containing 9-like NM 001031683 IFIT3 interferon-induced protein with tetratricopeptide repeats 3 NM 006417 IF144 interferon-induced protein 44 NM 006820 IF144L interferon-induced protein 44-like NM 001002264 EPSTI1 epithelial stromal interaction 1 (breast) NM 015474 SAMHD1 SAM domain and HD domain 1 NM 014439 ILI F7 interleukin 1 family, member 7 (zeta) NM 000640 IL13RA2 interleukin 13 receptor, alpha 2 NM 003764 STX11 syntaxin 11 NM 007115 TNFAIP6 tumor necrosis factor, alpha -induced protein 6 NM 025218 ULBP1 UL16 binding protein 1 NM 001130711 CLEC2A C-type lectin domain family 2, member ANM 005127 CLEC2B C-type lectin domain family 2, member B NM 003046 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y + system), member 2 NM _006577 B3GNT2 UDP-GIcNAc: betaGal beta-I, 3-N-acetylglucosaminyltransferase 2 NM 001712 CEACAMI carcinoembryonic antigen-related cell adhesion molecule 1 (biliary g lycoprotein) NM_003937 KYNU kynureninase (L-kynurenine hydrolase) NM 004529 MLLT3 myeloid / lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); Translocated to, 3 NM 014069 PSORSI C2 psoriasis susceptibility 1 candidate 2 NM 001085 SERPINA3 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 NM 004072 CMKLRI chemokine-like receptor 1 NM 172220 CSF3 colony stimulating factor 3 (granulocyte ) NM 001776 ENTPDI ectonucleoside triphosphate diphosphohydrolase 1 NM _006895 HNMT histamine N-methyltransferase NM 002359 MAFG v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) NM 014375 FETUB fetuin B NM 153487 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 NM 206963 RARRESI retinoic acid receptor responder (tazarotene induced) 1 NM 012449 STEAPI six transmembrane epithelial antigen of the prostate 1 NM 182606 TMPRSSI1A transmembrane protease, serine 11A NM 182643 DLC1 deleted in liver cancer 1 NM 030915 LBH limb bud and heart development homolog (mouse) NM 175634 RUNX1 TI runt- related transcription factor 1; translocated to, 1 (cyclin D-related) NM 005985 SNAI1 snail homolog 1 (Drosophila) NM 005098 MSC musculin (activated B-cell factor-1) NM 053001 OSR2 odd-skipped related 2 (Drosophila) NM 002585 PBX1 pre-B- cell leukemia homeobox 1 NM _017893 SEMA4G sema domain, immunoglobulin domain (Ig), domain transmembrane (TM) and short cytoplasmic domain, (semaphorin) 4G NM 013259 TAGLN3 transgelin 3 NM 017637 BNC2 basonuclin 2 NM 018717 MAML3 mastermind-like 3 (Drosophila) NM 153026 PRICKLEI prickle homolog 1 (Drosophila) NM 003882 WISP1 WNT1 inducible signaling pathway protein 1 NM 001111283 IGF1 insulin-like growth factor 1 (somatomedin C) NM 001037954 DIXDCI DIX domain containing 1 NM 203371 FIBIN end bud initiation factor homolog (zebrafish) NM 005264 GFRA1 GDNF family receptor alpha 1 NM 201433 GAS7 growth arrest-specific 7 NM 005192 CDKN3 cyclin-dependent kinase inhibitor 3 NM 025195 TRIB1 tribible homolog 1 (Drosophila) NM 022073 EGLN3 eglin homolog 3 (C, elegans) NM 133328 DEDD2 death e ffector domain containing 2 NM 006186 NR4A2 nuclear receptor subfamily 4, group A, member 2 NM 031458 PARP9 poly (ADP-ribose) family polymerase, member 9 NM 002192 INHBA inhibin, beta ANM 001099772 CYP4B1 cytochrome P450, family 4, subfamily B, polypeptide 1 NM 002275 KRT15 keratin 15 NM 175078 KRT77 keratin 77 NM 001343 DAB2 disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) NM 015277 NEDD4L neural precursor cell expressed, developmentally downregulated 4-like NM 000129 F1 3A1 coagulation factor XIII, Al polypeptide NM 004469 FIGF c-fos induced growth factor (vascular endothelial growth factor D) NM 007350 PHLDA1 pleckstrin homology-like domain, family A, member 1 NM 014822 SEC24D SEC24 family, member D (S, cerevisiae) NM 080474 SERPINB12 serpin peptidase inhibitor, clade B (ovalbumin), member 12 NM 014365 HSPB8 heat shock 22kDa protein 8 NM 014331 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y + system) member 11 NM 001172 ARG2 arginase, type 11 NM 007207 DUSP10 dual specificity phosphatase 10 NM 000433 NCF2 neutrophil cytosolic factor 2 NM 152310 ELOVL3 elongation of very long chain fatty acids (FEN1 / E1o2, SUR4 / E1o3, yeast) -like 3 NM 032717 AGPAT9 1-acylglycerol 3-phosphate 0-acyltransferase 9 NM 003956 CH25H cholesterol 25-hydroxylase NM 021187 CYP4F11 cytochrome P450, family 4, subfamily F, polypeptide 11 NM 007238 PXMP4 peroxisomal membrane protein 4, 24kDa NM 000351 STS steroid sulfatase (microsomal), isozym e S NM 024560 ACSS3 acyl-CoA synthase short-chain family member 3 NM 001277 CHKA alpha choline kinase NM 001006630 CHRM2 cholinergic receptor, muscarinic 2 NM 002612 PDK4 pyruvate dehydrogenase kinase, isozyme 4 NM 013261 PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha NM 001482 GATM glycine amidinotransferase (L-arginine: glycine amidinotransferase) NM 019891 ERO1LB ER01-like beta (S, cerevisiae) NM 014324 AMACR alpha-methylacyl-CoA racemase NM 001460 FMO2 flavin containing monooxygenase 2 (non-functional) NM 001461 FMO5 flavin containing monooxygenase 5 NM 152908 SLC47A2 solute carrier family 47, member 2 NM 138461 TM4SF19 transmembrane 4 L six family member 19 NM 015993 PLLP plasma membrane proteolipid (plasmolipin) NM_013390 TMEM2 transmembrane protein 2 NM 017631 DDX60 DEAD (Asp-Glu-Ala-Asp ) box polypeptide 60 NM 001012967 DDX6OL DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like NM 005325 HIST1H1A histone cluster 1, Hia NM 004836 ElF2AK3 eukaryotic tra nslation initiation factor 2-alpha kinase 3 NM 024524 ATP13A3 ATPase type 13A3 NM 000891 KCNJ2 potassium inwardly-rectifying channel, subfamily J, member 2 NM 018593 SLC16A10 solute carrier family 16, member 10 (aromatic amino acid transporter) NM 014585 SLC40A1 solute carrier family 40 (iron-regulated transporter), member 1 NM 182767 SLC6A15 solute carrier family 6 (neutral amino acid transporter), member 15 NM 001001323 ATP2B1 ATPase, Ca ++ transporting, plasma membrane 1 NM 001040624 NCALD neurocalcin delta NM 006996 SLC19A2 solute carrier family 19 ( thiamine transporter), member 2 NM 001128431 SLC39A14 solute carrier family 39 (zinc transporter), member 14 NM 001012661 SLC3A2 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 NM 181785 SLC46A3 solute carrier family 46, member 3 NM 001503 GPLD1 glycosylphosphatidylinositol specific phospholipase D1 NM 022041 GAN gigaxonin NM 005909 MAP1 B microtubule-associated protein 1B NM 012134 LMOD1 leiomo din 1 (smooth muscle) NM 001010000 ARHGAP28 Rho GTPase activating protein 28 NM 004570 PIK3C2G phosphoinositide-3-kinase, class 2, gamma polypeptide NM 053064 GNG2 guanine nucleotide binding protein (G protein), gamma 2 NM 000856 GUCY1A3 guanylate cyclase 1, soluble , alpha 3 NM 018945 PDE7B Phosphodiesterase 7B NM 001998512 PRKG1 protein kinase, cGMP-dependent, type I NM 023940 RASL11B RAS-like, family 11, member B NM 002923 RGS2 regulator of G-protein signaling 2, 24kDa AK303463 USP41 ubiquitin specific peptidase 41 NM 014363 SACS spastic ataxia of Charlevoix-Saguenay (bags) NM 001038633 RSPO1 R-spondin homolog (Xenopus laevis) NM 005733 KIF20A kinesin family member 20A NM 021724 NR1 D1 nuclear receptor subfamily 1, group D, member 1 NM 138573 NRG4 neuregulin 4 NM 005103 FEZ1 fasciculation and elongation protein zeta 1 (zygin I) NM 024769 ASAM adipocyte-specific adhesion molecule NM 017671 FERMT1 fermitin family homolog 1 (Drosophila) NM 024165 PHF1 PHD finger protein 1 NM 181533 AB HD12B abhydrolase domain containing 12B NM 206966 C5orf46 chromosome 5 open reading frame 46 NM 183373 C6orf145 chromosome 6 open reading frame 145 NM 018325 C9orf72 chromosome 9 open reading frame 72 NM 001215 CA6 carbonic anhydrase VI NM 014157 CCDC113 coiled-coil domain containing 113 NM 024519 FAM65A FAMILY with sequence similarity 65, member A NM 017938 FAM70A family with sequence similarity 70, member A NM 173815 FLJ37464 hypothetical protein FLJ37464 NM 001490 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) NM 015187 KIAA0746 KIAA0746 protein NM 005779 LHFPL2 lipoma HMGIC fusion partner-like 2 BC107865 LOC204010 ribosomal protein SA pseudogene NM 006152 LRMP lymphoid-restricted membrane protein NM 024717 Multiple MCTP1 C2 domains, transmembrane 1 NM 014033 METTL7A methyltransferase 7A BC066301 MGC87042 similar to 6 transmembrane epithelial antigen of prostate NM 144599 NIPA1 not imprinted in Prader-Willi / Angelman syndrome 1 NM 001085382 PSAPL1 prosaposin-like 1NM 031469 SH3BGRL2 SH3 domain binding glutamic acid-rich protein like 2 NM 020808 SIPA1L2 signal-induced proliferation-associated 1 like 2 NM 007000 UPK1A uroplakin lA NM 152495 CNIH3 gland homolog 3 (Drosophila) NM 024007 EBF1 early B 1 NM 020354 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 NM 017565 FAM20A family with sequence similarity 20, member A NM 153711 FAM26E family with sequence similarity 26, member E NM 153690 FAM43A family with sequence similarity 43, member A NM 016323 HERC5 hect RLD 5 NM 017912 HERC6 hectome and RLD 6 NM 001550 IFRD1 interferon-related developmental regulator 1 NM 033397 ITPRIP inositol 1,4,5-triphosphate receptor interacting protein NM 014851 KLHL21 kelch-like 21 (Drosophila) AK093957 LOC728264 hypothetical protein LOC728264 AF176921 MST131 MSTP131 NM 198474 OLFML1 olfactomedin-like 1 NM 015886 PI15 peptidase inhibitor 15 NM 001003793 RBMS3 RNA binding motif, single stranded interacting protein NM 005068 SIM1 single-minded homolog 1 (Drosophila) NM 175839 SMOX spermine oxidase NM 018266 TMEM39A transmembrane protein 39A NM 198152 UTS2D urotensin 2 domain containing NM 053276 VIT vitrin NM 182491 ZFAND2A zinc finger, AN1-type domain 2A NM 020747 ZNF608 zinc finger protein 608 b) measuring the level of expression in a sample of said skin that has been exposed to radiation comprising long UVA in the presence of a second photoprotective composition, said at least one gene selected from the group consisting of genes mentioned in step a); c) identifying as a photoprotective composition having the best protection efficacy against long UVA radiation, the photo-protective composition in the presence of which is detected: cl) a decrease in the level of expression of said at least one gene in the skin sample that has been exposed to radiation comprising long UVAs, relative to the level of expression of said at least one gene in the sample of said skin that has been exposed to radiation comprising long UVAs in the presence of the other photoprotective composition, when said at least one gene is selected from the group consisting of IL13RA2, STX11, TNFAIP6, ULBP1, SLC7A2, B3GNT2, CEACAM1, KYNU, CSF3, MAFG, MDGA1, STEAP1, MSC genes. , TAGLN3, TRIB1, DEDD2, NR4A2, INHBA, DAB2, NEDD4L, PHLDA1, SEC24D, HSPB8, SLC7A11, ARG2, DUSP10, NCF2, AGPAT9, CH25H, CYP4F11, CHKA, ERO1LB, TM4SF19, TMEM2, EIF2AK3, ATP13A3, SLC6A15, ATP2B1 , SLC19A2, SLC39A14, SLC3A2, MAP1B, NR1D1, FEZ1, ASA M, FERMT1, PHF1, C6orf145, C9orf72, FAM65A, KIAA0746, LHFPL2, LOC204010, MCTP1, MGC87042, NIPA1, SIPA1L2, CNIH3, ENTPD7, IFRD1, ITPRIP, KLHL21, MST131, SMOX, TMEM39A and ZFAND2A; and / or c2) an increase in the level of expression of said at least one gene in the skin sample that has been exposed to radiation comprising long UVAs, relative to the level of expression of said at least one gene in the sample of said skin which has been exposed to radiation comprising long UVA in the presence of the other photoprotective composition, when said at least one gene is selected from the group consisting of MX1, MX2, GBP2, GBP5, GBP6, OAS1 genes, OAS2, SAMD9, SAMD9L, IFIT3, IF144, IF144L, EPSTI1, SAMHD1, IL1F7, CLEC2A, CLEC2B, MLLT3, PSORS1C2, SERPINA3, CMKLR1, ENTPD1, HNMT, FETUB, RARRES1, TMPRSS11A, DLC1, LBH, RUNX1T1, SNAI1, OSR2, PBX1, SEMA4G, BNC2, MAML3, PRICKLE1, WISP1, IGF1, DIXDC1, FIBIN, GFRA1, GAS7, CDKN3, EGLN3, PARP9, CYP4B1, KRT15, KRT77, F13A1, FIGF, SERPINB12, ELOVL3, PXMP4, STS, ACSS3, CHRM2, PDK4, PPARGC1A, GATM, AMACR, FMO2, FMO5, SLC47A2, PLLP, DDX60, DDX6OL, HIST1H1A, KCNJ2, SLC16A10, SLC40A1, NCALD, SLC46A3, GPLD1, GAN, LMOD1, ARHGAP28, PIK3C2G, GNG2, GUCY1A3, PDE7B, PRKG1, RASL11B, RGS2, USP41, SACS, RSPO1, KIF20A, NRG4, ABHD12B, C5orf46, CA6, CCDC113, FAM70A, FLJ37464, GCNT1, LRMP, METTL7A, PSAPL1, SH3BGRL2, UPK1A, EBF1, FAM20A, FAM26E, FAM43A, HERC5, HERC6, LOC728264, OLFML1, P115, RBMS3, SIM1, UTS2D, VIT and ZNF608. The method according to any one of claims 1 to 3, wherein the radiation comprising long UVA is radiation comprising substantially wavelength radiations of 340 nm to 440 nm. The method according to any one of claims 1 to 4, wherein the radiation comprising long UVA is radiation comprising mainly wavelength radiations of 320 nm to 450 nm. The method according to any one of claims 1 to 5, wherein said skin which has been exposed to radiation comprising long UVA is a skin cell culture, an epidermis culture, a reconstructed complete skin, a expiating human skin, or the skin of a human being. The method according to any one of claims 1 to 6, wherein the skin sample is - an epidermis sample when said at least one gene is selected from the group consisting of MX1, MX2, GBP2, GBP6, SAMD9L, IFIT3, IF144, IF144L, IL1F7, IL13RA2, STX11, ULBP1, CLEC2A, CLEC2B, SLC7A2, B3GNT2, CEACAM1, KYNU, MLLT3, PSORS1C2, SERPINA3, FETUB, MDGA1, RARRES1, STEAP1, TMPRSS11A, MSC, OSR2, PBX1, SEMA4G, TAGLN3, CDKN3, TRIB1, EGLN3, INHBA, CYP4B1, KRT15, KRT77, DAB2, NEDD4L, PHLDA1, SEC24D, SERPINB12, SLC7A11, ARG2, DUSP10, NCF2, ELOVL3, AGPAT9, CH25H, CYP4F11, PXMP4, STS, GATM, ERO1LB, AMACR, FMO2, FMO5, SLC47A2, TM4SF19, PLLP, TMEM2, DDX60, HIST1H1A, ATP13A3, KCNJ2, SLC16A10, SLC40A1, SLC6A15, GPLD1, GAN, MAP1B, ARHGAP28, PIK3C2G, USP41, SACS, RSPO1, KIF20A, NR1D1, NRG4, FEZ1, ASAM, FERMT1, PHF1, ABHD12B, C5orf46, C6orf145, C9orf72, CA6, CCDC113, FAM65A, FAM70A, FLJ37464, GCNT1, KIAA0746, LHFPL2, LOC204010, LRMP, MCTP1, METTL7A, MGC87042, NIPA1, PSAPL1, SH 3BGRL2, SIPA1L2 and UPK1A, and / or - a dermal sample when said at least one gene is selected from the group consisting of MX1, MX2, GBP2, GBP5, OAS1, OAS2, SAMD9, SAMD9L, IFIT3, EPSTI1, SAMHD1, TNFAIP6 , CMKLR1, CSF3, ENTPD1, HNMT, MAFG, DLC1, LBH, RUNX1T1, SNAI1, BNC2, MAML3, PRICKLE1, WISP1, IGF1, DIXDC1, FIBIN, GFRA1, GAS7, DEDD2, NR4A2, PARP9, F13A1, FIGF, HSPB8, SLC7A11 , ELOVL3, ACSS3, CHKA, CHRM2, PDK4, PPARGC1A, DDX60, DDX6OL, EIF2AK3, ATP2B1, NCALD, SLC19A2, SLC39A14, SLC3A2, SLC46A3, LMOD1, GNG2, GUCY1A3, PDE7B, PRKG1, RASL11B, RGS2, USP41, RSPO1, CNIH3 , EBF1, ENTPD7, FAM20A, FAM26E, FAM43A, HERC5, HERC6, IFRD1, ITPRIP, KLHL21, LOC728264, MST131, OLFML1, PI15, RBMS3, SIM1, SMOX, TMEM39A, UTS2D, VIT, ZFAND2A and ZNF608. 8. Method according to any one of claims 1 to 7, wherein said at least one gene is selected from the group consisting of the genes MX2, GBP2, OAS1, SAMD9L, IFIT3, IF144, IL1F7, IL13RA2, CLEC2A, HNMT, MAFG, RARRES1, SNAI1, WISP1, IGF1, GAS7, CDKN3, INHBA, KRT15, DAB2, NEDD4L, F13A1, SLC7A11, ELOVL3, GATM, ERO1LB, FMO5, TM4SF19, DDX60, SLC16A10, SLC39A14, MAP1 B, ARHGAP28, GNG2, RGS2 , USP41, KIF20A, NR1D1, NRG4, HERC5 and SMOX. 9. A method according to any one of claims 1 to 8, wherein said at least one gene is selected from the group consisting of MX2, GBP2, CLEC2A, MAFG, IGF1, INHBA, DAB2, SLC7A11, ELOVL3, TM4SF19 genes and USP41. The method according to any one of claims 1 to 9, wherein said at least one gene is selected from the group consisting of CLEC2A, MX2, IGF1, TM4SF19 and SLC7A11. 11. A method according to any one of claims 1 to 10, wherein the level of expression of said at least one gene is determined by measuring the level of mRNA of said at least one gene. 12. A method according to any one of claims 1 to 11, wherein the level of expression of said at least one gene is determined by measuring the level of expression of the protein encoded by said at least one gene. 13.- Use of a kit comprising: a) means for detecting, in a biological sample, the expression of at least one gene selected from the group consisting of genes Number Short name GenBank access gene name (update 27/07/2010) NM 002462 MX1 myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) NM 002463 MX2 myxovirus (influenza virus) resistance 2 (mouse) NM 004120 GBP2 guanylate binding protein 2 interferon-inducible NM -052942 GBP5 guanylate binding protein 5 NM 198460 GBP6 guanylate binding protein family, member 6 NM 016816 OAS1 2 ', 5'-oligoadenylate synthetase 1, 40 / 46kDa NM 002535 OAS2 2'-5'-oligoadenylate synthetase 2, 69 / 71kDa NM 017654 SAMD9 sterile alpha motif containing domain 9 NM 152703 SAMD9L sterile alpha motif containing domain 9-like NM 001031683 IFIT3 interferon-induced protein with tetratricopeptide repeats 3 NM 006417 IF144 interferon-induced protein 44 NM 006820 IF144L interferon-induced otein 44-like NM 001002264 EPSTI1 epithelial stromal interaction 1 (breast) NM 015474 SAMHD1 SAM domain and HD domain 1 NM 014439 ILI F7 interleukin 1 family, member 7 (zeta) NM 000640 IL13RA2 interleukin 13 receptor, alpha 2 NM 003764 STX11 syntaxin 11 NM 007115 TNFAIP6 tumor necrosis factor, alpha-induced protein 6 NM 025218 ULBP1 UL16 binding protein 1 NM 001130711 CLEC2A C-type lectin domain family 2, member A NM 005127 CLEC2B C-type lectin domain family 2, member B NM 003046 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y + system), member 2NM 006577 B3GNT2 UDP-GIcNAc: betaGal beta-I, 3-N-acetylglucosaminyltransferase 2 NM 001712 CEACAMI carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) NM 003937 KYNU kynureninase (L-kynurenine hydrolase) NM 004529 MLLT3 myeloid / lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); Translocated to, 3 NM 014069 PSORSI C2 psoriasis susceptibility 1 candidate 2 NM 001085 SERPINA3 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 NM 004072 CMKLRI chemokine-like receptor 1 NM 172220 CSF3 colony stimulating factor 3 (granulocyte ) NM 001776 ENTPDI ectonucleoside triphosphate diphosphohydrolase 1 NM 006895 HNMT histamine N-methyltransferase NM 002359 MAFG v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) NM 014375 FETUB fetuin B NM 153487 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor NM 206963 RARRESI retinoic acid receptor responder (tazarotene induced) 1 NM 012449 STEAPI six transmembrane epithelial antigen of the prostate 1 NM 182606 TMPRSSI1A transmembrane protease, serine 11A NM 182643 DLC1 deleted in liver cancer 1 NM 030915 LBH limb bud and heart development homolog (mouse) NM 175634 RUNX1 TI runt- related transcription factor 1; translocated to, 1 (cyclin D-related) NM 005985 SNAI1 snail homolog 1 (Drosophila) NM 005098 MSC musculin (activated B-cell factor-1) NM 053001 OSR2 odd-skipped related 2 (Drosophila) NM 002585 PBX1 pre-B- cell leukemia homeobox 1 NM 017893 SEMA4G sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G NM 013259 TAGLN3 transgelin 3 NM 017637 BNC2 basonuclin 2 NM 018717 MAML3 mastermind-like 3 (Drosophila) NM 153026 PRICKLEI prickle homolog 1 (Drosophila) NM 003882 WISP1 WNT1 inducible signaling pathway protein 1 NM 001111283 IGF1 insulin-like growth factor 1 (somatomedin C) NM _001037954 DIXDCI DIX domain containing 1 NM 203371 FIBIN end bud initiation factor homolog (zebrafish) NM 005264 GFRA1 GDNF family receptor alpha 1 NM 201433 GAS7 growth arrest-specific 7 NM 005192 CDKN3 cyclin-dependent kinase inhibitor 3 NM 025195 TRIB1 tribible homolog 1 (Drosophila) NM 022073 EGLN3 eglin homolog 3 (C, elegans) NM 133328 DEDD2 death e ffector domain containing 2 NM 006186 NR4A2 nuclear receptor subfamily 4, group A, member 2 NM 031458 PARP9 poly (ADP-ribose) family polymerase, member 9 NM 002192 INHBA inhibin, beta A NM 001099772 CYP4B1 cytochrome P450, family 4, subfamily B, polypeptide 1 NM 002275 KRTI 5 keratin 15 NM 175078 KRT77 keratin 77NM 001343 DAB2 disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) NM 015277 NEDD4L neural precursor cell expressed, developmentally downregulated 4-like NM 000129 F1 3A1 coagulation factor XIII, A1 polypeptide NM 004469 FIGF c-fos induced growth factor (vascular endothelial growth factor D) NM 007350 PHLDA1 pleckstrin homology-like domain, family A, member 1 NM 014822 SEC24D SEC24 family, member D (S, cerevisiae) NM 080474 SERPINB12 serpin peptidase inhibitor, clade B (ovalbumin), member 12 NM 014365 HSPB8 heat shock 22kDa protein 8 NM 014331 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y + system) member 11 NM 001172 ARG2 arginase, type 11 NM 007207 DUSP10 dual specificity phosphatase 10 NM 000433 NCF2 neutrophil cytosolic factor 2 NM 152310 ELOVL3 elongation of very long chain fatty acids (FEN1 / E1o2, SUR4 / E1o3, yeast) -like 3 NM 032717 AGPAT9 1-acylglycerol-3-phosphate 0- acyltransferase 9 NM 003956 CH25H cholesterol 25-hydroxylase NM 021187 CYP4F11 cytochrome P450, family 4, subfamily F, polypeptide 11 NM 007238 PXMP4 peroxisomal membrane protein 4, 24kDa NM 000351 STS steroid sulfatase (microsomal), isozyme S NM 024560 ACSS3 acyl-CoA synthetase short-chain family member 3 NM 001277 CHKA choline alpha kinase NM 001006630 CHRM2 cholinergic receptor, muscarinic 2 NM 002612 PDK4 pyruvate dehydrogenase kinase, isozyme 4 NM 013261 PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha NM 001482 GATM glycine amidinotransferase (L- arginine: glycine amidinotransferase) NM 019891 ERO1LB ER01-like beta (S, cerevisiae) NM 014324 AMACR alpha-methylacyl-CoA racemase NM 001460 FMO2 flavin containing monooxygen e 2 (non-functional) NM 001461 FMO5 flavin containing monooxygenase 5 NM 152908 SLC47A2 solute carrier family 47, member 2 NM 138461 TM4SF19 transmembrane 4 L six family member 19 NM 015993 PLLP plasma membrane proteolipid (plasmolipin) NM 013390 TMEM2 transmembrane protein 2 NM 017631 DDX60 DEAD (Asp-Glu-Ala-Asp) box polypeptide 60 NM101012967 DDX6OL DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like NM 005325 HIST1H1A histone cluster 1, H1a NM 004836 ElF2AK3 eukaryotic translation initiation factor 2 NMU 024524 ATP13A3 ATPase type 13A3 NM 024524 KCNJ2 potassium inwardly-rectifying channel, subfamily J, member 2 NM 018593 SLC16A10 solute carrier family 16, member 10 (aromatic amino acid transporter) NM 014585 SLC40A1 solute carrier family 40 (iron- regulated transporter), member 1 NM 182767 SLC6A15 solute carrier family 6 (neutral amino acid transporter), member 15NM 001001323 ATP2B1 ATPase, Ca ++ transporting, plasma membrane 1 NM 001040624 NCALD neurocalcin delta NM 006996 SLC19A2 solute carrier family 19 (thiamine transporter), member 2 NM 001128431 SLC39A14 solute carrier family 39 (zinc transporter), member 14 NM 001012661 SLC3A2 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 NM 181785 SLC46A3 solute carrier family 46, member 3 NM 001503 GPLD1 glycosylphosphatidylinositol specific phospholipase D1 NM 022041 GAN gigaxonin NM 005909 MAP1 B microtubule-associated protein 1B NM 012134 LMOD1 leiomodin 1 (smooth muscle) NM 001010000 ARHGAP28 Rho GTPase activating protein 28 NM 004570 PIK3C2G phosphoinositide-3- kinase, class 2, gamma polypeptide NM 053064 GNG2 guanine nucleotide binding protein (G protein), gamma 2 NM 000856 GUCY1A3 guanylate cyclase 1, soluble, alpha 3 NM 018945 PDE7B phosphodiesterase 7B NM 001098512 PRKG1 protein kinase, cGMP-dependent, type I NM 023940 RASL11B RAS-like, family 11, member B NM 002923 RGS2 regulator of G-protein signaling 2, 24kDa AK303463 USP41 ubiquitin specific peptidase 41 N M 014363 SACS spastic ataxia of Charlevoix-Saguenay (bags) NM 001038633 RSPO1 R-spondin homolog (Xenopus laevis) NM 005733 KIF20A kinesin family member 20A NM 021724 NR1 D1 nuclear receptor subfamily 1, group D, member 1 NM 138573 NRG4 neuregulin 4 NM 005103 FEZ1 fasciculation and elongation protein zeta 1 (zygin I) NM 024769 ASAM adipocyte-specific adhesion molecule NM 017671 FERMT1 fermitin family homolog 1 (Drosophila) NM 024165 PHF1 PHD finger protein 1 NM 181533 ABHD12B abhydrolase domain containing 12B NM 206966 C5orf46 chromosome 5 open reading frame 46 NM 183373 C6orf145 chromosome 6 open reading frame 145 NM 018325 C9orf72 chromosome 9 open reading frame 72 NM 001215 CA6 carbonic anhydrase VI NM 014157 CCDC113 coiled-coil domain containing 113 NM 024519 FAM65A family with sequence similarity 65, member A NM 017938 FAM70A FLN37464 NM 001490 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) NM 015187 KIAA0746 KIAA0746 protein NM 005779 LHFPL2 lipoma HMGIC fusion partner-like 2 BC107865 LOC204010 ribosomal protein SA pseudogene NM 006152 LRMP lymphoid-restricted membrane protein NM 024717 Multiple MCTP1 C2 domains, transmembrane 1 NM Metabolic acid-binding protein 1A BC066301 MGC87042 METTL7A methyltransferase like 7A BC066301 MGC87042 similar to six epithelial transmembrane antigen of prostate NM 144599 NIPA1 nonprinted in Prader-Willi / Angelman syndrome 1 NM 001085382 Prosaposin-like PSAPL1 1 NM 031469 SH3BGRL2 SH3 binding domain glutamic acid-rich protein like 2 NM 020808 SIPA1L2 signal-induced proliferation-associated 1 like 2 NM 007000 UPK1A uroplakin 1ANM 152495 CNIH3 gland homolog 3 (Drosophila) NM 024007 EBF1 early B-cell factor 1 NM 020354 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 NM 017565 FAM20A family with sequence similarity 20, member A NM 153711 FAM26E family with sequence similarity 26, member E NM 153690 Family FAM43A with sequence similar arity 43, member A NM 016323 HERC5 hect. domain and RLD 5 NM 017912 HERC6 hect. domain and RLD 6 NM 001550 IFRD1 interferon-related developmental regulator 1 NM 033397 ITPRIP inositol 1,4,5-triphosphate receptor interacting protein NM 014851 KLHL21 kelch-like 21 (Drosophila) AK093957 LOC728264 hypothetical protein LOC728264 AF176921 MST131 MSTP131 NM 198474 OLFML1 olfactomedin-like 1 NM 015886 PI15 peptidase inhibitor 15 NM 001003793 RBMS3 RNA binding motif, single stranded interacting protein NM 005068 SIM1 single-minded homolog 1 (Drosophila) NM 175839 SMOX spermine oxidase NM 018266 TMEM39A transmembrane protein 39A NM 198152 UTS2D urotensin 2 domain containing NM 053276 VIT vitrin NM 182491 ZFAND2A zinc finger, AN1-type domain 2A NM 020747 ZNF608 zinc finger protein 608; and b) a solid support; for detecting the exposure of a skin to radiation comprising long UVAs.