FR2863168A1 - Antibacterial agents comprising gamma--butyrolactone degradation pathway inducers, e.g. succinate semialdehyde, useful in human or veterinary medicine, plant or foodstuff protection or disinfection - Google Patents

Abstract

The use of gamma -butyrolactone degradation pathway inducers (I) as antibacterial agents is new. Independent claims are included for: (1) (I) as medicaments; (2) a method for screening and selecting antibacterial agents, involving (a) contacting an organism (or cells from the organism) with test compound, (b) determining any induction of the gamma -butyrolactone degradation pathway and (c) selecting gamma -butyrolactone degradation pathway inhibiting compounds as antibacterial agents; and (3) antibacterial agents obtained by the above screening procedure. ACTIVITY : Antibacterial. MECHANISM OF ACTION : gamma -Butyrolactone degradation pathway inducer; N-acyl-homoserine lactone (NAHL) signal interrupter; quorum quencher. A suspension of bacteria from a soil sample (10 3>CFU/ml) in AB medium supplemented with yeast extract (0.2 g/l), actidinone (100 mg/l) and gamma -butyrolactone (Ia) (as inducer of the attKLM operon) or mannitol as carbon source was cultured at 25[deg]C for 3 days. The bacteria were washed with 0.8% saline and their capacity to inactivate N-acyl-homoserine lactone (NAHL) was tested in mono/dipotassium phosphate buffer (15 mM, pH 6.5) supplemented with N-hexanoyl-homoserine lactone (C6HSL) (25 MicroM) and yeast extract (0.2 g/l) by reverse phase thin layer chromatography. Results showed that the soil populations activated by (Ia) interrupted the C6HSL signal more rapidly than populations activated by mannitol. Morphological analysis also showed that the Agrobacterium tumefacienspopulation of the soil bacteria sample cultured in presence of (Ia) was not increased. (Ia) thus stimulated the capacity of complex microflora to inactivate NAHL.

Description

The present invention relates to the use of inductors of the track

  degradation of γ-butyrolactone to inactivate the N-acyl homoserine lactone signal produced by pathogenic bacteria and the applications of these inducers as antibacterials, particularly in the fields of agriculture, industry

  agrifood and human and animal medicine.

  The steady increase in the number of strains of antibiotic-resistant bacteria, as well as the formation of biofilms resistant to antibiotics, antiseptics and disinfectants, pose problems in the areas of human and animal health, agriculture and industry food.

  Therefore, to fight more effectively against pathogenic bacteria, there is a real need to have alternatives to antibiotic treatment and cleaning with conventional disinfectants.

  To bypass the defenses of the host (human, animal or plant), the bacteria have developed a virulence control strategy by an intercellular communication mechanism, depending on the population density, called quorum-sensing. These bacteria are capable of producing, detecting and responding to signal, self-inducing and diffusible small molecule molecules, called quormones; when the bacterial population reaches a sufficient density, the quormone concentration exceeds a critical threshold and the expression of the virulence genes is activated by the interaction of the quormones with specific transcriptional regulatory factors, thus allowing a synchronous, massive and efficient of the host.

  Thus, quormone signal disruption, also known as quorum quorum, represents a new approach for identifying new compounds that can be used as antibacterials in both human and veterinary medicine (prevention and treatment of bacterial infections), as well as in agriculture (fight against plant pathogens), agri-food industry (food preservation) and human and veterinary health (disinfection of medical, industrial, household and environmental equipment), (For a review see Camara et al., The Lancet, 2002, 2, 667-676 and Zhang et al., Trends in Plant Science, 2003, 8, 238244).

  Among the quormones, those of the family of N-acyl homoserine lactones (NAHL) that are present in many Gram-negative pathogenic bacteria are best characterized. These pathogenic bacteria include the genera Burkholderia, Erwinia and Pseudomonas, responsible for the destruction of crop crops of agronomic interest such as rice or potato, as well as nosocomial and opportunistic infections in humans.

  The NAHLs consist of a homoserine lactone ring, linked via an amide linkage to an acyl group of a saturated or unsaturated C4-C14 carbon chain, optionally substituted at the carbon in position 3 , by a hydroxyl or carbonyl group (Figure 1 of Camara et al., cited above). They interact specifically with LuxR family transcription factors, thereby maintaining the intracellular LuxR factor concentration that is unstable and rapidly degraded in the absence of binding to NAHLs.

  The biosynthesis of NAHL involves the synthesis of acyl-ACP (ACP for Acyl Carrier Protein) by the fatty acid synthesis route and the catalysis of the reaction between the acyl-ACP and the S-adenosylmethionine by NAHL synthase. The enzymatic degradation of NAHL involves two distinct pathways, the first involving a zinc hydrolase called lactonase, and the second an acylase.

  Among the genes coding respectively for these lactonases and these acylases, mention may be made of: the aiiA gene in Bacillus sp (Dong et al., PNAS, 2000, 97, 3526-3531) and its homologues such as the attM genes in Agrobacterium tumefaciens (Zhang et al., PNAS, 2002, 99, 4638-4643) and ahlD in Arthobacter sp. (Park et al., Microbiol., 2003, 149, 1541-1550), and the aiiD gene in Ralstonia sp. (Lin et al., Mol Microbiol., 2003, 47, 849-860) and its counterparts such as the pvdQ gene in Pseudomonas aeruginosa (Huang et al., Appl., Microbiol., 2003, 69, 5941-5949). .

  Various strategies have been envisaged for interrupting the NAHL signal: inhibition of the synthesis of NAHLs; triclosan is an antibiotic which inhibits the synthesis of fatty acids, themselves necessary for the synthesis of NAHL (Hoang et al., J. Bacteriol., 1999, 191, 5489-5497). However this antibiotic is not specific to NAHL and causes resistance.

  inhibition of NAHL signal recognition by bacterial cell receptors; the use of NAHL analogs including in particular halogenated furanones and derivatives of amides or of 1,2acylhydrazine (Manefield et al., Appl., Environ Microbiol., 2000, 66, 2079-2084; PCT International Application WO 03 / 039529 and US Pat. No. 6,455,031) has been proposed. Halogenated furanones form an unstable complex with the LuxR family transcription factors and accelerate the degradation of these proteins (Hentzer et al., EMBO, 2003, 22, 3803-3815). However, these compounds are not specific inhibitors of the NAHL signal and they are unusable in human and veterinary medicine because of their toxicity.

  - Enzymatic degradation of NAHL by expression of lactonases and exogenous acylases; the use of recombinant vectors or bacteria expressing an exogenous lactonase, as well as derived transgenic plants and animals has been proposed (PCT International Applications WO 02/061099 and WO 02/16623, Dong 15 et al., Nature , 2001, 411, 813-817, Dong et al., PNAS, 2000, 97, 3526-3631, Leadbetter et al., J. Bacteriol., 2000, 182, 6921-6926, Uroz et al., Microbiol., 2003, 149, 1981-1989); transgenic plants expressing the exogenous lactonase encoded by the Bacillus sp aiiA gene are more resistant to infection by pathogenic NAHL-producing bacteria than unmodified plants. However, this approach is cumbersome because it involves the construction of transgenic plants or animals or the inoculation of recombinant vectors expressing lactonase or acylase.

  The strategies contemplated have so far failed to identify compounds capable of inactivating the NAHL signal that are specific, non-toxic and easy to implement.

  Consequently, the inventors have set themselves the goal of identifying such compounds.

  The y-butyrolactone (GBL) degradation pathway involves three enzymes: (i) lactonase converts γ-butyrolactone (GBL) to γ-hydroxybutyrate (GHB), (ii) NAD-alcohol dehydrogenase oxidizes GHB to semialdehyde succinate ( SSA) and (iii) NAD-SSA dehydrogenase oxidizes SSA to succinic acid (SA), a compound of the Krebs cycle.

  While SA and SSA are intermediates of different metabolic pathways, common to eukaryotes and prokaryotes, GHB and GBL are rare in nature. GHB is essentially described as a metabolic intermediate of GBL possessing psychotropic properties (Mason et al., Acad Emerg Med., 2003, 9, 730-739). GBL is produced for industrial purposes and is found in plants and in fermented beverages such as wine (Lee et al., J. Agri Food, Chem., 2000, 48, 4290-4293, Vose et al., J. Forensic Sci., 2000, 46, 1164-1167).

  The γ-butyrolactone degradation pathway has been demonstrated only in humans and rats but not in bacteria (Mason et al., Cited above).

  The A. tumefaciens attM gene belongs to the attKLM operon, which to date is unique among sequenced bacterial genomes; it encodes a lactonase which opens the butyrolactone ring of NAHL and belongs to the family of zinc hydrolases (Zhang et al., cited above, Carlier A. et al., Appl., Env., Microbiol., 2003, 69, 4989- 4993). The function of the other genes of the attKLM operon has not been identi fi ed. In addition, the involvement of the attKLM operon in a metabolic pathway is not described.

  The inventors have shown that the attKLM operon is involved in the degradation and assimilation pathway of y-butyrolactone (GBL), yhydroxybutyrate (GHB) and semialdehyde succinate (SSA). This assimilation pathway is as follows: (i) attM coded lactonase converts ybutyrolactone (GBL) to y-hydroxybutyrate (GHB), (ii) attL-coded NAD-alcohol dehydrogenase oxidizes GHB to semialdehyde succinate (SSA) and (iii) attK-encoded NADSSA dehydrogenase oxidizes SSA to succinic acid (SA), a compound of the Krebs cycle.

  They have also shown that GBL, GHB and SSA are inducers of the expression of the attKLM operon capable of specifically inactivating endogenous and exogenous NAHL signals in Agrobacterium tumefaciens and in a complex micro-flora (bacterial consortium); these inducers are capable of stimulating the expression of an (endogenous) lactonase in these bacteria and consequently the enzymatic degradation of the endogenous and exogenous NAHLs by said bacteria.

  Thus, the inventors have shown that the inducers of the γ-butyrolactone degradation pathway represent new antibacterial compounds.

  Moreover, because of its involvement in the enzymatic degradation of NAHL, the degradation pathway of γ-butyrolactone represents a metabolic target for the identification of new antibacterial compounds, capable of specifically inactivating the NAHL signal in pathogenic bacteria using this signal.

  This new approach to interrupt the NAHL signal, which relies on the stimulation of the natural abilities of a prokaryotic or eukaryotic organism, particularly a bacterium or a human or nonhuman mammal to degrade NAHL is called metabolic quenching; it consists in stimulating the expression of endogenous lactonase (s) in said organism, by inducing a metabolic pathway, using biodegradable chemical compounds.

  Accordingly, the present invention relates to the use of an inducer of the γ-butyrolactone degradation pathway as an antibacterial agent.

  For the purposes of the present invention, an inducer of the γ-butyrolactone degradation pathway is understood to mean a compound capable of activating the metabolic pathway as defined above, in a prokaryotic or eukaryotic organism, in particular a bacterium or a human or non-human mammal.

  Induction of the γ-butyrolactone degradation pathway in said organism is measured, either directly by measuring lactonase activities (GBL as substrate), NAD alcohol dehydrogenase (GHB as substrate), and NAD-SSA dehydrogenase (SSA as substrate). ) or by measuring the activity of a reporter gene placed under the control of a promoter of a gene coding for an enzyme of the γ-butyrolactone degradation pathway as defined above (lactonase, NAD alcohol dehydrogenase, NAD-SSA dehydrogenase), or indirectly by comparative measurement of the amount of degraded NAHL in the presence or absence of inducer. The methods for measuring the activity of a reporter gene and the amount of degraded NAHL are conventional methods known to those skilled in the art.

  The invention encompasses the use of natural or synthetic chemical compounds, produced by chemical synthesis or by a microbiological process, in particular using a modified microorganism, in particular by the introduction of a suitable recombinant vector, which compounds exhibit the properties as defined above.

  According to an advantageous disposition of the use according to the invention, said inducer is chosen from the compounds corresponding to formula (1): R2 C3 HO / C2 R3

R

  wherein R1, R2 and R3 each represent hydrogen, hydroxyl, amine or carbonyl, or a C1-C4 alkyl, acyl or hydroxyalkyl group; it being understood that when R3 is a hydroxyl group, it can react with the hydroxyl group carried by the carbon in position 1 (C1) to form a cyclic ester (lactone), as well as their derived salts.

  Preferably, said inducer is chosen from: γ-butyrolactone, γ-hydroxybutyrate, semialdehyde succinate, 4-aminobutyric acid, 3-aminobutyric acid, 2-aminobutyric acid, 2-hydroxybutyric acid, acid 3-hydroxybutyric acid and butyric acid.

  According to the invention, said derived salts are especially salts of sodium, potassium, phosphate, carbonate; preferably it is a physiologically or pharmaceutically acceptable salt.

  According to an advantageous embodiment of the invention, said inducer is used for the preparation of a medicament for the prevention and treatment of infections by pathogenic microorganisms producing N-acyl homoserine lactone, in humans and animals .

  According to the invention, the medicinal product as defined above is capable of stimulating the expression of endogenous lactonase (s) in an individual (man or animal) or in the bacteria of the flora of said individual, and therefore to induce the enzymatic degradation of N-acyl homoserine lactones produced by bacteria that are pathogenic for this individual.

  According to this advantageous embodiment, the compounds of formula (I) and their salts are used enterally (oral, sublingual), parenteral or (I) local. They can be in the form of tablets, single or coated, capsules, granules, syrup, suppositories, injectable preparations, ointments, creams, gels, aerosol, which are prepared according to the usual methods. .

  In these galenic forms, the compounds of formula (I) are associated with excipients usually employed in pharmaceutical compositions, such as talc, gum arabic, lactose, starch, magnesium stearate, cocoa butter, aqueous or non-aqueous vehicles, fatty substances of animal or vegetable origin, paraffinic derivatives, glycols, various wetting agents, dispersants or emulsifiers, preservatives.

  The dosage varies depending on the condition to be treated, the route and rate of administration, and the nature and weight of the species to be treated (human or animal).

  Among the pathogenic microorganisms producing N-acyl homoserine lactone, which are responsible for infections in humans, mention may be made, in a non-limiting way: Pseudomonas aeruginosa, Burkholderia cepacia, Burkholderia mallei, Aeromonas aerophila, Chromobacterium violaceum, Yersininia enterocolitica , Yersinia pseudotuberculosis and Serratia liquefaciens.

  Among the pathogenic microorganisms producing N-acyl homoserine lactone, which are responsible for infections in animals, mention may be made, in a nonlimiting manner: pathogens of mammals and birds such as Serratia liquefaciens and fish pathogens and crustaceans such as Aeromonas aerophila, Aeromonas salmonicida, Vibrio anguillarum, and Vibrio harveyi, Yersinia ruckeri.

  According to an advantageous arrangement of this embodiment, said medicament comprises semialdehyde succinate.

  According to another advantageous embodiment of the invention, said inducer is intended for phytosanitary use, for the prevention and / or treatment of infections by pathogenic microorganisms producing N-acyl homoserine lactone, in plants.

  According to yet another advantageous embodiment of the invention, said inductor is intended for agri-food use, for the preservation of fresh products, especially fruits and vegetables.

  According to the invention, said inducer as defined above is capable of stimulating the expression of endogenous lactonase (s) in bacteria (pathogenic or non-pathogenic) present in the environment, that is to say cultures, especially in the soil, or harvests during storage. These lactonases are capable of degrading the N-acyl homoserine lactones produced by pathogenic bacteria for plant crops or which can damage crops. Thus, said inductor is used for the protection of plant crops in the field, or in a confined environment, such as greenhouses or bins or crops during storage.

  Advantageously, when said inductor is used for the protection of plant crops in the field, or in a confined environment, such as greenhouses or bins, it is used in the form of a mixed composition comprising nutritive elements for plant crops as defined above, especially for potato or rice crops grown in a greenhouse or container.

  Among the pathogenic microorganisms producing N-acyl homoserine lactone, which are responsible for infections in plants, mention may be made in a nonlimiting manner: Erwinia sp, in particular Erwinia carotovora and Erwinia chrysantemi, Burkholderia sp., In particular Burkholderia cepacia, Burkholderia glumae, Burkholderia plantarii, Agrobacterium tumefaciens, Pantoea stewartii and Ralstonia solanacearum.

  According to another advantageous embodiment of the invention, said inductor is used to disinfect the environment or the equipment.

  Said antibacterial product is used, without limitation, to disinfect: soil, water, or equipment for medical or surgical, industrial or domestic use.

  According to the invention, said inducer as defined above is capable of stimulating the expression of endogenous lactonase (s) in bacteria associated with surfaces in the form of biofilms, and therefore of inducing the degradation of N-acyl homoserine lactones produced by pathogenic bacteria using this signal.

  The present invention also relates to an inducer of the γ-butyrolactone degradation pathway as defined above as a medicament.

  The formulation and dosage of said medicament are as defined above.

  The subject of the present invention is also a method for selecting and encoding antibacterial compounds, characterized in that it comprises at least the following steps: a) bringing an organism or cells derived from said organism into contact with a test compound, b) measuring by any appropriate means the induction of the degradation pathway of γ-butyrolactone in said organism or said cells, and c) the selection of compounds capable of inducing the degradation pathway of γ-butyrolactone in said organism or said cells.

  According to the invention: said organism is a prokaryotic organism such as a bacterium or eukaryote such as a non-human mammal and said cells are primary cells or cell lines.

  when it is a non-human mammal, said compound is administered orally, locally or parenterally.

  the induction of the y-butyrolactone degradation pathway in said organism or said cells is measured, either directly by measuring lactonase activities (GBL as substrate), NAD alcohol dehydrogenase (GHB as substrate), and NAD-SSA dehydrogenase (SSA as substrate) or by measuring the activity of a reporter gene placed under the control of a promoter of a gene coding for an enzyme of the γ-butyrolactone degradation pathway as defined above ( lactonase, NAD alcohol dehydrogenase, NAD-SSA dehydrogenase), or indirectly by comparative measurement of the amount of degraded NAHL in the presence or absence of inducer. The methods for measuring the activity of a reporter gene and the amount of degraded NAHL are the conventional methods known to those skilled in the art.

  The present invention also relates to an antibacterial compound, characterized in that it is capable of being obtained by the screening / screening method as defined above.

  The compounds as defined in the present invention, in particular semialdehyde succinate, have the following advantages over the inactivators of the NAHL signal of the prior art: they are inexpensive and biodegradable; the use of these compounds does not require the construction of transgenic plants, the inoculation of genetically modified bacteria or the use of antibiotics.

  In addition to the foregoing, the invention further comprises other arrangements which will become apparent from the following description, which refers to examples demonstrating the ability of the inducers of the ybutyrolactone degradation pathway to inactivate the endogenous NAHL signal and Exogenous in bacteria, and the accompanying drawings in which: Figure 1 is a schematic representation of the attJKLM region of A. tumefaciens, as well as various bacterial and plasmid constructs derived from this region, used in this study. The double lines represent the DNA of the cloning vector, the single lines and the open boxes represent the DNA of the plasmid pAt of the C58 strain of A. tumefaciens.

  Figure 2 illustrates the structure of the compounds used in this study.

  Figure 3 illustrates the expression of attL and attM in E. coli.

  - Figure 4 illustrates the growth of A. tumefaciens in the presence of GBL, GHB, SA and SSA. A .: Growth curves in AB-GBL medium, from: A. tumefaciens C58 (filled squares), A. tumefaciens C101 (open squares), and A. tumefaciens C58 containing plasmids p6000 (solid triangles) or pMIR113 (open triangles) ).

  B: Growth curves of A. tumefaciens C58 (solid squares) and A. tumefaciens C101 (open squares) in AB-GHB, AB-SSA and AB-SA medium. The experiments are performed in triplicate, the standard deviations being smaller than the size of the symbols used.

  - Figure 5 illustrates the expression of transcriptional fusions attJ :: lacZ and attK :: lacZ in A. tumefaciens C58. The β-galactosidase activity of bacteria measured from four independent cultures is expressed in Miller units. Prior to activity measurements (3-galactosidase, the cells are incubated with increasing concentrations of the following factors: (A) mannitol (open squares), GBL (black squares), (B) mannitol (open squares), GHB (squares) black), SSA (gray canes).

  FIG. 6 illustrates the accumulation of NAHL in the absence of attKLM inducers. Strains of A. tumefaciens are cultured in ABmannitol medium. A: the concentration of oxo-C8HSL in the culture medium is compared with two times (GP1 and GP2) during the growth of A. tumefaciens C58 (filled squares) and C101 (open squares). B: the expression of the attK :: lacZ fusion is measured in A. tumefaciens C58, in the presence of increasing concentrations of C6HSL (open squares) and oxo-C8HSL (solid squares). C: The expression of the attJ :: lacZ, attK :: lacZ transcriptional fusions and the constituent fusion Pk :: lacZ is measured during the exponential (empty bars) and stationary (gray bars) growth phases. Activity measurements (3-galactosidase are performed in four independent cultures and expressed in Miller units.

  FIG. 7 illustrates the inactivation of the NAHL signal in the presence of the attKLM inductors. The residual amounts of C6HSL (A, C, D and F) and oxo-C8HSL (Charts B and E) present in cultures inoculated with A. tumefaciens are measured and expressed as a percentage relative to the corresponding amounts of C6HSL and C8HSL present in a non-inoculated control medium (quantity of C6HSL and C8HSL = 100). Prior to inoculation in NAHL-containing medium, A. tumefaciens C58 (open symbols) and C101 (full symbols) cells are induced by one of the following factors: (A, B, D and E) mannitol (cane) , GBL (triangle); (C and F), SA (square), SSA (triangle) and GHB (rhombus). The experiments are performed in triplicate. . FIG. 8 illustrates the inactivation of the NAHL signal by an activated complex microflora. After enrichment in medium GBL (empty square), GHB (empty triangle), SSA (empty diamond), SA (solid square), the capacity of the teluric microflora (A: 109 CFU / ml and B: 108 CFU / ml) has degrade the C6HSL (25 M) is tested. The residual amount of C6HSL is expressed as a percentage, based on the amount of C6HSL present in a mannitol-activated control microflora (amount of C6HSL = 100). The results correspond to four measurements made in four independent experiments.

  Example 1: Strains and plasmids used for the study of the operon att LM In the examples, the bacterial strains and the following plasmids were used under the conditions as described below.

  1) Bacterial strains The examples use A. tumefaciens strain C58 as well as its C58.C1, C58.C2 and C58.00 derivatives, which are deficient for the plasmids respectively, pTi (C58.C1), pAt (C58.C2) ), and pTi and pAt (C58.00), (Vaudequin-Dransart V. et al., Mol Plant-Microbe Interact., 1998, 11, 583-591).

  The ATJKLM :: aph mutant of A. tumefaciens, called C101 (FIG. 1) is derived from strain C58 by a standard gene replacement method by the introduction of a suicide plasmid, by electroporation (Ugalde JE et al. J. Bacteriol., 1998, 180, 6557-6564). More specifically, the aph gene isolated from plasmid p34S-Km (Dennis J. and Zylstra JC., Appl., Env Microbiol., 1998, 64, 2710-2715), was used to replace the attJKLM region ( 17: 17938588) between nucleotides 143 303 and 146, with reference to the sequence of plasmid pAtC58 (Wood DW et al., Science, 2001, 294, 2317-2323).

  Strains NTLR4 of A. tumefaciens (Cha C. et al., Plant-Microbe Interact Mol., 1998, 11, 1119-1129) and Chromobacterium violaceum CV026 (McClean KH et al., Microbiol., 1997, 143, 3703-3711) are used as an AHSL sensor, respectively for oxo-C8HSL and C6HSL.

  2) Culture conditions The E. coli strain DH5a coli is the routine host for cloning and gene expression experiments. The strain DH5a is cultured at 37 ° C. in rich medium (LB medium) and in minimal medium (M9 medium), (Sambroock J. et al., Molecular cloning: a laboratory manual 1989, 2nd Ed., Vol 3), supplemented with NAD (0.66 g / l), γ-aminobutyrate (1 g / l) as a nitrogen source (Schneider BL et al., J. Bacteriol., 2002, 184, 6976-6986), and a appropriate carbon source (2g / 1). The A. tumefaciens strains are cultured at 30 ° C. in rich medium (TY medium) and minimum medium (AB medium), (Chilton MD et al., Proc Natl Acad Sci USA, 1974, 71, 3672-3676), supplemented with NH4Cl (1 g / l) and one of the following carbon sources (2 g / l): mannitol, y butyrolactone (GBL), y-valerolactone (GVL), homoserine lactone (HSL), γ-hydroxybutyrate (GHB), semialdehyde succinate (SSA) and succinic acid (SA). Mannitol is also used as a carbon source for all Agrobacterium precultures. The growth curves of A. tumefaciens and E. coli are established by measuring the optical density (OD) at 600 nm. Finally, antibiotics are used at the following concentrations: ampicillin (50 mg / l), kanamycin (50 mg / l) and tetracycline (10 mg / l).

  3) Plasmids The plasmid schemes used are shown in FIG.

  The plasmid pMIR102 which constitutively expresses the lactonase encoded by attM is described in Carlier A. et al., Appl. Approx. Microbiol., 2003, 69, 4989-4993.

  The plasmid pMIR117 was constructed by cloning into the vector pGEM -T (Promega, Madison, USA), an amplification fragment of the gene attL, obtained using the primers (5'-3 '), SEQ ID N 1: ATACCTGTGCTCGGCCATC and SEQ ID N 2: TGCTGTCAGAAATGGGTCAG.

  Plasmid pMIR113 was constructed by cloning between BamHI sites and plasmid pME6000 pstldu (Maurhofer M. et al., Phytopathol., 1998, 88, 678684), an amplification fragment overlapping the attJ gene, obtained at using 5'-3 'primers, SEQ ID N 3: CAAACCATCGACGCAATATG and SEQ ID N 4: GCGGGATCCCTGGGGTATTGG.

  The plasmids pMIR121 and pMIR122 respectively containing the transcriptional fusions attJ: lacZ and attK: lacZ, were obtained in the following way: the divergent promoters attJ and attKLM were amplified in a single fragment, using the primers 5'-3 , SEQ ID N0 5: TCAGCCATGCACTATCCTTGA and SEQ ID N 6: GTCTAGCCATCCGCGGCTT, fused with the promoter-free lacZ-aph cassette of plasmid pKOK5 (Kokotek W. and Lotz W., Gene, 1989, 84, 467-471), and the SphI-Sad fragment was subcloned into the pME6031 vector (Heeb S. et al., Mol Plant-Microbe Interact, 2000, 13, 232-237).

  Plasmid pMIR123 constitutively expressing the lacZ gene was obtained by cloning the lacZ-aph cassette in front of the Pk promoter of the p6010 vector (Heeb S. et al., Mol Plant-Microbe Interact., 2000, 13, 232-237 ).

  Example 2: The attM and attL genes encode proteins involved in the uptake of γ-butyrolactone.

  The analysis of the amino acid sequences of the attK and attL gene products shows a strong identity between AttK and several NAD-succinate semialdehyde dehydrogenase (71% with the NAD-dependent dehydrogenase of COG1012) and between AttL and several NAD-alcohol dehydrogenases ( 49% with alcohol dehydrogenase IV of COG1454); the COG family was defined by Tatusov et al., NAR, 2001, 29, 22-28. This analysis indicates that the three enzymes encoded by this operon could participate in the degradation pathway of GBL.

  The involvement of AttL and AttM in the first two enzymatic steps of the degradation pathway of GBL has been experimentally verified in E. coli, which naturally assimilates SA and SSA.

  Figure 3 shows that the expression of attL is sufficient to convert E. coli into a bacterium that effectively assimilates GHB, but that attL and attM are simultaneously necessary for the growth of E. coli. coli in the presence of GBL.

  These results indicate that the three enzymes encoded by this operon participate in the GBL degradation pathway: (i) GBM-converted lactonase converted to GHB, (ii) GHB-attachable NAD-alcohol dehydrogenase in SAA, and (ii) iii) attK-encoded NAD-SSA dehydrogenase presumably oxidizes SSA to SA, a compound of the Krebs cycle.

  Example 3: Growth of A. tumefaciens in the presence of GBL is dependent on the attKLM operon; GBL, GHB and SSA stimulate the transcription of attKLM. 1) The growth of A. tumefaciens in the presence of GBL is dependent on the operon attKLM The involvement of the operon attKLM in the GBL assimilation pathway has been verified experimentally by the analysis of the growth of the C58 strain and derived mutants, in medium minimum (AB) supplemented with GBL, GHB, SSA or SA as carbon source (Figure 4).

  - growth in medium_GBL (Figure 4A) The strain C58 of A tumefaciens, although it does not assimilate a broad spectrum of lactones, because neither GVL nor HSL nor C6HSL can be used as a source of carbon, is however capable to grow in the presence of GBL as a carbon source. On the other hand, its C101 derivative (AattJKLM :: aph) which does not have the attKLM operon is incapable of doing so.

  This latter phenotype is also observed when additional copies of the attJ gene coding for attKLM transcriptional repressors are introduced into A. tumefaciens C58.

  The implication of these genes encoded by the plasmid pAt in the assimilation of GBL is in agreement with the phenotypes of strains C58.C2, C58.00 and C58.Cl; Strains C58.C2 and C58.00 which lack pAt can not grow in AB-GBL medium, while strain C58.Cl in which the plasmid pTi was removed but which keeps pAt, grows in AB-GBL medium. .

  growth in GHB medium, _SSA3 SA (FIG. 4B) The mutant C101 is also affected in the assimilation of GHB and SSA, whereas no difference is observed between C58 and C101 during their growth in AB-SA medium.

  2) GBL, GHB and SSA stimulate the transcription of attKLM The effect of GBL, GHB and SSA on the transcription of the attKLM operon was analyzed by measuring the 13-galactosidase activity in A. tumefaciens C58 transformed by electroporation, either by the plasmid pMIR122 bearing the attK :: lacZ transcriptional fusion, or by the plasmid pMIR121 carrying the transcriptional fusion attJ :: lacZ, used in comparison.

  The activity of β-galactosidase is measured using onitrophenyl D-D-galactopyranoside as a substrate and expressed in Miller units (Sambrook J. et al., Molecular cloning: a laboratory manual 1989, 2d ed. 3) Four independent cultures are made for each experimental condition.

  In the induction experiments, the cells containing the transcriptional fusions are cultured in AB-mannitol medium, then 360 μl of these cells are mixed with 40 μl of inducer solution to be tested and incubated for 2 hours at 24 ° C. the measurement of the 13-galactosidase activity is carried out.

  The addition of GBL to the culture of bacteria greatly increases the expression of the attK :: lacZ fusion whereas an equivalent addition of mannitol has no effect (FIG. 5). The expression of the ATTJ :: lacZ fusion is slightly increased by the addition of GBL (Figure 5), indicating that additional cellular factors or posttranscriptional modifications of the factor ATTJ, such as conformational changes in the presence of GBL, could participate in the regulation of the attKLM operon.

  Other lactones such as GVL and HSL do not induce the expression of the attKLM operon while the two metabolic intermediates of the GBL, GHB and SSA assimilation pathway are effective as inducers (Figure 5). Example 4: Interference between expression of attKLM and AHSL signals 1) Quantification of NAHL The oxo-C8HSL produced by A. tumefaciens are extracted with ethyl acetate, from an 8 ml sample of supernatant of Agrobacterium culture, and concentrated 100 times before quantification. The NAHL disappearance tests are carried out in E. coli after addition in 25 gM C6HSL medium as described by Carlier et al. Appl. Approx. Microbiol., 2003, 69, 4989-4993, and in A. tumefaciens after addition of 25 gM C6HSL and 10 gM oxo-C8HSL. In this experiment, stationary phase A. tumefaciens cultures are centrifuged and the pellet is resuspended at a cell density of 5 × 10 7 CFU / ml in fresh AB medium supplemented with mannitol, GBL, GHB, SSA or SA as a source. carbon. After 15 hours of incubation with stirring, the induced cells are washed with 0.8% NaCl and inoculated at 109 CFU / ml in fresh AB medium, supplemented with mannitol (0.2 g / l) and NH 4 Cl (0.1 g / 1) and with either C6HSL (25 gM) or oxo-C8HSL (10 gM).

  The amount of residual NAHL in the culture medium is tested by reverse thin layer liquid chromatography (TLC, KC 18 plates, Whatman); the samples are separated in a solvent system methanol: water (60:40), in comparison with a range of suitable reference products of known concentration, as described in Cha C. et al., Mol. Plant-Microbe Interact., 1998, 11, 1119-1129 and McClean KH. et al., Microbiol., 1997, 143, 3703-3711.

  2) Results When the attKLM operon is not induced, for example in the presence of mannitol as a carbon source, A. tumefaciens C58 and its mutant C101 accumulate the same amount of oxo-C8HSL in their growth medium (FIG. 6A ). Under the same conditions, the expression of the transcriptional fusions attJ: E: lacZ and attK :: lacZ is hardly affected by the addition of C6HSL and oxo-C8HSL and does not vary according to the stage of growth (FIGS. 6B and 6C ).

  These results indicate that in the absence of attKLM inducer, the attKLM operon does not affect the NAHL level in A. tumefaciens.

  On the other hand, when A. tumefaciens grows in AB-GBL medium, it does not accumulate oxo-C8HSL in the culture medium and becomes capable of inactivating the endogenous and exogenous C6HSL and oxo-C8HSL signals since the expression of the lactonase AttM is induced (Figures 7A and 7B). The broad spectrum of NAHL that may be cleaved by lactonase indicates that under conditions in which the attKLM operon is induced, A tumefaciens is able to interrupt any NAHL signal; it becomes a bacterium effectively degrading NAHL.

  Inactivation of the NAHL signal is also observed when A. tumefaciens is induced by GHB and SAA, whereas SA has no effect (Figure 7C).

  In similar experiments (FIGS. 7D to 7F), the C101 mutant is insensitive to the addition of inducers, confirming the genetic link between the disappearance of the NAHLs in the culture medium of A. tumefaciens C58 and the expression of the pathway. degradation of GBL.

  Example 5: attKLM inducers stimulate the ability of a complex flora to inactivate NAHL Samples of the teluric microflora are enriched in the following manner: bacterial suspensions obtained from temperate soil (Gif-sur-Yvette, France ) are inoculated at 103 CFU / ml (final density) in AB medium supplemented with yeast extract (0.2g / l), actidione (100mg / l) and GBL, GHB, SSA, SA or mannitol as a source of carbon. After 3 days of enrichment phase at 25 ° C., the bacteria are washed with NaCl solution (0.8%) and their capacity to inactivate NAHL is tested in KH2PO4 / K2HPO4 buffer (15 mM, pH 6.5). supplemented with C6HSL (25 M) and yeast extracts (0.2 g / l), following the protocol as described in Example 4.

  The interference between the GBL assimilation pathway and the NAHL inactivation is tested in a complex microflora (bacterial consortium). Soil populations that are activated by attKLM inducers interrupt the C6HSL signal more rapidly than populations activated with succinic acid (Figure 8) or mannitol. In addition, the morphological analysis of the tested population made it possible to verify that the step of culture of the sample of teluric bacteria in the presence of GHB, GBL and SSA did not enrich the population in A. tumefaciens These results indicate that the attKLM inducers are therefore able to stimulate the ability of a complex microflora to inactivate NAHLs.

  As is apparent from the above, the invention is not limited to those of its modes of implementation, implementation and application which have just been described more explicitly; it encompasses all the variants that may come to the mind of the technician in the field, without departing from the scope or scope of the present invention.

Claims (11)

  1) Use of an inducer of the degradation pathway of ybutyrolactone as antibacterial.   2) The use as claimed in claim 1, characterized in that said inducer is chosen from the compounds corresponding to formula (I): ## STR2 ## in which R 1, R 2 and R 3 each represent a hydrogen, a hydroxyl, amine or carbonyl group, or a C 1 -C 4 alkyl, acyl or hydroxyalkyl group; it being understood that when R3 is a hydroxyl group, it can react with the hydroxyl group borne by the carbon in position 1 (C1), to form a cyclic ester (lactone), as well as their derived salts.   3) Use according to claim 2, characterized in that said inductor is chosen from: γ-butyrolactone, γ-hydroxybutyrate, succinate semialdehyde, 4-aminobutyric acid, 3aminobutyric acid, 2-aminobutyric acid , 2-hydroxybutyric acid, 3-hydroxybutyric acid and butyric acid.   4) Use of an inducer of the ybutyrolactone degradation pathway according to any one of claims 1 to 3, for the preparation of a medicament for the prevention and treatment of infections with pathogenic microorganisms producing N- acyl homoserine lactone, in humans and animals.   5) Use according to claim 4, characterized in that said medicament comprises semialdehyde succinate.   6) Use according to any one of claims 1 to 3, characterized in that said inductor is intended for phytosanitary use, for the (I) prevention and / or treatment of infections by pathogenic microorganisms producing N- acyl homoserine lactone, in plants.   7) Use according to any one of claims 1 to 3, characterized in that said inductor is intended for agri-food use, for the conservation of fresh products, including fruits and vegetables.   8) Use of an inducer of the ybutyrolactone degradation pathway according to any one of claims 1 to 3 for disinfecting the environment or equipment.   9) Inducer of the γ-butyrolactone degradation pathway as defined in any one of claims 1 to 3 as a medicament.   10) A method for selecting / screening antibacterial compounds, characterized in that it comprises at least the following steps: a) bringing an organism or cells derived from said organism into contact with a test compound, b) measuring by any suitable means for inducing the y-butyrolactone degradation pathway in said organism or cells, and c) selecting compounds capable of inducing the γ-butyrolactone degradation pathway in said organism or cells.   11) Antibacterial compound, characterized in that it is obtainable by the screening method according to claim 10.